WorldWideScience

Sample records for drosophila mutagenesis sensitivity

  1. Highly Efficient Targeted Mutagenesis of Drosophila with the CRISPR/Cas9 System

    Directory of Open Access Journals (Sweden)

    Andrew R. Bassett

    2013-07-01

    Full Text Available Here, we present a simple and highly efficient method for generating and detecting mutations of any gene in Drosophila melanogaster through the use of the CRISPR/Cas9 system (clustered regularly interspaced palindromic repeats/CRISPR-associated. We show that injection of RNA into the Drosophila embryo can induce highly efficient mutagenesis of desired target genes in up to 88% of injected flies. These mutations can be transmitted through the germline to make stable lines. Our system provides at least a 10-fold improvement in efficiency over previously published reports, enabling wider application of this technique. We also describe a simple and highly sensitive method of detecting mutations in the target gene by high-resolution melt analysis and discuss how the new technology enables the study of gene function.

  2. Mutagenesis

    International Nuclear Information System (INIS)

    Dubinin, N.P.

    1986-01-01

    Problems on radiation mutagenesis, in particular, data on general factors of genetic radiation effects, dependences of mutation frequencies on radiation dose and threshold in genetic radiation effects, problems of low doses, modification of genetic radiation effects, repauir of injuries of genetic material, photoreactivation, causing structure chromosomal mutations under radiation action, on relative genetic efficiency of different types of radiation are considered besides others

  3. Rapid Discovery of Continuous-Performance Compounds and Powernap Compounds Through Large-Scale Mutagenesis in Drosophila

    Science.gov (United States)

    2008-04-22

    REPORT Rapid Discovery of Continuous-Performance Compounds and Powernap Compounds Through Large-Scale Mutagenesis in Drosophila 14. ABSTRACT 16...sustained wakefulness” (R. Benca-PI, N. Rattenborg-CoPI). The goal of both projects was to find ways to postpone temporarily the need for sleep ...Research Triangle Park, NC 27709-2211 15. SUBJECT TERMS drosophila short sleeping phenotype Kv potassium channel migration Giulio Tononi, Ruth

  4. [From random mutagenesis to precise genome editing: the development and evolution of genome editing techniques in Drosophila].

    Science.gov (United States)

    Su, Fang; Huang, Zong-liang; Guo, Ya-wen; Jiao, Ren-jie; Zi, Li; Chen, Jian-ming; Liu, Ji-yong

    2016-01-01

    Drosophila melanogaster, an important model organism for studying life science, has contributed more to the research of genetics, developmental biology and biomedicine with the development of genome editing techniques. Drosophila genome-editing techniques have evolved from random mutagenesis to precise genome editing and from simple mutant construction to diverse genome editing methods since the 20th century. Chemical mutagenesis, using Ethyl methanesulfonate (EMS), is an important technique to study gene function in forward genetics, however, the precise knockout of Drosophila genes could not be achieved. The gene targeting technology, based on homologous recombination, has accomplished the precise editing of Drosophila genome for the first time, but with low efficiency. The CRISPR/Cas9 (Clustered regularly interspaced short palindromic repeats/CRISPR-associated protein)-mediated precise genome editing is simple, fast and highly efficient compared with the gene targeting technology in Drosophila. In this review, we focus on Drosophila gene knockout, and summarize the evolution of genome editing techniques in Drosophila, emphasizing the development and applications of gene targeting, zinc-finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN) and CRISPR/Cas9 techniques.

  5. Exquisite light sensitivity of Drosophila melanogaster cryptochrome.

    Directory of Open Access Journals (Sweden)

    Pooja Vinayak

    Full Text Available Drosophila melanogaster shows exquisite light sensitivity for modulation of circadian functions in vivo, yet the activities of the Drosophila circadian photopigment cryptochrome (CRY have only been observed at high light levels. We studied intensity/duration parameters for light pulse induced circadian phase shifts under dim light conditions in vivo. Flies show far greater light sensitivity than previously appreciated, and show a surprising sensitivity increase with pulse duration, implying a process of photic integration active up to at least 6 hours. The CRY target timeless (TIM shows dim light dependent degradation in circadian pacemaker neurons that parallels phase shift amplitude, indicating that integration occurs at this step, with the strongest effect in a single identified pacemaker neuron. Our findings indicate that CRY compensates for limited light sensitivity in vivo by photon integration over extraordinarily long times, and point to select circadian pacemaker neurons as having important roles.

  6. Molecular Mechanisms for High Hydrostatic Pressure-Induced Wing Mutagenesis in Drosophila melanogaster.

    Science.gov (United States)

    Wang, Hua; Wang, Kai; Xiao, Guanjun; Ma, Junfeng; Wang, Bingying; Shen, Sile; Fu, Xueqi; Zou, Guangtian; Zou, Bo

    2015-10-08

    Although High hydrostatic pressure (HHP) as an important physical and chemical tool has been increasingly applied to research of organism, the response mechanisms of organism to HHP have not been elucidated clearly thus far. To identify mutagenic mechanisms of HHP on organisms, here, we treated Drosophila melanogaster (D. melanogaster) eggs with HHP. Approximately 75% of the surviving flies showed significant morphological abnormalities from the egg to the adult stages compared with control flies (p melanogaster induced by HHP were used to investigate the mutagenic mechanisms of HHP on organism. Thus 285 differentially expressed genes associated with wing mutations were identified using Affymetrix Drosophila Genome Array 2.0 and verified with RT-PCR. We also compared wing development-related central genes in the mutant flies with control flies using DNA sequencing to show two point mutations in the vestigial (vg) gene. This study revealed the mutagenic mechanisms of HHP-induced mutagenesis in D. melanogaster and provided a new model for the study of evolution on organisms.

  7. Directed mutagenesis under the action of mobile elements in unstable lines of Drosophila melanogaster

    International Nuclear Information System (INIS)

    Gerasimova, T.I.; Mizrokhi, L.Yu.; Obolenkova, L.A.; Georgiev, P.G.

    1985-01-01

    The unstable mutation ct/sup MR2/, obtained under hybrid dysgenesis and caused by the incorporation of MDG 4 into locus cut, was described earlier. A peculiarity of this line and its derivatives is that multiple transpositions of different mobile elements, the transposition spurts, take place in them with a frequency of 10 -2 -10 -4 . A consequence of this process is active insertion mutagenesis taking place under the action of different transposons with high locus specifity. The mutations are unstable and frequently revert to wild type. However, there are some unstable revertants in which the mobile element is eliminated almost completely, and yet unstable mutations appear at the same locus at a high rate. In the case of cut locus, this happens due to repeated integration of MDG 4. The authors report cases of such repeated directed mutagenesis for several loci. Reversions were observed in the homozygous line as well as during the process of obtaining homozygous lines of new mutations using the chromosome with multiple inversions FM4, Y/sup 31d/sc 8 dmB. In situ hybridization with the [ 3 H]-labeled DNA was carried out as described earlier. The plasmid DNA containing cloned MDG4 and their long terminal repeats were used as probes for hybridization. Hybridization was done on the salivary gland polytene chromosomes of larvae. The new spontaneous mutations appearing in the process of hybridization were tested for allelism with the standard mutations y, w, cm, ct, D, and g

  8. Site directed mutagenesis of Drosophila flightin disrupts phosphorylation and impairs flight muscle structure and mechanics.

    Science.gov (United States)

    Barton, Byron; Ayer, Gretchen; Maughan, David W; Vigoreaux, Jim O

    2007-01-01

    Flightin is a myosin rod binding protein that in Drosophila melanogaster is expressed exclusively in the asynchronous indirect flight muscles (IFM). Hyperphosphorylation of flightin coincides with the completion of myofibril assembly and precedes the emergence of flight competency in young adults. To investigate the role of flightin phosphorylation in vivo we generated three flightin null (fln(0)) Drosophila strains that express a mutant flightin transgene with two (Thr158, Ser 162), three (Ser139, Ser141, Ser145) or all five potential phosphorylation sites mutated to alanines. These amino acid substitutions result in lower than normal levels of flightin accumulation and transgenic strains that are unable to beat their wings. On two dimensional gels of IFM proteins, the transgenic strain with five mutant sites (fln(5STA)) is devoid of all phosphovariants, the transgenic strain with two mutant sites (fln(2TSA)) expresses only the two least acidic of the nine phosphovariants, and the transgenic strain with three mutant sites (fln(3SA)) expresses all nine phosphovariants, as the wild-type strain. These results suggest that phosphorylation of Thr158 and/or Ser162 is necessary for subsequent phosphorylation of other sites. All three transgenic strains show normal, albeit long, IFM sarcomeres in newly eclosed adults. In contrast, sarcomeres in fully mature fln(5STA) and fln(2TSA) adults show extensive breakdown while those in fln(3SA) are not as disordered. The fiber hypercontraction phenotype that characterizes fln(0) is fully evident in fln(5STA) and fln(2TSA) but partially rescued in fln(3SA). Mechanics on skinned fibers from newly eclosed flies show alterations in viscous modulus for fln(5STA) and fln(2TSA) that result in a significant reduction in oscillatory power output. Expression of fln(5STA) and fln(2TSA), but not fln(3SA), in a wild-type (fln(+)/fln(+)) background resulted in a dominant negative effect manifested as flight impairments and hypercontracted IFM

  9. Dopamine modulates metabolic rate and temperature sensitivity in Drosophila melanogaster.

    Directory of Open Access Journals (Sweden)

    Taro Ueno

    Full Text Available Homeothermal animals, such as mammals, maintain their body temperature by heat generation and heat dissipation, while poikilothermal animals, such as insects, accomplish it by relocating to an environment of their favored temperature. Catecholamines are known to regulate thermogenesis and metabolic rate in mammals, but their roles in other animals are poorly understood. The fruit fly, Drosophila melanogaster, has been used as a model system for the genetic studies of temperature preference behavior. Here, we demonstrate that metabolic rate and temperature sensitivity of some temperature sensitive behaviors are regulated by dopamine in Drosophila. Temperature-sensitive molecules like dTrpA1 and shi(ts induce temperature-dependent behavioral changes, and the temperature at which the changes are induced were lowered in the dopamine transporter-defective mutant, fumin. The mutant also displays a preference for lower temperatures. This thermophobic phenotype was rescued by the genetic recovery of the dopamine transporter in dopamine neurons. Flies fed with a dopamine biosynthesis inhibitor (3-iodo-L-tyrosine, which diminishes dopamine signaling, exhibited preference for a higher temperature. Furthermore, we found that the metabolic rate is up-regulated in the fumin mutant. Taken together, dopamine has functions in the temperature sensitivity of behavioral changes and metabolic rate regulation in Drosophila, as well as its previously reported functions in arousal/sleep regulation.

  10. Targeted mutagenesis of the Sap47 gene of Drosophila: Flies lacking the synapse associated protein of 47 kDa are viable and fertile

    Directory of Open Access Journals (Sweden)

    Huber Saskia

    2004-04-01

    Full Text Available Abstract Background Conserved proteins preferentially expressed in synaptic terminals of the nervous system are likely to play a significant role in brain function. We have previously identified and molecularly characterized the Sap47 gene which codes for a novel synapse associated protein of 47 kDa in Drosophila. Sequence comparison identifies homologous proteins in numerous species including C. elegans, fish, mouse and human. First hints as to the function of this novel protein family can be obtained by generating mutants for the Sap47 gene in Drosophila. Results Attempts to eliminate the Sap47 gene through targeted mutagenesis by homologous recombination were unsuccessful. However, several mutants were generated by transposon remobilization after an appropriate insertion line had become available from the Drosophila P-element screen of the Bellen/Hoskins/Rubin/Spradling labs. Characterization of various deletions in the Sap47 gene due to imprecise excision of the P-element identified three null mutants and three hypomorphic mutants. Null mutants are viable and fertile and show no gross structural or obvious behavioural deficits. For cell-specific over-expression and "rescue" of the knock-out flies a transgenic line was generated which expresses the most abundant transcript under the control of the yeast enhancer UAS. In addition, knock-down of the Sap47 gene was achieved by generating 31 transgenic lines expressing Sap47 RNAi constructs, again under UAS control. When driven by a ubiquitously expressed yeast transcription factor (GAL4, Sap47 gene suppression in several of these lines is highly efficient resulting in residual SAP47 protein concentrations in heads as low as 6% of wild type levels. Conclusion The conserved synaptic protein SAP47 of Drosophila is not essential for basic synaptic function. The Sap47 gene region may be refractory to targeted mutagenesis by homologous recombination. RNAi using a construct linking genomic DNA to anti

  11. Clustered regulatory interspaced short palindromic repeats (CRISPR)-mediated mutagenesis and phenotype rescue by piggyBac transgenesis in a nonmodel Drosophila species.

    Science.gov (United States)

    Tanaka, R; Murakami, H; Ote, M; Yamamoto, D

    2016-08-01

    How behavioural diversity emerged in evolution is an unexplored subject in biology. To tackle this problem, genes and circuits for a behaviour need to be determined in different species for phylogenetic comparisons. The recently developed clustered regulatory interspaced short palindromic repeats/CRISPR associated protein9 (CRISPR/Cas9) system made such a challenge possible by providing the means to induce mutations in a gene of interest in any organism. Aiming at elucidating diversification in genetic and neural networks for courtship behaviour, we attempted to generate a genetic tool kit in Drosophila subobscura, a nonmodel species distantly related to the genetic model Drosophila melanogaster. Here we report the generation of yellow (y) and white mutations with the aid of the CRISPR/Cas9 system, and the rescue of the y mutant phenotype by germline transformation of the newly established y mutant fly line with a y(+) -marked piggyBac vector. This successful mutagenesis and transformation in D. subobscura open up an avenue for comprehensive genetic analyses of higher functions in this and other nonmodel Drosophila species, representing a key step toward systematic comparisons of genes and circuitries underlying behaviour amongst species. © 2016 The Royal Entomological Society.

  12. Effect of radiation-sensitive mutations and mutagens/carcinogens on bacterial recombination and mutagenesis. Progress report

    Energy Technology Data Exchange (ETDEWEB)

    Matney, T.S.

    1978-01-01

    Progress is reported on effects of temperature sensitive DNA-initiation mutation in E. coli K-12 mutants; the use of Bacillus subtilis transforming system as an in vitro mutagenesis system; characteristics of the E. coli lysogen used to test the permeability to polycyclic aromatic hydrocarbons; and the genetic toxicology of gentian violet. (PCS)

  13. Second-GenerationDrosophilaChemical Tags: Sensitivity, Versatility, and Speed.

    Science.gov (United States)

    Sutcliffe, Ben; Ng, Julian; Auer, Thomas O; Pasche, Mathias; Benton, Richard; Jefferis, Gregory S X E; Cachero, Sebastian

    2017-04-01

    Labeling and visualizing cells and subcellular structures within thick tissues, whole organs, and even intact animals is key to studying biological processes. This is particularly true for studies of neural circuits where neurons form submicron synapses but have arbors that may span millimeters in length. Traditionally, labeling is achieved by immunofluorescence; however, diffusion of antibody molecules (>100 kDa) is slow and often results in uneven labeling with very poor penetration into the center of thick specimens; these limitations can be partially addressed by extending staining protocols to over a week ( Drosophila brain) and months (mice). Recently, we developed an alternative approach using genetically encoded chemical tags CLIP, SNAP, Halo, and TMP for tissue labeling; this resulted in >100-fold increase in labeling speed in both mice and Drosophila , at the expense of a considerable drop in absolute sensitivity when compared to optimized immunofluorescence staining. We now present a second generation of UAS- and LexA-responsive CLIPf, SNAPf, and Halo chemical labeling reagents for flies. These multimerized tags, with translational enhancers, display up to 64-fold increase in sensitivity over first-generation reagents. In addition, we developed a suite of conditional reporters (4xSNAPf tag and CLIPf-SNAPf-Halo2) that are activated by the DNA recombinase Bxb1. Our new reporters can be used with weak and strong GAL4 and LexA drivers and enable stochastic, intersectional, and multicolor Brainbow labeling. These improvements in sensitivity and experimental versatility, while still retaining the substantial speed advantage that is a signature of chemical labeling, should significantly increase the scope of this technology. Copyright © 2017 Sutcliffe et al.

  14. Proteomic characterization of inbreeding-related cold sensitivity in Drosophila melanogaster

    DEFF Research Database (Denmark)

    Vermeulen, Cornelis Joseph; Pedersen, Kamilla Sofie; Beck, Hans C

    2013-01-01

    insight into the molecular interplay between intrinsic stress responses, inbreeding depression and temperature tolerance, we performed a proteomic characterization of a well-defined conditional inbreeding effect in a single line of Drosophila melanogaster, which suffers from extreme cold sensitivity...

  15. Sensitized mutagenesis screen in Factor V Leiden mice identifies thrombosis suppressor loci.

    Science.gov (United States)

    Westrick, Randal J; Tomberg, Kärt; Siebert, Amy E; Zhu, Guojing; Winn, Mary E; Dobies, Sarah L; Manning, Sara L; Brake, Marisa A; Cleuren, Audrey C; Hobbs, Linzi M; Mishack, Lena M; Johnston, Alexander J; Kotnik, Emilee; Siemieniak, David R; Xu, Jishu; Li, Jun Z; Saunders, Thomas L; Ginsburg, David

    2017-09-05

    Factor V Leiden ( F5 L ) is a common genetic risk factor for venous thromboembolism in humans. We conducted a sensitized N -ethyl- N -nitrosourea (ENU) mutagenesis screen for dominant thrombosuppressor genes based on perinatal lethal thrombosis in mice homozygous for F5 L ( F5 L/L ) and haploinsufficient for tissue factor pathway inhibitor ( Tfpi +/- ). F8 deficiency enhanced the survival of F5 L/L Tfpi +/- mice, demonstrating that F5 L/L Tfpi +/- lethality is genetically suppressible. ENU-mutagenized F5 L/L males and F5 L/+ Tfpi +/- females were crossed to generate 6,729 progeny, with 98 F5 L/L Tfpi +/- offspring surviving until weaning. Sixteen lines, referred to as "modifier of Factor 5 Leiden ( MF5L1-16 )," exhibited transmission of a putative thrombosuppressor to subsequent generations. Linkage analysis in MF5L6 identified a chromosome 3 locus containing the tissue factor gene ( F3 ). Although no ENU-induced F3 mutation was identified, haploinsufficiency for F3 ( F3 +/- ) suppressed F5 L/L Tfpi +/- lethality. Whole-exome sequencing in MF5L12 identified an Actr2 gene point mutation (p.R258G) as the sole candidate. Inheritance of this variant is associated with suppression of F5 L/L Tfpi +/- lethality ( P = 1.7 × 10 -6 ), suggesting that Actr2 p.R258G is thrombosuppressive. CRISPR/Cas9 experiments to generate an independent Actr2 knockin/knockout demonstrated that Actr2 haploinsufficiency is lethal, supporting a hypomorphic or gain-of-function mechanism of action for Actr2 p.R258G Our findings identify F8 and the Tfpi/F3 axis as key regulators in determining thrombosis balance in the setting of F5 L and also suggest a role for Actr2 in this process.

  16. Random mutagenesis of a recombinant microbial transglutaminase for the generation of thermostable and heat-sensitive variants.

    Science.gov (United States)

    Marx, Christian K; Hertel, Thomas C; Pietzsch, Markus

    2008-09-10

    Recombinant microbial transglutaminase (rMTG), an enzyme useful for the cross-linking or the posttranslational modification of (therapeutic) proteins, was optimized by random mutagenesis for the first time. A screening method was developed which, in addition to state-of-the-art procedures, includes a proteolytic activation step of the expressed soluble pro-enzyme. The library of 5,500 clones was screened for variants with increased thermostability and heat-sensitivity, respectively. Mutant enzymes were overproduced, isolated and characterized. After just one round of mutagenesis, nine variants with a single amino acid exchange showed a remarkably increased thermostability at 60 degrees C. The exchange of a serine residue close to the N-terminus against proline resulted in an rMTG mutant (S2P) with 270% increased half-life. Seven variants exhibited an increased heat-sensitivity at 60 degrees C of which one mutant (G25S) retained its specific activity between 10 and 40 degrees C. The mutations responsible for the increased thermostability and the heat-sensitivity were identified and assigned to the three-dimensional (3D) structure. All single point mutations related to changed thermal properties of rMTG are located in the N-terminal domain (i.e. the left side wall of the active site cleft of the front view of the MTG as defined by the literature [Kashiwagi, T., Yokoyama, K., Ishikawa, K., Ono, K., Ejima, D., Matsui, H., Suzuki, E., 2002. Crystal structure of microbial transglutaminase from Streptoverticillium mobaraense. J. Biol. Chem. 277, 44252-44260] showing the importance of this part of the protein.

  17. Fatty acid composition of Drosophila photoreceptor light-sensitive microvilli

    Directory of Open Access Journals (Sweden)

    Yorka Muñoz

    2013-01-01

    Full Text Available Phototransduction, the mechanism underlying the electrical response to light in photoreceptor cells, has been thoroughly investigated in Drosophila melanogaster, an essential model in signal transduction research. These cells present a highly specialized photosensitive membrane consisting of thousands of microvilli forming a prominent structure termed a rhabdomere. These microvilli encompass the phototransduction proteins, most of which are transmembrane and exclusively rhabdomeric. Rhabdomere membrane lipids play a crucial role in the activation of the transient receptor potential ionic channels (TRP and TRPL responsible for initiating the photoresponse. Despite its importance, rhabdomere lipid composition has not been established. We developed a novel preparation enriched in rhabdomere membranes to perform a thorough characterization of the lipidomics of Drosophila rhabdomeres. Isolated eyes (500 were homogenized and subjected to a differential centrifugation protocol that generates a fraction enriched in rhabdomere membrane. Lipids extracted from this preparation were identified and quantified by gas chromatography coupled to mass spectrometry. We found an abundance of low sterol esters (C16:0, C18:0, highly abundant and diverse triglycerides, free fatty acids, a moderate variety of mono and diacyglycerols (C:16:0, 18:0, C18:1 and abundant phospholipids (principally C18:2. This preparation opens a new avenue for investigating essential aspects of phototransduction.

  18. Polymorphisms in early neurodevelopmental genes affect natural variation in alcohol sensitivity in adult drosophila.

    Science.gov (United States)

    Morozova, Tatiana V; Huang, Wen; Pray, Victoria A; Whitham, Thomas; Anholt, Robert R H; Mackay, Trudy F C

    2015-10-26

    Alcohol abuse and alcoholism are significant public health problems, but the genetic basis for individual variation in alcohol sensitivity remains poorly understood. Drosophila melanogaster presents a powerful model system for dissecting the genetic underpinnings that determine individual variation in alcohol-related phenotypes. We performed genome wide association analyses for alcohol sensitivity using the sequenced, inbred lines of the D. melanogaster Genetic Reference Panel (DGRP) together with extreme QTL mapping in an advanced intercross population derived from sensitive and resistant DGRP lines. The DGRP harbors substantial genetic variation for alcohol sensitivity and tolerance. We identified 247 candidate genes affecting alcohol sensitivity in the DGRP or the DGRP-derived advanced intercross population, some of which met a Bonferroni-corrected significance threshold, while others occurred among the top candidate genes associated with variation in alcohol sensitivity in multiple analyses. Among these were candidate genes associated with development and function of the nervous system, including several genes in the Dopamine decarboxylase (Ddc) cluster involved in catecholamine synthesis. We found that 58 of these genes formed a genetic interaction network. We verified candidate genes using mutational analysis, targeted gene disruption through RNAi knock-down and transcriptional profiling. Two-thirds of the candidate genes have been implicated in previous Drosophila, mouse and human studies of alcohol-related phenotypes. Individual variation in alcohol sensitivity in Drosophila is highly polygenic and in part determined by variation in evolutionarily conserved signaling pathways that are associated with catecholamine neurotransmitter biosynthesis and early development of the nervous system.

  19. Studies on mutagen-sensitive strains of Drosophila melanogaster. IV

    International Nuclear Information System (INIS)

    Ferro, W.

    1985-01-01

    The influence of defects in DNA repair processes on X-ray-induced genetic damage in post-meiotic male germ cell stages of Drosophila melanogaster was studied using the 'maternal effects approach'. Basc males were irradiated in N 2 , air or O 2 either as 48-h-old pupae (to sample spermatids) or as 3-4-day-old adults (to sample mature spermatozoa) and mated to females of 3 repair-deficient strains. Simultaneous controls involving mating of males to repair-proficient females (mei + ) were run. The frequencies of sex-linked recessive lethals and of autosomal translocations were determined following standard genetic procedures. The responses elicited in the different crosses with repair-deficient females were compared with those in mei + crosses. (Auth.)

  20. Calmodulin affects sensitization of Drosophila melanogaster odorant receptors

    Directory of Open Access Journals (Sweden)

    Latha eMukunda

    2016-02-01

    Full Text Available Flying insects have developed a remarkably sensitive olfactory system to detect faint and turbulent odor traces. This ability is linked to the olfactory receptors class of odorant receptors (ORs, occurring exclusively in winged insects. ORs form heteromeric complexes of an odorant specific receptor protein (OrX and a highly conserved co-receptor protein (Orco. The ORs form ligand gated ion channels that are tuned by intracellular signaling systems. Repetitive subthreshold odor stimulation of olfactory sensory neurons sensitizes insect ORs. This OR sensitization process requires Orco activity. In the present study we first asked whether OR sensitization can be monitored with heterologously expressed OR proteins. Using electrophysiological and calcium imaging methods we demonstrate that D. melanogaster OR proteins expressed in CHO cells show sensitization upon repeated weak stimulation. This was found for OR channels formed by Orco as well as by Or22a or Or56a and Orco. Moreover, we show that inhibition of calmodulin (CaM action on OR proteins, expressed in CHO cells, abolishes any sensitization. Finally, we investigated the sensitization phenomenon using an ex vivo preparation of olfactory sensory neurons (OSNs expressing Or22a inside the fly’s antenna. Using calcium imaging, we observed sensitization in the dendrites as well as in the soma. Inhibition of calmodulin with W7 disrupted the sensitization within the outer dendritic shaft, whereas the sensitization remained in the other OSN compartments. Taken together, our results suggest that CaM action is involved in sensitizing the OR complex and that this mechanisms accounts for the sensitization in the outer dendrites, whereas further mechanisms contribute to the sensitization observed in the other OSN compartments. The use of heterologously expressed OR proteins appears to be suitable for further investigations on the mechanistic basis of OR sensitization, while investigations on native

  1. Mutagenesis and Teratogenesis Section

    International Nuclear Information System (INIS)

    Anon.

    1976-01-01

    Progress is reported on research with mice in the areas of radioinduced and chemical mutagenesis, cytologic studies, radiation effects on DNA synthesis, radiation effects on germ cells, mutagenicity of coal-conversion products, and others. Research on Drosophila was concerned with mutagenesis and genetics of nucleases. Studies were conducted on hamster cells with regard to cytotoxicity and mutagenicity of alkylating agents, modification of the microtubule system, protein kinase activity, and others. Research on bacteria was concerned with effects of x radiation on bacteriophage of Haemophilus influenzae, x-ray induced DNA polymerase I-directed repair synthesis in Escherichia coli, transformation by DNA polymerase II in Bacillus subtilis, and others. Research on xenopus laevis was conducted in the areas of calcium-induced cleavage of oocytes, yolk degradation in explants, and others

  2. High Throughput Measurement of Locomotor Sensitization to Volatilized Cocaine in Drosophila melanogaster

    Directory of Open Access Journals (Sweden)

    Ana Filošević

    2018-02-01

    Full Text Available Drosophila melanogaster can be used to identify genes with novel functional roles in neuronal plasticity induced by repeated consumption of addictive drugs. Behavioral sensitization is a relatively simple behavioral output of plastic changes that occur in the brain after repeated exposures to drugs of abuse. The development of screening procedures for genes that control behavioral sensitization has stalled due to a lack of high-throughput behavioral tests that can be used in genetically tractable organism, such as Drosophila. We have developed a new behavioral test, FlyBong, which combines delivery of volatilized cocaine (vCOC to individually housed flies with objective quantification of their locomotor activity. There are two main advantages of FlyBong: it is high-throughput and it allows for comparisons of locomotor activity of individual flies before and after single or multiple exposures. At the population level, exposure to vCOC leads to transient and concentration-dependent increase in locomotor activity, representing sensitivity to an acute dose. A second exposure leads to further increase in locomotion, representing locomotor sensitization. We validate FlyBong by showing that locomotor sensitization at either the population or individual level is absent in the mutants for circadian genes period (per, Clock (Clk, and cycle (cyc. The locomotor sensitization that is present in timeless (tim and pigment dispersing factor (pdf mutant flies is in large part not cocaine specific, but derived from increased sensitivity to warm air. Circadian genes are not only integral part of the neural mechanism that is required for development of locomotor sensitization, but in addition, they modulate the intensity of locomotor sensitization as a function of the time of day. Motor-activating effects of cocaine are sexually dimorphic and require a functional dopaminergic transporter. FlyBong is a new and improved method for inducing and measuring locomotor

  3. Tachykinin acts upstream of autocrine Hedgehog signaling during nociceptive sensitization in Drosophila.

    Science.gov (United States)

    Im, Seol Hee; Takle, Kendra; Jo, Juyeon; Babcock, Daniel T; Ma, Zhiguo; Xiang, Yang; Galko, Michael J

    2015-11-17

    Pain signaling in vertebrates is modulated by neuropeptides like Substance P (SP). To determine whether such modulation is conserved and potentially uncover novel interactions between nociceptive signaling pathways we examined SP/Tachykinin signaling in a Drosophila model of tissue damage-induced nociceptive hypersensitivity. Tissue-specific knockdowns and genetic mutant analyses revealed that both Tachykinin and Tachykinin-like receptor (DTKR99D) are required for damage-induced thermal nociceptive sensitization. Electrophysiological recording showed that DTKR99D is required in nociceptive sensory neurons for temperature-dependent increases in firing frequency upon tissue damage. DTKR overexpression caused both behavioral and electrophysiological thermal nociceptive hypersensitivity. Hedgehog, another key regulator of nociceptive sensitization, was produced by nociceptive sensory neurons following tissue damage. Surprisingly, genetic epistasis analysis revealed that DTKR function was upstream of Hedgehog-dependent sensitization in nociceptive sensory neurons. Our results highlight a conserved role for Tachykinin signaling in regulating nociception and the power of Drosophila for genetic dissection of nociception.

  4. Sensitivity to ehter anasthesia and to γ-rays in mutagen-sensitive strains of Drosophila melanogaster

    International Nuclear Information System (INIS)

    Gamo, Sumiko; Nakashima-Tanaka, Eiji; Megumi, Tsuneo

    1990-01-01

    An ether-resistant strain of Drosophila melanogaster, Eth-29, has previously been found to be radiosensitive. Some mutagen-sensitive strains are known to be hypersensitive to X-rays in larvae. The correlation between sensitivities to ether anesthesia and to γ-rays was examined in adult flies of 12 mutagen-sensitive strains and 6 control strains. A wide variation in sensitivities to ether anesthesia, γ-ray knock-down and γ-ray lethality was demonstrated. No correlation between DNA-repaor capacity and ether sensitivity or γ-ray knock-down sensitivity was shown. Only mei-9 and mus201, which are deficient in excision repair, as well as Eth-29 were found to be sensitive to γ-ray lethality. These findings indicate that the targets for ehter anesthesia, knock-down and lethality may be different. Lethality appears to be caused by DNA damage, while the othe 2 endpoints appear not to be related to DNA damage. (author). 14 refs.; 3 tabs

  5. Contrasting influences of Drosophila white/mini-white on ethanol sensitivity in two different behavioral assays.

    Science.gov (United States)

    Chan, Robin F; Lewellyn, Lara; DeLoyht, Jacqueline M; Sennett, Kristyn; Coffman, Scarlett; Hewitt, Matthew; Bettinger, Jill C; Warrick, John M; Grotewiel, Mike

    2014-06-01

    The fruit fly Drosophila melanogaster has been used extensively to investigate genetic mechanisms of ethanol (EtOH)-related behaviors. Many past studies in flies, including studies from our laboratory, have manipulated gene expression using transposons carrying the genetic-phenotypic marker mini-white(mini-w), a derivative of the endogenous gene white(w). Whether the mini-w transgenic marker or the endogenous w gene influences behavioral responses to acute EtOH exposure in flies has not been systematically investigated. We manipulated mini-w and w expression via (i) transposons marked with mini-w, (ii) RNAi against mini-w and w, and (iii) a null allele of w. We assessed EtOH sensitivity and tolerance using a previously described eRING assay (based on climbing in the presence of EtOH) and an assay based on EtOH-induced sedation. In eRING assays, EtOH-induced impairment of climbing correlated inversely with expression of the mini-w marker from a series of transposon insertions. Additionally, flies harboring a null allele of w or flies with RNAi-mediated knockdown of mini-w were significantly more sensitive to EtOH in eRING assays than controls expressing endogenous w or the mini-w marker. In contrast, EtOH sensitivity and rapid tolerance measured in the EtOH sedation assay were not affected by decreased expression of mini-w or endogenous w in flies. EtOH sensitivity measured in the eRING assay is noticeably influenced by w and mini-w, making eRING problematic for studies on EtOH-related behavior in Drosophila using transgenes marked with mini-w. In contrast, the EtOH sensitivity assay described here is a suitable behavioral paradigm for studies on EtOH sensitivity and rapid tolerance in Drosophila including those that use widely available transgenes marked with mini-w. Copyright © 2014 by the Research Society on Alcoholism.

  6. QTL mapping of inbreeding-related cold sensitivity and conditional lethality in Drosophila melanogaster

    DEFF Research Database (Denmark)

    Vermeulen, Corneel J.; Bijlsma, R.; Loeschcke, Volker

    2008-01-01

    of inbreeding-related and conditionally expressed lethality in Drosophila melanogaster. The lethal effect was triggered by exposure to a cold shock. We used a North Carolina crossing Design 3 to establish the mapping population, as well as to estimate the average dominance ratio and heritability. We found two......Inbreeding depression is a central theme within genetics, and is of specific interest for researchers within evolutionary and conservation genetics and animal and plant breeding. Inbreeding effects are thought to be caused by the joint expression of conditional and unconditional deleterious alleles....... Whenever the expression of deleterious alleles is conditional, this can result in extreme environmental sensitivity in certain inbred lineages. Analysis of conditional lethal effects can reveal some of the loci that are sensitive to inbreeding. We performed a QTL (quantitative trait locus) mapping study...

  7. The Esg Gene Is Involved in Nicotine Sensitivity in Drosophila melanogaster.

    Directory of Open Access Journals (Sweden)

    Iván Sanchez-Díaz

    Full Text Available In humans, there is a strong correlation between sensitivity to substances of abuse and addiction risk. This differential tolerance to drugs has a strong genetic component. The identification of human genetic factors that alter drug tolerance has been a difficult task. For this reason and taking advantage of the fact that Drosophila responds similarly to humans to many drugs, and that genetically it has a high degree of homology (sharing at least 70% of genes known to be involved in human genetic diseases, we looked for genes in Drosophila that altered their nicotine sensitivity. We developed an instantaneous nicotine vaporization technique that exposed flies in a reproducible way. The amount of nicotine sufficient to "knock out" half of control flies for 30 minutes was determined and this parameter was defined as Half Recovery Time (HRT. Two fly lines, L4 and L70, whose HRT was significantly longer than control´s were identified. The L4 insertion is a loss of function allele of the transcriptional factor escargot (esg, whereas L70 insertion causes miss-expression of the microRNA cluster miR-310-311-312-313 (miR-310c. In this work, we demonstrate that esg loss of function induces nicotine sensitivity possibly by altering development of sensory organs and neurons in the medial section of the thoracoabdominal ganglion. The ectopic expression of the miR-310c also induces nicotine sensitivity by lowering Esg levels thus disrupting sensory organs and possibly to the modulation of other miR-310c targets.

  8. The Esg Gene Is Involved in Nicotine Sensitivity in Drosophila melanogaster.

    Science.gov (United States)

    Sanchez-Díaz, Iván; Rosales-Bravo, Fernando; Reyes-Taboada, José Luis; Covarrubias, Alejandra A; Narvaez-Padilla, Verónica; Reynaud, Enrique

    2015-01-01

    In humans, there is a strong correlation between sensitivity to substances of abuse and addiction risk. This differential tolerance to drugs has a strong genetic component. The identification of human genetic factors that alter drug tolerance has been a difficult task. For this reason and taking advantage of the fact that Drosophila responds similarly to humans to many drugs, and that genetically it has a high degree of homology (sharing at least 70% of genes known to be involved in human genetic diseases), we looked for genes in Drosophila that altered their nicotine sensitivity. We developed an instantaneous nicotine vaporization technique that exposed flies in a reproducible way. The amount of nicotine sufficient to "knock out" half of control flies for 30 minutes was determined and this parameter was defined as Half Recovery Time (HRT). Two fly lines, L4 and L70, whose HRT was significantly longer than control´s were identified. The L4 insertion is a loss of function allele of the transcriptional factor escargot (esg), whereas L70 insertion causes miss-expression of the microRNA cluster miR-310-311-312-313 (miR-310c). In this work, we demonstrate that esg loss of function induces nicotine sensitivity possibly by altering development of sensory organs and neurons in the medial section of the thoracoabdominal ganglion. The ectopic expression of the miR-310c also induces nicotine sensitivity by lowering Esg levels thus disrupting sensory organs and possibly to the modulation of other miR-310c targets.

  9. mei-9/sup a/ mutant of Drosophila melanogaster increases mutagen sensitivity and decreases excision repair

    International Nuclear Information System (INIS)

    Boyd, J.B.; Golino, M.D.; Setlow, R.B.

    1976-01-01

    The mei-9/sup a/ mutant of Drosophila melanogaster, which reduces meiotic recombination in females, is deficient in the excision of uv-induced pyrimidine dimers in both sexes. Assays were performed in primary cultures and established cell lines derived from embryos. An endonuclease preparation from M. luteus, which is specific for pyrimidine dimers, was employed to monitor uv-induced dimers in cellular DNA. The rate of disappearance of endonuclease-sensitive sites from DNA of control cells is 10-20 times faster than that from mei-9/sup a/ cells. The mutant mei-218, which is also deficient in meiotic recombination, removes nuclease-sensitive sites at control rates. The mei-9/sup a/ cells exhibit control levels of photorepair, postreplication repair and repair of single strand breaks. In mei-9 cells DNA synthesis and possibly postreplication repair are weakly sensitive to caffeine. Larvae which are hemizygous for either of the two mutants that define the mei-9 locus are hypersensitive to killing by the mutagens methyl methanesulfonate, nitrogen mustard and 2-acetylaminofluorene. Larvae hemizygous for the mei-218 mutant are insensitive to each of these reagents. These data demonstrate that the mei-9 locus is active in DNA repair of somatic cells. Thus functions involved in meiotic recombination are also active in DNA repair in this higher eukaryote. The results are consistent with the earlier suggestions that the mei-9 locus functions in the exchange events of meiosis. The mei-218 mutation behaves differently in genetic tests and our data suggest its function may be restricted to meiosis. These studies demonstrate that currently recognized modes of DNA repair can be efficiently detected in primary cell cultures derived from Drosophila embryos

  10. Steroid Receptor Isoform Expression in Drosophila Nociceptor Neurons Is Required for Normal Dendritic Arbor and Sensitivity.

    Directory of Open Access Journals (Sweden)

    Aidan L McParland

    Full Text Available Steroid hormones organize many aspects of development, including that of the nervous system. Steroids also play neuromodulatory and other activational roles, including regulation of sensitivity to painful stimuli in mammals. In Drosophila, ecdysteroids are the only steroid hormones, and therefore the fly represents a simplified model system in which to explore mechanisms of steroid neuromodulation of nociception. In this report, we present evidence that ecdysteroids, acting through two isoforms of their nuclear ecdysone receptor (EcR, modulate sensitivity to noxious thermal and mechanical stimuli in the fly larva. We show that EcRA and EcRB1 are expressed by third instar larvae in the primary nociceptor neurons, known as the class IV multidendritic neurons. Suppression of EcRA by RNA interference in these cells leads to hyposensitivity to noxious stimulation. Suppression of EcRB1 leads to reduction of dendritic branching and length of nociceptor neurons. We show that specific isoforms of the ecdysone receptor play critical cell autonomous roles in modulating the sensitivity of nociceptor neurons and may indicate human orthologs that represent targets for novel analgesic drugs.

  11. Global sensitivity analysis of a dynamic model for gene expression in Drosophila embryos

    Science.gov (United States)

    McCarthy, Gregory D.; Drewell, Robert A.

    2015-01-01

    It is well known that gene regulation is a tightly controlled process in early organismal development. However, the roles of key processes involved in this regulation, such as transcription and translation, are less well understood, and mathematical modeling approaches in this field are still in their infancy. In recent studies, biologists have taken precise measurements of protein and mRNA abundance to determine the relative contributions of key factors involved in regulating protein levels in mammalian cells. We now approach this question from a mathematical modeling perspective. In this study, we use a simple dynamic mathematical model that incorporates terms representing transcription, translation, mRNA and protein decay, and diffusion in an early Drosophila embryo. We perform global sensitivity analyses on this model using various different initial conditions and spatial and temporal outputs. Our results indicate that transcription and translation are often the key parameters to determine protein abundance. This observation is in close agreement with the experimental results from mammalian cells for various initial conditions at particular time points, suggesting that a simple dynamic model can capture the qualitative behavior of a gene. Additionally, we find that parameter sensitivites are temporally dynamic, illustrating the importance of conducting a thorough global sensitivity analysis across multiple time points when analyzing mathematical models of gene regulation. PMID:26157608

  12. ENU mutagenesis reveals that Notchless homolog 1 (Drosophila affects Cdkn1a and several members of the Wnt pathway during murine pre-implantation development

    Directory of Open Access Journals (Sweden)

    Lossie Amy C

    2012-12-01

    Full Text Available Abstract Background Our interests lie in determining the genes and genetic pathways that are important for establishing and maintaining maternal-fetal interactions during pregnancy. Mutation analysis targeted to a 34 Mb domain flanked by Trp53 and Wnt3 demonstrates that this region of mouse chromosome 11 contains a large number of essential genes. Two mutant alleles (l11Jus1 and l11Jus4, which fall into the same complementation group, survive through implantation but fail prior to gastrulation. Results Through a positional cloning strategy, we discovered that these homozygous mutant alleles contain non-conservative missense mutations in the Notchless homolog 1 (Drosophila (Nle1 gene. NLE1 is a member of the large WD40-repeat protein family, and is thought to signal via the canonical NOTCH pathway in vertebrates. However, the phenotype of the Nle1 mutant mice is much more severe than single Notch receptor mutations or even in animals in which NOTCH signaling is blocked. To test the hypothesis that NLE1 functions in multiple signaling pathways during pre-implantation development, we examined expression of multiple Notch downstream target genes, as well as select members of the Wnt pathway in wild-type and mutant embryos. We did not detect altered expression of any primary members of the Notch pathway or in Notch downstream target genes. However, our data reveal that Cdkn1a, a NOTCH target, was upregulated in Nle1 mutants, while several members of the Wnt pathway are downregulated. In addition, we found that Nle1 mutant embryos undergo caspase-mediated apoptosis as hatched blastocysts, but not as morulae or blastocysts. Conclusions Taken together, these results uncover potential novel functions for NLE1 in the WNT and CDKN1A pathways during embryonic development in mammals.

  13. Anion-sensitive fluorophore identifies the Drosophila swell-activated chloride channel in a genome-wide RNA interference screen.

    Directory of Open Access Journals (Sweden)

    Stephanie C Stotz

    Full Text Available When cells swell in hypo-osmotic solutions, chloride-selective ion channels (Cl(swell activate to reduce intracellular osmolality and prevent catastrophic cell rupture. Despite intensive efforts to assign a molecular identity to the mammalian Cl(swell channel, it remains unknown. In an unbiased genome-wide RNA interference (RNAi screen of Drosophila cells stably expressing an anion-sensitive fluorescent indicator, we identify Bestrophin 1 (dBest1 as the Drosophila Cl(swell channel. Of the 23 screen hits with mammalian homologs and predicted transmembrane domains, only RNAi specifically targeting dBest1 eliminated the Cl(swell current (I(Clswell. We further demonstrate the essential contribution of dBest1 to Drosophila I(Clswell with the introduction of a human Bestrophin disease-associated mutation (W94C. Overexpression of the W94C construct in Drosophila cells significantly reduced the endogenous I(Clswell. We confirm that exogenous expression of dBest1 alone in human embryonic kidney (HEK293 cells creates a clearly identifiable Drosophila-like I(Clswell. In contrast, activation of mouse Bestrophin 2 (mBest2, the closest mammalian ortholog of dBest1, is swell-insensitive. The first 64 residues of dBest1 conferred swell activation to mBest2. The chimera, however, maintains mBest2-like pore properties, strongly indicating that the Bestrophin protein forms the Cl(swell channel itself rather than functioning as an essential auxiliary subunit. dBest1 is an anion channel clearly responsive to swell; this activation depends upon its N-terminus.

  14. Inferring Drosophila gap gene regulatory network: a parameter sensitivity and perturbation analysis

    Directory of Open Access Journals (Sweden)

    Kaandorp Jaap A

    2009-09-01

    Full Text Available Abstract Background Inverse modelling of gene regulatory networks (GRNs capable of simulating continuous spatio-temporal biological processes requires accurate data and a good description of the system. If quantitative relations between genes cannot be extracted from direct measurements, an efficient method to estimate the unknown parameters is mandatory. A model that has been proposed to simulate spatio-temporal gene expression patterns is the connectionist model. This method describes the quantitative dynamics of a regulatory network in space. The model parameters are estimated by means of model-fitting algorithms. The gene interactions are identified without making any prior assumptions concerning the network connectivity. As a result, the inverse modelling might lead to multiple circuits showing the same quantitative behaviour and it is not possible to identify one optimal circuit. Consequently, it is important to address the quality of the circuits in terms of model robustness. Results Here we investigate the sensitivity and robustness of circuits obtained from reverse engineering a model capable of simulating measured gene expression patterns. As a case study we use the early gap gene segmentation mechanism in Drosophila melanogaster. We consider the limitations of the connectionist model used to describe GRN Inferred from spatio-temporal gene expression. We address the problem of circuit discrimination, where the selection criterion within the optimization technique is based of the least square minimization on the error between data and simulated results. Conclusion Parameter sensitivity analysis allows one to discriminate between circuits having significant parameter and qualitative differences but exhibiting the same quantitative pattern. Furthermore, we show that using a stochastic model derived from a deterministic solution, one can introduce fluctuations within the model to analyze the circuits' robustness. Ultimately, we show that

  15. Inferring Drosophila gap gene regulatory network: a parameter sensitivity and perturbation analysis.

    Science.gov (United States)

    Fomekong-Nanfack, Yves; Postma, Marten; Kaandorp, Jaap A

    2009-09-21

    Inverse modelling of gene regulatory networks (GRNs) capable of simulating continuous spatio-temporal biological processes requires accurate data and a good description of the system. If quantitative relations between genes cannot be extracted from direct measurements, an efficient method to estimate the unknown parameters is mandatory. A model that has been proposed to simulate spatio-temporal gene expression patterns is the connectionist model. This method describes the quantitative dynamics of a regulatory network in space. The model parameters are estimated by means of model-fitting algorithms. The gene interactions are identified without making any prior assumptions concerning the network connectivity. As a result, the inverse modelling might lead to multiple circuits showing the same quantitative behaviour and it is not possible to identify one optimal circuit. Consequently, it is important to address the quality of the circuits in terms of model robustness. Here we investigate the sensitivity and robustness of circuits obtained from reverse engineering a model capable of simulating measured gene expression patterns. As a case study we use the early gap gene segmentation mechanism in Drosophila melanogaster. We consider the limitations of the connectionist model used to describe GRN Inferred from spatio-temporal gene expression. We address the problem of circuit discrimination, where the selection criterion within the optimization technique is based of the least square minimization on the error between data and simulated results. Parameter sensitivity analysis allows one to discriminate between circuits having significant parameter and qualitative differences but exhibiting the same quantitative pattern. Furthermore, we show that using a stochastic model derived from a deterministic solution, one can introduce fluctuations within the model to analyze the circuits' robustness. Ultimately, we show that there is a close relation between circuit sensitivity and

  16. Inducing Cold-Sensitivity in the Frigophilic Fly Drosophila montana by RNAi.

    Directory of Open Access Journals (Sweden)

    Felipe M Vigoder

    Full Text Available Cold acclimation is a critical physiological adaptation for coping with seasonal cold. By increasing their cold tolerance individuals can remain active for longer at the onset of winter and can recover more quickly from a cold shock. In insects, despite many physiological studies, little is known about the genetic basis of cold acclimation. Recently, transcriptomic analyses in Drosophila virilis and D. montana revealed candidate genes for cold acclimation by identifying genes upregulated during exposure to cold. Here, we test the role of myo-inositol-1-phosphate synthase (Inos, in cold tolerance in D. montana using an RNAi approach. D. montana has a circumpolar distribution and overwinters as an adult in northern latitudes with extreme cold. We assessed cold tolerance of dsRNA knock-down flies using two metrics: chill-coma recovery time (CCRT and mortality rate after cold acclimation. Injection of dsRNAInos did not alter CCRT, either overall or in interaction with the cold treatment, however it did induced cold-specific mortality, with high levels of mortality observed in injected flies acclimated at 5°C but not at 19°C. Overall, injection with dsRNAInos induced a temperature-sensitive mortality rate of over 60% in this normally cold-tolerant species. qPCR analysis confirmed that dsRNA injection successfully reduced gene expression of Inos. Thus, our results demonstrate the involvement of Inos in increasing cold tolerance in D. montana. The potential mechanisms involved by which Inos increases cold tolerance are also discussed.

  17. Proteomic characterization of inbreeding-related cold sensitivity in Drosophila melanogaster.

    Directory of Open Access Journals (Sweden)

    Cornelis J Vermeulen

    Full Text Available Inbreeding depression is a widespread phenomenon of central importance to agriculture, medicine, conservation biology and evolutionary biology. Although the population genetic principles of inbreeding depression are well understood, we know little about its functional genomic causes. To provide insight into the molecular interplay between intrinsic stress responses, inbreeding depression and temperature tolerance, we performed a proteomic characterization of a well-defined conditional inbreeding effect in a single line of Drosophila melanogaster, which suffers from extreme cold sensitivity and lethality. We identified 48 differentially expressed proteins in a conditional lethal line as compared to two control lines. These proteins were enriched for proteins involved in hexose metabolism, in particular pyruvate metabolism, and many were found to be associated with lipid particles. These processes can be linked to known cold tolerance mechanisms, such as the production of cryoprotectants, membrane remodeling and the build-up of energy reserves. We checked mRNA-expression of seven genes with large differential protein expression. Although protein expression poorly correlated with gene expression, we found a single gene (CG18067 that, after cold shock, was upregulated in the conditional lethal line both at the mRNA and protein level. Expression of CG18067 also increased in control flies after cold shock, and has previously been linked to cold exposure and chill coma recovery time. Many differentially expressed proteins in our study appear to be involved in cold tolerance in non-inbred individuals. This suggest the conditional inbreeding effect to be caused by misregulation of physiological cold tolerance mechanisms.

  18. A new member of the amiloride-sensitive sodium channel family in Drosophila melanogaster peripheral nervous system.

    Science.gov (United States)

    Darboux, I; Lingueglia, E; Pauron, D; Barbry, P; Lazdunski, M

    1998-05-08

    Amiloride sensitivity is a common characteristic of structurally related cationic channels that are associated with a wide range of physiological functions. In Caenorhabditis elegans, neuronal and muscular degenerins are involved in mechanoperception. In animal epithelia, a Na(+)-selective channel participates in vectorial Na+ transport. In the snail nervous system, an ionotropic receptor for the peptide FMRFamide forms a Na(+)-selective channel. In mammalian brain and/or in sensory neurons, ASIC channels form H(+)-activated cation channels involved in nociception linked to acidosis. We have now cloned a new member of this family from Drosophila melanogaster. The corresponding protein displays low sequence identity with the previously cloned members of the super-family but it has the same structural organization. Its mRNA was detected from late embryogenesis (14-17 hours) and was present in the dendritic arbor subtype of the Drosophila peripheral nervous system multiple dendritic (md) sensory neurons. While the origin and specification of md neurons are well documented, their roles are still poorly understood. They could function as stretch or touch receptors, raising the possibility that this Drosophila gene product, called dmdNaC1, could also be involved in mechanotransduction.

  19. Mutagenesis and Teratogenesis Section

    International Nuclear Information System (INIS)

    Anon.

    1979-01-01

    Progress is reported in the following areas of research: studies on chromosome damage and indirect indicators of genetic damage; cytogenetic, embryological, and biochemical studies of mutants in mammals; studies on mammalian gonads in relation to mutagenic effects; systems for detecting mutagenic effects of chemicals; processes in repair of damage to DNA; methods for detecting mutations that result in proteins with altered amino acid sequences; recombination in Drosophila; DNA repair processes in bacteria; development of a sensitive teratological prescreen; teratogenic end points in amphibians; and development of a method for long-term culture of Xenopus oocytes

  20. Proteomic characterization of a temperature-sensitive conditional lethal in Drosophila melanogaster

    DEFF Research Database (Denmark)

    Pedersen, Kamilla Sofie; Codrea, M.C; Vermeulen, Corneel

    2010-01-01

    Genetic variation that is expressed only under specific environmental conditions can contribute to additional adverse effects of inbreeding if environmental conditions change. We present a proteomic characterization of a conditional lethal found in an inbred line of Drosophila melanogaster. The l...

  1. Genetic modifiers of comatose mutations in Drosophila: insights into neuronal NSF (N-ethylmaleimide-sensitive fusion factor) functions.

    Science.gov (United States)

    Sanyal, Subhabrata; Krishnan, K S

    2012-09-01

    By the middle of the 20th century, development of powerful genetic approaches had ensured that the fruit fly would remain a model organism of choice for genetic and developmental studies. But in the 1970s, a few pioneering groups turned their attention to the prospect of using the fly for neurophysiological experiments. They proposed that in a poikilothermic organism such as Drosophila, temperature-sensitive or "ts" mutations in proteins that controlled nerve function would translate to a "ts" paralytic phenotype. This was by no means an obvious or even a likely assumption. However, following directed screens these groups soon reported dramatic demonstrations of reversible ts paralysis in fly mutants. Resultantly, these "simple" experiments led to the isolation of a number of conditional mutations including shibire, paralytic, and comatose. All have since been cloned and have enabled deep mechanistic insights into synaptic transmission and nerve conduction. comatose (comt) mutations, for example, were found to map to missense changes in dNSF1, a neuron-specific fly homolog of mammalian NSF (N-ethylmaleimide-sensitive fusion factor). Studies on comt were also some of the first to discriminate between nuanced models of NSF function during presynaptic transmitter release that have since been borne out by experiments in multiple preparations. Here, the authors present an overview of NSF function as it is understood today, with an emphasis on contributions from Drosophila beginning with experiments carried out by Obaid Siddiqi in the Benzer laboratory. The authors also outline initial results from a genetic screen for phenotypic modifiers of comt that hold the promise of further elucidating NSF function at the synapse. Over the years, the neuromuscular system of Drosophila has served as a uniquely accessible model to unravel mechanisms underlying synaptic transmission. To this day, ts paralysis remains one of the most emphatic demonstrations of nerve function in an

  2. A major QTL affects temperature sensitive adult lethality and inbreeding depression in life span in Drosophila melanogaster.

    DEFF Research Database (Denmark)

    Vermeulen, Corneel J.; Bijlsma, R.; Loeschcke, Volker

    2008-01-01

    of inbreeding effects in specific traits, such as age-specific mortality and life span, provide a good starting point, as a limited set of genes is expected to be involved. Results Here we report on a QTL mapping study on inbreeding related and temperature sensitive lethality in male Drosophila melanogaster...... and the molecular properties of genes that give rise to or modulate its deleterious effects is lacking. These questions warrant the detailed study of genetic loci giving rise to inbreeding depression. However, the complex and polygenic nature of general inbreeding depression makes this a daunting task. Study...... simple, being due mainly to a single recessive QTL on the left arm of chromosome 2. This locus colocalised with a QTL that conditioned variation in female life span, acting as an overdominant locus for this trait. Male life span was additionally affected by variation at the X-chromosome. Conclusion...

  3. Phenotypic plasticity in Drosophila pigmentation caused by temperature sensitivity of a chromatin regulator network.

    Directory of Open Access Journals (Sweden)

    Jean-Michel Gibert

    2007-02-01

    Full Text Available Phenotypic plasticity is the ability of a genotype to produce contrasting phenotypes in different environments. Although many examples have been described, the responsible mechanisms are poorly understood. In particular, it is not clear how phenotypic plasticity is related to buffering, the maintenance of a constant phenotype against genetic or environmental variation. We investigate here the genetic basis of a particularly well described plastic phenotype: the abdominal pigmentation in female Drosophila melanogaster. Cold temperature induces a dark pigmentation, in particular in posterior segments, while higher temperature has the opposite effect. We show that the homeotic gene Abdominal-B (Abd-B has a major role in the plasticity of pigmentation in the abdomen. Abd-B plays opposite roles on melanin production through the regulation of several pigmentation enzymes. This makes the control of pigmentation very unstable in the posterior abdomen, and we show that the relative spatio-temporal expression of limiting pigmentation enzymes in this region of the body is thermosensitive. Temperature acts on melanin production by modulating a chromatin regulator network, interacting genetically with the transcription factor bric-à-brac (bab, a target of Abd-B and Hsp83, encoding the chaperone Hsp90. Genetic disruption of this chromatin regulator network increases the effect of temperature and the instability of the pigmentation pattern in the posterior abdomen. Colocalizations on polytene chromosomes suggest that BAB and these chromatin regulators cooperate in the regulation of many targets, including several pigmentation enzymes. We show that they are also involved in sex comb development in males and that genetic destabilization of this network is also strongly modulated by temperature for this phenotype. Thus, we propose that phenotypic plasticity of pigmentation is a side effect reflecting a global impact of temperature on epigenetic mechanisms

  4. TRPA1 channels in Drosophila and honey bee ectoparasitic mites share heat sensitivity and temperature-related physiological functions

    Directory of Open Access Journals (Sweden)

    Guangda Peng

    2016-10-01

    Full Text Available The transient receptor potential cation channel, subfamily A, member 1 (TRPA1 is conserved between many arthropods, and in some has been shown to function as a chemosensor for noxious compounds. Activation of arthropod TRPA1 channels by temperature fluctuations has been tested in only a few insect species, and all of them were shown to be activated by heat. The recent identification of chemosensitive TRPA1 channels from two honey bee ectoparasitic mite species (VdTRPA1 and TmTRPA1 have provided an opportunity to study the temperature-dependent activation and the temperature-associated physiological functions of TRPA1 channels in non-insect arthropods. We found that both mite TRPA1 channels are heat sensitive and capable of rescuing the temperature-related behavioral defects of a Drosophila melanogaster trpA1 mutant. These results suggest that heat-sensitivity of TRPA1 could be conserved between many arthropods despite its amino acid sequence diversity. Nevertheless, the ankyrin repeats (ARs 6 and 7 are well-conserved between six heat-sensitive arthropod TRPA1 channels and have critical roles for the heat activation of VdTRPA1.

  5. MtDNA mutagenesis impairs elimination of mitochondria during erythroid maturation leading to enhanced erythrocyte destruction

    NARCIS (Netherlands)

    Ahlqvist, K.J.; Leoncini, S.; Pecorelli, A.; Wortmann, S.B.; Ahola, S.; Forsstrom, S.; Guerranti, R.; Felice, C. De; Smeitink, J.; Ciccoli, L.; Hamalainen, R.H.; Suomalainen, A.

    2015-01-01

    Haematopoietic progenitor cells show special sensitivity to mitochondrial DNA (mtDNA) mutagenesis, which suggests that increased mtDNA mutagenesis could underlie anemias. Here we show that elevated mtDNA mutagenesis in mice with a proof-reading deficient mtDNA polymerase (PolG) leads to incomplete

  6. Diverse radiofrequency sensitivity and radiofrequency effects of mobile or cordless phone near fields exposure in Drosophila melanogaster.

    Directory of Open Access Journals (Sweden)

    Styliani Geronikolou

    Full Text Available INTRODUCTION: The impact of electromagnetic fields on health is of increasing scientific interest. The aim of this study was to examine how the Drosophila melanogaster animal model is affected when exposed to portable or mobile phone fields. METHODS/RESULTS: Two experiments have been designed and performed in the same laboratory conditions. Insect cultures were exposed to the near field of a 2G mobile phone (the GSM 2G networks support and complement in parallel the 3G wide band or in other words the transmission of information via voice signals is served by the 2G technology in both mobile phones generations and a 1880 MHz cordless phone both digitally modulated by human voice. Comparison with advanced statistics of the egg laying of the second generation exposed and non-exposed cultures showed limited statistical significance for the cordless phone exposed culture and statistical significance for the 900 MHz exposed insects. We calculated by physics, simulated and illustrated in three dimensional figures the calculated near fields of radiation inside the experimenting vials and their difference. Comparison of the power of the two fields showed that the difference between them becomes null when the experimental cylinder radius and the height of the antenna increase. CONCLUSIONS/SIGNIFICANCE: Our results suggest a possible radiofrequency sensitivity difference in insects which may be due to the distance from the antenna or to unexplored intimate factors. Comparing the near fields of the two frequencies bands, we see similar not identical geometry in length and height from the antenna and that lower frequencies tend to drive to increased radiofrequency effects.

  7. Studies on mutagen-sensitive strains of Drosophila melanogaster. Pt. 3

    International Nuclear Information System (INIS)

    Sankaranarayanan, K.; Ferro, W.; Rijksuniversiteit Leiden; Zijlstra, J.A.

    1983-01-01

    The sensitivity of male germ cells of ebony (UV and X-ray sensitive) and Canton-S (wild-type) flies to the induction of sex-linked recessive lethals by 3 direct-acting mutagens (methyl methanesulphonate (MMS), N-ethyl-N-nitrosourea (ENU) and 1,2:3,4-diepoxybutane (DEB)) and 2 chemicals that require metabolic activation (N-nitrosodiethylamine (DEN) and 1-(2,4,6-trichlorophenyl)-3-3-dimenthyltriazene (2,4,6-Cl 3 -PDMT)) was investigated. In addition, experiments were carried out to examine whether mutational lesions induced by MMS, ENU and DEN in mature spermatozoa of males were processed differently by the oocytes of ebony and Canton-S flies (maternal effect studies). With all 3 direct-acting mutagens, the mutational responses of the post-meiotic male germ cells of the ebony and Canton-S flies were similar. After DEN treatment however, the ebony males responded with significantly lower frequencies of sex-linked recessive lethals in their pre- and post-meiotic germ cells. Measurements of microsomal P-450 enzymes revealed no detectable differences between the 2 strains with respect to either total cytochrome P-450 content or benzo[a]pyrene hydroxylation activity; the p-nitroanisole demethylation activity however, was lower in the ebony than in Canton-S flies. With 2,4,6-Cl 3 -PDMT, the spermatids of ebony males responded with higher frequencies of recessive lethals than those of Canton-S males. The maternal effect studies provided no evidence for any differential processing of mutational lesions in the Canton-S and ebony females. (orig.)

  8. Characterization of conditionally expressed mutants affecting age-specific Drosophila melanogaster : Lethal conditions and temperature-sensitive periods

    NARCIS (Netherlands)

    Vermeulen, CJ; Bijlsma, R

    The specific genetic basis of inbreeding depression is poorly understood. To address this question, two conditionally expressed lethal effects that were found to cause line-specific life span reductions in two separate inbred lines of Drosophila melanogaster. were characterized phenotypically and

  9. Optimization of Combinatorial Mutagenesis

    Science.gov (United States)

    Parker, Andrew S.; Griswold, Karl E.; Bailey-Kellogg, Chris

    Protein engineering by combinatorial site-directed mutagenesis evaluates a portion of the sequence space near a target protein, seeking variants with improved properties (stability, activity, immunogenicity, etc.). In order to improve the hit-rate of beneficial variants in such mutagenesis libraries, we develop methods to select optimal positions and corresponding sets of the mutations that will be used, in all combinations, in constructing a library for experimental evaluation. Our approach, OCoM (Optimization of Combinatorial Mutagenesis), encompasses both degenerate oligonucleotides and specified point mutations, and can be directed accordingly by requirements of experimental cost and library size. It evaluates the quality of the resulting library by one- and two-body sequence potentials, averaged over the variants. To ensure that it is not simply recapitulating extant sequences, it balances the quality of a library with an explicit evaluation of the novelty of its members. We show that, despite dealing with a combinatorial set of variants, in our approach the resulting library optimization problem is actually isomorphic to single-variant optimization. By the same token, this means that the two-body sequence potential results in an NP-hard optimization problem. We present an efficient dynamic programming algorithm for the one-body case and a practically-efficient integer programming approach for the general two-body case. We demonstrate the effectiveness of our approach in designing libraries for three different case study proteins targeted by previous combinatorial libraries - a green fluorescent protein, a cytochrome P450, and a beta lactamase. We found that OCoM worked quite efficiently in practice, requiring only 1 hour even for the massive design problem of selecting 18 mutations to generate 107 variants of a 443-residue P450. We demonstrate the general ability of OCoM in enabling the protein engineer to explore and evaluate trade-offs between quality and

  10. Molecular genetics of rhodopsin and phototrans duction in the visual system of Drosophila

    International Nuclear Information System (INIS)

    Zuker, C.; Cowman, A.; Montell, C.; Rubin, G.

    1987-01-01

    The authors have isolated the genes encoding four Drosophila visual pigments. Each of these opsins is expressed in a set of functionally and anatomically distinct photoreceptor cells of the eye. One is expressed in the six outer photoreceptor cells (R1-R6), the second in the central R8 photoreceptor cell, and the other two in the UV sensitive R7 photoreceptor cells. They have determined the structure and nucleotide sequence of each of these genes. They have used P element-mediated gene transfer to introduce the cloned structural gene for the R1-R6 opsin in the Drosophila germline and restored the ninaE mutant phenotype to wild-type. In an attempt to study the contribution of the various opsins to the specific functional properties of the different photoreceptor cell types, they have genetically engineered Drosophila lines that express R8 opsin in the R1-R6 photoreceptor cells. In collaboration with Drs. Ozaki and Pak at Purdue University, they have used oligonucleotide site-directed mutagenesis to mutate selected amino acids and regions of the rhodopsin molecule and reintroduced the mutated genes into Drosophila to analyze structure-function relationships in the rhodopsin molecule

  11. DNA degradation, UV sensitivity and SOS-mediated mutagenesis in strains of Escherichia coli deficient in single-strand DNA binding protein: Effects of mutations and treatments that alter levels of exonuclease V or RecA protein

    International Nuclear Information System (INIS)

    Lieberman, H.B.; Witkin, E.M.

    1983-01-01

    Certain strains suppress the temperature-sensitivity caused by ssb-1, which encodes a mutant ssDNA binding protein (SSB). At 42 0 C, such strains are extremely UV-sensitive, degrade their DNA extensively after UV irradiation, and are defficient in UV mutability and UV induction of recA protein synthesis. We transduced recC22, which eliminates Exonuclease V activity, and recAo281, which causes operator-constitutive synthesis of recA protein, into such an ssb-1 strain. Both double mutants degraded their DNA extensively at 42 0 C after UV irradiation, and both were even more UV-sensitive than the ssb-1 single mutant. We conclude that one or more nucleases other than Exonuclease V degrades DNA in the ssb recC strain, and that recA protein, even if synthesized copiously, can function efficiently in recombinational DNA repair and in control of post-UV DNA degradation only if normal SSB is also present. Pretreatment with nalidixic acid at 30 0 C restored normal UV mutability at 42 0 C, but did not increase UV resistance, in an ssb-1 strain. Another ssb allele, ssb-113, which blocks SOS induction at 30 0 C, increases spontaneous mutability more than tenfold. The ssb-113 allele was transduced into the SOS-constitutive recA730 strain SC30. This double mutant expressed the same elevated spontaneous and UV-induced mutability at 30 0 C as the ssb + recA730 strain, and was three times more UV-resistant than its ssb-113 recA + parent. We conclude that ssb-1 at 42 0 C and ssb-113 at 30 0 C block UV-induced activation of recA protease, but that neither allele interferes with subsequent steps in SOS-mediated mutagenesis. (orig.)

  12. Classical mutagenesis in higher plants

    NARCIS (Netherlands)

    Koornneef, M.

    2002-01-01

    For a long time, mutagenesis research in plants focused on crop improvement and, especially for crop plants, opimised protocols were developed with barley being one of the favourite species. However, the interest in mutagenesis has shifted to basic plant research in the last 20 years, when the power

  13. Effect of gamma irradiation on the life span of Drosophila melanogaster (Demonstration of threshold and sexual sensitivity differences)

    International Nuclear Information System (INIS)

    Giess, M.-C.; Planel, H.

    1977-01-01

    Drosophila melanogaster is irradiated by 5 to 75 krads of 60 Co gamma radiation at a dose rate of 1,000 rads/mn, on the fourth day of its imaginal life. As a result, the life span of the flies is reduced for both sexes. However, females are more radiosensitive than males. On the other hand, the radiosensitivity threshold in females is lower than in males: a life span decrease starts in males at a dose of 10 krads and at a dose of 25 krads in females [fr

  14. Two Components of Aversive Memory in Drosophila, Anesthesia-Sensitive and Anesthesia-Resistant Memory, Require Distinct Domains Within the Rgk1 Small GTPase.

