WorldWideScience

Sample records for double peak electric

  1. Research on Double Price Regulations and Peak Shaving Reserve Mechanism in Coal-Electricity Supply Chain

    Directory of Open Access Journals (Sweden)

    Hongjun Peng

    2013-01-01

    Full Text Available The game models were used to study the mechanism of coal-electricity price conflict under conditions of double price regulations of coal and electricity. Based on this, the peak shaving reserve mechanism was designed to probe into the countermeasures against the coal-electricity price conflicts. The study revealed that in the boom seasons of coal demand, the initiatives of the coal enterprises to supply thermal coal and the electricity enterprises to order thermal coal are reduced under conditions of double price regulations. However, under the circumstances of coal price marketization, in the boom seasons of coal demand the thermal coal price may go up obviously, the initiatives of the coal enterprises to supply thermal coal are increased, and meanwhile the initiatives of the power enterprises to order thermal coal are decreased dramatically. The transportation capacity constraint of coal supply leads to the evident decrease of the initiatives of coal enterprises for the thermal coal supply. The mechanism of peak shaving reserve of thermal coal may not only reduce the price of coal market but also increase the enthusiasm of the power enterprises to order more thermal coal and the initiatives of the coal enterprises to supply more thermal coal.

  2. The origin of double peak electric field distribution in heavily irradiated silicon detectors

    CERN Document Server

    Eremin, V; Li, Z

    2002-01-01

    The first observation of double peak (DP) electric field distribution in heavily neutron irradiated (>10 sup 1 sup 4 n/cm sup 2) semiconductor detectors has been published about 6 yr ago. However, this effect was not quantitatively analyzed up to now. The explanation of the DP electric field distribution presented in this paper is based on the properties of radiation induced deep levels in silicon, which act as deep traps, and on the distribution of the thermally generated free carrier concentration in the detector bulk. In the frame of this model, the earlier published considerations on the so-called 'double junction (DJ) effect' are discussed as well. The comparison of the calculated electric field profiles at different temperatures with the experimental ones allows one to determine a set of deep levels. This set of deep levels, and their charge filling status are essential to the value and the distribution of space charge in the space charge region in the range of 305-240 K, which is actual temperature ran...

  3. Electricity Portfolio Management: Optimal Peak / Off-Peak Allocations

    OpenAIRE

    Huisman, Ronald; Mahieu, Ronald; Schlichter, Felix

    2007-01-01

    textabstractElectricity purchasers manage a portfolio of contracts in order to purchase the expected future electricity consumption profile of a company or a pool of clients. This paper proposes a mean-variance framework to address the concept of structuring the portfolio and focuses on how to allocate optimal positions in peak and off-peak forward contracts. It is shown that the optimal allocations are based on the difference in risk premiums per unit of day-ahead risk as a measure of relati...

  4. Facility Location with Double-peaked Preferences

    DEFF Research Database (Denmark)

    Filos-Ratsikas, Aris; Li, Minming; Zhang, Jie

    2015-01-01

    ; this makes the problem essentially more challenging. As our main contribution, we present a simple truthful-in-expectation mechanism that achieves an approximation ratio of 1+b=c for both the social and the maximum, cost, where b is the distance of the agent from the peak and c is the minimum cost...

  5. Commodity hydrogen from off-peak electricity

    Energy Technology Data Exchange (ETDEWEB)

    Darrow, K.; Biederman, N.; Konopka, A.

    1977-01-01

    This paper considers the use of off-peak electrical power as an energy source for the electrolytic production of hydrogen. The present industrial uses for hydrogen are examined to determine if hydrogen produced in this fashion would be competitive with the industry's onsite production or existing hydrogen prices. The paper presents a technical and economic feasibility analysis of the various components required and of the operation of the system as a whole including production, transmission, storage, and markets.

  6. Electric peak power forecasting by year 2025

    International Nuclear Information System (INIS)

    Alsayegh, O.A.; Al-Matar, O.A.; Fairouz, F.A.; Al-Mulla Ali, A.

    2005-01-01

    Peak power demand in Kuwait up to the year 2025 was predicted using an artificial neural network (ANN) model. The aim of the study was to investigate the effect of air conditioning (A/C) units on long-term power demand. Five socio-economic factors were selected as inputs for the simulation: (1) gross national product, (2) population, (3) number of buildings, (4) imports of A/C units, and (5) index of industrial production. The study used socio-economic data from 1978 to 2000. Historical data of the first 10 years of the studied time period were used to train the ANN. The electrical network was then simulated to forecast peak power for the following 11 years. The calculated error was then used for years in which power consumption data were not available. The study demonstrated that average peak power rates increased by 4100 MW every 5 years. Various scenarios related to changes in population, the number of buildings, and the quantity of A/C units were then modelled to estimate long-term peak power demand. Results of the study demonstrated that population had the strongest impact on future power demand, while the number of buildings had the smallest impact. It was concluded that peak power growth can be controlled through the use of different immigration policies, increased A/C efficiency, and the use of vertical housing. 7 refs., 2 tabs., 6 figs

  7. Electric peak power forecasting by year 2025

    Energy Technology Data Exchange (ETDEWEB)

    Alsayegh, O.A.; Al-Matar, O.A.; Fairouz, F.A.; Al-Mulla Ali, A. [Kuwait Inst. for Scientific Research, Kuwait City (Kuwait). Div. of Environment and Urban Development

    2005-07-01

    Peak power demand in Kuwait up to the year 2025 was predicted using an artificial neural network (ANN) model. The aim of the study was to investigate the effect of air conditioning (A/C) units on long-term power demand. Five socio-economic factors were selected as inputs for the simulation: (1) gross national product, (2) population, (3) number of buildings, (4) imports of A/C units, and (5) index of industrial production. The study used socio-economic data from 1978 to 2000. Historical data of the first 10 years of the studied time period were used to train the ANN. The electrical network was then simulated to forecast peak power for the following 11 years. The calculated error was then used for years in which power consumption data were not available. The study demonstrated that average peak power rates increased by 4100 MW every 5 years. Various scenarios related to changes in population, the number of buildings, and the quantity of A/C units were then modelled to estimate long-term peak power demand. Results of the study demonstrated that population had the strongest impact on future power demand, while the number of buildings had the smallest impact. It was concluded that peak power growth can be controlled through the use of different immigration policies, increased A/C efficiency, and the use of vertical housing. 7 refs., 2 tabs., 6 figs.

  8. Particle creation by peak electric field

    Energy Technology Data Exchange (ETDEWEB)

    Adorno, T.C. [Tomsk State University, Department of Physics, Tomsk (Russian Federation); Gavrilov, S.P. [Tomsk State University, Department of Physics, Tomsk (Russian Federation); Herzen State Pedagogical University of Russia, Department of General and Experimental Physics, St. Petersburg (Russian Federation); Gitman, D.M. [Tomsk State University, Department of Physics, Tomsk (Russian Federation); P. N. Lebedev Physical Institute, Moscow (Russian Federation); University of Sao Paulo, Institute of Physics, CP 66318, Sao Paulo, SP (Brazil)

    2016-08-15

    The particle creation by the so-called peak electric field is considered. The latter field is a combination of two exponential parts, one exponentially increasing and another exponentially decreasing. We find exact solutions of the Dirac equation with the field under consideration with appropriate asymptotic conditions and calculate all the characteristics of particle creation effect, in particular, differential mean numbers of created particle, total number of created particles, and the probability for a vacuum to remain a vacuum. Characteristic asymptotic regimes are discussed in detail and a comparison with the pure asymptotically decaying field is considered. (orig.)

  9. Peak Electric Load Relief in Northern Manhattan

    Directory of Open Access Journals (Sweden)

    Hildegaard D. Link

    2014-08-01

    Full Text Available The aphorism “Think globally, act locally,” attributed to René Dubos, reflects the vision that the solution to global environmental problems must begin with efforts within our communities. PlaNYC 2030, the New York City sustainability plan, is the starting point for this study. Results include (a a case study based on the City College of New York (CCNY energy audit, in which we model the impacts of green roofs on campus energy demand and (b a case study of energy use at the neighborhood scale. We find that reducing the urban heat island effect can reduce building cooling requirements, peak electricity loads stress on the local electricity grid and improve urban livability.

  10. Electricity portfolio management : optimal peak/off-peak allocations

    NARCIS (Netherlands)

    Huisman, R.; Mahieu, R.J.; Schlichter, F.

    2009-01-01

    Electricity purchasers manage a portfolio of contracts in order to purchase the expected future electricity consumption profile of a company or a pool of clients. This paper proposes a mean-variance framework to address the concept of structuring the portfolio and focuses on how to optimally

  11. Electricity Portfolio Management: Optimal Peak / Off-Peak Allocations

    NARCIS (Netherlands)

    R. Huisman (Ronald); R.J. Mahieu (Ronald); F. Schlichter (Felix)

    2007-01-01

    textabstractElectricity purchasers manage a portfolio of contracts in order to purchase the expected future electricity consumption profile of a company or a pool of clients. This paper proposes a mean-variance framework to address the concept of structuring the portfolio and focuses on how to

  12. Can double-peaked lines indicate merging effects in AGNs?

    Directory of Open Access Journals (Sweden)

    Popović L.Č.

    2000-01-01

    Full Text Available The influence of merging effects in the central part of an Active Galactic Nucleus (AGN on the emission spectral line shapes are discussed. We present a model of close binary Broad Line Region. The numerical experiments show that the merging effects can explain double peaked lines. The merging effects may also be present in the center of AGNs, although they emit slightly asymmetric as well as symmetric and relatively stable (in profile shape spectral lines. Depending on the black hole masses and their orbit elements such model may explain some of the line profile shapes observed in AGNs. This work shows that if one is looking for the merging effects in the central region as well as in the wide field structure of AGNs, he should first pay attention to objects which have double peaked lines.

  13. MERGERS IN DOUBLE-PEAKED [O III] ACTIVE GALACTIC NUCLEI

    International Nuclear Information System (INIS)

    Fu Hai; Djorgovski, S. G.; Myers, Adam D.; Yan Lin

    2011-01-01

    As a natural consequence of galaxy mergers, binary active galactic nuclei (AGNs) should be commonplace. Nevertheless, observational confirmations are rare, especially for binaries with separations less than 10 kpc. Such a system may show two sets of narrow emission lines in a single spectrum owing to the orbital motion of the binary. We have obtained high-resolution near-infrared images of 50 double-peaked [O III]λ5007 AGNs with the Keck II laser guide star adaptive optics system. The Sloan Digital Sky Survey sample is compiled from the literature and consists of 17 type-1 AGNs between 0.18 BH -σ * relation because of overestimated stellar velocity dispersions, illustrating the importance of removing mergers from the samples defining the M BH -σ * relations. Finally, we find that the emission-line properties are indistinguishable for spatially resolved and unresolved sources, emphasizing that scenarios involving a single AGN can produce the same double-peaked line profiles and they account for at least 70% of the double-peaked [O III] AGNs.

  14. Households' hourly electricity consumption and peak demand in Denmark

    DEFF Research Database (Denmark)

    Møller Andersen, Frits; Baldini, Mattia; Hansen, Lars Gårn

    2017-01-01

    consumption, we analyse the contribution of appliances and new services, such as individual heat pumps and electric vehicles, to peak consumption and the need for demand response incentives to reduce the peak.Initially, the paper presents a new model that represents the hourly electricity consumption profile...... of households in Denmark. The model considers hourly consumption profiles for different household appliances and their contribution to annual household electricity consumption. When applying the model to an official scenario for annual electricity consumption, assuming non-flexible consumption due...... to a considerable introduction of electric vehicles and individual heat pumps, household consumption is expected to increase considerably, especially peak hour consumption is expected to increase.Next the paper presents results from a new experiment where household customers are given economic and/or environmental...

  15. Reducing Electricity Demand Peaks by Scheduling Home Appliances Usage

    DEFF Research Database (Denmark)

    Rossello Busquet, Ana; Kardaras, Georgios; Iversen, Villy Bæk

    2011-01-01

    Nowadays there is a tendency to consume electricity during the same period of the day leading to demand peaks. Regular energy consumption habits lead to demand peaks at specific temporal intervals, because users consume power at the same time. In order to avoid demand peaks, users’ appliances...... should consume electricity in a more temporarily distributed way. A new methodology to schedule the usage of home appliances is proposed and analyzed in this paper. The main concept behind this approach is the aggregation of home appliances into priority classes and the definition of a maximum power...... consumption limit, which is not allowed to be exceeded during peak hours. The scenario simulated describes a modern household, where the electrical devices are classified in low and high priority groups. The high priority devices are always granted power in order to operate without temporal restrictions...

  16. Climate Change Impacts on Peak Electricity Consumption: US vs. Europe.

    Science.gov (United States)

    Auffhammer, M.

    2016-12-01

    It has been suggested that climate change impacts on the electric sector will account for the majority of global economic damages by the end of the current century and beyond. This finding is at odds with the relatively modest increase in climate driven impacts on consumption. Comprehensive high frequency load balancing authority level data have not been used previously to parameterize the relationship between electric demand and temperature for any major economy. Using statistical models we analyze multi-year data from load balancing authorities in the United States of America and the European Union, which are responsible for more than 90% of the electricity delivered to residential, industrial, commercial and agricultural customers. We couple the estimated response functions between total daily consumption and daily peak load with an ensemble of downscaled GCMs from the CMIP5 archive to simulate climate change driven impacts on both outcomes. We show moderate and highly spatially heterogeneous changes in consumption. The results of our peak load simulations, however, suggest significant changes in the intensity and frequency of peak events throughout the United States and Europe. As the electricity grid is built to endure maximum load, which usually occurs on the hottest day of the year, our findings have significant implications for the construction of costly peak generating and transmission capacity.

  17. Reducing electricity demand peaks by scheduling home appliances usage

    Energy Technology Data Exchange (ETDEWEB)

    Rossello-Busquet, A.; Kardaras, G.; Baek Iversen, V.; Soler, J.; Dittmann, L.

    2011-05-15

    Nowadays there is a tendency to consume electricity during the same period of the day leading to demand peaks. Regular energy consumption habits lead to demand peaks at specific temporal intervals, because users consume power at the same time. In order to avoid demand peaks, users' appliances should consume electricity in a more temporarily distributed way. A new methodology to schedule the usage of home appliances is proposed and analyzed in this paper. The main concept behind this approach is the aggregation of home appliances into priority classes and the definition of a maximum power consumption limit, which is not allowed to be exceeded during peak hours. The scenario simulated describes a modern household, where the electrical devices are classified in low and high priority groups. The high priority devices are always granted power in order to operate without temporal restrictions. On the contrary, the low priority devices have to pause their operation, when the algorithm dictates it, and resume it in the future. This can become beneficial for both energy companies and users. The electricity suppliers companies will be capable of regulating power generation during demand peaks periods. Moreover, users can be granted lower electricity bill rates for accepting delaying the operation of some of their appliances. In order to analyze this scenario, teletraffic engineering theory, which is used in evaluating the performance of telecommunication networks, is used. A reversible fair scheduling (RFS) algorithm, which was originally developed for telecommunication networks, is applied. The purpose is to analyze how a power consumption limit and priorities for home appliances will affect the demand peak and the users' everyday life. Verification of the effectiveness of the RFS algorithm is done by means of simulation and by using real data for power consumption and operation hours. The defined maximum power limit of 750 and 1000 Watt was not exceeded during

  18. Forecasting Strategies for Predicting Peak Electric Load Days

    Science.gov (United States)

    Saxena, Harshit

    Academic institutions spend thousands of dollars every month on their electric power consumption. Some of these institutions follow a demand charges pricing structure; here the amount a customer pays to the utility is decided based on the total energy consumed during the month, with an additional charge based on the highest average power load required by the customer over a moving window of time as decided by the utility. Therefore, it is crucial for these institutions to minimize the time periods where a high amount of electric load is demanded over a short duration of time. In order to reduce the peak loads and have more uniform energy consumption, it is imperative to predict when these peaks occur, so that appropriate mitigation strategies can be developed. The research work presented in this thesis has been conducted for Rochester Institute of Technology (RIT), where the demand charges are decided based on a 15 minute sliding window panned over the entire month. This case study makes use of different statistical and machine learning algorithms to develop a forecasting strategy for predicting the peak electric load days of the month. The proposed strategy was tested for a whole year starting May 2015 to April 2016 during which a total of 57 peak days were observed. The model predicted a total of 74 peak days during this period, 40 of these cases were true positives, hence achieving an accuracy level of 70 percent. The results obtained with the proposed forecasting strategy are promising and demonstrate an annual savings potential worth about $80,000 for a single submeter of RIT.

  19. Kinetic energy storage of off-peak electricity

    International Nuclear Information System (INIS)

    Simpson, L.A.; Oldaker, I.E.; Stermscheg, J.

    1975-09-01

    The concept of using large flywheels to store off-peak electricity has been considered. The development of high strength composite materials has made possible improvements in the energy storage capacity of such devices. The problems involved in designing large flywheels and their economic advantages over alternative means of energy storage are discussed. The economic arguments are based on the present or near future capabilities and costs of structural composite materials. The flywheel costs turn out to be considerably higher than for many alternative schemes including advanced batteries, gas turbine generators and pumped storage schemes. (author)

  20. Acetaminophen overdose associated with double serum concentration peaks

    Directory of Open Access Journals (Sweden)

    Cristian Papazoglu

    2015-12-01

    Full Text Available Acetaminophen is the most commonly used analgesic–antipyretic medication in the United States. Acetaminophen overdose, a frequent cause of drug toxicity, has been recognized as the leading cause of fatal and non-fatal hepatic necrosis. N-Acetylcysteine is the recommended antidote for acetaminophen poisoning. Despite evidence on the efficacy of N-acetylcysteine for prevention of hepatic injury, controversy persists about the optimal duration of the therapy. Here, we describe the case of a 65-year-old male with acetaminophen overdose and opioid co-ingestion who developed a second peak in acetaminophen serum levels after completing the recommended 21-hour intravenous N-acetylcysteine protocol and when the standard criteria for monitoring drug levels was achieved. Prolongation of N-acetylcysteine infusion beyond the standard protocol, despite a significant gap in treatment, was critical for successful avoidance of hepatotoxicity. Delay in acetaminophen absorption may be associated with a second peak in serum concentration following an initial declining trend, especially in cases of concomitant ingestion of opioids. In patients with acetaminophen toxicity who co-ingest other medications that may potentially delay gastric emptying or in those with risk factors for delayed absorption of acetaminophen, we recommend close monitoring of aminotransferase enzyme levels, as well as trending acetaminophen concentrations until undetectable before discontinuing the antidote therapy.

  1. Effects of a static electric field on nonsequential double ionization

    International Nuclear Information System (INIS)

    Li Hongyun; Wang Bingbing; Li Xiaofeng; Fu Panming; Chen Jing; Liu Jie; Jiang Hongbing; Gong Qihuang; Yan Zongchao

    2007-01-01

    Using a three-dimensional semiclassical method, we perform a systematic analysis of the effects of an additional static electric field on nonsequential double ionization (NSDI) of a helium atom in an intense, linearly polarized laser field. It is found that the static electric field influences not only the ionization rate, but also the kinetic energy of the ionized electron returning to the parent ion, in such a way that, if the rate is increased, then the kinetic energy of the first returning electron is decreased, and vice versa. These two effects compete in NSDI. Since the effect of the static electric field on the ionization of the first electron plays a more crucial role in the competition, the symmetric double-peak structure of the He 2+ momentum distribution parallel to the polarization of the laser field is destroyed. Furthermore, the contribution of the trajectories with multiple recollisions to the NSDI is also changed dramatically by the static electric field. As the static electric field increases, the trajectories with two recollisions, which start at the time when the laser and the static electric field are in the same direction, become increasingly important for the NSDI

  2. Residential implementation of critical-peak pricing of electricity

    International Nuclear Information System (INIS)

    Herter, Karen

    2007-01-01

    This paper investigates how critical-peak pricing (CPP) affects households with different usage and income levels, with the goal of informing policy makers who are considering the implementation of CPP tariffs in the residential sector. Using a subset of data from the California Statewide Pricing Pilot of 2003-04, average load change during summer events, annual percent bill change, and post-experiment satisfaction ratings are calculated across six customer segments, categorized by historical usage and income levels. Findings show that high-use customers respond significantly more in kW reduction than do low-use customers, while low-use customers save significantly more in percentage reduction of annual electricity bills than do high-use customers-results that challenge the strategy of targeting only high-use customers for CPP tariffs. Across income levels, average load and bill changes were statistically indistinguishable, as were satisfaction rates-results that are compatible with a strategy of full-scale implementation of CPP rates in the residential sector. Finally, the high-use customers earning less than $50,000 annually were the most likely of the groups to see bill increases-about 5% saw bill increases of 10% or more-suggesting that any residential CPP implementation might consider targeting this customer group for increased energy efficiency efforts

  3. Novel five-state latch using double-peak negative differential resistance and standard ternary inverter

    Science.gov (United States)

    Shin, Sunhae; Rok Kim, Kyung

    2016-04-01

    We propose complement double-peak negative differential resistance (NDR) devices with ultrahigh peak-to-valley current ratio (PVCR) over 106 by combining tunnel diode with conventional CMOS and its compact five-state latch circuit by introducing standard ternary inverter (STI). At the “high”-state of STI, n-type NDR device (tunnel diode with nMOS) has 1st NDR characteristics with 1st peak and valley by band-to-band tunneling (BTBT) and trap-assisted tunneling (TAT), whereas p-type NDR device (tunnel diode with pMOS) has second NDR characteristics from the suppression of diode current by off-state MOSFET. The “intermediate”-state of STI permits double-peak NDR device to operate five-state latch with only four transistors, which has 33% area reduction compared with that of binary inverter and 57% bit-density reduction compared with binary latch.

  4. The Nature of Double-peaked [O III] Active Galactic Nuclei

    Science.gov (United States)

    Fu, Hai; Yan, Lin; Myers, Adam D.; Stockton, Alan; Djorgovski, S. G.; Aldering, G.; Rich, Jeffrey A.

    2012-01-01

    Active galactic nuclei (AGNs) with double-peaked [O III] lines are suspected to be sub-kpc or kpc-scale binary AGNs. However, pure gas kinematics can produce the same double-peaked line profile in spatially integrated spectra. Here we combine integral-field spectroscopy and high-resolution imaging of 42 double-peaked [O III] AGNs from the Sloan Digital Sky Survey to investigate the constituents of the population. We find two binary AGNs where the line splitting is driven by the orbital motion of the merging nuclei. Such objects account for only ~2% of the double-peaked AGNs. Almost all (~98%) of the double-peaked AGNs were selected because of gas kinematics; and half of those show spatially resolved narrow-line regions that extend 4-20 kpc from the nuclei. Serendipitously, we find two spectrally unresolved binary AGNs where gas kinematics produced the double-peaked [O III] lines. The relatively frequent serendipitous discoveries indicate that only ~1% of binary AGNs would appear double-peaked in Sloan spectra and 2.2+2.5 -0.8% of all Sloan AGNs are binary AGNs. Therefore, the double-peaked sample does not offer much advantage over any other AGN samples in finding binary AGNs. The binary AGN fraction implies an elevated AGN duty cycle (8+8 -3%), suggesting galaxy interactions enhance nuclear accretion. We illustrate that integral-field spectroscopy is crucial for identifying binary AGNs: several objects previously classified as "binary AGNs" with long-slit spectra are most likely single AGNs with extended narrow-line regions (ENLRs). The formation of ENLRs driven by radiation pressure is also discussed. Some of the data presented herein were obtained at the W.M. Keck Observatory, which is operated as a scientific partnership among the California Institute of Technology, the University of California, and the National Aeronautics and Space Administration. The Observatory was made possible by the generous financial support of the W. M. Keck Foundation.

  5. The Research of Indoor Positioning Based on Double-peak Gaussian Model

    Directory of Open Access Journals (Sweden)

    Lina Chen

    2014-04-01

    Full Text Available Location fingerprinting using Wi-Fi signals has been very popular and is a well accepted indoor positioning method. The key issue of the fingerprinting approach is generating the fingerprint radio map. Limited by the practical workload, only a few samples of the received signal strength are collected at each reference point. Unfortunately, fewer samples cannot accurately represent the actual distribution of the signal strength from each access point. This study finds most Wi- Fi signals have two peaks. According to the new finding, a double-peak Gaussian arithmetic is proposed to generate a fingerprint radio map. This approach requires little time to receive WiFi signals and it easy to estimate the parameters of the double-peak Gaussian function. Compared to the Gaussian function and histogram method to generate a fingerprint radio map, this method better approximates the occurrence signal distribution. This paper also compared the positioning accuracy using K-Nearest Neighbour theory for three radio maps, the test results show that the positioning distance error utilizing the double-peak Gaussian function is better than the other two methods.

  6. Climate change and peak demand for electricity: Evaluating policies for reducing peak demand under different climate change scenarios

    Science.gov (United States)

    Anthony, Abigail Walker

    This research focuses on the relative advantages and disadvantages of using price-based and quantity-based controls for electricity markets. It also presents a detailed analysis of one specific approach to quantity based controls: the SmartAC program implemented in Stockton, California. Finally, the research forecasts electricity demand under various climate scenarios, and estimates potential cost savings that could result from a direct quantity control program over the next 50 years in each scenario. The traditional approach to dealing with the problem of peak demand for electricity is to invest in a large stock of excess capital that is rarely used, thereby greatly increasing production costs. Because this approach has proved so expensive, there has been a focus on identifying alternative approaches for dealing with peak demand problems. This research focuses on two approaches: price based approaches, such as real time pricing, and quantity based approaches, whereby the utility directly controls at least some elements of electricity used by consumers. This research suggests that well-designed policies for reducing peak demand might include both price and quantity controls. In theory, sufficiently high peak prices occurring during periods of peak demand and/or low supply can cause the quantity of electricity demanded to decline until demand is in balance with system capacity, potentially reducing the total amount of generation capacity needed to meet demand and helping meet electricity demand at the lowest cost. However, consumers need to be well informed about real-time prices for the pricing strategy to work as well as theory suggests. While this might be an appropriate assumption for large industrial and commercial users who have potentially large economic incentives, there is not yet enough research on whether households will fully understand and respond to real-time prices. Thus, while real-time pricing can be an effective tool for addressing the peak load

  7. Robust peak-shaving for a neighborhood with electric vehicles

    NARCIS (Netherlands)

    Gerards, Marco Egbertus Theodorus; Hurink, Johann L.

    2016-01-01

    Demand Side Management (DSM) is a popular approach for grid-aware peak-shaving. The most commonly used DSM methods either have no look ahead feature and risk deploying flexibility too early, or they plan ahead using predictions, which are in general not very reliable. To counter this, a DSM approach

  8. Implementing peak load reduction algorithms for household electrical appliances

    International Nuclear Information System (INIS)

    Dlamini, Ndumiso G.; Cromieres, Fabien

    2012-01-01

    Considering household appliance automation for reduction of household peak power demand, this study explored aspects of the interaction between household automation technology and human behaviour. Given a programmable household appliance switching system, and user-reported appliance use times, we simulated the load reduction effectiveness of three types of algorithms, which were applied at both the single household level and across all 30 households. All three algorithms effected significant load reductions, while the least-to-highest potential user inconvenience ranking was: coordinating the timing of frequent intermittent loads (algorithm 2); moving period-of-day time-flexible loads to off-peak times (algorithm 1); and applying short-term time delays to avoid high peaks (algorithm 3) (least accommodating). Peak reduction was facilitated by load interruptibility, time of use flexibility and the willingness of users to forgo impulsive appliance use. We conclude that a general factor determining the ability to shift the load due to a particular appliance is the time-buffering between the service delivered and the power demand of an appliance. Time-buffering can be ‘technologically inherent’, due to human habits, or realised by managing user expectations. There are implications for the design of appliances and home automation systems. - Highlights: ► We explored the interaction between appliance automation and human behaviour. ► There is potential for considerable load shifting of household appliances. ► Load shifting for load reduction is eased with increased time buffering. ► Design, human habits and user expectations all influence time buffering. ► Certain automation and appliance design features can facilitate load shifting.

  9. Contribution to performing gas solutions and the complementarity of energies to address electric peak consumptions

    International Nuclear Information System (INIS)

    2015-01-01

    This article aims at outlining the contribution that gas-based solutions may have for the reduction of the seasonal electricity peak consumption. After having recalled the principles related to electricity peak consumption (daily peak in summer and in winter due to the use of various equipment which lasts few hours, seasonal peak in winter due to the use of electric heating which may last several weeks) and the associated evolution of electricity consumptions over the last years, this article describes the main challenges related to the electric peak consumption: how to maintain the balance in real time between production and consumption. In France, the network manager must use, beside nuclear power stations, thermal productions (gas or coal-based) which result in higher CO 2 emissions. Electricity imports from Germany also degrade the French carbon footprint. Thus, the management of daily and seasonal peaks can be based on three levers of action: to act on supply by developing capacities to face the residual peak, to act on demand by smoothing the load curve by controlling the load of electric equipment, or to act on demand by a global reduction of the thermo-sensitive consumption of electricity

  10. Development of energy storage system for DC electric rolling stock applying electric double layer capacitor

    Energy Technology Data Exchange (ETDEWEB)

    Sekijima, Y.; Kudo, Y.; Inui, M. [Central Japan Railway Co., Aichi (Japan); Monden, Y.; Toda, S.; Aoyama, I. [Toshiba Corp., Tokyo (Japan)

    2006-07-01

    This paper provided details of an energy storage system designed for use with DC electric rolling stock through the application of an electric double layer capacitor (EDLC). The EDLC was selected due to its long life-span and its low operational costs. Testing was conducted to assess the system's basic control function, acceleration using stored energy, and behaviour during regenerative brake failure. A control circuit chip was used in the DC electric rolling stock on an inverter of the energy storage system. Tests confirmed that the control method was effective for actual rolling stocks. A full-scale energy storage system for installation on series 313 locomotives was then constructed. Braking energy was generated only from a regenerative brake. In case of brake failure, braking energy was generated from an air brake was well as an electric brake. Data from a field test conducted at the Tokaido and Chuo railway lines showed a capacity of 0.6 kWh. The EDLC was used to reduce peak air brake energy. It was concluded that storing 0.28 kW of brake energy in the EDLC can reduce peaks of air brake energy in high speed ranges. Experimental equipment was used to confirm use of the system with 0.56 kWh of EDLC, the average energy of air brake used in regenerative energy failure. 1 tab., 10 figs.

  11. Impact of peak electricity demand in distribution grids: a stress test

    NARCIS (Netherlands)

    Hoogsteen, Gerwin; Molderink, Albert; Hurink, Johann L.; Smit, Gerardus Johannes Maria; Schuring, Friso; Kootstra, Ben

    2015-01-01

    The number of (hybrid) electric vehicles is growing, leading to a higher demand for electricity in distribution grids. To investigate the effects of the expected peak demand on distribution grids, a stress test with 15 electric vehicles in a single street is conducted and described in this paper.

  12. Impacts of rising air temperatures on electric transmission ampacity and peak electricity load in the United States

    Science.gov (United States)

    Bartos, Matthew; Chester, Mikhail; Johnson, Nathan; Gorman, Brandon; Eisenberg, Daniel; Linkov, Igor; Bates, Matthew

    2016-11-01

    Climate change may constrain future electricity supply adequacy by reducing electric transmission capacity and increasing electricity demand. The carrying capacity of electric power cables decreases as ambient air temperatures rise; similarly, during the summer peak period, electricity loads typically increase with hotter air temperatures due to increased air conditioning usage. As atmospheric carbon concentrations increase, higher ambient air temperatures may strain power infrastructure by simultaneously reducing transmission capacity and increasing peak electricity load. We estimate the impacts of rising ambient air temperatures on electric transmission ampacity and peak per-capita electricity load for 121 planning areas in the United States using downscaled global climate model projections. Together, these planning areas account for roughly 80% of current peak summertime load. We estimate climate-attributable capacity reductions to transmission lines by constructing thermal models of representative conductors, then forcing these models with future temperature projections to determine the percent change in rated ampacity. Next, we assess the impact of climate change on electricity load by using historical relationships between ambient temperature and utility-scale summertime peak load to estimate the extent to which climate change will incur additional peak load increases. We find that by mid-century (2040-2060), increases in ambient air temperature may reduce average summertime transmission capacity by 1.9%-5.8% relative to the 1990-2010 reference period. At the same time, peak per-capita summertime loads may rise by 4.2%-15% on average due to increases in ambient air temperature. In the absence of energy efficiency gains, demand-side management programs and transmission infrastructure upgrades, these load increases have the potential to upset current assumptions about future electricity supply adequacy.

  13. Application of Electric Double Layer Capacitor for Solar Car

    OpenAIRE

    中西, 弘一; 岸, 純男; 仲森, 昌也; 荒賀, 浩一

    2016-01-01

    This paper describes a method for efficient work of electrical energy, using DC-DC converter as insulate between battery and Electrical Double Layer Capacitor (EDLC). In case of constant-current charge to the EDLC, the efficiency of the electric power is higher, compared to the constant-voltage charge.

  14. Effect of turbulent flow on the double electric layer

    International Nuclear Information System (INIS)

    Rutten, F. van.

    1978-01-01

    The existence of the double electric layer could explain the local deposition of corrosion products in water cooled reactors. It is shown that turbulent flow tends to drive the ions away from the wall, disturbs the diffuse layer and enables the electric field to extend further into the liquid phase. This electric field attracts the particles to the walls by electrophoresis [fr

  15. Extreme daily increases in peak electricity demand: Tail-quantile estimation

    International Nuclear Information System (INIS)

    Sigauke, Caston; Verster, Andréhette; Chikobvu, Delson

    2013-01-01

    A Generalized Pareto Distribution (GPD) is used to model extreme daily increases in peak electricity demand. The model is fitted to years 2000–2011 recorded data for South Africa to make a comparative analysis with the Generalized Pareto-type (GP-type) distribution. Peak electricity demand is influenced by the tails of probability distributions as well as by means or averages. At times there is a need to depart from the average thinking and exploit information provided by the extremes (tails). Empirical results show that both the GP-type and the GPD are a good fit to the data. One of the main advantages of the GP-type is the estimation of only one parameter. Modelling of extreme daily increases in peak electricity demand helps in quantifying the amount of electricity which can be shifted from the grid to off peak periods. One of the policy implications derived from this study is the need for day-time use of electricity billing system similar to the one used in the cellular telephone/and fixed line-billing technology. This will result in the shifting of electricity demand on the grid to off peak time slots as users try to avoid high peak hour charges. - Highlights: ► Policy makers should design demand response strategies to save electricity. ► Peak electricity demand is influenced by tails of probability distributions. ► Both the GSP and the GPD are a good fit to the data. ► Accurate assessment of level and frequency of extreme load forecasts is important.

  16. The electric double layer has a life of its own

    NARCIS (Netherlands)

    Merlet, Céline; Limmer, David T.; Salanne, Mathieu; Van Roij, René; Madden, Paul A.; Chandler, David; Rotenberg, Benjamin

    2014-01-01

    Using molecular dynamics simulations with recently developed importance sampling methods, we show that the differential capacitance of a model ionic liquid based double-layer capacitor exhibits an anomalous dependence on the applied electrical potential. Such behavior is qualitatively incompatible

  17. Recruiting, Training, Retaining, and Promoting the Workforce of the Future at Comanche Peak Steam Electric Station

    International Nuclear Information System (INIS)

    Sunseri, M.

    1999-01-01

    TXU Electric expects to encounter a relatively high turnover in the workforce in the coming years. To prepare for this challenge and to maintain a high level of performance, a number of approaches are being implemented. These approaches involve recruiting experienced personnel, recruiting and developing local nonexperienced personnel, and developing current employees. Through these approaches, TXU Electric expects to maintain a high-quality workforce for the continued support of Comanche Peak Steam Electric Station

  18. Liquid Crystals of Lithium Dodecylbenzenesulfonate for Electric Double Layer Capacitors

    International Nuclear Information System (INIS)

    Kuzmin, Andrey Vasil’evich; Yurtov, Evgeny V.

    2016-01-01

    Ionic lyotropic liquid crystals based on lithium dodecylbenzenesulfonate were used as electrolytes for electric double layer capacitors with carbon fibrous electrodes. The capacitors were tasted by cyclic voltammetry, galvanostatic charge and discharge, and impedance spectroscopy. The highest specific capacitance was achieved for electrical double layer capacitor equipped with ionic lyotropic liquid crystal of lithium dodecylbenzenesulfonate 35 wt% in water. The specific capacitance of capacitor was calculated from galvanostatic discharge curves – 15 F/g of carbon fibrous material

  19. Analysis on factors affecting household customers decision in using electricity at peak time and its correlation towards saving electricity

    Science.gov (United States)

    Pasasa, Linus; Marbun, Parlin; Mariza, Ita

    2015-09-01

    The purpose of this paper is to study and analyse the factors affecting customer decisions in using electricity at peak-load hours (between 17.00 to 22.00 WIB) and their behaviors towards electricity conservation in Indonesian household. The underlying rationale is to influence a reduction in energy consumption by stimulating energy saving behaviors, thereby reducing the impact of energy use on the environment. How is the correlation between the decisions in using electricity during peak load hours with the household customer's behavior towards saving electricity? The primary data is obtained by distributing questionnaires to customers of PT. PLN Jakarta Raya and Tangerang Distribution from Household segment. The data is analysed using the Structural Equation Model (SEM) and AMOS Software. The research is finding that all factors (Personal, Social, PLN Services, Psychological, and Cultural) are positively influence customer decision in using electricity at peak load hours. There is a correlation between the decisions in using electricity during peak load hours with the household customer's behavior towards saving electricity.

  20. Measurements and simulations for peak electrical load reduction in cooling dominated climate

    International Nuclear Information System (INIS)

    Sadineni, Suresh B.; Boehm, Robert F.

    2012-01-01

    Peak electric demand due to cooling load in the Desert Southwest region of the US has been an issue for the electrical energy suppliers. To address this issue, a consortium has been formed between the University of Nevada Las Vegas, Pulte Homes (home builder) and NV Energy (local utility) in order to reduce the peak load by more than 65%. The implemented strategies that were used to accomplish that goal consist of energy efficiency in homes, onsite electricity generation through roof integrated PV, direct load control, and battery storage at the substation level. The simulation models developed using building energy analysis software were validated against measured data. The electrical energy demand for the upgraded home during peak period (1:00–7:00 PM) decreased by approximately 37% and 9% compared to a code standard home of the same size, due to energy efficiency and PV generation, respectively. The total decrease in electrical demand due to energy efficiency and PV generation during the peak period is 46%. Additionally, a 2.2 °C increase in thermostat temperature from 23.9 °C to 26.1 °C between 4:00 PM and 7:00 PM has further decreased the average demand during the peak period by 69% of demand from a standard home. -- Highlights: ► A study to demonstrate peak load reductions of 65% at the substation. ► A new residential energy efficient community named Villa Trieste is being developed. ► The peak demand from the homes has decreased by 37% through energy efficiency. ► A 1.8 kWp system along with energy efficiency measures decreased peak by 46%.

  1. Government procurement of peak capacity in the New Zealand electricity market

    International Nuclear Information System (INIS)

    Poletti, Steve

    2009-01-01

    This paper analyzes the impact of government procurement of reserve electricity generation capacity on the long-run equilibrium in the electricity market. The approach here is to model the electricity market in a context where the supply companies have market power. The model is then used to analyze the impact of government direct supply of peak capacity on the market. We find that the firms build less peak-generation capacity when the government procures peak generating capacity. The long-run equilibrium with N firms and government capacity of K G results in an increase of total peak generation capacity of K G /(N+1) compared to the long-run equilibrium with no government capacity. Supply disruptions of baseline capacity during the peak time period are also considered. It is found that peak prices do not go up any further with (anticipated) supply disruptions. Instead the entire cost of the extra peakers is borne by customers on traditional meters and off-peak customers who face real-time pricing. (author)

  2. Double-peaked Emission Lines Due to a Radio Outflow in KISSR 1219

    Energy Technology Data Exchange (ETDEWEB)

    Kharb, P.; Vaddi, S. [National Centre for Radio Astrophysics—Tata Institute of Fundamental Research, Postbag 3, Ganeshkhind, Pune 411007 (India); Subramanian, S. [Kavli Institute for Astronomy and Astrophysics, Peking University, 5 Yiheyuan Road, Haidian District, Beijing 100871 (China); Das, M. [Indian Institute of Astrophysics, II Block, Koramangala, Bangalore 560034 (India); Paragi, Z., E-mail: kharb@ncra.tifr.res.in [Joint Institute for VLBI in Europe, Postbus 2, 7990 AA Dwingeloo (Netherlands)

    2017-09-01

    We present the results from 1.5 and 5 GHz phase-referenced VLBA and 1.5 GHz Karl G. Jansky Very Large Array (VLA) observations of the Seyfert 2 galaxy KISSR 1219, which exhibits double-peaked emission lines in its optical spectrum. The VLA and VLBA data reveal a one-sided core-jet structure at roughly the same position angles, providing evidence of an active galactic nucleus outflow. The absence of dual parsec-scale radio cores puts the binary black-hole picture in doubt for the case of KISSR 1219. The high brightness temperatures of the parsec-scale core and jet components (>10{sup 6} K) are consistent with this interpretation. Doppler boosting with jet speeds of ≳0.55 c to ≳0.25 c , going from parsec to kiloparsec scales, at a jet inclination ≳50° can explain the jet one-sidedness in this Seyfert 2 galaxy. A blueshifted broad emission line component in [O iii] is also indicative of an outflow in the emission line gas at a velocity of ∼350 km s{sup −1}, while the [O i] doublet lines suggest the presence of shock-heated gas. A detailed line ratio study using the MAPPINGS III code further suggests that a shock+precursor model can explain the line ionization data well. Overall, our data suggest that the radio outflow in KISSR 1219 is pushing the emission line clouds, both ahead of the jet and in a lateral direction, giving rise to the double peak emission line spectra.

  3. The Risk of Residential Peak Electricity Demand: A Comparison of Five European Countries

    Directory of Open Access Journals (Sweden)

    Jacopo Torriti

    2017-03-01

    Full Text Available The creation of a Europe-wide electricity market combined with the increased intermittency of supply from renewable sources calls for an investigation into the risk of aggregate peak demand. This paper makes use of a risk model to assess differences in time-use data from residential end-users in five different European electricity markets. Drawing on the Multinational Time-Use Survey database, it assesses risk in relation to the probability of electrical appliance use within households for five European countries. Findings highlight in which countries and for which activities the risk of aggregate peak demand is higher and link smart home solutions (automated load control, dynamic pricing and smart appliances to different levels of peak demand risk.

  4. Assessment of end-use electricity consumption and peak demand by Townsville's housing stock

    International Nuclear Information System (INIS)

    Ren, Zhengen; Paevere, Phillip; Grozev, George; Egan, Stephen; Anticev, Julia

    2013-01-01

    We have developed a comprehensive model to estimate annual end-use electricity consumption and peak demand of housing stock, considering occupants' use of air conditioning systems and major appliances. The model was applied to analyse private dwellings in Townsville, Australia's largest tropical city. For the financial year (FY) 2010–11 the predicted results agreed with the actual electricity consumption with an error less than 10% for cooling thermostat settings at the standard setting temperature of 26.5 °C and at 1.0 °C higher than the standard setting. The greatest difference in monthly electricity consumption in the summer season between the model and the actual data decreased from 21% to 2% when the thermostat setting was changed from 26.5 °C to 27.5 °C. Our findings also showed that installation of solar panels in Townville houses could reduce electricity demand from the grid and would have a minor impact on the yearly peak demand. A key new feature of the model is that it can be used to predict probability distribution of energy demand considering (a) that appliances may be used randomly and (b) the way people use thermostats. The peak demand for the FY estimated from the probability distribution tracked the actual peak demand at 97% confidence level. - Highlights: • We developed a model to estimate housing stock energy consumption and peak demand. • Appliances used randomly and thermostat settings for space cooling were considered. • On-site installation of solar panels was also considered. • Its' results agree well with the actual electricity consumption and peak demand. • It shows the model could provide the probability distribution of electricity demand

  5. A review of molecular modelling of electric double layer capacitors.

    Science.gov (United States)

    Burt, Ryan; Birkett, Greg; Zhao, X S

    2014-04-14

    Electric double-layer capacitors are a family of electrochemical energy storage devices that offer a number of advantages, such as high power density and long cyclability. In recent years, research and development of electric double-layer capacitor technology has been growing rapidly, in response to the increasing demand for energy storage devices from emerging industries, such as hybrid and electric vehicles, renewable energy, and smart grid management. The past few years have witnessed a number of significant research breakthroughs in terms of novel electrodes, new electrolytes, and fabrication of devices, thanks to the discovery of innovative materials (e.g. graphene, carbide-derived carbon, and templated carbon) and the availability of advanced experimental and computational tools. However, some experimental observations could not be clearly understood and interpreted due to limitations of traditional theories, some of which were developed more than one hundred years ago. This has led to significant research efforts in computational simulation and modelling, aimed at developing new theories, or improving the existing ones to help interpret experimental results. This review article provides a summary of research progress in molecular modelling of the physical phenomena taking place in electric double-layer capacitors. An introduction to electric double-layer capacitors and their applications, alongside a brief description of electric double layer theories, is presented first. Second, molecular modelling of ion behaviours of various electrolytes interacting with electrodes under different conditions is reviewed. Finally, key conclusions and outlooks are given. Simulations on comparing electric double-layer structure at planar and porous electrode surfaces under equilibrium conditions have revealed significant structural differences between the two electrode types, and porous electrodes have been shown to store charge more efficiently. Accurate electrolyte and

  6. Regulating electricity demand peaks for home appliances using reversible fair scheduling

    DEFF Research Database (Denmark)

    Kardaras, Georgios; Rossello Busquet, Ana; Iversen, Villy Bæk

    2010-01-01

    This paper describes a novel methodology for regulating electricity demand peaks for home appliances. To achieve this objective, we will make use of the reversible fair scheduling algorithm originally developed for telecommunication networks. The main concept behind this approach is the aggregati...

  7. Battery Peak Power Shaving Strategy to Prolong Battery Life for Electric Buses

    NARCIS (Netherlands)

    Pham, T.H.; Rosea, B.; Wilkins, S.

    2016-01-01

    This paper presents a battery peak power shaving strategy for battery electric buses. The developed strategy restricts the battery charge/discharge power when the propulsion power demand is high to avoid high deterioration of the battery capacity during operation. Without reducing the propulsion

  8. Analysis of the same day of the week increases in peak electricity ...

    African Journals Online (AJOL)

    Modelling of the same day of the week increases in peak electricity demand improves the reliability of a power network if an accurate assessment of the level and frequency of future extreme load forecasts is carried out. Key words: Gibbs sampling, generalized single pareto, generalized pareto distribution, pareto quantile ...

  9. Forecasting monthly peak demand of electricity in India—A critique

    International Nuclear Information System (INIS)

    Rallapalli, Srinivasa Rao; Ghosh, Sajal

    2012-01-01

    The nature of electricity differs from that of other commodities since electricity is a non-storable good and there have been significant seasonal and diurnal variations of demand. Under such condition, precise forecasting of demand for electricity should be an integral part of the planning process as this enables the policy makers to provide directions on cost-effective investment and on scheduling the operation of the existing and new power plants so that the supply of electricity can be made adequate enough to meet the future demand and its variations. Official load forecasting in India done by Central Electricity Authority (CEA) is often criticized for being overestimated due to inferior techniques used for forecasting. This paper tries to evaluate monthly peak demand forecasting performance predicted by CEA using trend method and compare it with those predicted by Multiplicative Seasonal Autoregressive Integrated Moving Average (MSARIMA) model. It has been found that MSARIMA model outperforms CEA forecasts both in-sample static and out-of-sample dynamic forecast horizons in all five regional grids in India. For better load management and grid discipline, this study suggests employing sophisticated techniques like MSARIMA for peak load forecasting in India. - Highlights: ► This paper evaluates monthly peak demand forecasting performance by CEA. ► Compares CEA forecasts it with those predicted by MSARIMA model. ► MSARIMA model outperforms CEA forecasts in all five regional grids in India. ► Opportunity exists to improve the performance of CEA forecasts.

  10. Capacitance of carbon-based electrical double-layer capacitors.

    Science.gov (United States)

    Ji, Hengxing; Zhao, Xin; Qiao, Zhenhua; Jung, Jeil; Zhu, Yanwu; Lu, Yalin; Zhang, Li Li; MacDonald, Allan H; Ruoff, Rodney S

    2014-01-01

    Experimental electrical double-layer capacitances of porous carbon electrodes fall below ideal values, thus limiting the practical energy densities of carbon-based electrical double-layer capacitors. Here we investigate the origin of this behaviour by measuring the electrical double-layer capacitance in one to five-layer graphene. We find that the capacitances are suppressed near neutrality, and are anomalously enhanced for thicknesses below a few layers. We attribute the first effect to quantum capacitance effects near the point of zero charge, and the second to correlations between electrons in the graphene sheet and ions in the electrolyte. The large capacitance values imply gravimetric energy storage densities in the single-layer graphene limit that are comparable to those of batteries. We anticipate that these results shed light on developing new theoretical models in understanding the electrical double-layer capacitance of carbon electrodes, and on opening up new strategies for improving the energy density of carbon-based capacitors.

  11. Technical Specifications, Comanche Peak Steam Electric Station, Unit 1 (Docket No. 50-445)

    International Nuclear Information System (INIS)

    1990-04-01

    The Technical Specifications for Comanche Peak Steam Electric Station, Unit 1 were prepared by the US Nuclear Regulatory Commission. They set forth the limits, operating conditions, and other requirements applicable to a nuclear reactor facility, as set forth in Section 50.36 of Title 10 of the Code of Federal Regulations Part 50, for the protection of the health and safety of the public

  12. Impact of roof integrated PV orientation on the residential electricity peak demand

    International Nuclear Information System (INIS)

    Sadineni, Suresh B.; Atallah, Fady; Boehm, Robert F.

    2012-01-01

    Highlights: ► A study to demonstrate peak load reductions at the substation. ► A new residential energy efficient community named Villa Trieste is being developed. ► The peak demand from the homes has decreased by 38% through energy efficiency. ► Orientation of roof integrated PV has less influence on the summer peak demand. ► Increasing thermostat temperature during peak by 1 °C can significantly reduce peaks. -- Abstract: Peak electricity demand has been an issue in the Desert Southwest region of the US, due to extreme summer temperatures. To address this issue, a consortium was formed between the University of Nevada, Las Vegas, Pulte Homes, and NV Energy. An energy efficient residential community was developed by the team in Las Vegas with approximately 200 homes to study substation-level peak reduction strategies. A summer peak reduction of more than 65%, between 1:00 PM and 7:00 PM, compared to code standard housing developments is the targeted goal of the project. Approximately 50 homes are already built and some are occupied. The energy performances of the homes have been monitored and are presented in this paper. Several peak electric load reduction strategies such as energy efficiency in buildings, roof integrated photovoltaics (PV) and direct load control have been applied. Though all the homes in the developed community are installed with 1.8 kW p PV systems, the orientation of the PV system depends on the building orientation. Focus of this paper is to find the impact of PV orientation on the peak load from a building. In addition, different time-of-use (TOU) energy pricing options are offered by the local electrical utility company. Hence it is important to find an optimal pricing option for each building. A computer model has been developed for one of the homes in the new development using building energy simulation code, ENERGY-10. Calculations on the PV orientations have shown that a south and 220° (i.e. 40° west of due south

  13. Electric-Field-Induced Superconductivity Detected by Magnetization Measurements of an Electric-Double-Layer Capacitor

    NARCIS (Netherlands)

    Kasahara, Yuichi; Nishijima, Takahiro; Sato, Tatsuya; Takeuchi, Yuki; Ye, Jianting; Yuan, Hongtao; Shimotani, Hidekazu; Iwasa, Yoshihiro

    We report evidence for superconductivity induced by the application of strong electric fields onto the surface of a band insulator, ZrNCl, provided by the observation of a shielding diamagnetic signal. We introduced an electric-double-layer capacitor configuration and in situ magnetization

  14. Estimate of China's energy carbon emissions peak and analysis on electric power carbon emissions

    Directory of Open Access Journals (Sweden)

    Zhi-Xuan Wang

    2014-12-01

    Full Text Available China's energy carbon emissions are projected to peak in 2030 with approximately 110% of its 2020 level under the following conditions: 1 China's gross primary energy consumption is 5 Gtce in 2020 and 6 Gtce in 2030; 2 coal's share of the energy consumption is 61% in 2020 and 55% in 2030; 3 non-fossil energy's share increases from 15% in 2020 to 20% in 2030; 4 through 2030, China's GDP grows at an average annual rate of 6%; 5 the annual energy consumption elasticity coefficient is 0.30 in average; and 6 the annual growth rate of energy consumption steadily reduces to within 1%. China's electricity generating capacity would be 1,990 GW, with 8,600 TW h of power generation output in 2020. Of that output 66% would be from coal, 5% from gas, and 29% from non-fossil energy. By 2030, electricity generating capacity would reach 3,170 GW with 11,900 TW h of power generation output. Of that output, 56% would be from coal, 6% from gas, and 37% from non-fossil energy. From 2020 to 2030, CO2 emissions from electric power would relatively fall by 0.2 Gt due to lower coal consumption, and relatively fall by nearly 0.3 Gt with the installation of more coal-fired cogeneration units. During 2020–2030, the portion of carbon emissions from electric power in China's energy consumption is projected to increase by 3.4 percentage points. Although the carbon emissions from electric power would keep increasing to 118% of the 2020 level in 2030, the electric power industry would continue to play a decisive role in achieving the goal of increase in non-fossil energy use. This study proposes countermeasures and recommendations to control carbon emissions peak, including energy system optimization, green-coal-fired electricity generation, and demand side management.

  15. A novel graphene nanoribbon FET with an extra peak electric field (EFP-GNRFET) for enhancing the electrical performances

    Energy Technology Data Exchange (ETDEWEB)

    Akbari Eshkalak, Maedeh [Young Researchers and Elite Club, Lahijan Branch, Islamic Azad University, Lahijan (Iran, Islamic Republic of); Anvarifard, Mohammad K., E-mail: m.anvarifard@guilan.ac.ir [Department of Engineering Sciences, Faculty of Technology and Engineering, East of Guilan, University of Guilan, Rudsar-Vajargah (Iran, Islamic Republic of)

    2017-04-25

    This work has provided an efficient technique to improve the electrical performance for the Graphene Nanoribbon Field Effect Transistors (GNRFETs) successfully. The physical gate length is divided into two gates named as the original gate and the other one as the virtual gate. We have applied a voltage source between these gates to control the channel of the GNRFETs. This technique has created an extra peak electric field in the middle of the channel resulting in the redistribution of surface potential profile. The proposed structure named as EFP-GNRFET has been compared with a simple GNRFET and has shown many improvements in terms of the critical parameters such as short channel effects, leakage current, subthreshold swing, ON-state to OFF-state current ratio, transconductance, output conductance and voltage gain. The structures under the study in this paper benefits from the Non-Equilibrium Green Function (NEGF) approach for solving Schrödinger equation coupled with the two-dimensional (2D) Poisson equation in a self-consistent manner. - Highlights: • Proposal of a novel graphene nanoribbon FET. • Creation of an extra peak in electric field. • Modification of the channel potential with the help of virtual gate. • Considerable improvement on electrical performances.

  16. Double anisotropic electrically conductive flexible Janus-typed membranes.

    Science.gov (United States)

    Li, Xiaobing; Ma, Qianli; Tian, Jiao; Xi, Xue; Li, Dan; Dong, Xiangting; Yu, Wensheng; Wang, Xinlu; Wang, Jinxian; Liu, Guixia

    2017-12-07

    Novel type III anisotropic conductive films (ACFs), namely flexible Janus-typed membranes, were proposed, designed and fabricated for the first time. Flexible Janus-typed membranes composed of ordered Janus nanobelts were constructed by electrospinning, which simultaneously possess fluorescence and double electrically conductive anisotropy. For the fabrication of the Janus-typed membrane, Janus nanobelts comprising a conductive side and an insulative-fluorescent side were primarily fabricated, and then the Janus nanobelts are arranged into parallel arrays using an aluminum rotary drum as the collector to obtain a single anisotropically conductive film. Subsequently, a secondary electrospinning process was applied to the as-prepared single anisotropically conductive films to acquire the final Janus-typed membrane. For this Janus-typed membrane, namely its left-to-right structure, anisotropic electrical conduction synchronously exists on both sides, and furthermore, the two electrically conductive directions are perpendicular. By modulating the amount of Eu(BA) 3 phen complex and conducting polyaniline (PANI), the characteristics and intensity of the fluorescence-electricity dual-function in the membrane can be tuned. The high integration of this peculiar Janus-typed membrane with simultaneous double electrically conductive anisotropy-fluorescent dual-functionality is successfully realized in this study. This design philosophy and preparative technique will provide support for the design and construction of new types of special nanostructures with multi-functionality.

  17. An exploratory analysis of California residential customer response to critical peak pricing of electricity

    International Nuclear Information System (INIS)

    Herter, Karen; McAuliffe, Patrick; Rosenfeld, Arthur

    2007-01-01

    This paper summarizes the results from an exploratory analysis of residential customer response to a critical peak pricing (CPP) experiment in California, in which 15 times per year participating customers received high price signals dispatched by a local electricity distribution company. The high prices were about three times the on-peak price for the otherwise applicable time-of-use rate. Using hourly load data collected during the 15-month experiment, we find statistically significant load reduction for participants both with and without automated end-use control technologies. During 5-h critical peak periods, participants without control technology used up to 13% less energy than they did during normal peak periods. Participants equipped with programmable communicating thermostats used 25% and 41% less for 5 and 2h critical events, respectively. Thus, this paper offers convincing evidence that the residential sector can provide substantial contributions to retail demand response, which is considered a potential tool for mitigating market power, stabilizing wholesale market prices, managing system reliability, and maintaining system resource adequacy. (author)

  18. Electric-field-induced superconductivity detected by magnetization measurements of an electric-double-layer capacitor

    International Nuclear Information System (INIS)

    Kasahara, Yuichi; Takeuchi, Yuki; Ye, Jianting; Yuan, Hongtao; Shimotani, Hidekazu; Iwasa, Yoshihiro; Nishimura, Takahiro; Sato, Tatsuya

    2010-01-01

    We report evidence for superconductivity induced by the application of strong electric fields onto the surface of a band insulator, ZrNCl, provided by the observation of a shielding diamagnetic signal. We introduced an electric-double-layer capacitor configuration and in situ magnetization measurements at low temperatures as a method to detect the novel electric-field-induced superconducting state. The results showed excellent agreement with a previous report using a transistor configuration, demonstrating that the present technique is a novel method for investigating the nonequilibrium phase induced by electric fields. (author)

  19. A model of market power in electricity industries subject to peak load pricing

    International Nuclear Information System (INIS)

    Arellano, Maria-Soledad; Serra, Pablo

    2007-01-01

    This paper studies the exercise of market power in price-regulated electricity industries under peak-load pricing and merit order dispatching, but where investment decisions are taken by independent generating companies. Within this context, we show that producers can exercise market power by under-investing in base-load capacity, compared to the welfare-maximizing configuration. We also show that when there is free entry with an exogenous fixed entry cost that is later sunk, more intense competition results in higher welfare but fewer firms. (author)

  20. Observation, modeling, and temperature dependence of doubly peaked electric fields in irradiated silicon pixel sensors

    CERN Document Server

    Swartz, M.; Allkofer, Y.; Bortoletto, D.; Cremaldi, L.; Cucciarelli, S.; Dorokhov, A.; Hoermann, C.; Kim, D.; Konecki, M.; Kotlinski, D.; Prokofiev, Kirill; Regenfus, Christian; Rohe, T.; Sanders, D.A.; Son, S.; Speer, T.

    2006-01-01

    We show that doubly peaked electric fields are necessary to describe grazing-angle charge collection measurements of irradiated silicon pixel sensors. A model of irradiated silicon based upon two defect levels with opposite charge states and the trapping of charge carriers can be tuned to produce a good description of the measured charge collection profiles in the fluence range from 0.5x10^{14} Neq/cm^2 to 5.9x10^{14} Neq/cm^2. The model correctly predicts the variation in the profiles as the temperature is changed from -10C to -25C. The measured charge collection profiles are inconsistent with the linearly-varying electric fields predicted by the usual description based upon a uniform effective doping density. This observation calls into question the practice of using effective doping densities to characterize irradiated silicon.

  1. Performance test of Spectran-F and Spectran-III computer programs for resolving the 137Cs-110Ag double peak in gamma-ray spectrometric analysis

    International Nuclear Information System (INIS)

    Terada, H.; Malinowski, J.; Blick, H.

    1981-09-01

    The performance of the computer programs (Spectran F and Spectran-III) in resolving the 137 Cs-sup(110m)Ag double peak at 661.6-657.7 keV in the gamma-ray spectrum was investigated. In the experiments, the intensity ratios of both lines in the double peak were varied from 0.1 to 60. The results obtained show, that both programs have almost the same performance in resolving the double peak investigated, with slight superiority of Spectran-F. If accuracy better than 5% is desired, the peak intensity ratio in the dublet must be kept below 10. (orig.)

  2. Residential demand response reduces air pollutant emissions on peak electricity demand days in New York City

    International Nuclear Information System (INIS)

    Gilbraith, Nathaniel; Powers, Susan E.

