WorldWideScience

Sample records for double-peaked balmer emission

  1. A RADIAL VELOCITY TEST FOR SUPERMASSIVE BLACK HOLE BINARIES AS AN EXPLANATION FOR BROAD, DOUBLE-PEAKED EMISSION LINES IN ACTIVE GALACTIC NUCLEI

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Jia; Halpern, Jules P. [Astronomy Department, Columbia University, 550 West 120th Street, New York, NY 10027 (United States); Eracleous, Michael [Department of Astronomy and Institute for Gravitation and The Cosmos, The Pennsylvania State University, 525 Davey Lab, University Park, PA 16802 (United States)

    2016-01-20

    One of the proposed explanations for the broad, double-peaked Balmer emission lines observed in the spectra of some active galactic nuclei (AGNs) is that they are associated with sub-parsec supermassive black hole (SMBH) binaries. Here, we test the binary broad-line region hypothesis through several decades of monitoring of the velocity structure of double-peakedemission lines in 13 low-redshift, mostly radio-loud AGNs. This is a much larger set of objects compared to an earlier test by Eracleous et al. and we use much longer time series for the three objects studied in that paper. Although systematic changes in radial velocity can be traced in many of their lines, they are demonstrably not like those of a spectroscopic binary in a circular orbit. Any spectroscopic binary period must therefore be much longer than the span of the monitoring (assuming a circular orbit), which in turn would require black hole masses that exceed by 1–2 orders of magnitude the values obtained for these objects using techniques such as reverberation mapping and stellar velocity dispersion. Moreover, the response of the double-peaked Balmer line profiles to fluctuations of the ionizing continuum and the shape of the Lyα profiles are incompatible with an SMBH binary. The binary broad-line region hypothesis is therefore disfavored. Other processes evidently shape these line profiles and cause the long-term velocity variations of the double peaks.

  2. Double-peaked Emission Lines Due to a Radio Outflow in KISSR 1219

    Energy Technology Data Exchange (ETDEWEB)

    Kharb, P.; Vaddi, S. [National Centre for Radio Astrophysics—Tata Institute of Fundamental Research, Postbag 3, Ganeshkhind, Pune 411007 (India); Subramanian, S. [Kavli Institute for Astronomy and Astrophysics, Peking University, 5 Yiheyuan Road, Haidian District, Beijing 100871 (China); Das, M. [Indian Institute of Astrophysics, II Block, Koramangala, Bangalore 560034 (India); Paragi, Z., E-mail: kharb@ncra.tifr.res.in [Joint Institute for VLBI in Europe, Postbus 2, 7990 AA Dwingeloo (Netherlands)

    2017-09-01

    We present the results from 1.5 and 5 GHz phase-referenced VLBA and 1.5 GHz Karl G. Jansky Very Large Array (VLA) observations of the Seyfert 2 galaxy KISSR 1219, which exhibits double-peaked emission lines in its optical spectrum. The VLA and VLBA data reveal a one-sided core-jet structure at roughly the same position angles, providing evidence of an active galactic nucleus outflow. The absence of dual parsec-scale radio cores puts the binary black-hole picture in doubt for the case of KISSR 1219. The high brightness temperatures of the parsec-scale core and jet components (>10{sup 6} K) are consistent with this interpretation. Doppler boosting with jet speeds of ≳0.55 c to ≳0.25 c , going from parsec to kiloparsec scales, at a jet inclination ≳50° can explain the jet one-sidedness in this Seyfert 2 galaxy. A blueshifted broad emission line component in [O iii] is also indicative of an outflow in the emission line gas at a velocity of ∼350 km s{sup −1}, while the [O i] doublet lines suggest the presence of shock-heated gas. A detailed line ratio study using the MAPPINGS III code further suggests that a shock+precursor model can explain the line ionization data well. Overall, our data suggest that the radio outflow in KISSR 1219 is pushing the emission line clouds, both ahead of the jet and in a lateral direction, giving rise to the double peak emission line spectra.

  3. Measurement of the deuterium Balmer series line emission on EAST

    Energy Technology Data Exchange (ETDEWEB)

    Wu, C. R.; Xu, Z.; Jin, Z.; Zhang, P. F. [Institute of Plasma Physics, Chinese Academy of Sciences, P.O. Box 1126, Hefei, Anhui 230031 (China); Science Island Branch of Graduate School, University of Science and Technology of China, Hefei, Anhui 230031 (China); Huang, J., E-mail: juan.huang@ipp.ac.cn; Gao, W.; Gao, W.; Chang, J. F.; Xu, J. C.; Duan, Y. M.; Chen, Y. J.; Zhang, L.; Wu, Z. W.; Li, J. G. [Institute of Plasma Physics, Chinese Academy of Sciences, P.O. Box 1126, Hefei, Anhui 230031 (China); Hou, Y. M. [Institute of Plasma Physics, Chinese Academy of Sciences, P.O. Box 1126, Hefei, Anhui 230031 (China); School of Nuclear Science and Technology, University of Science and Technology of China, Hefei, Anhui 230026 (China)

    2016-11-15

    Volume recombination plays an important role towards plasma detachment for magnetically confined fusion devices. High quantum number states of the Balmer series of deuterium are used to study recombination. On EAST (Experimental Advanced Superconducting Tokamak), two visible spectroscopic measurements are applied for the upper/lower divertor with 13 channels, respectively. Both systems are coupled with Princeton Instruments ProEM EMCCD 1024B camera: one is equipped on an Acton SP2750 spectrometer, which has a high spectral resolution ∼0.0049 nm with 2400 gr/mm grating to measure the D{sub α}(H{sub α}) spectral line and with 1200 gr/mm grating to measure deuterium molecular Fulcher band emissions and another is equipped on IsoPlane SCT320 using 600 gr/mm to measure high-n Balmer series emission lines, allowing us to study volume recombination on EAST and to obtain the related line averaged plasma parameters (T{sub e}, n{sub e}) during EAST detached phases. This paper will present the details of the measurements and the characteristics of deuterium Balmer series line emissions during density ramp-up L-mode USN plasma on EAST.

  4. COLLISIONLESS SHOCKS IN A PARTIALLY IONIZED MEDIUM. II. BALMER EMISSION

    Energy Technology Data Exchange (ETDEWEB)

    Morlino, G.; Bandiera, R.; Blasi, P.; Amato, E. [INAF-Osservatorio Astrofisico di Arcetri, Largo E. Fermi 5, I-50125 Firenze (Italy)

    2012-12-01

    Strong shocks propagating into a partially ionized medium are often associated with optical Balmer lines. This emission is due to impact excitation of neutral hydrogen by hot protons and electrons in the shocked gas. The structure of such Balmer-dominated shocks has been computed in a previous paper, where the distribution function of neutral particles was derived from the appropriate Boltzmann equation including coupling with ions and electrons through charge exchange and ionization. This calculation showed how the presence of neutrals can significantly modify the shock structure through the formation of a neutral-induced precursor ahead of the shock. Here we follow up on our previous work and investigate the properties of the resulting Balmer emission, with the aim of using the observed radiation as a diagnostic tool for shock parameters. Our main focus is on supernova remnant shocks, and we find that, for typical parameters, the H{alpha} emission typically has a three-component spectral profile, where (1) a narrow component originates from upstream cold hydrogen atoms, (2) a broad component comes from hydrogen atoms that have undergone charge exchange with shocked protons downstream of the shock, and (3) an intermediate component is due to hydrogen atoms that have undergone charge exchange with warm protons in the neutral-induced precursor. The relative importance of these three components depends on the shock velocity, on the original degree of ionization, and on the electron-ion temperature equilibration level. The intermediate component, which is the main signature of the presence of a neutral-induced precursor, becomes negligible for shock velocities {approx}< 1500 km s{sup -1}. The width of the intermediate line reflects the temperature in the precursor, while the width of the narrow one is left unaltered by the precursor. In addition, we show that the profiles of both the intermediate and broad components generally depart from a thermal distribution, as a

  5. Solar cycle variations of geocoronal balmer α emission

    International Nuclear Information System (INIS)

    Nossal, S.; Reynolds, R.J.; Roesler, F.L.; Scherb, F.

    1993-01-01

    Observations of the geocoronal Balmer in nightglow have been made from Wisconsin for more than a solar cycle with an internally consistent intensity reference to standard astronomical nebulae. These measurements were made with a double etalon, pressure-scanned, 15-cm aperture Fabry-Perot interferometer. The resulting long time data provides an opportunity to examine solar cycle influence on the mid-latitude exosphere and to address accompanying questions concerning the degree to which the exosphere is locally static or changing. The exospheric Balmer α absolute intensity measurements reported here show no statistically significant variations throughout the solar cycle when the variation with viewing geometry is removed by normalizing the data to reference exospheric model predictions by Anderson et al. However, the relative intensity dependence on solar depression angle does show a solar cycle variation. This variation suggests a possible related variation in the exospheric hydrogen density profile, although other interpretations are also possible. The results suggest that additional well-calibrated data taken over a longer time span could probe low-amplitude variations over the solar cycle and test predictions of a slow monotonic increase in exospheric hydrogen arising from greenhouse gases. 21 refs., 9 figs., 2 tabs

  6. Massive unseen companion of X Persei - emission contamination in the Balmer lines

    Energy Technology Data Exchange (ETDEWEB)

    Penrod, G.D.; Vogt, S.S.

    1985-12-01

    X Per is the optical counterpart of the pulsating X-ray source 4U 0352 + 30. Although nearly all observations of this system are consistent with a relatively simple model consisting of a normal O93-B0e star with a neutron star companion in a distant orbit, Hutchings et al. (1974) reported large-amplitude radial velocity variations with a 580-day period in the high-order Balmer absorption lines, which, if interpreted as orbital motion, imply the existence of a massive (more than 30 solar mass) unseen compansion, probably a black hole. High-quality Reticon spectra of the high-order Balmer lines have been obtained which show that the radial velocity variations reported by Hutchings et al. are spurious and are caused by asymmetric and variable emission components hiding in the absorption profiles. This result eliminates the necessity for postulating a massive, unseen secondary or tertiary star. All observed aspects of X Per now seem consistent with the Be + neutron star binary scenario. A previously reported 22.4-hr periodicity in the X-ray flux is explained in terms of nonradial g-mode pulsations of the Be star, which modulate the star's wind, and, hence, the accretion rate onto the neutron star. 21 references.

  7. Massive unseen companion of X Persei - emission contamination in the Balmer lines

    International Nuclear Information System (INIS)

    Penrod, G.D.; Vogt, S.S.

    1985-01-01

    X Per is the optical counterpart of the pulsating X-ray source 4U 0352 + 30. Although nearly all observations of this system are consistent with a relatively simple model consisting of a normal O93-B0e star with a neutron star companion in a distant orbit, Hutchings et al. (1974) reported large-amplitude radial velocity variations with a 580-day period in the high-order Balmer absorption lines, which, if interpreted as orbital motion, imply the existence of a massive (more than 30 solar mass) unseen compansion, probably a black hole. High-quality Reticon spectra of the high-order Balmer lines have been obtained which show that the radial velocity variations reported by Hutchings et al. are spurious and are caused by asymmetric and variable emission components hiding in the absorption profiles. This result eliminates the necessity for postulating a massive, unseen secondary or tertiary star. All observed aspects of X Per now seem consistent with the Be + neutron star binary scenario. A previously reported 22.4-hr periodicity in the X-ray flux is explained in terms of nonradial g-mode pulsations of the Be star, which modulate the star's wind, and, hence, the accretion rate onto the neutron star. 21 references

  8. HYDRO2GEN: Non-thermal hydrogen Balmer and Paschen emission in solar flares generated by electron beams

    Science.gov (United States)

    Druett, M. K.; Zharkova, V. V.

    2018-03-01

    Aim. Sharp rises of hard X-ray (HXR) emission accompanied by Hα line profiles with strong red-shifts up to 4 Å from the central wavelength, often observed at the onset of flares with the Specola Solare Ticinese Telescope (STT) and the Swedish Solar Telescope (SST), are not fully explained by existing radiative models. Moreover, observations of white light (WL) and Balmer continuum emission with the Interface Region Imaging Spectrograph (IRISH) reveal strong co-temporal enhancements and are often nearly co-spatial with HXR emission. These effects indicate a fast effective source of excitation and ionisation of hydrogen atoms in flaring atmospheres associated with HXR emission. In this paper, we investigate electron beams as the agents accounting for the observed hydrogen line and continuum emission. Methods: Flaring atmospheres are considered to be produced by a 1D hydrodynamic response to the injection of an electron beam defining their kinetic temperatures, densities, and macro velocities. We simulated a radiative response in these atmospheres using a fully non-local thermodynamic equilibrium (NLTE) approach for a 5-level plus continuum hydrogen atom model, considering its excitation and ionisation by spontaneous, external, and internal diffusive radiation and by inelastic collisions with thermal and beam electrons. Simultaneous steady-state and integral radiative transfer equations in all optically thick transitions (Lyman and Balmer series) were solved iteratively for all the transitions to define their source functions with the relative accuracy of 10-5. The solutions of the radiative transfer equations were found using the L2 approximation. Resulting intensities of hydrogen line and continuum emission were also calculated for Balmer and Paschen series. Results: We find that inelastic collisions with beam electrons strongly increase excitation and ionisation of hydrogen atoms from the chromosphere to photosphere. This leads to an increase in Lyman continuum

  9. Doppler shift measurement of Balmer-alpha line spectrum emission from a plasma in a negative hydrogen ion source

    International Nuclear Information System (INIS)

    Wada, M.; Doi, K.; Kisaki, M.; Nakano, H.; Tsumori, K.; Nishiura, M.

    2015-01-01

    Balmer-α light emission from the extraction region of the LHD one-third ion source has shown a characteristic Doppler broadening in the wavelength spectrum detected by a high resolution spectrometer. The spectrum resembles Gaussian distribution near the wavelength of the intensity peak, while it has an additional component of a broader foot. The measured broadening near the wavelength of the intensity peak corresponds to 0.6 eV hydrogen atom temperature. The spectrum exhibits a larger expansion in the blue wing which becomes smaller when the line of sight is tilted toward the driver region from the original observation axis parallel to the plasma grid. A surface collision simulation model predicts the possibility of hydrogen reflection at the plasma grid surface to form a broad Balmer-α light emission spectrum

  10. Doppler shift measurement of Balmer-alpha line spectrum emission from a plasma in a negative hydrogen ion source

    Energy Technology Data Exchange (ETDEWEB)

    Wada, M., E-mail: mwada@mail.doshisha.ac.jp; Doi, K. [Graduate School of Science and Engineering, Doshisha University, Kyotanabe, Kyoto 610-0321 Japan (Japan); Kisaki, M.; Nakano, H.; Tsumori, K. [National Institute for Fusion Science, Toki, Gifu (Japan); Nishiura, M. [Graduate School of Frontier Sciences, The Universtiy of Tokyo, Chiba 277-8561 (Japan)

    2015-04-08

    Balmer-α light emission from the extraction region of the LHD one-third ion source has shown a characteristic Doppler broadening in the wavelength spectrum detected by a high resolution spectrometer. The spectrum resembles Gaussian distribution near the wavelength of the intensity peak, while it has an additional component of a broader foot. The measured broadening near the wavelength of the intensity peak corresponds to 0.6 eV hydrogen atom temperature. The spectrum exhibits a larger expansion in the blue wing which becomes smaller when the line of sight is tilted toward the driver region from the original observation axis parallel to the plasma grid. A surface collision simulation model predicts the possibility of hydrogen reflection at the plasma grid surface to form a broad Balmer-α light emission spectrum.

  11. On the Origin of the Flare Emission in IRIS ’ SJI 2832 Filter:Balmer Continuum or Spectral Lines?

    Energy Technology Data Exchange (ETDEWEB)

    Kleint, Lucia; Krucker, Säm [University of Applied Sciences and Arts Northwestern Switzerland, Bahnhofstrasse 6, 5210 Windisch (Switzerland); Heinzel, Petr [Astronomical Institute, The Czech Academy of Sciences, Fričova 298, 25165 Ondřejov (Czech Republic)

    2017-03-10

    Continuum (“white-light,” WL) emission dominates the energetics of flares. Filter-based observations, such as the IRIS SJI 2832 filter, show WL-like brightenings during flares, but it is unclear whether the emission arises from real continuum emission or enhanced spectral lines, possibly turning into emission. The difficulty in filter-based observations, contrary to spectral observations, is to determine which processes contribute to the observed brightening during flares. Here we determine the contribution of the Balmer continuum and the spectral line emission to IRIS ’ SJI 2832 emission by analyzing the appropriate passband in simultaneous IRIS NUV spectra. We find that spectral line emission can contribute up to 100% to the observed slitjaw images (SJI) emission, that the relative contributions usually temporally vary, and that the highest SJI enhancements that are observed are most likely because of the Balmer continuum. We conclude that care should be taken when calling SJI 2832 a continuum filter during flares, because the influence of the lines on the emission can be significant.

  12. On the Origin of the Flare Emission in IRIS ’ SJI 2832 Filter:Balmer Continuum or Spectral Lines?

    International Nuclear Information System (INIS)

    Kleint, Lucia; Krucker, Säm; Heinzel, Petr

    2017-01-01

    Continuum (“white-light,” WL) emission dominates the energetics of flares. Filter-based observations, such as the IRIS SJI 2832 filter, show WL-like brightenings during flares, but it is unclear whether the emission arises from real continuum emission or enhanced spectral lines, possibly turning into emission. The difficulty in filter-based observations, contrary to spectral observations, is to determine which processes contribute to the observed brightening during flares. Here we determine the contribution of the Balmer continuum and the spectral line emission to IRIS ’ SJI 2832 emission by analyzing the appropriate passband in simultaneous IRIS NUV spectra. We find that spectral line emission can contribute up to 100% to the observed slitjaw images (SJI) emission, that the relative contributions usually temporally vary, and that the highest SJI enhancements that are observed are most likely because of the Balmer continuum. We conclude that care should be taken when calling SJI 2832 a continuum filter during flares, because the influence of the lines on the emission can be significant.

  13. Molecular enhancement of Balmer emissions following foil-induced dissociation of fast H2+ and H3+ ions

    International Nuclear Information System (INIS)

    Kobayashi, H.; Oda, N.

    1984-01-01

    Relative emission yields of Balmer lines as functions of the dwell time (t/sub D/ = 0.97--54.1 fs) in thin carbon foils (2--68 μg/cm 2 ) have been measured with (0.2--0.8)-MeV/amu H + , H 2 + , and H 3 + incident on thin carbon foils. Large molecular effects for emission yields of Balmer lines have been observed for H 2 + and H 3 + , where the molecular effect for H 3 + is larger than that for H 2 + . The molecular effects for H 2 + and H 3 + depend on the principal quantum number (n = 3--6), but this n dependence disappears at the largest t/sub D/ ( = 54.1 fs). The molecular effects rapidly decrease with increasing t/sub D/ in the small-t/sub D/ ( or approx. =2 fs) region. The magnitudes of the molecular effects at the largest t/sub D/ ( = 54.1 fs) are in good agreement with those by Andresen et al. [Phys. Scr. 19, 335 (1979)]. Relative populations of n-state hydrogens in the large-t/sub D/ (> or approx. =2 fs) region have been derived from the relative yields of Balmer lines as functions of n and t/sub D/. The molecular enhancement for relative populations of n-state hydrogens for H 2 + depends on n and t/sub D/, and decreases with increasing t/sub D/ and increases with increasing n

  14. Can double-peaked lines indicate merging effects in AGNs?

    Directory of Open Access Journals (Sweden)

    Popović L.Č.

    2000-01-01

    Full Text Available The influence of merging effects in the central part of an Active Galactic Nucleus (AGN on the emission spectral line shapes are discussed. We present a model of close binary Broad Line Region. The numerical experiments show that the merging effects can explain double peaked lines. The merging effects may also be present in the center of AGNs, although they emit slightly asymmetric as well as symmetric and relatively stable (in profile shape spectral lines. Depending on the black hole masses and their orbit elements such model may explain some of the line profile shapes observed in AGNs. This work shows that if one is looking for the merging effects in the central region as well as in the wide field structure of AGNs, he should first pay attention to objects which have double peaked lines.

  15. MERGERS IN DOUBLE-PEAKED [O III] ACTIVE GALACTIC NUCLEI

    International Nuclear Information System (INIS)

    Fu Hai; Djorgovski, S. G.; Myers, Adam D.; Yan Lin

    2011-01-01

    As a natural consequence of galaxy mergers, binary active galactic nuclei (AGNs) should be commonplace. Nevertheless, observational confirmations are rare, especially for binaries with separations less than 10 kpc. Such a system may show two sets of narrow emission lines in a single spectrum owing to the orbital motion of the binary. We have obtained high-resolution near-infrared images of 50 double-peaked [O III]λ5007 AGNs with the Keck II laser guide star adaptive optics system. The Sloan Digital Sky Survey sample is compiled from the literature and consists of 17 type-1 AGNs between 0.18 BH -σ * relation because of overestimated stellar velocity dispersions, illustrating the importance of removing mergers from the samples defining the M BH -σ * relations. Finally, we find that the emission-line properties are indistinguishable for spatially resolved and unresolved sources, emphasizing that scenarios involving a single AGN can produce the same double-peaked line profiles and they account for at least 70% of the double-peaked [O III] AGNs.

  16. Correlation between Balmer α emission and hydrogen flux through a superpermeable niobium membrane in a low-pressure multicusp plasma source

    International Nuclear Information System (INIS)

    Bruneteau, A.M.; Notkin, M.E.; Livshits, A.I.; Bacal, M.

    2002-01-01

    The purpose of this paper is to correlate hydrogen or deuterium flux through super permeable membranes with incident hydrogen or deuterium atom flux from the plasma. To this aim a hydrogen or deuterium plasma is created in a hybrid multicusp plasma source. We investigate Balmer α emission from the multicusp plasma and the output pressure behind a superpermeable niobium membrane immersed in the plasma.The output pressure is proportional to the flux of atoms and ions arriving on the membrane. We find that both output pressure and excited atoms emission satisfy plasma parameters relations. It is thus verified that plasma-driven superpermeation of hydrogen is due essentially to neutral atoms from the plasma incident to the membrane

  17. Searching for Dual AGNs in Galaxy Mergers: Understanding Double-Peaked [O III] and Ultra Hard X-rays as Selection Method

    Science.gov (United States)

    McGurk, Rosalie C.; Max, Claire E.; Medling, Anne; Shields, Gregory A.

    2015-01-01

    When galaxies merge, gas accretes onto both central supermassive black holes. Thus, one expects to see close pairs of active galactic nuclei (AGNs), or dual AGNs, in a fraction of galaxy mergers. However, finding them remains a challenge. The presence of double-peaked [O III] or of ultra hard X-rays have been proposed as techniques to select dual AGNs efficiently. We studied a sample of double-peaked narrow [O III] emitting AGNs from SDSS DR7. By obtaining new and archival high spatial resolution images taken with the Keck 2 Laser Guide Star Adaptive Optics system and the near-infrared (IR) camera NIRC2, we showed that 30% of double-peaked [O III] emission line SDSS AGNs have two spatial components within a 3' radius. However, spatially resolved spectroscopy or X-ray observations are needed to confirm these galaxy pairs as systems containing two AGNs. We followed up these spatially-double candidate dual AGNs with integral field spectroscopy from Keck OSIRIS and Gemini GMOS and with long-slit spectroscopy from Keck NIRSPEC and Shane Kast Double Spectrograph. We find double-peaked emitters are caused sometimes by dual AGN and sometimes by outflows or narrow line kinematics. We also performed Chandra X-ray ACIS-S observations on 12 double-peaked candidate dual AGNs. Using our observations and 8 archival observations, we compare the distribution of X-ray photons to our spatially double near-IR images, measure X-ray luminosities and hardness ratios, and estimate column densities. By assessing what fraction of double-peaked emission line SDSS AGNs are true dual AGNs, we can better determine whether double-peaked [O III] is an efficient dual AGN indicator and constrain the statistics of dual AGNs. A second technique to find dual AGN is the detection of ultra hard X-rays by the Swift Burst Alert Telescope. We use CARMA observations to measure and map the CO(1-0) present in nearby ultra-hard X-ray Active Galactic Nuclei (AGNs) merging with either a quiescent companion

  18. The Nature of Double-peaked [O III] Active Galactic Nuclei

    Science.gov (United States)

    Fu, Hai; Yan, Lin; Myers, Adam D.; Stockton, Alan; Djorgovski, S. G.; Aldering, G.; Rich, Jeffrey A.

    2012-01-01

    Active galactic nuclei (AGNs) with double-peaked [O III] lines are suspected to be sub-kpc or kpc-scale binary AGNs. However, pure gas kinematics can produce the same double-peaked line profile in spatially integrated spectra. Here we combine integral-field spectroscopy and high-resolution imaging of 42 double-peaked [O III] AGNs from the Sloan Digital Sky Survey to investigate the constituents of the population. We find two binary AGNs where the line splitting is driven by the orbital motion of the merging nuclei. Such objects account for only ~2% of the double-peaked AGNs. Almost all (~98%) of the double-peaked AGNs were selected because of gas kinematics; and half of those show spatially resolved narrow-line regions that extend 4-20 kpc from the nuclei. Serendipitously, we find two spectrally unresolved binary AGNs where gas kinematics produced the double-peaked [O III] lines. The relatively frequent serendipitous discoveries indicate that only ~1% of binary AGNs would appear double-peaked in Sloan spectra and 2.2+2.5 -0.8% of all Sloan AGNs are binary AGNs. Therefore, the double-peaked sample does not offer much advantage over any other AGN samples in finding binary AGNs. The binary AGN fraction implies an elevated AGN duty cycle (8+8 -3%), suggesting galaxy interactions enhance nuclear accretion. We illustrate that integral-field spectroscopy is crucial for identifying binary AGNs: several objects previously classified as "binary AGNs" with long-slit spectra are most likely single AGNs with extended narrow-line regions (ENLRs). The formation of ENLRs driven by radiation pressure is also discussed. Some of the data presented herein were obtained at the W.M. Keck Observatory, which is operated as a scientific partnership among the California Institute of Technology, the University of California, and the National Aeronautics and Space Administration. The Observatory was made possible by the generous financial support of the W. M. Keck Foundation.

  19. Novel five-state latch using double-peak negative differential resistance and standard ternary inverter

    Science.gov (United States)

    Shin, Sunhae; Rok Kim, Kyung

    2016-04-01

    We propose complement double-peak negative differential resistance (NDR) devices with ultrahigh peak-to-valley current ratio (PVCR) over 106 by combining tunnel diode with conventional CMOS and its compact five-state latch circuit by introducing standard ternary inverter (STI). At the “high”-state of STI, n-type NDR device (tunnel diode with nMOS) has 1st NDR characteristics with 1st peak and valley by band-to-band tunneling (BTBT) and trap-assisted tunneling (TAT), whereas p-type NDR device (tunnel diode with pMOS) has second NDR characteristics from the suppression of diode current by off-state MOSFET. The “intermediate”-state of STI permits double-peak NDR device to operate five-state latch with only four transistors, which has 33% area reduction compared with that of binary inverter and 57% bit-density reduction compared with binary latch.

  20. The Research of Indoor Positioning Based on Double-peak Gaussian Model

    Directory of Open Access Journals (Sweden)

    Lina Chen

    2014-04-01

    Full Text Available Location fingerprinting using Wi-Fi signals has been very popular and is a well accepted indoor positioning method. The key issue of the fingerprinting approach is generating the fingerprint radio map. Limited by the practical workload, only a few samples of the received signal strength are collected at each reference point. Unfortunately, fewer samples cannot accurately represent the actual distribution of the signal strength from each access point. This study finds most Wi- Fi signals have two peaks. According to the new finding, a double-peak Gaussian arithmetic is proposed to generate a fingerprint radio map. This approach requires little time to receive WiFi signals and it easy to estimate the parameters of the double-peak Gaussian function. Compared to the Gaussian function and histogram method to generate a fingerprint radio map, this method better approximates the occurrence signal distribution. This paper also compared the positioning accuracy using K-Nearest Neighbour theory for three radio maps, the test results show that the positioning distance error utilizing the double-peak Gaussian function is better than the other two methods.

  1. Correlation between the line width and the line flux of the double-peaked broad Hα of 3C390.3

    Science.gov (United States)

    Zhang, Xue-Guang

    2013-03-01

    In this paper, we carefully check the correlation between the line width (second moment) and the line flux of the double-peaked broad Hα of the well-known mapped active galactic nucleus (AGN) 3C390.3 in order to show some further distinctions between double-peaked emitters and normal broad-line AGN. Based on the virialization assumption MBH ∝ RBLR × V2(BLR) and the empirical relation RBLR ∝ L˜0.5, one strong negative correlation between the line width and the line flux of the double-peaked broad lines should be expected for 3C390.3, such as the negative correlation confirmed for the mapped broad-line object NGC 5548, RBLR × V2(BLR) ∝ L˜0.5 × σ2 = constant. Moreover, based on the public spectra around 1995 from the AGN WATCH project for 3C390.3, one reliable positive correlation is found between the line width and the line flux of the double-peaked broad Hα. In the context of the proposed theoretical accretion disc model for double-peaked emitters, the unexpected positive correlation can be naturally explained, due to different time delays for the inner and outer parts of the disc-like broad-line region (BLR) of 3C390.3. Moreover, the virialization assumption is checked and found to be still available for 3C390.3. However, the time-varying size of the BLR of 3C390.3 cannot be expected by the empirical relation RBLR ∝ L˜0.5. In other words, the mean size of the BLR of 3C390.3 can be estimated by the continuum luminosity (line luminosity), while the continuum emission strengthening leads to the size of BLR decreasing (not increasing) in different moments for 3C390.3. Then, we compared our results of 3C390.3 with the previous results reported in the literature for the other double-peaked emitters, and found that before to clearly correct the effects from disc physical parameters varying (such as the effects of disc precession) for long-term observed line spectra, it is not so meaningful to discuss the correlation of the line parameters of double-peaked

  2. Geocoronal Balmer α line profile observations and forward-model analysis

    Science.gov (United States)

    Mierkiewicz, E. J.; Bishop, J.; Roesler, F. L.; Nossal, S. M.

    2006-05-01

    High spectral resolution geocoronal Balmer α line profile observations from Pine Bluff Observatory (PBO) are presented in the context of forward-model analysis. Because Balmer series column emissions depend significantly on multiple scattering, retrieval of hydrogen parameters of general aeronomic interest from these observations (e.g., the hydrogen column abundance) currently requires a forward modeling approach. This capability is provided by the resonance radiative transfer code LYAO_RT. We have recently developed a parametric data-model comparison search procedure employing an extensive grid of radiative transport model input parameters (defining a 6-dimensional parameter space) to map-out bounds for feasible forward model retrieved atomic hydrogen density distributions. We applied this technique to same-night (March, 2000) ground-based Balmer α data from PBO and geocoronal Lyman β measurements from the Espectrógrafo Ultravioleta extremo para la Radiación Difusa (EURD) instrument on the Spanish satellite MINISAT-1 (provided by J.F. Gómez and C. Morales of the Laboratorio de Astrofisica Espacial y Física Fundamental, INTA, Madrid, Spain) in order to investigate the modeling constraints imposed by two sets of independent geocoronal intensity measurements, both of which rely on astronomical calibration methods. In this poster we explore extending this analysis to the line profile information also contained in the March 2000 PBO Balmer α data set. In general, a decrease in the Doppler width of the Balmer α emission with shadow altitude is a persistent feature in every night of PBO observations in which a wide range of shadow altitudes are observed. Preliminary applications of the LYAO_RT code, which includes the ability to output Doppler line profiles for both the singly and multiply scattered contributions to the Balmer α emission line, displays good qualitative agreement with regard to geocoronal Doppler width trends observed from PBO. Model-data Balmer

  3. How to accurately estimate BH masses of AGN with double-peaked emission lines

    OpenAIRE

    Xue Guang Zhang; Deborah Dultzin; Ting Gui Wang

    2008-01-01

    Presentamos una nueva relación para determinar la masa virial del Agujero Negro central en Núcleos Activos de Galaxias con perfiles de doble pico en las líneas anchas de baja ionización. Se discute cuál es el parámetro adecuado para estimar la velocidad local de las regiones de emisión y la relación para estimar la distancia de éstas regiones a la fuente de ionización. Seleccionamos 17 objetos con perfiles de doble pico del SDSS y con líneas de absorción medibles para determinar las masas...

  4. Formation of broad Balmer wings in symbiotic stars

    International Nuclear Information System (INIS)

    Chang, Seok-Jun; Heo, Jeong-Eun; Hong, Chae-Lin; Lee, Hee-Won

    2016-01-01

    Symbiotic stars are binary systems composed of a hot white dwarf and a mass losing giant. In addition to many prominent emission lines symbiotic stars exhibit Raman scattered O VI features at 6825 and 7088 Å. Another notable feature present in the spectra of many symbiotics is the broad wings around Balmer lines. Astrophysical mechanisms that can produce broad wings include Thomson scattering by free electrons and Raman scattering of Ly,β and higher series by neutral hydrogen. In this poster presentation we produce broad wings around Hα and H,β adopting a Monte Carlo techinique in order to make a quantitative comparison of these two mechanisms. Thomson wings are characterized by the exponential cutoff given by the termal width whereas the Raman wings are dependent on the column density and continuum shape in the far UV region. A brief discussion is provided. (paper)

  5. The origin of double peak electric field distribution in heavily irradiated silicon detectors

    CERN Document Server

    Eremin, V; Li, Z

    2002-01-01

    The first observation of double peak (DP) electric field distribution in heavily neutron irradiated (>10 sup 1 sup 4 n/cm sup 2) semiconductor detectors has been published about 6 yr ago. However, this effect was not quantitatively analyzed up to now. The explanation of the DP electric field distribution presented in this paper is based on the properties of radiation induced deep levels in silicon, which act as deep traps, and on the distribution of the thermally generated free carrier concentration in the detector bulk. In the frame of this model, the earlier published considerations on the so-called 'double junction (DJ) effect' are discussed as well. The comparison of the calculated electric field profiles at different temperatures with the experimental ones allows one to determine a set of deep levels. This set of deep levels, and their charge filling status are essential to the value and the distribution of space charge in the space charge region in the range of 305-240 K, which is actual temperature ran...

  6. Structure of the Balmer jump. The isolated hydrogen atom

    Science.gov (United States)

    Calvo, F.; Belluzzi, L.; Steiner, O.

    2018-06-01

    Context. The spectrum of the hydrogen atom was explained by Bohr more than one century ago. We revisit here some of the aspects of the underlying quantum structure, with a modern formalism, focusing on the limit of the Balmer series. Aims: We investigate the behaviour of the absorption coefficient of the isolated hydrogen atom in the neighbourhood of the Balmer limit. Methods: We analytically computed the total cross-section arising from bound-bound and bound-free transitions in the isolated hydrogen atom at the Balmer limit, and established a simplified semi-analytical model for the surroundings of that limit. We worked within the framework of the formalism of Landi Degl'Innocenti & Landolfi (2004, Astrophys. Space Sci. Lib., 307), which permits an almost straight-forward generalization of our results to other atoms and molecules, and which is perfectly suitable for including polarization phenomena in the problem. Results: We analytically show that there is no discontinuity at the Balmer limit, even though the concept of a "Balmer jump" is still meaningful. Furthermore, we give a possible definition of the location of the Balmer jump, and we check that this location is dependent on the broadening mechanisms. At the Balmer limit, we compute the cross-section in a fully analytical way. Conclusions: The Balmer jump is produced by a rapid drop of the total Balmer cross-section, yet this variation is smooth and continuous when both bound-bound and bound-free processes are taken into account, and its shape and location is dependent on the broadening mechanisms.

  7. Hydrogenic fast-ion diagnostic using Balmer-alpha light

    International Nuclear Information System (INIS)

    Heidbrink, W W; Burrell, K H; Luo, Y; Pablant, N A; Ruskov, E

    2004-01-01

    Hydrogenic fast-ion populations are common in toroidal magnetic fusion devices, especially in devices with neutral beam injection. As the fast ions orbit around the device and pass through a neutral beam, some fast ions neutralize and emit Balmer-alpha light. The intensity of this emission is weak compared with the signals from the injected neutrals, the warm (halo) neutrals and the cold edge neutrals, but, for a favourable viewing geometry, the emission is Doppler shifted away from these bright interfering signals. Signals from fast ions are detected in the DIII-D tokamak. When the electron density exceeds ∼7 x 10 19 m -3 , visible bremsstrahlung obscures the fast-ion signal. The intrinsic spatial resolution of the diagnostic is ∼5 cm for 40 keV amu -1 fast ions. The technique is well suited for diagnosis of fast-ion populations in devices with fast-ion energies (∼30 keV amu -1 ), minor radii (∼0.6 m) and plasma densities (∼ 20 m -3 ) that are similar to those of DIII-D

  8. Type 2 Active Galactic Nuclei with Double-peaked [O III] Lines. II. Single AGNs with Complex Narrow-line Region Kinematics are More Common than Binary AGNs

    Science.gov (United States)

    Shen, Yue; Liu, Xin; Greene, Jenny E.; Strauss, Michael A.

    2011-07-01

    Approximately 1% of low-redshift (z interpreted as either due to kinematics, such as biconical outflows and/or disk rotation of the narrow line region (NLR) around single black holes, or due to the relative motion of two distinct NLRs in a merging pair of AGNs. Here, we report follow-up near-infrared (NIR) imaging and optical slit spectroscopy of 31 double-peaked [O III] type 2 AGNs drawn from the Sloan Digital Sky Survey (SDSS) parent sample presented in Liu et al. The NIR imaging traces the old stellar population in each galaxy, while the optical slit spectroscopy traces the NLR gas. These data reveal a mixture of origins for the double-peaked feature. Roughly 10% of our objects are best explained by binary AGNs at (projected) kpc-scale separations, where two stellar components with spatially coincident NLRs are seen. ~50% of our objects have [O III] emission offset by a few kpc, corresponding to the two velocity components seen in the SDSS spectra, but there are no spatially coincident double stellar components seen in the NIR imaging. For those objects with sufficiently high-quality slit spectra, we see velocity and/or velocity dispersion gradients in [O III] emission, suggestive of the kinematic signatures of a single NLR. The remaining ~40% of our objects are ambiguous and will need higher spatial resolution observations to distinguish between the two scenarios. Our observations therefore favor the kinematics scenario with a single AGN for the majority of these double-peaked [O III] type 2 AGNs. We emphasize the importance of combining imaging and slit spectroscopy in identifying kpc-scale binary AGNs, i.e., in no cases does one of these alone allow an unambiguous identification. We estimate that ~0.5%-2.5% of the z ~ 150 km s-1. Based in part on observations obtained with the 6.5 m Magellan telescopes located at Las Campanas Observatory, Chile, and with the Apache Point Observatory 3.5 m telescope, which is owned and operated by the Astrophysical Research

  9. Integral Field Spectroscopy of Balmer-dominated Shocks in the Magellanic Cloud Supernova Remnant N103B

    Energy Technology Data Exchange (ETDEWEB)

    Ghavamian, Parviz [Department of Physics, Astronomy and Geosciences, Towson University, Towson, MD 21252 (United States); Seitenzahl, Ivo R.; Dopita, M. A. [Research School of Astronomy and Astrophysics, Australian National University, Canberra, ACT 2611 (Australia); Vogt, Frédéric P. A. [European Southern Observatory, Av. Alonso de Córdova 3107, 763 0355 Vitacura, Santiago (Chile); Terry, Jason P. [Department of Physics and Astronomy, University of Georgia (United States); Williams, Brian J. [NASA Goddard Space Flight Center, Greenbelt, MD 20771 (United States); Winkler, P. Frank, E-mail: pghavamian@towson.edu [Department of Physics, Middlebury College, Middlebury, VT 05753 (United States)

    2017-10-01

    We present results of integral field spectroscopy of Balmer-dominated shocks in the LMC supernova remnant (SNR) N103B, carried out using the Wide Field Integral Spectrograph (WiFeS ) on the 2.3 m telescope at the Siding Spring Observatory in Australia. Existing X-ray studies of N103B have indicated an SN Ia origin. Radiative shock emission from clumpy material surrounding the SNR may result from interaction of the forward shock with relic stellar wind material, possibly implicating a thermonuclear explosion in a single-degenerate binary system. The recently discovered Balmer-dominated shocks mark the impact of the forward shock with low density, partially neutral CSM gas, and form a partial shell encircling clumps of material exhibiting radiative shocks. The WiFeS spectra of N103B reveal broad H α emission having a width as high as 2350 km s{sup −1} along the northern rim, and both H α and H β broad profiles having widths around 1300 km s{sup −1} along the southern rim. Fits to the H α line profiles indicate that in addition to the usual broad and narrow emission components, a third component of intermediate width exists in these Balmer-dominated shocks, ranging from around 125 km s{sup −1} up to 225 km s{sup −1} in width. This is consistent with predictions of recent Balmer-dominated shock models, which predict that an intermediate-width component will be generated in a fast neutral precursor. We derive a Sedov age of approximately 685 ± 20 years for N103B from the Balmer-dominated spectra, consistent with the young age of 380–860 years estimated from light echo studies.

  10. Black Hole Mass Estimation in Type 1 AGN: Hβ vs. Mg II Lines and the Role of Balmer Continuum

    Energy Technology Data Exchange (ETDEWEB)

    Kovačević-Dojčinović, Jelena [Astronomical Observatory, Belgrade (Serbia); Marčeta-Mandić, Sladjana; Popović, Luka Č., E-mail: sladjana@aob.rs [Astronomical Observatory, Belgrade (Serbia); Department of Astronomy, Faculty of Mathematics, University of Belgrade, Belgrade (Serbia)

    2017-07-24

    Here we investigate the Hβ and Mg II spectral line parameters used for the black hole mass (M{sub BH}) estimation for a sample of Type 1 Active Galactic Nuclei (AGN) spectra selected from the Sloan Digital Sky Survey (SDSS) database. We have analyzed and compared the virialization of the Hβ and Mg II emission lines, and found that the Hβ line is more confident virial estimator than Mg II. We have investigated the influence of the Balmer continuum emission to the M{sub BH} estimation from the UV parameters, and found that the Balmer continuum emission can contribute to the overestimation of the M{sub BH} on average for ~5% (up to 10%).

  11. Hydrogen Balmer Line Broadening in Solar and Stellar Flares

    Energy Technology Data Exchange (ETDEWEB)

    Kowalski, Adam F. [Department of Astrophysical and Planetary Sciences, University of Colorado Boulder, 2000 Colorado Avenue, Boulder, CO 80305 (United States); Allred, Joel C. [NASA/Goddard Space Flight Center, Code 671, Greenbelt, MD 20771 (United States); Uitenbroek, Han [National Solar Observatory, University of Colorado Boulder, 3665 Discovery Drive, Boulder, CO 80303 (United States); Tremblay, Pier-Emmanuel [Department of Physics, University of Warwick, Coventry CV47AL (United Kingdom); Brown, Stephen [School of Physics and Astronomy, Kelvin Building, University of Glasgow, G12 8QQ (United Kingdom); Carlsson, Mats [Institute of Theoretical Astrophysics, University of Oslo, P.O. Box 1029 Blindern, NO-0315 Oslo (Norway); Osten, Rachel A. [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Wisniewski, John P. [Homer L. Dodge Department of Physics and Astronomy, University of Oklahoma, 440 W. Brooks Street, Norman, OK 73019 (United States); Hawley, Suzanne L., E-mail: Adam.Kowalski@lasp.colorado.edu [University of Washington Department of Astronomy, 3910 15th Avenue NE, Seattle, WA 98195 (United States)

    2017-03-10

    The broadening of the hydrogen lines during flares is thought to result from increased charge (electron, proton) density in the flare chromosphere. However, disagreements between theory and modeling prescriptions have precluded an accurate diagnostic of the degree of ionization and compression resulting from flare heating in the chromosphere. To resolve this issue, we have incorporated the unified theory of electric pressure broadening of the hydrogen lines into the non-LTE radiative-transfer code RH. This broadening prescription produces a much more realistic spectrum of the quiescent, A0 star Vega compared to the analytic approximations used as a damping parameter in the Voigt profiles. We test recent radiative-hydrodynamic (RHD) simulations of the atmospheric response to high nonthermal electron beam fluxes with the new broadening prescription and find that the Balmer lines are overbroadened at the densest times in the simulations. Adding many simultaneously heated and cooling model loops as a “multithread” model improves the agreement with the observations. We revisit the three-component phenomenological flare model of the YZ CMi Megaflare using recent and new RHD models. The evolution of the broadening, line flux ratios, and continuum flux ratios are well-reproduced by a multithread model with high-flux nonthermal electron beam heating, an extended decay phase model, and a “hot spot” atmosphere heated by an ultrarelativistic electron beam with reasonable filling factors: ∼0.1%, 1%, and 0.1% of the visible stellar hemisphere, respectively. The new modeling motivates future work to understand the origin of the extended gradual phase emission.

  12. Hydrogen Balmer Line Broadening in Solar and Stellar Flares

    International Nuclear Information System (INIS)

    Kowalski, Adam F.; Allred, Joel C.; Uitenbroek, Han; Tremblay, Pier-Emmanuel; Brown, Stephen; Carlsson, Mats; Osten, Rachel A.; Wisniewski, John P.; Hawley, Suzanne L.

    2017-01-01

    The broadening of the hydrogen lines during flares is thought to result from increased charge (electron, proton) density in the flare chromosphere. However, disagreements between theory and modeling prescriptions have precluded an accurate diagnostic of the degree of ionization and compression resulting from flare heating in the chromosphere. To resolve this issue, we have incorporated the unified theory of electric pressure broadening of the hydrogen lines into the non-LTE radiative-transfer code RH. This broadening prescription produces a much more realistic spectrum of the quiescent, A0 star Vega compared to the analytic approximations used as a damping parameter in the Voigt profiles. We test recent radiative-hydrodynamic (RHD) simulations of the atmospheric response to high nonthermal electron beam fluxes with the new broadening prescription and find that the Balmer lines are overbroadened at the densest times in the simulations. Adding many simultaneously heated and cooling model loops as a “multithread” model improves the agreement with the observations. We revisit the three-component phenomenological flare model of the YZ CMi Megaflare using recent and new RHD models. The evolution of the broadening, line flux ratios, and continuum flux ratios are well-reproduced by a multithread model with high-flux nonthermal electron beam heating, an extended decay phase model, and a “hot spot” atmosphere heated by an ultrarelativistic electron beam with reasonable filling factors: ∼0.1%, 1%, and 0.1% of the visible stellar hemisphere, respectively. The new modeling motivates future work to understand the origin of the extended gradual phase emission.

  13. Performance test of Spectran-F and Spectran-III computer programs for resolving the 137Cs-110Ag double peak in gamma-ray spectrometric analysis

    International Nuclear Information System (INIS)

    Terada, H.; Malinowski, J.; Blick, H.

    1981-09-01

    The performance of the computer programs (Spectran F and Spectran-III) in resolving the 137 Cs-sup(110m)Ag double peak at 661.6-657.7 keV in the gamma-ray spectrum was investigated. In the experiments, the intensity ratios of both lines in the double peak were varied from 0.1 to 60. The results obtained show, that both programs have almost the same performance in resolving the double peak investigated, with slight superiority of Spectran-F. If accuracy better than 5% is desired, the peak intensity ratio in the dublet must be kept below 10. (orig.)

  14. Source of the violet depression in carbon stars (a study of the Balmer decrement in carbon L.P.V.s)

    International Nuclear Information System (INIS)

    Orlati, M.A.

    1985-01-01

    In an effort to determine the nature of the agent(s) of the violet depression in N-type stars through the behavior of their Balmer decrement, slit spectrograms of two C, one CS, two S (all reported to have the violet depression) and one M type LPVs were repeatedly taken between May 1983 and November 1984. The observed phase related changes in the Balmer decrement exclude the possibility that the absorbers are circumstellar because the emission region in the best-observed star is seen to rise through the opacity source. The exact nature and number of kinds of absorbers remains to be determined

  15. Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines.

    Science.gov (United States)

    Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G

    2017-07-19

    Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

  16. CCD observations of the spatial structure of the hydrogen Balmer-alpha (Hα) diffuse galactic background

    International Nuclear Information System (INIS)

    Brinkmann, J.V.

    1987-01-01

    Images of hydrogen Balmer alpha emission were obtained in the galactic plane at the Orion arm rest velocity at longitudes of 66, 96, and 114 0 and at the Perseus arm velocity at 114 0 . These directions were chosen because of their lack of birth nebular emission and their high [Sll]6731/Hα ratio, a characteristic of the faint galactic emission-line background. The narrow band (0.26A) images were obtained during June and August 1985, and June 1986, with a newly-constructed RCA SID501DX CCD camera used with the existing 15-cm Fabry-Perot spectrometer at the Physical Sciences Laboratory of the University of Wisconsin, Madison. The field of view was 0. 0 75, with each binned pixel covering about two arc minutes. All images show a significant variation in detected Hα emission at the third-of-half-degree scale. The emission intensity varies by a factor of two over each field of view. Comparison of Orion arm and Perseus arm results indicates extinction is the most-likely cause of the observed spatial structure but star counts taken from the blue plate of Palomar Sky Survey show little spatial correlation with the α emission. This dilemma may be resolved by further investigations using IRAS images, which were not available in time for inclusion in this thesis

  17. Double peak-induced distance error in short-time-Fourier-transform-Brillouin optical time domain reflectometers event detection and the recovery method.

    Science.gov (United States)

    Yu, Yifei; Luo, Linqing; Li, Bo; Guo, Linfeng; Yan, Jize; Soga, Kenichi

    2015-10-01

    The measured distance error caused by double peaks in the BOTDRs (Brillouin optical time domain reflectometers) system is a kind of Brillouin scattering spectrum (BSS) deformation, discussed and simulated for the first time in the paper, to the best of the authors' knowledge. Double peak, as a kind of Brillouin spectrum deformation, is important in the enhancement of spatial resolution, measurement accuracy, and crack detection. Due to the variances of the peak powers of the BSS along the fiber, the measured starting point of a step-shape frequency transition region is shifted and results in distance errors. Zero-padded short-time-Fourier-transform (STFT) can restore the transition-induced double peaks in the asymmetric and deformed BSS, thus offering more accurate and quicker measurements than the conventional Lorentz-fitting method. The recovering method based on the double-peak detection and corresponding BSS deformation can be applied to calculate the real starting point, which can improve the distance accuracy of the STFT-based BOTDR system.

  18. The influence of static fields on the dynamic Stark spectra of hydrogen Balmer lines

    International Nuclear Information System (INIS)

    Janssen, G.C.A.M.; Jayakumar, R.; Granneman, E.H.A.

    1981-01-01

    In plasmas atomic-line radiation is influenced by static and high frequency fields. A simple method of calculating the Stark profiles of the Balmer α and β lines for the case of one-dimensional fields is discussed. Using a Holtsmark field for the static component, the resulting profile of Balmer α shows a splitting of the satellites. (author)

  19. The relation of double peaks, observed in quartz hydride atomizers, to the fate of free analyte atoms in the determination of arsenic and selenium by atomic absorption spectrometry

    International Nuclear Information System (INIS)

    D'Ulivo, Alessandro; Dedina, Jiri

    2002-01-01

    The mechanism at the origin of double peaks formation in quartz hydride atomizers were investigated by continuous flow hydride generation atomic absorption spectrometry. Arsenic and selenium were used as model analytes. The effect of atomization mode (flame-in-gas-shield (FIGS), miniature diffusion flame and double flame (DF)) and some experimental parameters as oxygen supply rate for microflame and the distance from atomization to free atoms detection point, were investigated on the shape of both analytical signals and calibration graphs. Rollover of calibration graphs and double peak formation are strictly related each to the other and could be observed only in FIGS atomizer mode under some particular conditions. A mechanism based on incomplete atomization of hydrides cannot explain the collected experimental evidences because the microflame of FIGS is able to produce quantitative atomization of large amount of hydrides even at supply rate of oxygen close to extinction threshold of microflame. The heterogeneous gas-solid reactions between finely dispersed particles, formed by free atom recombination, and the free atoms in the gaseous phase are at the origin of double peak formation

  20. Balmer line diagnostic of electron heating at collisionless shocks in supernova remnants

    International Nuclear Information System (INIS)

    Rakowski, C.

    2008-01-01

    The mechanism and extent of electron heating at collisionless shocks has recently been under intense investigation. H α Balmer line emission is excited immediately behind the shock front and provides the best diagnostic for the electron to proton temperature ratio at supernova remnant shocks. Two components of emission are produced, a narrow component from electron and proton impact excitation of cold neutrals, and a broad component produced through charge exchange between the cold neutrals and the shock heated protons. Thus the broad and narrow component fluxes reflect the competition between electron and proton impact ionization, electron and proton impact excitation and charge exchange. This diagnostic has led to the discovery of an approximate inverse square relationship between the electron to proton temperature ratio and the shock velocity. In turn, this implies a constant level of electron heating, independent of shock speed above ∼ 450 km/s. In this talk I will present the observational evidence to date. Time permitting, I will introduce how lower-hybrid waves in an extended cosmic ray precursor could explain such a relationship, and how this and other parameters in the H α profile might relate to properties of cosmic rays and magnetic field amplification ahead of the shock. (author)

  1. Relationship between the intensity of nonthermal radiation and widths of Balmer lines in the spectra of quasar-like nuclei

    International Nuclear Information System (INIS)

    Komberg, B.V.; Shefer, E.Yu.

    1983-01-01

    The data summarized by Steiner (1981) were used to derive the relationship between the intensity of nonthermal X-ray and radio emission and fullwidths of Balmer emission lines. It is shown that the existence of such dependences does not contradict the assumption on partition equidistribution of nonthermal radiation and motion of gas clouds energy in the region of formation of wide lines. Emphasis is given to similar dependence drived by Vayana (1981) for X-ray radiation from hot coronas of fast-rotating single stars, and a suggestion is made about radiation anisotropy from active nuclei (similar to that observed in the SS 433 system). The latter may imply the double nature of active nuclei

  2. A measurement of deuterium neutral by the Balmer-series in the STP-2 high beta screw pinch tokamak

    International Nuclear Information System (INIS)

    Yamaguchi, S.; Hirano, K.

    1980-06-01

    The Balmer-alpha and beta are measured with a calibrated spectrograph in STP-2 screw pinch tokamak operated under the maximum toroidal field being 9.2 kG, peak plasma current 30 kA and filling pressure 5 mtorr. The electron temperature and density profiles are obtained by ruby laser Thomson scattering. It is shown that electron temperature is about 10 eV and density is of the order of 10 14 /cm 3 . A non-cylindrical symmetric Abel-inversion technique is used to deduce the emission coefficient profiles from that of the line intensity of the Balmer's. In the present parameter range the neutral deuterium density is almost equal to the population density of the ground state, so that it is obtainable from measured intensities of D sub(α) and D sub(β) which give the population densities of the upper levels i = 3 and 4. The Collisional Radiative (CR) model is applied to the rate equations to estimate the ground state population density. It is found that at 4 μsec from the start of the discharge the deuterium neutral density may be approximately 2 x 10 12 /cm 3 at the center of plasma and 2 x 10 14 /cm 3 at the periphery. These values may contain an error of about factor two. Time history of neutral deuterium density is consistent with the increase of plasma density. (author)

  3. Hydrogen Balmer alpha intensity distributions and line profiles from multiple scattering theory using realistic geocoronal models

    Science.gov (United States)

    Anderson, D. E., Jr.; Meier, R. R.; Hodges, R. R., Jr.; Tinsley, B. A.

    1987-01-01

    The H Balmer alpha nightglow is investigated by using Monte Carlo models of asymmetric geocoronal atomic hydrogen distributions as input to a radiative transfer model of solar Lyman-beta radiation in the thermosphere and atmosphere. It is shown that it is essential to include multiple scattering of Lyman-beta radiation in the interpretation of Balmer alpha airglow data. Observations of diurnal variation in the Balmer alpha airglow showing slightly greater intensities in the morning relative to evening are consistent with theory. No evidence is found for anything other than a single sinusoidal diurnal variation of exobase density. Dramatic changes in effective temperature derived from the observed Balmer alpha line profiles are expected on the basis of changing illumination conditions in the thermosphere and exosphere as different regions of the sky are scanned.

  4. Nebular dust and extinction in ionized nebulae i.. the Balmer decrement

    International Nuclear Information System (INIS)

    Mathis, J.S.

    1983-01-01

    Many astronomical objects contain plasma with internal or surrounding dust. The extinction of H II regions can be determined from the H#betta#/Hα flux ratio, and also from the H#betta#/radio fluxes. The two determinations almost always disagree by large factors (typically, approx.3), with the (H#betta#/Hα) extinction being smaller. This is shown to be a consequence of the albedo of dust at Hα being smaller than that of H#betta#, so that the destruction of Hα by dust is larger than for constant albedo. If the difference in albedo is ignored, one interprets the lower Hα flux as being caused by a small optical depth in dust. Simple models for the geometry of the dust and emitting gas are discussed: spherical models with dust mixed with the ionized gas, and also a slab of absorbing dust overlying the nebula. The two geometries give similar results for the Balmer decrements, so geometry does not strongly enter the final results. The conclusion that albedo (Hα) 8000 A). Recommendations for dereddening emission-line objects are presented and should be applicable to planetary nebulae, active galactic nuclei, or quasi-stellar objects as well as to H II regions

  5. New value for the Rydberg constant by precision measurement of the hydrogen Balmer-β transition

    International Nuclear Information System (INIS)

    Zhao, P.

    1986-01-01

    The Rydberg constant R is determined to a very high accuracy of 3 parts in 10 10 by a direct comparison of the four hydrogen and deuterium Balmer-β transitions with a standard laser from the National Bureau of Standards. This experiment is now the most precise measurement for R and approaches the limits of accuracy for wavelength or frequency measurements in the visible region. The result is R = 109 737.315 73 (3) cm -1 with the definition of the meter: c = 299 792 458 m/sec. The experiment also yields the following results: the fine-structure splittings 4P/sub 1/2/ ↔ 4P/sub 3/2 in H: 1370.9 (3) MHz and in D: 1371.8(3) MHZ. The isotope shifts between H and D in the transitions 2S/sub 1/2/ ↔ 4P/sub 1/2/: 167 752.4(3) MHz and 2S/sub 1/2/ ↔ 4P/sub 3/2/ : 167 753.3 (3) MHz. The experiment utilizes atomic beam laser spectroscopy. A beam of atomic hydrogen (or deuterium) is excited by electron bombardment to the metastable 2S/sub 1/2/ state and is detected by a secondary electron emission detector. A chopped cw dye laser beam crosses the atomic beam at an angle of 90 0 to eliminate Doppler broadening. The metastables are quenched by laser excitation to 4P/sub 1/2/ or 4P/sub 3/2/ states. The signal is monitored by a lock-in amplifier with the chopper as reference

  6. BLACK HOLE MASS ESTIMATES BASED ON C IV ARE CONSISTENT WITH THOSE BASED ON THE BALMER LINES

    Energy Technology Data Exchange (ETDEWEB)

    Assef, R. J.; Denney, K. D.; Kochanek, C. S.; Peterson, B. M.; Kozlowski, S.; Dietrich, M.; Grier, C. J.; Khan, R. [Department of Astronomy, The Ohio State University, 140 W. 18th Ave., Columbus, OH 43210 (United States); Ageorges, N.; Buschkamp, P.; Gemperlein, H.; Hofmann, R. [Max-Planck-Institut fuer Extraterrestrische Physik, Giessenbachstr., D-85748 Garching (Germany); Barrows, R. S. [Arkansas Center for Space and Planetary Sciences, University of Arkansas, Fayetteville, AR 72701 (United States); Falco, E.; Kilic, M. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Feiz, C.; Germeroth, A. [Landessternwarte, ZAH, Koenigstuhl 12, D-69117 Heidelberg (Germany); Juette, M.; Knierim, V. [Astron. Institut der Ruhr Univ. Bochum, Universitaetsstr. 150, D-44780 Bochum (Germany); Laun, W., E-mail: rjassef@astronomy.ohio-state.edu [Max-Planck-Institut fuer Astronomie, Koenigstuhl 17, D-69117 Heidelberg (Germany); and others

    2011-12-01

    Using a sample of high-redshift lensed quasars from the CASTLES project with observed-frame ultraviolet or optical and near-infrared spectra, we have searched for possible biases between supermassive black hole (BH) mass estimates based on the C IV, H{alpha}, and H{beta} broad emission lines. Our sample is based upon that of Greene, Peng, and Ludwig, expanded with new near-IR spectroscopic observations, consistently analyzed high signal-to-noise ratio (S/N) optical spectra, and consistent continuum luminosity estimates at 5100 A. We find that BH mass estimates based on the full width at half-maximum (FWHM) of C IV show a systematic offset with respect to those obtained from the line dispersion, {sigma}{sub l}, of the same emission line, but not with those obtained from the FWHM of H{alpha} and H{beta}. The magnitude of the offset depends on the treatment of the He II and Fe II emission blended with C IV, but there is little scatter for any fixed measurement prescription. While we otherwise find no systematic offsets between C IV and Balmer line mass estimates, we do find that the residuals between them are strongly correlated with the ratio of the UV and optical continuum luminosities. This means that much of the dispersion in previous comparisons of C IV and H{beta} BH mass estimates are due to the continuum luminosities rather than to any properties of the lines. Removing this dependency reduces the scatter between the UV- and optical-based BH mass estimates by a factor of approximately two, from roughly 0.35 to 0.18 dex. The dispersion is smallest when comparing the C IV {sigma}{sub l} mass estimate, after removing the offset from the FWHM estimates, and either Balmer line mass estimate. The correlation with the continuum slope is likely due to a combination of reddening, host contamination, and object-dependent SED shapes. When we add additional heterogeneous measurements from the literature, the results are unchanged. Moreover, in a trial observation of a

  7. PTF11mnb: First analog of supernova 2005bf. Long-rising, double-peaked supernova Ic from a massive progenitor

    Science.gov (United States)

    Taddia, F.; Sollerman, J.; Fremling, C.; Karamehmetoglu, E.; Quimby, R. M.; Gal-Yam, A.; Yaron, O.; Kasliwal, M. M.; Kulkarni, S. R.; Nugent, P. E.; Smadja, G.; Tao, C.