    Science.gov (United States)

    Murakami, Satoshi; Minami-Ohtsubo, Maki; Nakato, Ryuichiro; Shirahige, Katsuhiko; Tabata, Tetsuya

    2017-05-31

    Multiple components have been identified that exhibit different stabilities for aversive olfactory memory in Drosophila These components have been defined by behavioral and genetic studies and genes specifically required for a specific component have also been identified. Intermediate-term memory generated after single cycle conditioning is divided into anesthesia-sensitive memory (ASM) and anesthesia-resistant memory (ARM), with the latter being more stable. We determined that the ASM and ARM pathways converged on the Rgk1 small GTPase and that the N-terminal domain-deleted Rgk1 was sufficient for ASM formation, whereas the full-length form was required for ARM formation. Rgk1 is specifically accumulated at the synaptic site of the Kenyon cells (KCs), the intrinsic neurons of the mushroom bodies, which play a pivotal role in olfactory memory formation. A higher than normal Rgk1 level enhanced memory retention, which is consistent with the result that Rgk1 suppressed Rac-dependent memory decay; these findings suggest that rgk1 bolsters ASM via the suppression of forgetting. We propose that Rgk1 plays a pivotal role in the regulation of memory stabilization by serving as a molecular node that resides at KC synapses, where the ASM and ARM pathway may interact. SIGNIFICANCE STATEMENT Memory consists of multiple components. Drosophila olfactory memory serves as a fundamental model with which to investigate the mechanisms that underlie memory formation and has provided genetic and molecular means to identify the components of memory, namely short-term, intermediate-term, and long-term memory, depending on how long the memory lasts. Intermediate memory is further divided into anesthesia-sensitive memory (ASM) and anesthesia-resistant memory (ARM), with the latter being more stable. We have identified a small GTPase in Drosophila , Rgk1, which plays a pivotal role in the regulation of olfactory memory stability. Rgk1 is required for both ASM and ARM. Moreover, N

  15. Sensitivity to thermal extremes in Australian Drosophila implies similar impacts of climate change on the distribution of widespread and tropical species.

    Science.gov (United States)

    Overgaard, Johannes; Kearney, Michael R; Hoffmann, Ary A

    2014-06-01

    Climatic factors influence the distribution of ectotherms, raising the possibility that distributions of many species will shift rapidly under climate change and/or that species will become locally extinct. Recent studies have compared performance curves of species from different climate zones and suggested that tropical species may be more susceptible to climate change than those from temperate environments. However, in other comparisons involving responses to thermal extremes it has been suggested that mid-latitude populations are more susceptible. Using a group of 10 closely related Drosophila species with known tropical or widespread distribution, we undertake a detailed investigation of their growth performance curves and their tolerance to thermal extremes. Thermal sensitivity of life history traits (fecundity, developmental success, and developmental time) and adult heat resistance were similar in tropical and widespread species groups, while widespread species had higher adult cold tolerance under all acclimation regimes. Laboratory measurements of either population growth capacity or acute tolerance to heat and cold extremes were compared to daily air temperature under current (2002-2007) and future (2100) conditions to investigate if these traits could explain current distributions and, therefore, also forecast future effects of climate change. Life history traits examining the thermal sensitivity of population growth proved to be a poor predictor of current species distributions. In contrast, we validate that adult tolerance to thermal extremes provides a good correlate of current distributions. Thus, in their current distribution range, most of the examined species experience heat exposure close to, but rarely above, the functional heat resistance limit. Similarly, adult functional cold resistance proved a good predictor of species distribution in cooler climates. When using the species' functional tolerance limits under a global warming scenario, we

  16. Antimicrobials, stress and mutagenesis.

    Directory of Open Access Journals (Sweden)

    Alexandro Rodríguez-Rojas

    2014-10-01

    Full Text Available Cationic antimicrobial peptides are ancient and ubiquitous immune effectors that multicellular organisms use to kill and police microbes whereas antibiotics are mostly employed by microorganisms. As antimicrobial peptides (AMPs mostly target the cell wall, a microbial 'Achilles heel', it has been proposed that bacterial resistance evolution is very unlikely and hence AMPs are ancient 'weapons' of multicellular organisms. Here we provide a new hypothesis to explain the widespread distribution of AMPs amongst multicellular organism. Studying five antimicrobial peptides from vertebrates and insects, we show, using a classic Luria-Delbrück fluctuation assay, that cationic antimicrobial peptides (AMPs do not increase bacterial mutation rates. Moreover, using rtPCR and disc diffusion assays we find that AMPs do not elicit SOS or rpoS bacterial stress pathways. This is in contrast to the main classes of antibiotics that elevate mutagenesis via eliciting the SOS and rpoS pathways. The notion of the 'Achilles heel' has been challenged by experimental selection for AMP-resistance, but our findings offer a new perspective on the evolutionary success of AMPs. Employing AMPs seems advantageous for multicellular organisms, as it does not fuel the adaptation of bacteria to their immune defenses. This has important consequences for our understanding of host-microbe interactions, the evolution of innate immune defenses, and also sheds new light on antimicrobial resistance evolution and the use of AMPs as drugs.

  17. Classical mutagenesis in higher plants

    OpenAIRE

    Koornneef, M.

    2002-01-01

    For a long time, mutagenesis research in plants focused on crop improvement and, especially for crop plants, opimised protocols were developed with barley being one of the favourite species. However, the interest in mutagenesis has shifted to basic plant research in the last 20 years, when the power of mutant approaches in combination with molecular techniques to investigate the molecular nature of the genes became fully appreciated

  18. Structure-function analysis of Drosophila Notch using genomic rescue transgenes.

    Science.gov (United States)

    Leonardi, Jessica; Jafar-Nejad, Hamed

    2014-01-01

    One of the evolutionarily conserved posttranslational modifications of the Notch receptors is the addition of an O-linked glucose to epidermal growth factor-like (EGF) repeats with a specific consensus sequence by the protein O-glucosyltransferase Rumi (POGLUT1 in human). Loss of rumi in flies results in a temperature-sensitive loss of Notch signaling. To demonstrate that the Notch receptor itself is the biologically relevant target of Rumi in flies, and to determine the role of the 18 Rumi target sites on Notch in regulating Notch signaling, we have performed an in vivo structure-function analysis of Drosophila Notch. In this chapter, we provide a detailed protocol for this analysis. To avoid the potential artifacts associated with overexpression of Notch and random insertion of transgenes, we have used recombineering and site-specific integration technologies, which have been adapted for usage in Drosophila in recent years. Using gene synthesis and site-directed mutagenesis, we generated a series of Notch genomic transgenes which harbor mutations in all or specific subsets of Notch O-glucose sites. Gene dosage and rescue experiments in animals raised at various temperatures allowed us to dissect the contribution of O-glucosylation sites to the regulation of the Notch signaling strength. The reagents and methods presented here can be used to address similar questions about other posttranslational modifications of Notch or other Drosophila proteins.

  19. Mutagenesis in mammalian cells

    International Nuclear Information System (INIS)

    Burki, H.J.

    1981-01-01

    Mutagenic processes in synchronous cultures of Chinese hamster ovary cells have been studied. There is a difference in the induction of mutants by ultraviolet light during the cell cycle. There appears to be a sensitive period in the middle of the G1 stage of the cell cycle suggesting some mutagenic mechanism is present at that time. Studies indicate that mutation induction during the cell cycle is also mutagen specific since exposure to ethyl nitrosourea in the same system produces different results. Two clones have been isolated which are ultrasensitive to ultraviolet light. These cells are being used to determine if this hypermutability is cell-cycle dependent, related to cell cycle biochemistry, or to repair processes independent of cell cycle. Tritium and bromodeoxyuridine induced damage to synchronously dividing cell cultures are also being studied in relation to DNA replication. Cell killing by ionizing radiation is also related to the cell cycle. Sensitive times in the cell cycle for mutation induction by ionization radiation are identified

  20. Comments on mutagenesis risk estimation

    International Nuclear Information System (INIS)

    Russell, W.L.

    1976-01-01

    Several hypotheses and concepts have tended to oversimplify the problem of mutagenesis and can be misleading when used for genetic risk estimation. These include: the hypothesis that radiation-induced mutation frequency depends primarily on the DNA content per haploid genome, the extension of this concept to chemical mutagenesis, the view that, since DNA is DNA, mutational effects can be expected to be qualitatively similar in all organisms, the REC unit, and the view that mutation rates from chronic irradiation can be theoretically and accurately predicted from acute irradiation data. Therefore, direct determination of frequencies of transmitted mutations in mammals continues to be important for risk estimation, and the specific-locus method in mice is shown to be not as expensive as is commonly supposed for many of the chemical testing requirements

  1. The influence of sterol metabolism upon radiation-induced aneuploidy of Drosophila melanogaster in the yeast-drosophila system

    International Nuclear Information System (INIS)

    Savitsij, V.V.; Luchnikova, E.M.; Inge-Vechtomov, S.I.

    1985-01-01

    The influence of sterol metabolism upon induced Drosophila melanogaster mutagenesis in an ecology-genetic yeast-drosophila system has been studied. The sterol deficit in fly organism has been created for account of using as food substrate for fremales of biomass of saccharomyces cerevisiae living cells of 9-2-PZ12 train with nyssup(r1) locus mutation which blocks the ergosterol synthesis. It has been found that the Drosophila females content on mutant yeast increases the frequency of losses and non discrepancy of X-chromosomes induced by X-radiation (1000 R). Addition into yeast biomass of 0.1 % cholesterol solution in 10 %-ethanol reduces the oocytes resistance to X-radiation up to control level. Possible hormonal and membrane mechanisms of increasing radiation-induced aneuploidy of Drosophila and the role of sterol metabolism in organism resistance to damaging factors are discussed

  2. Laboratory of Mutagenesis and DNA Repair

    International Nuclear Information System (INIS)

    2000-01-01

    Full text: Two main lines of research were continued: the first one concerned the mechanisms controlling the fidelity of DNA replication in Escherichia coli; the second concerned cellular responses of Saccharomyces cerevisiae to DNA damaging agents. We have been investigating the question whether during chromosomal DNA replication in Escherichia coli the two DNA strands may be replicated with differential accuracy. To address this question we set up a new system that allows the examination of mutagenesis either of the leading strand or the lagging strand. Our results suggest that the lagging strand replication of the E. coli chromosome may be more accurate than leading strand replication. More recently, we studied mutagenesis of the two strands in recA730 strains which exhibit constitutive expression of the SOS system. Our results clearly indicate that in recA730 strains there is a significant difference in the fidelity of replication between the two replicating strands. Based on our data we propose a model describing a possible mechanism of SOS mutagenesis. To get more insight into cellular responses to DNA damage we have isolated several novel genes of S. cerevisiae, the transcription of which is induced by DNA lesions. Main effort was concentrated on the characterization of the DIN7 gene. We found that Din7p specifically affects the metabolism of mitochondrial DNA (mtDNA). The elevated level of Din7p results in an increased frequency of mitochondrial petite mutants, as well as in a higher frequency of mitochondrial point mutations. Din7p affects also the stability of microsatellite sequences present in the mitochondrial genome. As expected, Din7p was found to be located in mitochondria. In another project, we found that the DIN8 gene isolated in our laboratory is identical with the UMP1 gene encoding a chaperone-like protein involved in 20S proteasome maturation. Interestingly, induction of UMP1 expression in response to DNA damage is subject to regulation

  3. Effect of sterol metabolism in the yeast-Drosophila system on the frequency of radiation-induced aneuploidy in the Drosophila melanogaster oocytes

    International Nuclear Information System (INIS)

    Savitskii, V.V.; Luchnikova, E.M.; Inge-Vechtomov, S.G.

    1986-01-01

    The effect of sterol metabolism on induced mutagenesis of Drosophila melanogaster was studied in the ecogenetic system of yeast-Drosophila. Sterol deficiency was created in Drosophila by using the biomass of live cells of Saccharomyces cerevisiae strain 9-2-P712 till mutation in locus nys/sup r1/ blocking the synthesis of ergosterol as the food. It was found that rearing of Drosophila females on the mutant yeast increases the frequency of loss and nondisjunction of X chromosomes induced in mature oocytes by X rays (1000 R). Addition of 0.1% of cholesterol solution in 10% ethanol to the yeast biomass restores the resistance of oocyte to X irradiation to the control level. The possible hormonal effect on membrane leading to increased radiation-induced aneuploidy in Drosophila and the role of sterol metabolism in determining the resistance to various damaging factors are discussed

  4. Radiation mutagenesis of subtropic plants

    International Nuclear Information System (INIS)

    Kerkadze, I.G.

    1987-01-01

    Possibilities of expansion of subtropic plant changeability and development of new gene bank for future selection-genetic studies are detected. New trends of radiation mutagenesis of subtropic plants are formulated as results of studies during many years. A lot of mutants is subjected to sufficient tests, and concrete results are obtained with the help of these tests for definite species. Summing genetic and selection estimations of the results, it is possible to make the conclusion that mutant selection represents one of the powerful methods of preparation of productive and qualitative species of subtropic plants, which are successfully introduced into practice

  5. Functional Analysis of Human NF1 in Drosophila

    Science.gov (United States)

    2007-01-01

    Stratagene Chameleon kit with a pBSK-specific phosphorylated selection primer (50 pCCGCCACCGCGATGTAGCTCCAATTCGC 30) and mutation -specific mutagenesis...identified by examining the phenotypes of mutated human gene expressed in Drosophila NF1 null mutants. We also propose that Gsα/NF1-activated AC...With this paradigm established, we further tested the effects of different hNF1 deletion mutations our lab created have on the stimulation event. We

  6. Direct random insertion mutagenesis of Helicobacter pylori

    NARCIS (Netherlands)

    de Jonge, Ramon; Bakker, Dennis; van Vliet, Arnoud H. M.; Kuipers, Ernst J.; Vandenbroucke-Grauls, Christina M. J. E.; Kusters, Johannes G.

    2003-01-01

    Random insertion mutagenesis is a widely used technique for the identification of bacterial virulence genes. Most strategies for random mutagenesis involve cloning in Escherichia coli for passage of plasmids or for phenotypic selection. This can result in biased selection due to restriction or

  7. Human SOD1 ALS Mutations in a Drosophila Knock-In Model Cause Severe Phenotypes and Reveal Dosage-Sensitive Gain- and Loss-of-Function Components.

    Science.gov (United States)

    Şahin, Aslı; Held, Aaron; Bredvik, Kirsten; Major, Paxton; Achilli, Toni-Marie; Kerson, Abigail G; Wharton, Kristi; Stilwell, Geoff; Reenan, Robert

    2017-02-01

    Amyotrophic Lateral Sclerosis (ALS) is the most common adult-onset motor neuron disease and familial forms can be caused by numerous dominant mutations of the copper-zinc superoxide dismutase 1 (SOD1) gene. Substantial efforts have been invested in studying SOD1-ALS transgenic animal models; yet, the molecular mechanisms by which ALS-mutant SOD1 protein acquires toxicity are not well understood. ALS-like phenotypes in animal models are highly dependent on transgene dosage. Thus, issues of whether the ALS-like phenotypes of these models stem from overexpression of mutant alleles or from aspects of the SOD1 mutation itself are not easily deconvolved. To address concerns about levels of mutant SOD1 in disease pathogenesis, we have genetically engineered four human ALS-causing SOD1 point mutations (G37R, H48R, H71Y, and G85R) into the endogenous locus of Drosophila SOD1 (dsod) via ends-out homologous recombination and analyzed the resulting molecular, biochemical, and behavioral phenotypes. Contrary to previous transgenic models, we have recapitulated ALS-like phenotypes without overexpression of the mutant protein. Drosophila carrying homozygous mutations rendering SOD1 protein enzymatically inactive (G85R, H48R, and H71Y) exhibited neurodegeneration, locomotor deficits, and shortened life span. The mutation retaining enzymatic activity (G37R) was phenotypically indistinguishable from controls. While the observed mutant dsod phenotypes were recessive, a gain-of-function component was uncovered through dosage studies and comparisons with age-matched dsod null animals, which failed to show severe locomotor defects or nerve degeneration. We conclude that the Drosophila knock-in model captures important aspects of human SOD1-based ALS and provides a powerful and useful tool for further genetic studies. Copyright © 2017 by the Genetics Society of America.

  8. Glia in Drosophila behavior.

    Science.gov (United States)

    Zwarts, L; Van Eijs, F; Callaerts, P

    2015-09-01

    Glial cells constitute about 10 % of the Drosophila nervous system. The development of genetic and molecular tools has helped greatly in defining different types of glia. Furthermore, considerable progress has been made in unraveling the mechanisms that control the development and differentiation of Drosophila glia. By contrast, the role of glia in adult Drosophila behavior is not well understood. We here summarize recent work describing the role of glia in normal behavior and in Drosophila models for neurological and behavioral disorders.

  9. Cellular components required for mutagenesis

    International Nuclear Information System (INIS)

    Elledge, S.J.; Perry, K.L.; Krueger, J.H.; Mitchell, B.B.; Walker, G.C.

    1983-01-01

    We have cloned the umuD and umuC genes of Escherichia coli and have shown that they code for two proteins of 16,000 and 45,000 daltons respectively; the two genes are organized in an operon that is repressed by the LexA protein. Similarly, we have shown that the mucA and mucB genes of the mutagenesis-enhancing plasmid pKM101 code for proteins of 16,000 and 45,000 daltons respectively and, like umuD/C, the genes are organized in an operon. Preliminary sequencing studies have indicated that the umuD/C and mucA/B loci are approximately 50% homologous at both the nucleic acid and deduced protein sequence levels and that the umuD gene is preceeded by two putative LexA binding sites separated by 4 basepairs. Like umuD/C, the mucA/B genes of pKM101 are induced by DNA damage and are repressed by LexA. In addition to inducing recA + lexA + -regulated din genes, DNA damaging agents such as uv and nalidixic acid also induce the heat shock proteins GroEL and DnaK in an htpR-dependent fashion. 22 references, 1 figure, 1 table

  10. Supplementation of Spirulina (Arthrospira platensis) Improves Lifespan and Locomotor Activity in Paraquat-Sensitive DJ-1βΔ93Flies, a Parkinson's Disease Model in Drosophila melanogaster.

    Science.gov (United States)

    Kumar, Ajay; Christian, Pearl K; Panchal, Komal; Guruprasad, B R; Tiwari, Anand K

    2017-09-03

    Spirulina (Arthrospira platensis) is a cyanobacterium (blue-green alga) consumed by humans and other animals because of its nutritional values and pharmacological properties. Apart from high protein contents, it also contains high levels of antioxidant and anti-inflammatory compounds, such as carotenoids, β-carotene, phycocyanin, and phycocyanobilin, indicating its possible pharmaco-therapeutic utility. In the present study using DJ-1β Δ93 flies, a Parkinson's disease model in Drosophila, we have demonstrated the therapeutic effect of spirulina and its active component C-phycocyanin (C-PC) in the improvement of lifespan and locomotor behavior. Our findings indicate that dietary supplementation of spirulina significantly improves the lifespan and locomotor activity of paraquat-fed DJ-1β Δ93 flies. Furthermore, supplementation of spirulina and C-PC individually and independently reduced the cellular stress marked by deregulating the expression of heat shock protein 70 and Jun-N-terminal kinase signaling in DJ-1β Δ93 flies. A significant decrease in superoxide dismutase and catalase activities in spirulina-fed DJ-1β Δ93 flies tends to indicate the involvement of antioxidant properties associated with spirulina in the modulation of stress-induced signaling and improvement in lifespan and locomotor activity in Drosophila DJ-1β Δ93 flies. Our results suggest that antioxidant boosting properties of spirulina can be used as a nutritional supplement for improving the lifespan and locomotor behavior in Parkinson's disease.

  11. DNA repair and mutagenesis of singlestranded bacteriophages

    Energy Technology Data Exchange (ETDEWEB)

    Doubleday, O.P.; Brandenburger, A.; Wagner, R. Jr.; Radman, M. (Brussels Univ. (Belgium)); Godson, G.N.

    1981-01-01

    Virtually all radiation-induced mutagenesis is believed to result from an error-prone repair activity (SOS repair) and to involve mutations occurring both at the site of radiation-induced lesions (targeted mutations) and in undamaged DNA (untargeted mutations). To examine the relative contributions of targeted and untargeted mutations to ..gamma.. and ultraviolet (UV) radiation mutagenesis we have determined the DNA sequences of 174 M13 revertant phages isolated from stocks of irradiated or unirradiated amber mutants grown in irradiated or unirradiated host bacteria. We have detected no obvious specificity of mutagenesis and find no evidence of a predominance of targeted mutations associated with either UV- or ..gamma..-irradiation of the phages or with the induction of the host SOS repair system. In particular, pyrimidine dimers do not appear to be the principal sites of UV-induced bare substitution mutagenesis, suggesting that such UV-induced mutagenesis may be untargeted or occur at sites of lesions other than pyrimidine dimers.

  12. Drosophila melanogaster deoxyribonucleoside kinase activates gemcitabine

    DEFF Research Database (Denmark)

    Knecht, Wolfgang; Mikkelsen, N.E.; Clausen, A.R.

    2009-01-01

    Drosophila melanogaster multisubstrate deoxyribonucleoside kinase (Dm-dNK) can additionally sensitize human cancer cell lines towards the anti-cancer drug gemcitabine. We show that this property is based on the Dm-dNK ability to efficiently phosphorylate gemcitabine. The 2.2 angstrom resolution...

  13. Photodynamic action of the methylene blue: mutagenesis and sinergism

    International Nuclear Information System (INIS)

    Capella, M.A.M.

    1988-01-01

    Two aspects of photodynamic therapy were studied: the associated mutagenesis and the interactions with physical agents, in order to increase its biological effects. The photodynamic action with methylene blue in the mutagenesis and sinergism is studied. (L.M.J.)

  14. Stationary-State Mutagenesis in Escherichia coli

    Indian Academy of Sciences (India)

    Stationary-phase mutagenesis in nondividing E. coli cells exposed to a nonlethal stress was, a few years ago, claimed to be a likely case of a Lamarckian mechanism capable of producing exclusively useful mutations in a directed manner. After a heated debate over the last decade it now appears to involve a Darwinian ...

  15. Studies on radioisotope mutagenesis in mammals

    International Nuclear Information System (INIS)

    Reddi, O.S.; Naidu, N.V.; Reddy, P.P.

    1974-01-01

    Studies on radioisotope mutagenesis are important from the point of view of the possible genetic hazards of their increasing use in medical and industrial applications and their concentration in man through environmental contamination. This paper reviews a series of studies undertaken on the genetic consequences of internal administation of certain selected radioisotopes, namely, 32 P, 131 I and 90 Sr in mammalian systems. (author)

  16. Complex epidemiological approach to human mutagenesis

    International Nuclear Information System (INIS)

    Czeizel, A.

    1980-01-01

    The main characteristics of the epidemiological approach are summarised and the criteria discussed for the adoption of this approach for the detection of human mutagenesis. Mutation monitoring systems are described and results of epidemiological studies of higher risk populations are presented. (C.F.)

  17. Seed mutagenesis in Portulaca grandiflora (Hook)

    International Nuclear Information System (INIS)

    Bennani, F.; Rossi-Hassani, B.D.

    2001-01-01

    Betalain pigments have been used as natural additives. Despite their importance, the biochemistry and genetics of betalain synthesis remain relatively undetermined. Portulaca grandiflora represents an ideal material for genetic analysis. In the present work, seed mutagenesis was examined with a view to enhance the chance of detection of new genetic markers in this species

  18. Ovotoxicants 4-vinylcyclohexene 1,2-monoepoxide and 4-vinylcyclohexene diepoxide disrupt redox status and modify different electrophile sensitive target enzymes and genes in Drosophila melanogaster

    Directory of Open Access Journals (Sweden)

    Amos O. Abolaji

    2015-08-01

    Full Text Available The compounds 4-vinylcyclohexene 1,2-monoepoxide (VCM and 4-Vinylcyclohexene diepoxide (VCD are the two downstream metabolites of 4-vinylcyclohexene (VCH, an ovotoxic agent in mammals. In addition, VCM and VCD may be found as by-products of VCH oxidation in the environment. Recently, we reported the involvement of oxidative stress in the toxicity of VCH in Drosophila melanogaster. However, it was not possible to determine the individual contributions of VCM and VCD in VCH toxicity. Hence, we investigated the toxicity of VCM and VCD (10–1000 µM in flies after 5 days of exposure via the diet. Our results indicated impairments in climbing behaviour and disruptions in antioxidant balance and redox status evidenced by an increase in DCFH oxidation, decreases in total thiol content and glutathione-S-transferase (GST activity in the flies exposed to VCM and VCD (p<0.05. These effects were accompanied by disruptions in the transcription of the genes encoding the proteins superoxide dismutase (SOD1, kelch-like erythroid-derived cap-n-collar (CNC homology (ECH-associated protein 1 (Keap-1, mitogen activated protein kinase 2 (MAPK-2, catalase, Cyp18a1, JAFRAC 1 (thioredoxin peroxidase 1 and thioredoxin reductase 1 (TrxR-1 (p<0.05. VCM and VCD inhibited acetylcholinesterase (AChE and delta aminolevulinic acid dehydratase (δ-ALA D activities in the flies (p<0.05. Indeed, here, we demonstrated that different target enzymes and genes were modified by the electrophiles VCM and VCD in the flies. Thus, D. melanogaster has provided further lessons on the toxicity of VCM and VCD which suggest that the reported toxicity of VCH may be mediated by its transformation to VCM and VCD.

  19. Use of mutagenesis, genetic mapping and next generation transcriptomics to investigate insecticide resistance mechanisms.

    Directory of Open Access Journals (Sweden)

    Predrag Kalajdzic

    Full Text Available Insecticide resistance is a worldwide problem with major impact on agriculture and human health. Understanding the underlying molecular mechanisms is crucial for the management of the phenomenon; however, this information often comes late with respect to the implementation of efficient counter-measures, particularly in the case of metabolism-based resistance mechanisms. We employed a genome-wide insertional mutagenesis screen to Drosophila melanogaster, using a Minos-based construct, and retrieved a line (MiT[w(-]3R2 resistant to the neonicotinoid insecticide Imidacloprid. Biochemical and bioassay data indicated that resistance was due to increased P450 detoxification. Deep sequencing transcriptomic analysis revealed substantial over- and under-representation of 357 transcripts in the resistant line, including statistically significant changes in mixed function oxidases, peptidases and cuticular proteins. Three P450 genes (Cyp4p2, Cyp6a2 and Cyp6g1 located on the 2R chromosome, are highly up-regulated in mutant flies compared to susceptible Drosophila. One of them (Cyp6g1 has been already described as a major factor for Imidacloprid resistance, which validated the approach. Elevated expression of the Cyp4p2 was not previously documented in Drosophila lines resistant to neonicotinoids. In silico analysis using the Drosophila reference genome failed to detect transcription binding factors or microRNAs associated with the over-expressed Cyp genes. The resistant line did not contain a Minos insertion in its chromosomes, suggesting a hit-and-run event, i.e. an insertion of the transposable element, followed by an excision which caused the mutation. Genetic mapping placed the resistance locus to the right arm of the second chromosome, within a ∼1 Mb region, where the highly up-regulated Cyp6g1 gene is located. The nature of the unknown mutation that causes resistance is discussed on the basis of these results.

  20. Studies on Drosophila radiosensitivity strains

    International Nuclear Information System (INIS)

    Varentsova, E.R.; Sharygin, V.I.; Khromykh, Yu.U.

    1985-01-01

    Fertility of radiosensitive mutant drosophila female strain rad (2) 201 61 after irradiation and frequency of dominant lethal mutations (DLM), induced by γ-radiation for 0-5 h and 5-7 days, are investigated. It is shown, that oocytes of the mutant strain are more radiosensitive as compared with cells of mongrel flies as to criterion of DLM appearance over the period of maturing. Early oocytes of stages 2-7 are the most sensitive, i.e. at the stages, corresponding to the manifestation of previously established recombination-defective properties of mutations rad (2) 201 61 . It is also sown, that doses of γ-rays, exceeding 10 Gy produce a strong sterilizing effect on mutant females due to destruction and resorption of egg chambers, irradiated at the stages of previtellogenetic growth of oocytes. In females, carrying mutation of radiosensitivity there is no direct correlation betwen sensitivity of oocytes proper to DLM induction and sensitivity of egg folleicles to resorbing effect of γ-rays. The ways of possible involvement of mutant locus studied into genetic processes in various specialized cells of drosophila

  1. CoinFLP: a system for efficient mosaic screening and for visualizing clonal boundaries in Drosophila

    OpenAIRE

    Bosch, Justin A.; Tran, Ngoc Han; Hariharan, Iswar K.

    2015-01-01

    Screens in mosaic Drosophila tissues that use chemical mutagenesis have identified many regulators of growth and patterning. Many of the mutant phenotypes observed were contingent upon the presence of both wild-type and mutant cells in the same tissue. More recently, large collections of RNAi lines or cDNAs expressed under Gal4/UAS control have been used to alter gene expression uniformly in specific tissues. However, these newer approaches are not easily combined with the efficient generatio...

  2. Rapid Recombination Mapping for High-Throughput Genetic Screens in Drosophila

    OpenAIRE

    Sapiro, Anne L.; Ihry, Robert J.; Buhr, Derek L.; Konieczko, Kevin M.; Ives, Sarah M.; Engstrom, Anna K.; Wleklinski, Nicholas P.; Kopish, Kristin J.; Bashirullah, Arash

    2013-01-01

    Mutagenesis screens are a staple of classical genetics. Chemical-induced mutations, however, are often difficult and time-consuming to identify. Here, we report that recombination analysis with pairs of dominant visible markers provides a rapid and reliable strategy to map mutations in Drosophila melanogaster. This method requires only two generations and a total of six crosses in vials to estimate the genetic map position of the responsible lesion with high accuracy. This genetic map positio...

  3. Sigma virus and mutation in Drosophila melanogaster

    International Nuclear Information System (INIS)

    Paquin, S.L.A.

    1977-01-01

    - The objectives of these experiments have been (1) to verify and evidence more fully the action of sigma in causing recessive lethal mutation on the X chromosome of Drosophila, both in the male and the female germ line; (2) to extend the study of sigma-induced recessive lethal mutation to the Drosophila autosomes; (3) to explore the possibility that this mutagenesis is site-directed; (4) to study the effects of sigma virus in conjunction with radiation in increasing non-disjunction and dominant lethality. The virus increases the rate of radiation-induced nondisjunction by altering meiotic chromosomal behavior. Percentage of non-disjunction with 500 rads of x-rays in the virus-free flies was 0.176, while in sigma-containing lines it was 0.333. With high doses of either x or neutron radiation, the presence of the virus enhances the frequency of dominant lethality. The difference is especially significant with the fast neutrons. The results indicate that sigma, and presumably other viruses, are indeed environmental mutagens and are, therefore, factors in the rate of background or spontaneous mutation

  4. Cloning-Independent and Counterselectable Markerless Mutagenesis System in Streptococcus mutans▿

    Science.gov (United States)

    Xie, Zhoujie; Okinaga, Toshinori; Qi, Fengxia; Zhang, Zhijun; Merritt, Justin

    2011-01-01

    Insertion duplication mutagenesis and allelic replacement mutagenesis are among the most commonly utilized approaches for targeted mutagenesis in bacteria. However, both techniques are limited by a variety of factors that can complicate mutant phenotypic studies. To circumvent these limitations, multiple markerless mutagenesis techniques have been developed that utilize either temperature-sensitive plasmids or counterselectable suicide vectors containing both positive- and negative-selection markers. For many species, these techniques are not especially useful due to difficulties of cloning with Escherichia coli and/or a lack of functional negative-selection markers. In this study, we describe the development of a novel approach for the creation of markerless mutations. This system employs a cloning-independent methodology and should be easily adaptable to a wide array of Gram-positive and Gram-negative bacterial species. The entire process of creating both the counterselection cassette and mutation constructs can be completed using overlapping PCR protocols, which allows extremely quick assembly and eliminates the requirement for either temperature-sensitive replicons or suicide vectors. As a proof of principle, we used Streptococcus mutans reference strain UA159 to create markerless in-frame deletions of 3 separate bacteriocin genes as well as triple mutants containing all 3 deletions. Using a panel of 5 separate wild-type S. mutans strains, we further demonstrated that the procedure is nearly 100% efficient at generating clones with the desired markerless mutation, which is a considerable improvement in yield compared to existing approaches. PMID:21948849

  5. Cloning-independent and counterselectable markerless mutagenesis system in Streptococcus mutans.

    Science.gov (United States)

    Xie, Zhoujie; Okinaga, Toshinori; Qi, Fengxia; Zhang, Zhijun; Merritt, Justin

    2011-11-01

    Insertion duplication mutagenesis and allelic replacement mutagenesis are among the most commonly utilized approaches for targeted mutagenesis in bacteria. However, both techniques are limited by a variety of factors that can complicate mutant phenotypic studies. To circumvent these limitations, multiple markerless mutagenesis techniques have been developed that utilize either temperature-sensitive plasmids or counterselectable suicide vectors containing both positive- and negative-selection markers. For many species, these techniques are not especially useful due to difficulties of cloning with Escherichia coli and/or a lack of functional negative-selection markers. In this study, we describe the development of a novel approach for the creation of markerless mutations. This system employs a cloning-independent methodology and should be easily adaptable to a wide array of Gram-positive and Gram-negative bacterial species. The entire process of creating both the counterselection cassette and mutation constructs can be completed using overlapping PCR protocols, which allows extremely quick assembly and eliminates the requirement for either temperature-sensitive replicons or suicide vectors. As a proof of principle, we used Streptococcus mutans reference strain UA159 to create markerless in-frame deletions of 3 separate bacteriocin genes as well as triple mutants containing all 3 deletions. Using a panel of 5 separate wild-type S. mutans strains, we further demonstrated that the procedure is nearly 100% efficient at generating clones with the desired markerless mutation, which is a considerable improvement in yield compared to existing approaches.

  6. Mutagenesis in bacteriophage T 7. 2

    International Nuclear Information System (INIS)

    Meyer, M.; Witte, W.

    1976-01-01

    UV induced mutagenesis of bacteriophage T 7 was investigated by using a forward mutation system (host range system) and a back mutation system (amber system). The results indicate a dependence of mutation of T 7 after UV irradiation only on the rec gene controlled functions of the bacterial host. The functions controlled by pol and uvr genes have no influence. Among other types of mutations UV irradiation leads to transitions from AT to GC. (author)

  7. Effects of chromosomal rearrangements on the zeste-white interaction in Drosophila melanogaster

    International Nuclear Information System (INIS)

    Smolik-Utlaut, S.M.; Gelbart, W.M.

    1987-01-01

    Three gene systems have been shown to exhibit proximity-dependent phenotypes in Drosophila melanogaster; bithorax (BX-C), decapentaplegic (DPP-C) and white (w). In structurally homozygous genotypes, specific allelic combinations at these loci exhibit one phenotype, while in certain rearrangement heterozygotes the same allelic combinations exhibit dramatically different phenotypes. The genetic properties of the proximity-dependent allelic complementation (termed transvection effects) at the BX-C and DPP-C, are quite similar. As determined by cytogenetic analysis of transvection-disrupting rearrangements, the critical regions for the BX-C and DDP-C transvection effects extend proximally from these loci for several hundred polytene chromosome bands. The interaction between the zeste and white loci appears to depend upon the proximity of the two w + alleles. By use of insertional duplications, displacement of w + homologues has been shown to interfere with the zeste-white interaction. In this report, the authors investigate the basis for the difference in the size of the BX-C and DPP-C critical regions from that of white using a 137 Cs-mutagenesis procedure. The authors test and eliminate the possibility that the difference is due to evidence strongly suggests that the zeste-white interaction is, at the phenotypic level, much less sensitive to displacement of the homologous genes than is transvection at either the BX-C or DPP-C. Given these results, they suggest that the zeste-white interaction and transvection are two different proximity-dependent phenomena

  8. Metabolomic Studies in Drosophila.

    Science.gov (United States)

    Cox, James E; Thummel, Carl S; Tennessen, Jason M

    2017-07-01

    Metabolomic analysis provides a powerful new tool for studies of Drosophila physiology. This approach allows investigators to detect thousands of chemical compounds in a single sample, representing the combined contributions of gene expression, enzyme activity, and environmental context. Metabolomics has been used for a wide range of studies in Drosophila , often providing new insights into gene function and metabolic state that could not be obtained using any other approach. In this review, we survey the uses of metabolomic analysis since its entry into the field. We also cover the major methods used for metabolomic studies in Drosophila and highlight new directions for future research. Copyright © 2017 by the Genetics Society of America.

  9. DNA polymerase III of Escherichia coli is required for UV and ethyl methanesulfonate mutagenesis

    Energy Technology Data Exchange (ETDEWEB)

    Hagensee, M.E.; Timme, T.L.; Bryan, S.K.; Moses, R.E.

    1987-06-01

    Strains of Escherichia coli possessing the pcbA1 mutation, a functional DNA polymerase I, and a temperature-sensitive mutation in DNA polymerase III can survive at the restrictive temperature (43 degrees C) for DNA polymerase III. The mutation rate of the bacterial genome of such strains after exposure to either UV light or ethyl methanesulfonate was measured by its rifampicin resistance or amino acid requirements. In addition, Weigle mutagenesis of preirradiated lambda phage was also measured. In all cases, no increase in mutagenesis was noted at the restrictive temperature for DNA polymerase III. Introduction of a cloned DNA polymerase III gene returned the mutation rate of the bacterial genome as well as the Weigle mutagenesis to normal at 43 degrees C. Using a recA-lacZ fusion, the SOS response after UV irradiation was measured and found to be normal at the restrictive and permissive temperature for DNA polymerase III, as was induction of lambda prophage. Recombination was also normal at either temperature. Our studies demonstrate that a functional DNA polymerase III is strictly required for mutagenesis at a step other than SOS induction.

  10. Role of radiation mutagenesis in cotton selection

    International Nuclear Information System (INIS)

    Mamedov, K.M.; Shamaeva, N.N.

    1987-01-01

    Experimantal mutagenesis in combination with the classical methods: hybridization and selection, are shown to be one of the effective methods for developing new species of cotton plants. Taking into account the character of mutant difference inheritance during hybridization of lines as well as the degree of correlative bonds, 10 most perspective lines from 198 ones are separated. They differ from the initial species by a complex of favorable hereditary changes according to the quantitative selectively useful features, that makes them advantageous for application of the existing ones and for the development of new species of fine-fiber cotton plants

  11. Heavy metals effect in Drosophila melanogaster germinal cells

    International Nuclear Information System (INIS)

    Rosa Duque de la, M.E.

    1984-01-01

    Heavy metals occur naturally and some of them are very important in cellular metabolism. Industrial development has increased metal concentration in the environment and in the living organisms tissues. This increase promotes the human risk to suffer teratogenesis, carcinogenesis and mutagenesis. Different biological systems have been used to proof the genetic effect of heavy metals including Drosophila. In the present work chromium, cadmium, lead, zinc and arsenic salts were administered to Drosophila females and males adults in order to determine the genetic effect produced by these compounds, in both femenine and masculine germinal cells. The mating system used (''Oster males'' and y 2 wsup(a)/y 2 wsup(a); e/e females) permited to determine among two succesive generations, the mutagenic effects produced by heavy metals in Drosophila. The salts administration to adult flies was made by injection. Non-disjunction, X-chromosome loss, and sex linked recessive lethals frequency was increased by heavy metals. It was observed a fertility disminution between F 1 descendants from individuals treated with the metalic salts. It was demonstrated that heavy metals can interact with genetic material at different levels in the two types of gametic cells to produce genetic damage. (author)

  12. Hearing regulates Drosophila aggression.

    Science.gov (United States)

    Versteven, Marijke; Vanden Broeck, Lies; Geurten, Bart; Zwarts, Liesbeth; Decraecker, Lisse; Beelen, Melissa; Göpfert, Martin C; Heinrich, Ralf; Callaerts, Patrick

    2017-02-21

    Aggression is a universal social behavior important for the acquisition of food, mates, territory, and social status. Aggression in Drosophila is context-dependent and can thus be expected to involve inputs from multiple sensory modalities. Here, we use mechanical disruption and genetic approaches in Drosophila melanogaster to identify hearing as an important sensory modality in the context of intermale aggressive behavior. We demonstrate that neuronal silencing and targeted knockdown of hearing genes in the fly's auditory organ elicit abnormal aggression. Further, we show that exposure to courtship or aggression song has opposite effects on aggression. Our data define the importance of hearing in the control of Drosophila intermale aggression and open perspectives to decipher how hearing and other sensory modalities are integrated at the neural circuit level.

  13. Induced mutagenesis in dam- mutants of Escherichia coli: A role for 6-methyladenine residues in mutation avoidance

    International Nuclear Information System (INIS)

    Glickmann, B.; Elsen, P. van den; Radmann, M.

    1978-01-01

    E. coli strains carrying the dam-3 and dam-4 mutations resulting in reduced levels of 6-methyladenine in the DNA have been found to be more sensitive to base analogue mutagenesis than dam + strains. Mutagenesis by EMS was also found to be enhanced in dam - strains. Dam - mutants, however, were not found to be hypermutable by UV light. It is concluded that the dam - strains are deficient in the correct repair of mispairing lesions. The data are consistent with the hypothesis that 6-methyladenine residues in the DNA are involved in strand discrimination during mismatch correction. (orig.) [de

  14. Radiation mutagenesis in selection of apple trees

    International Nuclear Information System (INIS)

    Kolontaev, V.M.; Kolontaev, Yu.V.

    1977-01-01

    After X-radiation of grafts of antonovka apple trees, three groups of morphological mutants, namely, weak-, average- and violently-growing, have been revealed. Although the mutation spectrum has some indefinite character a dose of 6 kR causes, more frequently and in a greater number, the weak-growing mutants, and a dose of 2 kR, the violently-growing ones. Mutants of each group differ in the precociousness (precocious and latefruiting), type of fruiting (nospur and spur) and yield (high- and low-yielding). Using the method of radiation mutagenesis it is possible to rise the frequency and spectrum of somatic mutability of antonovka apple trees and to induce forms having valuable features

  15. Scoring function to predict solubility mutagenesis

    Directory of Open Access Journals (Sweden)

    Deutsch Christopher

    2010-10-01

    Full Text Available Abstract Background Mutagenesis is commonly used to engineer proteins with desirable properties not present in the wild type (WT protein, such as increased or decreased stability, reactivity, or solubility. Experimentalists often have to choose a small subset of mutations from a large number of candidates to obtain the desired change, and computational techniques are invaluable to make the choices. While several such methods have been proposed to predict stability and reactivity mutagenesis, solubility has not received much attention. Results We use concepts from computational geometry to define a three body scoring function that predicts the change in protein solubility due to mutations. The scoring function captures both sequence and structure information. By exploring the literature, we have assembled a substantial database of 137 single- and multiple-point solubility mutations. Our database is the largest such collection with structural information known so far. We optimize the scoring function using linear programming (LP methods to derive its weights based on training. Starting with default values of 1, we find weights in the range [0,2] so that predictions of increase or decrease in solubility are optimized. We compare the LP method to the standard machine learning techniques of support vector machines (SVM and the Lasso. Using statistics for leave-one-out (LOO, 10-fold, and 3-fold cross validations (CV for training and prediction, we demonstrate that the LP method performs the best overall. For the LOOCV, the LP method has an overall accuracy of 81%. Availability Executables of programs, tables of weights, and datasets of mutants are available from the following web page: http://www.wsu.edu/~kbala/OptSolMut.html.

  16. The BDGP gene disruption project: Single transposon insertions associated with 40 percent of Drosophila genes

    Energy Technology Data Exchange (ETDEWEB)

    Bellen, Hugo J.; Levis, Robert W.; Liao, Guochun; He, Yuchun; Carlson, Joseph W.; Tsang, Garson; Evans-Holm, Martha; Hiesinger, P. Robin; Schulze, Karen L.; Rubin, Gerald M.; Hoskins, Roger A.; Spradling, Allan C.

    2004-01-13

    The Berkeley Drosophila Genome Project (BDGP) strives to disrupt each Drosophila gene by the insertion of a single transposable element. As part of this effort, transposons in more than 30,000 fly strains were localized and analyzed relative to predicted Drosophila gene structures. Approximately 6,300 lines that maximize genomic coverage were selected to be sent to the Bloomington Stock Center for public distribution, bringing the size of the BDGP gene disruption collection to 7,140 lines. It now includes individual lines predicted to disrupt 5,362 of the 13,666 currently annotated Drosophila genes (39 percent). Other lines contain an insertion at least 2 kb from others in the collection and likely mutate additional incompletely annotated or uncharacterized genes and chromosomal regulatory elements. The remaining strains contain insertions likely to disrupt alternative gene promoters or to allow gene mis-expression. The expanded BDGP gene disruption collection provides a public resource that will facilitate the application of Drosophila genetics to diverse biological problems. Finally, the project reveals new insight into how transposons interact with a eukaryotic genome and helps define optimal strategies for using insertional mutagenesis as a genomic tool.

  17. Targated mutagenesis and functional analysis of adipokinetic hormone-encoding gene in Drosophila

    Czech Academy of Sciences Publication Activity Database

    Sajwan, Suresh; Sidorov, Roman; Stašková, Tereza; Žaloudíková, Anna; Takasu, Y.; Kodrík, Dalibor; Žurovec, Michal

    2015-01-01

    Roč. 61, JUN 01 (2015), s. 79-86 ISSN 0965-1748 R&D Projects: GA ČR GA14-07172S; GA ČR GA14-27816S; GA ČR GAP305/10/2406 EU Projects: European Commission(CZ) FP7/2007-2013 Program:FP7 Institutional support: RVO:60077344 Keywords : neuropeptide * carbohydrate metabolism * drome-Akh Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.767, year: 2015 http://www.sciencedirect.com/science/article/pii/S0965174815000181

  18. Cancer in Drosophila

    DEFF Research Database (Denmark)

    Herranz, Héctor; Eichenlaub, Teresa; Cohen, Stephen M

    2016-01-01

    Cancer genomics has greatly increased our understanding of the complexity of the genetic and epigenetic changes found in human tumors. Understanding the functional relationships among these elements calls for the use of flexible genetic models. We discuss the use of Drosophila models to study...

  19. BMAA neurotoxicity in Drosophila.

    Science.gov (United States)

    Zhou, Xianchong; Escala, Wilfredo; Papapetropoulos, Spyridon; Bradley, Walter G; Zhai, R Grace

    2009-01-01

    We report the establishment of an in vivo model using the fruit fly Drosophila melanogaster to investigate the toxic effects of L-BMAA. We found that dietary intake of BMAA reduced the lifespan as well as the neurological functions of flies. Furthermore, we have developed an HPLC method to reliably detect both free and protein-bound BMAA in fly tissue extracts.

  20. Uvm mutants of Escherichia coli K 12 deficient in UV mutagenesis. Pt. 1

    International Nuclear Information System (INIS)

    Steinborn, G.

    1978-01-01

    Selection for defective reversion induction, after UV treatment of E. coli K 12, yielded uvm mutants. These mutants exhibited highly reduced or no UV mutability for all loci tested although they were moderately and normally mutable by X-rays and EMS, respectively. Uvm mutations confer only a slight sensitivity to killing by UV and X-rays and no clear sensitivity to the lethal effect of HN2, EMS or MMS. Growth and viability of untreated uvm cells were normal. The properties of uvm mutants are discussed in relation to those of other relevant mutant types and to some actual problems of induced mutagenesis. (orig.) 891 AJ [de

  1. Modeling Human Cancers in Drosophila.

    Science.gov (United States)

    Sonoshita, M; Cagan, R L

    2017-01-01

    Cancer is a complex disease that affects multiple organs. Whole-body animal models provide important insights into oncology that can lead to clinical impact. Here, we review novel concepts that Drosophila studies have established for cancer biology, drug discovery, and patient therapy. Genetic studies using Drosophila have explored the roles of oncogenes and tumor-suppressor genes that when dysregulated promote cancer formation, making Drosophila a useful model to study multiple aspects of transformation. Not limited to mechanism analyses, Drosophila has recently been showing its value in facilitating drug development. Flies offer rapid, efficient platforms by which novel classes of drugs can be identified as candidate anticancer leads. Further, we discuss the use of Drosophila as a platform to develop therapies for individual patients by modeling the tumor's genetic complexity. Drosophila provides both a classical and a novel tool to identify new therapeutics, complementing other more traditional cancer tools. © 2017 Elsevier Inc. All rights reserved.

  2. Heat shock and herpes virus: enhanced reactivation without untargeted mutagenesis

    International Nuclear Information System (INIS)

    Lytle, C.D.; Carney, P.G.

    1988-01-01

    Enhanced reactivation of Ultraviolet-irradiated virus has been reported to occur in heat-shocked host cells. Since enhanced virus reactivation is often accompanied by untargeted mutagenesis, we investigated whether such mutagenesis would occur for herpes simplex virus (HSV) in CV-1 monkey kidney cells subjected to heat shock. In addition to expressing enhanced reactivation, the treated cells were transiently more susceptible to infection by unirradiated HSV. No mutagenesis of unirradiated HSV was found whether infection occurred at the time of increased susceptibility to infection or during expression of enhanced viral reactivation

  3. Evolution of genes and genomes on the Drosophila phylogeny

    DEFF Research Database (Denmark)

    Clark, Andrew G; Eisen, Michael B; Smith, Douglas R

    2007-01-01

    Comparative analysis of multiple genomes in a phylogenetic framework dramatically improves the precision and sensitivity of evolutionary inference, producing more robust results than single-genome analyses can provide. The genomes of 12 Drosophila species, ten of which are presented here for the ...

  4. Neurophysiology of Drosophila models of Parkinson's disease.

    Science.gov (United States)

    West, Ryan J H; Furmston, Rebecca; Williams, Charles A C; Elliott, Christopher J H

    2015-01-01

    We provide an insight into the role Drosophila has played in elucidating neurophysiological perturbations associated with Parkinson's disease- (PD-) related genes. Synaptic signalling deficits are observed in motor, central, and sensory systems. Given the neurological impact of disease causing mutations within these same genes in humans the phenotypes observed in fly are of significant interest. As such we observe four unique opportunities provided by fly nervous system models of Parkinson's disease. Firstly, Drosophila models are instrumental in exploring the mechanisms of neurodegeneration, with several PD-related mutations eliciting related phenotypes including sensitivity to energy supply and vesicular deformities. These are leading to the identification of plausible cellular mechanisms, which may be specific to (dopaminergic) neurons and synapses rather than general cellular phenotypes. Secondly, models show noncell autonomous signalling within the nervous system, offering the opportunity to develop our understanding of the way pathogenic signalling propagates, resembling Braak's scheme of spreading pathology in PD. Thirdly, the models link physiological deficits to changes in synaptic structure. While the structure-function relationship is complex, the genetic tractability of Drosophila offers the chance to separate fundamental changes from downstream consequences. Finally, the strong neuronal phenotypes permit relevant first in vivo drug testing.

  5. Effective mutagenesis of Arabidopsis by heavy ion beam-irradiation

    International Nuclear Information System (INIS)

    Yamamoto, Y.Y.; Saito, H.; Ryuto, H.; Fukunishi, N.; Yoshida, S.; Abe, T.

    2005-01-01

    Full text: Arabidopsis researches frequently include the genetic approach, so efficient, convenient, and safe methods for mutagenesis are required. Currently, the most popular method for in house mutagenesis is application of EMS. Although this method is very effective, its base substitution-type mutations often gives leaky mutants with residual gene functions, leading some difficulty in understanding the corresponding gene functions. Heavy ion beam generated by accelerators gives highest energy transfer rates among known radiation-based mutagenesis methods including X ray, gamma ray, fast neutron, electron and proton irradiation. This feature is thought to give high frequency of the double strand break of genomic DNA and resultant short deletions, resulting frame shift-type mutations. At RIKEN Accelerator Research Facility (RARF, http://www.rarf.riken.go.jp/index-e.html), we have optimized conditions for effective mutagenesis of Arabidopsis regarding to ion species and irradiation dose, and achieved comparable mutation rates to the method with EMS. (author)

  6. Symposium on molecular and cellular mechanisms of mutagenesis

    Energy Technology Data Exchange (ETDEWEB)

    1981-01-01

    These proceedings contain abstracts only of the 21 papers presented at the Sympsoium. The papers dealt with molecular mechanisms of mutagenesis and cellular responses to chemical and physical mutagenic agents. (ERB)

  7. Symposium on molecular and cellular mechanisms of mutagenesis

    International Nuclear Information System (INIS)

    1981-01-01

    These proceedings contain abstracts only of the 21 papers presented at the Sympsoium. The papers dealt with molecular mechanisms of mutagenesis and cellular responses to chemical and physical mutagenic agents

  8. Transgenesis in Drosophila melanogaster.

    Science.gov (United States)

    Ringrose, Leonie

    2009-01-01

    Transgenesis in Drosophila melanogaster relies upon direct microinjection of embryos and subsequent crossing of surviving adults. The necessity of crossing single flies to screen for transgenic events limits the range of useful transgenesis techniques to those that have a very high frequency of integration, so that about 1 in 10 to 1 in 100 surviving adult flies carry a transgene. Until recently, only random P-element transgenesis fulfilled these criteria. However, recent advances have brought homologous recombination and site-directed integration up to and beyond this level of efficiency. For all transgenesis techniques in Drosophila melanogaster, microinjection of embryos is the central procedure. This chapter gives a detailed protocol for microinjection, and aims to enable the reader to use it for both site-directed integration and for P-element transgenesis.

  9. Drosophila by the dozen

    Energy Technology Data Exchange (ETDEWEB)

    Celniker, Susan E.; Hoskins, Roger A.

    2007-07-13

    This year's conference on Drosophila research illustratedwell the current focus of Drosophila genomics on the comprehensiveidentification of functional elements in the genome sequence, includingmRNA transcripts arising from multiple alternative start sites and splicesites, a multiplicity of noncoding transcripts and small RNAs,identification of binding sites for transcription factors, sequenceconservation in related species and sequence variation within species.Resources and technologies for genetics and functional genomics aresteadily being improved, including the building of collections oftransposon insertion mutants and hairpin constructs for RNA interference(RNAi). The conference also highlighted progress in the use of genomicinformation by many laboratories to study diverse aspects of biology andmodels of human disease. Here we will review a few highlights of especialinterest to readers of Genome Biology.

  10. The Roles of UmuD in Regulating Mutagenesis

    Directory of Open Access Journals (Sweden)

    Jaylene N. Ollivierre

    2010-01-01

    Full Text Available All organisms are subject to DNA damage from both endogenous and environmental sources. DNA damage that is not fully repaired can lead to mutations. Mutagenesis is now understood to be an active process, in part facilitated by lower-fidelity DNA polymerases that replicate DNA in an error-prone manner. Y-family DNA polymerases, found throughout all domains of life, are characterized by their lower fidelity on undamaged DNA and their specialized ability to copy damaged DNA. Two E. coli Y-family DNA polymerases are responsible for copying damaged DNA as well as for mutagenesis. These DNA polymerases interact with different forms of UmuD, a dynamic protein that regulates mutagenesis. The UmuD gene products, regulated by the SOS response, exist in two principal forms: UmuD2, which prevents mutagenesis, and UmuD2′, which facilitates UV-induced mutagenesis. This paper focuses on the multiple conformations of the UmuD gene products and how their protein interactions regulate mutagenesis.

  11. Evolution of genes and genomes on the Drosophila phylogeny.

    Science.gov (United States)

    Clark, Andrew G; Eisen, Michael B; Smith, Douglas R; Bergman, Casey M; Oliver, Brian; Markow, Therese A; Kaufman, Thomas C; Kellis, Manolis; Gelbart, William; Iyer, Venky N; Pollard, Daniel A; Sackton, Timothy B; Larracuente, Amanda M; Singh, Nadia D; Abad, Jose P; Abt, Dawn N; Adryan, Boris; Aguade, Montserrat; Akashi, Hiroshi; Anderson, Wyatt W; Aquadro, Charles F; Ardell, David H; Arguello, Roman; Artieri, Carlo G; Barbash, Daniel A; Barker, Daniel; Barsanti, Paolo; Batterham, Phil; Batzoglou, Serafim; Begun, Dave; Bhutkar, Arjun; Blanco, Enrico; Bosak, Stephanie A; Bradley, Robert K; Brand, Adrianne D; Brent, Michael R; Brooks, Angela N; Brown, Randall H; Butlin, Roger K; Caggese, Corrado; Calvi, Brian R; Bernardo de Carvalho, A; Caspi, Anat; Castrezana, Sergio; Celniker, Susan E; Chang, Jean L; Chapple, Charles; Chatterji, Sourav; Chinwalla, Asif; Civetta, Alberto; Clifton, Sandra W; Comeron, Josep M; Costello, James C; Coyne, Jerry A; Daub, Jennifer; David, Robert G; Delcher, Arthur L; Delehaunty, Kim; Do, Chuong B; Ebling, Heather; Edwards, Kevin; Eickbush, Thomas; Evans, Jay D; Filipski, Alan; Findeiss, Sven; Freyhult, Eva; Fulton, Lucinda; Fulton, Robert; Garcia, Ana C L; Gardiner, Anastasia; Garfield, David A; Garvin, Barry E; Gibson, Greg; Gilbert, Don; Gnerre, Sante; Godfrey, Jennifer; Good, Robert; Gotea, Valer; Gravely, Brenton; Greenberg, Anthony J; Griffiths-Jones, Sam; Gross, Samuel; Guigo, Roderic; Gustafson, Erik A; Haerty, Wilfried; Hahn, Matthew W; Halligan, Daniel L; Halpern, Aaron L; Halter, Gillian M; Han, Mira V; Heger, Andreas; Hillier, LaDeana; Hinrichs, Angie S; Holmes, Ian; Hoskins, Roger A; Hubisz, Melissa J; Hultmark, Dan; Huntley, Melanie A; Jaffe, David B; Jagadeeshan, Santosh; Jeck, William R; Johnson, Justin; Jones, Corbin D; Jordan, William C; Karpen, Gary H; Kataoka, Eiko; Keightley, Peter D; Kheradpour, Pouya; Kirkness, Ewen F; Koerich, Leonardo B; Kristiansen, Karsten; Kudrna, Dave; Kulathinal, Rob J; Kumar, Sudhir; Kwok, Roberta; Lander, Eric; Langley, Charles H; Lapoint, Richard; Lazzaro, Brian P; Lee, So-Jeong; Levesque, Lisa; Li, Ruiqiang; Lin, Chiao-Feng; Lin, Michael F; Lindblad-Toh, Kerstin; Llopart, Ana; Long, Manyuan; Low, Lloyd; Lozovsky, Elena; Lu, Jian; Luo, Meizhong; Machado, Carlos A; Makalowski, Wojciech; Marzo, Mar; Matsuda, Muneo; Matzkin, Luciano; McAllister, Bryant; McBride, Carolyn S; McKernan, Brendan; McKernan, Kevin; Mendez-Lago, Maria; Minx, Patrick; Mollenhauer, Michael U; Montooth, Kristi; Mount, Stephen M; Mu, Xu; Myers, Eugene; Negre, Barbara; Newfeld, Stuart; Nielsen, Rasmus; Noor, Mohamed A F; O'Grady, Patrick; Pachter, Lior; Papaceit, Montserrat; Parisi, Matthew J; Parisi, Michael; Parts, Leopold; Pedersen, Jakob S; Pesole, Graziano; Phillippy, Adam M; Ponting, Chris P; Pop, Mihai; Porcelli, Damiano; Powell, Jeffrey R; Prohaska, Sonja; Pruitt, Kim; Puig, Marta; Quesneville, Hadi; Ram, Kristipati Ravi; Rand, David; Rasmussen, Matthew D; Reed, Laura K; Reenan, Robert; Reily, Amy; Remington, Karin A; Rieger, Tania T; Ritchie, Michael G; Robin, Charles; Rogers, Yu-Hui; Rohde, Claudia; Rozas, Julio; Rubenfield, Marc J; Ruiz, Alfredo; Russo, Susan; Salzberg, Steven L; Sanchez-Gracia, Alejandro; Saranga, David J; Sato, Hajime; Schaeffer, Stephen W; Schatz, Michael C; Schlenke, Todd; Schwartz, Russell; Segarra, Carmen; Singh, Rama S; Sirot, Laura; Sirota, Marina; Sisneros, Nicholas B; Smith, Chris D; Smith, Temple F; Spieth, John; Stage, Deborah E; Stark, Alexander; Stephan, Wolfgang; Strausberg, Robert L; Strempel, Sebastian; Sturgill, David; Sutton, Granger; Sutton, Granger G; Tao, Wei; Teichmann, Sarah; Tobari, Yoshiko N; Tomimura, Yoshihiko; Tsolas, Jason M; Valente, Vera L S; Venter, Eli; Venter, J Craig; Vicario, Saverio; Vieira, Filipe G; Vilella, Albert J; Villasante, Alfredo; Walenz, Brian; Wang, Jun; Wasserman, Marvin; Watts, Thomas; Wilson, Derek; Wilson, Richard K; Wing, Rod A; Wolfner, Mariana F; Wong, Alex; Wong, Gane Ka-Shu; Wu, Chung-I; Wu, Gabriel; Yamamoto, Daisuke; Yang, Hsiao-Pei; Yang, Shiaw-Pyng; Yorke, James A; Yoshida, Kiyohito; Zdobnov, Evgeny; Zhang, Peili; Zhang, Yu; Zimin, Aleksey V; Baldwin, Jennifer; Abdouelleil, Amr; Abdulkadir, Jamal; Abebe, Adal; Abera, Brikti; Abreu, Justin; Acer, St Christophe; Aftuck, Lynne; Alexander, Allen; An, Peter; Anderson, Erica; Anderson, Scott; Arachi, Harindra; Azer, Marc; Bachantsang, Pasang; Barry, Andrew; Bayul, Tashi; Berlin, Aaron; Bessette, Daniel; Bloom, Toby; Blye, Jason; Boguslavskiy, Leonid; Bonnet, Claude; Boukhgalter, Boris; Bourzgui, Imane; Brown, Adam; Cahill, Patrick; Channer, Sheridon; Cheshatsang, Yama; Chuda, Lisa; Citroen, Mieke; Collymore, Alville; Cooke, Patrick; Costello, Maura; D'Aco, Katie; Daza, Riza; De Haan, Georgius; DeGray, Stuart; DeMaso, Christina; Dhargay, Norbu; Dooley, Kimberly; Dooley, Erin; Doricent, Missole; Dorje, Passang; Dorjee, Kunsang; Dupes, Alan; Elong, Richard; Falk, Jill; Farina, Abderrahim; Faro, Susan; Ferguson, Diallo; Fisher, Sheila; Foley, Chelsea D; Franke, Alicia; Friedrich, Dennis; Gadbois, Loryn; Gearin, Gary; Gearin, Christina R; Giannoukos, Georgia; Goode, Tina; Graham, Joseph; Grandbois, Edward; Grewal, Sharleen; Gyaltsen, Kunsang; Hafez, Nabil; Hagos, Birhane; Hall, Jennifer; Henson, Charlotte; Hollinger, Andrew; Honan, Tracey; Huard, Monika D; Hughes, Leanne; Hurhula, Brian; Husby, M Erii; Kamat, Asha; Kanga, Ben; Kashin, Seva; Khazanovich, Dmitry; Kisner, Peter; Lance, Krista; Lara, Marcia; Lee, William; Lennon, Niall; Letendre, Frances; LeVine, Rosie; Lipovsky, Alex; Liu, Xiaohong; Liu, Jinlei; Liu, Shangtao; Lokyitsang, Tashi; Lokyitsang, Yeshi; Lubonja, Rakela; Lui, Annie; MacDonald, Pen; Magnisalis, Vasilia; Maru, Kebede; Matthews, Charles; McCusker, William; McDonough, Susan; Mehta, Teena; Meldrim, James; Meneus, Louis; Mihai, Oana; Mihalev, Atanas; Mihova, Tanya; Mittelman, Rachel; Mlenga, Valentine; Montmayeur, Anna; Mulrain, Leonidas; Navidi, Adam; Naylor, Jerome; Negash, Tamrat; Nguyen, Thu; Nguyen, Nga; Nicol, Robert; Norbu, Choe; Norbu, Nyima; Novod, Nathaniel; O'Neill, Barry; Osman, Sahal; Markiewicz, Eva; Oyono, Otero L; Patti, Christopher; Phunkhang, Pema; Pierre, Fritz; Priest, Margaret; Raghuraman, Sujaa; Rege, Filip; Reyes, Rebecca; Rise, Cecil; Rogov, Peter; Ross, Keenan; Ryan, Elizabeth; Settipalli, Sampath; Shea, Terry; Sherpa, Ngawang; Shi, Lu; Shih, Diana; Sparrow, Todd; Spaulding, Jessica; Stalker, John; Stange-Thomann, Nicole; Stavropoulos, Sharon; Stone, Catherine; Strader, Christopher; Tesfaye, Senait; Thomson, Talene; Thoulutsang, Yama; Thoulutsang, Dawa; Topham, Kerri; Topping, Ira; Tsamla, Tsamla; Vassiliev, Helen; Vo, Andy; Wangchuk, Tsering; Wangdi, Tsering; Weiand, Michael; Wilkinson, Jane; Wilson, Adam; Yadav, Shailendra; Young, Geneva; Yu, Qing; Zembek, Lisa; Zhong, Danni; Zimmer, Andrew; Zwirko, Zac; Jaffe, David B; Alvarez, Pablo; Brockman, Will; Butler, Jonathan; Chin, CheeWhye; Gnerre, Sante; Grabherr, Manfred; Kleber, Michael; Mauceli, Evan; MacCallum, Iain

    2007-11-08

    Comparative analysis of multiple genomes in a phylogenetic framework dramatically improves the precision and sensitivity of evolutionary inference, producing more robust results than single-genome analyses can provide. The genomes of 12 Drosophila species, ten of which are presented here for the first time (sechellia, simulans, yakuba, erecta, ananassae, persimilis, willistoni, mojavensis, virilis and grimshawi), illustrate how rates and patterns of sequence divergence across taxa can illuminate evolutionary processes on a genomic scale. These genome sequences augment the formidable genetic tools that have made Drosophila melanogaster a pre-eminent model for animal genetics, and will further catalyse fundamental research on mechanisms of development, cell biology, genetics, disease, neurobiology, behaviour, physiology and evolution. Despite remarkable similarities among these Drosophila species, we identified many putatively non-neutral changes in protein-coding genes, non-coding RNA genes, and cis-regulatory regions. These may prove to underlie differences in the ecology and behaviour of these diverse species.

  12. Using CRISPR-Cas9 to Study ERK Signaling in Drosophila.

    Science.gov (United States)

    Forés, Marta; Papagianni, Aikaterini; Rodríguez-Muñoz, Laura; Jiménez, Gerardo

    2017-01-01

    Genome engineering using the clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR associated nuclease 9 (Cas9) technology is revolutionizing biomedical research. CRISPR-Cas9 enables precise editing of genes in a wide variety of cells and organisms, thereby accelerating molecular studies via targeted mutagenesis, epitope tagging, and other custom genetic modifications. Here, we illustrate the CRISPR-Cas9 methodology by focusing on Capicua (Cic), a nuclear transcriptional repressor directly phosphorylated and inactivated by ERK/MAPK. Specifically, we use CRISPR-Cas9 for targeting an ERK docking site of Drosophila Cic, thus generating ERK-insensitive mutants of this important signaling sensor.

  13. Shocking revelations and saccharin sweetness in the study of Drosophila olfactory memory.

    Science.gov (United States)

    Perisse, Emmanuel; Burke, Christopher; Huetteroth, Wolf; Waddell, Scott

    2013-09-09

    It is now almost forty years since the first description of learning in the fruit fly Drosophila melanogaster. Various incarnations of the classic mutagenesis approach envisaged in the early days have provided around one hundred learning defective mutant fly strains. Recent technological advances permit temporal control of neural function in the behaving fly. These approaches have radically changed experiments in the field and have provided a neural circuit perspective of memory formation, consolidation and retrieval. Combining neural perturbations with more classical mutant intervention allows investigators to interrogate the molecular and cellular processes of memory within the defined neural circuits. Here, we summarize some of the progress made in the last ten years that indicates a remarkable conservation of the neural mechanisms of memory formation between flies and mammals. We emphasize that considering an ethologically-relevant viewpoint might provide additional experimental power in studies of Drosophila memory. Copyright © 2013 Elsevier Ltd. All rights reserved.

  14. Drosophila larvae lacking the bcl-2 gene, buffy, are sensitive to nutrient stress, maintain increased basal target of rapamycin (Tor signaling and exhibit characteristics of altered basal energy metabolism

    Directory of Open Access Journals (Sweden)

    Monserrate Jessica P

    2012-07-01

    Full Text Available Abstract Background B cell lymphoma 2 (Bcl-2 proteins are the central regulators of apoptosis. The two bcl-2 genes in Drosophila modulate the response to stress-induced cell death, but not developmental cell death. Because null mutants are viable, Drosophila provides an optimum model system to investigate alternate functions of Bcl-2 proteins. In this report, we explore the role of one bcl-2 gene in nutrient stress responses. Results We report that starvation of Drosophila larvae lacking the bcl-2 gene, buffy, decreases survival rate by more than twofold relative to wild-type larvae. The buffy null mutant reacted to starvation with the expected responses such as inhibition of target of rapamycin (Tor signaling, autophagy initiation and mobilization of stored lipids. However, the autophagic response to starvation initiated faster in larvae lacking buffy and was inhibited by ectopic buffy. We demonstrate that unusually high basal Tor signaling, indicated by more phosphorylated S6K, was detected in the buffy mutant and that removal of a genomic copy of S6K, but not inactivation of Tor by rapamycin, reverted the precocious autophagy phenotype. Instead, Tor inactivation also required loss of a positive nutrient signal to trigger autophagy and loss of both was sufficient to activate autophagy in the buffy mutant even in the presence of enforced phosphoinositide 3-kinase (PI3K signaling. Prior to starvation, the fed buffy mutant stored less lipid and glycogen, had high lactate levels and maintained a reduced pool of cellular ATP. These observations, together with the inability of buffy mutant larvae to adapt to nutrient restriction, indicate altered energy metabolism in the absence of buffy. Conclusions All animals in their natural habitats are faced with periods of reduced nutrient availability. This study demonstrates that buffy is required for adaptation to both starvation and nutrient restriction. Thus, Buffy is a Bcl-2 protein that plays an

  15. The Drosophila melanogaster host model

    Science.gov (United States)

    Igboin, Christina O.; Griffen, Ann L.; Leys, Eugene J.