    2013-01-01

    Many urban areas in the United States have experienced difficulty meeting the National Ambient Air Quality Standards (NAAQS), partially due to pollution from electricity generating units. We evaluated the potential for residential demand response to reduce pollutant emissions on days with above average pollutant emissions and a high potential for poor air quality. The study focused on New York City (NYC) due to non-attainment with NAAQS standards, large exposed populations, and the existing goal of reducing pollutant emissions. The baseline demand response scenario simulated a 1.8% average reduction in NYC peak demand on 49 days throughout the summer. Nitrogen oxide and particulate matter less than 2.5 μm in diameter emission reductions were predicted to occur (−70, −1.1 metric tons (MT) annually), although, these were not likely to be sufficient for NYC to meet the NAAQS. Air pollution mediated damages were predicted to decrease by $100,000–$300,000 annually. A sensitivity analysis predicted that substantially larger pollutant emission reductions would occur if electricity demand was shifted from daytime hours to nighttime hours, or the total consumption decreased. Policies which incentivize shifting electricity consumption away from periods of high human and environmental impacts should be implemented, including policies directed toward residential consumers. - Highlights: • The impact of residential demand response on air emissions was modeled. • Residential demand response will decrease pollutant emissions in NYC. • Emissions reductions occur during periods with high potential for poor air quality. • Shifting demand to nighttime hours was more beneficial than to off-peak daytime hours

  3. Simulating double-peak hydrographs from single storms over mixed-use watersheds

    Science.gov (United States)

    Yang Yang; Theodore A. Endreny; David J. Nowak

    2015-01-01

    Two-peak hydrographs after a single rain event are observed in watersheds and storms with distinct volumes contributing as fast and slow runoff. The authors developed a hydrograph model able to quantify these separate runoff volumes to help in estimation of runoff processes and residence times used by watershed managers. The model uses parallel application of two...

  4. Elevated-constant pH control assessment at TXU's Comanche peak steam electric station

    International Nuclear Information System (INIS)

    Fellers, B.; Perkins, D.; Bosma, J.; Deshon, J.

    2002-01-01

    Industry experience with axial offset anomaly (AOA) has raised the importance of crud management strategies. Elevated-constant pH control is recognized as one potential solution. Additionally, minimizing radiation fields remains a high industry goal which is supported by this strategy. An investigation of industry experience and experimental data has supported a strategy of constant at-temperature pH of 7.4, requiring as much as 6-ppm lithium at the beginning-of-cycle (BOC). This approach, in a modern high temperature plant with high boron requirements, necessitated a careful assessment of potential risk for increased susceptibility to corrosion for both fuel cladding and RCS structural materials. This paper presents results of the assessment for Comanche peak steam electric station (CPSES) and plans for a demonstration of this practice. (author)

  5. Assessment of high temperature nuclear energy storage systems for the production of intermediate and peak-load electric power

    International Nuclear Information System (INIS)

    Fox, E.C.; Fuller, L.C.; Silverman, M.D.

    1977-01-01

    Increased cost of energy, depletion of domestic supplies of oil and natural gas, and dependence on foreign suppliers, have led to an investigation of energy storage as a means to displace the use of oil and gas presently being used to generate intermediate and peak-load electricity. Dedicated nuclear thermal energy storage is investigated as a possible alternative. An evaluation of thermal storage systems is made for several reactor concepts and economic comparisons are presented with conventional storage and peak power producing systems. It is concluded that dedicated nuclear storage has a small but possible useful role in providing intermediate and peak-load electric power

  6. Electroresistance Effect in Gold Thin Film Induced by Ionic-Liquid-Gated Electric Double Layer

    NARCIS (Netherlands)

    Nakayama, Hiroyasu; Ye, Jianting; Ohtani, Takashi; Fujikawa, Yasunori; Ando, Kazuya; Iwasa, Yoshihiro; Saitoh, Eiji

    Electroresistance effect was detected in a metallic thin film using ionic-liquid-gated electric-double-layer transistors (EDLTs). We observed reversible modulation of the electric resistance of a Au thin film. In this system, we found that an electric double layer works as a nanogap capacitor with

  7. Postabsorption concentration peaks with brand-name and generic verapamil: a double-blind, crossover study in elderly hypertensive patients.

    Science.gov (United States)

    Saseen, J J; Porter, J A; Barnette, D J; Bauman, J L; Zajac, E J; Carter, B L

    1997-06-01

    The pharmacokinetic actions, bioequivalence, and cardiovascular effects of two verapamil products were studied in a randomized, double-blind, crossover study in eight elderly hypertensive patients (median age, 69.5 years; range, 60-79 years) given brand-name or generic immediate-release verapamil in 120-mg twice-daily doses for 14 days. Blood pressures, heart rates, P-R intervals; and serum concentrations of R-/S-verapamil and norverapamil were measured multiple times in patients during the last day of each therapy. Median blood pressure decreased more with generic verapamil than with the brand-name drug, with the largest difference occurring at 0.5 hours (137/74 mmHg versus 144.5/80.5 mmHg; P = 0.05 and 0.091, respectively). Pharmacokinetic parameters were not different for the two products (P generic product, compared with the brand-name drug, had mean area under the concentration-time curve (time 0 to 12 hours) ratios (90% CI) of 1.09 (0.78-1.52), 1.16 (0.87-1.55) and 1.11 (0.81-1.52) for R-, S-, and total verapamil. Seventy concentration peaks (31 with the brand-name drug, 39 with the generic drug) appeared between 8 and 24 hours. Median percentages of increase of these peaks, compared with those of previous concentrations, were 48.3% and 36.3% for brand-name and generic drugs, respectively. Fifty of the 70 peaks (71%) were associated with a stereospecific concentration peak of norverapamil and, temporally, with meals. Our findings suggest that whereas the two verapamil products may not be bioequivalent by Food and Drug Administration criteria, the observed differences in effects were not clinically significant in this elderly population. Multiple concentration peaks after absorption were observed in all patients with both verapamil products and were perhaps related to enterohepatic recirculation.

  8. High Electricity Demand in the Northeast U.S.: PJM Reliability Network and Peaking Unit Impacts on Air Quality.

    Science.gov (United States)

    Farkas, Caroline M; Moeller, Michael D; Felder, Frank A; Henderson, Barron H; Carlton, Annmarie G

    2016-08-02

    On high electricity demand days, when air quality is often poor, regional transmission organizations (RTOs), such as PJM Interconnection, ensure reliability of the grid by employing peak-use electric generating units (EGUs). These "peaking units" are exempt from some federal and state air quality rules. We identify RTO assignment and peaking unit classification for EGUs in the Eastern U.S. and estimate air quality for four emission scenarios with the Community Multiscale Air Quality (CMAQ) model during the July 2006 heat wave. Further, we population-weight ambient values as a surrogate for potential population exposure. Emissions from electricity reliability networks negatively impact air quality in their own region and in neighboring geographic areas. Monitored and controlled PJM peaking units are generally located in economically depressed areas and can contribute up to 87% of hourly maximum PM2.5 mass locally. Potential population exposure to peaking unit PM2.5 mass is highest in the model domain's most populated cities. Average daily temperature and national gross domestic product steer peaking unit heat input. Air quality planning that capitalizes on a priori knowledge of local electricity demand and economics may provide a more holistic approach to protect human health within the context of growing energy needs in a changing world.

  9. The effect of utility time-varying pricing and load control strategies on residential summer peak electricity use. A review

    International Nuclear Information System (INIS)

    Newsham, Guy R.; Bowker, Brent G.

    2010-01-01

    Peak demand for electricity in North America is expected to grow, challenging electrical utilities to supply this demand in a cost-effective, reliable manner. Therefore, there is growing interest in strategies to reduce peak demand by eliminating electricity use, or shifting it to non-peak times. This strategy is commonly called 'demand response'. In households, common strategies are time-varying pricing, which charge more for energy use on peak, or direct load control, which allows utilities to curtail certain loads during high demand periods. We reviewed recent North American studies of these strategies. The data suggest that the most effective strategy is a critical peak price (CPP) program with enabling technology to automatically curtail loads on event days. There is little evidence that this causes substantial hardship for occupants, particularly if they have input into which loads are controlled and how, and have an override option. In such cases, a peak load reduction of at least 30% is a reasonable expectation. It might be possible to attain such load reductions without enabling technology by focusing on household types more likely to respond, and providing them with excellent support. A simple time-of-use (TOU) program can only expect to realise on-peak reductions of 5%. (author)

  10. Modeling Electric Double-Layers Including Chemical Reaction Effects

    DEFF Research Database (Denmark)

    Paz-Garcia, Juan Manuel; Johannesson, Björn; Ottosen, Lisbeth M.

    2014-01-01

    A physicochemical and numerical model for the transient formation of an electric double-layer between an electrolyte and a chemically-active flat surface is presented, based on a finite elements integration of the nonlinear Nernst-Planck-Poisson model including chemical reactions. The model works...... for symmetric and asymmetric multi-species electrolytes and is not limited to a range of surface potentials. Numerical simulations are presented, for the case of a CaCO3 electrolyte solution in contact with a surface with rate-controlled protonation/deprotonation reactions. The surface charge and potential...... are determined by the surface reactions, and therefore they depends on the bulk solution composition and concentration...

  11. Studies on electrical double layer capacitor with a low-viscosity ionic ...

    Indian Academy of Sciences (India)

    The performance of an electrical double layer capacitor (EDLC) composed of high surface area acti- vated carbon ... Since the electric energy stored in EDLCs are raised by the ..... capacitance value, observed by us with the present system, is.

  12. Lessons learned while implementing a safety parameter display system at the Comanche Peak steam electric station

    International Nuclear Information System (INIS)

    Hagar, B.

    1987-01-01

    With the completion of site Verification and Validation tests, the Safety Parameter Display System (SPDS) will be fully operational at the Comanche Peak Steam Electric Station. Implementation of the SPDS, which began in 1982, included: modifying generic Safety Assessment System Software; developing site-specific displays and features; installing and integrating system equipment into the plant; modifying station heating, ventilation, and air conditioning systems to provide necessary cooling; installing an additional uninterruptible power supply system to provide necessary power; and training station personnel in the operation and use of the system. Lessons learned during this project can be discussed in terms of an ideal SPDS implementation project. Such a project would design and implement an SPDS for a plant that is already under construction or operating, and would progress through a sequence of activities that includes: (1) developing and documenting the system design bases, and including all major design influences; (2) developing a database description and system functional specifications to clarify specific system requirements; (3) developing detailed system hardware and software design specifications to fully describe the system, and to enable identification of necessary site design changes early in the project; (4) implementing the system design; (5) configuring and extensively testing the system prior to routine system operation; and (6) tuning the system after the completion of system installation. The ideal project would include future system users in design development and system testing, and would use Verification and Validation techniques throughout the project to ensure that each sequential step is appropriate and correct

  13. Base-Load and Peak Electricity from a Combined Nuclear Heat and Fossil Combined-Cycle Plant

    International Nuclear Information System (INIS)

    Conklin, Jim; Forsberg, Charles W.

    2007-01-01

    A combined-cycle power plant is proposed that uses heat from a high-temperature reactor and fossil fuel to meet base-load and peak electrical demands. The high-temperature gas turbine produces shaft power to turn an electric generator. The hot exhaust is then fed to a heat recovery steam generator (HRSG) that provides steam to a steam turbine for added electrical power production. A simplified computational model of the thermal power conversion system was developed in order to parametrically investigate two different steady-state operation conditions: base load nuclear heat only from an Advanced High Temperature Reactor (AHTR), and combined nuclear heat with fossil heat to increase the turbine inlet temperature. These two cases bracket the expected range of power levels, where any intermediate power level can result during electrical load following. The computed results indicate that combined nuclear-fossil systems have the potential to offer both low-cost base-load electricity and lower-cost peak power relative to the existing combination of base-load nuclear plants and separate fossil-fired peak-electricity production units. In addition, electric grid stability, reduced greenhouse gases, and operational flexibility can also result with using the conventional technology presented here for the thermal power conversion system coupled with the AHTR

  14. A fuzzy-stochastic simulation-optimization model for planning electric power systems with considering peak-electricity demand: A case study of Qingdao, China

    International Nuclear Information System (INIS)

    Yu, L.; Li, Y.P.; Huang, G.H.

    2016-01-01

    In this study, a FSSOM (fuzzy-stochastic simulation-optimization model) is developed for planning EPS (electric power systems) with considering peak demand under uncertainty. FSSOM integrates techniques of SVR (support vector regression), Monte Carlo simulation, and FICMP (fractile interval chance-constrained mixed-integer programming). In FSSOM, uncertainties expressed as fuzzy boundary intervals and random variables can be effectively tackled. In addition, SVR coupled Monte Carlo technique is used for predicting the peak-electricity demand. The FSSOM is applied to planning EPS for the City of Qingdao, China. Solutions of electricity generation pattern to satisfy the city's peak demand under different probability levels and p-necessity levels have been generated. Results reveal that the city's electricity supply from renewable energies would be low (only occupying 8.3% of the total electricity generation). Compared with the energy model without considering peak demand, the FSSOM can better guarantee the city's power supply and thus reduce the system failure risk. The findings can help decision makers not only adjust the existing electricity generation/supply pattern but also coordinate the conflict interaction among system cost, energy supply security, pollutant mitigation, as well as constraint-violation risk. - Highlights: • FSSOM (Fuzzy-stochastic simulation-optimization model) is developed for planning EPS. • It can address uncertainties as fuzzy-boundary intervals and random variables. • FSSOM can satisfy peak-electricity demand and optimize power allocation. • Solutions under different probability levels and p-necessity levels are analyzed. • Results create tradeoff among system cost and peak-electricity demand violation risk.

  15. Hydrogen or Fossil Combustion Nuclear Combined Cycle Systems for Baseload and Peak Load Electricity Production. Annex X

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2013-12-15

    A combined cycle power plant is described that uses: (i) heat from a high temperature nuclear reactor to meet baseload electrical demands; and (ii) heat from the same high temperature reactor and burning natural gas, jet fuel or hydrogen to meet peak load electrical demands. For baseload electricity production, fresh air is compressed, then flows through a heat exchanger, where it is heated to between 700 and 900{sup o}C by using heat provided by a high temperature nuclear reactor via an intermediate heat transport loop, and finally exits through a high temperature gas turbine to produce electricity. The hot exhaust from the Brayton cycle gas turbine is then fed to a heat recovery steam generator that provides steam to a steam turbine for added electrical power production. To meet peak electricity demand, the air is first compressed and then heated with the heat from a high temperature reactor. Natural gas, jet fuel or hydrogen is then injected into the hot air in a combustion chamber, combusts and heats the air to 1300{sup o}C - the operating conditions for a standard natural gas fired combined cycle plant. The hot gas then flows through a gas turbine and a heat recovery steam generator before being sent to the exhaust stack. The higher temperatures increase the plant efficiency and power output. If hydrogen is used, it can be produced at night using energy from the nuclear reactor and stored until required. With hydrogen serving as the auxiliary fuel for peak power production, the electricity output to the electrical grid can vary from zero (i.e. when hydrogen is being produced) to the maximum peak power while the nuclear reactor operates at constant load. As nuclear heat raises air temperatures above the auto-ignition temperatures of the various fuels and powers the air compressor, the power output can be varied rapidly (compared with the capabilities of fossil fired turbines) to meet spinning reserve requirements and stabilize the electrical grid. This combined

  16. Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines.

    Science.gov (United States)

    Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G

    2017-07-19

    Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

  17. The electric double layer put to work : thermal physics at electrochemical interfaces

    NARCIS (Netherlands)

    Janssen, M.A.

    2017-01-01

    Where charged electrode surfaces meet fluids that contain mobile ions, so-called electric double layers (EDLs) form to screen the electric surface charge by a diffuse cloud of counterionic charge in the fluid phase. This double layer has been studied for over a century and is of paramount importance

  18. Optical and Electrical Characteristics of Graphene Double Layer Formed by a Double Transfer of Graphene Single Layers.

    Science.gov (United States)

    Kim, Young Jun; Bae, Gi Yoon; Chun, Sungwoo; Park, Wanjun

    2016-03-01

    We demonstrate formation of double layer graphene by means of a double transfer using two single graphene layers grown by a chemical vapor deposition method. It is observed that shiftiness and broadness in the double-resonance of Raman scattering are much weaker than those of bilayer graphene formed naturally. Transport characteristics examined from transmission line measurements and field effect transistors show the similar behavior with those of single layer graphene. It indicates that interlayer separation, in electrical view, is large enough to avoid correlation between layers for the double layer structure. It is also observed from a transistor with the double layer graphene that molecules adsorpted on two inner graphene surfaces in the double layered structure are isolated and conserved from ambient environment.

  19. Electric Car Users’ Time of Charging Problem under Peak Load Pricing When Delay in Charging Time Involves Uncertain Cost

    DEFF Research Database (Denmark)

    Fetene, Gebeyehu Manie

    The problem of peak load arises when demand fluctuates over time while the pro- duction technology is not flexible (or making it flexible is economically inefficient) and/or when a product is non-storable (or storage cost is huge). Peak load is a com- mon problem in consumption of public utilities......, on the one hand, observed cost saving benefit of postponing the time of charging to off-peak lower fee of charging and, on the other hand, the cost of delay in departure time for planned trips and uncertain cost of late charging associated with likelihood occur- rence of unanticipated trip before the car...... of electricity. The electric vehicle (EV) users choice of time of charging problem under PLP is different from that of general households using energy for house appliances since there is uncertain cost to the former as- sociated with likelihood occurrence of unanticipated trips such as visiting hospital...

  20. Modelling of electric characteristics of 150-watt peak solar panel using Boltzmann sigmoid function under various temperature and irradiance

    Science.gov (United States)

    Sapteka, A. A. N. G.; Narottama, A. A. N. M.; Winarta, A.; Amerta Yasa, K.; Priambodo, P. S.; Putra, N.

    2018-01-01

    Solar energy utilized with solar panel is a renewable energy that needs to be studied further. The site nearest to the equator, it is not surprising, receives the highest solar energy. In this paper, a modelling of electrical characteristics of 150-Watt peak solar panels using Boltzmann sigmoid function under various temperature and irradiance is reported. Current, voltage, temperature and irradiance data in Denpasar, a city located at just south of equator, was collected. Solar power meter is used to measure irradiance level, meanwhile digital thermometer is used to measure temperature of front and back panels. Short circuit current and open circuit voltage data was also collected at different temperature and irradiance level. Statistically, the electrical characteristics of 150-Watt peak solar panel can be modelled using Boltzmann sigmoid function with good fit. Therefore, it can be concluded that Boltzmann sigmoid function might be used to determine current and voltage characteristics of 150-Watt peak solar panel under various temperature and irradiance.

  1. Exceptionally High Electric Double Layer Capacitances of Oligomeric Ionic Liquids.

    Science.gov (United States)

    Matsumoto, Michio; Shimizu, Sunao; Sotoike, Rina; Watanabe, Masayoshi; Iwasa, Yoshihiro; Itoh, Yoshimitsu; Aida, Takuzo

    2017-11-15

    Electric double layer (EDL) capacitors are promising as next-generation energy accumulators if their capacitances and operation voltages are both high. However, only few electrolytes can simultaneously fulfill these two requisites. Here we report that an oligomeric ionic liquid such as IL4 TFSI with four imidazolium ion units in its structure provides a wide electrochemical window of ∼5.0 V, similar to monomeric ionic liquids. Furthermore, electrochemical impedance measurements using Au working electrodes demonstrated that IL4 TFSI exhibits an exceptionally high EDL capacitance of ∼66 μF/cm 2 , which is ∼6 times as high as those of monomeric ionic liquids so far reported. We also found that an EDL-based field effect transistor (FET) using IL4 TFSI as a gate dielectric material and SrTiO 3 as a channel material displays a very sharp transfer curve with an enhanced carrier accumulation capability of ∼64 μF/cm 2 , as determined by Hall-effect measurements.

  2. Atomistic Molecular Dynamics Simulations of the Electrical Double

    Science.gov (United States)

    Li, Zifeng; Milner, Scott; Fichthorn, Kristen

    2015-03-01

    The electrical double layer (EDL) near the polymer/water interface plays a key role in the colloidal stability of latex paint. To elucidate the structure of the EDL at the molecular level, we conducted an all-atom molecular dynamics simulations. We studied two representative surface charge groups in latex, the ionic surfactant sodium dodecyl sulfate (SDS) and the grafted short polyelectrolyte charged by dissociated methyl methacrylic acid (MAA) monomers. Our results confirm that the Poisson-Boltzmann theory works well outside the Stern layer. Our calculated electrostatic potential at the Outer Helmholtz Plane (OHP) is close to the zeta potential measured experimentally, which suggests that the potential at the OHP is a good estimate of the zeta potential. We found that the position of the OHP for the MAA polyelectrolyte system extends much further into the aqueous phase than that in the SDS system, resulting in a Stern layer that is twice as thick. This model will allow for future investigations of the interactions of the surface with different surfactants and rheology modifiers, which may serve as a guide to tune the rheology of latex formulations. We thank Dow Chemical Company for financial support.

  3. Security of supply, energy spillage control and peaking options within a 100% renewable electricity system for New Zealand

    International Nuclear Information System (INIS)

    Mason, I.G.; Page, S.C.; Williamson, A.G.

    2013-01-01

    In this paper, issues of security of supply, energy spillage control, and peaking options, within a fully renewable electricity system, are addressed. We show that a generation mix comprising 49% hydro, 23% wind, 13% geothermal, 14% pumped hydro energy storage peaking plant, and 1% biomass-fuelled generation on an installed capacity basis, was capable of ensuring security of supply over an historic 6-year period, which included the driest hydrological year on record in New Zealand since 1931. Hydro spillage was minimised, or eliminated, by curtailing a proportion of geothermal generation. Wind spillage was substantially reduced by utilising surplus generation for peaking purposes, resulting in up to 99.8% utilisation of wind energy. Peaking requirements were satisfied using 1550 MW of pumped hydro energy storage generation, with a capacity factor of 0.76% and an upper reservoir storage equivalent to 8% of existing hydro storage capacity. It is proposed that alternative peaking options, including biomass-fuelled gas turbines and demand-side measures, should be considered. As a transitional policy, the use of fossil-gas–fuelled gas turbines for peaking would result in a 99.8% renewable system on an energy basis. Further research into whether a market-based system is capable of delivering such a renewable electricity system is suggested. - Highlights: • A 100% renewable electricity system was modelled over a 6-year period. • Security of supply was demonstrated, including for the driest year since 1931. • Stored energy spillage was controlled by using flexible base-load generation. • Wind energy utilisation of 99.8% was obtained. • Transitional use of fossil gas for peaking resulted in a 99.8% renewable system

  4. Peak power reduction and energy efficiency improvement with the superconducting flywheel energy storage in electric railway system

    Science.gov (United States)

    Lee, Hansang; Jung, Seungmin; Cho, Yoonsung; Yoon, Donghee; Jang, Gilsoo

    2013-11-01

    This paper proposes an application of the 100 kWh superconducting flywheel energy storage systems to reduce the peak power of the electric railway system. The electric railway systems have high-power characteristics and large amount of regenerative energy during vehicles’ braking. The high-power characteristic makes operating cost high as the system should guarantee the secure capacity of electrical equipment and the low utilization rate of regenerative energy limits the significant energy efficiency improvement. In this paper, it had been proved that the peak power reduction and energy efficiency improvement can be achieved by using 100 kWh superconducting flywheel energy storage systems with the optimally controlled charging or discharging operations. Also, economic benefits had been assessed.

  5. Electric potential calculation in molecular simulation of electric double layer capacitors

    International Nuclear Information System (INIS)

    Wang, Zhenxing; Laird, Brian B; Olmsted, David L; Asta, Mark

    2016-01-01

    For the molecular simulation of electric double layer capacitors (EDLCs), a number of methods have been proposed and implemented to determine the one-dimensional electric potential profile between the two electrodes at a fixed potential difference. In this work, we compare several of these methods for a model LiClO 4 -acetonitrile/graphite EDLC simulated using both the traditional fixed-charged method (FCM), in which a fixed charge is assigned a priori to the electrode atoms, or the recently developed constant potential method (CPM) (2007 J. Chem. Phys . 126 084704), where the electrode charges are allowed to fluctuate to keep the potential fixed. Based on an analysis of the full three-dimensional electric potential field, we suggest a method for determining the averaged one-dimensional electric potential profile that can be applied to both the FCM and CPM simulations. Compared to traditional methods based on numerically solving the one-dimensional Poisson’s equation, this method yields better accuracy and no supplemental assumptions. (paper)

  6. Searching for Dual AGNs in Galaxy Mergers: Understanding Double-Peaked [O III] and Ultra Hard X-rays as Selection Method

    Science.gov (United States)

    McGurk, Rosalie C.; Max, Claire E.; Medling, Anne; Shields, Gregory A.

    2015-01-01

    When galaxies merge, gas accretes onto both central supermassive black holes. Thus, one expects to see close pairs of active galactic nuclei (AGNs), or dual AGNs, in a fraction of galaxy mergers. However, finding them remains a challenge. The presence of double-peaked [O III] or of ultra hard X-rays have been proposed as techniques to select dual AGNs efficiently. We studied a sample of double-peaked narrow [O III] emitting AGNs from SDSS DR7. By obtaining new and archival high spatial resolution images taken with the Keck 2 Laser Guide Star Adaptive Optics system and the near-infrared (IR) camera NIRC2, we showed that 30% of double-peaked [O III] emission line SDSS AGNs have two spatial components within a 3' radius. However, spatially resolved spectroscopy or X-ray observations are needed to confirm these galaxy pairs as systems containing two AGNs. We followed up these spatially-double candidate dual AGNs with integral field spectroscopy from Keck OSIRIS and Gemini GMOS and with long-slit spectroscopy from Keck NIRSPEC and Shane Kast Double Spectrograph. We find double-peaked emitters are caused sometimes by dual AGN and sometimes by outflows or narrow line kinematics. We also performed Chandra X-ray ACIS-S observations on 12 double-peaked candidate dual AGNs. Using our observations and 8 archival observations, we compare the distribution of X-ray photons to our spatially double near-IR images, measure X-ray luminosities and hardness ratios, and estimate column densities. By assessing what fraction of double-peaked emission line SDSS AGNs are true dual AGNs, we can better determine whether double-peaked [O III] is an efficient dual AGN indicator and constrain the statistics of dual AGNs. A second technique to find dual AGN is the detection of ultra hard X-rays by the Swift Burst Alert Telescope. We use CARMA observations to measure and map the CO(1-0) present in nearby ultra-hard X-ray Active Galactic Nuclei (AGNs) merging with either a quiescent companion

  7. A robust flexible-probabilistic programming method for planning municipal energy system with considering peak-electricity price and electric vehicle

    International Nuclear Information System (INIS)

    Yu, L.; Li, Y.P.; Huang, G.H.; An, C.J.

    2017-01-01

    Highlights: • A robust flexible probabilistic programming method is developed for planning MES. • Multiple uncertainties with various violations and satisfaction levels are examined. • Solutions of considering peak electricity prices and electric vehicles are analyzed. • RFPP-MES can better improve energy system reliability and abate pollutant emission. - Abstract: Effective electric power systems (EPS) planning with considering electricity price of 24-h time is indispensable in terms of load shifting, pollutant mitigation and energy demand-supply reliability as well as reducing electricity expense of end-users. In this study, a robust flexible probabilistic programming (RFPP) method is developed for planning municipal energy system (MES) with considering peak electricity prices (PEPs) and electric vehicles (EVs), where multiple uncertainties regarded as intervals, probability distributions and flexibilities as well as their combinations can be effectively reflected. The RFPP-MES model is then applied to planning Qingdao’s MES, where electrical load of 24-h time is simulated based on Monte Carlo. Results reveal that: (a) different time intervals lead to changes of energy supply patterns, the energy supply patterns would tend to the transition from self-supporting dominated (i.e. in valley hours) to outsourcing-dominated (i.e. in peak hours); (b) 15.9% of total imported electricity expense would be reduced compared to that without considering PEPs; (c) with considering EVs, the CO_2 emissions of Qingdao’s transportation could be reduced directly and the reduction rate would be 2.5%. Results can help decision makers improve energy supply patterns, reduce energy system costs and abate pollutant emissions as well as adjust end-users’ consumptions.

  8. Minimization of Impact from Electric Vehicle Supply Equipment to the Electric Grid Using a Dynamically Controlled Battery Bank for Peak Load Shaving

    Energy Technology Data Exchange (ETDEWEB)

    Castello, Charles C [ORNL

    2013-01-01

    This research presents a comparison of two control systems for peak load shaving using local solar power generation (i.e., photovoltaic array) and local energy storage (i.e., battery bank). The purpose is to minimize load demand of electric vehicle supply equipment (EVSE) on the electric grid. A static and dynamic control system is compared to decrease demand from EVSE. Static control of the battery bank is based on charging and discharging to the electric grid at fixed times. Dynamic control, with 15-minute resolution, forecasts EVSE load based on data analysis of collected data. In the proposed dynamic control system, the sigmoid function is used to shave peak loads while limiting scenarios that can quickly drain the battery bank. These control systems are applied to Oak Ridge National Laboratory s (ORNL) solar-assisted electric vehicle (EV) charging stations. This installation is composed of three independently grid-tied sub-systems: (1) 25 EVSE; (2) 47 kW photovoltaic (PV) array; and (3) 60 kWh battery bank. The dynamic control system achieved the greatest peak load shaving, up to 34% on a cloudy day and 38% on a sunny day. The static control system was not ideal; peak load shaving was 14.6% on a cloudy day and 12.7% on a sunny day. Simulations based on ORNL data shows solar-assisted EV charging stations combined with the proposed dynamic battery control system can negate up to 89% of EVSE load demand on sunny days.

  9. Relative permittivity in the electrical double layer from nonlinear optics

    Science.gov (United States)

    Boamah, Mavis D.; Ohno, Paul E.; Geiger, Franz M.; Eisenthal, Kenneth B.

    2018-06-01

    Second harmonic generation (SHG) spectroscopy has been applied to probe the fused silica/water interface at pH 7 and the uncharged 11 ¯ 02 sapphire/water interface at pH 5.2 in contact with aqueous solutions of NaCl, NaBr, NaI, KCl, RbCl, and CsCl as low as several 10 μM. For ionic strengths up to about 0.1 mM, the SHG responses were observed to increase, reversibly for all salts surveyed, when compared to the condition of zero salt added. Further increases in the salt concentration led to monotonic decreases in the SHG response. The SHG increases followed by decreases are found to be consistent with recent reports of phase interference and phase matching in nonlinear optics. By varying the relative permittivity employed in common mean field theories used to describe electrical double layers and by comparing our results to available literature data, we find that models recapitulating the experimental observations are the ones in which (1) the relative permittivity of the diffuse layer is that of bulk water, with other possible values as low as 30, (2) the surface charge density varies with salt concentration, and (3) the charge in the Stern layer or its thickness varies with salt concentration. We also note that the experimental data exhibit sensitivity depending on whether the salt concentration is increased from low to high values or decreased from high to low values, which, however, is not borne out in the fits, at least within the current uncertainties associated with the model point estimates.

  10. Double peak-induced distance error in short-time-Fourier-transform-Brillouin optical time domain reflectometers event detection and the recovery method.

    Science.gov (United States)

    Yu, Yifei; Luo, Linqing; Li, Bo; Guo, Linfeng; Yan, Jize; Soga, Kenichi

    2015-10-01

    The measured distance error caused by double peaks in the BOTDRs (Brillouin optical time domain reflectometers) system is a kind of Brillouin scattering spectrum (BSS) deformation, discussed and simulated for the first time in the paper, to the best of the authors' knowledge. Double peak, as a kind of Brillouin spectrum deformation, is important in the enhancement of spatial resolution, measurement accuracy, and crack detection. Due to the variances of the peak powers of the BSS along the fiber, the measured starting point of a step-shape frequency transition region is shifted and results in distance errors. Zero-padded short-time-Fourier-transform (STFT) can restore the transition-induced double peaks in the asymmetric and deformed BSS, thus offering more accurate and quicker measurements than the conventional Lorentz-fitting method. The recovering method based on the double-peak detection and corresponding BSS deformation can be applied to calculate the real starting point, which can improve the distance accuracy of the STFT-based BOTDR system.

  11. Peak reduction in decentralised electricity systems : Markets and prices for flexible planning

    NARCIS (Netherlands)

    Höning, N.F.

    2016-01-01

    In contemporary societies, industrial processes as well as domestic activities rely to a large degree on a well-functioning electricity system. This reliance exists both structurally (the system should always be available) and economically (the prices for electricity affect the costs of operating a

  12. Peak power reduction and energy efficiency improvement with the superconducting flywheel energy storage in electric railway system

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Hansang, E-mail: hslee80@kiu.ac.kr [School of Railway and Electrical Engineering, Kyungil University, Hayang-eup, Gyeongsan-si, Gyeongsangbuk-do 712-701 (Korea, Republic of); Jung, Seungmin [School of Electrical Engineering, Korea University, Anam-dong, Seongbuk-gu, Seoul 136-712 (Korea, Republic of); Cho, Yoonsung [Department of Electric and Energy Engineering, Catholic University of Daegu, Hayang-eup, Gyeongsan-si, Gyeongsangbuk-do 712-702 (Korea, Republic of); Yoon, Donghee [Department of New and Renewable Energy, Kyungil University, Hayang-eup, Gyeongsangbuk-do 712-701 (Korea, Republic of); Jang, Gilsoo, E-mail: gjang@korea.ac.kr [School of Electrical Engineering, Korea University, Anam-dong, Seongbuk-gu, Seoul 136-712 (Korea, Republic of)

    2013-11-15

    Highlights: •It is important to develop power and energy management system to save operating cost. •An 100 kWh of SFES is effective to decrease peak power and energy consumption. •Operation cost saving can be achieved using superconducting flywheel energy storage. -- Abstract: This paper proposes an application of the 100 kWh superconducting flywheel energy storage systems to reduce the peak power of the electric railway system. The electric railway systems have high-power characteristics and large amount of regenerative energy during vehicles’ braking. The high-power characteristic makes operating cost high as the system should guarantee the secure capacity of electrical equipment and the low utilization rate of regenerative energy limits the significant energy efficiency improvement. In this paper, it had been proved that the peak power reduction and energy efficiency improvement can be achieved by using 100 kWh superconducting flywheel energy storage systems with the optimally controlled charging or discharging operations. Also, economic benefits had been assessed.

  13. Peak power reduction and energy efficiency improvement with the superconducting flywheel energy storage in electric railway system

    International Nuclear Information System (INIS)

    Lee, Hansang; Jung, Seungmin; Cho, Yoonsung; Yoon, Donghee; Jang, Gilsoo

    2013-01-01

    Highlights: •It is important to develop power and energy management system to save operating cost. •An 100 kWh of SFES is effective to decrease peak power and energy consumption. •Operation cost saving can be achieved using superconducting flywheel energy storage. -- Abstract: This paper proposes an application of the 100 kWh superconducting flywheel energy storage systems to reduce the peak power of the electric railway system. The electric railway systems have high-power characteristics and large amount of regenerative energy during vehicles’ braking. The high-power characteristic makes operating cost high as the system should guarantee the secure capacity of electrical equipment and the low utilization rate of regenerative energy limits the significant energy efficiency improvement. In this paper, it had been proved that the peak power reduction and energy efficiency improvement can be achieved by using 100 kWh superconducting flywheel energy storage systems with the optimally controlled charging or discharging operations. Also, economic benefits had been assessed

  14. Reducing electricity consumption peaks with parametrised dynamic pricing strategies given maximal unit prices

    NARCIS (Netherlands)

    N.F. Höning (Nicolas); J.A. La Poutré (Han); F. Lopes; Z. Vale; J. Sousa; H. Coelho

    2013-01-01

    htmlabstractDemand response is a crucial mechanism for flattening of peak loads. For its implementation, we not only require consumers who react to price changes, but also intelligent strategies to select prices. We propose a parametrised meta-strategy for dynamic pricing and identify suitable

  15. Electroresistance effect in gold thin film induced by ionic-liquid-gated electric double layer

    International Nuclear Information System (INIS)

    Nakayama, Hiroyasu; Ohtani, Takashi; Fujikawa, Yasunori; Ando, Kazuya; Saitoh, Eiji; Ye, Jianting; Iwasa, Yoshihiro

    2012-01-01

    Electroresistance effect was detected in a metallic thin film using ionic-liquid-gated electric-double-layer transistors (EDLTs). We observed reversible modulation of the electric resistance of a Au thin film. In this system, we found that an electric double layer works as a nanogap capacitor with 27 (-25) MV cm -1 of electric field by applying only 1.7 V of positive (negative) gate voltage. The experimental results indicate that the ionic-liquid-gated EDLT technique can be used for controlling the surface electronic states on metallic systems. (author)

  16. A RADIAL VELOCITY TEST FOR SUPERMASSIVE BLACK HOLE BINARIES AS AN EXPLANATION FOR BROAD, DOUBLE-PEAKED EMISSION LINES IN ACTIVE GALACTIC NUCLEI

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Jia; Halpern, Jules P. [Astronomy Department, Columbia University, 550 West 120th Street, New York, NY 10027 (United States); Eracleous, Michael [Department of Astronomy and Institute for Gravitation and The Cosmos, The Pennsylvania State University, 525 Davey Lab, University Park, PA 16802 (United States)

    2016-01-20

    One of the proposed explanations for the broad, double-peaked Balmer emission lines observed in the spectra of some active galactic nuclei (AGNs) is that they are associated with sub-parsec supermassive black hole (SMBH) binaries. Here, we test the binary broad-line region hypothesis through several decades of monitoring of the velocity structure of double-peaked Hα emission lines in 13 low-redshift, mostly radio-loud AGNs. This is a much larger set of objects compared to an earlier test by Eracleous et al. and we use much longer time series for the three objects studied in that paper. Although systematic changes in radial velocity can be traced in many of their lines, they are demonstrably not like those of a spectroscopic binary in a circular orbit. Any spectroscopic binary period must therefore be much longer than the span of the monitoring (assuming a circular orbit), which in turn would require black hole masses that exceed by 1–2 orders of magnitude the values obtained for these objects using techniques such as reverberation mapping and stellar velocity dispersion. Moreover, the response of the double-peaked Balmer line profiles to fluctuations of the ionizing continuum and the shape of the Lyα profiles are incompatible with an SMBH binary. The binary broad-line region hypothesis is therefore disfavored. Other processes evidently shape these line profiles and cause the long-term velocity variations of the double peaks.

  17. Modelling and analysis of a novel compressed air energy storage system for trigeneration based on electrical energy peak load shifting

    International Nuclear Information System (INIS)

    Lv, Song; He, Wei; Zhang, Aifeng; Li, Guiqiang; Luo, Bingqing; Liu, Xianghua

    2017-01-01

    Highlights: • A new CAES system for trigeneration based on electrical peak load shifting is proposed. • The theoretical models and the thermodynamics process are established and analyzed. • The relevant parameters influencing its performance have been discussed and optimized. • A novel energy and economic evaluation methods is proposed to evaluate the performance of the system. - Abstract: The compressed air energy storage (CAES) has made great contribution to both electricity and renewable energy. In the pursuit of reduced energy consumption and relieving power utility pressure effectively, a novel trigeneration system based on CAES for cooling, heating and electricity generation by electrical energy peak load shifting is proposed in this paper. The cooling power is generated by the direct expansion of compressed air, and the heating power is recovered in the process of compression and storage. Based on the working principle of the typical CAES, the theoretical analysis of the thermodynamic system models are established and the characteristics of the system are analyzed. A novel method used to evaluate energy and economic performance is proposed. A case study is conducted, and the economic-social and technical feasibility of the proposed system are discussed. The results show that the trigeneration system works efficiently at relatively low pressure, and the efficiency is expected to reach about 76.3% when air is compressed and released by 15 bar. The annual monetary cost saving annually is about 53.9%. Moreover, general considerations about the proposed system are also presented.

  18. Current limitation by an electric double layer in ion laser discharges

    International Nuclear Information System (INIS)

    Torven, S.

    1977-12-01

    A theory for current limitation in ion laser discharges is investigated. The basic mechanism considered is saturation of the positive ion flux at an electric double layer by the limited flux of neutral atoms. The result is compared with a recently published synthesis of a large number of experimental data which agree well with those predicted by the double layer model

  19. Peak Shaving and Alternative Power: A Question of Economy, Quality of Life and Quality of Electricity

    National Research Council Canada - National Science Library

    Smith, David

    1999-01-01

    .... Fuel cells offer a variety of options for co-generation and power management. A prudent use of the by-products of electric generation from a fuel cell could increase efficiency of the plant and provide cost savings to the user...

  20. Electric and magnetic field modulated energy dispersion, conductivity and optical response in double quantum wire with spin-orbit interactions

    Science.gov (United States)

    Karaaslan, Y.; Gisi, B.; Sakiroglu, S.; Kasapoglu, E.; Sari, H.; Sokmen, I.

    2018-02-01

    We study the influence of electric field on the electronic energy band structure, zero-temperature ballistic conductivity and optical properties of double quantum wire. System described by double-well anharmonic confinement potential is exposed to a perpendicular magnetic field and Rashba and Dresselhaus spin-orbit interactions. Numerical results show up that the combined effects of internal and external agents cause the formation of crossing, anticrossing, camel-back/anomaly structures and the lateral, downward/upward shifts in the energy dispersion. The anomalies in the energy subbands give rise to the oscillation patterns in the ballistic conductance, and the energy shifts bring about the shift in the peak positions of optical absorption coefficients and refractive index changes.

  1. Peak shifting and cross-class subsidization: The impacts of solar PV on changes in electricity costs

    International Nuclear Information System (INIS)

    Johnson, Erik; Beppler, Ross; Blackburn, Chris; Staver, Benjamin; Brown, Marilyn; Matisoff, Daniel

    2017-01-01

    The expansion of distributed solar necessitates additional research into the impacts on both utilities and their customers. In this paper we use New Jersey solar data, PJM market data, and demand profiles from a PJM utility to investigate rate and bill impacts of large-scale solar penetration. In addition to the subsidization of solar adopters by non-participants, we highlight the channels through which cross-subsidization of rate classes can arise in practice. The results of our study indicate that the fear of a utility “death spiral” may be exaggerated. Significant solar can be incorporated with only a 2% increase in non-participant bills. At high levels of penetration, distributed solar has the potential to alter the system peak hour which affects the allocation of costs across rate-classes. As the peak hour shifts to the evening when solar production diminishes, residential customers face higher distribution costs. Policy makers and utilities need to be aware of these challenges in designing the next generation of rates that are better aligned with cost causality. - Highlights: • We develop a model of electricity costs with large amounts of solar adoption. • Solar adoption leads to cost redistribution across customer classes. • Costs are redistributed partially because peak utility load shifts later in the day. • Residential distributed solar generation affects electricity bills the most. • We confirm the subsidy of participants by non-participants in net metering programs.

  2. Field-Induced Superconductivity in Electric Double Layer Transistors

    NARCIS (Netherlands)

    Ueno, Kazunori; Shimotani, Hidekazu; Yuan, Hongtao; Ye, Jianting; Kawasaki, Masashi; Iwasa, Yoshihiro

    Electric field tuning of superconductivity has been a long-standing issue in solid state physics since the invention of the field-effect transistor (FET) in 1960. Owing to limited available carrier density in conventional FET devices, electric-field-induced superconductivity was believed to be

  3. The relation of double peaks, observed in quartz hydride atomizers, to the fate of free analyte atoms in the determination of arsenic and selenium by atomic absorption spectrometry

    International Nuclear Information System (INIS)

    D'Ulivo, Alessandro; Dedina, Jiri

    2002-01-01

    The mechanism at the origin of double peaks formation in quartz hydride atomizers were investigated by continuous flow hydride generation atomic absorption spectrometry. Arsenic and selenium were used as model analytes. The effect of atomization mode (flame-in-gas-shield (FIGS), miniature diffusion flame and double flame (DF)) and some experimental parameters as oxygen supply rate for microflame and the distance from atomization to free atoms detection point, were investigated on the shape of both analytical signals and calibration graphs. Rollover of calibration graphs and double peak formation are strictly related each to the other and could be observed only in FIGS atomizer mode under some particular conditions. A mechanism based on incomplete atomization of hydrides cannot explain the collected experimental evidences because the microflame of FIGS is able to produce quantitative atomization of large amount of hydrides even at supply rate of oxygen close to extinction threshold of microflame. The heterogeneous gas-solid reactions between finely dispersed particles, formed by free atom recombination, and the free atoms in the gaseous phase are at the origin of double peak formation

  4. Chaotic behaviour of an electrical analogue to the mechanical double pendulum

    Directory of Open Access Journals (Sweden)

    M. P. Hanias

    2008-02-01

    Full Text Available In this paper the analogy between a mechanical double pendulum and an oscillating electrical system is presented. Instead of using analytic equations, we used the MultiSim circuit simulation environment in order to reproduce and interpret the response of the electrical oscillator. The electrical double pendulum presents a chaotic regime which is studied quantita-tively by means of state space reconstruction. For this purpose the optimal delay time is calculated and the minimum em-bedding dimension is found with the method of False Nearest Neighbors.

  5. Peak electricity demand and social practice theories: Reframing the role of change agents in the energy sector

    International Nuclear Information System (INIS)

    Strengers, Yolande

    2012-01-01

    Demand managers currently draw on a limited range of psychology and economic theories in order to shift and shed peak electricity demand. These theories place individual consumers and their attitudes, behaviours and choices at the centre of the problem. This paper reframes the issue of peak electricity demand using theories of social practices, contending that the ‘problem’ is one of transforming, technologically-mediated social practices. It reflects on how this body of theory repositions and refocuses the roles and practices of professions charged with the responsibility and agency for affecting and managing energy demand. The paper identifies three areas where demand managers could refocus their attention: (i) enabling co-management relationships with consumers; (ii) working beyond their siloed roles with a broader range of human and non-human actors; and (iii) promoting new practice ‘needs’ and expectations. It concludes by critically reflecting on the limited agency attributed to ‘change agents’ such as demand managers in dominant understandings of change. Instead, the paper proposes the need to identify and establish a new group of change agents who are actively but often unwittingly involved in reconfiguring the elements of problematic peaky practices. - Highlights: ► I reframe peak electricity demand as a problem of changing social practices. ► Micro-grids, and dynamic pricing reorient household routines and enable co-management. ► Infrastructures inside and outside the home configure peaky practices. ► Demand managers are encouraged to promote and challenge consumer ‘needs’. ► I identify a new group of change agents implicated in peaky practices.

  6. Online peak power prediction based on a parameter and state estimator for lithium-ion batteries in electric vehicles

    International Nuclear Information System (INIS)

    Pei, Lei; Zhu, Chunbo; Wang, Tiansi; Lu, Rengui; Chan, C.C.

    2014-01-01

    The goal of this study is to realize real-time predictions of the peak power/state of power (SOP) for lithium-ion batteries in electric vehicles (EVs). To allow the proposed method to be applicable to different temperature and aging conditions, a training-free battery parameter/state estimator is presented based on an equivalent circuit model using a dual extended Kalman filter (DEKF). In this estimator, the model parameters are no longer taken as functions of factors such as SOC (state of charge), temperature, and aging; instead, all parameters will be directly estimated under the present conditions, and the impact of the temperature and aging on the battery model will be included in the parameter identification results. Then, the peak power/SOP will be calculated using the estimated results under the given limits. As an improvement to the calculation method, a combined limit of current and voltage is proposed to obtain results that are more reasonable. Additionally, novel verification experiments are designed to provide the true values of the cells' peak power under various operating conditions. The proposed methods are implemented in experiments with LiFePO 4 /graphite cells. The validating results demonstrate that the proposed methods have good accuracy and high adaptability. - Highlights: • A real-time peak power/SOP prediction method for lithium-ion batteries is proposed. • A training-free method based on DEKF is presented for parameter identification. • The proposed method can be applied to different temperature and aging conditions. • The calculation of peak power under the current and voltage limits is improved. • Validation experiments are designed to verify the accuracy of prediction results

  7. Investment in peak production means, future pitfall of the electricity sector deregulation?

    International Nuclear Information System (INIS)

    Peluchon, B.

    2008-01-01

    The electricity markets seem to have experienced problems of under-investment over and over again, hence regular crises which manifest themselves in very high price levels and the threat of power cuts. An explanation of this phenomenon is given in the literature under the heading 'problem of lacking revenue': a certain number of imperfections prevent the wholesale markets from generating enough revenue to encourage the building of new capacities. The purpose of this article is to present these issues as well as the solutions envisaged to remedy them: what is known as 'convergent' designs of capacity markets. However the fact that the operational reserves may be considered as a public good stops these designs from being considered as a definitive remedy to the problem of lacking revenue. (author)

  8. Strategic elements of steam cycle chemistry control practices at TXU's Comanche Peak steam electric station

    International Nuclear Information System (INIS)

    Fellers, B.; Stevens, J.; Nichols, G.

    2002-01-01

    Early industry experience defined the critical importance of Chemistry Control Practices to maintaining long-term performance of PWR steam generators. These lessons provided the impetus for a number of innovations and alternate practices at Comanche Peak. For example, advanced amine investigations and implementation of results provided record low iron transport and deposition. The benefits of the surface-active properties of dimethyl-amine exceeded initial expectations. Operation of pre-coat polishers and steam generator blowdown demineralizers in the amine cycle enabled optimization of amine concentrations and stable pH control. The strategy for coordinated control of oxygen and hydrazine dosing complemented the advanced amine program for protective oxide stabilization. Additionally, a proactive chemical cleaning was performed on Unit 1 to prevent degradations from general fouling of steam generator tube-tube support plate (TSP) and top-of-tubesheet (TTS) crevices. This paper shares the results of these innovations and practices. Also, the bases, theory, and philosophy supporting the strategic elements of program will be presented. (authors)

  9. Correlation between the line width and the line flux of the double-peaked broad Hα of 3C390.3

    Science.gov (United States)

    Zhang, Xue-Guang

    2013-03-01

    In this paper, we carefully check the correlation between the line width (second moment) and the line flux of the double-peaked broad Hα of the well-known mapped active galactic nucleus (AGN) 3C390.3 in order to show some further distinctions between double-peaked emitters and normal broad-line AGN. Based on the virialization assumption MBH ∝ RBLR × V2(BLR) and the empirical relation RBLR ∝ L˜0.5, one strong negative correlation between the line width and the line flux of the double-peaked broad lines should be expected for 3C390.3, such as the negative correlation confirmed for the mapped broad-line object NGC 5548, RBLR × V2(BLR) ∝ L˜0.5 × σ2 = constant. Moreover, based on the public spectra around 1995 from the AGN WATCH project for 3C390.3, one reliable positive correlation is found between the line width and the line flux of the double-peaked broad Hα. In the context of the proposed theoretical accretion disc model for double-peaked emitters, the unexpected positive correlation can be naturally explained, due to different time delays for the inner and outer parts of the disc-like broad-line region (BLR) of 3C390.3. Moreover, the virialization assumption is checked and found to be still available for 3C390.3. However, the time-varying size of the BLR of 3C390.3 cannot be expected by the empirical relation RBLR ∝ L˜0.5. In other words, the mean size of the BLR of 3C390.3 can be estimated by the continuum luminosity (line luminosity), while the continuum emission strengthening leads to the size of BLR decreasing (not increasing) in different moments for 3C390.3. Then, we compared our results of 3C390.3 with the previous results reported in the literature for the other double-peaked emitters, and found that before to clearly correct the effects from disc physical parameters varying (such as the effects of disc precession) for long-term observed line spectra, it is not so meaningful to discuss the correlation of the line parameters of double-peaked

  10. Further Development of the Nordic Electricity Market - a Common Solution for Investments in Transmission, Congestion Management and Peak Load Capacity

    International Nuclear Information System (INIS)

    Granstroem, Per-Olof

    2005-06-01

    The Nordic market fits well into place as a regional market in the over all European development, and it is therefore necessary to change the perspectives from a national one to a common Nordic approach. Despite the fact that the Nordic market is seen as a success, significant further improvements for customers and society can be made through deeper Nordic integration. The ongoing work on the Nordic electricity market within the Nordic Council of Ministers is therefore very welcomed and the Nordel report 'Enhancing Efficient Functioning of the Nordic Electricity Market' constitutes a good basis material for the further development of the market. There is a need to accelerate the pace of the harmonisation process, by making a clear timetable and prioritisation for the further work. Key issues for the next step are: Harmonisation of the legal framework and hence intensified co-operation among the Nordic governments; Implementation of the five known transmission investments, including a cost-benefit analysis; A more precise definition of the TSO responsibilities and core businesses, including operational reserves a prerequisite for further work on, e.g. the peak load issue; Initiation of cost-benefit analysis concerning future transmission investments; Guaranteed cross border capacity for market players; An analysis on settlement of imbalances and how this is affecting the peak load issue

  11. Double-sided auction mechanism design in electricity based on maximizing social welfare

    International Nuclear Information System (INIS)

    Zou Xiaoyan

    2009-01-01

    An efficient electricity double-sided auction mechanism should control market power and enhance the social welfare of the electricity market. Based on this goal, the paper designs a new double-sided auction mechanism. In the new mechanism, the social welfare contribution of each participant plays a pivotal role, because this contribution is the critical factor in market clearing, payment settling, and transaction matching rules. In particular, each winner of the auction can gain transfer payments according to his contribution to social welfare in the electricity market, and this gives the mechanism the ability to control the market power of some participants. At the same time, this mechanism ensures that the market organizer balances his budget. We then conduct a theoretical and empirical analysis based on the Spanish electricity market. Both of the results show that compared to the uniform-pricing mechanism, the new mechanism can reduce market power of participants and enhance the social welfare of the electricity market.

  12. Electricity Generation by Single- and Double Chamber Membrane ...

    African Journals Online (AJOL)

    Waste biomass is a cheap and relatively abundant source of microbes capable of producing electri-cal current. Rapidly developing microbial electrochemical technologies, such as microbial fuel cells, are part of a diverse platform of future sustainable energy. Application of Microbial Fuel Cells (MFCs) may represent a ...

  13. Pure Electric and Pure Magnetic Resonances in Near-Infrared Metal Double-Triangle Metamaterial Arrays

    International Nuclear Information System (INIS)

    Cao Zhi-Shen; Pan Jian; Chen Zhuo; Zhan Peng; Min Nai-Ben; Wang Zhen-Lin

    2011-01-01

    We experimentally and numerically investigate the optical properties of metamaterial arrays composed of double partially-overlapped metallic nanotriangles fabricated by an angle-resolved nanosphere lithography. We demonstrate that each double-triangle can be viewed as an artificial magnetic element analogous to the conventional metal split-ring-resonator. It is shown that under normal-incidence conditions, individual double-triangle can exhibit a strong local magnetic resonance, but the collective response of the metamaterial arrays is purely electric because magnetic resonances of the two double-triangles in a unit cell having opposite openings are out of phase. For oblique incidences the metamaterial arrays are shown to support a pure magnetic response at the same frequency band. Therefore, switchable electric and magnetic resonances are achieved in double-triangle arrays. Moreover, both the electric and magnetic resonances are shown to allow for a tunability over a large spectral range down to near-infrared. (condensed matter: electronic structure, electrical, magnetic, and optical properties)

  14. African electricity market liberalization, competition and structuring: Should double bid markets be set up?

    International Nuclear Information System (INIS)

    Founanou, M.

    2011-01-01

    In this paper, we analyse the possibility of using double auction mechanisms in the organization of the electricity markets in African countries. Today's electricity markets around the world are de-regulated and going through a restructuring process. In a context marked by the opening up to competition, a double auction for electricity supply is henceforth used to set prices in wholesale and retail electricity markets. Game theory analysis useful for studying the double auction prices proprieties. The double auction is a non-cooperative game, which is strategically equivalent to the auctions theory. The price formed, depending on the buyers and sellers' strategies, is a competitive price, which tends to the ideal price when competition operates intensely on both sides of market. For Africa, the presence of congestion costs and a chronic lack of capacity require the search for other solutions. We investigate optimal strategic behaviour when buyers and sellers are separated by a possibly constrained transmission line and show that bidders' strategies converge to truth-telling behaviour as the number of market participants increases. In the congestion case, this fails to occur. We also investigate how participants in wholesale electricity markets modify their bidding strategies as a function of the influence and behaviour of a transmission line owner. (author)

  15. Spin current and electrical polarization in GaN double-barrier structures

    OpenAIRE

    Litvinov, V. I.

    2007-01-01

    Tunnel spin polarization in a piezoelectric AlGaN/GaN double barrier structure is calculated. It is shown that the piezoelectric field and the spontaneous electrical polarization increase an efficiency of the tunnel spin injection. The relation between the electrical polarization and the spin orientation allows engineering a zero magnetic field spin injection manipulating the lattice-mismatch strain with an Al-content in the barriers.

  16. Electric Double-Layer Capacitor Fabricated with Addition of Carbon Nanotube to Polarizable Electrode

    OpenAIRE

    Yoshiyuki Show

    2012-01-01

    Electrical double-layer capacitor (EDLC) was fabricated with addition of carbon nanotube (CNT) to polarization electrodes as a conducting material. The CNT addition reduced the series resistance of the EDLC by one-twentieth, while the capacitance was not increased by the CNT addition. The low series resistance leaded to the high electrical energy stored in the EDLC. In this paper, the dependence of the series resistance, the specific capacitance, the energy, and the energy efficiencies on the...

  17. Safety Evaluation Report related to the operation of Comanche Peak Steam Electric Station, Unit 2 (Docket No. 50-446)

    International Nuclear Information System (INIS)

    1992-09-01

    This document supplement 25 to the Safety Evaluation Report related to the operation of the Comanche Peak Steam Electric Station (CPSES), Unit 2 (NUREG-0797), has been prepared by the Office of Nuclear Reactor Regulation of the US Nuclear Regulatory Commission (NRC). The facility is located in Somervell County, Texas, approximately 40 miles southwest of Fort Worth, Texas. This supplement reports the status of certain issues that had not been resolved when the Safety Evaluation Report and Supplements 1, 2, 3, 4, 6, 12, 21, 22, 23, and 24 to that report were published. This supplement deals primarily with Unit 2 issues; however, it also references evaluations for several Unit 1 licensing items resolved since Supplement 24 was issued

  18. Safety Evaluation Report related to the operation of Comanche Peak Steam Electric Station, Unit 2 (Docket No. 50-446)

    International Nuclear Information System (INIS)

    1993-02-01

    Supplement 26 to the Safety Evaluation Report related to the operation of the Comanche Peak Steam Electric Station (CPSES), Unit 2, has been prepared by the Office of Nuclear Reactor Regulation of the US Nuclear Regulatory Commission (NRC). The facility is located in Somervell County, Texas, approximately 40 miles southwest of Fort Worth, Texas. This supplement reports the status of certain issues that had not been resolved when the Safety Evaluation Report and Supplements 1, 2, 3, 4, 6, 12, 21, 22, 23, 24, and 25 to that report were published. This supplement deals primarily with Unit 2 issues; however, it also references evaluations for several licensing issues that relate to Unit 1, which have been resolved since Supplement 25 was issued

  19. Valence of wind power, photovoltaic and peak-load power plants as a part of the entire electricity system

    International Nuclear Information System (INIS)

    Schüppel, A.

    2014-01-01

    The transition to a higher share of renewable energy sources in the electricity sector leads to a multitude of challenges for the current electricity system. Within this thesis, the development of wind power and photovoltaics generation capacities in Germany is analysed based on the evaluation of technical and economic criteria. In order to derive those criteria, different scenarios with a separated and combined increase of wind and photovoltaics capacity are simulated using the model ATLANTIS. The results are compared to a reference scenario without additional wind and PV capacities. Furthermore, the value and functionality of the energy only market based on economic methods, as well as the value of peak load power plants based on opportunity costs are determined. The results of this thesis show, that the current market system is able to gain an additional annual welfare of four to six billion Euro at the best. This result shows that the task of optimising the power plant dispatch is well fulfilled by the current market design. However, the effects, e.g. fuel costs, which may influence this margin. The value of wind power and photovoltaics within the overall electricity system can be derived from the effort which is necessary to integrate these generation technologies into the existing system, and the changes in total costs of electricity generation. Based on the evaluation of time dependencies (seasonality of energy yield from wind and PV) as well as the development of total generation costs, the conclusion can be drawn that wind power is the more suitable RES generation technology for Germany. However, when it comes to grid integration measures, PV shows better results due to a higher generation potential in Southern Germany, which leads to a higher degree of utilisation. Therefore, there is no need to transport electricity from Northern to Southern Germany as it is the case with wind power. A common expansion of wind power and photovoltaics even shows slight

  20. Ray-theory approach to electrical-double-layer interactions.

    Science.gov (United States)

    Schnitzer, Ory

    2015-02-01

    A novel approach is presented for analyzing the double-layer interaction force between charged particles in electrolyte solution, in the limit where the Debye length is small compared with both interparticle separation and particle size. The method, developed here for two planar convex particles of otherwise arbitrary geometry, yields a simple asymptotic approximation limited to neither small zeta potentials nor the "close-proximity" assumption underlying Derjaguin's approximation. Starting from the nonlinear Poisson-Boltzmann formulation, boundary-layer solutions describing the thin diffuse-charge layers are asymptotically matched to a WKBJ expansion valid in the bulk, where the potential is exponentially small. The latter expansion describes the bulk potential as superposed contributions conveyed by "rays" emanating normally from the boundary layers. On a special curve generated by the centers of all circles maximally inscribed between the two particles, the bulk stress-associated with the ray contributions interacting nonlinearly-decays exponentially with distance from the center of the smallest of these circles. The force is then obtained by integrating the traction along this curve using Laplace's method. We illustrate the usefulness of our theory by comparing it, alongside Derjaguin's approximation, with numerical simulations in the case of two parallel cylinders at low potentials. By combining our result and Derjaguin's approximation, the interaction force is provided at arbitrary interparticle separations. Our theory can be generalized to arbitrary three-dimensional geometries, nonideal electrolyte models, and other physical scenarios where exponentially decaying fields give rise to forces.