    2018-01-01

    Aims: We study PTF11mnb, a He-poor supernova (SN) whose light curves resemble those of SN 2005bf, a peculiar double-peaked stripped-envelope (SE) SN, until the declining phase after the main peak. We investigate the mechanism powering its light curve and the nature of its progenitor star. Methods: Optical photometry and spectroscopy of PTF11mnb are presented. We compared light curves, colors and spectral properties to those of SN 2005bf and normal SE SNe. We built a bolometric light curve and modeled this light curve with the SuperNova Explosion Code (SNEC) hydrodynamical code explosion of a MESA progenitor star and semi-analytic models. Results: The light curve of PTF11mnb turns out to be similar to that of SN 2005bf until 50 d when the main (secondary) peaks occur at -18.5 mag. The early peak occurs at 20 d and is about 1.0 mag fainter. After the main peak, the decline rate of PTF11mnb is remarkably slower than what was observed in SN 2005bf, and it traces well the 56Co decay rate. The spectra of PTF11mnb reveal a SN Ic and have no traces of He unlike in the case of SN Ib 2005bf, although they have velocities comparable to those of SN 2005bf. The whole evolution of the bolometric light curve is well reproduced by the explosion of a massive (Mej = 7.8 M⊙), He-poor star characterized by a double-peaked 56Ni distribution, a total 56Ni mass of 0.59 M⊙, and an explosion energy of 2.2 × 1051 erg. Alternatively, a normal SN Ib/c explosion (M(56Ni) = 0.11 M⊙, EK = 0.2 × 1051 erg, Mej = 1 M⊙) can power the first peak while a magnetar, with a magnetic field characterized by B = 5.0 × 1014 G, and a rotation period of P = 18.1 ms, provides energy for the main peak. The early g-band light curve can be fit with a shock-breakout cooling tail or an extended envelope model from which a radius of at least 30 R⊙ is obtained. Conclusions: We presented a scenario where PTF11mnb was the explosion of a massive, He-poor star, characterized by a double-peaked 56Ni

  8. Discovery of Variable Hydrogen Balmer Absorption Lines with Inverse Decrement in PG 1411+442

    Energy Technology Data Exchange (ETDEWEB)

    Shi, Xi-Heng; Pan, Xiang; Zhang, Shao-Hua; Sun, Lu-Ming; Ji, Tuo; Liu, Bo; Zhou, Hong-Yan [Polar Research Institute of China, Jinqiao Road 451, Shanghai 200136 (China); Wang, Jian-Guo [Yunnan Observatories, Chinese Academy of Sciences, Kunming, Yunnan 650011 (China); Yang, Chen-Wei; Jiang, Ning, E-mail: zhouhongyan@pric.org.cn, E-mail: shixiheng@pric.org.cn [Key Laboratory for Research in Galaxies and Cosmology, Department of Astronomy, University of Science and Technology of China, Chinese Academy of Sciences, Hefei, Anhui 230026 (China)

    2017-07-01

    We present new optical spectra of the well-known broad absorption line (BAL) quasar PG 1411+442, using the DBSP spectrograph at the Palomar 200 inch telescope in 2014 and 2017 and the YFOSC spectrograph at the Lijiang 2.4 m telescope in 2015. A blueshifted narrow absorption line system is clearly revealed in 2014 and 2015 consisting of hydrogen Balmer series and metastable He i lines. The velocity of these lines is similar to the centroid velocity of the UV BALs, suggesting that both originate from the outflow. The Balmer lines vary significantly between the two observations and vanished in 2017. They were also absent in the archived spectra obtained before 2001. The variation is thought to be driven by photoionization change. Besides, the absorption lines show inversed Balmer decrement, i.e., the apparent optical depths of higher-order Balmer absorption lines are larger than those of lower-order lines, which is inconsistent with the oscillator strengths of the transitions. We suggest that such anomalous line ratios can be naturally explained by the thermal structure of a background accretion disk, which allows the obscured part of the disk to contribute differently to the continuum flux at different wavelengths. High-resolution spectroscopic and photometric monitoring would be very useful to probe the structure of the accretion disk as well as the geometry and physical conditions of the outflow.

  9. Evidence of a double peak in muscle activation to enhance strike speed and force: an example with elite mixed martial arts fighters.

    Science.gov (United States)

    McGill, Stuart M; Chaimberg, Jon D; Frost, David M; Fenwick, Chad M J

    2010-02-01

    The main issue addressed here is the paradox of muscle contraction to optimize speed and strike force. When muscle contracts, it increases in both force and stiffness. Force creates faster movement, but the corresponding stiffness slows the change of muscle shape and joint velocity. The purpose of this study was to investigate how this speed strength is accomplished. Five elite mixed martial arts athletes were recruited given that they must create high strike force very quickly. Muscle activation using electromyography and 3-dimensional spine motion was measured. A variety of strikes were performed. Many of the strikes intend to create fast motion and finish with a very large striking force, demonstrating a "double peak" of muscle activity. An initial peak was timed with the initiation of motion presumably to enhance stiffness and stability through the body before motion. This appeared to create an inertial mass in the large "core" for limb muscles to "pry" against to initiate limb motion. Then, some muscles underwent a relaxation phase as speed of limb motion increased. A second peak was observed upon contact with the opponent (heavy bag). It was postulated that this would increase stiffness through the body linkage, resulting in a higher effective mass behind the strike and likely a higher strike force. Observation of the contract-relax-contract pulsing cycle during forceful and quick strikes suggests that it may be fruitful to consider pulse training that involves not only the rate of muscle contraction but also the rate of muscle relaxation.

  10. Detecting cm-scale hot spot over 24-km-long single-mode fiber by using differential pulse pair BOTDA based on double-peak spectrum.

    Science.gov (United States)

    Diakaridia, Sanogo; Pan, Yue; Xu, Pengbai; Zhou, Dengwang; Wang, Benzhang; Teng, Lei; Lu, Zhiwei; Ba, Dexin; Dong, Yongkang

    2017-07-24

    In distributed Brillouin optical fiber sensor when the length of the perturbation to be detected is much smaller than the spatial resolution that is defined by the pulse width, the measured Brillouin gain spectrum (BGS) experiences two or multiple peaks. In this work, we propose and demonstrate a technique using differential pulse pair Brillouin optical time-domain analysis (DPP-BOTDA) based on double-peak BGS to enhance small-scale events detection capability, where two types of single mode fiber (main fiber and secondary fiber) with 116 MHz Brillouin frequency shift (BFS) difference have been used. We have realized detection of a 5-cm hot spot at the far end of 24-km single mode fiber by employing a 50-cm spatial resolution DPP-BOTDA with only 1GS/s sampling rate (corresponding to 10 cm/point). The BFS at the far end of 24-km sensing fiber has been measured with 0.54 MHz standard deviation which corresponds to a 0.5°C temperature accuracy. This technique is simple and cost effective because it is implemented using the similar experimental setup of the standard BOTDA, however, it should be noted that the consecutive small-scale events have to be separated by a minimum length corresponding to the spatial resolution defined by the pulse width difference.

  11. New Observations of Balmer Continuum Flux in Solar Flares Instrument Description and First Results

    Czech Academy of Sciences Publication Activity Database

    Kotrč, Pavel; Procházka, O.; Heinzel, Petr

    2016-01-01

    Roč. 291, č. 3 (2016), s. 779-789 ISSN 0038-0938 R&D Projects: GA ČR GAP209/12/1652 Grant - others:EC(XE) 295272; EC(XE) 606862 Program:FP7; FP7 Institutional support: RVO:67985815 Keywords : flares * spectrum * Balmer continuum Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 2.682, year: 2016

  12. Measuring the electron density in plasmas from the difference of Lorentzian part of the widths of two Balmer series hydrogen lines

    Energy Technology Data Exchange (ETDEWEB)

    Yubero, C. [Grupo de Física de Plasmas: Diagnosis, Modelos y Aplicaciones (FQM-136), Edificio A. Einstein (C-2), Campus de Rabanales, Universidad de Córdoba, 14071 Córdoba (Spain); García, M.C., E-mail: fa1gamam@uco.es [Grupo de Física de Plasmas: Diagnosis, Modelos y Aplicaciones (FQM-136), Edificio A. Einstein (C-2), Campus de Rabanales, Universidad de Córdoba, 14071 Córdoba (Spain); Dimitrijevic, M.S. [Astronomical Observatory, Volgina 7, 11060 Belgrade (Serbia); Sola, A.; Gamero, A. [Grupo de Física de Plasmas: Diagnosis, Modelos y Aplicaciones (FQM-136), Edificio A. Einstein (C-2), Campus de Rabanales, Universidad de Córdoba, 14071 Córdoba (Spain)

    2015-05-01

    We present an alternative optical emission spectroscopy method to measure the plasma electron density from the difference of widths of two Balmer series hydrogen lines (H{sub α} and H{sub β}), especially convenient for non-thermal plasmas since with this method, there is no need to know either the gas temperature or the van der Waals contribution to the Lorentzian part of the line. In this paper it has been assumed that the part of full width at half maximum due to Stark broadening can be determined with the approximation of Lorentzian line shape. The method has been applied to the determination of the electron density in an argon microwave-induced plasma maintained at atmospheric pressure, and comparison with the results obtained using other diagnostic methods has been done. - Highlights: • An alternative method to measure the electron density in plasmas from two Balmer series hydrogen lines (H{sub α} and H{sub β}) is presented. • The method is very convenient for plasmas with electron densities of the order of 10{sup 14} cm{sup −3} and above, at low gas temperatures. • It has been applied to the determination of the electron density of an argon microwave plasma at atmospheric pressure. • Results from it are in good agreement with previous ones obtained using other diagnostic methods.

  13. Near ultraviolet spectra of a group of early-type stars with Balmer emission

    International Nuclear Information System (INIS)

    Ringuelet, A.E.

    1980-01-01

    In the near ultraviolet region some absorption features in B stars are easily recognizable as criteria for assigning luminosity class. In the same region the characteristics displayed by Be stars suggest higher luminosities than in the photographic region. It appears that Fe II 2538-2548 A should be useful for studying the outer layers of stellar atmospheres. (author)

  14. Near ultraviolet spectra of a group of early-type stars with Balmer emission

    Energy Technology Data Exchange (ETDEWEB)

    Ringuelet, A E [Instituto de Astronomia y Fisica del Espacio, Buenos Aires (Argentina)

    1980-08-01

    In the near ultraviolet region some absorption features in B stars are easily recognizable as criteria for assigning luminosity class. In the same region the characteristics displayed by Be stars suggest higher luminosities than in the photographic region. It appears that Fe II 2538-2548 A should be useful for studying the outer layers of stellar atmospheres.

  15. Cross sections for Balmer-α excitation in heavy particle collisions

    International Nuclear Information System (INIS)

    Bae, Y.K.

    1982-01-01

    Doppler shifted and unshifted Balmer-α radiation has been observed in the absolute sense for energetic H + , H 2 + and H 3 + ions incident on molecular hydrogen by the method of decay inside the target within the energy range of 20 keV to 150 keV. Most of the measurements were based on single-collision conditions, but a simple thick-target experiment has been tried for the case of dissociative excitation of the target molecules by H atoms. The Balmer-α radiation emitted by hydrogen and deuterium beams has been used as a diagnostic method of neutral beam parameters. One important neutral beam parameter is the species mix between H + , H 2 + and H 3 + ion currents produced by the ion source and accelerator. This species mix can be resolved by analysis of the Balmer-α radiation if the beam is observed along an off normal axis with sufficient spectral resolution to separate the Doppler shifted radiation components from each other. An impediment to this approach to measuring the ion species is that some of the required cross sections have not been measured. This is the motivation for the presented experimental work. A home made monochromator gave enough optical throughput and spectral resolution for separation of the Doppler shifted lines from the unshifted lines. By selectively varying the target pressure and the distance of travel into the target prior to the observation region, excitation cross sections for three different angular momentum states (3s, 3p and 3d) have been determined. Combinations of a linear polarizer and a half-wave plate were used for polarization measurement

  16. Cross Sections for Balmer-Alpha Excitation in Heavy Particle Collisions.

    Science.gov (United States)

    Bae, Young Kun

    Doppler shifted and unshifted Balmer-alpha radiation has been observed in the absolute sense for energetic H('+), H(,2)('+) and H(,3)('+) ions incident on molecular hydrogen by the method of decay inside the target within the energy range of 20 keV to 150 keV. Most of the measurements were based on single-collision conditions, but a simple thick -target experiment has been tried for the case of dissociative excitation of the target molecules by H atoms. The Balmer-alpha radiation emitted by hydrogen and deuterium beams has been used as a diagnostic method of neutral beam parameters. One important neutral beam parameter is the species mix between H('+), H(,2)('+) and H(,3)('+) ion currents produced by the ion source and accelerator. This species mix can be resolved by analysis of the Balmer-alpha radiation if the beam is observed along an off normal axis with sufficient spectral resolution to separate the Doppler shifted radiation components from each other. An impediment to this approach to measuring the ion species is that some of the required cross sections have not been measured. This is the motivation for the presented experimental work. A home made monochromator gave enough optical throughput and spectral resolution for separation of the Doppler shifted lines from the unshifted lines. By selectively varying the target pressure and the distance of travel into the target prior to the observation region, excitation cross sections for three different angular momentum states (3s, 3p and 3d) have been determined. Combinations of a linear polarizer and a half-wave plate were used for polarization measurement. Separation of the individual Zeeman levels have been tried for the 3p state from the information obtained from the polarization. Theoretical estimates of the cascading corrections have been applied in the case of both thin and thick targets. The intensity development equations for thick targets also have been derived. Cross sections for 3s production show

  17. PRESSURE SHIFT AND GRAVITATIONAL REDSHIFT OF BALMER LINES IN WHITE DWARFS: REDISCUSSION

    Energy Technology Data Exchange (ETDEWEB)

    Halenka, Jacek; Olchawa, Wieslaw [Institute of Physics, University of Opole, ul. Oleska 48, 45-052, Opole (Poland); Madej, Jerzy [Astronomical Observatory, University of Warsaw, Al. Ujazdowskie 4, 00-478 Warszawa (Poland); Grabowski, Boleslaw, E-mail: halenka@uni.opole.pl, E-mail: wolch@uni.opole.pl, E-mail: jm@astrouw.edu.pl, E-mail: bgrab@uni.opole.pl [Wroclaw School of Information Technology WWSIS “Horyzont,” ul. Wejherowska 28, 54-239 Wroclaw (Poland)

    2015-08-01

    The Stark-induced shift and asymmetry, the so-called pressure shift (PS) of H{sub α} and H{sub β} Balmer lines in spectra of DA white dwarfs (WDs), have been examined in detail as masking effects in measurements of the gravitational redshift in WDs. The results are compared with our earlier ones from a quarter of a century ago. In these earlier papers, the standard, symmetrical Stark line profiles, as a dominant constituent of the Balmer line profiles but shifted as a whole by the PS effect, were applied to all spectrally active layers of the WD atmosphere. At present, in each of the WD layers, the Stark line profiles (especially of H{sub β}) are inherently asymmetrical and shifted due to the effects of strong inhomogeneity of the perturbing fields in plasma. To calculate the Stark line profiles in successive layers of the WD atmosphere we used the modified Full Computer Simulation Method, able to take adequately into account the complexity of local elementary quantum processes in plasma. In the case of the H{sub α} line, the present value of Stark-induced shift of the synthetic H{sub α} line profile is about half the previous one and it is negligible in comparison with the gravitational redshift. In the case of the H{sub β} line, the present value of Stark-induced shift of the synthetic H{sub β} line profile is about twice the previous one. The source of this extra shift is the asymmetry of H{sub β} peaks.

  18. Variations of the high-level Balmer line spectrum of the helium-strong star σ Orionis E

    Science.gov (United States)

    Smith, M. A.; Bohlender, D. A.

    2007-12-01

    Using the high-level Balmer lines and continuum, we trace the density structure of two magnetospheric disk segments of the prototypical Bp star σ Orionis E (B2p) as these segments occult portions of the star during the rotational cycle. High-resolution spectra of the Balmer lines ≥H9 and Balmer edge were obtained on seven nights in January-February 2007 at an average sampling of 0.01 cycles. We measured equivalent width variations due to the star occultations by two disk segments 0.4 cycles apart and constructed differential spectra of the migrations of the corresponding absorptions across the Balmer line profiles. We first estimated the rotational and magnetic obliquity angles. We then simulated the observed Balmer jump variation using the model atmosphere codes synspec/circus and evaluated the disk geometry and gas thermodynamics. We find that the two occultations are caused by two disk segments. The first of these transits quickly, indicating that the segment resides in a range of distances, perhaps 2.5-6 R*, from the star. The second consists of a more slowly moving segment situated closer to the surface and causing two semi-resolved absorbing maxima. During its transit this segment brushes across the star's “lower” limb. Judging from the line visibility up to H23-H24 during the occultations, both disk segments have mean densities near 1012 cm-3 and are opaque in the lines and continuum. They have semiheights less than 1/2 R*, and their temperatures are near 10 500 K and 12 000 K, respectively. In all, the disks of Bp stars have a much more complicated geometry than has been anticipated, as evidenced by their (sometimes) non-coplanarity, de-centerness, and from star to star, differences in disk height. Based on observations obtained at the the Dominion Astrophysical Observatory, Herzberg Institute of Astrophysics, National Research Council of Canada.

  19. The double peaks and symmetric path phenomena in the catalytic activity of Pd/Al2O3-TiO2 catalysts with different TiO2 contents

    Science.gov (United States)

    Zhang, Shen; Guo, Yuyu; Li, Xingying; Wu, Xu; Li, Zhe

    2018-06-01

    Physicochemical properties of Pd/Al2O3-TiO2 catalysts with different amounts of TiO2 contents were investigated by XRD, nitrogen adsorption-desorption, FTIR, NH3-TPD, H2-TPR and XPS techniques. Catalysts of different compositions were tested in the ethanol oxidation reaction to study the effects of TiO2 contents. Double peaks and symmetric path phenomena were observed at certain temperatures with the increase in TiO2 contents. The symmetric peak phenomena and the diverse activity fluctuations have been ascribed to the controlling factors such as temperature and compositions. With the increase in TiO2 content, the surface area, adsorbed oxygen contents and surface acid quantity decreased gradually. The large surface area and adsorbed oxygen contents were conducive to the performance, while increased acid amounts were not beneficial for ethanol oxidation. At 150 and 175 °C, Pd/AT(X1

  20. Hydrogen Balmer series measurements and determination of Rydberg's constant using two different spectrometers

    International Nuclear Information System (INIS)

    Amrani, D

    2014-01-01

    This paper investigates the use of two different methods, the optical and the computer-aided diffraction-grating spectrometer, to measure the wavelength of visible lines of Balmer series from the hydrogen atomic spectrum and estimate the value of Rydberg's constant. Analysis and interpretation of data showed that both methods, despite their difference in terms of the type of equipment used, displayed good performance in terms of precision of measurements of wavelengths of spectral lines. A comparison was carried out between the experimental value of Rydberg's constant obtained with both methods and the accepted value. The results of Rydberg's constant obtained with both the optical and computer-aided spectrometers were 1.099 28 × 10 −7  m −1  and 1.095 13 × 10 −7  m −1  with an error difference of 0.17% and 0.20% compared to the accepted value 1.097 373 × 10 −7  m −1 , respectively. (paper)

  1. Photoionization-driven Absorption-line Variability in Balmer Absorption Line Quasar LBQS 1206+1052

    Energy Technology Data Exchange (ETDEWEB)

    Sun, Luming; Zhou, Hongyan; Ji, Tuo; Jiang, Peng; Liu, Bo; Pan, Xiang; Shi, Xiheng; Zhang, Shaohua [Polar Research Institute of China, 451 Jinqiao Road, Shanghai (China); Liu, Wenjuan; Wang, Jianguo [Yunnan Observatories, Chinese Academy of Sciences, Kunming, Yunnan (China); Wang, Tinggui; Yang, Chenwei [Department of Astronomy, University of Science and Technology of China, 96 Jinzhai Road, Hefei, Anhui (China); Miller, Lauren P., E-mail: lmsun@mail.ustc.edu.cn [Lehigh University, 27 Memorial Drive West, Bethlehem, PA 18015 (United States)

    2017-04-01

    In this paper we present an analysis of absorption-line variability in mini-BAL quasar LBQS 1206+1052. The Sloan Digital Sky Survey spectrum demonstrates that the absorption troughs can be divided into two components of blueshift velocities of ∼700 and ∼1400 km s{sup −1} relative to the quasar rest frame. The former component shows rare Balmer absorption, which is an indicator of high-density absorbing gas; thus, the quasar is worth follow-up spectroscopic observations. Our follow-up optical and near-infrared spectra using MMT, YFOSC, TSpec, and DBSP reveal that the strengths of the absorption lines vary for both components, while the velocities do not change. We reproduce all of the spectral data by assuming that only the ionization state of the absorbing gas is variable and that all other physical properties are invariable. The variation of ionization is consistent with the variation of optical continuum from the V -band light curve. Additionally, we cannot interpret the data by assuming that the variability is due to a movement of the absorbing gas. Therefore, our analysis strongly indicates that the absorption-line variability in LBQS 1206+1052 is photoionization driven. As shown from photoionization simulations, the absorbing gas with blueshift velocity of ∼700 km s{sup −1} has a density in the range of 10{sup 9} to 10{sup 10} cm{sup −3} and a distance of ∼1 pc, and the gas with blueshift velocity of ∼1400 km s{sup −1} has a density of 10{sup 3} cm{sup −3} and a distance of ∼1 kpc.

  2. Double peak spectra in spontaneous edge electroluminescence

    Czech Academy of Sciences Publication Activity Database

    Zavadil, Jiří; Žďánský, Karel

    1993-01-01

    Roč. 36, č. 11 (1993), s. 1623-1632 ISSN 0038-1101 R&D Projects: GA AV ČR IAA167108 Keywords : light emitting diodes * electroluminescence * optical waveguide theory Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 0.871, year: 1993

  3. Facility Location with Double-peaked Preferences

    DEFF Research Database (Denmark)

    Filos-Ratsikas, Aris; Li, Minming; Zhang, Jie

    2015-01-01

    ; this makes the problem essentially more challenging. As our main contribution, we present a simple truthful-in-expectation mechanism that achieves an approximation ratio of 1+b=c for both the social and the maximum, cost, where b is the distance of the agent from the peak and c is the minimum cost...

  4. Study of neutral hydrogen transport in LHD core plasmas based on high dynamic-range Balmer-α spectroscopy

    International Nuclear Information System (INIS)

    Fujii, K.; Goto, M.; Morita, S.

    2014-10-01

    The radial distributions of the neutral hydrogen atom density and pressure in the Large Helical Device (LHD) were studied. The atom density distribution was determined from a detailed analysis of the intensity-calibrated Balmer-α line profile while the pressure distribution was obtained with a simple one-dimensional analytical model. We determined for the first time the atom density at the center of a fusion-oriented plasma, which is approximately three orders smaller than that at the edge. On the contrary, the atom pressure changes only a factor of 10 from the edge to core regions. (author)

  5. On the Origin of the Flare Emission in IRIS' SJI 2832 Filter: Balmer Continuum or Spectral Lines?

    Czech Academy of Sciences Publication Activity Database

    Kleint, L.; Heinzel, Petr; Krucker, S.

    2017-01-01

    Roč. 837, č. 2 (2017), 160/1-160/7 ISSN 0004-637X R&D Projects: GA ČR(CZ) GA16-18495S Institutional support: RVO:67985815 Keywords : Sun * chromosphere * flares Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics OBOR OECD: Astronomy (including astrophysics,space science) Impact factor: 5.533, year: 2016

  6. Doppler spectroscopy of hydrogen Balmer lines in a hollow cathode glow discharge in ammonia and argon-ammonia mixture

    International Nuclear Information System (INIS)

    Sisovic, N. M.; Konjevic, N.

    2008-01-01

    The results of Doppler spectroscopy of hydrogen Balmer lines from a stainless steel (SS) and copper (Cu) hollow cathode (HC) glow discharge in ammonia and argon-ammonia mixture are reported. The experimental profiles in ammonia discharge are fitted well by superposing three Gaussian profiles. The half widths, in energy units, of narrow and medium Gaussians are in the ranges 0.3-0.4 eV and 3-4 eV, respectively, for both hollow cathodes what is expected on the basis of earlier electron beam→NH 3 experiments. The half widths of the largest Gaussian in ammonia are 46 and 55 eV for SS and Cu HC, respectively. In argon-ammonia discharge, three Gaussians are also required to fit experimental profiles. While half widths of narrow and medium Gaussians are similar to those in ammonia, the half widths of the largest Gaussians are 35 and 42 eV for SS and Cu HC, respectively. The half widths of the largest Gaussians in ammonia and in argon-ammonia mixture indicate the presence of excessive Doppler broadening.

  7. DUST EXTINCTION FROM BALMER DECREMENTS OF STAR-FORMING GALAXIES AT 0.75 {<=} z {<=} 1.5 WITH HUBBLE SPACE TELESCOPE/WIDE-FIELD-CAMERA 3 SPECTROSCOPY FROM THE WFC3 INFRARED SPECTROSCOPIC PARALLEL SURVEY

    Energy Technology Data Exchange (ETDEWEB)

    Dominguez, A.; Siana, B.; Masters, D. [Department of Physics and Astronomy, University of California Riverside, Riverside, CA 92521 (United States); Henry, A. L.; Martin, C. L. [Department of Physics, University of California, Santa Barbara, CA 93106 (United States); Scarlata, C.; Bedregal, A. G. [Minnesota Institute for Astrophysics, University of Minnesota, Minneapolis, MN 55455 (United States); Malkan, M.; Ross, N. R. [Department of Physics and Astronomy, University of California Los Angeles, Los Angeles, CA 90095 (United States); Atek, H.; Colbert, J. W. [Spitzer Science Center, Caltech, Pasadena, CA 91125 (United States); Teplitz, H. I.; Rafelski, M. [Infrared Processing and Analysis Center, Caltech, Pasadena, CA 91125 (United States); McCarthy, P.; Hathi, N. P.; Dressler, A. [Observatories of the Carnegie Institution for Science, Pasadena, CA 91101 (United States); Bunker, A., E-mail: albertod@ucr.edu [Department of Physics, Oxford University, Denys Wilkinson Building, Keble Road, Oxford, OX1 3RH (United Kingdom)

    2013-02-15

    Spectroscopic observations of H{alpha} and H{beta} emission lines of 128 star-forming galaxies in the redshift range 0.75 {<=} z {<=} 1.5 are presented. These data were taken with slitless spectroscopy using the G102 and G141 grisms of the Wide-Field-Camera 3 (WFC3) on board the Hubble Space Telescope as part of the WFC3 Infrared Spectroscopic Parallel survey. Interstellar dust extinction is measured from stacked spectra that cover the Balmer decrement (H{alpha}/H{beta}). We present dust extinction as a function of H{alpha} luminosity (down to 3 Multiplication-Sign 10{sup 41} erg s{sup -1}), galaxy stellar mass (reaching 4 Multiplication-Sign 10{sup 8} M {sub Sun }), and rest-frame H{alpha} equivalent width. The faintest galaxies are two times fainter in H{alpha} luminosity than galaxies previously studied at z {approx} 1.5. An evolution is observed where galaxies of the same H{alpha} luminosity have lower extinction at higher redshifts, whereas no evolution is found within our error bars with stellar mass. The lower H{alpha} luminosity galaxies in our sample are found to be consistent with no dust extinction. We find an anti-correlation of the [O III] {lambda}5007/H{alpha} flux ratio as a function of luminosity where galaxies with L {sub H{alpha}} < 5 Multiplication-Sign 10{sup 41} erg s{sup -1} are brighter in [O III] {lambda}5007 than H{alpha}. This trend is evident even after extinction correction, suggesting that the increased [O III] {lambda}5007/H{alpha} ratio in low-luminosity galaxies is likely due to lower metallicity and/or higher ionization parameters.

  8. An Anomaly in the Inglis-Teller Limits of the C VI Lyman and Balmer Series in Laser-Produced Plasmas

    Science.gov (United States)

    Elton, R.; Iglesias, E.; Griem, H.; Weaver, J.; Pien, G.; Mancini, R.

    2002-11-01

    Soft x-ray spectra from thin carbon layers heated by the OMEGA and NIKE lasers have been obtained with both spherical and planar targets, respectively, using a flat-field grazing incidence spectrograph equipped with a gated microchannel plate for temporal resolution. In both experiments, late-time (recombining) hydrogenic C VI spectra show an n-to-1 Lyman spectral series blending with the continuum at n=4, contrary to n=9 in the n-to-2 Balmer series. It appears unlikely that plasma inhomogeneities are the sole cause of this anomaly, given the difference in the experimental configurations. Other explanations for the line-to-continuum merging (other than the usual Stark-broadened Inglis-Teller effect) under consideration include non-thermal Doppler broadening, deviations from statistical sublevel population distributions, and opacity effects. Collisional-radiative and hydrodynamic modeling, including cascades, is employed to further understand this phenomenon.

  9. TheoSSA - Model WD Spectra on Demand: The Impact of Ne, Na, Mg, and Iron-group Elements on the Balmer Lines

    Science.gov (United States)

    Reindl, N.; Rauch, T.

    2015-06-01

    The registered German Astrophysical Virtual Observatory (GAVO) service TheoSSA provides easy access to synthetic stellar spectra. This GAVO database contains already ten thousands of these, which were calculated with different chemical compositions of the elements H to Ni. In addition to the database, it is possible to calculate individual spectra for hot, compact stars based on the Tübingen NLTE Model-Atmosphere Package (TMAP) via the TMAW service. The TMAW models were, in the pilot phase, restricted to the elements H, He, C, N, and O. Now, TMAW is extended to additionally consider opacities from Ne, Na, and Mg. Soon, TMAW will also be able to include the opacities from the so-called iron-group elements (Ca - Ni). We describe the improvements and show the impact of Ne, Na, Mg, and iron-group elements on the Balmer lines.

  10. The spectroscopic evolution of the symbiotic star AG Draconis I. The O VI Raman, Balmer, and helium emission line variations during the outburst of 2006-2008

    Czech Academy of Sciences Publication Activity Database

    Shore, S. N.; Wahlgren, G.M.; Genovali, K.; Bernabei, S.; Koubský, Pavel; Šlechta, Miroslav; Škoda, Petr; Skopal, A.; Wolf, M.

    2010-01-01

    Roč. 510, February (2010), A70/1-A70/10 ISSN 0004-6361 Grant - others:ESA(XE) ESA- PECS Project No. 98058; Vega(SK) 2/7010/27 Institutional research plan: CEZ:AV0Z10030501 Keywords : AG Draconis * radiation mechanisms * atomic processes Subject RIV: BN - Astronomy, Celestial Mechanics, Astrophysics Impact factor: 4.410, year: 2010

  11. Measurement of the Antiprotonic Lyman- and Balmer X-rays of $\\overline{p}H$ and $\\overline{p}D$ Atoms at Very Low Target Pressures

    CERN Multimedia

    2002-01-01

    The aim of this experiment is to measure the energies and intensities of the n @A 1 (Lyman) and n @A 2 (Balmer) tansitions with high accuracy in both @*H and @*D, from which the strong interaction effects of the 1s- and 2p-level can be extracted. These observables may be related to the antiproton-proton and antiproton-neutron scattering length. \\\\ \\\\ Since in these targets collisional Stark effect occurs, we will stop the antiprotons in extreme thin gaseous targets (pressure as low as 10 Torr), where no Stark effect occurs and the 2-1 transition is favoured. In order to use antiprotons with high efficiency despite of the low target density, we will trap antiprotons of a momentum of 100 MeV/c in a magnetic field of cyclotron characteristics. The antiprotons are decelerated by their energy loss in the target gas. The focusing properties of the magnetic field serve to compensate the multiple scattering and we will end up with a concentrated stopping distribution at the centre. Due to the long orbiting time, back...

  12. The Redshifted Hydrogen Balmer and Metastable He 1 Absorption Line System in Mini-FeLoBAL Quasar SDSS J112526.12+002901.3: A Parsec-scale Accretion Inflow?

    Science.gov (United States)

    Shi, Xi-Heng; Jiang, Peng; Wang, Hui-Yuan; Zhang, Shao-Hua; Ji, Tuo; Liu, Wen-Juan; Zhou, Hong-Yan

    2016-10-01

    The accretion of the interstellar medium onto central super-massive black holes is widely accepted as the source of the gigantic energy released by the active galactic nuclei. However, few pieces of observational evidence have been confirmed directly demonstrating the existence of the inflows. The absorption line system in the spectra of quasar SDSS J112526.12+002901.3 presents an interesting example in which the rarely detected hydrogen Balmer and metastable He I absorption lines are found redshifted to the quasar's rest frame along with the low-ionization metal absorption lines Mg II, Fe II, etc. The repeated SDSS spectroscopic observations suggest a transverse velocity smaller than the radial velocity. The motion of the absorbing medium is thus dominated by infall. The He I* lines present a powerful probe to the strength of ionizing flux, while the Balmer lines imply a dense environment. With the help of photoionization simulations, we find that the absorbing medium is exposed to the radiation with ionization parameter U ≈ 10-1.8, and the density is n({{H}})≈ {10}9 {{cm}}-3. Thus the absorbing medium is located ˜4 pc away from the central engine. According to the similarity in the distance and physical conditions between the absorbing medium and the torus, we strongly propose the absorption line system as a candidate for the accretion inflow, which originates in the inner surface of the torus.

  13. A new beam emission polarimetry diagnostic for measuring the magnetic field line angle at the plasma edge of ASDEX Upgrade.

    Science.gov (United States)

    Viezzer, E; Dux, R; Dunne, M G

    2016-11-01

    A new edge beam emission polarimetry diagnostic dedicated to the measurement of the magnetic field line angle has been installed on the ASDEX Upgrade tokamak. The new diagnostic relies on the motional Stark effect and is based on the simultaneous measurement of the polarization direction of the linearly polarized π (parallel to the electric field) and σ (perpendicular to the electric field) lines of the Balmer line D α . The technical properties of the system are described. The calibration procedures are discussed and first measurements are presented.

  14. Dissociative Excitation of Acetylene Induced by Electron Impact: Excitation-emission Cross-sections

    Energy Technology Data Exchange (ETDEWEB)

    Országh, Juraj; Danko, Marián; Čechvala, Peter; Matejčík, Štefan, E-mail: matejcik@fmph.uniba.sk [Department of Experimental Physics, Faculty of Mathematics, Physics and Informatics, Comenius University in Bratislava, Mlynská dolina F-2, 842 48 Bratislava (Slovakia)

    2017-05-20

    The optical emission spectrum of acetylene excited by monoenergetic electrons was studied in the range of 190–660 nm. The dissociative excitation and dissociative ionization associated with excitation of the ions initiated by electron impact were dominant processes contributing to the spectrum. The spectrum was dominated by the atomic lines (hydrogen Balmer series, carbon) and molecular bands (CH(A–X), CH(B–X), CH{sup +}(B–A), and C{sub 2}). Besides the discrete transitions, we have detected the continuum emission radiation of ethynyl radical C{sub 2}H(A–X). For most important lines and bands of the spectrum we have measured absolute excitation-emission cross sections and determined the energy thresholds of the particular dissociative channels.

  15. Continuum emission in the 1980 July 1 solar flare

    International Nuclear Information System (INIS)

    Zirin, H.; Neidig, D.F.

    1981-01-01

    Comparison of continuum measurements of the 1980 July 1 flare at Big Bear Solar Observatory and Sacramento Peak Observatory show strong blue emission kernels with the ratio of Balmer continuum (Bac):lambda3862 continuum:continuum above 4275 A to be about 10:5:1. The blue continuum at 3862 A is too strong to be explained by unresolved lines. The Bac intensity was 2.5 times the photosphere and the strongest lambda3862 continuum was 2 times the photosphere. The brightest continuum kernel occurred late in the flare, after the hard X-ray peak and related in time to an isolated peak in the 2.2 MeV line, suggesting that the continuum was excited by protons above 20 MeV

  16. BROAD BALMER WINGS IN BA HYPER/SUPERGIANTS DISTORTED BY DIFFUSE INTERSTELLAR BANDS: FIVE EXAMPLES IN THE 30 DORADUS REGION FROM THE VLT-FLAMES TARANTULA SURVEY

    Energy Technology Data Exchange (ETDEWEB)

    Walborn, Nolan R.; Sana, Hugues; Sabbi, Elena, E-mail: walborn@stsci.edu, E-mail: hsana@stsci.edu, E-mail: sabbi@stsci.edu [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); and others

    2015-08-10

    Extremely broad emission wings at Hβ and Hα have been found in VLT-FLAMES Tarantula Survey data for five very luminous BA supergiants in or near 30 Doradus in the Large Magellanic Cloud. The profiles of both lines are extremely asymmetrical, which we have found to be caused by very broad diffuse interstellar bands (DIBs) in the longward wing of Hβ and the shortward wing of Hα. These DIBs are well known to interstellar but not to many stellar specialists, so that the asymmetries may be mistaken for intrinsic features. The broad emission wings are generally ascribed to electron scattering, although we note difficulties for that interpretation in some objects. Such profiles are known in some Galactic hyper/supergiants and are also seen in both active and quiescent Luminous Blue Variables (LBVs). No prior or current LBV activity is known in these 30 Dor stars, although a generic relationship to LBVs is not excluded; subject to further observational and theoretical investigation, it is possible that these very luminous supergiants are approaching the LBV stage for the first time. Their locations in the HRD and presumed evolutionary tracks are consistent with that possibility. The available evidence for spectroscopic variations of these objects is reviewed, while recent photometric monitoring does not reveal variability. A search for circumstellar nebulae has been conducted, with an indeterminate result for one of them.

  17. Optical emission line spectra of Seyfert galaxies and radio galaxies

    International Nuclear Information System (INIS)

    Osterbrock, D.E.

    1978-01-01

    Many radio galaxies have strong emission lines in their optical spectra, similar to the emission lines in the spectra of Seyfert galaxies. The range of ionization extends from [O I] and [N I] through [Ne V] and [Fe VII] to [Fe X]. The emission-line spectra of radio galaxies divide into two types, narrow-line radio galaxies whose spectra are indistinguishable from Seyfert 2 galaxies, and broad-line radio galaxies whose spectra are similar to Seyfert 1 galaxies. However on the average the broad-line radio galaxies have steeper Balmer decrements, stronger [O III] and weaker Fe II emission than the Seyfert 1 galaxies, though at least one Seyfert 1 galaxy not known to be a radio source has a spectrum very similar to typical broad-line radio galaxies. Intermediate-type Seyfert galaxies exist that show various mixtures of the Seyfert 1 and Seyfert 2 properties, and the narrow-line or Seyfert 2 property seems to be strongly correlated with radio emission. (Auth.)

  18. Acoustic emission

    International Nuclear Information System (INIS)

    Nichols, R.W.

    1976-01-01

    The volume contains six papers which together provide an overall review of the inspection technique known as acoustic emission or stress wave emission. The titles are: a welder's introduction to acoustic emission technology; use of acoustic emission for detection of defects as they arise during fabrication; examples of laboratory application and assessment of acoustic emission in the United Kingdom; (Part I: acoustic emission behaviour of low alloy steels; Part II: fatigue crack assessment from proof testing and continuous monitoring); inspection of selected areas of engineering structures by acoustic emission; Japanese experience in laboratory and practical applications of acoustic emission to welded structures; and ASME acoustic emission code status. (U.K.)

  19. Emission line galaxies and active galactic nuclei in WINGS clusters

    Science.gov (United States)

    Marziani, P.; D'Onofrio, M.; Bettoni, D.; Poggianti, B. M.; Moretti, A.; Fasano, G.; Fritz, J.; Cava, A.; Varela, J.; Omizzolo, A.

    2017-03-01

    We present the analysis of the emission line galaxies members of 46 low-redshift (0.04 employing diagnostic diagrams. We examined the emission line properties and frequencies of star-forming galaxies, transition objects, and active galactic nuclei (AGNs: LINERs and Seyferts), unclassified galaxies with emission lines, and quiescent galaxies with no detectable line emission. A deficit of emission line galaxies in the cluster environment is indicated by both a lower frequency, and a systematically lower Balmer emission line equivalent width and luminosity with respect to control samples; this implies a lower amount of ionized gas per unit mass and a lower star formation rate if the source is classified as Hii region. A sizable population of transition objects and of low-luminosity LINERs (≈ 10-20% of all emission line galaxies) are detected among WINGS cluster galaxies. These sources are a factor of ≈1.5 more frequent, or at least as frequent, as in control samples with respect to Hii sources. Transition objects and LINERs in clusters are most affected in terms ofline equivalent width by the environment and appear predominantly consistent with so-called retired galaxies. Shock heating can be a possible gas excitation mechanism that is able to account for observed line ratios. Specific to the cluster environment, we suggest interaction between atomic and molecular gas and the intracluster medium as a possible physical cause of line-emitting shocks. The data whose description is provided in Table B.1, and emission line catalog of the WINGS database are only available at the CDS via anonymous ftp to http://cdsarc.u-strasbg.fr (http://130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/599/A83

  20. Experimental characterization of true spontaneous emission rate of optically-pumped InGaAs/GaAs quantum-well laser structure

    Directory of Open Access Journals (Sweden)

    Q.-N. Yu

    2017-08-01

    Full Text Available In this paper, an experimental approach to acquiring true spontaneous emission rate of optically-pumped InGaAs/GaAs quantum-well laser structure is described. This method is based on a single edge-emitting laser chip with simple sample processing. The photoluminescence spectra are measured at both facets of the edge-emitting device and transformed to the spontaneous emission rate following the theory described here. The unusual double peaks appearing in the spontaneous emission rate spectra are observed for the InGaAs/GaAs quantum-well structure. The result is analyzed in terms of Indium-rich island and Model-Solid theories. The proposed method is suitable for electrically-pumped quantum-well laser structures, as well.

  1. Emission spectra from super-critical rippled plasma density profiles illuminated by intense laser pulses

    International Nuclear Information System (INIS)

    Ondarza R, R.; Boyd, T.J.M.

    2000-01-01

    High-order harmonic emission from the interaction of intense femtosecond laser pulses with super-critical plasmas characterized by a rippled density profile at the vacuum-plasma interface has been observed from particle-in-cell (PIC) simulations. A plasma simulation box several laser wavelengths in extent was prepared with a rippled density of a fraction of a laser wavelength. Emission spectra at the very initial stage of the interaction were recorded with spectral characteristics dissimilar to those previously reported in the literature. The reflected light spectra were characterized by a strong emission at the plasma line and by a series of harmonics at multiples of the ripple frequency. Harmonic spectra were obtained for different values of the plasma ripple frequency. In all cases the harmonics were emitted at the precise multiple harmonic number of the ripple frequency. Another important feature apparent from the simulations was that the emission peaks appeared to havea complex structure as compared with those for unrippled plasmas. For the cases when the plasma was rippled the peaks that corresponded to the multiples of the rippled density typically showed a double peak for the first few harmonics. The reflected emission plots for the main laser pulse showed strong emission at the plasma frequency and at multiples of that frequency as reported by the authors in the literature. (Author)

  2. [Emission characteristics of fine particles from grate firing boilers].

    Science.gov (United States)

    Wang, Shu-Xiao; Zhao, Xiu-Juan; Li, Xing-Hua; Wei, Wei; Hao, Ji-Ming

    2009-04-15

    Grate firing boilers are the main type of Chinese industrial boilers, which accounts for 85% of the industrial boilers and is one of the most important emission sources of primary air pollutants in China. In this study, five boilers in three cities were selected and tested to measure the emission characteristics of PM2.5, and gaseous pollutants were applied by a compact dilution sampling system, which was developed for this field study. Results showed that particles mass size distributions for the five industrial boilers presented single peak or double peak, former peaks near 0.14 microm and the later peaks after 1.0 microm; the cyclone dust remover and wet scrubber dust remover had effective removal efficiencies not only to PM2.5, but also to PM1.0; and under the condition of same control techniques, grate firing boiler with high capacity has less PM2.5 emission than the boiler with low capacity. In the PM2.5 collected from flue gases, SO4(2-) was the most abundant ion, accounted for 20%-40% of the PM2.5; and C was the most abundant element (7.5%-31.8%), followed by S (8.4%-18.7%). Carbon balance method was applied to calculate the emission factors of these pollutants. The emission factors of PM2.5, NO, and SO2 were in the range of 0.046-0.486 g x kg(-1), 1.63-2.47 g x kg(-1), 1.35-9.95 g x kg(-1) respectively. The results are useful for the emission inventory development of industrial boilers and the source analysis of PM2.5 in atmospheric environment.

  3. Simulating double-peak hydrographs from single storms over mixed-use watersheds

    Science.gov (United States)

    Yang Yang; Theodore A. Endreny; David J. Nowak

    2015-01-01

    Two-peak hydrographs after a single rain event are observed in watersheds and storms with distinct volumes contributing as fast and slow runoff. The authors developed a hydrograph model able to quantify these separate runoff volumes to help in estimation of runoff processes and residence times used by watershed managers. The model uses parallel application of two...

  4. Infrared emission from galactic H II regions

    International Nuclear Information System (INIS)

    Zeilik, M. II.

    1975-01-01

    Near-infrared observations are presented of selected galactic HII regions (especially G45.5 + 0.1, G45.1 + 0.1, S88, and W3A) to infer the physical conditions of the dust responsible for the 2 to 25 micron emission. Two-component dust models are developed to match the observed characteristics of the infrared emission from HII regions. The dust, assumed to be bare and well-mixed with the gas in the ionized volume, consists of large (0.1 micron) ''silicate'' grains and small (0.2 micron) graphite grains. The ''silicates'' have their cosmic maximum abundance with respect to hydrogen, but the graphite grains are depleted by factors of 25 to 100 in mass. The Lyman-alpha radiation field predominately heats the ''silicate'' grains, which produce almost all the emission at 20 microns and most of it from 8 to 13 microns. The stellar radiation field predominately heats the graphite grains, which generate most of the emission at 3.5 and 5 microns. Roughly half of the observed 2 to 25 micron luminosity (when corrected for extinction) arises from Lyman-alpha photons and the other half from the Lyman and Balmer continua. The grains are too hot to provide significant emission in the far-infrared; this probably arises from a dust shell around the HII region. This two-component model predicts that HII regions should have smaller sizes at 3.5 and 5 microns than at 10 and 20 microns. The emissivities of fine-structure infrared lines for the regions are calculated. In the one instance where observations of such lines have been published (G29.9 - 0.0), predicted emissivities fall below those observed, especially for the 12.86-micron line of NeII. The discrepancy probably arises from an incorrect modeling of the region's ionization structure, but it might also reflect variations in elemental abundances or deficiencies in model stellar atmospheres for hot stars

  5. IUE observations of circumstellar emission from the late-type variable R AQR (M6 + pec)

    Science.gov (United States)

    Hobbs, R. W.; Michalitsianos, A. G.; Kafatos, M.

    1981-01-01

    The IUE observations of R Aqr (M7 + pec) obtained in low dispersion are discussed with particular reference to circumstellar emission. Strong permitted, semiforbidden, and forbidden emission lines are seen, superimposed on a bright ultraviolet continuum. It is deduced that the strong emission line spectrum that involves C III, C IV, Si III, (0 II) and (0 III) probably arises from a dense compact nebula the size of which is comparable to the orbital radius of the binary system of which R Aqr is the primary star. The low excitation emission lines of Fe II, Mg II, 0 I, and Si II probably a white dwarf, comparable to or somewhat brighter than the Sun, since such a star can produce enough ionizing photons to excite the continuum and emission line spectrum and yet be sufficiently faint as to escape detection by direct observation. The UV continuum is attributed to Balmer recombination from the dense nebula and not to blackbody emission from the hot companion.

  6. [Emission spectrum temperature sensitivity of Mg4FGeO6 : mn induced by laser].

    Science.gov (United States)

    Wang, Sheng; Liu, Jing-Ru; Shao, Jun; Hu, Zhi-Yun; Tao, Bo; Huang, Mei-Sheng

    2013-08-01

    In order to develop a new sort of thermally sensitive phosphor coating, the emission spectrum thermally sensitivity of Mg4FGeO6 : Mn induced by laser was studied. The spectrum measurement system with heating function was set up, and the emission spectrum of Mg4FGeO6 : Mn at various temperatures were measured. Absorption spectrum was measured, and the mechanism of formation of the structure of double peak was analyzed with the perturbation theory of crystal lattice. The group of peaks around 630 nm is represented by the transitions 4F"2 to 4A2, whereas the group of peaks around 660 nm is due to the transitions 4F'2 to 4A2. The occupancy of both excited states 4F'2 and 4F"2 is in thermal equilibrium. Thus increasing temperature causes the intensity of the emission in the group around 630 nm to increase at the expense of the emission intensity of the group around 660 nm. The various spectral regions in emission differ with temperature, which could be used to support the intensity-ratio measurement method. The intensity-ratio change curve as a function of temperature was fitted, which shows that the range of temperature measurement is between room temperature and 800 K.

  7. Emissions Trading

    NARCIS (Netherlands)

    Woerdman, Edwin; Backhaus, Juergen

    2014-01-01

    Emissions trading is a market-based instrument to achieve environmental targets in a cost-effective way by allowing legal entities to buy and sell emission rights. The current international dissemination and intended linking of emissions trading schemes underlines the growing relevance of this

  8. Emission Facilities - Air Emission Plants

    Data.gov (United States)

    NSGIC Education | GIS Inventory — Represents the Primary Facility type Air Emission Plant (AEP) point features. Air Emissions Plant is a DEP primary facility type related to the Air Quality Program....

  9. Emission inventory; Inventaire des emissions

    Energy Technology Data Exchange (ETDEWEB)

    Fontelle, J.P. [CITEPA, Centre Interprofessionnel Technique d`Etudes de la Pollution Atmospherique, 75 - Paris (France)

    1997-12-31

    Statistics on air pollutant (sulfur dioxide, nitrogen oxides and ammonium) emissions, acid equivalent emissions and their evolution since 1990 in the various countries of Europe and the USA, are presented. Emission data from the industrial, agricultural, transportation and power sectors are given, and comparisons are carried out between countries based on Gnp and population, pollution import/export fluxes and compliance to the previous emission reduction objectives

  10. On the SW Sex-type eclipsing cataclysmic variable SDSS0756+0858

    Energy Technology Data Exchange (ETDEWEB)

    Tovmassian, Gagik; Hernandez, Mercedes Stephania; González-Buitrago, Diego; Zharikov, Sergey; García-Díaz, Maria Teresa, E-mail: gag@astro.unam.mx [Instituto de Astronomía, Universidad Nacional Autonoma de México, Apdo. Postal 877, Ensenada, Baja California 22800 (Mexico)

    2014-03-01

    We conducted a spectroscopic and photometric study of SDSS J075653.11+085831. X-ray observations were also attempted. We determined the orbital period of this binary system to be 3.29 hr. It is a deep eclipsing system, whose spectra show mostly single-peaked, Balmer emission lines and a rather intense He II line. There is also the presence of faint (often double-peaked) He I emission lines as well as several absorption lines, Mg I being the most prominent. All of these features point toward the affiliation of this object with the growing number of SW Sex-type objects. We developed a phenomenological model of an SW Sex system to reproduce the observed photometric and spectral features.

  11. On the SW Sex-type eclipsing cataclysmic variable SDSS0756+0858

    International Nuclear Information System (INIS)

    Tovmassian, Gagik; Hernandez, Mercedes Stephania; González-Buitrago, Diego; Zharikov, Sergey; García-Díaz, Maria Teresa

    2014-01-01

    We conducted a spectroscopic and photometric study of SDSS J075653.11+085831. X-ray observations were also attempted. We determined the orbital period of this binary system to be 3.29 hr. It is a deep eclipsing system, whose spectra show mostly single-peaked, Balmer emission lines and a rather intense He II line. There is also the presence of faint (often double-peaked) He I emission lines as well as several absorption lines, Mg I being the most prominent. All of these features point toward the affiliation of this object with the growing number of SW Sex-type objects. We developed a phenomenological model of an SW Sex system to reproduce the observed photometric and spectral features.

  12. Spectral Monitoring of AGN: Preliminary Results for Ark 564 and Arp 102B

    Directory of Open Access Journals (Sweden)

    Shapovalova A. I.

    2011-09-01

    Full Text Available We present preliminary results of the long-term spectral monitoring of two active galactic nuclei with different broad line shapes: Ark 564 and Arp 102B. Ark 564 is a bright nearby narrow-line Syfert 1 (NLS1 galaxy with relatively narrow permitted optical emission lines and a high Fe II/Hβ ratio, while Arp 102B is a nearby broad-line radio galaxy with broad double-peaked Balmer emission lines. The spectra of Ark 564 were observed during 11-year period (1999-2009 and the spectra of Arp 102B in the 12-year period (1998-2009, with SAO 6 m and 1 m telescopes (Russia and the OAGH 2.1 m telescope (Cananea, Mexico.

  13. Chromospheric Ca II H and K and H-alpha emission in single and binary stars of spectral types F6-M2

    International Nuclear Information System (INIS)

    Strassmeier, K.G.; Fekel, F.C.; Bopp, B.W.; Dempsey, R.C.; Henry, G.W.

    1990-01-01

    New observations of the Ca II H and K and H-epsilon region and/or the Balmer H-alpha line are presented for 100 mostly very active stars but also for weak or inactive stars with suspected activity. Correlations between chromospheric activity at Ca II H and K and H-alpha and effective surface temperature and rotation are identified, and several new stars with chromospheric Ca II H and K emission are discovered. No single activity-rotation relation can be derived for all luminosity classes, and there is clear evidence that evolved stars are generally more active than main-sequence stars of the same rotation period. Binary within the evolved stars appears to play no role, while main-sequence binary stars show generally higher levels of activity than their single counterparts. Chromospheric emission in the Ca II H and K lines depends on surface temperature in that flux declines with cooler temperature. 63 refs

  14. Suppression of Hydrogen Emission in an X-class White-light Solar Flare

    Energy Technology Data Exchange (ETDEWEB)

    Procházka, Ondrej; Milligan, Ryan O.; Mathioudakis, Mihalis [Astrophysics Research Centre, Queen’s University Belfast, Northern Ireland (United Kingdom); Allred, Joel C. [NASA Goddard Space Flight Center, Greenbelt, MD 20771 (United States); Kowalski, Adam F. [Department of Astrophysical and Planetary Sciences, University of Colorado Boulder, 2000 Colorado Avenue, Boulder, CO 80305 (United States); Kotrč, Pavel, E-mail: oprochazka01@qub.ac.uk [Astronomical Institute, The Czech Academy of Sciences, 25165 Ondřejov (Czech Republic)

    2017-03-01

    We present unique NUV observations of a well-observed X-class flare from NOAA 12087 obtained at the Ondřejov Observatory. The flare shows a strong white-light continuum but no detectable emission in the higher Balmer and Lyman lines. Reuven Ramaty High-Energy Solar Spectroscopic Imager and Fermi observations indicate an extremely hard X-ray spectrum and γ -ray emission. We use the RADYN radiative hydrodynamic code to perform two types of simulations: one where an energy of 3 × 10{sup 11} erg cm{sup −2} s{sup −1} is deposited by an electron beam with a spectral index of ≈3, and a second where the same energy is applied directly to the photosphere. The combination of observations and simulations allows us to conclude that the white-light emission and the suppression or complete lack of hydrogen emission lines is best explained by a model where the dominant energy deposition layer is located in the lower layers of the solar atmosphere, rather than the chromosphere.

  15. Spectral properties of X-ray selected narrow emission line galaxies

    Science.gov (United States)

    Romero-Colmenero, E.

    1998-03-01

    This thesis reports a study of the X-ray and optical properties of two samples of X-ray selected Narrow Emission Line Galaxies (NELGs), and their comparison with the properties of broad line Active Galactic Nuclei (AGN). One sample (18 NELGs) is drawn from the ROSAT International X-ray Optical Survey (RIXOS), the other (19 NELGs and 33 AGN) from the ROSAT UK Deep Survey. ROSAT multi-channel X-ray spectra have been extracted and fitted with power-law, bremsstrahlung and black body models for the brighter RIXOS sources. In most cases, power-law and bremsstrahlung models provide the best results. The average spectral energy index, alpha, of the RIXOS NELGs is 0.96 +/- 0.07, similar to that of AGN (alpha~1). For the fainter RIXOS NELGs, as well as for all the UK Deep Survey sources, counts in three spectral bands have been extracted and fitted with a power-law model, assuming the Galactic value for N_H. The brighter RIXOS sources demonstrated that the results obtained by these two different extraction and fitting procedures provide consistent results. Two average X-ray spectra, one for the NELGs and another for the AGN, were created from the UK Deep Survey sources. The power-law slope of the average NELG is alpha = 0.45 +/- 0.09, whilst that of the AGN is alpha = 0.96 +/- 0.03. ROSAT X-ray surveys have shown that the fractional surface density of NELGs increases with respect to AGN at faint fluxes (case for NELGs to be major contributors to the XRB at the fainter fluxes. The analysis of optical spectroscopy, obtained on La Palma and Hawaii, shows that NELGs form a very heterogeneous group, made up of a mixture of Seyfert 2, LINER and HII-region like galaxies. Seyfert 2 galaxies are found to possess in general the steepest X-ray slopes. Ways to explain this in the context of the unified model of AGN are discussed. The FWHM of some emission lines (Halpha, Hbeta, [NII]) in the NELGs appears to increase with steepening X-ray spectral slope. In the case of the Balmer lines

  16. Acoustic emission

    International Nuclear Information System (INIS)

    Straus, A.; Lopez Pumarega, M.I.; Di Gaetano, J.O.; D'Atellis, C.E.; Ruzzante, J.E.

    1990-01-01

    This paper is related to our activities on acoustic emission (A.E.). The work is made with different materials: metals and fibre reinforced plastics. At present, acoustic emission transducers are being developed for low and high temperature. A test to detect electrical discharges in electrical transformers was performed. Our experience in industrial tests to detect cracks or failures in tanks or tubes is also described. The use of A.E. for leak detection is considered. Works on pattern recognition of A.E. signals are also being performed. (Author)

  17. Cataclysmic variables in the SUPERBLINK proper motion survey

    Energy Technology Data Exchange (ETDEWEB)

    Skinner, Julie N.; Thorstensen, John R. [Department of Physics and Astronomy, 6127 Wilder Laboratory, Dartmouth College, Hanover, NH 03755-3528 (United States); Lépine, Sébastien, E-mail: jns@dartmouth.edu [Department of Physics and Astronomy, Georgia State University, 25 Park Place NE, Atlanta, GA 30303 (United States)

    2014-12-01

    We have discovered a new high proper motion cataclysmic variable (CV) in the SUPERBLINK proper motion survey, which is sensitive to stars with proper motions greater than 40 mas yr{sup −1}. This CV was selected for follow-up observations as part of a larger search for CVs selected based on proper motions and their near-UV−V and V−K{sub s} colors. We present spectroscopic observations from the 2.4 m Hiltner Telescope at MDM Observatory. The new CV's orbital period is near 96 minutes, its spectrum shows the double-peaked Balmer emission lines characteristic of quiescent dwarf novae, and its V magnitude is near 18.2. Additionally, we present a full list of known CVs in the SUPERBLINK catalog.

  18. A comparative study of carbon plasma emission in methane and argon atmospheres

    Science.gov (United States)

    Yousfi, H.; Abdelli-Messaci, S.; Ouamerali, O.; Dekhira, A.

    2018-04-01

    The interaction between laser produced plasma (LPP) and an ambient gas is largely investigated by Optical Emission Spectroscopy (OES). The analysis of carbon plasma produced by an excimer KrF laser was performed under controlled atmospheres of methane and argon. For each ambient gas, the features of produced species have been highlighted. Using the time of flight (TOF) analysis, we have observed that the C and C2 exhibit a triple and a double peaks respectively in argon atmosphere in contrast to the methane atmosphere. The evolution of the first peaks of C and C2 follows the plasma expansion, whereas the second peaks move backward, undergoing reflected shocks. It was found that the translational temperature, obtained by Shifted Maxwell Boltzmann distribution function is strongly affected by the nature of ambient gas. The dissociation of CH4 by electronic impact presents the principal approach for explaining the emission of CH radical in reactive plasma. Some chemical reactions have been proposed in order to explain the formation process of molecular species.

  19. Outer atmospheres of cool stars. XII - A survey of IUE ultraviolet emission line spectra of cool dwarf stars

    Science.gov (United States)

    Linsky, J. L.; Bornmann, P. L.; Carpenter, K. G.; Hege, E. K.; Wing, R. F.; Giampapa, M. S.; Worden, S. P.

    1982-01-01

    Quantitative information is obtained on the chromospheres and transition regions of M dwarf stars, in order to determine how the outer atmospheres of dMe stars differ from dM stars and how they compare with the outer atmospheres of quiet and active G and K type dwarfs. IUE spectra of six dMe and four dM stars, together with ground-based photometry and spectroscopy of the Balmer and Ca II H and K lines, show no evidence of flares. It is concluded, regarding the quiescent behavior of these stars, that emission-line spectra resemble that of the sun and contain emission lines formed in regions with 4000-20,000 K temperatures that are presumably analogous to the solar chromosphere, as well as regions with temperatures of 20,000-200,000 K that are presumably analogous to the solar transition region. Emission-line surface fluxes are proportional to the emission measure over the range of temperatures at which the lines are formed.