    2012-01-01

    The deleterious and sometimes fatal outcomes of bacterial infectious diseases are the net result of the interactions between the pathogen and the host, and the genetically tractable fruit fly, Drosophila melanogaster, has emerged as a valuable tool for modeling the pathogen–host interactions of a wide variety of bacteria. These studies have revealed that there is a remarkable conservation of bacterial pathogenesis and host defence mechanisms between higher host organisms and Drosophila. This review presents an in-depth discussion of the Drosophila immune response, the Drosophila killing model, and the use of the model to examine bacterial–host interactions. The recent introduction of the Drosophila model into the oral microbiology field is discussed, specifically the use of the model to examine Porphyromonas gingivalis–host interactions, and finally the potential uses of this powerful model system to further elucidate oral bacterial-host interactions are addressed. PMID:22368770

  16. Drosophila melanogaster deoxyribonucleoside kinase activates gemcitabine

    Energy Technology Data Exchange (ETDEWEB)

    Knecht, Wolfgang [BioCentrum-DTU, Technical University of Denmark, DK-2800 Lyngby (Denmark); Mikkelsen, Nils Egil [Department of Molecular Biology, Swedish University of Agricultural Sciences, Biomedical Centre, SE-751 24 Uppsala (Sweden); Clausen, Anders Ranegaard [Cell and Organism Biology, Lund University, Soelvegatan 35, SE-22362 Lund (Sweden); Willer, Mette [ZGene A/S, Agern Alle 7, DK-2970 Horsholm (Denmark); Eklund, Hans [Department of Molecular Biology, Swedish University of Agricultural Sciences, Biomedical Centre, SE-751 24 Uppsala (Sweden); Gojkovic, Zoran [ZGene A/S, Agern Alle 7, DK-2970 Horsholm (Denmark); Piskur, Jure, E-mail: Jure.Piskur@cob.lu.se [BioCentrum-DTU, Technical University of Denmark, DK-2800 Lyngby (Denmark); Cell and Organism Biology, Lund University, Soelvegatan 35, SE-22362 Lund (Sweden)

    2009-05-01

    Drosophila melanogaster multisubstrate deoxyribonucleoside kinase (Dm-dNK) can additionally sensitize human cancer cell lines towards the anti-cancer drug gemcitabine. We show that this property is based on the Dm-dNK ability to efficiently phosphorylate gemcitabine. The 2.2 A resolution structure of Dm-dNK in complex with gemcitabine shows that the residues Tyr70 and Arg105 play a crucial role in the firm positioning of gemcitabine by extra interactions made by the fluoride atoms. This explains why gemcitabine is a good substrate for Dm-dNK.

  17. Contribution of photoreceptor subtypes to spectral wavelength preference in Drosophila

    OpenAIRE

    Yamaguchi, Satoko; Desplan, Claude; Heisenberg, Martin

    2010-01-01

    The visual systems of most species contain photoreceptors with distinct spectral sensitivities that allow animals to distinguish lights by their spectral composition. In Drosophila, photoreceptors R1–R6 have the same spectral sensitivity throughout the eye and are responsible for motion detection. In contrast, photoreceptors R7 and R8 exhibit heterogeneity and are important for color vision. We investigated how photoreceptor types contribute to the attractiveness of light by blocking the func...

  18. Expression and site-directed mutagenesis of human dihydrofolate reductase

    Energy Technology Data Exchange (ETDEWEB)

    Prendergast, N.J.; Delcamp, T.J.; Smith, P.L.; Freisheim, J.H.

    1988-05-17

    A procaryotic high-level expression vector for human dihydrofolate reductase has been constructed and the protein characterized as a first step toward structure-function studies of this enzyme. A vector bearing the tac promoter, four synthetic oligodeoxynucleotides, and a restriction fragment from the dihydrofolate reductase cDNA were ligated in a manner which optimized the transcriptional and translational frequency of the enzyme mRNA. The reductase, comprising ca. 17% of the total soluble protein in the host bacteria, was purified to apparent homogeneity as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and characterized by amino acid composition, partial amino acid sequence, and steady-sate kinetic analysis. This expression vector has been used as a template for double-stranded plasmid DNA site-specific mutagenesis. Functional studies on a Cys-6 ..-->.. Ser-6 mutant enzyme support the contention that Cys-6 is obligatory for organomercurial activation of human dihydrofolate reductase. The Ser-6 mutant enzyme was not activated to any extent following a 24-h incubation with p-(hydroxymercuri)benzoate and nicotinamide adenine dinucleotide phosphate (reduced) (NADPH), whereas the k/sub cat/ for Cys-6 reductase increased 2-fold under identical conditions. The specific activities of the Cys-6 and Ser-6 enzymes were virtually identical as determined by methotrexate titration as were the K/sub m/ values for both dihydrofolate and NADPH. The Ser-6 mutant showed a decreased temperature stability and was more sensitive to inactivation by ..cap alpha..-chymotrypsin when compared to the wild-type enzyme. These results suggest that the Ser-6 mutant reductase is conformationally altered relative to the Cys-6 native enzyme.

  19. Dynamical Analysis of bantam-Regulated Drosophila Circadian Rhythm Model

    Science.gov (United States)

    Li, Ying; Liu, Zengrong

    MicroRNAs (miRNAs) interact with 3‧untranslated region (UTR) elements of target genes to regulate mRNA stability or translation, and play a crucial role in regulating many different biological processes. bantam, a conserved miRNA, is involved in several functions, such as regulating Drosophila growth and circadian rhythm. Recently, it has been discovered that bantam plays a crucial role in the core circadian pacemaker. In this paper, based on experimental observations, a detailed dynamical model of bantam-regulated circadian clock system is developed to show the post-transcriptional behaviors in the modulation of Drosophila circadian rhythm, in which the regulation of bantam is incorporated into a classical model. The dynamical behaviors of the model are consistent with the experimental observations, which shows that bantam is an important regulator of Drosophila circadian rhythm. The sensitivity analysis of parameters demonstrates that with the regulation of bantam the system is more sensitive to perturbations, indicating that bantam regulation makes it easier for the organism to modulate its period against the environmental perturbations. The effectiveness in rescuing locomotor activity rhythms of mutated flies shows that bantam is necessary for strong and sustained rhythms. In addition, the biological mechanisms of bantam regulation are analyzed, which may help us more clearly understand Drosophila circadian rhythm regulated by other miRNAs.

  20. Switch of rhodopsin expression in terminally differentiated Drosophila sensory neurons

    OpenAIRE

    Sprecher, Simon G.; Desplan, Claude

    2008-01-01

    Specificity of sensory neurons requires restricted expression of one sensory receptor gene and the exclusion of all others within a given cell. In the Drosophila retina, functional identity of photoreceptors depends on light-sensitive Rhodopsins (Rhs). The much simpler larval eye (Bolwig organ) is composed of about 12 photoreceptors, eight of which are green-sensitive (Rh6) and four blue-sensitive (Rh5)1. The larval eye becomes the adult extraretinal ‘eyelet’ composed of four green-sensitive ...

  1. Genome editing in Drosophila melanogaster: from basic genome engineering to the multipurpose CRISPR-Cas9 system.

    Science.gov (United States)

    Ren, Xingjie; Holsteens, Kristof; Li, Haiyi; Sun, Jin; Zhang, Yifan; Liu, Lu-Ping; Liu, Qingfei; Ni, Jian-Quan

    2017-05-01

    Nowadays, genome editing tools are indispensable for studying gene function in order to increase our knowledge of biochemical processes and disease mechanisms. The extensive availability of mutagenesis and transgenesis tools make Drosophila melanogaster an excellent model organism for geneticists. Early mutagenesis tools relied on chemical or physical methods, ethyl methane sulfonate (EMS) and X-rays respectively, to randomly alter DNA at a nucleotide or chromosomal level. Since the discovery of transposable elements and the availability of the complete fly genome, specific genome editing tools, such as P-elements, zinc-finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs), have undergone rapid development. Currently, one of the leading and most effective contemporary tools is the CRISPR-cas9 system made popular because of its low cost, effectiveness, specificity and simplicity of use. This review briefly addresses the most commonly used mutagenesis and transgenesis tools in Drosophila, followed by an in-depth review of the multipurpose CRISPR-Cas9 system and its current applications.

  2. Myoblast fusion in Drosophila

    International Nuclear Information System (INIS)

    Haralalka, Shruti; Abmayr, Susan M.

    2010-01-01

    The body wall musculature of a Drosophila larva is composed of an intricate pattern of 30 segmentally repeated muscle fibers in each abdominal hemisegment. Each muscle fiber has unique spatial and behavioral characteristics that include its location, orientation, epidermal attachment, size and pattern of innervation. Many, if not all, of these properties are dictated by founder cells, which determine the muscle pattern and seed the fusion process. Myofibers are then derived from fusion between a specific founder cell and several fusion competent myoblasts (FCMs) fusing with as few as 3-5 FCMs in the small muscles on the most ventral side of the embryo and as many as 30 FCMs in the larger muscles on the dorsal side of the embryo. The focus of the present review is the formation of the larval muscles in the developing embryo, summarizing the major issues and players in this process. We have attempted to emphasize experimentally-validated details of the mechanism of myoblast fusion and distinguish these from the theoretically possible details that have not yet been confirmed experimentally. We also direct the interested reader to other recent reviews that discuss myoblast fusion in Drosophila, each with their own perspective on the process . With apologies, we use gene nomenclature as specified by Flybase (http://flybase.org) but provide Table 1 with alternative names and references.

  3. SUMOylation in Drosophila Development

    Directory of Open Access Journals (Sweden)

    Albert J. Courey

    2012-07-01

    Full Text Available Small ubiquitin-related modifier (SUMO, an ~90 amino acid ubiquitin-like protein, is highly conserved throughout the eukaryotic domain. Like ubiquitin, SUMO is covalently attached to lysine side chains in a large number of target proteins. In contrast to ubiquitin, SUMO does not have a direct role in targeting proteins for proteasomal degradation. However, like ubiquitin, SUMO does modulate protein function in a variety of other ways. This includes effects on protein conformation, subcellular localization, and protein–protein interactions. Significant insight into the in vivo role of SUMOylation has been provided by studies in Drosophila that combine genetic manipulation, proteomic, and biochemical analysis. Such studies have revealed that the SUMO conjugation pathway regulates a wide variety of critical cellular and developmental processes, including chromatin/chromosome function, eggshell patterning, embryonic pattern formation, metamorphosis, larval and pupal development, neurogenesis, development of the innate immune system, and apoptosis. This review discusses our current understanding of the diverse roles for SUMO in Drosophila development.

  4. Genetic modifications of established varieties of potato through mutagenesis

    International Nuclear Information System (INIS)

    Brown, C.R.

    1984-01-01

    Owing to the high intercrossability of improved clones with primitive cultivars and many wild species there is little justification for use of induced mutations in potato to increase variability per se. Modification of certain traits while leaving the genotype basically intact is a promising use of mutagenesis in potato. The successful curing of defects in clones will depend on the establishment a priori of three principles. First, the clones undergoing mutagenesis should be well established varieties tolerant or resistant to the major biotic and abiotic stresses in the area of cultivation. The yield and culinary quality should also be considered high. Second, there should exist some indication that the variation desired is induceable, either through reports of natural intra-clone variation or previous mutagenesis studies. Third, initial screening should be done in virus-free materials

  5. Studies on mutagen-sensitive strains of Drosophila melanogaster. IX. Modification of genetic damage induced by X-irradiation of spermatozoa in N2, air or O2 by 4 autosomal repair-deficient mutants

    International Nuclear Information System (INIS)

    Ferro, W.

    1986-01-01

    The influence of defects in DNA repair on the recovery of X-ray-induced genetic damage in spermatozoa of Drosophila melanogaster was studied. Basc males were irradiated in N 2 , air or O 2 and mated to females of 4 repair-deficient mutant types. The responses in the different crosses with repair-deficient females were compared to those with repair-proficient mei + females (maternal effects). The main findings are the following: (1) with excision repair-deficient females the frequencies of spontaneous recessive lethals tend to be higher than with mei + females; (2) with excision repair-deficient females the frequencies of recessive lethals induced in N 2 and air and often in O 2 are higher than with mei + females; (3) with post-replication repair-deficient mutants a maternal effect is found for X-ray-induced translocations. The data are discussed and explained. (Auth.)

  6. ENU mutagenesis to generate genetically modified rat models.

    Science.gov (United States)

    van Boxtel, Ruben; Gould, Michael N; Cuppen, Edwin; Smits, Bart M G

    2010-01-01

    The rat is one of the most preferred model organisms in biomedical research and has been extremely useful for linking physiology and pathology to the genome. However, approaches to genetically modify specific genes in the rat germ line remain relatively scarce. To date, the most efficient approach for generating genetically modified rats has been the target-selected N-ethyl-N-nitrosourea (ENU) mutagenesis-based technology. Here, we describe the detailed protocols for ENU mutagenesis and mutant retrieval in the rat model organism.

  7. Genetic and physiological factors affecting repair and mutagenesis in yeast

    International Nuclear Information System (INIS)

    Lemontt, J.F.

    1979-01-01

    Current views of DNA repair and mutagenesis in the yeast Saccharomyces cerevisiae are discussed in the light of recent data, and with emphasis on the isolation and characterization of genetically well-defined mutations that affect DNA metabolism in general (including replication and recombination). Various pathways of repair are described particularly in relation to their involvement in mutagenic mechanisms. In addition to genetic control, certain physiological factors such as cell age, DNA replication, and the regulatory state of the mating-type locus, are shown to also play a role in repair and mutagenesis

  8. Genetic and physiological factors affecting repair and mutagenesis in yeast

    International Nuclear Information System (INIS)

    Lemontt, J.F.

    1979-01-01

    Current views of DNA repair and mutagenesis in the yeast Saccharomyces cerevisiae are discussed in the light of recent data and with emphasis on the isolation and characterization of genetically well-defined mutations that affect DNA metabolism in general (including replication and recombination). Various pathways of repair are described, particularly in relation to their imvolvement in mutagenic mechanisms. In addition to genetic control, certain physiological factors such as cell age, DNA replication, and the regulatory state of the mating-type locus are shown to also play a role in repair and mutagenesis

  9. Genetic and physiological factors affecting repair and mutagenesis in yeast

    Energy Technology Data Exchange (ETDEWEB)

    Lemontt, J F

    1979-01-01

    Current views of DNA repair and mutagenesis in the yeast Saccharomyces cerevisiae are discussed in the light of recent data, and with emphasis on the isolation and characterization of genetically well-defined mutations that affect DNA metabolism in general (including replication and recombination). Various pathways of repair are described particularly in relation to their involvement in mutagenic mechanisms. In addition to genetic control, certain physiological factors such as cell age, DNA replication, and the regulatory state of the mating-type locus, are shown to also play a role in repair and mutagenesis.

  10. Genetic and physiological factors affecting repair and mutagenesis in yeast

    Energy Technology Data Exchange (ETDEWEB)

    Lemontt, J F

    1979-01-01

    Current views of DNA repair and mutagenesis in the yeast Saccharomyces cerevisiae are discussed in the light of recent data and with emphasis on the isolation and characterization of genetically well-defined mutations that affect DNA metabolism in general (including replication and recombination). Various pathways of repair are described, particularly in relation to their imvolvement in mutagenic mechanisms. In addition to genetic control, certain physiological factors such as cell age, DNA replication, and the regulatory state of the mating-type locus are shown to also play a role in repair and mutagenesis.

  11. A mariner transposon vector adapted for mutagenesis in oral streptococci

    DEFF Research Database (Denmark)

    Nilsson, Martin; Christiansen, Natalia; Høiby, Niels

    2014-01-01

    ATs-pWV01, a selectable kanamycin resistance gene, a Himar1 transposase gene regulated by a xylose-inducible promoter, and an erythromycin resistance gene flanked by himar inverted repeats. The pMN100 plasmid was transformed into Streptococcus mutans UA159 and transposon mutagenesis was performed via...... a protocol established to perform high numbers of separate transpositions despite a low frequency of transposition. The distribution of transposon inserts in 30 randomly picked mutants suggested that mariner transposon mutagenesis is unbiased in S. mutans. A generated transposon mutant library containing...

  12. Enhanced reactivation of nitrous acid treated adenovirus is not associated with enhanced mutagenesis in pretreated with heavy metals HeLa cells.

    Science.gov (United States)

    Piperakis, S M

    1995-12-01

    The reversion frequency of an adenovirus 2 temperature-sensitive growth mutant treated with different doses of nitrous acid was determined after infection of control. UV-irradiated, cadmium chloride and zinc chloride treated HeLa cells. No enhanced mutagenesis was observed.

  13. Heat-enhanced reactivation of UV-irradiated adenovirus 2 is not associated with enhanced mutagenesis in HeLa cells

    Energy Technology Data Exchange (ETDEWEB)

    Piperakis, S.M.; McLennan, A.G. (Liverpool Univ. (UK). Dept. of Biochemistry)

    1984-04-01

    The reversion frequency of an adenovirus 2 temperature-sensitive growth mutant irradiated with different doses of UV light was determined after infection of control, UV-irradiated and heat-shocked HeLa cells. No enhancement of mutagenesis by treatment of the cells was observed. Heat-enhanced viral reactivation does not therefore display a significant error-prone component.

  14. Heat-enhanced reactivation of UV-irradiated adenovirus 2 is not associated with enhanced mutagenesis in HeLa cells.

    Science.gov (United States)

    Piperakis, S M; McLennan, A G

    1984-04-01

    The reversion frequency of an adenovirus 2 temperature-sensitive growth mutant irradiated with different doses of UV light was determined after infection of control, UV-irradiated and heat-shocked HeLa cells. No enhancement of mutagenesis by treatment of the cells was observed. Heat-enhanced viral reactivation does not therefore display a significant error-prone component.

  15. The role of Rdl in resistance to phenylpyrazoles in Drosophila melanogaster.

    Science.gov (United States)

    Remnant, Emily J; Morton, Craig J; Daborn, Phillip J; Lumb, Christopher; Yang, Ying Ting; Ng, Hooi Ling; Parker, Michael W; Batterham, Philip

    2014-11-01

    Extensive use of older generation insecticides may result in pre-existing cross-resistance to new chemical classes acting at the same target site. Phenylpyrazole insecticides block inhibitory neurotransmission in insects via their action on ligand-gated chloride channels (LGCCs). Phenylpyrazoles are broad-spectrum insecticides widely used in agriculture and domestic pest control. So far, all identified cases of target site resistance to phenylpyrazoles are based on mutations in the Rdl (Resistance to dieldrin) LGCC subunit, the major target site for cyclodiene insecticides. We examined the role that mutations in Rdl have on phenylpyrazole resistance in Drosophila melanogaster, exploring naturally occurring variation, and generating predicted resistance mutations by mutagenesis. Natural variation at the Rdl locus in inbred strains of D. melanogaster included gene duplication, and a line containing two Rdl mutations found in a highly resistant line of Drosophila simulans. These mutations had a moderate impact on survival following exposure to two phenylpyrazoles, fipronil and pyriprole. Homology modelling suggested that the Rdl chloride channel pore contains key residues for binding fipronil and pyriprole. Mutagenesis of these sites and assessment of resistance in vivo in transgenic lines showed that amino acid identity at the Ala(301) site influenced resistance levels, with glycine showing greater survival than serine replacement. We confirm that point mutations at the Rdl 301 site provide moderate resistance to phenylpyrazoles in D. melanogaster. We also emphasize the beneficial aspects of testing predicted mutations in a whole organism to validate a candidate gene approach. Copyright © 2014 Elsevier Ltd. All rights reserved.

  16. Crystal Structure and Substrate Specificity of Drosophila 3,4-Dihydroxyphenylalanine Decarboxylase

    Energy Technology Data Exchange (ETDEWEB)

    Han, Q.; Ding, H; Robinson, H; Christensen, B; Li, J

    2010-01-01

    3,4-Dihydroxyphenylalanine decarboxylase (DDC), also known as aromatic L-amino acid decarboxylase, catalyzes the decarboxylation of a number of aromatic L-amino acids. Physiologically, DDC is responsible for the production of dopamine and serotonin through the decarboxylation of 3,4-dihydroxyphenylalanine and 5-hydroxytryptophan, respectively. In insects, both dopamine and serotonin serve as classical neurotransmitters, neuromodulators, or neurohormones, and dopamine is also involved in insect cuticle formation, eggshell hardening, and immune responses. In this study, we expressed a typical DDC enzyme from Drosophila melanogaster, critically analyzed its substrate specificity and biochemical properties, determined its crystal structure at 1.75 Angstrom resolution, and evaluated the roles residues T82 and H192 play in substrate binding and enzyme catalysis through site-directed mutagenesis of the enzyme. Our results establish that this DDC functions exclusively on the production of dopamine and serotonin, with no activity to tyrosine or tryptophan and catalyzes the formation of serotonin more efficiently than dopamine. The crystal structure of Drosophila DDC and the site-directed mutagenesis study of the enzyme demonstrate that T82 is involved in substrate binding and that H192 is used not only for substrate interaction, but for cofactor binding of drDDC as well. Through comparative analysis, the results also provide insight into the structure-function relationship of other insect DDC-like proteins.

  17. Cytokines in Drosophila immunity.

    Science.gov (United States)

    Vanha-Aho, Leena-Maija; Valanne, Susanna; Rämet, Mika

    2016-02-01

    Cytokines are a large and diverse group of small proteins that can affect many biological processes, but most commonly cytokines are known as mediators of the immune response. In the event of an infection, cytokines are produced in response to an immune stimulus, and they function as key regulators of the immune response. Cytokines come in many shapes and sizes, and although they vary greatly in structure, their functions have been well conserved in evolution. The immune signaling pathways that respond to cytokines are remarkably conserved from fly to man. Therefore, Drosophila melanogaster, provides an excellent platform for studying the biology and function of cytokines. In this review, we will describe the cytokines and cytokine-like molecules found in the fly and discuss their roles in host immunity. Copyright © 2015 European Federation of Immunological Societies. Published by Elsevier B.V. All rights reserved.

  18. Humidity Sensing in Drosophila.

    Science.gov (United States)

    Enjin, Anders; Zaharieva, Emanuela E; Frank, Dominic D; Mansourian, Suzan; Suh, Greg S B; Gallio, Marco; Stensmyr, Marcus C

    2016-05-23

    Environmental humidity influences the fitness and geographic distribution of all animals [1]. Insects in particular use humidity cues to navigate the environment, and previous work suggests the existence of specific sensory mechanisms to detect favorable humidity ranges [2-5]. Yet, the molecular and cellular basis of humidity sensing (hygrosensation) remains poorly understood. Here we describe genes and neurons necessary for hygrosensation in the vinegar fly Drosophila melanogaster. We find that members of the Drosophila genus display species-specific humidity preferences related to conditions in their native habitats. Using a simple behavioral assay, we find that the ionotropic receptors IR40a, IR93a, and IR25a are all required for humidity preference in D. melanogaster. Yet, whereas IR40a is selectively required for hygrosensory responses, IR93a and IR25a mediate both humidity and temperature preference. Consistent with this, the expression of IR93a and IR25a includes thermosensory neurons of the arista. In contrast, IR40a is excluded from the arista but is expressed (and required) in specialized neurons innervating pore-less sensilla of the sacculus, a unique invagination of the third antennal segment. Indeed, calcium imaging showed that IR40a neurons directly respond to changes in humidity, and IR40a knockdown or IR93a mutation reduced their responses to stimuli. Taken together, our results suggest that the preference for a specific humidity range depends on specialized sacculus neurons, and that the processing of environmental humidity can happen largely in parallel to that of temperature. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Stationary-state mutagenesis in Escherichia coli: a model

    Indian Academy of Sciences (India)

    Here we propose a more detailed version of this model that also takes into account the observed genetic requirements of stationary-state mutagenesis. Briefly, G:T/U mismatches produced at methylatable cytosines are preferentially repaired in nondividing cells by the very short patch mismatch repair (VSPMR) mechanism ...

  20. Methods for targetted mutagenesis in gram-positive bacteria

    Science.gov (United States)

    Yang, Yunfeng

    2014-05-27

    The present invention provides a method of targeted mutagenesis in Gram-positive bacteria. In particular, the present invention provides a method that effectively integrates a suicide integrative vector into a target gene in the chromosome of a Gram-positive bacterium, resulting in inactivation of the target gene.

  1. Efficient multi-site-directed mutagenesis directly from genomic ...

    Indian Academy of Sciences (India)

    2012-09-29

    Sep 29, 2012 ... overlap extension PCR (OE-PCR) and Quick-change multi- site-directed mutagenesis systems developed by Stratagene. Company are predominately used owing to their simplicity and efficiency. Quick-change method is simple for MSM, but it requires circular plasmid as an amplification template.

  2. Effect of Colchicine Induced Mutagenesis on Growth and Yield of ...

    African Journals Online (AJOL)

    Chemical mutagenesis through the use of colchicine on the seeds of two varieties of sesame (Sesamum indicum L. Var. Ex-Sudan and E-8) with the aim of inducing variability that could be exploited in the genetic improvement of its growth and yield was carried out. The sesame seeds were treated with colchicines at four ...

  3. Targeted mutagenesis using CRISPR/Cas in inbred potatoes

    Science.gov (United States)

    Targeted mutagenesis using sequence-specific nucleases (SSNs) has been well established in several important crop species, but is in need of improvement in potato (Solanum tuberosum L.). For over a century, potatoes have been bred as autotetraploids (2n = 4x = 48), relying on F1 selections and clona...

  4. The European dimension for the mouse genome mutagenesis

    Czech Academy of Sciences Publication Activity Database

    Auwerx, J.; Avner, P.; Baldock, R.; Ballabio, A.; Balling, R.; Barbacid, M.; Berns, A.; Bradley, A.; Brown, S.; Carmeliet, P.; Chambon, P.; Cox, R.; Davidson, D.; Davies, K.; Duboule, D.; Forejt, Jiří; Granucci, F.; Hastie, N.; Angelis, M. H. de; Jackson, I.; Kioussis, D.; Kollias, G.; Lathrop, M.; Lendahl, U.; Malumbres, M.; von Melchner, H.; Müller, W.; Partanen, J.; Ricciardi-Castagnoli, P.; Rigby, P.; Rosen, B.; Rosenthal, N.; Skarnes, B.; Stewart, A. F.; Thornton, J.; Tocchini-Valentini, G.; Wagner, E.; Wahli, W.; Wurst, W.

    2004-01-01

    Roč. 16, - (2004), s. 925-927 ISSN 1061-4036 R&D Projects: GA MŠk(CZ) LN00A079 Institutional research plan: CEZ:AV0Z5052915 Keywords : The European Mouse Mutagenesis Consortium Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 24.695, year: 2004

  5. Insertional mutagenesis reveals genes involved in Bacillus cereus ATCC 14579 growth at low temperature.

    Science.gov (United States)

    Broussolle, Véronique; Pandiani, Franck; Haddad, Nabila; Michaud, Caroline; Carlin, Frédéric; Nguyen-the, Christophe; Brillard, Julien

    2010-05-01

    Transposon mutagenesis of Bacillus cereus ATCC 14579 yielded cold-sensitive mutants. Mutants of genes encoding enzymes of the central metabolism were affected by cold, but also by other stresses, such as pH or salt, whereas a mutant with transposon insertion in the promoter region of BC0259 gene, encoding a putative DEAD-box RNA helicase displaying homology with Escherichia coli CsdA and Bacillus subtilis CshA RNA helicases, was only cold-sensitive. Expression of the BC0259 gene at 10 degrees C is reduced in the mutant. Analysis of the 5' untranslated region revealed the transcriptional start and putative cold shock-responsive elements. The role of this RNA helicase in the cold-adaptive response of B. cereus is discussed.

  6. Use of Drosophila to study DNA repair

    International Nuclear Information System (INIS)

    Boyd, J.B.; Harris, P.V.; Sakaguchi, K.

    1988-01-01

    This paper discusses Drosophila, the premier metazoan organism for analyzing many fundamental features of eukaryotic gene regulation. The authors present adaptations of several approaches for studying DNA repair to an analysis of repair-defective mutants in Drosophila. A current understanding of Drosophila DNA repair is described

  7. Rapid recombination mapping for high-throughput genetic screens in Drosophila.

    Science.gov (United States)

    Sapiro, Anne L; Ihry, Robert J; Buhr, Derek L; Konieczko, Kevin M; Ives, Sarah M; Engstrom, Anna K; Wleklinski, Nicholas P; Kopish, Kristin J; Bashirullah, Arash

    2013-12-09

    Mutagenesis screens are a staple of classical genetics. Chemical-induced mutations, however, are often difficult and time-consuming to identify. Here, we report that recombination analysis with pairs of dominant visible markers provides a rapid and reliable strategy to map mutations in Drosophila melanogaster. This method requires only two generations and a total of six crosses in vials to estimate the genetic map position of the responsible lesion with high accuracy. This genetic map position can then be reliably used to identify the mutated gene through complementation testing with an average of nine deficiencies and Sanger sequencing. We have used this approach to successfully map a collection of mutations from an ethyl methanesulfonate-based mutagenesis screen on the third chromosome. We propose that this method also may be used in conjunction with whole-genome sequencing, particularly when multiple independent alleles of the mutated locus are not available. By facilitating the rapid identification of mutated genes, our mapping strategy removes a primary obstacle to the widespread use of powerful chemical mutagenesis screens to understand fundamental biological phenomena.

  8. Cadmium resistance in Drosophila: a small cadmium binding substance

    International Nuclear Information System (INIS)

    Jacobson, K.B.; Williams, M.W.; Richter, L.J.; Holt, S.E.; Hook, G.J.; Knoop, S.M.; Sloop, F.V.; Faust, J.B.

    1985-01-01

    A small cadmium-binding substance (CdBS) has been observed in adult Drosophila melanogaster that were raised for their entire growth cycle on a diet that contained 0.15 mM CdCl 2 . Induction of CdBS was observed in strains that differed widely in their sensitivity of CdCl 2 . This report describes the induction of CdBS and some of its characteristics. 17 refs., 4 figs., 1 tab

  9. High affinity recognition of serotonin transporter antagonists defined by species-scanning mutagenesis. An aromatic residue in transmembrane domain I dictates species-selective recognition of citalopram and mazindol.

    Science.gov (United States)

    Barker, E L; Perlman, M A; Adkins, E M; Houlihan, W J; Pristupa, Z B; Niznik, H B; Blakely, R D

    1998-07-31

    Human and Drosophila melanogaster serotonin (5-HT) transporters (SERTs) exhibit similar 5-HT transport kinetics and can be distinguished pharmacologically by many, but not all, biogenic amine transporter antagonists. By using human and Drosophila SERT chimeras, major determinants of potencies of two transporter antagonists, mazindol and citalopram, were tracked to the amino-terminal domains encompassing transmembrane domains I and II. Species-scanning mutagenesis, whereby amino acid substitutions are made switching residues from one species to another, was employed on the eight amino acids that differ between human and Drosophila SERTs in this region, and antagonist potencies were reassessed in 5-HT uptake assays. A single mutation in transmembrane domain I of human SERT, Y95F, shifted both citalopram and mazindol to Drosophila SERT-like potencies. Strikingly, these potency changes were in opposite directions suggesting Tyr95 contributes both positive and negative determinants of antagonist potency. To gain insight into how the Y95F mutant might influence mazindol potency, we determined how structural variants of mazindol responded to the mutation. Our studies demonstrate the importance of the hydroxyl group on the heterocyclic nucleus of mazindol for maintaining species-selective recognition of mazindol and suggest that transmembrane domain I participates in the formation of antagonist-binding sites for amine transporters.

  10. Novel patterns of ultraviolet mutagenesis and Weigle reactivation in Staphylococcus aureus and phage phi II

    International Nuclear Information System (INIS)

    Thompson, J.K.; Hart, M.G.R.

    1981-01-01

    The effects of u.v. irradiation on the survival of Staphylococcus aureus and its phage phi11 were studied. The recA and uvr mutations affected their survival like synonymous mutations in Escherichia coli. Weigle reactivation (W-reactivation) of phi11 occurred in wild-type S. aureus and in a uvr mutant. Reactivation was recA-dependent and was accompanied by u.v.-induced mutagenesis in a temperature-sensitive mutant of phi11. Bacterial mutation to streptomycin resistance was induced by u.v. and was also recA-dependent. In S. aureus, as in E. coli, u.v. was a more effective mutagen in the uvr genetic background. However, a dose-squared response for u.v.-induced mutation of wild-type and uvr strains of S. aureus to streptomycin resistance, and of a trp auxotroph to tryptophan independence, was found only with u.v. doses below 1 J m -2 . In relation to the Uvr mechanism of DNA repair, u.v. mutagenesis in S. aureus may involve both repairable and non-repairable lesions. As in E. Coli, the uvr genetic background reduced the u.v. dose required for maximal W-reactivation of u.v.-irradiated phage. However, there was no enhancement of W-reactivation by post-irradiation broth incubation of S. aureus. The results are compatible with a non-inducible mechanism for this phenomenon. (author)

  11. Mutagenic and recombinagenic activity of airborne particulates, PM10 and TSP, organic extracts in the Drosophila wing-spot test

    International Nuclear Information System (INIS)

    Rodrigues Dihl, Rafael; Grazielli Azevedo da Silva, Carla; Souza do Amaral, Viviane; Reguly, Maria Luiza; Rodrigues de Andrade, Heloisa Helena

    2008-01-01

    The genotoxicity associated with air pollution in the city of Canoas, Rio Grande do Sul (Brazil), was assessed in November (spring) and January (summer). We applied the somatic mutation and recombination test (SMART) in Drosophila melanogaster in its standard version with normal bioactivation (ST) and in its variant with increased cytochrome P450-dependent biotransformation capacity (HB). The data indicated the genotoxicity of TSP and PM10 collected in November, in both ST and HB crosses. The genotoxic activity of the PM10 material in the spring sample was exclusively associated with the induction of mitotic recombination, whereas the TSP genetic toxicity was due to both recombinational as well as point and/or chromosomal mutation events. Considering PM10 collected in January, a positive response-100% (17.10 m 3 /ml) concentration-was observed in the HB cross, which was not detected in the ST cross. - Drosophila Wing-Spot Test can be used for detection of airborne particulates mutagenesis

  12. Different efficiency of UmuDC and MucAB proteins in UV light induced mutagenesis in Escherichia coli

    International Nuclear Information System (INIS)

    Blanco, M.; Herrera, G.; Aleixandre, V.

    1986-01-01

    Two multicopy plasmids carrying either the umuDC or the mucAB operon were used to compare the efficiency of UmuDC and MucAB proteins in UV mutagenesis of Escherichia coli K12. It was found that in recA + uvr + bacteria, plasmid pIC80, mucAB + mediated UV mutagenesis more efficiently than did plasmid pSE 117, umuDC + . A similar result was obtained in lex A51(Def) cells, excluding the possibility that this was due to a differential regulation by LexA of the umuDC and mucAB operons. We conclude that some structural characteristic of the UmuDC and MucAB proteins determines their different efficiency in UV mutagenesis. This characteristic could be also responsible for the observation that in the recA430 mutant, pIC80 but no pSE117 can mediate UV mutagenesis. In the recAS142 mutant pIC80 also promoted UV mutagenesis more efficiently than pSE117. In this mutant, the recombination proficiency, the protease activity toward LexA and the mutation frequency were increased by the presence of adenine in the medium. In recA + uvrB5 bacteria, plasmid pSE117, umuDC caused both an increase in UV sensitivity as well as a reduction in the mutation frequency. These negative effects resulting from the overproduction of UmuDC proteins were higher in recA142 uvrB5 than in recA + uvrB5 cells. In contrast, overproduction of MucAB proteins in excision-deficient bacteria containing pIC80 led to a large increase in the mutation frequency. We suggest that the functional differences between UmuDC and MucAB proteins might be due to their different dependence on the direct role of RecA protease in UV mutagenesis. (orig.)

  13. Phenotypic plasticity of the Drosophila transcriptome.

    Directory of Open Access Journals (Sweden)

    Shanshan Zhou

    Full Text Available Phenotypic plasticity is the ability of a single genotype to produce different phenotypes in response to changing environments. We assessed variation in genome-wide gene expression and four fitness-related phenotypes of an outbred Drosophila melanogaster population under 20 different physiological, social, nutritional, chemical, and physical environments; and we compared the phenotypically plastic transcripts to genetically variable transcripts in a single environment. The environmentally sensitive transcriptome consists of two transcript categories, which comprise ∼15% of expressed transcripts. Class I transcripts are genetically variable and associated with detoxification, metabolism, proteolysis, heat shock proteins, and transcriptional regulation. Class II transcripts have low genetic variance and show sexually dimorphic expression enriched for reproductive functions. Clustering analysis of Class I transcripts reveals a fragmented modular organization and distinct environmentally responsive transcriptional signatures for the four fitness-related traits. Our analysis suggests that a restricted environmentally responsive segment of the transcriptome preserves the balance between phenotypic plasticity and environmental canalization.

  14. Mutagenesis breeding research of Lactobacillus brevis of nitrite reduction

    Directory of Open Access Journals (Sweden)

    LI Zeli

    2015-10-01

    Full Text Available The pollution of nitrite in food became one of the focus of food safety issues,the use of biotechnology methods degrading nitrite became hotspot.The primitive strain was Lactobacillus brevis C2,preserved in our laboratory,had the ability to degrade nitrite,through composite mutagenesis of 15 W,254 nm,20 cm ultraviolet mutagenesis (UV for 120 s and 0.8% diethyl sulfate(DES in 37℃ mutation for 40 min,after screening,we successfully obtained high efficient strain of nitrite degradation,named UV6-DS2,relative to the starting strain,under the condition of 400 mg/L nitrite,after 12 h degradation,nitrite degradation rate increased from 92.8% to 97.8%,to explore its application in food was able to effectively reduce concentration of nitrite in food.

  15. Minimizing off-Target Mutagenesis Risks Caused by Programmable Nucleases

    Directory of Open Access Journals (Sweden)

    Kentaro Ishida

    2015-10-01

    Full Text Available Programmable nucleases, such as zinc finger nucleases (ZFNs, transcription activator like effector nucleases (TALENs, and clustered regularly interspersed short palindromic repeats associated protein-9 (CRISPR-Cas9, hold tremendous potential for applications in the clinical setting to treat genetic diseases or prevent infectious diseases. However, because the accuracy of DNA recognition by these nucleases is not always perfect, off-target mutagenesis may result in undesirable adverse events in treated patients such as cellular toxicity or tumorigenesis. Therefore, designing nucleases and analyzing their activity must be carefully evaluated to minimize off-target mutagenesis. Furthermore, rigorous genomic testing will be important to ensure the integrity of nuclease modified cells. In this review, we provide an overview of available nuclease designing platforms, nuclease engineering approaches to minimize off-target activity, and methods to evaluate both on- and off-target cleavage of CRISPR-Cas9.

  16. Targeted mutagenesis in sea urchin embryos using TALENs.

    Science.gov (United States)

    Hosoi, Sayaka; Sakuma, Tetsushi; Sakamoto, Naoaki; Yamamoto, Takashi

    2014-01-01

    Genome editing with engineered nucleases such as zinc-finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) has been reported in various animals. We previously described ZFN-mediated targeted mutagenesis and insertion of reporter genes in sea urchin embryos. In this study, we demonstrate that TALENs can induce mutagenesis at specific genomic loci of sea urchin embryos. Injection of TALEN mRNAs targeting the HpEts transcription factor into fertilized eggs resulted in the impairment of skeletogenesis. Sequence analyses of the mutations showed that deletions and/or insertions occurred at the HpEts target site in the TALEN mRNAs-injected embryos. The results suggest that targeted gene disruption using TALENs is feasible in sea urchin embryos. © 2013 The Authors Development, Growth & Differentiation © 2013 Japanese Society of Developmental Biologists.

  17. Modelling Cooperative Tumorigenesis in Drosophila

    Science.gov (United States)

    2018-01-01

    The development of human metastatic cancer is a multistep process, involving the acquisition of several genetic mutations, tumour heterogeneity, and interactions with the surrounding microenvironment. Due to the complexity of cancer development in mammals, simpler model organisms, such as the vinegar fly, Drosophila melanogaster, are being utilized to provide novel insights into the molecular mechanisms involved. In this review, we highlight recent advances in modelling tumorigenesis using the Drosophila model, focusing on the cooperation of oncogenes or tumour suppressors, and the interaction of mutant cells with the surrounding tissue in epithelial tumour initiation and progression. PMID:29693007

  18. Photodynamic action of methylene blue: mutagenesis and synergism

    International Nuclear Information System (INIS)

    Capella, M.A.M.

    1988-01-01

    The associated mutagenesis and the interactions with physical agents in order to potencialize its biological effects are studied. The induction of mutation in bacterias due to photodynamic action of methylene blue is presented as well as the induction of single breaks in bacterial DNA and the relationship between the repair systems, especially the SOS one. The interaction of the photodynamic therapy with low intensity electric current is discussed. (M.A.C.) [pt

  19. Environmental mutagenesis and radiation biology: The legacy of William Morgan.

    Science.gov (United States)

    Schwartz, Jeffrey L

    2017-12-01

    A symposium entitled Environmental Mutagenesis and Radiation Biology was held on September 27, 2016 to honor the memory of Dr. William F. Morgan who passed away unexpectedly on November 13, 2015. The speakers presented the latest reviews on homologous recombination repair, induced genetic instability, bystander effects, and risk estimate development. Their presentations are presented following the introduction. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Temperature-dependent sex-reversal by a transformer-2 gene-edited mutation in the spotted wing drosophila, Drosophila suzukii

    Science.gov (United States)

    Female to male sex reversal was achieved in an emerging agricultural insect pest, Drosophila suzukii, by creating a temperature-sensitive point mutation in the sex-determination gene, transformer-2 (tra-2) using CRISPR/Cas9 (clustered regularly interspaced palindromic repeats/ CRISPR-associated) hom...

  1. Drosophila Vps13 Is Required for Protein Homeostasis in the Brain.

    Directory of Open Access Journals (Sweden)

    Jan J Vonk

    Full Text Available Chorea-Acanthocytosis is a rare, neurodegenerative disorder characterized by progressive loss of locomotor and cognitive function. It is caused by loss of function mutations in the Vacuolar Protein Sorting 13A (VPS13A gene, which is conserved from yeast to human. The consequences of VPS13A dysfunction in the nervous system are still largely unspecified. In order to study the consequences of VPS13A protein dysfunction in the ageing central nervous system we characterized a Drosophila melanogaster Vps13 mutant line. The Drosophila Vps13 gene encoded a protein of similar size as human VPS13A. Our data suggest that Vps13 is a peripheral membrane protein located to endosomal membranes and enriched in the fly head. Vps13 mutant flies showed a shortened life span and age associated neurodegeneration. Vps13 mutant flies were sensitive to proteotoxic stress and accumulated ubiquitylated proteins. Levels of Ref(2P, the Drosophila orthologue of p62, were increased and protein aggregates accumulated in the central nervous system. Overexpression of the human Vps13A protein in the mutant flies partly rescued apparent phenotypes. This suggests a functional conservation of human VPS13A and Drosophila Vps13. Our results demonstrate that Vps13 is essential to maintain protein homeostasis in the larval and adult Drosophila brain. Drosophila Vps13 mutants are suitable to investigate the function of Vps13 in the brain, to identify genetic enhancers and suppressors and to screen for potential therapeutic targets for Chorea-Acanthocytosis.

  2. Directed mutagenesis affects recombination in Azospirillum brasilense nif genes

    Directory of Open Access Journals (Sweden)

    C.P. Nunes

    2000-12-01

    Full Text Available In order to improve the gene transfer/mutagenesis system for Azospirillum brasilense, gene-cartridge mutagenesis was used to replace the nifD gene with the Tn5 kanamycin resistance gene. The construct was transferred to A. brasilense by electrotransformation. Of the 12 colonies isolated using the suicide plasmid pSUP202 as vector, only four did not show vector integration into the chromosome. Nevertheless, all 12 colonies were deficient in acetylene reduction, indicating an Nif- phenotype. Four Nif- mutants were analyzed by Southern blot, using six different probes spanning the nif and Km r genes and the plasmid vector. Apparently, several recombination events occurred in the mutant genomes, probably caused mainly by gene disruption owing to the mutagenesis technique used: resistance gene-cartridge mutagenesis combined with electrotransformation.Com o objetivo de melhorar os sistemas de transferência gênica e mutagênese para Azospirillum brasilense, a técnica de mutagênese através do uso de um gene marcador ("gene-cartridge mutagenesis" foi utilizada para substituir a região genômica de A. brasilense correspondente ao gene nifD por um segmento de DNA do transposon Tn5 contendo o gene que confere resistência ao antibiótico canamicina. A construção foi transferida para a linhagem de A. brasilense por eletrotransformação. Doze colônias transformantes foram isoladas com o plasmídeo suicida pSUP202 servindo como vetor. Dessas, somente quatro não possuíam o vetor integrado no cromossomo da bactéria. Independentemente da integração ou não do vetor, as 12 colônias foram deficientes na redução do gás acetileno, evidenciando o fenótipo Nif -. Quatro mutantes Nif - foram analisados através da técnica de Southern blot, utilizando-se seis diferentes fragmentos contendo genes nif, de resistência à canamicina e do vetor como sondas. Os resultados sugerem a ocorrência de eventos recombinacionais variados no genoma dos mutantes. A

  3. Drosophila Cancer Models Identify Functional Differences between Ret Fusions

    Directory of Open Access Journals (Sweden)

    Sarah Levinson

    2016-09-01

    Full Text Available We generated and compared Drosophila models of RET fusions CCDC6-RET and NCOA4-RET. Both RET fusions directed cells to migrate, delaminate, and undergo EMT, and both resulted in lethality when broadly expressed. In all phenotypes examined, NCOA4-RET was more severe than CCDC6-RET, mirroring their effects on patients. A functional screen against the Drosophila kinome and a library of cancer drugs found that CCDC6-RET and NCOA4-RET acted through different signaling networks and displayed distinct drug sensitivities. Combining data from the kinome and drug screens identified the WEE1 inhibitor AZD1775 plus the multi-kinase inhibitor sorafenib as a synergistic drug combination that is specific for NCOA4-RET. Our work emphasizes the importance of identifying and tailoring a patient’s treatment to their specific RET fusion isoform and identifies a multi-targeted therapy that may prove effective against tumors containing the NCOA4-RET fusion.

  4. Sensory Conflict Disrupts Activity of the Drosophila Circadian Network

    Directory of Open Access Journals (Sweden)

    Ross E.F. Harper

    2016-11-01

    Full Text Available Periodic changes in light and temperature synchronize the Drosophila circadian clock, but the question of how the fly brain integrates these two input pathways to set circadian time remains unanswered. We explore multisensory cue combination by testing the resilience of the circadian network to conflicting environmental inputs. We show that misaligned light and temperature cycles can lead to dramatic changes in the daily locomotor activities of wild-type flies during and after exposure to sensory conflict. This altered behavior is associated with a drastic reduction in the amplitude of PERIOD (PER oscillations in brain clock neurons and desynchronization between light- and temperature-sensitive neuronal subgroups. The behavioral disruption depends heavily on the phase relationship between light and temperature signals. Our results represent a systematic quantification of multisensory integration in the Drosophila circadian system and lend further support to the view of the clock as a network of coupled oscillatory subunits.

  5. Temperature-sensitive glutamate dehydrogenase mutants of Salmonella typhimurium.

    OpenAIRE

    Dendinger, S M; Brenchley, J E

    1980-01-01

    Mutants of Salmonella typhimurium defective in glutamate dehydrogenase activity were isolated in parent strains lacking glutamate synthase activity by localizcd mutagenesis or by a general mutagenesis combined with a cycloserine enrichment for glutamate auxotrophs. Two mutants with temperature-sensitive phenotypes had glutamate dehydrogenase activities that were more thermolabile than that of an isogenic control strain. Eight other mutants had less than 10% of the wild-type glutamate dehydrog...

  6. Screening for improved activity of a transglutaminase from Streptomyces mobaraensis created by a novel rational mutagenesis and random mutagenesis.

    Science.gov (United States)

    Yokoyama, Keiichi; Utsumi, Hiroe; Nakamura, Takefumi; Ogaya, Daisuke; Shimba, Nobuhisa; Suzuki, Eiichiro; Taguchi, Seiichi

    2010-08-01

    Microbial transglutaminase (MTG) has been used extensively in academic research and the food industries through its cross-linking or posttranslational modification of proteins. Two enzyme engineering approaches were applied to improve MTG activity. One is a novel method of rational mutagenesis, called water-accessible surface hot-space region-oriented mutagenesis (WASH-ROM). One hundred and fifty-one point mutations were selected at 40 residues, bearing high solvent-accessibility surface area, within a 15 A space from the active site Cys64. Among them, 32 mutants showed higher specific activity than the wild type. The other is a random mutagenesis of the whole region of the MTG gene, coupled with a new plate assay screening system, using Corynebacterium Expression System CORYNEX. This in vivo system allowed us to readily distinguish the change in enzymatic activity by monitoring the intensity of enzymatic reaction-derived color zones surrounding recombinant cells. From the library of 24,000 mutants, ten were finally selected as beneficial mutants exhibiting higher specific activity than the wild type. Furthermore, we found that Ser199Ala mutant with additional N-terminal tetrapeptide showed the highest specific activity (1.7 times higher than the wild type). These various beneficial positions leading to increased specific activity of MTG were identified to achieve further enzyme improvements.

  7. MMS exposure promotes increased MtDNA mutagenesis in the presence of replication-defective disease-associated DNA polymerase γ variants.

    Science.gov (United States)

    Stumpf, Jeffrey D; Copeland, William C

    2014-10-01

    Mitochondrial DNA (mtDNA) encodes proteins essential for ATP production. Mutant variants of the mtDNA polymerase cause mutagenesis that contributes to aging, genetic diseases, and sensitivity to environmental agents. We interrogated mtDNA replication in Saccharomyces cerevisiae strains with disease-associated mutations affecting conserved regions of the mtDNA polymerase, Mip1, in the presence of the wild type Mip1. Mutant frequency arising from mtDNA base substitutions that confer erythromycin resistance and deletions between 21-nucleotide direct repeats was determined. Previously, increased mutagenesis was observed in strains encoding mutant variants that were insufficient to maintain mtDNA and that were not expected to reduce polymerase fidelity or exonuclease proofreading. Increased mutagenesis could be explained by mutant variants stalling the replication fork, thereby predisposing the template DNA to irreparable damage that is bypassed with poor fidelity. This hypothesis suggests that the exogenous base-alkylating agent, methyl methanesulfonate (MMS), would further increase mtDNA mutagenesis. Mitochondrial mutagenesis associated with MMS exposure was increased up to 30-fold in mip1 mutants containing disease-associated alterations that affect polymerase activity. Disrupting exonuclease activity of mutant variants was not associated with increased spontaneous mutagenesis compared with exonuclease-proficient alleles, suggesting that most or all of the mtDNA was replicated by wild type Mip1. A novel subset of C to G transversions was responsible for about half of the mutants arising after MMS exposure implicating error-prone bypass of methylated cytosines as the predominant mutational mechanism. Exposure to MMS does not disrupt exonuclease activity that suppresses deletions between 21-nucleotide direct repeats, suggesting the MMS-induce mutagenesis is not explained by inactivated exonuclease activity. Further, trace amounts of CdCl2 inhibit mtDNA replication but

  8. groE mutants of Escherichia coli are defective in umuDC-dependent UV mutagenesis

    International Nuclear Information System (INIS)

    Donnelly, C.E.; Walker, G.C.

    1989-01-01

    Overexpression of the SOS-inducible umuDC operon of Escherichia coli results in the inability of these cells to grow at 30 degrees C. Mutations in several heat shock genes suppress this cold sensitivity. Suppression of umuD+C+-dependent cold sensitivity appears to occur by two different mechanisms. We show that mutations in lon and dnaK heat shock genes suppress cold sensitivity in a lexA-dependent manner. In contrast, mutations in groES, groEL, and rpoH heat shock genes suppress cold sensitivity regardless of the transcriptional regulation of the umuDC genes. We have also found that mutations in groES and groEL genes are defective in umuDC-dependent UV mutagenesis. This defect can be suppressed by increased expression of the umuDC operon. The mechanism by which groE mutations affect umuDC gene product function may be related to the stability of the UmuC protein, since the half-life of this protein is shortened because of mutations at the groE locus

  9. Drosophila proteins involved in metabolism of uracil-DNA possess different types of nuclear localization signals.

    Science.gov (United States)

    Merényi, Gábor; Kónya, Emese; Vértessy, Beáta G

    2010-05-01

    Adequate transport of large proteins that function in the nucleus is indispensable for cognate molecular events within this organelle. Selective protein import into the nucleus requires nuclear localization signals (NLS) that are recognized by importin receptors in the cytoplasm. Here we investigated the sequence requirements for nuclear targeting of Drosophila proteins involved in the metabolism of uracil-substituted DNA: the recently identified uracil-DNA degrading factor, dUTPase, and the two uracil-DNA glycosylases present in Drosophila. For the uracil-DNA degrading factor, NLS prediction identified two putative NLS sequences [PEKRKQE(320-326) and PKRKKKR(347-353)]. Truncation and site-directed mutagenesis using YFP reporter constructs showed that only one of these basic stretches is critically required for efficient nuclear localization in insect cells. This segment corresponds to the well-known prototypic NLS of SV40 T-antigen. An almost identical NLS segment is also present in the Drosophila thymine-DNA glycosylase, but no NLS elements were predicted in the single-strand-specific monofunctional uracil-DNA glycosylase homolog protein. This latter protein has a molecular mass of 31 kDa, which may allow NLS-independent transport. For Drosophila dUTPase, two isoforms with distinct features regarding molecular mass and subcellular distribution were recently described. In this study, we characterized the basic PAAKKMKID(10-18) segment of dUTPase, which has been predicted to be a putative NLS by in silico analysis. Deletion studies, using YFP reporter constructs expressed in insect cells, revealed the importance of the PAA(10-12) tripeptide and the ID(17-18) dipeptide, as well as the role of the PAAK(10-13) segment in nuclear localization of dUTPase. We constructed a structural model that shows the molecular basis of such recognition in three dimensions.

  10. [Studies of the repair of radiation-induced genetic damage in Drosophila]. Annual progress report, October 1, 1988--June 1, 1989

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1989-12-31

    The primary goal of this study is to achieve a more thorough understanding of the mechanisms employed by higher organisms to repair DNA damage induced by both ionizing and nonionizing radiation. These studies are also contributing to an improved understanding of the processes of mutagenesis and carcinogenesis in higher eukaryotes. The studies employ Drosophila as a model organism for investigating repair functions that are common to all higher eukaryotes. Drosophila was chosen in the early phases of this study primarily because of the ease with which one can isolate and characterize repair-deficient mutants in a metazoan organism. The laboratory has gone on to investigate the metabolic defects of such mutants while others have performed complementary genetic and cytogenetic studies which relate DNA repair processes to mutagenesis and chromosome stability. The repair studies have exploited the capacity to introduce mutant Drosophila cells into tissue culture and thereby compare repair defects directly with those of homologous human disorders. Researchers are currently employing recombinant DNA technology to investigate the mechanisms of the DNA repair pathways defined by those mutants.

  11. Untargeted viral mutagenesis is not found in X-irradiated monkey cells

    International Nuclear Information System (INIS)

    Lytle, C.D.; Carney, P.G.; Lee, W.; Bushar, H.F.

    1988-01-01

    The existence of untargeted viral mutagenesis in X-irradiated cells was investigated in a mammalian virus/cell system, where a low level of such viral mutagenesis can be demonstrated in UV-irradiated cells. In the positive control experiment UV-elicited mutagenesis was shown with cell exposures of 5, 10 and 15 J/m 2 and a delay of 24 h between cell irradiation and infection with unirradiated herpes simplex virus. Although X-ray doses of 1, 3 and 10 Gy elicit enhanced reactivation of UV-irradiated virus, no untargeted mutagenesis for any X-ray dose at post-irradiation infection times of 0, 24 or 72 h was observed in this study. Thus untargeted mutagenesis of herpes simplex virus was not demonstrated in X-irradiated monkey cells, under conditions where X-ray-enhanced reactivation occurs and where untargeted mutagenesis in UV-irradiated cells occurs. (author)

  12. Unique properties of Drosophila spermatocyte primary cilia

    Directory of Open Access Journals (Sweden)

    Maria Giovanna Riparbelli

    2013-09-01

    The primary cilium is an essential organelle required for animal development and adult homeostasis that is found on most animal cells. The primary cilium contains a microtubule-based axoneme cytoskeleton that typically grows from the mother centriole in G0/G1 phase of the cell cycle as a membrane-bound compartment that protrudes from the cell surface. A unique system of bidirectional transport, intraflagellar transport (IFT, maintains the structure and function of cilia. While the axoneme is dynamic, growing and shrinking at its tip, at the same time it is very stable to the effects of microtubule-targeting drugs. The primary cilia found on Drosophila spermatocytes diverge from the general rules of primary cilium biology in several respects. Among these unique attributes, spermatocyte cilia assemble from all four centrioles in an IFT-independent manner in G2 phase, and persist continuously through two cell divisions. Here, we show that Drosophila spermatocyte primary cilia are extremely sensitive to microtubule-targeting drugs, unlike their mammalian counterparts. Spermatocyte cilia and their axonemes fail to assemble or be maintained upon nocodazole treatment, while centriole replication appears unperturbed. On the other hand, paclitaxel (Taxol, a microtubule-stabilizing drug, disrupted transition zone assembly and anchoring to the plasma membrane while causing spermatocyte primary cilia to grow extensively long during the assembly/elongation phase, but did not overtly affect the centrioles. However, once assembled to their mature length, spermatocyte cilia appeared unaffected by Taxol. The effects of these drugs on axoneme dynamics further demonstrate that spermatocyte primary cilia are endowed with unique assembly properties.

  13. Genetic screens to identify new Notch pathway mutants in Drosophila.

    Science.gov (United States)

    Giagtzoglou, Nikolaos

    2014-01-01

    Notch signaling controls a wide range of developmental processes, including proliferation, apoptosis, and cell fate specification during both development and adult tissue homeostasis. The functional versatility of the Notch signaling pathway is tightly linked with the complexity of its regulation in different cellular contexts. To unravel the complexity of Notch signaling, it is important to identify the different components of the Notch signaling pathway. A powerful strategy to accomplish this task is based on genetic screens. Given that the developmental context of signaling is important, these screens should be customized to specific cell populations or tissues. Here, I describe how to perform F1 clonal forward genetic screens in Drosophila to identify novel components of the Notch signaling pathway. These screens combine a classical EMS (ethyl methanesulfonate) chemical mutagenesis protocol along with clonal analysis via FRT-mediated mitotic recombination. These F1 clonal screens allow rapid phenotypic screening within clones of mutant cells induced at specific developmental stages and in tissues of interest, bypassing the pleiotropic effects of isolated mutations. More importantly, since EMS mutations have been notoriously difficult to map to specific genes in the past, I briefly discuss mapping methods that allow rapid identification of the causative mutations.

  14. Genetic analysis of the claret locus of Drosophila melanogaster

    International Nuclear Information System (INIS)

    Sequeira, W.; Nelson, C.R.; Szauter, P.

    1989-01-01

    The claret (ca) locus of Drosophila melanogaster comprises two separately mutable domains, one responsible for eye color and one responsible for proper disjunction of chromosomes in meiosis and early cleavage divisions. Previously isolated alleles are of three types: (1) alleles of the claret (ca) type that affect eye color only, (2) alleles of the claret-nondisjunctional (ca nd ) type that affect eye color and chromosome behavior, and (3) a meiotic mutation, non-claret disjunctional (ncd), that affects chromosome behavior only. In order to investigate the genetic structure of the claret locus, the authors have isolated 19 radiation-induced alleles of claret on the basis of the eye color phenotype. Two of these 19 new alleles are of the ca nd type, while 17 are of the ca type, demonstrating that the two domains do not often act as a single target for mutagenesis. This suggests that the two separately mutable functions are likely to be encoded by separate or overlapping genes rather than by a single gene. One of the new alleles of the ca nd type is a chromosome rearrangement with a breakpoint at the position of the claret locus. If this breakpoint is the cause of the mutant phenotype and there are no other mutations associated with the rearrangement, the two functions must be encoded by overlapping genes

  15. Semi-automated quantitative Drosophila wings measurements.

    Science.gov (United States)

    Loh, Sheng Yang Michael; Ogawa, Yoshitaka; Kawana, Sara; Tamura, Koichiro; Lee, Hwee Kuan

    2017-06-28

    Drosophila melanogaster is an important organism used in many fields of biological research such as genetics and developmental biology. Drosophila wings have been widely used to study the genetics of development, morphometrics and evolution. Therefore there is much interest in quantifying wing structures of Drosophila. Advancement in technology has increased the ease in which images of Drosophila can be acquired. However such studies have been limited by the slow and tedious process of acquiring phenotypic data. We have developed a system that automatically detects and measures key points and vein segments on a Drosophila wing. Key points are detected by performing image transformations and template matching on Drosophila wing images while vein segments are detected using an Active Contour algorithm. The accuracy of our key point detection was compared against key point annotations of users. We also performed key point detection using different training data sets of Drosophila wing images. We compared our software with an existing automated image analysis system for Drosophila wings and showed that our system performs better than the state of the art. Vein segments were manually measured and compared against the measurements obtained from our system. Our system was able to detect specific key points and vein segments from Drosophila wing images with high accuracy.

  16. Mutagenesis in Newts: Protocol for Iberian Ribbed Newts.

    Science.gov (United States)

    Hayashi, Toshinori; Takeuchi, Takashi

    2016-01-01

    Newts have the remarkable capability of organ/tissue regeneration, and have been used as a unique experimental model for regenerative biology. The Iberian ribbed newt (Pleurodeles waltl) is suitable as a model animal. We have established methods for artificial insemination and efficient transgenesis using P. waltl newts. In addition to the transgenic technique, development of TALENs enables targeting mutagenesis in the newts. We have reported that TALENs efficiently disrupted targeted genes in newt embryos. In this chapter, we introduce a protocol for TALEN-mediated gene targeting in Iberian ribbed newts.

  17. The impact of host diet on Wolbachia titer in Drosophila.

    Directory of Open Access Journals (Sweden)

    Laura R Serbus

    2015-03-01

    Full Text Available While a number of studies have identified host factors that influence endosymbiont titer, little is known concerning environmental influences on titer. Here we examined nutrient impact on maternally transmitted Wolbachia endosymbionts in Drosophila. We demonstrate that Drosophila reared on sucrose- and yeast-enriched diets exhibit increased and reduced Wolbachia titers in oogenesis, respectively. The yeast-induced Wolbachia depletion is mediated in large part by the somatic TOR and insulin signaling pathways. Disrupting TORC1 with the small molecule rapamycin dramatically increases oocyte Wolbachia titer, whereas hyper-activating somatic TORC1 suppresses oocyte titer. Furthermore, genetic ablation of insulin-producing cells located in the Drosophila brain abolished the yeast impact on oocyte titer. Exposure to yeast-enriched diets altered Wolbachia nucleoid morphology in oogenesis. Furthermore, dietary yeast increased somatic Wolbachia titer overall, though not in the central nervous system. These findings highlight the interactions between Wolbachia and germline cells as strongly nutrient-sensitive, and implicate conserved host signaling pathways by which nutrients influence Wolbachia titer.

  18. Neurophysiology of Drosophila Models of Parkinson’s Disease

    Directory of Open Access Journals (Sweden)

    Ryan J. H. West

    2015-01-01

    Full Text Available We provide an insight into the role Drosophila has played in elucidating neurophysiological perturbations associated with Parkinson’s disease- (PD- related genes. Synaptic signalling deficits are observed in motor, central, and sensory systems. Given the neurological impact of disease causing mutations within these same genes in humans the phenotypes observed in fly are of significant interest. As such we observe four unique opportunities provided by fly nervous system models of Parkinson’s disease. Firstly, Drosophila models are instrumental in exploring the mechanisms of neurodegeneration, with several PD-related mutations eliciting related phenotypes including sensitivity to energy supply and vesicular deformities. These are leading to the identification of plausible cellular mechanisms, which may be specific to (dopaminergic neurons and synapses rather than general cellular phenotypes. Secondly, models show noncell autonomous signalling within the nervous system, offering the opportunity to develop our understanding of the way pathogenic signalling propagates, resembling Braak’s scheme of spreading pathology in PD. Thirdly, the models link physiological deficits to changes in synaptic structure. While the structure-function relationship is complex, the genetic tractability of Drosophila offers the chance to separate fundamental changes from downstream consequences. Finally, the strong neuronal phenotypes permit relevant first in vivo drug testing.

  19. FMRFamide signaling promotes stress-induced sleep in Drosophila.

    Science.gov (United States)

    Lenz, Olivia; Xiong, Jianmei; Nelson, Matthew D; Raizen, David M; Williams, Julie A

    2015-07-01

    Enhanced sleep in response to cellular stress is a conserved adaptive behavior across multiple species, but the mechanism of this process is poorly understood. Drosophila melanogaster increases sleep following exposure to septic or aseptic injury, and Caenorhabditis elegans displays sleep-like quiescence following exposure to high temperatures that stress cells. We show here that, similar to C. elegans, Drosophila responds to heat stress with an increase in sleep. In contrast to Drosophila infection-induced sleep, heat-induced sleep is not sensitive to the time-of-day of the heat pulse. Moreover, the sleep response to heat stress does not require Relish, the NFκB transcription factor that is necessary for infection-induced sleep, indicating that sleep is induced by multiple mechanisms from different stress modalities. We identify a sleep-regulating role for a signaling pathway involving FMRFamide neuropeptides and their receptor FR. Animals mutant for either FMRFamide or for the FMRFamide receptor (FR) have a reduced recovery sleep in response to heat stress. FR mutants, in addition, show reduced sleep responses following infection with Serratia marcescens, and succumb to infection at a faster rate than wild-type controls. Together, these findings support the hypothesis that FMRFamide and its receptor promote an adaptive increase in sleep following stress. Because an FMRFamide-like neuropeptide plays a similar role in C. elegans, we propose that FRMFamide neuropeptide signaling is an ancient regulator of recovery sleep which occurs in response to cellular stress. Copyright © 2015 Elsevier Inc. All rights reserved.

  20. Evaluation of the mutagenic potential of Cochlospermum regium in Drosophila melanogaster male germ cells

    Directory of Open Access Journals (Sweden)

    Nunes Wanderlene Blanco

    2003-01-01

    Full Text Available During the last few decades the search for medical treatments based on alternative medicine has increased significantly, making knowledge of the plants commonly used as folk medicines extremely important. The plant Cochlospermum regium, a member of the Cochlospermaceae found in the Brazilian cerrado (a type of savanna, is known to have high depurative activity and to be effective not only in treating skin problems such as pimples, boils and blotches but also in curing gastritis and ulcers. We prepared aqueous extracts using 13, 19 and 25 gL-1 of dried C. regium root and investigated these extracts for possible mutagenic effects on Drosophila melanogaster germ cells. Mutagenesis was assessed using the ring-X loss (RXL test which can detect chromosome mosaicism, partial loss of the ring X chromosome and chromosome non-disjunction. Our results showed that at the concentrations tested C. regium extracts did not induce ring-X loss in D. melanogaster.

  1. Regulation of gene expression and RNA editing in Drosophila adapting to divergent microclimates.

    Science.gov (United States)

    Yablonovitch, Arielle L; Fu, Jeremy; Li, Kexin; Mahato, Simpla; Kang, Lin; Rashkovetsky, Eugenia; Korol, Abraham B; Tang, Hua; Michalak, Pawel; Zelhof, Andrew C; Nevo, Eviatar; Li, Jin Billy

    2017-11-17

    Determining the mechanisms by which a species adapts to its environment is a key endeavor in the study of evolution. In particular, relatively little is known about how transcriptional processes are fine-tuned to adjust to different environmental conditions. Here we study Drosophila melanogaster from 'Evolution Canyon' in Israel, which consists of two opposing slopes with divergent microclimates. We identify several hundred differentially expressed genes and dozens of differentially edited sites between flies from each slope, correlate these changes with genetic differences, and use CRISPR mutagenesis to validate that an intronic SNP in prominin regulates its editing levels. We also demonstrate that while temperature affects editing levels at more sites than genetic differences, genetically regulated sites tend to be less affected by temperature. This work shows the extent to which gene expression and RNA editing differ between flies from different microclimates, and provides insights into the regulation responsible for these differences.

  2. New genes often acquire male-specific functions but rarely become essential in Drosophila.

    Science.gov (United States)

    Kondo, Shu; Vedanayagam, Jeffrey; Mohammed, Jaaved; Eizadshenass, Sogol; Kan, Lijuan; Pang, Nan; Aradhya, Rajaguru; Siepel, Adam; Steinhauer, Josefa; Lai, Eric C

    2017-09-15

    Relatively little is known about the in vivo functions of newly emerging genes, especially in metazoans. Although prior RNAi studies reported prevalent lethality among young gene knockdowns, our phylogenomic analyses reveal that young Drosophila genes are frequently restricted to the nonessential male reproductive system. We performed large-scale CRISPR/Cas9 mutagenesis of "conserved, essential" and "young, RNAi-lethal" genes and broadly confirmed the lethality of the former but the viability of the latter. Nevertheless, certain young gene mutants exhibit defective spermatogenesis and/or male sterility. Moreover, we detected widespread signatures of positive selection on young male-biased genes. Thus, young genes have a preferential impact on male reproductive system function. © 2017 Kondo et al.; Published by Cold Spring Harbor Laboratory Press.