  1. Development of a 3 kW double-acting thermoacoustic Stirling electric generator

    International Nuclear Information System (INIS)

    Wu, Zhanghua; Yu, Guoyao; Zhang, Limin; Dai, Wei; Luo, Ercang

    2014-01-01

    Highlights: • A 3 kW double-acting thermoacoustic Stirling electric generator is introduced. • 1.57 kW electric power with 16.8% thermal-to-electric efficiency was achieved. • High mechanical damping coefficient greatly decreases the system performance. • Performance difference is significant, which also decreased system performance. - Abstract: In this paper, a double-acting thermoacoustic Stirling electric generator is proposed as a new device capable of converting external heat into electric power. In the system, at least three thermoacoustic Stirling heat engines and three linear alternators are used to build a multiple-cylinder electricity generator. In comparison with the conventional thermoacoustic electricity generation system, the double-acting thermoacoustic Stirling electric generator has advantages on efficiency, power density and power capacity. In order to verify the idea, a prototype of 3 kW three-cylinder double-acting thermoacoustic Stirling electric generator is designed, built and tested. Based on the classic thermoacoustic theory, numerical simulation is performed to obtain the thermodynamic parameters of the engine. And distributions of key parameters are presented for a better understanding of the energy conversion process in the engine. In the experiments, a maximum electric power of about 1.57 kW and a maximum thermal-to-electric conversion efficiency of 16.8% were achieved with 5 MPa pressurized helium and 86 Hz working frequency. However, we find that the mechanical damping coefficient of the piston is dramatically increased due to the deformation of the cylinder wall caused by high thermal stress during the experiments. Thereby, the system performance was greatly reduced. Additionally, the performance differences between three engines and three alternators are significant, such as the heating temperature difference between three heater blocks of the engines, the piston displacement and the output electric power differences between

  2. Double photoexcitation of helium in a strong dc electric field

    International Nuclear Information System (INIS)

    Harries, James R.; Sullivan, James P.; Sternberg, James B.; Obara, Satoshi; Suzuki, Tadayuki; Azuma, Yoshiro; Hammond, Peter; Bozek, John; Berrah, Nora; Halka, Monica

    2003-01-01

    We report the first experimental measurements of the effect of an applied field on the photoexcitation and autoionization of doubly excited states of helium. Ground-state photoionization spectra have been measured in the region below the He + (N=2) threshold with static electric fields of up to 84.4 kV/cm across the interaction region. The results are compared to the theoretical calculations of Chung et al. [J. Phys. B10.1088/0953-4075/34/2/304 34, 165 (2001)], which are the only calculations available in this regime. Transitions to several states in the N=2, n=6 manifold are assigned, and a wealth of new structure is observed. Our data show that many more series are mixed in by the field than those predicted by theory

  3. Financial incentive approaches for reducing peak electricity demand, experience from pilot trials with a UK energy provider

    International Nuclear Information System (INIS)

    Bradley, Peter; Coke, Alexia; Leach, Matthew

    2016-01-01

    Whilst tariff-based approaches to load-shifting are common in the residential sector, incentive-based approaches are rare. This is so, even though providing customers incentives to shape their power consumption patterns has substantial potential. This paper presents findings from an exploratory UK pilot study that trials financial payments and detailed energy feedback to incentivise load-shifting of residential electricity consumption. An intervention study was implemented measuring actual energy use by individual households as well as conducting surveys and interviews. From the trials it was found that the approaches resulted in reductions in peak time energy use. Evidence from the study found that the incentives-based approaches were able to overcome some of the barriers to response experienced in Time-of-Use studies, though less good on others. Interestingly, the height of the barriers varied by the electricity-using practice and the incentivising approach applied. The height of the barriers also varied by participant. The study concludes by identifying that broad participation in demand response is likely to require a suite of incentivising approaches that appeal to different people, a key policy finding of interest to international agencies, government, public and private sector entities. - Highlights: • Novel study of financial incentive approaches for shifting residential energy. • First academic paper comprehensively identifying barriers to time of use tariffs. • First study reporting barriers to financial incentive approaches for demand response. • Incentive study design can be applied by government and energy companies.

  4. Application of electric double layer capacitor to pulse coil power supply

    International Nuclear Information System (INIS)

    Abe, Keita; Inomoto, Michiaki; Yamada, Takuma; Kamio, Shuji; Sakumura, Morio; Cao, Qinghong; Ono, Yasushi; Kuwahata, Akihiro; Imazawa, Ryota

    2011-01-01

    We developed a new application of the electric double layer capacitor (EDLC) as a sec-order quasi-DC power supply like flying-wheel motor-generators. We constructed the power supply using IGBT switching circuit and successfully demonstrated its initial operation whose current and duration time are 100 A and 3 sec, respectively, indicating a new potential of EDLC. (author)

  5. Electrical double layer at various electrode potentials: A modification by vibration

    Czech Academy of Sciences Publication Activity Database

    Zhan, H.; Červenka, Jiří; Prawer, S.; Garrett, D.J.

    2017-01-01

    Roč. 121, č. 8 (2017), s. 4760-4764 ISSN 1932-7447 Institutional support: RVO:68378271 Keywords : electrical double layer * vibration * high concentration * model Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 4.536, year: 2016

  6. Electric double layer transistors with ferroelectric BaTiO3 channels

    NARCIS (Netherlands)

    Ito, M.; Matsubara, Y.; Kozuka, Y.; Takahashi, K. S.; Kagawa, F.; Ye, J. T.; Iwasa, Y.; Ueno, K.; Tokura, Y.; Kawasaki, M.

    2014-01-01

    We report the surface conduction of a BaTiO3 thin film using electric double layer transistor (EDLT) structure. A transistor operation was observed at 220 K with an on/off ratio exceeding 10(5), demonstrating that ionic liquid gating is effective to induce carriers at the surface of ferroelectric

  7. Electric-double-layer potential distribution in multiple-layer immiscible electrolytes

    NARCIS (Netherlands)

    Das, S.; Hardt, Steffen

    2011-01-01

    In this Brief Report, we calculate the electric-double-layer (EDL) electrostatic potential in a system of several layers of immiscible electrolytes. Verwey-Niessen theory predicts that at the interface between two immiscible electrolytes back-to-back EDLs are formed. The present analysis extends

  8. Does electrical double layer formation lead to salt exclusion or to uptake?

    NARCIS (Netherlands)

    Lyklema, J.

    2005-01-01

    When electric double layers are formed, cases have been reported where this formation nvolves expulsion of electrolyte into the solution and cases in which electrolyte is absorbed from the solution. Both situations are experimentally and theoretically documented, but they cannot be simultaneously

  9. PTF11mnb: First analog of supernova 2005bf. Long-rising, double-peaked supernova Ic from a massive progenitor

    Science.gov (United States)

    Taddia, F.; Sollerman, J.; Fremling, C.; Karamehmetoglu, E.; Quimby, R. M.; Gal-Yam, A.; Yaron, O.; Kasliwal, M. M.; Kulkarni, S. R.; Nugent, P. E.; Smadja, G.; Tao, C.

    2018-01-01

    Aims: We study PTF11mnb, a He-poor supernova (SN) whose light curves resemble those of SN 2005bf, a peculiar double-peaked stripped-envelope (SE) SN, until the declining phase after the main peak. We investigate the mechanism powering its light curve and the nature of its progenitor star. Methods: Optical photometry and spectroscopy of PTF11mnb are presented. We compared light curves, colors and spectral properties to those of SN 2005bf and normal SE SNe. We built a bolometric light curve and modeled this light curve with the SuperNova Explosion Code (SNEC) hydrodynamical code explosion of a MESA progenitor star and semi-analytic models. Results: The light curve of PTF11mnb turns out to be similar to that of SN 2005bf until 50 d when the main (secondary) peaks occur at -18.5 mag. The early peak occurs at 20 d and is about 1.0 mag fainter. After the main peak, the decline rate of PTF11mnb is remarkably slower than what was observed in SN 2005bf, and it traces well the 56Co decay rate. The spectra of PTF11mnb reveal a SN Ic and have no traces of He unlike in the case of SN Ib 2005bf, although they have velocities comparable to those of SN 2005bf. The whole evolution of the bolometric light curve is well reproduced by the explosion of a massive (Mej = 7.8 M⊙), He-poor star characterized by a double-peaked 56Ni distribution, a total 56Ni mass of 0.59 M⊙, and an explosion energy of 2.2 × 1051 erg. Alternatively, a normal SN Ib/c explosion (M(56Ni) = 0.11 M⊙, EK = 0.2 × 1051 erg, Mej = 1 M⊙) can power the first peak while a magnetar, with a magnetic field characterized by B = 5.0 × 1014 G, and a rotation period of P = 18.1 ms, provides energy for the main peak. The early g-band light curve can be fit with a shock-breakout cooling tail or an extended envelope model from which a radius of at least 30 R⊙ is obtained. Conclusions: We presented a scenario where PTF11mnb was the explosion of a massive, He-poor star, characterized by a double-peaked 56Ni

  10. Investigation of surface charge density on solid–liquid interfaces by modulating the electrical double layer

    International Nuclear Information System (INIS)

    Moon, Jong Kyun; Song, Myung Won; Pak, Hyuk Kyu

    2015-01-01

    A solid surface in contact with water or aqueous solution usually carries specific electric charges. These surface charges attract counter ions from the liquid side. Since the geometry of opposite charge distribution parallel to the solid–liquid interface is similar to that of a capacitor, it is called an electrical double layer capacitor (EDLC). Therefore, there is an electrical potential difference across an EDLC in equilibrium. When a liquid bridge is formed between two conducting plates, the system behaves as two serially connected EDLCs. In this work, we propose a new method for investigating the surface charge density on solid–liquid interfaces. By mechanically modulating the electrical double layers and simultaneously applying a dc bias voltage across the plates, an ac electric current can be generated. By measuring the voltage drop across a load resistor as a function of bias voltage, we can study the surface charge density on solid–liquid interfaces. Our experimental results agree very well with the simple equivalent electrical circuit model proposed here. Furthermore, using this method, one can determine the polarity of the adsorbed state on the solid surface depending on the material used. We expect this method to aid in the study of electrical phenomena on solid–liquid interfaces. (paper)

  11. Single channel double-duct liquid metal electrical generator using a magnetohydrodynamic device

    Science.gov (United States)

    Haaland, Carsten M.; Deeds, W. Edward

    1999-01-01

    A single channel double-duct liquid metal electrical generator using a magnetohydrodynamic (MHD) device. The single channel device provides useful output AC electric energy. The generator includes a two-cylinder linear-piston engine which drives liquid metal in a single channel looped around one side of the MHD device to form a double-duct contra-flowing liquid metal MHD generator. A flow conduit network and drive mechanism are provided for moving liquid metal with an oscillating flow through a static magnetic field to produce useful AC electric energy at practical voltages and currents. Variable stroke is obtained by controlling the quantity of liquid metal in the channel. High efficiency is obtained over a wide range of frequency and power output.

  12. Double-section curvature tunable functional actuator with micromachined buckle and grid wire for electricity delivery

    Science.gov (United States)

    Feng, Guo-Hua; Hou, Sheng-You

    2015-09-01

    This paper presents an ionic polymer metal composite (IPMC)-driven tentacle-like biocompatible flexible actuator with double-section curvature tunability. This actuator, possessing an embedded electrical transmission ability that mimics skeletal muscle nerves in the human body, affords versatile device functions. Novel micromachined copper buckles and grid wires are fabricated and their superiority in electricity delivery and driving the IPMC component with less flexural rigidity is demonstrated. In addition, soft conductive wires realized on a polydimethylsiloxane structure function as electrical signal transmitters. A light-emitting diode integrated with the developed actuator offers directional guiding light ability while the actuator performs a snake-like motion. The electrical conductivity and Young’s modulus of the key actuator components are investigated, and flexural rigidity and dynamic behavior analyses of the actuator under electrical manipulation are elaborated.

  13. Double-section curvature tunable functional actuator with micromachined buckle and grid wire for electricity delivery

    International Nuclear Information System (INIS)

    Feng, Guo-Hua; Hou, Sheng-You

    2015-01-01

    This paper presents an ionic polymer metal composite (IPMC)-driven tentacle-like biocompatible flexible actuator with double-section curvature tunability. This actuator, possessing an embedded electrical transmission ability that mimics skeletal muscle nerves in the human body, affords versatile device functions. Novel micromachined copper buckles and grid wires are fabricated and their superiority in electricity delivery and driving the IPMC component with less flexural rigidity is demonstrated. In addition, soft conductive wires realized on a polydimethylsiloxane structure function as electrical signal transmitters. A light-emitting diode integrated with the developed actuator offers directional guiding light ability while the actuator performs a snake-like motion. The electrical conductivity and Young’s modulus of the key actuator components are investigated, and flexural rigidity and dynamic behavior analyses of the actuator under electrical manipulation are elaborated. (paper)

  14. Double resonance capacitance spectroscopy (DORCAS): A new experimental technique for assignment of X-ray absorption peaks to surface sites of semiconductor

    CERN Document Server

    Ishii, M

    2003-01-01

    As a new microspectroscopy for semiconductor surface analysis using an X-ray beam, double resonance capacitance spectroscopy (DORCAS) is proposed. For a microscopic X-ray absorption measurement, a local capacitance change owing to X-ray induced emission of localized electrons is detected by a microprobe. The applied bias voltage V sub b dependence of the capacitance also provides information on the surface density of state. The resonance of the Fermi energy with a surface level by V sub b control makes possible the selection of the observable surface site in the X-ray absorption measurements, i.e. site-specific spectroscopy. The double resonance of the surface site selection (V sub b resonance) and the resonant X-ray absorption of the selected site (photon energy h nu resonance) enhances the capacitance signal. The DORCAS measurement of the GaAs surface shows correlation peaks at h nu=10.402 keV and V sub b =-0.4 V and h nu=10.429 keV and V sub b =+0.1 V, indicating that these resonant X-ray absorption peaks ...

  15. Type 2 Active Galactic Nuclei with Double-peaked [O III] Lines. II. Single AGNs with Complex Narrow-line Region Kinematics are More Common than Binary AGNs

    Science.gov (United States)

    Shen, Yue; Liu, Xin; Greene, Jenny E.; Strauss, Michael A.

    2011-07-01

    Approximately 1% of low-redshift (z interpreted as either due to kinematics, such as biconical outflows and/or disk rotation of the narrow line region (NLR) around single black holes, or due to the relative motion of two distinct NLRs in a merging pair of AGNs. Here, we report follow-up near-infrared (NIR) imaging and optical slit spectroscopy of 31 double-peaked [O III] type 2 AGNs drawn from the Sloan Digital Sky Survey (SDSS) parent sample presented in Liu et al. The NIR imaging traces the old stellar population in each galaxy, while the optical slit spectroscopy traces the NLR gas. These data reveal a mixture of origins for the double-peaked feature. Roughly 10% of our objects are best explained by binary AGNs at (projected) kpc-scale separations, where two stellar components with spatially coincident NLRs are seen. ~50% of our objects have [O III] emission offset by a few kpc, corresponding to the two velocity components seen in the SDSS spectra, but there are no spatially coincident double stellar components seen in the NIR imaging. For those objects with sufficiently high-quality slit spectra, we see velocity and/or velocity dispersion gradients in [O III] emission, suggestive of the kinematic signatures of a single NLR. The remaining ~40% of our objects are ambiguous and will need higher spatial resolution observations to distinguish between the two scenarios. Our observations therefore favor the kinematics scenario with a single AGN for the majority of these double-peaked [O III] type 2 AGNs. We emphasize the importance of combining imaging and slit spectroscopy in identifying kpc-scale binary AGNs, i.e., in no cases does one of these alone allow an unambiguous identification. We estimate that ~0.5%-2.5% of the z ~ 150 km s-1. Based in part on observations obtained with the 6.5 m Magellan telescopes located at Las Campanas Observatory, Chile, and with the Apache Point Observatory 3.5 m telescope, which is owned and operated by the Astrophysical Research

  16. Evidence of a double peak in muscle activation to enhance strike speed and force: an example with elite mixed martial arts fighters.

    Science.gov (United States)

    McGill, Stuart M; Chaimberg, Jon D; Frost, David M; Fenwick, Chad M J

    2010-02-01

    The main issue addressed here is the paradox of muscle contraction to optimize speed and strike force. When muscle contracts, it increases in both force and stiffness. Force creates faster movement, but the corresponding stiffness slows the change of muscle shape and joint velocity. The purpose of this study was to investigate how this speed strength is accomplished. Five elite mixed martial arts athletes were recruited given that they must create high strike force very quickly. Muscle activation using electromyography and 3-dimensional spine motion was measured. A variety of strikes were performed. Many of the strikes intend to create fast motion and finish with a very large striking force, demonstrating a "double peak" of muscle activity. An initial peak was timed with the initiation of motion presumably to enhance stiffness and stability through the body before motion. This appeared to create an inertial mass in the large "core" for limb muscles to "pry" against to initiate limb motion. Then, some muscles underwent a relaxation phase as speed of limb motion increased. A second peak was observed upon contact with the opponent (heavy bag). It was postulated that this would increase stiffness through the body linkage, resulting in a higher effective mass behind the strike and likely a higher strike force. Observation of the contract-relax-contract pulsing cycle during forceful and quick strikes suggests that it may be fruitful to consider pulse training that involves not only the rate of muscle contraction but also the rate of muscle relaxation.

  17. Electric Double-Layer Capacitor Fabricated with Addition of Carbon Nanotube to Polarizable Electrode

    International Nuclear Information System (INIS)

    Yoshiyuki, S.

    2012-01-01

    Electrical double-layer capacitor (EDLC) was fabricated with addition of carbon nano tube (CNT) to polarization electrodes as a conducting material. The CNT addition reduced the series resistance of the EDLC by one-twentieth, while the capacitance was not increased by the CNT addition. The low series resistance leaded to the high electrical energy stored in the EDLC. In this paper, the dependence of the series resistance, the specific capacitance, the energy, and the energy efficiencies on the CNT addition is discussed

  18. Electric Double-Layer Capacitor Fabricated with Addition of Carbon Nanotube to Polarizable Electrode

    Directory of Open Access Journals (Sweden)

    Yoshiyuki Show

    2012-01-01

    Full Text Available Electrical double-layer capacitor (EDLC was fabricated with addition of carbon nanotube (CNT to polarization electrodes as a conducting material. The CNT addition reduced the series resistance of the EDLC by one-twentieth, while the capacitance was not increased by the CNT addition. The low series resistance leaded to the high electrical energy stored in the EDLC. In this paper, the dependence of the series resistance, the specific capacitance, the energy, and the energy efficiencies on the CNT addition is discussed.

  19. Spontaneous transfer of magnetically stored energy to Kinetic energy by electric double layers

    International Nuclear Information System (INIS)

    Lindberg, L.; Torven, S.

    1983-05-01

    Current disruptions are investigated in a magnetized plasma column with an inductive external electric circuit. It is found that they persist in spite of the fact that each disruption gives rise to a large inductive over-voltage. This drops off at an electric double layer formed in the plasma where most of the magnetic energy, initially stored in the circuit inductance, is released as particle energy. Simultanously as the current disrupts, the potential level at a local potential minimum in the plasma decreases. This is expected to cause the disruption by reflection of electrons. (authors)

  20. Strategy for improved frequency response of electric double-layer capacitors

    Science.gov (United States)

    Wada, Yoshifumi; Pu, Jiang; Takenobu, Taishi

    2015-10-01

    We propose a strategy for improving the response speed of electric double-layer capacitors (EDLCs) and electric double-layer transistors (EDLTs), based on an asymmetric structure with differently sized active materials and gate electrodes. We validate the strategy analytically by a classical calculation and experimentally by fabricating EDLCs with asymmetric Au electrodes (1:50 area ratio and 7.5 μm gap distance). The performance of the EDLCs is compared with that of conventional symmetric EDLCs. Our strategy dramatically improved the cut-off frequency from 14 to 93 kHz and this improvement is explained by fast charging of smaller electrodes. Therefore, this approach is particularly suitable to EDLTs, potentially expanding the applicability to medium speed (kHz-MHz) devices.

  1. Density functional theory of the electrical double layer: the RFD functional

    International Nuclear Information System (INIS)

    Gillespie, Dirk; Valisko, Monika; Boda, Dezso

    2005-01-01

    Density functional theory (DFT) of electrolytes is applied to the electrical double layer under a wide range of conditions. The ions are charged, hard spheres of different size and valence, and the wall creating the double layer is uncharged, weakly charged, and strongly charged. Under all conditions, the density and electrostatic potential profiles calculated using the recently proposed RFD electrostatic functional (Gillespie et al 2002 J. Phys.: Condens. Matter 14 12129; 2003 Phys. Rev. E 68 031503) compare well to Monte Carlo simulations. When the wall is strongly charged, the RFD functional results agree with the results of a simpler perturbative electrostatic DFT, but the two functionals' results qualitatively disagree when the wall is uncharged or weakly charged. The RFD functional reproduces these phenomena of weakly charged double layers. It also reproduces bulk thermodynamic quantities calculated from pair correlation functions

  2. Decreasing fuel cost weight in electric utility business. ; Urged peak measures and management constitution improvement. Denki jigyo no nenryohi weight wa gensho. ; Isogareru peak taisaku to keiei taishitsu kaizen

    Energy Technology Data Exchange (ETDEWEB)

    1993-09-01

    The electric power industry has made stable and economic power supply possible by advancing diversification in power sources and shifting the petroleum supply sources to southern countries and China. The cost constitution of the electric utility business in the fiscal year 1992 was such that the ratio of fuel cost is 15.9% against the total cost amount of 13 trillion 399.3 billion yen. As opposed, the fuel cost percent in the fiscal 1980 was 37.7%. This means that the effect of the fuel cost on the total cost has become smaller even if the fuel cost varies as a result of external factors including fluctuation in foreign exchange rates. Peaks in the power demand have been recorded in day time in high summer when air conditioning demand increases, which have been growing year after year. Expenses to maintain facilities and functions to deal with this demand increase have been increasing. The owned capital ratio in the electric power business was 15.7% in the fiscal 1992, which is by far lower than the average of whole industry of 28%. Execution of measures against the power peaks and improvement of the management constitution are the problems posed on the electric power industry. 4 figs., 1 tab.

  3. Electrical degradation of double-Schottky barrier in ZnO varistors

    Energy Technology Data Exchange (ETDEWEB)

    He, Jinliang, E-mail: hejl@tsinghua.edu.cn; Cheng, Chenlu; Hu, Jun [The State Key Lab of Power System, Department of Electrical Engineering, Tsinghua University, Beijing 100084 (China)

    2016-03-15

    Researches on electrical degradation of double-Schottky barrier in ZnO varistors are reviewed, aimed at the constitution of a full picture of universal degradation mechanism within the perspective of defect. Recent advances in study of ZnO materials by atomic-scale first-principles calculations are partly included and discussed, which brings to our attention distinct cognition on the native point defects and their profound impact on degradation.

  4. Novel electric double-layer capacitor with a coaxial fiber structure.

    Science.gov (United States)

    Chen, Xuli; Qiu, Longbin; Ren, Jing; Guan, Guozhen; Lin, Huijuan; Zhang, Zhitao; Chen, Peining; Wang, Yonggang; Peng, Huisheng

    2013-11-26

    A coaxial electric double-layer capacitor fiber is developed from the aligned carbon nanotube fiber and sheet, which functions as two electrodes with a polymer gel sandwiched between them. The unique coaxial structure enables a rapid transportation of ions between the two electrodes with a high electrochemical performance. These energy storage fibers are also flexible and stretchable, and can be woven into and widely used for electronic textiles. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Effect of the surface charge discretization on electric double layers. A Monte Carlo simulation study

    OpenAIRE

    Madurga Díez, Sergio; Martín-Molina, Alberto; Vilaseca i Font, Eudald; Mas i Pujadas, Francesc; Quesada-Pérez, Manuel

    2007-01-01

    The structure of the electric double layer in contact with discrete and continuously charged planar surfaces is studied within the framework of the primitive model through Monte Carlo simulations. Three different discretization models are considered together with the case of uniform distribution. The effect of discreteness is analyzed in terms of charge density profiles. For point surface groups,a complete equivalence with the situation of uniformly distributed charge is found if profiles are...

  6. Electric double layer capacitance on hierarchical porous carbons in an organic electrolyte

    OpenAIRE

    Yamada, Hirotoshi; Moriguchi, Isamu; Kudo, Tetsuichi

    2008-01-01

    Nanoporous carbons were prepared by using colloidal crystal as a template. Nitrogen adsorption/desorption isotherms and transmission electron microscope images revealed that the porous carbons exhibit hierarchical porous structures with meso/macropores and micropores. Electric double layer capacitor performance of the porous carbons was investigated in an organic electrolyte of 1 M LiClO4 in propylene carbonate and dimethoxy ethane. The hierarchical porous carbons exhibited large specific dou...

  7. Preparation of Fe-Pt perpendicular double-layered media with high electric resistivity backlayer

    International Nuclear Information System (INIS)

    Uchida, Masaru; Suzuki, Toshio; Ouchi, Kazuhiro

    2001-01-01

    High electric resistivity materials, oxide-added Fe-Si, were investigated as a soft-magnetic backlayer for Fe-Pt perpendicular double-layered media. It was found that there is a possibility of using (Fe-Si)-MgO as a backlayer. To promote a hetero-epitaxial growth of ordered Fe-Pt FCT(0 0 1), the backlayer needed a BCC(2 0 0) crystal orientation, in a situation where surface topology also played an important role

  8. Shallow donor impurities in different shaped double quantum wells under the hydrostatic pressure and applied electric field

    International Nuclear Information System (INIS)

    Kasapoglu, E.; Sari, H.; Sokmen, I.

    2005-01-01

    The combined electric field and hydrostatic pressure effects on the binding energy of the donor impurity in double triangle quantum well (DTQW), double graded (DGQW) and double square (DSQW) GaAs-(Ga,Al)As quantum wells are calculated by using a variational technique within the effective-mass approximation. The results have been obtained in the presence of an electric field applied along the growth direction as a function of hydrostatic pressure, the impurity position, barrier width and the geometric shape of the double quantum wells

  9. The electric double layer at a metal electrode in pure water

    Science.gov (United States)

    Brüesch, Peter; Christen, Thomas

    2004-03-01

    Pure water is a weak electrolyte that dissociates into hydronium ions and hydroxide ions. In contact with a charged electrode a double layer forms for which neither experimental nor theoretical studies exist, in contrast to electrolytes containing extrinsic ions like acids, bases, and solute salts. Starting from a self-consistent solution of the one-dimensional modified Poisson-Boltzmann equation, which takes into account activity coefficients of point-like ions, we explore the properties of the electric double layer by successive incorporation of various correction terms like finite ion size, polarization, image charge, and field dissociation. We also discuss the effect of the usual approximation of an average potential as required for the one-dimensional Poisson-Boltzmann equation, and conclude that the one-dimensional approximation underestimates the ion density. We calculate the electric potential, the ion distributions, the pH-values, the ion-size corrected activity coefficients, and the dissociation constants close to the electric double layer and compare the results for the various model corrections.

  10. Climate change is projected to have severe impacts on the frequency and intensity of peak electricity demand across the United States.

    Science.gov (United States)

    Auffhammer, Maximilian; Baylis, Patrick; Hausman, Catherine H

    2017-02-21

    It has been suggested that climate change impacts on the electric sector will account for the majority of global economic damages by the end of the current century and beyond [Rose S, et al. (2014) Understanding the Social Cost of Carbon: A Technical Assessment ]. The empirical literature has shown significant increases in climate-driven impacts on overall consumption, yet has not focused on the cost implications of the increased intensity and frequency of extreme events driving peak demand, which is the highest load observed in a period. We use comprehensive, high-frequency data at the level of load balancing authorities to parameterize the relationship between average or peak electricity demand and temperature for a major economy. Using statistical models, we analyze multiyear data from 166 load balancing authorities in the United States. We couple the estimated temperature response functions for total daily consumption and daily peak load with 18 downscaled global climate models (GCMs) to simulate climate change-driven impacts on both outcomes. We show moderate and heterogeneous changes in consumption, with an average increase of 2.8% by end of century. The results of our peak load simulations, however, suggest significant increases in the intensity and frequency of peak events throughout the United States, assuming today's technology and electricity market fundamentals. As the electricity grid is built to endure maximum load, our findings have significant implications for the construction of costly peak generating capacity, suggesting additional peak capacity costs of up to 180 billion dollars by the end of the century under business-as-usual.

  11. Modeling Electric Double-Layer Capacitors Using Charge Variation Methodology in Gibbs Ensemble

    Directory of Open Access Journals (Sweden)

    Ganeshprasad Pavaskar

    2018-01-01

    Full Text Available Supercapacitors deliver higher power than batteries and find applications in grid integration and electric vehicles. Recent work by Chmiola et al. (2006 has revealed unexpected increase in the capacitance of porous carbon electrodes using ionic liquids as electrolytes. The work has generated curiosity among both experimentalists and theoreticians. Here, we have performed molecular simulations using a recently developed technique (Punnathanam, 2014 for simulating supercapacitor system. In this technique, the two electrodes (containing electrolyte in slit pore are simulated in two different boxes using the Gibbs ensemble methodology. This reduces the number of particles required and interfacial interactions, which helps in reducing computational load. The method simulates an electric double-layer capacitor (EDLC with macroscopic electrodes with much smaller system sizes. In addition, the charges on individual electrode atoms are allowed to vary in response to movement of electrolyte ions (i.e., electrode is polarizable while ensuring these atoms are at the same electric potential. We also present the application of our technique on EDLCs with the electrodes modeled as slit pores and as complex three-dimensional pore networks for different electrolyte geometries. The smallest pore geometry showed an increase in capacitance toward the potential of 0 charge. This is in agreement with the new understanding of the electrical double layer in regions of dense ionic packing, as noted by Kornyshev’s theoretical model (Kornyshev, 2007, which also showed a similar trend. This is not addressed by the classical Gouy–Chapman theory for the electric double layer. Furthermore, the electrode polarizability simulated in the model improved the accuracy of the calculated capacitance. However, its addition did not significantly alter the capacitance values in the voltage range considered.

  12. Quantifying the thickness of the electrical double layer neutralizing a planar electrode: the capacitive compactness.

    Science.gov (United States)

    Guerrero-García, Guillermo Iván; González-Tovar, Enrique; Chávez-Páez, Martín; Kłos, Jacek; Lamperski, Stanisław

    2017-12-20

    The spatial extension of the ionic cloud neutralizing a charged colloid or an electrode is usually characterized by the Debye length associated with the supporting charged fluid in the bulk. This spatial length arises naturally in the linear Poisson-Boltzmann theory of point charges, which is the cornerstone of the widely used Derjaguin-Landau-Verwey-Overbeek formalism describing the colloidal stability of electrified macroparticles. By definition, the Debye length is independent of important physical features of charged solutions such as the colloidal charge, electrostatic ion correlations, ionic excluded volume effects, or specific short-range interactions, just to mention a few. In order to include consistently these features to describe more accurately the thickness of the electrical double layer of an inhomogeneous charged fluid in planar geometry, we propose here the use of the capacitive compactness concept as a generalization of the compactness of the spherical electrical double layer around a small macroion (González-Tovar et al., J. Chem. Phys. 2004, 120, 9782). To exemplify the usefulness of the capacitive compactness to characterize strongly coupled charged fluids in external electric fields, we use integral equations theory and Monte Carlo simulations to analyze the electrical properties of a model molten salt near a planar electrode. In particular, we study the electrode's charge neutralization, and the maximum inversion of the net charge per unit area of the electrode-molten salt system as a function of the ionic concentration, and the electrode's charge. The behaviour of the associated capacitive compactness is interpreted in terms of the charge neutralization capacity of the highly correlated charged fluid, which evidences a shrinking/expansion of the electrical double layer at a microscopic level. The capacitive compactness and its first two derivatives are expressed in terms of experimentally measurable macroscopic properties such as the

  13. Assessment of MTI Water Temperature Retrievals with Ground Truth from the Comanche Peak Steam Electric Station Cooling Lake

    International Nuclear Information System (INIS)

    Kurzeja, R.J.

    2002-01-01

    Surface water temperatures calculated from Multispectral Thermal Imager (MTI) brightness temperatures and the robust retrieval algorithm, developed by the Los Alamos National Laboratory (LANL), are compared with ground truth measurements at the Squaw Creek reservoir at the Comanche Peak Steam Electric Station near Granbury Texas. Temperatures calculated for thirty-four images covering the period May 2000 to March 2002 are compared with water temperatures measured at 10 instrumented buoy locations supplied by the Savannah River Technology Center. The data set was used to examine the effect of image quality on temperature retrieval as well as to document any bias between the sensor chip arrays (SCA's). A portion of the data set was used to evaluate the influence of proximity to shoreline on the water temperature retrievals. This study found errors in daytime water temperature retrievals of 1.8 C for SCA 2 and 4.0 C for SCA 1. The errors in nighttime water temperature retrievals were 3.8 C for SCA 1. Water temperature retrievals for nighttime appear to be related to image quality with the largest positive bias for the highest quality images and the largest negative bias for the lowest quality images. The daytime data show no apparent relationship between water temperature retrieval error and image quality. The average temperature retrieval error near open water buoys was less than corresponding values for the near-shore buoys. After subtraction of the estimated error in the ground truth data, the water temperature retrieval error was 1.2 C for the open-water buoys compared to 1.8 C for the near-shore buoys. The open-water error is comparable to that found at Nauru

  14. Detection of thoracic vascular structures by electrical impedance tomography: a systematic assessment of prominence peak analysis of impedance changes.

    Science.gov (United States)

    Wodack, K H; Buehler, S; Nishimoto, S A; Graessler, M F; Behem, C R; Waldmann, A D; Mueller, B; Böhm, S H; Kaniusas, E; Thürk, F; Maerz, A; Trepte, C J C; Reuter, D A

    2018-02-28

    Electrical impedance tomography (EIT) is a non-invasive and radiation-free bedside monitoring technology, primarily used to monitor lung function. First experimental data shows that the descending aorta can be detected at different thoracic heights and might allow the assessment of central hemodynamics, i.e. stroke volume and pulse transit time. First, the feasibility of localizing small non-conductive objects within a saline phantom model was evaluated. Second, this result was utilized for the detection of the aorta by EIT in ten anesthetized pigs with comparison to thoracic computer tomography (CT). Two EIT belts were placed at different thoracic positions and a bolus of hypertonic saline (10 ml, 20%) was administered into the ascending aorta while EIT data were recorded. EIT images were reconstructed using the GREIT model, based on the individual's thoracic contours. The resulting EIT images were analyzed pixel by pixel to identify the aortic pixel, in which the bolus caused the highest transient impedance peak in time. In the phantom, small objects could be located at each position with a maximal deviation of 0.71 cm. In vivo, no significant differences between the aorta position measured by EIT and the anatomical aorta location were obtained for both measurement planes if the search was restricted to the dorsal thoracic region of interest (ROIs). It is possible to detect the descending aorta at different thoracic levels by EIT using an intra-aortic bolus of hypertonic saline. No significant differences in the position of the descending aorta on EIT images compared to CT images were obtained for both EIT belts.

  15. Final Environmental Statement related to the operation of Comanche Peak Steam Electric Station, Units 1 and 2 (Docket Nos. 50-445 and 50-446)

    International Nuclear Information System (INIS)

    1989-10-01

    In September 1981, the staff of the Nuclear Regulatory Commission (NRC) issued its Final Environmental Statement (NUREG-0775) related to the operation of Comanche Peak Steam Electric Station, Units 1 and 2 (Docket Nos. 50-445 and 50-446), located in Somervell County, Texas, approximately 40 miles southwest of Fort Worth, Texas. The NRC has prepared this supplement to NUREG-0775 to present its evaluation of the alternative of operating Comanche Peak with the installation of further severe-accident-mitigation design features. The NRC has discovered no substantial changes in the proposed action as previously evaluated in the Final Environmental Statement that are relevant to environmental concerns and bearing on the licensing of Comanche Peak Steam Electric Station, Units 1 and 2. 6 refs., 3 tabs

  16. The time-dependent development of electric double-layers in saline solutions

    International Nuclear Information System (INIS)

    Morrow, R; McKenzie, D R; Bilek, M M M

    2006-01-01

    We have studied the time-dependent development of electric double-layers (ionic sheaths) in saline solutions by simultaneously solving the sodium and chlorine ion continuity equations coupled with Poisson's equation in one dimension. The study of the effects of time-varying electric fields in solution is relevant to the possible health effect of radio-frequency electric fields on cells in the human body and to assessing the potential of using external electric fields to orient proteins for attachment to surfaces for biosensing applications. Our calculations, for applied voltages of 10-175 mV between the electrode and the solution, predict time scales of ∼0.1-110 μs for the formation of double-layers in solutions of concentration between 0.001 and 1.0 M. We develop an empirical equation that can predict the double-layer formation time to within 10% over this wide parameter range. The method has been validated by comparing the solutions obtained, once the program has run to a steady state, with the standard non-linear Poisson-Boltzmann equations. Excellent agreement is found with the Gouy-Chapman solution of the non-linear Poisson-Boltzmann equation. Thus the method is not restricted in accuracy and applicability as is the case for the linear Poisson-Boltzmann equation. The method can also provide solutions for cases where there are orders of magnitude changes in the ion densities; this has not been the case for previous studies where small perturbation analysis has been employed. The method developed here can readily be extended to two and three dimensions using time-splitting methods

  17. Detecting cm-scale hot spot over 24-km-long single-mode fiber by using differential pulse pair BOTDA based on double-peak spectrum.

    Science.gov (United States)

    Diakaridia, Sanogo; Pan, Yue; Xu, Pengbai; Zhou, Dengwang; Wang, Benzhang; Teng, Lei; Lu, Zhiwei; Ba, Dexin; Dong, Yongkang

    2017-07-24

    In distributed Brillouin optical fiber sensor when the length of the perturbation to be detected is much smaller than the spatial resolution that is defined by the pulse width, the measured Brillouin gain spectrum (BGS) experiences two or multiple peaks. In this work, we propose and demonstrate a technique using differential pulse pair Brillouin optical time-domain analysis (DPP-BOTDA) based on double-peak BGS to enhance small-scale events detection capability, where two types of single mode fiber (main fiber and secondary fiber) with 116 MHz Brillouin frequency shift (BFS) difference have been used. We have realized detection of a 5-cm hot spot at the far end of 24-km single mode fiber by employing a 50-cm spatial resolution DPP-BOTDA with only 1GS/s sampling rate (corresponding to 10 cm/point). The BFS at the far end of 24-km sensing fiber has been measured with 0.54 MHz standard deviation which corresponds to a 0.5°C temperature accuracy. This technique is simple and cost effective because it is implemented using the similar experimental setup of the standard BOTDA, however, it should be noted that the consecutive small-scale events have to be separated by a minimum length corresponding to the spatial resolution defined by the pulse width difference.

  18. Exponential Increase in Relative Biological Effectiveness Along Distal Edge of a Proton Bragg Peak as Measured by Deoxyribonucleic Acid Double-Strand Breaks

    Energy Technology Data Exchange (ETDEWEB)

    Cuaron, John J., E-mail: cuaronj@mskcc.org [Memorial Sloan Kettering Cancer Center, New York, New York (United States); Chang, Chang [Texas Center for Proton Therapy, Irving, Texas (United States); Lovelock, Michael; Higginson, Daniel S. [Memorial Sloan Kettering Cancer Center, New York, New York (United States); Mah, Dennis [Procure Proton Therapy Center, Somerset, New Jersey (United States); Cahlon, Oren; Powell, Simon [Memorial Sloan Kettering Cancer Center, New York, New York (United States)

    2016-05-01

    Purpose: To quantify the relative biological effectiveness (RBE) of the distal edge of the proton Bragg peak, using an in vitro assay of DNA double-strand breaks (DSBs). Methods and Materials: U2OS cells were irradiated within the plateau of a spread-out Bragg peak and at each millimeter position along the distal edge using a custom slide holder, allowing for simultaneous measurement of physical dose. A reference radiation signal was generated using photons. The DNA DSBs at 3 hours (to assess for early damage) and at 24 hours (to assess for residual damage and repair) after irradiation were measured using the γH2AX assay and quantified via flow cytometry. Results were confirmed with clonogenic survival assays. A detailed map of the RBE as a function of depth along the Bragg peak was generated using γH2AX measurements as a biological endpoint. Results: At 3 hours after irradiation, DNA DSBs were higher with protons at every point along the distal edge compared with samples irradiated with photons to similar doses. This effect was even more pronounced after 24 hours, indicating that the impact of DNA repair is less after proton irradiation relative to photons. The RBE demonstrated an exponential increase as a function of depth and was measured to be as high as 4.0 after 3 hours and as high as 6.0 after 24 hours. When the RBE-corrected dose was plotted as a function of depth, the peak effective dose was extended 2-3 mm beyond what would be expected with physical measurement. Conclusions: We generated a highly comprehensive map of the RBE of the distal edge of the Bragg peak, using a direct assay of DNA DSBs in vitro. Our data show that the RBE of the distal edge increases with depth and is significantly higher than previously reported estimates.

  19. Electromagnetic Analysis and Design of Switched Reluctance Double-Rotor Machine for Hybrid Electric Vehicles

    Directory of Open Access Journals (Sweden)

    Shouliang Han

    2014-10-01

    Full Text Available The double-rotor machine is a kind of multiple input and output electromechanical energy transducer with two electrical ports and two mechanical ports, which is an ideal transmission system for hybrid electric vehicles and has a series of advantages such as integration of power and energy, high efficiency and compaction. In this paper, a switched reluctance double-rotor machine (SRDRM is proposed for hybrid electric vehicles, while no conductor or PM in the middle rotor. This machine not only inherits the merits of switched reluctance machine, such as simple salient rotor structure, high reliability and wide speed range, but also can avoid the outer rotor’s cooling problem effectively. By using an equivalent magnetic circuit model, the function of middle rotor yoke is analyzed. Electromagnetic analyses of the SRDRM are performed with analytical calculations and 2-D finite element methods, including the effects of main parameters on performance. Finally, a 4.4 kW prototype machine is designed and manufactured, and the tests are performed, which validate the proposed design method.

  20. Diffuse electric double layer in planar nanostructures due to Fermi-Dirac statistics

    International Nuclear Information System (INIS)

    Drab, Mitja; Kralj-Iglič, Veronika

    2016-01-01

    A double nanocapacitor modelled by two equally charged planar surfaces that confine oppositely charged quanta subjected to Fermi-Dirac statistics is considered theoretically. A global thermodynamic equilibrium was found by minimization of the Helmholtz free energy satisfying constraints that require electroneutrality and fixed total number of confined quanta. The solution obtained by using the Euler–Lagrange method yields self–consistent quantities: distribution of quanta within the pore, electric potential, equilibrium free energy and differential capacitance. Within real values, a rigorous numerical solution and an approximate analytical solution for electrons in the low temperature limit was found. The Fermi–Dirac constraints on the wave functions in the nanopore induced an effect of a diffuse electrical double layer near both charged surfaces. This effect is comparable to the corresponding effect of entropy at finite temperatures and for classical particles, as described by the acknowledged Poisson–Boltzmann theory. At small distances and small surface charges, the electrons are almost evenly distributed within the pore, while at larger distances they condense to the charged surfaces, shielding the electric field. The force between the charged surfaces is repulsive and monotonously decreases with increasing distance between surfaces. The energies stored in the nanocapacitor are up to ≃ 50 eV/nm"2.

  1. Spin-orbit coupling and electric-dipole spin resonance in a nanowire double quantum dot.

    Science.gov (United States)

    Liu, Zhi-Hai; Li, Rui; Hu, Xuedong; You, J Q

    2018-02-02

    We study the electric-dipole transitions for a single electron in a double quantum dot located in a semiconductor nanowire. Enabled by spin-orbit coupling (SOC), electric-dipole spin resonance (EDSR) for such an electron can be generated via two mechanisms: the SOC-induced intradot pseudospin states mixing and the interdot spin-flipped tunneling. The EDSR frequency and strength are determined by these mechanisms together. For both mechanisms the electric-dipole transition rates are strongly dependent on the external magnetic field. Their competition can be revealed by increasing the magnetic field and/or the interdot distance for the double dot. To clarify whether the strong SOC significantly impact the electron state coherence, we also calculate relaxations from excited levels via phonon emission. We show that spin-flip relaxations can be effectively suppressed by the phonon bottleneck effect even at relatively low magnetic fields because of the very large g-factor of strong SOC materials such as InSb.

  2. Electric field measurements on Cluster: comparing the double-probe and electron drift techniques

    Directory of Open Access Journals (Sweden)

    A. I. Eriksson

    2006-03-01

    Full Text Available The four Cluster satellites each carry two instruments designed for measuring the electric field: a double-probe instrument (EFW and an electron drift instrument (EDI. We compare data from the two instruments in a representative sample of plasma regions. The complementary merits and weaknesses of the two techniques are illustrated. EDI operations are confined to regions of magnetic fields above 30 nT and where wave activity and keV electron fluxes are not too high, while EFW can provide data everywhere, and can go far higher in sampling frequency than EDI. On the other hand, the EDI technique is immune to variations in the low energy plasma, while EFW sometimes detects significant nongeophysical electric fields, particularly in regions with drifting plasma, with ion energy (in eV below the spacecraft potential (in volts. We show that the polar cap is a particularly intricate region for the double-probe technique, where large nongeophysical fields regularly contaminate EFW measurments of the DC electric field. We present a model explaining this in terms of enhanced cold plasma wake effects appearing when the ion flow energy is higher than the thermal energy but below the spacecraft potential multiplied by the ion charge. We suggest that these conditions, which are typical of the polar wind and occur sporadically in other regions containing a significant low energy ion population, cause a large cold plasma wake behind the spacecraft, resulting in spurious electric fields in EFW data. This interpretation is supported by an analysis of the direction of the spurious electric field, and by showing that use of active potential control alleviates the situation.

  3. Analysis of adsorption behavior of cations onto quartz surface by electrical double-layer model

    International Nuclear Information System (INIS)

    Kitamura, Akira; Yamamoto, Tadashi; Fujiwara, Kenso; Nishikawa, Sataro; Moriyama, Hirotake

    1999-01-01

    In a study of the adsorption behavior of cations onto quartz, the distribution coefficient of a variety of cations was determined using the batch method, and using the titration method, the surface charge densities of quartz in a number of electrolyte solutions. The two values thus determined were analyzed applying the electrical double-layer model, from which optimum parameter values were derived for double-layer electrostatics and intrinsic adsorption equilibrium constants. Based on these parameter values, the mechanism of cation adsorption is discussed: A key factor governing this mechanism proved to be the hydration behavior of cations. Consideration of the Coulomb interaction between the adsorbate ions and adsorbent surface led to the finding of a simple rule governing in common the adsorption equilibrium constants of different metal ions. (author)

  4. Electrical and spectroscopic diagnostic of an atmospheric double arc argon plasma jet

    International Nuclear Information System (INIS)

    Tu, X; Cheron, B G; Yan, J H; Cen, K F

    2007-01-01

    An atmospheric argon plasma jet generated by an original dc double anode plasma torch has been investigated through its electrical and spectroscopic diagnostics. The arc instabilities and dynamic behavior of the argon plasma are analyzed using classical tools such as the statistical method, fast Fourier transform (FFT) and correlation function. The takeover mode is identified as the fluctuation characteristic of the double arc argon plasma jet in our experiment. The FFT and correlation analysis of electrical signals exhibit the only characteristic frequency of 150 Hz, which originates from the torch power and is independent of any change in the operating parameters. No high frequency fluctuations (1-15 kHz) are observed. This indicates that the nature of fluctuations in an argon plasma jet is induced mainly by the undulation of the tri-phase rectified power supply. It is found that each arc root attachment is diffused rather than located at a fixed position on the anode wall. Moreover, the emission spectroscopic technique is performed to determine the electron temperature and number density of the plasma jet inside and outside the arc chamber. Along the torch axis, the measured electron temperature and number density of the double arc argon plasma drop from 12 300 K and 7.6 x 10 22 m -3 at the divergent part of the first anode nozzle, to 10 500 K and 3.1 x 10 22 m -3 at the torch exit. In addition, the validity criteria of the local thermodynamic equilibrium (LTE) state in the plasma arc are examined. The results show that the measured electron densities are in good agreement with those calculated from the LTE model, which indicates that the double arc argon plasma at atmospheric pressure is close to the LTE state under our experimental conditions

  5. Equivalent electrical network model approach applied to a double acting low temperature differential Stirling engine

    International Nuclear Information System (INIS)

    Formosa, Fabien; Badel, Adrien; Lottin, Jacques

    2014-01-01

    Highlights: • An equivalent electrical network modeling of Stirling engine is proposed. • This model is applied to a membrane low temperate double acting Stirling engine. • The operating conditions (self-startup and steady state behavior) are defined. • An experimental engine is presented and tested. • The model is validated against experimental results. - Abstract: This work presents a network model to simulate the periodic behavior of a double acting free piston type Stirling engine. Each component of the engine is considered independently and its equivalent electrical circuit derived. When assembled in a global electrical network, a global model of the engine is established. Its steady behavior can be obtained by the analysis of the transfer function for one phase from the piston to the expansion chamber. It is then possible to simulate the dynamic (steady state stroke and operation frequency) as well as the thermodynamic performances (output power and efficiency) for given mean pressure, heat source and heat sink temperatures. The motion amplitude especially can be determined by the spring-mass properties of the moving parts and the main nonlinear effects which are taken into account in the model. The thermodynamic features of the model have then been validated using the classical isothermal Schmidt analysis for a given stroke. A three-phase low temperature differential double acting free membrane architecture has been built and tested. The experimental results are compared with the model and a satisfactory agreement is obtained. The stroke and operating frequency are predicted with less than 2% error whereas the output power discrepancy is of about 30%. Finally, some optimization routes are suggested to improve the design and maximize the performances aiming at waste heat recovery applications

  6. Experimental Evaluation of Simple Thermal Storage Control Strategies in Low-Energy Solar Houses to Reduce Electricity Consumption during Grid On-Peak Periods

    Directory of Open Access Journals (Sweden)

    Kyoung-Ho Lee

    2015-08-01

    Full Text Available There is growing interest in zero-energy and low-energy buildings, which have a net energy consumption (on an annual basis of almost zero. Because they can generate both electricity and thermal energy through the use of solar photovoltaic (PV and solar thermal collectors, and with the help of reduced building thermal demand, low-energy buildings can not only make a significant contribution to energy conservation on an annual basis, but also reduce energy consumption and peak demand. This study focused on electricity consumption during the on-peak period in a low-energy residential solar building and considers the use of a building’s thermal mass and thermal storage to reduce electricity consumption in summer and winter by modulation of temperature setpoints for heat pump and indoor thermostats in summer and additional use of a solar heating loop in winter. Experiments were performed at a low-energy solar demonstration house that has solar collectors, hot water storage, a ground-coupled heat pump, and a thermal storage tank. It was assumed that the on-peak periods were from 2 pm to 5 pm on hot summer days and from 5 pm to 8 pm on cold winter days. To evaluate the potential for utilizing the building’s thermal storage capacity in space cooling and heating, the use of simple control strategies on three test days in summer and two test days in the early spring were compared in terms of net electricity consumption and peak demand, which also considered the electricity generation from solar PV modules on the roof of the house.

  7. Modelling of a Double-Track Railway Contact System Electric Field Intensity

    Science.gov (United States)

    Belinsky, Stanislav; Khanzhina, Olga; Sidorov, Alexander

    2017-12-01

    Working conditions of personnel that serves contact system (CS) are affected by factors including health and safety, security and working hours (danger of rolling stock accidents, danger of electric shock strokes, work at height, severity and tension of work, increased noise level, etc.) Low frequency electromagnetic fields as part of both electric and magnetic fields are among of the most dangerous and harmful factors. These factors can affect not only the working personnel, but also a lot of people, who do not work with the contact system itself, but could be influenced by electromagnetic field as the result of their professional activity. People, who use public transport or live not far from the electrified lines, are endangered by these factors as well. There are results of the theoretical researches in which low frequency electric fields of railway contact system were designed with the use of mathematical and computer modelling. Significant features of electric field distribution near double-track railway in presence or absence of human body were established. The studies showed the dependence of low frequency electric field parameters on the distance to the track axis, height, and presence or absence of human body. The obtained data were compared with permissible standards established in the Russian Federation and other countries with advanced electrified railway system. Evaluation of low frequency electric fields harmful effect on personnel is the main result of this work. It is also established, that location of personnel, voltage and current level, amount of tracks and other factors influence electric fields of contact systems.

  8. Kinetics of the electric double layer formation modelled by the finite difference method

    Science.gov (United States)

    Valent, Ivan

    2017-11-01

    Dynamics of the elctric double layer formation in 100 mM NaCl solution for sudden potentail steps of 10 and 20 mV was simulated using the Poisson-Nernst-Planck theory and VLUGR2 solver for partial differential equations. The used approach was verified by comparing the obtained steady-state solution with the available exact solution. The simulations allowed for detailed analysis of the relaxation processes of the individual ions and the electric potential. Some computational aspects of the problem were discussed.

  9. Film of lignocellulosic carbon material for self-supporting electrodes in electric double-layer capacitors

    Directory of Open Access Journals (Sweden)

    Tsubasa Funabashi

    2013-09-01

    Full Text Available A novel thin, wood-based carbon material with heterogeneous pores, film of lignocellulosic carbon material (FLCM, was successfully fabricated by carbonizing softwood samples of Picea jezoensis (Jezo spruce. Simultaneous increase in the specific surface area of FLCM and its affinity for electrolyte solvents in an electric double-layer capacitor (EDLC were achieved by the vacuum ultraviolet/ozone (VUV/O3 treatment. This treatment increased the specific surface area of FLCM by 50% over that of original FLCM. The results obtained in this study confirmed that FLCM is an appropriate self-supporting EDLC electrode material without any warps and cracks.

  10. Electric Double Layer at Metal Oxide Surfaces: Static Properties of the Cassiterite-Water Interface

    Czech Academy of Sciences Publication Activity Database

    Vlček, Lukáš; Zhang, Z.; Machesky, M.L.; Fenter, P.; Rosenqvist, J.; Wesolowski, D.J.; Anovitz, L. M.; Předota, Milan; Cummings, P.T.

    2007-01-01

    Roč. 23, č. 9 (2007), s. 4925-4937 ISSN 0743-7463 Grant - others:OBES(US) DE-AC05-00OR22727; OBES(US) DE-AC02-05CH11231; OBES(US) DE-AC02-06CH11357 Institutional research plan: CEZ:AV0Z40720504 Source of funding: N - neverejné zdroje ; N - neverejné zdroje ; N - neverejné zdroje Keywords : electric double layer * cassiterite * water Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 4.009, year: 2007

  11. Phase modulation of mid-infrared radiation in double-quantum-well structures under a lateral electric field

    Energy Technology Data Exchange (ETDEWEB)

    Balagula, R. M.; Vinnichenko, M. Ya.; Makhov, I. S.; Sofronov, A. N., E-mail: sofronov@rphf.spbstu.ru; Firsov, D. A.; Vorobjev, L. E. [Peter the Great St. Petersburg Polytechnic University (Russian Federation)

    2017-03-15

    The modulation of polarized radiation by GaAs/AlGaAs structures with tunnel-coupled double quantum wells in a strong lateral electric field is studied. The spectra of the variation in the refractive index under a lateral electric field in the vicinity of the intersubband resonance are experimentally investigated.

  12. Analysis of gate underlap channel double gate MOS transistor for electrical detection of bio-molecules

    Science.gov (United States)

    Ajay; Narang, Rakhi; Saxena, Manoj; Gupta, Mridula

    2015-12-01

    In this paper, an analytical model for gate drain underlap channel Double-Gate Metal-Oxide-Semiconductor Field-Effect Transistor (DG-MOSFET) for label free electrical detection of biomolecules has been proposed. The conformal mapping technique has been used to derive the expressions for surface potential, lateral electric field, energy bands (i.e. conduction and valence band) and threshold voltage (Vth). Subsequently a full drain current model to analyze the sensitivity of the biosensor has been developed. The shift in the threshold voltage and drain current (after the biomolecules interaction with the gate underlap channel region of the MOS transistor) has been used as a sensing metric. All the characteristic trends have been verified through ATLAS (SILVACO) device simulation results.

  13. Molecular Simulations of Graphene-Based Electric Double-Layer Capacitors

    Science.gov (United States)

    Kalluri, Raja K.; Konatham, Deepthi; Striolo, Alberto

    2011-03-01

    Towards deploying renewable energy sources it is crucial to develop efficient and cost-effective technologies to store electricity. Traditional batteries are plagued by a number of practical problems that at present limit their widespread applicability. One possible solution is represented by electric double-layer capacitors (EDLCs). To deploy EDLCs at the large scale it is necessary to better understand how electrolytes pack and diffuse within narrow charged pores. We present here simulation results for the concentrated aqueous solutions of NaCl, CsCl, and NaI confined within charged graphene-based porous materials. We discuss how the structure of confined water, the salt concentration, the ions size, and the surface charge density determine the accumulation of electrolytes within the porous network. Our results, compared to data available for bulk systems, are critical for relating macroscopic observations to molecular-level properties of the confined working fluids. Research supported by the Department of Energy.

  14. Sub-millimeter arbitrary arrangements of monolithically micro-scale electrical double layer capacitors

    International Nuclear Information System (INIS)

    Laszczyk, Karolina U; Kazufumi, Kobashi; Sakurai, Shunsuke; Sekiguchi, Atsuko; Futaba, Don N; Yamada, Takeo; Hata, Kenji

    2015-01-01

    We report the investigation on the reproducibility of micro-scale electric double layer capacitors (micro-EDLCs). The micro-EDLC components were fabricated parallel using photolithography, wet and dry processing. Electrodes of the micro-EDLCs are highly dense packed Single Wall Carbon Nanotubes (SWCNTs) that form a mesh structure. The micro- EDLCs are connected 1-10 in series and in parallel being unified electrical circuits to tune the capacitance and the operational voltage. To confirm the reproducibility of the cells as well as the yield we performed electrochemical measurements in order to define the performance uniformity between cells strings and individual cells connected in a string. For 1-10 cells in series and in parallel the trends for the capacitance and operational voltage satisfied electrophysics rules governing cells addition. However, the measurements of the individual cells in a string revealed the significant performance discrepancy that might result in a shorten life cycling of a circuit. (paper)

  15. A micro-structured Si-based electrodes for high capacity electrical double layer capacitors

    International Nuclear Information System (INIS)

    Krikscikas, Valdas; Oguchi, Hiroyuki; Hara, Motoaki; Kuwano, Hiroki; Yanazawa, Hiroshi

    2014-01-01

    We challenged to make basis for Si electrodes of electric double layer capacitors (EDLC) used as a power source of micro-sensor nodes. Mcroelectromechanical systems (MEMS) processes were successfully introduced to fabricate micro-structured Si-based electrodes to obtain high surface area which leads to high capacity of EDLCs. Study of fundamental properties revealed that the microstructured electrodes benefit from good wettability to electrolytes, but suffer from electric resistance. We found that this problem can be solved by metal-coating of the electrode surface. Finally we build an EDLC consisting of Au-coated micro-structured Si electrodes. This EDLC showed capacity of 14.3 mF/cm 2 , which is about 530 times larger than that of an EDLC consisting of flat Au electrodes

  16. Sub-millimeter arbitrary arrangements of monolithically micro-scale electrical double layer capacitors

    Science.gov (United States)

    Laszczyk, Karolina U.; Kazufumi, Kobashi; Sakurai, Shunsuke; Sekiguchi, Atsuko; Futaba, Don N.; Yamada, Takeo; Hata, Kenji

    2015-12-01

    We report the investigation on the reproducibility of micro-scale electric double layer capacitors (micro-EDLCs). The micro-EDLC components were fabricated parallel using photolithography, wet and dry processing. Electrodes of the micro-EDLCs are highly dense packed Single Wall Carbon Nanotubes (SWCNTs) that form a mesh structure. The micro- EDLCs are connected 1-10 in series and in parallel being unified electrical circuits to tune the capacitance and the operational voltage. To confirm the reproducibility of the cells as well as the yield we performed electrochemical measurements in order to define the performance uniformity between cells strings and individual cells connected in a string. For 1-10 cells in series and in parallel the trends for the capacitance and operational voltage satisfied electrophysics rules governing cells addition. However, the measurements of the individual cells in a string revealed the significant performance discrepancy that might result in a shorten life cycling of a circuit.

  17. Application of either gas or diesel generator group in peak time (economy in electric energy expenses); Aplicacao de grupo gerador diesel ou gas nos horarios de ponta (economia nos gastos com energia eletrica)

    Energy Technology Data Exchange (ETDEWEB)

    Pereto, Antonio Soares [SABESP - Companhia de Saneamento Basico do Estado de Sao Paulo , SP (Brazil)

    1998-07-01

    This paper intend to demonstrate the results obtained with electric power expenses by applying electric energy generator groups during peak time in the Basic Sanitation Company of the Sao Paulo state, B R.