  20. Laser-induced carbon plasma emission spectroscopic measurements on solid targets and in gas-phase optical breakdown

    International Nuclear Information System (INIS)

    Nemes, Laszlo; Keszler, Anna M.; Hornkohl, James O.; Parigger, Christian

    2005-01-01

    We report measurements of time- and spatially averaged spontaneous-emission spectra following laser-induced breakdown on a solid graphite/ambient gas interface and on solid graphite in vacuum, and also emission spectra from gas-phase optical breakdown in allene C3H4 and helium, and in CO2 and helium mixtures. These emission spectra were dominated by CII (singly ionized carbon), CIII (doubly ionized carbon), hydrogen Balmer beta (H b eta), and Swan C2 band features. Using the local thermodynamic equilibrium and thin plasma assumptions, we derived electron number density and electron temperature estimates. The former was in the 1016 cm -3 range, while the latter was found to be near 20000 K. In addition, the vibration-rotation temperature of the Swan bands of the C2 radical was determined to be between 4500 and 7000 K, using an exact theoretical model for simulating diatomic emission spectra. This temperature range is probably caused by the spatial inhomogeneity of the laser-induced plasma plume. Differences are pointed out in the role of ambient CO2 in a solid graphite target and in gas-phase breakdown plasma

  1. Atomic hydrogen determination in medium-pressure microwave discharge hydrogen plasmas via emission actinometry

    International Nuclear Information System (INIS)

    Geng Zicai; Xu Yong; Yang Xuefeng; Wang Weiguo; Zhu Aimin

    2005-01-01

    Atomic hydrogen plays an important role in the chemical vapour deposition of functional materials, plasma etching and new approaches to the chemical synthesis of hydrogen-containing compounds. This work reports experimental determinations of atomic hydrogen in microwave discharge hydrogen plasmas formed from the TM 01 microwave mode in an ASTeX-type reactor, via optical emission spectroscopy using Ar as an actinometer. The relative intensities of the H atom Balmer lines and Ar-750.4 nm emissions as functions of input power and gas pressure have been investigated. At an input microwave power density of 13.5 W cm -3 , the approximate hydrogen dissociation fractions calculated from electron-impact excitation and quenching cross sections in the literature, decreased from ∼0.08 to ∼0.03 as the gas pressure was increased from 5 to 25 Torr. The influences of the above cross sections, and the electron and gas temperatures of the plasmas on the determination of the hydrogen dissociation fraction data have been discussed

  2. DETECTION OF BROAD Hα EMISSION LINES IN THE LATE-TIME SPECTRA OF A HYDROGEN-POOR SUPERLUMINOUS SUPERNOVA

    Energy Technology Data Exchange (ETDEWEB)

    Yan, Lin; Masci, F. [Infrared Processing and Analysis Center, California Institute of Technology, Pasadena, CA 91125 (United States); Quimby, R. [Department of Astronomy, San Diego State University, San Diego, CA 92182 (United States); Ofek, E.; Gal-Yam, A.; Vreeswijk, P. M.; Leloudas, G.; Cia, A. de; Yaron, O. [Department of Particle Physics and Astrophysics, Faculty of Physics, The Weizmann Institute of Science, Rehovot 76100 (Israel); Mazzali, P. [Astrophysics Research Institute, Liverpool John Moores University, IC2, Liverpool Science Park, 146 Brownlow Hill, Liverpool L3 5RF (United Kingdom); Perley, D. [Department of Astronomy, California Institute of Technology, Pasadena, CA 91125 (United States); Cenko, S. B. [Astrophysics Science Division, NASA Goddard Space Flight Center, Mail Code 661, Greenbelt, MD 20771 (United States); Cao, Y.; Kulkarni, S. R. [Astronomy Department, California Institute of Technology, Pasadena, CA 91125 (United States); Nugent, P. E. [Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Rebbapragada, Umaa D. [Jet Propulsion Laboratory, California Institute of Technology, Pasadena, CA 91109 (United States); Woźniak, P. R., E-mail: lyan@ipac.caltech.edu [Space and Remote Sensing, ISR-2, MS-B244 Los Alamos National Laboratory Los Alamos, NM 87545 (United States)

    2015-12-01

    iPTF13ehe is a hydrogen-poor superluminous supernova (SLSN) at z = 0.3434, with a slow-evolving light curve and spectral features similar to SN2007bi. It rises in 83–148 days to reach a peak bolometric luminosity of ∼1.3 × 10{sup 44} erg s{sup −1}, then decays slowly at 0.015 mag day{sup −1}. The measured ejecta velocity is ∼ 13,000 km s{sup −1}. The inferred explosion characteristics, such as the ejecta mass (70–220 M{sub ⊙}), and the total radiative and kinetic energy (E{sub rad} ∼ 10{sup 51} erg, E{sub kin} ∼ 2 × 10{sup 53} erg), are typical of slow-evolving H-poor SLSN events. However, the late-time spectrum taken at +251 days (rest, post-peak) reveals a Balmeremission feature with broad and narrow components, which has never been detected before among other H-poor SLSNe. The broad component has a velocity width of ∼4500 km s{sup −1} and a ∼300 km s{sup −1} blueward shift relative to the narrow component. We interpret this broad Hα emission with a luminosity of ∼2 × 10{sup 41} erg s{sup −1} as resulting from the interaction between the supernova ejecta and a discrete H-rich shell, located at a distance of ∼4 × 10{sup 16} cm from the explosion site. This interaction causes the rest-frame r-band LC to brighten at late times. The fact that the late-time spectra are not completely absorbed by the shock-ionized H-shell implies that its Thomson scattering optical depth is likely ≤1, thus setting upper limits on the shell mass ≤30 M{sub ⊙}. Of the existing models, a Pulsational Pair Instability supernova model can naturally explain the observed 30 M{sub ⊙} H-shell, ejected from a progenitor star with an initial mass of (95–150) M{sub ⊙} about 40 years ago. We estimate that at least ∼15% of all SLSNe-I may have late-time Balmer emission lines.

  3. Searching for the Expelled Hydrogen Envelope in Type I Supernovae via Late-Time H α Emission

    Energy Technology Data Exchange (ETDEWEB)

    Vinko, J.; Silverman, J. M.; Wheeler, J. C.; MacQueen, P.; Marion, G. H. [Department of Astronomy, University of Texas at Austin, Austin, TX 78712 (United States); Pooley, D. [Department of Physics and Astronomy, Trinity University, One Trinity Place, San Antonio, TX 78212 (United States); Szalai, T. [Department of Optics and Quantum Electronics, University of Szeged, Dom ter 9, Szeged, 6720 (Hungary); Kelly, P. [Department of Astronomy, University of California at Berkeley, 501 Campbell Hall, Berkeley, CA 94720-3411 (United States); Sárneczky, K. [Konkoly Observatory, Research Centre for Astronomy and Earth Sciences, Hungarian Academy of Sciences, Konkoly Thege ut 15-17, Budapest, 1121 (Hungary)

    2017-03-01

    We report the first results from our long-term observational survey aimed at discovering late-time interaction between the ejecta of hydrogen-poor Type I supernovae (SNe I) and the hydrogen-rich envelope expelled from the progenitor star several decades/centuries before explosion. The expelled envelope, moving with a velocity of ∼10–100 km s{sup −1}, is expected to be caught up by the fast-moving SN ejecta several years/decades after explosion, depending on the history of the mass-loss process acting in the progenitor star prior to explosion. The collision between the SN ejecta and the circumstellar envelope results in net emission in the Balmer lines, especially H α . We look for signs of late-time H α emission in older SNe Ia/Ibc/IIb with hydrogen-poor ejecta via narrowband imaging. Continuum-subtracted H α emission has been detected for 13 point sources: 9 SN Ibc, 1 SN IIb, and 3 SN Ia events. Thirty-eight SN sites were observed on at least two epochs, from which three objects (SN 1985F, SN 2005kl, and SN 2012fh) showed significant temporal variation in the strength of their H α emission in our Direct Imaging Auxiliary Functions Instrument (DIAFI) data. This suggests that the variable emission is probably not due to nearby H ii regions unassociated with the SN and hence is an important additional hint that ejecta–circumstellar medium interaction may take place in these systems. Moreover, we successfully detected the late-time H α emission from the Type Ib SN 2014C, which was recently discovered as a strongly interacting SN in various (radio, infrared, optical, and X-ray) bands.

  4. Emission Inventory for Fugitive Emissions in Denmark

    DEFF Research Database (Denmark)

    Plejdrup, Marlene Schmidt; Nielsen, Ole-Kenneth; Nielsen, Malene

    This report presents the methodology and data used in the Danish inventory of fugitive emissions from fuels for the years until 2007. The inventory of fugitive emissions includes CO2, CH4, N2O, NOx, CO, NMVOC, SO2, dioxin, PAH and particulate matter. In 2007 the total Danish emission of greenhouse...

  5. The End of the Lines for OX 169: No Binary Broad-Line Region

    Science.gov (United States)

    Halpern, J. P.; Eracleous, M.

    2000-03-01

    We show that unusual Balmer emission-line profiles of the quasar OX 169, frequently described as either self-absorbed or double peaked, are actually neither. The effect is an illusion resulting from two coincidences. First, the forbidden lines are quite strong and broad. Consequently, the [N II] λ6583 line and the associated narrow-line component of Hα present the appearance of twin Hα peaks. Second, the redshift of 0.2110 brings Hβ into coincidence with Na I D at zero redshift, and ISM absorption in Na I D divides the Hβ emission line. In spectra obtained over the past decade, we see no substantial change in the character of the line profiles and no indication of intrinsic double-peaked structure. The Hγ, Mg II, and Lyα emission lines are single peaked, and all of the emission-line redshifts are consistent once they are correctly attributed to their permitted and forbidden-line identifications. A systematic shift of up to 700 km s-1 between broad and narrow lines is seen, but such differences are common and could be due to gravitational and transverse redshift in a low-inclination disk. Stockton & Farnham had called attention to an apparent tidal tail in the host galaxy of OX 169 and speculated that a recent merger had supplied the nucleus with a coalescing pair of black holes that was now revealing its existence in the form of two physically distinct broad-line regions. Although there is no longer any evidence for two broad emission-line regions in OX 169, binary black holes should form frequently in galaxy mergers, and it is still worthwhile to monitor the radial velocities of emission lines that could supply evidence of their existence in certain objects.

  6. High resolution measurements and modeling of auroral hydrogen emission line profiles

    Directory of Open Access Journals (Sweden)

    B. S. Lanchester

    Full Text Available Measurements in the visible wavelength range at high spectral resolution (1.3 Å have been made at Longyearbyen, Svalbard (15.8 E,78.2 N during an interval of intense proton precipitation. The shape and Doppler shift of hydrogen Balmer beta line profiles have been compared with model line profiles, using as input ion energy spectra from almost coincident passes of the FAST and DMSP spacecraft. The comparison shows that the simulation contains the important physical processes that produce the profiles, and confirms that measured changes in the shape and peak wave-length of the hydrogen profiles are the result of changing energy input. This combination of high resolution measurements with modeling provides a method of estimating the incoming energy and changes in flux of precipitating protons over Svalbard, for given energy and pitch-angle distributions. Whereas for electron precipitation, information on the incident particles is derived from brightness and brightness ratios which require at least two spectral windows, for proton precipitation the Doppler profile of resulting hydrogen emission is directly related to the energy and energy flux of the incident energetic protons and can be used to gather information about the source region. As well as the expected Doppler shift to shorter wavelengths, the measured profiles have a significant red-shifted component, the result of upward flowing emitting hydrogen atoms.

    Key words. Ionosphere (auroral ionosphere; particle precipitation – Magnetospheric physics (auroral phenomena

  7. High resolution measurements and modeling of auroral hydrogen emission line profiles

    Directory of Open Access Journals (Sweden)

    B. S. Lanchester

    2003-07-01

    Full Text Available Measurements in the visible wavelength range at high spectral resolution (1.3 Å have been made at Longyearbyen, Svalbard (15.8 E,78.2 N during an interval of intense proton precipitation. The shape and Doppler shift of hydrogen Balmer beta line profiles have been compared with model line profiles, using as input ion energy spectra from almost coincident passes of the FAST and DMSP spacecraft. The comparison shows that the simulation contains the important physical processes that produce the profiles, and confirms that measured changes in the shape and peak wave-length of the hydrogen profiles are the result of changing energy input. This combination of high resolution measurements with modeling provides a method of estimating the incoming energy and changes in flux of precipitating protons over Svalbard, for given energy and pitch-angle distributions. Whereas for electron precipitation, information on the incident particles is derived from brightness and brightness ratios which require at least two spectral windows, for proton precipitation the Doppler profile of resulting hydrogen emission is directly related to the energy and energy flux of the incident energetic protons and can be used to gather information about the source region. As well as the expected Doppler shift to shorter wavelengths, the measured profiles have a significant red-shifted component, the result of upward flowing emitting hydrogen atoms.Key words. Ionosphere (auroral ionosphere; particle precipitation – Magnetospheric physics (auroral phenomena

  8. THE IMPORTANCE OF NEBULAR CONTINUUM AND LINE EMISSION IN OBSERVATIONS OF YOUNG MASSIVE STAR CLUSTERS

    International Nuclear Information System (INIS)

    Reines, Amy E.; Nidever, David L.; Whelan, David G.; Johnson, Kelsey E.

    2010-01-01

    In this spectroscopic study of infant massive star clusters, we find that continuum emission from ionized gas rivals the stellar luminosity at optical wavelengths. In addition, we find that nebular line emission is significant in many commonly used broadband Hubble Space Telescope (HST) filters including the F814W I-band, the F555W V-band, and the F435W B-band. Two young massive clusters (YMCs) in the nearby starburst galaxy NGC 4449 were targeted for follow-up spectroscopic observations after Reines et al. discovered an F814W I-band excess in their photometric study of radio-detected clusters in the galaxy. The spectra were obtained with the Dual Imaging Spectrograph (DIS) on the 3.5 m Apache Point Observatory (APO) telescope and have a spectral range of ∼3800-9800 A. We supplement these data with HST and Sloan Digital Sky Survey photometry of the clusters. By comparing our data to the Starburst99 and GALEV evolutionary synthesis models, we find that nebular continuum emission competes with the stellar light in our observations and that the relative contribution from the nebular continuum is largest in the U- and I-bands, where the Balmer (3646 A) and Paschen jumps (8207 A) are located. The spectra also exhibit strong line emission including the [S III] λλ9069, 9532 lines in the HST F814W I-band. We find that the combination of nebular continuum and line emission can account for the F814W I-band excess previously found by Reines et al. In an effort to provide a benchmark for estimating the impact of ionized gas emission on photometric observations of young massive stellar populations, we compute the relative contributions of the stellar continuum, nebular continuum, and emission lines to the total observed flux of a 3 Myr old cluster through various HST filter/instrument combinations, including filters in the Wide Field Camera 3. We urge caution when comparing observations of YMCs to evolutionary synthesis models since nebular continuum and line emission can

  9. X-ray heating and ionization of broad-emission-line regions in QSO's and active galaxies

    International Nuclear Information System (INIS)

    Weisheit, J.C.; Shields, G.A.; Tarter, C.B.

    1980-07-01

    Absorption of x-rays deep within the broad-line emitting clouds in QSO's and the nuclei of active galaxies creates extensive zones of warm (T approx. 10 4 K), partially ionized N/sub e//N approx. 0.1) gas. Because Lyman alpha photons are trapped in these regions, the x-ray energy is efficiently channeled into Balmer lines collisionally excited from the n = 2 level. The HI regions plus the HII regions created by ultraviolet photons illuminating the surfaces of the clouds give rise to integrated Lα/Hα line emission ratios between 1 and 2. Enhanced MgII line emission from the HI regions gives rise to integrated MgII/Hα ratios near 0.5. The OI line lambda 8446 is efficiently pumped by trapped Hα photons and in the x-ray heated zone an intensity ratio I (lambda 8446)/I(Hα) approx. < 0.1 is calculated. All of these computed ratios now are in agreement with observations

  10. The contribution of microbunching instability to solar flare emission in the GHz to THz range of frequencies

    Energy Technology Data Exchange (ETDEWEB)

    Michael Klopf, J. [Department of Applied Science, College of William and Mary, McGlothlin-Street Hall, Williamsburg, VA 23187 (United States); Kaufmann, Pierre; Raulin, Jean-Pierre; Szpigel, Sérgio [Centro de Rádio-Astronomia e Astrofísica Mackenzie, Escola de Engenharia, Universidade Presbiteriana Mackenzie, Rua Consolação 896, São Paulo, SP 01302-907 (Brazil)

    2014-08-10

    Recent solar flare observations in the sub-terahertz range have provided evidence of a new spectral component with fluxes increasing for larger frequencies, separated from the well-known microwave emission that maximizes in the gigahertz range. Suggested interpretations explain the terahertz spectral component but do not account for the simultaneous microwave component. We present a mechanism for producing the observed 'double spectra'. Based on coherent enhancement of synchrotron emission at long wavelengths in laboratory accelerators, we consider how similar processes may occur within a solar flare. The instability known as microbunching arises from perturbations that produce electron beam density modulations, giving rise to broadband coherent synchrotron emission at wavelengths comparable to the characteristic size of the microbunch structure. The spectral intensity of this coherent synchrotron radiation (CSR) can far exceed that of the incoherent synchrotron radiation (ISR), which peaks at a higher frequency, thus producing a double-peaked spectrum. Successful CSR simulations are shown to fit actual burst spectral observations, using typical flaring physical parameters and power-law energy distributions for the accelerated electrons. The simulations consider an energy threshold below which microbunching is not possible because of Coulomb repulsion. Only a small fraction of the radiating charges accelerated to energies above the threshold is required to produce the microwave component observed for several events. The ISR/CSR mechanism can occur together with other emission processes producing the microwave component. It may bring an important contribution to microwaves, at least for certain events where physical conditions for the occurrence of the ISR/CSR microbunching mechanism are possible.

  11. Intergalactic medium emission observations with the cosmic web imager. II. Discovery of extended, kinematically linked emission around SSA22 Lyα BLOB 2

    International Nuclear Information System (INIS)

    Christopher Martin, D.; Chang, Daphne; Matuszewski, Matt; Morrissey, Patrick; Rahman, Shahin; Moore, Anna; Steidel, Charles C.; Matsuda, Yuichi

    2014-01-01

    The intergalactic medium (IGM) is the dominant reservoir of baryons, delineates the large-scale structure of the universe at low to moderate overdensities, and provides gas from which galaxies form and evolve. Simulations of a cold-dark-matter- (CDM-) dominated universe predict that the IGM is distributed in a cosmic web of filaments and that galaxies should form along and at the intersections of these filaments. While observations of QSO absorption lines and the large-scale distribution of galaxies have confirmed the CDM paradigm, the cosmic web of IGM has never been confirmed by direct imaging. Here we report our observation of the Lyα blob 2 (LAB2) in SSA22 with the Cosmic Web Imager (CWI). This is an integral field spectrograph optimized for low surface brightness, extended emission. With 22 hr of total on- and off-source exposure, CWI has revealed that LAB2 has extended Lyα emission that is organized into azimuthal zones consistent with filaments. We perform numerous tests with simulations and the data to secure the robustness of this result, which relies on data with modest signal-to-noise ratios. We have developed a smoothing algorithm that permits visualization of data cube slices along image or spectral image planes. With both raw and smoothed data cubes we demonstrate that the filaments are kinematically associated with LAB2 and display double-peaked profiles characteristic of optically thick Lyα emission. The flux is 10-20 times brighter than expected for the average emission from the IGM but is consistent with boosted fluorescence from a buried QSO or gravitation cooling radiation. Using simple emission models, we infer a baryon mass in the filaments of at least 1-4 × 10 11 M ☉ , and the dark halo mass is at least 2 × 10 12 M ☉ . The spatial-kinematic morphology is more consistent with inflow from the cosmic web than outflow from LAB2, although an outflow feature maybe present at one azimuth. LAB2 and the surrounding gas have significant and

  12. Intergalactic medium emission observations with the cosmic web imager. II. Discovery of extended, kinematically linked emission around SSA22 Lyα BLOB 2

    Energy Technology Data Exchange (ETDEWEB)

    Christopher Martin, D.; Chang, Daphne; Matuszewski, Matt; Morrissey, Patrick; Rahman, Shahin [Cahill Center for Astrophysics, California Institute of Technology, 1216 East California Boulevard, Mail Code 278-17, Pasadena, CA 91125 (United States); Moore, Anna [Caltech Optical Observatories, Cahill Center for Astrophysics, California Institute of Technology, 1216 East California Boulevard, Mail Code 11-17, Pasadena, CA 91125 (United States); Steidel, Charles C.; Matsuda, Yuichi, E-mail: cmartin@srl.caltech.edu [Cahill Center for Astrophysics, California Institute of Technology, 1216 East California Boulevard, Mail Code 249-17, Pasadena, CA 91125 (United States)

    2014-05-10

    The intergalactic medium (IGM) is the dominant reservoir of baryons, delineates the large-scale structure of the universe at low to moderate overdensities, and provides gas from which galaxies form and evolve. Simulations of a cold-dark-matter- (CDM-) dominated universe predict that the IGM is distributed in a cosmic web of filaments and that galaxies should form along and at the intersections of these filaments. While observations of QSO absorption lines and the large-scale distribution of galaxies have confirmed the CDM paradigm, the cosmic web of IGM has never been confirmed by direct imaging. Here we report our observation of the Lyα blob 2 (LAB2) in SSA22 with the Cosmic Web Imager (CWI). This is an integral field spectrograph optimized for low surface brightness, extended emission. With 22 hr of total on- and off-source exposure, CWI has revealed that LAB2 has extended Lyα emission that is organized into azimuthal zones consistent with filaments. We perform numerous tests with simulations and the data to secure the robustness of this result, which relies on data with modest signal-to-noise ratios. We have developed a smoothing algorithm that permits visualization of data cube slices along image or spectral image planes. With both raw and smoothed data cubes we demonstrate that the filaments are kinematically associated with LAB2 and display double-peaked profiles characteristic of optically thick Lyα emission. The flux is 10-20 times brighter than expected for the average emission from the IGM but is consistent with boosted fluorescence from a buried QSO or gravitation cooling radiation. Using simple emission models, we infer a baryon mass in the filaments of at least 1-4 × 10{sup 11} M {sub ☉}, and the dark halo mass is at least 2 × 10{sup 12} M {sub ☉}. The spatial-kinematic morphology is more consistent with inflow from the cosmic web than outflow from LAB2, although an outflow feature maybe present at one azimuth. LAB2 and the surrounding gas

  13. Spectroscopic Peculiarity of the Herbig Be Star HD 259431

    Science.gov (United States)

    Pogodin, M. A.; Pavlovskij, S. E.; Drake, N. A.; Beskrovnaya, N. G.; Kozlova, O. V.; Alekseev, I. Yu.; Borges Fernandes, M.; Pereira, C. B.; Valyavin, G.

    2017-06-01

    High-resolution spectra of the Herbig Be star HD 259431 obtained in 2010-2016 at three observatories (Crimean AO, ESO in Chile, and OAN SPN in Mexico) are analysed. The object demonstrates a very rich emission line profile spectrum. The bulk of the lines exhibit double-peaked emission profiles and originate in the gaseous disk. The atmospheric lines are unusually shallow, and majority of them are distorted by the circumstellar (CS) contribution. Moreover, we have revealed that they are overlapped with an additional continuum emission. Using the observed ratio of the equivalent widths of two He I λ 4009 and 4026 lines, we estimated the spectral type of the object as B5 V. We also constructed the spectral energy distribution of the additional continuum using wide wings of the atmospheric Hβ-Hɛ lines free of the CS contribution. The continuum corresponds to the blue part of the black body spectrum. The Hβ - Hɛ Balmer emission lines show very variable profiles looking as either of P Cyg-type or a double-peaked emission line with a depression of the red wing. We found the period of this variability P = 2.630d and interpreted it as a sign of a rotating magnetosphere of the star with the magnetic axis inclined to the rotation axis. At different phases of rotation, the observer can see either an accretion flow at high magnetic latitudes or a wind zone at lower latitudes. We also estimated the inclination of the rotation axis i = 52°±1°.

  14. Plasma emission mechanisms

    International Nuclear Information System (INIS)

    Melrose, D.B.

    1985-01-01

    Only three emission processes are thought to play a role in solar radio emission: plasma emission, gyromagnetic emission and bremsstrahlung. In this chapter plasma emission is discussed and the processes involved in its production are treated, namely, the generation of Langmuir turbulence, the partial conversion into fundamental transverse radiation, production of secondary Langmuir waves and the generation of second-harmonic transverse radiation. (U.K.)

  15. Ion cyclotron emission by spontaneous emission

    Energy Technology Data Exchange (ETDEWEB)

    Da Costa, O [Commission of the European Communities, Abingdon (United Kingdom). JET Joint Undertaking; Gresillon, D [Ecole Polytechnique, 91 - Palaiseau (France). Lab. de Physique des Milieux Ionises

    1994-07-01

    The goal of the study is to examine whether the spontaneous emission can account for ICE (ion cyclotron emission) experimental results, or part of them. A straightforward approach to plasma emission is chosen, investigating the near equilibrium wave radiation by gyrating ions, and thus building from the majority and fast fusion ions the plasma fluctuations and emission on the fast magnetoacoustic or compressional Alfven wave mode in the IC frequency range. Similarities with the ICE experiments are shown: the emission temperature in the presence of fast ions (even in a very small amount), the strong fast ion emission increase with the harmonic, the fine double-line splitting of each peak, the linear but not proportional increase of the peak width with the harmonic. 3 refs., 2 figs.

  16. Ion cyclotron emission by spontaneous emission

    International Nuclear Information System (INIS)

    Da Costa, O.; Gresillon, D.

    1994-01-01

    The goal of the study is to examine whether the spontaneous emission can account for ICE (ion cyclotron emission) experimental results, or part of them. A straightforward approach to plasma emission is chosen, investigating the near equilibrium wave radiation by gyrating ions, and thus building from the majority and fast fusion ions the plasma fluctuations and emission on the fast magnetoacoustic or compressional Alfven wave mode in the IC frequency range. Similarities with the ICE experiments are shown: the emission temperature in the presence of fast ions (even in a very small amount), the strong fast ion emission increase with the harmonic, the fine double-line splitting of each peak, the linear but not proportional increase of the peak width with the harmonic. 3 refs., 2 figs

  17. ON THE EARLY-TIME EXCESS EMISSION IN HYDROGEN-POOR SUPERLUMINOUS SUPERNOVAE

    Energy Technology Data Exchange (ETDEWEB)

    Vreeswijk, Paul M.; Leloudas, Giorgos; Gal-Yam, Avishay; De Cia, Annalisa; Waldman, Roni; Ofek, Eran O.; Yaron, Ofer [Department of Particle Physics and Astrophysics, Weizmann Institute of Science, Rehovot 7610001 (Israel); Perley, Daniel A. [Dark Cosmology Centre, Niels Bohr Institute, University of Copenhagen, Juliane Maries Vej 30, DK-2100 København Ø (Denmark); Quimby, Robert M. [Department of Astronomy, San Diego State University, San Diego, CA 92182 (United States); Sullivan, Mark [School of Physics and Astronomy, University of Southampton, Southampton SO17 1BJ (United Kingdom); Yan, Lin [Infrared Processing and Analysis Center, California Institute of Technology, Pasadena, CA 91125 (United States); Fremling, Christoffer; Taddia, Francesco; Sollerman, Jesper [The Oskar Klein Centre, Department of Astronomy, Stockholm University, AlbaNova, SE-10691 Stockholm (Sweden); Valenti, Stefano [Department of Physics, University of California, Davis, CA 95616 (United States); Arcavi, Iair; Howell, D. Andrew [Department of Physics, University of California, Santa Barbara, CA 93106 (United States); Filippenko, Alexei V. [Department of Astronomy, University of California, Berkeley, CA 94720-3411 (United States); Cenko, S. Bradley [Astrophysics Science Division, NASA Goddard Space Flight Center, Mail Code 661, Greenbelt, MD 20771 (United States); Kasliwal, Mansi M., E-mail: paul.vreeswijk@weizmann.ac.il [Cahill Center for Astrophysics, California Institute of Technology, Pasadena, CA 91125 (United States); and others

    2017-01-20

    We present the light curves of the hydrogen-poor superluminous supernovae (SLSNe I) PTF 12dam and iPTF 13dcc, discovered by the (intermediate) Palomar Transient Factory. Both show excess emission at early times and a slowly declining light curve at late times. The early bump in PTF 12dam is very similar in duration (∼10 days) and brightness relative to the main peak (2–3 mag fainter) compared to that observed in other SLSNe I. In contrast, the long-duration (>30 days) early excess emission in iPTF 13dcc, whose brightness competes with that of the main peak, appears to be of a different nature. We construct bolometric light curves for both targets, and fit a variety of light-curve models to both the early bump and main peak in an attempt to understand the nature of these explosions. Even though the slope of the late-time decline in the light curves of both SLSNe is suggestively close to that expected from the radioactive decay of {sup 56}Ni and {sup 56}Co, the amount of nickel required to power the full light curves is too large considering the estimated ejecta mass. The magnetar model including an increasing escape fraction provides a reasonable description of the PTF 12dam observations. However, neither the basic nor the double-peaked magnetar model is capable of reproducing the light curve of iPTF 13dcc. A model combining a shock breakout in an extended envelope with late-time magnetar energy injection provides a reasonable fit to the iPTF 13dcc observations. Finally, we find that the light curves of both PTF 12dam and iPTF 13dcc can be adequately fit with the model involving interaction with the circumstellar medium.

  18. Vehicle Emissions Risk Management

    International Nuclear Information System (INIS)

    Ibrahem, L.G.

    2004-01-01

    Vehicle emissions are considered as a main source for air pollution. Emissions regulation is now well developed in most countries to meet cleaner air quality. Reducing emissions by using cleaner fuels, which meet certain specification, is not enough to get cleaner air, yet the vehicle technology is not improved. Here we will outline the following: - development in fuel specification and emissions regulation. main facts linking vehicle emissions, fuel properties and air quality. catalytic converter technology. Emissions sources: In modem cities, vehicle traffic is potentially a major source of emissions. However sometimes other sources of emissions from industry and other stationary sources can be equally important and include emissions that are of greater toxicity than those from vehicles

  19. Ammonia emissions in Europe

    DEFF Research Database (Denmark)

    Jacobsen, Brian H.

    2012-01-01

    The NEC (National Emission Ceiling) directive has set targets for the 2010 ammonia emissions from a number of European countries. The target will be reached by most EU-countries and the total emission for EU-27 has been reduced by 22% from 1990 to 2007. Denmark is one of the countries with the la......The NEC (National Emission Ceiling) directive has set targets for the 2010 ammonia emissions from a number of European countries. The target will be reached by most EU-countries and the total emission for EU-27 has been reduced by 22% from 1990 to 2007. Denmark is one of the countries...

  20. BROADENING OF BALMER LINES FOR HIGH QUANTUM NUMBER

    Energy Technology Data Exchange (ETDEWEB)

    Armstrong, B. H.

    1963-10-15

    It is shown that the impact theory breakdown at sufficiently large distances from the line center in effect lowers the principle quantum number at which electron broadening might otherwise be assumed to dominate. Since the impact theory breaks down and effectively the impact widths decrease progressively for the line components more distant from the center, the contributions of the components to the folding integral decrease rapidly except at their own positions. (R.E.U.)

  1. Spatially Resolved HST Grism Spectroscopy of a Lensed Emission Line Galaxy at z ~ 1

    Science.gov (United States)

    Frye, Brenda L.; Hurley, Mairead; Bowen, David V.; Meurer, Gerhardt; Sharon, Keren; Straughn, Amber; Coe, Dan; Broadhurst, Tom; Guhathakurta, Puragra

    2012-07-01

    We take advantage of gravitational lensing amplification by A1689 (z = 0.187) to undertake the first space-based census of emission line galaxies (ELGs) in the field of a massive lensing cluster. Forty-three ELGs are identified to a flux of i 775 = 27.3 via slitless grism spectroscopy. One ELG (at z = 0.7895) is very bright owing to lensing magnification by a factor of ≈4.5. Several Balmer emission lines (ELs) detected from ground-based follow-up spectroscopy signal the onset of a major starburst for this low-mass galaxy (M * ≈ 2 × 109 M ⊙) with a high specific star formation rate (≈20 Gyr-1). From the blue ELs we measure a gas-phase oxygen abundance consistent with solar (12+log(O/H) = 8.8 ± 0.2). We break the continuous line-emitting region of this giant arc into seven ~1 kpc bins (intrinsic size) and measure a variety of metallicity-dependent line ratios. A weak trend of increasing metal fraction is seen toward the dynamical center of the galaxy. Interestingly, the metal line ratios in a region offset from the center by ~1 kpc have a placement on the blue H II region excitation diagram with f ([O III])/f (Hβ) and f ([Ne III])/f (Hβ) that can be fitted by an active galactic nucleus (AGN). This asymmetrical AGN-like behavior is interpreted as a product of shocks in the direction of the galaxy's extended tail, possibly instigated by a recent galaxy interaction. Based, in part, on data obtained with the W. M. Keck Observatory, which is operated as a scientific partnership among the California Institute of Technology, the University of California, and NASA, and was made possible by the generous financial support of the W. M. Keck Foundation.

  2. Emissions Modeling Clearinghouse

    Data.gov (United States)

    U.S. Environmental Protection Agency — The Emissions Modeling Clearinghouse (EMCH) supports and promotes emissions modeling activities both internal and external to the EPA. Through this site, the EPA...

  3. National Emission Inventory

    Data.gov (United States)

    U.S. Environmental Protection Agency — The National Emission Inventory contains measured, modeled, and estimated data for emissions of all known source categories in the US (stationary sources, fires,...

  4. Emissions Trading Resources

    Science.gov (United States)

    Learn about emissions trading programs, also known as cap and trade programs, which are market-based policy tools for protecting human health and the environment by controlling emissions from a group of sources.

  5. What Is Emissions Trading?

    Science.gov (United States)

    Learn the basics about how emissions trading uses a market-based policy tool used to control large amounts of pollution emissions from a group of sources in order to protect human health and the environment.

  6. World Emission RETRO ANTHRO

    Data.gov (United States)

    Washington University St Louis — Anthropogenic and vegetation fire emissions data were generated monthly covering a period of 1960 to 2000. Anthropogenic emissions in the RETRO inventory are derived...

  7. Emissions & Measurements - Black Carbon

    Science.gov (United States)

    Emissions and Measurement (EM) research activities performed within the National Risk Management Research Lab NRMRL) of EPA's Office of Research and Development (ORD) support measurement and laboratory analysis approaches to accurately characterize source emissions, and near sour...

  8. Biodiesel Emissions Analysis Program

    Science.gov (United States)

    Using existing data, the EPA's biodiesel emissions analysis program sought to quantify the air pollution emission effects of biodiesel for diesel engines that have not been specifically modified to operate on biodiesel.

  9. Dioxin emissions and sources

    International Nuclear Information System (INIS)

    1994-01-01

    The papers presented at the seminar discussed dioxin emissions and sources, dioxin pollution of soils, waste water and sewage sludge, stocktaking of emission sources, and exposure and risk analyses for dioxin and other pollutants. (EF) [de

  10. National Emission Information System

    International Nuclear Information System (INIS)

    Sajtakova, E.; Spisakova, K.

    2005-01-01

    In this presentation the Slovak National Emission Information System (NEIS) is presented. The NEIS represents hierarchical oriented modular system of acquisition, verification, saving and reporting of data about annual emissions and payments for pollution of atmosphere

  11. Blue Emission in Proteins

    OpenAIRE

    Sarkar, Sohini; Sengupta, Abhigyan; Hazra, Partha; Mandal, Pankaj

    2014-01-01

    Recent literatures reported blue-green emission from amyloid fibril as exclusive signature of fibril formation. This unusual visible luminescence is regularly used to monitor fibril growth. Blue-green emission has also been observed in crystalline protein and in solution. However, the origin of this emission is not known exactly. Our spectroscopic study of serum proteins reveals that the blue-green emission is a property of protein monomer. Evidences suggest that semiconductor-like band struc...

  12. Emission computed tomography

    International Nuclear Information System (INIS)

    Ott, R.J.

    1986-01-01

    Emission Computed Tomography is a technique used for producing single or multiple cross-sectional images of the distribution of radionuclide labelled agents in vivo. The techniques of Single Photon Emission Computed Tomography (SPECT) and Positron Emission Tomography (PET) are described with particular regard to the function of the detectors used to produce images and the computer techniques used to build up images. (UK)

  13. International emissions trading

    DEFF Research Database (Denmark)

    Boom, Jan Tjeerd

    This thesis discusses the design and political acceptability of international emissions trading. It is shown that there are several designs options for emissions trading at the national level that have a different impact on output and thereby related factors such as employment and consumer prices....... The differences in impact of the design make that governments may prefer different designs of emissions trading in different situations. The thesis furthermore establishes that international emissions trading may lead to higher overall emissions, which may make it a less attractive instrument....

  14. Shipping emissions in ports

    OpenAIRE

    Merk, Olaf

    2014-01-01

    Shipping emissions in ports are substantial, accounting for 18 million tonnes of CO2 emissions, 0.4 million tonnes of NOx, 0.2 million of SOx and 0.03 million tonnes of PM10 in 2011. Around 85% of emissions come from containerships and tankers. Containerships have short port stays, but high emissions during these stays. Most of CO2 emissions in ports from shipping are in Asia and Europe (58%), but this share is low compared to their share of port calls (70%). European ports have much less emi...

  15. Air Emissions Factors and Quantification

    Science.gov (United States)

    Emissions factors are used in developing air emissions inventories for air quality management decisions and in developing emissions control strategies. This area provides technical information on and support for the use of emissions factors.

  16. OPTICAL MONITORING OF THE BROAD-LINE RADIO GALAXY 3C 390.3

    International Nuclear Information System (INIS)

    Dietrich, Matthias; Peterson, Bradley M.; Grier, Catherine J.; Bentz, Misty C.; Eastman, Jason; Frank, Stephan; Gonzalez, Raymond; Marshall, Jennifer L.; DePoy, Darren L.; Prieto, Jose L.

    2012-01-01

    We have undertaken a new ground-based monitoring campaign on the broad-line radio galaxy 3C 390.3 to improve the measurement of the size of the broad emission-line region and to estimate the black hole mass. Optical spectra and g-band images were observed in late 2005 for three months using the 2.4 m telescope at MDM Observatory. Integrated emission-line flux variations were measured for the hydrogen Balmer lines Hα, Hβ, Hγ, and for the helium line He IIλ4686, as well as g-band fluxes and the optical active galactic nucleus (AGN) continuum at λ = 5100 Å. The g-band fluxes and the optical AGN continuum vary simultaneously within the uncertainties, τ cent (0.2 ± 1.1) days. We find that the emission-line variations are delayed with respect to the variable g-band continuum by τ(Hα) 56.3 +2.4 –6.6 days, τ(Hβ) = 44.3 +3.0 –3.3 days, τ(Hγ) = 58.1 +4.3 –6.1 days, and τ(He II 4686) = 22.3 +6.5 –3.8 days. The blue and red peaks in the double-peaked line profiles, as well as the blue and red outer profile wings, vary simultaneously within ±3 days. This provides strong support for gravitationally bound orbital motion of the dominant part of the line-emitting gas. Combining the time delay of the strong Balmer emission lines of Hα and Hβ and the separation of the blue and red peaks in the broad double-peaked profiles in their rms spectra, we determine M vir bh = 1.77 +0.29 –0.31 × 10 8 M ☉ and using σ line of the rms spectra M vir bh 2.60 +0.23 –0.31 × 10 8 M ☉ for the central black hole of 3C 390.3, respectively. Using the inclination angle of the line-emitting region which is measured from superluminal motion detected in the radio range, accretion disk models to fit the optical double-peaked emission-line profiles, and X-ray observations, the mass of the black hole amounts to M bh = 0.86 +0.19 –0.18 × 10 9 M ☉ (peak separation) and M bh 1.26 +0.21 –0.16 × 10 9 M ☉ (σ line ), respectively. This result is consistent with the black

  17. OPTICAL MONITORING OF THE BROAD-LINE RADIO GALAXY 3C 390.3

    Energy Technology Data Exchange (ETDEWEB)

    Dietrich, Matthias; Peterson, Bradley M.; Grier, Catherine J.; Bentz, Misty C.; Eastman, Jason; Frank, Stephan; Gonzalez, Raymond; Marshall, Jennifer L.; DePoy, Darren L.; Prieto, Jose L., E-mail: dietrich@astronomy.ohio-state.edu [Department of Astronomy, Ohio State University, 140 West 18th Avenue, Columbus, OH 43210 (United States)

    2012-09-20

    We have undertaken a new ground-based monitoring campaign on the broad-line radio galaxy 3C 390.3 to improve the measurement of the size of the broad emission-line region and to estimate the black hole mass. Optical spectra and g-band images were observed in late 2005 for three months using the 2.4 m telescope at MDM Observatory. Integrated emission-line flux variations were measured for the hydrogen Balmer lines H{alpha}, H{beta}, H{gamma}, and for the helium line He II{lambda}4686, as well as g-band fluxes and the optical active galactic nucleus (AGN) continuum at {lambda} = 5100 A. The g-band fluxes and the optical AGN continuum vary simultaneously within the uncertainties, {tau}{sub cent} (0.2 {+-} 1.1) days. We find that the emission-line variations are delayed with respect to the variable g-band continuum by {tau}(H{alpha}) 56.3{sup +2.4}{sub -6.6} days, {tau}(H{beta}) = 44.3{sup +3.0}{sub -3.3} days, {tau}(H{gamma}) = 58.1{sup +4.3}{sub -6.1} days, and {tau}(He II 4686) = 22.3{sup +6.5}{sub -3.8} days. The blue and red peaks in the double-peaked line profiles, as well as the blue and red outer profile wings, vary simultaneously within {+-}3 days. This provides strong support for gravitationally bound orbital motion of the dominant part of the line-emitting gas. Combining the time delay of the strong Balmer emission lines of H{alpha} and H{beta} and the separation of the blue and red peaks in the broad double-peaked profiles in their rms spectra, we determine M {sup vir}{sub bh} = 1.77{sup +0.29}{sub -0.31} Multiplication-Sign 10{sup 8} M{sub Sun} and using {sigma}{sub line} of the rms spectra M {sup vir}{sub bh} 2.60{sup +0.23}{sub -0.31} Multiplication-Sign 10{sup 8} M{sub Sun} for the central black hole of 3C 390.3, respectively. Using the inclination angle of the line-emitting region which is measured from superluminal motion detected in the radio range, accretion disk models to fit the optical double-peaked emission-line profiles, and X-ray observations

  18. BP's emissions trading system

    International Nuclear Information System (INIS)

    Victor, David G.; House, Joshua C.

    2006-01-01

    Between 1998 and 2001, BP reduced its emissions of greenhouse gases by more than 10%. BP's success in cutting emissions is often equated with its use of an apparently market-based emissions trading program. However no independent study has ever examined the rules and operation of BP's system and the incentives acting on managers to reduce emissions. We use interviews with key managers and with traders in several critical business units to explore the bound of BP's success with emissions trading. No money actually changed hands when permits were traded, and the main effect of the program was to create awareness of money-saving emission controls rather than strong price incentives. We show that the trading system did not operate like a 'textbook' cap and trade scheme. Rather, the BP system operated much like a 'safety valve' trading system, where managers let the market function until the cost of doing so surpassed what the company was willing to tolerate

  19. The 1600 Å Emission Bump in Protoplanetary Disks: A Spectral Signature of H{sub 2}O Dissociation

    Energy Technology Data Exchange (ETDEWEB)

    France, Kevin [Laboratory for Atmospheric and Space Physics, University of Colorado, 600 UCB, Boulder, CO 80309 (United States); Roueff, Evelyne; Abgrall, Hervé, E-mail: kevin.france@colorado.edu [LERMA, Observatoire de Paris, PSL Research University, CNRS, Sorbonne Universités, UPMC Univ. Paris 06, F-92190, Meudon (France)

    2017-08-01

    The FUV continuum spectrum of many accreting pre-main sequence stars, Classical T Tauri Stars (CTTSs), does not continue smoothly from the well-studied Balmer continuum emission in the NUV, suggesting that additional processes contribute to the short-wavelength emission in these objects. The most notable spectral feature in the FUV continuum of some CTTSs is a broad emission approximately centered at 1600 Å, which has been referred to as the “1600 Å Bump.” The origin of this feature remains unclear. In an effort to better understand the molecular properties of planet-forming disks and the UV spectral properties of accreting protostars, we have assembled archival FUV spectra of 37 disk-hosting systems observed by the Hubble Space Telescope -Cosmic Origins Spectrograph. Clear 1600 Å Bump emission is observed above the smooth, underlying 1100–1800 Å continuum spectrum in 19/37 Classical T Tauri disks in the HST -COS sample, with the detection rate in transition disks (8/8) being much higher than that in primordial or non-transition sources (11/29). We describe a spectral deconvolution analysis to separate the Bump (spanning 1490–1690 Å) from the underlying FUV continuum, finding an average Bump luminosity L (Bump) ≈ 7 × 10{sup 29} erg s{sup −1}. Parameterizing the Bump with a combination of Gaussian and polynomial components, we find that the 1600 Å Bump is characterized by a peak wavelength λ {sub o} = 1598.6 ± 3.3 Å, with FWHM = 35.8 ± 19.1 Å. Contrary to previous studies, we find that this feature is inconsistent with models of H{sub 2} excited by electron -impact. We show that this Bump makes up between 5%–50% of the total FUV continuum emission in the 1490–1690 Å band and emits roughly 10%–80% of the total fluorescent H{sub 2} luminosity for stars with well-defined Bump features. Energetically, this suggests that the carrier of the 1600 Å Bump emission is powered by Ly α photons. We argue that the most likely mechanism

  20. Prompt neutron emission

    International Nuclear Information System (INIS)

    Sher, R.

    1959-01-01

    It is shown that Ramanna and Rao's tentative conclusion that prompt fission neutrons are emitted (in the fragment system) preferentially in the direction of fragment motion is not necessitated by their angular distribution measurements, which are well explained by the usual assumptions of isotropic emission with a Maxwell (or Maxwell-like) emission spectrum. The energy distribution (Watt spectrum) and the angular distribution, both including the effects of anisotropic emission, are given. (author) [fr

  1. Radio emission from Jupiter

    International Nuclear Information System (INIS)

    Velusamy, T.

    1976-01-01

    The basic features of the different radio emissions from the planet Jupiter are reviewed. These radio emissions characterized into three types as thermal, decimetric and decametric, are discussed. The coherent emission mechanism for the origin of the decametric bursts and the acceleration mechanism for relativistic electrons in the decimetric radiation have not been properly understood. The emissions are much related to the magnetic field of Jupiter. The system III rotation period for Jupiter has been calculated as 092 55 m 29.74 S. (A.K.)

  2. VOC emissions chambers

    Data.gov (United States)

    Federal Laboratory Consortium — In order to support the development of test methods and reference materials for volatile organic compounds (VOC) emissions from building materials and furnishings,...

  3. Microgravity Emissions Laboratory (MEL)

    Data.gov (United States)

    Federal Laboratory Consortium — The Microgravity Emissions Laboratory (MEL) utilizes a low-frequency acceleration measurement system for the characterization of rigid body inertial forces generated...

  4. Outsourcing CO2 Emissions

    Science.gov (United States)

    Davis, S. J.; Caldeira, K. G.

    2009-12-01

    CO2 emissions from the burning of fossil fuels are the primary cause of global warming. Much attention has been focused on the CO2 directly emitted by each country, but relatively little attention has been paid to the amount of emissions associated with consumption of goods and services in each country. This consumption-based emissions inventory differs from the production-based inventory because of imports and exports of goods and services that, either directly or indirectly, involved CO2 emissions. Using the latest available data and reasonable assumptions regarding trans-shipment of embodied carbon through third-party countries, we developed a global consumption-based CO2 emissions inventory and have calculated associated consumption-based energy and carbon intensities. We find that, in 2004, 24% of CO2 emissions are effectively outsourced to other countries, with much of the developed world outsourcing CO2 emissions to emerging markets, principally China. Some wealthy countries, including Switzerland and Sweden, outsource over half of their consumption-based emissions, with many northern Europeans outsourcing more than three tons of emissions per person per year. The United States is both a big importer and exporter of emissions embodied in trade, outsourcing >2.6 tons of CO2 per person and at the same time as >2.0 tons of CO2 per person are outsourced to the United States. These large flows indicate that CO2 emissions embodied in trade must be taken into consideration when considering responsibility for increasing atmospheric greenhouse gas concentrations.

  5. 47 CFR 78.103 - Emissions and emission limitations.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 4 2010-10-01 2010-10-01 false Emissions and emission limitations. 78.103... CABLE TELEVISION RELAY SERVICE Technical Regulations § 78.103 Emissions and emission limitations. (a) A CARS station may be authorized to employ any type of emission, for which there are technical standards...

  6. Air Emission Inventory for the INEEL -- 1999 Emission Report

    Energy Technology Data Exchange (ETDEWEB)

    Zohner, Steven K

    2000-05-01

    This report presents the 1999 calendar year update of the Air Emission Inventory for the Idaho National Engineering and Environmental Laboratory (INEEL). The INEEL Air Emission Inventory documents sources and emissions of nonradionuclide pollutants from operations at the INEEL. The report describes the emission inventory process and all of the sources at the INEEL, and provides nonradionuclide emissions estimates for stationary sources.

  7. Uncertainties in emission inventories

    NARCIS (Netherlands)

    Aardenne, van J.A.

    2002-01-01

    Emission inventories provide information about the amount of a pollutant that is emitted to the atmosphere as a result of a specific anthropogenic or natural process at a given time or place. Emission inventories can be used for either policy or scientific purposes. For

  8. Positron emission tomography

    International Nuclear Information System (INIS)

    Reivich, M.; Alavi, A.

    1985-01-01

    This book contains 24 selections. Some of the titles are: Positron Emission Tomography Instrumentation, Generator Systems for Positron Emitters, Reconstruction Algorithms, Cerebral Glucose Consumption: Methodology and Validation, Cerebral Blood Flow Tomography Using Xenon-133 Inhalation: Methods and Clinical Applications, PET Studies of Stroke, Cardiac Positron Emission Tomography, and Use of PET in Oncology

  9. National pollutants emission limits

    International Nuclear Information System (INIS)

    Chmielewski, A.G.; Pawelec, A.

    2011-01-01

    Fossil fuels are the main energy sources. Unfortunately the vast quantities of pollutants are emitted to the atmosphere during their combustion. These emissions lead to the environment degradation and affect human health. Therefore most of the countries have introduced the standards concerning emission control. These regulations for some countries are presented in the paper. (author)

  10. National pollutants emission limits

    Energy Technology Data Exchange (ETDEWEB)

    Chmielewski, A. G.; Pawelec, A. [Institute of Nuclear Chemistry and Technology, Warsaw (Poland)

    2011-07-01

    Fossil fuels are the main energy sources. Unfortunately the vast quantities of pollutants are emitted to the atmosphere during their combustion. These emissions lead to the environment degradation and affect human health. Therefore most of the countries have introduced the standards concerning emission control. These regulations for some countries are presented in the paper. (author)

  11. Database of emission lines

    Science.gov (United States)

    Binette, L.; Ortiz, P.; Joguet, B.; Rola, C.

    1998-11-01

    A widely accessible data bank (available through Netscape) and consiting of all (or most) of the emission lines reported in the litterature is being built. It will comprise objects as diverse as HII regions, PN, AGN, HHO. One of its use will be to define/refine existing diagnostic emission line diagrams.

  12. SIMULTANEOUS ULTRAVIOLET AND OPTICAL EMISSION-LINE PROFILES OF QUASARS: IMPLICATIONS FOR BLACK HOLE MASS DETERMINATION

    International Nuclear Information System (INIS)

    Ho, Luis C.; Dong Xiaobo; Goldoni, Paolo; Ponti, Gabriele; Greene, Jenny E.

    2012-01-01

    The X-shooter instrument on the Very Large Telescope was used to obtain spectra of seven moderate-redshift quasars simultaneously covering the spectral range ∼3000 Å to 2.5 μm. At z ≈ 1.5, most of the prominent broad emission lines in the ultraviolet to optical region are captured in their rest frame. We use this unique data set, which mitigates complications from source variability, to intercompare the line profiles of C IV λ1549, C III] λ1909, Mg II λ2800, and Hα and evaluate their implications for black hole (BH) mass estimation. We confirm that Mg II and the Balmer lines share similar kinematics and that they deliver mutually consistent BH mass estimates with minimal internal scatter (∼<0.1 dex) using the latest virial mass estimators. Although no virial mass formalism has yet been calibrated for C III], this line does not appear promising for such an application because of the large spread of its velocity width compared to lines of both higher and lower ionization; part of the discrepancy may be due to the difficulty of deblending C III] from its neighboring lines. The situation for C IV is complex and, because of the limited statistics of our small sample, inconclusive. On the one hand, slightly more than half of our sample (4/7) have C IV line widths that correlate reasonably well with Hα line widths, and their respective BH mass estimates agree to within ∼0.15 dex. The rest, on the other hand, exhibit exceptionally broad C IV profiles that overestimate virial masses by factors of 2-5 compared to Hα. As C IV is widely used to study BH demographics at high redshifts, we urgently need to revisit our analysis with a larger sample.

  13. Characterization of a direct dc-excited discharge in water by optical emission spectroscopy

    Energy Technology Data Exchange (ETDEWEB)

    Bruggeman, Peter; Leys, Christophe [Department of Applied Physics, Ghent University, Jozef Plateaustraat 22, B-9000 Ghent (Belgium); Schram, Daan [Department of Applied Physics, Technische Universiteit Eindhoven, PO Box 513, 5600 MB Eindhoven (Netherlands); Gonzalez, Manuel A [Departamento de Fisica Aplicada, Universidad de Valladolid, 47011 Valladolid (Spain); Rego, Robby [Flemish Institute of Technological Research, VITO Materials, Boeretang 200, B-2400 Mol (Belgium); Kong, Michael G [Department of Electronic and Electrical Engineering, Loughborough University, Loughborough, Leicestershire LE11 3TU (United Kingdom)], E-mail: peter.bruggeman@ugent.be

    2009-05-01

    Dc-excited discharges generated in water at the tip of a tungsten wire which is located at the orifice of a quartz capillary are investigated by time-averaged optical emission spectroscopy. Two distinctive discharge modes are observed. For small conductivities of the liquid the discharge is a streamer-like discharge in the liquid itself (liquid mode). For conductivities above typically 45 {mu}S cm{sup -1} a large vapour bubble is formed and a streamer discharge in this vapour bubble is observed (bubble mode). Plasma temperatures and electron densities are investigated for both modes. The gas temperature is estimated from the rotational temperature of N{sub 2}(C-B) and is 1600 {+-} 200 K for the bubble mode and 1900 {+-} 200 K for the liquid mode. The rotational temperature of OH(A-X) is up to 2 times larger and cannot be used as an estimate for the gas temperature. The rotational population distribution of OH(A), {nu} = 0 is also non-Boltzmann with a large overpopulation of high rotational states. This discrepancy in rotational temperatures is discussed in detail. Electron densities are obtained from the Stark broadening of the hydrogen Balmer beta line. The electron densities in the liquid mode are of the order of 10{sup 21} m{sup -3}. In the bubble mode electron densities are significantly smaller: (3-4) x 10{sup 20} m{sup -3}. These values are compared with the Stark broadening of the hydrogen alpha and gamma lines and with electron densities obtained from current density measurements. The chemical reactivities of the bubble and liquid modes are compared by means of the hydrogen peroxide production rate.

  14. Characterization of a direct dc-excited discharge in water by optical emission spectroscopy

    International Nuclear Information System (INIS)

    Bruggeman, Peter; Leys, Christophe; Schram, Daan; Gonzalez, Manuel A; Rego, Robby; Kong, Michael G

    2009-01-01

    Dc-excited discharges generated in water at the tip of a tungsten wire which is located at the orifice of a quartz capillary are investigated by time-averaged optical emission spectroscopy. Two distinctive discharge modes are observed. For small conductivities of the liquid the discharge is a streamer-like discharge in the liquid itself (liquid mode). For conductivities above typically 45 μS cm -1 a large vapour bubble is formed and a streamer discharge in this vapour bubble is observed (bubble mode). Plasma temperatures and electron densities are investigated for both modes. The gas temperature is estimated from the rotational temperature of N 2 (C-B) and is 1600 ± 200 K for the bubble mode and 1900 ± 200 K for the liquid mode. The rotational temperature of OH(A-X) is up to 2 times larger and cannot be used as an estimate for the gas temperature. The rotational population distribution of OH(A), ν = 0 is also non-Boltzmann with a large overpopulation of high rotational states. This discrepancy in rotational temperatures is discussed in detail. Electron densities are obtained from the Stark broadening of the hydrogen Balmer beta line. The electron densities in the liquid mode are of the order of 10 21 m -3 . In the bubble mode electron densities are significantly smaller: (3-4) x 10 20 m -3 . These values are compared with the Stark broadening of the hydrogen alpha and gamma lines and with electron densities obtained from current density measurements. The chemical reactivities of the bubble and liquid modes are compared by means of the hydrogen peroxide production rate.

  15. Observed Barium Emission Rates

    Science.gov (United States)

    Stenbaek-Nielsen, H. C.; Wescott, E. M.; Hallinan, T. J.

    1993-01-01

    The barium releases from the CRRES satellite have provided an opportunity for verifying theoretically calculated barium ion and neutral emission rates. Spectra of the five Caribbean releases in the summer of 1991 were taken with a spectrograph on board a U.S. Air Force jet aircraft. Because the line of sight release densities are not known, only relative rates could be obtained. The observed relative rates agree well with the theoretically calculated rates and, together with other observations, confirm the earlier detailed theoretical emission rates. The calculated emission rates can thus with good accuracy be used with photometric observations. It has been postulated that charge exchange between neutral barium and oxygen ions represents a significant source for ionization. If so. it should be associated with emissions at 4957.15 A and 5013.00 A, but these emissions were not detected.

  16. Carbon emissions in China

    International Nuclear Information System (INIS)

    Liu, Zhu

    2016-01-01

    This study analyzes the spatial-temporal pattern and processes of China's energy-related carbon emissions. Based on extensive quantitative analysis, it outlines the character and trajectory of China's energy-related carbon emissions during the period 1995-2010, examining the distribution pattern of China's carbon emissions from regional and sectoral perspectives and revealing the driving factors of China's soaring emission increase. Further, the book investigates the supply chain carbon emissions (the carbon footprints) of China's industrial sectors. Anthropogenic climate change is one of the most serious challenges currently facing humankind. China is the world's largest developing country, top primary energy consumer and carbon emitter. Achieving both economic growth and environmental conservation is the country's twofold challenge. Understanding the status, features and driving forces of China's energy-related carbon emissions is a critical aspect of attaining global sustainability. This work, for the first time, presents both key findings on and a systematic evaluation of China's carbon emissions from energy consumption. The results have important implications for global carbon budgets and burden-sharing with regard to climate change mitigation. The book will be of great interest to readers around the world, as it addresses a topic of truly global significance.

  17. Carbon emissions in China

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Zhu [Harvard Univ., Cambridge, MA (United States). Sustainability Science Program

    2016-07-01

    This study analyzes the spatial-temporal pattern and processes of China's energy-related carbon emissions. Based on extensive quantitative analysis, it outlines the character and trajectory of China's energy-related carbon emissions during the period 1995-2010, examining the distribution pattern of China's carbon emissions from regional and sectoral perspectives and revealing the driving factors of China's soaring emission increase. Further, the book investigates the supply chain carbon emissions (the carbon footprints) of China's industrial sectors. Anthropogenic climate change is one of the most serious challenges currently facing humankind. China is the world's largest developing country, top primary energy consumer and carbon emitter. Achieving both economic growth and environmental conservation is the country's twofold challenge. Understanding the status, features and driving forces of China's energy-related carbon emissions is a critical aspect of attaining global sustainability. This work, for the first time, presents both key findings on and a systematic evaluation of China's carbon emissions from energy consumption. The results have important implications for global carbon budgets and burden-sharing with regard to climate change mitigation. The book will be of great interest to readers around the world, as it addresses a topic of truly global significance.

  18. Emissions of road transport

    International Nuclear Information System (INIS)

    Maekelae, K.; Tuominen, A.

    2001-01-01

    Information on the emissions and energy consumption of different vehicles per transported amount of goods has up to last years been minimal. The unit emissions mean the amount of harmful compounds in the flue gases of a vehicle per service, time or energy unit. National three-year MOBILE 2-research program, started in 1999, determines the unit emissions of all the traffic sectors in Finland. VTT Building and Transport mainly carry out the research, but the Institute of Transportation Engineering of the Tampere University of Technology (TTKK) is responsible for a part of the research. The objective of the project is to create common rules for the determination of unit emissions values, and to determine the best possible values for Finnish conditions. Unit emission data is mainly needed for evaluation of the environmental impacts of production plants and other activities containing transportation of commodities. At the web sites of VTT Building and Transport there are about 60 pages of text and tables (about 4000 values) on unit emissions. The URL of the pages is http://www.vtt.fi/rte/projects/lipastoe/index.htm. These web pages present data on all the transportation sectors (road, railroad, water and air transportation), most of the materials concerning road transportation. Following compounds and values are included: CO, HC, NO x , particulates, SO 2 , CO 2 and energy consumption. Methane and nitrous oxide emissions values have also been presented

  19. Electronic Reporting of Air Emissions

    Science.gov (United States)

    EPA regulations require affected sources to perform emissions source tests, conduct continuous emissions monitoring, and submit compliance and emissions reports. This site provides technical resources and access for providing such submissions.