  3. A Drosophila wing spot test

    International Nuclear Information System (INIS)

    Ayaki, Toshikazu; Yoshikawa, Isao; Niikawa, Norio; Hoshi, Masaharu.

    1986-01-01

    A Drosophila wing spot test system was used to investigate the effects of low doses of X-rays, gamma rays, and both 2.3 and 14.1 MeV neutrons on somatic chromosome mutation (SCM) induction. The incidence of SCM was significantly increased with any type of radiation, with evident linear dose-response relationship within the range of 3 to 20 cGy. It was estimated that relative biological effectiveness value for SCM induction of 2.3 MeV neutrons to X-rays and gamma rays is much higher than that of 14.1 MeV neutrons to those photons (2.4 vs 8.0). The Drosophila wing spot test system seems to become a promising in vivo experimental method for higher animals in terms of the lack of necessity for a marvelously large number of materials required in conventional test system. (Namekawa, K.)

  4. Limited taste discrimination in Drosophila.

    Science.gov (United States)

    Masek, Pavel; Scott, Kristin

    2010-08-17

    In the gustatory systems of mammals and flies, different populations of sensory cells recognize different taste modalities, such that there are cells that respond selectively to sugars and others to bitter compounds. This organization readily allows animals to distinguish compounds of different modalities but may limit the ability to distinguish compounds within one taste modality. Here, we developed a behavioral paradigm in Drosophila melanogaster to evaluate directly the tastes that a fly distinguishes. These studies reveal that flies do not discriminate among different sugars, or among different bitter compounds, based on chemical identity. Instead, flies show a limited ability to distinguish compounds within a modality based on intensity or palatability. Taste associative learning, similar to olfactory learning, requires the mushroom bodies, suggesting fundamental similarities in brain mechanisms underlying behavioral plasticity. Overall, these studies provide insight into the discriminative capacity of the Drosophila gustatory system and the modulation of taste behavior.

  5. The Immune Phenotype of Three Drosophila Leukemia Models

    Directory of Open Access Journals (Sweden)

    Badrul Arefin

    2017-07-01

    Full Text Available Many leukemia patients suffer from dysregulation of their immune system, making them more susceptible to infections and leading to general weakening (cachexia. Both adaptive and innate immunity are affected. The fruit fly Drosophila melanogaster has an innate immune system, including cells of the myeloid lineage (hemocytes. To study Drosophila immunity and physiology during leukemia, we established three models by driving expression of a dominant-active version of the Ras oncogene (RasV12 alone or combined with knockdowns of tumor suppressors in Drosophila hemocytes. Our results show that phagocytosis, hemocyte migration to wound sites, wound sealing, and survival upon bacterial infection of leukemic lines are similar to wild type. We find that in all leukemic models the two major immune pathways (Toll and Imd are dysregulated. Toll–dependent signaling is activated to comparable extents as after wounding wild-type larvae, leading to a proinflammatory status. In contrast, Imd signaling is suppressed. Finally, we notice that adult tissue formation is blocked and degradation of cell masses during metamorphosis of leukemic lines, which is akin to the state of cancer-dependent cachexia. To further analyze the immune competence of leukemic lines, we used a natural infection model that involves insect-pathogenic nematodes. We identified two leukemic lines that were sensitive to nematode infections. Further characterization demonstrates that despite the absence of behavioral abnormalities at the larval stage, leukemic larvae show reduced locomotion in the presence of nematodes. Taken together, this work establishes new Drosophila models to study the physiological, immunological, and behavioral consequences of various forms of leukemia.

  6. Studies on Drosophila radiosensitive strains

    International Nuclear Information System (INIS)

    Varentsova, E.P.; Zakharov, I.A.

    1976-01-01

    45 of radiosensitive strains of Drosophila melanogaster were isolated by Curly/Lobe technique after EMS treatment of Livadia population males. The lethality of non-Curly late larvae after gamma-irradiation (4000r) characterized radiosensitivity strains. Most of them exhibited higher frequency of the spontaneous dominant lethals (up to 69%). The males of 6 strains were semi-sterile. 5 of these strains exhibited higher frequency of X-chromosome non-disjunction

  7. In vitro mutagenesis of commercial fern, Asplenium nidus from spores

    International Nuclear Information System (INIS)

    Norazlina Noordin

    2004-01-01

    Asplenium is a largest, most diverse fern genera. One of the common species is Asplenium nidus, well known as Bird's-nest fern, a medium to large fern with erect, stout, unbranched rhizomes. In creating variability of ferns for the benefit of the ornamental plant industry, in vitro mutagenesis is used. In this study, spores of Asplenium nidus were collected from frond bearing mature sporangia. Spores were cultured in modified 1/2 MS basal medium supplemented with various combinations of 6-Benzylaminopurine (BAP) and Naphtalene Acetic Acid (NAA). Spore cultures were incubated in incubation room at 24 degree C with 16 hours photoperiod (3500 lux). It was found that, the most effective combinations were 1 mg/1 BAP + 0. 1 mg/1 NAA and 2mg/1 BAP + 0. 1 mg/1 NAA. Prothallus was formed after 10 days of cultures and gametophytes were formed 1 month later. These gametophytes were irradiated with Gamma ray at doses of 0, 20, 90, 120, 150 and 180 Gy. From the preliminary result obtained from this study, for generating variations and desired phenotypic expression for Asplenium nidus, recommended doses for in vitro mutagenesis using spores are between 90 Gy to 150 Gy. Gametophytes were subcultured at monthly interval to ensure further development and propagation. Frequent monitoring for any changes in the morphology of the irradiated Asplenium nidus plants were carried out. (Author)

  8. Mechanisms of Base Substitution Mutagenesis in Cancer Genomes

    Directory of Open Access Journals (Sweden)

    Albino Bacolla

    2014-03-01

    Full Text Available Cancer genome sequence data provide an invaluable resource for inferring the key mechanisms by which mutations arise in cancer cells, favoring their survival, proliferation and invasiveness. Here we examine recent advances in understanding the molecular mechanisms responsible for the predominant type of genetic alteration found in cancer cells, somatic single base substitutions (SBSs. Cytosine methylation, demethylation and deamination, charge transfer reactions in DNA, DNA replication timing, chromatin status and altered DNA proofreading activities are all now known to contribute to the mechanisms leading to base substitution mutagenesis. We review current hypotheses as to the major processes that give rise to SBSs and evaluate their relative relevance in the light of knowledge acquired from cancer genome sequencing projects and the study of base modifications, DNA repair and lesion bypass. Although gene expression data on APOBEC3B enzymes provide support for a role in cancer mutagenesis through U:G mismatch intermediates, the enzyme preference for single-stranded DNA may limit its activity genome-wide. For SBSs at both CG:CG and YC:GR sites, we outline evidence for a prominent role of damage by charge transfer reactions that follow interactions of the DNA with reactive oxygen species (ROS and other endogenous or exogenous electron-abstracting molecules.

  9. Mechanisms of base substitution mutagenesis in cancer genomes.

    Science.gov (United States)

    Bacolla, Albino; Cooper, David N; Vasquez, Karen M

    2014-03-05

    Cancer genome sequence data provide an invaluable resource for inferring the key mechanisms by which mutations arise in cancer cells, favoring their survival, proliferation and invasiveness. Here we examine recent advances in understanding the molecular mechanisms responsible for the predominant type of genetic alteration found in cancer cells, somatic single base substitutions (SBSs). Cytosine methylation, demethylation and deamination, charge transfer reactions in DNA, DNA replication timing, chromatin status and altered DNA proofreading activities are all now known to contribute to the mechanisms leading to base substitution mutagenesis. We review current hypotheses as to the major processes that give rise to SBSs and evaluate their relative relevance in the light of knowledge acquired from cancer genome sequencing projects and the study of base modifications, DNA repair and lesion bypass. Although gene expression data on APOBEC3B enzymes provide support for a role in cancer mutagenesis through U:G mismatch intermediates, the enzyme preference for single-stranded DNA may limit its activity genome-wide. For SBSs at both CG:CG and YC:GR sites, we outline evidence for a prominent role of damage by charge transfer reactions that follow interactions of the DNA with reactive oxygen species (ROS) and other endogenous or exogenous electron-abstracting molecules.

  10. Crowding depression of UV-mutagenesis in E. coli

    International Nuclear Information System (INIS)

    Bockrath, R.; Harper, D.; Kristoff, S.; Stanford Univ., CA

    1980-01-01

    Strains of E. coli Br were exposed to UV radiation and assayed for reversion mutation, using a standard selection medium. If more irradiated bacteria were assayed per petri dish, a proportional increase in the number of indicated reversion mutants was oud only up to a limiting plating density. Beyond a density of about 10 8 viable bacteria per petri dish, the number of indicated revertants per viable bacteriy assayed (the mutation frequency) decreased as the plating density was increased. The crowding depression of mutagenesis was more severe for de novo and converted suppressor mutations, the mutation frequency being reduced 100-fold at a plating density of about 6 x 10 9 viable bacteria per plate. The effect on backmutation was 10 times less. Crowding depression of mutagenesis occured in excision-proficient and -deficient strains, with identical effects in the 2 strains on de novo and converted suppressor mutation, but different effects on backmutations. There were no accompanying effects on viability. Irreversible loss of potential mutants during crowded growth was indicated in wash-off experiments. The kinetics suggested a half-life of approximately 1 h. Kinetics for accumulation by the bacteria of the limiting metabolite (tyrosine) on the assay plate indicated a short period of time for protein synthesis, but direct examination of the proteins synthesized during early growth on a crowded plate demonstrated successful induction of recA protein. (orig.)

  11. Tradescantia bioassays as monitoring systems for environmental mutagenesis: a review

    International Nuclear Information System (INIS)

    Rodrigues, G.S.; Ma, T.H.; Pimentel, D.; Weinstein, L.H.

    1997-01-01

    Since the early studies on the genetic effects of chemical and physical agents, species and clones of Tradescantia have been used as experimental subjects, by virtue of a series of favorable genetic characteristics. Bearing just six pairs (2n = 12) of large, easily observable chromosomes, cells from almost every part of the plant, from the root tips to the developing pollen tube, yield excellent material for cytogenetic studies. As a consequence of the intensive use of Tradescantia in genetic studies, a series of genetic characteristics have been found that offer opportunities for the detection of agents affecting the stability of the genome. At least five such characteristics have been selected as endpoints for the establishment of assays to evaluate mutagenesis. Three of these, root-tip mitosis, pollen-tube, and microspore mitosis are essentially chromosome aberration assays, wherein one observes and evaluates the visible damage in the chromosomes. A fourth, the stamen-hair mutation assay (Trad-SHM), is a point mutation mitotic assay based on the expression of a recessive gene for flower color in heterozygous plants. The fifth assay is a cytogenetic test based on the formation of micronuclei (Trad-MCN) that result from chromosome breakage in the meiotic pollen mother cells. This article examines the characteristics and fundamentals of the Trad-MCN and the Trad-SHM assays and reviews the results obtained to date with these systems in the assessment of environmental mutagenesis. (author)

  12. Breeding of New Strains of Mushroom by Basidiospore Chemical Mutagenesis

    Science.gov (United States)

    Lee, Jia; Kang, Hyeon-Woo; Kim, Sang-Woo; Lee, Chang-Yun

    2011-01-01

    Chemical mutagenesis of basidiospores of Hypsizygus marmoreus generated new mushroom strains. The basidospores were treated with methanesulfonate methylester, an alkylating agent, to yield 400 mutant monokaryotic mycelia. Twenty fast-growing mycelia were selected and mated each other by hyphal fusion. Fifty out of the 190 matings were successful (mating rate of 26.3%), judged by the formation of clamp connections. The mutant dikaryons were cultivated to investigate their morphological and cultivation characteristics. Mutant strains No. 3 and No. 5 showed 10% and 6% increase in fruiting body production, respectively. Eight mutant strains showed delayed and reduced primordia formation, resulting in the reduced production yield with prolonged cultivation period. The number of the fruiting bodies of mutant No. 31, which displayed reduced primordial formation, was only 15, compared to the parental number of 65. Another interesting phenotype was a fruiting body with a flattened stipe and pileus. Dikaryons generated by mating with the mutant spore No. 14 produced flat fruiting bodies. Further molecular biological studies will provide details of the mechanism. This work shows that the chemical mutagenesis approach is highly utilizable in the development of mushroom strains as well as in the generation of resources for molecular genetic studies. PMID:22783115

  13. Tissue culture and mutagenesis of rain lily (zephyranthes)

    International Nuclear Information System (INIS)

    Mohd Nazir Basiran; Zaiton Ahmad; Shakinah Salleh; Shuhaimi Shamsudin; Aiza Shaliha Jamaludin

    2004-01-01

    There are three varieties of Zephyranthes used widely in landscaping due to their robust growth and attractive flowers in pink, yellow and white. Both in vivo and in vitro mutagenesis are an effective approach to increase the flower colour variations of Zephyranthes. In vitro propagation for the three varieties was attempted by using the induction medium developed by Sachar and Kapoor in 1959. The medium contains I ma of each indole 3-acetic acid (IAA), indole 3-butyric acid (IBA) and kinetin. Following surface sterilization of bulb scales, 17.8%, 10.5% and 10.7% of pink, white and yellow varieties respectively, were able to form small bulblets on the induction media. Further development of these bulblets into plantlets was also achieved on the same medium. Work is now being carried out to improve the efficiency of bulblet regeneration. Mutagenesis of Zephyranthes was initiated from bulbs of the pink varieties to develop new varieties with attractive combinations of flower colour and forms, shelf life and growth habits. These bulbs were irradiated using a gamma cell with a 60 Co source. Three variants with different flower colour and morphology have been achieved so far and are now being propagated in the nursery. (Author)

  14. Drosophila: Retrotransposons Making up Telomeres.

    Science.gov (United States)

    Casacuberta, Elena

    2017-07-19

    Drosophila and extant species are the best-studied telomerase exception. In this organism, telomere elongation is coupled with targeted retrotransposition of Healing Transposon (HeT-A) and Telomere Associated Retrotransposon (TART) with sporadic additions of Telomere Associated and HeT-A Related (TAHRE), all three specialized non-Long Terminal Repeat (non-LTR) retrotransposons. These three very special retroelements transpose in head to tail arrays, always in the same orientation at the end of the chromosomes but never in interior locations. Apparently, retrotransposon and telomerase telomeres might seem very different, but a detailed view of their mechanisms reveals similarities explaining how the loss of telomerase in a Drosophila ancestor could successfully have been replaced by the telomere retrotransposons. In this review, we will discover that although HeT-A, TART, and TAHRE are still the only examples to date where their targeted transposition is perfectly tamed into the telomere biology of Drosophila, there are other examples of retrotransposons that manage to successfully integrate inside and at the end of telomeres. Because the aim of this special issue is viral integration at telomeres, understanding the base of the telomerase exceptions will help to obtain clues on similar strategies that mobile elements and viruses could have acquired in order to ensure their survival in the host genome.

  15. Insulin receptor in Drosophila melanogaster

    International Nuclear Information System (INIS)

    Petruzzelli, L.; Herrera, R.; Rosen, O.

    1986-01-01

    A specific, high affinity insulin receptor is present in both adult Drosophila and in Drosophila embryos. Wheat germ lectin-enriched extracts of detergent-solubilized membranes from embryos and adults bind insulin with a K/sub d/ of 15 nM. Binding is specific for insulin; micromolar concentrations of proinsulin, IGFI, and IGFII are required to displace bound 125 I-insulin. Insulin-dependent protein tyrosine kinase activity appears during embryogenesis. It is evident between 6 and 12 hours of development, peaks between 12 and 18 hours and falls in the adult. During 0-6 hours of embryogenesis, and in the adult, a specific protein band (Mr = 135,000) is crosslinked to 125 I-insulin. During 6-12 and 12-18 hours of embryogenesis stages in which insulin-dependent protein tyrosine kinase is high, an additional band (Mr = 100,000) becomes crosslinked to 125 I-insulin. Isolation and DNA sequence analysis of genomic clones encoding the Drosophila insulin receptor will be presented as will the characterization of insulin receptor mRNA's during development

  16. 'Peer pressure' in larval Drosophila?

    Science.gov (United States)

    Niewalda, Thomas; Jeske, Ines; Michels, Birgit; Gerber, Bertram

    2014-06-06

    Understanding social behaviour requires a study case that is simple enough to be tractable, yet complex enough to remain interesting. Do larval Drosophila meet these requirements? In a broad sense, this question can refer to effects of the mere presence of other larvae on the behaviour of a target individual. Here we focused in a more strict sense on 'peer pressure', that is on the question of whether the behaviour of a target individual larva is affected by what a surrounding group of larvae is doing. We found that innate olfactory preference of a target individual was neither affected (i) by the level of innate olfactory preference in the surrounding group nor (ii) by the expression of learned olfactory preference in the group. Likewise, learned olfactory preference of a target individual was neither affected (iii) by the level of innate olfactory preference of the surrounding group nor (iv) by the learned olfactory preference the group was expressing. We conclude that larval Drosophila thus do not take note of specifically what surrounding larvae are doing. This implies that in a strict sense, and to the extent tested, there is no social interaction between larvae. These results validate widely used en mass approaches to the behaviour of larval Drosophila. © 2014. Published by The Company of Biologists Ltd.

  17. Quantification of Drosophila Grooming Behavior.

    Science.gov (United States)

    Barradale, Francesca; Sinha, Kairav; Lebestky, Tim

    2017-07-19

    Drosophila grooming behavior is a complex multi-step locomotor program that requires coordinated movement of both forelegs and hindlegs. Here we present a grooming assay protocol and novel chamber design that is cost-efficient and scalable for either small or large-scale studies of Drosophila grooming. Flies are dusted all over their body with Brilliant Yellow dye and given time to remove the dye from their bodies within the chamber. Flies are then deposited in a set volume of ethanol to solubilize the dye. The relative spectral absorbance of dye-ethanol samples for groomed versus ungroomed animals are measured and recorded. The protocol yields quantitative data of dye accumulation for individual flies, which can be easily averaged and compared across samples. This allows experimental designs to easily evaluate grooming ability for mutant animal studies or circuit manipulations. This efficient procedure is both versatile and scalable. We show work-flow of the protocol and comparative data between WT animals and mutant animals for the Drosophila type I Dopamine Receptor (DopR).

  18. Radioresistance and radiosensitivity in Drosophila melanogaster

    International Nuclear Information System (INIS)

    Reguly, M.L.

    1983-01-01

    Studying the mechanisms controlling radioresistant in Drosophila the sensibility of four strains of Drosophila melanogaster to sex-linked recessive lethal mutations induced by 5kR Cobalt-60 gamma radiation and 0,006 M EMS or 0,25% of caffeine was determined. (M.A.C.) [pt

  19. Size control in development: lessons from Drosophila

    Indian Academy of Sciences (India)

    which mediates dosage compensation in Drosophila; Mol. Cell 4 117–122. Kelley R L, Meller V H, Gordadze P R, Roman G, Davis R L and Kuroda M I 1999 Epigenetic spreading of the Drosophila dosage compensation complex from rox RNA genes into flanking chromatin; Cell 98. 513–522. Lucchesi J C 1998 Dosage ...

  20. The impact of green tea polyphenols on development and reproduction in Drosophila melanogaster.

    Science.gov (United States)

    Lopez, Terry E; Pham, Hoang M; Barbour, Julia; Tran, Phillip; Van Nguyen, Benjamin; Hogan, Sean P; Homo, Richelle L; Coskun, Volkan; Schriner, Samuel E; Jafari, Mahtab

    2016-01-01

    Although, green tea has numerous health benefits, adverse effects with excessive consumption have been reported. Using Drosophila melanogaster , a decrease in male fertility with green tea was evidenced. Here, the extent of green tea toxicity on development and reproduction was investigated. Drosophila melanogaster embryos and larvae were exposed to various doses of green tea polyphenols (GTP). Larvae exposed to 10 mg/mL GTP were slower to develop, emerged smaller, and exhibited a dramatic decline in the number of emerged offspring. GTP protected flies against desiccation but sensitized them to starvation and heat stress. Female offspring exhibited a decline in reproductive output and decreased survival while males were unaffected. GTP had a negative impact on reproductive organs in both males and females (e.g., atrophic testes in males, absence of mature eggs in females). Collectively, the data show that high doses of GTP adversely affect development and reproduction of Drosophila melanogaster .

  1. A novel mode of induction of the humoral innate immune response in Drosophila larvae

    Directory of Open Access Journals (Sweden)

    Hiroyuki Kenmoku

    2017-03-01

    Full Text Available Drosophila adults have been utilized as a genetically tractable model organism to decipher the molecular mechanisms of humoral innate immune responses. In an effort to promote the utility of Drosophila larvae as an additional model system, in this study, we describe a novel aspect of an induction mechanism for innate immunity in these larvae. By using a fine tungsten needle created for manipulating semi-conductor devices, larvae were subjected to septic injury. However, although Toll pathway mutants were susceptible to infection with Gram-positive bacteria as had been shown for Drosophila adults, microbe clearance was not affected in the mutants. In addition, Drosophila larvae were found to be sensitive to mechanical stimuli with respect to the activation of a sterile humoral response. In particular, pinching with forceps to a degree that might cause minor damage to larval tissues could induce the expression of the antifungal peptide gene Drosomycin; notably, this induction was partially independent of the Toll and immune deficiency pathways. We therefore propose that Drosophila larvae might serve as a useful model to analyze the infectious and non-infectious inflammation that underlies various inflammatory diseases such as ischemia, atherosclerosis and cancer.

  2. Genetic toxicity in surface water from Guaiba Hydrographic Region under the influence of industrial, urban and agricultural sewage in the Drosophila Wing-Spot Test

    International Nuclear Information System (INIS)

    Souza do Amaral, Viviane; Sinigaglia, Marialva; Reguly, Maria Luiza; Rodrigues de Andrade, Heloisa Helena

    2006-01-01

    Mutagenic and recombinagenic activity of surface waters in the Guaiba Hydrographic Region (RS, Brazil) was investigated using the SMART in Drosophila melanogaster. Two positive results in Cai River (September 2000 and August 2001) and in Taquari River (August 2001 and February 2002) - linked to direct recombinagenic toxicants were observed. In Jacui samples, an indirect mutagenic and recombinagenic action was detected in a September 2000 collection and a direct recombinational activity was observed in February 2002. Also in February 2002 - samples from Diluvio Brook and Guaiba Lake (GPC) were able to induce wing spots by mitotic recombinagenesis. The former sampling site showed toxicants to have a direct action, and the latter an increment in mitotic recombination that depended on metabolic action. The SMART wing test shows that all positive responses were mainly related to homologous mitotic recombination. - Drosophila Wing-Spot Test can be used for detection of environmental mutagenesis

  3. The use of centrifugation to study early Drosophila embryogenesis

    Science.gov (United States)

    Abbott, M. K.; Spooner, B. S. (Principal Investigator)

    1993-01-01

    By the end of 10th nuclear cycle, the somatic nuclei of the Drosophila embryo have migrated to the periphery of the egg. Centrifugation of embryos did not result in the displacement of these nuclei, since cytoskeletal elements anchor them to the cortex. But, mild centrifugal forces displace the centrally located, nascent yolk nuclei. If this increased sensitivity to hypergravity occurs before the beginning of nuclear differentiation during cycle 8, when the nascent yolk and somatic nuclei physically separate, then it would mark the earliest functional difference between these two lineages.

  4. Protocols to Study Growth and Metabolism in Drosophila.

    Science.gov (United States)

    Strassburger, Katrin; Teleman, Aurelio A

    2016-01-01

    Signaling pathways such as the insulin/insulin-like growth factor pathway concurrently regulate organismal growth and metabolism. Drosophila has become a popular model system for studying both organismal growth and metabolic regulation. Care must be taken, however, when assessing such phenotypes because they are quantitative in nature, and influenced by environment. This chapter first describes how to control animal age and nutrient availability, since growth and metabolism are sensitive to these parameters. It then provides protocols for measuring tissue growth, cell size, and metabolic parameters such as stored lipids and glycogen, and circulating sugars.

  5. Improving isopropanol tolerance and production of Clostridium beijerinckii DSM 6423 by random mutagenesis and genome shuffling

    NARCIS (Netherlands)

    Máté De Gérando, H.; Fayolle-Guichard, F.; Rudant, L.; Millah, S.K.; Monot, F.; Ferreira, Nicolas Lopes; López-Contreras, A.M.

    2016-01-01

    Random mutagenesis and genome shuffling was applied to improve solvent tolerance and isopropanol/butanol/ethanol (IBE) production in the strictly anaerobic bacteria Clostridium beijerinckii DSM 6423. Following chemical mutagenesis with N-methyl-N-nitro-N-nitrosoguanidine (NTG), screening of

  6. Construction of a high-efficiency multi-site-directed mutagenesis ...

    African Journals Online (AJOL)

    Although site-directed mutagenesis has been used in many fields, it still has low rate of success and high cost because of low-yield target products. A modified method for multi-site-directed mutagenesis was developed with shifted primer design and cold-start polymerase chain reaction (PCR). The developed method was ...

  7. Non-targeted mutagenesis of unirradiated lambda phage in Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Wood, R.D.; Hutchinson, F. (Yale Univ., New Haven, CT (USA). Dept. of Molecular Biophysics and Biochemistry)

    1984-03-05

    Non-targeted mutagenesis of lambda phage by ultraviolet light is the increase over background mutagenesis when non-irradiated phage are grown in irradiated Escherichia coli host cells. Such mutagenesis is caused by different processes from targeted mutagenesis, in which mutations in irradiated phage are correlated with photoproducts in the phage DNA. Non-irradiated phage grown in heavily irradiated uvr/sup +/ host cells showed non-targeted mutations, which were 3/4 frameshifts, whereas targeted mutations were 2/3 transitions. For non-targeted mutagenesis in heavily irradiated host cells, there were one or two mutant phage per mutant burst. From the results of a series of experiments with various mutant host cells, a major pathway of non-targeted mutagenesis by ultraviolet light was proposed which acts in addition to ''SOS induction''. This pathway involves binding of the enzyme DNA polymerase I to damaged genomic DNA, and low polymerase activity leads to frameshift mutations during semiconservative DNA replication. The data suggest that this process will play a much smaller role in ultraviolet mutagenesis of the bacterial genome than it does in the mutagenesis of lambda phage.

  8. Chemical mutagens, transposons, and transgenes to interrogate gene function in Drosophila melanogaster.

    Science.gov (United States)

    Venken, Koen J T; Bellen, Hugo J

    2014-06-15

    The study of genetics, genes, and chromosomal inheritance was initiated by Thomas Morgan in 1910, when the first visible mutations were identified in fruit flies. The field expanded upon the work initiated by Herman Muller in 1926 when he used X-rays to develop the first balancer chromosomes. Today, balancers are still invaluable to maintain mutations and transgenes but the arsenal of tools has expanded vastly and numerous new methods have been developed, many relying on the availability of the genome sequence and transposable elements. Forward genetic screens based on chemical mutagenesis or transposable elements have resulted in the unbiased identification of many novel players involved in processes probed by specific phenotypic assays. Reverse genetic approaches have relied on the availability of a carefully selected set of transposon insertions spread throughout the genome to allow the manipulation of the region in the vicinity of each insertion. Lastly, the ability to transform Drosophila with single copy transgenes using transposons or site-specific integration using the ΦC31 integrase has allowed numerous manipulations, including the ability to create and integrate genomic rescue constructs, generate duplications, RNAi knock-out technology, binary expression systems like the GAL4/UAS system as well as other methods. Here, we will discuss the most useful methodologies to interrogate the fruit fly genome in vivo focusing on chemical mutagenesis, transposons and transgenes. Genome engineering approaches based on nucleases and RNAi technology are discussed in following chapters. Copyright © 2014 Elsevier Inc. All rights reserved.

  9. Quantitative mutagenesis by chemicals and by radiations: prerequisites for the establishment of rad-equivalences

    International Nuclear Information System (INIS)

    Latarjet, R.

    1977-01-01

    The lesions produced in the genetic material by chemical mutagens, on the one hand, and radiations, on the other, are very similar. In both cases, they are either lesions in DNA or changes in the bonds between this DNA and the proteins which surround it. The lesions are sufficiently similar to elicit, in both cases, the activity of the same repair systems. The similarity between chemical and radiation induced mutagenesis can be demonstrated by checking that a strain which is hyper-sensitive to radiation because it lacks some repair system, is also hyper-sensitive to most chemical mutagens. These similarities between the lesions suggest that one can establish an equivalence between the 'dose' of a chemical and a dose of radiation, on the basis of the effects produced on some biological systems of reference. Once such equivalence has been established, one could extrapolate the rules of radiation protection to protection against that chemical. Is this principle applicable, and under which conditions. What prerequisites must be fulfilled. The goal of this paper is to answer these questions

  10. Amino acid substitutions of Na,K-ATPase conferring decreased sensitivity to cardenolides in insects compared to mammals.

    Science.gov (United States)

    Dalla, Safaa; Swarts, Herman G P; Koenderink, Jan B; Dobler, Susanne

    2013-12-01

    Mutagenesis analyses and a recent crystal structure of the mammalian Na,K-ATPase have identified amino acids which are responsible for high affinity binding of cardenolides (such as ouabain) which at higher doses block the enzyme in the phosphorylated state. Genetic analysis of the Na,K-ATPase of insects adapted to cardenolides in their food plants revealed that some species possess substitutions which confer strongly increased resistance to ouabain in the mammalian enzyme such as the substitution T797A or combined substitutions at positions 111 and 122. To test for the effect of these mutations against the background of insect Na,K-ATPase, we here expressed the ouabain sensitive Na,K-ATPase α-subunit of Drosophila melanogaster together with the β-subunit Nrv3 in baculovirus-infected Sf9 cells and introduced the substitutions N122H, T797A, Q111T-N122H, Q111V-N122H, all of which have been observed in cardenolide-adapted insects. While all constructs showed similar expression levels, ouabain affinity of mutated Na,K-ATPases was reduced compared to the wild-type fly enzyme. Ouabain sensitivity of the ATPase activity in inhibition assays was significantly decreased by all mutations, yet whereas the IC₅₀ for the single mutations of N122H (61.0 μM) or T797A (63.3 μM) was increased roughly 250-fold relative to the wild-type (0.24 μM), the double mutations of Q111V-N122H (IC₅₀ 550 μM) and Q111T-N122H (IC₅₀ 583 μM) proved to be still more effective yielding a 2.250-fold increased resistance to ouabain. The double mutations identified in cardenolide-adapted insects are more effective in reducing ouabain sensitivity of the enzyme than those found naturally in the rat Na,K-ATPase (Q111R-N122D) or in mutagenesis screens of the mammalian enzyme. Obviously, the intense selection pressure on cardenolide exposed insects has resulted in very efficient substitutions that decrease cardenolide sensitivity extremely. Copyright © 2013 Elsevier Ltd. All rights reserved.

  11. Creating Sunflower Mutant Lines (Helianthus Annuus L.) Using Induced Mutagenesis

    International Nuclear Information System (INIS)

    Encheva, J.

    2009-01-01

    Immature sunflower zygotic embryos of sunflower fertility restorer line 374 R were treated with ultrasound and gamma radiation before plating embryos to culture medium. All plants were isolated and self-pollinated for several generations. New sunflower forms with inherited morphological and biochemical changes were obtained. The genetic changes occurring during the mutation procedure included fourteen morphological and biochemical characters. In comparison to the check line 374 R, decreasing of the mean value of the indexes was registered for 33 % of the total number of characters and vise verse, significant increasing was observed for 60 %. Mutation for resistance to the local population of Orobanche cumana race A-E was obtained from the susceptible Bulgarian control line 374 R. Two investigated mutant lines possessed 100 % resistance to Orobanche and stable inheritance in the next generations. Our results showed that induced mutagenesis in sunflower can be successfully used to develop new lines useful for heterosis breeding

  12. Radiation induced DNA damage and repair in mutagenesis

    International Nuclear Information System (INIS)

    Strniste, G.F.; Chen, D.J.; Okinaka, R.T.

    1987-01-01

    The central theme in cellular radiobiological research has been the mechanisms of radiation action and the physiological response of cells to this action. Considerable effort has been directed toward the characterization of radiation-induced DNA damage and the correlation of this damage to cellular genetic change that is expressed as mutation or initiating events leading to cellular transformation and ultimately carcinogenesis. In addition, there has been a significant advancement in their understanding of the role of DNA repair in the process of mutation leading to genetic change in cells. There is extensive literature concerning studies that address radiation action in both procaryotic and eucaryotic systems. This brief report will make no attempt to summarize this voluminous data but will focus on recent results from their laboratory of experiments in which they have examined, at both the cellular and molecular levels, the process of ionizing radiation-induced mutagenesis in cultured human cells

  13. Scientific projection paper for mutagenesis, transformation and cell killing

    International Nuclear Information System (INIS)

    Todd, P.

    1980-01-01

    Our knowledge about mutagenesis, transformation, and cell killing by ionizing radiation consists of large bodies of data, which are potentially useful in terms of application to human risk assessment and to the constructive use of radiation, as in cancer treatment. The three end-points discussed above are united by at least five significant concepts in radiation research strategy: (1) The inter-relationships among the important end-points, mutation, carcinogenesis, and cell killing. Research on one is meaningful only in the context of information about the other two. (2) The interaction of radiations with other agents in producing these end-points. (3) The mechanisms of action of other environmental mutagenic, carcinogenic, and cytotoxic agents. (4) The use of repair deficient human mutant cells. (5) The study of radiation damage mechanisms. There is no better way to extrapolate laboratory data to the clinical and public worlds than to understand the underlying biological mechanisms that produced the data

  14. Results and perspectives of mutagenesis applied to durum wheat

    International Nuclear Information System (INIS)

    Bagnara, D.

    1975-01-01

    A review is made of the main aspects and problems of mutagenesis applied to the breeding of durum wheat (Triticum turgidum ssp. durum). Features and type of action of the main physical and chemical mutagens are considered: a comparison is also made between the two classes of mutagens, on the basis of results so far achieved. Mentions is then made of methods of treatment; parts of plant which can be treated; growing of treated material in segregating generations: data to be successively recorded. Methods of estimating mutation frequency and the problem of arising chimerical tissues and its possible overcoming are also discussed. Examination is made of some special effects of mutagens, namely: induction of translocations; diploidization of polyploids; induction of haploids and aneuploids; genetic analysis of specific loci; induction of male sterility. Finally, results are reviewed concerning induction and utilization, either as varieties or in cross breeding programmes, of mutants for characters of agronomic interest. (Bagnara, D.)

  15. Cationic Peptides Facilitate Iron-induced Mutagenesis in Bacteria.

    Directory of Open Access Journals (Sweden)

    Alexandro Rodríguez-Rojas

    2015-10-01

    Full Text Available Pseudomonas aeruginosa is the causative agent of chronic respiratory infections and is an important pathogen of cystic fibrosis patients. Adaptive mutations play an essential role for antimicrobial resistance and persistence. The factors that contribute to bacterial mutagenesis in this environment are not clear. Recently it has been proposed that cationic antimicrobial peptides such as LL-37 could act as mutagens in P. aeruginosa. Here we provide experimental evidence that mutagenesis is the product of a joint action of LL-37 and free iron. By estimating mutation rate, mutant frequencies and assessing mutational spectra in P. aeruginosa treated either with LL-37, iron or a combination of both we demonstrate that mutation rate and mutant frequency were increased only when free iron and LL-37 were present simultaneously. Colistin had the same effect. The addition of an iron chelator completely abolished this mutagenic effect, suggesting that LL-37 enables iron to enter the cells resulting in DNA damage by Fenton reactions. This was also supported by the observation that the mutational spectrum of the bacteria under LL-37-iron regime showed one of the characteristic Fenton reaction fingerprints: C to T transitions. Free iron concentration in nature and within hosts is kept at a very low level, but the situation in infected lungs of cystic fibrosis patients is different. Intermittent bleeding and damage to the epithelial cells in lungs may contribute to the release of free iron that in turn leads to generation of reactive oxygen species and deterioration of the respiratory tract, making it more susceptible to the infection.

  16. Cryptochrome mediates light-dependent magnetosensitivity of Drosophila's circadian clock.

    Directory of Open Access Journals (Sweden)

    Taishi Yoshii

    2009-04-01

    Full Text Available Since 1960, magnetic fields have been discussed as Zeitgebers for circadian clocks, but the mechanism by which clocks perceive and process magnetic information has remained unknown. Recently, the radical-pair model involving light-activated photoreceptors as magnetic field sensors has gained considerable support, and the blue-light photoreceptor cryptochrome (CRY has been proposed as a suitable molecule to mediate such magnetosensitivity. Since CRY is expressed in the circadian clock neurons and acts as a critical photoreceptor of Drosophila's clock, we aimed to test the role of CRY in magnetosensitivity of the circadian clock. In response to light, CRY causes slowing of the clock, ultimately leading to arrhythmic behavior. We expected that in the presence of applied magnetic fields, the impact of CRY on clock rhythmicity should be altered. Furthermore, according to the radical-pair hypothesis this response should be dependent on wavelength and on the field strength applied. We tested the effect of applied static magnetic fields on the circadian clock and found that flies exposed to these fields indeed showed enhanced slowing of clock rhythms. This effect was maximal at 300 muT, and reduced at both higher and lower field strengths. Clock response to magnetic fields was present in blue light, but absent under red-light illumination, which does not activate CRY. Furthermore, cry(b and cry(OUT mutants did not show any response, and flies overexpressing CRY in the clock neurons exhibited an enhanced response to the field. We conclude that Drosophila's circadian clock is sensitive to magnetic fields and that this sensitivity depends on light activation of CRY and on the applied field strength, consistent with the radical pair mechanism. CRY is widespread throughout biological systems and has been suggested as receptor for magnetic compass orientation in migratory birds. The present data establish the circadian clock of Drosophila as a model system

  17. Adaptive genic evolution in the Drosophila genomes

    DEFF Research Database (Denmark)

    Shapiro, Joshua A; Huang, Wei; Zhang, Chenhui

    2007-01-01

    and stable population. In this study, we sequenced 419 genes from 24 lines of Drosophila melanogaster and its close relatives. Together with data from Drosophila simulans, these data reveal the following. (i) Approximately 10% of the loci in regions of normal recombination are much less polymorphic at silent...... sites than expected, hinting at the action of selective sweeps. (ii) The level of polymorphism is negatively correlated with the rate of nonsynonymous divergence across loci. Thus, even under strict neutrality, the ratio of amino acid to silent nucleotide changes (A:S) between Drosophila species...

  18. Detection of cell death in Drosophila.

    Science.gov (United States)

    McCall, Kimberly; Peterson, Jeanne S; Pritchett, Tracy L

    2009-01-01

    Drosophila is a powerful model system for the identification of cell death genes and understanding the role of cell death in development. In this chapter, we describe three methods typically used for the detection of cell death in Drosophila. The TUNEL and acridine orange methods are used to detect dead or dying cells in a variety of tissues. We focus on methods for the embryo and the ovary, but these techniques can be used on other tissues as well. The third method is the detection of genetic interactions by expressing cell death genes in the Drosophila eye.

  19. Genetic and Environmental Control of Neurodevelopmental Robustness in Drosophila.

    Directory of Open Access Journals (Sweden)

    David J Mellert

    Full Text Available Interindividual differences in neuronal wiring may contribute to behavioral individuality and affect susceptibility to neurological disorders. To investigate the causes and potential consequences of wiring variation in Drosophila melanogaster, we focused on a hemilineage of ventral nerve cord interneurons that exhibits morphological variability. We find that late-born subclasses of the 12A hemilineage are highly sensitive to genetic and environmental variation. Neurons in the second thoracic segment are particularly variable with regard to two developmental decisions, whereas its segmental homologs are more robust. This variability "hotspot" depends on Ultrabithorax expression in the 12A neurons, indicating variability is cell-intrinsic and under genetic control. 12A development is more variable and sensitive to temperature in long-established laboratory strains than in strains recently derived from the wild. Strains with a high frequency of one of the 12A variants also showed a high frequency of animals with delayed spontaneous flight initiation, whereas other wing-related behaviors did not show such a correlation and were thus not overtly affected by 12A variation. These results show that neurodevelopmental robustness is variable and under genetic control in Drosophila and suggest that the fly may serve as a model for identifying conserved gene pathways that stabilize wiring in stressful developmental environments. Moreover, some neuronal lineages are variation hotspots and thus may be more amenable to evolutionary change.

  20. Carbon nanopipette electrodes for dopamine detection in Drosophila.

    Science.gov (United States)

    Rees, Hillary R; Anderson, Sean E; Privman, Eve; Bau, Haim H; Venton, B Jill

    2015-04-07

    Small, robust, sensitive electrodes are desired for in vivo neurotransmitter measurements. Carbon nanopipettes have been previously manufactured and used for single-cell drug delivery and electrophysiological measurements. Here, a modified fabrication procedure was developed to produce batches of solid carbon nanopipette electrodes (CNPEs) with ∼250 nm diameter tips, and controllable lengths of exposed carbon, ranging from 5 to 175 μm. The electrochemical properties of CNPEs were characterized with fast-scan cyclic voltammetry (FSCV) for the first time. CNPEs were used to detect the electroactive neurotransmitters dopamine, serotonin, and octopamine. CNPEs were significantly more sensitive for serotonin detection than traditional carbon-fiber microelectrodes (CFMEs). Similar to CFMEs, CNPEs have a linear response for dopamine concentrations ranging from 0.1 to 10 μM and a limit of detection of 25 ± 5 nM. Recordings with CNPEs were stable for over 3 h when the applied triangle waveform was scanned between -0.4 and +1.3 V vs Ag/AgCl/Cl(-) at 400 V/s. CNPEs were used to detect endogenous dopamine release in Drosophila larvae using optogenetics, which verified the utility of CNPEs for in vivo neuroscience studies. CNPEs are advantageous because they are 1 order of magnitude smaller in diameter than typical CFMEs and have a sharp, tunable geometry that facilitates penetration and implantation for localized measurements in distinct regions of small organisms, such as the Drosophila brain.

  1. Differentiation of Drosophila glial cells.

    Science.gov (United States)

    Sasse, Sofia; Neuert, Helen; Klämbt, Christian

    2015-01-01

    Glial cells are important constituents of the nervous system and a hallmark of these cells are their pronounced migratory abilities. In Drosophila, glial lineages have been well described and some of the molecular mechanisms necessary to guide migrating glial cells to their final target sites have been identified. With the onset of migration, glial cells are already specified into one of five main glial cell types. The perineurial and subperineurial glial cells are eventually located at the outer surface of the Drosophila nervous system and constitute the blood-brain barrier. The cortex glial cells ensheath all neuroblasts and their progeny and reside within the central nervous system. Astrocyte-like cells invade the neuropil to control synaptic function and ensheathing glial cells encase the entire neuropil. Within the peripheral nervous system, wrapping glial cells ensheath individual axons or axon fascicles. Here, we summarize the current knowledge on how differentiation of glial cells into the specific subtypes is orchestrated. Furthermore, we discuss sequencing data that will facilitate further analyses of glial differentiation in the fly nervous system. © 2015 Wiley Periodicals, Inc.

  2. Role of the RecF gene product in UV mutagenesis of lambda phage

    International Nuclear Information System (INIS)

    Wood, R.D.; Stein, J.

    1986-01-01

    E. coli recF mutants have a greatly reduced capacity for Weigle mutagenesis of ultraviolet light-irradiated lambda phage. A recF 332::Tn3 mutation was introduced into an E. coli recA441 lex A51 strain which constitutively expresses SOS functions. Weigle mutagenesis of phage lambda could occur in the resulting strain in the absence of host cell irradiation, and was increased when the recA441 (tif) allele was activated of recF strains to support Weigle mutagenesis can therefore be ascribed to a defect in expression of SOS functions after irradiation. (orig.)

  3. ADA1 and NET1 genes of yeast mediate both chromosome maintenance and mitochondrial rho- mutagenesis

    International Nuclear Information System (INIS)

    Koltovaya, N.A.; Gerasimova, A.S.; Chekhuta, I.A.; Devin, A.B.

    2002-01-01

    An increase in the mitochondrial (mt) rho - mutagenesis is a well-known response of yeast cells to mutations in the numerous nuclear genes as well as to various kinds of stress. Notwithstanding the extensive studies during several decades the biological significance of this response is not yet fully understood. The genetic approach to solution of this subject includes the study of genes that are required for the high incidence of spontaneous rho - mutants. Previously we found that mutations in certain nuclear genes including CDC28, the central cell-cycle regulation gene, may decrease the spontaneous rho - mutability and simultaneously affect maintenance of the yeast chromosomes and plasmids. The present work provides data on identification of two more genes, resembling CDC28 in this respect. These genes NET1 and ADA1 mediate important regulatory protein-protein interactions in the yeast cell. The effects of net1 and ada1 mutations on the maintenance of yeast mt genome, chromosomes and plasmids as well on cell sensitivity to ionizing radiation are also described. (author)

  4. Functional Analysis of Drosophila NF1

    National Research Council Canada - National Science Library

    Bernards, Andre

    2005-01-01

    ...) for Ras, yet homozygous loss of a highly conserved Drosophila NF1 ortholog results in several phenotypes that are insensitive to manipulating Ras signal transduction, but rescued by increasing...

  5. Drosophila melanogaster gene expression changes after spaceflight.

    Data.gov (United States)

    National Aeronautics and Space Administration — Gene expression levels were determined in 3rd instar and adult Drosophila melanogaster reared during spaceflight to elucidate the genetic and molecular mechanisms...

  6. Modeling tumor invasion and metastasis in Drosophila

    Directory of Open Access Journals (Sweden)

    Wayne O. Miles

    2011-11-01

    Full Text Available Conservation of major signaling pathways between humans and flies has made Drosophila a useful model organism for cancer research. Our understanding of the mechanisms regulating cell growth, differentiation and development has been considerably advanced by studies in Drosophila. Several recent high profile studies have examined the processes constraining the metastatic growth of tumor cells in fruit fly models. Cell invasion can be studied in the context of an in vivo setting in flies, enabling the genetic requirements of the microenvironment of tumor cells undergoing metastasis to be analyzed. This Perspective discusses the strengths and limitations of Drosophila models of cancer invasion and the unique tools that have enabled these studies. It also highlights several recent reports that together make a strong case for Drosophila as a system with the potential for both testing novel concepts in tumor progression and cell invasion, and for uncovering players in metastasis.

  7. BM2(reinverted) of Drosophila melanogaster is

    Indian Academy of Sciences (India)

    -chromosome (Lucchesi et al. 2005). Dosage compensation and the phenomenon of. Keywords. dosage compensation; histone acetylation; chromatin remodelling; H4K16; MOF; Drosophila. Journal of Genetics, Vol. 87, No. 3, December 2008.

  8. The Drosophila bipectinata species complex: phylogenetic ...

    Indian Academy of Sciences (India)

    PARUL BANERJEE

    c Indian Academy of Sciences. RESEARCH ARTICLE. The Drosophila bipectinata species complex: phylogenetic relationship among different members based on chromosomal variations. PARUL BANERJEE and BASHISTH N. SINGH. ∗. Genetics Laboratory, Department of Zoology, Banaras Hindu University, Varanasi ...

  9. Ecdysteroid receptors in Drosophila melanogaster adult females

    Science.gov (United States)

    Ecdysteroid receptors were identified and partially characterized from total cell extracts of whole animals and dissected tissues from Drosophila melanogaster adult females. Binding studies indicated the presence of two ecdysteroid binding components having high affinity and specificity consistent w...

  10. On the Morphology of the Drosophila Heart

    Directory of Open Access Journals (Sweden)

    Barbara Rotstein

    2016-04-01

    Full Text Available The circulatory system of Drosophila melanogaster represents an easily amenable genetic model whose analysis at different levels, i.e., from single molecules up to functional anatomy, has provided new insights into general aspects of cardiogenesis, heart physiology and cardiac aging, to name a few examples. In recent years, the Drosophila heart has also attracted the attention of researchers in the field of biomedicine. This development is mainly due to the fact that several genes causing human heart disease are also present in Drosophila, where they play the same or similar roles in heart development, maintenance or physiology as their respective counterparts in humans. This review will attempt to briefly introduce the anatomy of the Drosophila circulatory system and then focus on the different cell types and non-cellular tissue that constitute the heart.

  11. Spontaneous inflammatory pain model from a mouse line with N-ethyl-N-nitrosourea mutagenesis

    Directory of Open Access Journals (Sweden)

    Chen Tsung-Chieh

    2012-05-01

    Full Text Available Abstract Background N-ethyl-N-nitrosourea mutagenesis was used to induce a point mutation in C57BL/6 J mice. Pain-related phenotype screening was performed in 915 G3 mice. We report the detection of a heritable recessive mutant in meiotic recombinant N1F1 mice that caused an abnormal pain sensitivity phenotype with spontaneous skin inflammation in the paws and ears. Methods We investigated abnormal sensory processing, neuronal peptides, and behavioral responses after the induction of autoinflammatory disease. Single-nucleotide polymorphism (SNP markers and polymerase chain reaction product sequencing were used to identify the mutation site. Results All affected mice developed paw inflammation at 4–8 weeks. Histological examinations revealed hyperplasia of the epidermis in the inflamed paws and increased macrophage expression in the spleen and paw tissues. Mechanical and thermal nociceptive response thresholds were reduced in the affected mice. Locomotor activity was decreased in affected mice with inflamed hindpaws, and this reduction was attributable to the avoidance of contact of the affected paw with the floor. Motor strength and daily activity in the home cage in the affected mice did not show any significant changes. Although Fos immunoreactivity was normal in the dorsal horn of affected mice, calcitonin gene-related peptide immunoreactivity significantly increased in the deep layer of the dorsal horn. The number of microglia increased in the spinal cord, hippocampus, and cerebral cortex in affected mice, and the proliferation of microglia was maintained for a couple of months. Two hundred eighty-five SNP markers were used to reveal the affected gene locus, which was found on the distal part of chromosome 18. A point mutation was detected at A to G in exon 8 of the pstpip2 gene, resulting in a conserved tyrosine residue at amino acid 180 replaced by cysteine (Y180 C. Conclusions The data provide definitive evidence that a mutation

  12. Die induzierbare antivirale Immunantwort von Drosophila melanogaster

    OpenAIRE

    Kemp, Cordula

    2010-01-01

    In der vorliegenden Arbeit wurde Drosophila melanogaster als Modell ge- nutzt, um die angeborene Immunantwort gegen virale Infektionen zu studie- ren. Wir untersuchten mit Hilfe von genomweiten microarrays das Transkriptom von Fliegen, welche entweder mit dem Drosophila C Virus (DCV), dem Flock- house Virus (FHV) oder dem Sindbis Virus (SINV) infiziert waren. Infektion mit diesen drei positiv orientierten Einzelstrang RNS Viren führte zu einer starken transkriptionellen Antwort, welche deutlic...

  13. Mapping of gene mutations in drosophila melanogaster

    OpenAIRE

    Halvorsen, Charlotte Marie

    2004-01-01

    In this experiment, mutant genes of a given unknown mutant strain of Drosophila melanogaster were mapped to specific chromosomes. Drosophila melanogaster, commonly known as the fruit fly, was the appropriate choice for the organism to use in this specific experiment because of its relatively rapid life cycle of 10-14 days and because of the small amount of space and food neccessary for maintaining thousands of flies. The D. Melanogaster unknown strain specifically used in this experiment wa...

  14. A Drosophila Model for Screening Antiobesity Agents

    Directory of Open Access Journals (Sweden)

    Tran Thanh Men

    2016-01-01

    Full Text Available Although triacylglycerol, the major component for lipid storage, is essential for normal physiology, its excessive accumulation causes obesity in adipose tissue and is associated with organ dysfunction in nonadipose tissue. Here, we focused on the Drosophila model to develop therapeutics for preventing obesity. The brummer (bmm gene in Drosophila melanogaster is known to be homologous with human adipocyte triglyceride lipase, which is related to the regulation of lipid storage. We established a Drosophila model for monitoring bmm expression by introducing the green fluorescent protein (GFP gene as a downstream reporter of the bmm promoter. The third-instar larvae of Drosophila showed the GFP signal in all tissues observed and specifically in the salivary gland nucleus. To confirm the relationship between bmm expression and obesity, the effect of oral administration of glucose diets on bmm promoter activity was analyzed. The Drosophila flies given high-glucose diets showed higher lipid contents, indicating the obesity phenotype; this was suggested by a weaker intensity of the GFP signal as well as reduced bmm mRNA expression. These results demonstrated that the transgenic Drosophila model established in this study is useful for screening antiobesity agents. We also report the effects of oral administration of histone deacetylase inhibitors and some vegetables on the bmm promoter activity.

  15. Characterization of Autophagic Responses in Drosophila melanogaster.

    Science.gov (United States)

    Xu, T; Kumar, S; Denton, D

    2017-01-01

    Drosophila is an excellent model system for studying autophagy during animal development due to the availability of genetic reagents and opportunity for in vivo cell biological analysis. The regulation and mechanism of autophagy are highly evolutionarily conserved and the role of autophagy has been characterized during various stages of Drosophila development as well as following starvation. Studies in Drosophila have revealed novel insights into the role of distinct components of the autophagy machinery. This chapter describes protocols for examining autophagy during Drosophila development. A crucial step in the induction of autophagy is the incorporation of Atg8a into the autophagosome. This can be measured as autophagic puncta using live fluorescent imaging, immunostaining, or immunoblot analysis of LC3/Atg8a processing. The level of autophagy can also be examined using other specific components of the autophagy pathway as markers detected by immunofluorescent imaging. Based on the distinct morphology of autophagy, it can also be examined by transmission electron microscopy. In addition, one of the advantages of using Drosophila as a model is the ability to undertake genetic analysis of individual components of the autophagy machinery. Current approaches that can be used to monitor autophagy, including the overall flux and individual steps in Drosophila melanogaster, will be discussed. © 2017 Elsevier Inc. All rights reserved.

  16. Reverse genetics through random mutagenesis in Histoplasma capsulatum

    Directory of Open Access Journals (Sweden)

    Rappleye Chad A

    2009-11-01

    Full Text Available Abstract Background The dimorphic fungal pathogen Histoplasma capsulatum causes respiratory and systemic disease in humans and other mammals. Progress in understanding the mechanisms underlying the biology and the pathogenesis of Histoplasma has been hindered by a shortage of methodologies for mutating a gene of interest. Results We describe a reverse genetics process that combines the random mutagenesis of Agrobacterium-mediated transformation with screening techniques to identify targeted gene disruptions in a collection of insertion mutants. Isolation of the desired mutant is accomplished by arraying individual clones from a pool and employing a PCR-addressing method. Application of this procedure facilitated the isolation of a cbp1 mutant in a North American type 2 strain, a Histoplasma strain recalcitrant to gene knock-outs through homologous recombination. Optimization of cryopreservation conditions allows pools of mutants to be banked for later analysis and recovery of targeted mutants. Conclusion This methodology improves our ability to isolate mutants in targeted genes, thereby facilitating the molecular genetic analysis of Histoplasma biology. The procedures described are widely applicable to many fungal systems and will be of particular interest to those for which homologous recombination techniques are inefficient or do not currently exist.

  17. A wheat cold resistance mutant derived from space mutagenesis

    International Nuclear Information System (INIS)

    Li Peng; Sun Mingzhu; Zhang Fengyun; Gao Guoqiang; Qiu Denglin; Li Xinhua

    2012-01-01

    A cold resistance mutant, obtained by spaceflight mutagenesis on the seeds of wheat variety Han6172, and the DNA of cold resistance mutant and contrast Han6172 were compared by SRAP technique. 380 pairs of primers were screened, 6 pairs of them had polymorphisms between mutant and contrast, the rate was 1.58%, and this data indicated that there are no obvious DNA differences between mutant and contrast Six specific fragments were obtained, 3 fragments of them were amplified in mutant. Homology analysis in GenBank showed that Me3-Em7-Mt, Me4-Em11-CK, Me7-Em19-CK and Me6-Em9-Mt all had homologous sequences with wheat chromosome 3B-specific BAC library, and this result indicated that the gene and regulator sequences associated with mutant cold resistance might locate on 3B chromosome. It was speculated that space mutation induced the mutation of 3B chromosome primary structure, and influenced the expressions of cold resistance genes, which resulted in the mutation of cold resistance ability. (authors)

  18. Overproduction of Clavulanic Acid by UV Mutagenesis of Streptomyces clavuligerus.

    Science.gov (United States)

    Korbekandi, Hassan; Darkhal, Parisa; Hojati, Zohreh; Abedi, Daryoush; Hamedi, Javad; Pourhosein, Meraj

    2010-01-01

    Clavulanic acid is produced industrially by fermentation of Streptomyces clavuligerus and researches have increased its production by strain improvement, recombinant DNA technology, and media composition and growth condition optimization. The main objective of this study was to increase the level of clavulanic acid production from Streptomyces clavuligerus (DSM 738), using UV irradiation. After incubation, the spores and aerial mycelia were scraped off the agar plate by a sterile loop. After passing through a cotton wool, the serially diluted spore suspension was spread on GYM- agar containing caffeine. The plates were irradiated with UV light, wrapped in aluminum foil and incubated. The colonies were sub-cultured again to express the mutations. An aliquot of the spore suspension prepared from the resulted culture was poured in GYM agar plates and incubated. The plates were overlaid with nutrient-agar containing penicillin G and Klebsiela pneumoniae, and incubated. The inhibition zone diameter was measured and compared with the wild type colony. Repeating this procedure, the overproducer mutants were selected. Concentration of clavulanic acid was determined by HPLC analysis. It was concluded that secondary metabolites, mainly antibiotics containing clavulanic acid, were produced about 6-7 days after the growth, and concentration of clavulanic acid was increased up to two-folds after UV mutagenesis.

  19. Retroviral Vectors for Analysis of Viral Mutagenesis and Recombination

    Directory of Open Access Journals (Sweden)

    Jonathan M.O. Rawson

    2014-09-01

    Full Text Available Retrovirus population diversity within infected hosts is commonly high due in part to elevated rates of replication, mutation, and recombination. This high genetic diversity often complicates the development of effective diagnostics, vaccines, and antiviral drugs. This review highlights the diverse vectors and approaches that have been used to examine mutation and recombination in retroviruses. Retroviral vectors for these purposes can broadly be divided into two categories: those that utilize reporter genes as mutation or recombination targets and those that utilize viral genes as targets of mutation or recombination. Reporter gene vectors greatly facilitate the detection, quantification, and characterization of mutants and/or recombinants, but may not fully recapitulate the patterns of mutagenesis or recombination observed in native viral gene sequences. In contrast, the detection of mutations or recombination events directly in viral genes is more biologically relevant but also typically more challenging and inefficient. We will highlight the advantages and disadvantages of the various vectors and approaches used as well as propose ways in which they could be improved.

  20. ENU Mutagenesis in Mice Identifies Candidate Genes For Hypogonadism

    Science.gov (United States)

    Weiss, Jeffrey; Hurley, Lisa A.; Harris, Rebecca M.; Finlayson, Courtney; Tong, Minghan; Fisher, Lisa A.; Moran, Jennifer L.; Beier, David R.; Mason, Christopher; Jameson, J. Larry

    2012-01-01

    Genome-wide mutagenesis was performed in mice to identify candidate genes for male infertility, for which the predominant causes remain idiopathic. Mice were mutagenized using N-ethyl-N-nitrosourea (ENU), bred, and screened for phenotypes associated with the male urogenital system. Fifteen heritable lines were isolated and chromosomal loci were assigned using low density genome-wide SNP arrays. Ten of the fifteen lines were pursued further using higher resolution SNP analysis to narrow the candidate gene regions. Exon sequencing of candidate genes identified mutations in mice with cystic kidneys (Bicc1), cryptorchidism (Rxfp2), restricted germ cell deficiency (Plk4), and severe germ cell deficiency (Prdm9). In two other lines with severe hypogonadism candidate sequencing failed to identify mutations, suggesting defects in genes with previously undocumented roles in gonadal function. These genomic intervals were sequenced in their entirety and a candidate mutation was identified in SnrpE in one of the two lines. The line harboring the SnrpE variant retains substantial spermatogenesis despite small testis size, an unusual phenotype. In addition to the reproductive defects, heritable phenotypes were observed in mice with ataxia (Myo5a), tremors (Pmp22), growth retardation (unknown gene), and hydrocephalus (unknown gene). These results demonstrate that the ENU screen is an effective tool for identifying potential causes of male infertility. PMID:22258617

  1. Targeted mutagenesis using CRISPR/Cas system in medaka

    Directory of Open Access Journals (Sweden)

    Satoshi Ansai

    2014-04-01

    Full Text Available Clustered regularly interspaced short palindromic repeats (CRISPR/CRISPR-associated (Cas system-based RNA-guided endonuclease (RGEN has recently emerged as a simple and efficient tool for targeted genome editing. In this study, we showed successful targeted mutagenesis using RGENs in medaka, Oryzias latipes. Somatic and heritable mutations were induced with high efficiency at the targeted genomic sequence on the DJ-1 gene in embryos that had been injected with the single guide RNA (sgRNA transcribed by a T7 promoter and capped RNA encoding a Cas9 nuclease. The sgRNAs that were designed for the target genomic sequences without the 5′ end of GG required by the T7 promoter induced the targeted mutations. This suggests that the RGEN can target any sequence adjacent to an NGG protospacer adjacent motif (PAM sequence, which occurs once every 8 bp. The off-target alterations at 2 genomic loci harboring double mismatches in the 18-bp targeting sequences were induced in the RGEN-injected embryos. However, we also found that the off-target effects could be reduced by lower dosages of sgRNA. Taken together, our results suggest that CRISPR/Cas-mediated RGENs may be an efficient and flexible tool for genome editing in medaka.

  2. Directed combinatorial mutagenesis of Escherichia coli for complex phenotype engineering

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Rongming; Liang, Liya; Garst, Andrew D.; Choudhury, Alaksh; Nogué, Violeta Sànchez i.; Beckham, Gregg T.; Gill, Ryan T.

    2018-05-01

    Strain engineering for industrial production requires a targeted improvement of multiple complex traits, which range from pathway flux to tolerance to mixed sugar utilization. Here, we report the use of an iterative CRISPR EnAbled Trackable genome Engineering (iCREATE) method to engineer rapid glucose and xylose co-consumption and tolerance to hydrolysate inhibitors in E. coli. Deep mutagenesis libraries were rationally designed, constructed, and screened to target ~40,000 mutations across 30 genes. These libraries included global and high-level regulators that regulate global gene expression, transcription factors that play important roles in genome-level transcription, enzymes that function in the sugar transport system, NAD(P)H metabolism, and the aldehyde reduction system. Specific mutants that conferred increased growth in mixed sugars and hydrolysate tolerance conditions were isolated, confirmed, and evaluated for changes in genome-wide expression levels. We tested the strain with positive combinatorial mutations for 3-hydroxypropionic acid (3HP) production under high furfural and high acetate hydrolysate fermentation, which demonstrated a 7- and 8-fold increase in 3HP productivity relative to the parent strain, respectively.

  3. CRISPR/Cas-mediated targeted mutagenesis in Daphnia magna.

    Directory of Open Access Journals (Sweden)

    Takashi Nakanishi

    Full Text Available The water flea Daphnia magna has been used as an animal model in ecology, evolution, and environmental sciences. Thanks to the recent progress in Daphnia genomics, genetic information such as the draft genome sequence and expressed sequence tags (ESTs is now available. To investigate the relationship between phenotypes and the available genetic information about Daphnia, some gene manipulation methods have been developed. However, a technique to induce targeted mutagenesis into Daphnia genome remains elusive. To overcome this problem, we focused on an emerging genome editing technique mediated by the clustered regularly interspaced short palindromic repeats/CRISPR-associated (CRISPR/Cas system to introduce genomic mutations. In this study, we targeted a functionally conserved regulator of eye development, the eyeless gene in D. magna. When we injected Cas9 mRNAs and eyeless-targeting guide RNAs into eggs, 18-47% of the survived juveniles exhibited abnormal eye morphology. After maturation, up to 8.2% of the adults produced progenies with deformed eyes, which carried mutations in the eyeless loci. These results showed that CRISPR/Cas system could introduce heritable mutations into the endogenous eyeless gene in D. magna. This is the first report of a targeted gene knockout technique in Daphnia and will be useful in uncovering Daphnia gene functions.

  4. Oligonucleotide-directed mutagenesis for precision gene editing.

    Science.gov (United States)

    Sauer, Noel J; Mozoruk, Jerry; Miller, Ryan B; Warburg, Zachary J; Walker, Keith A; Beetham, Peter R; Schöpke, Christian R; Gocal, Greg F W

    2016-02-01

    Differences in gene sequences, many of which are single nucleotide polymorphisms, underlie some of the most important traits in plants. With humanity facing significant challenges to increase global agricultural productivity, there is an urgent need to accelerate the development of these traits in plants. oligonucleotide-directed mutagenesis (ODM), one of the many tools of Cibus' Rapid Trait Development System (RTDS(™) ) technology, offers a rapid, precise and non-transgenic breeding alternative for trait improvement in agriculture to address this urgent need. This review explores the application of ODM as a precision genome editing technology, with emphasis on using oligonucleotides to make targeted edits in plasmid, episomal and chromosomal DNA of bacterial, fungal, mammalian and plant systems. The process of employing ODM by way of RTDS technology has been improved in many ways by utilizing a fluorescence conversion system wherein a blue fluorescent protein (BFP) can be changed to a green fluorescent protein (GFP) by editing a single nucleotide of the BFP gene (CAC→TAC; H66 to Y66). For example, dependent on oligonucleotide length, applying oligonucleotide-mediated technology to target the BFP transgene in Arabidopsis thaliana protoplasts resulted in up to 0.05% precisely edited GFP loci. Here, the development of traits in commercially relevant plant varieties to improve crop performance by genome editing technologies such as ODM, and by extension RTDS, is reviewed. © 2015 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  5. Recurrent AAV2-related insertional mutagenesis in human hepatocellular carcinomas.

    Science.gov (United States)

    Nault, Jean-Charles; Datta, Shalini; Imbeaud, Sandrine; Franconi, Andrea; Mallet, Maxime; Couchy, Gabrielle; Letouzé, Eric; Pilati, Camilla; Verret, Benjamin; Blanc, Jean-Frédéric; Balabaud, Charles; Calderaro, Julien; Laurent, Alexis; Letexier, Mélanie; Bioulac-Sage, Paulette; Calvo, Fabien; Zucman-Rossi, Jessica

    2015-10-01

    Hepatocellular carcinomas (HCCs) are liver tumors related to various etiologies, including alcohol intake and infection with hepatitis B (HBV) or C (HCV) virus. Additional risk factors remain to be identified, particularly in patients who develop HCC without cirrhosis. We found clonal integration of adeno-associated virus type 2 (AAV2) in 11 of 193 HCCs. These AAV2 integrations occurred in known cancer driver genes, namely CCNA2 (cyclin A2; four cases), TERT (telomerase reverse transcriptase; one case), CCNE1 (cyclin E1; three cases), TNFSF10 (tumor necrosis factor superfamily member 10; two cases) and KMT2B (lysine-specific methyltransferase 2B; one case), leading to overexpression of the target genes. Tumors with viral integration mainly developed in non-cirrhotic liver (9 of 11 cases) and without known risk factors (6 of 11 cases), suggesting a pathogenic role for AAV2 in these patients. In conclusion, AAV2 is a DNA virus associated with oncogenic insertional mutagenesis in human HCC.

  6. In vitro mutagenesis for the improvement of Josapine pineapple

    International Nuclear Information System (INIS)

    Rusli Ibrahim; Amir Hamzah

    2006-01-01

    Pineapple is the most important fruit in terms of revenue earner in Malaysia. There are about 10,000 ha cultivated with this fruit and half of this is owned by estates and planted for the canning industry. The export of canned pineapple is about 2 million standard cases annually valued at RM 60 million, while the export of fresh pineapple is about 40,000 tonnes worth about RM 10 million. The industry for canning is however, an ailing industry with production on the decline since the 70s. Somaclonal variations and induced mutation using irradiation in breeding are least invasive in changes to genetic make-up of an established variety and will be useful for improving the pineapple varieties. The use of tissue culture to generate somaclones with minute genetic changes that do not damage the overall varietal identity would be the most suitable tool to improve the variety. Protocols for the production of tissue culture plantlets of pineapple using bioreactor technology has been developed and proved to be much more efficient and productive compared to conventional method. In vitro mutagenesis using adventitious buds had produced new plants with smooth leaves, vigorous growth and ornamental-like characters. A total of 30,000 plants derived from tissue culture will be planted and screened in the field for the improvement of Josapine pineapple against bacterial heart rot disease and multiple crown. (Author)

  7. Validation-based insertional mutagenesis for identification of Nup214 as a host factor for EV71 replication in RD cells

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Bei; Zhang, XiaoYu; Zhao, Zhendong, E-mail: timjszzd@163.com

    2013-08-02

    Highlights: •We introduced a new mutagenesis strategy named VBIM to the viral research. •This method can identify either host factors or host restriction factors. •Using VBIM system, we identified Nup214 as a host factor for EV71 replication in RD cells. -- Abstract: Lentiviral validation-based insertional mutagenesis (VBIM) is a sophisticated, forward genetic approach that is used for the investigation of signal transduction in mammalian cells. Using VBIM, we conducted function-based genetic screening for host genes that affect enterovirus 71 (EV71) viral replication. This included host factors that are required for the life cycle of EV71 and host restriction factors that inhibit EV71 replication. Several cell clones, resistant to EV71, were produced using EV71 infection as a selection pressure and the nuclear pore protein 214 (Nup214) was identified as a host factor required for EV71 replication. In SD2-2, the corresponding VBIM lentivirus transformed clone, the expression of endogenous Nup214 was significantly down-regulated by the reverse inserted VBIM promoter. After Cre recombinase-mediated excision of the VBIM promoter, the expression of Nup214 recovered and the clone regained sensitivity to the EV71 infection. Furthermore, over-expression of Nup214 in the cells suggested that Nup214 was promoting EV71 replication. Results of this study indicate that a successful mutagenesis strategy has been established for screening host genes related to viral replication.