  18. Asymptotic theory of double layer and shielding of electric field at the edge of illuminated plasma

    Energy Technology Data Exchange (ETDEWEB)

    Benilov, M. S. [Departamento de Física, CCCEE, Universidade da Madeira, Largo do Município, 9000 Funchal (Portugal); Thomas, D. M. [Blackett Laboratory, Imperial College London, Prince Consort Road, London SW7 2BW (United Kingdom)

    2014-04-15

    The method of matched asymptotic expansions is applied to the problem of a collisionless plasma generated by UV illumination localized in a central part of the plasma in the limiting case of small Debye length λ{sub D}. A second-approximation asymptotic solution is found for the double layer positioned at the boundary of the illuminated region and for the un-illuminated plasma for the plane geometry. Numerical calculations for different values of λ{sub D} are reported and found to confirm the asymptotic results. The net integral space charge of the double layer is asymptotically small, although in the plane geometry it is just sufficient to shield the ambipolar electric field existing in the illuminated region and thus to prevent it from penetrating into the un-illuminated region. The double layer has the same mathematical nature as the intermediate transition layer separating an active plasma and a collisionless sheath, and the underlying physics is also the same. In essence, the two layers represent the same physical object: a transonic layer.

  19. Insights into the effects of solvent properties in graphene based electric double-layer capacitors with organic electrolytes

    Science.gov (United States)

    Zhang, Shuo; Bo, Zheng; Yang, Huachao; Yang, Jinyuan; Duan, Liangping; Yan, Jianhua; Cen, Kefa

    2016-12-01

    Organic electrolytes are widely used in electric double-layer capacitors (EDLCs). In this work, the microstructure of planar graphene-based EDLCs with different organic solvents are investigated with molecular dynamics simulations. Results show that an increase of solvent polarity could weaken the accumulation of counter-ions nearby the electrode surface, due to the screen of electrode charges and relatively lower ionic desolvation. It thus suggests that solvents with low polarity could be preferable to yield high EDL capacitance. Meanwhile, the significant effects of the size and structure of solvent molecules are reflected by non-electrostatic molecule-electrode interactions, further influencing the adsorption of solvent molecules on electrode surface. Compared with dimethyl carbonate, γ-butyrolactone, and propylene carbonate, acetonitrile with relatively small-size and linear structure owns weak non-electrostatic interactions, which favors the easy re-orientation of solvent molecules. Moreover, the shift of solvent orientation in surface layer, from parallel orientation to perpendicular orientation relative to the electrode surface, deciphers the solvent twin-peak behavior near negative electrode. The as-obtained insights into the roles of solvent properties on the interplays among particles and electrodes elucidate the solvent influences on the microstructure and capacitive behavior of EDLCs using organic electrolytes.

  20. Potential contribution of consumer production and cogeneration to peak electricity supply in France over the next decade

    International Nuclear Information System (INIS)

    Timbert, G.; Coiffard, J.

    1991-01-01

    This study revealed considerable potential for the development of independently generated electricity in general and of cogeneration in particular in France; this growth is related to the following factors: increased fuel costs, new price scales for the purchase of independently generated electricity or for the sale of gas produced under the same conditions, development of appropriate financing schemes, modification of the regulatory threshold limiting power sold to the EDF public utility, improved know-how, special investment schemes, tax encouragement

  1. Final environmental statement related to the operation of Comanche Peak Steam Electric Station, Units 1 and 2: (Docket Nos. 50-445 and 50-446)

    International Nuclear Information System (INIS)

    1981-09-01

    The proposed action is the issuance of operating licenses to the Texas Utilities Generating Company for the startup and operation of Units 1 and 2 of the Comanche Peak Steam Electric Station located on Squaw Creek Reservoir in Somervell County, Texas, about 7 km north-northeast of Glen Rose, Texas, and about 65 km southwest of Fort Worth in north-central Texas. The information in this environmental statement represents the second assessment of the environmental impact associated with the Comanche Peak Steam Electric Station pursuant to the guidelines of the National Environmental Policy Act of 1969 (NEPA) and 10 CFR Part 51 of the Commission's Regulations. After receiving an application to construct this station, the staff carried out a review of impact that would occur during its construction and operation. This evaluation was issued as a Final Environmental Statement -- Construction Phase. After this environmental review, a safety review, an evaluation by the Advisory Committee on Reactor Safeguards, and public hearings in Glen Rose, Texas, the US Atomic Energy Commission (now US Nuclear Regulatory Commission) issued construction permits for the construction of Units 1 and 2 of the Comanche Peak Steam Electric Station. 16 figs., 34 tabs

  2. Crystal structural, magnetic and electrical transport properties of CeKFeMoO6 double perovskite

    International Nuclear Information System (INIS)

    Huo Guoyan; Ren Minghui; Wang Xiaoqing; Zhang Hongrui; Shi Pengfei

    2010-01-01

    The crystal structural, magnetic and electrical transport properties of double perovskite CeKFeMoO 6 have been investigated. The crystal structure of the compound is assigned to the monoclinic system with space group P2 1 /n and its lattice parameters are a=0.55345(3) nm, b=0.56068(2) nm, c=0.78390(1) nm, β=89.874(2). The divergence between zero-field-cooling and field-cooling M-T curves demonstrates the anisotropic behavior. The Curie temperature measured from C p -T curve is about 340 K. Isothermal magnetization curve shows that the saturation and spontaneous magnetization are 1.90 and 1.43 μ B /f.u. at 300 K, respectively. The electrical behavior of the sample shows a semiconductor. The electrical transport behavior can be described by variable range hopping model. Large magnetoresistance, -0.88 and -0.18, can be observed under low magnetic field, 0.5 T, at low and room temperature, respectively.

  3. High-Surface-Area Nitrogen-Doped Reduced Graphene Oxide for Electric Double-Layer Capacitors.

    Science.gov (United States)

    Youn, Hee-Chang; Bak, Seong-Min; Kim, Myeong-Seong; Jaye, Cherno; Fischer, Daniel A; Lee, Chang-Wook; Yang, Xiao-Qing; Roh, Kwang Chul; Kim, Kwang-Bum

    2015-06-08

    A two-step method consisting of solid-state microwave irradiation and heat treatment under NH3 gas was used to prepare nitrogen-doped reduced graphene oxide (N-RGO) with a high specific surface area (1007 m(2)  g(-1) ), high electrical conductivity (1532 S m(-1) ), and low oxygen content (1.5 wt %) for electrical double-layer capacitor applications. The specific capacitance of N-RGO was 291 F g(-1) at a current density of 1 A g(-1) , and a capacitance of 261 F g(-1) was retained at 50 A g(-1) , which indicated a very good rate capability. N-RGO also showed excellent cycling stability and preserved 96 % of the initial specific capacitance after 100 000 cycles. Near-edge X-ray absorption fine-structure spectroscopy results provided evidenced for the recovery of π conjugation in the carbon networks with the removal of oxygenated groups and revealed chemical bonding of the nitrogen atoms in N-RGO. The good electrochemical performance of N-RGO is attributed to its high surface area, high electrical conductivity, and low oxygen content. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Role of Electrical Double Layer Structure in Ionic Liquid Gated Devices.

    Science.gov (United States)

    Black, Jennifer M; Come, Jeremy; Bi, Sheng; Zhu, Mengyang; Zhao, Wei; Wong, Anthony T; Noh, Joo Hyon; Pudasaini, Pushpa R; Zhang, Pengfei; Okatan, Mahmut Baris; Dai, Sheng; Kalinin, Sergei V; Rack, Philip D; Ward, Thomas Zac; Feng, Guang; Balke, Nina

    2017-11-22

    Ionic liquid gating of transition metal oxides has enabled new states (magnetic, electronic, metal-insulator), providing fundamental insights into the physics of strongly correlated oxides. However, despite much research activity, little is known about the correlation of the structure of the liquids in contact with the transition metal oxide surface, its evolution with the applied electric potential, and its correlation with the measured electronic properties of the oxide. Here, we investigate the structure of an ionic liquid at a semiconducting oxide interface during the operation of a thin film transistor where the electrical double layer gates the device using experiment and theory. We show that the transition between the ON and OFF states of the amorphous indium gallium zinc oxide transistor is accompanied by a densification and preferential spatial orientation of counterions at the oxide channel surface. This process occurs in three distinct steps, corresponding to ion orientations, and consequently, regimes of different electrical conductivity. The reason for this can be found in the surface charge densities on the oxide surface when different ion arrangements are present. Overall, the field-effect gating process is elucidated in terms of the interfacial ionic liquid structure, and this provides unprecedented insight into the working of a liquid gated transistor linking the nanoscopic structure to the functional properties. This knowledge will enable both new ionic liquid design as well as advanced device concepts.

  5. Online Estimation of Peak Power Capability of Li-Ion Batteries in Electric Vehicles by a Hardware-in-Loop Approach

    Directory of Open Access Journals (Sweden)

    Fengchun Sun

    2012-05-01

    Full Text Available Battery peak power capability estimations play an important theoretical role for the proper use of the battery in electric vehicles. To address the failures in relaxation effects and real-time ability performance, neglecting the battery’s design limits and other issues of the traditional peak power capability calculation methods, a new approach based on the dynamic electrochemical-polarization (EP battery model, taking into consideration constraints of current, voltage, state of charge (SoC and power is proposed. A hardware-in-the-loop (HIL system is built for validating the online model-based peak power capability estimation approach of batteries used in hybrid electric vehicles (HEVs and a HIL test based on the Federal Urban Driving Schedules (FUDS is used to verify and evaluate its real-time computation performance, reliability and robustness. The results show the proposed approach gives a more accurate estimate compared with the hybrid pulse power characterization (HPPC method, avoiding over-charging or over-discharging and providing a powerful guarantee for the optimization of HEVs power systems. Furthermore, the HIL test provides valuable data and critical guidance to evaluate the accuracy of the developed battery algorithms.

  6. The double probe electric field experiment on Freja: description and first results

    International Nuclear Information System (INIS)

    Marklund, G.T.; Blomberg, L.G.; Lindqvist, A.A.; Faelthammar, C.G.; Haerendel, G.; Mozer, F.S.; Pedersen, A.; Tanskanen, P.

    1993-10-01

    A description is given of the Freja double-probe electric field instrument. Its capability to perform high-resolution measurements of the aurora and its fine-structure as well as collect information on sub-auroral and low-latitude phenomena is illustrated by selected results from the first six months of operation. The instrument is highly flexible and possible to operate in a number of different modes. It is also equipped with a 4-Megabyte burst memory for high data sampling rate and temporary storage of data. It has been fully operational since October 1992, and delivers data from ∼22 hours/day including about 5-6 auroral crossings/day of the northern and southern auroral ionosphere. New and important information in the auroral fine structure and electrodynamics is obtained by means of burst resolution data (6144 samples/s) and normal resolution data (768 sample/s). Common burst data collection triggered by the electric field event detector has turned out to be very useful for the selection of scientifically interesting events. This is illustrated by high-resolution data of a pair of extremely intense and narrow electric field structures (1 V/m) which are associated with a total absence of precipitating particles, depletions of the thermal plasma and with an intense wave activity. The low inclination of the Freja orbit provides a new perspective for studying large-scale phenomena associated with east-west gradients as is exemplified by electric field data from a satellite crossing over north-south oriented auroral structures presumably resulting from rotational distortions of east-west aligned auroral arcs. The different plasma regimes encountered by Freja are continuously monitored by means of current sweeps applied to the probes and by the satellite potential

  7. Theory of the formation of the electric double layer at the ion exchange membrane-solution interface.

    Science.gov (United States)

    Moya, A A

    2015-02-21

    This work aims to extend the study of the formation of the electric double layer at the interface defined by a solution and an ion-exchange membrane on the basis of the Nernst-Planck and Poisson equations, including different values of the counter-ion diffusion coefficient and the dielectric constant in the solution and membrane phases. The network simulation method is used to obtain the time evolution of the electric potential, the displacement electric vector, the electric charge density and the ionic concentrations at the interface between a binary electrolyte solution and a cation-exchange membrane with total co-ion exclusion. The numerical results for the temporal evolution of the interfacial electric potential and the surface electric charge are compared with analytical solutions derived in the limit of the shortest times by considering the Poisson equation for a simple cationic diffusion process. The steady-state results are justified from the Gouy-Chapman theory for the diffuse double layer in the limits of similar and high bathing ionic concentrations with respect to the fixed-charge concentration inside the membrane. Interesting new physical insights arise from the interpretation of the process of the formation of the electric double layer at the ion exchange membrane-solution interface on the basis of a membrane model with total co-ion exclusion.

  8. Large-area WSe2 electric double layer transistors on a plastic substrate

    KAUST Repository

    Funahashi, Kazuma; Pu, Jiang; Li, Ming Yang; Li, Lain-Jong; Iwasa, Yoshihiro; Takenobu, Taishi

    2015-01-01

    Due to the requirements for large-area, uniform films, currently transition metal dichalcogenides (TMDC) cannot be used in flexible transistor industrial applications. In this study, we first transferred chemically grown large-area WSe2 monolayer films from the as-grown sapphire substrates to the flexible plastic substrates. We also fabricated electric double layer transistors using the WSe2 films on the plastic substrates. These transistors exhibited ambipolar operation and an ON/OFF current ratio of ∼104, demonstrating chemically grown WSe2 transistors on plastic substrates for the first time. This achievement can be an important first step for the next-generation TMDC based flexible devices. © 2015 The Japan Society of Applied Physics.

  9. Effect of the surface charge discretization on electric double layers: a Monte Carlo simulation study.

    Science.gov (United States)

    Madurga, Sergio; Martín-Molina, Alberto; Vilaseca, Eudald; Mas, Francesc; Quesada-Pérez, Manuel

    2007-06-21

    The structure of the electric double layer in contact with discrete and continuously charged planar surfaces is studied within the framework of the primitive model through Monte Carlo simulations. Three different discretization models are considered together with the case of uniform distribution. The effect of discreteness is analyzed in terms of charge density profiles. For point surface groups, a complete equivalence with the situation of uniformly distributed charge is found if profiles are exclusively analyzed as a function of the distance to the charged surface. However, some differences are observed moving parallel to the surface. Significant discrepancies with approaches that do not account for discreteness are reported if charge sites of finite size placed on the surface are considered.

  10. Preparation and Characterization of Carbon Nanotubes-Based Composite Electrodes for Electric Double Layer Capacitors

    International Nuclear Information System (INIS)

    Seo, Min Kang; Park, Soo Jin

    2012-01-01

    In this work, we prepared activated multi-walled carbon nanotubes/polyacrylonitrile (A-MWCNTs/C) composites by film casting and activation method. Electrochemical properties of the composites were investigated in terms of serving as MWCNTs-based electrode materials for electric double layer capacitors (EDLCs). As a result, the A-MWCNTs/C composites had much higher BET specific surface area, and pore volume, and lower volume ratio of micropores than those of pristine MWCNTs/PAN ones. Furthermore, some functional groups were added on the surface of the A-MWCNTs/C composites. The specific capacitance of the A-MWCNTs/C composites was more than 4.5 times that of the pristine ones at 0.1 V discharging voltage owing to the changes of the structure and surface characteristics of the MWCNTs by activation process

  11. Electric double-layer capacitance between an ionic liquid and few-layer graphene.

    Science.gov (United States)

    Uesugi, Eri; Goto, Hidenori; Eguchi, Ritsuko; Fujiwara, Akihiko; Kubozono, Yoshihiro

    2013-01-01

    Ionic-liquid gates have a high carrier density due to their atomically thin electric double layer (EDL) and extremely large geometrical capacitance Cg. However, a high carrier density in graphene has not been achieved even with ionic-liquid gates because the EDL capacitance CEDL between the ionic liquid and graphene involves the series connection of Cg and the quantum capacitance Cq, which is proportional to the density of states. We investigated the variables that determine CEDL at the molecular level by varying the number of graphene layers n and thereby optimising Cq. The CEDL value is governed by Cq at n 4. This transition with n indicates a composite nature for CEDL. Our finding clarifies a universal principle that determines capacitance on a microscopic scale, and provides nanotechnological perspectives on charge accumulation and energy storage using an ultimately thin capacitor.

  12. Graphene electric double layer capacitor with ultra-high-power performance

    International Nuclear Information System (INIS)

    Miller, John R.; Outlaw, R.A.; Holloway, B.C.

    2011-01-01

    We have demonstrated, for the first time, efficient 120 Hz filtering by an electric double layer capacitor (EDLC). The key to this ultra-high-power performance is electrodes made from vertically oriented graphene nanosheets grown directly on metal current collectors. This design minimized both electronic and ionic resistance and produced capacitors having RC time-constants of less than 200 μs. Significantly, graphene nanosheets have a preponderance of exposed edge planes that greatly increase stored charge over designs relying on basal plane surfaces. Collectively these factors make vertically oriented graphene nanosheet electrodes ideally suited for producing high-frequency EDLCs. Capacitors constructed with these electrodes are predicted to be significantly smaller than aluminum electrolyte capacitors that they could functionally replace plus be manufactured using standard semiconductor process equipment, creating interesting commercial opportunities.

  13. Sulfonated poly(ether ether ketone) membranes for electric double layer capacitors

    International Nuclear Information System (INIS)

    Kim, Wan Ju; Kim, Dong-Won

    2008-01-01

    Sulfonated poly(ether ether ketone) (S-PEEK) with different degree of sulfonation (DS) has been prepared and evaluated as a proton conducting membrane for electric double layer capacitor (EDLC). The polymer electrolytes prepared with S-PEEK membrane exhibited ionic conductivities about 1.2 x 10 -3 -4.5 x 10 -3 S cm -1 at room temperature, which depended on both soaking solvent and degree of sulfonation. The quasi-solid-state EDLCs consisted of activated carbon electrodes and S-PEEK membrane were assembled, and their electrochemical characteristics were studied by cyclic voltammetry and charge-discharge cycle tests. The effect of DS on the electrochemical performances of EDLCs has been investigated

  14. Nanographene derived from carbon nanofiber and its application to electric double-layer capacitors

    International Nuclear Information System (INIS)

    Mitani, Satoshi; Sathish, Marappan; Rangappa, Dinesh; Unemoto, Atsushi; Tomai, Takaaki; Honma, Itaru

    2012-01-01

    The fascinating properties of graphene are attracting considerable attention in engineering fields such as electronics, optics, and energy engineering. These properties can be controlled by controlling graphene's structure, e.g., the number of layers and the sheet size. In this study, we synthesized nanosized graphene from a platelet-type carbon nanofiber. The thickness and size of nanographene oxide are around 1 nm and 60 nm and we obtained nanographene by hydrazine reduction of nanographene oxide. We applied the nanographene to an ionic-liquid electric double-layer capacitor (EDLC), which exhibited a much larger capacitance per specific surface area than an EDLC using conventional activated carbon. Furthermore, the capacitance increased significantly with increasing cycle time. After 30th cycle, the capacitance was achieved 130 F g −1 , though the surface area was only 240 m 2 g −1 . These results suggest that nanographene structure induce the capacitance enhancement.

  15. Cooperation of micro- and meso-porous carbon electrode materials in electric double-layer capacitors

    Energy Technology Data Exchange (ETDEWEB)

    Zheng, Cheng [State Key Laboratory of Electroanalytical Chemistry, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, 5625 Renmin Street, Changchun 130022, Jilin Province (China); Graduate University of Chinese Academy of Sciences, Beijing 100039 (China); Qi, Li; Wang, Hongyu [State Key Laboratory of Electroanalytical Chemistry, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, 5625 Renmin Street, Changchun 130022, Jilin Province (China); Yoshio, Masaki [Advanced Research Center, Saga University, 1341 Yoga-machi, Saga 840-0047 (Japan)

    2010-07-01

    The capacitive characteristics of micro- and meso-porous carbon materials have been compared in cyclic voltammetric studies and galvanostatic charge-discharge tests. Meso-porous carbon can keep certain high capacitance values at high scan rates, whereas micro-porous carbon possesses very high capacitance values at low scan rates but fades quickly as the scan rate rises up. For better performance of electric double-layer capacitors (EDLCs), the cooperative application of both kinds of carbon materials has been proposed in the following two ways: mixing both kinds of carbons in the same electrode or using the asymmetric configuration of carbon electrodes in the same EDLC. The cooperative effect on the electrochemical performance has also been addressed. (author)

  16. Application of a recently proposed test to the hypernettedchain approximation for the electric double layer

    Directory of Open Access Journals (Sweden)

    D.Henderson

    2007-09-01

    Full Text Available Bhuiyan, Outhwaite, and Henderson, J. Electroanal. Chem., 2007, 607, 54, have studied the electric double layer formed by a symmetric electrolyte in the restricted primitive model and suggested that an examination of the product of the coion and counter ion profiles, normalized to the one when the distance of an ion from the electrode is large, is an interesting and useful test of a theory. This product is identically one in the Poisson-Boltzmann theory but simulation results show that, at contact, this product can be greater or smaller than one at small electrode charge but always seems to tend to zero at large electrode charge. In this study we report the results of the hypernetted chain approximation (HNC/MSA version for this product and find that, at contact, for this theory this product is always greater than the one at small electrode charge but tends to zero at large electrode charge.

  17. Electric Double-Layer Interaction between Dissimilar Charge-Conserved Conducting Plates.

    Science.gov (United States)

    Chan, Derek Y C

    2015-09-15

    Small metallic particles used in forming nanostructured to impart novel optical, catalytic, or tribo-rheological can be modeled as conducting particles with equipotential surfaces that carry a net surface charge. The value of the surface potential will vary with the separation between interacting particles, and in the absence of charge-transfer or electrochemical reactions across the particle surface, the total charge of each particle must also remain constant. These two physical conditions require the electrostatic boundary condition for metallic nanoparticles to satisfy an equipotential whole-of-particle charge conservation constraint that has not been studied previously. This constraint gives rise to a global charge conserved constant potential boundary condition that results in multibody effects in the electric double-layer interaction that are either absent or are very small in the familiar constant potential or constant charge or surface electrochemical equilibrium condition.

  18. Large-area WSe2 electric double layer transistors on a plastic substrate

    KAUST Repository

    Funahashi, Kazuma

    2015-04-27

    Due to the requirements for large-area, uniform films, currently transition metal dichalcogenides (TMDC) cannot be used in flexible transistor industrial applications. In this study, we first transferred chemically grown large-area WSe2 monolayer films from the as-grown sapphire substrates to the flexible plastic substrates. We also fabricated electric double layer transistors using the WSe2 films on the plastic substrates. These transistors exhibited ambipolar operation and an ON/OFF current ratio of ∼104, demonstrating chemically grown WSe2 transistors on plastic substrates for the first time. This achievement can be an important first step for the next-generation TMDC based flexible devices. © 2015 The Japan Society of Applied Physics.

  19. Electron-related nonlinearities in GaAs-Ga{sub 1-x}Al{sub x}As double quantum wells under the effects of intense laser field and applied electric field

    Energy Technology Data Exchange (ETDEWEB)

    Mora-Ramos, M.E. [Facultad de Ciencias, Universidad Autonoma del Estado de Morelos, Ave. Universidad 1001, CP 62209, Cuernavaca, Morelos, Mexico (Mexico); Instituto de Fisica, Universidad de Antioquia, AA 1226 Medellin (Colombia); Duque, C.A., E-mail: cduque_echeverri@yahoo.es [Instituto de Fisica, Universidad de Antioquia, AA 1226 Medellin (Colombia); Kasapoglu, E.; Sari, H. [Cumhuriyet University, Physics Department, 58140 Sivas (Turkey); Soekmen, I. [Dokuz Eyluel University, Physics Department, 35160 Buca, Izmir (Turkey)

    2013-03-15

    The combined effects of intense laser radiation and applied electric fields on the intersubband-related linear and nonlinear optical properties in GaAs-based quantum wells are discussed. It is shown that for asymmetric double quantum well, the increasing laser field intensity causes progressive redshifts in the peak positions of the second and third harmonic coefficients. However, the resonant peaks of the nonlinear optical rectification can suffer a blueshift or a redshift, depending on the laser strengths. The same feature appears in the case of the resonant peaks corresponding to the total coefficients of optical absorption and relative change in the refractive index. - Highlights: Black-Right-Pointing-Pointer Nonlinear optical properties in double quantum wells. Black-Right-Pointing-Pointer Increasing laser field intensity causes redshifts in the peak positions. Black-Right-Pointing-Pointer Resonant peak of second order nonlinearities can be blue-shifted. Black-Right-Pointing-Pointer Relative change in refractive index depends of the applied electric field. Black-Right-Pointing-Pointer The energy position depends of the laser field parameter.

  20. Dissimilar kinetic behavior of electrically manipulated single- and double-stranded DNA tethered to a gold surface.

    Science.gov (United States)

    Rant, Ulrich; Arinaga, Kenji; Tornow, Marc; Kim, Yong Woon; Netz, Roland R; Fujita, Shozo; Yokoyama, Naoki; Abstreiter, Gerhard

    2006-05-15

    We report on the electrical manipulation of single- and double-stranded oligodeoxynucleotides that are end tethered to gold surfaces in electrolyte solution. The response to alternating repulsive and attractive electric surface fields is studied by time-resolved fluorescence measurements, revealing markedly distinct dynamics for the flexible single-stranded and stiff double-stranded DNA, respectively. Hydrodynamic simulations rationalize this finding and disclose two different kinetic mechanisms: stiff polymers undergo rotation around the anchoring pivot point; flexible polymers, on the other hand, are pulled onto the attracting surface segment by segment.

  1. Applying Psychology to Economic Policy Design: Using Incentive Preserving Rebates to Increase Acceptance of Critical Peak Electricity Pricing

    OpenAIRE

    Letzler, Robert

    2007-01-01

    This project extends the idea that policy makers should address problems by improving economic incentives. This project adds that presenting incentives in a way that reflects how people make decisions can sometimes improve consumers’ responses to the incentives and policy outcomes. This paper uses behavioral economics to propose ways to increase electricity policy effectiveness. The cost of generating power fluctuates enormously from hour to hour but most customers pay time-invariant prices f...

  2. Ab initio study of the Si(CH3)2O double free radical under external electric field

    International Nuclear Information System (INIS)

    Chen Xiaojun; Luo Sunzhong; Jiang Shubing; Huang Wei; Gao Xiaoling; Ma Meizhong; Zhu Zhenghe

    2004-01-01

    Infrared spectrum and NMR chemical shifts of Si(CH 3 ) 2 O double free radical were calculated employing density functional theory (DFT) with the basis sets 6-311 + G(2d, p). Excited states, dipole moment and energy of Si(CH 3 ) 2 O double free radical were also calculated using time dependent density function theory (TD-DFT) with the same basis sets. It is found that the external electric field along the X, Y and Z axis affect differently on the excited states and other properties of Si(CH 3 ) 2 O double free radical. (author)

  3. Evaluation of electric double layer capacitor using Ketjenblack as conductive nanofiller

    International Nuclear Information System (INIS)

    Tashima, Daisuke; Yoshitama, Hiromu; Otsubo, Masahisa; Maeno, Seiji; Nagasawa, Yoshinobu

    2011-01-01

    Highlights: → The capacitances of electric double layer capacitors (EDLCs) with nanocomposite electrodes were examined. → It was found that the Ketjenblack-containing EDLCs showed fairly high capacitance (150-210 F/g) compared to EDLCs containing acetylene black with the aqueous electrolyte. → A maximum specific capacitance of 252 F/g was obtained in EDLCs containing 20 wt.% KB with a large amount of the surface functional group. → Reduction-oxidation reactions were thought to occur at the interface between the electrolyte and surface functional group, which increased the specific capacitance of the EDLCs. - Abstract: In this study, the capacitances of electric double layer capacitors (EDLCs) with nanocomposite electrodes were examined by analyzing their charge-discharge characteristics and cyclic voltammograms. In addition, the internal resistance of these EDLCs was evaluated using two kinds of conductive nanofillers: acetylene black (AB) and Ketjenblack (KB). Usually, KB exhibits higher electronic conductivity than AB. The temperature dependence of the capacitance and internal resistance of the prepared EDLCs at 0-50 deg. C using an aqueous electrolyte, organic electrolyte, and two kinds of ionic liquids was evaluated. Moreover, the influence on the capacitance and internal resistance when KB containing a surface functional group is used as the conductive nanofiller of the polarized electrode was examined. It was found that the KB-containing EDLCs showed fairly high capacitance (150-210 F/g) compared to EDLCs containing AB with the aqueous electrolyte. In addition, a maximum specific capacitance of 252 F/g was obtained in EDLCs containing 20 wt.% KB with a large amount of the surface functional group. Reduction-oxidation reactions were thought to occur at the interface between the electrolyte and surface functional group, which increased the specific capacitance of the EDLCs.

  4. The Importance of Ion Size and Electrode Curvature on Electrical Double Layers in Ionic Liquids

    Energy Technology Data Exchange (ETDEWEB)

    Feng, Guang [Clemson University; Qiao, Rui [ORNL; Huang, Jingsong [ORNL; Dai, Sheng [ORNL; Sumpter, Bobby G [ORNL; Meunier, Vincent [ORNL

    2010-01-01

    Room-temperature ionic liquids (ILs) are an emerging class of electrolytes for supercapacitors. We investigate the effects of ion size and electrode curvature on the electrical double layers (EDLs) in two ILs 1-butyl-3-methylimidazolium chloride [BMIM][Cl] and 1-butyl-3-methylimidazolium hexafluorophosphate [BMIM][PF(6)], using a combination of molecular dynamics (MD) and quantum density functional theory (DFT) simulations. The sizes of the counter-ion and co-ion affect the ion distribution and orientational structure of EDLs. The EDL capacitances near both planar and cylindrical electrodes were found to follow the order: [BMIM][Cl] (near the positive electrode) > [BMIM][PF(6)] (near the positive electrode) {approx} [BMIM][Cl] (near the negative electrode) {approx} [BMIM][PF(6)] (near the negative electrode). The EDL capacitance was also found to increase as the electrode curvature increases. These capacitance data can be fit to the Helmholtz model and the recently proposed exohedral electrical double-cylinder capacitor (xEDCC) model when the EDL thickness is properly parameterized, even though key features of the EDLs in ILs are not accounted for in these models. To remedy the shortcomings of existing models, we propose a 'Multiple Ion Layers with Overscreening' (MILO) model for the EDLs in ILs that takes into account two critical features of such EDLs, i.e., alternating layering of counter-ions and co-ions and charge overscreening. The capacitance computed from the MILO model agrees well with the MD prediction. Although some input parameters of the MILO model must be obtained from MD simulations, the MILO model may provide a new framework for understanding many important aspects of EDLs in ILs (e.g., the variation of EDL capacitance with the electrode potential) that are difficult to interpret using classical EDL models and experiments.

  5. A model for the electrical double layer combining integral equation techniques with quantum density functional theory

    International Nuclear Information System (INIS)

    Luque, N.B.; Woelki, S.; Henderson, D.; Schmickler, W.

    2011-01-01

    Highlights: · We augment a double-layer model based on integral equations by calculating the interaction parameters with the electrode from quantum density functional theory · Explicit model calculations for Ag(1 1 1) in aqueous solutions give at least qualitatively good results for the particle profiles · Ours is the only method which allows the calculation of capacity-charge characteristics. · We obtain reasonable values for the Helmholtz (inner-layer) capacity. - Abstract: We have complemented the singlet reference interaction site model for the electric double layer by quantum chemical calculations for the interaction of ions and solvents with an electrode. Specific calculations have been performed for an aqueous solution of NaCl in contact with a Ag(1 1 1) electrode. The particle profiles near the electrode show the specific adsorption of Cl - ions, but not of Na + , and are at least in qualitative agreement with those obtained by molecular dynamics. Including the electronic response of the silver surface into the model results in reasonable capacity-charge characteristics.

  6. Effect of nuclear radiation on the electrical properties of chemical double layer capacitors

    International Nuclear Information System (INIS)

    Laghari, J.R.; Hammoud, A.N.

    1990-01-01

    The effects of nuclear radiation on the electrical properties of chemical double layer capacitors are determined. The capacitors were irradiated in a 2-MW nuclear reactor to different fluence levels. The exposure rate was 2.2 x 10 10 n/cm 2 · s of thermal neutrons, 9.52 x 10 8 n/cm 2 · s of fast neutrons (> 2 MeV), and 1.47 x 10 6 rad/h of gamma radiation. The properties measured during and after irradiation included the capacitance, equivalent series resistance, and open-circuit voltage. The post-irradiation effect on the leakage current was also determined. It was found that while the capacitance increased during irradiation, the equivalent series resistance and the open-circuit voltage decreased slightly during irradiation. Changes in these properties were not permanent s was evident from post-irradiation measurements. The leakage current did not show any significant change with radiation. The results indicate that chemical double layer capacitors can be suitably used as backup power source in electronic equipment operating in a radiation environment with total fluences up to 4.05 x 10 14 n/cm 2

  7. Formation of high aspect ratio polyamide-6 nanofibers via electrically induced double layer during electrospinning

    International Nuclear Information System (INIS)

    Nirmala, R.; Nam, Ki Taek; Park, Soo-Jin; Shin, Yu-Shik; Navamathavan, R.; Kim, Hak Yong

    2010-01-01

    In the present study, the formation of high aspect ratio nanofibers in polyamide-6 was investigated as a function of applied voltage ranging from 15 to 25 kV using electrospinning technique. All other experimental parameters were kept constant. The electrospun polyamide-6 nanofibers were characterized by field-emission scanning electron microscopy (FE-SEM), transmission electron microscopy (TEM) and matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF). FE-SEM images of polyamide-6 nanofibers showed that the diameter of the electrospun fiber was decreased with increasing applied voltage. At the critical applied voltage, the polymer solution was completely ionized to form the dense high aspect ratio nanofibers in between the main nanofibers. The diameter of the polyamide-6 nanofibers was observed to be in the range of 75-110 nm, whereas the high aspect ratio structures consisted of regularly distributed very fine nanofibers with diameters of about 9-28 nm. Trends in fiber diameter and diameter distribution were discussed for the high aspect ratio nanofibers. TEM results revealed that the formation of double layers in polyamide-6 nanofibers and then split-up into ultrafine fibers. The electrically induced double layer in combination with the polyelectrolytic nature of solution is proposed as the suitable mechanisms for the formation of high aspect ratio nanofibers in polyamide-6.

  8. Cut down the peak daytime demand for electricity at the residence; Jutaku ni okeru denryoku fuka heijunka

    Energy Technology Data Exchange (ETDEWEB)

    Ishihara, O. [Kumamoto University, Kumamoto (Japan). Faculty of Engineering

    1996-09-05

    For leveling of power load in small-scale buildings and houses, a test house with actual size was constructed in order to examine soil heat storage system using photovoltaic power generation system and nighttime power. A hundred of polycrystal silicone solar cells with about 5 kW and twenty of amorphous ones were fixed on the roof, to connect with commercial power source by the system interconnection having inverse power flow. For leveling of power load in the periods of heating and cooling, soil heat storage system was applied using nighttime power. Pipes for circulating cooling and heating water were embedded. Heat pump was operated only in the time zone of nighttime power, to obtain cooling and heating source for fan coil unit in the daytime. The sold power was larger than purchased power under continuous cooling condition for twelve hours in summer. Since cooling load was supplied from nighttime power with lower price, there was a large peak cut effect in the daytime. As a result of the tests using a house with actual size, the system was found to be applied practically both in summer and in winter. Effectiveness of peak cut of power load in summer was also provided. 7 refs., 10 figs., 2 tabs.

  9. Safety Evaluation Report related to the operation of Comanche Peak Steam Electric Station, Units 1 and 2 (Docket Nos. 50-445 and 50-446)

    International Nuclear Information System (INIS)

    1990-02-01

    Supplement 23 to the Safety Evaluation Report related to the operation of the Comanche Peak Steam Electric Station (CPSES), Units 1 and 2 (NUREG-0797), has been prepared by the Office of Nuclear Reactor Regulation of the US Nuclear Regulatory Commission (NRC). The facility is located in Somervell County, Texas, approximately 40 miles southwest of Fort Worth, Texas. This supplement reports the status of certain issues that had not been resolved when the Safety Evaluation Report and supplements 1, 2, 3, 4, 6, 12, 21, and 22 to that report were published. This supplement also includes the evaluations for licensing items resolved since Supplement 22 was issued. Supplement 5 has not been issued. Supplements 7, 8, 9, 10, and 11 were limited to the staff evaluation of allegations investigated by the NRC Technical Review Team. Supplement 13 presented the staff's evaluation of the Comanche Peak Response Team (CPRT) Program Plan, which was formulated by the applicant to resolve various construction and design issues raised by sources external to TU Electric. Supplements 14 through 19 presented the staff's evaluation of the CPSES Corrective Action Program: large- and small-bore piping and pipe supports (Supplement 14); cable trays and cable tray hangers (Supplement 15); conduit supports (Supplement 16); mechanical, civil/structural, electrical, instrumentation and controls, and systems portions of the heating, ventilation, and air conditioning (HVAC) system workscopes (Supplement 17); HVAC structural design (Supplement 18); and equipment qualification (Supplement 19). Supplement 20 presented the staff's evaluation of the Comanche Peak Response Team implementation of the CPRT Program

  10. Variability of electricity load patterns and its effect on demand response: A critical peak pricing experiment on Korean commercial and industrial customers

    International Nuclear Information System (INIS)

    Jang, Dongsik; Eom, Jiyong; Jae Park, Min; Jeung Rho, Jae

    2016-01-01

    To the extent that demand response represents an intentional electricity usage adjustment to price changes or incentive payments, consumers who exhibit more-variable load patterns on normal days may be capable of altering their loads more significantly in response to dynamic pricing plans. This study investigates the variation in the pre-enrollment load patterns of Korean commercial and industrial electricity customers and their impact on event-day loads during a critical peak pricing experiment in the winter of 2013. Contrary to conventional approaches to profiling electricity loads, this study proposes a new clustering technique based on variability indices that collectively represent the potential demand–response resource that these customers would supply. Our analysis reveals that variability in pre-enrollment load patterns does indeed have great predictive power for estimating their impact on demand–response loads. Customers in relatively low-variability clusters provided limited or no response, whereas customers in relatively high-variability clusters consistently presented large load impacts, accounting for most of the program-level peak reductions. This study suggests that dynamic pricing programs themselves may not offer adequate motivation for meaningful adjustments in load patterns, particularly for customers in low-variability clusters. - Highlights: • A method of clustering customers by variability indices is developed. • Customers in high-variability clusters provide substantial peak reductions. • Low-variability clusters exhibit limited reductions. • For low-variability customers, alternative policy instruments is well advised. • A model of discerning customer's demand response potential is suggested.

  11. Evaluation of the constant potential method in simulating electric double-layer capacitors

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Zhenxing; Laird, Brian B., E-mail: blaird@ku.edu [Department of Chemistry, University of Kansas, Lawrence, Kansas 66045 (United States); Yang, Yang; Olmsted, David L.; Asta, Mark [Department of Materials Science and Engineering, University of California, Berkeley, California 94720 (United States)

    2014-11-14

    A major challenge in the molecular simulation of electric double layer capacitors (EDLCs) is the choice of an appropriate model for the electrode. Typically, in such simulations the electrode surface is modeled using a uniform fixed charge on each of the electrode atoms, which ignores the electrode response to local charge fluctuations in the electrolyte solution. In this work, we evaluate and compare this Fixed Charge Method (FCM) with the more realistic Constant Potential Method (CPM), [S. K. Reed et al., J. Chem. Phys. 126, 084704 (2007)], in which the electrode charges fluctuate in order to maintain constant electric potential in each electrode. For this comparison, we utilize a simplified LiClO{sub 4}-acetonitrile/graphite EDLC. At low potential difference (ΔΨ ⩽ 2 V), the two methods yield essentially identical results for ion and solvent density profiles; however, significant differences appear at higher ΔΨ. At ΔΨ ⩾ 4 V, the CPM ion density profiles show significant enhancement (over FCM) of “inner-sphere adsorbed” Li{sup +} ions very close to the electrode surface. The ability of the CPM electrode to respond to local charge fluctuations in the electrolyte is seen to significantly lower the energy (and barrier) for the approach of Li{sup +} ions to the electrode surface.

  12. Evaluation of the constant potential method in simulating electric double-layer capacitors

    International Nuclear Information System (INIS)

    Wang, Zhenxing; Laird, Brian B.; Yang, Yang; Olmsted, David L.; Asta, Mark

    2014-01-01

    A major challenge in the molecular simulation of electric double layer capacitors (EDLCs) is the choice of an appropriate model for the electrode. Typically, in such simulations the electrode surface is modeled using a uniform fixed charge on each of the electrode atoms, which ignores the electrode response to local charge fluctuations in the electrolyte solution. In this work, we evaluate and compare this Fixed Charge Method (FCM) with the more realistic Constant Potential Method (CPM), [S. K. Reed et al., J. Chem. Phys. 126, 084704 (2007)], in which the electrode charges fluctuate in order to maintain constant electric potential in each electrode. For this comparison, we utilize a simplified LiClO 4 -acetonitrile/graphite EDLC. At low potential difference (ΔΨ ⩽ 2 V), the two methods yield essentially identical results for ion and solvent density profiles; however, significant differences appear at higher ΔΨ. At ΔΨ ⩾ 4 V, the CPM ion density profiles show significant enhancement (over FCM) of “inner-sphere adsorbed” Li + ions very close to the electrode surface. The ability of the CPM electrode to respond to local charge fluctuations in the electrolyte is seen to significantly lower the energy (and barrier) for the approach of Li + ions to the electrode surface

  13. Electric double layer and electrokinetic potential of pectic macromolecules in sugar beet

    Directory of Open Access Journals (Sweden)

    Kuljanin Tatjana A.

    2008-01-01

    Full Text Available Electrokinetic potential is an important property of colloidal particles and, regarding the fact that it is a well defined and easily measurable property, it is considered to be a permanent characteristic of a particular colloidal system. In fact, it is a measure of electrokinetic charge that surrounds the colloidal particle in a solution and is in direct proportion with the mobility of particles in an electric field. Gouy-Chapman-Stern-Graham's model of electric double layer was adopted and it was proven experimentally that the addition of Cu++ ions to sugar beet pectin caused a reduction in the negative electrokinetic potential proportional to the increase of Cu++ concentration. Higher Cu++ concentrations increased the proportion of cation specific adsorption (Cu++ and H+ with regard to electrostatic Coulombic forces. Consequently, there is a shift in the shear plane between the fixed and diffuse layers directed towards the diffuse layer, i.e. towards its compression and decrease in the electrokinetic potential or even charge inversion of pectin macromolecules.

  14. A Novel Electricity Transaction Mode of Microgrids Based on Blockchain and Continuous Double Auction

    Directory of Open Access Journals (Sweden)

    Jian Wang

    2017-11-01

    Full Text Available The installed capacity of distributed generation (DG based on renewable energy sources has increased continuously in power systems, and its market-oriented transaction is imperative. However, traditional transaction management based on centralized organizations has many disadvantages, such as high operation cost, low transparency, and potential risk of transaction data modification. Therefore, a decentralized electricity transaction mode for microgrids is proposed in this study based on blockchain and continuous double auction (CDA mechanism. A buyer and seller initially complete the transaction matching in the CDA market. In view of the frequent price fluctuation in the CDA market, an adaptive aggressiveness strategy is used to adjust the quotation timely according to market changes. DG and consumer exchange digital certificate of power and expenditure on the blockchain system and the interests of consumers are then guaranteed by multi-signature when DG cannot generate power due to failure or other reasons. The digital certification of electricity assets is replaced by the sequence number with specific tags in the transaction script, and the size of digital certification can be adjusted according to transaction energy quantity. Finally, the feasibility of market mechanism through specific microgrid case and settlement process is also provided.

  15. Estimates of peak electric fields induced by Transcranial magnetic stimulation in pregnant women as patients using an FEM full-body model.

    Science.gov (United States)

    Yanamadala, J; Noetscher, G M; Makarov, S N; Pascual-Leone, A

    2017-07-01

    Transcranial magnetic stimulation (TMS) for treatment of depression during pregnancy is an appealing alternative to fetus-threatening drugs. However, no studies to date have been performed that evaluate the safety of TMS for a pregnant mother patient and her fetus. A full-body FEM model of a pregnant woman with about 100 tissue parts has been developed specifically for the present study. This model allows accurate computations of induced electric field in every tissue given different locations of a shape-eight coil, a biphasic pulse, common TMS pulse durations, and using different values of the TMS intensity measured in SMT (Standard Motor Threshold) units. Our simulation results estimate the maximum peak values of the electric field in the fetal area for every fetal tissue separately and for the TMS intensity of one SMT unit.

  16. Evaluation of the Fourier Frequency Spectrum Peaks of Milk Electrical Conductivity Signals as Indexes to Monitor the Dairy Goats’ Health Status by On-Line Sensors

    Directory of Open Access Journals (Sweden)

    Mauro Zaninelli

    2015-08-01

    Full Text Available The aim of this study is a further characterization of the electrical conductivity (EC signal of goat milk, acquired on-line by EC sensors, to identify new indexes representative of the EC variations that can be observed during milking, when considering not healthy (NH glands. Two foremilk gland samples from 42 Saanen goats, were collected for three consecutive weeks and for three different lactation stages (LS: 0–60 Days In Milking (DIM; 61–120 DIM; 121–180 DIM, for a total amount of 1512 samples. Bacteriological analyses and somatic cells counts (SCC were used to define the health status of the glands. With negative bacteriological analyses and SCC < 1,000,000 cells/mL, glands were classified as healthy. When bacteriological analyses were positive or showed a SCC > 1,000,000 cells/mL, glands were classified as NH. For each milk EC signal, acquired on-line and for each gland considered, the Fourier frequency spectrum of the signal was calculated and three representative frequency peaks were identified. To evaluate data acquired a MIXED procedure was used considering the HS, LS and LS × HS as explanatory variables in the statistical model.Results showed that the studied frequency peaks had a significant relationship with the gland’s health status. Results also explained how the milk EC signals’ pattern change in case of NH glands. In fact, it is characterized by slower fluctuations (due to the lower frequencies of the peaks and by an irregular trend (due to the higher amplitudes of all the main frequency peaks. Therefore, these frequency peaks could be used as new indexes to improve the performances of algorithms based on multivariate models which evaluate the health status of dairy goats through the use of gland milk EC sensors.

  17. Evaluation of the Fourier Frequency Spectrum Peaks of Milk Electrical Conductivity Signals as Indexes to Monitor the Dairy Goats’ Health Status by On-Line Sensors

    Science.gov (United States)

    Zaninelli, Mauro; Agazzi, Alessandro; Costa, Annamaria; Tangorra, Francesco Maria; Rossi, Luciana; Savoini, Giovanni

    2015-01-01

    The aim of this study is a further characterization of the electrical conductivity (EC) signal of goat milk, acquired on-line by EC sensors, to identify new indexes representative of the EC variations that can be observed during milking, when considering not healthy (NH) glands. Two foremilk gland samples from 42 Saanen goats, were collected for three consecutive weeks and for three different lactation stages (LS: 0–60 Days In Milking (DIM); 61–120 DIM; 121–180 DIM), for a total amount of 1512 samples. Bacteriological analyses and somatic cells counts (SCC) were used to define the health status of the glands. With negative bacteriological analyses and SCC 1,000,000 cells/mL, glands were classified as NH. For each milk EC signal, acquired on-line and for each gland considered, the Fourier frequency spectrum of the signal was calculated and three representative frequency peaks were identified. To evaluate data acquired a MIXED procedure was used considering the HS, LS and LS × HS as explanatory variables in the statistical model.Results showed that the studied frequency peaks had a significant relationship with the gland’s health status. Results also explained how the milk EC signals’ pattern change in case of NH glands. In fact, it is characterized by slower fluctuations (due to the lower frequencies of the peaks) and by an irregular trend (due to the higher amplitudes of all the main frequency peaks). Therefore, these frequency peaks could be used as new indexes to improve the performances of algorithms based on multivariate models which evaluate the health status of dairy goats through the use of gland milk EC sensors. PMID:26307993

  18. External electric field effect on the binding energy of a hydrogenic donor impurity in InGaAsP/InP concentric double quantum rings

    Science.gov (United States)

    Hu, Min; Wang, Hailong; Gong, Qian; Wang, Shumin

    2018-04-01

    Within the framework of effective-mass envelope-function theory, the ground state binding energy of a hydrogenic donor impurity is calculated in the InGaAsP/InP concentric double quantum rings (CDQRs) using the plane wave method. The effects of geometry, impurity position, external electric field and alloy composition on binding energy are considered. It is shown that the peak value of the binding energy appears in two rings with large gap as the donor impurity moves along the radial direction. The binding energy reaches the peak value at the center of ring height when the donor impurity moves along the axial direction. The binding energy shows nonlinear variation with the increase of ring height. With the external electric field applied along the z-axis, the binding energy of the donor impurity located at zi ≥ 0 decreases while that located at zi < 0 increases. In addition, the binding energy decreases with increasing Ga composition, but increases with the increasing As composition.

  19. Classical density functional theory and Monte Carlo simulation study of electric double layer in the vicinity of a cylindrical electrode

    Science.gov (United States)

    Zhou, Shiqi; Lamperski, Stanisław; Sokołowska, Marta

    2017-07-01

    We have performed extensive Monte-Carlo simulations and classical density functional theory (DFT) calculations of the electrical double layer (EDL) near a cylindrical electrode in a primitive model (PM) modified by incorporating interionic dispersion interactions. It is concluded that (i) in general, an unsophisticated use of the mean field (MF) approximation for the interionic dispersion interactions does not distinctly worsen the classical DFT performance, even if the salt ions considered are highly asymmetrical in size (3:1) and charge (5:1), the bulk molar concentration considered is high up to a total bulk ion packing fraction of 0.314, and the surface charge density of up to 0.5 C m-2. (ii) More specifically, considering the possible noises in the simulation, the local volume charge density profiles are the most accurately predicted by the classical DFT in all situations, and the co- and counter-ion singlet distributions are also rather accurately predicted; whereas the mean electrostatic potential profile is relatively less accurately predicted due to an integral amplification of minor inaccuracy of the singlet distributions. (iii) It is found that the layered structure of the co-ion distribution is abnormally possible only if the surface charge density is high enough (for example 0.5 C m-2) moreover, the co-ion valence abnormally influences the peak height of the first counter-ion layer, which decreases with the former. (iv) Even if both the simulation and DFT indicate an insignificant contribution of the interionic dispersion interaction to the above three ‘local’ quantities, it is clearly shown by the classical DFT that the interionic dispersion interaction does significantly influence a ‘global’ quantity like the cylinder surface-aqueous electrolyte interfacial tension, and this may imply the role of the interionic dispersion interaction in explaining the specific Hofmeister effects. We elucidate all of the above observations based on the

  20. Impact of the layout on the electrical characteristics of double-sided silicon 3D sensors fabricated at FBK

    Energy Technology Data Exchange (ETDEWEB)

    Povoli, M., E-mail: povoli@disi.unitn.it [Dipartimento di Ingegneria e Scienza dell' Informazione, Università di Trento, Via Sommarive, 14, I-38123 Povo di Trento (Italy); INFN, Sezione di Padova (Gruppo Collegato di Trento) (Italy); Bagolini, A.; Boscardin, M. [Fondazione Bruno Kessler, Centro per i Materiali e i Microsistemi (FBK-CMM), Via Sommarive, 18, I-38123 Povo di Trento, TN (Italy); Dalla Betta, G.-F. [Dipartimento di Ingegneria e Scienza dell' Informazione, Università di Trento, Via Sommarive, 14, I-38123 Povo di Trento (Italy); INFN, Sezione di Padova (Gruppo Collegato di Trento) (Italy); Giacomini, G.; Mattedi, F.; Vianello, E.; Zorzi, N. [Fondazione Bruno Kessler, Centro per i Materiali e i Microsistemi (FBK-CMM), Via Sommarive, 18, I-38123 Povo di Trento, TN (Italy)

    2013-01-21

    We report on experimental results and TCAD simulations addressing the impact of layout on the electrical characteristics of double-sided 3D diodes fabricated at Fondazione Bruno Kessler (FBK), Trento, Italy. Simulations are found to accurately reproduce the device characteristics, thus explaining the basic mechanisms governing the breakdown behavior and capacitance of different devices and providing useful hints for layout optimization.

  1. Impact of the layout on the electrical characteristics of double-sided silicon 3D sensors fabricated at FBK

    International Nuclear Information System (INIS)

    Povoli, M.; Bagolini, A.; Boscardin, M.; Dalla Betta, G.-F.; Giacomini, G.; Mattedi, F.; Vianello, E.; Zorzi, N.

    2013-01-01

    We report on experimental results and TCAD simulations addressing the impact of layout on the electrical characteristics of double-sided 3D diodes fabricated at Fondazione Bruno Kessler (FBK), Trento, Italy. Simulations are found to accurately reproduce the device characteristics, thus explaining the basic mechanisms governing the breakdown behavior and capacitance of different devices and providing useful hints for layout optimization.

  2. Variable Charge and Electrical Double Layer of Mineral-Water Interfaces: Silver Halides versus Metal (Hydr)Oxides

    NARCIS (Netherlands)

    Hiemstra, T.

    2012-01-01

    Classically, silver (Ag) halides have been used to understand thermodynamic principles of the charging process and the corresponding development of the electrical double layer (EDL). A mechanistic approach to the processes on the molecular level has not yet been carried out using advanced surface

  3. Electrostatic and Electrochemical Nature of Liquid-Gated Electric-Double-Layer Transistors Based on Oxide Semiconductors

    NARCIS (Netherlands)

    Yuan, Hongtao; Shimotani, Hidekazu; Ye, Jianting; Yoon, Sungjae; Aliah, Hasniah; Tsukazaki, Atsushi; Kawasaki, Masashi; Iwasa, Yoshihiro

    2010-01-01

    The electric-double-layer (EDL) formed at liquid/solid interfaces provides a broad and interdisciplinary attraction in terms of electrochemistry, photochemistry, catalysts, energy storage, and electronics because of the large interfacial capacitance coupling and its ability for high-density charge

  4. Safety evaluation report related to the operation of Comanche Peak Steam Electric Station, Units 1 and 2: Docket No. 50-445 and 50-446

    International Nuclear Information System (INIS)

    1988-11-01

    Supplement 20 to the Safety Evaluation Report related to the operation of the Comanche Peak Steam Electric Station (CPSES), Units 1 and 2 (NUREG-0797), has been prepared by the Office of Special Projects of the US Nuclear Regulatory Commission (NRC). The facility is located in Somervell County, Texas, approximately 40 miles southwest of Fort Worth, Texas. This supplement presents the staff's evaluation of CPRT implementation of the Comanche Peak Response Team (CPRT) Program Plan and the issue-specific action plans (ISAPs), as well as the CPRT's investigations to determine the adequacy of various types of programs and hardware at CPSES. The results and conclusions of the CPRT activities are documented in a results report for each ISAP, a Collective Evaluation Report (CER), and a Collective Significance Report (CSR). This supplement also presents the staff's safety evaluation of TU Electric's root cause assessment of past CPSES design deficiencies and weaknesses. The NRC staff concludes that the CPRT has adequately implemented its investigative activities related to the design, construction, construction quality assurance/quality control, and testing at CPSES. The NRC staff further concludes that the CPRT evaluation of the results of its investigation is thorough and complete and its recommendations for corrective actions are sufficient to resolve identified deficiencies

  5. A Fresh Look at Weather Impact on Peak Electricity Demand and Energy Use of Buildings Using 30-Year Actual Weather Data

    Energy Technology Data Exchange (ETDEWEB)

    Hong, Tianzhen; Chang, Wen-Kuei; Lin, Hung-Wen

    2013-05-01

    Buildings consume more than one third of the world?s total primary energy. Weather plays a unique and significant role as it directly affects the thermal loads and thus energy performance of buildings. The traditional simulated energy performance using Typical Meteorological Year (TMY) weather data represents the building performance for a typical year, but not necessarily the average or typical long-term performance as buildings with different energy systems and designs respond differently to weather changes. Furthermore, the single-year TMY simulations do not provide a range of results that capture yearly variations due to changing weather, which is important for building energy management, and for performing risk assessments of energy efficiency investments. This paper employs large-scale building simulation (a total of 3162 runs) to study the weather impact on peak electricity demand and energy use with the 30-year (1980 to 2009) Actual Meteorological Year (AMY) weather data for three types of office buildings at two design efficiency levels, across all 17 ASHRAE climate zones. The simulated results using the AMY data are compared to those from the TMY3 data to determine and analyze the differences. Besides further demonstration, as done by other studies, that actual weather has a significant impact on both the peak electricity demand and energy use of buildings, the main findings from the current study include: 1) annual weather variation has a greater impact on the peak electricity demand than it does on energy use in buildings; 2) the simulated energy use using the TMY3 weather data is not necessarily representative of the average energy use over a long period, and the TMY3 results can be significantly higher or lower than those from the AMY data; 3) the weather impact is greater for buildings in colder climates than warmer climates; 4) the weather impact on the medium-sized office building was the greatest, followed by the large office and then the small

  6. Structure and Capacitance of Electrical Double Layers at the Graphene–Ionic Liquid Interface

    Directory of Open Access Journals (Sweden)

    Pengfei Lu

    2017-09-01

    Full Text Available Molecular dynamics simulations are carried out to investigate the structure and capacitance of the electrical double layers (EDLs at the interface of vertically oriented graphene and ionic liquids [EMIM]+/[BF4]−. The distribution and migration of the ions in the EDL on the rough and non-rough electrode surfaces with different charge densities are compared and analyzed, and the effect of the electrode surface morphology on the capacitance of the EDL is clarified. The results suggest that alternate distributions of anions and cations in several consecutive layers are formed in the EDL on the electrode surface. When the electrode is charged, the layers of [BF4]− anions experience more significant migration than those of [EMIM]+ cations. These ion layers can be extended deeper into the bulk electrolyte solution by the stronger interaction of the rough electrode, compared to those on the non-rough electrode surface. The potential energy valley of ions on the neutral electrode surface establishes a potential energy difference to compensate the energy cost of the ion accumulation, and is capable of producing a potential drop across the EDL on the uncharged electrode surface. Due to the greater effective contact area between the ions and electrode, the rough electrode possesses a larger capacitance than the non-rough one. In addition, it is harder for the larger-sized [EMIM]+ cations to accumulate in the narrow grooves on the rough electrode, when compared with the smaller [BF4]−. Consequently, the double-hump-shaped C–V curve (which demonstrates the relationship between differential capacitance and potential drop across the EDL for the rough electrode is asymmetric, where the capacitance increases more significantly when the electrode is positively charged.

  7. Structural, magnetic and electrical characterization of Cd-substituted Mg ferrites synthesized by double sintering technique

    Energy Technology Data Exchange (ETDEWEB)

    Zahir, R. [Department of Physics, Chittagong University of Engineering and Technology, Chittagong 4349 (Bangladesh); Chowdhury, F.-U.Z, E-mail: faruque@cuet.ac.bd [Department of Physics, Chittagong University of Engineering and Technology, Chittagong 4349 (Bangladesh); Uddin, M.M. [Department of Physics, Chittagong University of Engineering and Technology, Chittagong 4349 (Bangladesh); Hakim, M.A. [Materials Science Division, Atomic Energy Center, Dhaka 1000 (Bangladesh)

    2016-07-15

    Cd-substituted Mg ferrites with compositional formula Mg{sub 1−x}Cd{sub x}Fe{sub 2}O{sub 4} with 0.1≤x≤0.6 in the steps of 0.1 have been synthesized by double sintering ceramic technique. The X-ray diffraction analysis has revealed that the samples crystallize in a single phase cubic spinel structure. The lattice parameter has increased with increasing Cd content in conformity with Vegard's law. The study of scanning electron microscopy has revealed that Cd substitution has increased the particle size of the ferrites increases from ~2.2 to 9.2 µm. Some probable interpretations based on literature have been discussed. The increase in particle size with increasing of Cd content has consequently resulted in the initial permeability. The Curie temperature has decreased linearly with increasing Cd content which pointed out the weakening of A-B exchange interaction. The spectra of quality factor have showed a steady bandwidth of 0.1–8 MHz, this finding makes the ferrite system suitable for broadband pulse transformer. The variation of electrical resistivity (DC and AC) has been explained on the basis of electron hopping between Fe{sup 2+}and Fe{sup 3+}. - Highlights: • Synthesis of Cd-substituted Mg ferrites by double sintering ceramic technique. • Studies of Cd substitution on the structural and magnetic properties of Mg Ferrites. • The Curie temperature decreases linearly with increasing Cd concentration. • Due to the conduction of hopping of charge carriers DC resistivity decreases.

  8. Safety evaluation report related to the operation of Comanche Peak Steam Electric Station, Units 1 and 2 (Docket Nos. 50-445 and 50-446)

    International Nuclear Information System (INIS)

    1988-11-01

    Supplement 19 to the Safety Evaluation Report related to the operation of the Comanche Peak Steam Electric Station (CPSES), Units 1 and 2 (NUREG-0797), has been prepared by the Office of Special Projects of the US Nuclear Regulatory Commission (NRC). The facility is located in Somervell County, Texas, approximately 40 miles southwest of Fort Worth, Texas. This supplement presents the staff's evaluation of the Texas Utilities Electric Company's (lead applicant's) corrective action program (CAP) related to equipment qualification. The scope and methodology for the CAP workscope, as summarized in Revision 0 to the Equipment Qualification Project Status Report and as detailed in related documents, were developed to resolve various issues raised by the Comanche Peak Response Team (CPRT) and the NRC staff to ensure that plant equipment is appropriately environmentally and/or seismically and dynamically qualified and documented in accordance with the validated plant design resulting from other CAP scopes of work for Unit 1 and areas common to Units 1 and 2. The staff concludes that the CAP workscope for equipment qualification provides a comprehensive program for resolving the concerns identified by the CPRT and the NRC staff, including issues raised in the Comanche Peak Safety Evaluation Report and its supplements, and its implementation will ensure that the environmental and/or seismic and dynamic qualification of equipment at CPSES satisfies the validated plant design and the applicable requirements of 10 CFR Part 50. As is routine staff practice, the NRC staff will verify the adequacy of implementation of the environmental and seismic and dynamic equipment qualification program at CPSES during inspections that will take place before fuel loading. 97 refs

  9. DNA double-strand break and apoptosis induction in human lymphocytes in different cycle cell phases by 60Co gamma rays and Bragg peak protons of a medical beam

    International Nuclear Information System (INIS)

    Khachenkova, A.A.; Boreyko, A.V.; Mozhaeva, A.V.; Chausov, V.N.; Ravnachka, I.I.; Amov, I.; Tiunchik, S.I.