  20. Biogenic Emission Inventory System (BEIS)

    Science.gov (United States)

    Biogenic Emission Inventory System (BEIS) estimates volatile organic compound (VOC) emissions from vegetation and nitric oxide (NO) emission from soils. Recent BEIS development has been restricted to the SMOKE system

  1. National Greenhouse Gas Emission Inventory

    Data.gov (United States)

    U.S. Environmental Protection Agency — The National Greenhouse Gas Emission Inventory contains information on direct emissions of greenhouse gases as well as indirect or potential emissions of greenhouse...

  2. Emission sources and quantities

    International Nuclear Information System (INIS)

    Heinen, B.

    1991-01-01

    The paper examines emission sources and quantities for SO 2 and NO x . Natural SO 2 is released from volcanic sources and to a much lower extent from marsh gases. In nature NO x is mainly produced in the course of the chemical and bacterial denitrification processes going on in the soil. Manmade pollutants are produced in combustion processes. The paper concentrates on manmade pollution. Aspects discussed include: mechanism of pollution development; manmade emission sources (e.g. industry, traffic, power plants and domestic sources); and emission quantities and forecasts. 11 refs., 2 figs., 5 tabs

  3. Quantification in emission tomography

    International Nuclear Information System (INIS)

    Buvat, Irene

    2011-11-01

    The objective of this lecture is to understand the possibilities and limitations of the quantitative analysis of single photon emission computed tomography (SPECT) and positron emission tomography (PET) images. It is also to identify the conditions to be fulfilled to obtain reliable quantitative measurements from images. Content: 1 - Introduction: Quantification in emission tomography - definition and challenges; quantification biasing phenomena 2 - Main problems impacting quantification in PET and SPECT: problems, consequences, correction methods, results (Attenuation, scattering, partial volume effect, movement, un-stationary spatial resolution in SPECT, fortuitous coincidences in PET, standardisation in PET); 3 - Synthesis: accessible efficiency, know-how, Precautions, beyond the activity measurement

  4. Single photon emission tomography

    International Nuclear Information System (INIS)

    Buvat, Irene

    2011-09-01

    The objective of this lecture is to present the single photon emission computed tomography (SPECT) imaging technique. Content: 1 - Introduction: anatomic, functional and molecular imaging; Principle and role of functional or molecular imaging; 2 - Radiotracers: chemical and physical constraints, main emitters, radioisotopes production, emitters type and imaging techniques; 3 - Single photon emission computed tomography: gamma cameras and their components, gamma camera specifications, planar single photon imaging characteristics, gamma camera and tomography; 4 - Quantification in single photon emission tomography: attenuation, scattering, un-stationary spatial resolution, partial volume effect, movements, others; 5 - Synthesis and conclusion

  5. National Emission Inventory (NEI)

    Data.gov (United States)

    U.S. Environmental Protection Agency — This data exchange allows states to submit data to the US Environmental Protection Agency's National Emissions Inventory (NEI). NEI is a national database of air...

  6. 2011 NATA - Emissions Sources

    Data.gov (United States)

    U.S. Environmental Protection Agency — This dataset includes all emissions sources that were modeled in the 2011 National Air Toxics Assessment (NATA), inlcluding point, nonpoint, and mobile sources, and...

  7. Cardiac positron emission tomography

    International Nuclear Information System (INIS)

    Eftekhari, M.; Ejmalian, G.

    2003-01-01

    Positron emission tomography is an intrinsically tool that provide a unique and unparalleled approach for clinicians and researchers to interrogate the heart noninvasively. The ability to label substances of physiological interest with positron-emitting radioisotopes has permitted insight into normal blood flow and metabolism and the alterations that occur with disease states. Positron emission tomography of the heart has evolved as a unique, noninvasive approach for the assessment of myocardial perfusion, metabolism, and function. Because of the intrinsic quantitative nature of positron emission tomography measurements as well as the diverse compounds that can be labeled with positron- emitting radioisotopes, studies with positron emission tomography have provided rich insight into the physiology of the heart under diverse conditions

  8. Pulsar Emission Spectrum

    OpenAIRE

    Gruzinov, Andrei

    2013-01-01

    Emission spectrum is calculated for a weak axisymmetric pulsar. Also calculated are the observed spectrum, efficiency, and the observed efficiency. The underlying flow of electrons and positrons turns out to be curiously intricate.

  9. Biogenic Emission Sources

    Science.gov (United States)

    Biogenic emissions sources come from natural sources and need to accounted for in photochemical grid models. They are computed using a model which utilizes spatial information on vegetation and land use.

  10. Photon enhanced thermionic emission

    Science.gov (United States)

    Schwede, Jared; Melosh, Nicholas; Shen, Zhixun

    2014-10-07

    Photon Enhanced Thermionic Emission (PETE) is exploited to provide improved efficiency for radiant energy conversion. A hot (greater than 200.degree. C.) semiconductor cathode is illuminated such that it emits electrons. Because the cathode is hot, significantly more electrons are emitted than would be emitted from a room temperature (or colder) cathode under the same illumination conditions. As a result of this increased electron emission, the energy conversion efficiency can be significantly increased relative to a conventional photovoltaic device. In PETE, the cathode electrons can be (and typically are) thermalized with respect to the cathode. As a result, PETE does not rely on emission of non-thermalized electrons, and is significantly easier to implement than hot-carrier emission approaches.

  11. Positron emission tomography

    International Nuclear Information System (INIS)

    Iio, Masahiro

    1982-01-01

    Utilization of positron emission tomography was reviewed in relation to construction and planned construction of small-size medical cyclotrons, planned construction of positron cameras and utilization of short-lived radionuclides. (Chiba, N.)

  12. Radiated Emissions Test Approach

    Science.gov (United States)

    2015-10-02

    1. Draft Department of Transportation (DOT) Test Plan to Develop : Interference Tolerance Masks for GNSS Receivers in the L1 : Radiofrequency Band (1559 1610 MHz) provides high level : overview of radiated emissions test setup : 2. Presenta...

  13. Nanoscale Terahertz Emission Spectroscopy

    DEFF Research Database (Denmark)

    Pedersen, Pernille Klarskov; Kim, Hyewon; Colvin, Vicki L.

    By utilizing plasmonic coupling to an AFM probe, we demonstrate Laser Terahertz Emission Nanoscopy (LTEN) with sub-20 nm resolution. We demonstrate the resolution by imaging a single gold nanorod on an InAs substrate....

  14. Emission spectrochemical analysis

    International Nuclear Information System (INIS)

    Rives, R.D.; Bruks, R.R.

    1983-01-01

    The emission spectrochemical method of analysis based on the fact that atoms of elements can be excited in the electric arc or in the laser beam and will emit radiation with characteristic wave lengths is considered. The review contains the data on spectrochemical analysis, of liquids geological materials, scheme of laser microprobe. The main characteristics of emission spectroscopy, atomic absorption spectroscopy and X-ray fluorescent analysis, are aeneralized

  15. Positron emission tomography

    International Nuclear Information System (INIS)

    Chandrasekhar, Preethi; Himabindu, Pucha

    2000-01-01

    Positron Emission Tomography (PET) is a non-invasive nuclear imaging technique used to study different molecular pathways and anatomical structures. PET has found extensive applications in various fields of medicine viz. cardiology, oncology, psychiatry/psychology, neuro science and pulmonology. This study paper basically deals with the physics, chemistry and biology behind the PET technique. It discusses the methodology for generation of the radiotracers responsible for emission of positrons and the annihilation and detection techniques. (author)

  16. Positron emission tomography

    International Nuclear Information System (INIS)

    Dvorak, O.

    1989-01-01

    The principle is briefly described of positron emission tomography, and its benefits and constraints are listed. It is emphasized that positron emission tomography (PET) provides valuable information on metabolic changes in the organism that are otherwise only very difficult to obtain, such as brain diagnosis including relationships between mental disorders and the physiology and pathophysiology of the brain. A PET machine is to be installed in Czechoslovakia in the near future. (L.O.)

  17. Transient Infrared Emission Spectroscopy

    Science.gov (United States)

    Jones, Roger W.; McClelland, John F.

    1989-12-01

    Transient Infrared Emission Spectroscopy (TIRES) is a new technique that reduces the occurrence of self-absorption in optically thick solid samples so that analytically useful emission spectra may be observed. Conventional emission spectroscopy, in which the sample is held at an elevated, uniform temperature, is practical only for optically thin samples. In thick samples the emission from deep layers of the material is partially absorbed by overlying layers.1 This self-absorption results in emission spectra from most optically thick samples that closely resemble black-body spectra. The characteristic discrete emission bands are severely truncated and altered in shape. TIRES bypasses this difficulty by using a laser to heat only an optically thin surface layer. The increased temperature of the layer is transient since the layer will rapidly cool and thicken by thermal diffusion; hence the emission collection must be correlated with the laser heating. TIRES may be done with both pulsed and cw lasers.2,3 When a pulsed laser is used, the spectrometer sampling must be synchronized with the laser pulsing so that only emission during and immediately after each laser pulse is observed.3 If a cw laser is used, the sample must move rapidly through the beam. The hot, transient layer is then in the beam track on the sample at and immediately behind the beam position, so the spectrometer field of view must be limited to this region near the beam position.2 How much self-absorption the observed emission suffers depends on how thick the heated layer has grown by thermal diffusion when the spectrometer samples the emission. Use of a pulsed laser synchronized with the spectrometer sampling readily permits reduction of the time available for heat diffusion to about 100 acs .3 When a cw laser is used, the heat-diffusion time is controlled by how small the spectrometer field of view is and by how rapidly the sample moves past within this field. Both a very small field of view and a

  18. First detection of rotational CO line emission in a red giant branch star

    Science.gov (United States)

    Groenewegen, M. A. T.

    2014-01-01

    Context. For stars with initial masses below ~1 M⊙, the mass loss during the first red giant branch (RGB) phase dominates mass loss in the later asymptotic giant branch (AGB) phase. Nevertheless, mass loss on the RGB is still often parameterised by a simple Reimers law in stellar evolution models. Aims: To try to detect CO thermal emission in a small sample of nearby RGB stars with reliable Hipparcos parallaxes that were shown to have infrared excess in an earlier paper. Methods: A sample of five stars was observed in the CO J = 2-1 and J = 3-2 lines with the IRAM and APEX telescopes. Results: One star, the one with the largest mass-loss rate based on the previous analysis of the spectral energy distribution, was detected. The expansion velocity is unexpectedly large at 12 km s-1. The line profile and intensity are compared to the predictions from a molecular line emission code. The standard model predicts a double-peaked profile, while the observations indicate a flatter profile. A model that does fit the data has a much smaller CO envelope (by a factor of 3), and a CO abundance that is two times larger and/or a larger mass-loss rate than the standard model. This could indicate that the phase of large mass loss has only recently started. Conclusions: The detection of CO in an RGB star with a luminosity of only ~1300 L⊙ and a mass-loss rate as low as a few 10-9M⊙ yr-1 is important and the results also raise new questions. However, ALMA observations are required in order to study the mass-loss process of RGB stars in more detail, both for reasons of sensitivity (6 h of integration in superior weather at IRAM were needed to get a 4σ detection in the object with the largest detection probability), and spatial resolution (to determine the size of the CO envelope). Based on observations made with ESO telescopes at the La Silla Paranal Observatory under programme ID 091.D-0073 (ESO time) and 091.F-9322 (Swedish time). Based on observations with the Atacama

  19. Economical benzene emission reduction

    International Nuclear Information System (INIS)

    Schuetz, R.

    1999-01-01

    Benzene has been classified as a toxic compound under the Canadian Environmental Protection Act. This has prompted the Alberta Energy and Utilities Board (AEUB) to introduce specific reporting and monitoring guidelines for the oil and gas industry regarding excessive benzene emissions. Glycol dehydration units have been determined to be the major single source of benzene emissions causing air and soil pollution. DualTank Corp. has designed a condensation and storage tank unit to enhance emission reduction, odour elimination and liquid recovery from dehydration units. Their newly designed combined tank unit consists of a large, uninsulated surface area for cooling, and an excessive internal volume for increased retention time. The first prototype was installed in December 1998 at an Enerplus Resources Site. The system provides excellent benzene emission reduction and the elimination of odours and visual plumes. Effective January 1, 1999, the petroleum and natural gas industry must either clean up excessive emissions voluntarily or face government imposed regulations, facility shutdowns and/or fines. 1 fig

  20. Transportation Emissions: some basics

    DEFF Research Database (Denmark)

    Kontovas, Christos A.; Psaraftis, Harilaos N.

    2016-01-01

    transportation and especially carbon dioxide emissions are at the center stage of discussion by the world community through various international treaties, such as the Kyoto Protocol. The transportation sector also emits non-CO2 pollutants that have important effects on air quality, climate, and public health......Transportation is the backbone of international trade and a key engine driving globalization. However, there is growing concern that the Earth’s atmospheric composition is being altered by human activities, including transportation, which can lead to climate change. Air pollution from....... The main purpose of this chapter is to introduce some basic concepts that are relevant in the quest of green transportation logistics. First, we present the basics of estimating emissions from transportation activities, the current statistics and future trends, as well as the total impact of air emissions...

  1. Practical acoustic emission testing

    CERN Document Server

    2016-01-01

    This book is intended for non-destructive testing (NDT) technicians who want to learn practical acoustic emission testing based on level 1 of ISO 9712 (Non-destructive testing – Qualification and certification of personnel) criteria. The essential aspects of ISO/DIS 18436-6 (Condition monitoring and diagnostics of machines – Requirements for training and certification of personnel, Part 6: Acoustic Emission) are explained, and readers can deepen their understanding with the help of practice exercises. This work presents the guiding principles of acoustic emission measurement, signal processing, algorithms for source location, measurement devices, applicability of testing methods, and measurement cases to support not only researchers in this field but also and especially NDT technicians.

  2. Instantaneous wave emission model

    International Nuclear Information System (INIS)

    Kruer, W.L.

    1970-12-01

    A useful treatment of electrostatic wave emission by fast particles in a plasma is given. First, the potential due to a fast particle is expressed as a simple integration over the particle orbit; several interesting results readily follow. The potential in the wake of an accelerating particle is shown to be essentially that produced through local excitation of the plasma by the particle free-streaming about its instantaneous orbit. Application is made to one dimension, and it is shown that the wave emission and adsorption synchronize to the instantaneous velocity distribution function. Guided by these calculations, we then formulate a test particle model for computing the instantaneous wave emission by fast particles in a Vlasov plasma. This model lends itself to physical interpretation and provides a direct approach to many problems. By adopting a Fokker-Planck description for the particle dynamics, we calculate the broadening of the wave-particle resonance due to velocity diffusion and drag

  3. Tomography by positrons emission

    International Nuclear Information System (INIS)

    Mosconi, Sergio L.

    1999-01-01

    The tomography by positrons emission is a technology that allows to measure the concentration of positrons emission in a tri dimensional body through external measurements. Among the isotope emissions have carbon isotopes are ( 11 C), of the oxygen ( 15 O), of the nitrogen ( 13 N) that are three the element that constitute the base of the organic chemistry. Theses have on of the PET's most important advantages, since many biological interesting organic molecules can be tracer with these isotopes for the metabolism studies 'in vivo' through PET, without using organic tracers that modify the metabolism. The mentioned isotopes, also possess the characteristic of having short lifetime, that constitute on of PET's advantages from the dosimetric point of view. Among 11 C, 15 O, and 13 N, other isotopes that can be obtained of a generator as the 68 Ga and 82 Rb

  4. Carbon emissions control strategies

    International Nuclear Information System (INIS)

    Chandler, W.U.

    1990-01-01

    This study was undertaken to address a fundamental issue: the cost of slowing climate change. Experts in eight nations were asked to evaluate, using the best economic models available, the prospects for reducing fossil fuel-based carbon emissions in their respective nations. The nations selected as case studies include: the Soviet Union, Poland, the United States, Japan, Hungary, France, the United Kingdom, and Canada. As important contributors to the greenhouse effect, these industrialized nations must find ways to substantially reduce their emissions. This is especially critical given that developing nations' emissions are expected to rise in the coming decades in the search for economic development. Ten papers have been processed separately for inclusion in the appropriate data bases

  5. The relation of double peaks, observed in quartz hydride atomizers, to the fate of free atoms in the determination of arsenic and selenium by atomic absorption spectrometry

    Czech Academy of Sciences Publication Activity Database

    D'Ulivo, A.; Dědina, Jiří

    2002-01-01

    Roč. 57, č. 12 (2002), s. 2069-2079 ISSN 0584-8547 R&D Projects: GA ČR GA203/01/0453 Institutional research plan: CEZ:AV0Z4031919 Keywords : hydride atomization * hydride generation * atomic absortion spectrometry Subject RIV: CB - Analytical Chemistry, Separation Impact factor: 2.695, year: 2002

  6. Field emission electronics

    CERN Document Server

    Egorov, Nikolay

    2017-01-01

    This book is dedicated to field emission electronics, a promising field at the interface between “classic” vacuum electronics and nanotechnology. In addition to theoretical models, it includes detailed descriptions of experimental and research techniques and production technologies for different types of field emitters based on various construction principles. It particularly focuses on research into and production of field cathodes and electron guns using recently developed nanomaterials and carbon nanotubes. Further, it discusses the applications of field emission cathodes in new technologies such as light sources, flat screens, microwave and X-ray devices.

  7. Positron emission tomography

    International Nuclear Information System (INIS)

    Wienhard, K.; Heiss, W.D.

    1984-01-01

    The principles and selected clinical applications of positron emission tomography are described. In this technique a chemical compound is labeled with a positron emitting isotope and its biochemical pathway is traced by coincidence detection of the two annihilation photons. The application of the techniques of computed tomography allows to reconstruct the spatial distribution of the radioactivity within a subject. The 18 F-deoxyglucose method for quantitative measurement of local glucose metabolism is discussed in order to illustrate the possibilities of positron emission tomography to record physiological processes in vivo. (orig.) [de

  8. Positron emission tomography

    International Nuclear Information System (INIS)

    Paans, A.M.J.

    1981-01-01

    Positron emitting radiopharmaceuticals have special applications in in-vivo studies of biochemical processes. The combination of a cyclotron for the production of radionuclides and a positron emission tomograph for the registration of the distribution of radioactivity in the body enables the measurement of local radioactivity concentration in tissues, and opens up new possibilities in the diagnosis and examination of abnormalities in the metabolism. The principles and procedures of positron emission tomography are described and the necessary apparatus considered, with emphasis on the positron camera. The first clinical applications using 55 Co bloemycine for tumor detection are presented. (C.F.)

  9. Secondary ion emission

    International Nuclear Information System (INIS)

    Krohn, V.E.

    1976-01-01

    The Saha-Langmuir equation that describes the equilibrium emission process, surface ionization, has also been used to describe ion yields observed in the non-equilibrium emission process, sputtering. In describing sputtering, it is probably best to include the potential due to an image charge in the expression for negative as well as positive ion yield and to treat the work function and the temperature as parameters having limited physical significance. Arguments are presented to suggest that sputtered material is not emitted from a plasma. (Auth.)

  10. The 1600 Å Emission Bump in Protoplanetary Disks: A Spectral Signature of H2O Dissociation

    Science.gov (United States)

    France, Kevin; Roueff, Evelyne; Abgrall, Hervé

    2017-08-01

    The FUV continuum spectrum of many accreting pre-main sequence stars, Classical T Tauri Stars (CTTSs), does not continue smoothly from the well-studied Balmer continuum emission in the NUV, suggesting that additional processes contribute to the short-wavelength emission in these objects. The most notable spectral feature in the FUV continuum of some CTTSs is a broad emission approximately centered at 1600 Å, which has been referred to as the “1600 Å Bump.” The origin of this feature remains unclear. In an effort to better understand the molecular properties of planet-forming disks and the UV spectral properties of accreting protostars, we have assembled archival FUV spectra of 37 disk-hosting systems observed by the Hubble Space Telescope-Cosmic Origins Spectrograph. Clear 1600 Å Bump emission is observed above the smooth, underlying 1100-1800 Å continuum spectrum in 19/37 Classical T Tauri disks in the HST-COS sample, with the detection rate in transition disks (8/8) being much higher than that in primordial or non-transition sources (11/29). We describe a spectral deconvolution analysis to separate the Bump (spanning 1490-1690 Å) from the underlying FUV continuum, finding an average Bump luminosity L(Bump) ≈ 7 × 1029 erg s-1. Parameterizing the Bump with a combination of Gaussian and polynomial components, we find that the 1600 Å Bump is characterized by a peak wavelength λ o = 1598.6 ± 3.3 Å, with FWHM = 35.8 ± 19.1 Å. Contrary to previous studies, we find that this feature is inconsistent with models of H2 excited by electron -impact. We show that this Bump makes up between 5%-50% of the total FUV continuum emission in the 1490-1690 Å band and emits roughly 10%-80% of the total fluorescent H2 luminosity for stars with well-defined Bump features. Energetically, this suggests that the carrier of the 1600 Å Bump emission is powered by Lyα photons. We argue that the most likely mechanism is Lyα-driven dissociation of H2O in the inner disk, r

  11. Emission computed tomography

    International Nuclear Information System (INIS)

    Budinger, T.F.; Gullberg, G.T.; Huesman, R.H.

    1979-01-01

    This chapter is devoted to the methods of computer assisted tomography for determination of the three-dimensional distribution of gamma-emitting radionuclides in the human body. The major applications of emission computed tomography are in biological research and medical diagnostic procedures. The objectives of these procedures are to make quantitative measurements of in vivo biochemical and hemodynamic functions

  12. Emissions - problems and benefits

    International Nuclear Information System (INIS)

    Rossi, C.; Hurd, P.J.

    1992-01-01

    Air pollution due to emissions arising from the use of biomass in electricity generation is discussed. One of the most attractive aspects of the use of biomass is that there is no net increase of carbon dioxide in the atmosphere. During growth biomass absorbs CO 2 ; during combustion, either directly or as biomass derived fuels, it releases CO 2 , making a closed cycle. Another benefit from the use of biomass is its typically very low sulphur content and the consequent low sulphur oxide emissions from biomass-fired generation plants. Biomass is, however, less satisfactory in relation to nitrogen oxides (NO x ). Control of the nitrogen content of the biomass feedstock, advanced high technology combustion techniques and some post-engine treatment may all be necessary to comply with the legal limits for NO x emissions. The low ash content of biomass, particularly biomass derived oils, makes it possible to limit particulate emission to very low levels. It will be important, though, to bear in mind the need to limit the sodium and potassium content to below 1 ppm by mass in bio-oil to be used in a high temperature gas turbine. Levels of micropollutants will be low if the chlorine content of biomass feedstock is low. However, residence times at peak temperature in typical gas turbines combustors are too short to destroy some micropollutants. (UK)

  13. Positron emission tomography

    International Nuclear Information System (INIS)

    Pavuk, M.

    2003-12-01

    The aim of this project is to provide a simple summary of new trends in positron emission tomography and its basic physical principles. It provides thereby compendious introduction of the trends of the present development in diagnostics using PET systems. A review of available literature was performed. (author)

  14. Evoked acoustic emission

    DEFF Research Database (Denmark)

    Elberling, C; Parbo, J; Johnsen, N J

    1985-01-01

    Stimulated acoustic emissions were recorded in response to tonal stimuli at 60 dB p.e. SPL in a small group of normal-hearing adults. Power spectral analysis reveals that the evoked activity from each ear contains energy in preferential frequency bands and the change of stimulus frequency has only...

  15. Positron emission tomography

    NARCIS (Netherlands)

    Paans, AMJ

    Positron Emission Tomography (PET) is a method for determining biochemical and physiological processes in vivo in a quantitative way by using radiopharmaceuticals labelled with positron emitting radionuclides as C-11, N-13, O-15 and F-18 and by measuring the annihilation radiation using a

  16. Quantifying Anthropogenic Dust Emissions

    Science.gov (United States)

    Webb, Nicholas P.; Pierre, Caroline

    2018-02-01

    Anthropogenic land use and land cover change, including local environmental disturbances, moderate rates of wind-driven soil erosion and dust emission. These human-dust cycle interactions impact ecosystems and agricultural production, air quality, human health, biogeochemical cycles, and climate. While the impacts of land use activities and land management on aeolian processes can be profound, the interactions are often complex and assessments of anthropogenic dust loads at all scales remain highly uncertain. Here, we critically review the drivers of anthropogenic dust emission and current evaluation approaches. We then identify and describe opportunities to: (1) develop new conceptual frameworks and interdisciplinary approaches that draw on ecological state-and-transition models to improve the accuracy and relevance of assessments of anthropogenic dust emissions; (2) improve model fidelity and capacity for change detection to quantify anthropogenic impacts on aeolian processes; and (3) enhance field research and monitoring networks to support dust model applications to evaluate the impacts of disturbance processes on local to global-scale wind erosion and dust emissions.

  17. Emissions from urban waste

    International Nuclear Information System (INIS)

    Chacha, J.S.

    1998-01-01

    Indiscriminate emission of gases and fumes from improper storage, transport systems and wastes disposals have polluted the environment especially surface and underground water and air. This has irreversibly affects on the environment some of which can be devastating to life.Some of the potential adverse effects on environment include the ozone depletion, acid rain,soil degradation and climate change

  18. Improved Emission Spectrographic Facility

    International Nuclear Information System (INIS)

    Goergen, C.R.; Lethco, A.J.; Hosken, G.B.; Geckeler, D.R.

    1980-10-01

    The Savannah River Plant's original Emission Spectrographic Laboratory for radioactive samples had been in operation for 25 years. Due to the deteriorated condition and the fire hazard posed by the wooden glove box trains, a project to update the facility was funded. The new laboratory improved efficiency of operation and incorporated numerous safety and contamination control features

  19. Radioecology, emissions and immissions

    International Nuclear Information System (INIS)

    Tschurlovits, M.

    1988-01-01

    7 contributions are presented on radionuclide emissions from particular nuclear installations, on radionuclide migration and measurements in the environment, on the equipment of a particular laboratory and on setting limiting values. All of them are in INIS scope and are treated separately. (qui)

  20. Emissions Models and Other Methods to Produce Emission Inventories

    Science.gov (United States)

    An emissions inventory is a summary or forecast of the emissions produced by a group of sources in a given time period. Inventories of air pollution from mobile sources are often produced by models such as the MOtor Vehicle Emission Simulator (MOVES).

  1. Danish emission inventories for agriculture

    DEFF Research Database (Denmark)

    Mikkelsen, Mette Hjorth; Albrektsen, Rikke; Gyldenkærne, Steen

    . This report contains a description of the emissions from the agricultural sector from 1985 to 2009. Furthermore, the report includes a detailed description of methods and data used to calculate the emissions, which is based on national methodologies as well as international guidelines. For the Danish...... emissions calculations and data management an Integrated Database model for Agricultural emissions (IDA) is used. The emission from the agricultural sector includes emission of the greenhouse gases methane (CH4), nitrous oxide (N2O), ammonia (NH3), particulate matter (PM), non-methane volatile organic...... compounds (NMVOC) and other pollutants related to the field burning of agricultural residue such as NOx, CO2, CO, SO2, heavy metals, dioxin and PAH. The ammonia emission from 1985 to 2009 has decreased from 119 300 tonnes of NH3 to 73 800 tonnes NH3, corresponding to a 38 % reduction. The emission...

  2. Pre-equilibrium gamma emissions

    International Nuclear Information System (INIS)

    Ghosh, Sudip

    1993-01-01

    Together with the direct reaction and the compound nuclear emissions the pre-equilibrium (PEQ) or pre-compound processes give a fairly complete picture of nuclear reactions induced by light ions at energies of some tens of MeV. PEQ particle emissions covering the higher energy continuum spectra have been investigated in detail both experimentally and theoretically. In contrast, very little work has been done on PEQ γ- emissions. The reason is that in spite of extensive work done on PEQ particle emissions, the mechanism is not yet fully understood. Also, the PEQ γ-emission cross-sections (∼ micro barns) are very small compared to the PEQ particle emission cross-sections (∼ milli barns). Yet apart from the academic interest the understanding of PEQ γ-emissions is important for applied fusion research etc. In this paper the PEQ γ-emissions is discussed and the work done in this field is reviewed. (author). 14 refs

  3. Estimating Emissions from Railway Traffic

    DEFF Research Database (Denmark)

    Jørgensen, Morten W.; Sorenson, Spencer C.

    1998-01-01

    Several parameters of importance for estimating emissions from railway traffic are discussed, and typical results presented. Typical emissions factors from diesel engines and electrical power generation are presented, and the effect of differences in national electrical generation sources...

  4. Future Emissions from Railway Traffic

    DEFF Research Database (Denmark)

    Sorenson, Spencer C.

    1998-01-01

    In investigation of the expected development in factors which influence railway energy consumption and emissions. Traffic factors such as train speed, load, an occupancy were considered. Tehcnical factors such an emissions factors, fleet composition and train weight were also considered. An estim......In investigation of the expected development in factors which influence railway energy consumption and emissions. Traffic factors such as train speed, load, an occupancy were considered. Tehcnical factors such an emissions factors, fleet composition and train weight were also considered...

  5. Global emissions inventories

    International Nuclear Information System (INIS)

    Dignon, J.

    1995-07-01

    Atmospheric chemistry determines the concentrations of most of the important greenhouse gases except for carbon dioxide. The rate of removal of the greenhouse gases from the atmosphere is also controlled by atmospheric chemistry. The indirect effects of chemical forcing resulting from the chemical interactions of other species can also affect the concentrations of radiatively important gases such as ozone. In order to establish the contribution of any possible climatic change attributable to individual greenhouse gases, spatially and temporally resolved estimates of their emissions need to be established. Unfortunately, for most of the radiatively important species the global magnitudes of their individual fluxes are not known to better than a factor of two and their spatial distributions are even more poorly characterized. Efforts to estimate future projections of potential impacts and to monitor international agreements will require continued research to narrow the uncertainties of magnitude and geographical distribution of emissions

  6. Positron emission tomography

    International Nuclear Information System (INIS)

    Yamamoto, Y.L.; Thompson, C.J.; Diksic, M.; Meyer, E.; Feindel, W.H.

    1984-01-01

    One of the most exciting new technologies introduced in the last 10 yr is positron emission tomography (PET). PET provides quantitative, three-dimensional images for the study of specific biochemical and physiological processes in the human body. This approach is analogous to quantitative in-vivo autoradiography but has the added advantage of permitting non-invasive in vivo studies. PET scanning requires a small cyclotron to produce short-lived positron emitting isotopes such as oxygen-15, carbon-11, nitrogen-13 and fluorine-18. Proper radiochemical facilities and advanced computer equipment are also needed. Most important, PET requires a multidisciplinary scientific team of physicists, radiochemists, mathematicians, biochemists and physicians. The most recent trends are reviewed in the imaging technology, radiochemistry, methodology and clinical applications of positron emission tomography. (author)

  7. Forecasting carbon dioxide emissions.

    Science.gov (United States)

    Zhao, Xiaobing; Du, Ding

    2015-09-01

    This study extends the literature on forecasting carbon dioxide (CO2) emissions by applying the reduced-form econometrics approach of Schmalensee et al. (1998) to a more recent sample period, the post-1997 period. Using the post-1997 period is motivated by the observation that the strengthening pace of global climate policy may have been accelerated since 1997. Based on our parameter estimates, we project 25% reduction in CO2 emissions by 2050 according to an economic and population growth scenario that is more consistent with recent global trends. Our forecasts are conservative due to that we do not have sufficient data to fully take into account recent developments in the global economy. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. Emission spectrometric isotope analyzer

    International Nuclear Information System (INIS)

    Mauersberger, K.; Meier, G.; Nitschke, W.; Rose, W.; Schmidt, G.; Rahm, N.; Andrae, G.; Krieg, D.; Kuefner, W.; Tamme, G.; Wichlacz, D.

    1982-01-01

    An emission spectrometric isotope analyzer has been designed for determining relative abundances of stable isotopes in gaseous samples in discharge tubes, in liquid samples, and in flowing gaseous samples. It consists of a high-frequency generator, a device for defined positioning of discharge tubes, a grating monochromator with oscillating slit and signal converter, signal generator, window discriminator, AND connection, read-out display, oscillograph, gas dosing device and chemical conversion system with carrier gas source and vacuum pump

  9. Positron emission tomography

    International Nuclear Information System (INIS)

    Marchenkov, N.S.

    2000-01-01

    The foundations of the positron emission tomography (PET), widely used for the medical diagnostics, are considered. The brief description of the cyclotron for production of radionuclides, applied in the PET, the target devices for manufacturing the position emitters, the moduli for the radiopharmaceuticals synthesis (RPS) for the PET is presented. The necessity and concept of complete automation of the RPS for the PET are discussed [ru

  10. Power plant emissions reduction

    Science.gov (United States)

    Anand, Ashok Kumar; Nagarjuna Reddy, Thirumala Reddy

    2015-10-20

    A system for improved emissions performance of a power plant generally includes an exhaust gas recirculation system having an exhaust gas compressor disposed downstream from the combustor, a condensation collection system at least partially disposed upstream from the exhaust gas compressor, and a mixing chamber in fluid communication with the exhaust gas compressor and the condensation collection system, where the mixing chamber is in fluid communication with the combustor.

  11. Field emission in RF cavities

    International Nuclear Information System (INIS)

    Bonin, B.

    1996-01-01

    Electron field emission limits the accelerating gradient in superconducting cavities. It is shown how and why it is an important problem. The phenomenology of field emission is then described, both in DC and RF regimes. Merits of a few plausible 'remedies' to field emission are discussed. (author)

  12. Emission trading: A discussion paper

    International Nuclear Information System (INIS)

    1992-05-01

    Emission trading is a market-based incentive program designed to control air emissions in which a cap is placed on the total quantity of pollutants allowed to be emitted in an airshed. Appropriate shares of this amount are allocated among participating emission sources, and participants can buy or sell their shares. Advantages of emission trading include its potential to achieve air emission targets at a lower cost than the traditional command and control approach, and its ability to accommodate economic growth without compromising environmental quality. A study was conducted to evaluate the potential use of emission trading programs to achieve emission reduction goals set for nitrogen oxides, volatile organic compounds (VOC), and sulfur oxides. Emission trading programs in the USA are reviewed and a set of factors important for the success of emission trading are identified. Key policy and design issues related to an emission trading program are identified, explained, and discussed. Administrative issues are then analyzed, such as legislative authority, monitoring and enforcement requirements, and trading between jurisdictions. A preliminary assessment of emission trading for control of NOx and VOC in the Lower Fraser Valley indicates that emission trading would be feasible, but legislative authority to implement such a program would have to be introduced

  13. Emissions trading stalls

    International Nuclear Information System (INIS)

    Milne, R.

    1998-01-01

    A brief article examines prospects for emission trading of greenhouse gas emissions in the UK. Topics covered include a checklist of principles for any trading system, plans for oil companies to do it internally, the possibility for carbon sinks as well as emissions and developments around the world. (UK) alt. Directly northward of the Sigsbee Escarpment, there is a relatively thin, low-velocity zone known as a ''gumbo zone''. Here two other pressure compartments are proposed. The origin of them is two-fold. First, initial sedimentation consists of pelagic clay draped over oceanic and transitional crust. Later, as the continental margin progrades nearer sedimentation becomes hemipelagic and coarser as gravity-driven sediments predominate. Secondly, as the salt wedge overrides a given spot of the basement, it is possible to develop a shear couple between the migrating salt and the stationary basement. The resultant shear (the site of the next strike-slip fault) may change pressures beneath the salt such that the shear may create two pressure compartments. The differences between the two compartments may be accentuated by lithologic changes caused by depositional mechanisms. (author)

  14. White emission via electroplex emission from two blue materials.

    Science.gov (United States)

    Li, Junming; Song, Dandan; Zhao, Suling; Zhang, Fujun; Xu, Zheng; Song, Jinglu; Lu, Lifang; Liu, Xiaodong; Wang, Yongsheng

    2010-03-01

    Influences of electric fields on the emission from organic light-emitting diodes (OLEDs) based on poly (N-vinylcarbazole) (PVK); 2, 9-dimethyl-4, 7-diphenyl-1, 10-phenanthroline (BCP); and tris (8-hydroxyquinoline) aluminum (Alq3) were studied. There are three emission peaks at 420 nm, 520 nm, and 620 nm of the device ITO/PEDOT: PSS/PVK/BCP/LiF/Al under different driving voltages. The emissions at 420 nm and 520 nm should be from the exciton emission of PVK and Alq3, respectively. The last emission at 620 nm could be attributed to electroplex emission at the interface between the PVK and BCP layers. A high intensity white emission via electroplex formation was obtained with Commission International d'Eclairage (CIE) coordinates (0.33, 0.34) at 15 V, which is very close to the equienergy white point (0.33, 0.33).

  15. Emission inventory for fugitive emissions from fuel in Denmark

    DEFF Research Database (Denmark)

    Plejdrup, Marlene Schmidt; Nielsen, Ole-Kenneth; Nielsen, Malene

    This report presents the methodology and data used in the Danish inventory of fugitive emissions from fuels for the years until 2013. The inventory of fugitive emissions includes CO2, CH4, N2O, SO2, NOx, NMVOC, CO, particulate matter, Black carbon, heavy metals, dioxin and PAHs. In 2013 the total...... Danish emission of greenhouse gasses was 54 584 Gg CO2 equivalents. Fugitive emissions from fuels account for 387 Gg CO2 equivalents or approximately 1 %. The major part of the fugitive emissions are emitted as CO2 (61 %) mainly from flaring in upstream oil and gas production. The major source...... of fugitive CH4 emission is production of oil and gas in the North Sea, refining of oil and loading of oil onto ships both offshore and onshore. The fugitive emissions of NMVOC originate for the major part from oil and gas production, loading of ships, transmission and distribution of oil, and to a less...

  16. Energetic neutral atom precipitation during magnetic storms: optical emission, ionization, and energy deposition at low and middle latitudes

    International Nuclear Information System (INIS)

    Tinsley, B.A.

    1979-01-01

    Observations of hydrogen Balmer β and He + 4686-A emission made at Huancayo, Peru, during two magnetic storms are consistent with the expectations of energetic neutral atom precipitation resulting from charge exchange loss of ring current ions and support the view that charge exchange is the major loss process for larger geomagnetic storms. The intensities are consistent with previous satellite observations of the emission (called the equatorial aurora) and when translated into ionization rates for the upper E region give production rates in order of magnitude larger than normal nighttime levels. Such ionization enhancements have previously been measured by ionosondes and incoherent scatter at low latitudes and attributed to electron precipitation. New calculations of the latitude variation correct earlier work and show that for a ring current with pitch angle distribution isotropic to the loss cone, located on shells of L value 2 to 6, the maximum influx rate of precipitating neutrals is found at magnetic latitudes 25 0 to 50 0 . Most of the energetic neutrals are lost to interplanetary space, and the fraction impacting the thermosphere has been recalculated to range from 11 to 2.2% for L values 2 to 6. For a typical magnetic storm with energy loss rate due to charge exchange, the equivalent to a Dst rate of change of 20 n T/h, the energy input into the thermosphere at the latitude of maximum is calculated to be 0.15 to 0.05 mW/m 2 from L shells 2 to 6. The ionization production can be of the order of 10 ions cm 3 s 1 at 140 km, and optical emission, of the order of 1 rayleigh (R), both varying according to the species and energy of the impacting neutrals (i.e., the former ring current ions). The latitude distribution shrinks toward the equator after injection has ceased, as the magnetospheric pitch angle distribution evolves toward 90 0 , on a time scale (for protons <30 keV at L=3) of the order of 2 hours

  17. THE NEW ECLIPSING CV MASTER OTJ192328.22+612413.5—A POSSIBLE SW SEXTANTIS STAR

    International Nuclear Information System (INIS)

    Kennedy, M. R.; Callanan, P.; Bouanane, S.; Garnavich, P. M.; Rose, B. M.; Szkody, P.; Bendjoya, P.; Abe, L.; Rivet, J. P.; Suarez, O.

    2016-01-01

    We present optical photometry and spectroscopy of the new eclipsing cataclysmic variable MASTER OTJ192328.22+612413.5, discovered by the MASTER team. We find the orbital period to be P = 0.16764612(5) day/4.023507(1) hr. The depth of the eclipse (2.9 ± 0.1 mag) suggests that the system is nearly edge on, and modeling of the system confirms the inclination to be between 81.°3 and 83.°6. The brightness outside the eclipse varies between observations, with a change of 1.6 ± 0.1 mag. Spectroscopy reveals double-peaked Balmer emission lines. By using spectral features matching a late M-type companion, we bound the distance to be 750 ± 250 pc, depending on the companion’s spectral type. The source displays 2 mag brightness changes on timescales of days. The amplitude of these changes, along with the spectrum at the faint state, suggest that the system is possibly a dwarf nova. The lack of any high-excitation He ii lines suggests that this system is not magnetically dominated. The light curve in both quiescence and outburst resembles that of Lanning 386, implying MASTER OTJ192328.22+612413.5 is a possible cross between a dwarf nova and a SW Sextantis star.

  18. THE NEW ECLIPSING CV MASTER OTJ192328.22+612413.5—A POSSIBLE SW SEXTANTIS STAR

    Energy Technology Data Exchange (ETDEWEB)

    Kennedy, M. R.; Callanan, P.; Bouanane, S. [Department of Physics, University College Cork, Cork (Ireland); Garnavich, P. M.; Rose, B. M. [Department of Physics, University of Notre Dame, Notre Dame, IN 46556 (United States); Szkody, P. [Department of Astronomy, University of Washington, Seattle, WA (United States); Bendjoya, P.; Abe, L.; Rivet, J. P.; Suarez, O., E-mail: markkennedy@umail.ucc.ie [Laboratoire Lagrange UMR 7293, Université de Nice Sophia-Antipolis, Observatoire de la Côte d’Azur (France)

    2016-07-01

    We present optical photometry and spectroscopy of the new eclipsing cataclysmic variable MASTER OTJ192328.22+612413.5, discovered by the MASTER team. We find the orbital period to be P = 0.16764612(5) day/4.023507(1) hr. The depth of the eclipse (2.9 ± 0.1 mag) suggests that the system is nearly edge on, and modeling of the system confirms the inclination to be between 81.°3 and 83.°6. The brightness outside the eclipse varies between observations, with a change of 1.6 ± 0.1 mag. Spectroscopy reveals double-peaked Balmer emission lines. By using spectral features matching a late M-type companion, we bound the distance to be 750 ± 250 pc, depending on the companion’s spectral type. The source displays 2 mag brightness changes on timescales of days. The amplitude of these changes, along with the spectrum at the faint state, suggest that the system is possibly a dwarf nova. The lack of any high-excitation He ii lines suggests that this system is not magnetically dominated. The light curve in both quiescence and outburst resembles that of Lanning 386, implying MASTER OTJ192328.22+612413.5 is a possible cross between a dwarf nova and a SW Sextantis star.

  19. Austrian emission under international comparison

    International Nuclear Information System (INIS)

    Anderl, M.; Gager, M.; Gugele, B.; Huttunen, K.; Kurzweil, A.; Poupa, S.; Ritter, M.; Wappel, D.; Wieser, M.

    2004-01-01

    A comparison between anthropogenic emissions of CO 2 , CH 4 , N 2 O, SO 2 , NO x , volatile organic compounds (NMVOC), NH 3 and CO from the European Union, European Union candidate countries and Austria is presented. Data covers the years 1999-2001 and the emissions values per habitant are provided as well as a comparison against the Kyoto goals. In the middle of the European mean values are the austrian emissions values, austrian SO 2 emissions are the smallest, however CH 4 , CO and NMVOC emissions are over the European mean values. 8 figs., 6 tabs. (nevyjel)

  20. Aspects related to 'emission trading'

    International Nuclear Information System (INIS)

    Tutuianu, Ovidiu

    1999-01-01

    The paper presents the aspects of international GHG (greenhouse gases) emission trading, such as: quality of GHG emission data, possible partners, monitoring activity, market mechanisms and difficulties. The following conclusions are drown: - debates on international trade with GHG emissions are currently in a very early stage; - actions are possible and feasible, particularly after Kyoto Conference, as versatile mechanism (besides the Joint Implementation Projects) which have in view the lowering of the global emission costs in different zones of the planet; - difficulties concerning monitoring, reporting and verification, practically preclude implementing a system of emission trading covering all the GHG, all the sources and reservoirs; - an international viable system of emission trading could initiate with a limited number of participants and consideration of only emission categories easy to be confined and surveyed; - existence of a national market and corresponding institutions for monitoring which could booster an international system development

  1. Experimental investigation of n-butanol/diesel fuel blends and n-butanol fumigation – Evaluation of engine performance, exhaust emissions, heat release and flammability analysis

    International Nuclear Information System (INIS)

    Şahin, Zehra; Durgun, Orhan; Aksu, Orhan N.

    2015-01-01

    Highlights: • n-Butanol/diesel fuel blends and n-butanol fumigation investigated experimentally. • Flammability analysis of n-butanol performed. • Smoke decreases significantly for n-butanol/diesel fuel blends and n-butanol fumigation. • HC emission increases significantly for n-butanol/diesel fuel blends and n-butanol fumigation. • 2% n-Butanol/diesel fuel blend decreases slightly BSFC. - Abstract: The aim of this paper is to investigate and compare the effects of n-butanol/diesel fuel blends (nBDFBs) and n-butanol fumigation (nBF) on the engine performance and exhaust emissions in a turbocharged automobile diesel engine. Also, evaluations based on heat release and flammability analysis have been done. Experiments have been performed for various n-nBDFBs and nBF at different engine speeds and loads. For nBDFBs and nBF tests; nB2, nB4 and nB6 and nBF2, nBF4 and nBF6n-butanol percentages were selected. Here, for example nB2 and nBF2 contains 2% n-butanol and 98% diesel fuel by volume respectively. The test results showed that smoke decreases significantly by applying both of these two methods. However, decrement ratios of smoke for fumigation method are higher than that of blend method. NO x emission decreases for nB2, but it increases for nB4 and nB6 at selected engine speeds and loads. NO x emission decreases generally for nBF. For nB2 and nB4, BSFC decreases slightly but it increases for nB6. For nBF, BSFC increases at all of the test conditions. Adding n-butanol to diesel fuel becomes expensive for two methods. For nBDFBs, heat release rate (HRR) diagrams exhibit similar typical characteristic to NDF. However, for nBF, HRR shows slightly different pattern from NDF and a double peak is observed in the HRR diagram. The first peak occurs earlier than NDF and the second peak takes places later. In addition, this diagram shows that the first peak becomes larger and the second peak diminishes as n-butanol ratio is increased. Because of pilot injection of

  2. Very Broad [O III] λλ4959, 5007 Emission from the NGC 4472 Globular Cluster RZ 2109 and Implications for the Mass of Its Black Hole X-Ray Source

    Science.gov (United States)

    Zepf, Stephen E.; Stern, Daniel; Maccarone, Thomas J.; Kundu, Arunav; Kamionkowski, Marc; Rhode, Katherine L.; Salzer, John J.; Ciardullo, Robin; Gronwall, Caryl

    2008-08-01

    We present Keck LRIS spectroscopy of the black hole-hosting globular cluster RZ 2109 in the Virgo elliptical galaxy NGC 4472. We find that this object has extraordinarily broad [O III] λ5007 and [O III] λ4959 emission lines, with velocity widths of approximately 2000 km s-1. This result has significant implications for the nature of this accreting black hole system and the mass of the globular cluster black hole. We show that the broad [O III] λ5007 emission must arise from material driven at high velocity from the black hole system. This is because the volume available near the black hole is too small by many orders of magnitude to have enough [O III]-emitting atoms to account for the observed L([O III] λ5007) at high velocities, even if this volume is filled with oxygen at the critical density for [O III] λ5007. The Balmer emission is also weak, indicating the observed [O III] is not due to shocks. We therefore conclude that the [O III] λλ4959, 5007 is produced by photoionization of material driven across the cluster. The only known way to drive significant material at high velocity is for a system accreting mass near or above its Eddington limit, which indicates a stellar-mass black hole. Since it is dynamically implausible to form an accreting stellar-mass black hole system in a globular cluster with an intermediate-mass black hole (IMBH), it appears this massive globular cluster does not have an IMBH. We discuss further tests of this conclusion, and its implications for the MBH - Mstellar and MBH - σ relations. Based on observations made at the W. M. Keck Observatory, which is operated as a scientific partnership among the California Institute of Technology, the University of California, and the National Aeronautics and Space Administration. The Observatory was made possible by the generous financial support of the W. M. Keck Foundation.

  3. Positron Emission Tomography (PET)

    International Nuclear Information System (INIS)

    Welch, M.J.

    1990-01-01

    Positron emission tomography (PET) assesses biochemical processes in the living subject, producing images of function rather than form. Using PET, physicians are able to obtain not the anatomical information provided by other medical imaging techniques, but pictures of physiological activity. In metaphoric terms, traditional imaging methods supply a map of the body's roadways, its, anatomy; PET shows the traffic along those paths, its biochemistry. This document discusses the principles of PET, the radiopharmaceuticals in PET, PET research, clinical applications of PET, the cost of PET, training of individuals for PET, the role of the United States Department of Energy in PET, and the futures of PET. 22 figs

  4. Positron Emission Tomography (PET)

    Energy Technology Data Exchange (ETDEWEB)

    Welch, M.J.

    1990-01-01

    Positron emission tomography (PET) assesses biochemical processes in the living subject, producing images of function rather than form. Using PET, physicians are able to obtain not the anatomical information provided by other medical imaging techniques, but pictures of physiological activity. In metaphoric terms, traditional imaging methods supply a map of the body's roadways, its, anatomy; PET shows the traffic along those paths, its biochemistry. This document discusses the principles of PET, the radiopharmaceuticals in PET, PET research, clinical applications of PET, the cost of PET, training of individuals for PET, the role of the United States Department of Energy in PET, and the futures of PET. 22 figs.

  5. Acoustic emission intrusion detector

    International Nuclear Information System (INIS)

    Carver, D.W.; Whittaker, J.W.

    1980-01-01

    An intrusion detector is provided for detecting a forcible entry into a secured structure while minimizing false alarms. The detector uses a piezoelectric crystal transducer to sense acoustic emissions. The transducer output is amplified by a selectable gain amplifier to control the sensitivity. The rectified output of the amplifier is applied to a Schmitt trigger circuit having a preselected threshold level to provide amplitude discrimination. Timing circuitry is provided which is activated by successive pulses from the Schmitt trigger which lie within a selected time frame for frequency discrimination. Detected signals having proper amplitude and frequency trigger an alarm within the first complete cycle time of a detected acoustical disturbance signal

  6. Positron Emission Tomography (PET)

    Science.gov (United States)

    Welch, M. J.

    1990-01-01

    Positron emission tomography (PET) assesses biochemical processes in the living subject, producing images of function rather than form. Using PET, physicians are able to obtain not the anatomical information provided by other medical imaging techniques, but pictures of physiological activity. In metaphoric terms, traditional imaging methods supply a map of the body's roadways, its, anatomy; PET shows the traffic along those paths, its biochemistry. This document discusses the principles of PET, the radiopharmaceuticals in PET, PET research, clinical applications of PET, the cost of PET, training of individuals for PET, the role of the United States Department of Energy in PET, and the futures of PET.

  7. Acoustic emission intrusion detector

    International Nuclear Information System (INIS)

    Carver, D.W.

    1978-01-01

    In order to improve the security of handling special nuclear materials at the Oak Ridge Y-12 Plant, a sensitive acoustic emission detector has been developed that will detect forcible entry through block or tile walls, concrete floors, or concrete/steel vault walls. A small, low-powered processor was designed to convert the output from a sensitive, crystal-type acoustic transducer to an alarm relay signal for use with a supervised alarm loop. The unit may be used to detect forcible entry through concrete, steel, block, tile, and/or glass

  8. Positron emission tomography

    CERN Document Server

    Paans, A M J

    2006-01-01

    Positron Emission Tomography (PET) is a method for measuring biochemical and physiological processes in vivo in a quantitative way by using radiopharmaceuticals labelled with positron emitting radionuclides such as 11C, 13N, 15O and 18F and by measuring the annihilation radiation using a coincidence technique. This includes also the measurement of the pharmacokinetics of labelled drugs and the measurement of the effects of drugs on metabolism. Also deviations of normal metabolism can be measured and insight into biological processes responsible for diseases can be obtained. At present the combined PET/CT scanner is the most frequently used scanner for whole-body scanning in the field of oncology.

  9. VOC emissions control systems

    International Nuclear Information System (INIS)

    Spessard, J.E.

    1993-01-01

    The air pollution control equipment marketplace offers many competing technologies for controlling emissions of volatile organic compounds (VOC) in air. If any technology was economically and technically superior under all conditions, it would be the only one on the market. In fact, each technology used to control VOCs is superior under some set of conditions. The reasons for choosing one control technology over another are situation-specific. Some general guidelines to VOC control technologies and the situations where each may be appropriate are presented in this article. The control technologies and applications are summarized in a table

  10. The Kinematics of Multiple-peaked Lyα Emission in Star-forming Galaxies at z ~ 2-3

    Science.gov (United States)

    Kulas, Kristin R.; Shapley, Alice E.; Kollmeier, Juna A.; Zheng, Zheng; Steidel, Charles C.; Hainline, Kevin N.

    2012-01-01

    We present new results on the Lyα emission-line kinematics of 18 z ~ 2-3 star-forming galaxies with multiple-peaked Lyα profiles. With our large spectroscopic database of UV-selected star-forming galaxies at these redshifts, we have determined that ~30% of such objects with detectable Lyα emission display multiple-peaked emission profiles. These profiles provide additional constraints on the escape of Lyα photons due to the rich velocity structure in the emergent line. Despite recent advances in modeling the escape of Lyα from star-forming galaxies at high redshifts, comparisons between models and data are often missing crucial observational information. Using Keck II NIRSPEC spectra of Hα (z ~ 2) and [O III]λ5007 (z ~ 3), we have measured accurate systemic redshifts, rest-frame optical nebular velocity dispersions, and emission-line fluxes for the objects in the sample. In addition, rest-frame UV luminosities and colors provide estimates of star formation rates and the degree of dust extinction. In concert with the profile sub-structure, these measurements provide critical constraints on the geometry and kinematics of interstellar gas in high-redshift galaxies. Accurate systemic redshifts allow us to translate the multiple-peaked Lyα profiles into velocity space, revealing that the majority (11/18) display double-peaked emission straddling the velocity-field zero point with stronger red-side emission. Interstellar absorption-line kinematics suggest the presence of large-scale outflows for the majority of objects in our sample, with an average measured interstellar absorption velocity offset of langΔv absrang = -230 km s-1. A comparison of the interstellar absorption kinematics for objects with multiple- and single-peaked Lyα profiles indicate that the multiple-peaked objects are characterized by significantly narrower absorption line widths. We compare our data with the predictions of simple models for outflowing and infalling gas distributions around

  11. Properties of Dense Cores Embedded in Musca Derived from Extinction Maps and {sup 13}CO, C{sup 18}O, and NH{sub 3} Emission Lines

    Energy Technology Data Exchange (ETDEWEB)

    Machaieie, Dinelsa A.; Vilas-Boas, José W.; Wuensche, Carlos A. [Instituto Nacional de Pesquisas Espaciais, Av. dos Astronautas 1.758—Jardim da Granja, CEP-12227-010, São José dos Campos, SP (Brazil); Racca, Germán A. [Universidade do Estado do Rio Grande do Norte, Faculdade de Ciências Exatas e Naturais/Depto. de Física, Campus Universitário Central, Setor II BR 110, KM 48, Rua Prof. António Campos, Costa e Silva 59610-090—Mossoró-RN (Brazil); Myers, Philip C. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Hickel, Gabriel R., E-mail: dinelsa.machaieie@inpe.br [Universidade Federal de Itajubá, Departamento de Física, Av. BPS, 1303, Pinheirinho, Itajubá, MG (Brazil)

    2017-02-10

    Using near-infrared data from the Two Micron All Sky Survey catalog and the Near Infrared Color Excess method, we studied the extinction distribution in five dense cores of Musca, which show visual extinction greater than 10 mag and are potential sites of star formation. We analyzed the stability in four of them, fitting their radial extinction profiles with Bonnor–Ebert isothermal spheres, and explored their properties using the J = 1–0 transition of {sup 13}CO and C{sup 18}O and the J = K = 1 transition of NH{sub 3}. One core is not well described by the model. The stability parameter of the fitted cores ranges from 4.5 to 5.7 and suggests that all cores are stable, including Mu13, which harbors one young stellar object (YSO), the IRAS 12322-7023 source. However, the analysis of the physical parameters shows that Mu13 tends to have larger A {sub V}, n {sub c}, and P {sub ext} than the remaining starless cores. The other physical parameters do not show any trend. It is possible that those are the main parameters to explore in active star-forming cores. Mu13 also shows the most intense emission of NH{sub 3}. Its {sup 13}CO and C{sup 18}O lines have double peaks, whose integrated intensity maps suggest that they are due to the superposition of clouds with different radial velocities seen in the line of sight. It is not possible to state whether these clouds are colliding and inducing star formation or are related to a physical process associated with the formation of the YSO.

  12. GHG emissions due to deforestation

    International Nuclear Information System (INIS)

    Croezen, H.; Van Valkengoed, M.

    2009-05-01

    An assessment was made for the magnitude of greenhouse gas emissions resulting from deforestation and forest degradation in tropical forests in Malaysia and Indonesia related to Dutch economic activities. Greenhouse gas emissions (GHG) are calculated in relation to (1) the emissions related to vegetation removal sec; and (2) the emissions related to removal and more long term effects related to assimilation of CO2 in forest regrowth and changes in organic material in soils. Emissions related to vegetation removal and aggregated emissions for both vegetation removal and long term effects are reported separately. Soil organic carbon stock changes are considered by Greenpeace as more uncertain, so the emphasis will be on the direct emissions. Changes in carbon stocks and N2O emissions and actually also changes in vegetation all are events that occur gradually, rather than immediately. Only removal of existing vegetation and possible burning of this vegetation and associated emissions related to both activities are immediate by nature. Carbon stocks and N2O emissions change to a new level within several decades after deforestation or forest degradation. Removed vegetation can grow back or be replaced eventually by other vegetation, thereby changing the net greenhouse gas (GHG) emissions related to deforestation or forest degradation. Vegetation extracted for commercial purposes such as timber or pulp will also take years or decades to become waste and be converted into CO2. In IPCC and LCA's all these emissions are taken into account - or at least all emissions occurring within a period of 20 years, as required by IPCC. Soil organic carbon stock changes are also considered by Greenpeace as more uncertain, so the emphasis will be on the direct emmissions.

  13. Emission- and product standards

    International Nuclear Information System (INIS)

    Jong, P. de

    1988-01-01

    This report makes part of a series of eight reports which have been drawn up in behalf of the dutch Policy Notition Radiation Standards (BNS). In this report the results are presented of an inventarization of the use of radioactive materials and ionizing-radiation emitting apparates in the Netherlands. Ch. 2 deals with the varous applications of radioactive materials in the Netherlands. Herein also the numbers and the various locations by application, and the amounts and character of the radioactive materials used, come under discussion. Besides, the various waste currents are considered separately. The use of ionizing-radiation emitting apparates is treated in ch. 3. In ch. 4 the differences and agreements of the various applications, concentrating on the emission and product standards to be drawn up, are entered further. Also on the base of these considerations, a number of starting points are formulated with regard to the way in which emission and product standards may be drawn up. Ch. 7 deals with the conclusions and indicates the most important hiates. (H.W.). 25 refs.; 5 figs.; 25 tabs

  14. For sale: Sulfur emissions

    International Nuclear Information System (INIS)

    Heiderscheit, J.

    1992-01-01

    The allowance trading market has started a slow march to maturity. Competitive developers should understand the risks and opportunities now presented. The marketplace for sulfur dioxide (SO 2 ) emissions allowances - the centerpiece of Title 4's acid rain reduction program - remains enigmatic 19 months after the Clean Air Act amendments of 1990 were passed. Yet it is increasingly clear that the emission allowance market will likely confound the gloom and doom of its doubters. The recently-announced $10 million dollar Wisconsin Power and Light allowance sales to Duquesne Light and the Tennessee Valley Authority are among the latest indications of momentum toward a stabilizing market. This trend puts additional pressure on independent developers to finalize their allowance strategies. Developers who understand what the allowance trading program is and what it is not, know the key players, and grasp the unresolved regulatory issues will have a new competitive advantage. The topics addressed in this article include the allowance marketplace, marketplace characteristics, the regulatory front, forward-looking strategies, and increasing marketplace activity

  15. Positron emission tomography. Positronemisionstomografi

    Energy Technology Data Exchange (ETDEWEB)

    Bolwig, T G; Haunsoe, S; Dahlgaard Hove, J; Hesse, B; Hoejgard, L; Jensen, M; Paulson, O B; Hastrup Svendsen, J; Soelvsten Soerensen, S

    1994-10-01

    Positron emission tomography (PET) is a method for quantitative imaging of regional physiological and biochemical parameters. Positron emitting radioactive isotopes can be produced by a cyclotron, eg. the biologically important carbon ([sup 11]C), oxygen ([sup 15]O), and nitrogen ([sup 13]N) elements. With the tomographic principles of the PET scanner the quantitative distribution of the administered isotopes can be determined and images can be provided as well as dynamic information on blood flow, metabolism and receptor function. In neurology PET has been used for investigations on numerous physiological processes in the brain: circulation, metabolism and receptor studies. In Parkinson's disease PET studies have been able to localize the pathology specifically, and in early stroke PET technique can outline focal areas with living but non-functioning cells, and this could make it possible to intervene in this early state. With positron emission tomography a quantitative evaluation of myocardial blood flow, glucose and fatty acid metabolism can be made as well as combined assessments of blood flow and metabolism. Combined studies of blood flow and metabolism can determine whether myocardial segments with abnormal motility consist of necrotic or viable tissue, thereby delineating effects of revascularisation. In the future it will probably be possible to characterize the myocardial receptor status in different cardiac diseases. The PET technique is used in oncology for clinical as well as more basic research on tumor perfusion and metabolism. Further, tumor uptake of positron labelled cytotoxic drugs might predict the clinical benefit of treatment. (au) (19 refs.).