  8. Validation-based insertional mutagenesis for identification of Nup214 as a host factor for EV71 replication in RD cells

    International Nuclear Information System (INIS)

    Wang, Bei; Zhang, XiaoYu; Zhao, Zhendong

    2013-01-01

    Highlights: •We introduced a new mutagenesis strategy named VBIM to the viral research. •This method can identify either host factors or host restriction factors. •Using VBIM system, we identified Nup214 as a host factor for EV71 replication in RD cells. -- Abstract: Lentiviral validation-based insertional mutagenesis (VBIM) is a sophisticated, forward genetic approach that is used for the investigation of signal transduction in mammalian cells. Using VBIM, we conducted function-based genetic screening for host genes that affect enterovirus 71 (EV71) viral replication. This included host factors that are required for the life cycle of EV71 and host restriction factors that inhibit EV71 replication. Several cell clones, resistant to EV71, were produced using EV71 infection as a selection pressure and the nuclear pore protein 214 (Nup214) was identified as a host factor required for EV71 replication. In SD2-2, the corresponding VBIM lentivirus transformed clone, the expression of endogenous Nup214 was significantly down-regulated by the reverse inserted VBIM promoter. After Cre recombinase-mediated excision of the VBIM promoter, the expression of Nup214 recovered and the clone regained sensitivity to the EV71 infection. Furthermore, over-expression of Nup214 in the cells suggested that Nup214 was promoting EV71 replication. Results of this study indicate that a successful mutagenesis strategy has been established for screening host genes related to viral replication

  9. New record for the invasive Spotted Wing Drosophila, Drosophila suzukii Matsumura (Diptera: Drosophilidae) in Anillaco, Argentina

    Science.gov (United States)

    The invasive Spotted Wing Drosophila (SWD), Drosophila suzukii Matsumura, is reported for the first time in La Rioja, Argentina. This represents a major range expansion for this species. The natural enemies of SWD, Leptopilina clavipes and Ganaspis hookeri were also collected with the SWD at the s...

  10. Effect of non-nutritive sugars to decrease the survivorship of spotted wing drosophila, Drosophila suzukii

    Science.gov (United States)

    In this study, we investigated the effects of non-nutritive sugars and sugar alcohols on the survivorship of spotted wing drosophila, Drosophila suzukii, and found erythritol and erythrose as potentially toxic to the fly. In a dose-dependent study, erythritol and erythrose significantly reduced fly ...

  11. Identification of four Drosophila allatostatins as the cognate ligands for the Drosophila orphan receptor DAR-2

    DEFF Research Database (Denmark)

    Lenz, C; Williamson, M; Hansen, G N

    2001-01-01

    to be the receptor for an intrinsic Drosophila A-type (cockroach-type) allatostatin. Here, we have permanently expressed DAR-2 in CHO cells and found that it is the cognate receptor for four Drosophila A-type allatostatins, the drostatins-A1 to -A4. Of all the drostatins, drostatin-A4 (Thr...

  12. Second-Generation Drosophila Chemical Tags: Sensitivity, Versatility, and Speed

    OpenAIRE

    Sutcliffe, B; Ng, Julian Tze; Auer, TO; Pasche, M; Benton, R; Jefferis, Gregory Stephen; Cachero, S

    2017-01-01

    Labeling and visualizing cells and subcellular structures within thick tissues, whole organs and even intact animals is key to studying biological processes. This is particularly true for studies of neural circuits where neurons form submicron synapses but have arbors that may span millimeters in length. Traditionally, labeling is achieved by immunofluorescence; however diffusion of antibody molecules (>100 kDa) is slow and often results in uneven labeling with very poor penetration into the ...

  13. Second Generation Drosophila Chemical Tags: Sensitivity, Versatility and Speed

    OpenAIRE

    Sutcliffe, Ben; Ng, Julian; Auer, Thomas O.; Pasche, Mathias; Benton, Richard; Jefferis, Gregory S. X. E.; Cachero, Sebastian

    2017-01-01

    Labeling and visualizing cells and subcellular structures within thick tissues, whole organs, and even intact animals is key to studying biological processes. This is particularly true for studies of neural circuits where neurons form submicron synapses but have arbors that may span millimeters in length. Traditionally, labeling is achieved by immunofluorescence; however, diffusion of antibody molecules (>100 kDa) is slow and often results in uneven labeling with very poor penetration into th...

  14. Quantification of Histamine and Carcinine in Drosophila melanogaster Tissues.

    Science.gov (United States)

    Denno, Madelaine E; Privman, Eve; Borman, Ryan P; Wolin, Danielle C; Venton, B Jill

    2016-03-16

    Histamine is a neurotransmitter crucial to the visual processing of Drosophila melanogaster. It is inactivated by metabolism to carcinine, a β-alanyl derivative, and the same enzyme that controls that process also converts dopamine to N-β-alanyl-dopamine. Direct detection of histamine and carcinine has not been reported in single Drosophila brains. Here, we quantify histamine, carcinine, dopamine, and N-β-alanyl-dopamine in Drosophila tissues by capillary electrophoresis coupled to fast-scan cyclic voltammetry (CE-FSCV). Limits of detection were low, 4 ± 1 pg for histamine, 10 ± 4 pg for carcinine, 2.8 ± 0.3 pg for dopamine, and 9 ± 3 pg for N-β-alanyl-dopamine. Tissue content was compared in the brain, eyes, and cuticle from wild-type (Canton S) and mutant (tan(3) and ebony(1)) strains. In tan(3) mutants, the enzyme that produces histamine from carcinine is nonfunctional, whereas in ebony(1) mutants, the enzyme that produces carcinine from histamine is nonfunctional. In all fly strains, the neurotransmitter content was highest in the eyes and there were no strain differences for tissue content in the cuticle. The main finding was that carcinine levels changed significantly in the mutant flies, whereas histamine levels did not. In particular, tan(3) flies had significantly higher carcinine levels in the eyes and brain than Canton S or ebony(1) flies. N-β-Alanyl-dopamine was detected in tan(3) mutants but not in other strains. These results show the utility of CE-FSCV for sensitive detection of histamine and carcinine, which allows a better understanding of their content and metabolism in different types of tissues to be obtained.

  15. The PIKE homolog Centaurin gamma regulates developmental timing in Drosophila.

    Directory of Open Access Journals (Sweden)

    Anna Lisa Gündner

    Full Text Available Phosphoinositide-3-kinase enhancer (PIKE proteins encoded by the PIKE/CENTG1 gene are members of the gamma subgroup of the Centaurin superfamily of small GTPases. They are characterized by their chimeric protein domain architecture consisting of a pleckstrin homology (PH domain, a GTPase-activating (GAP domain, Ankyrin repeats as well as an intrinsic GTPase domain. In mammals, three PIKE isoforms with variations in protein structure and subcellular localization are encoded by the PIKE locus. PIKE inactivation in mice results in a broad range of defects, including neuronal cell death during brain development and misregulation of mammary gland development. PIKE -/- mutant mice are smaller, contain less white adipose tissue, and show insulin resistance due to misregulation of AMP-activated protein kinase (AMPK and insulin receptor/Akt signaling. here, we have studied the role of PIKE proteins in metabolic regulation in the fly. We show that the Drosophila PIKE homolog, ceng1A, encodes functional GTPases whose internal GAP domains catalyze their GTPase activity. To elucidate the biological function of ceng1A in flies, we introduced a deletion in the ceng1A gene by homologous recombination that removes all predicted functional PIKE domains. We found that homozygous ceng1A mutant animals survive to adulthood. In contrast to PIKE -/- mouse mutants, genetic ablation of Drosophila ceng1A does not result in growth defects or weight reduction. Although metabolic pathways such as insulin signaling, sensitivity towards starvation and mobilization of lipids under high fed conditions are not perturbed in ceng1A mutants, homozygous ceng1A mutants show a prolonged development in second instar larval stage, leading to a late onset of pupariation. In line with these results we found that expression of ecdysone inducible genes is reduced in ceng1A mutants. Together, we propose a novel role for Drosophila Ceng1A in regulating ecdysone signaling-dependent second to

  16. Identification of four Drosophila allatostatins as the cognate ligands for the Drosophila orphan receptor DAR-2

    DEFF Research Database (Denmark)

    Lenz, C; Williamson, M; Hansen, G N

    2001-01-01

    The allatostatins are generally inhibitory insect neuropeptides. The Drosophila orphan receptor DAR-2 is a G-protein-coupled receptor, having 47% amino acid residue identity with another Drosophila receptor, DAR-1 (which is also called dros. GPCR, or DGR) that was previously shown...... to be the receptor for an intrinsic Drosophila A-type (cockroach-type) allatostatin. Here, we have permanently expressed DAR-2 in CHO cells and found that it is the cognate receptor for four Drosophila A-type allatostatins, the drostatins-A1 to -A4. Of all the drostatins, drostatin-A4 (Thr...... weakly in the brain. The Drosophila larval gut also contains about 20-30 endocrine cells, expressing the gene for the drostatins-A1 to -A4. We suggest, therefore, that DAR-2 mediates an allatostatin (drostatin)-induced inhibition of gut motility. This is the first report on the permanent and functional...

  17. Molecular neurobiology of Drosophila taste.

    Science.gov (United States)

    Freeman, Erica Gene; Dahanukar, Anupama

    2015-10-01

    Drosophila is a powerful model in which to study the molecular and cellular basis of taste coding. Flies sense tastants via populations of taste neurons that are activated by compounds of distinct categories. The past few years have borne witness to studies that define the properties of taste neurons, identifying functionally distinct classes of sweet and bitter taste neurons that express unique subsets of gustatory receptor (Gr) genes, as well as water, salt, and pheromone sensing neurons that express members of the pickpocket (ppk) or ionotropic receptor (Ir) families. There has also been significant progress in terms of understanding how tastant information is processed and conveyed to higher brain centers, and modulated by prior dietary experience or starvation. Copyright © 2015. Published by Elsevier Ltd.

  18. Gustatory Processing in Drosophila melanogaster.

    Science.gov (United States)

    Scott, Kristin

    2018-01-07

    The ability to identify nutrient-rich food and avoid toxic substances is essential for an animal's survival. Although olfaction and vision contribute to food detection, the gustatory system acts as a final checkpoint control for food acceptance or rejection. The vinegar fly Drosophila melanogaster tastes many of the same stimuli as mammals and provides an excellent model system for comparative studies of taste detection. The relative simplicity of the fly brain and behaviors, along with the molecular genetic and functional approaches available in this system, allow the examination of gustatory neural circuits from sensory input to motor output. This review discusses the molecules and cells that detect taste compounds in the periphery and the circuits that process taste information in the brain. These studies are providing insight into how the detection of taste compounds regulates feeding decisions.

  19. Mutagenesis of bacteriophage T7 and T7 DNA by alkylation damage.

    OpenAIRE

    Masker, W E; Dodson, L A; Maupin, M

    1985-01-01

    We have developed a new assay for in vitro mutagenesis of bacteriophage T7 DNA that measures the generation of mutations in the specific T7 gene that codes for the phage ligase. This assay was used to examine mutagenesis caused by in vitro DNA synthesis in the presence of O6-methylguanosine triphosphate. Reversion of one of the newly generated ligase mutants by ethyl methanesulfonate was also tested.

  20. Mutagenesis of bacteriophage T7 and T7 DNA by alkylation damage.

    Science.gov (United States)

    Masker, W E; Dodson, L A; Maupin, M

    1985-01-01

    We have developed a new assay for in vitro mutagenesis of bacteriophage T7 DNA that measures the generation of mutations in the specific T7 gene that codes for the phage ligase. This assay was used to examine mutagenesis caused by in vitro DNA synthesis in the presence of O6-methylguanosine triphosphate. Reversion of one of the newly generated ligase mutants by ethyl methanesulfonate was also tested. PMID:3903213

  1. How batrachotoxin modifies the sodium channel permeation pathway: computer modeling and site-directed mutagenesis.

    Science.gov (United States)

    Wang, Sho-Ya; Mitchell, Jane; Tikhonov, Denis B; Zhorov, Boris S; Wang, Ging Kuo

    2006-03-01

    A structural model of the rNav1.4 Na+ channel with batrachotoxin (BTX) bound within the inner cavity suggested that the BTX pyrrole moiety is located between a lysine residue at the DEKA selectivity filter (Lys1237) and an adjacent phenylalanine residue (Phe1236). We tested this pyrrole-binding model by site-directed mutagenesis of Phe1236 at D3/P-loop with 11 amino acids. Mutants F1236D and F1236E expressed poorly, whereas nine other mutants either expressed robust Na+ currents, like the wild-type (F1236Y/Q/K), or somewhat reduced current (F1236G/A/C/N/W/R). Gating properties were altered modestly in most mutant channels, with F1236G displaying the greatest shift in activation and steady-state fast inactivation (-10.1 and -7.5 mV, respectively). Mutants F1236K and F1236R were severely resistant to BTX after 1000 repetitive pulses (+50 mV/20 ms at 2 Hz), whereas seven other mutants were sensitive but with reduced magnitudes compared with the wild type. It is noteworthy that rNav1.4-F1236K mutant Na+ channels remained highly sensitive to block by the local anesthetic bupivacaine, unlike several other BTX-resistant mutant channels. Our data thus support a model in which BTX, when bound within the inner cavity, interacts with the D3/P-loop directly. Such a direct interaction provides clues on how BTX alters the Na+ channel selectivity and conductance.

  2. Characterization of actin and poly-L-proline binding sites of Acanthamoeba profilin with monoclonal antibodies and by mutagenesis.

    Science.gov (United States)

    Kaiser, D A; Pollard, T D

    1996-02-16

    We characterized several deletion and substitution mutations of Acanthamoeba profilin and nine monoclonal antibodies to Acanthamoeba profilin. The results provide two independent lines of evidence about the binding sites for actin and poly-L-proline on the profilin molecule. This new evidence is consistent with the main conclusions about these binding sites from previous structural and mutagenic studies. Mutagenesis also revealed that the native structure of profilin is very sensitive to substitutions and deletions at the C terminus. For example, profilin with a deletion of the eight C-terminal residues has many of the physical properties of a molten globule, yet remarkably still binds to actin. This instability may account for the lack of function of similar mutants in yeast.

  3. Single Nucleotide Polymorphism Markers for Genetic Mapping in Drosophila melanogaster

    OpenAIRE

    Hoskins, Roger A.; Phan, Alexander C.; Naeemuddin, Mohammed; Mapa, Felipa A.; Ruddy, David A.; Ryan, Jessica J.; Young, Lynn M.; Wells, Trent; Kopczynski, Casey; Ellis, Michael C.

    2001-01-01

    For nearly a century, genetic analysis in Drosophila melanogaster has been a powerful tool for analyzing gene function, yet Drosophila lacks the molecular genetic mapping tools that recently have revolutionized human, mouse, and plant genetics. Here, we describe the systematic characterization of a dense set of molecular markers in Drosophila by using a sequence tagged site-based physical map of the genome. We identify 474 biallelic markers in standard laboratory strains of Drosophila that sp...

  4. Mutagenic effect of radionuclides incorporated into DNA of Drosophila melanogaster. Technical progress report, December 15, 1985-July 15, 1986

    International Nuclear Information System (INIS)

    Lee, W.R.

    1986-01-01

    This project compares the mutagenic effect of ionizing radiation from tritium to that of x-ray. Mutants are described at the molecular level after having been characterized by classical genetic techniques in Drosophila melanogaster, therefore tying together the molecular studies with previous work in mutagenesis. The objectives of this project are to analyze x-ray and tritium induced mutants by ''walking down'' the chromosomes and studying the frequency of breaks that are not associated with the gene used in screening for the mutants, to study the molecular effect of these mutants in heterozygotes with the aim of developing methods of detecting mutants in heterozygotes that may be applicable to human populations, and to induce mutants from tritium beta radiation and analyze them at the molecular level. 9 refs., 4 figs

  5. Phenotypic plasticity in Drosophila cactophilic species: the effect of competition, density, and breeding sites.

    Science.gov (United States)

    Fanara, Juan Jose; Werenkraut, Victoria

    2017-08-01

    Changes in the environmental conditions experienced by naturally occurring populations are frequently accompanied by changes in adaptive traits allowing the organism to cope with environmental unpredictability. Phenotypic plasticity is a major aspect of adaptation and it has been involved in population dynamics of interacting species. In this study, phenotypic plasticity (i.e., environmental sensitivity) of morphological adaptive traits were analyzed in the cactophilic species Drosophila buzzatii and Drosophila koepferae (Diptera: Drosophilidae) considering the effect of crowding conditions (low and high density), type of competition (intraspecific and interspecific competition) and cacti hosts (Opuntia and Columnar cacti). All traits (wing length, wing width, thorax length, wing loading and wing aspect) showed significant variation for each environmental factor considered in both Drosophila species. The phenotypic plasticity pattern observed for each trait was different within and between these cactophilic Drosophila species depending on the environmental factor analyzed suggesting that body size-related traits respond almost independently to environmental heterogeneity. The effects of ecological factors analyzed in this study are discussed in order to elucidate the causal factors investigated (type of competition, crowding conditions and alternative host) affecting the election of the breeding site and/or the range of distribution of these cactophilic species. © 2016 Institute of Zoology, Chinese Academy of Sciences.

  6. Drosophila olfactory receptors as classifiers for volatiles from disparate real world applications

    International Nuclear Information System (INIS)

    Nowotny, Thomas; De Bruyne, Marien; Warr, Coral G; Berna, Amalia Z; Trowell, Stephen C

    2014-01-01

    Olfactory receptors evolved to provide animals with ecologically and behaviourally relevant information. The resulting extreme sensitivity and discrimination has proven useful to humans, who have therefore co-opted some animals’ sense of smell. One aim of machine olfaction research is to replace the use of animal noses and one avenue of such research aims to incorporate olfactory receptors into artificial noses. Here, we investigate how well the olfactory receptors of the fruit fly, Drosophila melanogaster, perform in classifying volatile odourants that they would not normally encounter. We collected a large number of in vivo recordings from individual Drosophila olfactory receptor neurons in response to an ecologically relevant set of 36 chemicals related to wine (‘wine set’) and an ecologically irrelevant set of 35 chemicals related to chemical hazards (‘industrial set’), each chemical at a single concentration. Resampled response sets were used to classify the chemicals against all others within each set, using a standard linear support vector machine classifier and a wrapper approach. Drosophila receptors appear highly capable of distinguishing chemicals that they have not evolved to process. In contrast to previous work with metal oxide sensors, Drosophila receptors achieved the best recognition accuracy if the outputs of all 20 receptor types were used. (paper)

  7. Drosophila muscleblind is involved in troponin T alternative splicing and apoptosis.

    Directory of Open Access Journals (Sweden)

    Marta Vicente-Crespo

    2008-02-01

    Full Text Available Muscleblind-like proteins (MBNL have been involved in a developmental switch in the use of defined cassette exons. Such transition fails in the CTG repeat expansion disease myotonic dystrophy due, in part, to sequestration of MBNL proteins by CUG repeat RNA. Four protein isoforms (MblA-D are coded by the unique Drosophila muscleblind gene.We used evolutionary, genetic and cell culture approaches to study muscleblind (mbl function in flies. The evolutionary study showed that the MblC protein isoform was readily conserved from nematods to Drosophila, which suggests that it performs the most ancestral muscleblind functions. Overexpression of MblC in the fly eye precursors led to an externally rough eye morphology. This phenotype was used in a genetic screen to identify five dominant suppressors and 13 dominant enhancers including Drosophila CUG-BP1 homolog aret, exon junction complex components tsunagi and Aly, and pro-apoptotic genes Traf1 and reaper. We further investigated Muscleblind implication in apoptosis and splicing regulation. We found missplicing of troponin T in muscleblind mutant pupae and confirmed Muscleblind ability to regulate mouse fast skeletal muscle Troponin T (TnnT3 minigene splicing in human HEK cells. MblC overexpression in the wing imaginal disc activated apoptosis in a spatially restricted manner. Bioinformatics analysis identified a conserved FKRP motif, weakly resembling a sumoylation target site, in the MblC-specific sequence. Site-directed mutagenesis of the motif revealed no change in activity of mutant MblC on TnnT3 minigene splicing or aberrant binding to CUG repeat RNA, but altered the ability of the protein to form perinuclear aggregates and enhanced cell death-inducing activity of MblC overexpression.Taken together our genetic approach identify cellular processes influenced by Muscleblind function, whereas in vivo and cell culture experiments define Drosophila troponin T as a new Muscleblind target, reveal a

  8. Enhanced susceptibility of a transposable-element-bearing strain of Drosophila melanogaster to somatic eye-color mutations by ethyl nitrosourea, methyl nitrosourea, and X-rays

    International Nuclear Information System (INIS)

    Ryo, H.; Kondo, S.; Rasmuson, B.

    1983-01-01

    A strain of Drosophila with the genes z and w + plus a transposable element (TE) is about 3 times more sensitive than a strain without TE toward somatic eye-color mutations after larval exposure to ethyl nitrosourea, methyl nitrosourea and X-rays. The assay system with TE is simple, reliable, and sensitive for detecting somatic mutations induced in vivo by mutagens. (orig.)

  9. Effect of Hawthorn on Drosophila Melanogaster Antioxidant-Related ...

    African Journals Online (AJOL)

    Purpose: To study the effects of various doses of hawthorn extract on Drosophila lifespan, antioxidant enzyme activity and expression of antioxidant-related regulation genes. Methods: Experiments with Drosophila as an animal model were conducted. The effects of hawthorn on Drosophila melanogaster antioxidant related ...

  10. Mutagenesis and haploid culture for disease resistance in Brassica napus

    International Nuclear Information System (INIS)

    MacDonald, M.V.; Ahmad, I.; Ingram, D.S.

    1990-01-01

    Full text: Most winter oilseed rape cultivars share parentage and therefore show little genetic diversity. There is no known resistance to Alternaria spp. in oilseed rape or in any related Brassica species. Experiments with tissue culture yielded only transient, non-genetic resistance. Therefore, mutagenesis may be used to generate heritable resistance to Alternaria spp. Gamma irradiation was applied to seeds of 'Bienvenue', secondary embryoids of cvs 'Primor' and 'Rapora', and buds of cvs 'Primor' and 'Ariana'. Isolated microspores from cv 'Ariana' and rapid cycling B. napus were also treated. The doses used ranged from 0-100 Gy for isolated microspores and buds, up to 600 Gy for seeds and 960 Gy for secondary embryoids. EMS was used to treat seeds of line WRG-42 (supplied by Nickersons RPB) and microspores of cv 'Bienvenue' and rapid cycling B. napus. Seeds were treated with up to 2.0% EMS for 0.2 h. before plating them on the culture medium. Seed irradiation up to 600 Gy did not reduce germination. M 1 and M 2 progenies were tested both in the laboratory and in field trials, and none of these were found to be resistant to Alternaria. However, considerable variation for other characters was observed. Haploid cultures from these plants were extremely difficult to regenerate, and for this reason no regenerant plants have been tested for resistance. For irradiated secondary embryoids the regeneration capacity decreased with increasing dose. Regenerated plants have been tested for resistance to Alternaria, but stable resistance was not observed. Haploid cultures were obtained from irradiated buds, using both anther and microspore culture. Low irradiation treatment was beneficial to developing embryoids. Some regenerants have been obtained from EMS treated microspores and seeds. Four plants have repeatedly given increased levels of resistance to A. brassicicola, and progenies are being tested to determine the genetic nature of the resistance. (author)

  11. uvsI mutants defective in UV mutagenesis define a fourth epistatic group of uvs genes in Aspergillus.

    Science.gov (United States)

    Chae, S K; Kafer, E

    1993-01-01

    Three UV-sensitive mutations of A. nidulans, uvsI, uvsJ and uvsA, were tested for epistatic relationships with members of the previously established groups, here called the "UvsF", "UvsC", and "UvsB" groups. uvsI mutants are defective for spontaneous and induced reversion of certain point mutations and differ also for other properties from previously analyzed uvs types. They are very sensitive to the killing effects of UV-light and 4-NQO (4-nitro-quinoline-N-oxide) but not to MMS (methylmethane sulfonate). When double- and single-mutant uvs strains were compared for sensitivity to these three agents, synergistic or additive effects were found for uvsI with all members of the three groups. The uvsI gene may therefore represent a fourth epistatic group, possibly involved in mutagenic repair. On the other hand, uvsJ was clearly epistatic with members of the UvsF group and fitted well into this group also by phenotype. The uvsA gene was tentatively assigned to the UvsC group. uvsA showed epistatic interactions with uvsC in all tests, and like UvsC-group mutants is UV-sensitive mainly in dividing cells. However, the uvsA mutation does not cause the defects in recombination and UV mutagenesis typical for this group.

  12. Drosophila melanogaster as a model system for assessing development under conditions of microgravity

    Science.gov (United States)

    Abbott, M. K.; Hilgenfeld, R. B.; Denell, R. E.; Spooner, B. S. (Principal Investigator)

    1992-01-01

    More is known about the regulation of early developmental events in Drosophila than any other animal. In addition, its size and short life cycle make it a facile experimental system. Since developmental perturbations have been demonstrated when both oogenesis and embryogenesis occur in the space environment, there is a strong rationale for using this organism for the elucidation of specific gravity-sensitive developmental events.

  13. Drosophila TRPA1 isoforms detect UV light via photochemical production of H2O2

    Science.gov (United States)

    Guntur, Ananya R.; Gu, Pengyu; Takle, Kendra; Chen, Jingyi; Xiang, Yang; Yang, Chung-Hui

    2015-01-01

    The transient receptor potential A1 (TRPA1) channel is an evolutionarily conserved detector of temperature and irritant chemicals. Here, we show that two specific isoforms of TRPA1 in Drosophila are H2O2 sensitive and that they can detect strong UV light via sensing light-induced production of H2O2. We found that ectopic expression of these H2O2-sensitive Drosophila TRPA1 (dTRPA1) isoforms conferred UV sensitivity to light-insensitive HEK293 cells and Drosophila neurons, whereas expressing the H2O2-insensitive isoform did not. Curiously, when expressed in one specific group of motor neurons in adult flies, the H2O2-sensitive dTRPA1 isoforms were as competent as the blue light-gated channelrhodopsin-2 in triggering motor output in response to light. We found that the corpus cardiacum (CC) cells, a group of neuroendocrine cells that produce the adipokinetic hormone (AKH) in the larval ring gland endogenously express these H2O2-sensitive dTRPA1 isoforms and that they are UV sensitive. Sensitivity of CC cells required dTRPA1 and H2O2 production but not conventional phototransduction molecules. Our results suggest that specific isoforms of dTRPA1 can sense UV light via photochemical production of H2O2. We speculate that UV sensitivity conferred by these isoforms in CC cells may allow young larvae to activate stress response—a function of CC cells—when they encounter strong UV, an aversive stimulus for young larvae. PMID:26443856

  14. Detection of genetically altered copper levels in Drosophila tissues by synchrotron x-ray fluorescence microscopy.

    Directory of Open Access Journals (Sweden)

    Jessica C Lye

    Full Text Available Tissue-specific manipulation of known copper transport genes in Drosophila tissues results in phenotypes that are presumably due to an alteration in copper levels in the targeted cells. However direct confirmation of this has to date been technically challenging. Measures of cellular copper content such as expression levels of copper-responsive genes or cuproenzyme activity levels, while useful, are indirect. First-generation copper-sensitive fluorophores show promise but currently lack the sensitivity required to detect subtle changes in copper levels. Moreover such techniques do not provide information regarding other relevant biometals such as zinc or iron. Traditional techniques for measuring elemental composition such as inductively coupled plasma mass spectroscopy are not sensitive enough for use with the small tissue amounts available in Drosophila research. Here we present synchrotron x-ray fluorescence microscopy analysis of two different Drosophila tissues, the larval wing imaginal disc, and sectioned adult fly heads and show that this technique can be used to detect changes in tissue copper levels caused by targeted manipulation of known copper homeostasis genes.

  15. Enhanced reactivation of UV-irradiated adenovirus 2 is not associated with enhanced mutagenesis in carcinogen-pretreated HeLa cells.

    Science.gov (United States)

    Piperakis, S M

    1987-11-01

    Treatment of HeLa cells with low doses of the carcinogens aflatoxin B1, methyl methanesulfonate (MMS) or ethyl methanesulfonate (EMS) increases the survival rate of UV-irradiated adenovirus 2 (ade2). This increase is maximal if the time interval between cell treatment and virus infection is delayed by 36 h. No enhanced mutagenesis was found measuring the reversion frequency of a temperature-sensitive mutant of ade2 grown in HeLa cells treated with the same carcinogens. The enhanced viral reactivation observed does not, therefore, display a significant error-prone component.

  16. Gut-associated microbes of Drosophila melanogaster

    Science.gov (United States)

    Broderick, Nichole; Lemaitre, Bruno

    2012-01-01

    There is growing interest in using Drosophila melanogaster to elucidate mechanisms that underlie the complex relationships between a host and its microbiota. In addition to the many genetic resources and tools Drosophila provides, its associated microbiota is relatively simple (1–30 taxa), in contrast to the complex diversity associated with vertebrates (> 500 taxa). These attributes highlight the potential of this system to dissect the complex cellular and molecular interactions that occur between a host and its microbiota. In this review, we summarize what is known regarding the composition of gut-associated microbes of Drosophila and their impact on host physiology. We also discuss these interactions in the context of their natural history and ecology and describe some recent insights into mechanisms by which Drosophila and its gut microbiota interact. “Workers with Drosophila have been considered fortunate in that they deal with the first multicellular invertebrate to be cultured monoxenically (Delcourt and Guyenot, 1910); the first to be handled axenically on a semisynthetic diet (Guyenot, 1917); and the first to be grown on a defined diet (Schultz et al., 1946). This list of advantages is somewhat embarrassing, since it implies an interest in nutrition that, in reality, was only secondary. The very first studies were concerned with the reduction of variability in genetic experiments (Delcourt and Guyenot, 1910) and standardization of the nutritional environment.” -James Sang, 1959 Ann NY Acad 1 PMID:22572876

  17. An integrated optical coherence microscopy imaging and optical stimulation system for optogenetic pacing in Drosophila melanogaster (Conference Presentation)

    Science.gov (United States)

    Alex, Aneesh; Li, Airong; Men, Jing; Jerwick, Jason; Tanzi, Rudolph E.; Zhou, Chao

    2016-03-01

    Electrical stimulation is the clinical standard for cardiac pacing. Although highly effective in controlling cardiac rhythm, the invasive nature, non-specificity to cardiac tissues and possible tissue damage limits its applications. Optogenetic pacing of the heart is a promising alternative, which is non-invasive and more specific, has high spatial and temporal precision, and avoids the shortcomings in electrical stimulation. Drosophila melanogaster, which is a powerful model organism with orthologs of nearly 75% of human disease genes, has not been studied for optogenetic pacing in the heart. Here, we developed a non-invasive integrated optical pacing and optical coherence microscopy (OCM) imaging system to control the heart rhythm of Drosophila at different developmental stages using light. The OCM system is capable of providing high imaging speed (130 frames/s) and ultrahigh imaging resolutions (1.5 μm and 3.9 μm for axial and transverse resolutions, respectively). A light-sensitive pacemaker was developed in Drosophila by specifically expressing the light-gated cation channel, channelrhodopsin-2 (ChR2) in transgenic Drosophila heart. We achieved non-invasive and specific optical control of the Drosophila heart rhythm throughout the fly's life cycle (larva, pupa, and adult) by stimulating the heart with 475 nm pulsed laser light. Heart response to stimulation pulses was monitored non-invasively with OCM. This integrated non-invasive optogenetic control and in vivo imaging technique provides a novel platform for performing research studies in developmental cardiology.

  18. Structural Analysis and Deletion Mutagenesis Define Regions of QUIVER/SLEEPLESS that Are Responsible for Interactions with Shaker-Type Potassium Channels and Nicotinic Acetylcholine Receptors.

    Directory of Open Access Journals (Sweden)

    Meilin Wu

    Full Text Available Ly6 proteins are endogenous prototoxins found in most animals. They show striking structural and functional parallels to snake α-neurotoxins, including regulation of ion channels and cholinergic signaling. However, the structural contributions of Ly6 proteins to regulation of effector molecules is poorly understood. This question is particularly relevant to the Ly6 protein QUIVER/SLEEPLESS (QVR/SSS, which has previously been shown to suppress excitability and synaptic transmission by upregulating potassium (K channels and downregulating nicotinic acetylcholine receptors (nAChRs in wake-promoting neurons to facilitate sleep in Drosophila. Using deletion mutagenesis, co-immunoprecipitations, ion flux assays, surface labeling and confocal microscopy, we demonstrate that only loop 2 is required for many of the previously described properties of SSS in transfected cells, including interactions with K channels and nAChRs. Collectively our data suggest that QVR/SSS, and by extension perhaps other Ly6 proteins, target effector molecules using limited protein motifs. Mapping these motifs may be useful in rational design of drugs that mimic or suppress Ly6-effector interactions to modulate nervous system function.

  19. Structural Analysis and Deletion Mutagenesis Define Regions of QUIVER/SLEEPLESS that Are Responsible for Interactions with Shaker-Type Potassium Channels and Nicotinic Acetylcholine Receptors.

    Science.gov (United States)

    Wu, Meilin; Liu, Clifford Z; Joiner, William J

    2016-01-01

    Ly6 proteins are endogenous prototoxins found in most animals. They show striking structural and functional parallels to snake α-neurotoxins, including regulation of ion channels and cholinergic signaling. However, the structural contributions of Ly6 proteins to regulation of effector molecules is poorly understood. This question is particularly relevant to the Ly6 protein QUIVER/SLEEPLESS (QVR/SSS), which has previously been shown to suppress excitability and synaptic transmission by upregulating potassium (K) channels and downregulating nicotinic acetylcholine receptors (nAChRs) in wake-promoting neurons to facilitate sleep in Drosophila. Using deletion mutagenesis, co-immunoprecipitations, ion flux assays, surface labeling and confocal microscopy, we demonstrate that only loop 2 is required for many of the previously described properties of SSS in transfected cells, including interactions with K channels and nAChRs. Collectively our data suggest that QVR/SSS, and by extension perhaps other Ly6 proteins, target effector molecules using limited protein motifs. Mapping these motifs may be useful in rational design of drugs that mimic or suppress Ly6-effector interactions to modulate nervous system function.

  20. Hypoxia induces mitochondrial mutagenesis and dysfunction in inflammatory arthritis.

    LENUS (Irish Health Repository)

    Biniecka, Monika

    2012-02-01

    mitochondrial genome mutagenesis, and antioxidants significantly rescue these events.

  1. Codon cassette mutagenesis: a general method to insert or replace individual codons by using universal mutagenic cassettes.

    OpenAIRE

    Kegler-Ebo, D M; Docktor, C M; DiMaio, D

    1994-01-01

    We describe codon cassette mutagenesis, a simple method of mutagenesis that uses universal mutagenic cassettes to deposit single codons at specific sites in double-stranded DNA. A target molecule is first constructed that contains a blunt, double-strand break at the site targeted for mutagenesis. A double-stranded mutagenic codon cassette is then inserted at the target site. Each mutagenic codon cassette contains a three base pair direct terminal repeat and two head-to-head recognition sequen...

  2. Receptor Tyrosine Kinases in Drosophila Development

    Science.gov (United States)

    Sopko, Richelle; Perrimon, Norbert

    2013-01-01

    Tyrosine phosphorylation plays a significant role in a wide range of cellular processes. The Drosophila genome encodes more than 20 receptor tyrosine kinases and extensive studies in the past 20 years have illustrated their diverse roles and complex signaling mechanisms. Although some receptor tyrosine kinases have highly specific functions, others strikingly are used in rather ubiquitous manners. Receptor tyrosine kinases regulate a broad expanse of processes, ranging from cell survival and proliferation to differentiation and patterning. Remarkably, different receptor tyrosine kinases share many of the same effectors and their hierarchical organization is retained in disparate biological contexts. In this comprehensive review, we summarize what is known regarding each receptor tyrosine kinase during Drosophila development. Astonishingly, very little is known for approximately half of all Drosophila receptor tyrosine kinases. PMID:23732470

  3. Viruses and Antiviral Immunity in Drosophila

    Science.gov (United States)

    Xu, Jie; Cherry, Sara

    2013-01-01

    Viral pathogens present many challenges to organisms, driving the evolution of a myriad of antiviral strategies to combat infections. A wide variety of viruses infect invertebrates, including both natural pathogens that are insect-restricted, and viruses that are transmitted to vertebrates. Studies using the powerful tools available in the model organism Drosophila have expanded our understanding of antiviral defenses against diverse viruses. In this review, we will cover three major areas. First, we will describe the tools used to study viruses in Drosophila. Second, we will survey the major viruses that have been studied in Drosophila. And lastly, we will discuss the well-characterized mechanisms that are active against these diverse pathogens, focusing on non-RNAi mediated antiviral mechanisms. Antiviral RNAi is discussed in another paper in this issue. PMID:23680639

  4. Apoptosis in Drosophila: which role for mitochondria?

    Science.gov (United States)

    Clavier, Amandine; Rincheval-Arnold, Aurore; Colin, Jessie; Mignotte, Bernard; Guénal, Isabelle

    2016-03-01

    It is now well established that the mitochondrion is a central regulator of mammalian cell apoptosis. However, the importance of this organelle in non-mammalian apoptosis has long been regarded as minor, mainly because of the absence of a crucial role for cytochrome c in caspase activation. Recent results indicate that the control of caspase activation and cell death in Drosophila occurs at the mitochondrial level. Numerous proteins, including RHG proteins and proteins of the Bcl-2 family that are key regulators of Drosophila apoptosis, constitutively or transiently localize in mitochondria. These proteins participate in the cell death process at different levels such as degradation of Diap1, a Drosophila IAP, production of mitochondrial reactive oxygen species or stimulation of the mitochondrial fission machinery. Here, we review these mitochondrial events that might have their counterpart in human.

  5. Octopaminergic modulation of the visual flight speed regulator of Drosophila.

    Science.gov (United States)

    van Breugel, Floris; Suver, Marie P; Dickinson, Michael H

    2014-05-15

    Recent evidence suggests that flies' sensitivity to large-field optic flow is increased by the release of octopamine during flight. This increase in gain presumably enhances visually mediated behaviors such as the active regulation of forward speed, a process that involves the comparison of a vision-based estimate of velocity with an internal set point. To determine where in the neural circuit this comparison is made, we selectively silenced the octopamine neurons in the fruit fly Drosophila, and examined the effect on vision-based velocity regulation in free-flying flies. We found that flies with inactivated octopamine neurons accelerated more slowly in response to visual motion than control flies, but maintained nearly the same baseline flight speed. Our results are parsimonious with a circuit architecture in which the internal control signal is injected into the visual motion pathway upstream of the interneuron network that estimates groundspeed. © 2014. Published by The Company of Biologists Ltd.

  6. X Chromosome and Autosome Dosage Responses in Drosophila melanogaster Heads

    Science.gov (United States)

    Chen, Zhen-Xia; Oliver, Brian

    2015-01-01

    X chromosome dosage compensation is required for male viability in Drosophila. Dosage compensation relative to autosomes is two-fold, but this is likely to be due to a combination of homeostatic gene-by-gene regulation and chromosome-wide regulation. We have baseline values for gene-by-gene dosage compensation on autosomes, but not for the X chromosome. Given the evolutionary history of sex chromosomes, these baseline values could differ. We used a series of deficiencies on the X and autosomes, along with mutations in the sex-determination gene transformer-2, to carefully measure the sex-independent X-chromosome response to gene dosage in adult heads by RNA sequencing. We observed modest and indistinguishable dosage compensation for both X chromosome and autosome genes, suggesting that the X chromosome is neither inherently more robust nor sensitive to dosage change. PMID:25850426

  7. 2012 Gordon Research Conference on Mutagenesis - Formal Schedule and Speaker/Poster Program

    Energy Technology Data Exchange (ETDEWEB)

    Demple, Bruce [Stony Brook Univ., NY (United States). School of Medicine

    2012-08-24

    The delicate balance among cellular pathways that control mutagenic changes in DNA will be the focus of the 2012 Mutagenesis Gordon Research Conference. Mutagenesis is essential for evolution, while genetic stability maintains cellular functions in all organisms from microbes to metazoans. Different systems handle DNA lesions at various times of the cell cycle and in different places within the nucleus, and inappropriate actions can lead to mutations. While mutation in humans is closely linked to disease, notably cancers, mutational systems can also be beneficial. The conference will highlight topics of beneficial mutagenesis, including full establishment of the immune system, cell survival mechanisms, and evolution and adaptation in microbial systems. Equal prominence will be given to detrimental mutation processes, especially those involved in driving cancer, neurological diseases, premature aging, and other threats to human health. Provisional session titles include Branching Pathways in Mutagenesis; Oxidative Stress and Endogenous DNA Damage; DNA Maintenance Pathways; Recombination, Good and Bad; Problematic DNA Structures; Localized Mutagenesis; Hypermutation in the Microbial World; and Mutation and Disease.

  8. Phosphorylation at serines 216 and 221 is important for Drosophila HeT-A Gag protein stability.

    Directory of Open Access Journals (Sweden)

    Sukhdev S Brar

    Full Text Available Telomeres from Drosophila appear to be very different from those of other organisms - in size and the mechanism of their maintenance. In the absence of the enzyme telomerase, Drosophila telomeres are maintained by retrotransposition of three elements, HeT-A, TART, and TAHRE, but details of their transposition mechanisms are not known. Here we characterized some biochemical characteristics of the HeT-A Gag protein encoded by the HeT-A element to understand this mechanism. The HeT-A Gag protein when overexpressed in S2 cells was localized to the nucleus but was resistant to high salt, detergents and nuclease extraction treatments. Analysis of the HeT-A Gag protein by tandem mass spectrophotometry revealed that serines 216 and 221 are phosphorylated. Substituting these serines with alanine or aspartic acid by site-directed mutagenesis did not result in any changes in HeT-A Gag translocation across the nucleus, suggesting that phosphorylation of these sites is not associated with HeT-A Gag translocation, but time course experiments showed that these phosphorylation sites are important for Gag-protein stability.

  9. REDfly: a Regulatory Element Database for Drosophila.

    Science.gov (United States)

    Gallo, Steven M; Li, Long; Hu, Zihua; Halfon, Marc S

    2006-02-01

    Bioinformatics studies of transcriptional regulation in the metazoa are significantly hindered by the absence of readily available data on large numbers of transcriptional cis-regulatory modules (CRMs). Even the richly annotated Drosophila melanogaster genome lacks extensive CRM information. We therefore present here a database of Drosophila CRMs curated from the literature complete with both DNA sequence and a searchable description of the gene expression pattern regulated by each CRM. This resource should greatly facilitate the development of computational approaches to CRM discovery as well as bioinformatics analyses of regulatory sequence properties and evolution.

  10. Relationship of DNA repair processes to mutagenesis and carcinogenesis in mammalian cells. Progress report, November 1, 1979-October 31, 1980

    International Nuclear Information System (INIS)

    Evans, H.H.

    1980-10-01

    The objective of this research is to determine the role of DNA repair in mutagenesis and carcinogenesis in mammalian cells. Use of the host-cell reactivation viral suicide enrichment procedure was initiated in the isolation of repair-deficient mutants. Lightly mutagenized BHK cells were infected with irradiated Herpes simplex virus (HSV); several radiation-sensitive strains were isolated among the survivors of the infection. The characterization of these strains is progressing and the enrichments are continuing. That alterations in the frequency of mutation of C3H/10T 1/2 cells, occurring as a result of holding the cells in a confluent state following treatment with ethylmethane sulfonate, parallel the alterations in the frequency of neoplastic transformation was found. The repair capabilities of BHK cells were found to be intermediate in comparison to repair-proficient and -deficient human cells with regard to the reactivation of HSV treated with various inactivating agents. The effect of confluency and of low serum levels on DNA synthesis, as well as the response to the cytotoxic effects of MNNG and acriflavin were determined in BHK cells in preparation for the investigation of the role of DNA repair in mutagenesis and transformation. It was also found that C3H/10T 1/2 cells partially recover from the toxic effects of 4-nitroquinoline-1-oxide if they are held in a confluent state for 6 to 22 hrs following treatment. Addition of catalase did not alleviate the toxic effects of 4-NQO. The cells contain a relatively high endogenous level of this enzyme

  11. Overexpression of kermit/dGIPC is associated with lethality in Drosophila melanogaster

    Directory of Open Access Journals (Sweden)

    G.B. Pereira

    2011-04-01

    Full Text Available Insertional mutagenesis is an important tool for functional genomics in Drosophila melanogaster. The insertion site in the KG00562 mutant fly line has been mapped to the CG8709 (herein named DmLpin locus and to the 3’ of kermit (also called dGIPC. This mutant line presents a high lethality rate resulting from a gain of function. To obtain some insight into the biological role of the mutated locus, we have characterized the mutation and its relation to the high mortality of the KG00562 fly line. In this mutant, we did not detect one of the DmLpin transcripts, namely DmLpinK, but we did detect an unusual 2.3-kb mRNA (LpinK-w. Further investigation revealed that the LpinK-w transcript results from an aberrant splicing between the untranslated first exon of DmLpinK and the mini-white marker gene. Lack of DmLpinK or LpinK-w expression does not contribute to lethality, since heterozygous KG00562/Def7860 animals presented lethality rates comparable to those of the wild type. In contrast, the overexpression of kermit was associated with lethality of the KG00562 fly line. Significantly higher levels of kermit were detected in the Malpighian tubules of KG00562/+ flies that presented higher lethality rates than wild-type or KG00562/Def7860 animals, in which the lethality was rescued. In agreement with a recently reported study, our data support the hypothesis that misexpression of kermit/dGIPC could interfere with Drosophila development, with further investigations being needed in this direction.

  12. Environmental Stress Induces Trinucleotide Repeat Mutagenesis in Human Cells by Alt-Nonhomologous End Joining Repair.

    Science.gov (United States)

    Chatterjee, Nimrat; Lin, Yunfu; Yotnda, Patricia; Wilson, John H

    2016-07-31

    Multiple pathways modulate the dynamic mutability of trinucleotide repeats (TNRs), which are implicated in neurodegenerative disease and evolution. Recently, we reported that environmental stresses induce TNR mutagenesis via stress responses and rereplication, with more than 50% of mutants carrying deletions or insertions-molecular signatures of DNA double-strand break repair. We now show that knockdown of alt-nonhomologous end joining (alt-NHEJ) components-XRCC1, LIG3, and PARP1-suppresses stress-induced TNR mutagenesis, in contrast to the components of homologous recombination and NHEJ, which have no effect. Thus, alt-NHEJ, which contributes to genetic mutability in cancer cells, also plays a novel role in environmental stress-induced TNR mutagenesis. Published by Elsevier Ltd.

  13. Effect of umuC mutations on targeted and untargeted ultraviolet mutagenesis in bacteriophage lambda

    International Nuclear Information System (INIS)

    Maenhaut-Michel, G.; Caillet-Fauquet, P.

    1984-01-01

    Mutagenesis of phage lambda towards clear-plaque (c + → c) results in two classes of mutants that can be distinguished genetically and morphologically. Indirect mutagenesis, i.e. mutagenesis of unirradiated phage lambdac + stimulated by the ultraviolet irradiation of the Escherichia coli host, results in mixed bursts (c/c + ) of turbid wild-type and clear=plaque mutant phages. Pure bursts of lambdac mutants are induced by irradiation of the phage genome. Irradiation of both phages and host bacteria stimulates the production of the two classes of mutant clones. It is shown that three different mutant alleles of the E. coli umuC gene only prevent the appearance of pure bursts of clear-plaque mutants, while mixed bursts are produced at least as frequently in umuC mutants as in the umuC + parent. (author)

  14. Modeling glial contributions to seizures and epileptogenesis: cation-chloride cotransporters in Drosophila melanogaster.

    Directory of Open Access Journals (Sweden)

    Zeid M Rusan

    Full Text Available Flies carrying a kcc loss-of-function mutation are more seizure-susceptible than wild-type flies. The kcc gene is the highly conserved Drosophila melanogaster ortholog of K+/Cl- cotransporter genes thought to be expressed in all animal cell types. Here, we examined the spatial and temporal requirements for kcc loss-of-function to modify seizure-susceptibility in flies. Targeted RNA interference (RNAi of kcc in various sets of neurons was sufficient to induce severe seizure-sensitivity. Interestingly, kcc RNAi in glia was particularly effective in causing seizure-sensitivity. Knockdown of kcc in glia or neurons during development caused a reduction in seizure induction threshold, cell swelling, and brain volume increase in 24-48 hour old adult flies. Third instar larval peripheral nerves were enlarged when kcc RNAi was expressed in neurons or glia. Results suggest that a threshold of K+/Cl- cotransport dysfunction in the nervous system during development is an important determinant of seizure-susceptibility in Drosophila. The findings presented are the first attributing a causative role for glial cation-chloride cotransporters in seizures and epileptogenesis. The importance of elucidating glial cell contributions to seizure disorders and the utility of Drosophila models is discussed.

  15. Genetic changeover in Drosophila populations

    International Nuclear Information System (INIS)

    Wallace, B.

    1986-01-01

    Three populations of Drosophila melanogaster that were daughter populations of two others with histories of high, continuous radiation exposure [population 5 (irradiated, small population size) gave rise to populations 17 (small) and 18 (large); population 6 (irradiated, large population size) gave rise to population 19 (large)] were maintained for 1 year with no radiation exposure. The frequency with which random combinations of second chromosomes taken from population 19 proved to be lethal changed abruptly after about 8 months, thus revealing the origin of a selectively favored element in that population. (This element may or may not have been the cause of the lethality.) A comparison of the loss of lethals in populations 17 and 18 with a loss that occurred concurrently in the still-irradiated population 5 suggests that a second, selectively favored element had arisen in that population just before populations 17 and 18 were split off. This element was on a nonlethal chromosome. The result in population 5 was the elimination of many lethals from that population, followed by a subsequent increase as mutations occurred in the favored nonlethal chromosome. Populations 17 and 18, with no radiation exposure, underwent a loss of lethals with no subsequent increase. The events described here, as well as others to be described elsewhere, suggest that populations may be subject to episodic periods of rapid gene frequency changes that occur under intense selection pressure. In the instances in which the changeover was revealed by the elimination of preexisting lethals, earlier lethal frequencies were reduced by approximately one-half; the selectively favored elements appear, then, to be favored in the heterozygous--not homozygous--condition

  16. Direct Mutagenesis of Thousands of Genomic Targets using Microarray-derived Oligonucleotides

    DEFF Research Database (Denmark)

    Bonde, Mads; Kosuri, Sriram; Genee, Hans Jasper

    2015-01-01

    Multiplex Automated Genome Engineering (MAGE) allows simultaneous mutagenesis of multiple target sites in bacterial genomes using short oligonucleotides. However, large-scale mutagenesis requires hundreds to thousands of unique oligos, which are costly to synthesize and impossible to scale...... operons in E. coli using this method, which we call Microarray-Oligonucleotide (MO)-MAGE. The resulting mutant library was characterized by high-throughput sequencing to show that all attempted insertions were estimated to have occurred at an average frequency of 0.02 % per loci with 0.4 average...

  17. The influence of glycerol on γ-induced mutagenesis in Salmonella typhimurium cells

    International Nuclear Information System (INIS)

    Basha, S.G.; Krasavin, E.A.; Kozubek, S.; Amirtaev, K.G.

    1990-01-01

    A study was made of the modifying effect of glycerol on the survival rate and γ-radiation-induced mutagenesis of Salmonella typhimurium cells TA98, TA100 and TA102. The DMF value, with respect to the survival rate, was 2.05-0.20. The dependence of the yield of γ-radiation-induced mutants on radiation dose was described by the curve with a maximum; the mutation frequency M(D) was well described by a gradual function M(D)=kD x . DMF values of the induced mutagenesis amounted to 2 for strains TA100 and TA102, and 1.5 for strain TA98

  18. Chromosomal localization of autosomal mutations in Drosophila ...

    Indian Academy of Sciences (India)

    Unknown

    1Drosophila Stock Centre, Department of Studies in Zoology, University of Mysore,. Manasagangotri, Mysore 570 006, ... of genetic markers. In the present study, we have exploited the differences in karyotypic composition between these two subspecies, and their cross-fertility, in order to localize some autosomal genes.

  19. Lamin C and chromatin organization in Drosophila

    Indian Academy of Sciences (India)

    wm4h; Su(var)205/lamCEX187 had nearly normal red eye colour with little evidence of variegation, in contrast to the variegated eyes of the PEV strains crossed to w1118 strains. (figure 5,A&B). Precise excisions of ..... 2003 A P- element insertion screen identified mutations in. 455 novel essential genes in Drosophila.

  20. Second-Order Conditioning in "Drosophila"

    Science.gov (United States)

    Tabone, Christopher J.; de Belle, J. Steven

    2011-01-01

    Associative conditioning in "Drosophila melanogaster" has been well documented for several decades. However, most studies report only simple associations of conditioned stimuli (CS, e.g., odor) with unconditioned stimuli (US, e.g., electric shock) to measure learning or establish memory. Here we describe a straightforward second-order conditioning…

  1. Behavioural reproductive isolation and speciation in Drosophila

    Indian Academy of Sciences (India)

    In the genus Drosophila, the phenomenon of behavioural reproductive isolation, which is an important type of premating (prezygotic) reproductive isolating mechanisms, has been extensively studied and interesting data have been documented. In many cases incomplete sexual isolation has been observed and the pattern ...

  2. The Drosophila melanogaster circadian pacemaker circuit

    Indian Academy of Sciences (India)

    2016-08-26

    Aug 26, 2016 ... As an experimental model system, the fruit fly Drosophila melanogaster has been seminal in shaping our understanding of the circadian clockwork. The wealth of genetic tools at our disposal over the past four decades has enabled discovery of the genetic and molecular bases of circadian rhythmicity.

  3. Functional Neuroanatomy of "Drosophila" Olfactory Memory Formation

    Science.gov (United States)

    Guven-Ozkan, Tugba; Davis, Ronald L.

    2014-01-01

    New approaches, techniques and tools invented over the last decade and a half have revolutionized the functional dissection of neural circuitry underlying "Drosophila" learning. The new methodologies have been used aggressively by researchers attempting to answer three critical questions about olfactory memories formed with appetitive…

  4. Biological effects of radon in Drosophila

    International Nuclear Information System (INIS)

    Pimentel P, A.E.; Tavera D, L.; Cruces M, M.P.; Arceo M, C.; Rosa D, M.E. de la

    1992-04-01

    The main objective of this investigation, is to study the biological effects of the Radon-222 at low dose in 'Drosophila melanogaster'. It is necessary to mention that these effects will analyze from the genetic point of view for: 1) To evaluate in which form the Radon-222 to low dose it influences in some genetic components of the adaptation in Drosophila, such as: fecundity, viability egg-adult and sex proportion. 2) To evaluate which is the genetic effect that induces the Radon to low dose by means of the SMART technique in Drosophila melanogaster, and this way to try of to identify which is the possible mechanism that causes the genetic damage to somatic level. The carried out investigation was divided in three stages: 1. Tests to the vacuum resistance. 2. Test of somatic mutation, and 3. Determination of the presence of radon daughters on the adult of Drosophila. It is necessary to point out that all the experiments were made by triplicate and in each one of them was placed detectors in preset places. Those obtained results are presented inside the 4 charts included in the present work. (Author)

  5. Egg-laying rhythm in Drosophila melanogaster

    Indian Academy of Sciences (India)

    Extensive research has been carried out to understand how circadian clocks regulate various physiological processes in organisms. The discovery of clock genes and the molecular clockwork has helped researchers to understand the possible role of these genes in regulating various metabolic processes. In Drosophila ...

  6. Radiation effects on the drosophila melanogaster genoma

    International Nuclear Information System (INIS)

    Arceo-Maldonado, C.

    1989-01-01

    When DNA of living beings has been damaged, the cells show different responses depending on their physiological state. Repair mechanisms can be classified into two groups: constitutive which are always present in the cells and inductible, which must be stimulated to show themselves. It is suggested that a repair mechanism exists in the drosophila ovules which act upon the damage present in mature spermatozoids. Our aim is to verify whether or not a radiation dosis applied to the female drosophila will modify the frequency of individuals which have lost the paternal sex chromosomes. YW/YW virgin females and XEZ males and fbb-/bS Y y + y were mated for two days in order to collect radiation treated spermatozoids. The results were consistent as to the parameters being evaluated and lead one to suppose that the radiation applied to the female drosophila produced some changes in the ovule metabolism which reduced the frequency of individuals with lost chromosomes. It is believed that ionizing radiation interferes with the repair mechanisms that are existent and constitutive, retarding and hindering the restoration of chromosome fragments and this brings about death of the zygote or death of the eggs which lessens the frequencies of individuals carriers of chromosomic aberrations. Ionizing radiations applied to the female drosophila modifies the frequency of loss of patternal chromosomes and comes about when the radiation dose to the female is 700 rad. (Author)

  7. Analysis of Phagocytosis in the Drosophila Ovary.

    Science.gov (United States)

    Meehan, Tracy L; Serizier, Sandy B; Kleinsorge, Sarah E; McCall, Kimberly

    2016-01-01

    Programmed cell death (PCD) is essential for health and development. Generally, the last step of PCD is clearance, or engulfment, by phagocytes. Engulfment can be broken down into five basic steps: attraction of the phagocyte, recognition of the dying cell, internalization, phagosome maturation, and acidification of the engulfed material. The Drosophila melanogaster ovary serves as an excellent model to study diverse types of PCD and engulfment by epithelial cells. Here, we describe several methods to detect and analyze multiple steps of engulfment in the Drosophila ovary: recognition, vesicle uptake, phagosome maturation, and acidification. Annexin V detects phosphatidylserine, which is flipped to the outer leaflet of the plasma membrane of apoptotic cells, serving as an "eat me" signal. Several germline markers including tral-GFP, Orb, and cleaved Dcp-1 can all be used to label the germline and visualize its uptake into engulfing follicle cells. Drosophila strains expressing GFP and mCherry protein fusions can enable a detailed analysis of phagosome maturation. LysoTracker labels highly acidified compartments, marking phagolysosomes. Together these labels can be used to mark the progression of engulfment in Drosophila follicle cells.

  8. The Drosophila melanogaster circadian pacemaker circuit

    Indian Academy of Sciences (India)

    2008-12-07

    Dec 7, 2008 ... large variety of tissues in the fly such as the eye, brain, pro- boscis, antennae, wings, abdomen, Malpighian tubules and testes (Plautz et al. 1997; Giebultowicz 2001). Although cell-autonomous circadian function is attributed to several tissues in Drosophila, circadian pacemaker neurons located in the brain ...

  9. Lamin C and chromatin organization in Drosophila

    Indian Academy of Sciences (India)

    Drosophila lamin C (LamC) is a developmentally regulated component of the nuclear lamina. The lamC gene is situated in the fifth intron of the essential gene tout velu (ttv). We carried out genetic analysis of lamC during development. Phenotypic analyses of RNAi-mediated downregulation of lamC expression as well as ...

  10. The Drosophila bipectinata species complex: phylogenetic ...

    Indian Academy of Sciences (India)

    Navya

    Acad. Sci India 82, 99-115. Tomimura Y., Matsuda, M. and Tobari, Y. N. 2005 Chromosomal phylogeny and geographical divergence in the Drosophila bipectinata complex. Genome 48, 487–502. White M. J. D. 1958 Restriction and recombination in grasshopper populations and species. Cold Spr. Harb. Symp. Quant. Biol.

  11. Sex determining signal in Drosophila melanogaster

    Indian Academy of Sciences (India)

    Administrator

    Drosophila; sex determination; X/A ratio; Sex-lethal. Sexual dimorphism is the most striking naturally occurring phenotypic variation that is a direct outcome of a simple. Mendelian segregation. Molecular genetic dissection of mechanisms underlying sexual development in organisms ranging from flies to humans has been a ...

  12. Radioresistance and radiosensitivity in Drosophila melanogaster

    International Nuclear Information System (INIS)

    Reguly, M.L.; Marques, E.K.

    1987-01-01

    The mechanisms of radioresistance in Drosophila are studied. The mutagenic effects of 5KR of 60 Cobalt gamma radiation and of 0,006M dose of ethyl methanesulfonate (EMS) on four D. Melanogaster strains (RC 1 , CO 3 , BUE and LEN) are investigated. (M.A.C.) [pt

  13. Drosophila Melanogaster as an Experimental Organism.

    Science.gov (United States)

    Rubin, Gerald M.

    1988-01-01

    Discusses the role of the fruit fly in genetics research requiring a multidisciplinary approach. Describes embryological and genetic methods used in the experimental analysis of this organism. Outlines the use of Drosophila in the study of the development and function of the nervous system. (RT)

  14. Intersex (ix) mutations of Drosophila melanogaster cause ...

    Indian Academy of Sciences (India)

    In Drosophila, a hierarchy of regulatory genes control somatic sexual differences (Baker 1989; Burtis and ... also function independently of dsx to regulate other aspects of sexual differentiation in tissue-specific manner. .... bination, for facilitating the analysis of single and double mutant genotypes. Double homozygote males ...

  15. Mapping selection within Drosophila melanogaster embryo's anatomy

    DEFF Research Database (Denmark)

    Salvador-Martínez, Irepan; Coronado-Zamora, Marta; Castellano, David

    2018-01-01

    We present a survey of selection across Drosophila melanogaster embryonic anatomy. Our approach integrates genomic variation, spatial gene expression patterns and development, with the aim of mapping adaptation over the entire embryo's anatomy. Our adaptation map is based on analyzing spatial gen...

  16. Developing a Drosophila Model of Schwannomatosis

    Science.gov (United States)

    2013-02-01

    General Hospital Cancer Center, Harvard Medical School, Charlestown, Massachusetts 02129, USA; 2Computer Science and Artificial Intelligence Laboratory...1384–1387. 61. Petersen UM, Kadalayil L, Rehorn KP, Hoshizaki DK, Reuter R, et al. (1999) Serpent regulates Drosophila immunity genes in the larval

  17. Intersex (ix) mutations of Drosophila melanogaster cause ...

    Indian Academy of Sciences (India)

    In Drosophila melanogaster, the intersex (ix) is a terminally positioned gene in somatic sex determination hierarchy and function with the female specific product of double sex (DSXF) to implement female sexual differentiation. The null phenotype of ix is to transform diplo-X individuals into intersexes while leaving haplo-X ...

  18. The Drosophila bipectinata species complex: phylogenetic ...

    Indian Academy of Sciences (India)

    [Banerjee P. and Singh B. N. 2017 The Drosophila bipectinata species complex: phylogenetic relationship among different members based on chromosomal variations. J. Genet. 96, 97–107]. Introduction ..... loops touch the chromocenter and in our microphotograph. (depicting both the arms) too, the involvement of chromo-.

  19. Drosophila increase exploration after visually detecting predators.

    Directory of Open Access Journals (Sweden)

    Miguel de la Flor

    Full Text Available Novel stimuli elicit behaviors that are collectively known as specific exploration. These behaviors allow the animal to become more familiar with the novel objects within its environment. Specific exploration is frequently suppressed by defensive reactions to predator cues. Herein, we examine if this suppression occurs in Drosophila melanogaster by measuring the response of these flies to wild harvested predators. The flies used in our experiments have been cultured and had not lived under predator threat for multiple decades. In a circular arena with centrally-caged predators, wild type Drosophila actively avoided the pantropical jumping spider, Plexippus paykulli, and the Texas unicorn mantis, Phyllovates chlorophaena, indicating an innate defensive reaction to these predators. Interestingly, wild type Drosophila males also avoided a centrally-caged mock spider, and the avoidance of the mock spider became exaggerated when it was made to move within the cage. Visually impaired Drosophila failed to detect and avoid the Plexippus paykulli and the moving mock spider, while the broadly anosmic orco2 mutants were fully capable of detecting and avoiding Plexippus paykulli, indicating that these flies principally relied upon vison to perceive the predator stimuli. During early exploration of the arena, exploratory activity increased in the presence of Plexippus paykulli and the moving mock spider. The elevated activity induced by Plexippus paykulli disappeared after the fly had finished exploring, suggesting the flies were capable of habituating the predator cues. Taken together, these results indicate that despite being isolated from predators for decades Drosophila will visually detect these predators, retain innate defensive behaviors, respond by increasing exploratory activity in the arena rather than suppressing activity, and may habituate to normal predator cues.

  20. Optogenetic pacing in Drosophila melanogaster (Conference Presentation)

    Science.gov (United States)

    Alex, Aneesh; Li, Airong; Men, Jing; Jerwick, Jason; Tanzi, Rudolph E.; Zhou, Chao

    2016-03-01

    A non-invasive, contact-less cardiac pacing technology can be a powerful tool in basic cardiac research and in clinics. Currently, electrical pacing is the gold standard for cardiac pacing. Although highly effective in controlling the cardiac function, the invasive nature, non-specificity to cardiac tissues and possible tissue damage limits its capabilities. Optical pacing of heart is a promising alternative, which is non-invasive and more specific, has high spatial and temporal precision, and avoids shortcomings in electrical stimulation. Optical coherence tomography has been proved to be an effective technique in non-invasive imaging in vivo with ultrahigh resolution and imaging speed. In the last several years, non-invasive specific optical pacing in animal hearts has been reported in quail, zebrafish, and rabbit models. However, Drosophila Melanogaster, which is a significant model with orthologs of 75% of human disease genes, has rarely been studied concerning their optical pacing in heart. Here, we combined optogenetic control of Drosophila heartbeat with optical coherence microscopy (OCM) technique for the first time. The light-gated cation channel, channelrhodopsin-2 (ChR2) was specifically expressed by transgene as a pacemaker in drosophila heart. By stimulating the pacemaker with 472 nm pulsed laser light at different frequencies, we achieved non-invasive and more specific optical control of the Drosophila heart rhythm, which demonstrates the wide potential of optical pacing for studying cardiac dynamics and development. Imaging capability of our customized OCM system was also involved to observe the pacing effect visually. No tissue damage was found after long exposure to laser pulses, which proved the safety of optogenetic control of Drosophila heart.

  1. Organization and evolution of Drosophila terminin: similarities and differences between Drosophila and human telomeres

    Directory of Open Access Journals (Sweden)

    Grazia Daniela Raffa

    2013-05-01

    Full Text Available Drosophila lacks telomerase and fly telomeres are elongated by occasional transposition of three specialized retroelements. Drosophila telomeres do not terminate with GC-rich repeats and are assembled independently of the sequence of chromosome ends. Recent work has shown that Drosophila telomeres are capped by the terminin complex, which includes the fast-evolving proteins HOAP, HipHop, Moi and Ver. These proteins are not conserves outside Drosophilidae and localize and function exclusively at telomeres, protecting them from fusion events. Other proteins required to prevent end-to-end fusion in flies include HP1, Eff/UbcD1, ATM, the components of the Mre11-Rad50-Nbs (MRN complex, and the Woc transcription factor. These proteins do not share the terminin properties; they are evolutionarily conserved non-fast-evolving proteins that do not accumulate only telomeres and do not serve telomere-specific functions. We propose that following telomerase loss, Drosophila rapidly evolved terminin to bind chromosome ends in a sequence-independent manner. This hypothesis suggests that terminin is the functional analog of the shelterin complex that protects human telomeres. The non-terminin proteins are instead likely to correspond to ancestral telomere-associated proteins that did not evolve as rapidly as terminin because of the functional constraints imposed by their involvement in diverse cellular processes. Thus, it appears that the main difference between Drosophila and human telomeres is in the protective complexes that specifically associate with the DNA termini. We believe that Drosophila telomeres offer excellent opportunities for investigations on human telomere biology. The identification of additional Drosophila genes encoding non-terminin proteins involved in telomere protection might lead to the discovery of novel components of human telomeres.

  2. Differential expression of SOS genes in an E. coli mutant producing unstable lexA protein enhances excision repair but inhibits mutagenesis

    International Nuclear Information System (INIS)

    Peterson, K.R.; Ganesan, A.K.; Mount, D.W.; Stanford Univ., CA)

    1986-01-01

    The SOS response is displayed following treatments which damage DNA or inhibit DNA replication. Two associated activities include enhanced capacity for DNA repair resulting from derepression of the recA, uvrA, uvrB and uvrD genes and increased mutagenesis due to derepression of recA, umuC and umuD. These changes are the consequence of the derepression of at least seventeen unlinked operons negatively regulated by LexA repressor. Following treatments that induce the SOS response, a signal molecule interacts with RecA protein, converting it to an activated form. Activated RecA protein facilitates the proteolytic cleavage of LexA repressor, which results in derepression of the regulon. The cell then enters a new physiological state during which time DNA repair processes are augmented. The lexA41 mutant of E. coli is a uv-resistant derivative of another mutant, lexA3, which produces a repressor that is not cleaved following inducing treatments. The resultant protein is unstable. Lac operon fusions to most of the genes in the SOS regulon were used to show that the various damage-inducible genes were derepressed to different extents. uvrA, B, and D were almost fully derepressed. Consistent with this finding, the rate of removal of T4 endonuclease V-sensitive sites was more rapid in the uv-irradiated lexA41 mutant than in normal cells, suggesting a more active excision repair system. We propose that the instability of the LexA41 protein reduces the intracellular concentration of repressor to a level that allows a high level of excision repair. The additional observation that SOS mutagenesis was only weakly induced in a lexA41 uvrA - mutant implies that the mutant protein partially represses one or more genes whose products promote SOS mutagenesis. 17 refs., 4 figs., 1 tab

  3. FlyTED: the Drosophila Testis Gene Expression Database

    OpenAIRE

    Zhao, Jun; Klyne, Graham; Benson, Elizabeth; Gudmannsdottir, Elin; White-Cooper, Helen; Shotton, David

    2009-01-01

    FlyTED, the Drosophila Testis Gene Expression Database, is a biological research database for gene expression images from the testis of the fruit fly Drosophila melanogaster. It currently contains 2762 mRNA in situ hybridization images and ancillary metadata revealing the patterns of gene expression of 817 Drosophila genes in testes of wild type flies and of seven meiotic arrest mutant strains in which spermatogenesis is defective. This database has been built by adapting a widely used digita...