    2009-01-01

    A comparative analysis is made of the regularities in the formation of DNA double-strand break and apoptosis induction in peripheral human blood lymphocytes in different cell cycle phases after 60 Co gamma and extended Bragg peak proton irradiation. It is shown that the formation of apoptotic cells in a lymphocyte population increases linearly in all the cell cycle stages after proton irradiation. The maximal DNA double-strand break and apoptosis yield in lymphocytes is observed in the S phase of the cell cycle

  10. On the theory of electric double layer with explicit account of a polarizable co-solvent

    Energy Technology Data Exchange (ETDEWEB)

    Budkov, Yu. A., E-mail: urabudkov@rambler.ru [Laboratory of NMR Spectroscopy and Numerical Investigations of Liquids, G. A. Krestov Institute of Solution Chemistry of the Russian Academy of Sciences, Ivanovo (Russian Federation); Department of Applied Mathematics, National Research University Higher School of Economics, Moscow (Russian Federation); Kolesnikov, A. L. [Institut für Nichtklassische Chemie e.V., Universität Leipzig, Leipzig (Germany); Kiselev, M. G. [Laboratory of NMR Spectroscopy and Numerical Investigations of Liquids, G. A. Krestov Institute of Solution Chemistry of the Russian Academy of Sciences, Ivanovo (Russian Federation)

    2016-05-14

    We present a continuation of our theoretical research into the influence of co-solvent polarizability on a differential capacitance of the electric double layer. We formulate a modified Poisson-Boltzmann theory, using the formalism of density functional approach on the level of local density approximation taking into account the electrostatic interactions of ions and co-solvent molecules as well as their excluded volume. We derive the modified Poisson-Boltzmann equation, considering the three-component symmetric lattice gas model as a reference system and minimizing the grand thermodynamic potential with respect to the electrostatic potential. We apply present modified Poisson-Boltzmann equation to the electric double layer theory, showing that accounting for the excluded volume of co-solvent molecules and ions slightly changes the main result of our previous simplified theory. Namely, in the case of small co-solvent polarizability with its increase under the enough small surface potentials of electrode, the differential capacitance undergoes the significant growth. Oppositely, when the surface potential exceeds some threshold value (which is slightly smaller than the saturation potential), the increase in the co-solvent polarizability results in a differential capacitance decrease. However, when the co-solvent polarizability exceeds some threshold value, its increase generates a considerable enhancement of the differential capacitance in a wide range of surface potentials. We demonstrate that two qualitatively different behaviors of the differential capacitance are related to the depletion and adsorption of co-solvent molecules at the charged electrode. We show that an additive of the strongly polarizable co-solvent to an electrolyte solution can shift significantly the saturation potential in two qualitatively different manners. Namely, a small additive of strongly polarizable co-solvent results in a shift of saturation potential to higher surface potentials. On

  11. On the theory of electric double layer with explicit account of a polarizable co-solvent

    International Nuclear Information System (INIS)

    Budkov, Yu. A.; Kolesnikov, A. L.; Kiselev, M. G.

    2016-01-01

    We present a continuation of our theoretical research into the influence of co-solvent polarizability on a differential capacitance of the electric double layer. We formulate a modified Poisson-Boltzmann theory, using the formalism of density functional approach on the level of local density approximation taking into account the electrostatic interactions of ions and co-solvent molecules as well as their excluded volume. We derive the modified Poisson-Boltzmann equation, considering the three-component symmetric lattice gas model as a reference system and minimizing the grand thermodynamic potential with respect to the electrostatic potential. We apply present modified Poisson-Boltzmann equation to the electric double layer theory, showing that accounting for the excluded volume of co-solvent molecules and ions slightly changes the main result of our previous simplified theory. Namely, in the case of small co-solvent polarizability with its increase under the enough small surface potentials of electrode, the differential capacitance undergoes the significant growth. Oppositely, when the surface potential exceeds some threshold value (which is slightly smaller than the saturation potential), the increase in the co-solvent polarizability results in a differential capacitance decrease. However, when the co-solvent polarizability exceeds some threshold value, its increase generates a considerable enhancement of the differential capacitance in a wide range of surface potentials. We demonstrate that two qualitatively different behaviors of the differential capacitance are related to the depletion and adsorption of co-solvent molecules at the charged electrode. We show that an additive of the strongly polarizable co-solvent to an electrolyte solution can shift significantly the saturation potential in two qualitatively different manners. Namely, a small additive of strongly polarizable co-solvent results in a shift of saturation potential to higher surface potentials. On

  12. Safety evaluation report related to the operation of Comanche Peak Steam Electric Station, Units 1 and 2 (Docket Nos. 50-445 and 50-446)

    International Nuclear Information System (INIS)

    1990-04-01

    Supplement 24 to the Safety Evaluation Report related to the operation of the Comanche Peak Steam Electric Station (CPSES), Units 1 and 2 (NUREG-0797), has been prepared by the Office of Nuclear Reactor Regulation of the US Nuclear Regulatory Commission (NRC). The facility is located in Somervell County, Texas, approximately 40 miles southwest of Fort Worth, Texas. This supplement reports the status of certain issues that had not been resolved when the Safety Evaluation Report and Supplements 1, 2, 3, 4, 6, 12, 21, 22, and 23 to that report were published. This supplement also includes the evaluations for licensing items resolved since Supplement 23 was issued. Supplement 5 has not been issued. Supplements 7, 8, 9, 10, and 11 were limited to the staff evaluation of allegations investigated by the NRC Technical Review Team. Supplement 13 represented the staff's evaluation of the Comanche Peak Response Team (CPRT) Program Plan, which was formulated by the applicant to resolve various construction and design issues raised by sources external to TU Electric. Supplements 14 through 19 presented the staff's evaluation of the CPSES Corrective Action Program: large- and small-bore piping and pipe supports (Supplement 14); cable trays and cable tray hangers (Supplement 15); conduit supports (Supplement 16); mechanical, civil/structural, electrical, instrumentation and controls, and systems portions of the heating, ventilation, and air conditioning (HVAC) system workscopes (Supplement 17); HVAC structural design (Supplement 18); and equipment qualification (Supplement 19). Supplement 20 presented the staff's evaluation of the CPRT implementation of its Program Plan and the issue-specific action plans, as well as the CPRT's investigations to determine the adequacy of various types of programs and hardware at CPSES

  13. A fresh look at weather impact on peak electricity demand and energy use of buildings using 30-year actual weather data

    International Nuclear Information System (INIS)

    Hong, Tianzhen; Chang, Wen-Kuei; Lin, Hung-Wen

    2013-01-01

    Highlights: • Weather has a significant impact on both the peak electricity demand and energy use. • Weather impact varies with building type, building efficiency level, and location. • Simulated results using TMY3 weather data can under or over estimate those of AMY. • It is crucial to assess performance of buildings using long-term actual weather data. • Findings enable building stakeholders to make better decisions on weather impact. - Abstract: Buildings consume more than one third of the world’s total primary energy. Weather plays a unique and significant role as it directly affects the thermal loads and thus energy performance of buildings. The traditional simulated energy performance using Typical Meteorological Year (TMY) weather data represents the building performance for a typical year, but not necessarily the average or typical long-term performance as buildings with different energy systems and designs respond differently to weather changes. Furthermore, the single-year TMY simulations do not provide a range of results that capture yearly variations due to changing weather, which is important for building energy management, and for performing risk assessments of energy efficiency investments. This paper employs large-scale building simulation (a total of 3162 runs) to study the weather impact on peak electricity demand and energy use with the 30-year (1980–2009) Actual Meteorological Year (AMY) weather data for three types of office buildings at two design efficiency levels, across all 17 ASHRAE climate zones. The simulated results using the AMY data are compared to those from the TMY3 data to determine and analyze the differences. Besides further demonstration, as done by other studies, that actual weather has a significant impact on both the peak electricity demand and energy use of buildings, the main findings from the current study include: (1) annual weather variation has a greater impact on the peak electricity demand than it does

  14. Polyfurfuryl alcohol derived activated carbons for high power electrical double layer capacitors

    Energy Technology Data Exchange (ETDEWEB)

    Ruiz, V. [CSIRO Division of Energy Technology, Box 312, Clayton South, Vic. 3169 (Australia); Pandolfo, A.G., E-mail: tony.pandolfo@csiro.a [CSIRO Division of Energy Technology, Box 312, Clayton South, Vic. 3169 (Australia)

    2010-10-30

    Polyfurfuryl alcohol (PFA) derived activated carbons were prepared by the acid catalysed polymerization of furfuryl alcohol, followed by potassium hydroxide activation. Activated carbons with apparent BET surface areas ranging from 1070 to 2600 m{sup 2} g{sup -1}, and corresponding average micropore sizes between 0.6 and 1.6 nm were obtained. The porosity of these carbons can be carefully controlled during activation and their performance as electrode materials in electric double layer capacitors (EDLCs) in a non-aqueous electrolyte (1 M Et{sub 4}NBF{sub 4}/ACN) is investigated. Carbon materials with a low average pore size (<{approx}0.6 nm) exhibited electrolyte accessibility issues and an associated decrease in capacitance at high charging rates. PFA carbons with larger average pore sizes exhibited greatly improved performance, with specific electrode capacitances of 150 F g{sup -1} at an operating voltage window of 0-2.5 V; which corresponds to 32 Wh kg{sup -1} and 38 kW kg{sup -1} on an active material basis. These carbons also displayed an outstanding performance at high current densities delivering up to 100 F g{sup -1} at current densities as high as 250 A g{sup -1}. The exceptionally high capacitance and power of this electrode material is attributed to its good electronic conductivity and a highly effective combination of micro- and fine mesoporosity.

  15. Polyfurfuryl alcohol derived activated carbons for high power electrical double layer capacitors

    International Nuclear Information System (INIS)

    Ruiz, V.; Pandolfo, A.G.

    2010-01-01

    Polyfurfuryl alcohol (PFA) derived activated carbons were prepared by the acid catalysed polymerization of furfuryl alcohol, followed by potassium hydroxide activation. Activated carbons with apparent BET surface areas ranging from 1070 to 2600 m 2 g -1 , and corresponding average micropore sizes between 0.6 and 1.6 nm were obtained. The porosity of these carbons can be carefully controlled during activation and their performance as electrode materials in electric double layer capacitors (EDLCs) in a non-aqueous electrolyte (1 M Et 4 NBF 4 /ACN) is investigated. Carbon materials with a low average pore size ( -1 at an operating voltage window of 0-2.5 V; which corresponds to 32 Wh kg -1 and 38 kW kg -1 on an active material basis. These carbons also displayed an outstanding performance at high current densities delivering up to 100 F g -1 at current densities as high as 250 A g -1 . The exceptionally high capacitance and power of this electrode material is attributed to its good electronic conductivity and a highly effective combination of micro- and fine mesoporosity.

  16. An enhanced lumped element electrical model of a double barrier memristive device

    International Nuclear Information System (INIS)

    Solan, Enver; Ochs, Karlheinz; Dirkmann, Sven; Hansen, Mirko; Kohlstedt, Hermann; Ziegler, Martin; Schroeder, Dietmar; Mussenbrock, Thomas

    2017-01-01

    The massive parallel approach of neuromorphic circuits leads to effective methods for solving complex problems. It has turned out that resistive switching devices with a continuous resistance range are potential candidates for such applications. These devices are memristive systems—nonlinear resistors with memory. They are fabricated in nanotechnology and hence parameter spread during fabrication may aggravate reproducible analyses. This issue makes simulation models of memristive devices worthwhile. Kinetic Monte-Carlo simulations based on a distributed model of the device can be used to understand the underlying physical and chemical phenomena. However, such simulations are very time-consuming and neither convenient for investigations of whole circuits nor for real-time applications, e.g. emulation purposes. Instead, a concentrated model of the device can be used for both fast simulations and real-time applications, respectively. We introduce an enhanced electrical model of a valence change mechanism (VCM) based double barrier memristive device (DBMD) with a continuous resistance range. This device consists of an ultra-thin memristive layer sandwiched between a tunnel barrier and a Schottky-contact. The introduced model leads to very fast simulations by using usual circuit simulation tools while maintaining physically meaningful parameters. Kinetic Monte-Carlo simulations based on a distributed model and experimental data have been utilized as references to verify the concentrated model. (paper)

  17. Important parameters affecting the cell voltage of aqueous electrical double-layer capacitors

    Science.gov (United States)

    Wu, Tzu-Ho; Hsu, Chun-Tsung; Hu, Chi-Chang; Hardwick, Laurence J.

    2013-11-01

    This study discusses and demonstrates how the open-circuit potential and charges stored in the working potential window on positive and negative electrodes affect the cell voltage of carbon-based electrical double-layer capacitors (EDLCs) in aqueous electrolytes. An EDLC consisting of two activated carbon electrodes is employed as the model system for identifying these key parameters although the potential window of water decomposition can be simply determined by voltammetric methods. First, the capacitive performances of an EDLC with the same charge on positive and negative electrodes are evaluated by cyclic voltammetric, charge-discharge, electrochemical impedance spectroscopic (EIS) analyses, and inductance-capacitance-resistance meter (LCR meter). The principles for obtaining the highest acceptable cell voltage of such symmetric ECs with excellent reversibility and capacitor-like behaviour are proposed. Aqueous charge-balanced EDLCs can be operated as high as 2.0 V with high energy efficiency (about 90%) and only 4% capacitance loss after the 600-cycle stability checking. The necessity of charge balance (but not capacitance balance) for positive and negative electrodes is substantiated from the lower acceptable cell voltage of charge-unbalanced EDLCs.

  18. Edge effects in vertically-oriented graphene based electric double-layer capacitors

    Science.gov (United States)

    Yang, Huachao; Yang, Jinyuan; Bo, Zheng; Zhang, Shuo; Yan, Jianhua; Cen, Kefa

    2016-08-01

    Vertically-oriented graphenes (VGs) have been demonstrated as a promising active material for electric double-layer capacitors (EDLCs), partially due to their edge-enriched structure. In this work, the 'edge effects', i.e., edges as the promoters of high capacitance, in VG based EDLCs are investigated with experimental research and numerical simulations. VGs with diverse heights (i.e., edge-to-basal ratios) and edge densities are prepared with varying the plasma-enabled growth time and employing different plasma sources. Electrochemical measurements show that the edges play a predominant role on the charge storage behavior of VGs. A simulation is further conducted to unveil the roles of the edges on the separation and adsorption of ions within VG channels. The initial charge distribution of a VG plane is obtained with density functional theory (DFT) calculations, which is subsequently applied to a molecular dynamics (MD) simulation system to gain the insights into the microscope EDLC structures. Compared with the basal planes, the edges present higher initial charge density (by 4.2 times), higher ion packing density (by 2.6 times), closer ion packing location (by 0.8 Å), and larger ion separation degree (by 14%). The as-obtained findings will be instructive in designing the morphology and structure of VGs for enhanced capacitive performances.

  19. Electric double-layer capacitor based on an ionic clathrate hydrate.

    Science.gov (United States)

    Lee, Wonhee; Kwon, Minchul; Park, Seongmin; Lim, Dongwook; Cha, Jong-Ho; Lee, Huen

    2013-07-01

    Herein, we suggest a new approach to an electric double-layer capacitor (EDLC) that is based on a proton-conducting ionic clathrate hydrate (ICH). The ice-like structures of clathrate hydrates, which are comprised of host water molecules and guest ions, make them suitable for applications in EDLC electrolytes, owing to their high proton conductivities and thermal stabilities. The carbon materials in the ICH Me4NOH⋅5 H2O show a high specific capacitance, reversible charge-discharge behavior, and a long cycle life. The ionic-hydrate complex provides the following advantages in comparison with conventional aqueous and polymer electrolytes: 1) The ICH does not cause leakage problems under normal EDLC operating conditions. 2) The hydrate material can be utilized itself, without requiring any pre-treatments or activation for proton conduction, thus shortening the preparation procedure of the EDLC. 3) The crystallization of the ICH makes it possible to tailor practical EDLC dimensions because of its fluidity as a liquid hydrate. 4) The hydrate solid electrolyte exhibits more-favorable electrochemical stability than aqueous and polymer electrolytes. Therefore, ICH materials are expected to find practical applications in versatile energy devices that incorporate electrochemical systems. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Preparation of porous carbon sphere from waste sugar solution for electric double-layer capacitor

    Science.gov (United States)

    Hao, Zhi-Qiang; Cao, Jing-Pei; Wu, Yan; Zhao, Xiao-Yan; Zhuang, Qi-Qi; Wang, Xing-Yong; Wei, Xian-Yong

    2017-09-01

    Waste sugar solution (WSS), which contains abundant 2-keto-L-gulonic acid, is harmful to the environment if discharged directly. For value-added utilization of the waste resource, a novel process is developed for preparation of porous carbon spheres by hydrothermal carbonization (HTC) of WSS followed by KOH activation. Additionally, the possible preparation mechanism of carbon spheres is proposed. The effects of hydrothermal and activation parameters on the properties of the carbon sphere are also investigated. The carbon sphere is applied to electric double-layer capacitor and its electrochemical performance is studied. These results show that the carbon sphere obtained by HTC at 180 °C for 12 h with the WSS/deionized water volume ratio of 2/3 possess the highest specific capacitance under identical activation conditions. The specific capacitance of the carbon spheres can reach 296.1 F g-1 at a current density of 40 mA g-1. Besides, excellent cycle life and good capacitance retention (89.6%) are observed at 1.5 A g-1 after 5000 cycles. This study not only provides a facile and potential method for the WSS treatment, but also achieves the high value-added recycling of WSS for the preparation of porous carbon spheres with superior electrochemical properties.

  1. Outstanding features of alginate-based gel electrolyte with ionic liquid for electric double layer capacitors

    Science.gov (United States)

    Soeda, Kazunari; Yamagata, Masaki; Ishikawa, Masashi

    2015-04-01

    An alginate-based gel electrolyte with an ionic liquid (Alg/IL) is investigated for electric double-layer capacitors (EDLCs) by using physicochemical and electrochemical measurements. The Alg/EMImBF4 (EMImBF4 = 1-ethyl-3-methylimidazolium tetrafluoroborate) gel electrolyte is thermally stable up to 280 °C, where EMImBF4 decomposes. Furthermore, the EDLC with the gel electrolyte can be operated even at high temperature. The cell containing Alg/EMImBF4 is also electrochemically stable even under high voltage (∼3.5 V) operation. Thus, the alginate is a suitable host polymer for the gel electrolyte for EDLCs. According to the result of charge-discharge characteristics, the voltage drop in the charge-discharge curve for the cell with Alg/EMImBF4 gel electrolyte is considerably smaller than that with liquid-phase EMImBF4 electrolyte. To clarify the effect of Alg in contact with the activated carbon electrode, we also prepared an Alg-containing ACFC electrode (Alg + ACFC), and evaluated its EDLC characteristics in liquid EMImBF4. The results prove that the presence of Alg close to the active materials significantly reduces the internal resistance of the EDLC cell, which may be attributed to the high affinity of Alg to activated carbon.

  2. Carrier mobility and scattering lifetime in electric double-layer gated few-layer graphene

    Energy Technology Data Exchange (ETDEWEB)

    Piatti, E.; Galasso, S.; Tortello, M.; Nair, J.R.; Gerbaldi, C. [Dipartimento di Scienza Applicata e Tecnologia, Politecnico di Torino, 10129 Torino (Italy); Bruna, M.; Borini, S. [Istituto Nazionale di Ricerca Metrologica (INRIM), 10135 Torino (Italy); Daghero, D. [Dipartimento di Scienza Applicata e Tecnologia, Politecnico di Torino, 10129 Torino (Italy); Gonnelli, R.S., E-mail: renato.gonnelli@polito.it [Dipartimento di Scienza Applicata e Tecnologia, Politecnico di Torino, 10129 Torino (Italy)

    2017-02-15

    Highlights: • We fabricated few-layer graphene FETs by mechanical exfoliation and standard microfabrication techniques. • We employed a Li-TFSI based ion gel to induce carrier densities as high as ≈6e14 e{sup −}/cm{sup 2} in the devices' channel. • We found a strong asymmetry in the sheet conductance and mobility doping dependences between electron and hole doping. • We combined the experimental results with ab initio DFT calculations to obtain the average scattering lifetime of the charge carriers. • We found that the increase in the carrier density and an unexpected increase in the density of charged scattering centers compete in determining the scattering lifetime. - Abstract: We fabricate electric double-layer field-effect transistor (EDL-FET) devices on mechanically exfoliated few-layer graphene. We exploit the large capacitance of a polymeric electrolyte to study the transport properties of three, four and five-layer samples under a large induced surface charge density both above and below the glass transition temperature of the polymer. We find that the carrier mobility shows a strong asymmetry between the hole and electron doping regime. We then employ ab initio density functional theory (DFT) calculations to determine the average scattering lifetime from the experimental data. We explain its peculiar dependence on the carrier density in terms of the specific properties of the electrolyte we used in our experiments.

  3. Preparation of activated carbon aerogels with hierarchically porous structures for electrical double layer capacitors

    International Nuclear Information System (INIS)

    Liu, Dong; Shen, Jun; Liu, Nianping; Yang, Huiyu; Du, Ai

    2013-01-01

    Activated carbon aerogels (ACAs) with hierarchically porous structures and high specific surface area have been prepared via CO 2 and KOH activation processes. The pore structures of ACAs are characterized by N 2 adsorption/desorption and scanning electron microscopy. The experimental results show that the ACAs contain three types of pores: micropores with diameters below 2 nm, small mesopores with diameters from 2 to 4 nm and large pores or channels with diameters over 30 nm. The typical sample ACAs-4, which possess pore volume of 2.73 cm 3 g −1 and specific surface area of 2119 m 2 g −1 , exhibits high specific capacitances of 250 F g −1 and 198 F g −1 at the current densities of 0.5 A g −1 and 20 A g −1 respectively in 6 M KOH aqueous solution. Furthermore, the resultant ACAs electrode materials also exhibit high power density, good cycling stability and long lifetime. With these features, ACAs are expected to be promising electrode materials for electrical double layer capacitors

  4. Transparent Thin-Film Transistors Based on Sputtered Electric Double Layer.

    Science.gov (United States)

    Cai, Wensi; Ma, Xiaochen; Zhang, Jiawei; Song, Aimin

    2017-04-20

    Electric-double-layer (EDL) thin-film transistors (TFTs) have attracted much attention due to their low operation voltages. Recently, EDL TFTs gated with radio frequency (RF) magnetron sputtered SiO₂ have been developed which is compatible to large-area electronics fabrication. In this work, fully transparent Indium-Gallium-Zinc-Oxide-based EDL TFTs on glass substrates have been fabricated at room temperature for the first time. A maximum transmittance of about 80% has been achieved in the visible light range. The transparent TFTs show a low operation voltage of 1.5 V due to the large EDL capacitance (0.3 µF/cm² at 20 Hz). The devices exhibit a good performance with a low subthreshold swing of 130 mV/dec and a high on-off ratio > 10⁵. Several tests have also been done to investigate the influences of light irradiation and bias stress. Our results suggest that such transistors might have potential applications in battery-powered transparent electron devices.

  5. Effect of Plasma Membrane Semipermeability in Making the Membrane Electric Double Layer Capacitances Significant.

    Science.gov (United States)

    Sinha, Shayandev; Sachar, Harnoor Singh; Das, Siddhartha

    2018-01-30

    Electric double layers (or EDLs) formed at the membrane-electrolyte interface (MEI) and membrane-cytosol interface (MCI) of a charged lipid bilayer plasma membrane develop finitely large capacitances. However, these EDL capacitances are often much larger than the intrinsic capacitance of the membrane, and all of these capacitances are in series. Consequently, the effect of these EDL capacitances in dictating the overall membrane-EDL effective capacitance C eff becomes negligible. In this paper, we challenge this conventional notion pertaining to the membrane-EDL capacitances. We demonstrate that, on the basis of the system parameters, the EDL capacitance for both the permeable and semipermeable membranes can be small enough to influence C eff . For the semipermeable membranes, however, this lowering of the EDL capacitance can be much larger, ensuring a reduction of C eff by more than 20-25%. Furthermore, for the semipermeable membranes, the reduction in C eff is witnessed over a much larger range of system parameters. We attribute such an occurrence to the highly nonintuitive electrostatic potential distribution associated with the recently discovered phenomena of charge-inversion-like electrostatics and the attainment of a positive zeta potential at the MCI for charged semipermeable membranes. We anticipate that our findings will impact the quantification and the identification of a large number of biophysical phenomena that are probed by measuring the plasma membrane capacitance.

  6. Electrochemical properties of novel ionic liquids for electric double layer capacitor applications

    International Nuclear Information System (INIS)

    Sato, Takaya; Masuda, Gen; Takagi, Kentaro

    2004-01-01

    An aliphatic quaternary ammonium salt which has a methoxyethyl group on the nitrogen atom formed an ionic liquid (room temperature molten salt) when combined with the tetrafluoroborate (BF 4 - ) and bis(trifluoromethylsulfonyl)imide [TFSI; (CF 3 SO 2 ) 2 N - ] anions. The limiting oxidation and reduction potentials, specific conductivity, and some other physicochemical properties of the novel ionic liquids, N,N-diethyl-N-methyl-N-(2-methoxyethyl)ammonium tetrafluoroborate (DEME-BF 4 ) and DEME-TFSI have been evaluated and compared with those of 1-ethyl-3-methylimidazolium tetrafluoroborate. DEME-BF 4 is a practically useful ionic liquid for electrochemical capacitors as it has a quite wide potential window (6.0 V) and high ionic conductivity (4.8 mS cm -1 at 25 deg. C). We prepared an electric double layer capacitor (EDLC) composed of a pair of activated carbon electrodes and DEME-BF 4 as the electrolyte. This EDLC (working voltage ∼2.5 V) has both, a higher capacity above room temperature and a better charge-discharge cycle durability at 100 deg. C when compared to a conventional EDLC using an organic liquid electrolyte such as a tetraethylammonium tetrafluoroborate in propylene carbonate

  7. Suitability of the double Langevin function for description of anhysteretic magnetization curves in NO and GO electrical steel grades

    Directory of Open Access Journals (Sweden)

    Simon Steentjes

    2017-05-01

    Full Text Available This paper compares the match obtained using the classical Langevin function, the tanh function as well as a recently by the authors proposed double Langevin function with the measured anhysteretic magnetization curve of three different non-oriented electrical steel grades and one grain-oriented grade. Two standard non-oriented grades and a high-silicon grade (Si content of 6.5% made by CVD are analyzed. An excellent match is obtained using the double Langevin function, whereas the classical solutions are less appropriate. Thereby, problems such as those due to propagation of approximation errors observed in hysteresis modeling can be bypassed.

  8. Safety Evaluation Report related to the operation of Comanche Peak Steam Electric Station, Units 1 and 2. Docket Nos. 50-445 and 50-446

    International Nuclear Information System (INIS)

    1983-03-01

    Supplement No. 3 to the Safety Evaluation Report (SER) related to the operation of the Comanche Peak Steam electric Station, Units 1 and 2, has been prepared by the Office of Nuclear Reactor Regulation of the US Nuclear Regulatory Commission. the facility is located in Somervell County, Texas. Subject to favorable resolution of the items identified in this supplement, the staff concludes that the facility can be operated by the applicatn without endangering the health and safety of the public. This document provides the NRC staff's evaluation of the outstanding and confirmatory issues that have been resolved since Supplement No. 2 was issued in January 1982, and addresses changes to the SER and its earlier supplements which have resulted from the receipt of additonal information from the applicant during the period of January throught October 1982

  9. Safety evaluation report related to the operation of Comanche Peak Steam Electric Station, Units 1 and 2: Docket Nos. 50-445 and 50-446

    International Nuclear Information System (INIS)

    1988-07-01

    Supplement 15 to the Safety Evaluation Report related to the operation of the Comanche Peak Steam Electric Station (CPSES), Units 1 and 2 (NUREG-0797), has been prepared by the Office of Special Projects of the US Nuclear Regulatory Commission (NRC). The facility is located in Somervell County, Texas, approximately 40 miles southwest of Fort Worth, Texas. This supplement presents the staff's evaluation of the applicant's Corrective Action Program (CAP) related to the design of cable trays and cable tray hangers. The scope and methodologies for the CAP workscope as summarized in Revision O to the cable tray and cable tray hanger project status report and as detailed in related documents referenced in this evaluation were developed to resolve various design issues raised by the Atomic Safety and Licensing Board (ASLB) the intervenor, Citizens Association for Sound Energy (CASE); the Comanche Peak Response Team (CPRT); CYGNA Energy Services (CYGNA); and the NRC staff. The NRC staff concludes that the CAP workscope for cable trays and cable tray hangers provides a comprehensive program for resolving the associated technical concerns identified by the ASLB, CASE, CPRT, CYGNA, and the NRC staff and its implementation ensures that the design of cable trays and cable tray hangers at CPSES satisfies the applicable requirements of 10 CFR Part 50

  10. Safety Evaluation Report related to the operation of Comanche Peak Steam Electric Station, Units 1 and 2 (Docket Nos. 50-445 and 50-446)

    International Nuclear Information System (INIS)

    1990-01-01

    Supplement 22 to the Safety Evaluation Report related to the operation of the Comanche Peak Steam Electric Station, Units 1 and 2 (NUREG-0797), has been prepared by the Office of Nuclear Reactor Regulation of the US Nuclear Regulatory Commission. The facility is located in Somervell County, Texas, approximately 40 miles southwest of Fort Worth, Texas. This supplement reports the status of certain issues that had not been resolved at the time of publication of the Safety Evaluation Report and Supplements 1, 2, 3, 4, 6, 12, and 21 to that report. This supplement also includes the evaluations for licensing items resolved since Supplement 21 was issued. Supplement 5 has been cancelled. Supplements 7 through 11 were limited to the staff evaluation of allegations investigated by the NRC Technical Review Team. Supplement 13 presented the staff's evaluation of the Comanche Peak Response Team (CPRT) Program Plan, which was formulated by the applicant to resolve various construction and design issues raised by sources external to the applicant. Supplements 14 through 20 presented the staff's evaluation of the applicant's Corrective Action Program and CPRT activities. Items identified in Supplements 7, 8, 9, 10, 11, 13, 14, and 15 through 20 are not included in this supplement, except to the extent that they affect the applicant's Final Safety Analysis Report. 154 refs., 24 figs., 8 tabs

  11. Safety evaluation report related to the operation of Comanche Peak Steam Electric Station, Units 1 and 2 (Docket Nos. 50-445 and 50-446)

    International Nuclear Information System (INIS)

    1988-03-01

    Supplement 14 to the Safety Evaluation Report related to the operation of the Comanche Peak Stam Electric Station (CPSES), Units 1 and 2 (NUREG-0797), has been prepared by the Office of Special Projects of the US Nuclear Regulatory Commission (NRC). The facility is located in Somerville County, Texas, approximately 40 miles southwest of Fort Worth, Texas. This supplement presents the staff's evaluation of the applicants' Corrective Action Program (CAP0 related to large ans small bore piping and pipe supports. The scope and methodologies for CAP workshop as summarized in revision O to the large and small bore piping project status reports and as detailed in related documents referenced in this evaluation were developed to resolve various design issues raised by the Atomic Safety and Licensing Board (ASLB);the intervenor, Citizens Association for Sound Energy (CASE);the Camanche Peak Response Team (CPRT);SYGNA Energy Services (CYGNA);and the NRC staff. The NRC staff concludes that the CAP workscopes for large and small bore piping provide a comprehensive program for resolving the associated technical concerns identified by the ASLB, CASE, CPRT, CYGNA, and the NRC staff and their implementation ensures that the design of large and small bore piping and pipe supports at CPSES satisfies the applicable requirements of 10 CFR 50

  12. Suppression of ion conductance by electro-osmotic flow in nano-channels with weakly overlapping electrical double layers

    Directory of Open Access Journals (Sweden)

    Yang Liu

    2016-08-01

    Full Text Available This theoretical study investigates the nonlinear ionic current-voltage characteristics of nano-channels that have weakly overlapping electrical double layers. Numerical simulations as well as a 1-D mathematical model are developed to reveal that the electro-osmotic flow (EOF interplays with the concentration-polarization process and depletes the ion concentration inside the channels, thus significantly suppressing the channel conductance. The conductance may be restored at high electrical biases in the presence of recirculating vortices within the channels. As a result of the EOF-driven ion depletion, a limiting-conductance behavior is identified, which is intrinsically different from the classical limiting-current behavior.

  13. Absorption coefficient and relative refractive index change for a double δ-doped GaAs MIGFET-like structure: Electric and magnetic field effects

    Science.gov (United States)

    Martínez-Orozco, J. C.; Rodríguez-Magdaleno, K. A.; Suárez-López, J. R.; Duque, C. A.; Restrepo, R. L.

    2016-04-01

    In this work we present theoretical results for the electronic structure as well as for the absorption coefficient and relative refractive index change for an asymmetric double δ-doped like confining potential in the active region of a Multiple Independent Gate Field Effect Transistor (MIGFET) system. We model the potential profile as a double δ-doped like potential profile between two Schottky (parabolic) potential barriers that are just the main characteristics of the MIGFET configuration. We investigate the effect of external electromagnetic fields in this kind of quantum structures, in particular we applied a homogeneous constant electric field in the growth direction z as well as a homogeneous constant magnetic field in the x-direction. In general we conclude that by applying electromagnetic fields we can modulate the resonant peaks of the absorption coefficient as well as their energy position. Also with such probes it is possible to control the nodes and amplitude of the relative refractive index changes related to resonant intersubband optical transitions.

  14. Driving mechanisms of ionic polymer actuators having electric double layer capacitor structures.

    Science.gov (United States)

    Imaizumi, Satoru; Kato, Yuichi; Kokubo, Hisashi; Watanabe, Masayoshi

    2012-04-26

    Two solid polymer electrolytes, composed of a polyether-segmented polyurethaneurea (PEUU) and either a lithium salt (lithium bis(trifluoromethanesulfonyl)amide: Li[NTf2]) or a nonvolatile ionic liquid (1-ethyl-3-methylimidazolium bis(trifluoromethanesulfonyl)amide: [C2mim][NTf2]), were prepared in order to utilize them as ionic polymer actuators. These salts were preferentially dissolved in the polyether phases. The ionic transport mechanism of the polyethers was discussed in terms of the diffusion coefficients and ionic transference numbers of the incorporated ions, which were estimated by means of pulsed-field gradient spin-echo (PGSE) NMR. There was a distinct difference in the ionic transport properties of each polymer electrolyte owing to the difference in the magnitude of interactions between the cations and the polyether. The anionic diffusion coefficient was much faster than that of the cation in the polyether/Li[NTf2] electrolyte, whereas the cation diffused faster than the anion in the polyether/[C2mim][NTf2] electrolyte. Ionic polymer actuators, which have a solid-state electric-double-layer-capacitor (EDLC) structure, were prepared using these polymer electrolyte membranes and ubiquitous carbon materials such as activated carbon and acetylene black. On the basis of the difference in the motional direction of each actuator against applied voltages, a simple model of the actuation mechanisms was proposed by taking the difference in ionic transport properties into consideration. This model discriminated the behavior of the actuators in terms of the products of transference numbers and ionic volumes. The experimentally observed behavior of the actuators was successfully explained by this model.

  15. Characteristics of powdered activated carbon treated with dielectric barrier discharge for electric double-layer capacitors

    International Nuclear Information System (INIS)

    Tashima, Daisuke; Yoshitama, Hiromu; Sakoda, Tatsuya; Okazaki, Akihito; Kawaji, Takayuki

    2012-01-01

    Highlights: ► The specific capacitance of the EDLCs could be improved by oxygen plasma treatment. ► 15 s treated EDLCs showed a 20% increase in capacitance relative to untreated EDLCs. ► The plasma treatment yields EDLCs that are suitable for high-energy applications. - Abstract: The electrochemical properties of electric double-layer capacitors (EDLCs) made with plasma-treated powdered activated carbon (treated using a dielectric barrier discharge) were examined using cyclic voltammetry (CV), Cole–Cole plots, and X-ray photoelectron spectroscopy (XPS). The dielectric barrier discharge method, which operates at atmospheric pressure, dramatically reduces the processing time and does not require vacuum equipment, making it a more practical alternative than low-pressure plasma treatment. The experimental data indicate that the specific capacitance of the EDLCs could be improved by oxygen plasma treatment. Capacitance of EDLCs made with activated carbon treated for 15 s showed 193.5 F/g that 20% increase in the specific capacitance relative to untreated EDLCs. This result indicates that the plasma treatment yields EDLCs that are suitable for high-energy applications. The enhancement of capacitance was mainly attributed to an increase in the BET surface area of the activated carbon and the creation of carboxyl groups on the surface of the carbon. The carboxyl groups induced oxidation–reduction reactions in the presence of O 2 which was included in the operation gas. In addition, the carboxyl groups improved the penetration of the electrolyte solution into the carbon electrodes.

  16. A systematic comparison of different approaches of density functional theory for the study of electrical double layers

    International Nuclear Information System (INIS)

    Yang, Guomin; Liu, Longcheng

    2015-01-01

    Based on the best available knowledge of density functional theory (DFT), the reference-fluid perturbation method is here extended to yield different approaches that well account for the cross correlations between the Columbic interaction and the hard-sphere exclusion in an inhomogeneous ionic hard-sphere fluid. In order to quantitatively evaluate the advantage and disadvantage of different approaches in describing the interfacial properties of electrical double layers, this study makes a systematic comparison against Monte Carlo simulations over a wide range of conditions. The results suggest that the accuracy of the DFT approaches is well correlated to a coupling parameter that describes the coupling strength of electrical double layers by accounting for the steric effect and that can be used to classify the systems into two regimes. In the weak-coupling regime, the approaches based on the bulk-fluid perturbation method are shown to be more accurate than the counterparts based on the reference-fluid perturbation method, whereas they exhibit the opposite behavior in the strong-coupling regime. More importantly, the analysis indicates that, with a suitable choice of the reference fluid, the weighted correlation approximation (WCA) to DFT gives the best account of the coupling effect of the electrostatic-excluded volume correlations. As a result, a piecewise WCA approach can be developed that is robust enough to describe the structural and thermodynamic properties of electrical double layers over both weak- and strong-coupling regimes

  17. Application of a Gradient Descent Continuous Actor-Critic Algorithm for Double-Side Day-Ahead Electricity Market Modeling

    Directory of Open Access Journals (Sweden)

    Huiru Zhao

    2016-09-01

    Full Text Available An important goal of China’s electric power system reform is to create a double-side day-ahead wholesale electricity market in the future, where the suppliers (represented by GenCOs and demanders (represented by DisCOs compete simultaneously with each other in one market. Therefore, modeling and simulating the dynamic bidding process and the equilibrium in the double-side day-ahead electricity market scientifically is not only important to some developed countries, but also to China to provide a bidding decision-making tool to help GenCOs and DisCOs obtain more profits in market competition. Meanwhile, it can also provide an economic analysis tool to help government officials design the proper market mechanisms and policies. The traditional dynamic game model and table-based reinforcement learning algorithm have already been employed in the day-ahead electricity market modeling. However, those models are based on some assumptions, such as taking the probability distribution function of market clearing price (MCP and each rival’s bidding strategy as common knowledge (in dynamic game market models, and assuming the discrete state and action sets of every agent (in table-based reinforcement learning market models, which are no longer applicable in a realistic situation. In this paper, a modified reinforcement learning method, called gradient descent continuous Actor-Critic (GDCAC algorithm was employed in the double-side day-ahead electricity market modeling and simulation. This algorithm can not only get rid of the abovementioned unrealistic assumptions, but also cope with the Markov decision-making process with continuous state and action sets just like the real electricity market. Meanwhile, the time complexity of our proposed model is only O(n. The simulation result of employing the proposed model in the double-side day-ahead electricity market shows the superiority of our approach in terms of participant’s profit or social welfare

  18. Electrical conduction of organic ultrathin films evaluated by an independently driven double-tip scanning tunneling microscope.

    Science.gov (United States)

    Takami, K; Tsuruta, S; Miyake, Y; Akai-Kasaya, M; Saito, A; Aono, M; Kuwahara, Y

    2011-11-02

    The electrical transport properties of organic thin films within the micrometer scale have been evaluated by a laboratory-built independently driven double-tip scanning tunneling microscope, operating under ambient conditions. The two tips were used as point contact electrodes, and current in the range from 0.1 pA to 100 nA flowing between the two tips through the material can be detected. We demonstrated two-dimensional contour mapping of the electrical resistance on a poly(3-octylthiophene) thin films as shown below. The obtained contour map clearly provided an image of two-dimensional electrical conductance between two point electrodes on the poly(3-octylthiophene) thin film. The conductivity of the thin film was estimated to be (1-8) × 10(-6) S cm(-1). Future prospects and the desired development of multiprobe STMs are also discussed.

  19. Analysis of output power and capacity reduction in electrical storage facilities by peak shift control of PV system with bifacial modules

    International Nuclear Information System (INIS)

    Obara, Shin’ya; Konno, Daisuke; Utsugi, Yuta; Morel, Jorge

    2014-01-01

    Highlights: • Characteristics of a large-scale power plant using bifacial solar cell is described. • Conversion efficiency of bifacial photovoltaics obtained using 3D-CAD modeling. • Power supply of bifacial PV can be matched with demand by adjusting the orientation. - Abstract: Bifacial photovoltaics are widely investigated with the aim of reducing the amount of silicon used and increasing conversion efficiencies. The output power of bifacial photovoltaics depends on the quantity of solar radiation incident on the reverse face. Furthermore, controlling the orientation can distribute the times of peak power output in the morning and afternoon to better match the demand. In this study, the demand patterns of individual houses or the whole Hokkaido region were analyzed assuming the substitution of a conventional large-scale electric power system with one using bifacial photovoltaics. The supply–demand balances and electrical storage capacities were investigated. When comparing a large scale solar power plant (mega-solar power plant) using monofacial photovoltaics or vertical bifacial photovoltaics (in which the orientation could be adjusted), the supply–demand could be better balanced for individual houses in the latter case, thereby allowing the storage capacity to be reduced. A bifacial solar module was modeled by 3D-CAD (three dimensional computer aided design) and thermal fluid analysis. The module temperature distribution of bifacial photovoltaics was calculated with respect to the environmental conditions (wind flow, direct and diffuse solar radiation, etc.) and internal heat generation, as well as the orientation of the solar panels. Furthermore, the output power of bifacial photovoltaics can be easily obtained from the analysis result of modular temperature distribution and the relation between temperature and output power

  20. 'Peak oil' or 'peak demand'?

    International Nuclear Information System (INIS)

    Chevallier, Bruno; Moncomble, Jean-Eudes; Sigonney, Pierre; Vially, Rolland; Bosseboeuf, Didier; Chateau, Bertrand

    2012-01-01

    This article reports a workshop which addressed several energy issues like the objectives and constraints of energy mix scenarios, the differences between the approaches in different countries, the cost of new technologies implemented for this purposes, how these technologies will be developed and marketed, which will be the environmental and societal acceptability of these technical choices. Different aspects and issues have been more precisely presented and discussed: the peak oil, development of shale gases and their cost (will non conventional hydrocarbons modify the peak oil and be socially accepted?), energy efficiency (its benefits, its reality in France and other countries, its position in front of the challenge of energy transition), and strategies in the transport sector (challenges for mobility, evolution towards a model of sustainable mobility)

  1. The double peaks and symmetric path phenomena in the catalytic activity of Pd/Al2O3-TiO2 catalysts with different TiO2 contents

    Science.gov (United States)

    Zhang, Shen; Guo, Yuyu; Li, Xingying; Wu, Xu; Li, Zhe

    2018-06-01

    Physicochemical properties of Pd/Al2O3-TiO2 catalysts with different amounts of TiO2 contents were investigated by XRD, nitrogen adsorption-desorption, FTIR, NH3-TPD, H2-TPR and XPS techniques. Catalysts of different compositions were tested in the ethanol oxidation reaction to study the effects of TiO2 contents. Double peaks and symmetric path phenomena were observed at certain temperatures with the increase in TiO2 contents. The symmetric peak phenomena and the diverse activity fluctuations have been ascribed to the controlling factors such as temperature and compositions. With the increase in TiO2 content, the surface area, adsorbed oxygen contents and surface acid quantity decreased gradually. The large surface area and adsorbed oxygen contents were conducive to the performance, while increased acid amounts were not beneficial for ethanol oxidation. At 150 and 175 °C, Pd/AT(X1

  2. Aerial radiological survey of the Comanche Peak Steam Electric Station and surrounding area, Glen Rose, Texas. Date of Survey: March 1982

    International Nuclear Information System (INIS)

    1982-12-01

    An aerial radiological survey was performed from 1 to 9 March 1982 over a 260-square-kilometer area centered on the Comanche Peak Steam Electric Station located in Somervell County, Texas. The survey was conducted by the Energy Measurements Group of EG and G for the US Nuclear Regulatory Commission. All gamma ray data were collected by flying parallel lines spaced 152 meters (500 feet) apart at an altitude of 91 meters (300 feet) above ground level. Count rates obtained from the aerial platform were converted to total exposure rates at 1 meter above the ground and are presented in the form of an isoradiation contour map. The observed exposure rates ranged from 6 to 12 microroentgens per hour (μR/h), with the average background ranging from 6 to 8 μR/h. These values include an estimated cosmic ray contribution of 3.8 μR/h. The exposure rates obtained from ground-based measurements taken in typical background locations within the survey area displayed positive agreement with the aerial data

  3. Safety evaluation report related to the operation of Comanche Peak Steam Electric Station, Units 1 and 2 (Docket Nos. 50-445 and 50-446)

    International Nuclear Information System (INIS)

    1988-11-01

    Supplement 18 to the Safety Evaluation Report related to the operation of the Comanche Peak Steam Electric Station (CPSES), Units 1 and 2 (NUREG-0797), has been prepared by the Office of Special Projects of the US Nuclear Regulatory Commission (NRC). The facility is located in Somervell County, Texas, approximately 40 miles southwest of Fort Worth, Texas. This supplement presents the staff's evaluation of the applicant's Corrective Action Program (CAP) related to the structural design of the heating, ventilation, and air conditioning (HVAC) systems. The scope and methodologies for the CAP workscope as summarized in Revision 0 to the HVAC project status report and as detailed in related documents referenced in this evaluation were developed to resolve the technical concerns identified in the HVAC area. The NRC staff concludes that the CAP workscope for the HVAC structural design provides a comprehensive program for resolving the associated technical concerns and its implementation ensures that the structural design of the HVAC systems at CPSES satisfies the applicable requirements of 10 CFR Part 50. 32 refs

  4. Safety Evaluation Report related to the operation of Comanche Peak Steam Electric Station, Units 1 and 2 (Docket Nos. 50-445 and 50-446). Supplement No. 7

    International Nuclear Information System (INIS)

    1985-01-01

    Supplement 7 to the Safety Evaluation Report for the Texas Utilities Electric Company application for a license to operate Comanche Peak Steam Electric Station, Units 1 and 2 (Docket Nos. 50-445, 50-446), located in Somervell County, Texas, has been jointly prepared by the Office of Nuclear Reactor Regulation and the Comanche Peak Technical Review of the US Nuclera Regulatory Commission. This supplement provides the results of the staff's evaluation and resolution of approximately 80 technical concerns and allegations in the areas of Electric/Instrumentation and Test Programs regarding construction and plant readiness testing practices at the Comanche Peak facility. Issues raised during Atomic Safety and Licensing Board hearings will be dealt with in future supplements to the Safety Evaluation Report

  5. Dynamic behaviour of the silica-water-bio electrical double layer in the presence of a divalent electrolyte.

    Science.gov (United States)

    Lowe, B M; Maekawa, Y; Shibuta, Y; Sakata, T; Skylaris, C-K; Green, N G

    2017-01-25

    Electronic devices are becoming increasingly used in chemical- and bio-sensing applications and therefore understanding the silica-electrolyte interface at the atomic scale is becoming increasingly important. For example, field-effect biosensors (BioFETs) operate by measuring perturbations in the electric field produced by the electrical double layer due to biomolecules binding on the surface. In this paper, explicit-solvent atomistic calculations of this electric field are presented and the structure and dynamics of the interface are investigated in different ionic strengths using molecular dynamics simulations. Novel results from simulation of the addition of DNA molecules and divalent ions are also presented, the latter of particular importance in both physiological solutions and biosensing experiments. The simulations demonstrated evidence of charge inversion, which is known to occur experimentally for divalent electrolyte systems. A strong interaction between ions and DNA phosphate groups was demonstrated in mixed electrolyte solutions, which are relevant to experimental observations of device sensitivity in the literature. The bound DNA resulted in local changes to the electric field at the surface; however, the spatial- and temporal-mean electric field showed no significant change. This result is explained by strong screening resulting from a combination of strongly polarised water and a compact layer of counterions around the DNA and silica surface. This work suggests that the saturation of the Stern layer is an important factor in determining BioFET response to increased salt concentration and provides novel insight into the interplay between ions and the EDL.

  6. Characteristics of Superjunction Lateral-Double-Diffusion Metal Oxide Semiconductor Field Effect Transistor and Degradation after Electrical Stress

    Science.gov (United States)

    Lin, Jyh‑Ling; Lin, Ming‑Jang; Lin, Li‑Jheng

    2006-04-01

    The superjunction lateral double diffusion metal oxide semiconductor field effect has recently received considerable attention. Introducing heavily doped p-type strips to the n-type drift region increases the horizontal depletion capability. Consequently, the doping concentration of the drift region is higher and the conduction resistance is lower than those of conventional lateral-double-diffusion metal oxide semiconductor field effect transistors (LDMOSFETs). These characteristics may increase breakdown voltage (\\mathit{BV}) and reduce specific on-resistance (Ron,sp). In this study, we focus on the electrical characteristics of conventional LDMOSFETs on silicon bulk, silicon-on-insulator (SOI) LDMOSFETs and superjunction LDMOSFETs after bias stress. Additionally, the \\mathit{BV} and Ron,sp of superjunction LDMOSFETs with different N/P drift region widths and different dosages are discussed. Simulation tools, including two-dimensional (2-D) TSPREM-4/MEDICI and three-dimensional (3-D) DAVINCI, were employed to determine the device characteristics.

  7. On the contact values of the density profiles in an electric double layer using density functional theory

    Directory of Open Access Journals (Sweden)

    L.B. Bhuiyan

    2012-06-01

    Full Text Available A recently proposed, local second contact value theorem [Henderson D., Boda D., J. Electroanal. Chem., 2005, Vol. 582, 16] for the charge profile of an electric double layer is used in conjunction with existing Monte Carlo data from the literature to assess the contact behavior of the electrode-ion distributions predicted by the density functional theory. The results for the contact values of the co- and counterion distributions and their product are obtained for the symmetric valency, restricted primitive model planar double layer for a range of electrolyte concentrations and temperatures. Overall the theoretical results satisfy the second contact value theorem reasonably well the agreement with the simulations being semi-quantitative or better. The product of the co- and counterion contact values as a function of the electrode surface charge density is qualitative with the simulations with increasing deviations at higher concentrations.

  8. Mean-Field Theory of Electrical Double Layer In Ionic Liquids with Account of Short-Range Correlations

    International Nuclear Information System (INIS)

    Goodwin, Zachary A.H.; Feng, Guang; Kornyshev, Alexei A.

    2017-01-01

    We develop the theory of the electrical double layer in ionic liquids as proposed earlier by Kornyshev (2007). In the free energy function we keep the so called ‘short-range correlation terms’ which were omitted there. With some simplifying assumptions, we arrive at a modified expression for differential capacitance, which makes differential capacitance curves less sharply depending on electrode potential and having smaller values at extrema than in the previous theory. This brings the results closer to typical experimental observations, and makes it appealing to use this formalism for treatment of experimental data. Implications on Debye length and the extent of ion paring in ionic liquids are then briefly discussed.

  9. Threshold electrical stimulation (TES) in ambulant children with CP: a randomized double-blind placebo-controlled clinical trial

    DEFF Research Database (Denmark)

    Dali, Christine í; Hansen, Flemming Juul; Pedersen, Søren Anker

    2002-01-01

    A randomized double-blind placebo-controlled clinical trial was carried out to determine whether a group of stable children with cerebral palsy (36 males, 21 females; mean age 10 years 11 months, range 5 to 18 years) would improve their motor skills after 12 months of threshold electrical...... stimulation (TES). Two thirds received active and one third received inactive stimulators. For the primary outcome we constructed a set of plausible motor function tests and studied the change in summary indices of the performance measurements. Tests were videotaped and assessed blindly to record qualitative...

  10. The effect of the electrical double layer on hydrodynamic lubrication: a non-monotonic trend with increasing zeta potential

    Directory of Open Access Journals (Sweden)

    Dalei Jing

    2017-07-01

    Full Text Available In the present study, a modified Reynolds equation including the electrical double layer (EDL-induced electroviscous effect of lubricant is established to investigate the effect of the EDL on the hydrodynamic lubrication of a 1D slider bearing. The theoretical model is based on the nonlinear Poisson–Boltzmann equation without the use of the Debye–Hückel approximation. Furthermore, the variation in the bulk electrical conductivity of the lubricant under the influence of the EDL is also considered during the theoretical analysis of hydrodynamic lubrication. The results show that the EDL can increase the hydrodynamic load capacity of the lubricant in a 1D slider bearing. More importantly, the hydrodynamic load capacity of the lubricant under the influence of the EDL shows a non-monotonic trend, changing from enhancement to attenuation with a gradual increase in the absolute value of the zeta potential. This non-monotonic hydrodynamic lubrication is dependent on the non-monotonic electroviscous effect of the lubricant generated by the EDL, which is dominated by the non-monotonic electrical field strength and non-monotonic electrical body force on the lubricant. The subject of the paper is the theoretical modeling and the corresponding analysis.

  11. The electric double layer at high surface potentials: The influence of excess ion polarizability

    NARCIS (Netherlands)

    Hatlo, M. M.; van Roij, R.H.H.G.; Lue, L.

    2012-01-01

    By including the excess ion polarizability into the Poisson-Boltzmann theory, we show that the decrease in differential capacitance with voltage, observed for metal electrodes above a threshold potential, can be understood in terms of thickening of the double layer due to ion-induced polarizability

  12. Effects of image charges, interfacial charge discreteness, and surface roughness on the zeta potential of spherical electric double layers.

    Science.gov (United States)

    Gan, Zecheng; Xing, Xiangjun; Xu, Zhenli

    2012-07-21

    We investigate the effects of image charges, interfacial charge discreteness, and surface roughness on spherical electric double layer structures in electrolyte solutions with divalent counterions in the setting of the primitive model. By using Monte Carlo simulations and the image charge method, the zeta potential profile and the integrated charge distribution function are computed for varying surface charge strengths and salt concentrations. Systematic comparisons were carried out between three distinct models for interfacial charges: (1) SURF1 with uniform surface charges, (2) SURF2 with discrete point charges on the interface, and (3) SURF3 with discrete interfacial charges and finite excluded volume. By comparing the integrated charge distribution function and the zeta potential profile, we argue that the potential at the distance of one ion diameter from the macroion surface is a suitable location to define the zeta potential. In SURF2 model, we find that image charge effects strongly enhance charge inversion for monovalent interfacial charges, and strongly suppress charge inversion for multivalent interfacial charges. For SURF3, the image charge effect becomes much smaller. Finally, with image charges in action, we find that excluded volumes (in SURF3) suppress charge inversion for monovalent interfacial charges and enhance charge inversion for multivalent interfacial charges. Overall, our results demonstrate that all these aspects, i.e., image charges, interfacial charge discreteness, their excluding volumes, have significant impacts on zeta potentials of electric double layers.

  13. Determination of Surface Potential and Electrical Double-Layer Structure at the Aqueous Electrolyte-Nanoparticle Interface

    Directory of Open Access Journals (Sweden)

    Matthew A. Brown

    2016-01-01

    Full Text Available The structure of the electrical double layer has been debated for well over a century, since it mediates colloidal interactions, regulates surface structure, controls reactivity, sets capacitance, and represents the central element of electrochemical supercapacitors. The surface potential of such surfaces generally exceeds the electrokinetic potential, often substantially. Traditionally, a Stern layer of nonspecifically adsorbed ions has been invoked to rationalize the difference between these two potentials; however, the inability to directly measure the surface potential of dispersed systems has rendered quantitative measurements of the Stern layer potential, and other quantities associated with the outer Helmholtz plane, impossible. Here, we use x-ray photoelectron spectroscopy from a liquid microjet to measure the absolute surface potentials of silica nanoparticles dispersed in aqueous electrolytes. We quantitatively determine the impact of specific cations (Li^{+}, Na^{+}, K^{+}, and Cs^{+} in chloride electrolytes on the surface potential, the location of the shear plane, and the capacitance of the Stern layer. We find that the magnitude of the surface potential increases linearly with the hydrated-cation radius. Interpreting our data using the simplest assumptions and most straightforward understanding of Gouy-Chapman-Stern theory reveals a Stern layer whose thickness corresponds to a single layer of water molecules hydrating the silica surface, plus the radius of the hydrated cation. These results subject electrical double-layer theories to direct and falsifiable tests to reveal a physically intuitive and quantitatively verified picture of the Stern layer that is consistent across multiple electrolytes and solution conditions.

  14. Determination of Surface Potential and Electrical Double-Layer Structure at the Aqueous Electrolyte-Nanoparticle Interface

    Science.gov (United States)

    Brown, Matthew A.; Abbas, Zareen; Kleibert, Armin; Green, Richard G.; Goel, Alok; May, Sylvio; Squires, Todd M.

    2016-01-01

    The structure of the electrical double layer has been debated for well over a century, since it mediates colloidal interactions, regulates surface structure, controls reactivity, sets capacitance, and represents the central element of electrochemical supercapacitors. The surface potential of such surfaces generally exceeds the electrokinetic potential, often substantially. Traditionally, a Stern layer of nonspecifically adsorbed ions has been invoked to rationalize the difference between these two potentials; however, the inability to directly measure the surface potential of dispersed systems has rendered quantitative measurements of the Stern layer potential, and other quantities associated with the outer Helmholtz plane, impossible. Here, we use x-ray photoelectron spectroscopy from a liquid microjet to measure the absolute surface potentials of silica nanoparticles dispersed in aqueous electrolytes. We quantitatively determine the impact of specific cations (Li+ , Na+ , K+ , and Cs+ ) in chloride electrolytes on the surface potential, the location of the shear plane, and the capacitance of the Stern layer. We find that the magnitude of the surface potential increases linearly with the hydrated-cation radius. Interpreting our data using the simplest assumptions and most straightforward understanding of Gouy-Chapman-Stern theory reveals a Stern layer whose thickness corresponds to a single layer of water molecules hydrating the silica surface, plus the radius of the hydrated cation. These results subject electrical double-layer theories to direct and falsifiable tests to reveal a physically intuitive and quantitatively verified picture of the Stern layer that is consistent across multiple electrolytes and solution conditions.

  15. Safety Evaluation Report related to the operation of Comanche Peak Steam Electric Station, Units 1 and 2 (Docket Nos. 50-445 and 50-446). Supplement No. 8

    International Nuclear Information System (INIS)

    1985-02-01

    Supplement 8 to the Safety Evaluation Report for the Texas Utilities Electric Company application for a license to operate Comanche Peak Steam Electric Station, Units 1 and 2 (Docket Nos. 50-445, 50-446), located in Somervell County, Texas, has been jointly prepared by the Office of Nuclear Reactor Regulation and the Comanche Peak Technical Review Team of the US Nuclear Regulatory Commission. This Supplement provides the results of the staff's evaluation and resolution of approximately 80 technical concerns and allegations relating to civil and structural and miscellaneous issues regarding construction and plant readiness testing practices at the Comanche Peak facility. Issues raised during recent Atomic Safety and Licensing Board hearings will be dealt with in future supplements to the Safety Evaluation Report

  16. Performance of a CW double electric discharge for supersonic CO lasers

    Science.gov (United States)

    Stanton, A. C.; Hanson, R. K.; Mitchner, M.

    1980-01-01

    The results of an experimental investigation of a CW double discharge in supersonic CO mixtures are reported. Stable discharges in CO/N2 and CO/Ar mixtures, with a maximum energy loading of 0.5 eV/CO molecule, were achieved in a small-scale continuous-flow supersonic channel. Detailed measurements of the discharge characteristics were performed, including electrostatic probe measurements of floating potential and electron number density and spectroscopic measurements of the CO vibrational population distributions. The results of these measurements indicate that the vibrational excitation efficiency of the discharge is approximately 60%, for moderate levels of main discharge current. These experiments, on a small scale, demonstrate that the double-discharge scheme provides adequate vibrational energy loading for efficient CO laser operation under CW supersonic flow conditions.

  17. Peak regulation right

    International Nuclear Information System (INIS)

    Gao, Z. |; Ren, Z.; Li, Z.; Zhu, R.