  16. Syncrude emissions reduction project

    Energy Technology Data Exchange (ETDEWEB)

    Fiedler, M.A. [Alstom Power Inc., Knoxville, TN (United States); Ibbotson, P. [Syncrude Canada Ltd., Calgary, AB (Canada)

    2008-07-01

    This paper described an emissions reduction project conducted by Syncrude Canada and various other companies currently developing and processing oil sands in Alberta. Syncrude's upgrader expansion program included the installation of an ammonia-based wet flue gas desulfurizer (FGD) designed to remove sulphur dioxide (SO{sub 2}) from a coker train. Syncrude is also installing the FGD technology at its existing plants. It is expected that installation of the FGDs will reduced total site emissions of SO{sub 2} by 60 per cent. The fluid cokers are used to crack the long hydrocarbon chain bitumen molecules into shorter molecules. It is expected that the FGD system will also reduce particulate and SO{sub 3} levels. The FGD system was selected after an evaluation of technologies used by the coal-fired power industry. A dry FGD system was selected to operate above the water saturation temperature of the flue gas. Calcium oxide was used as a reagent. Hot gas was quenched in a spray dryer absorber with a slurry of calcium hydroxide. Rotary atomizers were used to developer uniform droplets of slurry. The system's fabric filter was a low ratio reverse gas-cleaned unit. Particulate matter from the gases was deposited on the interior of the filter bags. Clean hot gas was drawn through reverse gas fans into a reverse gas manifold. A timeline of the FGD technology installation process was included. 3 tabs., 28 figs.

  17. Elastic emission polishing

    Energy Technology Data Exchange (ETDEWEB)

    Loewenthal, M.; Loseke, K.; Dow, T.A.; Scattergood, R.O.

    1988-12-01

    Elastic emission polishing, also called elastic emission machining (EEM), is a process where a stream of abrasive slurry is used to remove material from a substrate and produce damage free surfaces with controlled surface form. It is a noncontacting method utilizing a thick elasto-hydrodynamic film formed between a soft rotating ball and the workpiece to control the flow of the abrasive. An apparatus was built in the Center, which consists of a stationary spindle, a two-axis table for the workpiece, and a pump to circulate the working fluid. The process is controlled by a programmable computer numerical controller (CNC), which presently can operate the spindle speed and movement of the workpiece in one axis only. This apparatus has been used to determine material removal rates on different material samples as a function of time, utilizing zirconium oxide (ZrO{sub 2}) particles suspended in distilled water as the working fluid. By continuing a study of removal rates the process should become predictable, and thus create a new, effective, yet simple tool for ultra-precision mechanical machining of surfaces.

  18. Positron emission tomography

    International Nuclear Information System (INIS)

    Bolwig, T.G.; Haunsoe, S.; Dahlgaard Hove, J.; Hesse, B.; Hoejgard, L.; Jensen, M.; Paulson, O.B.; Hastrup Svendsen, J.; Soelvsten Soerensen, S.

    1994-01-01

    Positron emission tomography (PET) is a method for quantitative imaging of regional physiological and biochemical parameters. Positron emitting radioactive isotopes can be produced by a cyclotron, eg. the biologically important carbon ( 11 C), oxygen ( 15 O), and nitrogen ( 13 N) elements. With the tomographic principles of the PET scanner the quantitative distribution of the administered isotopes can be determined and images can be provided as well as dynamic information on blood flow, metabolism and receptor function. In neurology PET has been used for investigations on numerous physiological processes in the brain: circulation, metabolism and receptor studies. In Parkinson's disease PET studies have been able to localize the pathology specifically, and in early stroke PET technique can outline focal areas with living but non-functioning cells, and this could make it possible to intervene in this early state. With positron emission tomography a quantitative evaluation of myocardial blood flow, glucose and fatty acid metabolism can be made as well as combined assessments of blood flow and metabolism. Combined studies of blood flow and metabolism can determine whether myocardial segments with abnormal motility consist of necrotic or viable tissue, thereby delineating effects of revascularisation. In the future it will probably be possible to characterize the myocardial receptor status in different cardiac diseases. The PET technique is used in oncology for clinical as well as more basic research on tumor perfusion and metabolism. Further, tumor uptake of positron labelled cytotoxic drugs might predict the clinical benefit of treatment. (au) (19 refs.)

  19. Biomass burning - Combustion emissions, satellite imagery, and biogenic emissions

    Science.gov (United States)

    Levine, Joel S.; Cofer, Wesley R., III; Winstead, Edward L.; Rhinehart, Robert P.; Cahoon, Donald R., Jr.; Sebacher, Daniel I.; Sebacher, Shirley; Stocks, Brian J.

    1991-01-01

    After detailing a technique for the estimation of the instantaneous emission of trace gases produced by biomass burning, using satellite imagery, attention is given to the recent discovery that burning results in significant enhancement of biogenic emissions of N2O, NO, and CH4. Biomass burning accordingly has an immediate and long-term impact on the production of atmospheric trace gases. It is presently demonstrated that satellite imagery of fires may be used to estimate combustion emissions, and could be used to estimate long-term postburn biogenic emission of trace gases to the atmosphere.

  20. Data analysis in emission tomography using emission-count posteriors

    International Nuclear Information System (INIS)

    Sitek, Arkadiusz

    2012-01-01

    A novel approach to the analysis of emission tomography data using the posterior probability of the number of emissions per voxel (emission count) conditioned on acquired tomographic data is explored. The posterior is derived from the prior and the Poisson likelihood of the emission-count data by marginalizing voxel activities. Based on emission-count posteriors, examples of Bayesian analysis including estimation and classification tasks in emission tomography are provided. The application of the method to computer simulations of 2D tomography is demonstrated. In particular, the minimum-mean-square-error point estimator of the emission count is demonstrated. The process of finding this estimator can be considered as a tomographic image reconstruction technique since the estimates of the number of emissions per voxel divided by voxel sensitivities and acquisition time are the estimates of the voxel activities. As an example of a classification task, a hypothesis stating that some region of interest (ROI) emitted at least or at most r-times the number of events in some other ROI is tested. The ROIs are specified by the user. The analysis described in this work provides new quantitative statistical measures that can be used in decision making in diagnostic imaging using emission tomography. (paper)

  1. Data analysis in emission tomography using emission-count posteriors

    Science.gov (United States)

    Sitek, Arkadiusz

    2012-11-01

    A novel approach to the analysis of emission tomography data using the posterior probability of the number of emissions per voxel (emission count) conditioned on acquired tomographic data is explored. The posterior is derived from the prior and the Poisson likelihood of the emission-count data by marginalizing voxel activities. Based on emission-count posteriors, examples of Bayesian analysis including estimation and classification tasks in emission tomography are provided. The application of the method to computer simulations of 2D tomography is demonstrated. In particular, the minimum-mean-square-error point estimator of the emission count is demonstrated. The process of finding this estimator can be considered as a tomographic image reconstruction technique since the estimates of the number of emissions per voxel divided by voxel sensitivities and acquisition time are the estimates of the voxel activities. As an example of a classification task, a hypothesis stating that some region of interest (ROI) emitted at least or at most r-times the number of events in some other ROI is tested. The ROIs are specified by the user. The analysis described in this work provides new quantitative statistical measures that can be used in decision making in diagnostic imaging using emission tomography.

  2. Calibration of acoustic emission transducers

    International Nuclear Information System (INIS)

    Leschek, W.C.

    1976-01-01

    A method is described for calibrating an acoustic emission transducer to be used in a pre-set frequency range. The absolute reception sensitivity of a reference transducer is determined at frequencies selected within the frequency range. The reference transducer and the acoustic emission transducer are put into acoustic communication with the surface of a limited acoustic medium representing an equivalent acoustic load appreciably identical to that of the medium in which the use of the acoustic emission transducer is intended. A blank random acoustic noise is emitted in the acoustic medium in order to establish a diffuse and reverberating sound field, after which the output responses of the reference transducer and of the acoustic emission transducer are obtained with respect to the diffuse and reverberating field, for selected frequencies. The output response of the acoustic emission transducer is compared with that of the reference transducer for the selected frequencies, so as to determine the reception sensitivity of the acoustic emission transducer [fr

  3. COMPLEX VARIABILITY OF THE Hα EMISSION LINE PROFILE OF THE T TAURI BINARY SYSTEM KH 15D: THE INFLUENCE OF ORBITAL PHASE, OCCULTATION BY THE CIRCUMBINARY DISK, AND ACCRETION PHENOMENA

    International Nuclear Information System (INIS)

    Hamilton, Catrina M.; Johns-Krull, Christopher M.; Mundt, Reinhard; Herbst, William; Winn, Joshua N.

    2012-01-01

    We have obtained 48 high-resolution echelle spectra of the pre-main-sequence eclipsing binary system KH 15D (V582 Mon, P = 48.37 days, e ∼ 0.6, M A = 0.6 M ☉ , M B = 0.7 M ☉ ). The eclipses are caused by a circumbinary disk (CBD) seen nearly edge on, which at the epoch of these observations completely obscured the orbit of star B and a large portion of the orbit of star A. The spectra were obtained over five contiguous observing seasons from 2001/2002 to 2005/2006 while star A was fully visible, fully occulted, and during several ingress and egress events. The Hα line profile shows dramatic changes in these time series data over timescales ranging from days to years. A fraction of the variations are due to 'edge effects' and depend only on the height of star A above or below the razor sharp edge of the occulting disk. Other observed variations depend on the orbital phase: the Hα emission line profile changes from an inverse P-Cygni-type profile during ingress to an enhanced double-peaked profile, with both a blue and a red emission component, during egress. Each of these interpreted variations are complicated by the fact that there is also a chaotic, irregular component present in these profiles. We find that the complex data set can be largely understood in the context of accretion onto the stars from a CBD with gas flows as predicted by the models of eccentric T Tauri binaries put forward by Artymowicz and Lubow, Günther and Kley, and de Val-Borro et al. In particular, our data provide strong support for the pulsed accretion phenomenon, in which enhanced accretion occurs during and after perihelion passage.

  4. Coaxial discharge plasma parameters and radiation emission

    International Nuclear Information System (INIS)

    Solimen, H.M.

    1993-01-01

    Results are reported for experiments carried out on a Mather type coaxial discharge plasma device. Experimental measurements of the electron temperature and density for the plasma propagated from the coaxial discharge are determined by using a biased double electric probe. The experimental results illustrated that , there are two groups of the plasma in the ejected plasma bulk, at 9 cm from the muzzle axis, the plasma reached the probe at 20 μsec from the start of discharge. The first group has electron temperature and density 27 eV and 3 x 10 14 cm -3 respectively,while The second group has 25 eV and 3 x 10 14 cm -3 respectively. The decay rate of the electron temperature and density of each group is presented. The plasma radiation spectrum is detected by a dielectric filter at 3500 A degree or 6100 A degree . The experimental measurements showed that, without or with dielectric filters, the visible radiation consists from two pulses with different magnitudes within the same half cycle of discharge. The time resolution of the soft x-ray is achieved by means of scintillator detector. The detected x-ray pulse during the first half cycle of discharge had a double peaks with different structures. All the experimental results present in this paper showed that the plasma bulk propagated in the expansion chamber, consists of two-groups. 6 fig

  5. Methane emissions from coal mining

    International Nuclear Information System (INIS)

    Williams, A.; Mitchell, C.

    1993-01-01

    This paper outlines some of the problems associated with the prediction of levels of methane emission from underground and surface coal mines. Current knowledge of coal mining emissions sources is outlined. On the basis of this information the methodology proposed by the IPCC/OECD Programme on National Inventories is critically examined and alternatives considered. Finally, the technical options for emissions control are examined together with their feasibility. 8 refs., 6 figs., 2 tabs

  6. F centers emission in KCN

    International Nuclear Information System (INIS)

    Ohkura, H.; Carmo, L.C.S. do; Kalinowski, H.J.; Ribeiro, S.C.

    1976-01-01

    The emission spectrum of F centers in KCN is reported. The temperature dependence of this emission between 62 K and 178K was measured and the energy gap between the relaxed excited state and conduction band could be determined as 070 eV. Below the antiferroelectric transition temperature at 83K a blue shift in the peak of the emission spectrum is observed due partially to the internal Stark effect

  7. Fraud risks in emissions trading

    International Nuclear Information System (INIS)

    2010-09-01

    The system of emission trading is a complex composed entity with on the one hand a strong environmental component and on the other hand a financial world that hooked on this instrument. In chapter 2 an introduction is provided to the emission trading system. The subsequent chapters elaborate Types of Fraud (Chapter 3), Powers (Chapter 4), and Instruments (Chapter 5). The report shows that various forms of fraud are occurring in emission trading, such as VAT fraud and identity theft. [nl

  8. Emissions from photovoltaic life cycles.

    Science.gov (United States)

    Fthenakis, Vasilis M; Kim, Hyung Chul; Alsema, Erik

    2008-03-15

    Photovoltaic (PV) technologies have shown remarkable progress recently in terms of annual production capacity and life cycle environmental performances, which necessitate timely updates of environmental indicators. Based on PV production data of 2004-2006, this study presents the life-cycle greenhouse gas emissions, criteria pollutant emissions, and heavy metal emissions from four types of major commercial PV systems: multicrystalline silicon, monocrystalline silicon, ribbon silicon, and thin-film cadmium telluride. Life-cycle emissions were determined by employing average electricity mixtures in Europe and the United States during the materials and module production for each PV system. Among the current vintage of PV technologies, thin-film cadmium telluride (CdTe) PV emits the least amount of harmful air emissions as it requires the least amount of energy during the module production. However, the differences in the emissions between different PV technologies are very small in comparison to the emissions from conventional energy technologies that PV could displace. As a part of prospective analysis, the effect of PV breeder was investigated. Overall, all PV technologies generate far less life-cycle air emissions per GWh than conventional fossil-fuel-based electricity generation technologies. At least 89% of air emissions associated with electricity generation could be prevented if electricity from photovoltaics displaces electricity from the grid.

  9. The Emissions Gap Report 2014

    DEFF Research Database (Denmark)

    Farrell, Timothy Clifford

    This fifth Emissions Gap report has a different focus from previous years. While it updates the 2020 emissions gap analysis, it gives particular attention to the implications of the global carbon dioxide emissions budget for staying within the 2 °C limit beyond 2020. It does so because countries...... are giving increasing attention to where they need to be in 2025, 2030 and beyond. Furthermore, this year’s update of the report benefits from the findings on the emissions budget from the latest series of Intergovernmental Panel on Climate Change (IPCC) reports...

  10. Cleaning the Diesel Engine Emissions

    DEFF Research Database (Denmark)

    Christensen, Thomas Budde

    This paper examines how technologies for cleaning of diesel emission from road vehicles can be supported by facilitating a technology push in the Danish automotive emission control industry. The European commission is at present preparing legislation for the euro 5 emission standard (to be enforced...... in 2010). The standard is expected to include an 80% reduction of the maximum particulate emissions from diesel cars. The fulfillment of this requirement entails development and production of particulate filters for diesel cars and trucks. Theoretically the paper suggests a rethinking of public industry...

  11. Carbon emissions and income inequality

    International Nuclear Information System (INIS)

    Ravallion, M.; Heil, M.; Jalan, J.

    2000-01-01

    We find that the distribution of income matters to aggregate carbon dioxide emissions and hence global warming. Higher inequality, both between and within countries is associated with lower carbon emissions at given average incomes. We also confirm that economic growth generally comes with higher emissions. Thus our results suggest that trade-offs exist between climate control (on the one hand) and both social equity and economic growth (on the other). However, economic growth improves the trade off with equity, and lower inequality improves the trade off with growth. By combining growth with equity, more pro-poor growth processes yield better longer-term trajectories of carbon emissions. (Author)

  12. OPIC Greenhouse Gas Emissions Inventory

    Data.gov (United States)

    Overseas Private Investment Corporation — Independent analysis details quantifying the greenhouse gas ("GHG") emissions directly attributable to projects to which the Overseas Private Investment Corporation...

  13. Gaseous emissions from coal stockpiles

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2013-01-15

    Stockpiled coal undergoes atmospheric oxidation and desorption processes during open air storage. These processes release gases to the environment which may effect health and safety by their toxicity and flammability. In extreme cases, this could lead to a fire. This report discusses gaseous emissions from coal stockpiles. It covers gas emission mechanisms, and gas sampling and testing methods, before examining in more detail the principal gases that have been emitted. It concludes that there is limited research in this area and more data are needed to evaluate the risks of gaseous emissions. Some methods used to prevent coal self-heating and spontaneous combustion can be applied to reduce emissions from coal stockpiles.

  14. Continuous acoustic emission from aluminium

    International Nuclear Information System (INIS)

    Fenici, P.; Kiesewetter, N.; Schiller, P.

    1976-01-01

    Continuous acoustic emission of aluminum single crystals and polycrystals during tensile tests at constant cross-head speed and at room temperature is measured with a Root Mean Square Level recorder. By means of the Kaiser effect it is shown that the continuous emission is related to the plastic deformation. The plot of continuous emission against strain takes different shapes for pure single crystals, pure polycrystals and impure polycrystals. The measured voltages have about the same value for pure single and polycrystals and are considerably greater than that for impure polycrystals. A method is developed to distinguish between continuous emission and burst

  15. FTIR Emission spectroscopy of surfaces

    Science.gov (United States)

    Van Woerkom, P. C. M.

    A number of vibrational spectroscopic techniques are available For the study of surfaces, such as ATR, IR reflection-absorption, IR emission, etc. Infrared emission is hardly used, although interesting applications are possible now due to the high sensitivity of Fourier transform IR (FTIR) spectrometers. Two examples, where infrared emission measurements are very fruitful, will be given. One is the investigation of the curing behaviour of organic coatings, the other is the in situ study of heterogeneously catalyzed reactions. Undoubtedly, infrared emission measurements offer a number of specific advantages in some cases. Especially the less critical demands on the sample preparation are important.

  16. Emission computed tomography

    International Nuclear Information System (INIS)

    Phelps, M.E.

    1977-01-01

    Although there are many common aspects to x-ray transmission and radionuclide emission (ECT) computerized tomography, there are added difficulties and a number of particular factors which form the basis of ECT. The relationship between the physical factors, system design, methodologic approach and assumptions of ECT is discussed. The instrumentation design and application strategies in ECT at this time are diverse and in a rapid stage of development. The approaches are divided into two major categories of Single Photon Counting (SPC) employing scanner and camera concepts with radionuclides of 99 /sup m/Tc, 201 Tl, 123 I etc., and Annihilation Coincidence Detection (ACD) of positron-emitting radionuclides. Six systems in the former and ten systems in the latter category, with examples of typical studies, illustrate the different approaches

  17. Positron emission computed tomography

    International Nuclear Information System (INIS)

    Grover, M.; Schelbert, H.R.

    1985-01-01

    Regional mycardial blood flow and substrate metabolism can be non-invasively evaluated and quantified with positron emission computed tomography (Positron-CT). Tracers of exogenous glucose utilization and fatty acid metabolism are available and have been extensively tested. Specific tracer kinetic models have been developed or are being tested so that glucose and fatty acid metabolism can be measured quantitatively by Positron-CT. Tracers of amino acid and oxygen metabolism are utilized in Positron-CT studies of the brain and development of such tracers for cardiac studies are in progress. Methods to quantify regional myocardial blood flow are also being developed. Previous studies have demonstrated the ability of Positron-/CT to document myocardial infarction. Experimental and clinical studies have begun to identify metabolic markers of reversibly ischemic myocardium. The potential of Positron-CT to reliably detect potentially salvageable myocardium and, hence, to identify appropriate therapeutic interventions is one of the most exciting applications of the technique

  18. Positron emission tomography camera

    International Nuclear Information System (INIS)

    Anon.

    1987-01-01

    A positron emission tomography camera having a plurality of detector planes positioned side-by-side around a patient area to detect radiation. Each plane includes a plurality of photomultiplier tubes and at least two rows of scintillation crystals on each photomultiplier tube extend across to adjacent photomultiplier tubes for detecting radiation from the patient area. Each row of crystals on each photomultiplier tube is offset from the other rows of crystals, and the area of each crystal on each tube in each row is different than the area of the crystals on the tube in other rows for detecting which crystal is actuated and allowing the detector to detect more inter-plane slides. The crystals are offset by an amount equal to the length of the crystal divided by the number of rows. The rows of crystals on opposite sides of the patient may be rotated 90 degrees relative to each other

  19. Positron emission tomography camera

    International Nuclear Information System (INIS)

    Anon.

    1986-01-01

    A positron emission tomography camera having a plurality of detector rings positioned side-by-side or offset by one-half of the detector cross section around a patient area to detect radiation therefrom. Each ring contains a plurality of scintillation detectors which are positioned around an inner circumference with a septum ring extending inwardly from the inner circumference along each outer edge of each ring. An additional septum ring is positioned in the middle of each ring of detectors and parallel to the other septa rings, whereby the inward extent of all the septa rings may be reduced by one-half and the number of detectors required in each ring is reduced. The additional septa reduces the costs of the positron camera and improves its performance

  20. Positron emission tomography camera

    International Nuclear Information System (INIS)

    Anon.

    1987-01-01

    A positron emission tomography camera having a plurality of detector rings positioned side-by-side or offset by one-half of the detector cross section around a patient area to detect radiation therefrom. Each detector ring or offset ring includes a plurality of photomultiplier tubes and a plurality of scintillation crystals are positioned relative to the photomultiplier tubes whereby each tube is responsive to more than one crystal. Each alternate crystal in the ring is offset by one-half or less of the thickness of the crystal such that the staggered crystals are seen by more than one photomultiplier tube. This sharing of crystals and photomultiplier tubes allows identification of the staggered crystal and the use of smaller detectors shared by larger photomultiplier tubes thereby requiring less photomultiplier tubes, creating more scanning slices, providing better data sampling, and reducing the cost of the camera. The offset detector ring geometry reduces the costs of the positron camera and improves its performance

  1. Emission tomography system

    International Nuclear Information System (INIS)

    Phelps, M.E.; Hoffman, E.J.; Williams, C.W.; Burgiss, S.G.

    1983-01-01

    In the present invention a positron emission tomographic system is provided in which the random photon coincidence background is determined for the lines of sight along which the positron annihiliations are located. The circuitry is arranged so that this background may be subtracted almost simultaneously from the total photon coincidence measurement, or may be stored in a temporary memory for latter subtraction. In this system, an appropriate coincidence resolution time is selected and coincidences of photons detected at 180 degree opposed detectors within the time resolution are recorded as the overall coincidence count. This total count includes a source(true events) count plus a background(random coincidences) count. The background count is determined by measuring photons detected at these same sets of photon detectors and employing the same coincidence resolution period, where the signals from one set of detectors are passed through a delay longer in time than this resolution period

  2. Emission computed tomograph

    International Nuclear Information System (INIS)

    Hirose, Y.; Kanno, I.; Koga, K.; Miura, S.; Uemura, K.

    1981-01-01

    Emission computed tomograph wherein a pluralty of detectors surround an object to be examined so as to detect x- or gamma radiation emitted by said object. In front of each of said detectors there is provided a collimator which comprises a pair of main plates and a subsidiary plate interposed therebetween. The plates are made of a material capable of blocking penetration of the radiation therethrough and so supported as to be swingable over an angle sufficient to cover the whole of said object. The plates of all the collimators are simultaneously swung to the same side and at the same angular speed thereby to change the direction of incidence of said radiation on each of said detectors

  3. SHOCKED POSTSTARBUST GALAXY SURVEY. I. CANDIDATE POST-STARBUST GALAXIES WITH EMISSION LINE RATIOS CONSISTENT WITH SHOCKS

    Energy Technology Data Exchange (ETDEWEB)

    Alatalo, Katherine; Rich, Jeffrey A. [Observatories of the Carnegie Institution of Washington, 813 Santa Barbara Street, Pasadena, CA 91101 (United States); Cales, Sabrina L. [Yale Center for Astronomy and Astrophysics, Physics Department, Yale University, New Haven, CT 06511 (United States); Appleton, Philip N.; Lanz, Lauranne [Infrared Processing and Analysis Center, California Institute of Technology, Pasadena, CA 91125 (United States); Kewley, Lisa J.; Medling, Anne M. [Research School of Astronomy and Astrophysics, Australian National University, Cotter Road, Weston ACT 2611 (Australia); Lacy, Mark; Nyland, Kristina, E-mail: kalatalo@carnegiescience.edu [National Radio Astronomy Observatory, 520 Edgemont Road, Charlottesville, VA 22903 (United States)

    2016-06-01

    There are many mechanisms by which galaxies can transform from blue, star-forming spirals, to red, quiescent early-type galaxies, but our current census of them does not form a complete picture. Recent observations of nearby case studies have identified a population of galaxies that quench “quietly.” Traditional poststarburst searches seem to catch galaxies only after they have quenched and transformed, and thus miss any objects with additional ionization mechanisms exciting the remaining gas. The Shocked POststarburst Galaxy Survey (SPOGS) aims to identify transforming galaxies, in which the nebular lines are excited via shocks instead of through star formation processes. Utilizing the Oh-Sarzi-Schawinski-Yi (OSSY) measurements on the Sloan Digital Sky Survey Data Release 7 catalog, we applied Balmer absorption and shock boundary criteria to identify 1067 SPOG candidates (SPOGs*) within z = 0.2. SPOGs* represent 0.2% of the OSSY sample galaxies that exceed the continuum signal-to-noise cut (and 0.7% of the emission line galaxy sample). SPOGs* colors suggest that they are in an earlier phase of transition than OSSY galaxies that meet an “E+A” selection. SPOGs* have a 13% 1.4 GHz detection rate from the Faint Images of the Radio Sky at Twenty Centimeters Survey, higher than most other subsamples, and comparable only to low-ionization nuclear emission line region hosts, suggestive of the presence of active galactic nuclei (AGNs). SPOGs* also have stronger Na i D absorption than predicted from the stellar population, suggestive of cool gas being driven out in galactic winds. It appears that SPOGs* represent an earlier phase in galaxy transformation than traditionally selected poststarburst galaxies, and that a large proportion of SPOGs* also have properties consistent with disruption of their interstellar media, a key component to galaxy transformation. It is likely that many of the known pathways to transformation undergo a SPOG phase. Studying this sample of

  4. Emission allowances stall in marketplace

    International Nuclear Information System (INIS)

    Malec, W.F.

    1993-01-01

    Misinformation and public misunderstanding have given emissions trading a bad reputation in the public marketplace, says William F. Malec, executive vice president of the Tennessee Valley Authority (TVA), in Knoxville, Tennessee. Media coverage of a May 1992 emissions-allowance trade between TVA and Wisconsin Power and Light open-quotes focused on the agreement's pollution-trading aspects, not its overall potential economic and environmental benefits,close quotes Malec says. Such negative portrayal of TVA's transaction sparked severe public criticism and charges that emissions trading gives utilities the right to pollute. open-quotes The fact is that TVA sought the emissions-trading agreement as a means to reduce overall emissions in the most cost-effective way,close quotes Malec explains. Emissions trading allows a company with emission levels lower than clean-air standards to earn open-quotes credits.close quotes These credits then may be purchased by a company with emission levels that exceed federal standards. Under this arrangement, the environment is protected and companies that buy credits save money because they do not have to purchase expensive emissions-control devices or reduce their production levels. Malec says TVA decided to enter into the emissions-allowance market, not only to cut costs, but also to publicize the existence and benefits of emissions trading. However, TVA's experience proves that open-quotes people will not accept what they do not understand,close quotes concludes Malec, open-quotes especially when complex environmental issues are involved.close quotes

  5. Carbon emissions and an equitable emission reduction criterion

    International Nuclear Information System (INIS)

    Golomb, Dan

    1999-01-01

    In 1995 the world-wide carbon emissions reached 5.8 billion metric tonnes per year (GTC/y). The Kyoto protocol calls for a reduction of carbon emissions from the developed countries (Annex I countries) of 6-8% below 1990 levels on the average, and unspecified commitments for the less developed (non-Annex I) countries. It is doubtful that the Kyoto agreement will be ratified by some parliaments, especially the USA Congress. Furthermore, it is shown that if the non-Annex I countries will not curtail their carbon emissions drastically, the global emissions will soar to huge levels by the middle of the next century. An equitable emission criterion is proposed which may lead to a sustainable rate of growth of carbon emissions, and be acceptable to all countries of the world. The criterion links the rate of growth of carbon emissions to the rate of growth of the Gross Domestic Product (GDP). A target criterion is proposed R = 0.15 KgC/SGDP, which is the current average for western European countries and Japan. This allows for both the growth of the GDP and carbon emissions. However, to reach the target in a reasonable time, the countries for which R≤ 0.3 would be allowed a carbon emission growth rate of 1%./y, and countries for which R≥ 0.3, 0.75%/y. It is shown that by 2050 the world-wide carbon emissions would reach about 10 GTC/y, which is about 3 times less than the Kyoto agreement would allow. (Author)

  6. Spectroscopic measurements of plasma emission light for plasma-based acceleration experiments

    International Nuclear Information System (INIS)

    Filippi, F.; Mostacci, A.; Palumbo, L.; Anania, M.P.; Biagioni, A.; Chiadroni, E.; Ferrario, M.; Cianchi, A.; Zigler, A.

    2016-01-01

    Advanced particle accelerators are based on the excitation of large amplitude plasma waves driven by either electron or laser beams. Future experiments scheduled at the SPARC-LAB test facility aim to demonstrate the acceleration of high brightness electron beams through the so-called resonant Plasma Wakefield Acceleration scheme in which a train of electron bunches (drivers) resonantly excites wakefields into a preformed hydrogen plasma; the last bunch (witness) injected at the proper accelerating phase gains energy from the wake. The quality of the accelerated beam depends strongly on plasma density and its distribution along the acceleration length. The measurements of plasma density of the order of 10 16 –10 17  cm −3 can be performed with spectroscopic measurements of the plasma-emitted light. The measured density distribution for hydrogen filled capillary discharge with both Balmer alpha and Balmer beta lines and shot-to-shot variation are here reported.

  7. Spectroscopic measurements of plasma emission light for plasma-based acceleration experiments

    Science.gov (United States)

    Filippi, F.; Anania, M. P.; Biagioni, A.; Chiadroni, E.; Cianchi, A.; Ferrario, M.; Mostacci, A.; Palumbo, L.; Zigler, A.

    2016-09-01

    Advanced particle accelerators are based on the excitation of large amplitude plasma waves driven by either electron or laser beams. Future experiments scheduled at the SPARC_LAB test facility aim to demonstrate the acceleration of high brightness electron beams through the so-called resonant Plasma Wakefield Acceleration scheme in which a train of electron bunches (drivers) resonantly excites wakefields into a preformed hydrogen plasma; the last bunch (witness) injected at the proper accelerating phase gains energy from the wake. The quality of the accelerated beam depends strongly on plasma density and its distribution along the acceleration length. The measurements of plasma density of the order of 1016-1017 cm-3 can be performed with spectroscopic measurements of the plasma-emitted light. The measured density distribution for hydrogen filled capillary discharge with both Balmer alpha and Balmer beta lines and shot-to-shot variation are here reported.

  8. Exciton emissions in alkali cyanides

    International Nuclear Information System (INIS)

    Weid, J.P. von der.

    1979-10-01

    The emissions of Alkali Cyanides X irradiated at low temperature were measured. In addition to the molecular (Frenkel Type) exciton emissions, another emitting centre was found and tentatively assigned to a charge transfer self trapped exciton. The nature of the molecular exciton emitting state is discussed. (Author) [pt

  9. Reducing ammonia emissions in Europe

    DEFF Research Database (Denmark)

    Jacobsen, Brian H.

    2011-01-01

    The NEC directive has set targets for the 2010 ammonia emissions from a number of European countries. The target will be reached by most EU-countries and the total emission for EU-27 has been reduced by 22% from 1990 to 2007. Denmark is one of the countries with the largest reductions since 1990...

  10. NORTRIP emission model user guide

    Energy Technology Data Exchange (ETDEWEB)

    Denby, Rolstad Bruce

    2012-07-01

    The NORTRIP emission model has been developed at NILU, in conjunction with other Nordic institutes, to model non-exhaust traffic induced emissions. This short summary document explains how to run the NORTRIP model from the MATLAB environment or by using the executable user interface version. It also provides brief information on input files and the model architecture.(Author)

  11. DOES ELECTRIC CAR PRODUCE EMISSIONS?

    Directory of Open Access Journals (Sweden)

    Vladimír RIEVAJ

    2017-03-01

    Full Text Available This article focuses on the comparison of the amount of emissions produced by vehicles with a combustion engine and electric cars. The comparison, which is based on the LCA factor results, indicates that an electric car produces more emissions than a vehicle with combustion engine. The implementation of electric cars will lead to an increase in the production of greenhouse gases.

  12. Acoustic Emission Technology and Application

    International Nuclear Information System (INIS)

    Joo, Y. S.; Lim, S. H.; Eom, H. S.; Kim, J. H.; Jung, H. K.

    2003-10-01

    Acoustic emission is the elastic wave that is generated by the rapid release of energy from the localized sources within a material. After the observation of acoustic emission phenomenon in 1950, the research and further investigation had been performed. Acoustic emission examination becomes a rapidly matured nondestructive testing method with demonstrated capabilities for characterizing material behavior and for detecting the defect. It is of interest as a possible passive monitoring technique for detecting, locating and characterizing the defects in component and structure. Acoustic emission technology has recently strengthened the on-line monitoring application for the detection of incipient failures and the assurance of structural integrity. The field of acoustic emission testing is still growing vigorously and presents many challenges. Especially, acoustic emission has been successfully applied in the leak detection of primary pressure boundary of nuclear power plants. In this state-of-art report, the principle, measurement and field applications of acoustic emission technique is reviewed and summarized. Acoustic emission technology will contribute to the assurance of nuclear safety as the on-line monitoring technique of structural integrity of NSSS components and structures

  13. Estimates of wildland fire emissions

    Science.gov (United States)

    Yongqiang Liu; John J. Qu; Wanting Wang; Xianjun Hao

    2013-01-01

    Wildland fire missions can significantly affect regional and global air quality, radiation, climate, and the carbon cycle. A fundamental and yet challenging prerequisite to understanding the environmental effects is to accurately estimate fire emissions. This chapter describes and analyzes fire emission calculations. Various techniques (field measurements, empirical...

  14. Emission of formaldehyde from furniture

    DEFF Research Database (Denmark)

    Andersen, Helle Vibeke; Klinke, Helene B.; Funch, Lis Winther

    The emission of formaldehyde from 20 pieces of furniture, representing a variety of types, was measured in climate chambers. Most tests show low emissions but certain scenarios of furnishing, including furniture with large surface areas in relation to room volume can emit formaldehyde resulting...

  15. Pricing Carbon Emissions in China

    NARCIS (Netherlands)

    C-L. Chang (Chia-Lin); T.K. Mai (Te-Ke); M.J. McAleer (Michael)

    2018-01-01

    markdownabstractThe purpose of the paper is to provide a clear mechanism for determining carbon emissions pricing in China as a guide to how carbon emissions might be mitigated to reduce fossil fuel pollution. The Chinese Government has promoted the development of clean energy, including

  16. The Emissions Gap Report 2012

    NARCIS (Netherlands)

    Vuuren, D.P. van

    2012-01-01

    One of the fundamental questions in the global climate negotiations is: what level of “ambition”, in terms of collective emission reductions, is needed to protect global climate? To help answer this question UNEP and the scientific community have published a series of reports on the “emissions

  17. Deliberating emission reduction options

    Energy Technology Data Exchange (ETDEWEB)

    Dowd, A. M.; Rodriguez, M.; Jeanneret, T. [Commonwealth Scientific and Industrial Research Organisation CSIRO, 37 Graham Rd, Highett VIC 3190 (Australia); De Best-Waldhober, M.; Straver, K.; Mastop, J.; Paukovic, M. [Energy research Centre of the Netherlands ECN, Policy Studies, Amsterdam (Netherlands)

    2012-06-15

    For more than 20 years there has been a concerted international effort toward addressing climate change. International conventions, such as the United Nations Foreign Convention on Climate Change (UNFCCC; ratified in 1994), have been established by committed nations seeking to address global climate change through the reduction of greenhouse gases emitted into the Earth's atmosphere (Global CCS Institute, 2011). Long recognised as the most crucial of the greenhouse gases to impact global warming, the majority of carbon dioxide's anthropogenic global emissions are directly related to fuel combustion of which both Australia and the Netherlands' energy production is significantly reliant. Both these nations will need to consider many opinions and make hard decisions if alternative energy options are to be implemented at the scale that is required to meet international emission targets. The decisions that are required not only need to consider the many options available but also their consequences. Along with politicians, policy developers and industry, the general public also need to be active participants in deciding which energy options, and their subsequent consequences, are acceptable for implementation at the national level. Access to balanced and factual information is essential in establishing informed opinions on the many policy options available. Past research has used several methods to measure public perceptions and opinions yet for complex issues, such as emission reduction, some of these methods have shown to be problematic. For example, semi structured interviews can provide data that is flexible and context rich yet is does also come with the limitations such as it seldom provides a practical assessment that can be utilised from researcher to researcher, across disciplines and public participation techniques. Surveys on the other hand usually address these limitations but surveys that do not encourage comparison of information or ask participants to

  18. Deliberating emission reduction options

    Energy Technology Data Exchange (ETDEWEB)

    Dowd, A.M.; Rodriguez, M.; Jeanneret, T. [Commonwealth Scientific and Industrial Research Organisation CSIRO, 37 Graham Rd, Highett VIC 3190 (Australia); De Best-Waldhober, M.; Straver, K.; Mastop, J.; Paukovic, M. [Energy research Centre of the Netherlands ECN, Policy Studies, Amsterdam (Netherlands)

    2012-06-15

    For more than 20 years there has been a concerted international effort toward addressing climate change. International conventions, such as the United Nations Foreign Convention on Climate Change (UNFCCC; ratified in 1994), have been established by committed nations seeking to address global climate change through the reduction of greenhouse gases emitted into the Earth's atmosphere (Global CCS Institute, 2011). Long recognised as the most crucial of the greenhouse gases to impact global warming, the majority of carbon dioxide's anthropogenic global emissions are directly related to fuel combustion of which both Australia and the Netherlands' energy production is significantly reliant. Both these nations will need to consider many opinions and make hard decisions if alternative energy options are to be implemented at the scale that is required to meet international emission targets. The decisions that are required not only need to consider the many options available but also their consequences. Along with politicians, policy developers and industry, the general public also need to be active participants in deciding which energy options, and their subsequent consequences, are acceptable for implementation at the national level. Access to balanced and factual information is essential in establishing informed opinions on the many policy options available. Past research has used several methods to measure public perceptions and opinions yet for complex issues, such as emission reduction, some of these methods have shown to be problematic. For example, semi structured interviews can provide data that is flexible and context rich yet is does also come with the limitations such as it seldom provides a practical assessment that can be utilised from researcher to researcher, across disciplines and public participation techniques. Surveys on the other hand usually address these limitations but surveys that do not encourage comparison of information or ask

  19. Electronic emission and electron guns

    International Nuclear Information System (INIS)

    Roy, Amitava

    2010-01-01

    This paper reviews the process of electron emission from metal surface. Although electrons move freely in conductors like metals, they normally do not leave the metal without some manipulation. In fact, heating and bombardment are the two primary ways in which electrons are emitted through the use of a heating element behind the cathode (termed thermionic emission) or as a result of bombardment with a beam of electrons, ions, or metastable atoms (termed secondary emission). Another important emission mechanism called Explosive Electron Emission (EEE) is also often used in various High Voltage Pulse Power Systems to generate very high current (few hundreds of kA) pulsed electron beams. The electron gun is the device in that it shoots off a continuous (or pulsed) stream of electrons. A brief idea about the evolution of the electron gun components and their basis of functioning are also discussed. (author)

  20. Enteric Methane Emission from Pigs

    DEFF Research Database (Denmark)

    Jørgensen, Henry; Theil, Peter Kappel; Knudsen, Knud Erik Bach

    2011-01-01

    per kg meat produced is increased (Fernández et al. 1983; Lekule et al. 1990). The present chapter will summarise our current knowledge concerning dietary and enteric fermentation that may influence the methane (CH4) emission in pigs. Enteric fermentation is the digestive process by which.......3 % of the worlds pig population. The main number of pigs is in Asia (59.6 %) where the main pig population stay in China (47.8 % of the worlds pig population). The objective of the chapter is therefore: To obtain a general overview of the pigs’ contribution to methane emission. Where is the pigs’ enteric gas...... produced and how is it measured. The variation in methane emission and factors affecting the emission. Possibility for reducing the enteric methane emission and the consequences....

  1. Nanoparticle emissions from combustion engines

    CERN Document Server

    Merkisz, Jerzy

    2015-01-01

     This book focuses on particulate matter emissions produced by vehicles with combustion engines. It describes the physicochemical properties of the particulate matter, the mechanisms of its formation and its environmental impacts (including those on human beings). It discusses methods for measuring particulate mass and number, including the state-of-the-art in Portable Emission Measurement System (PEMS) equipment for measuring the exhaust emissions of both light and heavy-duty vehicles and buses under actual operating conditions. The book presents the authors’ latest investigations into the relations between particulate emission (mass and number) and engine operating parameters, as well as their new findings obtained through road tests performed on various types of vehicles, including those using diesel particulate filter regeneration. The book, which addresses the needs of academics and professionals alike, also discusses relevant European regulations on particulate emissions and highlights selected metho...

  2. Model for traffic emissions estimation

    Science.gov (United States)

    Alexopoulos, A.; Assimacopoulos, D.; Mitsoulis, E.

    A model is developed for the spatial and temporal evaluation of traffic emissions in metropolitan areas based on sparse measurements. All traffic data available are fully employed and the pollutant emissions are determined with the highest precision possible. The main roads are regarded as line sources of constant traffic parameters in the time interval considered. The method is flexible and allows for the estimation of distributed small traffic sources (non-line/area sources). The emissions from the latter are assumed to be proportional to the local population density as well as to the traffic density leading to local main arteries. The contribution of moving vehicles to air pollution in the Greater Athens Area for the period 1986-1988 is analyzed using the proposed model. Emissions and other related parameters are evaluated. Emissions from area sources were found to have a noticeable share of the overall air pollution.

  3. COAL DUST EMISSION PROBLEM

    Directory of Open Access Journals (Sweden)

    M. M. Biliaiev

    2016-12-01

    Full Text Available Purpose. The article aims to develop 2D numerical models for the prediction of atmospheric pollution during transportation of coal in the railway car, as well as the ways to protect the environment and the areas near to the mainline from the dust emission due to the air injection installation. Methodology. To solve this problem there were developed numerical models based on the use of the equations of motion of an inviscid incompressible fluid and mass transfer. For the numerical integration of the transport equation of the pollutant the implicit alternating-triangular difference scheme was used. For numerical integration of the 2D equation for the velocity potential the method of total approximation was used. The developed numerical models are the basis of established software package. On the basis of the constructed numerical models it was carried out a computational experiment to assess the level of air pollution when transporting bulk cargo by rail when the railway car has the air injection. Findings. 2D numerical models that belong to the class «diagnostic models» were developed. These models take into account the main physical factors affecting the process of dispersion of dust pollution in the atmosphere during transportation of bulk cargo. The developed numerical models make it possible to calculate the dust loss process, taking into account the use of the air injection of the car. They require a small cost of the computer time during practical realization at the low and medium power machines. There were submitted computational calculations to determine pollutant concentrations and the formation of the zone of pollution near the train with bulk cargo in «microscale» scale taking into account the air curtains. Originality. 2D numerical models taking into account the relevant factors influencing the process of dispersion of pollutants in the atmosphere, and the formation of the zone of pollution during transportation of bulk cargo by

  4. Photophysics of fullerenes: Thermionic emission

    International Nuclear Information System (INIS)

    Compton, R.N.; Tuinman, A.A.; Huang, J.

    1996-01-01

    Multiphoton ionization of fullerenes using long-pulse length lasers occurs mainly through vibrational autoionization. In many cases the laser ionization can be described as thermionic in analogy to the boiling off of electrons from a filament. Thermionic emission manifests itself as a delayed emission of electrons following pulsed laser excitation. Klots has employed quasiequilibrium theory to calculate rate constants for thermionic emission from fullerenes which seem to quantitatively account for the observed delayed emission times and the measured electron energy distributions. The theory of Klots also accounts for the thermionic emission of C 60 excited by a low power CW Argon Ion laser. Recently Klots and Compton have reviewed the evidence for thermionic emission from small aggregates where mention was also made of experiments designed to determine the effects of externally applied electric fields on thermionic emission rates. The authors have measured the fullerene ion intensity as a function of the applied electric field and normalized this signal to that produced by single photon ionization of an atom in order to correct for all collection efficiency artifacts. The increase in fullerene ion signal relative to that of Cs + is attributed to field enhanced thermionic emission. From the slope of the Schottky plot they obtain a temperature of approximately 1,000 K. This temperature is comparable to but smaller than that estimated from measurements of the electron kinetic energies. This result for field enhanced thermionic emission is discussed further by Klots and Compton. Thermionic emission from neutral clusters has long been known for autodetachment from highly excited negative ions. Similarly, electron attachment to C 60 in the energy range from 8 to 12 eV results in C 60 anions with lifetimes in the range of microseconds. Quasiequilibrium theory (QET) calculations are in reasonable accord with these measurements

  5. Photophysics of fullerenes: Thermionic emission

    Energy Technology Data Exchange (ETDEWEB)

    Compton, R.N. [Univ. of Tennessee, Knoxville, TN (United States)]|[Oak Ridge National Lab., TN (United States); Tuinman, A.A. [Univ. of Tennessee, Knoxville, TN (United States); Huang, J. [Ames Lab., IA (United States)

    1996-09-01

    Multiphoton ionization of fullerenes using long-pulse length lasers occurs mainly through vibrational autoionization. In many cases the laser ionization can be described as thermionic in analogy to the boiling off of electrons from a filament. Thermionic emission manifests itself as a delayed emission of electrons following pulsed laser excitation. Klots has employed quasiequilibrium theory to calculate rate constants for thermionic emission from fullerenes which seem to quantitatively account for the observed delayed emission times and the measured electron energy distributions. The theory of Klots also accounts for the thermionic emission of C{sub 60} excited by a low power CW Argon Ion laser. Recently Klots and Compton have reviewed the evidence for thermionic emission from small aggregates where mention was also made of experiments designed to determine the effects of externally applied electric fields on thermionic emission rates. The authors have measured the fullerene ion intensity as a function of the applied electric field and normalized this signal to that produced by single photon ionization of an atom in order to correct for all collection efficiency artifacts. The increase in fullerene ion signal relative to that of Cs{sup +} is attributed to field enhanced thermionic emission. From the slope of the Schottky plot they obtain a temperature of approximately 1,000 K. This temperature is comparable to but smaller than that estimated from measurements of the electron kinetic energies. This result for field enhanced thermionic emission is discussed further by Klots and Compton. Thermionic emission from neutral clusters has long been known for autodetachment from highly excited negative ions. Similarly, electron attachment to C{sub 60} in the energy range from 8 to 12 eV results in C{sub 60} anions with lifetimes in the range of microseconds. Quasiequilibrium theory (QET) calculations are in reasonable accord with these measurements.

  6. Air pollution from motor vehicle emissions

    International Nuclear Information System (INIS)

    Petrushevska, Ljubica

    1996-01-01

    This paper presents some aspects of air pollution from motor vehicle emissions as: characteristic primary and secondary pollutants, dependence of the motor vehicle emission from the engine type; the relationship of typical engine emission and performance to air-fuel ratio, transport of pollutants from mobile sources of emissions, as well as some world experiences in the control approaches for exhaust emissions. (author)

  7. 47 CFR 74.794 - Digital emissions.

    Science.gov (United States)

    2010-10-01

    ... 47 Telecommunication 4 2010-10-01 2010-10-01 false Digital emissions. 74.794 Section 74.794... Booster Stations § 74.794 Digital emissions. (a)(1) An applicant for a digital LPTV or TV translator... emissions within one of the following emission masks: simple or stringent. (2) The power level of emissions...

  8. Positron emission tomography

    Energy Technology Data Exchange (ETDEWEB)

    Lindback, Stig [GEMS PET Systems AB, Uppsala (Sweden)

    1995-07-15

    Positron Emission Tomography (PET) is an advanced nuclear medicine technique used for research at major centres. Unique diagnostic information is obtained from tomographic measurements of the biochemistry and physiology of tissues and organs. In theory, diseases are related to biochemical changes and these can be observed with PET long before any anatomical changes are detectable. In PET the radioactive component is a positron-emitting isotope or 'tracer'. The positrons annihilate with electrons in the body to produce two gamma rays 180° apart; coincidence detection of these gammas provides a very efficient method of determining the spatial distribution of the radioisotope tracer. Because physiological measurements are usually required in a single imaging session, very short-lived isotopes are used to label the tracer molecules; isotope production and labelling is usually carried out in situ. The most commonly used radionuclides are carbon- 11 (half-life 20 minutes), nitrogen-13 (10 minutes), oxygen-15 (2 minutes), and fluorine-18 (110 minutes). A PET system has three major components: - a particle accelerator with targets for production of the positron-emitting isotopes; - chemistry modules for synthesis and labelling of the desired tracers; - and a PET camera for in-vivo measurements of the distribution of the tracer in the body.

  9. Pricing hazardous substance emissions

    Energy Technology Data Exchange (ETDEWEB)

    Staring, Knut; Vennemo, Haakon

    1998-12-31

    This report discusses pricing of emissions to air of several harmful substances. It combines ranking indices for environmentally harmful substances with economic valuation data to yield price estimates. The ranking methods are discussed and a relative index established. Given the relative ranking of the substances, they all become valued by assigning a value to one of them, the `anchor` substance, for which lead is selected. Valuations are provided for 19 hazardous substances that are often subject to environmental regulations. They include dioxins, TBT, etc. The study concludes with a discussion of other categories of substances as well as uncertainties and possible refinements. When the valuations are related to CO, NOx, SOx and PM 10, the index system undervalues these pollutants as compared to other studies. The scope is limited to the outdoor environment and does not include global warming and eutrophication. The indices are based on toxicity and so do not apply to CO{sub 2} or other substances that are biologically harmless. The index values are not necessarily valid for all countries and should be considered as preliminary. 18 refs., 6 tabs.

  10. Positron emission tomography

    International Nuclear Information System (INIS)

    Lindback, Stig

    1995-01-01

    Positron Emission Tomography (PET) is an advanced nuclear medicine technique used for research at major centres. Unique diagnostic information is obtained from tomographic measurements of the biochemistry and physiology of tissues and organs. In theory, diseases are related to biochemical changes and these can be observed with PET long before any anatomical changes are detectable. In PET the radioactive component is a positron-emitting isotope or 'tracer'. The positrons annihilate with electrons in the body to produce two gamma rays 180° apart; coincidence detection of these gammas provides a very efficient method of determining the spatial distribution of the radioisotope tracer. Because physiological measurements are usually required in a single imaging session, very short-lived isotopes are used to label the tracer molecules; isotope production and labelling is usually carried out in situ. The most commonly used radionuclides are carbon- 11 (half-life 20 minutes), nitrogen-13 (10 minutes), oxygen-15 (2 minutes), and fluorine-18 (110 minutes). A PET system has three major components: - a particle accelerator with targets for production of the positron-emitting isotopes; - chemistry modules for synthesis and labelling of the desired tracers; - and a PET camera for in-vivo measurements of the distribution of the tracer in the body

  11. Pricing hazardous substance emissions

    Energy Technology Data Exchange (ETDEWEB)

    Staring, Knut; Vennemo, Haakon

    1997-12-31

    This report discusses pricing of emissions to air of several harmful substances. It combines ranking indices for environmentally harmful substances with economic valuation data to yield price estimates. The ranking methods are discussed and a relative index established. Given the relative ranking of the substances, they all become valued by assigning a value to one of them, the `anchor` substance, for which lead is selected. Valuations are provided for 19 hazardous substances that are often subject to environmental regulations. They include dioxins, TBT, etc. The study concludes with a discussion of other categories of substances as well as uncertainties and possible refinements. When the valuations are related to CO, NOx, SOx and PM 10, the index system undervalues these pollutants as compared to other studies. The scope is limited to the outdoor environment and does not include global warming and eutrophication. The indices are based on toxicity and so do not apply to CO{sub 2} or other substances that are biologically harmless. The index values are not necessarily valid for all countries and should be considered as preliminary. 18 refs., 6 tabs.

  12. Neutrino Emission from Supernovae

    Science.gov (United States)

    Janka, Hans-Thomas

    Supernovae are the most powerful cosmic sources of MeV neutrinos. These elementary particles play a crucial role when the evolution of a massive star is terminated by the collapse of its core to a neutron star or a black hole and the star explodes as supernova. The release of electron neutrinos, which are abundantly produced by electron captures, accelerates the catastrophic infall and causes a gradual neutronization of the stellar plasma by converting protons to neutrons as dominant constituents of neutron star matter. The emission of neutrinos and antineutrinos of all flavors carries away the gravitational binding energy of the compact remnant and drives its evolution from the hot initial to the cold final state. The absorption of electron neutrinos and antineutrinos in the surroundings of the newly formed neutron star can power the supernova explosion and determines the conditions in the innermost supernova ejecta, making them an interesting site for the nucleosynthesis of iron-group elements and trans-iron nuclei.

  13. Advanced Collaborative Emissions Study (ACES)

    Energy Technology Data Exchange (ETDEWEB)

    Greenbaum, Daniel; Costantini, Maria; Van Erp, Annemoon; Shaikh, Rashid; Bailey, Brent; Tennant, Chris; Khalek, Imad; Mauderly, Joe; McDonald, Jacob; Zielinska, Barbara; Bemis, Jeffrey; Storey, John; Hallberg, Lance; Clark, Nigel

    2013-12-31

    The objective of the Advanced Collaborative Emissions Study (ACES) was to determine before widespread commercial deployment whether or not the new, energy-efficient, heavy duty diesel engines (2007 and 2010 EPA Emissions Standards Compliant) may generate anticipated toxic emissions that could adversely affect the environment and human health. ACES was planned to take place in three phases. In Phase 1, extensive emissions characterization of four production-intent prototype engine and control systems designed to meet 2007 standards for nitrogen oxides (NOx) and particulate matter (PM) was conducted at an existing emissions characterization facility: Southwest Research Institute (SwRI). One of the tested engines was selected (at random, after careful comparison of results) for health testing in Phase 3. In Phase 2, extensive emission characterization of three production-intent prototype engine and control systems meeting the 2010 standards (including more advanced NOx controls to meet the more stringent 2010 NOx standards) was conducted at the same test facility. In Phase 3, one engine/aftertreatment system selected from Phase 1 was further characterized during health effects studies (at an existing inhalation toxicology laboratory: Lovelace Respiratory Research Institute, [LRRI]) to form the basis of the ACES safety assessment. The Department of Energy (DOE) award provided funding for emissions characterization in Phases 1 and 2 as well as exposure characterization in Phase 3. The main health analyses in Phase 3 were funded separately and are not reported here.

  14. Radioactive air emissions 1992 summary

    International Nuclear Information System (INIS)

    Wahl, L.

    1993-10-01

    This report summarizes, by radionuclide or product and by emitting facility, the Laboratory's 1992 radioactive air emissions. In 1992, the total activity of radionuclides emitted into the air from Laboratory stacks was approximately 73,500 Ci. This was an increase over the activity of the total 1991 radioactive air emissions, which was approximately 62,400 Ci. Total 1992 Laboratory emissions of each radionuclide or product are summarized by tables and graphs in the first section of this report. Compared to 1991 radioactive air emissions, total tritium activity was decreased, total plutonium activity was decreased, total uranium activity was decreased, total mixed fission product activity was increased, total 41 Ar activity was decreased, total gaseous/mixed activation product (except 41 Ar) activity was increased, total particulate/vapor activation product activity was increased, and total 32 P activity was decreased. Radioactive emissions from specific facilities are detailed in this report. Each section provides 1992 data on a single radionuclide or product and is further divided by emitting facility. For each facility from which a particular radionuclide or product was emitted, a bar chart displays the air emissions of each radionuclide or product from each facility over the 12 reporting periods of 1992, a line chart shows the trend in total emissions of that radionuclide or product from that facility for the past three years, the greatest activity during the 1990--1992 period is discussed, and unexpected or unusual results are noted

  15. Biomass burning: Combustion emissions, satellite imagery, and biogenic emissions

    International Nuclear Information System (INIS)

    Levine, J.S.; Cofer, W.R III; Rhinehart, R.P.; Cahoon, D.R. J.; Winstead, E.L.; Sebacher, S.; Sebacher, D.I.; Stocks, B.J.

    1991-01-01

    This chapter deals with two different, but related, aspects of biomass burning. The first part of the chapter deals with a technique to estimate the instantaneous emissions of trace gases produced by biomass burning using satellite imagery. The second part of the chapter concerns the recent discovery that burning results in significantly enhanced biogenic emissions of N 2 O, NO, and CH 4 . Hence, biomass burning has both an immediate and long-term impact on the production of trace gases to the atmosphere. The objective of this research is to better assess and quantify the role of this research is to better assess and quantify the role and impact of biomass as a driver for global change. It will be demonstrated that satellite imagery of fires may be used to estimate combustion emissions and may in the future be used to estimate the long-term postburn biogenic emissions of trace gases to the atmosphere

  16. Fighting against VOC emissions; Lutter contre les emissions de COV

    Energy Technology Data Exchange (ETDEWEB)

    Fanlo, J.L. [Ecole des Mines d' Ales, 30 (France); Puech, G. [APAVE, 75 - Paris (France); Patoux, R. [Rhodia Rhoditech (France)] [and others

    2001-12-01

    This document brings together 15 testimonies of experts about the processes used in the industry for the abatement of volatile organic compound (VOC) emissions. The different points approached concern: the first industrial experiments of fight against VOC emissions, how to audit the facilities, how to make a diagnosis, to hierarchized and to measure continuously VOC emissions, how to anticipate the explosion risks linked with VOC treatment processes, the techniques of VOC abatement at the source implemented by industrialists, the implementation of an emission mastery scheme by Crow Cork and Seal company, the implementation of a solvent management plan by Turbomeca company and of a paints strategy by Renault car-making company, the combination of VOC abatement techniques implemented by industrialists, the classification of destruction and recovery processes: the experience feedback of Sanofi Synthelabo and of Air Liquide companies, the combination of upstream and downstream techniques implemented by Pechiney Rhenalu, Ashland Polyester and Quebecor companies. (J.S.)

  17. Neutron emission from TFTR supershots

    International Nuclear Information System (INIS)

    Strachan, J.D.; Bell, M.G.; Bitter, M.; Budny, R.; Hawryluk, R.; Hill, K.W.; Hsuan, H.; Jassby, D.L.; Johnson, L.C.; LeBlanc, B.; Mansfield, D.; Meade, D.; Mikkelsen, D.R.; Mueller, D.; Park, H.; Ramsey, A.; Scott, S.; Synakowski, E.; Taylor, G.; Marmer, E.; Snipes, J.; Terry, J.

    1992-10-01

    Empirical scaling relations are deduced describing the neutron emission from TFTR supershots using a data base that includes all of the supershot plasmas (525) from the 1990 campaign. A physics-based scaling for the neutron emission is derived from the dependence of the central plasma parameters on machine settings and the energy confinement time. This scaling has been used to project the fusion rate for equivalent DT plasmas in TFTR, and to explore machine operation space which optimizes the fusion rate. Increases in neutron emission are possible by either increasing the toroidal magnetic field or further improving the limiter conditioning

  18. Livestock and greenhouse gas emissions

    DEFF Research Database (Denmark)

    Herrero, M; Gerber, P; Vellinga, T

    2011-01-01

    emissions. In reality, estimates of international scientific organizations such as the International Governmental Panel on Climate Change (IPCC) and the Food and Agriculture Organization (FAO) are in close agreement, with variation mainly arising on how GHG emissions are allocated to land use and land use...... change. Other estimates involve major deviations from international protocols, such as estimated global warming potential of CH4 or including respired CO2 in GHG emissions. These approaches also fail to differentiate short-term CO2 arising from oxidation of plant C by ruminants from CO2 released from...

  19. Methane emissions from coal mining

    International Nuclear Information System (INIS)

    Boyer, C.M.; Kelafant, J.R.; Kuuskraa, V.A.; Manger, K.C.; Kruger, D.

    1990-09-01

    The report estimates global methane emissions from coal mining on a country specific basis, evaluates the technologies available to degasify coal seams and assesses the economics of recovering methane liberated during mining. 33 to 64 million tonnes were liberated in 1987 from coal mining, 75 per cent of which came from China, the USSR, Poland and the USA. Methane emissions from coal mining are likely to increase. Emission levels vary between surface and underground mines. The methane currently removed from underground mines for safety reasons could be used in a number of ways, which may be economically attractive. 55 refs., 19 figs., 24 tabs

  20. Infrared emission from supernova condensates

    International Nuclear Information System (INIS)

    Dwek, E.; Werner, M.W.

    1981-01-01

    We examine the possibility of detecting grains formed in supernovae by observations of their emission in the infrared. The basic processes determining the temperature and infrared radiation of grains in supernovae environments are analyzed, and the results are used to estimate the infrared emission from the highly metal enriched ''fast moving knots'' in Cas A. The predicted fluxes lie within the reach of current ground-based facilities at 10 μm, and their emission should be detectable throughout the infrared band with cryogenic space telescopes

  1. 77 FR 16508 - National Emission Standards for Hazardous Air Pollutant Emissions: Group IV Polymers and Resins...