  4. Early Olfactory Processing in Drosophila: Mechanisms and Principles

    OpenAIRE

    Wilson, Rachel I.

    2013-01-01

    In the olfactory system of Drosophila melanogaster, it is relatively straightforward to make in vivo measurements of activity in neurons corresponding to targeted processing. This, together with the numerical simplicity of the Drosophila olfactory system, has produced rapid gains in our understanding of Drosophila olfaction. This review summarizes the neurophysiology of the first two layers of this system: the peripheral olfactory receptor neurons and their postsynaptic targets in the antenna...

  5. Workshop on ENU Mutagenesis: Planning for Saturation, July 25-28, 2002

    Energy Technology Data Exchange (ETDEWEB)

    Nadeau, Joseph H

    2002-07-25

    The goal of the conference is to enhance the development of improved technologies and new approaches to the identification of genes underlying chemically-induced mutant phenotypes. The conference brings together ENU mutagenesis experts from the United States and aborad for a small, intensive workshop to consider these issues.

  6. Efficient method for site-directed mutagenesis in large plasmids without subcloning.

    Directory of Open Access Journals (Sweden)

    Louay K Hallak

    Full Text Available Commonly used methods for site-directed DNA mutagenesis require copying the entire target plasmid. These methods allow relatively easy modification of DNA sequences in small plasmids but become less efficient and faithful for large plasmids, necessitating full sequence verification. Introduction of mutations in larger plasmids requires subcloning, a slow and labor-intensive process, especially for multiple mutations. We have developed an efficient DNA mutagenesis technique, UnRestricted Mutagenesis and Cloning (URMAC that replaces subcloning steps with quick biochemical reactions. URMAC does not suffer from plasmid size constraints and allows simultaneous introduction of multiple mutations. URMAC involves manipulation of only the mutagenesis target site(s, not the entire plasmid being mutagenized, therefore only partial sequence verification is required. Basic URMAC requires two PCR reactions, each followed by a ligation reaction to circularize the product, with an optional third enrichment PCR step followed by a traditional cloning step that requires two restriction sites. Here, we demonstrate URMAC's speed, accuracy, and efficiency through several examples, creating insertions, deletions or substitutions in plasmids ranging from 2.6 kb to 17 kb without subcloning.

  7. Efficient method for site-directed mutagenesis in large plasmids without subcloning.

    Science.gov (United States)

    Hallak, Louay K; Berger, Kelly; Kaspar, Rita; Kwilas, Anna R; Montanaro, Federica; Peeples, Mark E

    2017-01-01

    Commonly used methods for site-directed DNA mutagenesis require copying the entire target plasmid. These methods allow relatively easy modification of DNA sequences in small plasmids but become less efficient and faithful for large plasmids, necessitating full sequence verification. Introduction of mutations in larger plasmids requires subcloning, a slow and labor-intensive process, especially for multiple mutations. We have developed an efficient DNA mutagenesis technique, UnRestricted Mutagenesis and Cloning (URMAC) that replaces subcloning steps with quick biochemical reactions. URMAC does not suffer from plasmid size constraints and allows simultaneous introduction of multiple mutations. URMAC involves manipulation of only the mutagenesis target site(s), not the entire plasmid being mutagenized, therefore only partial sequence verification is required. Basic URMAC requires two PCR reactions, each followed by a ligation reaction to circularize the product, with an optional third enrichment PCR step followed by a traditional cloning step that requires two restriction sites. Here, we demonstrate URMAC's speed, accuracy, and efficiency through several examples, creating insertions, deletions or substitutions in plasmids ranging from 2.6 kb to 17 kb without subcloning.

  8. Random mutagenesis of human serine racemase reveals residues important for the enzymatic activity

    Czech Academy of Sciences Publication Activity Database

    Hoffman, Hillary Elizabeth; Jirásková, Jana; Zvelebil, M.; Konvalinka, Jan

    2010-01-01

    Roč. 75, č. 1 (2010), s. 59-79 ISSN 0010-0765 R&D Projects: GA MŠk 1M0508 Institutional research plan: CEZ:AV0Z40550506 Keywords : D-serine * serine racemase * random mutagenesis Subject RIV: CE - Biochemistry Impact factor: 0.853, year: 2010

  9. Relationship of DNA repair processes to mutagenesis and carcinogenesis in mammalian cells. Final report, August 1, 1977-January 31, 1985

    International Nuclear Information System (INIS)

    Evans, H.H.

    1985-01-01

    We have compared the lethal, mutagenic, and carcinogenic effects of radiation and alkylating agents in several types of cells. In C3H 10T 1/2 cells, lethal effects decreased, while the frequency of ouabain-resistant mutants and of transformed cells increased during a 4-hour holding period following EMS treatment. To isolate repair-deficient mutants, we used diploid BHK cells which were characterized with regard to reactivation of uv- and x-irradiated Herpes Simplex virus (HSV). Three radiation-sensitive BHK strains were isolated using a host cell viral-reactivation suicide procedure. Two of these strains were sensitive to the cytotoxic effects of alkylating agents. One strain was hypermutable and one hypomutable following treatment with EMS. Mouse lymphoma strain L5178Y-S (LY-S), though more sensitive to the lethal effects of X radiation and alkylating agents than strain L5178Y-R (LY-R), was less mutable by these agents at the Na + /K + ATPase and hypoxanthine/guanine phosphoribosyltransferase (HGPRT) loci. Strain LY-S exhibited less dose-rate dependence for lethal effects than strain LY-R, but no dose-rate dependence was observed in radiation-induced mutagenesis for either strain. Repair of x ray-induced potentially lethal damage (PLD) at 25 0 was observed for strain LY-S but not LY-R. Addition of 3-aminobenzamide (2 mm) to the medium sensitized both strains to x radiation, uv radiation and MNU, and inhibited rapair of x ray-induced PLD in strain LY-S

  10. Additive Expression of Consolidated Memory through Drosophila Mushroom Body Subsets.

    Directory of Open Access Journals (Sweden)

    Chu-Huai Yang

    2016-05-01

    Full Text Available Associative olfactory memory in Drosophila has two components called labile anesthesia-sensitive memory and consolidated anesthesia-resistant memory (ARM. Mushroom body (MB is a brain region critical for the olfactory memory and comprised of 2000 neurons that can be classified into αβ, α'β', and γ neurons. Previously we demonstrated that two parallel pathways mediated ARM consolidation: the serotonergic dorsal paired medial (DPM-αβ neurons and the octopaminergic anterior paired lateral (APL-α'β' neurons. This finding prompted us to ask how this composite ARM is retrieved. Here, we showed that blocking the output of αβ neurons and that of α'β' neurons each impaired ARM retrieval, and blocking both simultaneously had an additive effect. Knockdown of radish and octβ2R in αβ and α'β' neurons, respectively, impaired ARM. A combinatorial assay of radish mutant background rsh1 and neurotransmission blockade confirmed that ARM retrieved from α'β' neuron output is independent of radish. We identified MBON-β2β'2a and MBON-β'2mp as the MB output neurons downstream of αβ and α'β' neurons, respectively, whose glutamatergic transmissions also additively contribute to ARM retrieval. Finally, we showed that α'β' neurons could be functionally subdivided into α'β'm neurons required for ARM retrieval, and α'β'ap neurons required for ARM consolidation. Our work demonstrated that two parallel neural pathways mediating ARM consolidation in Drosophila MB additively contribute to ARM expression during retrieval.

  11. Identification of genes that promote or inhibit olfactory memory formation in Drosophila.

    Science.gov (United States)

    Walkinshaw, Erica; Gai, Yunchao; Farkas, Caitlin; Richter, Daniel; Nicholas, Eric; Keleman, Krystyna; Davis, Ronald L

    2015-04-01

    Genetic screens in Drosophila melanogaster and other organisms have been pursued to filter the genome for genetic functions important for memory formation. Such screens have employed primarily chemical or transposon-mediated mutagenesis and have identified numerous mutants including classical memory mutants, dunce and rutabaga. Here, we report the results of a large screen using panneuronal RNAi expression to identify additional genes critical for memory formation. We identified >500 genes that compromise memory when inhibited (low hits), either by disrupting the development and normal function of the adult animal or by participating in the neurophysiological mechanisms underlying memory formation. We also identified >40 genes that enhance memory when inhibited (high hits). The dunce gene was identified as one of the low hits and further experiments were performed to map the effects of the dunce RNAi to the α/β and γ mushroom body neurons. Additional behavioral experiments suggest that dunce knockdown in the mushroom body neurons impairs memory without significantly affecting acquisition. We also characterized one high hit, sickie, to show that RNAi knockdown of this gene enhances memory through effects in dopaminergic neurons without apparent effects on acquisition. These studies further our understanding of two genes involved in memory formation, provide a valuable list of genes that impair memory that may be important for understanding the neurophysiology of memory or neurodevelopmental disorders, and offer a new resource of memory suppressor genes that will aid in understanding restraint mechanisms employed by the brain to optimize resources. Copyright © 2015 by the Genetics Society of America.

  12. CoinFLP: a system for efficient mosaic screening and for visualizing clonal boundaries in Drosophila.

    Science.gov (United States)

    Bosch, Justin A; Tran, Ngoc Han; Hariharan, Iswar K

    2015-02-01

    Screens in mosaic Drosophila tissues that use chemical mutagenesis have identified many regulators of growth and patterning. Many of the mutant phenotypes observed were contingent upon the presence of both wild-type and mutant cells in the same tissue. More recently, large collections of RNAi lines or cDNAs expressed under Gal4/UAS control have been used to alter gene expression uniformly in specific tissues. However, these newer approaches are not easily combined with the efficient generation of genetic mosaics. The CoinFLP system described here enables mosaic screens in the context of gene knockdown or overexpression by automatically generating a reliable ratio of mutant to wild-type tissue in a developmentally controlled manner. CoinFLP-Gal4 generates mosaic tissues composed of clones of which only a subset expresses Gal4. CoinFLP-LexGAD/Gal4 generates tissues composed of clones that express either Gal4 or LexGAD, thus allowing the study of interactions between different types of genetically manipulated cells. By combining CoinFLP-LexGAD/Gal4 with the split-GFP system GRASP, boundaries between genetically distinct cell populations can be visualized at high resolution. © 2015. Published by The Company of Biologists Ltd.

  13. Genetic analysis of the ADGF multigene family by homologous recombination and gene conversion in Drosophila.

    Science.gov (United States)

    Dolezal, Tomas; Gazi, Michal; Zurovec, Michal; Bryant, Peter J

    2003-10-01

    Many Drosophila genes exist as members of multigene families and within each family the members can be functionally redundant, making it difficult to identify them by classical mutagenesis techniques based on phenotypic screening. We have addressed this problem in a genetic analysis of a novel family of six adenosine deaminase-related growth factors (ADGFs). We used ends-in targeting to introduce mutations into five of the six ADGF genes, taking advantage of the fact that five of the family members are encoded by a three-gene cluster and a two-gene cluster. We used two targeting constructs to introduce loss-of-function mutations into all five genes, as well as to isolate different combinations of multiple mutations, independent of phenotypic consequences. The results show that (1) it is possible to use ends-in targeting to disrupt gene clusters; (2) gene conversion, which is usually considered a complication in gene targeting, can be used to help recover different mutant combinations in a single screening procedure; (3) the reduction of duplication to a single copy by induction of a double-strand break is better explained by the single-strand annealing mechanism than by simple crossing over between repeats; and (4) loss of function of the most abundantly expressed family member (ADGF-A) leads to disintegration of the fat body and the development of melanotic tumors in mutant larvae.

  14. Alternative NF-κB Isoforms in the Drosophila Neuromuscular Junction and Brain.

    Directory of Open Access Journals (Sweden)

    Bo Zhou

    Full Text Available The Drosophila NF-κB protein Dorsal is expressed at the larval neuromuscular junction, where its expression appears unrelated to known Dorsal functions in embryonic patterning and innate immunity. Using confocal microscopy with domain-specific antisera, we demonstrate that larval muscle expresses only the B isoform of Dorsal, which arises by intron retention. We find that Dorsal B interacts with and stabilizes Cactus at the neuromuscular junction, but exhibits Cactus independent localization and an absence of detectable nuclear translocation. We further find that the Dorsal-related immune factor Dif encodes a B isoform, reflecting a conservation of B domains across a range of insect NF-κB proteins. Carrying out mutagenesis of the Dif locus via a site-specific recombineering approach, we demonstrate that Dif B is the major, if not sole, Dif isoform in the mushroom bodies of the larval brain. The Dorsal and Dif B isoforms thus share a specific association with nervous system tissues as well as an alternative protein structure.

  15. Molecular cloning, functional expression, and gene silencing of two Drosophila receptors for the Drosophila neuropeptide pyrokinin-2

    DEFF Research Database (Denmark)

    Rosenkilde, Carina; Cazzamali, Giuseppe; Williamson, Michael

    2003-01-01

    The database of the Drosophila Genome Project contains the sequences of two genes, CG8784 and CG8795, predicted to code for two structurally related G protein-coupled receptors. We have cloned these genes and expressed their coding parts in Chinese hamster ovary cells. We found that both receptors...... can be activated by low concentrations of the Drosophila neuropeptide pyrokinin-2 (CG8784, EC(50) for pyrokinin-2, 1x10(-9)M; CG8795, EC(50) for pyrokinin-2, 5 x 10(-10)M). The precise role of Drosophila pyrokinin-2 (SVPFKPRLamide) in Drosophila is unknown, but in other insects, pyrokinins have...... embryos and first instar larvae. In addition to the two Drosophila receptors, we also identified two probable pyrokinin receptors in the genomic database from the malaria mosquito Anopheles gambiae. The two Drosophila pyrokinin receptors are, to our knowledge, the first invertebrate pyrokinin receptors...

  16. Origin and Evolution of Y chromosomes: Drosophila tales

    Science.gov (United States)

    Carvalho, A. Bernardo; Koerich, Leonardo B.; Clark, Andrew G.

    2010-01-01

    Classically Y chromosomes are thought to originate from X chromosomes through a process of degeneration and gene loss. Now, the availability of 12 Drosophila genomes provides the opportunity to study the origin and evolution of Y chromosomes in an informative phylogenetic context. Surprisingly, the majority of Drosophila Y-linked genes are recent acquisitions from autosomes, and Y chromosome gene gains are more frequent than gene losses. Moreover, the D. pseudoobscura Y chromosome lacks homology with the Y of most Drosophila species. Thus the Drosophila Y has a different evolutionary history from canonical Y chromosomes (such as the mammalian Y), and it also might have a different origin. PMID:19443075

  17. Mutants dissecting development and behaviour in drosophila

    International Nuclear Information System (INIS)

    Joshi, Adita; Chandrashekaran, Shanti; Sharma, R.P.

    2005-01-01

    We have traced in this paper the progress in Drosophila genetics research from the 1960s, at the IARI, spearheaded by the visionary insight of M. S. Swaminathan. The work started with the study of indirect effect of radiation and the synergistic interaction of physical and chemical mutagens on chromosomal and genetic changes. This paved the way for the study of single gene mutants in dissecting developmental and behavioural processes. New genes discovered by us have been shown to encode conserved cell signalling molecules controlling developmental and behavioural pathways. With the complete sequencing of the Drosophila genome, in the year 2000, mounting evidence for the homology between Drosophila and human genes controlling genetic disorders became available. This has led to the fly becoming an indispensable tool for studying human diseases as well as a model to test for drugs and pharmaceuticals against human diseases and complex behavioural processes. For example wingless in Drosophila belongs to the conserved Wnt gene family and aberrant WNT signalling is linked to a range of human diseases, most notably cancer. Inhibition as well as activation of WNT signalling form the basis of an effective therapy for some cancers as well as several other clinical conditions. Recent experiments have shown that WNTs might also normally participate in self-renewal, proliferation or differentiation of stem cells and altering WNT signalling might be beneficial to the use of stem cells for therapeutic means. Likewise, the stambhA mutant of Drosophila which was discovered for its temperature-dependent paralytic behaviour is the fly homologue of Phospholipase Cβ. Phospholipase C mediated G protein signalling plays a central role in vital processes controlling epilepsy, vision, taste, and olfaction in animals. Proteins of the G-signalling pathway are of intense research interest since many human diseases involve defects in G-protein signalling pathways. In fact, approximately 50

  18. A Mutant Mouse with a Highly Specific Contextual Fear-Conditioning Deficit Found in an N-Ethyl-N-Nitrosourea (ENU) Mutagenesis Screen

    Science.gov (United States)

    Pletcher, Mathew T.; Wiltshire, Tim; Tarantino, Lisa M.; Mayford, Mark; Reijmers, Leon G.; Coats, Jennifer K.

    2006-01-01

    Targeted mutagenesis in mice has shown that genes from a wide variety of gene families are involved in memory formation. The efficient identification of genes involved in learning and memory could be achieved by random mutagenesis combined with high-throughput phenotyping. Here, we provide the first report of a mutagenesis screen that has…

  19. Discrimination of tomatoes bred by spaceflight mutagenesis using visible/near infrared spectroscopy and chemometrics.

    Science.gov (United States)

    Shao, Yongni; Xie, Chuanqi; Jiang, Linjun; Shi, Jiahui; Zhu, Jiajin; He, Yong

    2015-04-05

    Visible/near infrared spectroscopy (Vis/NIR) based on sensitive wavelengths (SWs) and chemometrics was proposed to discriminate different tomatoes bred by spaceflight mutagenesis from their leafs or fruits (green or mature). The tomato breeds were mutant M1, M2 and their parent. Partial least squares (PLS) analysis and least squares-support vector machine (LS-SVM) were implemented for calibration models. PLS analysis was implemented for calibration models with different wavebands including the visible region (400-700 nm) and the near infrared region (700-1000 nm). The best PLS models were achieved in the visible region for the leaf and green fruit samples and in the near infrared region for the mature fruit samples. Furthermore, different latent variables (4-8 LVs for leafs, 5-9 LVs for green fruits, and 4-9 LVs for mature fruits) were used as inputs of LS-SVM to develop the LV-LS-SVM models with the grid search technique and radial basis function (RBF) kernel. The optimal LV-LS-SVM models were achieved with six LVs for the leaf samples, seven LVs for green fruits, and six LVs for mature fruits, respectively, and they outperformed the PLS models. Moreover, independent component analysis (ICA) was executed to select several SWs based on loading weights. The optimal LS-SVM model was achieved with SWs of 550-560 nm, 562-574 nm, 670-680 nm and 705-71 5 nm for the leaf samples; 548-556 nm, 559-564 nm, 678-685 nm and 962-974 nm for the green fruit samples; and 712-718 nm, 720-729 nm, 968-978 nm and 820-830 nm for the mature fruit samples. All of them had better performance than PLS and LV-LS-SVM, with the parameters of correlation coefficient (rp), root mean square error of prediction (RMSEP) and bias of 0.9792, 0.2632 and 0.0901 based on leaf discrimination, 0.9837, 0.2783 and 0.1758 based on green fruit discrimination, 0.9804, 0.2215 and -0.0035 based on mature fruit discrimination, respectively. The overall results indicated that ICA was an effective way for the

  20. Comparative radiation genetics. What we learnt from our studies on Medaka germ cell mutagenesis

    International Nuclear Information System (INIS)

    Shima, Akihiro

    2004-01-01

    Having been interested in studying germ cell mutagenesis from the biodiversity viewpoint, in 1985 we started developing a nonmammalian specific-locus test (SLT) system using the Medaka, Oryzias latipes. The tester strain with five marker loci, which is a prerequisite for SLT, was established by consecutive crossings of five spontaneous single mutants followed by selection based on the phenotype of each mutant. The genetic endpoints available were dominant lethal mutations (DLM), total specific-locus mutations (TSLM) and viable specific-locus mutations. Using γ-rays, ethylnitrosourea and Fe-ion beam as mutagens to which wild type males or females were exposed, we screened approx. 1.6 million F1 embryos that correspond to approx. 4.7 million loci. In an attempt to best express the comparative sensitivity of Medaka germ cells to the genetic effects of γ-rays, the gametic doubling doses for acute and high-dose γ-rays were estimated. Extensive sex differences within the wild type (HNI) strain as well as strain differences in male germ cells between the two wild type strains (HNI and Sakura) were notably found in doubling doses for DLM and TSLM. Interestingly, among these values, the doubling dose for TSLM in spermatogonia of the HNI strain (0.33 Gy) nearly coincided with that estimated from the Russell 7-locus system of mice (0.44 Gy). Our data also suggested that the initial genomic changes induced in male germ cells would not straightforwardly manifest themselves as phenotypic effects in F1 progeny, but that twofold checks, one a prefertilization check in the gonads against genomic alterations using DNA repair machinery as well as apoptotic response, and the other postfertilization check in developing embryos through dominant lethal effects. should operate to restore or ameliorate those genomic changes. More mechanistically, AP/PCR-RAPD DNA fingerprinting was employed in order to scan as wider regions of the zygotic genome as possible. These anonymous DNA markers

  1. Radiation induced mutagenesis in soybean (Glycine Max L. Merrill)

    International Nuclear Information System (INIS)

    Wakode, M.M.; Nandanwar, R.S.; Patil, G.P.

    2000-01-01

    The mutagenic effects of gamma rays (10, 20 and 30 kR) on some biological parameter in M1 generation and frequency and spectrum of chlorophyll and morphological mutations in five cultivars of soybean viz. JS-8021, JS-335, JS- 7105, Monetta and PKV -1 have been studied. A dose dependant decrease was noticed in most of the characters like root length, shoot length, germination, plant height, plant survival and pollen sterility. While seedling height, number of seeds per pod and number of branches per plant were not affected significantly. The highest frequency and spectrum of chlorophyll and morphological mutations was noticed in variety JS-8021 in which 20 different gene loci for various characters were mutated. However variety JS- 7105 showed less radio sensitive response for different traits in which only 12 different loci were mutated. While JS-335, monetta and PKV-I showed moderate response to frequency and spectrum of various mutations. These varieties showed differential response to radio sensitivity, some useful mutations included, high yielding mutant in 20 kR, non shattering mutant in 30 kR and vine type mutant in 10 kR in variety monetta. Extra early type, erect and high branched type mutant were recorded with high frequency in 10 and 20 kR respectively in variety JS-8021. In general, 20 kR dose was found more effective in all the varieties studied. (author)

  2. Green fluorescent protein/beta-galactosidase double reporters for visualizing Drosophila gene expression patterns.

    Science.gov (United States)

    Timmons, L; Becker, J; Barthmaier, P; Fyrberg, C; Shearn, A; Fyrberg, E

    1997-01-01

    We characterized 120 novel yeast Ga14-targeted enhancer trap lines in Drosophila using upstream activating sequence (UAS) reporter plasmids incorporating newly constructed fusions of Aequorea victoria green fluorescent protein (GFP) and Escherichia coli beta-galactosidase genes. Direct comparisons of GFP epifluorescence and beta-galactosidase staining revealed that both proteins function comparably to their unconjugated counterparts within a wide variety of Drosophila tissues. Generally, both reporters accumulated in similar patterns within individual lines, but in some tissues, e.g., brain, GFP staining was more reliable than that of beta-galactosidase, whereas in other tissues, most notably tests and ovaries, the converse was true. In cases of weak enhancers, we occasionally could detect beta-galactosidase staining in the absence of discernible GFP fluorescence. This shortcoming of GFP can, in most cases, be alleviated by using the more efficient S65T GFP derivative. The GFP/beta-gal reporter fusion protein facilitated monitoring several aspects of protein accumulation. In particular, the ability to visualize GFP fluorescence enhances recognition of global static and dynamic patterns in live animals, whereas beta-galactosidase histochemistry affords sensitive high resolution protein localization. We present a catalog of Ga 14-expressing strains that will be useful for investigating several aspects of Drosophila melanogaster cell and developmental biology.

  3. Drosophila melanogaster as a model host for the Burkholderia cepacia complex.

    Directory of Open Access Journals (Sweden)

    Josée Castonguay-Vanier

    2010-07-01

    Full Text Available Colonization with bacterial species from the Burkholderia cepacia complex (Bcc is associated with fast health decline among individuals with cystic fibrosis. In order to investigate the virulence of the Bcc, several alternative infection models have been developed. To this end, the fruit fly is increasingly used as surrogate host, and its validity to enhance our understanding of host-pathogen relationships has been demonstrated with a variety of microorganisms. Moreover, its relevance as a suitable alternative to mammalian hosts has been confirmed with vertebrate organisms.The aim of this study was to establish Drosophila melanogaster as a surrogate host for species from the Bcc. While the feeding method proved unsuccessful at killing the flies, the pricking technique did generate mortality within the populations. Results obtained with the fruit fly model are comparable with results obtained using mammalian infection models. Furthermore, validity of the Drosophila infection model was confirmed with B. cenocepacia K56-2 mutants known to be less virulent in murine hosts or in other alternative models. Competitive index (CI analyses were also performed using the fruit fly as host. Results of CI experiments agree with those obtained with mammalian models.We conclude that Drosophila is a useful alternative infection model for Bcc and that fly pricking assays and competition indices are two complementary methods for virulence testing. Moreover, CI results indicate that this method is more sensitive than mortality tests.

  4. Genetic interactions between the Drosophila tumor suppressor gene ept and the stat92E transcription factor.

    Directory of Open Access Journals (Sweden)

    M Melissa Gilbert

    2009-09-01

    Full Text Available Tumor Susceptibility Gene-101 (TSG101 promotes the endocytic degradation of transmembrane proteins and is implicated as a mutational target in cancer, yet the effect of TSG101 loss on cell proliferation in vertebrates is uncertain. By contrast, Drosophila epithelial tissues lacking the TSG101 ortholog erupted (ept develop as enlarged undifferentiated tumors, indicating that the gene can have anti-growth properties in a simple metazoan. A full understanding of pathways deregulated by loss of Drosophila ept will aid in understanding potential links between mammalian TSG101 and growth control.We have taken a genetic approach to the identification of pathways required for excess growth of Drosophila eye-antennal imaginal discs lacking ept. We find that this phenotype is very sensitive to the genetic dose of stat92E, the transcriptional effector of the Jak-Stat signaling pathway, and that this pathway undergoes strong activation in ept mutant cells. Genetic evidence indicates that stat92E contributes to cell cycle deregulation and excess cell size phenotypes that are observed among ept mutant cells. In addition, autonomous Stat92E hyper-activation is associated with altered tissue architecture in ept tumors and an effect on expression of the apical polarity determinant crumbs.These findings identify ept as a cell-autonomous inhibitor of the Jak-Stat pathway and suggest that excess Jak-Stat signaling makes a significant contribution to proliferative and tissue architectural phenotypes that occur in ept mutant tissues.

  5. Homology directed repair is unaffected by the absence of siRNAs in Drosophila melanogaster.

    Science.gov (United States)

    Schmidts, Ines; Böttcher, Romy; Mirkovic-Hösle, Milijana; Förstemann, Klaus

    2016-09-30

    Small interfering RNAs (siRNAs) defend the organism against harmful transcripts from exogenous (e.g. viral) or endogenous (e.g. transposons) sources. Recent publications describe the production of siRNAs induced by DNA double-strand breaks (DSB) in Neurospora crassa, Arabidopsis thaliana, Drosophila melanogaster and human cells, which suggests a conserved function. A current hypothesis is that break-induced small RNAs ensure efficient homologous recombination (HR). However, biogenesis of siRNAs is often intertwined with other small RNA species, such as microRNAs (miRNAs), which complicates interpretation of experimental results. In Drosophila, siRNAs are produced by Dcr-2 while miRNAs are processed by Dcr-1. Thus, it is possible to probe siRNA function without miRNA deregulation. We therefore examined DNA double-strand break repair after perturbation of siRNA biogenesis in cultured Drosophila cells as well as mutant flies. Our assays comprised reporters for the single-strand annealing pathway, homologous recombination and sensitivity to the DSB-inducing drug camptothecin. We could not detect any repair defects caused by the lack of siRNAs derived from the broken DNA locus. Since production of these siRNAs depends on local transcription, they may thus participate in RNA metabolism-an established function of siRNAs-rather than DNA repair. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. The nuclear receptor DHR3 modulates dS6 kinase-dependent growth in Drosophila.

    Directory of Open Access Journals (Sweden)

    Jacques Montagne

    2010-05-01

    Full Text Available S6 kinases (S6Ks act to integrate nutrient and insulin signaling pathways and, as such, function as positive effectors in cell growth and organismal development. However, they also have been shown to play a key role in limiting insulin signaling and in mediating the autophagic response. To identify novel regulators of S6K signaling, we have used a Drosophila-based, sensitized, gain-of-function genetic screen. Unexpectedly, one of the strongest enhancers to emerge from this screen was the nuclear receptor (NR, Drosophila hormone receptor 3 (DHR3, a critical constituent in the coordination of Drosophila metamorphosis. Here we demonstrate that DHR3, through dS6K, also acts to regulate cell-autonomous growth. Moreover, we show that the ligand-binding domain (LBD of DHR3 is essential for mediating this response. Consistent with these findings, we have identified an endogenous DHR3 isoform that lacks the DBD. These results provide the first molecular link between the dS6K pathway, critical in controlling nutrient-dependent growth, and that of DHR3, a major mediator of ecdysone signaling, which, acting together, coordinate metamorphosis.

  7. Transcriptome analysis of Drosophila neural stem cells.

    Science.gov (United States)

    Gold, Katrina S; Brand, Andrea H

    2012-01-01

    In Drosophila, the central nervous system is populated by a set of asymmetrically dividing neural stem cells called neuroblasts. Neuroblasts are derived from epithelial or neuroepithelial precursors, and divide along their apico-basal axes to produce a large apical neuroblast and a smaller basal ganglion mother cell. The ganglion mother cell will divide once again to produce two post-mitotic neurons or glia. In this chapter we outline a method for labeling different types of neural precursors in the Drosophila central nervous system, followed by their extraction and processing for transcriptome analysis. This technique has allowed us to capture and compare the expression profiles of neuroblasts and neuroepithelial cells, resulting in the identification of key genes required for the regulation of self-renewal and differentiation.

  8. Drosophila VAMP7 regulates Wingless intracellular trafficking.

    Science.gov (United States)

    Gao, Han; He, Fang; Lin, Xinhua; Wu, Yihui

    2017-01-01

    Drosophila Wingless (Wg) is a morphogen that determines cell fate during development. Previous studies have shown that endocytic pathways regulate Wg trafficking and signaling. Here, we showed that loss of vamp7, a gene required for vesicle fusion, dramatically increased Wg levels and decreased Wg signaling. Interestingly, we found that levels of Dally-like (Dlp), a glypican that can interact with Wg to suppress Wg signaling at the dorsoventral boundary of the Drosophila wing, were also increased in vamp7 mutant cells. Moreover, Wg puncta in Rab4-dependent recycling endosomes were Dlp positive. We hypothesize that VAMP7 is required for Wg intracellular trafficking and the accumulation of Wg in Rab4-dependent recycling endosomes might affect Wg signaling.

  9. Maintenance of a Drosophila melanogaster Population Cage.

    Science.gov (United States)

    Caravaca, Juan Manuel; Lei, Elissa P

    2016-03-15

    Large quantities of DNA, RNA, proteins and other cellular components are often required for biochemistry and molecular biology experiments. The short life cycle of Drosophila enables collection of large quantities of material from embryos, larvae, pupae and adult flies, in a synchronized way, at a low economic cost. A major strategy for propagating large numbers of flies is the use of a fly population cage. This useful and common tool in the Drososphila community is an efficient way to regularly produce milligrams to tens of grams of embryos, depending on uniformity of developmental stage desired. While a population cage can be time consuming to set up, maintaining a cage over months takes much less time and enables rapid collection of biological material in a short period. This paper describes a detailed and flexible protocol for the maintenance of a Drosophila melanogaster population cage, starting with 1.5 g of harvested material from the previous cycle.

  10. Adaptive Evolution of Gene Expression in Drosophila

    Directory of Open Access Journals (Sweden)

    Armita Nourmohammad

    2017-08-01

    Full Text Available Gene expression levels are important quantitative traits that link genotypes to molecular functions and fitness. In Drosophila, population-genetic studies have revealed substantial adaptive evolution at the genomic level, but the evolutionary modes of gene expression remain controversial. Here, we present evidence that adaptation dominates the evolution of gene expression levels in flies. We show that 64% of the observed expression divergence across seven Drosophila species are adaptive changes driven by directional selection. Our results are derived from time-resolved data of gene expression divergence across a family of related species, using a probabilistic inference method for gene-specific selection. Adaptive gene expression is stronger in specific functional classes, including regulation, sensory perception, sexual behavior, and morphology. Moreover, we identify a large group of genes with sex-specific adaptation of expression, which predominantly occurs in males. Our analysis opens an avenue to map system-wide selection on molecular quantitative traits independently of their genetic basis.

  11. Neural control of aggression in Drosophila.

    Science.gov (United States)

    Hoopfer, Eric D

    2016-06-01

    Like most animal species, fruit flies fight to obtain and defend resources essential to survival and reproduction. Aggressive behavior in Drosophila is genetically specified and also strongly influenced by the fly's social context, past experiences and internal states, making it an excellent framework for investigating the neural mechanisms that regulate complex social behaviors. Here, I summarize our current knowledge of the neural control of aggression in Drosophila and discuss recent advances in understanding the sensory pathways that influence the decision to fight or court, the neuromodulatory control of aggression, the neural basis by which internal states can influence both fighting and courtship, and how social experience modifies aggressive behavior. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Counting Calories in Drosophila Diet Restriction

    Science.gov (United States)

    Min, Kyung-Jin; Flatt, Thomas; Kulaots, Indrek; Tatar, Marc

    2007-01-01

    The extension of life span by diet restriction in Drosophila has been argued to occur without limiting calories. Here we directly measure the calories assimilated by flies when maintained on full- and restricted-diets. We find that caloric intake is reduced on all diets that extend life span. Flies on low-yeast diet are long-lived and consume about half the calories of flies on high yeast diets, regardless of the energetic content of the diet itself. Since caloric intake correlates with yeast concentration and thus with the intake of every metabolite in this dietary component, it is premature to conclude for Drosophila that calories do not explain extension of life span. PMID:17125951

  13. The fabulous destiny of the Drosophila heart.

    Science.gov (United States)

    Medioni, Caroline; Sénatore, Sébastien; Salmand, Pierre-Adrien; Lalevée, Nathalie; Perrin, Laurent; Sémériva, Michel

    2009-10-01

    For the last 15 years the fly cardiovascular system has attracted developmental geneticists for its potential as a model system of organogenesis. Heart development in Drosophila indeed provides a remarkable system for elucidating the basic molecular and cellular mechanisms of morphogenesis and, more recently, for understanding the genetic control of cardiac physiology. The success of these studies can in part be attributed to multidisciplinary approaches, the multiplicity of existing genetic tools, and a detailed knowledge of the system. Striking similarities with vertebrate cardiogenesis have long been stressed, in particular concerning the conservation of key molecular regulators of cardiogenesis and the new data presented here confirm Drosophila cardiogenesis as a model not only for organogenesis but also for the study of molecular mechanisms of human cardiac disease.

  14. Remembering components of food in Drosophila

    Directory of Open Access Journals (Sweden)

    Gaurav eDas

    2016-02-01

    Full Text Available Remembering features of past feeding experience can refine foraging and food choice. Insects can learn to associate sensory cues with components of food, such as sugars, amino acids, water, salt, alcohol, toxins and pathogens. In the fruit fly Drosophila some food components activate unique subsets of dopaminergic neurons that innervate distinct functional zones on the mushroom bodies. This architecture suggests that the overall dopaminergic neuron population could provide a potential cellular substrate through which the fly might learn to value a variety of food components. In addition, such an arrangement predicts that individual component memories reside in unique locations. Dopaminergic neurons are also critical for food memory consolidation and deprivation-state dependent motivational control of the expression of food-relevant memories. Here we review our current knowledge of how nutrient-specific memories are formed, consolidated and specifically retrieved in insects, with a particular emphasis on Drosophila.

  15. Development of larval motor circuits in Drosophila.

    Science.gov (United States)

    Kohsaka, Hiroshi; Okusawa, Satoko; Itakura, Yuki; Fushiki, Akira; Nose, Akinao

    2012-04-01

    How are functional neural circuits formed during development? Despite recent advances in our understanding of the development of individual neurons, little is known about how complex circuits are assembled to generate specific behaviors. Here, we describe the ways in which Drosophila motor circuits serve as an excellent model system to tackle this problem. We first summarize what has been learned during the past decades on the connectivity and development of component neurons, in particular motor neurons and sensory feedback neurons. We then review recent progress in our understanding of the development of the circuits as well as studies that apply optogenetics and other innovative techniques to dissect the circuit diagram. New approaches using Drosophila as a model system are now making it possible to search for developmental rules that regulate the construction of neural circuits. © 2012 The Authors Development, Growth & Differentiation © 2012 Japanese Society of Developmental Biologists.

  16. The translation factors of Drosophila melanogaster.

    Science.gov (United States)

    Marygold, Steven J; Attrill, Helen; Lasko, Paul

    2017-01-02

    Synthesis of polypeptides from mRNA (translation) is a fundamental cellular process that is coordinated and catalyzed by a set of canonical 'translation factors'. Surprisingly, the translation factors of Drosophila melanogaster have not yet been systematically identified, leading to inconsistencies in their nomenclature and shortcomings in functional (Gene Ontology, GO) annotations. Here, we describe the complete set of translation factors in D. melanogaster, applying nomenclature already in widespread use in other species, and revising their functional annotation. The collection comprises 43 initiation factors, 12 elongation factors, 3 release factors and 6 recycling factors, totaling 64 of which 55 are cytoplasmic and 9 are mitochondrial. We also provide an overview of notable findings and particular insights derived from Drosophila about these factors. This catalog, together with the incorporation of the improved nomenclature and GO annotation into FlyBase, will greatly facilitate access to information about the functional roles of these important proteins.

  17. Motor Control of Drosophila Courtship Song

    Directory of Open Access Journals (Sweden)

    Troy R. Shirangi

    2013-11-01

    Full Text Available Many animals utilize acoustic signals—or songs—to attract mates. During courtship, Drosophila melanogaster males vibrate a wing to produce trains of pulses and extended tone, called pulse and sine song, respectively. Courtship songs in the genus Drosophila are exceedingly diverse, and different song features appear to have evolved independently of each other. How the nervous system allows such diversity to evolve is not understood. Here, we identify a wing muscle in D. melanogaster (hg1 that is uniquely male-enlarged. The hg1 motoneuron and the sexually dimorphic development of the hg1 muscle are required specifically for the sine component of the male song. In contrast, the motoneuron innervating a sexually monomorphic wing muscle, ps1, is required specifically for a feature of pulse song. Thus, individual wing motor pathways can control separate aspects of courtship song and may provide a “modular” anatomical substrate for the evolution of diverse songs.

  18. Plasticity in the Drosophila larval visual System

    Directory of Open Access Journals (Sweden)

    Abud J Farca-Luna

    2013-07-01

    Full Text Available The remarkable ability of the nervous system to modify its structure and function is mostly experience and activity modulated. The molecular basis of neuronal plasticity has been studied in higher behavioral processes, such as learning and memory formation. However, neuronal plasticity is not restricted to higher brain functions, but may provide a basic feature of adaptation of all neural circuits. The fruit fly Drosophila melanogaster provides a powerful genetic model to gain insight into the molecular basis of nervous system development and function. The nervous system of the larvae is again a magnitude simpler than its adult counter part, allowing the genetic assessment of a number of individual genetically identifiable neurons. We review here recent progress on the genetic basis of neuronal plasticity in developing and functioning neural circuits focusing on the simple visual system of the Drosophila larva.

  19. Rapid matching in Drosophila place learning

    Science.gov (United States)

    Zars, Melissa; Zars, Troy

    2009-08-01

    The level of conditioned behavior in animals is proportional to the intensity, amount, frequency, or probability of reinforcement. Interestingly, this matching can be dynamic, with performance levels following, for example, a switch in the probability of reinforcement with a short delay. We previously found that conditioned performance levels in Drosophila match reinforcement intensity in a place conditioning paradigm. Whether Drosophila can match conditioned behavior to a change in reinforcement intensity was an open question. In this study, we found that both conditioned behavior and memory levels match reinforcement intensity after a switch, and this rapid matching occurs within 2 min. Thus, fruit flies can dynamically match conditioned behavior and memory levels to a change in reinforcement intensity.

  20. The Drosophila melanogaster PeptideAtlas facilitates the use of peptide data for improved fly proteomics and genome annotation

    Directory of Open Access Journals (Sweden)

    King Nichole L

    2009-02-01

    Full Text Available Abstract Background Crucial foundations of any quantitative systems biology experiment are correct genome and proteome annotations. Protein databases compiled from high quality empirical protein identifications that are in turn based on correct gene models increase the correctness, sensitivity, and quantitative accuracy of systems biology genome-scale experiments. Results In this manuscript, we present the Drosophila melanogaster PeptideAtlas, a fly proteomics and genomics resource of unsurpassed depth. Based on peptide mass spectrometry data collected in our laboratory the portal http://www.drosophila-peptideatlas.org allows querying fly protein data observed with respect to gene model confirmation and splice site verification as well as for the identification of proteotypic peptides suited for targeted proteomics studies. Additionally, the database provides consensus mass spectra for observed peptides along with qualitative and quantitative information about the number of observations of a particular peptide and the sample(s in which it was observed. Conclusion PeptideAtlas is an open access database for the Drosophila community that has several features and applications that support (1 reduction of the complexity inherently associated with performing targeted proteomic studies, (2 designing and accelerating shotgun proteomics experiments, (3 confirming or questioning gene models, and (4 adjusting gene models such that they are in line with observed Drosophila peptides. While the database consists of proteomic data it is not required that the user is a proteomics expert.

  1. The Microtubule Regulatory Protein Stathmin Is Required to Maintain the Integrity of Axonal Microtubules in Drosophila.

    Directory of Open Access Journals (Sweden)

    Jason E Duncan

    Full Text Available Axonal transport, a form of long-distance, bi-directional intracellular transport that occurs between the cell body and synaptic terminal, is critical in maintaining the function and viability of neurons. We have identified a requirement for the stathmin (stai gene in the maintenance of axonal microtubules and regulation of axonal transport in Drosophila. The stai gene encodes a cytosolic phosphoprotein that regulates microtubule dynamics by partitioning tubulin dimers between pools of soluble tubulin and polymerized microtubules, and by directly binding to microtubules and promoting depolymerization. Analysis of stai function in Drosophila, which has a single stai gene, circumvents potential complications with studies performed in vertebrate systems in which mutant phenotypes may be compensated by genetic redundancy of other members of the stai gene family. This has allowed us to identify an essential function for stai in the maintenance of the integrity of axonal microtubules. In addition to the severe disruption in the abundance and architecture of microtubules in the axons of stai mutant Drosophila, we also observe additional neurological phenotypes associated with loss of stai function including a posterior paralysis and tail-flip phenotype in third instar larvae, aberrant accumulation of transported membranous organelles in stai deficient axons, a progressive bang-sensitive response to mechanical stimulation reminiscent of the class of Drosophila mutants used to model human epileptic seizures, and a reduced adult lifespan. Reductions in the levels of Kinesin-1, the primary anterograde motor in axonal transport, enhance these phenotypes. Collectively, our results indicate that stai has an important role in neuronal function, likely through the maintenance of microtubule integrity in the axons of nerves of the peripheral nervous system necessary to support and sustain long-distance axonal transport.

  2. The Microtubule Regulatory Protein Stathmin Is Required to Maintain the Integrity of Axonal Microtubules in Drosophila

    Science.gov (United States)

    Duncan, Jason E.; Lytle, Nikki K.; Zuniga, Alfredo; Goldstein, Lawrence S. B.

    2013-01-01

    Axonal transport, a form of long-distance, bi-directional intracellular transport that occurs between the cell body and synaptic terminal, is critical in maintaining the function and viability of neurons. We have identified a requirement for the stathmin (stai) gene in the maintenance of axonal microtubules and regulation of axonal transport in Drosophila . The stai gene encodes a cytosolic phosphoprotein that regulates microtubule dynamics by partitioning tubulin dimers between pools of soluble tubulin and polymerized microtubules, and by directly binding to microtubules and promoting depolymerization. Analysis of stai function in Drosophila , which has a single stai gene, circumvents potential complications with studies performed in vertebrate systems in which mutant phenotypes may be compensated by genetic redundancy of other members of the stai gene family. This has allowed us to identify an essential function for stai in the maintenance of the integrity of axonal microtubules. In addition to the severe disruption in the abundance and architecture of microtubules in the axons of stai mutant Drosophila , we also observe additional neurological phenotypes associated with loss of stai function including a posterior paralysis and tail-flip phenotype in third instar larvae, aberrant accumulation of transported membranous organelles in stai deficient axons, a progressive bang-sensitive response to mechanical stimulation reminiscent of the class of Drosophila mutants used to model human epileptic seizures, and a reduced adult lifespan. Reductions in the levels of Kinesin-1, the primary anterograde motor in axonal transport, enhance these phenotypes. Collectively, our results indicate that stai has an important role in neuronal function, likely through the maintenance of microtubule integrity in the axons of nerves of the peripheral nervous system necessary to support and sustain long-distance axonal transport. PMID:23840848

  3. Optimising homing endonuclease gene drive performance in a semi-refractory species: the Drosophila melanogaster experience.

    Directory of Open Access Journals (Sweden)

    Yuk-Sang Chan

    Full Text Available Homing endonuclease gene (HEG drive is a promising insect population control technique that employs meganucleases to impair the fitness of pest populations. Our previous studies showed that HEG drive was more difficult to achieve in Drosophila melanogaster than Anopheles gambiae and we therefore investigated ways of improving homing performance in Drosophila. We show that homing in Drosophila responds to increased expression of HEGs specifically during the spermatogonia stage and this could be achieved through improved construct design. We found that 3'-UTR choice was important to maximise expression levels, with HEG activity increasing as we employed Hsp70, SV40, vasa and βTub56D derived UTRs. We also searched for spermatogonium-specific promoters and found that the Rcd-1r promoter was able to drive specific expression at this stage. Since Rcd-1 is a regulator of differentiation in other species, it suggests that Rcd-1r may serve a similar role during spermatogonial differentiation in Drosophila. Contrary to expectations, a fragment containing the entire region between the TBPH gene and the bgcn translational start drove strong HEG expression only during late spermatogenesis rather than in the germline stem cells and spermatogonia as expected. We also observed that the fraction of targets undergoing homing was temperature-sensitive, falling nearly four-fold when the temperature was lowered to 18°C. Taken together, this study demonstrates how a few simple measures can lead to substantial improvements in the HEG-based gene drive strategy and reinforce the idea that the HEG approach may be widely applicable to a variety of insect control programs.

  4. Drosophila pink1 is required for mitochondrial function and interacts genetically with parkin.

    Science.gov (United States)

    Clark, Ira E; Dodson, Mark W; Jiang, Changan; Cao, Joseph H; Huh, Jun R; Seol, Jae Hong; Yoo, Soon Ji; Hay, Bruce A; Guo, Ming

    2006-06-29

    Parkinson's disease is the second most common neurodegenerative disorder and is characterized by the degeneration of dopaminergic neurons in the substantia nigra. Mitochondrial dysfunction has been implicated as an important trigger for Parkinson's disease-like pathogenesis because exposure to environmental mitochondrial toxins leads to Parkinson's disease-like pathology. Recently, multiple genes mediating familial forms of Parkinson's disease have been identified, including PTEN-induced kinase 1 (PINK1; PARK6) and parkin (PARK2), which are also associated with sporadic forms of Parkinson's disease. PINK1 encodes a putative serine/threonine kinase with a mitochondrial targeting sequence. So far, no in vivo studies have been reported for pink1 in any model system. Here we show that removal of Drosophila PINK1 homologue (CG4523; hereafter called pink1) function results in male sterility, apoptotic muscle degeneration, defects in mitochondrial morphology and increased sensitivity to multiple stresses including oxidative stress. Pink1 localizes to mitochondria, and mitochondrial cristae are fragmented in pink1 mutants. Expression of human PINK1 in the Drosophila testes restores male fertility and normal mitochondrial morphology in a portion of pink1 mutants, demonstrating functional conservation between human and Drosophila Pink1. Loss of Drosophila parkin shows phenotypes similar to loss of pink1 function. Notably, overexpression of parkin rescues the male sterility and mitochondrial morphology defects of pink1 mutants, whereas double mutants removing both pink1 and parkin function show muscle phenotypes identical to those observed in either mutant alone. These observations suggest that pink1 and parkin function, at least in part, in the same pathway, with pink1 functioning upstream of parkin. The role of the pink1-parkin pathway in regulating mitochondrial function underscores the importance of mitochondrial dysfunction as a central mechanism of Parkinson's disease

  5. Characterization of the effect of Cr(VI) on humoral innate immunity using Drosophila melanogaster.

    Science.gov (United States)

    Pragya, P; Shukla, A K; Murthy, R C; Abdin, M Z; Kar Chowdhuri, D

    2015-11-01

    With the advancement of human race, different anthropogenic activities have heaped the environment with chemicals that can cause alteration in the immune system of exposed organism. As a first line of barrier, the evolutionary conserved innate immunity is crucial for the health of an organism. However, there is paucity of information regarding in vivo assessment of the effect of environmental chemicals on innate immunity. Therefore, we examined the effect of a widely used environmental chemical, Cr(VI), on humoral innate immune response using Drosophila melanogaster. The adverse effect of Cr(VI) on host humoral response was characterized by decreased gene expression of antimicrobial peptides (AMPs) in the exposed organism. Concurrently, a significantly decreased transcription of humoral pathway receptors (Toll and PGRP) and triglyceride level along with inhibition of antioxidant enzyme activities were observed in exposed organism. This in turn weakened the immune response of exposed organism that was manifested by their reduced resistance against bacterial infection. In addition, overexpression of the components of humoral immunity particularly Diptericin benefits Drosophila from Cr(VI)-induced humoral immune-suppressive effect. To our knowledge, this is the first report regarding negative impact of an environmental chemical on humoral innate immune response of Drosophila along with subsequent protection by AMPs, which may provide novel insight into host-chemical interactions. Also, our data validate the utility and sensitivity of Drosophila as a model that could be used for screening the possible risk of environmental chemicals on innate immunity with minimum ethical concern that can be further extrapolated to higher organisms. © 2014 Wiley Periodicals, Inc.

  6. One-Tube-Only Standardized Site-Directed Mutagenesis: An Alternative Approach to Generate Amino Acid Substitution Collections.

    Directory of Open Access Journals (Sweden)

    Janire Mingo

    Full Text Available Site-directed mutagenesis (SDM is a powerful tool to create defined collections of protein variants for experimental and clinical purposes, but effectiveness is compromised when a large number of mutations is required. We present here a one-tube-only standardized SDM approach that generates comprehensive collections of amino acid substitution variants, including scanning- and single site-multiple mutations. The approach combines unified mutagenic primer design with the mixing of multiple distinct primer pairs and/or plasmid templates to increase the yield of a single inverse-PCR mutagenesis reaction. Also, a user-friendly program for automatic design of standardized primers for Ala-scanning mutagenesis is made available. Experimental results were compared with a modeling approach together with stochastic simulation data. For single site-multiple mutagenesis purposes and for simultaneous mutagenesis in different plasmid backgrounds, combination of primer sets and/or plasmid templates in a single reaction tube yielded the distinct mutations in a stochastic fashion. For scanning mutagenesis, we found that a combination of overlapping primer sets in a single PCR reaction allowed the yield of different individual mutations, although this yield did not necessarily follow a stochastic trend. Double mutants were generated when the overlap of primer pairs was below 60%. Our results illustrate that one-tube-only SDM effectively reduces the number of reactions required in large-scale mutagenesis strategies, facilitating the generation of comprehensive collections of protein variants suitable for functional analysis.

  7. Genetics and neurobiology of aggression in Drosophila

    OpenAIRE

    Zwarts, Liesbeth; Versteven, Marijke; Callaerts, Patrick

    2012-01-01

    Aggressive behavior is widely present throughout the animal kingdom and is crucial to ensure survival and reproduction. Aggressive actions serve to acquire territory, food, or mates and in defense against predators or rivals; while in some species these behaviors are involved in establishing a social hierarchy. Aggression is a complex behavior, influenced by a broad range of genetic and environmental factors. Recent studies in Drosophila provide insight into the genetic basis and control of a...

  8. Structure and Development of Glia in Drosophila

    OpenAIRE

    Hartenstein, Volker

    2011-01-01

    Insect glia represents a conspicuous and diverse population of cells and plays a role in controlling neuronal progenitor proliferation, axonal growth, neuronal differentiation and maintenance, and neuronal function. Genetic studies in Drosophila have elucidated many aspects of glial structure, function and development. Just as in vertebrates, it appears as if different classes of glial cells are specialized for different functions. Based on topology and cell shape, glial cells of the central ...

  9. Ultrastructural Analysis of Myoblast Fusion in Drosophila

    OpenAIRE

    Zhang, Shiliang; Chen, Elizabeth H.

    2008-01-01

    Myoblast fusion in Drosophila has become a powerful genetic system with which to unravel the mechanisms underlying cell fusion. The identification of important components of myoblast fusion by genetic analysis has led to a molecular pathway toward our understanding of this cellular process. In addition to the application of immunohistochemistry and live imaging techniques to visualize myoblast fusion at the light microscopic level, ultrastructural analysis using electron microscopy remains an...

  10. Organization Of The Drosophila Larval Visual Circuit

    OpenAIRE

    Fritsch, Pauline; Gendre, Nanae; Maier, Larisa; Fetter, Rick; Schneider-Mizell, Casey; Truman, James; Zlatic, Marta; Cardona, Albert; Larderet, Ivan; Sprecher, Simon

    2017-01-01

    Visual systems transduce, process and transmit light-dependent environmental cues. Computation of visual features depends on the types of photoreceptor neurons (PR) present, the organization of the eye and the wiring of the underlying neural circuit. Here, we describe the circuit architecture of the visual system of Drosophila larvae by mapping the synaptic wiring diagram and neurotransmitters. By contacting different targets, the two larval PR-subtypes create parallel circuits potentially un...

  11. A Drosophila Model to Image Phagosome Maturation

    Directory of Open Access Journals (Sweden)

    Douglas A. Brooks

    2013-03-01

    Full Text Available Phagocytosis involves the internalization of extracellular material by invagination of the plasma membrane to form intracellular vesicles called phagosomes, which have functions that include pathogen degradation. The degradative properties of phagosomes are thought to be conferred by sequential fusion with endosomes and lysosomes; however, this maturation process has not been studied in vivo. We employed Drosophila hemocytes, which are similar to mammalian professional macrophages, to establish a model of phagosome maturation. Adult Drosophila females, carrying transgenic Rab7-GFP endosome and Lamp1-GFP lysosome markers, were injected with E. coli DH5α and the hemocytes were collected at 15, 30, 45 and 60 minutes after infection. In wild-type females, E. coli were detected within enlarged Rab7-GFP positive phagosomes at 15 to 45 minutes after infection; and were also observed in enlarged Lamp1-GFP positive phagolysosomes at 45 minutes. Two-photon imaging of hemocytes in vivo confirmed this vesicle morphology, including enlargement of Rab7-GFP and Lamp1-GFP structures that often appeared to protrude from hemocytes. The interaction of endosomes and lysosomes with E. coli phagosomes observed in Drosophila hemocytes was consistent with that previously described for phagosome maturation in human ex vivo macrophages. We also tested our model as a tool for genetic analysis using 14-3-3e mutants, and demonstrated altered phagosome maturation with delayed E. coli internalization, trafficking and/or degradation. These findings demonstrate that Drosophila hemocytes provide an appropriate, genetically amenable, model for analyzing phagosome maturation ex vivo and in vivo.

  12. Adaptive dynamics of cuticular hydrocarbons in Drosophila

    Czech Academy of Sciences Publication Activity Database

    Rajpurohit, S.; Hanus, Robert; Vrkoslav, Vladimír; Behrman, E. L.; Bergland, A. O.; Petrov, D.; Cvačka, Josef; Schmidt, P. S.

    2017-01-01

    Roč. 30, č. 1 (2017), s. 66-80 ISSN 1010-061X R&D Projects: GA ČR GAP206/12/1093 Institutional support: RVO:61388963 Keywords : cuticular hydrocarbons * Drosophila * experimental evolution * spatiotemporal variation * thermal plasticity Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Biology (theoretical, mathematical, thermal, cryobiology, biological rhythm), Evolutionary biology Impact factor: 2.792, year: 2016 http://onlinelibrary.wiley.com/doi/10.1111/jeb.12988/full

  13. Neurophysiology of Drosophila Models of Parkinson's Disease

    OpenAIRE

    West, Ryan J. H.; Furmston, Rebecca; Williams, Charles A. C.; Elliott, Christopher J. H.

    2015-01-01

    We provide an insight into the role Drosophila has played in elucidating neurophysiological perturbations associated with Parkinson's disease- (PD-) related genes. Synaptic signalling deficits are observed in motor, central, and sensory systems. Given the neurological impact of disease causing mutations within these same genes in humans the phenotypes observed in fly are of significant interest. As such we observe four unique opportunities provided by fly nervous system models of Parkinson's ...

  14. Three-dimensional imaging of Drosophila melanogaster.

    Directory of Open Access Journals (Sweden)

    Leeanne McGurk

    2007-09-01

    Full Text Available The major hindrance to imaging the intact adult Drosophila is that the dark exoskeleton makes it impossible to image through the cuticle. We have overcome this obstacle and describe a method whereby the internal organs of adult Drosophila can be imaged in 3D by bleaching and clearing the adult and then imaging using a technique called optical projection tomography (OPT. The data is displayed as 2D optical sections and also in 3D to provide detail on the shape and structure of the adult anatomy.We have used OPT to visualize in 2D and 3D the detailed internal anatomy of the intact adult Drosophila. In addition this clearing method used for OPT was tested for imaging with confocal microscopy. Using OPT we have visualized the size and shape of neurodegenerative vacuoles from within the head capsule of flies that suffer from age-related neurodegeneration due to a lack of ADAR mediated RNA-editing. In addition we have visualized tau-lacZ expression in 2D and 3D. This shows that the wholemount adult can be stained without any manipulation and that this stain penetrates well as we have mapped the localization pattern with respect to the internal anatomy.We show for the first time that the intact adult Drosophila can be imaged in 3D using OPT, also we show that this method of clearing is also suitable for confocal microscopy to image the brain from within the intact head. The major advantage of this is that organs can be represented in 3D in their natural surroundings. Furthermore optical sections are generated in each of the three planes and are not prone to the technical limitations that are associated with manual sectioning. OPT can be used to dissect mutant phenotypes and to globally map gene expression in both 2D and 3D.

  15. Studies on maternal repair in Drosophila melanogaster

    International Nuclear Information System (INIS)

    Mendelson, D.

    1976-01-01

    The work reported in this thesis is mainly concerned with studies on the nature of the repair mechanism(s) operating in Drosophila oocytes, and which act on chromosome damage induced by X-irradiation of post-meiotic male germ-cells. Caffeine treatment of the females has been used as an analytical tool to gain an insight into the nature of this repair mechanism and its genetic basis

  16. Plasticity of the chemoreceptor repertoire in Drosophila melanogaster.

    Directory of Open Access Journals (Sweden)

    Shanshan Zhou

    2009-10-01

    Full Text Available For most organisms, chemosensation is critical for survival and is mediated by large families of chemoreceptor proteins, whose expression must be tuned appropriately to changes in the chemical environment. We asked whether expression of chemoreceptor genes that are clustered in the genome would be regulated independently; whether expression of certain chemoreceptor genes would be especially sensitive to environmental changes; whether groups of chemoreceptor genes undergo coordinated rexpression; and how plastic the expression of chemoreceptor genes is with regard to sex, development, reproductive state, and social context. To answer these questions we used Drosophila melanogaster, because its chemosensory systems are well characterized and both the genotype and environment can be controlled precisely. Using customized cDNA microarrays, we showed that chemoreceptor genes that are clustered in the genome undergo independent transcriptional regulation at different developmental stages and between sexes. Expression of distinct subgroups of chemoreceptor genes is sensitive to reproductive state and social interactions. Furthermore, exposure of flies only to odor of the opposite sex results in altered transcript abundance of chemoreceptor genes. These genes are distinct from those that show transcriptional plasticity when flies are allowed physical contact with same or opposite sex members. We analyzed covariance in transcript abundance of chemosensory genes across all environmental conditions and found that they segregated into 20 relatively small, biologically relevant modules of highly correlated transcripts. This finely pixilated modular organization of the chemosensory subgenome enables fine tuning of the expression of the chemoreceptor repertoire in response to ecologically relevant environmental and physiological conditions.

  17. ‘Peer pressure’ in larval Drosophila?

    Directory of Open Access Journals (Sweden)

    Thomas Niewalda

    2014-06-01

    Full Text Available Understanding social behaviour requires a study case that is simple enough to be tractable, yet complex enough to remain interesting. Do larval Drosophila meet these requirements? In a broad sense, this question can refer to effects of the mere presence of other larvae on the behaviour of a target individual. Here we focused in a more strict sense on ‘peer pressure’, that is on the question of whether the behaviour of a target individual larva is affected by what a surrounding group of larvae is doing. We found that innate olfactory preference of a target individual was neither affected (i by the level of innate olfactory preference in the surrounding group nor (ii by the expression of learned olfactory preference in the group. Likewise, learned olfactory preference of a target individual was neither affected (iii by the level of innate olfactory preference of the surrounding group nor (iv by the learned olfactory preference the group was expressing. We conclude that larval Drosophila thus do not take note of specifically what surrounding larvae are doing. This implies that in a strict sense, and to the extent tested, there is no social interaction between larvae. These results validate widely used en mass approaches to the behaviour of larval Drosophila.

  18. An automated paradigm for Drosophila visual psychophysics.

    Science.gov (United States)

    Evans, Oliver; Paulk, Angelique C; van Swinderen, Bruno

    2011-01-01

    Mutations that cause learning and memory defects in Drosophila melanogaster have been found to also compromise visual responsiveness and attention. A better understanding of attention-like defects in such Drosophila mutants therefore requires a more detailed characterization of visual responsiveness across a range of visual parameters. We designed an automated behavioral paradigm for efficiently dissecting visual responsiveness in Drosophila. Populations of flies walk through multiplexed serial choice mazes while being exposed to moving visuals displayed on computer monitors, and infra-red fly counters at the end of each maze automatically score the responsiveness of a strain. To test our new design, we performed a detailed comparison between wild-type flies and a learning and memory mutant, dunce(1). We first confirmed that the learning mutant dunce(1) displays increased responsiveness to a black/green moving grating compared to wild type in this new design. We then extended this result to explore responses to a wide range of psychophysical parameters for moving gratings (e.g., luminosity, contrast, spatial frequency, velocity) as well as to a different stimulus, moving dots. Finally, we combined these visuals (gratings versus dots) in competition to investigate how dunce(1) and wild-type flies respond to more complex and conflicting motion effects. We found that dunce(1) responds more strongly than wild type to high contrast and highly structured motion. This effect was found for simple gratings, dots, and combinations of both stimuli presented in competition.

  19. An automated paradigm for Drosophila visual psychophysics.

    Directory of Open Access Journals (Sweden)

    Oliver Evans

    Full Text Available BACKGROUND: Mutations that cause learning and memory defects in Drosophila melanogaster have been found to also compromise visual responsiveness and attention. A better understanding of attention-like defects in such Drosophila mutants therefore requires a more detailed characterization of visual responsiveness across a range of visual parameters. METHODOLOGY/PRINCIPAL FINDINGS: We designed an automated behavioral paradigm for efficiently dissecting visual responsiveness in Drosophila. Populations of flies walk through multiplexed serial choice mazes while being exposed to moving visuals displayed on computer monitors, and infra-red fly counters at the end of each maze automatically score the responsiveness of a strain. To test our new design, we performed a detailed comparison between wild-type flies and a learning and memory mutant, dunce(1. We first confirmed that the learning mutant dunce(1 displays increased responsiveness to a black/green moving grating compared to wild type in this new design. We then extended this result to explore responses to a wide range of psychophysical parameters for moving gratings (e.g., luminosity, contrast, spatial frequency, velocity as well as to a different stimulus, moving dots. Finally, we combined these visuals (gratings versus dots in competition to investigate how dunce(1 and wild-type flies respond to more complex and conflicting motion effects. CONCLUSIONS/SIGNIFICANCE: We found that dunce(1 responds more strongly than wild type to high contrast and highly structured motion. This effect was found for simple gratings, dots, and combinations of both stimuli presented in competition.

  20. Transcriptional regulation of xenobiotic detoxification in Drosophila

    Science.gov (United States)

    Misra, Jyoti R.; Horner, Michael A.; Lam, Geanette; Thummel, Carl S.

    2011-01-01

    Living organisms, from bacteria to humans, display a coordinated transcriptional response to xenobiotic exposure, inducing enzymes and transporters that facilitate detoxification. Several transcription factors have been identified in vertebrates that contribute to this regulatory response. In contrast, little is known about this pathway in insects. Here we show that the Drosophila Nrf2 (NF-E2-related factor 2) ortholog CncC (cap ‘n’ collar isoform-C) is a central regulator of xenobiotic detoxification responses. A binding site for CncC and its heterodimer partner Maf (muscle aponeurosis fibromatosis) is sufficient and necessary for robust transcriptional responses to three xenobiotic compounds: phenobarbital (PB), chlorpromazine, and caffeine. Genetic manipulations that alter the levels of CncC or its negative regulator, Keap1 (Kelch-like ECH-associated protein 1), lead to predictable changes in xenobiotic-inducible gene expression. Transcriptional profiling studies reveal that more than half of the genes regulated by PB are also controlled by CncC. Consistent with these effects on detoxification gene expression, activation of the CncC/Keap1 pathway in Drosophila is sufficient to confer resistance to the lethal effects of the pesticide malathion. These studies establish a molecular mechanism for the regulation of xenobiotic detoxification in Drosophila and have implications for controlling insect populations and the spread of insect-borne human diseases. PMID:21896655

  1. The Ran pathway in Drosophila melanogaster mitosis

    Directory of Open Access Journals (Sweden)

    James G Wakefield

    2015-11-01

    Full Text Available Over the last two decades, the small GTPase Ran has emerged as a central regulator of both mitosis and meiosis, particularly in the generation, maintenance and regulation of the microtubule (MT-based bipolar spindle. Ran-regulated pathways in mitosis bear many similarities to the well-characterized functions of Ran in nuclear transport and, as with transport, the majority of these mitotic effects are mediated through affecting the physical interaction between karyopherins and Spindle Assembly Factors (SAFs - a loose term describing proteins or protein complexes involved in spindle assembly through promoting nucleation, stabilization, and/or depolymerization of MTs, through anchoring MTs to specific structures such as centrosomes, chromatin or kinetochores, or through sliding MTs along each other to generate the force required to achieve bipolarity. As such, the Ran-mediated pathway represents a crucial functional module within the wider spindle assembly landscape. Research into mitosis using the model organism Drosophila melanogaster has contributed substantially to our understanding of centrosome and spindle function. However, in comparison to mammalian systems, very little is known about the contribution of Ran-mediated pathways in Drosophila mitosis. This article sets out to summarize our understanding of the roles of the Ran pathway components in Drosophila mitosis, focusing on the syncytial blastoderm embryo, arguing that, far from being superfluous, it can provide important insights into the conserved functions on Ran during spindle formation.

  2. Pervasive natural selection in the Drosophila genome?

    Directory of Open Access Journals (Sweden)

    Guy Sella

    2009-06-01

    Full Text Available Over the past four decades, the predominant view of molecular evolution saw little connection between natural selection and genome evolution, assuming that the functionally constrained fraction of the genome is relatively small and that adaptation is sufficiently infrequent to play little role in shaping patterns of variation within and even between species. Recent evidence from Drosophila, reviewed here, suggests that this view may be invalid. Analyses of genetic variation within and between species reveal that much of the Drosophila genome is under purifying selection, and thus of functional importance, and that a large fraction of coding and noncoding differences between species are adaptive. The findings further indicate that, in Drosophila, adaptations may be both common and strong enough that the fate of neutral mutations depends on their chance linkage to adaptive mutations as much as on the vagaries of genetic drift. The emerging evidence has implications for a wide variety of fields, from conservation genetics to bioinformatics, and presents challenges to modelers and experimentalists alike.

  3. Tet protein function during Drosophila development.

    Directory of Open Access Journals (Sweden)

    Fei Wang

    Full Text Available The TET (Ten-eleven translocation 1, 2 and 3 proteins have been shown to function as DNA hydroxymethylases in vertebrates and their requirements have been documented extensively. Recently, the Tet proteins have been shown to also hydroxylate 5-methylcytosine in RNA. 5-hydroxymethylcytosine (5hmrC is enriched in messenger RNA but the function of this modification has yet to be elucidated. Because Cytosine methylation in DNA is barely detectable in Drosophila, it serves as an ideal model to study the biological function of 5hmrC. Here, we characterized the temporal and spatial expression and requirement of Tet throughout Drosophila development. We show that Tet is essential for viability as Tet complete loss-of-function animals die at the late pupal stage. Tet is highly expressed in neuronal tissues and at more moderate levels in somatic muscle precursors in embryos and larvae. Depletion of Tet in muscle precursors at early embryonic stages leads to defects in larval locomotion and late pupal lethality. Although Tet knock-down in neuronal tissue does not cause lethality, it is essential for neuronal function during development through its affects upon locomotion in larvae and the circadian rhythm of adult flies. Further, we report the function of Tet in ovarian morphogenesis. Together, our findings provide basic insights into the biological function of Tet in Drosophila, and may illuminate observed neuronal and muscle phenotypes observed in vertebrates.