    2005-01-01

    A peak regulation right concept and corresponding transaction mechanism for an electricity market was presented. The market was based on a power pool and independent system operator (ISO) model. Peak regulation right (PRR) was defined as a downward regulation capacity purchase option which allowed PRR owners to buy certain quantities of peak regulation capacity (PRC) at a specific price during a specified period from suppliers. The PRR owner also had the right to decide whether or not they would buy PRC from suppliers. It was the power pool's responsibility to provide competitive and fair peak regulation trading markets to participants. The introduction of PRR allowed for unit capacity regulation. The PRR and PRC were rated by the supplier, and transactions proceeded through a bidding process. PRR suppliers obtained profits by selling PRR and PRC, and obtained downward regulation fees regardless of whether purchases are made. It was concluded that the peak regulation mechanism reduced the total cost of the generating system and increased the social surplus. 6 refs., 1 tab., 3 figs

  18. Two-electron states in double quantum dot in direct electric field

    International Nuclear Information System (INIS)

    Burdov, V.A.

    2001-01-01

    One determined analytically the wave functions of stationary states and the spectrum of two-electron system in symmetric binary quantum point. It is shown that in the normal state at the absence of external electric field the electrons due to the Coulomb blockade can not be collectively in one quantum point. In the external electric field the situation changes. When a certain critical value of field intensity is reached the probability of detection of both electrons in one quantum point by a jump increases from zero up to 1 [ru

  19. Introduction of electric double layer capacitors in the solar-EV; Solar denki jidosha eno denki nijuso condenser no oyo

    Energy Technology Data Exchange (ETDEWEB)

    Fujinaka, M [Tokyo Denki University, Tokyo (Japan)

    1996-10-27

    A basic experiment was carried out on a supplementary power supply, in which solar cells and electric double layer capacitors(EDLC) were combined for a DC/DC converter, for the use of a solar-electric vehicle (S-EV); and in actuality, an S-EV was loaded with the power supply with a running test conducted on a public road. The EDLC was found effective and useful for avoiding temporary lowering of voltage and momentary break. An electric supply was thereby made possible for an emergency light without the use of the DC/DC converter. However, in a tunnel or a night driving and in case of failure of the DC/DC converter, an operating time of only 7 minutes or so was affordable with the EDLC having a capacity of 100F. Moreover, particularly with a heavy load, it was impossible to maintain a voltage for many hours. Under the circumstances, an S-EV design would primarily require two sets of independent DC/DC converter loaded in the future. The EDLC, young after it was developed, still has a small energy density compared with a lead storage battery. Yet, an EDLC with a higher performance being developed, there is a possibility that it will be applied to S-EV`s by utilizing its characteristics such as a high efficiency and a long service life. 4 refs., 8 figs.

  20. Electric and dielectric behavior of copper-chromium layered double hydroxide intercalated with dodecyl sulfate anions using impedance spectroscopy

    Science.gov (United States)

    Elhatimi, Wafaa; Bouragba, Fatima Zahra; Lahkale, Redouane; Sadik, Rachid; Lebbar, Nacira; Siniti, Mostapha; Sabbar, Elmouloudi

    2018-05-01

    The Cu2Cr-DS-LDH hybrid was successfully prepared by the anion exchange method at room temperature. The structure, the chemical composition and the physico-chemical properties of the sample were determined using powder X-ray diffraction (PXRD), Fourier transform infrared spectroscopy (FT-IR), thermogravimetric analysis (TGA) and inductively coupled plasma (ICP). In this work, the electrical and dielectric properties investigated are determined using impedance spectroscopy (IS) in a frequency range of 1 Hz to 1 MHz. Indeed, the Nyquist diagram modelized by an electrical equivalent circuit showed three contributions attributed respectively to the polarization of grains, grains boundaries and interface electrode-sample. This modelization allowed us to determine the intrinsic electrical parameters of the hybrid (resistance, pseudo-capacitance and relaxation time). The presence of the non-Debye relaxation phenomena was confirmed by the frequency analysis of impedance. Moreover, the evolution of the alternating current conductivity (σac) studied obeys the double power law of Jonscher. The ionic conduction of this material was generated through a jump movement by translation of the charge carriers. As for the dielectric behavior of the material, the evolution of dielectric constant as a function of frequency shows relatively high values in a frequency range between 10 Hz and 1 KHz. The low values of the loss tangent obtained in this frequency zone can valorize this LDH hybrid.

  1. Les mécanismes d'action des détergents et les doubles couche électriques aux interfaces Action Mechanisms of Detergents and Double Electric Layer At Interfaces

    Directory of Open Access Journals (Sweden)

    Briant J.

    2006-11-01

    Full Text Available Les doubles couches électriques aux interfaces jouent un rôle important dans l'action des additifs détergents ioniques, surtout dans la stabilisation des suspensions. Les phénomènes électrocinétiques aux interfaces : électroosmose, potentiel d'écoulement, électrophorèse, potentiel de sédimentation permettent de mettre en évidence la double couche électrique et d'en déterminer certaines caractéristiques signe de la charge de la couche mobile, potentiel électrocinétique, etc. Les relations entre la stabilité des suspensions et l'interaction des doubles couches électriques ont fait l'objet d'études approfondies de Deriaguin, Verwey et Overbeek. Ces auteurs ont analysé le mécanisme d'action des doubles couches électriques et la façon dont elles pouvaient créer des forces de répulsion capables de surmonter les forces d'attraction de Van der Waals entre particules. Leur analyse permet d'expliquer les observations faites sur les effets de la charge des particules, la nature des ions fixés, la concentration de la phase dispersante en produits actifs. Le mécanisme d'action des doubles couches électriques permet peut-être d'appréhender mieux le mécanisme d'action des additifs non ioniques. Double electric loyers at interfaces play an important part in the action of ionic detergent additives, especially in the stability of suspensions. Electrokinetic phenomena at interfaces (electroosmosis,flow potential, electrophoresis, sedimentation potential can be used to reveal the double electric layer and to determine various properties such as the sign of the charge of the mobile loyer, the electrokinetic potential, etc. The relations between the stabillity of suspensions and the interaction of double electric loyers have been the subject of in-depth research by Deriaguin, Verwey and Overbeek. The authors have analyzed the action mechanism of double electric loyers and the way they can create repulsion forces capable of overcoming

  2. Electric double layer effect on observable characteristics of the tunnel current through a bridged electrochemical contact

    DEFF Research Database (Denmark)

    Kuznetsov, A.M.; Medvedev, I.G.; Ulstrup, Jens

    2007-01-01

    Scanning tunneling microscopy and electrical conductivity of redox molecules in conducting media (aqueous or other media) acquire increasing importance both as novel single-molecule science and with a view on molecular scale functional elements. Such configurations require full and independent el...

  3. Towards understanding the structure and capacitance of electrical double layer in ionic liquids

    Energy Technology Data Exchange (ETDEWEB)

    Fedorov, Maxim V. [Max Planck Institute for Mathematics in the Sciences, D 04103 Leipzig (Germany); Unilever Centre for Molecular Science Informatics, Department of Chemistry, University of Cambridge, Lensfield Road, Cambridge CB2 1EW (United Kingdom); Kornyshev, Alexei A. [Department of Chemistry, Faculty of Natural Sciences, Imperial College London, SW7 2AZ London (United Kingdom)

    2008-10-01

    In order to understand basic principles of the double layer formation in room temperature ionic liquids, we have performed Molecular Dynamic simulations for a simplified system: dense assembly of charged Lennard-Jones spheres between charged walls. For simplicity, in this first investigation we have considered the cations and anions of the same size. We have calculated the corresponding values of the double layer capacitance as a function of the electrode potential and compared the results with existing theories. We have found that the capacitance curve does not follow the U-shape of the Gouy-Chapman theory, but has a bell-shape in agreement with the mean-field theory that takes into account the effect of limited maximum packing of ions. The wings of capacitance decrease inversely proportional to the square root of the electrode potential, as prescribed by the mean-field theory and the charge conservation law at large electrode polarizations. We have found, however, that the mean-field theory does not quantitatively reproduce the simulation results at small electrode potentials, having detected their remarkable overscreening effects (ionic correlations). The plots for the distributions of ions near the electrode at different electrode charges show that for the considered system, unlike it is often assumed, the double layer is not one layer thick. The overscreening effects, dominating near the potential of zero charge (p.z.c.), are suppressed by the high electrode polarizations, following the onset of the so-called 'lattice saturation effect'. The maximum of the capacitance coincides with the p.z.c., but it is true only for this 'symmetric' system. If sizes of cations and anions are different the maximum will be shifted away from the p.z.c., and generally the shape of the capacitance curve could be more complicated. (author)

  4. Influence of the crystallographic structure of the electrode surface on the structure of the electrical double layer and adsorption of organic molecules

    International Nuclear Information System (INIS)

    Kochorovski, Z.; Zagorska, I.; Pruzhkovska-Drakhal, R.; Trasatti, S.

    1995-01-01

    The results of systematic investigation of influence of crystal structure of Bi-, Sb- and Cd-electrode surfaces on regularities of double electric layer structure in aqueous and nonaqueous solutions of surface-nonactive electrolyte are given. Influence of electrode surface characteristics on adsorptive behaviour of different organic molecules has been studied. General regularities of of chemical nature influence and surface crystallographic structure on the double layer structure and on organic compounds adsorption have been established. 57 refs., 7 figs., 4 tabs

  5. Relation between the ion size and pore size for an electric double-layer capacitor.

    Science.gov (United States)

    Largeot, Celine; Portet, Cristelle; Chmiola, John; Taberna, Pierre-Louis; Gogotsi, Yury; Simon, Patrice

    2008-03-05

    The research on electrochemical double layer capacitors (EDLC), also known as supercapacitors or ultracapacitors, is quickly expanding because their power delivery performance fills the gap between dielectric capacitors and traditional batteries. However, many fundamental questions, such as the relations between the pore size of carbon electrodes, ion size of the electrolyte, and the capacitance have not yet been fully answered. We show that the pore size leading to the maximum double-layer capacitance of a TiC-derived carbon electrode in a solvent-free ethyl-methylimmidazolium-bis(trifluoro-methane-sulfonyl)imide (EMI-TFSI) ionic liquid is roughly equal to the ion size (approximately 0.7 nm). The capacitance values of TiC-CDC produced at 500 degrees C are more than 160 F/g and 85 F/cm(3) at 60 degrees C, while standard activated carbons with larger pores and a broader pore size distribution present capacitance values lower than 100 F/g and 50 F/cm(3) in ionic liquids. A significant drop in capacitance has been observed in pores that were larger or smaller than the ion size by just an angstrom, suggesting that the pore size must be tuned with sub-angstrom accuracy when selecting a carbon/ion couple. This work suggests a general approach to EDLC design leading to the maximum energy density, which has been now proved for both solvated organic salts and solvent-free liquid electrolytes.

  6. Effect of conductivity variations within the electric double layer on the streaming potential estimation in narrow fluidic confinements.

    Science.gov (United States)

    Das, Siddhartha; Chakraborty, Suman

    2010-07-06

    In this article, we investigate the implications of ionic conductivity variations within the electrical double layer (EDL) on the streaming potential estimation in pressure-driven fluidic transport through narrow confinements. Unlike the traditional considerations, we do not affix the ionic conductivities apriori by employing preset values of dimensionless parameters (such as the Dukhin number) to estimate the streaming potential. Rather, utilizing the Gouy-Chapman-Grahame model for estimating the electric potential and charge density distribution within the Stern layer, we first quantify the Stern layer electrical conductivity as a function of the zeta potential and other pertinent parameters quantifying the interaction of the ionic species with the charged surface. Next, by invoking the Boltzmann model for cationic and anionic distribution within the diffuse layer, we obtain the diffuse layer electrical conductivity. On the basis of these two different conductivities pertaining to the two different portions of the EDL as well as the bulk conductivity, we define two separate Dukhin numbers that turn out to be functions of the dimensionless zeta potential and the channel height to Debye length ratio. We derive analytical expressions for the streaming potential as a function of the fundamental governing parameters, considering the above. The results reveal interesting and significant deviations between the streaming potential predictions from the present considerations against the corresponding predictions from the classical considerations in which electrochemically consistent estimates of variable EDL conductivity are not traditionally accounted for. In particular, it is revealed that the variations of streaming potential with zeta potential are primarily determined by the competing effects of EDL electromigration and ionic advection. Over low and high zeta potential regimes, the Stern layer and diffuse layer conductivities predominantly dictate the streaming

  7. Electrical double layer structure at the gallium metals in a methanol solution of a surface-inactive electrolyte

    International Nuclear Information System (INIS)

    Emets, V.V.

    1997-01-01

    The structure of double electric layer on Ga-, In-Ga- and Tl-Ga-electrodes in methanol solutions of surface-inactive electrolyte has been studied. It is shown that in the absence of chemisorption interaction between metal and solvent, the distance of the nearest approach of methanol dipoles to the surface of Ga-, In-Ga- and Tl-Ga-electrodes is practically the same. Accordingly, the specificity of the metals contact with solvent is reduced solely to their chemisorption interaction. In the zero charge area and for negative charges the chemisorption interaction with methanol molecules increases in the sequence Tl-Ga< In-Ga< Ga. The growth correlates both with the metals acceptor ability towards electron, which is characterized by the work of metal electron escape to vacuum, and donor ability of the solvent characterized by its donor number

  8. The surface chemical properties of multi-walled carbon nanotubes modified by thermal fluorination for electric double-layer capacitor

    Science.gov (United States)

    Jung, Min-Jung; Jeong, Euigyung; Lee, Young-Seak

    2015-08-01

    The surfaces of multi-walled carbon nanotubes (MWCNTs) were thermally fluorinated at various temperatures to enhance the electrochemical properties of the MWCNTs for use as electric double-layer capacitor (EDLC) electrodes. The fluorine functional groups were added to the surfaces of the MWCNTs via thermal fluorination. The thermal fluorination exposed the Fe catalyst on MWCNTs, and the specific surface area increased due to etching during the fluorination. The specific capacitances of the thermally fluorinated at 100 °C, MWCNT based electrode increased from 57 to 94 F/g at current densities of 0.2 A/g, respectively. This enhancement in capacitance can be attributed to increased polarization of the thermally fluorinated MWCNT surface, which increased the affinity between the electrode surface and the electrolyte ions.

  9. Superparamagnetic magnetite nanocrystals-graphene oxide nanocomposites: facile synthesis and their enhanced electric double-layer capacitor performance.

    Science.gov (United States)

    Wang, Qihua; Wang, Dewei; Li, Yuqi; Wang, Tingmei

    2012-06-01

    Superparamagnetic magnetite nanocrystals-graphene oxide (FGO) nanocomposites were successfully synthesized through a simple yet versatile one-step solution-processed approach at ambient conditions. Magnetite (Fe3O4) nanocrystals (NCs) with a size of 10-50 nm were uniformly deposited on the surfaces of graphene oxide (GO) sheets, which were confirmed by transmission electron microscopy (TEM) and high-angle annular dark field scanning transmission election microscopy (HAADF-STEM) studies. FGO with different Fe3O4 loadings could be controlled by simply manipulating the initial weight ratio of the precursors. The M-H measurements suggested that the as-prepared FGO nanocomposites have a large saturation magnetizations that made them can move regularly under an external magnetic field. Significantly, FGO nanocomposites also exhibit enhanced electric double-layer capacitor (EDLC) activity compared with pure Fe3O4 NCs and GO in terms of specific capacitance and high-rate charge-discharge.

  10. Performance of electrical double layer capacitors fabricated with gel polymer electrolytes containing Li+ and K+-salts: A comparison

    International Nuclear Information System (INIS)

    Singh, Manoj K.; Hashmi, S. A.

    2015-01-01

    The comparative performance of the solid-state electrical double layer capacitors (EDLCs) based on the multiwalled carbon nanotube (MWCNT) electrodes and poly (vinaylidinefluoride-co-hexafluoropropyline) (PVdF-HFP) based gel polymer electrolytes (GPEs) containing potassium and lithium salts have been studied. The room temperature ionic conductivity of the GPEs have been found to be ∼3.8×10 −3 and 5.9×10 −3 S cm −1 for lithium and potassium based systems. The performance of EDLC cells studied by impedance spectroscopy, cyclic voltammetry and constant current charge-discharge techniques, indicate that the EDLC with potassium salt containing GPE shows excellent performance almost equivalent to the EDLC with Li-salt-based GPE

  11. Bulk Concentration Dependence of Electrolyte Resistance Within Mesopores of Carbon Electrodes in Electric Double-Layer Capacitors

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Jaekwang; Kim, Daeun; Lee, Ilbok; Son, Hyungbin; Lee, Donghyun; Yoon, Songhun [Chung-Ang University, Seoul (Korea, Republic of); Shim, Hyewon [Korea Institute of Nuclear Nonproliferation and Control, Daejeon (Korea, Republic of); Lee, Jinwoo [POSTECH, Pohang (Korea, Republic of)

    2016-02-15

    Hexagonally ordered mesoporous carbon materials were prepared and used as electrode materials in an electric double-layer capacitor. Using this electrode, the change of electrolyte resistance within the mesopores was investigated according to the bulk electrolyte concentration. Using three different electrochemical transient experiments-imaginary capacitance analysis, chronoamperometry, and hronopotentiometry-the time constant associated with electrolyte transport was determined, which was then used to obtain the electrolyte resistance within the mesopores. With decreasing electrolyte concentration, the increase in electrolyte resistance was smaller than the increase in the resistivity of the bulk electrolyte, which is indicative of a different environment for ionic transport within the mesopores. On using the confinement effect within the mesopores, the predicted higher concentration within mesopore probably results in lower electrolyte resistance, especially under low bulk concentrations.

  12. Time-dependent density functional theory for the charging kinetics of electric double layer containing room-temperature ionic liquids.

    Science.gov (United States)

    Lian, Cheng; Zhao, Shuangliang; Liu, Honglai; Wu, Jianzhong

    2016-11-28

    Understanding the charging kinetics of electric double layers is of fundamental importance for the design and development of novel electrochemical devices such as supercapacitors and field-effect transistors. In this work, we study the dynamic behavior of room-temperature ionic liquids using a classical time-dependent density functional theory that accounts for the molecular excluded volume effects, the electrostatic correlations, and the dispersion forces. While the conventional models predict a monotonic increase of the surface charge with time upon application of an electrode voltage, our results show that dispersion between ions results in a non-monotonic increase of the surface charge with the duration of charging. Furthermore, we investigate the effects of van der Waals attraction between electrode/ionic-liquid interactions on the charging processes.

  13. Short-Term Synaptic Plasticity Regulation in Solution-Gated Indium-Gallium-Zinc-Oxide Electric-Double-Layer Transistors.

    Science.gov (United States)

    Wan, Chang Jin; Liu, Yang Hui; Zhu, Li Qiang; Feng, Ping; Shi, Yi; Wan, Qing

    2016-04-20

    In the biological nervous system, synaptic plasticity regulation is based on the modulation of ionic fluxes, and such regulation was regarded as the fundamental mechanism underlying memory and learning. Inspired by such biological strategies, indium-gallium-zinc-oxide (IGZO) electric-double-layer (EDL) transistors gated by aqueous solutions were proposed for synaptic behavior emulations. Short-term synaptic plasticity, such as paired-pulse facilitation, high-pass filtering, and orientation tuning, was experimentally emulated in these EDL transistors. Most importantly, we found that such short-term synaptic plasticity can be effectively regulated by alcohol (ethyl alcohol) and salt (potassium chloride) additives. Our results suggest that solution gated oxide-based EDL transistors could act as the platforms for short-term synaptic plasticity emulation.

  14. Nitrogen removal and electricity production at a double-chamber microbial fuel cell with cathode nitrite denitrification.

    Science.gov (United States)

    Yu, Yangyang; Zhao, Jianqiang; Wang, Sha; Zhao, Huimin; Ding, Xiaoqian; Gao, Kun

    2017-12-01

    Double-chamber microbial fuel cell was applied to investigate the performance of the electricity production and nitrite denitrification through feeding nitrite into the cathode. Factors influencing denitrification performance and power production, such as external resistance, influent nitrite concentration and Nitrite Oxygen Bacteria inhibitors, were studied. The results show that when the concentration of nitrite nitrogen and external resistance were 100 mg L -1 and 10 Ω, respectively, the nitrite denitrification reached the best state. The NaN 3 can inhibit nitrite oxidation effectively; meanwhile, the nitrite denitrification with N 2 O as the final products was largely improved. The [Formula: see text] was reduced to [Formula: see text], causing the cathode denitrification coulombic efficiency to exceed 100%. In chemoautotrophic bio-nitrification, microorganisms may utilize H 2 O to oxidize nitrite under anaerobic conditions. Proteobacteria might play a major role in the process of denitrification in MFC.

  15. Electrical Double Layer-Induced Ion Surface Accumulation for Ultrasensitive Refractive Index Sensing with Nanostructured Porous Silicon Interferometers.

    Science.gov (United States)

    Mariani, Stefano; Strambini, Lucanos Marsilio; Barillaro, Giuseppe

    2018-03-23

    Herein, we provide the first experimental evidence on the use of electrical double layer (EDL)-induced accumulation of charged ions (using both Na + and K + ions in water as the model) onto a negatively charged nanostructured surface (e.g., thermally growth SiO 2 )-Ion Surface Accumulation, ISA-as a means of improving performance of nanostructured porous silicon (PSi) interferometers for optical refractometric applications. Nanostructured PSi interferometers are very promising optical platforms for refractive index sensing due to PSi huge specific surface (hundreds of m 2 per gram) and low preparation cost (less than $0.01 per 8 in. silicon wafer), though they have shown poor resolution ( R) and detection limit (DL) (on the order of 10 -4 -10 -5 RIU) compared to other plasmonic and photonic platforms ( R and DL on the order of 10 -7 -10 -8 RIU). This can be ascribed to both low sensitivity and high noise floor of PSi interferometers when bulk refractive index variation of the solution infiltrating the nanopores either approaches or is below 10 -4 RIU. Electrical double layer-induced ion surface accumulation (EDL-ISA) on oxidized PSi interferometers allows the interferometer output signal (spectral interferogram) to be impressively amplified at bulk refractive index variation below 10 -4 RIU, increasing, in turn, sensitivity up to 2 orders of magnitude and allowing reliable measurement of refractive index variations to be carried out with both DL and R of 10 -7 RIU. This represents a 250-fold-improvement (at least) with respect to the state-of-the-art literature on PSi refractometers and pushes PSi interferometer performance to that of state-of-the-art ultrasensitive photonics/plasmonics refractive index platforms.

  16. Double-ended metal halide arc discharge lamp with electrically isolated containment shroud

    Science.gov (United States)

    Muzeroll, Martin M. (Inventor)

    1994-01-01

    A double-ended arc discharge lamp includes a sealed, light-transmissive outer jacket, a light-transmissive shroud mounted within the outer jacket and directly supported by the outer jacket, and an arc discharge tube mounted within the shroud. The arc tube is typically a metal halide arc discharge tube. In a preferred embodiment, the shroud includes an outwardly flared portion at each end. The outwardly flared portions space the shroud from the outer jacket and support the shroud within the outer jacket. The outwardly flared portions of the shroud can be affixed to the outer jacket by fusing. The outer jacket can be provided with inwardly extending dimples for locating the shroud with respect to the outer jacket. In another embodiment, the outer jacket includes reduced diameter portions near each end which are attached to the shroud.

  17. Photoluminescence energy transitions in GaAs-Ga{sub 1-x}Al{sub x}As double quantum wells: Electric and magnetic fields and hydrostatic pressure effects

    Energy Technology Data Exchange (ETDEWEB)

    Lopez, S.Y. [Grupo de Educacion en Ciencias Experimentales y Matematicas-GECEM, Facultad de Educacion, Universidad de Antioquia, AA 1226 Medellin (Colombia); Mora-Ramos, M.E. [Facultad de Ciencias, Universidad Autonoma del Estado de Morelos, Av. Universidad 1001, CP 62209, Cuernavaca, Morelos (Mexico); Duque, C.A., E-mail: cduque@fisica.udea.edu.c [Instituto de Fisica, Universidad de Antioquia, AA 1226 Medellin (Colombia)

    2009-12-15

    The photoluminescence energy transitions in GaAs-Ga{sub 1-x}Al{sub x}As coupled double quantum wells are presented by considering the simultaneous effects of applied electric and magnetic fields and hydrostatic pressure. Calculations have been made in the framework of the effective mass and parabolic band approximations and using a variational procedure. The electric field is taken to be oriented along the growth direction of the heterostructure whereas for the magnetic field both in-plane and in-growth directions have been considered. The results show that the hydrostatic pressure and the applied electric field are two useful tools to tune the direct and indirect exciton transitions in such heterostructures. Our results are in good agreement with previous experimental findings in double quantum wells under applied electric field and hydrostatic pressure.

  18. Photoluminescence energy transitions in GaAs-Ga1-xAlxAs double quantum wells: Electric and magnetic fields and hydrostatic pressure effects

    International Nuclear Information System (INIS)

    Lopez, S.Y.; Mora-Ramos, M.E.; Duque, C.A.

    2009-01-01

    The photoluminescence energy transitions in GaAs-Ga 1-x Al x As coupled double quantum wells are presented by considering the simultaneous effects of applied electric and magnetic fields and hydrostatic pressure. Calculations have been made in the framework of the effective mass and parabolic band approximations and using a variational procedure. The electric field is taken to be oriented along the growth direction of the heterostructure whereas for the magnetic field both in-plane and in-growth directions have been considered. The results show that the hydrostatic pressure and the applied electric field are two useful tools to tune the direct and indirect exciton transitions in such heterostructures. Our results are in good agreement with previous experimental findings in double quantum wells under applied electric field and hydrostatic pressure.

  19. Machine & electrical double control air dryer for vehicle air braking system

    Science.gov (United States)

    Zhang, Xuan; Yang, Liu; Wang, Xian Yan; Tan, Xiao Yan; Wang, Wei

    2017-09-01

    As is known to all, a vehicle air brake system, in which usually contains moisture. To solve the problem, it is common to use air dryer to dry compressed air effectively and completely remove the moisture and oil of braking system. However, the existing air dryer is not suitable for all commercial vehicles. According to the operational status of the new energy vehicles in the initial operating period, the structure design principle of the machine & electric control air dryer is expounded from the aspects of the structure and operating principle, research & development process.

  20. Double peak spectra in spontaneous edge electroluminescence

    Czech Academy of Sciences Publication Activity Database

    Zavadil, Jiří; Žďánský, Karel

    1993-01-01

    Roč. 36, č. 11 (1993), s. 1623-1632 ISSN 0038-1101 R&D Projects: GA AV ČR IAA167108 Keywords : light emitting diodes * electroluminescence * optical waveguide theory Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 0.871, year: 1993

  1. Improving the electromagnetic compatibility of track circuits with electric rolling stock of double power supply with induction traction motors and electrictraction network

    Directory of Open Access Journals (Sweden)

    N.G. Visin

    2012-04-01

    Full Text Available In this article the research results of many authors on the effect of current interference from the existing electric rolling stock with induction traction motors (ITM on the track circuits and the possibility of exceeding the train traffic safety standards are used. The new promising scheme of power circuit for electric locomotive of double power supply with an ITM applying the intermediary high-frequency transformer for reducing significantly the interference effects to SCB and communication devices is developed.

  2. Reevaluation of Performance of Electric Double-layer Capacitors from Constant-current Charge/Discharge and Cyclic Voltammetry.

    Science.gov (United States)

    Allagui, Anis; Freeborn, Todd J; Elwakil, Ahmed S; Maundy, Brent J

    2016-12-09

    The electric characteristics of electric-double layer capacitors (EDLCs) are determined by their capacitance which is usually measured in the time domain from constant-current charging/discharging and cyclic voltammetry tests, and from the frequency domain using nonlinear least-squares fitting of spectral impedance. The time-voltage and current-voltage profiles from the first two techniques are commonly treated by assuming ideal R s C behavior in spite of the nonlinear response of the device, which in turn provides inaccurate values for its characteristic metrics [corrected]. In this paper we revisit the calculation of capacitance, power and energy of EDLCs from the time domain constant-current step response and linear voltage waveform, under the assumption that the device behaves as an equivalent fractional-order circuit consisting of a resistance R s in series with a constant phase element (CPE(Q, α), with Q being a pseudocapacitance and α a dispersion coefficient). In particular, we show with the derived (R s , Q, α)-based expressions, that the corresponding nonlinear effects in voltage-time and current-voltage can be encompassed through nonlinear terms function of the coefficient α, which is not possible with the classical R s C model. We validate our formulae with the experimental measurements of different EDLCs.

  3. Toward the Physical Basis of Complex Systems: Dielectric Analysis of Porous Silicon Nanochannels in the Electrical Double Layer Length Range

    Directory of Open Access Journals (Sweden)

    Radu Mircea Ciuceanu

    2011-01-01

    Full Text Available Dielectric analysis (DEA shows changes in the properties of
    a materials as a response to the application on it of a time dependent electric field. Dielectric measurements are extremely sensitive to small changes in materials properties, that molecular relaxation, dipole changes, local motions that involve the reorientation of dipoles, and so can be observed by DEA. Electrical double layer (EDL, consists in a shielding layer that is naturally created within the liquid near a charged surface. The thickness of the EDL is given by the characteristic Debye length what grows less with the ionic strength defined by half summ products of concentration with square of charge for all solvent
    ions (co-ions, counterions, charged molecules. The typical length scale for the Debye length is on the order of 1 nm, depending on the ionic contents in the solvent; thus, the EDL becomes significant for nano-capillaries that nanochannels. The electrokinetic e®ects in the nanochannels depend essentialy on the distribution of charged species in EDL, described by the Poisson-Boltzmann equation those solutions require the solvent dielectric permittivity. In this work we propose a model for solvent low-frequency permittivity and a DEA profile taking into account both the porous silicon electrode and aqueous solvent properties in the Debye length range.

  4. Transport properties of Dirac electrons in graphene based double velocity-barrier structures in electric and magnetic fields

    International Nuclear Information System (INIS)

    Liu, Lei; Li, Yu-Xian; Liu, Jian-Jun

    2012-01-01

    Using transfer matrix method, transport properties in graphene based double velocity-barrier structures under magnetic and electric fields are numerically studied. It is found that velocity barriers for the velocity ratio (the Fermi velocity inside the barrier to that outside the barrier) less than one (or for the velocity ratio greater than one) have properties similar to electrostatic wells (or barriers). The velocity barriers for the velocity ratio greater than one significantly enlarge the resonant tunneling region of electrostatic barriers. In the presence of magnetic field, the plateau width of the Fano factor with a Poissonian value shortens (or broadens) for the case of the velocity ratio less than one (or greater than one). When the Fermi energy is equal to the electrostatic barrier height, for different values of the velocity ratio, both the conductivities and the Fano factors remain fixed. -- Highlights: ► We model graphene based velocity-barrier structures in electric and magnetic fields. ► Velocity barrier for ξ 1) have property similar to electrostatic well (barrier). ► Velocity barrier for ξ>1 enlarge the resonant tunneling region of electrostatic barrier. ► The plateau width of Fano factor shortens (or broadens) for the case of ξ 1). ► The conductivity remains fixed at the point of E F =U 0 for different values of ξ.

  5. Reevaluation of Performance of Electric Double-layer Capacitors from Constant-current Charge/Discharge and Cyclic Voltammetry

    Science.gov (United States)

    Allagui, Anis; Freeborn, Todd J.; Elwakil, Ahmed S.; Maundy, Brent J.

    2016-12-01

    The electric characteristics of electric-double layer capacitors (EDLCs) are determined by their capacitance which is usually measured in the time domain from constant-current charging/discharging and cyclic voltammetry tests, and from the frequency domain using nonlinear least-squares fitting of spectral impedance. The time-voltage and current-voltage profiles from the first two techniques are commonly treated by assuming ideal SsC behavior in spite of the nonlinear response of the device, which in turn provides inaccurate values for its characteristic metrics. In this paper we revisit the calculation of capacitance, power and energy of EDLCs from the time domain constant-current step response and linear voltage waveform, under the assumption that the device behaves as an equivalent fractional-order circuit consisting of a resistance Rs in series with a constant phase element (CPE(Q, α), with Q being a pseudocapacitance and α a dispersion coefficient). In particular, we show with the derived (Rs, Q, α)-based expressions, that the corresponding nonlinear effects in voltage-time and current-voltage can be encompassed through nonlinear terms function of the coefficient α, which is not possible with the classical RsC model. We validate our formulae with the experimental measurements of different EDLCs.

  6. Electrodeposition to construct free-standing chitosan/layered double hydroxides hydro-membrane for electrically triggered protein release.

    Science.gov (United States)

    Zhao, Pengkun; Zhao, Yanan; Xiao, Ling; Deng, Hongbing; Du, Yumin; Chen, Yun; Shi, Xiaowen

    2017-10-01

    In this study, we report the electrodeposition of a chitosan/layered double hydroxides (LDHs) hydro-membrane for protein release triggered by an electrical signal. The electrodeposition was performed in a chitosan and insulin loaded LDHs suspension in the absence of salt. A free-standing chitosan/LDHs hydro-membrane was generated on the electrode with improved mechanical properties, which is dramatically different from the weak hydrogel deposited in the presence of salt. The amount of LDHs in the hydro-membrane affects the optical transmittance and multilayered structure of the hybrid membrane. Compared to the weak chitosan/LDHs hydrogel, the hydro-membrane has a higher insulin loading capacity and the release of insulin is relatively slow. By biasing electrical potentials to the hydro-membrane, the release behavior of insulin can be adjusted accordingly. In addition, the chitosan/LDHs hydro-membrane showed no toxicity to cells. Our results provide a facile method to construct a chitosan/LDHs hybrid multilayered hydro-membrane and suggest the great potential of the hydro-membrane in controlled protein release. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Relationship between electronic structure and electric conductivity of double rhodium oxides from X-ray spectral data

    International Nuclear Information System (INIS)

    Firsov, M.N.; Nefedov, V.I.; Shaplygin, I.S.

    1983-01-01

    Quantum yield spectra of X-ray photoemission of O K - and Rh M 3 -bands of double rhodium oxides with Be, Mg, Ca, Sr, Ba, Cd, V, Nb, Ta, Mo, W are obtained. Quantum yield spectra are analogous to absorption spectra and reflect vacant states in a crystal, in particular, the quantum yield spectrum of O K-band is associated with oxygen vacant states of p-symmetry while Rh M 3 -band spectrum with rhomium vacant states of d-symmetry. In all rhodium compounds investigated the first vacant band is formed by the rhodium 4d-states. The forbidden zone between the last occupied and first free states of rhodiUm has a small width (eV fractions), which explains the semiconductor character of electric conductivity of the investigated compounds. Electric resistance variation in investigated series of rhodium compounds is in agreement with peculiarities of their electronic structure and entirely depends on variation in the electron density on rhodium atoms

  8. Structural, morphological and electrical properties of Sn-substituted Ni-Zn ferrites synthesized by double sintering technique

    Energy Technology Data Exchange (ETDEWEB)

    Ali, M.A. [Department of Physics, Chittagong University of Engineering and Technology (CUET), Chittagong 4349 (Bangladesh); Uddin, M.M., E-mail: mohi@cuet.ac.bd [Department of Physics, Chittagong University of Engineering and Technology (CUET), Chittagong 4349 (Bangladesh); Khan, M.N.I. [Materials Science Division, Atomic Energy Center, Dhaka 1000 (Bangladesh); Chowdhury, F.U.-Z. [Department of Physics, Chittagong University of Engineering and Technology (CUET), Chittagong 4349 (Bangladesh); Haque, S.M. [Materials Science Division, Atomic Energy Center, Dhaka 1000 (Bangladesh)

    2017-02-15

    The Sn-substituted Ni-Zn ferrites, (0.0≤x≤0.30), have been synthesized by the standard double sintering technique from the oxide nanopowders of Ni, Zn, Fe and Sn. The structural and electrical properties have been investigated by the X-ray diffraction (XRD), scanning electron microscopy (SEM), DC resistivity and dielectric measurements. From XRD data, the single cubic spinel phase has been confirmed for x≤0.1, whereas for x>0.1 an extra intermediate phase has been detected along with the cubic spinel phase of Ni-Zn ferrite. The grain size is increased due to Sn substitution in Ni-Zn ferrites. DC resistivity as a function of temperature has been measured by two probe method. The semiconducting nature has been found operative in the samples. The DC resistivity was found to decrease whilst the dielectric constant increased with increasing Sn content in Ni-Zn ferrites. The unusual behavior of the dielectric loss factor of the ferrites was explained by the Rezlescu model. The electrical relaxation of the ferrites has been studied in terms of electric modulus formalism and the time for dielectric relaxation was calculated. The contribution of grain resistance has been studied from the Cole-Cole plot. The suitability to use the as prepared samples in the miniaturized memory devices based capacitive components or energy storage principles are confirmed from the values of dielectric constant. - Highlights: • Sn-substituted Ni-Zn ferrites with cubic spinel structure have been synthesized. • a{sub th} is calculated and well compared with a{sub expt}. • Dielectric unusual behavior has been successfully explained by the Rezlescu model. • Long τ (ns) is determined, can be utilized for memory and spintronics devices.

  9. Safety Evaluation Report related to the operation of Comanche Peak Steam Electric Station, Units 1 and 2 (Docket Nos. 50-445 and 50-446). Supplement No. 11

    International Nuclear Information System (INIS)

    1985-05-01

    Supplement 11 to the Safety Evaluation Report for the Texas Utilities Electric Company application for a license to operate Comanche Peak Steam Electric Station, Units 1 and 2 (Docket Nos. 50-445, 50-446), located in Somervell County, Texas, has been jointly prepared by the Office of Nuclear Reactor Regulation and the Comanche Peak Technical Review Team (TRT) of the US Nuclear Regulatory Commission (NRC) and is in two parts. Part 1 (Appendix 0) of this supplement provides the results of the TRT's evaluation of approximately 124 concerns and allegations relating specifically to quality assurance and quality control (QA/QC) issues regarding construction proctices at the Comanche Peak facility. Part 2 (Appendix P) contains an overall summary and conclusion of the QA/QC aspects of the NRC Technical Review Team efforts as reported in supplemental Safety Evaluation Report SERs 7, 8, 9, and 10. Since QA/QC issues are also contained in each of the other supplements, the TRT considered that such a summary and conclusion from all supplements was necessary for a complete TRT description of QA/QC activities at Comanche Peak

  10. Variation in band gap energy and electrical analysis of double doped cobalt ferrite

    Science.gov (United States)

    Parveen, Azra; Agrawal, Shraddha; Azam, Ameer

    2018-05-01

    The Ca and Cr doped cobalt ferrite nanoparticles (Co0.9Ca0.1) (Fe0.8 Cr0.2)2O4 were synthesized by microwave gel combustion method. Microstructural studies were carried out by XRD and SEM. Structural studies suggest that the crystal system remains spinal even with the doping of calcium and chromium. The SEM image shows the spherical morphology of surface of the sample. Optical properties of Ca and Cr doped cobalt ferrite were studied by UV-visible technique in the range of 400-600 nm. The electrical conductivity of pure and doped cobalt ferrite were studied as a function of frequency and were explained on the basis of electron hopping.

  11. Carbon aerogels as electrode material for electrical double layer supercapacitors-Synthesis and properties

    Energy Technology Data Exchange (ETDEWEB)

    Halama, Agnieszka [Electrotechnical Institute, Division of Electrotechnology and Materials Science, Wroclaw (Poland); Szubzda, Bronislaw, E-mail: szubzda@iel.wroc.p [Electrotechnical Institute, Division of Electrotechnology and Materials Science, Wroclaw (Poland); Pasciak, Grzegorz [Electrotechnical Institute, Division of Electrotechnology and Materials Science, Wroclaw (Poland)

    2010-10-30

    This paper constitutes a description of technological research the aim of which was to design a symmetric supercapacitor dedicated for the system of quality of electrical energy improvement (supply interruption, voltage dip). The main task was to use the carbon aerogel technology as the efficient method for production of electrode material with desirable properties. Carbon aerogels were prepared by carbonization of resorcinol-formaldehyde (RF) polymer gels. RF-gels were synthesized by curing polycondensation and by the inverse emulsion polymerization of resorcinol with formaldehyde, followed by microwave drying. The morphostructural characteristics of the carbon aerogels were investigated by atomic force microscopy (AFM) and the N{sub 2} adsorption (BET method). The electrochemical properties were characterized by means of cycle voltammetry, galvanostatic charging/discharging, and self-discharge.

  12. Extraction of the neutron electric form factor from measurements of inclusive double spin asymmetries

    Science.gov (United States)

    Sulkosky, V.; Jin, G.; Long, E.; Zhang, Y.-W.; Mihovilovic, M.; Kelleher, A.; Anderson, B.; Higinbotham, D. W.; Širca, S.; Allada, K.; Annand, J. R. M.; Averett, T.; Bertozzi, W.; Boeglin, W.; Bradshaw, P.; Camsonne, A.; Canan, M.; Cates, G. D.; Chen, C.; Chen, J.-P.; Chudakov, E.; De Leo, R.; Deng, X.; Deur, A.; Dutta, C.; El Fassi, L.; Flay, D.; Frullani, S.; Garibaldi, F.; Gao, H.; Gilad, S.; Gilman, R.; Glamazdin, O.; Golge, S.; Gomez, J.; Hansen, J.-O.; Holmstrom, T.; Huang, J.; Ibrahim, H.; de Jager, C. W.; Jensen, E.; Jiang, X.; Jones, M.; Kang, H.; Katich, J.; Khanal, H. P.; King, P.; Korsch, W.; LeRose, J.; Lindgren, R.; Lu, H.-J.; Luo, W.; Markowitz, P.; Meekins, D.; Meziane, M.; Michaels, R.; Moffit, B.; Monaghan, P.; Muangma, N.; Nanda, S.; Norum, B. E.; Pan, K.; Parno, D.; Piasetzky, E.; Posik, M.; Punjabi, V.; Puckett, A. J. R.; Qian, X.; Qiang, Y.; Qui, X.; Riordan, S.; Saha, A.; Sawatzky, B.; Shabestari, M.; Shahinyan, A.; Shoenrock, B.; John, J. St.; Subedi, R.; Tobias, W. A.; Tireman, W.; Urciuoli, G. M.; Wang, D.; Wang, K.; Wang, Y.; Watson, J.; Wojtsekhowski, B.; Ye, Z.; Zhan, X.; Zhang, Y.; Zheng, X.; Zhao, B.; Zhu, L.; Jefferson Lab Hall A Collaboration

    2017-12-01

    Background: Measurements of the neutron charge form factor, GEn, are challenging because the neutron has no net charge. In addition, measurements of the neutron form factors must use nuclear targets which require accurately accounting for nuclear effects. Extracting GEn with different targets and techniques provides an important test of our handling of these effects. Purpose: The goal of the measurement was to use an inclusive asymmetry measurement technique to extract the neutron charge form factor at a four-momentum transfer of 1 (GeV/c ) 2 . This technique has very different systematic uncertainties than traditional exclusive measurements and thus serves as an independent check of whether nuclear effects have been taken into account correctly. Method: The inclusive quasielastic reaction 3He ⃗(e ⃗,e') was measured at Jefferson Laboratory. The neutron electric form factor, GEn, was extracted at Q2=0.98 (GeV/c ) 2 from ratios of electron-polarization asymmetries measured for two orthogonal target spin orientations. This Q2 is high enough that the sensitivity to GEn is not overwhelmed by the neutron magnetic contribution, and yet low enough that explicit neutron detection is not required to suppress pion production. Results: The neutron electric form factor, GEn, was determined to be 0.0414 ±0.0077 (stat)±0.0022 (syst) , providing the first high-precision inclusive extraction of the neutron's charge form factor. Conclusions: The use of the inclusive quasielastic 3He ⃗(e ⃗,e') with a four-momentum transfer near 1 (GeV/c ) 2 has been used to provide a unique measurement of GEn. This new result provides a systematically independent validation of the exclusive extraction technique results and implies that the nuclear corrections are understood. This is contrary to the proton form factor where asymmetry and differential cross section measurements have been shown to have large systematic differences.

  13. Electrical Double-Layer and Ion Bridging Forces between Symmetric and Asymmetric Charged Surfaces in the Presence of Mono- and Divalent Ions

    DEFF Research Database (Denmark)

    Liu, Xiaoyan; Feilberg, Karen Louise; Yan, Wei

    2017-01-01

    charged (3-aminopropyl)trimethoxysilane, and the negatively charged (3-mercaptopropyl)trimethoxysilane. The interactions between the three symmetric systems, as well as between the three asymmetric combinations of surfaces, were measured and compared to calculated electrical double-layer forces...

  14. Quasistationary states in single and double GaAs–(Ga,Al)As quantum wells: Applied electric field and hydrostatic pressure effects

    International Nuclear Information System (INIS)

    Schönhöbel, A.M.; Girón-Sedas, J.A.; Porras-Montenegro, N.

    2014-01-01

    We have calculated exactly the energy of electron quasistationary states in GaAs–(Ga,Al)As single and double quantum wells under the action of applied electric field and hydrostatic pressure by using Enderlein's method to solve the Schrödinger equation. Numerical results were obtained by means of the density of states as a function of the applied electric field, hydrostatic pressure, Al concentration and the structure geometry as well. We found two regions very well differentiated in energy; for lower values there are quasistationary states and for higher, fast oscillations. The quasistationary ground and excited energy states diminish with the well width and the applied electric field, and increase with the confinement potential and the width of the central barrier in the double quantum well. In the latter structure we observed the anti-crossing between the first and second quasistationary energy levels, phenomena which certainly depend on the central barrier width. Otherwise, in the region of fast oscillations, the period of Franz–Keldysh oscillation type in single quantum well and double quantum well increases with the applied electric field and the number of nodes augments with the well width. Also, we found that the increase of the central barrier height in the double quantum well diminishes the number of nodes, while the applied hydrostatic pressure changes the length of pulsations in both structures.

  15. Electrical features of an amorphous indium-gallium-zinc-oxide film transistor using a double active matrix with different oxygen contents

    International Nuclear Information System (INIS)

    Koo, Ja Hyun; Kang, Tae Sung; Hong, Jin Pyo

    2012-01-01

    The electrical characteristics of amorphous indium-gallium-zinc-oxide (a-IGZO) thin film transistor (TFTs) are systematically studied using a double a-IGZO active layer that is composed of a-IGZO x (oxygen-ion-poor region) and a-IGZO y (oxygen-ion-rich-region). An active layer is designed to have a serially-stacked bi-layer matrix with different oxygen contents, providing the formation of different electron conduction channels. Two different oxygen contents in the active layer are obtained by varying the O 2 partial pressure during sputtering. The a-IGZO TFT based on a double active layer exhibits a high mobility of 9.1 cm 2 /Vsec, a threshold voltage (V T ) of 16.5 V, and ΔV T shifts of less than 1.5 V under gate voltage stress. A possible electrical sketch for the double active layer channel is also discussed.

  16. Exactly solvable model of the two-dimensional electrical double layer.

    Science.gov (United States)

    Samaj, L; Bajnok, Z

    2005-12-01

    We consider equilibrium statistical mechanics of a simplified model for the ideal conductor electrode in an interface contact with a classical semi-infinite electrolyte, modeled by the two-dimensional Coulomb gas of pointlike unit charges in the stability-against-collapse regime of reduced inverse temperatures 0layer) carries some nonzero surface charge density. The model is mappable onto an integrable semi-infinite sine-Gordon theory with Dirichlet boundary conditions. The exact form-factor and boundary state information gained from the mapping provide asymptotic forms of the charge and number density profiles of electrolyte particles at large distances from the interface. The result for the asymptotic behavior of the induced electric potential, related to the charge density via the Poisson equation, confirms the validity of the concept of renormalized charge and the corresponding saturation hypothesis. It is documented on the nonperturbative result for the asymptotic density profile at a strictly nonzero beta that the Debye-Hückel beta-->0 limit is a delicate issue.

  17. Building Automation and Control Systems and Electrical Distribution Grids: A Study on the Effects of Loads Control Logics on Power Losses and Peaks

    Directory of Open Access Journals (Sweden)

    Salvatore Favuzza

    2018-03-01

    Full Text Available Growing home comfort is causing increasing energy consumption in residential buildings and a consequent stress in urban medium and low voltage distribution networks. Therefore, distribution system operators are obliged to manage problems related to the reliability of the electricity system and, above all, they must consider investments for enhancing the electrical infrastructure. The purpose of this paper is to assess how the reduction of building electricity consumption and the modification of the building load profile, due to load automation, combined with suitable load control programs, can improve network reliability and distribution efficiency. This paper proposes an extensive study on this issue, considering various operating scenarios with four load control programs with different purposes, the presence/absence of local generation connected to the buildings and different external thermal conditions. The study also highlights how different climatic conditions can influence the effects of the load control logics.

  18. A comparison of four methods to evaluate the effect of a utility residential air-conditioner load control program on peak electricity use

    Energy Technology Data Exchange (ETDEWEB)

    Newsham, Guy R., E-mail: guy.newsham@nrc-cnrc.gc.ca [National Research Council Canada-Institute for Research in Construction, Building M24, 1200 Montreal Road, Ottawa, Ontario, K1A 0R6 (Canada); Birt, Benjamin J. [National Research Council Canada-Institute for Research in Construction, Building M24, 1200 Montreal Road, Ottawa, Ontario, K1A 0R6 (Canada); Rowlands, Ian H. [University of Waterloo, Ontario (Canada)

    2011-10-15

    We analyzed the peak load reductions due to a residential direct load control program for air-conditioners in southern Ontario in 2008. In this program, participant thermostats were increased by 2 deg. C for four hours on five event days. We used hourly, whole-house data for 195 participant households and 268 non-participant households, and four different methods of analysis ranging from simple spreadsheet-based comparisons of average loads on event days, to complex time-series regression. Average peak load reductions were 0.2-0.9 kWh/h per household, or 10-35%. However, there were large differences between event days and across event hours, and in results for the same event day/hour, with different analysis methods. There was also a wide range of load reductions between individual households, and only a minority of households contributed to any given event. Policy makers should be aware of how the choice of an analysis method may affect decisions regarding which demand-side management programs to support, and how they might be incentivized. We recommend greater use of time-series methods, although it might take time to become comfortable with their complexity. Further investigation of what type of households contribute most to aggregate load reductions would also help policy makers better target programs. - Highlights: > We analyzed peak load reductions due to residential a/c load control. > We used four methods, ranging from simple comparisons to time-series regression. > Average peak load reductions were 0.2-0.9 kW per household, varying by method. > We recommend a move towards time-series regression for future studies. > A minority of participant households contributed to a given load control event.

  19. Poly(Acrylic acid–Based Hybrid Inorganic–Organic Electrolytes Membrane for Electrical Double Layer Capacitors Application

    Directory of Open Access Journals (Sweden)

    Chiam-Wen Liew

    2016-05-01

    Full Text Available Nanocomposite polymer electrolyte membranes (NCPEMs based on poly(acrylic acid(PAA and titania (TiO2 are prepared by a solution casting technique. The ionic conductivity of NCPEMs increases with the weight ratio of TiO2.The highest ionic conductivity of (8.36 ± 0.01 × 10−4 S·cm−1 is obtained with addition of 6 wt % of TiO2 at ambient temperature. The complexation between PAA, LiTFSI and TiO2 is discussed in Attenuated total reflectance-Fourier Transform Infrared (ATR-FTIR studies. Electrical double layer capacitors (EDLCs are fabricated using the filler-free polymer electrolyte or the most conducting NCPEM and carbon-based electrodes. The electrochemical performances of fabricated EDLCs are studied through cyclic voltammetry (CV and galvanostatic charge-discharge studies. EDLC comprising NCPEM shows the specific capacitance of 28.56 F·g−1 (or equivalent to 29.54 mF·cm−2 with excellent electrochemical stability.

  20. In situ NMR and electrochemical quartz crystal microbalance techniques reveal the structure of the electrical double layer in supercapacitors

    Science.gov (United States)

    Griffin, John M.; Forse, Alexander C.; Tsai, Wan-Yu; Taberna, Pierre-Louis; Simon, Patrice; Grey, Clare P.

    2015-08-01

    Supercapacitors store charge through the electrosorption of ions on microporous electrodes. Despite major efforts to understand this phenomenon, a molecular-level picture of the electrical double layer in working devices is still lacking as few techniques can selectively observe the ionic species at the electrode/electrolyte interface. Here, we use in situ NMR to directly quantify the populations of anionic and cationic species within a working microporous carbon supercapacitor electrode. Our results show that charge storage mechanisms are different for positively and negatively polarized electrodes for the electrolyte tetraethylphosphonium tetrafluoroborate in acetonitrile; for positive polarization charging proceeds by exchange of the cations for anions, whereas for negative polarization, cation adsorption dominates. In situ electrochemical quartz crystal microbalance measurements support the NMR results and indicate that adsorbed ions are only partially solvated. These results provide new molecular-level insight, with the methodology offering exciting possibilities for the study of pore/ion size, desolvation and other effects on charge storage in supercapacitors.

  1. The Origin of Improved Electrical Double-Layer Capacitance by Inclusion of Topological Defects and Dopants in Graphene for Supercapacitors.

    Science.gov (United States)

    Chen, Jiafeng; Han, Yulei; Kong, Xianghua; Deng, Xinzhou; Park, Hyo Ju; Guo, Yali; Jin, Song; Qi, Zhikai; Lee, Zonghoon; Qiao, Zhenhua; Ruoff, Rodney S; Ji, Hengxing

    2016-10-24

    Low-energy density has long been the major limitation to the application of supercapacitors. Introducing topological defects and dopants in carbon-based electrodes in a supercapacitor improves the performance by maximizing the gravimetric capacitance per mass of the electrode. However, the main mechanisms governing this capacitance improvement are still unclear. We fabricated planar electrodes from CVD-derived single-layer graphene with deliberately introduced topological defects and nitrogen dopants in controlled concentrations and of known configurations, to estimate the influence of these defects on the electrical double-layer (EDL) capacitance. Our experimental study and theoretical calculations show that the increase in EDL capacitance due to either the topological defects or the nitrogen dopants has the same origin, yet these two factors improve the EDL capacitance in different ways. Our work provides a better understanding of the correlation between the atomic-scale structure and the EDL capacitance and presents a new strategy for the development of experimental and theoretical models for understanding the EDL capacitance of carbon electrodes. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Enhancing the performance of green solid-state electric double-layer capacitor incorporated with fumed silica nanoparticles

    Science.gov (United States)

    Chong, Mee Yoke; Numan, Arshid; Liew, Chiam-Wen; Ng, H. M.; Ramesh, K.; Ramesh, S.

    2018-06-01

    Solid polymer electrolyte (SPE) based on fumed silica nanoparticles as nanofillers, hydroxylethyl cellulose (HEC) as host polymer, magnesium trifluoromethanesulfonate salt and 1-ethyl-3-methylimidazolium trifluoromethanesulfonate ionic liquid is prepared by solution casting technique. The ionic conductivity, interactions of adsorbed ions on the host polymer, structural crystallinity and thermal stability are evaluated by electrochemical impedance spectroscopy (EIS), Fourier transform infrared spectroscopy (FTIR), X-ray diffraction (XRD) and thermogravimetric analysis (TGA), respectively. Ionic conductivity studies at room temperature reveals that the SPE with 2 wt. % of fumed silica nanoparticles gives the highest conductivity compared to its counterpart. The XRD and FTIR studies confirm the dissolution of salt, ionic liquid and successful incorporation of fumed silica nanoparticles with host polymer. In order to examine the performance of SPEs, electric double-layer capacitor (EDLC) are fabricated by using activated carbon electrodes. EDLC studies demonstrate that SPE incorporated with 2 wt. % fumed silica nanoparticles gives high specific capacitance (25.0 F/g) at a scan rate of 5 mV/s compared to SPE without fumed silica. Additionally, it is able to withstand 71.3% of capacitance from its initial capacitance value over 1600 cycles at a current density of 0.4 A/g.

  3. Properties of a planar electric double layer under extreme conditions investigated by classical density functional theory and Monte Carlo simulations.

    Science.gov (United States)

    Zhou, Shiqi; Lamperski, Stanisław; Zydorczak, Maria

    2014-08-14

    Monte Carlo (MC) simulation and classical density functional theory (DFT) results are reported for the structural and electrostatic properties of a planar electric double layer containing ions having highly asymmetric diameters or valencies under extreme concentration condition. In the applied DFT, for the excess free energy contribution due to the hard sphere repulsion, a recently elaborated extended form of the fundamental measure functional is used, and coupling of Coulombic and short range hard-sphere repulsion is described by a traditional second-order functional perturbation expansion approximation. Comparison between the MC and DFT results indicates that validity interval of the traditional DFT approximation expands to high ion valences running up to 3 and size asymmetry high up to diameter ratio of 4 whether the high valence ions or the large size ion are co- or counter-ions; and to a high bulk electrolyte concentration being close to the upper limit of the electrolyte mole concentration the MC simulation can deal with well. The DFT accuracy dependence on the ion parameters can be self-consistently explained using arguments of liquid state theory, and new EDL phenomena such as overscreening effect due to monovalent counter-ions, extreme layering effect of counter-ions, and appearance of a depletion layer with almost no counter- and co-ions are observed.

  4. Effects of surface chemical properties of activated carbon modified by amino-fluorination for electric double-layer capacitor.

    Science.gov (United States)

    Jung, Min-Jung; Jeong, Euigyung; Cho, Seho; Yeo, Sang Young; Lee, Young-Seak

    2012-09-01

    The surface of phenol-based activated carbon (AC) was seriatim amino-fluorinated with solution of ammonium hydroxide and hydrofluoric acid in varying ratio to fabricate electrode materials for use in an electric double-layer capacitor (EDLC). The specific capacitance of the amino-fluorinated AC-based EDLC was measured in a 1 M H(2)SO(4) electrolyte, in which it was observed that the specific capacitances increased from 215 to 389 Fg(-1) and 119 and 250 Fg(-1) with the current densities of 0.1 and 1.0 Ag(-1), respectively, in comparison with those of an untreated AC-based EDLC when the amino-fluorination was optimized via seriatim mixed solution of 7.43 mol L(-1) ammonium hydroxide and 2.06 mol L(-1) hydrofluoric acid. This enhancement of capacitance was attributed to the synergistic effects of an increased electrochemical activity due to the formation of surface N- and F-functional groups and increased, specific surface area, and mesopore volumes, all of which resulted from the amino-fluorination of the electrode material. Copyright © 2012 Elsevier Inc. All rights reserved.

  5. Electric double-layer capacitors with tea waste derived activated carbon electrodes and plastic crystal based flexible gel polymer electrolytes

    Science.gov (United States)

    Suleman, M.; Deraman, M.; Othman, M. A. R.; Omar, R.; Hashim, M. A.; Basri, N. H.; Nor, N. S. M.; Dolah, B. N. M.; Hanappi, M. F. Y. M.; Hamdan, E.; Sazali, N. E. S.; Tajuddin, N. S. M.; Jasni, M. R. M.

    2016-08-01

    We report a novel configuration of symmetrical electric double-layer capacitors (EDLCs) comprising a plastic crystalline succinonitrile (SN) based flexible polymer gel electrolyte, incorporated with sodium trifluoromethane sulfonate (NaTf) immobilised in a host polymer poly (vinylidine fluoride-co-hexafluoropropylene) (PVdF-HFP). The cost-effective activated carbon powder possessing a specific surface area (SSA) of ~ 1700 m2g-1 containing a large proportion of meso-porosity has been derived from tea waste to use as supercapacitor electrodes. The high ionic conductivity (~3.6×10-3 S cm-1 at room temperature) and good electrochemical stability render the gel polymer electrolyte film a suitable candidate for the fabrication of EDLCs. The performance of the EDLCs has been tested by electrochemical impedance spectroscopy (EIS), cyclic voltammetry (CV), and galvanostatic charge-discharge studies. The performance of the EDLC cell is found to be promising in terms of high values of specific capacitance (~270 F g-1), specific energy (~ 36 Wh kg-1), and power density (~ 33 kW kg-1).

  6. Towards understanding the effects of van der Waals strengths on the electric double-layer structures and capacitive behaviors

    Science.gov (United States)

    Yang, Huachao; Bo, Zheng; Yang, Jinyuan; Yan, Jianhua; Cen, Kefa

    2017-10-01

    Solid-liquid interactions are considered to play a crucial role in charge storage capability of electric double-layer capacitors (EDLCs). In this work, effects of van der Waals (VDW) strengths on the EDL structures and capacitive performances within two representative electrolytes of solvated aqueous solutions and solvent-free ionic liquids are illuminated by molecular dynamics simulations. Single crystalline metals with similar lattice constant but diverse VDW potentials are employed as electrodes. Upon enhancing VDW strengths, capacitance of aqueous electrolytes first increases conspicuously by ∼34.0% and then descends, manifesting a non-monotonic trend, which goes beyond traditional perspectives. Such unusual observation is interpreted by the excluded-volume effects stemmed from ion-solvent competitions. Stimulated by predominant coulombic interactions, more ions are aggregated at the interface despite of the increasing VDW potentials, facilitating superior screening efficiency and capacitance. However, further enhancing strengths preferentially attracts more solvents instead of ions to the electrified surface, which in turn strikingly repels ions from Helmholtz layers, deteriorating electrode capacitance. An essentially similar feather is also recognized for ionic liquids, while the corresponding mechanisms are prominently ascribed to the suppressed ionic separations issued from cation-anion competitions. We highlight that constructing electrode materials with a moderate-hydrophilicity could further advance the performances of EDLCs.