    Science.gov (United States)

    2012-03-21

    ... National Emission Standards for Hazardous Air Pollutant Emissions: Group IV Polymers and Resins; Pesticide... Hazardous Air Pollutant Emissions: Group IV Polymers and Resins; National Emission Standards for Hazardous... proposed rule titled, National Emission Standards for Hazardous Air Pollutant Emissions: Group IV Polymers...

  2. Zero emission city. Preliminary study; Null-Emissions-Stadt. Sondierungsstudie

    Energy Technology Data Exchange (ETDEWEB)

    Diefenbach, N; Enseling, A; Werner, P; Flade, A; Greiff, R; Hennings, D; Muehlich, E; Wullkopf, U; Sturm, P; Kieslich, W; Born, R; Grossklos, M; Hatteh, R; Mueller, K; Ratschow, A; Valouch-Fornoff, C

    2002-10-01

    The idea of a 'zero emission city' is investigated by the Institut Wohnen und Umwelt on behalf of the Federal Minister of Education and Research. After describing the current situation and defining the key parameters of a 'zero emission city', settlement structures, power supply, production processes and transportation are analyzed and linked with the communal action level to obtain a framework for research, activities and actions. The study ends with recommendations for a research programme 'zero emission city'. (orig.) [German] Die von den Staedten der Industrielaender ausgehenden Emissionen stellen im Hinblick auf die globalen Belastungen wie z.B. Treibhauseffekt, Ozonabbau und Versauerung das Hauptproblem dar. Aus diesem Grunde bietet es sich an, den Gedanken der 'Null-Emissions-Stadt', der Vision einer moeglichst emissionsfreien Stadt, aufzugreifen und auf seine Tragfaehigkeit fuer innovative Handlungsmodelle forschungsstrategisch zu ueberpruefen. Das Bundesministerium fuer Bildung und Forschung hat das Institut Wohnen und Umwelt beauftragt, in einer Sondierungsstudie dieser Fragestellung nachzugehen. Nach der Festlegung der Ausgangsbedingungen und Eckpunkte der Vision 'Null-Emissions-Stadt' und der Analyse der vier Handlungsfelder Siedlungsstrukturen, Energieversorgung, Produktionsprozesse (Kreislaufwirtschaft) und Verkehr werden diese aufgegriffen und mit der kommunalen Handlungsebene verknuepft und zu einem Forschungs-, Handlungs- und moeglichen Aktionsrahmen zusammengefuegt. Die Studie schliesst mit Hinweisen fuer die Gestaltung eines Forschungsprogramms 'Null-Emissions-Stadt'. (orig.)

  3. Zero emission city. Preliminary study; Null-Emissions-Stadt. Sondierungsstudie

    Energy Technology Data Exchange (ETDEWEB)

    Diefenbach, N.; Enseling, A.; Werner, P.; Flade, A.; Greiff, R.; Hennings, D.; Muehlich, E.; Wullkopf, U.; Sturm, P.; Kieslich, W.; Born, R.; Grossklos, M.; Hatteh, R.; Mueller, K.; Ratschow, A.; Valouch-Fornoff, C.

    2002-10-01

    The idea of a 'zero emission city' is investigated by the Institut Wohnen und Umwelt on behalf of the Federal Minister of Education and Research. After describing the current situation and defining the key parameters of a 'zero emission city', settlement structures, power supply, production processes and transportation are analyzed and linked with the communal action level to obtain a framework for research, activities and actions. The study ends with recommendations for a research programme 'zero emission city'. (orig.) [German] Die von den Staedten der Industrielaender ausgehenden Emissionen stellen im Hinblick auf die globalen Belastungen wie z.B. Treibhauseffekt, Ozonabbau und Versauerung das Hauptproblem dar. Aus diesem Grunde bietet es sich an, den Gedanken der 'Null-Emissions-Stadt', der Vision einer moeglichst emissionsfreien Stadt, aufzugreifen und auf seine Tragfaehigkeit fuer innovative Handlungsmodelle forschungsstrategisch zu ueberpruefen. Das Bundesministerium fuer Bildung und Forschung hat das Institut Wohnen und Umwelt beauftragt, in einer Sondierungsstudie dieser Fragestellung nachzugehen. Nach der Festlegung der Ausgangsbedingungen und Eckpunkte der Vision 'Null-Emissions-Stadt' und der Analyse der vier Handlungsfelder Siedlungsstrukturen, Energieversorgung, Produktionsprozesse (Kreislaufwirtschaft) und Verkehr werden diese aufgegriffen und mit der kommunalen Handlungsebene verknuepft und zu einem Forschungs-, Handlungs- und moeglichen Aktionsrahmen zusammengefuegt. Die Studie schliesst mit Hinweisen fuer die Gestaltung eines Forschungsprogramms 'Null-Emissions-Stadt'. (orig.)

  4. Prompt neutron emission; Emission des neutrons prompts de fission

    Energy Technology Data Exchange (ETDEWEB)

    Sher, R [Commissariat a l' Energie Atomique, Saclay (France).Centre d' Etudes Nucleaires

    1959-07-01

    It is shown that Ramanna and Rao's tentative conclusion that prompt fission neutrons are emitted (in the fragment system) preferentially in the direction of fragment motion is not necessitated by their angular distribution measurements, which are well explained by the usual assumptions of isotropic emission with a Maxwell (or Maxwell-like) emission spectrum. The energy distribution (Watt spectrum) and the angular distribution, both including the effects of anisotropic emission, are given. (author) [French] On montre que la conclusion experimentale de Ramanna et Rao selon laquelle les neutrons prompts de fission sont emis (dans le systeme de reference des fragments) preferentiellement dans la direction du mouvement du fragment, ne decoule pas necessairement de leurs mesures de distribution angulaire. Celles-ci sont bien expliquees par l'hypothese classique de l'emission isotrope et d'un spectre d'emission maxwellien (ou quasi-maxwellien). On donne la distribution en energie (ou spectre de Watt) et la distribution angulaire, comprenant toutes les deux les effets d'emission anisotrope. (auteur)

  5. Danish emission inventory for particular matter (PM)

    Energy Technology Data Exchange (ETDEWEB)

    Nielsen, M; Winther, M; Illerup, J B; Hjort Mikkelsen, M

    2003-11-01

    The first Danish emission inventory that was reported in 2002 was a provisional-estimate based on data presently available. This report documents methodology, emission factors and references used for an improved Danish emission inventory for particulate matter. Further results of the improved emission inventory for the year 2000 are shown. The particulate matter emission inventory includes TSP, PM,, and PM, The report covers emission inventories for transport and stationary combustion. An appendix covering emissions from agriculture is also included. For the transport sector, both exhaust and non-exhaust emission such as tyre and break wear and road abrasion are included. (au)

  6. Turkey Run Landfill Emissions Dataset

    Data.gov (United States)

    U.S. Environmental Protection Agency — landfill emissions measurements for the Turkey run landfill in Georgia. This dataset is associated with the following publication: De la Cruz, F., R. Green, G....

  7. Advanced Emissions Control Development Program

    Energy Technology Data Exchange (ETDEWEB)

    A.P.Evans; K.E. Redinger; M.J. Holmes

    1998-04-01

    The objective of the Advanced Emissions Control Development Program (AECDP) is to develop practical, cost-effective strategies for reducing the emissions of air toxics from coal-fired boilers. Ideally, the project aim is to effectively control air toxic emissions through the use of conventional flue gas cleanup equipment such as electrostatic precipitators (ESPS), fabric filters (baghouse), and wet flue gas desulfurization. Development work to date has concentrated on the capture of mercury, other trace metals, fine particulate and hydrogen chloride. Following the construction and evaluation of a representative air toxics test facility in Phase I, Phase II focused on the evaluation of mercury and several other air toxics emissions. The AECDP is jointly funded by the United States Department of Energy's Federal Energy Technology Center (DOE), the Ohio Coal Development Office within the Ohio Department of Development (oCDO), and Babcock& Wilcox-a McDermott company (B&W).

  8. Dataset of NRDA emission data

    Data.gov (United States)

    U.S. Environmental Protection Agency — Emissions data from open air oil burns. This dataset is associated with the following publication: Gullett, B., J. Aurell, A. Holder, B. Mitchell, D. Greenwell, M....

  9. Controlling radiated emissions by design

    CERN Document Server

    Mardiguian, Michel

    2014-01-01

    The 3rd edition of Controlling Radiated Emissions by Design has been updated to reflect the latest changes in the field. New to this edition is material related to technical advances, specifically super-fast data rates on wire pairs, with no increase in RF interference. Throughout the book, details are given to control RF emissions using EMC design techniques. This book retains the step-by-step approach for incorporating EMC into every new design from the ground up. It describes the selection of quieter IC technologies, their implementation into a noise-free printed circuit layout, and the gathering of these into a low emissions package. Also included is how to design an I/O filter, along with connectors and cable considerations. All guidelines are supported throughout with comprehensive calculated examples. Design engineers, EMC specialists, and technicians will benefit from learning about the development of more efficient and economical control of emissions.

  10. CONSTRAINING RADIO EMISSION FROM MAGNETARS

    Energy Technology Data Exchange (ETDEWEB)

    Lazarus, P.; Kaspi, V. M.; Dib, R. [Department of Physics, Rutherford Physics Building, McGill University, 3600 University Street, Montreal, Quebec H3A 2T8 (Canada); Champion, D. J. [Max-Planck-Institut fuer Radioastronomie, Auf dem Huegel 69, 53121 Bonn (Germany); Hessels, J. W. T., E-mail: plazar@physics.mcgill.ca [Netherlands Institute for Radio Astronomy (ASTRON), Postbus 2, 7990 AA Dwingeloo (Netherlands)

    2012-01-10

    We report on radio observations of five magnetars and two magnetar candidates carried out at 1950 MHz with the Green Bank Telescope in 2006-2007. The data from these observations were searched for periodic emission and bright single pulses. Also, monitoring observations of magnetar 4U 0142+61 following its 2006 X-ray bursts were obtained. No radio emission was detected for any of our targets. The non-detections allow us to place luminosity upper limits of L{sub 1950} {approx}< 1.60 mJy kpc{sup 2} for periodic emission and L{sub 1950,single} {approx}< 7.6 Jy kpc{sup 2} for single pulse emission. These are the most stringent limits yet for the magnetars observed. The resulting luminosity upper limits together with previous results are discussed, as is the importance of further radio observations of radio-loud and radio-quiet magnetars.

  11. Field emission for cantilever sensors

    NARCIS (Netherlands)

    Yang, C.K.; le Fèbre, A.J.; Pandraud, G.; van der Drift, E.; French, P.J.

    2008-01-01

    Field emission provides an alternative sensing solution in scaled electromechanical systems and devices, when typical displacement detection techniques fail in submicron and nanodimenions. Apart from its independency from device dimension, it has also a high response, integration and high

  12. Emissivity measurements on aeronautical alloys

    International Nuclear Information System (INIS)

    Campo, L. del; Perez-Saez, R.B.; Gonzalez-Fernandez, L.; Esquisabel, X.; Fernandez, I.; Gonzalez-Martin, P.; Tello, M.J.

    2010-01-01

    The emissivity of three Ni and Co based aeronautical alloys is analyzed in this paper. These alloys are employed in high temperature environments whenever good corrosion resistance, high temperature resistance and high strength are essential. Thus, apart from the aeronautical industry, these alloys are also used in other technological applications, as for example, aerospace, nuclear reactors, and tooling. The results in this paper extend the emissivity data for these alloys available in the literature. Emissivity dependence on the radiation wavelength (2-22 μm), sample temperature (200-650 o C) and emission angle (0-85 o ) has been investigated. In addition, the effect of surface finish and oxidation has also been taken into consideration. The data in this paper have several applications, as temperature measurement of a target by pyrometry, low observability of airplanes and thermal radiation heat transfer simulation in airplane nozzles or furnaces.

  13. Mercury Emissions: The Global Context

    Science.gov (United States)

    Mercury emissions are a global problem that knows no national or continental boundaries. Mercury that is emitted to the air can travel thousands of miles in the atmosphere before it is eventually deposited back to the earth.

  14. SPECIFIC EMISSIONS FROM BIOMASS COMBUSTION

    Directory of Open Access Journals (Sweden)

    Pavel Skopec

    2014-02-01

    Full Text Available This paper deals with determining the specific emissions from the combustion of two kinds of biomass fuels in a small-scale boiler. The tested fuels were pellets made of wood and pellets made of rape plant straw. In order to evaluate the specific emissions, several combustion experiments were carried out using a commercial 25 kW pellet-fired boiler. The specific emissions of CO, SO2 and NOx were evaluated in relation to a unit of burned fuel, a unit of calorific value and a unit of produced heat. The specific emissions were compared with some data acquired from the reference literature, with relatively different results. The differences depend mainly on the procedure used for determining the values, and references provide no information about this. Although some of our experimental results may fit with one of the reference sources, they do not fit with the other. The reliability of the references is therefore disputable.

  15. Emissivity measurements on aeronautical alloys

    Energy Technology Data Exchange (ETDEWEB)

    Campo, L. del, E-mail: leire.del-campo@cnrs-orleans.f [Departamento de Fisica de la Materia Condensada, Facultad de Ciencia y Tecnologia, Universidad del Pais Vasco, Barrio Sarriena s/n, 48940 Leioa, Bizkaia (Spain); Perez-Saez, R.B., E-mail: raul.perez@ehu.e [Departamento de Fisica de la Materia Condensada, Facultad de Ciencia y Tecnologia, Universidad del Pais Vasco, Barrio Sarriena s/n, 48940 Leioa, Bizkaia (Spain); Instituto de Sintesis y Estudio de Materiales, Universidad del Pais Vasco, Apdo. 644, 48080 Bilbao (Spain); Gonzalez-Fernandez, L. [Departamento de Fisica de la Materia Condensada, Facultad de Ciencia y Tecnologia, Universidad del Pais Vasco, Barrio Sarriena s/n, 48940 Leioa, Bizkaia (Spain); Esquisabel, X.; Fernandez, I. [Industria de Turbo Propulsores, S.A., Planta de Zamudio, Edificio 300, 48170 Zamudio, Bizkaia (Spain); Gonzalez-Martin, P. [Industria de Turbo Propulsores, S.A., Parque empresarial San Fernando, Avda. Castilla 2, 28830 San Fernando de Henares, Madrid (Spain); Tello, M.J. [Departamento de Fisica de la Materia Condensada, Facultad de Ciencia y Tecnologia, Universidad del Pais Vasco, Barrio Sarriena s/n, 48940 Leioa, Bizkaia (Spain); Instituto de Sintesis y Estudio de Materiales, Universidad del Pais Vasco, Apdo. 644, 48080 Bilbao (Spain)

    2010-01-21

    The emissivity of three Ni and Co based aeronautical alloys is analyzed in this paper. These alloys are employed in high temperature environments whenever good corrosion resistance, high temperature resistance and high strength are essential. Thus, apart from the aeronautical industry, these alloys are also used in other technological applications, as for example, aerospace, nuclear reactors, and tooling. The results in this paper extend the emissivity data for these alloys available in the literature. Emissivity dependence on the radiation wavelength (2-22 {mu}m), sample temperature (200-650 {sup o}C) and emission angle (0-85{sup o}) has been investigated. In addition, the effect of surface finish and oxidation has also been taken into consideration. The data in this paper have several applications, as temperature measurement of a target by pyrometry, low observability of airplanes and thermal radiation heat transfer simulation in airplane nozzles or furnaces.

  16. Acoustic emission linear pulse holography

    Science.gov (United States)

    Collins, H.D.; Busse, L.J.; Lemon, D.K.

    1983-10-25

    This device relates to the concept of and means for performing Acoustic Emission Linear Pulse Holography, which combines the advantages of linear holographic imaging and Acoustic Emission into a single non-destructive inspection system. This unique system produces a chronological, linear holographic image of a flaw by utilizing the acoustic energy emitted during crack growth. The innovation is the concept of utilizing the crack-generated acoustic emission energy to generate a chronological series of images of a growing crack by applying linear, pulse holographic processing to the acoustic emission data. The process is implemented by placing on a structure an array of piezoelectric sensors (typically 16 or 32 of them) near the defect location. A reference sensor is placed between the defect and the array.

  17. Understanding Emissions in East Asia - The KORUS 2015 Emissions Inventory

    Science.gov (United States)

    Woo, J. H.; Kim, Y.; Park, R.; Choi, Y.; Simpson, I. J.; Emmons, L. K.; Streets, D. G.

    2017-12-01

    The air quality over Northeast Asia have been deteriorated for decades due to high population and energy use in the region. Despite of more stringent air pollution control policies by the governments, air quality over the region seems not been improved as much - even worse sometimes. The needs of more scientific understanding of inter-relationship among emissions, transport, chemistry over the region are much higher to effectively protect public health and ecosystems. Two aircraft filed campaigns targeting year 2016, MAPS-Seoul and KORUS-AQ, have been organized to study the air quality of over Korea and East Asia relating to chemical evolution, emission inventories, trans-boundary contribution, and satellite application. We developed a new East-Asia emissions inventory, named KORUS2015, based on NIER/KU-CREATE (Comprehensive Regional Emissions inventory for Atmospheric Transport Experiment), in support of the filed campaigns. For anthropogenic emissions, it has 54 fuel classes, 201 sub-sectors and 13 pollutants, including CO2, SO2, NOx, CO, NMVOC, NH3, PM10, and PM2.5. Since the KORUS2015 emissions framework was developed using the integrated climate and air quality assessment modeling framework (i.e. GAINS) and is fully connected with the comprehensive emission processing/modeling systems (i.e. SMOKE, KU-EPS, and MEGAN), it can be effectively used to support atmospheric field campaigns for science and policy. During the field campaigns, we are providing modeling emissions inventory to participating air quality models, such as CMAQ, WRF-Chem, CAMx, GEOS-Chem, MOZART, for forecasting and post-analysis modes. Based on initial assessment of those results, we are improving our emissions, such as VOC speciation, biogenic VOCs modeling. From the 2nditeration between emissions and modeling/measurement, further analysis results will be presented at the conference. Acknowledgements : This subject is supported by Korea Ministry of Environment as "Climate Change

  18. Trace emissions from gaseous combustion

    Energy Technology Data Exchange (ETDEWEB)

    Seebold, J.G. [Chevron Research and Technology Co., Richmond, CA (United States)

    2000-07-01

    The U.S. Clean Air Act (CAA) was amended in 1990 to include the development of maximum achievable control technology (MACT) emission standards for hazardous air pollutants (HAPs) for certain stationary sources by November 2000. MACT emissions standards would affect process heaters and industrial boilers since combustion processes are a potential source for many air toxins. The author noted that one of the problems with MACT is the lack of a clear solid scientific footing which is needed to develop environmentally responsible regulations. In order to amend some of these deficiencies, a 4-year, $7 million research project on the origin and fate of trace emissions in the external combustion of gaseous hydrocarbons was undertaken in a collaborative effort between government, universities and industry. This collaborative project entitled the Petroleum Environmental Research Forum (PERF) Project 92-19 produced basic information and phenomenological understanding in two important areas, one basic and one applied. The specific objectives of the project were to measure emissions while operating different full-scale burners under various operating conditions and then to analyze the emission data to identify which operating conditions lead to low air toxic emissions. Another objective was to develop new chemical kinetic mechanisms and predictive models for the formation of air toxic species which would explain the origin and fate of these species in process heaters and industrial boilers. It was determined that a flame is a very effective reactor and that trace emissions from a typical gas-fired industry burner are very small. An unexpected finding was that trace emissions are not affected by hydrocarbon gaseous fuel composition, nor by the use of ultra low nitrous oxide burners. 2 refs., 8 figs.

  19. Estimating emissions from railway traffic

    Energy Technology Data Exchange (ETDEWEB)

    Joergensen, M.W.; Sorenson, C.

    1997-07-01

    The report discusses methods that can be used to estimate the emissions from various kinds of railway traffic. The methods are based on the estimation of the energy consumption of the train, so that comparisons can be made between electric and diesel driven trains. Typical values are given for the necessary traffic parameters, emission factors, and train loading. Detailed models for train energy consumption are presented, as well as empirically based methods using average train speed and distance between stop. (au)

  20. Quantifying emissions from spontaneous combustion

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2013-09-01

    Spontaneous combustion can be a significant problem in the coal industry, not only due to the obvious safety hazard and the potential loss of valuable assets, but also with respect to the release of gaseous pollutants, especially CO2, from uncontrolled coal fires. This report reviews methodologies for measuring emissions from spontaneous combustion and discusses methods for quantifying, estimating and accounting for the purpose of preparing emission inventories.

  1. New technologies for low emissions

    Energy Technology Data Exchange (ETDEWEB)

    Burnett, G. [Kansas City Power & Light (USA)

    2001-05-01

    This paper examines new technology for coal-fired power stations, designed to achieve very low emissions with focus on the post-combustion emissions control systems installed at Howthorn. The first post-combustion system through which the flue gas passes is a selective catalytic reduction (SCR) system, consisting of two catalyst-equipped casing and various support equipment designed to provide continuous control of NOx emissions. The second system is a dry flue gas desulphurisation (dry FGD) system consisting of two spray dry absorber (SDA) vessels and supporting equipment to provide control of SO{sub 2} emissions. The third system consists of a pulse-jet bag house (PJBH) and supporting equipment to control particulate emissions. Finally, the fourth system is a material handling system (ash handling system), consisting of equipment provided to remove, recycle, and dispose of solid wastes associated with the combustion process and the three other pollution control systems. These systems bring the operation of Hawthorn 5 into compliance with federal, state, and local emission standards and enhance the positive relationship KCP & L has with its neighbours. 6 figs., 1 tab.

  2. Electron emission from pseudospark cathodes

    International Nuclear Information System (INIS)

    Anders, A.; Anders, S.; Gundersen, M.A.

    1994-01-01

    The pseudospark cathode has the remarkable property of macroscopically homogeneous electron emission at very high current density (>1 kA/cm 2 ) over a large area (some cm 2 ). The model of electron emission presented here is based on the assumption that the pseudospark microscopically utilizes explosive arc processes, as distinct from earlier models of ''anomalous emission in superdense glow discharges.'' Explosive emission similar to vacuum are cathode spots occurs rapidly when the field strength is sufficiently high. The plasma remains macroscopically homogeneous since the virtual plasma anode adapts to the cathode morphology so that the current is carried by a large number of homogeneously distributed cathode spots which are similar to ''type 1'' and ''type 2'' spots of vacuum arc discharges. The net cathode erosion is greatly reduced relative to ''spark gap-type'' emission. At very high current levels, a transition to highly erosive spot types occurs, and this ''arcing'' leads to a significant reduction in device lifetime. Assuming vacuum-arc-like cathode spots, the observed current density and time constants can be easily explained. The observed cathode erosion rate and pattern, recent fast-camera data, laser-induced fluorescence, and spectroscopic measurements support this approach. A new hypothesis is presented explaining current quenching at relatively low currents. From the point of view of electron emission, the ''superdense glow'' or ''superemissive phase'' of pseudosparks represents an arc and not a glow discharge even if no filamentation or ''arcing'' is observed

  3. Emissions trading under market imperfections

    Energy Technology Data Exchange (ETDEWEB)

    Lappi, P.

    2013-08-15

    In this thesis we consider emissions trading under various market imperfections such as uncertainty over permit price, imperfect competition and noncompliance. First, we study the effects of uncertain permit price on the firms choice of emission intensive and clean inputs in an multi-input production process. We also assess the risk aversion factors of some Finnish heat and power producers. Second, we study imperfect competition in output and permit markets with a two-stage model, where output decision is made before permit trades. The emphasis is on the strategic interaction between firms and on the efficiency increasing regulation. Third, we turn back to uncertainty and analyse the welfare difference between emissions trading and emission tax, when some of the firms may be noncompliant. The main finding is that welfare is greater with emission tax than with emissions trading, when at least one firm is noncompliant. Finally, we extend some existing models of permit banking and borrowing to encompass also noncompliant behavior of firms. Here, we analyse the incentives of compliant firms to become noncompliant at some point in time and also the time paths of the choice variables. (orig.)

  4. Flaw identification using acoustic emission

    International Nuclear Information System (INIS)

    Woodward, B.; McDonald, N.R.

    1975-01-01

    Acoustic emission 'signatures' contain information about the fine structure of metallurgical source events and their interpretation may provide a means of assessing the severity of internal flaws as well as surface flaws. The ultimate aim of this research on signature analysis is to develop a real time non-destructive testing technique having the capability of flaw recognition as well as flaw location in nuclear reactor components and structures under stress. Thus the requisite, unlike that in most acoustic emission work to date, is for a technique which affords discrimination between acoustic emission from different types of flaws propagating simultaneously. The approach described here requires detailed analysis of the emission signatures in terms of a specific statistical parameter, energy spectral density. In order to realise the full inspection potential of acoustic emission monitoring data obtained from zirconium and steel testpieces have been correlated with metallurgical condition and mechanical behaviour, since the nature of emission signatures is strongly affected by the physical characteristics and internal structure of the material. (Auth.)

  5. Price floors for emissions trading

    International Nuclear Information System (INIS)

    Wood, Peter John; Jotzo, Frank

    2011-01-01

    Price floors in greenhouse gas emissions trading schemes can guarantee minimum abatement efforts if prices are lower than expected, and they can help manage cost uncertainty, possibly as complements to price ceilings. Provisions for price floors are found in several recent legislative proposals for emissions trading. Implementation however has potential pitfalls. Possible mechanisms are government commitments to buy back permits, a reserve price at auction, or an extra fee or tax on acquittal of emissions permits. Our analysis of these alternatives shows that the fee approach has budgetary advantages and is more compatible with international permit trading than the alternatives. It can also be used to implement more general hybrid approaches to emissions pricing. - Research highlights: → Price floors for emissions trading schemes guarantee a minimum carbon price. → Price floors mean that emissions can be less than specified by the ETS cap. → We examine how price floors can relate to different policy objectives. → We compare different mechanisms for implementing a price floor. → We find that a mechanism where there is an extra tax or fee has advantages.

  6. Optical spectroscopy of the Be/X-ray binary V850 Centauri/GX 304-1 during faint X-ray periodical activity

    Science.gov (United States)

    Malacaria, C.; Kollatschny, W.; Whelan, E.; Santangelo, A.; Klochkov, D.; McBride, V.; Ducci, L.

    2017-07-01

    Context. Be/X-ray binaries (BeXRBs) are the most populous class of high-mass X-ray binaries. Their X-ray duty cycle is tightly related to the optical companion wind activity, which in turn can be studied through dedicated optical spectroscopic observations. Aims: We study optical spectral features of the Be circumstellar disk to test their long-term variability and their relation with the X-ray activity. Special attention has been given to the Hα emission line, one of the best tracers of the disk conditions. Methods: We obtained optical broadband medium resolution spectra from a dedicated campaign with the Anglo-Australian Telescope and the Southern African Large Telescope in 2014-2015. Data span over one entire binary orbit, and cover both X-ray quiescent and moderately active periods. We used Balmer emission lines to follow the evolution of the circumstellar disk. Results: We observe prominent spectral features, like double-peaked Hα and Hβ emission lines. The HαV/R ratio significantly changes over a timescale of about one year. Our observations are consistent with a system observed at a large inclination angle (I ≳ 60°). The derived circumstellar disk size shows that the disk evolves from a configuration that prevents accretion onto the neutron star, to one that allows only moderate accretion. This is in agreement with the contemporary observed X-ray activity. Our results are interpreted within the context of inefficient tidal truncation of the circumstellar disk, as expected for this source's binary configuration. We derived the Hβ-emitting region size, which is equal to about half of the corresponding Hα-emitting disk, and constrain the luminosity class of V850 Cen as III-V, consistent with the previously proposed class.

  7. ECO2, Emissions Trading Services, development project

    International Nuclear Information System (INIS)

    Ruokonen, A.

    2006-01-01

    Emissions Trading started within EU at the beginning of 2005. It caused substantial changes to the business environment of energy companies and energy intensive industry. The planning of Emissions Trading is a complicated process and companies will need consulting, IT systems and other services. Emissions Trading introduces a new factor of production emission allowances, which are tradable commodities. In future, Emissions Trading emissions, emission allowances and the prices of emission allowances have to be considered during the fuel purchasing and the energy production planning. And the best possible knowledge of the own emissions balance and market situation has a monetary value when trading emission allowances. Allocation of emission allowances has done in each country according to National Allocation Plan (NAP), accepted by EU. Finland itself and thus also the Finnish companies will be net buyers of emission allowances in long run. That means commonly that the Finnish companies have to buy more allowances meaning some extra costs to the companies. That's why it is very important to develop and provide to the companies an innovatory emissions planning, follow-up, management and reporting systems. With good emission balance management the extra costs of Emissions Trading will be as low as possible. In ECO2 project, Empower together with Power-Deriva, developed Expert services, Emissions Balance Management and Reporting services and Risk Management services for Emissions Trading and needed software and tools for these services. (orig.)

  8. Emission from power plants 1989-1998

    International Nuclear Information System (INIS)

    Anon.

    1999-01-01

    Emissions from power plants consist of several substances with different environmental effects. Most important is emission of CO 2 ,SO 2 and NO x . The actual emission of CO 2 declined from 33 million ton in 1997 to 29 million ton in 1998, while the corrected emission of CO 2 declined from 27 million ton to 26 million ton. The primary cause to the decline in the actual emission of CO 2 is the constant changing of the energy consumption from coal towards natural gas. The corrected emission of CO 2 increased a little from 1989 to 1991, but has declined since 1991. The actual emission of CO 2 has been more variable, which especially reflects the fluctuating import and export of electricity. The actual emission of SO 2 has in the period varied, but the tendency is declining emission of SO 2 . In the years 1991 and 1996 the actual emission of SO 2 increased, these being the years where the net export of electricity increased. The corrected emission of SO 2 has generally declined during the period. The actual emission of NO x has varied during the period, but the tendency is declining emission. Emission of NO x has been large this year with large electricity export. Correction the emission for net import and export of electricity the NO x emission has declined during 1989-1998. The corrected emission of NO x has declined 54 % during the period 1989-1998. The reason is primary the usage of low NO x burners. (EHS)

  9. Austrian emission inventory for dust

    International Nuclear Information System (INIS)

    Winiwarter, W.; Trenker, C.; Hoeflinger, W.

    2001-09-01

    For the first time, Austrian emissions of anthropogenic particulate matter emissions to the atmosphere have been estimated. Results have been reported as total suspended particles (TSP) as well as for the fractions of particles smaller than 10 μm or 2.5 μm aerodynamic diameter (PM 10 , PM 2.5 ), respectively. Base years for the inventory were 1990, 1995 and 1999. Excluded from this assessment is wind blown dust, which has been considered a natural source here. National statistics have been applied, specifically those also used previously in the Austrian air pollution inventory (OLI). Emission factors have been taken from literature compilations, only for exceptional cases specific Austrian assessments were performed or original literature on emission measurements was consulted. Resuspension of dust by road traffic emerged as the most important source. For the size fraction of PM 10 this source contributed about half of the emissions, when applying the calculation scheme by the U.S. EPA. While this scheme is widely used and well documented, its validity is currently subject of intense scientific debate. As these results do not seem to coincide with ambient air measurements, resuspension of road dust is considered separately and not now included in the national total. The sum of all other sources increases from 75,000 t of TSP in 1990 and 1995 to 77,000 t in 1999, while both PM 10 and PM 2.5 exhibit decreasing tendency (at 45,000 t and 26,000 t in 1999, respectively). The increase in TSP derives from increasing traffic and friction related emissions (tire wear, break wear), decrease of the finer particulate matter is due to reductions in firewood consumption for domestic heating. Most important source sectors are fugitive emissions from material transfer in industry as well as the building industry and the tilling of agricultural land. Common to these sources is the high uncertainty of available data. Wood combustion is the most important of the non

  10. Methane emissions form terrestrial plants

    Energy Technology Data Exchange (ETDEWEB)

    Bergamaschi, P.; Dentener, F.; Grassi, G.; Leip, A.; Somogyi, Z.; Federici, S.; Seufert, G.; Raes, F. [European Commission, DG Joint Research Centre, Institute for Environment and Sustainability, Ispra (Italy)

    2006-07-01

    In a recent issue of Nature Keppler et al. (2006) report the discovery that terrestrial plants emit CH4 under aerobic conditions. Until now it was thought that bacterial decomposition of plant material under anaerobic conditions, such as in wetlands and water flooded rice paddies, is the main process leading to emissions from terrestrial ecosystems. In a first attempt to upscale these measurements, the authors estimate that global total emissions may be 149 Tg CH4/yr (62-236 Tg CH4/yr), with the main contribution estimated from tropical forests and grasslands (107 Tg CH4/yr with a range of 46-169 Tg CH4/yr). If confirmed, this new source of emission would constitute a significant fraction of the total global methane sources (estimated 500-600 Tg CH4/yr for present day total natural and anthropogenic sources) and have important implications for the global CH4 budget. To accommodate it within the present budget some sources would need to be re-assessed downwards and/or some sinks re-assessed upwards. Furthermore, also considering that methane is a {approx}23 times more powerful greenhouse gas than CO2, the possible feedbacks of these hitherto unknown CH4 emissions on global warming and their impacts on greenhouse gases (GHG) mitigation strategies need to be carefully evaluated. The merit of the paper is without doubt related to the remarkable discovery of a new process of methane emissions active under aerobic conditions. However, we think that the applied approach of scaling up emissions from the leaf level to global totals by using only few measured data (mainly from herbaceous species) and the Net Primary Productivity of the main biomes is scientifically questionable and tends to overestimate considerably the global estimates, especially for forest biomes. Furthermore, some significant constraints on the upper limit of the global natural CH4 emissions arise from the pre-industrial CH4 budget. Pre-industrial atmospheric CH4 mixing ratios have been measured

  11. 40 CFR 61.67 - Emission tests.

    Science.gov (United States)

    2010-07-01

    ... EMISSION STANDARDS FOR HAZARDOUS AIR POLLUTANTS National Emission Standard for Vinyl Chloride § 61.67... hours, but in no case in excess of 72 hours of sample collection. Vinyl chloride emissions are to be... request, for inspection by the Administrator, for a minimum of 3 years, records of emission test results...

  12. Synchronization of cubic distortion spontaneous otoacoustic emissions

    NARCIS (Netherlands)

    van Dijk, P; Wit, HP

    A spontaneous otoacoustic emission spectrum may contain equally spaced emission peaks. Then, two peaks, at frequencies, f(1) and f(2), respectively, apparently generate a distortion product at f(d)=2f(1)-f(2) [or 2f(2)-f(1)]. For the three emission peaks of nine of such triplets tin six emission

  13. Emissions trading: saviour or destroyer?

    International Nuclear Information System (INIS)

    Dougas, P.; Kearney, B.

    2007-01-01

    Australia is almost certain to get a greenhouse gas emissions trading scheme in the next five years. Trading is now embraced by both political parties at the federal level and by all the states, as a key policy to address greenhouse gas emissions. But the story does not end there - there are crucial design and implementation decisions that will affect the efficiency and effectiveness of an emissions trading scheme and it is vital for the Australian economy that we get this right. Addressing greenhouse gas emissions will be a massive and costly effort and we need to make sure this happens, but at the lowest possible cost. Populist solutions and silver bullets abound, but there are no simple solutions and we need to start taking action on a broad front to minimise the cost. Emissions trading will have significant and lasting effects of the broader Australian economy, but is likely to be felt most in the energy sector. We need informed and rational discussion and policy development to get it right

  14. Flaw identification using acoustic emission

    International Nuclear Information System (INIS)

    Woodward, B.; McDonald, N.R.

    1975-01-01

    In order to realise the full inspection potential of acoustic emission monitoring, data obtained from zirconium and steel testpieces have been correlated with metallurgical condition and mechanical behaviour, since the nature of emission signatures is strongly affected by the physical characteristics and internal structure of the material. During experiments, signals were tape recorded and the surface of each testpiece was recorded on movie film or videotape so that acoustic and visual information could be correlated. Large numbers of tape-recorded bursts have been analysed with a real time spectrum analyser, and statistical parameters (such as mean energy density, mean frequency and variance) derived from the spectra were calculated by an IBM 360/50 computer and selectively displayed on a line plotter. In the case of zirconium, observed differences in these parameters were an indication that the emission signals were generated by three different metallurgical mechanisms. A movie film of testpiece surface deformation revealed the occurrence of twin initiation, twin broadening and slip. Fracture events either in the zirconium matrix or in second phase particles are also possible although not observed directly. A direct correlation was confirmed between twin initiations and emission signals. Work is proceeding on establishing a different correlation between emission signals and stress corrosion cracks

  15. Acoustic emission from polycrystalline graphites

    International Nuclear Information System (INIS)

    Ioka, I.; Yoda, S.; Oku, T.; Miyamoto, Y.

    1987-01-01

    Acoustic emission was monitored from polycrystalline graphites with different microstructure (pore size and pore volume) subjected to compressive loading. The graphites used in this study comprised five brands, that is, PGX, ISEM-1, IG-11, IG-15, and ISO-88. A root mean square (RMS) voltage and event counts of acoustic emission for graphites were measured during compressive loading. The acoustic emission was measured using a computed-based data acquisition and analysis system. The graphites were first deformed up to 80 % of the average fracture stress, then unloaded and reloaded again until the fracture occured. During the first loading, the change in RMS voltage for acoustic emission was detected from the initial stage. During the unloading, the RMS voltage became zero level as soon as the applied stress was released and then gradually rose to a peak and declined. The behavior indicated that the reversed plastic deformation occured in graphites. During the second loading, the RMS voltage gently increased until the applied stress exceeded the maximum stress of the first loading; there is no Kaiser effect in the graphites. A bicrystal model could give a reasonable explanation of this results. The empirical equation between the ratio of σ AE to σ f and σ f was obtained. It is considered that the detection of microfracture by the acoustic emission technique is effective in macrofracture prediction of polycrystalline graphites. (author)

  16. Isoprene emission from Indian trees

    Science.gov (United States)

    Varshney, C. K.; Singh, Abhai Pratap

    2003-12-01

    Isoprene is the most dominant non-methane volatile organic compound (NMVOC) emitted by plants. NMVOCs play an important role in regulating the composition of atmospheric trace gases including global concentration of tropospheric ozone. Our present knowledge about NMVOCs emission is mainly from studies on temperate tree species. So far information on biogenic NMVOCs emission from tropical tree species is limited. In this study, isoprene emission rates from 40 tropical Indian tree species belonging to 33 genera and 17 families were measured for the first time using a dynamic flow through enclosure chamber technique. The isoprene emission rate from plants (30°C and PAR 1000 μmolm-2s-1) ranged from undetectable to 81.5 μg g-1 h-1 and values were found to be comparable with other studies on tropical tree species. Tree species screened for isoprene emission in the present study may be grouped into the four categories, proposed by [2001], namely, 18 species were negligible or BDL isoprene emitting (Morus alba Linn., which were earlier reported as BDL or non isoprene emitters in US [, 1998; , 2001] were found to be appreciably high isoprene emitters (0.61-21.60 μg g-1 h-1) in the present study.

  17. Trading emissions improve air quality

    International Nuclear Information System (INIS)

    Lents, J.M.

    1993-01-01

    While admitting sharply contrasting views exist, James M. Lents of the South Coast Air Quality Management District in southern California sees emissions trading open-quotes as a lifesaver for our troubled planet.close quotes He explains: open-quotes If political support for the environment is to be maintained, we must seek the most economical and flexible means of pursuing cleanup. At present, market incentives and emissions trading represent our best hope.close quotes Lents is putting his money where his pen is. The air quality management district he heads plans to use market incentives, including emissions trading, to reduce air pollution in the notoriously dirty southern California area. When the system goes into operation in 1994, he estimates it will save southern California businesses more than $400 million a year in compliance costs, while also making major improvements in the region's air quality. If the idea works there, why won't it work elsewhere, even on a global scale, Lents asks? He believes it will. But open-quotes the ultimate success of emissions-trading programs, whether regional, national, or international in scope, lies in the proof that they're actually achieving reductions in harmful emissions,close quotes he emphasizes. open-quotes These reductions must be real and verifiable to satisfy the Clean Air Act and a skeptical public.close quotes

  18. Embodied greenhouse gas emission by Macao

    International Nuclear Information System (INIS)

    Li, J.S.; Chen, G.Q.; Lai, T.M.; Ahmad, B.; Chen, Z.M.; Shao, L.; Ji, Xi

    2013-01-01

    Comprehensive inventory of cities' greenhouse gas emissions (GHG) is the basis for cities to make appropriate mitigation plans. However, previous studies on cities' GHG emissions consider emissions occurring within the city boundary (Scope 1) and out of boundary electricity emissions (Scope 2), but neglect indirect emissions associated with commodities consumed by cities (Scope 3), resulting in emission leakage. To cope with this problem, a systematic accounting covering all 3 scopes is presented in a case study of Macao for the years 2005–2009, based on the latest embodied emission intensity databases for China and for the world. The results show that total emissions are dominated by indirect emissions mainly embodied in imports, which is 3–4 times direct emissions during the period concerned. It is verified that accounting under Scopes 1 and 2 cannot capture the full picture of cities' emissions, especially cities like Macao which are dominated by service industry and inevitably sustained by massive materials and services from other regions. Our study suggests that Macao should adjust its current GHG mitigation policies which consider only its emissions occurring within its border, as Macao is a net GHG emissions importer. This work is the first assessment of Macao's embodied GHG emissions. - Highlights: • A systematic accounting procedure is presented to inventory a city's GHG emissions. • A comprehensive review of GHG emissions is performed for Macao. • Indirect GHG emissions dominate Macao's embodied GHG emissions. • Macao induced large amount of GHG emissions in other regions through trade. • The variation in GHG emission structure against socio-economic changes is revealed

  19. Emissivity of discretized diffusion problems

    International Nuclear Information System (INIS)

    Densmore, Jeffery D.; Davidson, Gregory; Carrington, David B.

    2006-01-01

    The numerical modeling of radiative transfer by the diffusion approximation can produce artificially damped radiation propagation if spatial cells are too optically thick. In this paper, we investigate this nonphysical behavior at external problem boundaries by examining the emissivity of the discretized diffusion approximation. We demonstrate that the standard cell-centered discretization produces an emissivity that is too low for optically thick cells, a situation that leads to the lack of radiation propagation. We then present a modified boundary condition that yields an accurate emissivity regardless of cell size. This modified boundary condition can be used with a deterministic calculation or as part of a hybrid transport-diffusion method for increasing the efficiency of Monte Carlo simulations. We also discuss the range of applicability, as a function of cell size and material properties, when this modified boundary condition is employed in a hybrid technique. With a set of numerical calculations, we demonstrate the accuracy and usefulness of this modified boundary condition

  20. Instrumentation for positron emission tomography

    International Nuclear Information System (INIS)

    Budinger, T.F.; Derenzo, S.E.; Huesman, R.H.

    1984-01-01

    Positron emission tomography with a spatial resolution of 2 mm full width at half maximum for quantitation in regions of interest 4 mm in diameter will become possible with the development of detectors that achieve ultrahigh resolution. Improved resolution will be possible using solid-state photodetectors for crystal identification or photomultiplier tubes with many small electron multipliers. Temporal resolution of 2 seconds and gating of cyclic events can be accomplished if statistical requirements are met. The major physical considerations in achieving high-resolution positron emission tomography are the degradation in resolution resulting from positron range, emission angle, parallax error, detector sampling density, the sensitivity of various detector materials and packing schemes, and the tradeoff between temporal resolution and statistical accuracy. The accuracy of data required for physiological models depends primarily on the fidelity of spatial sampling independent of statistical constraints

  1. High mobility emissive organic semiconductor

    Science.gov (United States)

    Liu, Jie; Zhang, Hantang; Dong, Huanli; Meng, Lingqiang; Jiang, Longfeng; Jiang, Lang; Wang, Ying; Yu, Junsheng; Sun, Yanming; Hu, Wenping; Heeger, Alan J.

    2015-01-01

    The integration of high charge carrier mobility and high luminescence in an organic semiconductor is challenging. However, there is need of such materials for organic light-emitting transistors and organic electrically pumped lasers. Here we show a novel organic semiconductor, 2,6-diphenylanthracene (DPA), which exhibits not only high emission with single crystal absolute florescence quantum yield of 41.2% but also high charge carrier mobility with single crystal mobility of 34 cm2 V−1 s−1. Organic light-emitting diodes (OLEDs) based on DPA give pure blue emission with brightness up to 6,627 cd m−2 and turn-on voltage of 2.8 V. 2,6-Diphenylanthracene OLED arrays are successfully driven by DPA field-effect transistor arrays, demonstrating that DPA is a high mobility emissive organic semiconductor with potential in organic optoelectronics. PMID:26620323

  2. Neutron star evolution and emission

    Science.gov (United States)

    Epstein, R. I.; Edwards, B. C.; Haines, T. J.

    1997-01-01

    This is the final report of a three-year, Laboratory Directed Research and Development (LDRD) project at the Los Alamos National Laboratory (LANL). The authors investigated the evolution and radiation characteristics of individual neutron stars and stellar systems. The work concentrated on phenomena where new techniques and observations are dramatically enlarging the understanding of stellar phenomena. Part of this project was a study of x-ray and gamma-ray emission from neutron stars and other compact objects. This effort included calculating the thermal x-ray emission from young neutron stars, deriving the radio and gamma-ray emission from active pulsars and modeling intense gamma-ray bursts in distant galaxies. They also measured periodic optical and infrared fluctuations from rotating neutron stars and search for high-energy TeV gamma rays from discrete celestial sources.

  3. Air emission inventory for the Idaho National Engineering Laboratory: 1994 emissions report

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1995-07-01

    This report Presents the 1994 update of the Air Emission inventory for the Idaho National Engineering Laboratory (INEL). The INEL Air Emission Inventory documents sources and emissions of non-radionuclide pollutants from operations at the INEL. The report describes the emission inventory process and all of the sources at the INEL, and provides non-radionuclide emissions estimates for stationary sources.

  4. Air emission inventory for the Idaho National Engineering Laboratory: 1994 emissions report

    International Nuclear Information System (INIS)

    1995-07-01

    This report Presents the 1994 update of the Air Emission inventory for the Idaho National Engineering Laboratory (INEL). The INEL Air Emission Inventory documents sources and emissions of non-radionuclide pollutants from operations at the INEL. The report describes the emission inventory process and all of the sources at the INEL, and provides non-radionuclide emissions estimates for stationary sources

  5. Air Emission Inventory for the Idaho National Engineering and Environmental Laboratory - Calendar Year 1999 Emission Report

    Energy Technology Data Exchange (ETDEWEB)

    Zohner, S.K.

    2000-05-30

    This report presents the 1999 calendar year update of the Air Emission Inventory for the Idaho National Engineering and Environmental Laboratory (INEEL). The INEEL Air Emission Inventory documents sources and emissions of nonradionuclide pollutants from operations at the INEEL. The report describes the emission inventory process and all of the sources at the INEEL, and provides nonradionuclide emissions estimates for stationary sources.

  6. Air Emission Inventory for the Idaho National Engineering and Environmental Laboratory - Calendar Year 1998 Emissions Report

    Energy Technology Data Exchange (ETDEWEB)

    S. K. Zohner

    1999-10-01

    This report presents the 1998 calendar year update of the Air Emission Inventory for the Idaho National Engineering and Environmental Laboratory (INEEL). The INEEL Air Emission Inventory documents sources and emissions of nonradionuclide pollutants from operations at the INEEL. The report describes the emission inventory process and all of the sources at the INEEL, and provides nonradiological emissions estimates for stationary sources.

  7. Greenhouse effects of aircraft emissions

    International Nuclear Information System (INIS)

    Fortuin, J.P.F.; Wauben, W.M.F.; Dorland, R. van; Kelder, H.

    1996-01-01

    Ranges for direct and indirect greenhouse effects due to present day aircraft emissions are quantified for northern midlatitudes, using the concept of fixed temperature (FT) radiative forcing as calculated with a radiative transfer model. The direct greenhouse effects considered here are from emissions of carbon dioxide, water vapor, and nitrogen dioxide. To calculate the concentration increases of carbon dioxide and stratospheric water vapor, an analytical expression is developed based on a linear approximation of global fuel burn versus time. Unlike the expressions currently used in the literature, the authors' expression does not account for emission rates only, but also for a loss term--hence making it more suitable for shorter lived emittants. For midlatitude summer conditions, a total radiative forcing ranging from 0.04 to 0.09 Wm -2 is calculated for the direct greenhouse effects, whereas for midlatitude winter the range is 0.07 to 0.26 Wm -2 . The indirect greenhouse effects considered here are sulfate aerosol formation from sulfur dioxide emissions, contrail formation from emitted water vapor and condensation nuclei, and ozone formation from NO x emissions. The total radiative forcing coming from these indirect effects range from -0.67 to 0.25 Wm -2 in summer a/nd from -0.36 to 0.21 Wm -2 in winter. Further, the global distribution of NO x and ozone increases from aircraft emissions world-wide are simulated with a three-dimensional chemistry transport model for January and July. The geographical distribution of the radiative forcing associated with the simulated ozone increases is also calculated for these months

  8. OVOC Emissions and Atmospheric Transformations.

    Science.gov (United States)

    Yokelson, R. J.; Christian, T. J.; Bertschi, I. T.; Ward, D. E.; Field, R. J.; Hobbs, P. V.; Goode, J.; Mason, S.; Susott, R.; Babbitt, R.; Hao, W. M.

    2002-12-01

    We quantified the main emissions from a few vegetation samples and many biomass fires using ground-based, open-path FTIR and airborne, closed-cell FTIR. The two instruments have been rigorously compared to each other and to PTR-MS and canister sampling. OVOC are major emissions from plants. OVOC account for about 70 percent of NMOC from savanna fires (the largest type of biomass burning) and 70-80 percent of NMOC from production and use of domestic biofuels (the second largest type of biomass burning). A table of average biofuel emissions is presented. Data from laboratory and free-burning fires, obtained from Alaska to South Africa, is used to develop equations that predict OVOC emissions from a wide variety of global fires. The impact of OVOC on smoke plume chemistry and the post-emission transformations of OVOC were investigated with two models. Addition of HCHO alone to the simple chemistry used in some global models dramatically reduces NOx lifetime and speeds up O3 formation rates in plumes. A detailed model verifies these effects and shows that OVOC profoundly affect formation of HOx, peroxide, and nitrogen reservoir species. The modeled photochemical transformations of OVOC are diverse, but some key pathways are unknown. We observed rapid production of both O3 and additional OVOC and OH of 1.7E7 in smoke plumes in Alaska and Africa; all reasonably consistent with model predictions. In addition, we found that cloud processing caused large post-emission changes in smoke trace gases including removal of nearly all methanol, a decrease in acetic acid, and a large increase in HCHO. These observations suggest that OVOC could react in cloud droplets and lead to production of modified aerosol. In addition, transport of OVOC by deep convection may be associated with large effects not explained by solubility alone.

  9. Transportable Emissions Testing Laboratory for Alternative Vehicles Emissions Testing

    Energy Technology Data Exchange (ETDEWEB)

    Clark, Nigel

    2012-01-31

    The overall objective of this project was to perform research to quantify and improve the energy efficiency and the exhaust emissions reduction from advanced technology vehicles using clean, renewable and alternative fuels. Advanced vehicle and alternative fuel fleets were to be identified, and selected vehicles characterized for emissions and efficiency. Target vehicles were to include transit buses, school buses, vocational trucks, delivery trucks, and tractor-trailers. Gaseous species measured were to include carbon monoxide, carbon dioxide, oxides of nitrogen, hydrocarbons, and particulate matter. An objective was to characterize particulate matter more deeply than by mass. Accurate characterization of efficiency and emissions was to be accomplished using a state-of-the-art portable emissions measurement system and an accompanying chassis dynamometer available at West Virginia University. These two units, combined, are termed the Transportable Laboratory. An objective was to load the vehicles in a real-world fashion, using coast down data to establish rolling resistance and wind drag, and to apply the coast down data to the dynamometer control. Test schedules created from actual vehicle operation were to be employed, and a specific objective of the research was to assess the effect of choosing a test schedule which the subject vehicle either cannot follow or can substantially outperform. In addition the vehicle loading objective was to be met better with an improved flywheel system.

  10. 47 CFR 74.637 - Emissions and emission limitations.

    Science.gov (United States)

    2010-10-01

    ... paragraph (a) of this section, the resolution bandwidth (BRES) of the measuring equipment used for... the nearest greater resolution bandwidth available on the measuring equipment. In all cases, if BRES... to other stations is caused by emissions outside the authorized channel, the FCC may require greater...

  11. The downside of emissions trading

    International Nuclear Information System (INIS)

    Viialainen, M.

    2004-01-01

    High unemployment and redundancies are a major problem in Finland today, and the economic downturn has only intensified as a result of the weak dollar and low investments. The growth of the global economy and the expansion of the EU are likely to see the shift in production and jobs away from Finland to low- cost countries, such as China or the countries of Eastern Central Europe, only intensily. The cost burden imposed by emissions trading will be an added problem. The disproportionally high emission reduction demands placed on Finland within the EU could lead to the loss of as many as 15,000 jobs, according to some estimates

  12. Nanoscale Laser Terahertz Emission Microscopy

    DEFF Research Database (Denmark)

    Klarskov, Pernille; Kim, Hyewon; Colvin, Vicki L.

    2017-01-01

    Laser terahertz emission microscopy (LTEM) has become a powerful tool for studying ultrafast dynamics and local fields in many different types of materials. This technique, which relies on acceleration of charge carriers in a material upon femtosecond excitation, can provide insight into the phys......Laser terahertz emission microscopy (LTEM) has become a powerful tool for studying ultrafast dynamics and local fields in many different types of materials. This technique, which relies on acceleration of charge carriers in a material upon femtosecond excitation, can provide insight...

  13. Power station stack gas emissions

    International Nuclear Information System (INIS)

    Hunwick, Richard J.

    2006-01-01

    There are increasing awareness and pressure to reduce emissions of acid rain and photochemical smog. There is a need to produce new control system and equipment to capture those emissions. The most visible form of pollutions are the chimney smoke, dust and particles of fly ash from mineral matter in the fuel. Acid gases are hard on structures and objects containing limestone. Coal fired power generation is likely to be able to sustain its competitive advantage as a clean source of electricity in comparison with nuclear power and natural gas

  14. Positron emission tomography in oncology

    International Nuclear Information System (INIS)

    Anon.

    1988-01-01

    This report describes the current and potential uses of positron emission tomography in clinical medicine and research related to oncology. Assessment will be possible of metabolism and physiology of tumors and their effects on adjacent tissues. Specific probes are likely to be developed for target sites on tumors, including monoclonal antibodies and specific growth factors that recognize tumors. To date, most oncological applications of positron emission tomography tracers have been qualitative; in the future, quantitative metabolic measurements should aid in the evaluation of tumor biology and response to treatment

  15. NMF on positron emission tomography

    DEFF Research Database (Denmark)

    Bödvarsson, Bjarni; Hansen, Lars Kai; Svarer, Claus

    2007-01-01

    In positron emission tomography, kinetic modelling of brain tracer uptake, metabolism or binding requires knowledge of the cerebral input function. Traditionally, this is achieved with arterial blood sampling in the arm or as shown in (Liptrot, M, et al., 2004) by non-invasive K-means clustering....... We propose another method to estimate time-activity curves (TAC) extracted directly from dynamic positron emission tomography (PET) scans by non-negative matrix factorization (NMF). Since the scaling of the basis curves is lost in the NMF the estimated TAC is scaled by a vector alpha which...

  16. Study of field emission phenomena

    International Nuclear Information System (INIS)

    Ramanathan, Devaki; Vijendran, P.

    1976-01-01

    The theory of field emission has been explained, using Fowler-Nordheim equation and the Fowler-Nordheim plot. The imaging theory is also described in brief. The fabrication details of a field emission microscope (FEM) are mentioned. The design of the tube and the emitter assemblies are explained in detail. Simple experiments that can be demonstrated on the FEM such as indexing, detetermination of work function and surface diffusion constants, etc. are also mentioned. The use of FEM as a simple teaching aid has been brought out. (K.B.)

  17. Field Emission from Carbon Nanostructures

    Directory of Open Access Journals (Sweden)

    Filippo Giubileo

    2018-03-01

    Full Text Available Field emission electron sources in vacuum electronics are largely considered to achieve faster response, higher efficiency and lower energy consumption in comparison with conventional thermionic emitters. Carbon nanotubes had a leading role in renewing attention to field emission technologies in the early 1990s, due to their exceptional electron emitting properties enabled by their large aspect ratio, high electrical conductivity, and thermal and chemical stability. In the last decade, the search for improved emitters has been extended to several carbon nanostructures, comprising carbon nanotubes, either individual or films, diamond structures, graphitic materials, graphene, etc. Here, we review the main results in the development of carbon-based field emitters.

  18. NEC-2020 emission reduction scenarios

    DEFF Research Database (Denmark)

    Slentø, Erik; Nielsen, Ole-Kenneth; Hoffmann, Leif

    The upcoming NEC-2020 EU directive sets up emission ceilings for NOX, SO2, NH3, NMVOC and PM in order to meet the environmental exposure targets of the Thematic Strategy. This report contains an assessment of intermediary emission reduction scenarios for Denmark, computed by the GAINS model 2007,......, which serves as the basis for the pending negotiations in EU. The assessment is brought up to date by including a brief evaluation of the new reduction scenarios published in 2008, founding the European Commission NEC-2020 directive proposal....

  19. Reducing emissions from diesel combustion

    International Nuclear Information System (INIS)

    Anon.

    1992-01-01

    This paper contains information dealing with engine design to reduce emissions and improve or maintain fuel economy. Topics include: Observation of High Pressure Fuel Spray with Laser Light Sheet Method; Determination of Engine Cylinder Pressures from Crankshaft Speed Fluctuations; Combustion Similarity for Different Size Diesel Engines: Theoretical Prediction and Experimental Results; Prediction of Diesel Engine Particulate Emission During Transient Cycles; Characteristics and Combustibility of Particulate Matter; Dual-Fuel Diesel Engine Using Butane; Measurement of Flame Temperature Distribution in D.I. Diesel Engine with High Pressure Fuel Injection: and Combustion in a Small DI Diesel Engine at Starting

  20. Low emission internal combustion engine

    Science.gov (United States)

    Karaba, Albert M.

    1979-01-01

    A low emission, internal combustion compression ignition engine having a cylinder, a piston movable in the cylinder and a pre-combustion chamber communicating with the cylinder near the top thereof and in which low emissions of NO.sub.x are achieved by constructing the pre-combustion chamber to have a volume of between 70% and 85% of the combined pre-chamber and main combustion chamber volume when the piston is at top dead center and by variably controlling the initiation of fuel injection into the pre-combustion chamber.

  1. Dust emission from wet, low-emission coke quenching process

    Science.gov (United States)

    Komosiński, Bogusław; Bobik, Bartłomiej; Konieczny, Tomasz; Cieślik, Ewelina

    2018-01-01

    Coke plants, which produce various types of coke (metallurgical, foundry or heating), at temperatures between 600 and 1200°C, with limited access to oxygen, are major emitters of particulates and gaseous pollutants to air, water and soils. Primarily, the process of wet quenching should be mentioned, as one of the most cumbersome. Atmospheric pollutants include particulates, tar substances, organic pollutants including B(a)P and many others. Pollutants are also formed from the decomposition of water used to quench coke (CO, phenol, HCN, H2S, NH3, cresol) and decomposition of hot coke in the first phase of quenching (CO, H2S, SO2) [1]. The development of the coke oven technology has resulted in the changes made to different types of technological installations, such as the use of baffles in quench towers, the removal of nitrogen oxides by selective NOx reduction, and the introduction of fabric filters for particulates removal. The BAT conclusions for coke plants [2] provide a methodology for the measurement of particulate emission from a wet, low-emission technology using Mohrhauer probes. The conclusions define the emission level for wet quenching process as 25 g/Mgcoke. The conducted research was aimed at verification of the presented method. For two of three quench towers (A and C) the requirements included in the BAT conclusions are not met and emissions amount to 87.34 and 61.35 g/Mgcoke respectively. The lowest particulates emission was recorded on the quench tower B and amounted to 22.5 g/Mgcoke, therefore not exceeding the requirements.

  2. Particulate Matter Emission Factors for Biomass Combustion

    Directory of Open Access Journals (Sweden)

    Simone Simões Amaral

    2016-10-01

    Full Text Available Emission factor is a relative measure and can be used to estimate emissions from multiple sources of air pollution. For this reason, data from literature on particulate matter emission factors from different types of biomass were evaluated in this paper. Initially, the main sources of particles were described, as well as relevant concepts associated with particle measurements. In addition, articles about particle emissions were classified and described in relation to the sampling environment (open or closed and type of burned biomass (agricultural, garden, forest, and dung. Based on this analysis, a set of emission factors was presented and discussed. Important observations were made about the main emission sources of particulate matter. Combustion of compacted biomass resulted in lower particulate emission factors. PM2.5 emissions were predominant in the burning of forest biomass. Emission factors were more elevated in laboratory burning, followed by burns in the field, residences and combustors.