  4. Two inwardly rectifying potassium channels, Irk1 and Irk2, play redundant roles in Drosophila renal tubule function

    Science.gov (United States)

    Wu, Yipin; Baum, Michel; Huang, Chou-Long

    2015-01-01

    Inwardly rectifying potassium channels play essential roles in renal physiology across phyla. Barium-sensitive K+ conductances are found on the basolateral membrane of a variety of insect Malpighian (renal) tubules, including Drosophila melanogaster. We found that barium decreases the lumen-positive transepithelial potential difference in isolated perfused Drosophila tubules and decreases fluid secretion and transepithelial K+ flux. In those insect species in which it has been studied, transcripts from multiple genes encoding inwardly rectifying K+ channels are expressed in the renal (Malpighian) tubule. In Drosophila melanogaster, this includes transcripts of the Irk1, Irk2, and Irk3 genes. The role of each of these gene products in renal tubule function is unknown. We found that simultaneous knockdown of Irk1 and Irk2 in the principal cell of the fly tubule decreases transepithelial K+ flux, with no additive effect of Irk3 knockdown, and decreases barium sensitivity of transepithelial K+ flux by ∼50%. Knockdown of any of the three inwardly rectifying K+ channels individually has no effect, nor does knocking down Irk3 simultaneously with Irk1 or Irk2. Irk1/Irk2 principal cell double-knockdown tubules remain sensitive to the kaliuretic effect of cAMP. Inhibition of the Na+/K+-ATPase with ouabain and Irk1/Irk2 double knockdown have additive effects on K+ flux, and 75% of transepithelial K+ transport is due to Irk1/Irk2 or ouabain-sensitive pathways. In conclusion, Irk1 and Irk2 play redundant roles in transepithelial ion transport in the Drosophila melanogaster renal tubule and are additive to Na+/K+-ATPase-dependent pathways. PMID:26224687

  5. Genetic monitoring of irradiated Drosophila populations treated with antimutagen melanine

    International Nuclear Information System (INIS)

    Mosseh, I.B.; Savchenko, V.K.; Lyakh, I.P.

    1986-01-01

    It was shown that viability of irradiated Drosophila is, on an average, lower than in intact populations. The fertility first decreases then increases exceeding the control level. Melanine added to the diet increases fertility and viability of both exposed and intact Drosophila populations

  6. Drosophila suzukii population response to environment and management strategies

    Science.gov (United States)

    Spotted wing drosophila, Drosophila suzukii, quickly emerged as a devastating invasive pest of small and stone fruits in the Americas and Europe. To better understand the population dynamics of D. suzukii, we reviewed recent work on juvenile development, adult reproduction, and seasonal variation in...

  7. First foreign exploration for asian parasitoids of Drosophila suzukii

    Science.gov (United States)

    The invasive spotted wing drosophila, Drosophila suzukii Matsumura (Dipt.: Drosophilidae), is a native of East Asia and is now widely established in North America and Europe, where it is a serious pest of small and stone fruit crops. The lack of effective indigenous parasitoids of D. suzukii in the ...

  8. Drosophila Courtship Conditioning As a Measure of Learning and Memory

    NARCIS (Netherlands)

    Koemans, T.S.; Oppitz, C.; Donders, R.; Bokhoven, H. van; Schenck, A.; Keleman, K.; Kramer, J.M.

    2017-01-01

    Many insights into the molecular mechanisms underlying learning and memory have been elucidated through the use of simple behavioral assays in model organisms such as the fruit fly, Drosophila melanogaster. Drosophila is useful for understanding the basic neurobiology underlying cognitive deficits

  9. Medium-term changes in Drosophila subobscura chromosomal ...

    Indian Academy of Sciences (India)

    2015-06-02

    Jun 2, 2015 ... [Zivanovic G., Arenas C. and Mestres F. 2015 Medium-term changes in Drosophila subobscura chromosomal inversion polymorphism: a possible relation with global warming? J. Genet. 94, 343–346]. Introduction. Drosophila subobscura is a species with a rich chromosomal polymorphism for inversions.

  10. Ultradian rhythm unmasked in the Pdf clock mutant of Drosophila

    Indian Academy of Sciences (India)

    2014-07-20

    Jul 20, 2014 ... temperature compensated. Our results suggest that Drosophila has an endogenous ultradian oscillator that is masked by circadian rhythmic behaviours. [Seki Y and Tanimura T 2014 Ultradian rhythm unmasked in the Pdf clock mutant of Drosophila. J. Biosci. 39 585-594]. DOI 10.1007/s12038-014-9450-z.

  11. Ionizing radiation causes the stress response in Drosophila melanogaster

    International Nuclear Information System (INIS)

    Gruntenko, N.E.; Zakharenko, L.P.; Raushenbakh, I.Yu.

    1998-01-01

    Potentiality of the stress-reaction arising in Drosophila melanogaster under gamma-irradiation of the source with 137 Cs (irradiation dose is 10 Gy , radiation dose rate amounts 180 c Gy/min) is studied. It is shown that radiation induces the stress-reaction in Drosophila resulting in alterations in energetic metabolism (biogenic amines metabolic system) and in reproductive function [ru

  12. Status of research on Drosophila ananassae at global level

    Indian Academy of Sciences (India)

    Abstract. Drosophila, a dipteran insect, has been found to be the best biological model for different kinds of studies. D melanogaster was first described by Meigen in 1830, is most extensively studied species of the genus Drosophila and a number of investigations employing this species have been documented in areas ...

  13. Relationship of DNA repair processes to mutagenesis and carcinogenesis in mammalian cells. Progress report, August 1, 1977-October 31, 1980

    International Nuclear Information System (INIS)

    Evans, H.H.

    1980-10-01

    The objective of this research is to determine the role of DNA repair in mutagenesis and carcinogenesis in mammalian cells. More specifically, mutant strains will be selected which are deficient in various DNA repair pathways. These strains will be studied with regard to (1) the nature of the defect in repair, and (2) the mutability and transformability of the defective cells by various agents as compared to the wild type parental cells. The results to date include progress in the following areas: (1) determination of optimum conditions for growth and maintenance of cells and for quantitative measurement of various cellular parameters; (2) investigation of the effect of holding mutagenized cells for various periods in a density inhibited state on survival and on mutation and transformation frequencies; (3) examination of the repair capabilities of BHK cells, as compared to repair-proficient and repair-deficient human cells and excision-deficient mouse cells, as measured by the reactivation of Herpes simplex virus (HSV) treated with radiation and ethylmethane sulfonate (EMS); (4) initiation of host cell reactivation viral sucide enrichment and screening of survivors of the enrichment for sensitivity to ionizing radiation; and (5) investigation of the toxicity, mutagenicity, and carcinogenicity of various metabolites of 4-nitroquinoline-1-oxide (4-NQO)

  14. Polyamines modulate carcinogen-induced mutagenesis in vivo.

    Science.gov (United States)

    Wallon, U Margaretha; O'Brien, Thomas G

    2005-01-01

    Elevated polyamine levels as a consequence of targeted overexpression of ornithine decarboxylase (ODC) to murine skin enhance susceptibility to tumorigenesis in this tissue. A possible mechanism for the enhanced susceptibility phenotype is an increased sensitivity of tissues with elevated polyamine levels to the mutagenic action of carcinogens. To test this hypothesis, a transgenic mouse model containing the Big Blue transgene and also expressing a K6/ODC transgene was developed. Incorporation of the K6/ODC transgene into the Big Blue model did not affect the spontaneous lacI mutant frequency in either skin or epidermis of the double-transgenic mice. After skin treatment with single doses of either 7,12-dimethylbenz[a]anthracene or N-methyl-N'-nitro-N-nitrosoguanidine, however, the mutant frequency was significantly increased in the skin of double-transgenic Big Blue;K6/ODC mice compared to Big Blue controls. The increases in mutant frequency were clearly due to ODC transgene activity, since treatment of mice with the ODC inhibitor, alpha-difluoromethylornithine, completely abolished the difference in mutant frequencies between double-transgenic and Big Blue mice. These results demonstrate that intracellular polyamine levels modulate mutation induction following carcinogen exposure. 2004 Wiley-Liss, Inc.

  15. The developmental transcriptome of Drosophila melanogaster

    Energy Technology Data Exchange (ETDEWEB)

    University of Connecticut; Graveley, Brenton R.; Brooks, Angela N.; Carlson, Joseph W.; Duff, Michael O.; Landolin, Jane M.; Yang, Li; Artieri, Carlo G.; van Baren, Marijke J.; Boley, Nathan; Booth, Benjamin W.; Brown, James B.; Cherbas, Lucy; Davis, Carrie A.; Dobin, Alex; Li, Renhua; Lin, Wei; Malone, John H.; Mattiuzzo, Nicolas R.; Miller, David; Sturgill, David; Tuch, Brian B.; Zaleski, Chris; Zhang, Dayu; Blanchette, Marco; Dudoit, Sandrine; Eads, Brian; Green, Richard E.; Hammonds, Ann; Jiang, Lichun; Kapranov, Phil; Langton, Laura; Perrimon, Norbert; Sandler, Jeremy E.; Wan, Kenneth H.; Willingham, Aarron; Zhang, Yu; Zou, Yi; Andrews, Justen; Bicke, Peter J.; Brenner, Steven E.; Brent, Michael R.; Cherbas, Peter; Gingeras, Thomas R.; Hoskins, Roger A.; Kaufman, Thomas C.; Oliver, Brian; Celniker, Susan E.

    2010-12-02

    Drosophila melanogaster is one of the most well studied genetic model organisms; nonetheless, its genome still contains unannotated coding and non-coding genes, transcripts, exons and RNA editing sites. Full discovery and annotation are pre-requisites for understanding how the regulation of transcription, splicing and RNA editing directs the development of this complex organism. Here we used RNA-Seq, tiling microarrays and cDNA sequencing to explore the transcriptome in 30 distinct developmental stages. We identified 111,195 new elements, including thousands of genes, coding and non-coding transcripts, exons, splicing and editing events, and inferred protein isoforms that previously eluded discovery using established experimental, prediction and conservation-based approaches. These data substantially expand the number of known transcribed elements in the Drosophila genome and provide a high-resolution view of transcriptome dynamics throughout development. Drosophila melanogaster is an important non-mammalian model system that has had a critical role in basic biological discoveries, such as identifying chromosomes as the carriers of genetic information and uncovering the role of genes in development. Because it shares a substantial genic content with humans, Drosophila is increasingly used as a translational model for human development, homeostasis and disease. High-quality maps are needed for all functional genomic elements. Previous studies demonstrated that a rich collection of genes is deployed during the life cycle of the fly. Although expression profiling using microarrays has revealed the expression of, 13,000 annotated genes, it is difficult to map splice junctions and individual base modifications generated by RNA editing using such approaches. Single-base resolution is essential to define precisely the elements that comprise the Drosophila transcriptome. Estimates of the number of transcript isoforms are less accurate than estimates of the number of genes

  16. Rhodopsin 7–The unusual Rhodopsin in Drosophila

    Directory of Open Access Journals (Sweden)

    Pingkalai R. Senthilan

    2016-09-01

    Full Text Available Rhodopsins are the major photopigments in the fruit fly Drosophila melanogaster. Drosophila express six well-characterized Rhodopsins (Rh1–Rh6 with distinct absorption maxima and expression pattern. In 2000, when the Drosophila genome was published, a novel Rhodopsin gene was discovered: Rhodopsin 7 (Rh7. Rh7 is highly conserved among the Drosophila genus and is also found in other arthropods. Phylogenetic trees based on protein sequences suggest that the seven Drosophila Rhodopsins cluster in three different groups. While Rh1, Rh2 and Rh6 form a “vertebrate-melanopsin-type”–cluster, and Rh3, Rh4 and Rh5 form an “insect-type”-Rhodopsin cluster, Rh7 seem to form its own cluster. Although Rh7 has nearly all important features of a functional Rhodopsin, it differs from other Rhodopsins in its genomic and structural properties, suggesting it might have an overall different role than other known Rhodopsins.

  17. Intestinal stem cells in the adult Drosophila midgut

    International Nuclear Information System (INIS)

    Jiang, Huaqi; Edgar, Bruce A.

    2011-01-01

    Drosophila has long been an excellent model organism for studying stem cell biology. Notably, studies of Drosophila's germline stem cells have been instrumental in developing the stem cell niche concept. The recent discovery of somatic stem cells in adult Drosophila, particularly the intestinal stem cells (ISCs) of the midgut, has established Drosophila as an exciting model to study stem cell-mediated adult tissue homeostasis and regeneration. Here, we review the major signaling pathways that regulate the self-renewal, proliferation and differentiation of Drosophila ISCs, discussing how this regulation maintains midgut homeostasis and mediates regeneration of the intestinal epithelium after injury. -- Highlights: ► The homeostasis and regeneration of adult fly midguts are mediated by ISCs. ► Damaged enterocytes induce the proliferation of intestinal stem cells (ISC). ► EGFR and Jak/Stat signalings mediate compensatory ISC proliferation. ► Notch signaling regulates ISC self-renewal and differentiation.

  18. Drosophila melanogaster as a model organism to study nanotoxicity.

    Science.gov (United States)

    Ong, Cynthia; Yung, Lin-Yue Lanry; Cai, Yu; Bay, Boon-Huat; Baeg, Gyeong-Hun

    2015-05-01

    Drosophila melanogaster has been used as an in vivo model organism for the study of genetics and development since 100 years ago. Recently, the fruit fly Drosophila was also developed as an in vivo model organism for toxicology studies, in particular, the field of nanotoxicity. The incorporation of nanomaterials into consumer and biomedical products is a cause for concern as nanomaterials are often associated with toxicity in many in vitro studies. In vivo animal studies of the toxicity of nanomaterials with rodents and other mammals are, however, limited due to high operational cost and ethical objections. Hence, Drosophila, a genetically tractable organism with distinct developmental stages and short life cycle, serves as an ideal organism to study nanomaterial-mediated toxicity. This review discusses the basic biology of Drosophila, the toxicity of nanomaterials, as well as how the Drosophila model can be used to study the toxicity of various types of nanomaterials.

  19. Detecting novel low-abundant transcripts in Drosophila

    DEFF Research Database (Denmark)

    Lee, Sanggyu; Bao, Jingyue; Zhou, Guolin

    2005-01-01

    Increasing evidence suggests that low-abundant transcripts may play fundamental roles in biological processes. In an attempt to estimate the prevalence of low-abundant transcripts in eukaryotic genomes, we performed a transcriptome analysis in Drosophila using the SAGE technique. We collected 244......,313 SAGE tags from transcripts expressed in Drosophila embryonic, larval, pupae, adult, and testicular tissue. From these SAGE tags, we identified 40,823 unique SAGE tags. Our analysis showed that 55% of the 40,823 unique SAGE tags are novel without matches in currently known Drosophila transcripts...... in the Drosophila genome. Our study reveals the presence of a significant number of novel low-abundant transcripts in Drosophila, and highlights the need to isolate these novel low-abundant transcripts for further biological studies. Udgivelsesdato: 2005-Jun...

  20. Repair of lesions provoked by X-rays in embryos of Drosophila (D. melanogaster Meig)

    International Nuclear Information System (INIS)

    Ghelelovitch, S.

    1975-01-01

    The sensitivity of Drosophila eggs to the lethal action of X-rays did not remain constant during embryogenesis. The X-ray doses used in the present investigation may have retarded the hatching of the larvae but did not block development immediately after irradiation. A fraction of the damage induced in young embryos was repaired during gastrulation. The amount of repair was independent of the X-ray dose but was influenced by the temperature. The damage could be repaired even after the cells of the embryo had undergone many mitotic cycles. (author)

  1. The use of a mutationally unstable X-chromosome in Drosophila melanogaster for mutagenicity testing

    International Nuclear Information System (INIS)

    Rasmuson, B.; Svahlin, H.; Rasmuson, A.; Montell, I.; Olofsson, H.

    1978-01-01

    Somatic eye-colour mutations in an unstable genetic system, caused by a transposable element in the white locus of the X-chromosome in Drosophila melanogaster, is suggested as an assay system for mutagenicity testing. The system is evaluated by comparison with a corresponding system in a stable X-chromosome. Its sensitivity is confirmed with X-ray and EMS treatment, and it is found to be confined to the specific segment of the X-chromosome where the transposable element is localized. (Auth.)

  2. Altered lipid accumulation in Nannochloropsis salina CCAP849/3 following EMS and UV induced mutagenesis

    Directory of Open Access Journals (Sweden)

    T.A. Beacham

    2015-09-01

    Full Text Available Microalgae have potential as a chemical feed stock in a range of industrial applications. Nannochloropsis salina was subject to EMS mutagenesis and the highest lipid containing cells selected using fluorescence-activated cell sorting. Assessment of growth, lipid content and fatty acid composition identified mutant strains displaying a range of altered traits including changes in the PUFA content and a total FAME increase of up to 156% that of the wild type strain. Combined with a reduction in growth this demonstrated a productivity increase of up to 76%. Following UV mutagenesis, lipid accumulation of the mutant cultures was elevated to more than 3 fold that of the wild type strain, however reduced growth rates resulted in a reduction in overall productivity. Changes observed are indicative of alterations to the regulation of the omega 6 Kennedy pathway. The importance of these variations in physiology for industrial applications such as biofuel production is discussed.

  3. Altered lipid accumulation in Nannochloropsis salina CCAP849/3 following EMS and UV induced mutagenesis.

    Science.gov (United States)

    Beacham, T A; Macia, V Mora; Rooks, P; White, D A; Ali, S T

    2015-09-01

    Microalgae have potential as a chemical feed stock in a range of industrial applications. Nannochloropsis salina was subject to EMS mutagenesis and the highest lipid containing cells selected using fluorescence-activated cell sorting. Assessment of growth, lipid content and fatty acid composition identified mutant strains displaying a range of altered traits including changes in the PUFA content and a total FAME increase of up to 156% that of the wild type strain. Combined with a reduction in growth this demonstrated a productivity increase of up to 76%. Following UV mutagenesis, lipid accumulation of the mutant cultures was elevated to more than 3 fold that of the wild type strain, however reduced growth rates resulted in a reduction in overall productivity. Changes observed are indicative of alterations to the regulation of the omega 6 Kennedy pathway. The importance of these variations in physiology for industrial applications such as biofuel production is discussed.

  4. The mutagenesis and breeding of high productive strains of streptomyces jingyangensis '5406'

    International Nuclear Information System (INIS)

    Qi Hongyan; Yin Xinyun

    1988-03-01

    The purpose of these experiments is to explore the mutagenesis rhythm and breed high productive strains of actinomycete '5406'. The single colony agar pieces of strain F 358 were treated with fast neutron and 60 Co-γ ray irradiation Two mutants have been selected from 20025 treated single colonies. The output of cytokinins from them is higher than from strain F 358 . The original strain 'Mu-Tan-al' rejuvenated by freezing was treated with several physical and chemical mutagens. The mutagenesis rhythm has been summed up tentatively. Eight mutants obtained from 93014 treated single colonies produced more '5406' antibiotics than that of strain 'Mu-Tan-al,. The effect of mutant 'N2-10-Ra3' was the best

  5. Mutagenesis of the bacterial RNA polymerase alpha subunit for improvement of complex phenotypes.

    Science.gov (United States)

    Klein-Marcuschamer, Daniel; Santos, Christine Nicole S; Yu, Huimin; Stephanopoulos, Gregory

    2009-05-01

    Combinatorial or random methods for strain engineering have been extensively used for the improvement of multigenic phenotypes and other traits for which the underlying mechanism is not fully understood. Although the preferred method has traditionally been mutagenesis and selection, our laboratory has successfully used mutant transcription factors, which direct the RNA polymerase (RNAP) during transcription, to engineer complex phenotypes in microbial cells. Here, we show that it is also possible to impart new phenotypes by altering the RNAP core enzyme itself, in particular through mutagenesis of the alpha subunit of the bacterial polymerase. We present the use of this tool for improving tolerance of Escherichia coli to butanol and other solvents and for increasing the titers of two commercially relevant products, L-tyrosine and hyaluronic acid. In addition, we explore the underlying physiological changes that give rise to the solvent-tolerant mutant.

  6. Mutagenesis of the somaclones in vitro of cut roses by 60Co γ-rays irradiation

    International Nuclear Information System (INIS)

    Qu Suping; Su Yan; Wang Lihua; Tang Kaixue; Wang Jihua; Zhang Hao

    2009-01-01

    Mutagenesis of cut rose in vitro irradiated by 60 Co γ-rays was studied. The callus of leaves and regenerations adventitious bud was used as the explants for mutagenesis. Effect of 60 Co γ-rays irradiation on the callus's regeneration rate, adventitious bud's multiplication rate and vegetal status were studied. The results showed that the regeneration frequency of callus was decreased by 60 Co γ-rays irradiation. The regenerations adventitious bud was the better experimental materials compared with the callus of leaves. The lethal dose was 122 Gy and the semi-lethal dose was 76 Gy according to the regression equation. The appropriate dose on adventitious bud by irradiation rays was 50-60 Gy. (authors)

  7. Software-Supported USER Cloning Strategies for Site-Directed Mutagenesis and DNA Assembly

    DEFF Research Database (Denmark)

    Genee, Hans Jasper; Bonde, Mads Tvillinggaard; Bagger, Frederik Otzen

    2015-01-01

    USER cloning is a fast and versatile method for engineering of plasmid DNA. We have developed a user friendly Web server tool that automates the design of optimal PCR primers for several distinct USER cloning-based applications. Our Web server, named AMUSER (Automated DNA Modifications with USER...... cloning), facilitates DNA assembly and introduction of virtually any type of site-directed mutagenesis by designing optimal PCR primers for the desired genetic changes. To demonstrate the utility, we designed primers for a simultaneous two-position site-directed mutagenesis of green fluorescent protein...... (GFP) to yellow fluorescent protein (YFP), which in a single step reaction resulted in a 94% cloning efficiency. AMUSER also supports degenerate nucleotide primers, single insert combinatorial assembly, and flexible parameters for PCR amplification. AMUSER is freely available online at ....

  8. Regulation of mutagenesis by exogenous biological factors in the eukaryotic cell systems

    Directory of Open Access Journals (Sweden)

    Lukash L. L.

    2013-07-01

    Full Text Available The representations of the mutations and the nature of spontaneous mutation process and mutagenesis induced by exogenous oncoviruses, DNAs and proteins-mitogens are analysed. Exogenous biological factors induce DNA damages in regulatory-informational way, acting on the cellular systems for maintenance of genetical stability. Molecular mechanisms are the same as at spontaneous mutagenesis but they are realized with the participation of alien genetical material. Among biological mutagens, the oncoviruses and mobile genetic elements (MGEs are distinguished as the strongest destabilizing factors which direct tumor transformation of somatic mammalian cells. Genetical reprogramming or changing the programs of gene expression at the differentiation of stem and progenitor cells under growth factors and citokines is probably followed by mutations and recombinations as well.

  9. An In Vitro Single-Primer Site-Directed Mutagenesis Method for Use in Biotechnology.

    Science.gov (United States)

    Huang, Yanchao; Zhang, Likui

    2017-01-01

    Site-directed mutagenesis is a powerful method to introduce mutation(s) into DNA sequences. A number of methods have been developed over the years with a main goal being to create a high number of mutant genes. The single-mutagenic primer method for site-directed mutagenesis is the most direct method that yields mutant genes in about 25-50 % of transformants in a robust, low-cost reaction. The supercompetent XL10-Gold bacteria used in the Stratagene protocol carry a phage, which may be a problem for some applications; however, in our single-mutagenic primer method the supercompetent bacteria are not needed. A thermostable DNA polymerase with high fidelity and processivity, such as Phusion DNA polymerase, is required for our optimized procedure to avoid extra mutation(s) and enhance mutagenic efficiency.

  10. An efficient method for multiple site-directed mutagenesis using type IIs restriction enzymes.

    Science.gov (United States)

    Zhang, Zhiqiang; Xu, Kun; Xin, Ying; Zhang, Zhiying

    2015-05-01

    Site-directed mutagenesis (SDM) methods are very important in modern molecular biology, biochemistry, and protein engineering. Here, we present a novel SDM method that can be used for multiple mutation generation using type IIs restriction enzymes. This approach is faster and more convenient than the overlap polymerase chain reaction (PCR) method due to its having fewer reaction steps and being cheaper than, but as convenient as, enzymatic assembly. We illustrate the usefulness of our method by introducing three mutations into the bacterial Streptococcus thermophilus Cas9 (bStCas9) gene, converting the humanized S. thermophilus Cas9 (hStCas9) gene into nuclease dead or H847A nickase mutants and generating sunnyTALEN mutagenesis from a wild-type TALEN backbone. Copyright © 2015 Elsevier Inc. All rights reserved.

  11. Cell-mediated mutagenesis and cell transformation of mammalian cells by chemical carcinogens

    International Nuclear Information System (INIS)

    Huberman, E.; Langenbach, R.

    1977-01-01

    We have developed a cell-mediated mutagenesis assay in which cells with the appropriate markers for mutagenesis are co-cultivated with either lethally irradiated rodent embryonic cells that can metabolize carcinogenic hydrocarbons or with primary rat liver cells that can metabolize chemicals carcinogenic to the liver. During co-cultivation, the reactive metabolites of the procarcinogen appear to be transmitted to the mutable cells and induce mutations in them. Assays of this type make it possible to demonstrate a relationship between carcinogenic potency of the chemicals and their ability to induce mutations in mammalian cells. In addition, by simultaneously comparing the frequencies of transformation and mutation induced in normal diploid hamster cells by benzo(a)pyrene (BP) and one of its metabolites, it is possible to estimate the genetic target size for cell transformation in vitro

  12. Rapid and highly accurate detection of Drosophila suzukii, spotted wing Drosophila (Diptera: Drosophilidae) by loop-mediated isothermal amplification assays

    Science.gov (United States)

    Drosophila suzukii, the spotted wing drosophila (SWD), is currently a major pest that causes severe economic losses to thin-skinned, small fruit growers in North America and Europe. The monitoring and early detection of SWD in the field is of the utmost importance for its proper management. Althou...

  13. Isolation of protease-free alcohol dehydrogenase (ADH) from Drosophila simulans and several homozygous and heterozygous Drosophila melanogaster variants

    NARCIS (Netherlands)

    Smilda, T; Lamme, DA; Collu, G; Jekel, PA; Reinders, P; Beintema, JJ

    The enzyme alcohol dehydrogenase (ADH) from several naturally occurring ADH variants of Drosophila melanogaster and Drosophila simulans Lc,as isolated. Affinity chromatography with the ligand Cibacron Blue and elution with NAD(+) showed similar behavior for D. melanogaster ADH-FF, ADH-71k, and D.

  14. The influence of Adh function on ethanol preference and tolerance in adult Drosophila melanogaster.

    Science.gov (United States)

    Ogueta, Maite; Cibik, Osman; Eltrop, Rouven; Schneider, Andrea; Scholz, Henrike

    2010-11-01

    Preference determines behavioral choices such as choosing among food sources and mates. One preference-affecting chemical is ethanol, which guides insects to fermenting fruits or leaves. Here, we show that adult Drosophila melanogaster prefer food containing up to 5% ethanol over food without ethanol and avoid food with high levels (23%) of ethanol. Although female and male flies behaved differently at ethanol-containing food sources, there was no sexual dimorphism in the preference for food containing modest ethanol levels. We also investigated whether Drosophila preference, sensitivity and tolerance to ethanol was related to the activity of alcohol dehydrogenase (Adh), the primary ethanol-metabolizing enzyme in D. melanogaster. Impaired Adh function reduced ethanol preference in both D. melanogaster and a related species, D. sechellia. Adh-impaired flies also displayed reduced aversion to high ethanol concentrations, increased sensitivity to the effects of ethanol on postural control, and negative tolerance/sensitization (i.e., a reduction of the increased resistance to ethanol's effects that normally occurs upon repeated exposure). These data strongly indicate a linkage between ethanol-induced behavior and ethanol metabolism in adult fruit flies: Adh deficiency resulted in reduced preference to low ethanol concentrations and reduced aversion to high ones, despite recovery from ethanol being strongly impaired.

  15. Mutagenesis of Jatropha curcas - Exploring new traits in the breeding of a biofuel plant

    International Nuclear Information System (INIS)

    Azhar Mohamad; Sobri Hussein; Abdul Rahim Harun

    2010-01-01

    Mutagenesis in plant species is considered effective in recovering and producing useful mutants as it leads to a high degree of chimerism and produces high degree of somaclonal variations for further selection in breeding programmes. Jatropha curcas is a species with many attributes and considerable potential, especially as bio diesel. Narrow genetic background of Jatropha spp. gives less selection to growers for better quality plant materials. In this study, a new method through nuclear technology was used to increase the genetic variability of Jatropha towards novel superior potential mutant lines. The objective of the study is to generate new mutant varieties of Jatropha curcas through the mutagenesis approach in getting new sustainable mutants for high oil yield and improved plant characteristics. Seeds of a Jatropha cultivar were from selected materials from Lembaga Kenaf and Tembakau Negara, Kelantan. Radiosensitivity test was done by irradiating a total of each 60 seeds at multiple doses (0 Gy, 20 Gy, 40 Gy, 60 Gy, 80 Gy, 100 Gy, 200 Gy, 300 Gy, 400 Gy, 600 Gy and 700 Gy). After getting the LD 50 , three doses i.e. 250 Gy, 300 Gy and 350 Gy were selected for mutagenesis, where a total of 1000 seeds were exposed to gamma radiation. The seeds were hardened and field planted at close distance of 1 m x 1 m. Pruning was conducted three times at two months interval prior to screening for early flowering, short stature and high branching mutant lines. Radiosensitivity of seeds to acute gamma irradiation revealed that the LD 50 was at 320 Gy. At nursery stage, somatic mutations related to chlorophyll changes were observed on leaves with certain shapes. Screening of Jatropha via seed mutagenesis bore 6 early flowering mutants, 7 dwarf mutants and, 17 high branching plants. In narrowing the mutant lines, cuttings from each selected trait were collected and re-planted for further evaluation. (author)

  16. The contribution of Nth and Nei DNA glycosylases to mutagenesis in Mycobacterium smegmatis.

    Science.gov (United States)

    Moolla, Nabiela; Goosens, Vivianne J; Kana, Bavesh D; Gordhan, Bhavna G

    2014-01-01

    The increased prevalence of drug resistant strains of Mycobacterium tuberculosis (Mtb) indicates that significant mutagenesis occurs during tuberculosis disease in humans. DNA damage by host-derived reactive oxygen/nitrogen species is hypothesized to be critical for the mutagenic process in Mtb thus, highlighting an important role for DNA repair enzymes in maintenance of genome fidelity. Formamidopyrimidine (Fpg/MutM/Fapy) and EndonucleaseVIII (Nei) constitute the Fpg/Nei family of DNA glycosylases and together with EndonucleaseIII (Nth) are central to the base excision repair pathway in bacteria. In this study we assess the contribution of Nei and Nth DNA repair enzymes in Mycobacterium smegmatis (Msm), which retains a single nth homologue and duplications of the Fpg (fpg1 and fpg2) and Nei (nei1 and nei2) homologues. Using an Escherichia coli nth deletion mutant, we confirm the functionality of the mycobacterial nth gene in the base excision repair pathway. Msm mutants lacking nei1, nei2 and nth individually or in combination did not display aberrant growth in broth culture. Deletion of nth individually results in increased UV-induced mutagenesis and combinatorial deletion with the nei homologues results in reduced survival under oxidative stress conditions and an increase in spontaneous mutagenesis to rifampicin. Deletion of nth together with the fpg homolgues did not result in any growth/survival defects or changes in mutation rate. Furthermore, no differential emergence of the common rifampicin resistance conferring genotypes were noted. Collectively, these data confirm a role for Nth in base excision repair in mycobacteria and further highlight a novel interplay between the Nth and Nei homologues in spontaneous mutagenesis. Copyright © 2013 Elsevier B.V. All rights reserved.

  17. Repair and mutagenesis of herpes simplex virus in UV-irradiated monkey cells

    International Nuclear Information System (INIS)

    Lytle, C.D.; Goddard, J.G.; Lin, C.H.

    1980-01-01

    Mutagenic repair in mammalian cells was investigated by determining the mutagenesis of UV-irradiated or unirradiated herpes simplex virus in UV-irradiated CV-1 monkey kidney cells. These results were compared with the results for UV-enhanced virus reactivation (UVER) in the same experimental situation. High and low multiplicities of infection were used to determine the effects of multiplicity reactivation (MR). UVER and MR were readily demonstrable and were approximately equal in amount in an infectious center assay. For this study, a forward-mutation assay was developed to detect virus mutants resistant to iododeoxycytidine (ICdR), probably an indication of the mutant virus being defective at its thymidine kinase locus. ICdR-resistant mutants did not have a growth advantage over wild-type virus in irradiated or unirradiated cells. Thus, higher fractions of mutant virus indicated greater mutagenesis during virus repair and/or replication. The data showed that: (1) unirradiated virus was mutated in unirradiated cells, providing a background level of mutagenesis; (2) unirradiated virus was mutated about 40% more in irradiated cells, indicating that virus replication (DNA synthesis) became more mutagenic as a result of cell irradiation; (3) irradiated virus was mutated much more (about 6-fold) than unirradiated virus, even in unirradiated cells; (4) cell irradiation did not change the mutagenesis of irradiated virus except at high multiplicity of infection. High multiplicity of infection did not demonstrate UVER or MR alone to be either error-free or error-prone. When the two processes were present simultaneously, they were mutagenic. (orig.)

  18. Peptidergic control of a fruit crop pest: the spotted-wing drosophila, Drosophila suzukii

    Science.gov (United States)

    Neuropeptides play an important role in the regulation of feeding in insects and offer potential targets for the development of new chemicals to control insect pests. A pest that has attracted much recent attention is the highly invasive Drosophila suzukii, a polyphagous pest that can cause serious...

  19. Biological effects of radon in Drosophila; Efectos biologicos del radon en Drosophila

    Energy Technology Data Exchange (ETDEWEB)

    Pimentel P, A.E.; Tavera D, L.; Cruces M, M.P.; Arceo M, C.; Rosa D, M.E. de la

    1992-04-15

    The main objective of this investigation, is to study the biological effects of the Radon-222 at low dose in 'Drosophila melanogaster'. It is necessary to mention that these effects will analyze from the genetic point of view for: 1) To evaluate in which form the Radon-222 to low dose it influences in some genetic components of the adaptation in Drosophila, such as: fecundity, viability egg-adult and sex proportion. 2) To evaluate which is the genetic effect that induces the Radon to low dose by means of the SMART technique in Drosophila melanogaster, and this way to try of to identify which is the possible mechanism that causes the genetic damage to somatic level. The carried out investigation was divided in three stages: 1. Tests to the vacuum resistance. 2. Test of somatic mutation, and 3. Determination of the presence of radon daughters on the adult of Drosophila. It is necessary to point out that all the experiments were made by triplicate and in each one of them was placed detectors in preset places. Those obtained results are presented inside the 4 charts included in the present work. (Author)

  20. Yeasts acquire resistance secondary to antifungal drug treatment by adaptive mutagenesis.

    Directory of Open Access Journals (Sweden)

    David Quinto-Alemany

    Full Text Available Acquisition of resistance secondary to treatment both by microorganisms and by tumor cells is a major public health concern. Several species of bacteria acquire resistance to various antibiotics through stress-induced responses that have an adaptive mutagenesis effect. So far, adaptive mutagenesis in yeast has only been described when the stress is nutrient deprivation. Here, we hypothesized that adaptive mutagenesis in yeast (Saccharomyces cerevisiae and Candida albicans as model organisms would also take place in response to antifungal agents (5-fluorocytosine or flucytosine, 5-FC, and caspofungin, CSP, giving rise to resistance secondary to treatment with these agents. We have developed a clinically relevant model where both yeasts acquire resistance when exposed to these agents. Stressful lifestyle associated mutation (SLAM experiments show that the adaptive mutation frequencies are 20 (S. cerevisiae -5-FC, 600 (C. albicans -5-FC or 1000 (S. cerevisiae--CSP fold higher than the spontaneous mutation frequency, the experimental data for C. albicans -5-FC being in agreement with the clinical data of acquisition of resistance secondary to treatment. The spectrum of mutations in the S. cerevisiae -5-FC model differs between spontaneous and acquired, indicating that the molecular mechanisms that generate them are different. Remarkably, in the acquired mutations, an ectopic intrachromosomal recombination with an 87% homologous gene takes place with a high frequency. In conclusion, we present here a clinically relevant adaptive mutation model that fulfils the conditions reported previously.

  1. Transgenic Chinese hamster V79 cell lines which exhibit variable levels of gpt mutagenesis

    International Nuclear Information System (INIS)

    Klein, C.B.; Rossman, T.G.

    1990-01-01

    The Escherichia coli gpt gene coding for xanthine-guanine phosphoribosyl transferase has been stably transfected into HPRT - Chinese hamster V79 cells. Several gpt - cell lines have been established, which retain the sequence(s) even after long-term culture without selection for gpt. While spontaneous mutagenesis to gpt - occurs rather frequently for most cell lines, it cannot be correlated with either the number of plasmid integration sites or deletion of the plasmid sequence(s). One transgenic cell line (g12), which continuously maintains a low spontaneous mutation frequency was used in comparative mutagenesis studies with wild-type V79 cells (gpt vs. hprt). Alkylating agents such as N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) and β-propiolactone (BPL) are shown to be equally toxic and mutagenic in both g12 and V79 cells. UV and X-rays are also equally toxic to both cell lines. The data presented here suggests that g12 cells may be useful to study mammalian mutagenesis by agents which yield limited response at the hprt locus

  2. Induction of Pectinase Hyper Production by Multistep Mutagenesis Using a Fungal Isolate--Aspergillus flavipes.

    Science.gov (United States)

    Akbar, Sabika; Prasuna, R Gyana; Khanam, Rasheeda

    2014-04-01

    Aspergillus flavipes, a slow growing pectinase producing ascomycete, was isolated from soil identified and characterised in the previously done preliminary studies. Optimisation studies revealed that Citrus peel--groundnut oil cake [CG] production media is the best media for production of high levels of pectinase up to 39 U/ml using wild strain of A. flavipes. Strain improvement of this isolated strain for enhancement of pectinase production using multistep mutagenesis procedure is the endeavour of this project. For this, the wild strain of A. flavipes was treated with both physical (UV irradiation) and chemical [Colchicine, Ethidium bromide, H2O2] mutagens to obtain Ist generation mutants. The obtained mutants were assayed and differentiated basing on pectinase productivity. The better pectinase producing strains were further subjected to multistep mutagenesis to attain stability in mutants. The goal of this project was achieved by obtaining the best pectinase secreting mutant, UV80 of 45 U/ml compared to wild strain and sister mutants. This fact was confirmed by quantitatively analysing 3rd generation mutants obtained after multistep mutagenesis.

  3. Spontaneous mutability and light-induced mutagenesis in Salmonella typhimurium: effects of an R-plasmid

    International Nuclear Information System (INIS)

    Valdivia, L.

    1979-01-01

    The UV-protecting plasmid R46 was transferred by conjugation to a genetically marked mouse-virulent Salmonella typhimurium strain, not derived from LT2; in this host the plasmid conferred UV protection and enhanced UV mutagenesis just as it does in LT2 lines. Tra - derivatives of R46 encountered during transduction retained UV-protecting and mutagenesis-enhancing ability. Stored strains carrying the R46-derived plasmids with strong mutator effect but not UV-protecting had lost most of their original streptomycin resistance but were slightly resistant to spectinomycin; attempts to transfer such plasmids failed. R46 enhanced the weak mutagenic effect of visible light on several his and trp mutants of strain LT2, including some whose frequency of spontaneous reversion was not increased by the plasmid. A mutagenic effect was produced by visible-light irradiation of hisG46(R46), either growing cells or nonmultiplying (histidine-deprived cells at 10 0 C). Presence of catalase or cyanide during irradiation did not prevent mutagenesis, which excludes some hypothetical mechanisms. Visible-light irradiation of hisG46 or hisG46(R46) under strict anaerobiosis had little or no mutagenic effect (controls showed that revertants if produced would have been detected). This is as expected if visible-light irradiation in air causes photodynamic damage to DNA and mutations are produced during error-prone, plasmid-enhanced repair

  4. CRISPR/Cas9-mediated targeted gene mutagenesis in Spodoptera litura.

    Science.gov (United States)

    Bi, Hong-Lun; Xu, Jun; Tan, An-Jiang; Huang, Yong-Ping

    2016-06-01

    Custom-designed nuclease technologies such as the clustered regularly interspaced short palindromic repeat (CRISPR)-associated (Cas) system provide attractive genome editing tools for insect functional genetics. The targeted gene mutagenesis mediated by the CRISPR/Cas9 system has been achieved in several insect orders including Diptera, Lepidoptera and Coleoptera. However, little success has been reported in agricultural pests due to the lack of genomic information and embryonic microinjection techniques in these insect species. Here we report that the CRISPR/Cas9 system induced efficient gene mutagenesis in an important Lepidopteran pest Spodoptera litura. We targeted the S. litura Abdominal-A (Slabd-A) gene which is an important embryonic development gene and plays a significant role in determining the identities of the abdominal segments of insects. Direct injection of Cas9 messenger RNA and Slabd-A-specific single guide RNA (sgRNA) into S. litura embryos successfully induced the typical abd-A deficient phenotype, which shows anomalous segmentation and ectopic pigmentation during the larval stage. A polymerase chain reaction-based analysis revealed that the Cas9/sgRNA complex effectively induced a targeted mutagenesis in S. litura. These results demonstrate that the CRISPR/Cas9 system is a powerful tool for genome manipulation in Lepidopteran pests such as S. litura. © 2016 Institute of Zoology, Chinese Academy of Sciences.

  5. Insertional Mutagenesis by a Hybrid PiggyBac and Sleeping Beauty Transposon in the Rat

    Science.gov (United States)

    Furushima, Kenryo; Jang, Chuan-Wei; Chen, Diane W.; Xiao, Ningna; Overbeek, Paul A.; Behringer, Richard R.

    2012-01-01

    A hybrid piggyBac/Sleeping Beauty transposon-based insertional mutagenesis system that can be mobilized by simple breeding was established in the rat. These transposons were engineered to include gene trap sequences and a tyrosinase (Tyr) pigmentation reporter to rescue the albinism of the genetic background used in the mutagenesis strategy. Single-copy transposon insertions were transposed into the rat genome by co-injection of plasmids carrying the transposon and RNA encoding piggyBac transposase into zygotes. The levels of transgenic Tyr expression were influenced by chromosomal context, leading to transgenic rats with different pigmentation that enabled visual genotyping. Transgenic rats designed to ubiquitously express either piggyBac or Sleeping Beauty transposase were generated by standard zygote injection also on an albino background. Bigenic rats carrying single-copy transposons at known loci and transposase transgenes exhibited coat color mosaicism, indicating somatic transposition. PiggyBac or Sleeping Beauty transposase bigenic rats bred with wild-type albino rats yielded offspring with pigmentation distinct from the initial transposon insertions as a consequence of germline transposition to new loci. The germline transposition frequency for Sleeping Beauty and piggyBac was ∼10% or about one new insertion per litter. Approximately 50% of the insertions occurred in introns. Chimeric transcripts containing endogenous and gene trap sequences were identified in Gabrb1 mutant rats. This mutagenesis system based on simple crosses and visual genotyping can be used to generate a collection of single-gene mutations in the rat. PMID:23023007

  6. UV-induced mutagenesis in Escherichia coli SOS response: a quantitative model.

    Directory of Open Access Journals (Sweden)

    Sandeep Krishna

    2007-03-01

    Full Text Available Escherichia coli bacteria respond to DNA damage by a highly orchestrated series of events known as the SOS response, regulated by transcription factors, protein-protein binding, and active protein degradation. We present a dynamical model of the UV-induced SOS response, incorporating mutagenesis by the error-prone polymerase, Pol V. In our model, mutagenesis depends on a combination of two key processes: damage counting by the replication forks and a long-term memory associated with the accumulation of UmuD'. Together, these provide a tight regulation of mutagenesis, resulting, we show, in a "digital" turn-on and turn-off of Pol V. Our model provides a compact view of the topology and design of the SOS network, pinpointing the specific functional role of each of the regulatory processes. In particular, we suggest that the recently observed second peak in the activity of promoters in the SOS regulon (Friedman et al., 2005, PLoS Biology 3(7: e238 is the result of positive feedback from Pol V to RecA filaments.

  7. In vitro Inactivation of Latent HSV by Targeted Mutagenesis Using an HSV-specific Homing Endonuclease

    Directory of Open Access Journals (Sweden)

    Martine Aubert

    2014-01-01

    Full Text Available Following acute infection, herpes simplex virus (HSV establishes latency in sensory neurons, from which it can reactivate and cause recurrent disease. Available antiviral therapies do not affect latent viral genomes; therefore, they do not prevent reactivation following therapy cessation. One possible curative approach involves the introduction of DNA double strand breaks in latent HSV genomes by rare-cutting endonucleases, leading to mutagenesis of essential viral genes. We tested this approach in an in vitro HSV latency model using the engineered homing endonuclease (HE HSV1m5, which recognizes a sequence in the HSV-1 gene UL19, encoding the virion protein VP5. Coexpression of the 3′-exonuclease Trex2 with HEs increased HE-mediated mutagenesis frequencies up to sixfold. Following HSV1m5/Trex2 delivery with adeno-associated viral (AAV vectors, the target site was mutated in latent HSV genomes with no detectable cell toxicity. Importantly, HSV production by latently infected cells after reactivation was decreased after HSV1m5/Trex2 exposure. Exposure to histone deacetylase inhibitors prior to HSV1m5/Trex2 treatment increased mutagenesis frequencies of latent HSV genomes another two- to fivefold, suggesting that chromatin modification may be a useful adjunct to gene-targeting approaches. These results support the continuing development of HEs and other nucleases (ZFNs, TALENs, CRISPRs for cure of chronic viral infections.

  8. Mouse ENU Mutagenesis to Understand Immunity to Infection: Methods, Selected Examples, and Perspectives

    Directory of Open Access Journals (Sweden)

    Grégory Caignard

    2014-09-01

    Full Text Available Infectious diseases are responsible for over 25% of deaths globally, but many more individuals are exposed to deadly pathogens. The outcome of infection results from a set of diverse factors including pathogen virulence factors, the environment, and the genetic make-up of the host. The completion of the human reference genome sequence in 2004 along with technological advances have tremendously accelerated and renovated the tools to study the genetic etiology of infectious diseases in humans and its best characterized mammalian model, the mouse. Advancements in mouse genomic resources have accelerated genome-wide functional approaches, such as gene-driven and phenotype-driven mutagenesis, bringing to the fore the use of mouse models that reproduce accurately many aspects of the pathogenesis of human infectious diseases. Treatment with the mutagen N-ethyl-N-nitrosourea (ENU has become the most popular phenotype-driven approach. Our team and others have employed mouse ENU mutagenesis to identify host genes that directly impact susceptibility to pathogens of global significance. In this review, we first describe the strategies and tools used in mouse genetics to understand immunity to infection with special emphasis on chemical mutagenesis of the mouse germ-line together with current strategies to efficiently identify functional mutations using next generation sequencing. Then, we highlight illustrative examples of genes, proteins, and cellular signatures that have been revealed by ENU screens and have been shown to be involved in susceptibility or resistance to infectious diseases caused by parasites, bacteria, and viruses.

  9. Combined mutagenesis of Rhodosporidium toruloides for improved production of carotenoids and lipids.

    Science.gov (United States)

    Zhang, Chaolei; Shen, Hongwei; Zhang, Xibin; Yu, Xue; Wang, Han; Xiao, Shan; Wang, Jihui; Zhao, Zongbao K

    2016-10-01

    To improve production of lipids and carotenoids by the oleaginous yeast Rhodosporidium toruloides by screening mutant strains. Upon physical mutagenesis of the haploid strain R. toruloides np11 with an atmospheric and room temperature plasma method followed by chemical mutagenesis with nitrosoguanidine, a mutant strain, R. toruloides XR-2, formed dark-red colonies on a screening plate. When cultivated in nitrogen-limited media, XR-2 cells grew slower but accumulated 0.23 g lipids/g cell dry wt and 0.75 mg carotenoids/g CDW. To improve its production capacity, different amino acids and vitamins were supplemented. p-Aminobenzoic acid and tryptophan had beneficial effects on cell growth. When cultivated in nitrogen-limited media in the presence of selected vitamins, XR-2 accumulated 0.41 g lipids/g CDW and 0.69 mg carotenoids/g CDW. A mutant R. toruloides strain with improved production profiles for lipids and carotenoids was obtained, indicating its potential to use combined mutagenesis for a more productive phenotype.

  10. Isolation of temperature-sensitive mutants of 16 S rRNA in Escherichia coli

    DEFF Research Database (Denmark)

    Triman, K; Becker, E; Dammel, C

    1989-01-01

    Temperature-sensitive mutants have been isolated following hydroxylamine mutagenesis of a plasmid containing Escherichia coli rRNA genes carrying selectable markers for spectinomycin resistance (U1192 in 16 S rRNA) and erythromycin resistance (G2058 in 23 S rRNA). These antibiotic resistance...

  11. First record of spotted wing drosophila Drosophila suzukii (Diptera: Drosophilidae in Montenegro

    Directory of Open Access Journals (Sweden)

    Snježana Hrnčić

    2015-01-01

    Full Text Available The spotted wing drosophila Drosophila suzukii Matsumura (Diptera: Drosophilidae is an invasive pest originating from Southeast Asia. It was detected for the first time in Europe in 2008 (Spain and Italy and subsequently in other European countries. It is a highly polyphagous pest that infests healthy, ripening fruit and presents a serious threat to fruit production, particularly of soft skinned fruit. In the first half of October 2013, a new fruit fly species was unexpectedly detected in Tephri traps baited with the three-component female-biased attractant BioLure that is regularly used for monitoring the Mediterranean fruit fly Ceratitis capitata Wiedem. (Diptera: Tephritidae in Montenegro. Brief visual inspection identified the new species as the spotted wing drosophila D. suzukii. The pest was first recorded in several localities on the Montenegrin seacoast around Boka Kotor Bay. After the finding, all Drosophila specimens were collected from traps for further laboratory observation. A quick follow-up monitoring of other Tephri traps was carried out within the next few days on the rest of the seacoast (localities from Tivat to Ulcinj. Additionally, Tephri traps were set up around Lake Skadar and in the city of Podgorica, as well as on fresh fruit markets in Podgorica. The results of this preliminary study showed that D. suzukii was present in all surveyed locations and adults were captured until late December. Both sexes were found in traps with BioLure. Our data show that D. suzukii is present in southern parts of Montenegro and there is a serious threat of its further spreading, particularly towards northern parts of the country where the main raspberry and blueberry production is placed. The results also show that Tephri traps baited with BioLure can be used for detection and monitoring of spotted wing drosophila.

  12. Nematocytes: Discovery and characterization of a novel anculeate hemocyte in Drosophila falleni and Drosophila phalerata.

    Directory of Open Access Journals (Sweden)

    Julianna Bozler

    Full Text Available Immune challenges, such as parasitism, can be so pervasive and deleterious that they constitute an existential threat to a species' survival. In response to these ecological pressures, organisms have developed a wide array of novel behavioral, cellular, and molecular adaptations. Research into these immune defenses in model systems has resulted in a revolutionary understanding of evolution and functional biology. As the field has expanded beyond the limited number of model organisms our appreciation of evolutionary innovation and unique biology has widened as well. With this in mind, we have surveyed the hemolymph of several non-model species of Drosophila. Here we identify and describe a novel hemocyte, type-II nematocytes, found in larval stages of numerous Drosophila species. Examined in detail in Drosophila falleni and Drosophila phalerata, we find that these remarkable cells are distinct from previously described hemocytes due to their anucleate state (lacking a nucleus and unusual morphology. Type-II nematocytes are long, narrow cells with spindle-like projections extending from a cell body with high densities of mitochondria and microtubules, and exhibit the ability to synthesize proteins. These properties are unexpected for enucleated cells, and together with our additional characterization, we demonstrate that these type-II nematocytes represent a biological novelty. Surprisingly, despite the absence of a nucleus, we observe through live cell imaging that these cells remain motile with a highly dynamic cellular shape. Furthermore, these cells demonstrate the ability to form multicellular structures, which we suggest may be a component of the innate immune response to macro-parasites. In addition, live cell imaging points to a large nucleated hemocyte, type-I nematocyte, as the progenitor cell, leading to enucleation through a budding or asymmetrical division process rather than nuclear ejection: This study is the first to report such a

  13. Ultraviolet light protection, enhancement of ultraviolet light mutagenesis, and mutator effect of plasmid R46 in Salmonella typhimurium

    International Nuclear Information System (INIS)

    Mortelmans, K.E.; Stocker, B.A.D.

    1976-01-01

    Plasmid R46 partially protected Salmonella typhimurium, wild type or uvrB or polA, against the lethal effect of ultraviolet (uv) irradiation, but did not protect recA mutants. The plasmid also increased frequency of uv-induced reversion to His + in all tested his point mutants (wild type for uv sensitivity), including amber, ochre, UGA, missense, and frame-shift mutants. Plasmid R46 also increased uv-induced reversion to His + in uvrB and polA strains, but no uv mutagenic effect was detected in R - or R46-carrying recA derivatives of a his(amber) mutant. The spontaneous reversion frequency of his nonsense mutants of all classes, and of some his missense mutants, was increased about 10-fold when the strains carried R46, but the plasmid had no effect on the spontaneous reversion frequency of some other his missense mutations or of reversion rate of his frame-shift mutants (except for two uvrB derivatives of one single-base insertion mutant). The plasmid increased the ability of wild type, polA, and uvrB hosts to support plaque production by uv-irradiated phage, and made strain LT2 his G46 less sensitive to methyl methane sulfonate and to x rays and more responsive to the mutagenic effect of visible-light irradiation. R46 increased spontaneous reversion frequency of a his(amber) rec + strain, but had no such effect in its recA sublines. Since the plasmid in the absence of host recA function fails to produce its mutator effect, or to confer uv protection or to enhance uv mutagenesis, these three effects may be produced via some mechanism involved in recA-dependent deoxyribonucleic acid repair, perhaps by an increase in activity of the ''error-prone'' component of the inducible repair pathway

  14. Whole genome phylogenies for multiple Drosophila species

    Directory of Open Access Journals (Sweden)

    Seetharam Arun

    2012-12-01

    Full Text Available Abstract Background Reconstructing the evolutionary history of organisms using traditional phylogenetic methods may suffer from inaccurate sequence alignment. An alternative approach, particularly effective when whole genome sequences are available, is to employ methods that don’t use explicit sequence alignments. We extend a novel phylogenetic method based on Singular Value Decomposition (SVD to reconstruct the phylogeny of 12 sequenced Drosophila species. SVD analysis provides accurate comparisons for a high fraction of sequences within whole genomes without the prior identification of orthologs or homologous sites. With this method all protein sequences are converted to peptide frequency vectors within a matrix that is decomposed to provide simplified vector representations for each protein of the genome in a reduced dimensional space. These vectors are summed together to provide a vector representation for each species, and the angle between these vectors provides distance measures that are used to construct species trees. Results An unfiltered whole genome analysis (193,622 predicted proteins strongly supports the currently accepted phylogeny for 12 Drosophila species at higher dimensions except for the generally accepted but difficult to discern sister relationship between D. erecta and D. yakuba. Also, in accordance with previous studies, many sequences appear to support alternative phylogenies. In this case, we observed grouping of D. erecta with D. sechellia when approximately 55% to 95% of the proteins were removed using a filter based on projection values or by reducing resolution by using fewer dimensions. Similar results were obtained when just the melanogaster subgroup was analyzed. Conclusions These results indicate that using our novel phylogenetic method, it is possible to consult and interpret all predicted protein sequences within multiple whole genomes to produce accurate phylogenetic estimations of relatedness between

  15. Oxidative stress contributes to outcome severity in a Drosophila melanogaster model of classic galactosemia

    Directory of Open Access Journals (Sweden)

    Patricia P. Jumbo-Lucioni

    2013-01-01

    Classic galactosemia is a genetic disorder that results from profound loss of galactose-1P-uridylyltransferase (GALT. Affected infants experience a rapid escalation of potentially lethal acute symptoms following exposure to milk. Dietary restriction of galactose prevents or resolves the acute sequelae; however, many patients experience profound long-term complications. Despite decades of research, the mechanisms that underlie pathophysiology in classic galactosemia remain unclear. Recently, we developed a Drosophila melanogaster model of classic galactosemia and demonstrated that, like patients, GALT-null Drosophila succumb in development if exposed to galactose but live if maintained on a galactose-restricted diet. Prior models of experimental galactosemia have implicated a possible association between galactose exposure and oxidative stress. Here we describe application of our fly genetic model of galactosemia to the question of whether oxidative stress contributes to the acute galactose sensitivity of GALT-null animals. Our first approach tested the impact of pro- and antioxidant food supplements on the survival of GALT-null and control larvae. We observed a clear pattern: the oxidants paraquat and DMSO each had a negative impact on the survival of mutant but not control animals exposed to galactose, and the antioxidants vitamin C and α-mangostin each had the opposite effect. Biochemical markers also confirmed that galactose and paraquat synergistically increased oxidative stress on all cohorts tested but, interestingly, the mutant animals showed a decreased response relative to controls. Finally, we tested the expression levels of two transcripts responsive to oxidative stress, GSTD6 and GSTE7, in mutant and control larvae exposed to galactose and found that both genes were induced, one by more than 40-fold. Combined, these results implicate oxidative stress and response as contributing factors in the acute galactose sensitivity of GALT-null Drosophila and, by

  16. Drosophila KCNQ channel displays evolutionarily conserved electrophysiology and pharmacology with mammalian KCNQ channels.

    Directory of Open Access Journals (Sweden)

    Sonia Cavaliere

    Full Text Available Of the five human KCNQ (Kv7 channels, KCNQ1 with auxiliary subunit KCNE1 mediates the native cardiac I(Ks current with mutations causing short and long QT cardiac arrhythmias. KCNQ4 mutations cause deafness. KCNQ2/3 channels form the native M-current controlling excitability of most neurons, with mutations causing benign neonatal febrile convulsions. Drosophila contains a single KCNQ (dKCNQ that appears to serve alone the functions of all the duplicated mammalian neuronal and cardiac KCNQ channels sharing roughly 50-60% amino acid identity therefore offering a route to investigate these channels. Current information about the functional properties of dKCNQ is lacking therefore we have investigated these properties here. Using whole cell patch clamp electrophysiology we compare the biophysical and pharmacological properties of dKCNQ with the mammalian neuronal and cardiac KCNQ channels expressed in HEK cells. We show that Drosophila KCNQ (dKCNQ is a slowly activating and slowly-deactivating K(+ current open at sub-threshold potentials that has similar properties to neuronal KCNQ2/3 with some features of the cardiac KCNQ1/KCNE1 accompanied by conserved sensitivity to a number of clinically relevant KCNQ blockers (chromanol 293B, XE991, linopirdine and opener (zinc pyrithione. We also investigate the molecular basis of the differential selectivity of KCNQ channels to the opener retigabine and show a single amino acid substitution (M217W can confer sensitivity to dKCNQ. We show dKCNQ has similar electrophysiological and pharmacological properties as the mammalian KCNQ channels, allowing future study of physiological and pathological roles of KCNQ in Drosophila and whole organism screening for new modulators of KCNQ channelopathies.

  17. A Drosophila model to investigate the neurotoxic side effects of radiation exposure

    Directory of Open Access Journals (Sweden)

    Lisa J. Sudmeier

    2015-07-01

    Full Text Available Children undergoing cranial radiation therapy (CRT for pediatric central nervous system malignancies are at increased risk for neurological deficits later in life. We have developed a model of neurotoxic damage in adult Drosophila following irradiation during the juvenile stages with the goal of elucidating underlying neuropathological mechanisms and of ultimately identifying potential therapeutic targets. Wild-type third-instar larvae were irradiated with single doses of γ-radiation, and the percentage that survived to adulthood was determined. Motor function of surviving adults was examined with a climbing assay, and longevity was assessed by measuring lifespan. Neuronal cell death was assayed by using immunohistochemistry in adult brains. We also tested the sensitivity at different developmental stages by irradiating larvae at various time points. Irradiating late third-instar larvae at a dose of 20 Gy or higher impaired the motor activity of surviving adults. A dose of 40 Gy or higher resulted in a precipitous reduction in the percentage of larvae that survive to adulthood. A dose-dependent decrease in adult longevity was paralleled by a dose-dependent increase in activated Death caspase-1 (Dcp1 in adult brains. Survival to adulthood and adult lifespan were more severely impaired with decreasing larval age at the time of irradiation. Our initial survey of the Drosophila Genetic Reference Panel demonstrated that differences in genotype can confer phenotypic differences in radio-sensitivity for developmental survival and motor function. This work demonstrates the usefulness of Drosophila to model the toxic effects of radiation during development, and has the potential to unravel underlying mechanisms and to facilitate the discovery of novel therapeutic interventions.

  18. A Drosophila model to investigate the neurotoxic side effects of radiation exposure.

    Science.gov (United States)

    Sudmeier, Lisa J; Howard, Steven P; Ganetzky, Barry

    2015-07-01

    Children undergoing cranial radiation therapy (CRT) for pediatric central nervous system malignancies are at increased risk for neurological deficits later in life. We have developed a model of neurotoxic damage in adult Drosophila following irradiation during the juvenile stages with the goal of elucidating underlying neuropathological mechanisms and of ultimately identifying potential therapeutic targets. Wild-type third-instar larvae were irradiated with single doses of γ-radiation, and the percentage that survived to adulthood was determined. Motor function of surviving adults was examined with a climbing assay, and longevity was assessed by measuring lifespan. Neuronal cell death was assayed by using immunohistochemistry in adult brains. We also tested the sensitivity at different developmental stages by irradiating larvae at various time points. Irradiating late third-instar larvae at a dose of 20 Gy or higher impaired the motor activity of surviving adults. A dose of 40 Gy or higher resulted in a precipitous reduction in the percentage of larvae that survive to adulthood. A dose-dependent decrease in adult longevity was paralleled by a dose-dependent increase in activated Death caspase-1 (Dcp1) in adult brains. Survival to adulthood and adult lifespan were more severely impaired with decreasing larval age at the time of irradiation. Our initial survey of the Drosophila Genetic Reference Panel demonstrated that differences in genotype can confer phenotypic differences in radio-sensitivity for developmental survival and motor function. This work demonstrates the usefulness of Drosophila to model the toxic effects of radiation during development, and has the potential to unravel underlying mechanisms and to facilitate the discovery of novel therapeutic interventions. © 2015. Published by The Company of Biologists Ltd.

  19. Using Drosophila melanogaster as a model for genotoxic chemical mutational studies with a new program, SnpSift

    Directory of Open Access Journals (Sweden)

    Douglas Mark Ruden

    2012-03-01

    Full Text Available This paper describes a new program SnpSift for filtering differential DNA sequence variants between two or more experimental genomes after genotoxic chemical exposure. Here, we illustrate how SnpSift can be used to identify candidate phenotype-relevant variants including single nucleotide polymorphisms (SNPs, multiple nucleotide polymorphisms (MNPs, insertions and deletions (InDels in mutant strains isolated from genome-wide chemical mutagenesis of Drosophila melanogaster. First, the genomes of two independently-isolated mutant fly strains that are allelic for a novel recessive male-sterile locus generated by genotoxic chemical exposure were sequenced using the Illumina next-generation DNA sequencer to obtain 20- to 29-fold coverage of the euchromatic sequences. The sequencing reads were processed and variants were called using standard bioinformatic tools. Next, SnpEff was used to annotate all sequence variants and their potential mutational effects on associated genes. Then, SnpSift was used to filter and select differential variants that potentially disrupt a common gene in the two allelic mutant strains. The potential causative DNA lesions were partially validated by capillary sequencing of PCR-amplified DNA in the genetic interval as defined by meiotic mapping and deletions that remove defined regions of the chromosome. Of the five candidate genes located in the genetic interval, the Pka-like gene CG12069 was found to carry a separate premature stop codon mutation in each of the two allelic mutants whereas the other 4 candidate genes within the interval have wild-type sequences. The Pka-like gene is therefore a strong candidate gene for the male-sterile locus. These results demonstrate that combining SnpEff and SnpSift can expedite the identification of candidate phenotype-causative mutations in chemically-mutagenized Drosophila strains. This technique can also be used to characterize the variety of mutations generated by genotoxic

  20. The intimate genetics of Drosophila fertilization

    Science.gov (United States)

    Loppin, Benjamin; Dubruille, Raphaëlle; Horard, Béatrice

    2015-01-01

    The union of haploid gametes at fertilization initiates the formation of the diploid zygote in sexually reproducing animals. This founding event of embryogenesis includes several fascinating cellular and nuclear processes, such as sperm–egg cellular interactions, sperm chromatin remodelling, centrosome formation or pronuclear migration. In comparison with other aspects of development, the exploration of animal fertilization at the functional level has remained so far relatively limited, even in classical model organisms. Here, we have reviewed our current knowledge of fertilization in Drosophila melanogaster, with a special emphasis on the genes involved in the complex transformation of the fertilizing sperm nucleus into a replicated set of paternal chromosomes. PMID:26246493

  1. Crystal structure of enolase from Drosophila melanogaster.

    Science.gov (United States)

    Sun, Congcong; Xu, Baokui; Liu, Xueyan; Zhang, Zhen; Su, Zhongliang

    2017-04-01

    Enolase is an important enzyme in glycolysis and various biological processes. Its dysfunction is closely associated with diseases. Here, the enolase from Drosophila melanogaster (DmENO) was purified and crystallized. A crystal of DmENO diffracted to 2.0 Å resolution and belonged to space group R32. The structure was solved by molecular replacement. Like most enolases, DmENO forms a homodimer with conserved residues in the dimer interface. DmENO possesses an open conformation in this structure and contains conserved elements for catalytic activity. This work provides a structural basis for further functional and evolutionary studies of enolase.

  2. Genome, evolution, Drosophila and beyond: the new dimensions.

    Science.gov (United States)

    Prigent, Stéphane R; Rajpurohit, Subhash

    2007-01-01

    A century ago a little fly with red eyes was first used for genetic studies. That insignificant fly, called at that time Drosophila ampelophila, revolutionized biology while becoming the model we know today under the name of Drosophila melanogaster. Since then its study has never ceased, but the field of interest has somewhat changed during the century. To caricature a little, today we essentially learn from Drosophila meetings that the fly has a brain! It is true that the fly is a tremendous model organism for neurobiology. But this fly is, in fact, an appropriate and recognized model for the whole of biology. Indeed, Drosophila meetings are exceptional opportunities to gather biologists of diverse backgrounds together. There we not only learn about the latest improvements in our field of interest, but surely appreciate learning another bit of biology. From this biological melting pot has emerged a culture very specific to the fly community. Thus besides neurobiology, cell biology and development, a diversity of other research fields exist; they all have their own place in the cultural and historical dimension of the "drosophila" model. Several communications from those diverse research fields were presented at the 8th Japanese Drosophila Research Conference (JDRC8) and are briefly covered here. We believe it more judicious to call the model "drosophila" without a capital initial, as the model has never really been limited to only the Drosophila genus. The vernacular name "drosophila" is currently used to designate any fly of the Drosophilidae family and we believe the term more appropriate than "small fruit fly" or "vinegar fly" to better include the species and ecological diversity of the model.

  3. Imaging Live Drosophila Brain with Two-Photon Fluorescence Microscopy

    Science.gov (United States)

    Ahmed, Syeed Ehsan

    Two-photon fluorescence microscopy is an imaging technique which delivers distinct benefits for in vivo cellular and molecular imaging. Cyclic adenosine monophosphate (cAMP), a second messenger molecule, is responsible for triggering many physiological changes in neural system. However, the mechanism by which this molecule regulates responses in neuron cells is not yet clearly understood. When cAMP binds to a target protein, it changes the structure of that protein. Therefore, studying this molecular structure change with fluorescence resonance energy transfer (FRET) imaging can shed light on the cAMP functioning mechanism. FRET is a non-radiative dipole-dipole coupling which is sensitive to small distance change in nanometer scale. In this study we have investigated the effect of dopamine in cAMP dynamics in vivo. In our study two-photon fluorescence microscope was used for imaging mushroom bodies inside live Drosophila melanogaster brain and we developed a method for studying the change in cyclic AMP level.

  4. Architecture of the primary taste center of Drosophila melanogaster larvae.

    Science.gov (United States)

    Colomb, Julien; Grillenzoni, Nicola; Ramaekers, Ariane; Stocker, Reinhard F

    2007-06-10

    A simple nervous system combined with stereotypic behavioral responses to tastants, together with powerful genetic and molecular tools, have turned Drosophila larvae into a very promising model for studying gustatory coding. Using the Gal4/UAS system and confocal microscopy for visualizing gustatory afferents, we provide a description of the primary taste center in the larval central nervous system. Essentially, gustatory receptor neurons target different areas of the subesophageal ganglion (SOG), depending on their segmental and sensory organ origin. We define two major and two smaller subregions in the SOG. One of the major areas is a target of pharyngeal sensilla, the other one receives inputs from both internal and external sensilla. In addition to such spatial organization of the taste center, circumstantial evidence suggests a subtle functional organization: aversive and attractive stimuli might be processed in the anterior and posterior part of the SOG, respectively. Our results also suggest less coexpression of gustatory receptors than proposed in prior studies. Finally, projections of putative second-order taste neurons seem to cover large areas of the SOG. These neurons may thus receive multiple gustatory inputs. This suggests broad sensitivity of secondary taste neurons, reminiscent of the situation in mammals.