  7. Electric double-layer capacitors with tea waste derived activated carbon electrodes and plastic crystal based flexible gel polymer electrolytes

    International Nuclear Information System (INIS)

    Suleman, M; Deraman, M; Othman, M A R; Omar, R; Basri, N H; Nor, N S M; Dolah, B N M; Hanappi, M F Y M; Hamdan, E; Sazali, N E S; Tajuddin, N S M; Jasni, M R M; Hashim, M A

    2016-01-01

    We report a novel configuration of symmetrical electric double-layer capacitors (EDLCs) comprising a plastic crystalline succinonitrile (SN) based flexible polymer gel electrolyte, incorporated with sodium trifluoromethane sulfonate (NaTf) immobilised in a host polymer poly (vinylidine fluoride-co-hexafluoropropylene) (PVdF-HFP). The cost-effective activated carbon powder possessing a specific surface area (SSA) of ∼ 1700 m 2 g -1 containing a large proportion of meso-porosity has been derived from tea waste to use as supercapacitor electrodes. The high ionic conductivity (∼3.6×10 -3 S cm -1 at room temperature) and good electrochemical stability render the gel polymer electrolyte film a suitable candidate for the fabrication of EDLCs. The performance of the EDLCs has been tested by electrochemical impedance spectroscopy (EIS), cyclic voltammetry (CV), and galvanostatic charge-discharge studies. The performance of the EDLC cell is found to be promising in terms of high values of specific capacitance (∼270 F g -1 ), specific energy (∼ 36 Wh kg -1 ), and power density (∼ 33 kW kg -1 ). (paper)

  8. Fundamental measure theory for the electric double layer: implications for blue-energy harvesting and water desalination

    International Nuclear Information System (INIS)

    Härtel, Andreas; Janssen, Mathijs; Samin, Sela; Roij, René van

    2015-01-01

    Capacitive mixing (CAPMIX) and capacitive deionization (CDI) are promising candidates for harvesting clean, renewable energy and for the energy efficient production of potable water, respectively. Both CAPMIX and CDI involve water-immersed porous carbon (supercapacitors) electrodes at voltages of the order of hundreds of millivolts, such that counter-ionic packing is important for the electric double layer (EDL) which forms near the surfaces of these porous materials. Thus, we propose a density functional theory (DFT) to model the EDL, where the White-Bear mark II fundamental measure theory functional is combined with a mean-field Coulombic and a mean spherical approximation-type correction to describe the interplay between dense packing and electrostatics, in good agreement with molecular dynamics simulations. We discuss the concentration-dependent potential rise due to changes in the chemical potential in capacitors in the context of an over-ideal theoretical description and its impact on energy harvesting and water desalination. Compared to less elaborate mean-field models our DFT calculations reveal a higher work output for blue-energy cycles and a higher energy demand for desalination cycles. (paper)

  9. Experimental studies on poly methyl methacrylate based gel polymer electrolytes for application in electrical double layer capacitors

    International Nuclear Information System (INIS)

    Hashmi, S A; Kumar, Ashok; Tripathi, S K

    2007-01-01

    Studies have been carried out on gel polymer electrolytes comprising poly methyl methacrylate (PMMA)-ethylene carbonate (EC)-propylene carbonate (PC)-salts, LiClO 4 , NaClO 4 and (C 2 H 5 ) 4 NClO 4 (TEAClO 4 ) with a view to using them as electrolytes in electrical double layer capacitors (EDLCs) based on activated charcoal powder electrodes. The optimum composition of gel electrolytes, PMMA (20 wt%)-EC : PC (1 : 1 v/v)-1.0 M salts exhibit high ionic conductivity of the order of ∼10 -3 S cm -1 at room temperature with good mechanical/dimensional stability, suitable for their application in EDLCs. The EDLCs have been characterized using linear sweep cyclic voltammetry, galvanostatic charge-discharge tests and ac impedance spectroscopy. The values of capacitance of 68-151 mF cm -2 (equivalent to single electrode specific capacitance of 38-78 Fg -1 of activated charcoal powder) have been observed. These values correspond to a specific energy of 5.3-10.8 Wh kg -1 and a power density of 0.19-0.22 kW kg -1 . The capacitance values have been observed to be stable up to 5000 voltammetric cycles or even more. A comparison of studies shows the predominant role of anions of the gel electrolytes in the capacitive behaviour of EDLCs

  10. Enhancement of superconducting transition temperature in FeSe electric-double-layer transistor with multivalent ionic liquids

    Science.gov (United States)

    Miyakawa, Tomoki; Shiogai, Junichi; Shimizu, Sunao; Matsumoto, Michio; Ito, Yukihiro; Harada, Takayuki; Fujiwara, Kohei; Nojima, Tsutomu; Itoh, Yoshimitsu; Aida, Takuzo; Iwasa, Yoshihiro; Tsukazaki, Atsushi

    2018-03-01

    We report on an enhancement of the superconducting transition temperature (Tc) of the FeSe-based electric-double-layer transistor (FeSe-EDLT) by applying the multivalent oligomeric ionic liquids (ILs). The IL composed of dimeric cation (divalent IL) enables a large amount of charge accumulation on the surface of the FeSe ultrathin film, resulting in inducing electron-rich conduction even in a rather thick 10 nm FeSe channel. The onset Tc in FeSe-EDLT with the divalent IL is enhanced to be approaching about 50 K at the thin limit, which is about 7 K higher than that in EDLT with conventional monovalent ILs. The enhancement of Tc is a pronounced effect of the application of the divalent IL, in addition to the large capacitance, supposing preferable interface formation of ILs driven by geometric and/or Coulombic effect. The present finding strongly indicates that multivalent ILs are powerful tools for controlling and improving physical properties of materials.

  11. Influence of ion pairing in ionic liquids on electrical double layer structures and surface force using classical density functional approach.

    Science.gov (United States)

    Ma, Ke; Forsman, Jan; Woodward, Clifford E

    2015-05-07

    We explore the influence of ion pairing in room temperature ionic liquids confined by planar electrode surfaces. Using a coarse-grained model for the aromatic ionic liquid [C4MIM(+)][BF4 (-)], we account for an ion pairing component as an equilibrium associating species within a classical density functional theory. We investigated the resulting structure of the electrical double layer as well as the ensuing surface forces and differential capacitance, as a function of the degree of ion association. We found that the short-range structure adjacent to surfaces was remarkably unaffected by the degree of ion pairing, up to several molecular diameters. This was even the case for 100% of ions being paired. The physical implications of ion pairing only become apparent in equilibrium properties that depend upon the long-range screening of charges, such as the asymptotic behaviour of surface forces and the differential capacitance, especially at low surface potential. The effect of ion pairing on capacitance is consistent with their invocation as a source of the anomalous temperature dependence of the latter. This work shows that ion pairing effects on equilibrium properties are subtle and may be difficult to extract directly from simulations.

  12. Spatiotemporal electrochemical measurements across an electric double layer capacitor electrode with application to aqueous sodium hybrid batteries

    Science.gov (United States)

    Tully, Katherine C.; Whitacre, Jay F.; Litster, Shawn

    2014-02-01

    This paper presents in-situ spatiotemporal measurements of the electrolyte phase potential within an electric double layer capacitor (EDLC) negative electrode as envisaged for use in an aqueous hybrid battery for grid-scale energy storage. The ultra-thick electrodes used in these batteries to reduce non-functional material costs require sufficiently fast through-plane mass and charge transport to attain suitable charging and discharging rates. To better evaluate the through-plane transport, we have developed an electrode scaffold (ES) for making in situ electrolyte potential distribution measurements at discrete known distances across the thickness of an uninterrupted EDLC negative electrode. Using finite difference methods, we calculate local current, volumetric charging current and charge storage distributions from the spatiotemporal electrolyte potential measurements. These potential distributions provide insight into complex phenomena that cannot be directly observed using other existing methods. Herein, we use the distributions to identify areas of the electrode that are underutilized, assess the effects of various parameters on the cumulative charge storage distribution, and evaluate an effectiveness factor for charge storage in EDLC electrodes.

  13. Exploring new scaling regimes for streaming potential and electroviscous effects in a nanocapillary with overlapping electric double layers.

    Science.gov (United States)

    Das, Siddhartha; Guha, Arnab; Mitra, Sushanta K

    2013-12-04

    In this paper, we unravel new scaling regimes for streaming potential and electroviscous effects in a nanocapillary with thick overlapping Electric Double Layers (EDLs). We observe that the streaming potential, for a given value of the capillary zeta (ζ) potential, varies with the EDL thickness and a dimensionless parameter R, quantifying the conduction current. Depending on the value of R, variation of the streaming potential with the EDL thickness demonstrates distinct scaling regimes: one can witness a Quadratic Regime where the streaming potential varies as the square of the EDL thickness, a Weak Regime where the streaming potential shows a weaker variation with the EDL thickness, and a Saturation Regime where the streaming potential ceases to vary with the EDL thickness. Effective viscosity, characterizing the electroviscous effect, obeys the variation of the streaming potential for smaller EDL thickness values; however, for larger EDL thickness the electroosmotic flow profile dictates the electroviscous effect, with insignificant contribution of the streaming potential. Copyright © 2013 Elsevier B.V. All rights reserved.

  14. Dynamic monitoring of transmembrane potential changes: a study of ion channels using an electrical double layer-gated FET biosensor.

    Science.gov (United States)

    Pulikkathodi, Anil Kumar; Sarangadharan, Indu; Chen, Yi-Hong; Lee, Geng-Yen; Chyi, Jen-Inn; Lee, Gwo-Bin; Wang, Yu-Lin

    2018-03-27

    In this research, we have designed, fabricated and characterized an electrical double layer (EDL)-gated AlGaN/GaN high electron mobility transistor (HEMT) biosensor array to study the transmembrane potential changes of cells. The sensor array platform is designed to detect and count circulating tumor cells (CTCs) of colorectal cancer (CRC) and investigate cellular bioelectric signals. Using the EDL FET biosensor platform, cellular responses can be studied in physiological salt concentrations, thereby eliminating complex automation. Upon investigation, we discovered that our sensor response follows the transmembrane potential changes of captured cells. Our whole cell sensor platform can be used to monitor the dynamic changes in the membrane potential of cells. The effects of continuously changing electrolyte ion concentrations and ion channel blocking using cadmium are investigated. This methodology has the potential to be used as an electrophysiological probe for studying ion channel gating and the interaction of biomolecules in cells. The sensor can also be a point-of-care diagnostic tool for rapid screening of diseases.

  15. Can ionophobic nanopores enhance the energy storage capacity of electric-double-layer capacitors containing nonaqueous electrolytes?

    International Nuclear Information System (INIS)

    Lian, Cheng; University of California, Riverside, CA; Liu, Honglai; Henderson, Douglas; Wu, Jianzhong

    2016-01-01

    The ionophobicity effect of nanoporous electrodes on the capacitance and the energy storage capacity of nonaqueous-electrolyte supercapacitors is studied by means of the classical density functional theory (DFT). It has been hypothesized that ionophobic nanopores may create obstacles in charging, but they store energy much more efficiently than ionophilic pores. In this paper, we find that, for both ionic liquids and organic electrolytes, an ionophobic pore exhibits a charging behavior different from that of an ionophilic pore, and that the capacitance–voltage curve changes from a bell shape to a two-hump camel shape when the pore ionophobicity increases. For electric-double-layer capacitors containing organic electrolytes, an increase in the ionophobicity of the nanopores leads to a higher capacity for energy storage. Without taking into account the effects of background screening, the DFT predicts that an ionophobic pore containing an ionic liquid does not enhance the supercapacitor performance within the practical voltage ranges. However, by using an effective dielectric constant to account for ion polarizability, the DFT predicts that, like an organic electrolyte, an ionophobic pore with an ionic liquid is also able to increase the energy stored when the electrode voltage is beyond a certain value. We find that the critical voltage for an enhanced capacitance in an ionic liquid is larger than that in an organic electrolyte. Finally, our theoretical predictions provide further understanding of how chemical modification of porous electrodes affects the performance of supercapacitors.

  16. New Approach for High-Voltage Electrical Double-Layer Capacitors Using Vertical Graphene Nanowalls with and without Nitrogen Doping.

    Science.gov (United States)

    Chi, Yu-Wen; Hu, Chi-Chang; Shen, Hsiao-Hsuan; Huang, Kun-Ping

    2016-09-14

    Integrating various devices to achieve high-performance energy storage systems to satisfy various demands in modern societies become more and more important. Electrical double-layer capacitors (EDLCs), one kind of the electrochemical capacitors, generally provide the merits of high charge-discharge rates, extremely long cycle life, and high efficiency in electricity capture/storage, leading to a desirable device of electricity management from portable electronics to hybrid vehicles or even smart grid application. However, the low cell voltage (2.5-2.7 V in organic liquid electrolytes) of EDLCs lacks the direct combination of Li-ion batteries (LIBs) and EDLCs for creating new functions in future applications without considering the issue of a relatively low energy density. Here we propose a guideline, "choosing a matching pair of electrode materials and electrolytes", to effectively extend the cell voltage of EDLCs according to three general strategies. Based on the new strategy proposed in this work, materials with an inert surface enable to tolerate a wider potential window in commercially available organic electrolytes in comparison with activated carbons (ACs). The binder-free, vertically grown graphene nanowalls (GNW) and nitrogen-doped GNW (NGNW) electrodes respectively provide good examples for extending the upper potential limit of a positive electrode of EDLCs from 0.1 to 1.5 V (vs Ag/AgNO3) as well as the lower potential limit of a negative electrode of EDLCs from -2.0 V to ca. -2.5 V in 1 M TEABF4/PC (propylene carbonate) compared to ACs. This newly designed asymmetric EDLC exhibits a cell voltage of 4 V, specific energy of 52 Wh kg(-1) (ca. a device energy density of 13 Wh kg(-1)), and specific power of 8 kW kg(-1) and ca. 100% retention after 10,000 cycles charge-discharge, reducing the series number of EDLCs to enlarge the module voltage and opening the possibility for directly combining EDLCs and LIBs in advanced applications.

  17. Spatial peak-load pricing

    International Nuclear Information System (INIS)

    Arellano, M. Soledad; Serra, Pablo

    2007-01-01

    This article extends the traditional electricity peak-load pricing model to include transmission costs. In the context of a two-node, two-technology electric power system, where suppliers face inelastic demand, we show that when the marginal plant is located at the energy-importing center, generators located away from that center should pay the marginal capacity transmission cost; otherwise, consumers should bear this cost through capacity payments. Since electric power transmission is a natural monopoly, marginal-cost pricing does not fully cover costs. We propose distributing the revenue deficit among users in proportion to the surplus they derive from the service priced at marginal cost. (Author)

  18. Simultaneous control of thermoelectric properties in p- and n-type materials by electric double-layer gating: New design for thermoelectric device

    Science.gov (United States)

    Takayanagi, Ryohei; Fujii, Takenori; Asamitsu, Atsushi

    2015-05-01

    We report a novel design of a thermoelectric device that can control the thermoelectric properties of p- and n-type materials simultaneously by electric double-layer gating. Here, p-type Cu2O and n-type ZnO were used as the positive and negative electrodes of the electric double-layer capacitor structure. When a gate voltage was applied between the two electrodes, holes and electrons accumulated on the surfaces of Cu2O and ZnO, respectively. The thermopower was measured by applying a thermal gradient along the accumulated layer on the electrodes. We demonstrate here that the accumulated layers worked as a p-n pair of the thermoelectric device.

  19. High Power Electric Double-Layer Capacitors based on Room-Temperature Ionic Liquids and Nanostructured Carbons

    Science.gov (United States)

    Perez, Carlos R.

    The efficient storage of electrical energy constitutes both a fundamental challenge for 21st century science and an urgent requirement for the sustainability of our technological civilization. The push for cleaner renewable forms of energy production, such as solar and wind power, strongly depends on a concomitant development of suitable storage methods to pair with these intermittent sources, as well as for mobile applications, such as vehicles and personal electronics. In this regard, Electrochemical Double-Layer Capacitors (supercapacitors) represent a vibrant area of research due to their environmental friendliness, long lifetimes, high power capability, and relative underdevelopment when compared to electrochemical batteries. Currently supercapacitors have gravimetric energies one order of magnitude lower than similarly advanced batteries, while conversly enjoying a similar advantage over them in terms of power. The challenge is to increase the gravimentric energies and conserve the high power. On the material side, research focuses on highly porous supports and electrolytes, the critical components of supercapacitors. Through the use of electrolyte systems with a wider electrochemical stability window, as well as properly tailored carbon nanomaterials as electrodes, significant improvements in performance are possible. Room Temperature Ionic Liquids and Carbide-Derived Carbons are promising electrolytes and electrodes, respectively. RTILs have been shown to be stable at up to twice the voltage of organic solvent-salt systems currently employed in supercapacitors, and CDCs are tunable in pore structure, show good electrical conductivity, and superior demonstrated capability as electrode material. This work aims to better understand the interplay of electrode and electrolyte parameters, such as pore structure and ion size, in the ultimate performance of RTIL-based supercapacitors in terms of power, energy, and temperature of operation. For this purpose, carbon

  20. Electrode Mass Balancing as an Inexpensive and Simple Method to Increase the Capacitance of Electric Double-Layer Capacitors

    Science.gov (United States)

    Andres, Britta; Engström, Ann-Christine; Blomquist, Nicklas; Forsberg, Sven; Dahlström, Christina; Olin, Håkan

    2016-01-01

    Symmetric electric double-layer capacitors (EDLCs) have equal masses of the same active material in both electrodes. However, having equal electrode masses may prevent the EDLC to have the largest possible specific capacitance if the sizes of the hydrated anions and cations in the electrolyte differ because the electrodes and the electrolyte may not be completely utilized. Here we demonstrate how this issue can be resolved by mass balancing. If the electrode masses are adjusted according to the size of the ions, one can easily increase an EDLC’s specific capacitance. To that end, we performed galvanostatic cycling to measure the capacitances of symmetric EDLCs with different electrode mass ratios using four aqueous electrolytes— Na2SO4, H2SO4, NaOH, and KOH (all with a concentration of 1 M)—and compared these to the theoretical optimal electrode mass ratio that we calculated using the sizes of the hydrated ions. Both the theoretical and experimental values revealed lower-than-1 optimal electrode ratios for all electrolytes except KOH. The largest increase in capacitance was obtained for EDLCs with NaOH as electrolyte. Specifically, we demonstrate an increase of the specific capacitance by 8.6% by adjusting the electrode mass ratio from 1 to 0.86. Our findings demonstrate that electrode mass balancing is a simple and inexpensive method to increase the capacitance of EDLCs. Furthermore, our results imply that one can reduce the amount of unused material in EDLCs and thus decrease their weight, volume and cost. PMID:27658253

  1. Can ionophobic nanopores enhance the energy storage capacity of electric-double-layer capacitors containing nonaqueous electrolytes?

    Science.gov (United States)

    Lian, Cheng; Liu, Honglai; Henderson, Douglas; Wu, Jianzhong

    2016-10-01

    The ionophobicity effect of nanoporous electrodes on the capacitance and the energy storage capacity of nonaqueous-electrolyte supercapacitors is studied by means of the classical density functional theory (DFT). It has been hypothesized that ionophobic nanopores may create obstacles in charging, but they store energy much more efficiently than ionophilic pores. In this study, we find that, for both ionic liquids and organic electrolytes, an ionophobic pore exhibits a charging behavior different from that of an ionophilic pore, and that the capacitance-voltage curve changes from a bell shape to a two-hump camel shape when the pore ionophobicity increases. For electric-double-layer capacitors containing organic electrolytes, an increase in the ionophobicity of the nanopores leads to a higher capacity for energy storage. Without taking into account the effects of background screening, the DFT predicts that an ionophobic pore containing an ionic liquid does not enhance the supercapacitor performance within the practical voltage ranges. However, by using an effective dielectric constant to account for ion polarizability, the DFT predicts that, like an organic electrolyte, an ionophobic pore with an ionic liquid is also able to increase the energy stored when the electrode voltage is beyond a certain value. We find that the critical voltage for an enhanced capacitance in an ionic liquid is larger than that in an organic electrolyte. Our theoretical predictions provide further understanding of how chemical modification of porous electrodes affects the performance of supercapacitors. The authors are saddened by the passing of George Stell but are pleased to contribute this article in his memory. Some years ago, DH gave a talk at a Gordon Conference that contained an approximation that George had demonstrated previously to be in error in one of his publications. Rather than making this point loudly in the discussion, George politely, quietly, and privately pointed this out

  2. The Influence of Carbonate Ions on the Structure of the Electrical Double Layer at the Interface of Hydroxyapatite/Electrolyte Solution

    Directory of Open Access Journals (Sweden)

    Ewa SKWAREK

    2016-05-01

    Full Text Available The aim of the work was to investigate the changes in the double electrical layer at the hydroxyapatite containing different amount of carbonate ions/electrolyte solution. Besides, the main properties of the edl (electrical double layer, i.e. surface charge density and zeta potential were determined by electrophoresis measurements and potentiometer titration, respectively. The synthesized adsorbents were characterized by the following methods: X-ray diffraction, FTIR (Fourier Transform Infrared Spectroscopy, adsorption and desorption of nitrogen and scanning electron microscopy. The analyzed samples had different structures and particle sizes. It was proved that increase in the carbonate groups content is connected with the decrease of apatite grain sizes and crystallinity reduction. The characteristic parameters of the electric double layer were also different: pHpzc (point zero of charge of hydroxyapatite was 6.5 whereas for carbonate apatite was higher – pHpzc = 8. In both cases determination of precise pHIEP (isoelectric point was not possible but it is known that its value is lower than 4.DOI: http://dx.doi.org/10.5755/j01.ms.22.2.7817

  3. Leveling of battery load and extension of battery life by serial connection of electric double layer capacitors with batteries for electric vehicles. Experimental results on the small model; Denki jidoshayo denchi to denki nijuso capacitor no chokuretsu setsuzoku ni yoru denchi futan no heijunka oyobi denchijumyo no enshinka. (kogata model ni yoru jikken seika). Kogata model ni yoru jikken seika

    Energy Technology Data Exchange (ETDEWEB)

    Takehara, J.; Okubo, N.; Miyaoka, K. [Chugoku Electric Power Co. Inc., Hiroshima (Japan)

    1996-10-25

    The load leveling method of batteries for electric vehicles was studied for extension of a battery life and mileage every charging. Under large load fluctuation conditions such as deceleration and acceleration, use of electric power sources other than battery for peek load at acceleration can improve a battery life, output power capacity and mileage every charging. Combination of effective recovery of regenerative power at deceleration with its discharge at acceleration is one of the effective methods. The electric double layer capacitors are serially connected with the batteries, regenerative power is charged only into the capacitors, and both voltages of the battery and capacitor are applied to a power circuit. Battery load is reduced by load on the capacitor. Until the capacitor is re-charged by regenerative power after full discharge, power is supplied only by battery through a diode. Capacitor power is used as effectively as possible until approaching considerably low voltage. As peak load of the battery is reduced by 30%, the mileage increases by 5.7%, and the battery cycle life becomes 1.5 times longer. 7 refs., 5 figs., 3 tabs.

  4. Electricity

    CERN Document Server

    Basford, Leslie

    2013-01-01

    Electricity Made Simple covers the fundamental principles underlying every aspect of electricity. The book discusses current; resistance including its measurement, Kirchhoff's laws, and resistors; electroheat, electromagnetics and electrochemistry; and the motor and generator effects of electromagnetic forces. The text also describes alternating current, circuits and inductors, alternating current circuits, and a.c. generators and motors. Other methods of generating electromagnetic forces are also considered. The book is useful for electrical engineering students.

  5. Electrical double layer modulation of hybrid room temperature ionic liquid/aqueous buffer interface for enhanced sweat based biosensing.

    Science.gov (United States)

    Jagannath, Badrinath; Muthukumar, Sriram; Prasad, Shalini

    2018-08-03

    We have investigated the role of kosmotropic anionic moieties and chaotropic cationic moieties of room temperature hydrophilic ionic liquids in enhancing the biosensing performance of affinity based immunochemical biosensors in human sweat. Two ionic liquids, 1-butyl-3-methylimidazolium tetrafluoroborate (BMIM[BF 4 ]) and choline dihydrogen phosphate (Choline[DHP]) were investigated in this study with Choline[DHP] being more kosmotropic in nature having a more protein stabilizing effect based on the hofmeister series. Non-faradaic interfacial charge transfer has been employed as the mechanism for evaluating the formation and the biosensing of capture probe antibodies in room temperature ionic liquids (RTILs)/aqueous human sweat interface. The charge of the ionic moieties were utilized to form compact electrical double layers around the antibodies for enhancing the stability of the antibody capture probes, which was evaluated through zeta potential measurements. The zeta potential measurements indicated stability of antibodies due to electrostatic repulsion of the RTIL charged moieties encompassing the antibodies, thus preventing any aggregation. Here, we report for the first time of non-faradaic electrochemical impedance spectroscopy equivalent circuit model analysis for analyzing and interpreting affinity based biosensing at hybrid electrode/ionic liquid-aqueous sweat buffer interface guided by the choice of the ionic liquid. Interleukin-6 (IL-6) and cortisol two commonly occurring biomarkers in human sweat were evaluated using this method. The limit of detection (LOD) obtained using both ionic liquids for IL-6 was 0.2 pg mL -1 with cross-reactivity studies indicating better performance of IL-6 detection using Choline[DHP] and no response to cross-reactive molecule. The LOD of 0.1 ng/mL was achieved for cortisol and the cross-reactivity studies indicated that cortisol antibody in BMIM[BF 4 ] did not show any signal response to cross-reactive molecules

  6. Mechanical characteristics of a double-fed machine in asynchronous mode and prospects of its application in the electric drive of mining machines

    Science.gov (United States)

    Ostrovlyanchik, V. Yu; Popolzin, I. Yu; Kubarev, V. A.; Marshev, D. A.

    2017-09-01

    The concept of a double-fed machine as an asynchronous motor with a phase rotor and a source of additional voltage is defined. Based on the analysis of a circuit replacing the double-fed machine, an expression is derived relating the moment, slip, amplitude and phase of additional voltage across the rotor. The conditions maximizing the moment with respect to amplitude and phase of additional voltage in the rotor circuit are also obtained, the phase surface of function of machine electromagnetic moment is constructed. The analysis of basic equation of electric drive motion in relation to electric drive of mine hoisting installations and the conclusion about the necessity of work in all four quadrants of coordinate plane “moment-slip” are made. Family of mechanical characteristics is constructed for a double-fed machine and its achievable speed control range in asynchronous mode is determined. Based on the type of mechanical characteristics and the calculated range of speed control, the conclusion is made about the suitability of using a dual-fed asynchronous machine for driving mine mechanisms with a small required speed control range and the need for organizing a combined operating mode for driving mine hoisting installations and other mechanisms with a large speed control range.

  7. Safety evaluation report related to the operation of Comanche Peak Steam Electric Station, Units 1 and 2 (Docket Nos. 50-445 and 50-446): Supplement No. 21

    International Nuclear Information System (INIS)

    1989-04-01

    Supplement 21 to the Safety Evaluation Report related to the operation of the Comanche Peak Steam Electric Station (CPSES), Units 1 and 2 (NUREG-0797), has been prepared by the Office of Nuclear Reactor Regulation of the US Nuclear Regulatory Commission (NRC). The facility is located in Somervell County, Texas, approximately 40 miles southwest of Fort Worth, Texas. This supplement reports the status of certain issues that had not been resolved when the Safety Evaluation Report and Supplements 1, 2, 3, 4, 6, and 12 to that report were published. This supplement also lists the new issues that have been identified since Supplement 12 was issued and includes the evaluations for licensing items resolved in this interim period. 21 refs

  8. Safety Evaluation Report related to the operation of Comanche Peak Steam Electric Station, Units 1 and 2 (Docket Nos. 50-445 and 50-446). Supplement No. 13

    International Nuclear Information System (INIS)

    1986-05-01

    Supplement 13 to the Safety Evaluation Report related to the operation of Comanche Peak Steam Electric Station (CPSES), Units 1 and 2 (NUREG-0797), has been prepared by the Office of Nuclear Reactor Regulation of the US Nuclear Regulatory Commission (NRC). The facility is located in Somervell County, Texas, approximately 40 miles southwest of Fort Worth, Texas. This supplement presents the staff's evaluation of the Comanche Peak Response Team (CPRT) Program Plan which was formulated by the applicant to resolve various construction and design issues raised by the Atomic Safety and Licensing Board, allegers, intervenor Citizens Association for Sound Energy (CASE), NRC inspections of various types, and Cygna Energy Services while conducting its independent design assessment. The NRC staff concludes that the CPRT Program Plan provides an overall structure for addressing all existing issues and any future issues which may be identified from further evaluations, and if properly implemented will provide important evidence of the design and construction quality of CPSES, and will identify any needed corrective action. The report identifies items to be addressed by the NRC staff during the implementation phase

  9. Peak Shaving Considering Streamflow Uncertainties | Iwuagwu ...

    African Journals Online (AJOL)

    The main thrust of this paper is peak shaving with a Stochastic hydro model. In peak sharing, the amount of hydro energy scheduled may be a minimum but it serves to replace less efficient thermal units. The sample system is die Kainji hydro plant and the thermal units of the National Electric Power Authority. The random ...

  10. Electric-line-source illumination of a circular cylinder of lossless double-negative material: an investigation of near field, directivity, and radiation resistance

    DEFF Research Database (Denmark)

    Arslanagic, Samel; Breinbjerg, Olav

    2006-01-01

    the properties of the near field, inside as well as outside the cylinder, and the far-field. Third, the variations of these fields are examined, as well as the radiation resistance and radiation pattern, as functions of the geometrical and electromagnetic parameters of the configuration. It is demonstrated......This work investigates the properties of an antenna-like configuration with an electric line source radiating in the presence of a double-negative circular cylinder. First, the analytical eigenfunction-series solution is derived. Second, this solution is employed in numerical calculations to study...

  11. A mini review of designed mesoporous materials for energy-storage applications: from electric double-layer capacitors to hybrid supercapacitors

    Science.gov (United States)

    Lim, Eunho; Jo, Changshin; Lee, Jinwoo

    2016-04-01

    In recent years, porous materials have attracted significant attention in various research fields because of their structural merits. In particular, well-designed mesoporous structures with two- or three-dimensionally interconnected pores have been recognized as electrode materials of particular interest for achieving high-performance electrochemical capacitors (ECs). In this mini review, recent progress in the design of mesoporous electrode materials for ECs, from electric double-layer capacitors (EDLCs) and pseudocapacitors (PCs) to hybrid supercapacitors (HSCs), and research challenges for the development of new mesoporous electrode materials has been discussed.

  12. Influence of time-periodic potentials on electronic transport in double-well structure

    International Nuclear Information System (INIS)

    Chun-Lei, Li; Yan, Xu

    2010-01-01

    Within the framework of the Floquet theorem, we have investigated single-electron photon-assisted tunneling in a double-well system using the transfer matrix technique. The transmission probability displays satellite peaks on both sides of the main resonance peaks and these satellite peaks originate from emission or absorption photons. The single-electron resonance tunneling can be controlled through changing the applied harmonically potential positions, such as driven potential in wells, in barriers, or in whole double-well systems. This advantage should be useful in the optimization of the parameters of a transmission device. (condensed matter: electronic structure, electrical, magnetic, and optical properties)

  13. Catalytic Graphitization for Preparation of Porous Carbon Material Derived from Bamboo Precursor and Performance as Electrode of Electrical Double-Layer Capacitor

    Science.gov (United States)

    Tsubota, Toshiki; Maguchi, Yuta; Kamimura, Sunao; Ohno, Teruhisa; Yasuoka, Takehiro; Nishida, Haruo

    2015-12-01

    The combination of addition of Fe (as a catalyst for graphitization) and CO2 activation (a kind of gaseous activation) was applied to prepare a porous carbon material from bamboo powder (a waste product of superheated steam treatment). Regardless of the heat treatment temperature, many macropores were successfully formed after the heating process by removal of Fe compounds. A turbostratic carbon structure was generated in the Fe-added sample heated at 850°C. It was confirmed that the added Fe acted as a template for pore formation. Moreover, it was confirmed that the added Fe acted as a catalyst for graphitization. The resulting electrochemical performance as the electrode of an electrical double-layer capacitor, as demonstrated by cyclic voltammetry, electrochemical impedance spectroscopy, and charge-discharge testing, could be explained based on the graphitization and activation effects. Addition of Fe could affect the electrical properties of carbon material derived from bamboo.

  14. Combined effects of hydrostatic pressure and electric field on the donor binding energy and polarizability in laterally coupled double InAs/GaAs quantum-well wires

    International Nuclear Information System (INIS)

    Tangarife, E.; Duque, C.A.

    2010-01-01

    This work is concerned with the theoretical study of the combined effects of applied electric field and hydrostatic pressure on the binding energy and impurity polarizability of a donor impurity in laterally coupled double InAs/GaAs quantum-well wires. calculations have been made in the effective mass and parabolic band approximations and using a variational method. The results are reported for different configurations of wire and barriers widths, impurity position, and electric field and hydrostatic pressure strengths. Our results show that for symmetrical structures the binding energy is an even function of the impurity position along the growth direction of the structure. Also, we found that for hydrostatic pressure strength up to 38 kbar, the binding energy increases linearly with hydrostatic pressure, while for larger values of hydrostatic pressure the binding energy has a nonlinear behavior. Finally, we found that the hydrostatic pressure can increase the coupling between the two parallel quantum well wires.

  15. Boron cross-linked graphene oxide/polyvinyl alcohol nanocomposite gel electrolyte for flexible solid-state electric double layer capacitor with high performance

    International Nuclear Information System (INIS)

    Huang, Yi-Fu; Wu, Peng-Fei; Zhang, Ming-Qiu; Ruan, Wen-Hong; Giannelis, Emmanuel P.

    2014-01-01

    Highlights: • Gel electrolyte is prepared and used in electric double layer capacitor. • Insertion of boron crosslinks into GO agglomerates opens channels for ion migration. • Solid supercapacitors show excellent specific capacitance and cycle stability. • Nanocomposite electrolyte shows better thermal stability and mechanical properties. - Abstract: A new family of boron cross-linked graphene oxide/polyvinyl alcohol (GO-B-PVA) nanocomposite gels is prepared by freeze-thaw/boron cross-linking method. Then the gel electrolytes saturated with KOH solution are assembled into electric double layer capacitors (EDLCs). Structure, thermal and mechanical properties of GO-B-PVA are explored. The electrochemical properties of EDLCs using GO-B-PVA/KOH are investigated, and compared with those using GO-PVA/KOH gel or KOH solution electrolyte. FTIR shows that boron cross-links are introduced into GO-PVA, while the boronic structure inserted into agglomerated GO sheets is demonstrated by DMA analysis. The synergy effect of the GO and the boron crosslinking benefits for ionic conductivity due to unblocking ion channels, and for improvement of thermal stability and mechanical properties of the electrolytes. Higher specific capacitance and better cycle stability of EDLCs are obtained by using the GO-B-PVA/KOH electrolyte, especially the one at higher GO content. The nanocomposite gel electrolytes with excellent electrochemical properties and solid-like character are candidates for the industrial application in high-performance flexible solid-state EDLCs

  16. Emergence of a Stern Layer from the Incorporation of Hydration Interactions into the Gouy-Chapman Model of the Electrical Double Layer.

    Science.gov (United States)

    Brown, Matthew A; Bossa, Guilherme Volpe; May, Sylvio

    2015-10-27

    In one of the most commonly used phenomenological descriptions of the electrical double layer, a charged solid surface and a diffuse region of mobile ions are separated from each other by a thin charge-depleted Stern layer. The Stern layer acts as a capacitor that improves the classical Gouy-Chapman model by increasing the magnitude of the surface potential and limiting the maximal counterion concentration. We show that very similar Stern-like properties of the diffuse double layer emerge naturally from adding a nonelectrostatic hydration repulsion to the electrostatic Coulomb potential. The interplay of electrostatic attraction and hydration repulsion of the counterions and the surface leads to the formation of a diffuse counterion layer that remains well separated from the surface. In addition, hydration repulsions between the ions limit and control the maximal ion concentration and widen the width of the diffuse double layer. Our mean-field model, which we express in terms of electrostatic and hydration potentials, is physically consistent and conceptually similar to the classical Gouy-Chapman model. It allows the incorporation of ion specificity, accounts for hydration properties of charged surfaces, and predicts Stern layer properties, which we analyze in terms of the effective size of the hydrated counterions.

  17. Observations of propagating double layers in a high current discharge

    International Nuclear Information System (INIS)

    Lindberg, L.

    1988-01-01

    Observations of current disruptions and strong electric fields along the magnetic field in a high-density (2 x 10 19 m - 3 , highly-ionized, moving, and expanding plasma column are reported. The electric field is interpreted in terms of propagating, strong electric double layers (3-5kV). An initial plasma column is formed in an axial magnetic field (0.1T) by means of a conical theta-pinch plasma gun. When an axial current (max 5kA, 3-5 kV) is drawn through the column spontaneous disruptions and double-layer formation occur within a few microseconds. Floating, secondary emitting Langmuir probes are used. They often indicate very high positive potential peaks (1-2 kV above the anode potential during a few μs) in the plasma on the positive side of the double layer. Short, intense bursts of HF radiation are detected at the disruptions

  18. Generation Mix Study Focusing on Nuclear Power by Practical Peak Forecast

    International Nuclear Information System (INIS)

    Shin, Jung Ho; Roh, Myung Sub

    2013-01-01

    The excessive underestimation can lead to a range of problem; expansion of LNG plant requiring short construction period, the following increase of electricity price, low reserve margin and inefficient configuration of power source. With regard to nuclear power, the share of the stable and economic base load plant, nuclear power, can reduce under the optimum level. Amongst varied factors which contribute to the underestimate, immoderate target for demand side management (DSM) including double deduction of the constraint amount by DSM from peak demand forecast is one of the causes. The hypothesis in this study is that the better optimum generation mix including the adequate share of nuclear power can be obtained under the condition of the peak demand forecast without deduction of DSM target because this forecast is closer to the actual peak demand. In this study, the hypothesis is verified with comparison between peak demand forecast before (or after) DSM target application and the actual peak demand in the 3 rd through 5 th BPE from 2006 to 2010. Furthermore, this research compares and analyzes several generation mix in 2027 focusing on the nuclear power by a few conditions using the WASP-IV program on the basis of the 6 th BPE in 2013. According to the comparative analysis on the peak demand forecast and actual peak demand from 2006 to 2010, the peak demand forecasts without the deduction of the DSM target is closer to the actual peak demand than the peak demand forecasts considering the DSM target in the 3 th , 4 th , 5 th entirely. In addition, the generation mix until 2027 is examined by the WASP-IV. As a result of the program run, when considering the peak demand forecast without DSM reflection, since the base load plants including nuclear power take up adequate proportion, stable and economic supply of electricity can be achieved. On the contrary, in case of planning based on the peak demand forecast with DSM reflected and then compensating the shortage by

  19. Generation Mix Study Focusing on Nuclear Power by Practical Peak Forecast

    Energy Technology Data Exchange (ETDEWEB)

    Shin, Jung Ho; Roh, Myung Sub [KEPCO International Nuclear Graduate School, Ulsan (Korea, Republic of)

    2013-10-15

    The excessive underestimation can lead to a range of problem; expansion of LNG plant requiring short construction period, the following increase of electricity price, low reserve margin and inefficient configuration of power source. With regard to nuclear power, the share of the stable and economic base load plant, nuclear power, can reduce under the optimum level. Amongst varied factors which contribute to the underestimate, immoderate target for demand side management (DSM) including double deduction of the constraint amount by DSM from peak demand forecast is one of the causes. The hypothesis in this study is that the better optimum generation mix including the adequate share of nuclear power can be obtained under the condition of the peak demand forecast without deduction of DSM target because this forecast is closer to the actual peak demand. In this study, the hypothesis is verified with comparison between peak demand forecast before (or after) DSM target application and the actual peak demand in the 3{sup rd} through 5{sup th} BPE from 2006 to 2010. Furthermore, this research compares and analyzes several generation mix in 2027 focusing on the nuclear power by a few conditions using the WASP-IV program on the basis of the 6{sup th} BPE in 2013. According to the comparative analysis on the peak demand forecast and actual peak demand from 2006 to 2010, the peak demand forecasts without the deduction of the DSM target is closer to the actual peak demand than the peak demand forecasts considering the DSM target in the 3{sup th}, 4{sup th}, 5{sup th} entirely. In addition, the generation mix until 2027 is examined by the WASP-IV. As a result of the program run, when considering the peak demand forecast without DSM reflection, since the base load plants including nuclear power take up adequate proportion, stable and economic supply of electricity can be achieved. On the contrary, in case of planning based on the peak demand forecast with DSM reflected and then

  20. Practical load management - Peak shaving using photovoltaics

    International Nuclear Information System (INIS)

    Berger, W.

    2009-01-01

    This article takes a look at how photovoltaic (PV) power generation can be used in a practical way to meet peak demands for electricity. Advice is provided on how photovoltaics can provide peak load 'shaving' through the correlation between its production and the peak loads encountered during the day. The situation regarding feed-in tariffs in Italy is discussed, as are further examples of installations in Germany and Austria. Further, an initiative of the American Southern California Edison utility is discussed which foresees the installation of large PV plant on the roofs of commercial premises to provide local generation of peak energy and thus relieve demands on their power transportation network.

  1. Structure of cylindrical electric double layers: Comparison of density functional and modified Poisson-Boltzmann theories with Monte Carlo simulations

    Directory of Open Access Journals (Sweden)

    V.Dorvilien

    2013-01-01

    Full Text Available The structure of cylindrical double layers is studied using a modified Poisson Boltzmann theory and the density functional approach. In the model double layer the electrode is a cylindrical polyion that is infinitely long, impenetrable, and uniformly charged. The polyion is immersed in a sea of equi-sized rigid ions embedded in a dielectric continuum. An in-depth comparison of the theoretically predicted zeta potentials, the mean electrostatic potentials, and the electrode-ion singlet density distributions is made with the corresponding Monte Carlo simulation data. The theories are seen to be consistent in their predictions that include variations in ionic diameters, electrolyte concentrations, and electrode surface charge densities, and are also able to reproduce well some new and existing Monte Carlo results.

  2. Electricity

    International Nuclear Information System (INIS)

    Tombs, F.

    1983-01-01

    The subject is discussed, with particular reference to the electricity industry in the United Kingdom, under the headings; importance and scope of the industry's work; future fuel supplies (estimated indigenous fossil fuels reserves); outlook for UK energy supplies; problems of future generating capacity and fuel mix (energy policy; construction programme; economics and pricing; contribution of nuclear power - thermal and fast reactors; problems of conversion of oil-burning to coal-burning plant). (U.K.)

  3. Analysis of carrier behavior in C60/P(VDF-TrFE) double-layer capacitor by using electric-field-induced optical second-harmonic generation measurement

    International Nuclear Information System (INIS)

    Cui, Xiaojin; Taguchi, Dai; Manaka, Takaaki; Iwamoto, Mitsumasa

    2013-01-01

    By using displacement current measurement (DCM) and electric-field-induced optical second-harmonic generation (EFISHG) measurement, we studied the carrier behavior in the indium-tin oxide (ITO)/Poly(vinylidene fluoride-trifluoroethylene) (P(VDF-TrFE))/C60/Au(or Al) capacitors. Two DCM peaks appeared asymmetrically at around −35.5 V and +30.0 V in the dark. Correspondingly, the EFISHG response from the C60 layer was observed, but the peak positions were different with respect to DCM ones. The results show that the spontaneous polarization of the ferroelectric P(VDF-TrFE) polymeric layer directly affects the electric field in the C60 layer, and thus governs the carrier motion in this layer. As a result, the C60 layer serves like an insulator in the dark, while electrons and holes are captured and released at the interface in response to the turn-over of spontaneous polarization of ferroelectric layer. On the other hand, under white light illumination, C60 layer serves like a conductor due to the increase of photogenerated mobile carriers, and these carriers dominate the carrier motions therein. Our findings here will be helpful for analyzing carrier behaviors in organic electronic devices using ferroelectric polymers

  4. Analysis of carrier behavior in C60/P(VDF-TrFE) double-layer capacitor by using electric-field-induced optical second-harmonic generation measurement

    Energy Technology Data Exchange (ETDEWEB)

    Cui, Xiaojin [Department of Physical Electronics, Tokyo Institute of Technology 2-12-1 O-okayama, Meguro-ku, Tokyo 152-8552 (Japan); State Key Laboratory of New Ceramics and Fine Processing, School of Materials Science and Engineering, Tsinghua University, Beijing 100084 (China); Taguchi, Dai; Manaka, Takaaki; Iwamoto, Mitsumasa, E-mail: iwamoto@pe.titech.ac.jp [Department of Physical Electronics, Tokyo Institute of Technology 2-12-1 O-okayama, Meguro-ku, Tokyo 152-8552 (Japan)

    2013-12-21

    By using displacement current measurement (DCM) and electric-field-induced optical second-harmonic generation (EFISHG) measurement, we studied the carrier behavior in the indium-tin oxide (ITO)/Poly(vinylidene fluoride-trifluoroethylene) (P(VDF-TrFE))/C60/Au(or Al) capacitors. Two DCM peaks appeared asymmetrically at around −35.5 V and +30.0 V in the dark. Correspondingly, the EFISHG response from the C60 layer was observed, but the peak positions were different with respect to DCM ones. The results show that the spontaneous polarization of the ferroelectric P(VDF-TrFE) polymeric layer directly affects the electric field in the C60 layer, and thus governs the carrier motion in this layer. As a result, the C60 layer serves like an insulator in the dark, while electrons and holes are captured and released at the interface in response to the turn-over of spontaneous polarization of ferroelectric layer. On the other hand, under white light illumination, C60 layer serves like a conductor due to the increase of photogenerated mobile carriers, and these carriers dominate the carrier motions therein. Our findings here will be helpful for analyzing carrier behaviors in organic electronic devices using ferroelectric polymers.

  5. Peak Experience Project

    Science.gov (United States)

    Scott, Daniel G.; Evans, Jessica

    2010-01-01

    This paper emerges from the continued analysis of data collected in a series of international studies concerning Childhood Peak Experiences (CPEs) based on developments in understanding peak experiences in Maslow's hierarchy of needs initiated by Dr Edward Hoffman. Bridging from the series of studies, Canadian researchers explore collected…

  6. Double unification of particles with fields and electricity with gravity in non-empty space of continuous complex energies

    Directory of Open Access Journals (Sweden)

    Bulyzhenkov Igor E.

    2016-01-01

    Full Text Available Non-empty space reading of Maxwell equations as local energy identities explains why a Coulomb field is carried rigidly by electrons in experiments. The analytical solution of the Poisson equation defines the sharp radial shape of charged elementary densities which are proportional to continuous densities of electric self-energy. Both Coulomb field and radial charge densities are free from energy divergences. Non-empty space of electrically charged mass-energy can be described by complex analytical densities resulting in real values for volume mass integrals and in imaginary values for volume charge integrals. Imaginary electric charges in the Newton gravitational law comply with real Coulomb forces. Unification of forces through complex charges rids them of radiation self-acceleration. Strong gravitational fields repeal probe bodies that might explainthe accelerated expansion of the dense Metagalaxy. Outward and inward spherical waves form the standing wave process within the radial carrier of complex energy.

  7. Double twist : Can-K's electric submersible twin screw pump is designed to handle the nastiest crudes

    Energy Technology Data Exchange (ETDEWEB)

    Byfield, M.

    2010-12-15

    This article described the Can-K Group of Companies' electric submersible twin screw pump (ESTSP) designed for pumping heavy crudes with high levels of asphaltenes, hydrogen sulphide, wax, and methane. The technology was awarded the 2010 winner of best production technology for a company with fewer than 100 employees. The ESTSP can pump at a greater depth than other lift technologies. The design challenges included making the pump small enough to fit inside the well casing while also able to generate the high pressures necessary for pumping heavy oil. The ESTSP can compete directly against other lift technologies, including electric submersible pumps (ESPs). In the design, two shafts are separated by a timing gear. Each shaft has short sections of interlocking screws that do not touch, which lessens tension and the need for torque, lowering electricity consumption. The ESTSP is more efficient than ESP systems, particularly in more viscous mediums with high gas-to-oil ratios. The positive displacement pump interprets only volume and does not distinguish between gas and oil, functioning with gas content up to 97 percent. ESTSP can also handle more sand than ESP because it does not rely on centrifugal force. A patented screw design also helps prevent pump seizure resulting from sand and other solids. The pump uses downhole electric motors from other manufacturers. The inherent efficiencies of twin screw pumps give the technology the potential to replace conventional ESPs. 2 figs.

  8. Structural, vibrational and electrical properties of ordered double perovskite oxide BaLaMnSbO6

    International Nuclear Information System (INIS)

    Bharti, Chandrahas; Sen, A.; Chanda, Sadhan; Sinha, T.P.

    2014-01-01

    Graphical abstract: Raman spectrum with group theoretical analysis -- Highlights: • BaLaMnSbO 6 (BLMS) is synthesized in tetragonal phase (TP). • Rietveld refinement and Raman spectroscopy confirms the TP. • The presence of cation ordering is observed. • The electrical activation energy is ∼0.5 eV. • BLMS shows polaron hopping. -- Abstract: BaLaMnSbO 6 (BLMS) has been successfully synthesized by solid-state reaction technique. In contrast to earlier reports, Rietveld refinement of powder X-ray diffraction (XRD) data of BLMS shows tetragonal structure having space group I4/m. The octahedral tilt about the direction of the c-axis is found to be 8.99° and the superlattice line (0 1 1) indicates the presence of cation ordering. FT-IR and Raman analysis as well as group theoretical investigation confirm the ordered tetragonal structure of BLMS with I4/m space group. The anti-phase distortions appear to be sufficiently large as detected by infrared and Raman spectroscopies, which give rise to the degeneracy and breaking of the symmetries of the normal modes. Impedance spectroscopy is used to investigate the dielectric relaxation and ac electrical conductivity in the temperature range of 303–403 K and in the frequency range of 0.1 kHz–1 MHz. Experimental electric modulus data are fitted to the Cole–Cole model in order to analyse the dielectric relaxation in BLMS. The frequency dependence ac electrical conductivity data are fitted to Jonscher’s universal power law at various temperatures. The dc conductivity follows Arrhenius law with activation energy (E a ) 0.51 eV suggesting the polaron hopping. The complex impedance plane plots of BLMS indicate the presence of both grain and grain boundary effects and are analyzed by the electrical equivalent circuit consisting of a resistance and capacitance

  9. Structural, vibrational and electrical properties of ordered double perovskite oxide BaLaMnSbO{sub 6}

    Energy Technology Data Exchange (ETDEWEB)

    Bharti, Chandrahas, E-mail: bhartic@cgcri.res.in [Sensor and Actuator Division, CSIR-Central Glass and Ceramic Research Institute, 196, Raja SC Mullick Road, Kolkata 700032 (India); Sen, A. [Sensor and Actuator Division, CSIR-Central Glass and Ceramic Research Institute, 196, Raja SC Mullick Road, Kolkata 700032 (India); Chanda, Sadhan; Sinha, T.P. [Department of Physics, Bose Institute, 93/1, Acharya Prafulla Chandra Road, Kolkata 700009 (India)

    2014-03-25

    Graphical abstract: Raman spectrum with group theoretical analysis -- Highlights: • BaLaMnSbO{sub 6} (BLMS) is synthesized in tetragonal phase (TP). • Rietveld refinement and Raman spectroscopy confirms the TP. • The presence of cation ordering is observed. • The electrical activation energy is ∼0.5 eV. • BLMS shows polaron hopping. -- Abstract: BaLaMnSbO{sub 6} (BLMS) has been successfully synthesized by solid-state reaction technique. In contrast to earlier reports, Rietveld refinement of powder X-ray diffraction (XRD) data of BLMS shows tetragonal structure having space group I4/m. The octahedral tilt about the direction of the c-axis is found to be 8.99° and the superlattice line (0 1 1) indicates the presence of cation ordering. FT-IR and Raman analysis as well as group theoretical investigation confirm the ordered tetragonal structure of BLMS with I4/m space group. The anti-phase distortions appear to be sufficiently large as detected by infrared and Raman spectroscopies, which give rise to the degeneracy and breaking of the symmetries of the normal modes. Impedance spectroscopy is used to investigate the dielectric relaxation and ac electrical conductivity in the temperature range of 303–403 K and in the frequency range of 0.1 kHz–1 MHz. Experimental electric modulus data are fitted to the Cole–Cole model in order to analyse the dielectric relaxation in BLMS. The frequency dependence ac electrical conductivity data are fitted to Jonscher’s universal power law at various temperatures. The dc conductivity follows Arrhenius law with activation energy (E{sub a}) 0.51 eV suggesting the polaron hopping. The complex impedance plane plots of BLMS indicate the presence of both grain and grain boundary effects and are analyzed by the electrical equivalent circuit consisting of a resistance and capacitance.

  10. Peak-interviewet

    DEFF Research Database (Denmark)

    Raalskov, Jesper; Warming-Rasmussen, Bent

    Peak-interviewet er en særlig effektiv metode til at gøre ubevidste menneskelige ressourcer bevidste. Fokuspersonen (den interviewede) interviewes om en selvvalgt, personlig succesoplevelse. Terapeuten/coachen (intervieweren) spørger ind til processen, som ledte hen til denne succes. Herved afdæk...... fokuspersonen ønsker at tage op (nye mål eller nye processer). Nærværende workingpaper beskriver, hvad der menes med et peak-interview, peakinterviwets teoretiske fundament samt metodikken til at foretage et tillidsfuldt og effektiv peak-interview....

  11. Switching Device Dead Time Optimization of Resonant Double-Sided LCC Wireless Charging System for Electric Vehicles

    Directory of Open Access Journals (Sweden)

    Xi Zhang

    2017-11-01

    Full Text Available Aiming at the reduction of the influence of the dead time setting on power level and efficiency of the inverter of double-sided LCC resonant wireless power transfer (WPT system, a dead time soft switching optimization method for metal–oxide–semiconductor field-effect transistor (MOSFET is proposed. At first, the mathematic description of double-sided LCC resonant wireless charging system is established, and the operating mode is analyzed as well, deducing the quantitative characteristic that the secondary side compensation capacitor C2 can be adjusted to ensure that the circuit is inductive. A dead time optimization design method is proposed, contributing to achieving zero-voltage switching (ZVS of the inverter, which is closely related to the performance of the WPT system. In the end, a prototype is built. The experimental results verify that dead time calculated by this optimized method can ensure the soft switching of the inverter MOSFET and promote the power and efficiency of the WPT.

  12. Peak power ratio generator

    Science.gov (United States)

    Moyer, R.D.

    A peak power ratio generator is described for measuring, in combination with a conventional power meter, the peak power level of extremely narrow pulses in the gigahertz radio frequency bands. The present invention in a preferred embodiment utilizes a tunnel diode and a back diode combination in a detector circuit as the only high speed elements. The high speed tunnel diode provides a bistable signal and serves as a memory device of the input pulses for the remaining, slower components. A hybrid digital and analog loop maintains the peak power level of a reference channel at a known amount. Thus, by measuring the average power levels of the reference signal and the source signal, the peak power level of the source signal can be determined.

  13. Electrostatic interaction between an enzyme and electrodes in the electric double layer examined in a view of direct electron transfer-type bioelectrocatalysis.

    Science.gov (United States)

    Sugimoto, Yu; Kitazumi, Yuki; Tsujimura, Seiya; Shirai, Osamu; Yamamoto, Masahiro; Kano, Kenji

    2015-01-15

    Effects of the electrode poential on the activity of an adsorbed enzyme has been examined by using copper efflux oxidase (CueO) as a model enzyme and by monitoring direct electron transfer (DET)-type bioelectrocatalysis of oxygen reduction. CueO adsorbed on bare Au electrodes at around the point of zero charge (E(pzc)) shows the highest DET activity, and the activity decreases as the adsorption potential (E(ad); at which the enzyme adsorbs) is far from E(pzc). We propose a model to explain the phenomena in which the electrostatic interaction between the enzyme and electrodes in the electric double layer affects the orientation and the stability of the adsorbed enzyme. The self-assembled monolayer of butanethiol on Au electrodes decreases the electric field in the outside of the inner Helmholtz plane and drastically diminishes the E(ad) dependence of the DET activity of CueO. When CueO is adsorbed on bare Au electrodes under open circuit potential and then is held at hold potentials (E(ho)) more positive than E(pzc), the DET activity of the CueO rapidly decreases with the hold time. The strong electric field with positive surface charge density on the metallic electrode (σ(M)) leads to fatal denaturation of the adsorbed CueO. Such denaturation effect is not so serious at E(ho)electric field with negative σ(M) induces an orientation inconvenient for the DET reaction during the adsorption process. A positively charged neomycin shows a promoter ability to CueO adsorbed at E(ad)

  14. Peak Oil, Peak Coal and Climate Change

    Science.gov (United States)

    Murray, J. W.

    2009-05-01

    Research on future climate change is driven by the family of scenarios developed for the IPCC assessment reports. These scenarios create projections of future energy demand using different story lines consisting of government policies, population projections, and economic models. None of these scenarios consider resources to be limiting. In many of these scenarios oil production is still increasing to 2100. Resource limitation (in a geological sense) is a real possibility that needs more serious consideration. The concept of 'Peak Oil' has been discussed since M. King Hubbert proposed in 1956 that US oil production would peak in 1970. His prediction was accurate. This concept is about production rate not reserves. For many oil producing countries (and all OPEC countries) reserves are closely guarded state secrets and appear to be overstated. Claims that the reserves are 'proven' cannot be independently verified. Hubbert's Linearization Model can be used to predict when half the ultimate oil will be produced and what the ultimate total cumulative production (Qt) will be. US oil production can be used as an example. This conceptual model shows that 90% of the ultimate US oil production (Qt = 225 billion barrels) will have occurred by 2011. This approach can then be used to suggest that total global production will be about 2200 billion barrels and that the half way point will be reached by about 2010. This amount is about 5 to 7 times less than assumed by the IPCC scenarios. The decline of Non-OPEC oil production appears to have started in 2004. Of the OPEC countries, only Saudi Arabia may have spare capacity, but even that is uncertain, because of lack of data transparency. The concept of 'Peak Coal' is more controversial, but even the US National Academy Report in 2007 concluded only a small fraction of previously estimated reserves in the US are actually minable reserves and that US reserves should be reassessed using modern methods. British coal production can be

  15. Preparation of porous carbon spheres from 2-keto-l-gulonic acid mother liquor by oxidation and activation for electric double-layer capacitor application.

    Science.gov (United States)

    Hao, Zhi-Qiang; Cao, Jing-Pei; Zhao, Xiao-Yan; Wu, Yan; Zhu, Jun-Sheng; Dang, Ya-Li; Zhuang, Qi-Qi; Wei, Xian-Yong

    2018-03-01

    A novel strategy is proposed for the increase of specific surface area (SSA) of porous carbon sphere (PCS) by oxidation and activation. 2-keto-l-gulonic acid mother liquor (GAML) as a high-pollution waste has a relatively high value of reutilization. For its high value-added utilization, GAML is used as the precursor for preparation of PCS as carbon-based electrode materials for electric double-layer capacitor. PCS is prepared by hydrothermal carbonization, carbonization and KOH activation, and Fe(NO 3 ) 3 9H 2 O is used as an oxidizing agent during carbonization. The as-prepared PCS has excellent porosity and high SSA of 2478 m 2  g -1 . Meanwhile, the pore structure of PCS can be controlled by the adjustment of carbonization parameters (carbonization temperature and the loading of Fe(NO 3 ) 3 9H 2 O). Besides, the SSA and specific capacitance of PCS can be increased remarkably when Fe(NO 3 ) 3 9H 2 O is added in carbonization. The specific capacitance of PCS can reach 303.7 F g -1 at 40 mA g -1 . PCSs as electrode material have superior electrochemical stability. After 8000 cycles, the capacitance retention is 98.3% at 2 A g -1 . The electric double-layer capacitance of PCS is improved when CS is carbonized with Fe(NO 3 ) 3 9H 2 O, and the economic and environmental benefits are achieved by the effective recycle of GAML. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. The Effects of Self-Discharge on the Performance of Symmetric Electric Double-Layer Capacitors and Active Electrolyte-Enhanced Supercapacitors: Insights from Modeling and Simulation

    Science.gov (United States)

    Ike, Innocent S.; Sigalas, Iakovos; Iyuke, Sunny E.

    2017-02-01

    The effects of self-discharge on the performance of symmetric electric double-layer capacitors (EDLCs) and active electrolyte-enhanced supercapacitors were examined by incorporating self-discharge into electrochemical capacitor models during charging and discharging. The sources of self-discharge in capacitors were side reactions or redox reactions and several impurities and electric double-layer (EDL) instability. The effects of self-discharge during capacitor storage was negligible since it took a fully charged capacitor a minimum of 14.0 days to be entirely discharged by self-discharge in all conditions studied, hence self-discharge in storage condition can be ignored. The first and second charge-discharge cycle energy efficiencies η_{{{{E}}1}} and η_{{{{E}}2}} of a capacitor of electrode effective conductivity α1 = 0.05 S/cm with only EDL instability self-discharge with current density J_{{VR}} = 1.25 × 10-3 A/cm2 were 72.33% and 72.34%, respectively. Also, energy efficiencies η_{{{{E}}1}} and η_{{{{E}}2}} of a similar capacitor with both side reactions and redox reactions and EDL instability self-discharges with current densities J_{{VR}} = 0.00125 A/cm2 and J_{{{{VR}}1}} = 0.0032 A/cm2 were 38.13% and 38.14% respectively, compared with 84.24% and 84.25% in a similar capacitor without self-discharge. A capacitor with only EDL instability self-discharge and that with both side reactions and redox reactions and EDL instability self-discharge lost 9.73 Wh and 28.38 Wh of energy, respectively, through self-discharge during charging and discharging. Hence, EDLCs charging and discharging time is significantly dependent on the self-discharge rate which are too large to be ignored.