  3. Emission Trading under the Kyoto Protocol

    Energy Technology Data Exchange (ETDEWEB)

    Holtsmark, Bjart; Hagem, Cathrine

    1998-12-01

    This report discusses the potential gains from emission trading and raises some crucial questions. It shows that the total costs of the Kyoto Protocol could be reduced by about 95% through emission trading. Emission trading is an option also in the domestic arenas. The governments of the Annex B countries may allocate emission quotas to local enterprises as emission permits. Thus new markets for greenhouse gas emission quotas may emerge, domestically and internationally. It is emphasized that emission trading at the national and international levels must be discussed separately. The Nordic governments, for example, will find several good reasons for supporting emission trading at the international level if not necessarily domestically. The Nordic countries have already implemented domestic taxes on CO{sub 2} emissions and this tax policy could be sustained while these governments support and take part in emission trading at the international level.The report also considers a possible side effect of emission trading: free emission trading among Annex B countries could reduce the total abatement compared to a non-tradable policy as a consequence of the fact that some of the countries that are in transition to a market economy may be given emission limitations above their business-as-usual emissions. 40 refs., 7 figs., 4 tabs.

  4. Emissions Trading: Trends and Prospects

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2007-07-01

    This paper provides the latest developments of announced, proposed and existing greenhouse gas emissions trading schemes (ETS) around the world since 2006. It also examines different potential design options for ETS (e.g. coverage, allocation mode, provision for offsets), and how these options are treated in the existing, announced or proposed schemes.

  5. Holland bought Slovakian's emission quotas

    International Nuclear Information System (INIS)

    TREND

    2003-01-01

    It is not a direct trade but more an environmental investment. Dutch government decided to buy over 5 million tons of carbon dioxide emission quotas of Rumania, Hungary and Slovakia. But this is not a direct purchase; it is related to investments into major projects that would decrease emission of greenhouse gases in the mentioned countries. Holland will improve its emission balance set by Kyoto Protocol and 'on the other hand we will offer eastern European countries technologies they are missing,' explained the main objectives of Dutch environmental projects Erik Saat from Senter agency at Dutch Ministry of Economy. The Dutch agency has so far selected one project in Slovakia - absorption of methane gas on waste dumps of eight Slovak towns. This project in value of 5 million Euro will decrease the emission by an equivalent of 500 thousand tons of CO 2 . Slovak Ministry of Environment that has to approve these projects welcomes any activity that would lead to decreasing greenhouse gas pollution. Every three months Senter agency select the best projects submitted in order to fulfil the commitments resulting from Kyoto Protocol. (Author)

  6. Fiber optics spectrochemical emission sensors

    Science.gov (United States)

    Griffin, Jeffrey W.; Olsen, Khris B.

    1992-01-01

    A method of in situ monitoring of a body of a fluid stored in a tank or groundwater or vadose zone gases in a well for the presence of selected chemical species uses a probe insertable into the well or tank via a cable and having electrical apparatus for exciting selected chemical species in the body of fluid. The probe can have a pair of electrodes for initiating a spark or a plasma cell for maintaining a plasma to excite the selected chemical species. The probe also has optical apparatus for receiving optical emissions emitted by the excited species and optically transmitting the emissions via the cable to an analysis location outside the well. The analysis includes detecting a selected wavelength in the emissions indicative of the presence of the selected chemical species. A plurality of probes can be suspended at an end of a respective cable, with the transmitting and analyzing steps for each probe being synchronized sequentially for one set of support equipment and instrumentation to monitor at multiple test points. The optical apparatus is arranged about the light guide axis so that the selected chemical species are excited the fluid in alignment with the light guide axis and optical emissions are received from the excited chemical species along such axis.

  7. Acoustic emission on stressed concrete

    International Nuclear Information System (INIS)

    Jamet, P.; Birac, C.; Prunelle, D. de; Contre, M.; Astruc, M.; Kavyrchine, M.

    1983-08-01

    In a first part of this study, a comparison is made between the mechanical behaviour and the acoustic emission measurements on laboratory specimen during four points bending tests. The specimen were made of plain or/and reinforced concrete. The second part confirms, on real reinforced beams, the laboratory study results

  8. MICRO AUTO GASIFICATION SYSTEM: EMISSIONS ...

    Science.gov (United States)

    A compact, CONEX-housed waste to energy unit, Micro Auto Gasification System (MAGS), was characterized for air emissions from burning of military waste types. The MAGS unit is a dual chamber gasifier with a secondary diesel-fired combustor. Eight tests were conducted with multiple waste types in a 7-day period at the Kilauea Military Camp in Hawai’i. The emissions characterized were chosen based on regulatory emissions limits as well as their ability to cause adverse health effects on humans: particulate matter (PM), mercury, heavy metals, volatile organic compounds (VOCs), polyaromatic hydrocarbons (PAHs), and polychlorinated dibenzo-p-dioxins (PCDDs) and polychlorinated dibenzofurans (PCDFs). Three military waste feedstock compositions reflecting the variety of wastes to be encountered in theatre were investigated: standard waste (SW), standard waste with increased plastic content (HP), standard waste without SW food components but added first strike ration (FSR) food and packaging material (termed FSR). A fourth waste was collected from the Kilauea dumpster that served the dining facility and room lodging (KMC). Limited scrubber water and solid ash residue samples were collected to obtain a preliminary characterization of these effluents/residues.Gasifying SW, HP, and KMC resulted in similar PCDD/PCDF stack concentrations, 0.26-0.27 ng TEQ/m3 at 7% O2, while FSR waste generated a notably higher stack concentration of 0.68 ng TEQ/m3 at 7% O2. The PM emission

  9. The Emissions Gap Report 2015

    DEFF Research Database (Denmark)

    Following the historic signing of the 2030 Agenda for Sustainable Development, this sixth edition of the UNEP Emissions Gap Report comes as world leaders start gathering in Paris to establish a new agreement on climate change. The report offers an independent assessment of the mitigation...

  10. Shell theorem for spontaneous emission

    DEFF Research Database (Denmark)

    Kristensen, Philip Trøst; Mortensen, Jakob Egeberg; Lodahl, Peter

    2013-01-01

    and therefore is given exactly by the dipole approximation theory. This surprising result is a spontaneous emission counterpart to the shell theorems of classical mechanics and electrostatics and provides insights into the physics of mesoscopic emitters as well as great simplifications in practical calculations....

  11. Emissions & Measurements - Black Carbon | Science ...

    Science.gov (United States)

    Emissions and Measurement (EM) research activities performed within the National Risk Management Research Lab NRMRL) of EPA's Office of Research and Development (ORD) support measurement and laboratory analysis approaches to accurately characterize source emissions, and near source concentrations of air pollutants. They also support integrated Agency research programs (e.g., source to health outcomes) and the development of databases and inventories that assist Federal, state, and local air quality managers and industry implement and comply with air pollution standards. EM research underway in NRMRL supports the Agency's efforts to accurately characterize, analyze, measure and manage sources of air pollution. This pamphlet focuses on the EM research that NRMRL researchers conduct related to black carbon (BC). Black Carbon is a pollutant of concern to EPA due to its potential impact on human health and climate change. There are extensive uncertainties in emissions of BC from stationary and mobile sources. Emissions and Measurement (EM) research activities performed within the National Risk Management Research Lab NRMRL) of EPA's Office of Research and Development (ORD)

  12. Spontaneous emission by moving atoms

    International Nuclear Information System (INIS)

    Meystre, P.; Wilkens, M.

    1994-01-01

    It is well known that spontaneous emission is not an intrinsic atomic property, but rather results from the coupling of the atom to the vacuum modes of the electromagnetic field. As such, it can be modified by tailoring the electromagnetic environment into which the atom can radiate. This was already realized by Purcell, who noted that the spontaneous emission rate can be enhanced if the atom placed inside a cavity is resonant with one of the cavity is resonant with one of the cavity modes, and by Kleppner, who discussed the opposite case of inhibited spontaneous emission. It has also been recognized that spontaneous emission need not be an irreversible process. Indeed, a system consisting of a single atom coupled to a single mode of the electromagnetic field undergoes a periodic exchange of excitation between the atom and the field. This periodic exchange remains dominant as long as the strength of the coupling between the atom and a cavity mode is itself dominant. 23 refs., 6 figs

  13. Emission and absorption of radiation

    International Nuclear Information System (INIS)

    Fetter, S.

    1992-01-01

    A full understanding of fissile-material detection requires a solid knowledge of nuclear physics, especially the emission and absorption of radiation. The purpose of this paper is therefore to give a brief explanation of these processes so that the reader can better understand the assumptions leading to the results in the main text

  14. Carbon emissions of infrastructure development.

    Science.gov (United States)

    Müller, Daniel B; Liu, Gang; Løvik, Amund N; Modaresi, Roja; Pauliuk, Stefan; Steinhoff, Franciska S; Brattebø, Helge

    2013-10-15

    Identifying strategies for reconciling human development and climate change mitigation requires an adequate understanding of how infrastructures contribute to well-being and greenhouse gas emissions. While direct emissions from infrastructure use are well-known, information about indirect emissions from their construction is highly fragmented. Here, we estimated the carbon footprint of the existing global infrastructure stock in 2008, assuming current technologies, to be 122 (-20/+15) Gt CO2. The average per-capita carbon footprint of infrastructures in industrialized countries (53 (± 6) t CO2) was approximately 5 times larger that that of developing countries (10 (± 1) t CO2). A globalization of Western infrastructure stocks using current technologies would cause approximately 350 Gt CO2 from materials production, which corresponds to about 35-60% of the remaining carbon budget available until 2050 if the average temperature increase is to be limited to 2 °C, and could thus compromise the 2 °C target. A promising but poorly explored mitigation option is to build new settlements using less emissions-intensive materials, for example by urban design; however, this strategy is constrained by a lack of bottom-up data on material stocks in infrastructures. Infrastructure development must be considered in post-Kyoto climate change agreements if developing countries are to participate on a fair basis.

  15. Pulsar kicks from majoron emission

    International Nuclear Information System (INIS)

    Farzan, Yasaman; Gelmini, Graciela; Kusenko, Alexander

    2005-01-01

    We show that majoron emission from a hot nascent neutron star can be anisotropic in the presence of a strong magnetic field. If majorons carry a non-negligible fraction of the supernova energy, the resulting recoil velocity of a neutron star can explain the observed velocities of pulsars

  16. Emissions allocation in transportation routes

    NARCIS (Netherlands)

    Leenders, B.P.J.; Velázquez Martínez, J.; Fransoo, J.C.

    2017-01-01

    This article studies the allocation of CO2 emissions to a specific shipment in routing transportation. The authors show that this problem differs from a cost allocation problem specifically because the concavity condition does not hold necessarily in the CO2 allocation problem. This implies that a

  17. Keep the focus on emissions

    Science.gov (United States)

    Clack, C.; Benson, S. M.; Peterson, P.; Long, J. C. S.

    2016-12-01

    Most think that the major battle over climate is between those that want to solve the climate problem and the climate deniers. But there is another conflict, perhaps equally significant between people who all agree climate is a problem but who disagree radically about what they think the solution is. The imperative for stopping further climate change is to stop GHG emissions and the first energy sector of importance is electricity. Every major plan to eliminate emmissions from energy requires a carbon-free electricity system. The most popular idea about how to do this is to use all renewable energy, i.e. solar and wind power. But no one has ever built a large scale 100% renewable energy system and the few examples we have about regions that have tried are not encouraging. As the percentage of renewable energy goes up, ensuring a reliable supply often requires a fossil-based back-up system, so emissions can actually increase. Also, 100% renewable systems rely on massive deployment rates, far beyond any historical precident and often assume that adequate energy storage will "happen" through a combination of currently unavailable technologies. This approach is about adding renewable capacity, not about reducing emissions. Sweden provides a counter example that relies entirely on nuclear power and hydro and has an emission-free, reliable energy system. Likewise, biofuel is often cited as a climate-friendly substitute for petroleum-based fuels. Life-cycle analsyis indicates biofuels are often worse than petroleum-based fuels. We focus efficiency measures on buildings, but efficiency in transportation is even more important because we don't really have the fuel that is carbon neutral. Vehicle efficiency and reductions in vehicle miles traveled does better to address emissions. As mitigation is so important, climate advocates used to think discussion of adaptation was a distraction that should be avoided. But losing track of the need to eliminate emissions is the real

  18. Carbon emission from farm operations.

    Science.gov (United States)

    Lal, R

    2004-09-01

    This manuscript is a synthesis of the available information on energy use in farm operations, and its conversion into carbon equivalent (CE). A principal advantage of expressing energy use in terms of carbon (C) emission as kg CE lies in its direct relation to the rate of enrichment of atmospheric concentration of CO2. Synthesis of the data shows that estimates of emissions in kg CE/ha are 2-20 for different tillage operations, 1-1.4 for spraying chemicals, 2-4 for drilling or seeding and 6-12 for combine harvesting. Similarly, estimates of C emissions in kg CE/kg for different fertilizer nutrients are 0.9-1.8 for N, 0.1-0.3 for P2O5, 0.1-0.2 for K20 and 0.03-0.23 for lime. Estimates of C emission in kg CE/kg of active ingredient (a.i.) of different pesticides are 6.3 for herbicides, 5.1 for insecticides and 3.9 for fungicides. Irrigation, lifting water from deep wells and using sprinkling systems, emits 129+/-98 kg CE for applying 25 cm of water and 258+/-195 for 50 cm of water. Emission for different tillage methods are 35.3 kg CE/ha for conventional till, 7.9 kg CE/ha for chisel till or minimum till, and 5.8 kg CE/ha for no-till method of seedbed preparation. In view of the high C costs of major inputs, sustainable management of agricultural ecosystems implies that an output/input ratio, expressed either as gross or net output of C, must be >1 and has an increasing trend over time.

  19. AIRFORCE. Aircraft emissions and radiative forcing from emissions

    Energy Technology Data Exchange (ETDEWEB)

    Meijer, E W; Kelder, H; Velthoven, P F.J. van; Wauben, W M.F. [Royal Netherlands Meteorological Inst., De Bilt (Netherlands); Beck, J P; Velders, G J.M. [National Inst. of Public Health and the Environment, Bilthoven (Netherlands); Lelieveld, J; Scheeren, B A [Institute of Marine and Atmospheric Research Utrecht (Netherlands)

    1998-12-31

    The Dutch AIRFORCE project focuses on the effects of subsonic aircraft emissions on the chemical composition of the atmosphere and subsequent radiative forcing. It includes measurements in the tropopause region and the modelling of exhaust plumes and large-scale effects. An aircraft exhaust plume model has been developed to study plume processes. The results of the plume model are used in the global transport chemistry model CTMK to determine large-scale effects of plume processes. Due to the efficient conversion of NO{sub x} into HNO{sub 3} inside aircraft exhaust plumes, a decrease of about 25% of the O{sub 3} perturbation was found in the NAFC at 200 hPa in July. Measurements of hydrocarbons revealed a dominant role of the anthropogenic continental emissions of light hydrocarbons in the tropopause region. (author) 20 refs.

  20. AIRFORCE. Aircraft emissions and radiative forcing from emissions

    Energy Technology Data Exchange (ETDEWEB)

    Meijer, E.W.; Kelder, H.; Velthoven, P.F.J. van; Wauben, W.M.F. [Royal Netherlands Meteorological Inst., De Bilt (Netherlands); Beck, J.P.; Velders, G.J.M. [National Inst. of Public Health and the Environment, Bilthoven (Netherlands); Lelieveld, J.; Scheeren, B.A. [Institute of Marine and Atmospheric Research Utrecht (Netherlands)

    1997-12-31

    The Dutch AIRFORCE project focuses on the effects of subsonic aircraft emissions on the chemical composition of the atmosphere and subsequent radiative forcing. It includes measurements in the tropopause region and the modelling of exhaust plumes and large-scale effects. An aircraft exhaust plume model has been developed to study plume processes. The results of the plume model are used in the global transport chemistry model CTMK to determine large-scale effects of plume processes. Due to the efficient conversion of NO{sub x} into HNO{sub 3} inside aircraft exhaust plumes, a decrease of about 25% of the O{sub 3} perturbation was found in the NAFC at 200 hPa in July. Measurements of hydrocarbons revealed a dominant role of the anthropogenic continental emissions of light hydrocarbons in the tropopause region. (author) 20 refs.

  1. Pollutant emissions of commercial and industrial wood furnaces; determination of emissions and emission reducing techniques

    International Nuclear Information System (INIS)

    Baumbach, G.; Angerer, M.

    1993-01-01

    Approximately 382.000 t of wood waste from production processes are fired in Baden-Wuerttemberg per year in 4345 furnaces with capacities of less than 1 MW (field of application of the ''1 BImSchV''). This corresponds to an energy consumption of 5600 TJ. The firings with a totally installed capacity of 594 MW are operated mainly by joiners, carpenters, in sawmills and furniture factories. Certainly there are typical differences between the diverse branches concerning the characteristics of the firings such as capacity, kind of firing, of fuel supply and heat generation. Because of lacking established emission factors, at present time the emissions of these furnaces cannot be calculated. Therefore field measurements are carried out at a representative selection of the registered installations. The emissions are measured in consideration of the usual ways of operation and the commonly used fuels. Supplementarily the compound of the emitted hydrocarbons and their dependence on completeness of the combustion as well as the compound and the grain size distribution of the particle emissions are investigated. (orig.) [de

  2. Wildland fire emissions, carbon, and climate: Emission factors

    Science.gov (United States)

    Shawn Urbanski

    2014-01-01

    While the vast majority of carbon emitted by wildland fires is released as CO2, CO, and CH4, wildland fire smoke is nonetheless a rich and complex mixture of gases and aerosols. Primary emissions include significant amounts of CH4 and aerosol (organic aerosol and black carbon), which are short-lived climate forcers. In addition to CO2 and short-lived climate forcers,...

  3. The peculiar balmer decrement of SN 2009ip: Constraints on circumstellar geometry

    Energy Technology Data Exchange (ETDEWEB)

    Levesque, Emily M.; Stringfellow, Guy S.; Bally, John; Keeney, Brian A. [CASA, Department of Astrophysical and Planetary Sciences, University of Colorado 389-UCB, Boulder, CO 80309 (United States); Ginsburg, Adam G., E-mail: Emily.Levesque@colorado.edu [European Southern Observatory, ESO Headquarters, Karl-Schwarzschild-Strasse 2, D-95748 Garching bei München (Germany)

    2014-01-01

    We present optical and near-IR spectroscopic observations of the luminous blue variable SN 2009ip during its remarkable photometric evolution of 2012. The spectra sample three key points in the SN 2009ip light curve, corresponding to its initial brightening in August (2012-A) and its dramatic rebrightening in early October (2012-B). Based on line fluxes and velocities measured in our spectra, we find a surprisingly low I(Hα)/I(Hβ) ratio (∼1.3-1.4) in the 2012-B spectra. Such a ratio implies either a rare Case B recombination scenario where Hα, but not Hβ, is optically thick, or an extremely high density for the circumstellar material of n{sub e} > 10{sup 13} cm{sup –3}. The Hα line intensity yields a minimum radiating surface area of ≳20,000 AU{sup 2} in Hα at the peak of SN 2009ip's photometric evolution. Combined with the nature of this object's spectral evolution in 2012, a high circumstellar density and large radiating surface area imply the presence of a thin disk geometry around the central star (and, consequently, a possible binary companion), suggesting that the observed 2012-B rebrightening of SN 2009ip can be attributed to the illumination of the disk's inner rim by fast-moving ejecta produced by the underlying events of 2012-A.

  4. Simultaneous emission and transmission scanning in positron emission tomography

    International Nuclear Information System (INIS)

    Satoh, Tomohiko; Tanaka, Kazumi; Kitamura, Keishi; Amano, Masaharu; Miura, Shuichi

    2001-01-01

    Examination by PET (positron emission tomography) scanning, following the dosage of 2-deoxy- 18 F fluoro-D-glucose (FDG), is positively utilized for the diagnosis of cancers, rather than for the purpose of studies. This is because the examination by FDG-PET (PET scanning following the dosage of FDG) ensures higher efficiency in discrimination of cancers, than conventional CT and PET. The method of whole body scanning by PET scanning following the dosage of FDG is effectively utilized not only for discrimination cancers, but also for determining the degree of malignancy of tumors and evaluating the methods of treatment of cancers. In conventional methods for examining the degree of malignancy of tumors and evaluating the methods of cancer treatment, it is necessary to correct for the gamma-ray attenuation, which requires a longer time for examination, increasing the physical and psychological pains of the patients. We have installed the simultaneous emission and transmission scanning capability into the HEADTOME-V of the Shimadzu SET-2000W Series positron emission tomographic scanning instruments, to establish an instrument that permits FDG-PET whole body scanning in actual clinical fields, with minimized physical and psychological pains of patients concerned, yet ensuring an outstandingly high examination efficiency. This report also presents some data obtained by this newly developed instrument and those obtained in practical applications. (author)

  5. Assessment of real driving emissions via portable emission measurement system

    Science.gov (United States)

    Clenci, A.; Sălan, V.; Niculescu, R.; Iorga-Simăn, V.; Zaharia, C.

    2017-10-01

    The European Commission approved a so-called Real Driving Emission (RDE) test in response to the criticisms to the current driving cycle used at chassis dyno for homologation purpose (NEDC): it is considered outdated and misleading since air pollutants in real driving conditions are considerably higher than the certification thresholds. So, what’s at stake is the air quality which degraded continuously despite the ever-increasing severity of the regulations during the last almost three decades. Thus, from September 2017, the RDE test will become part of the type approval process for all cars sold in Europe. As its name points out, it will include “real world driving” using a portable emissions measurement system (PEMS). The paper presents the RDE features (PEMS mounting, testing environment, boundary conditions, driving dynamics) and presents a case study on the influence of the driving style upon the tail-pipe emissions under the RDE testing. The results presented in the paper issued from the existing cooperation on this topic between University of Pitesti and Renault Technologie Roumanie

  6. Methane emissions from MBT landfills

    Energy Technology Data Exchange (ETDEWEB)

    Heyer, K.-U., E-mail: heyer@ifas-hamburg.de; Hupe, K.; Stegmann, R.

    2013-09-15

    Highlights: • Compilation of methane generation potential of mechanical biological treated (MBT) municipal solid waste. • Impacts and kinetics of landfill gas production of MBT landfills, approach with differentiated half-lives. • Methane oxidation in the waste itself and in soil covers. • Estimation of methane emissions from MBT landfills in Germany. - Abstract: Within the scope of an investigation for the German Federal Environment Agency (“Umweltbundesamt”), the basics for the estimation of the methane emissions from the landfilling of mechanically and biologically treated waste (MBT) were developed. For this purpose, topical research including monitoring results regarding the gas balance at MBT landfills was evaluated. For waste treated to the required German standards, a methane formation potential of approximately 18–24 m{sup 3} CH{sub 4}/t of total dry solids may be expected. Monitoring results from MBT landfills show that a three-phase model with differentiated half-lives describes the degradation kinetics in the best way. This is due to the fact that during the first years of disposal, the anaerobic degradation processes still proceed relatively intensively. In addition in the long term (decades), a residual gas production at a low level is still to be expected. Most of the soils used in recultivation layer systems at German landfills show a relatively high methane oxidation capacity up to 5 l CH{sub 4}/(m{sup 2} h). However, measurements at MBT disposal sites indicate that the majority of the landfill gas (in particular at non-covered areas), leaves the landfill body via preferred gas emission zones (hot spots) without significant methane oxidation. Therefore, rather low methane oxidation factors are recommended for open and temporarily covered MBT landfills. Higher methane oxidation rates can be achieved when the soil/recultivation layer is adequately designed and operated. Based on the elaborated default values, the First Order Decay (FOD

  7. Isoprene emission from wetland sedges

    Directory of Open Access Journals (Sweden)

    A. Ekberg

    2009-04-01

    Full Text Available High latitude wetlands play an important role for the surface-atmosphere exchange of carbon dioxide (CO2 and methane (CH4, but fluxes of biogenic volatile organic compounds (BVOC in these ecosystems have to date not been extensively studied. This is despite BVOC representing a measurable proportion of the total gaseous C fluxes at northern locations and in the face of the high temperature sensitivity of these systems that requires a much improved process understanding to interpret and project possible changes in response to climate warming. We measured emission of isoprene and photosynthetic gas exchange over two growing seasons (2005–2006 in a subarctic wetland in northern Sweden with the objective to identify the physiological and environmental controls of these fluxes on the leaf scale. The sedge species Eriophorum angustifolium and Carex rostrata were both emitters of isoprene. Springtime emissions were first detected after an accumulated diurnal mean temperature above 0°C of about 100 degree days. Maximum measured growing season standardized (basal emission rates (20°C, 1000 μmol m−2 s−1 were 1075 (2005 and 1118 (2006 μg C m−2 (leaf area h−1 in E. angustifolium, and 489 (2005 and 396 (2006 μg C m−2 h−1 in C. rostrata. Over the growing season, basal isoprene emission varied in response to the temperature history of the last 48 h. Seasonal basal isoprene emission rates decreased with leaf nitrogen (N, which may be explained by the typical growth and resource allocation pattern of clonal sedges as the leaves age. The observations were used to model emissions over the growing season, accounting for effects of temperature history, links to leaf assimilation rate and the light and temperature dependencies of the cold-adapted sedges.

  8. Air Emissions Sources, Charts and Maps

    Data.gov (United States)

    U.S. Environmental Protection Agency — Air Emissions provides (1) interactive charts supporting national, state, or county charts, (2) county maps of criteria air pollutant emissions for a state, and (3)...

  9. AP-42 Emissions Factors (WebFIRE)

    Data.gov (United States)

    U.S. Environmental Protection Agency — Emissions factors have long been the fundamental tool in developing national, regional, state, and local emissions inventories for air quality management decisions...

  10. Laboratory technique for quantitative thermal emissivity ...

    Indian Academy of Sciences (India)

    Emission of radiation from a sample occurs due to thermal vibration of its .... Quantitative thermal emissivity measurements of geological samples. 393. Figure 1. ...... tral mixture modeling: A new analysis of rock and soil types at the Viking ...

  11. Canada`s greenhouse gas emissions inventory

    Energy Technology Data Exchange (ETDEWEB)

    Jaques, A. [Environment Canada, Ottawa, ON (Canada)

    1998-09-01

    In 1994, Canada was the seventh largest global emitter of CO{sub 2}. The Kyoto Protocol has made it necessary to continue to improve methods for developing emissions inventories. An emissions inventory was defined as `a comprehensive account of air pollutant emissions and associated data from sources within the inventory area over a specified time frame that can be used to determine the effect of emissions on the environment`. The general approach is to compile large-scale emission estimates under averaged conditions for collective sources and sectors, using data that is available on a sectoral, provincial and national basis. Ideally, continuous emission monitors should be used to develop emissions inventories. Other needed improvements include additional research on emissions data, and increased support for international negotiations on reporting policies and related methodologies, verification procedures and adjustments. 1 ref., 5 figs.

  12. Evaluation of green house gas emissions models.

    Science.gov (United States)

    2014-11-01

    The objective of the project is to evaluate the GHG emissions models used by transportation agencies and industry leaders. Factors in the vehicle : operating environment that may affect modal emissions, such as, external conditions, : vehicle fleet c...

  13. Compliance and Emissions Data Reporting Interface (CEDRI)

    Data.gov (United States)

    U.S. Environmental Protection Agency — EPA regulations codified in 40 CFR Part 60 and 63 require affected sources to perform emissions source tests, conduct continuous emissions monitoring, and submit...

  14. Estimation of Turkish road transport emissions

    International Nuclear Information System (INIS)

    Soylu, Seref

    2007-01-01

    Using the COPERT III program, an inventory of Turkish road transport emissions was calculated and the contributions of road transport to global and local air pollutant emissions were examined for the year 2004. It was observed that passenger cars are the main source of CO, HC, and Pb emissions while heavy duty vehicles are mainly responsible for NO x , particulate matter (PM), and SO 2 emissions. Taking the emissions for the year 2004 as the baseline, a parametric study was conducted to determine the emission reduction potentials of different road transport strategies. The results indicated that the following road transport strategies; fleet renewal, promotion of public transportation, and faster urban traffic speed are very effective strategies for reducing regulated emissions and fuel consumption (FC) from a technical point of view. It was also noted that replacement of two-stroke motorcycles with four-stroke motorcycles is as effective as fleet renewal in reducing HC emissions

  15. Controlling nanowire emission profile using conical taper

    DEFF Research Database (Denmark)

    Gregersen, Niels; Nielsen, Torben Roland; Mørk, Jesper

    2008-01-01

    The influence of a conical taper on nanowire light emission is studied. For nanowires with divergent output beams, the introduction of tapers improves the emission profile and increase the collection efficiency of the detection optics....

  16. Field emission studies at Saclay and Orsay

    International Nuclear Information System (INIS)

    Tan, J.

    1996-01-01

    During the last five years, DC and RF equipment for field emission studies have been developed at Saclay and Orsay laboratories. Combining these devices, straight comparison has been carried out between DC and RF field emission from artificial emission sites on the same sample. Other topics are also reviewed: high field cleaning, plausible origins of thermal effects that occurred on emission sites in RF, behaviour of alumina particles under RF field, and optical observations and measurements. (author)

  17. Electron cyclotron emission from the PLT tokamak

    International Nuclear Information System (INIS)

    Hosea, J.; Arunasalam, V.; Cano, R.

    1977-07-01

    Experimental measurements of electron cyclotron emission from the PLT tokamak plasma reveal that black-body emission occurs at the fundamental frequency. Such emission, not possible by direct thermal excitation of electromagnetic waves, is herein attributed to thermal excitation of electrostatic (Bernstein) waves which then mode convert into electromagnetic waves. The local feature of the electrostatic wave generation permits spatially and time resolved measurements of electron temperature as for the second harmonic emission

  18. Greenhouse gas emissions increase global warming

    OpenAIRE

    Mohajan, Haradhan

    2011-01-01

    This paper discusses the greenhouse gas emissions which cause the global warming in the atmosphere. In the 20th century global climate change becomes more sever which is due to greenhouse gas emissions. According to International Energy Agency data, the USA and China are approximately tied and leading global emitters of greenhouse gas emissions. Together they emit approximately 40% of global CO2 emissions, and about 35% of total greenhouse gases. The developed and developing industrialized co...

  19. MOVES (MOTOR VEHICLE EMISSION SIMULATOR) MODEL ...

    Science.gov (United States)

    A computer model, intended to eventually replace the MOBILE model and to incorporate the NONROAD model, that will provide the ability to estimate criteria and toxic air pollutant emission factors and emission inventories that are specific to the areas and time periods of interest, at scales ranging from local to national. Development of a new emission factor and inventory model for mobile source emissions. The model will be used by air pollution modelers within EPA, and at the State and local levels.

  20. Developing emission reduction credit trading in Texas

    International Nuclear Information System (INIS)

    Dodds, J.E.

    1993-01-01

    The Texas Air Control Board has begun to develop a system of emission reduction credit training. The system will be developed incrementally over time. The first step, banking of VOC and NO x Emission Reduction Credits, began March 15, 1993. Additional programs under study and development include NO x RACT trading, emission credits for motor vehicle scrappage and alternative fuel conversion, and establishment of community organizations to generate and acquire emission reduction credits for economic development purposes

  1. Pollutants emission in power sector

    International Nuclear Information System (INIS)

    Chmielewski, A.G.

    2011-01-01

    Fossil fuels, including coal, natural gas, petroleum, shale oil and bitumen, are the primary source of heat and electrical energy production and are responsible for emitting a large number and amount of pollutants into the atmosphere via exhaust gases from industry, power stations, residential heating systems and vehicles. During the combustion process, different pollutants such as CO 2 , SO X (including SO 2 and SO 3 ), NO X (including NO 2 , NO and N 2 O), fly ash, VOCs and mercury are emitted. These emissions cause big environmental and human health hazard. CO 2 , N 2 O, some VOCs, CH 4 contribute to the global greenhouse effect, adding a new dimension to the environmental degradation resulting from the burning of fossil fuels. These problems regarding emissions inventory, their impact on the environment and human health, air pollution control technologies and costs, periods of fossil fuels depletion, role of renewable and nuclear energy in the further civilization development are briefly discussed. (author)

  2. Evaluation of Emissions Bio diesel

    International Nuclear Information System (INIS)

    Rodriguez Maroto, J. J.; Dorronsoro Arenal, J. L.; Rojas Garcia, E.; Perez Pastor, R.; Garcia Alonso, S.

    2007-01-01

    The generation of energy from vegetal products is one of the possibilities to our reach in order to reduce the atmospheric pollution. Particularly, the use of bio diesel in internal combustion engines can be one of the best options. The finest particles emitted by the combustion engines are easily breathable and on them different substances can be absorbed presumably toxic, between which it is possible to emphasize the polycyclic aromatic hydrocarbons (PAHs), by its demonstrated carcinogen character. In this work, it is studied on the one hand, the characteristics that can present the aerosol of emission in a diesel engine with a maximum power of 97 kW, working without load to 600 rpm, using as combustible mixtures of bio diesel and diesel in different proportions. On the other hand, the evolution that takes place in the concentration of PAHs in emission particles, according to the percentage of bio diesel used in the combustible mixture. (Author) 9 refs

  3. Evaluation of Emissions Bio diesel

    Energy Technology Data Exchange (ETDEWEB)

    Rodriguez Maroto, J J; Dorronsoro Arenal, J L; Rojas Garcia, E; Perez Pastor, R; Garcia Alonso, S

    2007-09-27

    The generation of energy from vegetal products is one of the possibilities to our reach in order to reduce the atmospheric pollution. Particularly, the use of bio diesel in internal combustion engines can be one of the best options. The finest particles emitted by the combustion engines are easily breathable and on them different substances can be absorbed presumably toxic, between which it is possible to emphasize the polycyclic aromatic hydrocarbons (PAHs), by its demonstrated carcinogen character. In this work, it is studied on the one hand, the characteristics that can present the aerosol of emission in a diesel engine with a maximum power of 97 kW, working without load to 600 rpm, using as combustible mixtures of bio diesel and diesel in different proportions. On the other hand, the evolution that takes place in the concentration of PAHs in emission particles, according to the percentage of bio diesel used in the combustible mixture. (Author) 9 refs.

  4. Aerosol emission during human speech

    Science.gov (United States)

    Asadi, Sima; Wexler, Anthony S.; Cappa, Christopher D.; Bouvier, Nicole M.; Barreda-Castanon, Santiago; Ristenpart, William D.

    2017-11-01

    We show that the rate of aerosol particle emission during healthy human speech is strongly correlated with the loudness (amplitude) of vocalization. Emission rates range from approximately 1 to 50 particles per second for quiet to loud amplitudes, regardless of language spoken (English, Spanish, Mandarin, or Arabic). Intriguingly, a small fraction of individuals behave as ``super emitters,'' consistently emitting an order of magnitude more aerosol particles than their peers. We interpret the results in terms of the eggressive flowrate during vocalization, which is known to vary significantly for different types of vocalization and for different individuals. The results suggest that individual speech patterns could affect the probability of airborne disease transmission. The results also provide a possible explanation for the existence of ``super spreaders'' who transmit pathogens much more readily than average and who play a key role in the spread of epidemics.

  5. Climate, energy and emissions trading

    International Nuclear Information System (INIS)

    Baron, R.; Philibert, C.

    2007-01-01

    The authors question the 4 main concerns that have arisen since the implementation of emission trade markets 3 years ago. First, the allowance policy was not accurate enough and has led to a surplus offer of CO 2 allowances. Secondly, the impact on electricity prices of carbon emission costs was all the higher as it happened at the moment of the deregulation of electricity markets. Thirdly, the CO 2 allowances whose price will near 14 euros a ton for the 2008-2012 period are accused of hindering the competitiveness of the European industrial sector. Fourth, the present allowance system that gives to new comers free CO 2 allowances is not very conducive to the adoption by these new comers of technologies that are less CO 2 emitting. Some ways of improvement are given. (A.C.)

  6. Mechanisms of fission neutron emission

    International Nuclear Information System (INIS)

    Maerten, H.

    1991-01-01

    The time evolution in fission is the starting point for discussing not only the main mechanism of fission neutron emission, the evaporation from fully accelerated fragments, but also possible secondary ones connected with dynamical features of nuclear fission. ''Asymptotic'' conditions as relevant for describing the particle release from highly excited, rapidly moving fragments are defined. Corresponding statistical model approaches to fission neutron emission, based on the adequate consideration of the intricate fragment occurrence probability, reproduce most of the experimental data. The remarkable influence of fission modes on neutron observables is analyzed in the framework of a macroscopic-microscopic scission point model consistent with energy conservation. Finally, chances and deficiencies for solving the mechanism puzzle are summarized. (author). 87 refs, 21 figs

  7. Acoustic emission linear pulse holography

    International Nuclear Information System (INIS)

    Collins, H.D.; Busse, L.J.; Lemon, D.K.

    1983-01-01

    This paper describes the emission linear pulse holography which produces a chronological linear holographic image of a flaw by utilizing the acoustic energy emitted during crack growth. A thirty two point sampling array is used to construct phase-only linear holograms of simulated acoustic emission sources on large metal plates. The concept behind the AE linear pulse holography is illustrated, and a block diagram of a data acquisition system to implement the concept is given. Array element spacing, synthetic frequency criteria, and lateral depth resolution are specified. A reference timing transducer positioned between the array and the inspection zone and which inititates the time-of-flight measurements is described. The results graphically illustrate the technique using a one-dimensional FFT computer algorithm (ie. linear backward wave) for an AE image reconstruction

  8. Emissions from the Bena Landfill

    Science.gov (United States)

    Schafer, C.; Blake, D. R.; Hughes, S.

    2016-12-01

    In 2013, Americans generated 254 million tons of municipal solid waste (MSW). The gas generated from the decomposition of MSW is composed of approximately 50% methane, 50% carbon dioxide, and a small proportion of non-methane organic compounds (NMOCs). NMOCs constitute less than 1% of landfill emissions, but they can have a disproportionate environmental impact as they are highly reactive ozone precursors. During the 2016 Student Airborne Research Program (SARP), whole air samples were collected at the Bena landfill outside of Bakersfield, CA and throughout Bakersfield and analyzed using gas chromatography in order to quantify NMOC emissions. This area was determined to have elevated concentrations of benzene, trichloroethylene, and tetrachloroethylene, all of which are categorized by the EPA as hazardous to human health. Benzene was found to have a concentration of 145 ± 4 pptv, four times higher than the background levels in Bakersfield (36 ± 1 pptv). Trichloroethylene and tetrachloroethylene had concentrations of 18 ± 1 pptv and 31 ± 1 pptv which were 18 and 10 times greater than background concentrations, respectively. In addition, hydroxyl radical reactivity (ROH) was calculated to determine the potential for tropospheric ozone formation. The total ROH of the landfill was 7.5 ± 0.2 s-1 compared to total background ROH of 1.0 ± 0.1 s-1 . NMOCs only made up 0.6% of total emissions, but accounted for 67% of total ROH.These results can help to shape future landfill emission policies by highlighting the importance of NMOCs in addition to methane. More research is needed to investigate the ozone forming potential of these compounds at landfills across the country.

  9. Positron emission tomography. Basic principles

    International Nuclear Information System (INIS)

    Rodriguez, Jose Luis; Massardo, Teresa; Gonzalez, Patricio

    2001-01-01

    The basic principles of positron emission tomography (PET) technique are reviewed. lt allows to obtain functional images from gamma rays produced by annihilation of a positron, a positive beta particle. This paper analyzes positron emitters production in a cyclotron, its general mechanisms, and the various detection systems. The most important clinical applications are also mentioned, related to oncological uses of fluor-l8-deoxyglucose

  10. Competitiveness and linking of emission trading systems

    Energy Technology Data Exchange (ETDEWEB)

    Hausotter, Tobias; Steuwer, Sibyl; Taenzler, Dennis [adelphi, Berlin (Germany)

    2011-01-15

    The establishment of emission trading systems raises concerns among industries regarding international competitive disadvantages for the industries under an emissions cap. This study aims to assess competitiveness exposure of industrial sectors and presents policy measures to address these concerns. Moreover, the study provides a comparison of different existing approaches to competitiveness concerns proposed by regional emission trading systems. (orig.)

  11. Judicial aspects of emission trade. Disputes

    International Nuclear Information System (INIS)

    Bitter, J.W.

    2004-01-01

    Emission trade will start in Europe in 2005. In a series of articles an overview will be given of several juridical aspects with respect to the international and national trade of emission. In this last part attention will be paid to settlement of disputes in emissions trade [nl

  12. Bioluminescence emissions of the firefly Luciola praeusta ...

    Indian Academy of Sciences (India)

    Prakash

    The emission of light by fireflies has been of considerable ... vivo emission spectrum of a firefly Luciola praeusta, where the full width at ... In vivo emission spectra of fifty specimens, both male .... oxidation in a liquid phase; Biofizika 9 306–311.

  13. Multifragment emission times in Xe induced reactions

    Energy Technology Data Exchange (ETDEWEB)

    Moroni, A. [INFN and Dipartimento di Fisica, Via Celoria 16, 20133 Milano (Italy); Bowman, D.R. [AECL Research, Chalk River Laboratories, Chalk River, Ont. (Canada); Bruno, M. [Dipartimento di Fisica and INFN, Via Irnerio 46, 40126 Bologna (Italy); Buttazzo, P. [Dipartimento di Fisica and INFN, Via A. Valerio 2, 34127 Trieste (Italy); Celano, L. [INFN, Via Amendola 173, 70126 Bari (Italy); Colonna, N. [INFN, Via Amendola 173, 70126 Bari (Italy); D`Agostino, M. [Dipartimento di Fisica and INFN, Via Irnerio 46, 40126 Bologna (Italy); Dinius, J.D. [NSCL, Michigan State University, E. Lansing, 48824 MI (United States); Ferrero, A. [INFN and Dipartimento di Fisica, Via Celoria 16, 20133 Milano (Italy); Fiandri, M.L. [Dipartimento di Fisica and INFN, Via Irnerio 46, 40126 Bologna (Italy); Gelbke, K. [NSCL, Michigan State University, E. Lansing, 48824 MI (United States); Glasmacher, T. [NSCL, Michigan State University, E. Lansing, 48824 MI (United States); Gramegna, F. [INFN Laboratori Nazionali di Legnaro, Via Romea 4, 35020 Legnaro (Italy); Handzy, D.O. [NSCL, Michigan State University, E. Lansing, 48824 MI (United States); Horn, D. [AECL Research, Chalk River Laboratories, Chalk River, Ont. (Canada); Hsi Wenchien [NSCL, Michigan State University, E. Lansing, 48824 MI (United States); Huang, M. [NSCL, Michigan State University, E. Lansing, 48824 MI (United States); Iori, I. [INFN and Dipartimento di Fisica, Via Celoria 16, 20133 Milano (Italy); Lisa, M. [NSCL, Michigan State University, E. Lansing, 48824 MI (United States); Lynch, W.G. [NSCL, Michigan State University, E. Lansing, 48824 MI (United States); Margagliotti, G.V. [Dipartimento di Fisica and INFN, Via A. Valerio 2, 34127 Trieste (Italy); Mastinu, P.F. [Dipartimento di Fisica and INFN, Via Irnerio 46, 40126 Bologna (Italy); Milazzo, P.M. [Dipartimento di Fisica and INFN, Via Irnerio 46, 40126 Bologna (Italy); Montoya, C.

    1995-02-06

    Multifragment emission is studied in {sup 129}Xe+{sup nat}Cu reactions. The emission process for central collisions occurs on a time scale of similar 200fm/c at 30MeV/n. Intermediate-mass-fragment yields, velocity correlation functions and emission velocities of Z=6 fragments are compared with predictions of statistical decay models. ((orig.)).

  14. 40 CFR 61.163 - Emission monitoring.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 8 2010-07-01 2010-07-01 false Emission monitoring. 61.163 Section 61... Emissions From Glass Manufacturing Plants § 61.163 Emission monitoring. (a) An owner or operator of a glass..., calibrate, maintain, and operate a continuous monitoring system for the measurement of the opacity of...

  15. 40 CFR 61.183 - Emission monitoring.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 8 2010-07-01 2010-07-01 false Emission monitoring. 61.183 Section 61... Emissions From Arsenic Trioxide and Metallic Arsenic Production Facilities § 61.183 Emission monitoring. (a..., calibrate, maintain, and operate a continuous monitoring system for the measurement of the opacity of each...

  16. 47 CFR 90.669 - Emission limits.

    Science.gov (United States)

    2010-10-01

    ... 896-901/935-940 Mhz Band § 90.669 Emission limits. (a) On any frequency in an MTA licensee's spectrum block that is adjacent to a non-MTA frequency, the power of any emission shall be attenuated below the... 47 Telecommunication 5 2010-10-01 2010-10-01 false Emission limits. 90.669 Section 90.669...

  17. New Commitment Options: Compatibility with Emissions Trading

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2006-07-01

    This paper considers different options for quantitative greenhouse gas emission commitments from the standpoint of their technical compatibility with emissions trading. These are dynamic targets, binding targets with price caps, non-binding targets, sector-wide targets/mechanisms, action targets, allowances and endowments, and long-term permits. This paper considers these options from the standpoint of their compatibility with emissions trading.

  18. Fugitive methane emissions from an agricultural biodigester

    International Nuclear Information System (INIS)

    Flesch, Thomas K.; Desjardins, Raymond L.; Worth, Devon

    2011-01-01

    The use of agricultural biodigesters provides a strategy for reducing greenhouse gas (GHG) emissions while generating energy. The GHG reduction associated with a biodigester will be affected by fugitive emissions from the facility. The objective of this study was to measure fugitive methane (CH 4 ) emissions from a Canadian biodigester. The facility uses anaerobic digestion to produce biogas from cattle manure and other organic feedstock, which is burnt to generate electricity (1 MW capacity) and heat. An inverse dispersion technique was used to calculate emissions. Fugitive emissions were related to the operating state of the biodigester, and over four seasonal campaigns the emission rate averaged 3.2, 0.8, and 26.6 kg CH 4 hr -1 for normal operations, maintenance, and flaring periods, respectively. During normal operations the average fugitive emission rate corresponded to 3.1% of the CH 4 gas production rate. -- Highlights: → Biodigesters reduce greenhouse gas emissions. → Net emission reduction affected by fugitive emissions. → Fugitive CH 4 measured at agricultural biodigester (1 MW generating capacity). → Emissions were 3.1% of gas production. → Emissions lower than assumed in carbon credit protocols.

  19. Characterizing sources of emissions from wildland fires

    Science.gov (United States)

    Roger D. Ottmar; Ana Isabel Miranda; David V. Sandberg

    2009-01-01

    Smoke emissions from wildland fire can be harmful to human health and welfare, impair visibility, and contribute to greenhouse gas emissions. The generation of emissions and heat release need to be characterized to estimate the potential impacts of wildland fire smoke. This requires explicit knowledge of the source, including size of the area burned, burn period,...

  20. Aircraft Piston Engine Exhaust Emission Symposium

    Science.gov (United States)

    1976-01-01

    A 2-day symposium on the reduction of exhaust emissions from aircraft piston engines was held on September 14 and 15, 1976, at the Lewis Research Center in Cleveland, Ohio. Papers were presented by both government organizations and the general aviation industry on the status of government contracts, emission measurement problems, data reduction procedures, flight testing, and emission reduction techniques.

  1. Review Existing and Proposed Emissions Trading Systems

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2010-07-01

    This paper reviews key design features of mandatory emissions trading systems that had been established or were under consideration in 2010, with a particular focus on implications for the energy sector. Putting a price on greenhouse gas emissions is a cornerstone policy in climate change mitigation. To this end, many countries have implemented or are developing domestic emissions trading systems.

  2. 47 CFR 22.359 - Emission limitations.

    Science.gov (United States)

    2010-10-01

    ... provided the measured power is integrated over the full required measurement bandwidth (i.e., 30 kHz or 1..., to the FCC. (d) Interference caused by out of band emissions. If any emission from a transmitter..., the FCC may require a greater attenuation of that emission than specified in this section. [70 FR...

  3. 47 CFR 22.861 - Emission limitations.

    Science.gov (United States)

    2010-10-01

    ... improve measurement accuracy provided the measured power is integrated over the full required measurement... transferees and, upon request, to the FCC. (d) Interference caused by out of band emissions. If any emission..., the FCC may require a greater attenuation of that emission than specified in this section. [70 FR...

  4. 40 CFR 76.11 - Emissions averaging.

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 16 2010-07-01 2010-07-01 false Emissions averaging. 76.11 Section 76.11 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) ACID RAIN NITROGEN OXIDES EMISSION REDUCTION PROGRAM § 76.11 Emissions averaging. (a) General...

  5. NOx emission reduction from gas turbines

    International Nuclear Information System (INIS)

    Groppi, G.; Lietti, L.; Forzatti, P.

    2001-01-01

    NO x emissions from gas turbines are a serious environmental concern. Primary control technologies significantly reduce NO x formation, which however is still too high to match increasingly strict emission laws. Catalytic processes can provide lower NO x emissions both as primary and secondary control methods, but their economics should be carefully addressed [it

  6. Characteristic emission in glutaraldehyde polymerized hemoglobin

    International Nuclear Information System (INIS)

    Ma Li; Wang Xiaojun

    2011-01-01

    Hemoglobin with different modifications has been investigated using spectroscopic techniques. A new emission at around 371 nm has been observed under excitation of 305 nm from glutaraldehyde polymerized human hemoglobin. Intensity and peak position of the emission are dependent on both oxidation state and ligand environment and the emission has been identified from the hemoglobin oligomer.

  7. Secondary electron emission from insulators

    International Nuclear Information System (INIS)

    Kanaya, K.; Ono, S.; Ishigaki, F.

    1978-01-01

    The high yield of secondary electron emission from insulators due to electron bombardment may be the result of an increase of the depth of escape. The free-electron scattering theory is applied to the high energy of primary beams, but cannot be applied to the low energy of secondary escaping beams because of the large energy gap of the insulators. The plasmon loss with the valence electron is considered when the secondary electrons escape. Based on the energy retardation power formula of the penetration and energy loss of an electron probe into solid targets, secondary electron emissions from insulators are calculated from the assumptions that the distribution of the secondary electrons due to both incident and back-scattered electrons within the target is isotropic and that it follows the absorption law of the Lenard type. The universal yield-energy curve of the secondary electron emission, which is deduced as a function of three parameters such as ionisation potential, valence electron and the back-scattered coefficient in addition to the free-electron density effect, is found to be in good agreement with the experimental results. (author)

  8. Wave emission by resonance crossing

    International Nuclear Information System (INIS)

    Tracy, E.R.; Kaufman, A.N.; Liang, Y.

    1995-01-01

    The emission of collective waves by a moving charged particle in a nonuniform medium is discussed. Emission occurs in a nonuniform medium when the local dispersion relation of the collective wave is satisfied. This is a form of resonance crossing. Using the Weyl symbol calculus, a local expansion of the collective wave equation driven by the particle source is derived in the neighborhood of the crossing. The collective wave dispersion manifold and the gyroballistic wave dispersion manifold can be used as a pair of local coordinates in the neighborhood of the resonance crossing, which greatly simplifies the analysis. This change of representation is carried out using a metaplectic transform (a generalization of the fourier transform). The Wigner function of the emitted wave field is then computed in the new coordinates. The Wigner function is a phase space scalar, hence the numerical value is invariant under linear canonical transformations. This invariance is invoked to finally arrive at the Wigner function in the original (physical) coordinates. The wave-action and -energy emission rates are then computed from the Wigner function. copyright 1995 American Institute of Physics

  9. Gold emissivities for hydrocode applications

    Science.gov (United States)

    Bowen, C.; Wagon, F.; Galmiche, D.; Loiseau, P.; Dattolo, E.; Babonneau, D.

    2004-10-01

    The Radiom model [M. Busquet, Phys Fluids B 5, 4191 (1993)] is designed to provide a radiative-hydrodynamic code with non-local thermodynamic equilibrium (non-LTE) data efficiently by using LTE tables. Comparison with benchmark data [M. Klapisch and A. Bar-Shalom, J. Quant. Spectrosc. Radiat. Transf. 58, 687 (1997)] has shown Radiom to be inaccurate far from LTE and for heavy ions. In particular, the emissivity was found to be strongly underestimated. A recent algorithm, Gondor [C. Bowen and P. Kaiser, J. Quant. Spectrosc. Radiat. Transf. 81, 85 (2003)], was introduced to improve the gold non-LTE ionization and corresponding opacity. It relies on fitting the collisional ionization rate to reproduce benchmark data given by the Averroès superconfiguration code [O. Peyrusse, J. Phys. B 33, 4303 (2000)]. Gondor is extended here to gold emissivity calculations, with two simple modifications of the two-level atom line source function used by Radiom: (a) a larger collisional excitation rate and (b) the addition of a Planckian source term, fitted to spectrally integrated Averroès emissivity data. This approach improves the agreement between experiments and hydrodynamic simulations.

  10. Fugitive emissions from nanopowder manufacturing

    International Nuclear Information System (INIS)

    Trompetter, W. J.; Ancelet, T.; Davy, P. K.; Kennedy, J.

    2016-01-01

    In response to health and safety questions and concerns regarding particulate matter emissions from equipment used for synthesizing NiFe and TiO 2 nanopowders, a study was undertaken to assess their impact on the air quality inside and outside a laboratory where the manufacturing equipment is operated. Elemental concentrations determined by ion beam analysis (IBA) of air particulate matter (PM) samples collected hourly with a Streaker TM sampler were used to identify possible sources and estimate contributions from nanopowder production and other sources. The fugitive nanopowder emissions were the highest at the indoor sampling location when powders were being manufactured. Average fugitive emissions of 210 ng m −3 (1-h average) (maximum 2163 ng m −3 1-h average) represented 2 % (maximum 20 %) of the average PM collected (9359 ng m −3 1-h average). The measured NiFe alloy or TiO 2 PM concentrations were much smaller than the 8-h time-weighted average (TWA) workplace exposure standards (WES) for these materials (≥1,000,000 ng m −3 ). Most PM was found to be from infiltrated outdoor ambient sources. This suggests that nanopowder production in the laboratory is not likely to have adverse health effects on individuals using the equipment, although further improvements can be made to further limit exposure.Graphical abstract

  11. Emissions trading in the Netherlands

    International Nuclear Information System (INIS)

    Zapfel, P.

    2002-01-01

    In the article 'Emissions trading in the Netherlands. The optimal route towards an international scheme?' (issue 1, 2002) Mulder asks the question to what extent a Dutch national CO2 trading scheme is a worthwhile effort toward an international trading scheme (i.e. is it a first step toward a European-wide emissions trading scheme) when presenting the proposal of the Dutch Commission on CO2 trade and related economic analysis. His conclusion, underlined by modeling results, is that a national scheme along the lines proposed by the Dutch Commission is an expensive policy instrument due to the high transaction costs. The first-best option according to Mulder is to impose CO2-emissions trading with an absolute ceiling on an international level. In the meantime, he states, improving the design of the energy tax system may be an efficient alternative. In this comment I would like to address two issues. First, does the approach proposed by the Dutch Commission make sense from a European perspective towards an EU-wide cap and trade allowance scheme as proposed by the European Commission in October 2001? and Second, what might this Dutch model and philosophy, scaled up to the EU level, look like?

  12. Trace element emissions from coal

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2012-09-15

    Trace elements are emitted during coal combustion. The quantity, in general, depends on the physical and chemical properties of the element itself, the concentration of the element in the coal, the combustion conditions and the type of particulate control device used, and its collection efficiency as a function of particle size. Some trace elements become concentrated in certain particle streams following combustion such as bottom ash, fly ash, and flue gas particulate matter, while others do not. Various classification schemes have been developed to describe this partitioning behaviour. These classification schemes generally distinguish between: Class 1: elements that are approximately equally concentrated in the fly ash and bottom ash, or show little or no fine particle enrichment, examples include Mn, Be, Co and Cr; Class 2: elements that are enriched in the fly ash relative to bottom ash, or show increasing enrichment with decreasing particle size, examples include As, Cd, Pb and Sb; Class 3: elements which are emitted in the gas phase (primarily Hg (not discussed in this review), and in some cases, Se). Control of class 1 trace elements is directly related to control of total particulate matter emissions, while control of the class 2 elements depends on collection of fine particulates. Due to the variability in particulate control device efficiencies, emission rates of these elements can vary substantially. The volatility of class 3 elements means that particulate controls have only a limited impact on the emissions of these elements.

  13. Greenhouse gases and emissions trading

    International Nuclear Information System (INIS)

    LeBlanc, A.; Dudek, D.J.

    1993-01-01

    Global cooperation is essential in cutting greenhouse-gas emissions, say Alice LeBlanc and Daniel J. Dudek of the Environmental Defense in New York City. The first step, they continue, is agreement among nations on an overall global limit for all greenhouse gases, followed by an allocation of the global limit among nations. The agreements must contain effective reporting and monitoring systems and enforcement provisions, they add. The Framework Convention on Climate Change, signed by most nations of the world in Brazil in 1992, provides the foundation for such an agreement, LeBlanc and Dudek note. open-quotes International emissions trading is a way to lower costs and expand reduction options for the benefit of all,close quotes they contend. Under such an arrangement, an international agency would assign allowances, stated in tons of carbon dioxide. Countries would be free to buy and sell allowances, but no country could exceed, in a given year, the total allowances it holds. By emitting less than its allowed amount, a country would accumulate more allowances, which it could sell. The authors claim such a system would offer benefits to the world economy by saving billions of dollars in pollution-reduction costs while still achieving emission limits established in an international agreement

  14. Fugitive emissions from nanopowder manufacturing

    Energy Technology Data Exchange (ETDEWEB)

    Trompetter, W. J., E-mail: b.trompetter@gns.cri.nz; Ancelet, T.; Davy, P. K.; Kennedy, J. [GNS Science (New Zealand)

    2016-07-15

    In response to health and safety questions and concerns regarding particulate matter emissions from equipment used for synthesizing NiFe and TiO{sub 2} nanopowders, a study was undertaken to assess their impact on the air quality inside and outside a laboratory where the manufacturing equipment is operated. Elemental concentrations determined by ion beam analysis (IBA) of air particulate matter (PM) samples collected hourly with a Streaker{sup TM} sampler were used to identify possible sources and estimate contributions from nanopowder production and other sources. The fugitive nanopowder emissions were the highest at the indoor sampling location when powders were being manufactured. Average fugitive emissions of 210 ng m{sup −3} (1-h average) (maximum 2163 ng m{sup −3} 1-h average) represented 2 % (maximum 20 %) of the average PM collected (9359 ng m{sup −3} 1-h average). The measured NiFe alloy or TiO{sub 2} PM concentrations were much smaller than the 8-h time-weighted average (TWA) workplace exposure standards (WES) for these materials (≥1,000,000 ng m{sup −3}). Most PM was found to be from infiltrated outdoor ambient sources. This suggests that nanopowder production in the laboratory is not likely to have adverse health effects on individuals using the equipment, although further improvements can be made to further limit exposure.Graphical abstract.

  15. Gold emissivities for hydrocode applications

    International Nuclear Information System (INIS)

    Bowen, C.; Wagon, F.; Galmiche, D.; Loiseau, P.; Dattolo, E.; Babonneau, D.

    2004-01-01

    The Radiom model [M. Busquet, Phys Fluids B 5, 4191 (1993)] is designed to provide a radiative-hydrodynamic code with non-local thermodynamic equilibrium (non-LTE) data efficiently by using LTE tables. Comparison with benchmark data [M. Klapisch and A. Bar-Shalom, J. Quant. Spectrosc. Radiat. Transf. 58, 687 (1997)] has shown Radiom to be inaccurate far from LTE and for heavy ions. In particular, the emissivity was found to be strongly underestimated. A recent algorithm, Gondor [C. Bowen and P. Kaiser, J. Quant. Spectrosc. Radiat. Transf. 81, 85 (2003)], was introduced to improve the gold non-LTE ionization and corresponding opacity. It relies on fitting the collisional ionization rate to reproduce benchmark data given by the Averroes superconfiguration code [O. Peyrusse, J. Phys. B 33, 4303 (2000)]. Gondor is extended here to gold emissivity calculations, with two simple modifications of the two-level atom line source function used by Radiom: (a) a larger collisional excitation rate and (b) the addition of a Planckian source term, fitted to spectrally integrated Averroes emissivity data. This approach improves the agreement between experiments and hydrodynamic simulations

  16. Application of the emission inventory model TEAM: Uncertainties in dioxin emission estimates for central Europe

    NARCIS (Netherlands)

    Pulles, M.P.J.; Kok, H.; Quass, U.

    2006-01-01

    This study uses an improved emission inventory model to assess the uncertainties in emissions of dioxins and furans associated with both knowledge on the exact technologies and processes used, and with the uncertainties of both activity data and emission factors. The annual total emissions for the

  17. 76 FR 13851 - National Emission Standards for Hazardous Air Pollutants: Mercury Emissions From Mercury Cell...

    Science.gov (United States)

    2011-03-14

    ... National Emission Standards for Hazardous Air Pollutants: Mercury Emissions From Mercury Cell Chlor-Alkali...-5] RIN 2060-AN99 National Emission Standards for Hazardous Air Pollutants: Mercury Emissions From Mercury Cell Chlor-Alkali Plants AGENCY: Environmental Protection Agency (EPA). ACTION: Supplemental...