  5. A new Drosophila octopamine receptor responds to serotonin.

    Science.gov (United States)

    Qi, Yi-Xiang; Xu, Gang; Gu, Gui-Xiang; Mao, Fen; Ye, Gong-Yin; Liu, Weiwei; Huang, Jia

    2017-11-01

    As the counterparts of the vertebrate adrenergic transmitters, octopamine and tyramine are important physiological regulators in invertebrates. They control and modulate many physiological and behavioral functions in insects. In this study, we reported the pharmacological properties of a new α2-adrenergic-like octopamine receptor (CG18208) from Drosophila melanogaster, named DmOctα2R. This new receptor gene encodes two transcripts by alternative splicing. The long isoform DmOctα2R-L differs from the short isoform DmOctα2R-S by the presence of an additional 29 amino acids within the third intracellular loop. When heterologously expressed in mammalian cell lines, both receptors were activated by octopamine, tyramine, epinephrine and norepinephrine, resulting in the inhibition of cAMP production in a dose-dependent manner. The long form is more sensitive to the above ligands than the short form. The adrenergic agonists naphazoline, tolazoline and clonidine can stimulate DmOctα2R as full agonists. Surprisingly, serotonin and serotoninergic agonists can also activate DmOctα2R. Several tested adrenergic antagonists and serotonin antagonists blocked the action of octopamine or serotonin on DmOctα2R. The data presented here reported an adrenergic-like G protein-coupled receptor activated by serotonin, suggesting that the neurotransmission and neuromodulation in the nervous system could be more complex than previously thought. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Recurring ethanol exposure induces disinhibited courtship in Drosophila.

    Directory of Open Access Journals (Sweden)

    Hyun-Gwan Lee

    Full Text Available Alcohol has a strong causal relationship with sexual arousal and disinhibited sexual behavior in humans; however, the physiological support for this notion is largely lacking and thus a suitable animal model to address this issue is instrumental. We investigated the effect of ethanol on sexual behavior in Drosophila. Wild-type males typically court females but not males; however, upon daily administration of ethanol, they exhibited active intermale courtship, which represents a novel type of behavioral disinhibition. The ethanol-treated males also developed behavioral sensitization, a form of plasticity associated with addiction, since their intermale courtship activity was progressively increased with additional ethanol experience. We identified three components crucial for the ethanol-induced courtship disinhibition: the transcription factor regulating male sex behavior Fruitless, the ABC guanine/tryptophan transporter White and the neuromodulator dopamine. fruitless mutant males normally display conspicuous intermale courtship; however, their courtship activity was not enhanced under ethanol. Likewise, white males showed negligible ethanol-induced intermale courtship, which was not only reinstated but also augmented by transgenic White expression. Moreover, inhibition of dopamine neurotransmission during ethanol exposure dramatically decreased ethanol-induced intermale courtship. Chronic ethanol exposure also affected a male's sexual behavior toward females: it enhanced sexual arousal but reduced sexual performance. These findings provide novel insights into the physiological effects of ethanol on sexual behavior and behavioral plasticity.

  7. A Subset of Serotonergic Neurons Evokes Hunger in Adult Drosophila.

    Science.gov (United States)

    Albin, Stephanie D; Kaun, Karla R; Knapp, Jon-Michael; Chung, Phuong; Heberlein, Ulrike; Simpson, Julie H

    2015-09-21

    Hunger is a complex motivational state that drives multiple behaviors. The sensation of hunger is caused by an imbalance between energy intake and expenditure. One immediate response to hunger is increased food consumption. Hunger also modulates behaviors related to food seeking such as increased locomotion and enhanced sensory sensitivity in both insects and vertebrates. In addition, hunger can promote the expression of food-associated memory. Although progress is being made, how hunger is represented in the brain and how it coordinates these behavioral responses is not fully understood in any system. Here, we use Drosophila melanogaster to identify neurons encoding hunger. We found a small group of neurons that, when activated, induced a fed fly to eat as though it were starved, suggesting that these neurons are downstream of the metabolic regulation of hunger. Artificially activating these neurons also promotes appetitive memory performance in sated flies, indicating that these neurons are not simply feeding command neurons but likely play a more general role in encoding hunger. We determined that the neurons relevant for the feeding effect are serotonergic and project broadly within the brain, suggesting a possible mechanism for how various responses to hunger are coordinated. These findings extend our understanding of the neural circuitry that drives feeding and enable future exploration of how state influences neural activity within this circuit. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. Mdr65 decreases toxicity of multiple insecticides in Drosophila melanogaster.

    Science.gov (United States)

    Sun, Haina; Buchon, Nicolas; Scott, Jeffrey G

    2017-10-01

    ABC transporters are ubiquitous membrane-bound proteins, present in both prokaryotes and eukaryotes. The major function of eukaryotic ABC transporters is to mediate the efflux of a variety of substrates (including xenobiotics) out of cells. ABC transporters have been widely investigated in humans, particularly for their involvement in multidrug resistance (MDR). Considerably less is known about their roles in transport and/or excretion in insects. ABC transporters are only known to function as exporters in insects. Drosophila melanogaster has 56 ABC transporter genes, including eight which are phylogenetically most similar to the human Mdr genes (ABCB1 clade). We investigated the role of ABC transporters in the ABCB1 clade in modulating the susceptibility to insecticides. We took advantage of the GAL4/UAS system in D. melanogaster to knockdown the expression levels of Mdr65, Mdr50, Mdr49 and ABCB6 using transgenic UAS-RNAi lines and conditional driver lines. The most notable effects were increased sensitivities to nine different insecticides by silencing of Mdr65. Furthermore, a null mutation of Mdr65 decreased the malathion, malaoxon and fipronil LC 50 values by a factor of 1.9, 2.1 and 3.9, respectively. Altogether, this data demonstrates the critical role of ABC transporters, particularly Mdr65, in altering the toxicity of specific, structurally diverse, insecticides in D. melanogaster. Copyright © 2017 Elsevier Ltd. All rights reserved.

  9. The use of TALENs for nonhomologous end joining mutagenesis in silkworm and fruitly

    Czech Academy of Sciences Publication Activity Database

    Takasu, Y.; Tamura, T.; Sajwan, Suresh; Kobayashi, I.; Žurovec, Michal

    2014-01-01

    Roč. 69, č. 1 (2014), s. 46-57 ISSN 1046-2023 R&D Projects: GA ČR GAP305/10/2406 Grant - others:Japan Society for the Promotion of Science(JP) 23580083 Institutional support: RVO:60077344 Keywords : Bombyx mori * Drosophila melanogaster * pBlue-TAL Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.645, year: 2014 http://www.sciencedirect.com/science/article/pii/S1046202314000449

  10. The mutation frequency of Drosophila melanogaster populations living under conditions of increased background radiation due to the Chernobyl accident

    International Nuclear Information System (INIS)

    Zainullin, V.G.; Rakin, A.O.; Shevchenko, V.A.; Myasnyankina, E.N.; Generalova, M.V.

    1992-01-01

    One of the problems facing the program in the wake of the Chernobyl accident is the estimation of genetic damage to plants and animals. Special attention was directed to studying the influence of radioactive pollutants at the accident site by means of an appropriate test system, using standard genetic subjects. The present study describes such investigations. Levels of persistent genetic damage in natural populations of Drosophila melanogaster found in the vicinity of the Chernobyl accident site were examined from August 1986-September 1989. Evidence is presented which indicates a relationship between the levels of radioactive pollution resulting from the Chernobyl accident and increasing genetic damage to exposed populations. The possible reasons for the decrease of mutation frequency observed in 1988 and 1989 are also discussed. Furthermore, evidence is presented which suggests that radiosensitive Drosophila mutants may be particularly sensitive indicators of radioactive pollution. (author). 16 refs.; 6 figs

  11. Circadian Modulation of Consolidated Memory Retrieval Following Sleep Deprivation in Drosophila

    Science.gov (United States)

    Glou, Eric Le; Seugnet, Laurent; Shaw, Paul J.; Preat, Thomas; Goguel, Valérie

    2012-01-01

    Objectives: Several lines of evidence indicate that sleep plays a critical role in learning and memory. The aim of this study was to evaluate anesthesia resistant memory following sleep deprivation in Drosophila. Design: Four to 16 h after aversive olfactory training, flies were sleep deprived for 4 h. Memory was assessed 24 h after training. Training, sleep deprivation, and memory tests were performed at different times during the day to evaluate the importance of the time of day for memory formation. The role of circadian rhythms was further evaluated using circadian clock mutants. Results Memory was disrupted when flies were exposed to 4 h of sleep deprivation during the consolidation phase. Interestingly, normal memory was observed following sleep deprivation when the memory test was performed during the 2 h preceding lights-off, a period characterized by maximum wake in flies. We also show that anesthesia resistant memory was less sensitive to sleep deprivation in flies with disrupted circadian rhythms. Conclusions Our results indicate that anesthesia resistant memory, a consolidated memory less costly than long-term memory, is sensitive to sleep deprivation. In addition, we provide evidence that circadian factors influence memory vulnerability to sleep deprivation and memory retrieval. Taken together, the data show that memories weakened by sleep deprivation can be retrieved if the animals are tested at the optimal circadian time. Citation: Le Glou E; Seugnet L; Shaw PJ; Preat T; Goguel V. Circadian modulation of consolidated memory retrieval following sleep deprivation in Drosophila. SLEEP 2012;35(10):1377-1384. PMID:23024436

  12. Genetic dissection reveals two separate retinal substrates for polarization vision in Drosophila.

    Science.gov (United States)

    Wernet, Mathias F; Velez, Mariel M; Clark, Damon A; Baumann-Klausener, Franziska; Brown, Julian R; Klovstad, Martha; Labhart, Thomas; Clandinin, Thomas R

    2012-01-10

    Linearly polarized light originates from atmospheric scattering or surface reflections and is perceived by insects, spiders, cephalopods, crustaceans, and some vertebrates. Thus, the neural basis underlying how this fundamental quality of light is detected is of broad interest. Morphologically unique, polarization-sensitive ommatidia exist in the dorsal periphery of many insect retinas, forming the dorsal rim area (DRA). However, much less is known about the retinal substrates of behavioral responses to polarized reflections. Drosophila exhibits polarotactic behavior, spontaneously aligning with the e-vector of linearly polarized light, when stimuli are presented either dorsally or ventrally. By combining behavioral experiments with genetic dissection and ultrastructural analyses, we show that distinct photoreceptors mediate the two behaviors: inner photoreceptors R7+R8 of DRA ommatidia are necessary and sufficient for dorsal polarotaxis, whereas ventral responses are mediated by combinations of outer and inner photoreceptors, both of which manifest previously unknown features that render them polarization sensitive. Drosophila uses separate retinal pathways for the detection of linearly polarized light emanating from the sky or from shiny surfaces. This work establishes a behavioral paradigm that will enable genetic dissection of the circuits underlying polarization vision. Copyright © 2012 Elsevier Ltd. All rights reserved.

  13. Behavioral and electrophysiological analysis of general anesthesia in 3 background strains of Drosophila melanogaster.

    Science.gov (United States)

    Zalucki, Oressia; Day, Rebecca; Kottler, Benjamin; Karunanithi, Shanker; van Swinderen, Bruno

    2015-01-01

    General anesthetics achieve behavioral unresponsiveness via a mechanism that is incompletely understood. The study of genetic model systems such as the fruit fly Drosophila melanogaster is crucial to advancing our understanding of how anesthetic drugs render animals unresponsive. Previous studies have shown that wild-type control strains differ significantly in their sensitivity to general anesthetics, which potentially introduces confounding factors for comparing genetic mutations placed on these wild-type backgrounds. Here, we examined a variety of behavioral and electrophysiological endpoints in Drosophila, in both adult and larval animals. We characterized these endpoints in 3 commonly used fly strains: wild-type Canton Special (CS), and 2 commonly used white-eyed strains, isoCJ1 and w(1118). We found that CS and isoCJ1 show remarkably similar sensitivity to isoflurane across a variety of behavioral and electrophysiological endpoints. In contrast, w(1118) is resistant to isoflurane compared to the other 2 strains at both the adult and larval stages. This resistance is however not reflected at the level of neurotransmitter release at the larval neuromuscular junction (NMJ). This suggests that the w(1118) strain harbors another mutation that produces isoflurane resistance, by acting on an arousal pathway that is most likely preserved between larval and adult brains. This mutation probably also affects sleep, as marked differences between isoCJ1 and w(1118) have also recently been found for behavioral responsiveness and sleep intensity measures.

  14. The Drosophila melanogaster phospholipid flippase dATP8B is required for odorant receptor function.

    Directory of Open Access Journals (Sweden)

    Yu-Chi Liu

    2014-03-01

    Full Text Available The olfactory systems of insects are fundamental to all aspects of their behaviour, and insect olfactory receptor neurons (ORNs exhibit exquisite specificity and sensitivity to a wide range of environmental cues. In Drosophila melanogaster, ORN responses are determined by three different receptor families, the odorant (Or, ionotropic-like (IR and gustatory (Gr receptors. However, the precise mechanisms of signalling by these different receptor families are not fully understood. Here we report the unexpected finding that the type 4 P-type ATPase phospholipid transporter dATP8B, the homologue of a protein associated with intrahepatic cholestasis and hearing loss in humans, is crucial for Drosophila olfactory responses. Mutations in dATP8B severely attenuate sensitivity of odorant detection specifically in Or-expressing ORNs, but do not affect responses mediated by IR or Gr receptors. Accordingly, we find dATP8B to be expressed in ORNs and localised to the dendritic membrane of the olfactory neurons where signal transduction occurs. Localisation of Or proteins to the dendrites is unaffected in dATP8B mutants, as is dendrite morphology, suggesting instead that dATP8B is critical for Or signalling. As dATP8B is a member of the phospholipid flippase family of ATPases, which function to determine asymmetry in phospholipid composition between the outer and inner leaflets of plasma membranes, our findings suggest a requirement for phospholipid asymmetry in the signalling of a specific family of chemoreceptor proteins.

  15. The Imd pathway is involved in antiviral immune responses in Drosophila.

    Directory of Open Access Journals (Sweden)

    Alexandre Costa

    2009-10-01

    Full Text Available Cricket Paralysis virus (CrPV is a member of the Dicistroviridae family of RNA viruses, which infect a broad range of insect hosts, including the fruit fly Drosophila melanogaster. Drosophila has emerged as an effective system for studying innate immunity because of its powerful genetic techniques and the high degree of gene and pathway conservation. Intra-abdominal injection of CrPV into adult flies causes a lethal infection that provides a robust assay for the identification of mutants with altered sensitivity to viral infection. To gain insight into the interactions between viruses and the innate immune system, we injected wild type flies with CrPV and observed that antimicrobial peptides (AMPs were not induced and hemocytes were depleted in the course of infection. To investigate the contribution of conserved immune signaling pathways to antiviral innate immune responses, CrPV was injected into isogenic mutants of the Immune Deficiency (Imd pathway, which resembles the mammalian Tumor Necrosis Factor Receptor (TNFR pathway. Loss-of-function mutations in several Imd pathway genes displayed increased sensitivity to CrPV infection and higher CrPV loads. Our data show that antiviral innate immune responses in flies infected with CrPV depend upon hemocytes and signaling through the Imd pathway.

  16. Modeling Fragile X Syndrome in Drosophila

    Science.gov (United States)

    Drozd, Małgorzata; Bardoni, Barbara; Capovilla, Maria

    2018-01-01

    Intellectual disability (ID) and autism are hallmarks of Fragile X Syndrome (FXS), a hereditary neurodevelopmental disorder. The gene responsible for FXS is Fragile X Mental Retardation gene 1 (FMR1) encoding the Fragile X Mental Retardation Protein (FMRP), an RNA-binding protein involved in RNA metabolism and modulating the expression level of many targets. Most cases of FXS are caused by silencing of FMR1 due to CGG expansions in the 5′-UTR of the gene. Humans also carry the FXR1 and FXR2 paralogs of FMR1 while flies have only one FMR1 gene, here called dFMR1, sharing the same level of sequence homology with all three human genes, but functionally most similar to FMR1. This enables a much easier approach for FMR1 genetic studies. Drosophila has been widely used to investigate FMR1 functions at genetic, cellular, and molecular levels since dFMR1 mutants have many phenotypes in common with the wide spectrum of FMR1 functions that underlay the disease. In this review, we present very recent Drosophila studies investigating FMRP functions at genetic, cellular, molecular, and electrophysiological levels in addition to research on pharmacological treatments in the fly model. These studies have the potential to aid the discovery of pharmacological therapies for FXS.

  17. Imaging fictive locomotor patterns in larval Drosophila

    Science.gov (United States)

    Bayley, Timothy G.; Taylor, Adam L.; Berni, Jimena; Bate, Michael; Hedwig, Berthold

    2015-01-01

    We have established a preparation in larval Drosophila to monitor fictive locomotion simultaneously across abdominal and thoracic segments of the isolated CNS with genetically encoded Ca2+ indicators. The Ca2+ signals closely followed spiking activity measured electrophysiologically in nerve roots. Three motor patterns are analyzed. Two comprise waves of Ca2+ signals that progress along the longitudinal body axis in a posterior-to-anterior or anterior-to-posterior direction. These waves had statistically indistinguishable intersegmental phase delays compared with segmental contractions during forward and backward crawling behavior, despite being ∼10 times slower. During these waves, motor neurons of the dorsal longitudinal and transverse muscles were active in the same order as the muscle groups are recruited during crawling behavior. A third fictive motor pattern exhibits a left-right asymmetry across segments and bears similarities with turning behavior in intact larvae, occurring equally frequently and involving asymmetry in the same segments. Ablation of the segments in which forward and backward waves of Ca2+ signals were normally initiated did not eliminate production of Ca2+ waves. When the brain and subesophageal ganglion (SOG) were removed, the remaining ganglia retained the ability to produce both forward and backward waves of motor activity, although the speed and frequency of waves changed. Bilateral asymmetry of activity was reduced when the brain was removed and abolished when the SOG was removed. This work paves the way to studying the neural and genetic underpinnings of segmentally coordinated motor pattern generation in Drosophila with imaging techniques. PMID:26311188

  18. Structure of PCNA from Drosophila melanogaster

    International Nuclear Information System (INIS)

    Wang, Ke; Shi, Zhubing; Zhang, Min; Cheng, Dianlin

    2013-01-01

    Proliferating cell nuclear antigen (PCNA) plays essential roles in DNA replication, DNA repair, cell-cycle regulation and chromatin metabolism. The PCNA from Drosophila melanogaster (DmPCNA) has been purified and crystallized. Proliferating cell nuclear antigen (PCNA) plays essential roles in DNA replication, DNA repair, cell-cycle regulation and chromatin metabolism. The PCNA from Drosophila melanogaster (DmPCNA) was purified and crystallized. The crystal of DmPCNA diffracted to 2.0 Å resolution and belonged to space group H3, with unit-cell parameters a = b = 151.16, c = 38.28 Å. The structure of DmPCNA was determined by molecular replacement. DmPCNA forms a symmetric homotrimer in a head-to-tail manner. An interdomain connector loop (IDCL) links the N- and C-terminal domains. Additionally, the N-terminal and C-terminal domains contact each other through hydrophobic associations. Compared with human PCNA, the IDCL of DmPCNA has conformational changes, which may explain their difference in function. This work provides a structural basis for further functional and evolutionary studies of PCNA

  19. Adaptive Evolution of Gene Expression in Drosophila.

    Science.gov (United States)

    Nourmohammad, Armita; Rambeau, Joachim; Held, Torsten; Kovacova, Viera; Berg, Johannes; Lässig, Michael

    2017-08-08

    Gene expression levels are important quantitative traits that link genotypes to molecular functions and fitness. In Drosophila, population-genetic studies have revealed substantial adaptive evolution at the genomic level, but the evolutionary modes of gene expression remain controversial. Here, we present evidence that adaptation dominates the evolution of gene expression levels in flies. We show that 64% of the observed expression divergence across seven Drosophila species are adaptive changes driven by directional selection. Our results are derived from time-resolved data of gene expression divergence across a family of related species, using a probabilistic inference method for gene-specific selection. Adaptive gene expression is stronger in specific functional classes, including regulation, sensory perception, sexual behavior, and morphology. Moreover, we identify a large group of genes with sex-specific adaptation of expression, which predominantly occurs in males. Our analysis opens an avenue to map system-wide selection on molecular quantitative traits independently of their genetic basis. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  20. Quantification of food intake in Drosophila.

    Directory of Open Access Journals (Sweden)

    Richard Wong

    2009-06-01

    Full Text Available Measurement of food intake in the fruit fly Drosophila melanogaster is often necessary for studies of behaviour, nutrition and drug administration. There is no reliable and agreed method for measuring food intake of flies in undisturbed, steady state, and normal culture conditions. We report such a method, based on measurement of feeding frequency by proboscis-extension, validated by short-term measurements of food dye intake. We used the method to demonstrate that (a female flies feed more frequently than males, (b flies feed more often when housed in larger groups and (c fly feeding varies at different times of the day. We also show that alterations in food intake are not induced by dietary restriction or by a null mutation of the fly insulin receptor substrate chico. In contrast, mutation of takeout increases food intake by increasing feeding frequency while mutation of ovo(D increases food intake by increasing the volume of food consumed per proboscis-extension. This approach provides a practical and reliable method for quantification of food intake in Drosophila under normal, undisturbed culture conditions.

  1. The smell of love in Drosophila

    Directory of Open Access Journals (Sweden)

    Anna B. eZiegler

    2013-04-01

    Full Text Available Odors are key sensory signals for social communication and food search in animals including insects. Drosophila melanogaster, is a powerful neurogenetic model commonly used to reveal molecular and cellular mechanisms involved in odorant detection. Males use olfaction together with other sensory modalities to find their mates. Here, we review known olfactory signals, their related olfactory receptors, and the corresponding neuronal architecture impacting courtship. OR67d receptor detects 11-cis-Vaccenyl Acetate (cVA, a male specific pheromone transferred to the female during copulation. Transferred cVA is able to reduce female attractiveness for other males after mating, and is also suspected to decrease male-male courtship. cVA can also serve as an aggregation signal, maybe through another OR. OR47b was shown to be activated by fly odors, and to enhance courtship depending on taste pheromones. IR84a detects phenylacetic acid (PAA and phenylacetaldehyde. These two odors are not pheromones produced by flies, but are present in various fly food sources. PAA enhances male courtship, acting as a food aphrodisiac. Drosophila males have thus developed complementary olfactory strategies to help them to select their mates.

  2. Odd-Paired: The Drosophila Zic Gene.

    Science.gov (United States)

    Hursh, Deborah A; Stultz, Brian G

    2018-01-01

    Zinc finger in the cerebellum (Zic) proteins are a family of transcription factors with multiple roles during development, particularly in neural tissues. The founding member of the Zic family is the Drosophila odd-paired (opa) gene. The Opa protein has a DNA binding domain containing five Cys2His2-type zinc fingers and has been shown to act as a sequence-specific DNA binding protein. Opa has significant homology to mammalian Zic1, Zic2, and Zic3 within the zinc finger domain and in two other conserved regions outside that domain. opa was initially identified as a pair-rule gene, part of the hierarchy of genes that establish the segmental body plan of the early Drosophila embryo. However, its wide expression pattern during embryogenesis indicates it plays additional roles. Embryos deficient in opa die before hatching with aberrant segmentation but also with defects in larval midgut formation. Post-embryonically, opa plays important roles in adult head development and circadian rhythm. Based on extensive neural expression, opa is predicted to be involved in many aspects of neural development and behavior, like other proteins of the Zic family. Consensus DNA binding sites have been identified for Opa and have been shown to activate transcription in vivo. However, there is evidence Opa may serve as a transcriptional regulator in the absence of direct DNA binding, as has been seen for other Zic proteins.

  3. Genetic variation for cardiac dysfunction in Drosophila.

    Directory of Open Access Journals (Sweden)

    Karen A Ocorr

    Full Text Available BACKGROUND: Common diseases may be attributed to combinations of variant alleles, but there are few model systems where the interactions among such variants can be studied in controlled genetic crosses. While association studies are designed to detect common polymorphisms of moderate effect, new approaches are required to characterize the impact on disease of interactions among rare alleles. METHODOLOGY/PRINCIPAL FINDINGS: We show that wild populations of Drosophila melanogaster harbor rare polymorphisms of major effect (RAME that predispose flies to a specific disease phenotype, age-dependent cardiac dysfunction. A screen of fifty inbred wild-type lines revealed a continuous spectrum of pacing-induced heart failure that generally increases in frequency with age. High-speed video analysis of the inbred lines with high rates of inducible heart failure indicates specific defects in cardiac function, including arrhythmias and contractile disorders ('cardiomyopathies'. A combination of bulked segregant analysis and single feature polymorphism (SFP detection localizes one of the cardiac susceptibility loci to the 97C interval on the fly genome. CONCLUSIONS/SIGNIFICANCE: Wild-type Drosophila, like humans, are predisposed to cardiac dysfunction. Identification of factors associated with these naturally occurring cardiac traits promises to provide important insights into the epidemiology of cardiac disease.

  4. High throughput mutagenesis for identification of residues regulating human prostacyclin (hIP receptor expression and function.

    Directory of Open Access Journals (Sweden)

    Anke Bill

    Full Text Available The human prostacyclin receptor (hIP receptor is a seven-transmembrane G protein-coupled receptor (GPCR that plays a critical role in vascular smooth muscle relaxation and platelet aggregation. hIP receptor dysfunction has been implicated in numerous cardiovascular abnormalities, including myocardial infarction, hypertension, thrombosis and atherosclerosis. Genomic sequencing has discovered several genetic variations in the PTGIR gene coding for hIP receptor, however, its structure-function relationship has not been sufficiently explored. Here we set out to investigate the applicability of high throughput random mutagenesis to study the structure-function relationship of hIP receptor. While chemical mutagenesis was not suitable to generate a mutagenesis library with sufficient coverage, our data demonstrate error-prone PCR (epPCR mediated mutagenesis as a valuable method for the unbiased screening of residues regulating hIP receptor function and expression. Here we describe the generation and functional characterization of an epPCR derived mutagenesis library compromising >4000 mutants of the hIP receptor. We introduce next generation sequencing as a useful tool to validate the quality of mutagenesis libraries by providing information about the coverage, mutation rate and mutational bias. We identified 18 mutants of the hIP receptor that were expressed at the cell surface, but demonstrated impaired receptor function. A total of 38 non-synonymous mutations were identified within the coding region of the hIP receptor, mapping to 36 distinct residues, including several mutations previously reported to affect the signaling of the hIP receptor. Thus, our data demonstrates epPCR mediated random mutagenesis as a valuable and practical method to study the structure-function relationship of GPCRs.

  5. Sensitivity analysis

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/003741.htm Sensitivity analysis To use the sharing features on this page, please enable JavaScript. Sensitivity analysis determines the effectiveness of antibiotics against microorganisms (germs) ...

  6. Molecular Cloning and Genomic Organization of a Novel Receptor from Drosophila melanogaster Structurally Related to Mammalian Galanin Receptors

    DEFF Research Database (Denmark)

    Lenz, Camilla; Søndergaard, L.; Grimmelikhuijzen, Cornelis J.P.

    2000-01-01

    neurobiologi, molekylærbiologi, zoologi, neurohormonereceptor, allatostatin, galanin, insekt, Drosophila......neurobiologi, molekylærbiologi, zoologi, neurohormonereceptor, allatostatin, galanin, insekt, Drosophila...

  7. Sex-specific pattern formation during early Drosophila development.

    Science.gov (United States)

    Manu; Ludwig, Michael Z; Kreitman, Martin

    2013-05-01

    The deleterious effects of different X-chromosome dosage in males and females are buffered by a process called dosage compensation, which in Drosophila is achieved through a doubling of X-linked transcription in males. The male-specific lethal complex mediates this process, but is known to act only after gastrulation. Recent work has shown that the transcription of X-linked genes is also upregulated in males prior to gastrulation; whether it results in functional dosage compensation is not known. Absent or partial early dosage compensation raises the possibility of sex-biased expression of key developmental genes, such as the segmentation genes controlling anteroposterior patterning. We assess the functional output of early dosage compensation by measuring the expression of even-skipped (eve) with high spatiotemporal resolution in male and female embryos. We show that eve has a sexually dimorphic pattern, suggesting an interaction with either X-chromosome dose or the sex determination system. By manipulating the gene copy number of an X-linked transcription factor, giant (gt), we traced sex-biased eve patterning to gt dose, indicating that early dosage compensation is functionally incomplete. Despite sex-biased eve expression, the gene networks downstream of eve are able to produce sex-independent segmentation, a point that we establish by measuring the proportions of segments in elongated germ-band embryos. Finally, we use a whole-locus eve transgene with modified cis regulation to demonstrate that segment proportions have a sex-dependent sensitivity to subtle changes in Eve expression. The sex independence of downstream segmentation despite this sensitivity to Eve expression implies that additional autosomal gene- or pathway-specific mechanisms are required to ameliorate the effects of partial early dosage compensation.

  8. Genome-wide comparative analysis of four Indian Drosophila species.

    Science.gov (United States)

    Mohanty, Sujata; Khanna, Radhika

    2017-12-01

    Comparative analysis of multiple genomes of closely or distantly related Drosophila species undoubtedly creates excitement among evolutionary biologists in exploring the genomic changes with an ecology and evolutionary perspective. We present herewith the de novo assembled whole genome sequences of four Drosophila species, D. bipectinata, D. takahashii, D. biarmipes and D. nasuta of Indian origin using Next Generation Sequencing technology on an Illumina platform along with their detailed assembly statistics. The comparative genomics analysis, e.g. gene predictions and annotations, functional and orthogroup analysis of coding sequences and genome wide SNP distribution were performed. The whole genome of Zaprionus indianus of Indian origin published earlier by us and the genome sequences of previously sequenced 12 Drosophila species available in the NCBI database were included in the analysis. The present work is a part of our ongoing genomics project of Indian Drosophila species.

  9. Neurogenetics of female reproductive behaviors in Drosophila melanogaster

    NARCIS (Netherlands)

    Laturney, Meghan; Billeter, Jean-Christophe; Friedmann, T; Dunlap, JC; Goodwin, SF

    2014-01-01

    We follow an adult Drosophila melanogaster female through the major reproductive decisions she makes during her lifetime, including habitat selection, precopulatory mate choice, postcopulatory physiological changes, polyandry, and egg-laying site selection. In the process, we review the molecular

  10. Neuromodulation and Strategic Action Choice in Drosophila Aggression.

    Science.gov (United States)

    Asahina, Kenta

    2017-07-25

    In this review, I discuss current knowledge and outstanding questions on the neuromodulators that influence aggressive behavior of the fruit fly Drosophila melanogaster. I first present evidence that Drosophila exchange information during an agonistic interaction and choose appropriate actions based on this information. I then discuss the influence of several biogenic amines and neuropeptides on aggressive behavior. One striking characteristic of neuromodulation is that it can configure a neural circuit dynamically, enabling one circuit to generate multiple outcomes. I suggest a consensus effect of each neuromodulatory molecule on Drosophila aggression, as well as effects of receptor proteins where relevant data are available. Lastly, I consider neuromodulation in the context of strategic action choices during agonistic interactions. Genetic components of neuromodulatory systems are highly conserved across animals, suggesting that molecular and cellular mechanisms controlling Drosophila aggression can shed light on neural principles governing action choice during social interactions.

  11. NF-1 Dependent Gene Regulation in Drosophila Melanogaster

    National Research Council Canada - National Science Library

    Zhong, Yi

    2004-01-01

    .... We have used an Affymetrix whole genome chip, containing all 13,500 genes of the fruit fly Drosophila, to identify 93 genes with altered expression patterns in flies that have no NF1 protein compared...

  12. Induction of morphological aberrations by enzyme inhibition in Drosophila melanogaster

    NARCIS (Netherlands)

    Bos, M.; Scharloo, W.; Bijlsma, R.; de Boer, I.M.; den Hollander, J.

    1969-01-01

    Zusatz zum Futter vonDrosophila melanogaster von 5-Fluoro-2-deoxyuridin oder Aminopterin induziert überzählige Skutellar- und Dorsozentralborsten sowie gekerbte Flügel. Diese Modifikationen wurden als Konsequenz von Enzymhemmung interpretiert.

  13. Targeted mutagenesis in tetraploid switchgrass (Panicum virgatum L.) using CRISPR/Cas9.

    Science.gov (United States)

    Liu, Yang; Merrick, Paul; Zhang, Zhengzhi; Ji, Chonghui; Yang, Bing; Fei, Shui-Zhang

    2018-02-01

    The CRISPR/Cas9 system has become a powerful tool for targeted mutagenesis. Switchgrass (Panicum virgatum L.) is a high yielding perennial grass species that has been designated as a model biomass crop by the U.S. Department of Energy. The self-infertility and high ploidy level make it difficult to study gene function or improve germplasm. To overcome these constraints, we explored the feasibility of using CRISPR/Cas9 for targeted mutagenesis in a tetraploid cultivar 'Alamo' switchgrass. We first developed a transient assay by which a non-functional green-fluorescent protein gene containing a 1-bp frameshift insertion in its 5' coding region was successfully mutated by a Cas9/sgRNA complex resulting in its restored function. Agrobacterium-mediated stable transformation of embryogenic calli derived from mature caryopses averaged a 3.0% transformation efficiency targeting the genes of teosinte branched 1(tb1)a and b and phosphoglycerate mutase (PGM). With a single construct containing two sgRNAs targeting different regions of tb1a and tb1b genes, primary transformants (T0) containing CRISPR/Cas9-induced mutations were obtained at frequencies of 95.5% (tb1a) and 11% (tb1b), respectively, with T0 mutants exhibiting increased tiller production. Meanwhile, a mutation frequency of 13.7% was obtained for the PGM gene with a CRISPR/Cas9 construct containing a single sgRNA. Among the PGM T0 mutants, six are heterozygous and one is homozygous for a 1-bp deletion in the target region with no apparent phenotypical alterations. We show that CRISPR/Cas9 system can generate targeted mutagenesis effectively and obtain targeted homozygous mutants in T0 generation in switchgrass, circumventing the need of inbreeding. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  14. Increased efficiency of targeted mutagenesis by CRISPR/Cas9 in plants using heat stress.

    Science.gov (United States)

    LeBlanc, Chantal; Zhang, Fei; Mendez, Josefina; Lozano, Yamile; Chatpar, Krishna; Irish, Vivian F; Jacob, Yannick

    2018-01-01

    The CRISPR/Cas9 system has greatly improved our ability to engineer targeted mutations in eukaryotic genomes. While CRISPR/Cas9 appears to work universally, the efficiency of targeted mutagenesis and the adverse generation of off-target mutations vary greatly between different organisms. In this study, we report that Arabidopsis plants subjected to heat stress at 37°C show much higher frequencies of CRISPR-induced mutations compared to plants grown continuously at the standard temperature (22°C). Using quantitative assays relying on green fluorescent protein (GFP) reporter genes, we found that targeted mutagenesis by CRISPR/Cas9 in Arabidopsis is increased by approximately 5-fold in somatic tissues and up to 100-fold in the germline upon heat treatment. This effect of temperature on the mutation rate is not limited to Arabidopsis, as we observed a similar increase in targeted mutations by CRISPR/Cas9 in Citrus plants exposed to heat stress at 37°C. In vitro assays demonstrate that Cas9 from Streptococcus pyogenes (SpCas9) is more active in creating double-stranded DNA breaks at 37°C than at 22°C, thus indicating a potential contributing mechanism for the in vivo effect of temperature on CRISPR/Cas9. This study reveals the importance of temperature in modulating SpCas9 activity in eukaryotes, and provides a simple method to increase on-target mutagenesis in plants using CRISPR/Cas9. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  15. Cationic antimicrobial peptides promote microbial mutagenesis and pathoadaptation in chronic infections.

    Directory of Open Access Journals (Sweden)

    Dominique H Limoli

    2014-04-01

    Full Text Available Acquisition of adaptive mutations is essential for microbial persistence during chronic infections. This is particularly evident during chronic Pseudomonas aeruginosa lung infections in cystic fibrosis (CF patients. Thus far, mutagenesis has been attributed to the generation of reactive species by polymorphonucleocytes (PMN and antibiotic treatment. However, our current studies of mutagenesis leading to P. aeruginosa mucoid conversion have revealed a potential new mutagen. Our findings confirmed the current view that reactive oxygen species can promote mucoidy in vitro, but revealed PMNs are proficient at inducing mucoid conversion in the absence of an oxidative burst. This led to the discovery that cationic antimicrobial peptides can be mutagenic and promote mucoidy. Of specific interest was the human cathelicidin LL-37, canonically known to disrupt bacterial membranes leading to cell death. An alternative role was revealed at sub-inhibitory concentrations, where LL-37 was found to induce mutations within the mucA gene encoding a negative regulator of mucoidy and to promote rifampin resistance in both P. aeruginosa and Escherichia coli. The mechanism of mutagenesis was found to be dependent upon sub-inhibitory concentrations of LL-37 entering the bacterial cytosol and binding to DNA. LL-37/DNA interactions then promote translesion DNA synthesis by the polymerase DinB, whose error-prone replication potentiates the mutations. A model of LL-37 bound to DNA was generated, which reveals amino termini α-helices of dimerized LL-37 bind the major groove of DNA, with numerous DNA contacts made by LL-37 basic residues. This demonstrates a mutagenic role for antimicrobials previously thought to be insusceptible to resistance by mutation, highlighting a need to further investigate their role in evolution and pathoadaptation in chronic infections.

  16. CRISPR/Cas9-mediated targeted mutagenesis in the liverwort Marchantia polymorpha L.

    Science.gov (United States)

    Sugano, Shigeo S; Shirakawa, Makoto; Takagi, Junpei; Matsuda, Yoriko; Shimada, Tomoo; Hara-Nishimura, Ikuko; Kohchi, Takayuki

    2014-03-01

    Targeted genome modification technologies are key tools for functional genomics. The clustered regularly interspaced short palindromic repeats (CRISPR)-associated endonuclease Cas9 system (CRISPR/Cas9) is an emerging technology for targeted genome modification. The CRISPR/Cas9 system consists of a short guide RNA (gRNA), which specifies the target genome sequence, and the Cas9 protein, which has endonuclease activity. The CRISPR/Cas9 system has been applied to model animals and flowering plants, including rice, sorghum, wheat, tobacco and Arabidopsis. Here, we report the application of CRISPR/Cas9 to targeted mutagenesis in the liverwort Marchantia polymorpha L., which has emerged as a model species for studying land plant evolution. The U6 promoter of M. polymorpha was identified and cloned to express the gRNA. The target sequence of the gRNA was designed to disrupt the gene encoding auxin response factor 1 (ARF1) in M. polymorpha. Using Agrobacterium-mediated transformation, we isolated stable mutants in the gametophyte generation of M. polymorpha. CRISPR/Cas9-based site-directed mutagenesis in vivo was achieved using either the Cauliflower mosaic virus 35S or M. polymorpha EF1α promoter to express Cas9. Isolated mutant individuals showing an auxin-resistant phenotype were not chimeric. Moreover, stable mutants were produced by asexual reproduction of T1 plants. Multiple arf1 alleles were easily established using CRIPSR/Cas9-based targeted mutagenesis. Our results provide a rapid and simple approach for molecular genetics in M. polymorpha, and raise the possibility that CRISPR/Cas9 may be applied to a wide variety of plant species.

  17. Retroviral insertional mutagenesis identifies genes that collaborate with NUP98-HOXD13 during leukemic transformation.

    Science.gov (United States)

    Slape, Christopher; Hartung, Helge; Lin, Ying-Wei; Bies, Juraj; Wolff, Linda; Aplan, Peter D

    2007-06-01

    The t(2;11)(q31;p15) chromosomal translocation results in a fusion between the NUP98 and HOXD13 genes and has been observed in patients with myelodysplastic syndrome (MDS) or acute myelogenous leukemia. We previously showed that expression of the NUP98-HOXD13 (NHD13) fusion gene in transgenic mice results in an invariably fatal MDS; approximately one third of mice die due to complications of severe pancytopenia, and about two thirds progress to a fatal acute leukemia. In the present study, we used retroviral insertional mutagenesis to identify genes that might collaborate with NHD13 as the MDS transformed to an acute leukemia. Newborn NHD13 transgenic mice and littermate controls were infected with the MOL4070LTR retrovirus. The onset of leukemia was accelerated, suggesting a synergistic effect between the NHD13 transgene and the genes neighboring retroviral insertion events. We identified numerous common insertion sites located near protein-coding genes and confirmed dysregulation of a subset of these by expression analyses. Among these genes were Meis1, a known collaborator of HOX and NUP98-HOX fusion genes, and Mn1, a transcriptional coactivator involved in human leukemia through fusion with the TEL gene. Other putative collaborators included Gata2, Erg, and Epor. Of note, we identified a common insertion site that was >100 kb from the nearest coding gene, but within 20 kb of the miR29a/miR29b1 microRNA locus. Both of these miRNA were up-regulated, demonstrating that retroviral insertional mutagenesis can target miRNA loci as well as protein-coding loci. Our data provide new insights into NHD13-mediated leukemogenesis as well as retroviral insertional mutagenesis mechanisms.

  18. Charting the genotype-phenotype map: lessons from the Drosophila melanogaster Genetic Reference Panel.

    Science.gov (United States)

    Mackay, Trudy F C; Huang, Wen

    2018-01-01

    Understanding the genetic architecture (causal molecular variants, their effects, and frequencies) of quantitative traits is important for precision agriculture and medicine and predicting adaptive evolution, but is challenging in most species. The Drosophila melanogaster Genetic Reference Panel (DGRP) is a collection of 205 inbred strains with whole genome sequences derived from a single wild population in Raleigh, NC, USA. The large amount of quantitative genetic variation, lack of population structure, and rapid local decay of linkage disequilibrium in the DGRP and outbred populations derived from DGRP lines present a favorable scenario for performing genome-wide association (GWA) mapping analyses to identify candidate causal genes, polymorphisms, and pathways affecting quantitative traits. The many GWA studies utilizing the DGRP have revealed substantial natural genetic variation for all reported traits, little evidence for variants with large effects but enrichment for variants with low P-values, and a tendency for lower frequency variants to have larger effects than more common variants. The variants detected in the GWA analyses rarely overlap those discovered using mutagenesis, and often are the first functional annotations of computationally predicted genes. Variants implicated in GWA analyses typically have sex-specific and genetic background-specific (epistatic) effects, as well as pleiotropic effects on other quantitative traits. Studies in the DGRP reveal substantial genetic control of environmental variation. Taking account of genetic architecture can greatly improve genomic prediction in the DGRP. These features of the genetic architecture of quantitative traits are likely to apply to other species, including humans. WIREs Dev Biol 2018, 7:e289. doi: 10.1002/wdev.289 This article is categorized under: Invertebrate Organogenesis > Flies. © 2017 Wiley Periodicals, Inc.

  19. Improvement of the activity and thermostability of microbial transglutaminase by multiple-site mutagenesis.

    Science.gov (United States)

    Mu, Dongdong; Lu, Jiaojiao; Shu, Chang; Li, Haowen; Li, Xingjiang; Cai, Jing; Luo, Shuizhong; Yang, Peizhou; Jiang, Shaotong; Zheng, Zhi

    2018-01-01

    Microbial transglutaminase (MTG) is an enzyme widely used in the food industry. Mutiple-site mutagenesis of Streptomyces mobaraensis transglutaminase was performed in Escherichia coli. According to enzymatic assay and thermostability study, among three penta-site MTG mutants (DM01-03), DM01 exhibited the highest enzymatic activity of 55.7 ± 1.4 U/mg and longest half-life at 50 °C (418.2 min) and 60 °C (24.8 min).

  20. Scaffolding functions of arrestin-2 revealed by crystal structure and mutagenesis.

    Science.gov (United States)

    Milano, Shawn K; Pace, Helen C; Kim, You-Me; Brenner, Charles; Benovic, Jeffrey L

    2002-03-12

    Arrestin binding to activated, phosphorylated G protein-coupled receptors (GPCRs) represents a critical step in regulation of light- and hormone-dependent signaling. Nonvisual arrestins, such as arrestin-2, interact with multiple proteins for the purpose of propagating and terminating signaling events. Using a combination of X-ray crystallography, molecular modeling, mutagenesis, and binding analysis, we reveal structural features of arrestin-2 that may enable simultaneous binding to phosphorylated receptor, SH3 domains, phosphoinositides, and beta-adaptin. The structure of full-length arrestin-2 thus provides a uniquely oriented scaffold for assembly of multiple, diverse molecules involved in GPCR signal transduction.

  1. Use of CRISPR/Cas Genome Editing Technology for Targeted Mutagenesis in Rice.

    Science.gov (United States)

    Xu, Rongfang; Wei, Pengcheng; Yang, Jianbo

    2017-01-01

    Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/CRISPR-associated protein (Cas) system is a newly emerging mutagenesis (gene-editing) tool in genetic engineering. Among the agriculturally important crops, several genes have been successfully mutated by the system, and some agronomic important traits have been rapidly generated, which indicates the potential applications in both scientific research and plant breeding. In this chapter, we describe a standard gene-editing procedure to effectively target rice genes and to make specific rice mutants using the CRISPR/Cas9 system mediated by Agrobacterium transformation.

  2. The significance of disulfide bonding in biological activity of HB-EGF, a mutagenesis approach

    OpenAIRE

    Hoskins, J.T.; Zhou, Z.; Harding, P.A.

    2008-01-01

    A site-directed mutagenesis approach was taken to disrupt each of 3 disulfide bonds within human HB-EGF by substituting serine for both cysteine residues that contribute to disulfide bonding. Each HB-EGF disulfide analogue (HB-EGF-Cys/Ser108/121, HB-EGF-Cys/Ser116/132, and HB-EGF-Cys/Ser134/143) was cloned under the regulation of the mouse metallothionein (MT) promoter and stably expressed in mouse fibroblasts. HB-EGF immunoreactive proteins with Mr of 6.5, 21 and 24kDa were observed from lys...

  3. Mutagenesis and Functional Analysis of the Pore-Forming Toxin HALT-1 from Hydra magnipapillata

    OpenAIRE

    Liew, Yvonne Jing Mei; Soh, Wai Tuck; Jiemy, William Febry; Hwang, Jung Shan

    2015-01-01

    Actinoporins are small 18.5 kDa pore-forming toxins. A family of six actinoporin genes has been identified in the genome of Hydra magnipapillata, and HALT-1 (Hydra actinoporin-like toxin-1) has been shown to have haemolytic activity. In this study, we have used site-directed mutagenesis to investigate the role of amino acids in the pore-forming N-terminal region and the conserved aromatic cluster required for cell membrane binding. A total of 10 mutants of HALT-1 were constructed and teste...

  4. Screening a random mutagenesis library of a fungal β-fructofuranosidase using FT-MIR ATR spectroscopy and multivariate analysis.

    Science.gov (United States)

    Trollope, K M; Nieuwoudt, H H; Görgens, J F; Volschenk, H

    2014-05-01

    Short-chain fructooligosaccharides (scFOS) are valuable health-promoting food additives. During the batch production of scFOS from sucrose the β-fructofuranosidase catalyst is subject to product inhibition by glucose. Engineering the enzyme for reduced sensitivity to glucose could improve product yields or process productivity while preserving the simple industrial batch design. Random mutagenesis is a useful technique for engineering proteins but should be coupled to a relevant high-throughput screen. Such a screen for sucrose and scFOS quantification remains elusive. This work presents the development of a screening method displaying potential high-throughput capacity for the evaluation of β-fructofuranosidase libraries using Fourier transform mid-infrared attenuated total reflectance (FT-MIR ATR) spectroscopy and multivariate analysis. A calibration model for the quantification of sucrose in enzyme assay samples ranged from 5 to 200 g/l and the standard error of prediction was below 13 g/l. A library of the Aspergillus japonicus fopA gene was generated by error prone PCR and screened in Saccharomyces cerevisiae. Using FT-MIR ATR spectroscopy, potential hits were identified as those variants that converted more sucrose in the presence of the glucose inhibitor than the parent. Subsequent analysis of reaction products generated by top performers using high-performance liquid chromatography identified a variant producing higher scFOS levels than the parent. At the peak difference in performance the variant produced 28 % more scFOS from the same amount of sucrose. This study highlights the application of FT-MIR ATR spectroscopy to a variant discovery pipeline in the directed evolution of a β-fructofuranosidase for enhanced scFOS production.

  5. Drosophila C Virus Systemic Infection Leads to Intestinal Obstruction

    OpenAIRE

    Chtarbanova, Stanislava; Lamiable, Olivier; Lee, Kwang-Zin; Galiana, Delphine; Troxler, Laurent; Meignin, Carine; Hetru, Charles; Hoffmann, Jules A.; Daeffler, Laurent; Imler, Jean-Luc

    2014-01-01

    Drosophila C virus (DCV) is a positive-sense RNA virus belonging to the Dicistroviridae family. This natural pathogen of the model organism Drosophila melanogaster is commonly used to investigate antiviral host defense in flies, which involves both RNA interference and inducible responses. Although lethality is used routinely as a readout for the efficiency of the antiviral immune response in these studies, virus-induced pathologies in flies still are poorly understood. Here, we characterize ...

  6. The Persistence of Facultative Parthenogenesis in Drosophila albomicans

    OpenAIRE

    Chang, Chia-chen; Ting, Chau-Ti; Chang, Ching-Ho; Fang, Shu; Chang, Hwei-yu

    2014-01-01

    Parthenogenesis has evolved independently in more than 10 Drosophila species. Most cases are tychoparthenogenesis, which is occasional or accidental parthenogenesis in normally bisexual species with a low hatching rate of eggs produced by virgin females; this form is presumed to be an early stage of parthenogenesis. To address how parthenogenesis and sexual reproduction coexist in Drosophila populations, we investigated several reproductive traits, including the fertility, parthenogenetic cap...

  7. Dietary glucose regulates yeast consumption in adult Drosophila males

    OpenAIRE

    Lebreton, S?bastien; Witzgall, Peter; Olsson, Marie; Becher, Paul G.

    2014-01-01

    The adjustment of feeding behavior in response to hunger and satiety contributes to homeostatic regulation in animals. The fruit fly Drosophila melanogaster feeds on yeasts growing on overripe fruit, providing nutrients required for adult survival, reproduction and larval growth. Here, we present data on how the nutritional value of food affects subsequent yeast consumption in Drosophila adult males. After a period of starvation, flies showed intensive yeast consumption. In comparison, flies ...

  8. Molecular characterization of the Drosophila responses towards nematodes

    OpenAIRE

    Arefin, Md. Badrul

    2016-01-01

    A sophisticated evolutionary conserved innate immune system has evolved in insects to fight pathogens and to restrict damage in harmful (danger) situations including cancer. A significant amount of knowledge about different infection models in Drosophila has been generated in past decades, which revealed functional resemblances and implications for vertebrate systems. However, how Drosophila responds towards multicellular parasitic nematodes and in danger situations is still little understood...

  9. Genomic and karyotypic variation in Drosophila parasitoids (Hymenoptera, Cynipoidea, Figitidae

    Directory of Open Access Journals (Sweden)

    Vladimir Gokhman

    2011-08-01

    Full Text Available Drosophila melanogaster Meigen, 1830 has served as a model insect for over a century. Sequencing of the 11 additional Drosophila Fallen, 1823 species marks substantial progress in comparative genomics of this genus. By comparison, practically nothing is known about the genome size or genome sequences of parasitic wasps of Drosophila. Here, we present the first comparative analysis of genome size and karyotype structures of Drosophila parasitoids of the Leptopilina Förster, 1869 and Ganaspis Förster, 1869 species. The gametic genome size of Ganaspis xanthopoda (Ashmead, 1896 is larger than those of the three Leptopilina species studied. The genome sizes of all parasitic wasps studied here are also larger than those known for all Drosophila species. Surprisingly, genome sizes of these Drosophila parasitoids exceed the average value known for all previously studied Hymenoptera. The haploid chromosome number of both Leptopilina heterotoma (Thomson, 1862 and L. victoriae Nordlander, 1980 is ten. A chromosomal fusion appears to have produced a distinct karyotype for L. boulardi (Barbotin, Carton et Keiner-Pillault, 1979 (n = 9, whose genome size is smaller than that of wasps of the L. heterotoma clade. Like L. boulardi, the haploid chromosome number for G. xanthopoda is also nine. Our studies reveal a positive, but non linear, correlation between the genome size and total chromosome length in Drosophila parasitoids. These Drosophila parasitoids differ widely in their host range, and utilize different infection strategies to overcome host defense. Their comparative genomics, in relation to their exceptionally well-characterized hosts, will prove to be valuable for understanding the molecular basis of the host-parasite arms race and how such mechanisms shape the genetic structures of insect communities.

  10. Reassignment of Drosophila willistoni Genome Scaffolds to Chromosome II Arms

    OpenAIRE

    Garcia, Carolina; Delprat, Alejandra; Ruiz, Alfredo; Valente, Vera L. S.

    2015-01-01

    Drosophila willistoni is a geographically widespread Neotropical species. The genome of strain Gd-H4-1 from Guadeloupe Island (Caribbean) was sequenced in 2007 as part of the 12 Drosophila Genomes Project. The assembled scaffolds were joined based on conserved linkage and assigned to polytene chromosomes based on a handful of genetic and physical markers. This paucity of markers was particularly striking in the metacentric chromosome II, comprised two similarly sized arms, IIL and IIR, tradit...

  11. Mapping of cis-regulatory sites in the promoter of testis-specific stellate genes of Drosophila melanogaster.

    Science.gov (United States)

    Olenkina, O M; Egorova, K S; Aravin, A A; Naumova, N M; Gvozdev, V A; Olenina, L V

    2012-11-01

    Tandem Stellate genes organized into two clusters in heterochromatin and euchromatin of the X-chromosome are part of the Ste-Su(Ste) genetic system required for maintenance of male fertility and reproduction of Drosophila melanogaster. Stellate genes encode a regulatory subunit of protein kinase CK2 and are the main targets of germline-specific piRNA-silencing; their derepression leads to appearance of protein crystals in spermatocytes, meiotic disturbances, and male sterility. A short promoter region of 134 bp appears to be sufficient for testis-specific transcription of Stellate, and it contains three closely located cis-regulatory elements called E-boxes. By using reporter analysis, we confirmed a strong functionality of the E-boxes in the Stellate promoter for in vivo transcription. Using selective mutagenesis, we have shown that the presence of the central E-box 2 is preferable to maintain a high-level testis-specific transcription of the reporter gene under the Stellate promoter. The Stellate promoter provides transcription even in heterochromatin, and corresponding mRNAs are translated with the generation of full-size protein products in case of disturbances in the piRNA-silencing process. We have also shown for the first time that the activity of the Stellate promoter is determined by chromatin context of the X-chromosome in male germinal cells, and it increases at about twofold when relocating in autosomes.

  12. Genetic perturbation of key central metabolic genes extends lifespan in Drosophila and affects response to dietary restriction.

    Science.gov (United States)

    Talbert, Matthew E; Barnett, Brittany; Hoff, Robert; Amella, Maria; Kuczynski, Kate; Lavington, Erik; Koury, Spencer; Brud, Evgeny; Eanes, Walter F

    2015-09-22

    There is a connection between nutrient inputs, energy-sensing pathways, lifespan variation and aging. Despite the role of metabolic enzymes in energy homeostasis and their metabolites as nutrient signals, little is known about how their gene expression impacts lifespan. In this report, we use P-element mutagenesis in Drosophila to study the effect on lifespan of reductions in expression of seven central metabolic enzymes, and contrast the effects on normal diet and dietary restriction. The major observation is that for five of seven genes, the reduction of gene expression extends lifespan on one or both diets. Two genes are involved in redox balance, and we observe that lower activity genotypes significantly extend lifespan. The hexokinases also show extension of lifespan with reduced gene activity. Since both affect the ATP/ADP ratio, this connects with the role of AMP-activated protein kinase as an energy sensor in regulating lifespan and mediating caloric restriction. These genes possess significant expression variation in natural populations, and our experimental genotypes span this level of natural activity variation. Our studies link the readout of energy state with the perturbation of the genes of central metabolism and demonstrate their effect on lifespan. © 2015 The Author(s).

  13. Functional evolution of duplicated odorant-binding protein genes, Obp57d and Obp57e, in Drosophila.

    Directory of Open Access Journals (Sweden)

    Eriko Harada

    Full Text Available Odorant-binding proteins (OBPs are extracellular proteins found in insect chemosensilla, where they participate in the sensing of odors, tastes, and pheromones. Although a large number of OBP genes have been identified in insect genomes, their molecular functions and biological roles have been clarified in limited cases. Two OBP genes, Obp57d and Obp57e, were involved in the evolution of host-plant preference in Drosophila sechellia. Comparative analyses of the Obp57d/e genomic sequences from 27 closely related species suggested that the two genes arose by tandem gene duplication and functionally diverged from each other. In this study, the functional evolution of Obp57d and Obp57e was examined by in vitro binding assays using recombinant proteins synthesized in a bacterial system. Compared to the ancestral Dpse\\OBP57de, Dmel\\OBP57d was more specialized to tridecanoic acid while Dmel\\OBP57e was generalized regarding their binding affinity, suggesting that the two OBP genes underwent subfunctionalization and neofunctionalization. A behavioral analysis using knockout flies supported that the biological role is different between OBP57d and OBP57e in vivo. Site-directed mutagenesis of the evolutionarily conserved amino acids revealed that these residues play an important role in protein folding. These findings provide a clue to understanding how the repertoire of OBP genes is maintained in a genome under natural selection.

  14. Efficient methods for targeted mutagenesis in zebrafish using zinc-finger nucleases: data from targeting of nine genes using CompoZr or CoDA ZFNs.

    Directory of Open Access Journals (Sweden)

    Raman Sood

    Full Text Available Recently, it has been shown that targeted mutagenesis using zinc-finger nucleases (ZFNs and transcription activator-like effector nucleases (TALENs can be used to generate knockout zebrafish lines for analysis of their function and/or developing disease models. A number of different methods have been developed for the design and assembly of gene-specific ZFNs and TALENs, making them easily available to most zebrafish researchers. Regardless of the choice of targeting nuclease, the process of generating mutant fish is similar. It is a time-consuming and multi-step process that can benefit significantly from development of efficient high throughput methods. In this study, we used ZFNs assembled through either the CompoZr (Sigma-Aldrich or the CoDA (context-dependent assembly platforms to generate mutant zebrafish for nine genes. We report our improved high throughput methods for 1 evaluation of ZFNs activity by somatic lesion analysis using colony PCR, eliminating the need for plasmid DNA extractions from a large number of clones, and 2 a sensitive founder screening strategy using fluorescent PCR with PIG-tailed primers that eliminates the stutter bands and accurately identifies even single nucleotide insertions and deletions. Using these protocols, we have generated multiple mutant alleles for seven genes, five of which were targeted with CompoZr ZFNs and two with CoDA ZFNs. Our data also revealed that at least five-fold higher mRNA dose was required to achieve mutagenesis with CoDA ZFNs than with CompoZr ZFNs, and their somatic lesion frequency was lower (<5% when compared to CopmoZr ZFNs (9-98%. This work provides high throughput protocols for efficient generation of zebrafish mutants using ZFNs and TALENs.

  15. Age-Related Reduction of Recovery Sleep and Arousal Threshold in Drosophila

    Science.gov (United States)

    Vienne, Julie; Spann, Ryanne; Guo, Fang; Rosbash, Michael

    2016-01-01

    Study Objectives: Physiological studies show that aging affects both sleep quality and quantity in humans, and sleep complaints increase with age. Along with knowledge about the negative effects of poor sleep on health, understanding the enigmatic relationship between sleep and aging is important. Because human sleep is similar to Drosophila (fruit fly) sleep in many ways, we addressed the effects of aging on sleep in this model organism. Methods: Baseline sleep was recorded in five different Drosophila genotypes raised at either 21°C or 25°C. The amount of sleep recovered was then investigated after a nighttime of sleep deprivation (12 h) and after chronic sleep deprivation (3 h every night for multiple nights). Finally, the effects of aging on arousal, namely, sensitivity to neuronal and mechanical stimuli, were studied. Results: We show that fly sleep is affected by age in a manner similar to that of humans and other mammals. Not only do older flies of several genotypes have more fragmented sleep and reduced total sleep time compared to young flies, but older flies also fail to recover as much sleep after sleep deprivation. This suggests either lower sleep homeostasis and/or a failure to properly recover sleep. Older flies also show a decreased arousal threshold, i.e., an increased response to neuronal and mechanical wake-promoting stimuli. The reduced threshold may either reflect or cause the reduced recovery sleep of older flies compared to young flies after sleep deprivation. Conclusions: Further studies are certainly needed, but we suggest that the lower homeostatic sleep drive of older flies causes their decreased arousal threshold. Citation: Vienne J, Spann R, Guo F, Rosbash M. Age-related reduction of recovery sleep and arousal threshold in Drosophila. SLEEP 2016;39(8):1613–1624. PMID:27306274

  16. Molecular Regulation of Alternative Polyadenylation (APA) within the Drosophila Nervous System.

    Science.gov (United States)

    Vallejos Baier, Raul; Picao-Osorio, Joao; Alonso, Claudio R

    2017-10-27

    Alternative polyadenylation (APA) is a widespread gene regulatory mechanism that generates mRNAs with different 3'-ends, allowing them to interact with different sets of RNA regulators such as microRNAs and RNA-binding proteins. Recent studies have shown that during development, neural tissues produce mRNAs with particularly long 3'UTRs, suggesting that such extensions might be important for neural development and function. Despite this, the mechanisms underlying neural APA are not well understood. Here, we investigate this problem within the Drosophila nervous system, focusing on the roles played by general cleavage and polyadenylation factors (CPA factors). In particular, we examine the model that modulations in CPA factor concentration may affect APA during development. For this, we first analyse the expression of the Drosophila orthologues of all mammalian CPA factors and note that their expression decreases during embryogenesis. In contrast to this global developmental decrease in CPA factor expression, we see that cleavage factor I (CFI) expression is actually elevated in the late embryonic central nervous system, suggesting that CFI might play a special role in neural tissues. To test this, we use the UAS/Gal4 system to deplete CFI proteins from neural tissue and observe that in this condition, multiple genes switch their APA patterns, demonstrating a role of CFI in APA control during Drosophila neural development. Furthermore, analysis of genes with 3'UTR extensions of different length leads us to suggest a novel relation between 3'UTR length and sensitivity to CPA factor expression. Our work thus contributes to the understanding of the mechanisms of APA control within the developing central nervous system. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  17. The GATOR1 Complex Regulates Metabolic Homeostasis and the Response to Nutrient Stress in Drosophila melanogaster

    Directory of Open Access Journals (Sweden)

    Youheng Wei

    2016-12-01

    Full Text Available TORC1 regulates metabolism and growth in response to a large array of upstream inputs. The evolutionarily conserved trimeric GATOR1 complex inhibits TORC1 activity in response to amino acid limitation. In humans, the GATOR1 complex has been implicated in a wide array of pathologies including cancer and hereditary forms of epilepsy. However, the precise role of GATOR1 in animal physiology remains largely undefined. Here, we characterize null mutants of the GATOR1 components nprl2, nprl3, and iml1 in Drosophila melanogaster. We demonstrate that all three mutants have inappropriately high baseline levels of TORC1 activity and decreased adult viability. Consistent with increased TORC1 activity, GATOR1 mutants exhibit a cell autonomous increase in cell growth. Notably, escaper nprl2 and nprl3 mutant adults have a profound locomotion defect. In line with a nonautonomous role in the regulation of systemic metabolism, expressing the Nprl3 protein in the fat body, a nutrient storage organ, and hemocytes but not muscles and neurons rescues the motility of nprl3 mutants. Finally, we show that nprl2 and nprl3 mutants fail to activate autophagy in response to amino acid limitation and are extremely sensitive to both amino acid and complete starvation. Thus, in Drosophila, in addition to maintaining baseline levels of TORC1 activity, the GATOR1 complex has retained a critical role in the response to nutrient stress. In summary, the TORC1 inhibitor GATOR1 contributes to multiple aspects of the development and physiology of Drosophila.

  18. A single and rapid calcium wave at egg activation in Drosophila

    Directory of Open Access Journals (Sweden)

    Anna H. York-Andersen

    2015-03-01

    Full Text Available Activation is an essential process that accompanies fertilisation in all animals and heralds major cellular changes, most notably, resumption of the cell cycle. While activation involves wave-like oscillations in intracellular Ca2+ concentration in mammals, ascidians and polychaete worms and a single Ca2+ peak in fish and frogs, in insects, such as Drosophila, to date, it has not been shown what changes in intracellular Ca2+ levels occur. Here, we utilise ratiometric imaging of Ca2+ indicator dyes and genetically encoded Ca2+ indicator proteins to identify and characterise a single, rapid, transient wave of Ca2+ in the Drosophila egg at activation. Using genetic tools, physical manipulation and pharmacological treatments we demonstrate that the propagation of the Ca2+ wave requires an intact actin cytoskeleton and an increase in intracellular Ca2+ can be uncoupled from egg swelling, but not from progression of the cell cycle. We further show that mechanical pressure alone is not sufficient to initiate a Ca2+ wave. We also find that processing bodies, sites of mRNA decay and translational regulation, become dispersed following the Ca2+ transient. Based on this data we propose the following model for egg activation in Drosophila: exposure to lateral oviduct fluid initiates an increase in intracellular Ca2+ at the egg posterior via osmotic swelling, possibly through mechano-sensitive Ca2+ channels; a single Ca2+ wave then propagates in an actin dependent manner; this Ca2+ wave co-ordinates key developmental events including resumption of the cell cycle and initiation of translation of mRNAs such as bicoid.

  19. The GATOR1 Complex Regulates Metabolic Homeostasis and the Response to Nutrient Stress in Drosophila melanogaster.

    Science.gov (United States)

    Wei, Youheng; Reveal, Brad; Cai, Weili; Lilly, Mary A

    2016-12-07

    TORC1 regulates metabolism and growth in response to a large array of upstream inputs. The evolutionarily conserved trimeric GATOR1 complex inhibits TORC1 activity in response to amino acid limitation. In humans, the GATOR1 complex has been implicated in a wide array of pathologies including cancer and hereditary forms of epilepsy. However, the precise role of GATOR1 in animal physiology remains largely undefined. Here, we characterize null mutants of the GATOR1 components nprl2, nprl3, and iml1 in Drosophila melanogaster We demonstrate that all three mutants have inappropriately high baseline levels of TORC1 activity and decreased adult viability. Consistent with increased TORC1 activity, GATOR1 mutants exhibit a cell autonomous increase in cell growth. Notably, escaper nprl2 and nprl3 mutant adults have a profound locomotion defect. In line with a nonautonomous role in the regulation of systemic metabolism, expressing the Nprl3 protein in the fat body, a nutrient storage organ, and hemocytes but not muscles and neurons rescues the motility of nprl3 mutants. Finally, we show that nprl2 and nprl3 mutants fail to activate autophagy in response to amino acid limitation and are extremely sensitive to both amino acid and complete starvation. Thus, in Drosophila, in addition to maintaining baseline levels of TORC1 activity, the GATOR1 complex has retained a critical role in the response to nutrient stress. In summary, the TORC1 inhibitor GATOR1 contributes to multiple aspects of the development and physiology of Drosophila. Copyright © 2016 Wei et al.

  20. Trehalose as an indicator of desiccation stress in Drosophila melanogaster larvae: A potential marker of anhydrobiosis

    Energy Technology Data Exchange (ETDEWEB)

    Thorat, Leena J. [Centre for Advanced Studies, Department of Zoology, University of Pune, Pune 411007 (India); Gaikwad, Sushama M. [Division of Biochemical Sciences, National Chemical Laboratory, Pune 411008 (India); Nath, Bimalendu B., E-mail: bbnath@unipune.ac.in [Centre for Advanced Studies, Department of Zoology, University of Pune, Pune 411007 (India)

    2012-03-23

    Highlights: Black-Right-Pointing-Pointer First report confirming anhydrobiosis in Drosophila melanogaster larvae. Black-Right-Pointing-Pointer Trehalose synthesis and accumulation in larvae that hydrolyzed on rehydration. Black-Right-Pointing-Pointer Trehalose synthesis in concert with the enzymes involved in trehalose metabolism. Black-Right-Pointing-Pointer Inhibition of trehalose hydrolysis in presence of a specific trehalase inhibitor. Black-Right-Pointing-Pointer Trehalose proposed as a reliable marker for biomonitoring of climate change studies. -- Abstract: In the current scenario of global climate change, desiccation is considered as one of the major environmental stressors for the biota exposed to altered levels of ambient temperature and humidity. Drosophila melanogaster, a cosmopolitan terrestrial insect has been chosen as a humidity-sensitive bioindicator model for the present study since its habitat undergoes frequent stochastic and/or seasonally aggravated dehydration regimes. We report here for the first time the occurrence of anhydrobiosis in D. melanogaster larvae by subjecting them to desiccation stress under laboratory conditions. Larvae desiccated for ten hours at <5% relative humidity could enter anhydrobiosis and could revive upon rehydration followed by resumption of active metabolism. As revealed by FTIR and HPLC analyzes, our findings strongly indicated the synthesis and accumulation of trehalose in the desiccating larvae. Biochemical measurements pointed out the desiccation-responsive trehalose metabolic pathway that was found to be coordinated in concert with the enzymes trehalose 6-phosphate synthase and trehalase. Further, an inhibitor-based experimental approach using deoxynojirimycin, a specific trehalase inhibitor, demonstrated the pivotal role of trehalose in larval anhydrobiosis of D. melanogaster. We therefore propose trehalose as a potential marker for the assessment of anhydrobiosis in Drosophila. The present findings thus add