  18. Five essays on emissions trading

    Energy Technology Data Exchange (ETDEWEB)

    Godal, Odd

    2005-03-01

    The thesis discusses energy, environmental and economic aspects of polluting emissions with emphasis on greenhouse gas trade and political measures. 5 papers are included with titles: 1) Carbon trading across sources and periods constrained by the Marrakesh Accords which examines examine the potential effects on permit prices and abatement costs of four compliance rules governing emissions trade across sources and periods in the Kyoto Protocol: The banking rule that allows excess permits to be used later; the restoration rate rule that penalizes borrowing; the commitment period reserve rule that limits sales; and finally, the suspension rule that restricts borrowing and sales. Our framework is a two-period model where parties may be out of compliance in the Kyoto period, but are assumed to comply at a later time. Under varying assumptions about market power and US participation, we find that the rules may have pronounced effects on individual costs, but overall efficiency is not severely affected. 2) Affine price expectations and equilibrium in strategic markets which considers equilibrium in imperfect markets, featuring agents who exchange property rights. Important cases include trade in emission permits of greenhouse gases, or exchange of catch quotas of fish. Some players act strategically while others are price-takers. The ''demand curve'' is endogenous, and it affects all parties. The resulting, reduced objectives need not be concave. Therefore, existence of equilibrium is a delicate matter. To simplify things, and to ensure availability of ''equilibria up to first order'', we presume that all strategic agents form affine price expectations. 3) Greenhouse gases, quota exchange and oligopolistic competition that discusses the problem how quotas can be shared in the ''emissions market'' and how can the agents reach as overall equilibrium in the product market. 4) Strategic markets in property rights

  19. Five essays on emissions trading

    Energy Technology Data Exchange (ETDEWEB)

    Godal, Odd

    2005-03-01

    The thesis discusses energy, environmental and economic aspects of polluting emissions with emphasis on greenhouse gas trade and political measures. 5 papers are included with titles: 1) Carbon trading across sources and periods constrained by the Marrakesh Accords which examines examine the potential effects on permit prices and abatement costs of four compliance rules governing emissions trade across sources and periods in the Kyoto Protocol: The banking rule that allows excess permits to be used later; the restoration rate rule that penalizes borrowing; the commitment period reserve rule that limits sales; and finally, the suspension rule that restricts borrowing and sales. Our framework is a two-period model where parties may be out of compliance in the Kyoto period, but are assumed to comply at a later time. Under varying assumptions about market power and US participation, we find that the rules may have pronounced effects on individual costs, but overall efficiency is not severely affected. 2) Affine price expectations and equilibrium in strategic markets which considers equilibrium in imperfect markets, featuring agents who exchange property rights. Important cases include trade in emission permits of greenhouse gases, or exchange of catch quotas of fish. Some players act strategically while others are price-takers. The ''demand curve'' is endogenous, and it affects all parties. The resulting, reduced objectives need not be concave. Therefore, existence of equilibrium is a delicate matter. To simplify things, and to ensure availability of ''equilibria up to first order'', we presume that all strategic agents form affine price expectations. 3) Greenhouse gases, quota exchange and oligopolistic competition that discusses the problem how quotas can be shared in the ''emissions market'' and how can the agents reach as overall equilibrium in the product market. 4) Strategic markets in property rights without price-takers that deals with Cournot-type models of

  20. Temporal and spatial variation in recent vehicular emission inventories in China based on dynamic emission factors.

    Science.gov (United States)

    Cai, Hao; Xie, Shaodong

    2013-03-01

    The vehicular emission trend in China was tracked for the recent period 2006-2009 based on a database of dynamic emission factors of CO, nonmethane volatile organic compounds (NMVOC), NOx, PM10, CO2, CH4, and N2O for all categories of on-road motor vehicles in China, which was developed at the provincial level using the COPERT 4 model, to account for the effects of rapid advances in engine technologies, implementation of improved emission standards, emission deterioration due to mileage, and fuel quality improvement. Results show that growth rates of CO and NMVOC emissions slowed down, but NOx and PM10 emissions continued rising rapidly for the period 2006-2009. Moreover CO2, CH4, and N2O emissions in 2009 almost doubled compared to those in 2005. Characteristics of recent spatial distribution of emissions and emission contributions by vehicle category revealed that priority of vehicular emission control should be put on the eastern and southeastern coastal provinces and northern regions, and passenger cars and motorcycles require stricter control for the reduction of CO and NMVOC emissions, while effective reduction of NOx and PM10 emissions can be achieved by better control of heavy-duty vehicles, buses and coaches, and passenger cars. Explicit provincial-level Monte Carlo uncertainty analysis, which quantified for the first time the Chinese vehicular emission uncertainties associated with both COPERT-derived and domestically measured emission factors by vehicle technology, showed that CO, NMVOC, and NOx emissions for the period 2006-2009 were calculated with the least uncertainty, followed by PM10 and CO2, despite relatively larger uncertainties in N2O and CH4 emissions. The quantified low uncertainties of emissions revealed a necessity of applying vehicle technology- and vehicle age-specific dynamic emission factors for vehicular emission estimation, and these improved methodologies are applicable for routine update and forecast of China's on-road motor vehicle

  1. 2008 LANL radionuclide air emissions report

    Energy Technology Data Exchange (ETDEWEB)

    Fuehne, David P.

    2009-06-01

    The emissions of radionuclides from Department of Energy Facilities such as Los Alamos National Laboratory (LANL) are regulated by the Amendments to the Clean Air Act of 1990, National Emissions Standards for Hazardous Air Pollutants (40 CFR 61 Subpart H). These regulations established an annual dose limit of 10 mrem to the maximally exposed member of the public attributable to emissions of radionuclides. This document describes the emissions of radionuclides from LANL and the dose calculations resulting from these emissions for calendar year 2008. This report meets the reporting requirements established in the regulations.

  2. 2010 LANL radionuclide air emissions report /

    Energy Technology Data Exchange (ETDEWEB)

    Fuehne, David P.

    2011-06-01

    The emissions of radionuclides from Department of Energy Facilities such as Los Alamos National Laboratory (LANL) are regulated by the Amendments to the Clean Air Act of 1990, National Emissions Standards for Hazardous Air Pollutants (40 CFR 61 Subpart H). These regulations established an annual dose limit of 10 mrem to the maximally exposed member of the public attributable to emissions of radionuclides. This document describes the emissions of radionuclides from LANL and the dose calculations resulting from these emissions for calendar year 2010. This report meets the reporting requirements established in the regulations.

  3. Evaporation Controlled Emission in Ventilated Rooms

    DEFF Research Database (Denmark)

    Topp, Claus; Nielsen, Peter V.; Heiselberg, Per

    -scale ventilated room when the emission is fully or partly evaporation controlled. The objective of the present research work has been to investigate the change of emission rates from small-scale experiments to full-scale ventilated rooms and to investigate the influence of the local air velocity field near......Emission of volatile organic compounds (VOCs) from materials is traditionally determined from tests carried out in small-scale test chambers. However, a difference in scale may lead to a difference in the measured emission rate in a small-scale test chamber and the actual emission rate in a full...

  4. Air emissions inventory for the Idaho National Engineering Laboratory -- 1995 emissions report

    International Nuclear Information System (INIS)

    1996-06-01

    This report presents the 1995 update of the Air Emission Inventory for the Idaho National Engineering Laboratory (INEL). The INEL Air Emission Inventory documents sources and emissions of non-radionuclide pollutants from operations at the INEL. The report describes the emission inventory process and all of the sources at the INEL, and provides non-radionuclide emissions estimates for stationary sources. The air contaminants reported include nitrogen oxides, sulfur oxides, carbon monoxide, volatile organic compounds, particulates, and hazardous air pollutants (HAPs)

  5. Particle number emissions of gasoline hybrid electric vehicles; Partikelanzahl-Emission bei Hybridfahrzeugen mit Ottomotor

    Energy Technology Data Exchange (ETDEWEB)

    Porter, Scott [Horiba Instruments Inc., Ann Arbor, MI (United States)

    2012-04-15

    Hybrid Electric Vehicles (HEV) are commonly reputed to be environmentally friendly. Different studies show that this assumption raises some questions in terms of particle number emissions. Against the background that upcoming emission standards will not only limit particle matter emissions but also particle number emissions for gasoline engines, the exhaust behaviour of downsized gasoline engines used in HEV should be investigated more extensively. A Horiba study compares the particle number emissions of a gasoline vehicle to those of a gasoline powered HEV. (orig.)

  6. Air emissions inventory for the Idaho National Engineering Laboratory -- 1995 emissions report

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1996-06-01

    This report presents the 1995 update of the Air Emission Inventory for the Idaho National Engineering Laboratory (INEL). The INEL Air Emission Inventory documents sources and emissions of non-radionuclide pollutants from operations at the INEL. The report describes the emission inventory process and all of the sources at the INEL, and provides non-radionuclide emissions estimates for stationary sources. The air contaminants reported include nitrogen oxides, sulfur oxides, carbon monoxide, volatile organic compounds, particulates, and hazardous air pollutants (HAPs).

  7. EU-Type Carbon Emissions Trade and the Distributional Impact of Overlapping Emissions Taxes

    OpenAIRE

    Thomas Eichner; Rüdiger Pethig

    2009-01-01

    The European Union fulfills its emissions reductions commitments by means of an emissions trading scheme covering some part of each member state’s economy and by national emissions control in the rest of their economies. The member states also levy energy/emissions taxes overlapping with the trading scheme. Restricting our focus on cost-effective policies, this paper investigates the distributive consequences of increasing the overlapping emissions tax that is uniform across countries. For ...

  8. Mitigating greenhouse gas emissions: Voluntary reporting

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1997-10-01

    The Voluntary Reporting Program, developed pursuant to Section 1605(b) of the Energy Policy Act of 1992, permits corporations, government agencies, households, and voluntary organizations to report on their emissions of greenhouse gases, and on actions taken that have reduced or avoided emissions or sequestered carbon, to the Energy Information Administration (EIA). This, the second annual report of the Voluntary Reporting Program, describes information provided by the participating organizations on their aggregate emissions and emissions reductions, as well as their emissions reduction or avoidance projects, through 1995. This information has been compiled into a database that includes reports from 142 organizations and descriptions of 967 projects that either reduced greenhouse gas emissions or sequestered carbon. Fifty-one reporters also provided estimates of emissions, and emissions reductions achieved, for their entire organizations. The projects described actions taken to reduce emissions of carbon dioxide from energy production and use; to reduce methane and nitrous oxide emissions from energy use, waste management, and agricultural processes; to reduce emissions of halocarbons, such as CFCs and their replacements; and to increase carbon sequestration.

  9. On the mechanism of fission neutron emission

    International Nuclear Information System (INIS)

    Maerten, H.; Richter, D.; Seeliger, D.

    1986-01-01

    This review represents the present knowledge of the mechanism of prompt fission neutron emission. Starting with a brief fission process characterization related with neutron emission, possible emission mechanisms are discussed. It is emphasized that the experimental study of special mechanisms, i.e. scission neutron emission processes, requires a sufficiently correct description of emission probabilities on the base of the main mechanism, i.e. the evaporation from fully accelerated fragments. Adequate statistical-model approaches have to account for the complexity of nuclear fission reflected by an intricate fragment distribution. The present picture of scission neutron emission is not clarified neither experimentally nor theoretically. Deduced data are contradictory and depend on the used analysis procedures often involving rough discriptions of evaporated-neutron distributions. The contribution of two secondary mechanisms of fission neutron emission, i.e. the neutron evaporation during fragment acceleration and neutron emission due to the decay of 5 He after ternary fission, is estimated. We summarize the recent progress of the theoretical description of fission neutron spectra in the framework of statistical models considering the standard spectrum of 252 Cf(sf) neutrons especially. The main experimental basis for the study of fission neutron emission is the accurate measurement of emission probabilities as a function of emission energy and angle (at least) as well as fragment parameters (mass number ratio and kinetic energy). The present status is evaluated. (author)

  10. Alberta air emissions : trends and projections

    International Nuclear Information System (INIS)

    2008-06-01

    This paper provided a summary of air emissions trends and projections for Alberta. Predicted regional distribution trends and industry sector emissions were presented. Historical and projected emissions included sulfur oxides (SO x ) nitrogen oxide (NO x ), volatile organic compounds (VOCs), and ammonia (NH 3 ). Results of the study indicated that carbon monoxide (CO) emissions were decreasing, while VOCs, NO x , SO x , PM 2.5 and NH 3 levels were increasing. Approximately 9 per cent of ammonia emissions were from point sources, while the majority of PM 2.5 emissions were attributed to unpaved roads and construction operations. Agricultural animal operations accounted for most of the VOC source emissions in the region. Increased development of the oil sands industry is contributing to increases in VOC emissions. Increases in NH 3 were attributed to growth in the agricultural sector and the increasing use of confined feeding operations in the region. Results of the study indicated that greenhouse gas (GHG) emissions in Alberta will keep increasing as a result of Alberta's growing economy. It was concluded that emissions from other industrial sectors are also expected to increase. In 2005, Alberta's total GHG emissions were 233 megatonnes of CO 2 equivalent, of which 168 megatonnes were attributed to industry. Results were presented in both graph and tabular formats. 3 tabs., 25 figs

  11. Electron emission at the rail surface

    International Nuclear Information System (INIS)

    Thornhill, L.; Battech, J.

    1991-01-01

    In this paper the authors examine the processes by which current is transferred from the cathode rail to the plasma armature in an arc-driven railgun. Three electron emission mechanisms are considered, namely thermionic emission, field-enhanced thermionic emission (or Schottky emission), and photoemission. The author's calculations show that the dominant electron emission mechanism depends, to a great extent, on the work function of the rail surface, the rail surface temperature, the electric field at the rail surface, and the effective radiation temperature of the plasma. For conditions that are considered to be typical of a railgun armature, Schottky emission is the dominant electron emission mechanism, providing current densities on the order of 10 9 A/m 2

  12. Benchmarking of refinery emissions performance : Executive summary

    International Nuclear Information System (INIS)

    2003-07-01

    This study was undertaken to collect emissions performance data for Canadian and comparable American refineries. The objective was to examine parameters that affect refinery air emissions performance and develop methods or correlations to normalize emissions performance. Another objective was to correlate and compare the performance of Canadian refineries to comparable American refineries. For the purpose of this study, benchmarking involved the determination of levels of emission performance that are being achieved for generic groups of facilities. A total of 20 facilities were included in the benchmarking analysis, and 74 American refinery emission correlations were developed. The recommended benchmarks, and the application of those correlations for comparison between Canadian and American refinery performance, were discussed. The benchmarks were: sulfur oxides, nitrogen oxides, carbon monoxide, particulate, volatile organic compounds, ammonia and benzene. For each refinery in Canada, benchmark emissions were developed. Several factors can explain differences in Canadian and American refinery emission performance. 4 tabs., 7 figs

  13. Greenhouse Gas Emissions from Agricultural Production

    DEFF Research Database (Denmark)

    Bennetzen, Eskild Hohlmann

    unit. This dissertation presents results and comprehensions from my PhD study on the basis of three papers. The overall aim has been to develop a new identity-based framework, the KPI, to estimate and analyse GHG emissions from agriculture and LUC and apply this on national, regional and global level....... The KPI enables combined analyses of changes in total emissions, emissions per area and emissions per product. Also, the KPI can be used to assess how a change in each GHG emission category affects the change in total emissions; thus pointing to where things are going well and where things are going less...... well in relation to what is actually produced. The KPI framework is scale independent and can be applied at any level from field and farm to global agricultural production. Paper I presents the first attempt to develop the KPI identity framework and, as a case study, GHG emissions from Danish crop...

  14. Spontaneous light emission in complex nanostructures

    Science.gov (United States)

    Blanco, L. A.; García de Abajo, F. J.

    2004-05-01

    The spontaneous emission of an excited atom surrounded by different materials is studied in the framework of a semiclassical approach, where the transition dipole moment acts as the source of the emission field. The emission in the presence of semiinfinite media, metallic nanorings, spheres, gratings, and other complex geometries is investigated. Strong emission enhancement effects are obtained in some of these geometries associated to the excitation of plasmons (e.g., in nanorings or spheres). Furthermore, the emission is shown to take place only along narrow angular distributions when the atom is located inside a low-index dielectric and near its planar surface, or when metallic nanogratings are employed at certain resonant wave lengths. In particular, axially symmetric gratings made of real silver metal are considered, and both emission rate enhancement and focused far-field emission are achieved simultaneously when the grating is decorated with further nanostructures.

  15. Danish emission inventories for stationary combustion plants

    DEFF Research Database (Denmark)

    Nielsen, Malene; Nielsen, Ole-Kenneth; Plejdrup, Marlene Schmidt

    Emission inventories for stationary combustion plants are presented and the methodologies and assumptions used for the inventories are described. The pollutants considered are SO2, NOx, NMVOC, CH4, CO, CO2, N2O, NH3, particulate matter, heavy metals, PCDD/F, HCB and PAH. The CO2 emission in 2011...... of decreased emissions from large power plants and waste incineration plants. The combustion of wood in residential plants has increased considerably until 2007 resulting in increased emission of PAH and particulate matter. The emission of NMVOC has increased since 1990 as a result of both the increased...... combustion of wood in residential plants and the increased emission from lean-burn gas engines. The PCDD/F emission decreased since 1990 due to flue gas cleaning on waste incineration plants....

  16. Danish emission inventories for stationary combustion plants

    DEFF Research Database (Denmark)

    Nielsen, Malene; Nielsen, Ole-Kenneth; Plejdrup, Marlene Schmidt

    Emission inventories for stationary combustion plants are presented and the methodologies and assumptions used for the inventories are described. The pollutants considered are SO2, NOx, NMVOC, CH4, CO, CO2, N2O, NH3, particulate matter, heavy metals, dioxins, HCB and PAH. The CO2 emission in 2008...... incineration plants. The combustion of wood in residential plants has increased considerably in recent years resulting in increased emission of PAH, particulate matter and CO. The emission of NMVOC has increased since 1990 as a result of both the increased combustion of wood in residential plants...... and the increased emission from lean-burn gas engines. The dioxin emission decreased since 1990 due to flue gas cleaning on waste incineration plants. However in recent years the emission has increased as a result of the increased combustion of wood in residential plants....

  17. Danish emission inventories for stationary combustion plants

    DEFF Research Database (Denmark)

    Nielsen, Malene; Nielsen, Ole-Kenneth; Plejdrup, Marlene Schmidt

    Emission inventories for stationary combustion plants are presented and the methodologies and assumptions used for the inventories are described. The pollutants considered are SO2, NOx, NMVOC, CH4, CO, CO2, N2O, particulate matter, heavy metals, dioxins, HCB and PAH. The CO2 emission in 2007 was 10...... incineration plants. The combustion of wood in residential plants has increased considerably in recent years resulting in increased emission of PAH, particulate matter and CO. The emission of NMVOC has increased since 1990 as a result of both the increased combustion of wood in residential plants...... and the increased emission from lean-burn gas engines. The dioxin emission decreased since 1990 due to flue gas cleaning on waste incineration plants. However in recent years the emission has increased as a result of the increased combustion of wood in residential plants....

  18. Inventories and scenarios of nitrous oxide emissions

    International Nuclear Information System (INIS)

    Davidson, Eric A; Kanter, David

    2014-01-01

    Effective mitigation for N 2 O emissions, now the third most important anthropogenic greenhouse gas and the largest remaining anthropogenic source of stratospheric ozone depleting substances, requires understanding of the sources and how they may increase this century. Here we update estimates and their uncertainties for current anthropogenic and natural N 2 O emissions and for emissions scenarios to 2050. Although major uncertainties remain, ‘bottom-up’ inventories and ‘top-down’ atmospheric modeling yield estimates that are in broad agreement. Global natural N 2 O emissions are most likely between 10 and 12 Tg N 2 O-N yr −1 . Net anthropogenic N 2 O emissions are now about 5.3 Tg N 2 O-N yr −1 . Gross anthropogenic emissions by sector are 66% from agriculture, 15% from energy and transport sectors, 11% from biomass burning, and 8% from other sources. A decrease in natural emissions from tropical soils due to deforestation reduces gross anthropogenic emissions by about 14%. Business-as-usual emission scenarios project almost a doubling of anthropogenic N 2 O emissions by 2050. In contrast, concerted mitigation scenarios project an average decline of 22% relative to 2005, which would lead to a near stabilization of atmospheric concentration of N 2 O at about 350 ppb. The impact of growing demand for biofuels on future projections of N 2 O emissions is highly uncertain; N 2 O emissions from second and third generation biofuels could remain trivial or could become the most significant source to date. It will not be possible to completely eliminate anthropogenic N 2 O emissions from agriculture, but better matching of crop N needs and N supply offers significant opportunities for emission reductions. (paper)

  19. Trends in onroad transportation energy and emissions.

    Science.gov (United States)

    Frey, H Christopher

    2018-06-01

    Globally, 1.3 billion on-road vehicles consume 79 quadrillion BTU of energy, mostly gasoline and diesel fuels, emit 5.7 gigatonnes of CO 2 , and emit other pollutants to which approximately 200,000 annual premature deaths are attributed. Improved vehicle energy efficiency and emission controls have helped offset growth in vehicle activity. New technologies are diffusing into the vehicle fleet in response to fuel efficiency and emission standards. Empirical assessment of vehicle emissions is challenging because of myriad fuels and technologies, intervehicle variability, multiple emission processes, variability in operating conditions, and varying capabilities of measurement methods. Fuel economy and emissions regulations have been effective in reducing total emissions of key pollutants. Real-world fuel use and emissions are consistent with official values in the United States but not in Europe or countries that adopt European standards. Portable emission measurements systems, which uncovered a recent emissions cheating scandal, have a key role in regulatory programs to ensure conformity between "real driving emissions" and emission standards. The global vehicle fleet will experience tremendous growth, especially in Asia. Although existing data and modeling tools are useful, they are often based on convenience samples, small sample sizes, large variability, and unquantified uncertainty. Vehicles emit precursors to several important secondary pollutants, including ozone and secondary organic aerosols, which requires a multipollutant emissions and air quality management strategy. Gasoline and diesel are likely to persist as key energy sources to mid-century. Adoption of electric vehicles is not a panacea with regard to greenhouse gas emissions unless coupled with policies to change the power generation mix. Depending on how they are actually implemented and used, autonomous vehicles could lead to very large reductions or increases in energy consumption. Numerous other

  20. Acoustic Emission Stethoscope - Measurements with Acoustic Emission on Wind Turbines

    Energy Technology Data Exchange (ETDEWEB)

    Krystof Kryniski [AaF Infrastructure, Stockholm (Sweden)

    2013-02-15

    A remote ultrasonic stethoscope, designed on mobile devices to help a maintenance team in diagnosing drive train problems, has been demonstrated. By implementing an acoustic emission technology, the operating conditions of wind turbines have been assessed by trending techniques and ultrasonic acoustic emission converted into audible sound. The new approach has been developed and tested and compared to other monitoring techniques. Acoustic emission has generally been shown to provide a number of advantages over vibration and shock pulse methods because the system is operating in a substantially higher frequency range (100 kHz) and therefore it is more immune to operation of surrounding machines and components. Quick attenuation of ultrasonic propagation waves in the drive-train structure helps to pin-point the origin of any fault as the signals are sharper and more pronounced. Further, with the intensity measurements a direction of the source of ultrasonic energy can be identified. Using a high frequency thus makes the method suitable for measuring local effects and to determine local defects since the disturbing signals from other parts are damped. Recently developed programmable sensors capable of processing signals onboard, producing quality outputs with extremely low noise-to-signal ratio, have been used. It is discussed how the new approach can lower the cost of a wind-turbine monitoring system, while at the same time making it simple and more reliable, see Appendix A. The method has been tested on rotating parts of wind-turbines, including traditionally difficult areas such as low speed main bearings and planetary gearboxes. The method developed in the project was designed to see physical processes such as friction, impacts and metal removal, occurring when machinery degrades, can be detected and notified with the developed notification system. Apart from reporting the status and displaying the changes of the pre-defined parameters or symptoms, the system has

  1. Learning from global emissions scenarios

    International Nuclear Information System (INIS)

    O'Neill, Brian C; Nakicenovic, Nebojsa

    2008-01-01

    Scenarios of global greenhouse gas emissions have played a key role in climate change analysis for over twenty years. Currently, several research communities are organizing to undertake a new round of scenario development in the lead-up to the Fifth Assessment Report of the Intergovernmental Panel on Climate Change (IPCC). To help inform this process, we assess a number of past efforts to develop and learn from sets of global greenhouse gas emissions scenarios. We conclude that while emissions scenario exercises have likely had substantial benefits for participating modeling teams and produced insights from individual models, learning from the exercises taken as a whole has been more limited. Model comparison exercises have typically focused on the production of large numbers of scenarios while investing little in assessing the results or the production process, perhaps on the assumption that later assessment efforts could play this role. However, much of this assessment potential remains untapped. Efforts such as scenario-related chapters of IPCC reports have been most informative when they have gone to extra lengths to carry out more specific comparison exercises, but in general these assessments do not have the remit or resources to carry out the kind of detailed analysis of scenario results necessary for drawing the most useful conclusions. We recommend that scenario comparison exercises build-in time and resources for assessing scenario results in more detail at the time when they are produced, that these exercises focus on more specific questions to improve the prospects for learning, and that additional scenario assessments are carried out separately from production exercises. We also discuss the obstacles to better assessment that might exist, and how they might be overcome. Finally, we recommend that future work include much greater emphasis on understanding how scenarios are actually used, as a guide to improving scenario production.

  2. Secondary Emission Calorimeter Sensor Development

    Science.gov (United States)

    Winn, David R.; Onel, Yasar

    2012-12-01

    In a Secondary Emission electron(SEe) detector module, Secondary Emission electrons (SEe) are generated from an SE surface/cathode, when charged hadronic or electromagnetic particles, particularly shower particles, penetrate an SE sampling module placed between absorber materials (Fe, Cu, Pb, W etc) in calorimeters. The SE cathode is a thin (10-50 nm thick) film (simple metal-oxides, or other higher yield materials) on the surface of a metal plate, which serves as the entrance “window” to a compact vacuum vessel (metal or metal-ceramic); this SE film cathode is analogous to a photocathode, and the SEe are similar to p.e., which are then amplified by dynodes, also is in a PMT. SE sensor modules can make use of electrochemically etched/machined or laser-cut metal mesh dynode sheets, as large as ~30 cm square, to amplify the Secondary Emission Electrons (SEe), much like those that compact metal mesh or mesh dynode PMT's use to amplify p.e.'s. The construction requirements easier than a PMT, since the entire final assembly can be done in air; there are no critical controlled thin film depositions, cesiation or other oxygen-excluded processes or other required vacuum activation, and consequently bake-out can be a refractory temperatures; the module is sealed by normal vacuum techniques (welding or brazing or other high temperature joinings), with a simple final heated vacuum pump-out and tip-off. The modules envisioned are compact, high gain, high speed, exceptionally radiation damage resistant, rugged, and cost effective, and can be fabricated in arbitrary tileable shapes. The SE sensor module anodes can be segmented transversely to sizes appropriate to reconstruct electromagnetic cores with high precision. The GEANT4 and existing calorimeter data estimated calorimeter response performance is between 35-50 Secondary Emission electrons per GeV, in a 1 cm thick Cu absorber calorimeter, with a gain per SEe > 105 per SEe, and an e/pi<1.2. The calorimeter pulse width is

  3. Emission constrained secure economic dispatch

    International Nuclear Information System (INIS)

    Arya, L.D.; Choube, S.C.; Kothari, D.P.

    1997-01-01

    This paper describes a methodology for secure economic operation of power system accounting emission constraint areawise as well as in totality. Davidon-Fletcher-Powell's method of optimization has been used. Inequality constraints are accounted for by a penalty function. Sensitivity coefficients have been used to evaluate the gradient vector as well as for the calculation of incremental transmission loss (ITL). AC load flow results are required in the beginning only. The algorithm has been tested on IEEE 14- and 25-bus test systems. (Author)

  4. Positron emission tomography takes lead

    International Nuclear Information System (INIS)

    Simms, R.

    1989-01-01

    Positron emission tomography (PET)'s ability to detect functional abnormalities before they manifest anatomically is examined and some of its most common applications are outlined. It is emphasised that when PET facility and Australian Nuclear Science and Technology Organization's national cyclotron are established at the Royal Prince Alfred Hospital, the availability of short-lived tracers such as oxygen 15, nitrogen 13 and fluorine 18 would improve the specificity of tests(e.g. for brain tumors or cardiac viability) further. Construction of the cyclotron will start shortly and is due to be completed and operating by the end of 1991

  5. Acoustic emission methodology and application

    CERN Document Server

    Nazarchuk, Zinoviy; Serhiyenko, Oleh

    2017-01-01

    This monograph analyses in detail the physical aspects of the elastic waves radiation during deformation or fracture of materials. I presents the  methodological bases for the practical use of acoustic emission device, and describes the results of theoretical and experimental researches of evaluation of the crack growth resistance of materials, selection of the useful AE signals. The efficiency of this methodology is shown through the diagnostics of various-purpose industrial objects. The authors obtain results of experimental researches with the help of the new methods and facilities.

  6. Apparatus for measuring radioactive emissions

    International Nuclear Information System (INIS)

    Bohme, R.C.; Lazerson, M.M.

    1984-01-01

    Apparatus for measuring radioactive emissions from moving radioactive material comprises at least one radiation detector in a housing serving as a first radiation shield and in which at least one groove is formed to expose at least a portion of a receptor surface of the detector. The groove extends transverse to the direction of movement of the material over the detector. A second radiation shield may be located between at least a portion of the first shield and the detector. The material of the second shield is inherently less contaminated and emits secondary excitation radiation of lower energy than the first material. (author)

  7. Fundamentals of positron emission tomography

    International Nuclear Information System (INIS)

    Ostertag, H.

    1989-01-01

    Positron emission tomography is a modern radionuclide method of measuring physiological quantities or metabolic parameters in vivo. The methods is based on: (1) Radioactive labelling with positron emitters; (2) the coincidence technique for the measurement of the annihilation radiation following positron decay; (3) analysis of the data measured using biological models. The basic aspects and problems of the method are discussed. The main fields of future research are the synthesis of new labelled compounds and the development of mathematical models of the biological processes to be investigated. (orig.) [de

  8. Emission tomography for adrenal imaging

    International Nuclear Information System (INIS)

    Britton, K.E.; Shapiro, B.; Hawkins, L.A.

    1980-01-01

    Single photon emission tomography (SPET) of the adrenals was compared to convential gamma camera images. Depths of 19 adrenals were assessed by both the lateral skin-upper kidney pole method and by SPET. Eleven patients with adrenal disorders were also studied. An advantage of using SPET was that the analogue transverse section image showed improvement over the conventional posterior view because the liver activity was well separated from the adrenal. Furthermore, non-adrenal tissue background was virtually eliminated and adrenal depth determination facilitated. (U.K.)

  9. Secondary emission monitor (SEM) grids.

    CERN Multimedia

    Patrice Loïez

    2002-01-01

    A great variety of Secondary Emission Monitors (SEM) are used all over the PS Complex. At other accelerators they are also called wire-grids, harps, etc. They are used to measure beam density profiles (from which beam size and emittance can be derived) in single-pass locations (not on circulating beams). Top left: two individual wire-planes. Top right: a combination of a horizontal and a vertical wire plane. Bottom left: a ribbon grid in its frame, with connecting wires. Bottom right: a SEM-grid with its insertion/retraction mechanism.

  10. Spectroscopic observations of the symbiotic star AG Draconis

    Energy Technology Data Exchange (ETDEWEB)

    Smith, S E; Bopp, B W [Toledo Univ., OH (USA)

    1981-06-01

    Spectroscopic observations, covering the lambdalambda 3500-7000 region, of the symbiotic star AG Draconis are reported. The Balmer and He I line profiles were found to show pronounced blueward asymmetries. Changes in the line profiles of the Balmer lines were observed, and found to be well correlated with the 554-day photometric period of Meinunger, with a second, blueward component being visible in the Balmer emissions at photometric minimum. The weak, blueshifted component in the Balmer emission lines is explained in terms of a stellar wind from the hot secondary at of the order of 60 kms s/sup -1/. The behaviour of the broad emission feature at lambda6380 has been investigated. This feature was found to originate from an ion with an ionization potential in the range 77-101 eV. Various models for AG Dra are discussed.

  11. Evaluating Bay Area Methane Emission Inventory

    Energy Technology Data Exchange (ETDEWEB)

    Fischer, Marc [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Jeong, Seongeun [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States)

    2016-03-01

    As a regulatory agency, evaluating and improving estimates of methane (CH4) emissions from the San Francisco Bay Area is an area of interest to the Bay Area Air Quality Management District (BAAQMD). Currently, regional, state, and federal agencies generally estimate methane emissions using bottom-up inventory methods that rely on a combination of activity data, emission factors, biogeochemical models and other information. Recent atmospheric top-down measurement estimates of methane emissions for the US as a whole (e.g., Miller et al., 2013) and in California (e.g., Jeong et al., 2013; Peischl et al., 2013) have shown inventories underestimate total methane emissions by ~ 50% in many areas of California, including the SF Bay Area (Fairley and Fischer, 2015). The goal of this research is to provide information to help improve methane emission estimates for the San Francisco Bay Area. The research effort builds upon our previous work that produced methane emission maps for each of the major source sectors as part of the California Greenhouse Gas Emissions Measurement (CALGEM) project (http://calgem.lbl.gov/prior_emission.html; Jeong et al., 2012; Jeong et al., 2013; Jeong et al., 2014). Working with BAAQMD, we evaluate the existing inventory in light of recently published literature and revise the CALGEM CH4 emission maps to provide better specificity for BAAQMD. We also suggest further research that will improve emission estimates. To accomplish the goals, we reviewed the current BAAQMD inventory, and compared its method with those from the state inventory from the California Air Resources Board (CARB), the CALGEM inventory, and recent published literature. We also updated activity data (e.g., livestock statistics) to reflect recent changes and to better represent spatial information. Then, we produced spatially explicit CH4 emission estimates on the 1-km modeling grid used by BAAQMD. We present the detailed activity data, methods and derived emission maps by sector

  12. Emissions of Greenhouse gases in the Netherlands

    Energy Technology Data Exchange (ETDEWEB)

    Evers, C.W.A. [Ministry of Housing, The Hague (Netherlands). Inspectorate for Environmental Protection; Berdowski, J.J.M.; Pulles, T.P.J. [TNO Inst. for Environmental Sciences, Delft (Netherlands)

    1995-12-31

    The Dutch emission inventory system enables the registration, analysis and localization of emission data of both industrial and non-industrial sources in the Netherlands. The results can be used to test the effectiveness of governmental environmental policy. These activities are part of the policy evaluation tasks of the Inspectorate General for Environmental Protection (IGEP) and of the Ministry of Transport, Public Works and Water Management. The emission inventory takes place in cycles of one year. Recently, the most relevant results of the Dutch emission inventory for 1992 have been published. In that cycle the emissions in 1992 to air and water from about 800 major companies have been registered. These 800 companies are the most important contributors to the total industrial emissions in the Netherlands. The emissions of these companies are registered within the individual inventory system. The emissions from the smaller enterprises and from diffuse non-industrial sources are stored in the collective emission inventory system. The data collected in the 1992 inventory have been established for the first time in close cooperation between the IGEP, TNO, the Central Bureau of Statistics and the National Institute of Public Health and Environmental Protection. This implies that the data presented here have to be considered as the official data for the emissions in the Netherlands for the year 1992. (author)

  13. Analysis of emissions from prebunched electron beams

    Directory of Open Access Journals (Sweden)

    Jia Qika

    2017-07-01

    Full Text Available The emissions of the prebunched electron beam, including the coherent spontaneous emission and the self-amplified stimulated emission, are analyzed by using one-dimensional FEL theory. Neglecting the interaction of the electrons and the radiation field, the formula of the coherent spontaneous emission is given, the power of which is proportional to the square of the initial bunching factor and of the undulator length. For the general emission case of the prebunched electron beam, the evolution equation of the optical field is deducted. Then the analytical expression of the emission power is obtained for the resonant case; it is applicable to the regions from the low gain to the high gain. It is found that when the undulator length is shorter than four gain lengths, the emission is just the coherent spontaneous emission, and conversely, it is the self-amplified stimulated emission growing exponentially. For the nonresonant prebunched electron beam, the variations of the emission intensity with the detuning parameter for different interaction length are presented. The radiation field characters of the prebunched electron beam are discussed and compared with that of the seeded FEL amplifier.

  14. Implementing SO2 Emissions in China

    International Nuclear Information System (INIS)

    Schreifels, J.; Yang, J.

    2003-01-01

    Over the past 10 years, the Chinese State Environmental Protection Administration (SEPA) has actively investigated the potential to use emission trading to reduce sulphur dioxide (SO2) emissions from electricity generators and industrial sources. In 1999, SEPA partnered with the U.S. Environmental Protection Agency (U.S. EPA) to cooperate on a study to assess the feasibility of implementing SO2 emission trading in China. SEPA has also pursued emission trading pilot projects in several cities and provinces. The authors, using information from the feasibility study and pilot projects, introduce the circumstances necessary for SO2 emission trading in China, outline the experience to date, and analyse implementation opportunities and barriers in China. The contents of the paper are: (1) SO2 emission control policies in China; (2) institutional requirements and the basis for introducing SO2 emission trading in China; (3) case studies of emission trading in China; (4) opportunities and barriers to implementing emission trading in China; (5) recommendations to transition from pilot projects to a nationwide SO2 emission trading program; and (6) conclusions and suggestions

  15. Dioxin air emission inventory 1990-2004

    Energy Technology Data Exchange (ETDEWEB)

    Capral Henriksen, T; Illerup, J B; Nielsen, Ole-Kenneth [DMU, Dept. of Policy Analysis (Denmark)

    2006-12-15

    The present Danish dioxin air emission inventory shows that the emission has been reduced from 68.6 g I-TEQ in 1990 to 22.0 g I-TEQ in 2004, or about 68% over this period. Most of the significant reductions have been achieved in the industrial sector, where emissions have been reduced from 14.67 g I-TEQ in 1990 to 0.17 g I-TEQ in 2004; a reduction of almost 99%. Lower emissions from steel and aluminium reclamation industries form the major part of the reduction within industry. Emissions from waste incineration reduced from 32.5 g I-TEQ in 1990 to 2.1 g ITEQ in 2004; which is approx. 94%. This is due to installation of dioxin abatement equipment in incineration plants. The most important source of emission in 2004 is residential wood combustion, at 8.5 g I-TEQ, or around 40% of the total emission. In 2004, accidental fires, which are estimated to emit 6.1 g I-TEQ/year, are the second most important source, contributing with around 28% of the total emission. The present dioxin emission inventory for Denmark shows how emissions in 2004 come from sources other than waste incineration plants and industry, which were the largest sources in 1990. (au)

  16. Emissions of Greenhouse gases in the Netherlands

    Energy Technology Data Exchange (ETDEWEB)

    Evers, C W.A. [Ministry of Housing, The Hague (Netherlands). Inspectorate for Environmental Protection; Berdowski, J J.M.; Pulles, T P.J. [TNO Inst. for Environmental Sciences, Delft (Netherlands)

    1996-12-31

    The Dutch emission inventory system enables the registration, analysis and localization of emission data of both industrial and non-industrial sources in the Netherlands. The results can be used to test the effectiveness of governmental environmental policy. These activities are part of the policy evaluation tasks of the Inspectorate General for Environmental Protection (IGEP) and of the Ministry of Transport, Public Works and Water Management. The emission inventory takes place in cycles of one year. Recently, the most relevant results of the Dutch emission inventory for 1992 have been published. In that cycle the emissions in 1992 to air and water from about 800 major companies have been registered. These 800 companies are the most important contributors to the total industrial emissions in the Netherlands. The emissions of these companies are registered within the individual inventory system. The emissions from the smaller enterprises and from diffuse non-industrial sources are stored in the collective emission inventory system. The data collected in the 1992 inventory have been established for the first time in close cooperation between the IGEP, TNO, the Central Bureau of Statistics and the National Institute of Public Health and Environmental Protection. This implies that the data presented here have to be considered as the official data for the emissions in the Netherlands for the year 1992. (author)

  17. Assessment of atmospheric mercury emissions in Finland

    Science.gov (United States)

    Mukherjee; Melanen; Ekqvist; Verta

    2000-10-02

    This paper is part of the study of atmospheric emissions of heavy metals conducted by the Finnish Environment Institute in collaboration with the Technical Research Centre of Finland (VTT) under the umbrella of the Finnish Ministry of the Environment. The scope of our study is limited solely to anthropogenic mercury that is emitted directly to the atmosphere. This article addresses emission factors and trends of atmospheric mercury emissions during the 1990s and is based mainly on the database of the Finnish Environmental Administration. In addition, data based on the measurements taken by the VTT regarding emission factors have been used to estimate emissions of mercury from the incineration of waste. The study indicates that the total emission of mercury has decreased from 1140 kg in 1990 to 620 kg in 1997, while industrial and energy production have been on the increase simultaneously. The 45% emission reduction is due to improved gas cleaning equipment, process changes, automation, the installation of flue gas desulfurization process in coal-fired power plants and strict pollution control laws. In the past, some authors have estimated a higher mercury emission in Finland. In this study, it is also observed that there are no big changes in the quality of raw materials. Estimated emission factors can be of great help to management for estimating mercury emissions and also its risk assessment.

  18. Imported emissions. The world trade stowaway

    International Nuclear Information System (INIS)

    Fink, Meike; Gautier, Celia

    2013-05-01

    This study first gives an overview of existing tools and methodological challenges to account emissions included in consumed products fabricated elsewhere. It notably discusses the passage from a methodology based on a production principle to a methodology based on a consumption principle, outlines the different methodologies associated with the different analysis levels, and the importance of uncertainty sources. The second part proposes a view on emission flows included in exports and imports. It addresses the following issues: the international level, increasing importance of emissions transferred via world trade, emissions related to consumption per capita and per social class, carbon and energy intensity of products at the origin of emissions, composition of imported and exported products and intensity of their emissions, impact of a methodological change on greenhouse gas emissions by France, extent of emissions imported in France, and Germany as the first trade partner and emission importer of France. The third part discusses the political implications of an accounting of emissions related to consumption and to world trade

  19. QSOs with narrow emission lines

    International Nuclear Information System (INIS)

    Baldwin, J.A.; Mcmahon, R.; Hazard, C.; Williams, R.E.

    1988-01-01

    Observations of two new high-redshift, narrow-lined QSOs (NLQSOs) are presented and discussed together with observations of similar objects reported in the literature. Gravitational lensing is ruled out as a possible means of amplifying the luminosity for one of these objects. It is found that the NLQSOs have broad bases on their emission lines as well as the prominent narrow cores which define this class. Thus, these are not pole-on QSOs. The FWHM of the emission lines fits onto the smoothly falling tail of the lower end of the line-width distribution for complete QSO samples. The equivalent widths of the combined broad and narrow components of the lines are normal for QSOs of the luminosity range under study. However, the NLQSOs do show ionization differences from broader-lined QSOs; most significant, the semiforbidden C III/C IV intensity ratio is unusually low. The N/C abundance ratio in these objects is found to be normal; the Al/C abundance ratio may be quite high. 38 references

  20. Positron emission tomography in oncology

    International Nuclear Information System (INIS)

    Lecomte, R.; Bentourkia, M.; Benard, F.

    2002-01-01

    Positron Emission Tomography is a sophisticated molecular imaging technique, using a special scanner, that displays the functional status of tissues in the body at the cellular level (their metabolism). It is a diagnostic scan that provides the physician with information not available with traditional anatomic studies such as CT or MRI. PET can detect changes in cell function (disease) long before they are evident as physical (anatomic) changes seen on CT or MRI. In this way PET can add important information about many diseases allowing the physician to make a diagnosis often much earlier than with anatomic imaging techniques such as CT or MRI alone. In addition, in cases where an abnormality is noted on CT or MRI, PET can help differentiate benign changes from changes due to disease. PET scanning also typically images the entire body, unlike CT/MRI which is usually broken up into specific limited body section scans. All cells use glucose as an energy source but cancer cells use much more since they are growing much faster and out of control. This is the basis of imaging with F-18 FDG glucose, the radiotracer agent use in a PET oncology study. The abnormal, accelerated glucose used by cancer cells is detected by the PET scanner that processes the emissions from the F-18 FDG glucose by abnormally high levels of metabolism (tumor)

  1. Greenhouse Gas Emissions From Cattle

    Directory of Open Access Journals (Sweden)

    Podkówka Zbigniew

    2015-03-01

    Full Text Available Cattle produce greenhouse gases (GHG which lead to changes in the chemical composition of the atmosphere. These gases which cause greenhouse effect include: methane (CH4, nitrous oxide (N2O, nitrogen oxides (NOx, sulphur dioxide (SO2, ammonia (NH3, dust particles and non-methane volatile organic compounds, commonly described as other than methane hydrocarbons. Fermentation processes taking place in the digestive tract produce ‘digestive gases’, distinguished from gases which are emitted during the decomposition of manure. Among these digestive gases methane and non-methane volatile organic compounds are of particular relevance importance. The amount of gases produced by cows can be reduced by choosing to rear animals with an improved genetically based performance. A dairy cow with higher production efficiency, producing milk with higher protein content and at the same time reduced fat content emits less GHG into the environment. Increasing the ratio of feed mixtures in a feed ration also reduces GHG emissions, especially of methane. By selection of dairy cows with higher production efficiency and appropriate nutrition, the farm's expected milk production target can be achieved while at the same time, the size of the herd is reduced, leading to a reduction of GHG emissions.

  2. Pollutants emission in power sector

    Energy Technology Data Exchange (ETDEWEB)

    Chmielewski, A. G. [Faculty of Chemical and Process Engineering, Warsaw University of Technology, Warsaw (Poland); Institute of Nuclear Chemistry and Technology, Warsaw (Poland)

    2011-07-01

    Fossil fuels, including coal, natural gas, petroleum, shale oil and bitumen, are the primary source of heat and electrical energy production and are responsible for emitting a large number and amount of pollutants into the atmosphere via exhaust gases from industry, power stations, residential heating systems and vehicles. During the combustion process, different pollutants such as CO{sub 2}, SO{sub X} (including SO{sub 2} and SO{sub 3}), NO{sub X} (including NO{sub 2}, NO and N{sub 2}O), fly ash, VOCs and mercury are emitted. These emissions cause big environmental and human health hazard. CO{sub 2}, N{sub 2}O, some VOCs, CH{sub 4} contribute to the global greenhouse effect, adding a new dimension to the environmental degradation resulting from the burning of fossil fuels. These problems regarding emissions inventory, their impact on the environment and human health, air pollution control technologies and costs, periods of fossil fuels depletion, role of renewable and nuclear energy in the further civilization development are briefly discussed. (author)

  3. Reducing emissions from uranium dissolving

    International Nuclear Information System (INIS)

    Griffith, W.L.; Compere, A.L.; Huxtable, W.P.; Googin, J.M.

    1992-10-01

    This study was designed to assess the feasibility of decreasing NO x emissions from the current uranium alloy scrap tray dissolving facility. In the current process, uranium scrap is dissolved in boiling nitric acid in shallow stainless-steel trays. As scrap dissolves, more metal and more nitric acid are added to the tray by operating personnel. Safe geometry is assured by keeping liquid level at or below 5 cm, the depth of a safe infinite slab. The accountability batch control system provides additional protection against criticality. Both uranium and uranium alloys are dissolved. Nitric acid is recovered from the vapors for reuse. Metal nitrates are sent to uranium recovery. Brown NO x fumes evolved during dissolving have occasionally resulted in a visible plume from the trays. The fuming is most noticeable during startup and after addition of fresh acid to a tray. Present environmental regulations are expected to require control of brown NO x emissions. A detailed review of the literature, indicated the feasibility of slightly altering process chemistry to favor the production of NO 2 which can be scrubbed and recycled as nitric acid. Methods for controlling the process to manage offgas product distribution and to minimize chemical reaction hazards were also considered

  4. 40 CFR Table 3 to Subpart Ffff of... - Emission Limits for Hydrogen Halide and Halogen HAP Emissions or HAP Metals Emissions From...

    Science.gov (United States)

    2010-07-01

    ... Halogen HAP Emissions or HAP Metals Emissions From Process Vents 3 Table 3 to Subpart FFFF of Part 63... to Subpart FFFF of Part 63—Emission Limits for Hydrogen Halide and Halogen HAP Emissions or HAP... following table that applies to your process vents that contain hydrogen halide and halogen HAP emissions or...

  5. Emission of greenhouse gases from Danish agriculture

    International Nuclear Information System (INIS)

    Olesen, J.E.; Petersen, S.O.; Fenhann, J.V.; Andersen, J.M.; Jacobsen, B.H.

    2001-01-01

    The basis for inventories of methane and nitrous oxide emissions from Danish agriculture has been reviewed and re-evaluated. This has resulted in revised estimates for most of the sources. The revised estimates predict a decline in emissions of methane and nitrous oxide from Danish agriculture from 14.1 Mt CO 2 equivalents in 1990 to 10.6 Mt CO 2 equivalents in 2010. The new estimates give lower emission of methane (4% for 1990 and 15% for 2010), and almost unchanged emissions for nitrous oxide (1% smaller for 1990 and 3% higher for 2010) compared with previous estimates. Since nitrous oxide is a more potent greenhouse gas than methane, the revised estimates are almost identical to the old ones for 2010 when expressed as CO 2 equivalents. The old and the revised estimates give a decline in emissions in CO 2 equivalents from 1990 to 2010 of 23 and 24% respectively. For 1999 the estimated emissions of methane constituted 29% of the total emission of CO 2 equivalents in the form of methane and nitrous oxide. The contribution of nitrous oxide derived from nitrogen turnover in the field was almost 47% of the emission. All emission sources are estimated as the product of an activity and an emission factor. The estimates are associated with uncertainties in both the activities and the emission factors. The uncertainty in the activity data is rather small for most of the items, but probably somewhat larger for N fixation, grazing, and cultivation of organic soils and N leaching. The largest uncertainty is associated with the amount of crop residues, which also constitutes one of the largest contributions to the total greenhouse gas emissions. Emission factors for methane are relatively certain, whereas there are large uncertainties associated with the emission factors for nitrous oxide. This is partly due to the fact that the emission factors are based on emission data representing many different climatic conditions, soil types and crops. The large uncertainty in the

  6. The ABAG biogenic emissions inventory project

    Science.gov (United States)

    Carson-Henry, C. (Editor)

    1982-01-01

    The ability to identify the role of biogenic hydrocarbon emissions in contributing to overall ozone production in the Bay Area, and to identify the significance of that role, were investigated in a joint project of the Association of Bay Area Governments (ABAG) and NASA/Ames Research Center. Ozone, which is produced when nitrogen oxides and hydrocarbons combine in the presence of sunlight, is a primary factor in air quality planning. In investigating the role of biogenic emissions, this project employed a pre-existing land cover classification to define areal extent of land cover types. Emission factors were then derived for those cover types. The land cover data and emission factors were integrated into an existing geographic information system, where they were combined to form a Biogenic Hydrocarbon Emissions Inventory. The emissions inventory information was then integrated into an existing photochemical dispersion model.

  7. Anthropogenic sulfur dioxide emissions: 1850–2005

    Directory of Open Access Journals (Sweden)

    S. J. Smith

    2011-02-01

    Full Text Available Sulfur aerosols impact human health, ecosystems, agriculture, and global and regional climate. A new annual estimate of anthropogenic global and regional sulfur dioxide emissions has been constructed spanning the period 1850–2005 using a bottom-up mass balance method, calibrated to country-level inventory data. Global emissions peaked in the early 1970s and decreased until 2000, with an increase in recent years due to increased emissions in China, international shipping, and developing countries in general. An uncertainty analysis was conducted including both random and systemic uncertainties. The overall global uncertainty in sulfur dioxide emissions is relatively small, but regional uncertainties ranged up to 30%. The largest contributors to uncertainty at present are emissions from China and international shipping. Emissions were distributed on a 0.5° grid by sector for use in coordinated climate model experiments.

  8. Controlling fugitive emissions from mechanical seals

    International Nuclear Information System (INIS)

    Adams, W.V.

    1992-01-01

    This paper reports that enactment of the 1990 Federal Clean Air Amendments will sharply focus efforts in the process industries to reduce fugitive emissions. Moreover, state and local governments may be imposing stricter laws and regulations which will affect allowable fugitive emissions from U.S. refineries and process plants. Plants outside the U.S. have similar concerns. Clearly, mechanical seals for process pumps represent an enormous population and is one category of equipment destined for careful evaluation as a means to control fugitive emissions. Fugitive are unintentional emissions from valves, pumps, flanges, compressors, etc., as opposed to point-source emissions from stacks, vents and flares. Fugitive emissions do not occur as a part of normal plant operations, but result from the effects of: Malfunctions, Age, Lack of proper maintenance, Operator error, Improper equipment specification, Use of inferior technology, and externally caused damage

  9. Quantification of methane emissions from danish landfills

    DEFF Research Database (Denmark)

    Scheutz, Charlotte; Mønster, Jacob; Kjeldsen, Peter

    2013-01-01

    Whole-landfill methane emission was quantified using a tracer technique that combines controlled tracer gas release from the landfill with time-resolved concentration measurements downwind of the landfill using a mobile high-resolution analytical instrument. Methane emissions from 13 Danish...... landfills varied between 2.6 and 60.8 kg CH4 h–1. The highest methane emission was measured at the largest (in terms of disposed waste amounts) of the 13 landfills, whereas the lowest methane emissions (2.6-6.1 kgCH4 h–1) were measured at the older and smaller landfills. At two of the sites, which had gas...... collection, emission measurements showed that the gas collection systems only collected between 30-50% of the methane produced (assuming that the produced methane equalled the sum of the emitted methane and the collected methane). Significant methane emissions were observed from disposed shredder waste...

  10. Greenhouse gas emissions from hydroelectric reservoirs

    International Nuclear Information System (INIS)

    Rosa, L.P.; Schaeffer, R.

    1994-01-01

    In a recent paper, Rudd et al. have suggested that, per unit of electrical energy produced, greenhouse-gas emissions from some hydroelectric reservoirs in northern Canada may be comparable to emissions from fossil-fuelled power plants. The purpose of this comment is to elaborate these issues further so as to understand the potential contribution of hydroelectric reservoirs to the greenhouse effect. More than focusing on the total budget of carbon emissions (be they in the form of CH 4 or be they in the form of CO 2 ), this requires an evaluation of the accumulated greenhouse effect of gas emissions from hydroelectric reservoirs and fossil-fuelled power plants. Two issues will be considered: (a) global warming potential (GWP) for CH 4 ; and (b) how greenhouse-gas emissions from hydroelectric power plants stand against emissions from fossil-fuelled power plants with respect to global warming

  11. Introduction to the physics of electron emission

    CERN Document Server

    Jensen, Kevin L

    2018-01-01

    Electron emission is both a fundamental phenomenon and an enabling component that lies at the very heart of modern science and technology. Written by a recognized authority in the field, with expertise in both electron emission physics and electron beam physics, An Introduction to Electron Emission provides an in-depth look at the physics behind thermal, field, photo, and secondary electron emission mechanisms, how that physics affects the beams that result through space charge and emittance growth, and explores the physics behind their utilization in an array of applications. The book addresses mathematical and numerical methods underlying electron emission, describing where the equations originated, how they are related, and how they may be correctly used to model actual sources for devices using electron beams. Writing for the beam physics and solid state communities, the author explores applications of electron emission methodology to solid state, statistical, and quantum mechanical ideas and concepts r...

  12. An explanation of carbon emission markets

    International Nuclear Information System (INIS)

    2009-01-01

    After having outlined the necessity to drastically reduce anthropic carbon emissions, and discussed how to associate standards, taxes and quota markets, the authors describe how carbon emission markets have emerged: the Kyoto protocol, the emission trade scheme (ETS) of the European Union, other carbon markets (existing or in preparation). They introduce and present four pillars of carbon emission markets: the allocation process, the reliability of emission measurement and control, market records and transparency, and introduction of flexibility. They examine the possibility of success in the development of a greenhouse gas emission market. The authors discuss the problems raised by a design of carbon markets by government and their use by private actors, how to connect existing or future regional carbon markets, the integration of forest and agriculture through new compensatory mechanisms, how to face carbon leaks by widening carbon markets

  13. White light emission from engineered silicon carbide

    DEFF Research Database (Denmark)

    Ou, Haiyan

    Silicon carbide (SiC) is a wide indirect bandgap semiconductor. The light emission efficiency is low in nature. But this material has very unique physical properties like good thermal conductivity, high break down field etc in addition to its abundance. Therefore it is interesting to engineer its...... light emission property so that to take fully potential applications of this material. In this talk, two methods, i.e. doping SiC heavily by donor-acceptor pairs and making SiC porous are introduced to make light emission from SiC. By co-doping SiC with nitrogen and boron heavily, strong yellow emission...... is demonstrated. After optimizing the passivation conditions, strong blue-green emission from porous SiC is demonstrated as well. When combining the yellow emission from co-doped SiC and blue-green from porous SiC, a high color rendering index white light source is achieved....

  14. Emission properties of aluminium-lithium alloy

    International Nuclear Information System (INIS)

    Bondarenko, G.G.; Shishkov, A.V.

    1995-01-01

    High secondary emission properties at comparatively low operation temperatures were obtained when investigating aluminum-lithium alloy Al - 2.2 mass % Li. The maximal value of the coefficient of secondary electron emission for alloy, activated under optimal conditions, is achieved at comparatively low energy of primary electrons, equal to 600 eV. Low value of the first critical potential (15 ± 2 eV) was obtained. It is important for operation of secondary emission cathodes. 12 refs.; 4 figs

  15. Neutral currents and neutrino emission of stars

    International Nuclear Information System (INIS)

    Gershtejn, S.S.; Folomeshkin, V.N.; Khlopov, M.Yu.; Eramzhyan, R.A.

    1975-01-01

    Possible emission of ν sub(e) ν tilde sub(e) and ν sub(μ) ν tilde sub(μ) pairs in nucleon collisions or nuclear transitions has been studied. Neutrino pair emission in neutron collision turns out to be essential for cooling of neutron stars. Neutrino pair emission in nuclear transitions is effective just before the core implosion of a hot massive star and at the initial stage of implosion (till a full dissociation of nuclei into nucleons)

  16. Modeling greenhouse gas emissions from dairy farms.

    Science.gov (United States)

    Rotz, C Alan

    2017-11-15

    Dairy farms have been identified as an important source of greenhouse gas emissions. Within the farm, important emissions include enteric CH 4 from the animals, CH 4 and N 2 O from manure in housing facilities during long-term storage and during field application, and N 2 O from nitrification and denitrification processes in the soil used to produce feed crops and pasture. Models using a wide range in level of detail have been developed to represent or predict these emissions. They include constant emission factors, variable process-related emission factors, empirical or statistical models, mechanistic process simulations, and life cycle assessment. To fully represent farm emissions, models representing the various emission sources must be integrated to capture the combined effects and interactions of all important components. Farm models have been developed using relationships across the full scale of detail, from constant emission factors to detailed mechanistic simulations. Simpler models, based upon emission factors and empirical relationships, tend to provide better tools for decision support, whereas more complex farm simulations provide better tools for research and education. To look beyond the farm boundaries, life cycle assessment provides an environmental accounting tool for quantifying and evaluating emissions over the full cycle, from producing the resources used on the farm through processing, distribution, consumption, and waste handling of the milk and dairy products produced. Models are useful for improving our understanding of farm processes and their interacting effects on greenhouse gas emissions. Through better understanding, they assist in the development and evaluation of mitigation strategies for reducing emissions and improving overall sustainability of dairy farms. The Authors. Published by the Federation of Animal Science Societies and Elsevier Inc. on behalf of the American Dairy Science Association®. This is an open access article

  17. Economic effects on taxing CO2 emissions

    International Nuclear Information System (INIS)

    Haaparanta, P.; Jerkkola, J.; Pohjola, J.

    1996-01-01

    The CO 2 emissions can be reduced by using economic instruments, like carbon tax. This project included two specific questions related to CO 2 taxation. First one was the economic effects of increasing CO 2 tax and decreasing other taxes. Second was the economic adjustment costs of reducing net emissions instead of gross emissions. A computable general equilibrium (CGE) model was used in this analysis. The study was taken place in Helsinki School of Economics

  18. Radioluminescence dating: the IR emission of feldspar

    International Nuclear Information System (INIS)

    Schilles, Thomas.; Habermann, Jan

    2000-01-01

    A new luminescence reader for radioluminescence (RL) measurements is presented. The system allows detection of RL emissions in the near infrared region (IR). Basic bleaching properties of the IR-RL emission of feldspars are investigated. Sunlight-bleaching experiments as a test for sensitivity changes are presented. IR-bleaching experiments were carried out to obtain information about the underlying physical processes of the IR-RL emission

  19. Determinants and predictability of global wildfire emissions

    Directory of Open Access Journals (Sweden)

    W. Knorr

    2012-08-01

    Full Text Available Biomass burning is one of the largest sources of atmospheric trace gases and aerosols globally. These emissions have a major impact on the radiative balance of the atmosphere and on air quality, and are thus of significant scientific and societal interest. Several datasets have been developed that quantify those emissions on a global grid and offered to the atmospheric modelling community. However, no study has yet attempted to systematically quantify the dependence of the inferred pyrogenic emissions on underlying assumptions and input data. Such a sensitivity study is needed for understanding how well we can currently model those emissions and what the factors are that contribute to uncertainties in those emission estimates.

    Here, we combine various satellite-derived burned area products, a terrestrial ecosystem model to simulate fuel loads and the effect of fire on ecosystem dynamics, a model of fuel combustion, and various emission models that relate combusted biomass to the emission of various trace gases and aerosols. We carry out simulations with varying parameters for combustion completeness and fuel decomposition rates within published estimates, four different emissions models and three different global burned-area products. We find that variations in combustion completeness and simulated fuel loads have the largest impact on simulated global emissions for most species, except for some with highly uncertain emission factors. Variation in burned-area estimates also contribute considerably to emission uncertainties. We conclude that global models urgently need more field-based data for better parameterisation of combustion completeness and validation of simulated fuel loads, and that further validation and improvement of burned area information is necessary for accurately modelling global wildfire emissions. The results are important for chemical transport modelling studies, and for simulations of biomass burning impacts on the

  20. Linking GHG Emission Trading Systems and Markets

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2006-07-01

    Several different types of links are possible between different GHG-mitigation systems. These include: Linking two or more emission trading schemes so that emissions trading can occur both within and between different schemes ('direct links'); and Linking emission trading systems to registries/mechanisms and systems that generate offsets from project based mechanisms or from direct purchases/transfers of AAUs ('indirect links').