  17. Effects of electrolytic composition on the electric double-layer capacitance at smooth-surface carbon electrodes in organic media

    International Nuclear Information System (INIS)

    Kim, In-Tae; Egashira, Minato; Yoshimoto, Nobuko; Morita, Masayuki

    2010-01-01

    As a fundamental research on the optimization of electrolyte composition in practical electrochemical capacitor device, double-layer capacitance at Glassy Carbon (GC) and Boron-doped Diamond (BDD), as typical smooth-surface carbon electrodes, has been studied as a function of the electrolyte composition in organic media. Specific capacitance (differential capacitance: F cm -2 ) determined by an AC impedance method, in which no contribution of mass-transport effects is included, corresponded well to integrated capacitance evaluated by conventional cyclic voltammetry. The specific capacitance at the GC electrode varied with polarized potential and showed clear PZC (potential of zero charge), while the potential dependence of the capacitance at BDD was very small. The effects of the solvent and the electrolytic salt on the capacitance behavior were common for both electrodes. That is, the sizes of the solvent molecule and the electrolytic ion (cation) strongly affected the capacitance at these smooth-surface carbon electrodes.

  18. Electric conductivity of double fluorides in the systems M1F-Th(U)F4(M1=K, Tl) and M2F2-ThF4(M2=Ca, Sr, Ba)

    International Nuclear Information System (INIS)

    Murin, I.V.; Andreev, A.M.; Amelin, Yu.V.

    1982-01-01

    The temperature dependence of electric conductivity of some double fluorides formed in the systems M 1 F-Th(U)F 4 (M 1 =K, Tl) and M 2 F 2 -ThF 4 (M 2 =Ca, Sr, Ba) as well as UF 3 in a wide temperature range is studied. It is shown that the values of electric conductivity and activation energy of these fluorides depend on the compound structure and cation nature. The temperature electric conductivity dependence for double fluorides with the tysonite structure is close to the lanthanum fluoride dependence. Taking into account low electron electric conductivity component the conclusion is drawn that the investigated compounds can be used as solid electrolytes

  19. Electrical stimulation for chronic non-specific low back pain in a working-age population: a 12-week double blinded randomized controlled trial.

    Science.gov (United States)

    Thiese, Matthew S; Hughes, Matthew; Biggs, Jeremy

    2013-03-28

    Non-invasive electrotherapy is commonly used for treatment of chronic low back pain. Evidence for efficacy of most electrotherapy modalities is weak or lacking. This study aims to execute a high-quality, double-blinded randomized controlled clinical trial comparing 1) H-Wave(®) Device stimulation plus usual care with 2) transcutaneous electrical nerve stimulation (TENS) plus usual care, and 3) Sham electrotherapy plus usual care to determine comparative efficacy for treatment of chronic non-specific low back pain patients. Chronic non-specific low back pain patients between ages of 18-65 years, with pain of at least 3 months duration and minimal current 5/10 VAS pain. Patients will have no significant signs or symptoms of lumbosacral nerve impingement, malignancy, spinal stenosis, or mood disorders. Double blind RCT with 3 arms and 38 subjects per arm. Randomization by permuted blocks of random length, stratified by Workers Compensation claim (yes vs. no), and use of opioids. The null hypothesis of this study is that there are no statistically significant differences in functional improvement between treatment types during and at the end of a 12-week week treatment period. Subjective data will be collected using Filemaker Pro™ database management collection tools. Objective data will be obtained through functional assessments. Data will be collected at enrollment and at 1, 4, 8, and 12 weeks for each participant by a blinded assessor. H-Wave(®) device stimulation (Intervention A) plus usual care, transcutaneous electrical nerve stimulation (TENS) (Intervention B) plus usual care, and sham electrotherapy plus usual care (control). Each treatment arm will have identical numbers of visits (4) and researcher contact time (approximately 15 hours). Oswestry Disability Index. Secondary measures include: Rowland Morris Instrument, VAS pain score, functional evaluation including strength when pushing and pulling, pain free range of motion in flexion and extension

  20. Make peak flow a habit

    Science.gov (United States)

    Asthma - make peak flow a habit; Reactive airway disease - peak flow; Bronchial asthma - peak flow ... 2014:chap 55. National Asthma Education and Prevention Program website. How to use a peak flow meter. ...

  1. Spectral Induced Polarization of Low-pH Concrete. Influence of the Electrical Double Layer and Pore Size

    Science.gov (United States)

    Leroy, P. G.; Gaboreau, S.; Zimmermann, E.; Hoerdt, A.; Claret, F.; Huisman, J. A.; Tournassat, C.

    2017-12-01

    Low-pH concretes are foreseen to be used in nuclear waste disposal. Understanding their reactivity upon the considered host-rock is a key point. Evolution of mineralogy, porosity, pore size distribution and connectivity can be monitored in situ using geophysical methods such as induced polarization (IP). This electrical method consists of injecting an alternating current and measuring the resulting voltage in the porous medium. Spectral IP (SIP) measurements in the 10 mHz to 10 kHz frequency range were carried out on low-pH concrete and cement paste first in equilibrium and then in contact with a CO2 enriched and diluted water. We observed a very high resistivity of the materials (> 10 kOhm m) and a strong phase shift between injected current and measured voltage (superior to 40 mrad and above 100 mrad for frequencies > 100 Hz). These observations were modelled by considering membrane polarization with ion exclusion in nanopores whose surface electrical properties were computed using a basic Stern model of the cement/water interface. Pore size distribution was deduced from SIP and was compared to the measured ones. In addition, we observed a decrease of the material resistivity due to the dissolution of cement in contact with external water. Our results show that SIP may be a valuable method to monitor the mineralogy and the petrophysical and transport properties of cements.

  2. Automated asteroseismic peak detections

    DEFF Research Database (Denmark)

    de Montellano, Andres Garcia Saravia Ortiz; Hekker, S.; Themessl, N.

    2018-01-01

    Space observatories such as Kepler have provided data that can potentially revolutionize our understanding of stars. Through detailed asteroseismic analyses we are capable of determining fundamental stellar parameters and reveal the stellar internal structure with unprecedented accuracy. However......, such detailed analyses, known as peak bagging, have so far been obtained for only a small percentage of the observed stars while most of the scientific potential of the available data remains unexplored. One of the major challenges in peak bagging is identifying how many solar-like oscillation modes are visible...... of detected oscillation modes. The algorithm presented here opens the possibility for detailed and automated peak bagging of the thousands of solar-like oscillators observed by Kepler....

  3. Effects of overlapping electric double layer on mass transport of a macro-solute across porous wall of a micro/nanochannel for power law fluid.

    Science.gov (United States)

    Bhattacharjee, Saikat; Mondal, Mrinmoy; De, Sirshendu

    2017-05-01

    Effects of overlapping electric double layer and high wall potential on transport of a macrosolute for flow of a power law fluid through a microchannel with porous walls are studied in this work. The electric potential distribution is obtained by coupling the Poisson's equation without considering the Debye-Huckel approximation. The numerical solution shows that the center line potential can be 16% of wall potential at pH 8.5, at wall potential -73 mV and scaled Debye length 0.5. Transport phenomena involving mass transport of a neutral macrosolute is formulated by species advective equation. An analytical solution of Sherwood number is obtained for power law fluid. Effects of fluid rheology are studied in detail. Average Sherwood number is more for a pseudoplastic fluid compared to dilatant upto the ratio of Poiseuille to electroosmotic velocity of 5. Beyond that, the Sherwood number is independent of fluid rheology. Effects of fluid rheology and solute size on permeation flux and concentration of neutral solute are also quantified. More solute permeation occurs as the fluid changes from pseudoplastic to dilatant. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. A systematic Monte Carlo simulation study of the primitive model planar electrical double layer over an extended range of concentrations, electrode charges, cation diameters and valences

    Science.gov (United States)

    Valiskó, Mónika; Kristóf, Tamás; Gillespie, Dirk; Boda, Dezső

    2018-02-01

    The purpose of this study is to provide data for the primitive model of the planar electrical double layer, where ions are modeled as charged hard spheres, the solvent as an implicit dielectric background (with dielectric constant ɛ = 78.5), and the electrode as a smooth, uniformly charged, hard wall. We use canonical and grand canonical Monte Carlo simulations to compute the concentration profiles, from which the electric field and electrostatic potential profiles are obtained by solving Poisson's equation. We report data for an extended range of parameters including 1:1, 2:1, and 3:1 electrolytes at concentrations c = 0.0001 - 1 M near electrodes carrying surface charges up to σ = ±0.5 Cm-2. The anions are monovalent with a fixed diameter d- = 3 Å, while the charge and diameter of cations are varied in the range z+ = 1, 2, 3 and d+ = 1.5, 3, 6, and 9 Å (the temperature is 298.15 K). We provide all the raw data in the supplementary material (ftp://ftp.aip.org/epaps/aip_advances/E-AAIDBI-8-084802">supplementary material).

  5. Using Plantar Electrical Stimulation to Improve Postural Balance and Plantar Sensation Among Patients With Diabetic Peripheral Neuropathy: A Randomized Double Blinded Study.

    Science.gov (United States)

    Najafi, Bijan; Talal, Talal K; Grewal, Gurtej Singh; Menzies, Robert; Armstrong, David G; Lavery, Lawrence A

    2017-07-01

    People with diabetic peripheral neuropathy (DPN) often exhibit deteriorations in motor-performance mainly due to lack of plantar-sensation. The study explored effectiveness of plantar electrical-stimulation therapy to enhance motor-performance among people with DPN. Using a double-blinded model, 28 volunteers with DPN (age: 57.8 ± 10.2 years) were recruited and randomized to either intervention (IG: n = 17) or control (CG: n = 11) group. Both groups received identical plantar-stimulation devices for six weeks of daily use at home; however, only the IG devices were set to deliver stimulation. Balance (ankle, hip, and center of mass [COM] sway) and gait (stride velocity [SV], stride time [ST], stride length [SL], and cadence) were measured using validated wearable sensors. Outcomes were assessed at baseline and at six-week. Clinical assessment including vascular as measured by ankle-brachial-index (ABI) and plantar-sensation as quantified by vibratory plantar threshold (VPT) were also measured at baseline and six weeks. No difference were observed between groups for baseline characteristics ( P > .050). Posttherapy, ankle and COM sway with eyes open were significantly improved ( P 1.20 ( P = .041, d = 0.99) Conclusion: This study suggests that daily home use of plantar electrical-stimulation may be a practical means to enhance motor-performance and plantar-sensation in people with DPN.

  6. A systematic Monte Carlo simulation study of the primitive model planar electrical double layer over an extended range of concentrations, electrode charges, cation diameters and valences

    Directory of Open Access Journals (Sweden)

    Mónika Valiskó

    2018-02-01

    Full Text Available The purpose of this study is to provide data for the primitive model of the planar electrical double layer, where ions are modeled as charged hard spheres, the solvent as an implicit dielectric background (with dielectric constant ϵ = 78.5, and the electrode as a smooth, uniformly charged, hard wall. We use canonical and grand canonical Monte Carlo simulations to compute the concentration profiles, from which the electric field and electrostatic potential profiles are obtained by solving Poisson’s equation. We report data for an extended range of parameters including 1:1, 2:1, and 3:1 electrolytes at concentrations c = 0.0001 − 1 M near electrodes carrying surface charges up to σ = ±0.5 Cm−2. The anions are monovalent with a fixed diameter d− = 3 Å, while the charge and diameter of cations are varied in the range z+ = 1, 2, 3 and d+ = 1.5, 3, 6, and 9 Å (the temperature is 298.15 K. We provide all the raw data in the supplementary material.

  7. Preparation of hierarchical porous carbon from waste printed circuit boards for high performance electric double-layer capacitors

    Science.gov (United States)

    Du, Xuan; Wang, Li; Zhao, Wei; Wang, Yi; Qi, Tao; Li, Chang Ming

    2016-08-01

    Renewable clean energy and resources recycling have become inevitable choices to solve worldwide energy shortages and environmental pollution problems. It is a great challenge to recycle tons of waste printed circuit boards (PCB) produced every year for clean environment while creating values. In this work, low cost, high quality activated carbons (ACs) were synthesized from non-metallic fractions (NMF) of waste PCB to offer a great potential for applications of electrochemical double-layer capacitors (EDLCs). After recovering metal from waste PCB, hierarchical porous carbons were produced from NMF by carbonization and activation processes. The experimental results exhibit that some pores were formed after carbonization due to the escape of impurity atoms introduced by additives in NMF. Then the pore structure was further tailored by adjusting the activation parameters. Roles of micropores and non-micropores in charge storage were investigated when the hierarchical porous carbons were applied as electrode of EDLCs. The highest specific capacitance of 210 F g-1 (at 50 mA g-1) and excellent rate capability were achieved when the ACs possessing a proper micropores/non-micropores ratio. This work not only provides a promising method to recycle PCB, but also investigates the structure tailoring arts for a rational hierarchical porous structure in energy storage/conversion.

  8. Transient finite element analysis of electric double layer using Nernst-Planck-Poisson equations with a modified Stern layer.

    Science.gov (United States)

    Lim, Jongil; Whitcomb, John; Boyd, James; Varghese, Julian

    2007-01-01

    A finite element implementation of the transient nonlinear Nernst-Planck-Poisson (NPP) and Nernst-Planck-Poisson-modified Stern (NPPMS) models is presented. The NPPMS model uses multipoint constraints to account for finite ion size, resulting in realistic ion concentrations even at high surface potential. The Poisson-Boltzmann equation is used to provide a limited check of the transient models for low surface potential and dilute bulk solutions. The effects of the surface potential and bulk molarity on the electric potential and ion concentrations as functions of space and time are studied. The ability of the models to predict realistic energy storage capacity is investigated. The predicted energy is much more sensitive to surface potential than to bulk solution molarity.

  9. Automated asteroseismic peak detections

    Science.gov (United States)

    García Saravia Ortiz de Montellano, Andrés; Hekker, S.; Themeßl, N.

    2018-05-01

    Space observatories such as Kepler have provided data that can potentially revolutionize our understanding of stars. Through detailed asteroseismic analyses we are capable of determining fundamental stellar parameters and reveal the stellar internal structure with unprecedented accuracy. However, such detailed analyses, known as peak bagging, have so far been obtained for only a small percentage of the observed stars while most of the scientific potential of the available data remains unexplored. One of the major challenges in peak bagging is identifying how many solar-like oscillation modes are visible in a power density spectrum. Identification of oscillation modes is usually done by visual inspection that is time-consuming and has a degree of subjectivity. Here, we present a peak-detection algorithm especially suited for the detection of solar-like oscillations. It reliably characterizes the solar-like oscillations in a power density spectrum and estimates their parameters without human intervention. Furthermore, we provide a metric to characterize the false positive and false negative rates to provide further information about the reliability of a detected oscillation mode or the significance of a lack of detected oscillation modes. The algorithm presented here opens the possibility for detailed and automated peak bagging of the thousands of solar-like oscillators observed by Kepler.

  10. Effect of transcutaneous electrical nerve stimulation on pain, function, and quality of life in fibromyalgia: a double-blind randomized clinical trial.

    Science.gov (United States)

    Noehren, Brian; Dailey, Dana L; Rakel, Barbara A; Vance, Carol G T; Zimmerman, Miriam B; Crofford, Leslie J; Sluka, Kathleen A

    2015-01-01

    Fibromyalgia is a common chronic pain condition that has a significant impact on quality of life and often leads to disability. To date, there have been few well-controlled trials assessing the utility of nonpharmacological treatment modalities such as transcutaneous electrical nerve stimulation (TENS) in the management of pain and improvement in function in individuals with fibromyalgia. The purpose of this study will be to complete a long-term, multicenter study to assess the effects of TENS in women with fibromyalgia. This will be a phase II randomized, double-blind, placebo-controlled, multicenter clinical trial. Three hundred forty-three participants with fibromyalgia will be recruited for this study. Participants will be randomly assigned to 1 of 3 groups: the intervention (TENS), placebo, or no treatment. After completing the randomized period, all participants will receive the intervention for 1 month. The participants will be asked to use TENS at the highest tolerable level for at least 2 hours daily during physical activity. The primary outcome will be pain with movement, with secondary outcomes assessing functional abilities, patient-reported outcomes, and quantitative sensory testing. Because having participants refrain from their typical medications is not practical, their usage and any change in medication use will be recorded. The results of this study will provide some of the first evidence from a large-scale, double-blind, placebo-controlled trial on the effectiveness of TENS on pain control and quality-of-life changes in patients with fibromyalgia. © 2015 American Physical Therapy Association.

  11. Low-power logic computing realized in a single electric-double-layer MoS2 transistor gated with polymer electrolyte

    Science.gov (United States)

    Guo, Junjie; Xie, Dingdong; Yang, Bingchu; Jiang, Jie

    2018-06-01

    Due to its mechanical flexibility, large bandgap and carrier mobility, atomically thin molybdenum disulphide (MoS2) has attracted widespread attention. However, it still lacks a facile route to fabricate a low-power high-performance logic gates/circuits before it gets the real application. Herein, we reported a facile and environment-friendly method to establish the low-power logic function in a single MoS2 field-effect transistor (FET) configuration gated with a polymer electrolyte. Such low-power and high-performance MoS2 FET can be implemented by using water-soluble polyvinyl alcohol (PVA) polymer as proton-conducting electric-double-layer (EDL) dielectric layer. It exhibited an ultra-low voltage (1.5 V) and a good performance with a high current on/off ratio (Ion/off) of 1 × 105, a large electron mobility (μ) of 47.5 cm2/V s, and a small subthreshold swing (S) of 0.26 V/dec, respectively. The inverter can be realized by using such a single MoS2 EDL FET with a gain of ∼4 at the operation voltage of only ∼1 V. Most importantly, the neuronal AND logic computing can be also demonstrated by using such a double-lateral-gate single MoS2 EDL transistor. These results show an effective step for future applications of 2D MoS2 FETs for integrated electronic engineering and low-energy environment-friendly green electronics.

  12. Liquid waste processing at Comanche Peak

    International Nuclear Information System (INIS)

    Hughes-Edwards, L.M.; Edwards, J.M.

    1996-01-01

    This article describes the radioactive waste processing at Comanche Peak Steam Electric Station. Topics covered are the following: Reduction of liquid radioactive discharges (system leakage, outage planning); reduction of waste resin generation (waste stream segregation, processing methodology); reduction of activity released and off-site dose. 8 figs., 2 tabs

  13. A new automatic fixed peak technology of microcontroller

    International Nuclear Information System (INIS)

    Huang Liguo; Wang Dequan; Zhang Damin; Li Jun; Liu Yuwen; Guo Qingxue; Wang Guifeng

    1999-01-01

    The microcontroller automatic fixed peak technology which differs from fashion half channel fixed peak is described. It bases on the principles of selecting double single channel and readjusting the voltage of power source. This technology is suitable to the industrial isotope instruments with various radioactive sources

  14. Electrical properties of SAM-modified ITO surface using aromatic small molecules with double bond carboxylic acid groups for OLED applications

    International Nuclear Information System (INIS)

    Can, Mustafa; Havare, Ali Kemal; Aydın, Hasan; Yagmurcukardes, Nesli; Demic, Serafettin; Icli, Sıddık; Okur, Salih

    2014-01-01

    Graphical abstract: - Highlights: • We report that the performance of OLED consist of aromatic small molecules with double bond carboxylic acid groups on ITO surface. • The OLED devices were tested in terms of electrical and optical characteristics. • The I–V results show that OLEDs with SAM-modified ITO surface have lower turn on voltages than OLED configurations without SAMs. - Abstract: 5-[(3-Methylphenyl)(phenyl)amino]isophthalic acid (5-MePIFA) and 5-(diphenyl)amino]isophthalic acid (5-DPIFA) organic molecules were synthesized to form self-assembled monolayer on indium tin oxide (ITO) anode to enhance hole transport from ITO to organic hole transport layers such as TPD. The modified surface was characterized by scanning tunneling microscopy (STM). The change in the surface potential was measured by Kelvin probe force microscopy (KPFM). Our Kelvin probe force microscopy (KPFM) measurements showed that the surface potentials increased more than 100 mV with reference to bare indium tin-oxide. The results show that the threshold voltage on OLEDs with modified ITO is lowered significantly compared to OLEDs with unmodified ITO. The hole mobility of TPD has been estimated using space–charge-limited current measurements (SCLC)

  15. Molecular dynamics simulations of the electrical double layer on smectite surfaces contacting concentrated mixed electrolyte (NaCl-CaCl2)

    Energy Technology Data Exchange (ETDEWEB)

    Bourg, I.C.; Sposito, G.

    2011-04-01

    We report new molecular dynamics results elucidating the structure of the electrical double layer (EDL) on smectite surfaces contacting mixed NaCl-CaCl{sup 2} electrolyte solutions in the range of concentrations relevant to pore waters in geologic repositories for CO{sub 2} or high-level radioactive waste (0.34-1.83 mol{sub c} dm{sup -3}). Our results confirm the existence of three distinct ion adsorption planes (0-, {beta}-, and d-planes), often assumed in EDL models, but with two important qualifications: (1) the location of the {beta}- and d-planes are independent of ionic strength or ion type and (2) 'indifferent electrolyte' ions can occupy all three planes. Charge inversion occurred in the diffuse ion swarm because of the affinity of the clay surface for CaCl{sup +} ion pairs. Therefore, at concentrations 0.34 mol{sub c} dm{sup -3}, properties arising from long-range electrostatics at interfaces (electrophoresis, electro-osmosis, co-ion exclusion, colloidal aggregation) will not be correctly predicted by most EDL models. Co-ion exclusion, typically neglected by surface speciation models, balanced a large part of the clay mineral structural charge in the more concentrated solutions. Water molecules and ions diffused relatively rapidly even in the first statistical water monolayer, contradicting reports of rigid 'ice-like' structures for water on clay mineral surfaces.

  16. Molecular dynamics simulations of the electrical double layer on smectite surfaces contacting concentrated mixed electrolyte (NaCl-CaCl2) solutions.

    Science.gov (United States)

    Bourg, Ian C; Sposito, Garrison

    2011-08-15

    We report new molecular dynamics results elucidating the structure of the electrical double layer (EDL) on smectite surfaces contacting mixed NaCl-CaCl(2) electrolyte solutions in the range of concentrations relevant to pore waters in geologic repositories for CO(2) or high-level radioactive waste (0.34-1.83 mol(c) dm(-3)). Our results confirm the existence of three distinct ion adsorption planes (0-, β-, and d-planes), often assumed in EDL models, but with two important qualifications: (1) the location of the β- and d-planes are independent of ionic strength or ion type and (2) "indifferent electrolyte" ions can occupy all three planes. Charge inversion occurred in the diffuse ion swarm because of the affinity of the clay surface for CaCl(+) ion pairs. Therefore, at concentrations ≥0.34 mol(c) dm(-3), properties arising from long-range electrostatics at interfaces (electrophoresis, electro-osmosis, co-ion exclusion, colloidal aggregation) will not be correctly predicted by most EDL models. Co-ion exclusion, typically neglected by surface speciation models, balanced a large part of the clay mineral structural charge in the more concentrated solutions. Water molecules and ions diffused relatively rapidly even in the first statistical water monolayer, contradicting reports of rigid "ice-like" structures for water on clay mineral surfaces. Published by Elsevier Inc.

  17. Centrifugal spinning: A novel approach to fabricate porous carbon fibers as binder-free electrodes for electric double-layer capacitors

    Science.gov (United States)

    Lu, Yao; Fu, Kun; Zhang, Shu; Li, Ying; Chen, Chen; Zhu, Jiadeng; Yanilmaz, Meltem; Dirican, Mahmut; Zhang, Xiangwu

    2015-01-01

    Carbon nanofibers (CNFs), among various carbonaceous candidates for electric double-layer capacitor (EDLC) electrodes, draw extensive attention because their one-dimensional architecture offers both shortened electron pathways and high ion-accessible sites. Creating porous structures on CNFs yields larger surface area and enhanced capacitive performance. Herein, porous carbon nanofibers (PCNFs) were synthesized via centrifugal spinning of polyacrylonitrile (PAN)/poly(methyl methacrylate) (PMMA) solutions combined with thermal treatment and were used as binder-free EDLC electrodes. Three precursor fibers with PAN/PMMA weight ratios of 9/1, 7/3 and 5/5 were prepared and carbonized at 700, 800, and 900 °C, respectively. The highest specific capacitance obtained was 144 F g-1 at 0.1 A g-1 with a rate capability of 74% from 0.1 to 2 A g-1 by PCNFs prepared with PAN/PMMA weight ratio of 7/3 at 900 °C. These PCNFs also showed stable cycling performance. The present work demonstrates that PCNFs are promising EDLC electrode candidate and centrifugal spinning offers a simple, cost-effective strategy to produce PCNFs.

  18. Boron cross-linked graphene oxide/polyvinyl alcohol nanocomposite gel electrolyte for flexible solid-state electric double layer capacitor with high performance

    KAUST Repository

    Huang, Yi-Fu; Wu, Peng-Fei; Zhang, Ming-Qiu; Ruan, Wen-Hong; Giannelis, Emmanuel P.

    2014-01-01

    A new family of boron cross-linked graphene oxide/polyvinyl alcohol (GO-B-PVA) nanocomposite gels is prepared by freeze-thaw/boron cross-linking method. Then the gel electrolytes saturated with KOH solution are assembled into electric double layer capacitors (EDLCs). Structure, thermal and mechanical properties of GO-B-PVA are explored. The electrochemical properties of EDLCs using GO-B-PVA/KOH are investigated, and compared with those using GO-PVA/KOH gel or KOH solution electrolyte. FTIR shows that boron cross-links are introduced into GO-PVA, while the boronic structure inserted into agglomerated GO sheets is demonstrated by DMA analysis. The synergy effect of the GO and the boron crosslinking benefits for ionic conductivity due to unblocking ion channels, and for improvement of thermal stability and mechanical properties of the electrolytes. Higher specific capacitance and better cycle stability of EDLCs are obtained by using the GO-B-PVA/KOH electrolyte, especially the one at higher GO content. The nanocomposite gel electrolytes with excellent electrochemical properties and solid-like character are candidates for the industrial application in high-performance flexible solid-state EDLCs. © 2014 Elsevier Ltd.

  19. Electrical properties of SAM-modified ITO surface using aromatic small molecules with double bond carboxylic acid groups for OLED applications

    Energy Technology Data Exchange (ETDEWEB)

    Can, Mustafa [Izmir Katip Celebi University, Faculty of Engineering, Department of Engineering Sciences, Çiğli, Izmir (Turkey); Havare, Ali Kemal [Toros University, Faculty of Engineering, Electric and Electronic Department, Mersin (Turkey); Aydın, Hasan; Yagmurcukardes, Nesli [Izmir Institute of Technology, Material Science and Engineering, Izmir (Turkey); Demic, Serafettin [Izmir Katip Celebi University, Faculty of Engineering, Department of Material Science and Engineering, Çiğli, Izmir (Turkey); Icli, Sıddık [Ege University, Solar Energy Institute, Izmir (Turkey); Okur, Salih, E-mail: salih.okur@ikc.edu.tr [Izmir Katip Celebi University, Faculty of Engineering, Department of Material Science and Engineering, Çiğli, Izmir (Turkey)

    2014-09-30

    Graphical abstract: - Highlights: • We report that the performance of OLED consist of aromatic small molecules with double bond carboxylic acid groups on ITO surface. • The OLED devices were tested in terms of electrical and optical characteristics. • The I–V results show that OLEDs with SAM-modified ITO surface have lower turn on voltages than OLED configurations without SAMs. - Abstract: 5-[(3-Methylphenyl)(phenyl)amino]isophthalic acid (5-MePIFA) and 5-(diphenyl)amino]isophthalic acid (5-DPIFA) organic molecules were synthesized to form self-assembled monolayer on indium tin oxide (ITO) anode to enhance hole transport from ITO to organic hole transport layers such as TPD. The modified surface was characterized by scanning tunneling microscopy (STM). The change in the surface potential was measured by Kelvin probe force microscopy (KPFM). Our Kelvin probe force microscopy (KPFM) measurements showed that the surface potentials increased more than 100 mV with reference to bare indium tin-oxide. The results show that the threshold voltage on OLEDs with modified ITO is lowered significantly compared to OLEDs with unmodified ITO. The hole mobility of TPD has been estimated using space–charge-limited current measurements (SCLC)

  20. The Influence of Anion Shape on the Electrical Double Layer Microstructure and Capacitance of Ionic Liquids-Based Supercapacitors by Molecular Simulations

    Directory of Open Access Journals (Sweden)

    Ming Chen

    2017-02-01

    Full Text Available Room-temperature ionic liquids (RTILs are an emerging class of electrolytes for supercapacitors. In this work, we investigate the effects of different supercapacitor models and anion shape on the electrical double layers (EDLs of two different RTILs: 1-ethyl-3-methylimidazolium bis(trifluoromethanesulfonylimide ([Emim][Tf2N] and 1-ethyl-3-methylimidazolium 2-(cyanopyrrolide ([Emim][CNPyr] by molecular dynamics (MD simulation. The EDL microstructure is represented by number densities of cations and anions, and the potential drop near neutral and charged electrodes reveal that the supercapacitor model with a single electrode has the same EDL structure as the model with two opposite electrodes. Nevertheless, the employment of the one-electrode model without tuning the bulk density of RTILs is more time-saving in contrast to the two-electrode one. With the one-electrode model, our simulation demonstrated that the shapes of anions significantly imposed effects on the microstructure of EDLs. The EDL differential capacitance vs. potential (C-V curves of [Emim][CNPyr] electrolyte exhibit higher differential capacitance at positive potentials. The modeling study provides microscopic insight into the EDLs structure of RTILs with different anion shapes.

  1. Preemptive Analgesic Effects of Transcutaneous Electrical Nerve Stimulation (TENS) on Postoperative Pain: A Randomized, Double-Blind, Placebo-Controlled Trial.

    Science.gov (United States)

    Eidy, Mohammad; Fazel, Mohammad Reza; Janzamini, Monir; Haji Rezaei, Mostafa; Moravveji, Ali Reza

    2016-04-01

    Transcutaneous electrical nerve stimulation (TENS) is a non-pharmacological analgesic method used to control different types of pain. The aim of this study was to evaluate the effects of preoperative TENS on post inguinal hernia repair pain. This randomized, double-blind, placebo-controlled clinical trial was performed on 66 male patients with unilateral inguinal hernias who were admitted to the Shahid Beheshti hospital in Kashan, Iran, from April to October 2014. Participants were selected using a convenience sampling method and were assigned to intervention (n = 33) and control (n = 33) groups using permuted-block randomization. Patients in the intervention group were treated with TENS 1 hour before surgery, while the placebo was administered to patients in the control group. All of the patients underwent inguinal hernia repair by the Lichtenstein method, and pain intensity was evaluated at 2, 4, 6, and 12 hours after surgery using a visual analogue scale. Additionally, the amounts of analgesic administered by pump were calculated and compared between the two groups. The mean estimated postoperative pain intensity was 6.21 ± 1.63 in the intervention group and 5.45 ± 1.82 in the control group (P = 0.08). In the intervention group pain intensity at 2 and 4 hours after surgery were 3.54 ± 1.48 and 5.12 ± 1.41 (P TENS can reduce postoperative pain in the early hours after inguinal hernia repair surgery.

  2. Electric-dipole moment of CaF by molecular-beam, laser-rf, double-resonance study of Stark splittings

    International Nuclear Information System (INIS)

    Childs, W.J.; Goodman, L.S.; Nielsen, U.; Pfeufer, V.

    1984-01-01

    The electronic structure of diatomic molecules is much more complex for open-shell sytems (radicals) than for the normal closed-shell systems, and the development of an adequate theoretical understanding will require a substantial upgrading of experimental knowledge in both quality and quantity. The alkaline-earth monohalide family of radicals, with only a single electron outside closed-shell cores, would appear to be a logical starting point for such studies, and there has been a great increase in work in this area in the last few years in spite of the special difficulties of working with free radicals. As the work of measuring the vibrational and rotational structure of the electronic states has become more complete, attention has turned to study of the much weaker spin-rotation and hyperfine interactions. Within the last three years, these interactions have been studied systematically at high precision in the calcium monohalide family with the molecular-beam, laser-rf double-resonance technique. The same method has now been modified and extended to make possible measurement of the electric-dipole moments of these molecules through observation of the Stark splittings of radiofrequency transitions. It is hoped that when considered together, the several types of data will make it possible to understand the ground-state electronic wave functions of these molecules at least qualitatively. 2 figures

  3. An Approach to Solid-State Electrical Double Layer Capacitors Fabricated with Graphene Oxide-Doped, Ionic Liquid-Based Solid Copolymer Electrolytes.

    Science.gov (United States)

    Fattah, N F A; Ng, H M; Mahipal, Y K; Numan, Arshid; Ramesh, S; Ramesh, K

    2016-06-06

    Solid polymer electrolyte (SPE) composed of semi-crystalline poly (vinylidene fluoride-hexafluoropropylene) [P(VdF-HFP)] copolymer, 1-ethyl-3-methylimidazolium bis (trifluoromethyl sulphonyl) imide [EMI-BTI] and graphene oxide (GO) was prepared and its performance evaluated. The effects of GO nano-filler were investigated in terms of enhancement in ionic conductivity along with the electrochemical properties of its electrical double layer capacitors (EDLC). The GO-doped SPE shows improvement in ionic conductivity compared to the P(VdF-HFP)-[EMI-BTI] SPE system due to the existence of the abundant oxygen-containing functional group in GO that assists in the improvement of the ion mobility in the polymer matrix. The complexation of the materials in the SPE is confirmed in X-ray diffraction (XRD) and thermogravimetric analysis (TGA) studies. The electrochemical performance of EDLC fabricated with GO-doped SPE is examined using cyclic voltammetry and charge-discharge techniques. The maximum specific capacitance obtained is 29.6 F∙g -1 , which is observed at a scan rate of 3 mV/s in 6 wt % GO-doped, SPE-based EDLC. It also has excellent cyclic retention as it is able keep the performance of the EDLC at 94% even after 3000 cycles. These results suggest GO doped SPE plays a significant role in energy storage application.

  4. Restoring the consistency with the contact density theorem of a classical density functional theory of ions at a planar electrical double layer.

    Science.gov (United States)

    Gillespie, Dirk

    2014-11-01

    Classical density functional theory (DFT) of fluids is a fast and efficient theory to compute the structure of the electrical double layer in the primitive model of ions where ions are modeled as charged, hard spheres in a background dielectric. While the hard-core repulsive component of this ion-ion interaction can be accurately computed using well-established DFTs, the electrostatic component is less accurate. Moreover, many electrostatic functionals fail to satisfy a basic theorem, the contact density theorem, that relates the bulk pressure, surface charge, and ion densities at their distances of closest approach for ions in equilibrium at a smooth, hard, planar wall. One popular electrostatic functional that fails to satisfy the contact density theorem is a perturbation approach developed by Kierlik and Rosinberg [Phys. Rev. A 44, 5025 (1991)PLRAAN1050-294710.1103/PhysRevA.44.5025] and Rosenfeld [J. Chem. Phys. 98, 8126 (1993)JCPSA60021-960610.1063/1.464569], where the full free-energy functional is Taylor-expanded around a bulk (homogeneous) reference fluid. Here, it is shown that this functional fails to satisfy the contact density theorem because it also fails to satisfy the known low-density limit. When the functional is corrected to satisfy this limit, a corrected bulk pressure is derived and it is shown that with this pressure both the contact density theorem and the Gibbs adsorption theorem are satisfied.

  5. Solvent primitive model of an electric double layer in slit-like pores: microscopic structure, adsorption and capacitance from a density functional approach

    Directory of Open Access Journals (Sweden)

    O. Pizio

    2014-06-01

    Full Text Available We investigate the electric double layer formed between charged walls of a slit-like pore and a solvent primitive model (SPM for electrolyte solution. The recently developed version of the weighted density functional approach for electrostatic interparticle interaction is applied to the study of the density profiles, adsorption and selectivity of adsorption of ions and solvent species. Our principal focus, however, is in the dependence of differential capacitance on the applied voltage, on the electrode and on the pore width. We discuss the properties of the model with respect to the behavior of a primitive model, i.e., in the absence of a hard-sphere solvent. We observed that the differential capacitance of the SPM on the applied electrostatic potential has the camel-like shape unless the ion fraction is high. Moreover, it is documented that the dependence of differential capacitance of the SPM on the pore width is oscillatory, which is in close similarity to the primitive model.

  6. Pain relief by transcutaneous electric nerve stimulation with bidirectional modulated sine waves in patients with chronic back pain: a randomized, double-blind, sham-controlled study.

    Science.gov (United States)

    Shimoji, Koki; Takahashi, Norio; Nishio, Yasuyuki; Koyanagi, Mika; Aida, Sumihisa

    2007-01-01

    Objectives.  Newly developed bidirectional modulated sine waves (BMW) might provide some derived benefit to patients with low back pain. Pain relief by transcutaneous electric nerve stimulation (TENS) with BMWs was tested. Materials and Methods.  Analgesic effects of BMWs and conventional bidirectional pulsed waves on chronic back pain in 28 patients were compared, and effects of repeated TENS using BMWs on chronic back pain were investigated in 21 patients by means of a randomized double-blind, sham-controlled, parallel-group method. Pain intensity was assessed using numerical rating scale (NRS). Results.  There was significant immediate reduction in NRS in patients receiving BMWs, and 60 min after treatment compared to sham TENS. Weekly repeated treatments using massage and TENS with BMWs for 5 weeks resulted in a decrease of NRS, but there were no significant differences between the TENS plus massage and sham TENS plus massage groups. Conclusions.  This study shows that TENS with BMWs significantly inhibits chronic back pain, and treatment effects are attained within a day. The results also suggest that there were no statistically significant long-term effects of TENS with BMW in the repeated treatment.

  7. Boron cross-linked graphene oxide/polyvinyl alcohol nanocomposite gel electrolyte for flexible solid-state electric double layer capacitor with high performance

    KAUST Repository

    Huang, Yi-Fu

    2014-06-01

    A new family of boron cross-linked graphene oxide/polyvinyl alcohol (GO-B-PVA) nanocomposite gels is prepared by freeze-thaw/boron cross-linking method. Then the gel electrolytes saturated with KOH solution are assembled into electric double layer capacitors (EDLCs). Structure, thermal and mechanical properties of GO-B-PVA are explored. The electrochemical properties of EDLCs using GO-B-PVA/KOH are investigated, and compared with those using GO-PVA/KOH gel or KOH solution electrolyte. FTIR shows that boron cross-links are introduced into GO-PVA, while the boronic structure inserted into agglomerated GO sheets is demonstrated by DMA analysis. The synergy effect of the GO and the boron crosslinking benefits for ionic conductivity due to unblocking ion channels, and for improvement of thermal stability and mechanical properties of the electrolytes. Higher specific capacitance and better cycle stability of EDLCs are obtained by using the GO-B-PVA/KOH electrolyte, especially the one at higher GO content. The nanocomposite gel electrolytes with excellent electrochemical properties and solid-like character are candidates for the industrial application in high-performance flexible solid-state EDLCs. © 2014 Elsevier Ltd.

  8. An Approach to Solid-State Electrical Double Layer Capacitors Fabricated with Graphene Oxide-Doped, Ionic Liquid-Based Solid Copolymer Electrolytes

    Directory of Open Access Journals (Sweden)

    N. F. A. Fattah

    2016-06-01

    Full Text Available Solid polymer electrolyte (SPE composed of semi-crystalline poly (vinylidene fluoride-hexafluoropropylene [P(VdF-HFP] copolymer, 1-ethyl-3-methylimidazolium bis (trifluoromethyl sulphonyl imide [EMI-BTI] and graphene oxide (GO was prepared and its performance evaluated. The effects of GO nano-filler were investigated in terms of enhancement in ionic conductivity along with the electrochemical properties of its electrical double layer capacitors (EDLC. The GO-doped SPE shows improvement in ionic conductivity compared to the P(VdF-HFP-[EMI-BTI] SPE system due to the existence of the abundant oxygen-containing functional group in GO that assists in the improvement of the ion mobility in the polymer matrix. The complexation of the materials in the SPE is confirmed in X-ray diffraction (XRD and thermogravimetric analysis (TGA studies. The electrochemical performance of EDLC fabricated with GO-doped SPE is examined using cyclic voltammetry and charge–discharge techniques. The maximum specific capacitance obtained is 29.6 F∙g−1, which is observed at a scan rate of 3 mV/s in 6 wt % GO-doped, SPE-based EDLC. It also has excellent cyclic retention as it is able keep the performance of the EDLC at 94% even after 3000 cycles. These results suggest GO doped SPE plays a significant role in energy storage application.

  9. Investigation of the Characteristic Properties of Glacial Acetic Acid-Catalyzed Carbon Xerogels and Their Electrochemical Performance for Use as Electrode Materials in Electrical Double-Layer Capacitors

    Directory of Open Access Journals (Sweden)

    Nguyen Khanh Nguyen Quach

    2017-01-01

    Full Text Available Glacial acetic acid was used as a catalyst in the preparation process of carbon xerogels from the condensation of resorcinol and formaldehyde for shortening significantly the gelation time. The effect of the resorcinol/catalyst ratio over a large range of 2 to 500, the solvent exchange manner with acetone, and the pyrolysis temperature of 700 to 1000°C on the characteristic properties of the carbon xerogels were investigated. A resorcinol/catalyst ratio of 2 and a pyrolysis temperature at 800°C were found to be the optimal condition for the preparation of carbon xerogels with a well-balanced porosity between micro- and mesopores, high surface area (577.62 m2g−1, and large pore volume (0.97 cm3g−1, which are appropriate for use as electrode materials in an electrical double-layer capacitor. The carbon xerogel electrodes that were prepared under these optimal conditions exhibited a good electrochemical performance with the highest specific capacitance of 169 Fg−1 in 6 M KOH electrolyte at a scan rate of 5 mVs−1 from cyclic voltammetry.

  10. Variation in the electrical properties of 100 V/100 A rated mesh and stripe TDMOSFETs (trench double-diffused MOSFETs) for motor drive applications

    Energy Technology Data Exchange (ETDEWEB)

    Na, Kyoung-Il; Kah, Dong-Ha; Kim, Sang-Gi; Koo, Jin-Gun; Kim, Jong-Dae; Yang, Yil-Suk; Lee, Jin-Ho [Electronics and Telecommunications Research Institute, Daejeon (Korea, Republic of)

    2012-05-15

    The vertical power metal-oxide semiconductor field-effect transistors (MOSFETs) with deep trench structures are the most promising candidates to overcome the trade-off relationship between the ON-resistance (R{sub ON}) and the blocking voltage (BV{sub DS}). Especially, 100 V/100 A rated trench power MOSFETs are used in components of many power systems, such as motors and LED lighting drive ICs, DC-DC converters in electric vehicles, and so on. In this work, we studied variations of the electrical characteristics, such as threshold voltage (V{sub TH}), BV{sub DS}, and drain current drivability, with p-well doping concentration via the SILVACO simulator. From simulation results, we found the BV{sub DS} and the drain current (I{sub D}) as functions of the p-well doping concentration at an ion implantation energy of 80 keV. With increasing of p-well doping concentration in the guard ring region, both V{sub TH} and BV{sub DS} slowly increased, but I{sub D} decreased, because the boron lateral diffusion during the fabrication process below gate trench region affected the doping concentration of the p-body at the active region. Additionally, 100 V/100 A rated trench double-diffused MOSFETs (TDMOSFETs) with meshes and stripes were successfully developed by using a silicon deep etching process. The variations in the electrical properties, such as V{sub TH}, BV{sub DS}, and drain current drivability, of the two different kinds of fabricated devices, with cell design and density in TDMOSFETs were also studied. The BV{sub DS} and the V{sub TH} in the stripe-type TDMOSFET were 110 and 3 V, respectively. However, the V{sub TH} of mesh-type device was smaller 0.5 V than that of stripe-type because of corner effect. The BV{sub DS} improved about 20 V compared to stripe-type TDMOSFET due to edge termination, and the maximum drain current (I{sub D.MAX}) was improved by about 10% due to an increase in the gate width at the same chip size. These effects were reflected in devices with

  11. Variation in the electrical properties of 100 V/100 A rated mesh and stripe TDMOSFETs (trench double-diffused MOSFETs) for motor drive applications

    International Nuclear Information System (INIS)

    Na, Kyoung-Il; Kah, Dong-Ha; Kim, Sang-Gi; Koo, Jin-Gun; Kim, Jong-Dae; Yang, Yil-Suk; Lee, Jin-Ho

    2012-01-01

    The vertical power metal-oxide semiconductor field-effect transistors (MOSFETs) with deep trench structures are the most promising candidates to overcome the trade-off relationship between the ON-resistance (R ON ) and the blocking voltage (BV DS ). Especially, 100 V/100 A rated trench power MOSFETs are used in components of many power systems, such as motors and LED lighting drive ICs, DC-DC converters in electric vehicles, and so on. In this work, we studied variations of the electrical characteristics, such as threshold voltage (V TH ), BV DS , and drain current drivability, with p-well doping concentration via the SILVACO simulator. From simulation results, we found the BV DS and the drain current (I D ) as functions of the p-well doping concentration at an ion implantation energy of 80 keV. With increasing of p-well doping concentration in the guard ring region, both V TH and BV DS slowly increased, but I D decreased, because the boron lateral diffusion during the fabrication process below gate trench region affected the doping concentration of the p-body at the active region. Additionally, 100 V/100 A rated trench double-diffused MOSFETs (TDMOSFETs) with meshes and stripes were successfully developed by using a silicon deep etching process. The variations in the electrical properties, such as V TH , BV DS , and drain current drivability, of the two different kinds of fabricated devices, with cell design and density in TDMOSFETs were also studied. The BV DS and the V TH in the stripe-type TDMOSFET were 110 and 3 V, respectively. However, the V TH of mesh-type device was smaller 0.5 V than that of stripe-type because of corner effect. The BV DS improved about 20 V compared to stripe-type TDMOSFET due to edge termination, and the maximum drain current (I D.MAX ) was improved by about 10% due to an increase in the gate width at the same chip size. These effects were reflected in devices with different cell densities. When the cell density was increased, however

  12. Peak reading detector circuit

    International Nuclear Information System (INIS)

    Courtin, E.; Grund, K.; Traub, S.; Zeeb, H.

    1975-01-01

    The peak reading detector circuit serves for picking up the instants during which peaks of a given polarity occur in sequences of signals in which the extreme values, their time intervals, and the curve shape of the signals vary. The signal sequences appear in measuring the foetal heart beat frequence from amplitude-modulated ultrasonic, electrocardiagram, and blood pressure signals. In order to prevent undesired emission of output signals from, e. g., disturbing intermediate extreme values, the circuit consists of the series connections of a circuit to simulate an ideal diode, a strong unit, a discriminator for the direction of charging current, a time-delay circuit, and an electronic switch lying in the decharging circuit of the storage unit. The time-delay circuit thereby causes storing of a preliminary maximum value being used only after a certain time delay for the emission of the output signal. If a larger extreme value occurs during the delay time the preliminary maximum value is cleared and the delay time starts running anew. (DG/PB) [de

  13. Nonlinear optical rectification and optical absorption in GaAs-Ga1-xAlxAs asymmetric double quantum wells: Combined effects of applied electric and magnetic fields and hydrostatic pressure

    International Nuclear Information System (INIS)

    Karabulut, I.; Mora-Ramos, M.E.; Duque, C.A.

    2011-01-01

    The intersubband electron-related nonlinear optical absorption and nonlinear optical rectification in GaAs-Ga 1-x Al x As asymmetric double quantum wells are studied, under the influence of combined or independent applied electric and magnetic fields as well as hydrostatic pressure. The outcome of the density matrix formalism and the effective mass, and parabolic-band approximations have been considered as main theoretical tools for the description. It is obtained that under particular geometrical conditions, with or without electric and/or magnetic field strength, the optical rectification is null and, simultaneously, in such circumstances the optical absorption has a relative maximum. It is also detected that the influence of the hydrostatic pressure leads to increasing or decreasing behaviors of the nonlinear optical absorption in dependence of the particular regime of pressure values considered, with significant distinction of the cases of opposite electric field orientations. - Highlights: → Maxima of the NOA correspond to zero in the NOR. → Electric fields can couple the double quantum wells. → Hydrostatic pressure can couple the double quantum wells. → NOA can increase/decrease with hydrostatic pressure. → Overlap between wave functions depends on the magnetic field.

  14. Safety Evaluation Report related to the operation of Comanche Peak Steam Electric Station, Units 1 and 2 (Docket Nos. 50-445 and 50-446). Supplement No. 10

    International Nuclear Information System (INIS)

    1985-04-01

    This Supplement provides the results of the staff's evaluation and resolution of approximately 400 technical concerns and allegations in the mechanical and piping area regarding construction practices at the Comanche Peak facility. This report does not address the Walsh/Doyle allegations regarding deficiencies in the pipe support design process and the new allegations recently received by the staff

  15. Characterization and organic electric-double-layer-capacitor application of KOH activated coal-tar-pitch-based carbons: Effect of carbonization temperature

    Science.gov (United States)

    Choi, Poo Reum; Lee, Eunji; Kwon, Soon Hyung; Jung, Ji Chul; Kim, Myung-Soo

    2015-12-01

    The present study reports the influence of pre-carbonization on the properties of KOH-activated coal tar pitch (CTP). The change of crystallinity and pore structure of pre-carbonized CTPs as well as their activated carbons (ACs) as function of pre-carbonization temperature are investigated. The crystallinity of pre-carbonized CTPs increases with increasing the carbonization temperature up to 600 °C, but a disorder occurs during the carbonization around 700 °C and an order happens gradually with increasing the carbonization temperatures in range of 800-1000 °C. The CTPs pre-carbonized at high temperatures are more difficult to be activated with KOH than those pre-carbonized at low temperatures due to the increase of micro-crystalline size and the decrease of surface functional groups. The micro-pores and meso-pores are well developed at around 1.0 nm and 2.4 nm, respectively, as the ACs are pre-carbonized at temperatures of 500-600 °C, exhibiting high specific capacitances as electrode materials for electric double layer capacitor (EDLC). Although the specific surface area (SSA) and pore volume of ACs pre-carbonized at temperatures of 900-1000 °C are extraordinary low (non-porous) as compared to those of AC pre-carbonized at 600 °C, their specific capacitances are comparable to each other. The large specific capacitances with low SSA ACs can be attributed to the structural change resulting from the electrochemical activation during the 1st charge above 2.0 V.

  16. Super-capacitive electro-chemical performance of polymer blend gel polymer electrolyte (GPE) in carbon-based electrical double-layer capacitors

    International Nuclear Information System (INIS)

    Syahidah, S. Nuur; Majid, S.R.

    2013-01-01

    This study reports on the fabrication and comparative performance characteristics of a symmetrical electrical double-layer capacitor (EDLC) employed gel polymer electrolyte (GPE) assembled between carbon based electrodes. Three cells, A, B and C were fabricated using different composition of active materials (activated or porous carbon), binder (PVdF-HFP) and conductivity enhancer (super-P). The configuration of cell A: 0.9 porous carbon/0.1 PVdF-HFP, cell B: 0.45 activated carbon/0.45 porous carbon/0.1 PVdF-HFP and cell C: 0.8 activated carbon/0.1 super-P/0.1 PVdF-HFP. The GPE, comprising a poly(vinyl pyrrolidone) (PVP)/poly(vinylidene fluoride co-hexafluoroproplyne) (PVdF-HFP) blend complexed with magnesium triflate, Mg(CF 3 SO 3 ) 2 , was prepared by the solution casting technique at 60 °C. The physico-chemical properties of the GPEs were characterized by electrochemical impedance spectroscopy (EIS), scanning electron microscopy (SEM), linear sweep voltammetry (LSV) and cyclic voltammetry (CV). The ionic conductivity at the ambient temperature of the GPE is 2.16 × 10 −4 S cm −1 at 7.5 wt.% of Mg(CF 3 SO 3 ) 2 with a ∼2.6 V electro-chemical stability window. At the 1000th cycle, the specific capacitance, C s of cell A is 89 F g −1 while cell B and C are 63 and 49 F g −1 . Cell A shows excellent long-term cyclic stability (less than a 5% decrease in specific capacitance after 1000 cycles). The best operating voltage for cell A is 1.6 V with the specific capacitance 106 F g −1 after 500 cycles

  17. Does transcutaneous electrical nerve stimulation (TENS) alleviate the pain experienced during bone marrow sampling in addition to standard techniques? A randomised, double-blinded, controlled trial.

    Science.gov (United States)

    Tucker, David L; Rockett, Mark; Hasan, Mehedi; Poplar, Sarah; Rule, Simon A

    2015-06-01

    Bone marrow aspiration and trephine (BMAT) biopsies remain important tests in haematology. However, the procedures can be moderately to severely painful despite standard methods of pain relief. To test the efficacy of transcutaneous electrical nerve stimulation (TENS) in alleviating the pain from BMAT in addition to standard analgesia using a numerical pain rating scale (NRS). 70 patients requiring BMAT were randomised (1:1) in a double-blind, placebo-controlled trial. -35 patients received TENS impulses at a strong but comfortable amplitude (intervention group) and 35 patients received TENS impulses just above the sensory threshold (control group) (median pulse amplitude 20 and 7 mA, respectively). Patients and operators were blinded to group allocation. Pain assessments were made using a numerical pain scale completed after the procedure. No significant difference in NRS pain recalled after the procedure was detected (median pain score 5.7 (95% CI 4.8 to 6.6) in control vs 5.6 (95% CI 4.8 to 6.4) in the intervention group). However, 100% of patients who had previous experience of BMAT and >94% of participants overall felt they benefited from using TENS and would recommend it to others for this procedure. There were no side effects from the TENS device, and it was well tolerated. TENS is a safe, non-invasive adjunct to analgesia for reducing pain during bone marrow biopsy and provides a subjective benefit to most users; however, no objective difference in pain scores was detected when using TENS in this randomised controlled study. NCT02005354. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  18. Asymmetric GaAs n-type double δ-doped quantum wells as a source of intersubband-related nonlinear optical response: Effects of an applied electric field

    Energy Technology Data Exchange (ETDEWEB)

    Rodríguez-Magdaleno, K.A.; Martínez-Orozco, J.C.; Rodríguez-Vargas, I. [Unidad Académica de Física, Universidad Autónoma de Zacatecas, Calz. Solidaridad Esq. Paseo a La Bufa S/N. C.P. 98060 Zacatecas (Mexico); Mora-Ramos, M.E. [Facultad de Ciencias, Universidad Autónoma del Estado de Morelos, Av. Universidad 1001, CP 62209 Cuernavaca, Morelos (Mexico); Física Teórica y Aplicada, Escuela de Ingeniería de Antioquia, AA 7516 Medellín (Colombia); Grupo de Materia Condensada-UdeA, Instituto de Física, Facultad de Ciencias Exactas y Naturales, Universidad de Antioquia UdeA, Calle 70 No. 52-21, Medellín (Colombia); Duque, C.A., E-mail: cduque@fisica.udea.edu.co [Grupo de Materia Condensada-UdeA, Instituto de Física, Facultad de Ciencias Exactas y Naturales, Universidad de Antioquia UdeA, Calle 70 No. 52-21, Medellín (Colombia)

    2014-03-15

    In this work, the conduction band electron states and the associated intersubband-related linear and nonlinear optical absorption coefficient and relative refractive index change are calculated for an asymmetric double n-type δ-doped quantum well in a GaAs-matrix. The effects of an external applied static electric field are included. Values of the two-dimensional impurities density (N{sub 2d}) of each single δ-doped quantum well are taken to vary within the range of 1.0×10{sup 12} to 7.0×10{sup 12} cm{sup −2}, consistent with the experimental data growth regime. The optical responses are reported as a function of the δ-doped impurities density and the applied electric field. It is shown that single electron states and the related optical quantities are significantly affected by the structural asymmetry of the double δ-doped quantum well system. In addition, a brief comparison with the free-carrier-related optical response is presented. -- Highlights: • Nonlinear optics in asymmetric double n-type δ-doped quantum well in a GaAs-matrix. • The system is considered under external applied electric field in growth direction. • The 2D impurity density is consistent with the experimental data growth regime. • The optical quantities are significantly affected by the structural asymmetry of the system.

  19. Asymmetric GaAs n-type double δ-doped quantum wells as a source of intersubband-related nonlinear optical response: Effects of an applied electric field

    International Nuclear Information System (INIS)

    Rodríguez-Magdaleno, K.A.; Martínez-Orozco, J.C.; Rodríguez-Vargas, I.; Mora-Ramos, M.E.; Duque, C.A.

    2014-01-01

    In this work, the conduction band electron states and the associated intersubband-related linear and nonlinear optical absorption coefficient and relative refractive index change are calculated for an asymmetric double n-type δ-doped quantum well in a GaAs-matrix. The effects of an external applied static electric field are included. Values of the two-dimensional impurities density (N 2d ) of each single δ-doped quantum well are taken to vary within the range of 1.0×10 12 to 7.0×10 12 cm −2 , consistent with the experimental data growth regime. The optical responses are reported as a function of the δ-doped impurities density and the applied electric field. It is shown that single electron states and the related optical quantities are significantly affected by the structural asymmetry of the double δ-doped quantum well system. In addition, a brief comparison with the free-carrier-related optical response is presented. -- Highlights: • Nonlinear optics in asymmetric double n-type δ-doped quantum well in a GaAs-matrix. • The system is considered under external applied electric field in growth direction. • The 2D impurity density is consistent with the experimental data growth regime. • The optical quantities are significantly affected by the structural asymmetry of the system

  20. C/NOFS Satellite Electric Field and Plasma Density Observations of Plasma Instabilities Below the Equatorial F-Peak -- Evidence for Approximately 500 km-Scale Spread-F "Precursor" Waves Driven by Zonal Shear Flow and km-Scale, Narrow-Banded Irregularities

    Science.gov (United States)

    Pfaff, R.; Freudenreich, H.; Klenzing, J.; Liebrecht, C.; Valladares, C.

    2011-01-01

    As solar activity has increased, the ionosphere F-peak has been elevated on numerous occasions above the C/NOFS satellite perigee of 400km. In particular, during the month of April, 2011, the satellite consistently journeyed below the F-peak whenever the orbit was in the region of the South Atlantic anomaly after sunset. During these passes, data from the electric field and plasma density probes on the satellite have revealed two types of instabilities which had not previously been observed in the C/NOFS data set (to our knowledge): The first is evidence for 400-500km-scale bottomside "undulations" that appear in the density and electric field data. In one case, these large scale waves are associated with a strong shear in the zonal E x B flow, as evidenced by variations in the meridional (outward) electric fields observed above and below the F-peak. These undulations are devoid of smaller scale structures in the early evening, yet appear at later local times along the same orbit associated with fully-developed spread-F with smaller scale structures. This suggests that they may be precursor waves for spread-F, driven by a collisional shear instability, following ideas advanced previously by researchers using data from the Jicamarca radar. A second new result (for C/NOFS) is the appearance of km-scale irregularities that are a common feature in the electric field and plasma density data that also appear when the satellite is below the F -peak at night. The vector electric field instrument on C/NOFS clearly shows that the electric field component of these waves is strongest in the zonal direction. These waves are strongly correlated with simultaneous observations of plasma density oscillations and appear both with, and without, evidence of larger-scale spread-F depletions. These km-scale, quasi-coherent waves strongly resemble the bottomside, sinusoidal irregularities reported in the Atmosphere Explorer satellite data set by Valladares et al. [JGR, 88, 8025, 1983

  1. On the physics of relativistic double layers

    International Nuclear Information System (INIS)

    Carlqvist, P.

    1982-06-01

    A model of a strong, time-independent, and relativistic double layer is studied. Besides double layers having the electric field parallel to the current the model also describes a certain type of oblique double layers. The 'Langmuir condition' (ratio of ion current density to electron current density) as well as an expression for the potential drop of the double layer are derived. Furthermore, the distribution of charged particles, electric field, and potential within the double layer are clarified and discussed. It is found that the properties of relativistic double layers differ substantially from the properties of corresponding non-relativistic double layers. (Author)

  2. A double layer review

    International Nuclear Information System (INIS)

    Block, L.P.

    1977-06-01

    A review of the main results on electrostatic double layers (sometimes called space charge layers or sheaths) obtained from theory, and laboratory and space experiments up to the spring of 1977 is given. By means of barium jets and satellite probes, double layers have now been found at the altitudes, earlier predicted theoretically. The general potential distribution above the auroral zone, suggested by inverted V-events and electric field reversals, is corroborated. (author)

  3. Peak load arrangements : Assessment of Nordel guidelines

    Energy Technology Data Exchange (ETDEWEB)

    2009-07-01

    Two Nordic countries, Sweden and Finland, have legislation that empowers the TSO to acquire designated peak load resources to mitigate the risk for shortage situations during the winter. In Denmark, the system operator procures resources to maintain a satisfactory level of security of supply. In Norway the TSO has set up a Regulation Power Option Market (RKOM) to secure a satisfactory level of operational reserves at all times, also in winter with high load demand. Only the arrangements in Finland and Sweden fall under the heading of Peak Load Arrangements defined in Nordel Guidelines. NordREG has been invited by the Electricity Market Group (EMG) to evaluate Nordel's proposal for 'Guidelines for transitional Peak Load Arrangements'. The EMG has also financed a study made by EC Group to support NordREG in the evaluation of the proposal. The study has been taken into account in NordREG's evaluation. In parallel to the EMG task, the Swedish regulator, the Energy Markets Inspectorate, has been given the task by the Swedish government to investigate a long term solution of the peak load issue. The Swedish and Finnish TSOs have together with Nord Pool Spot worked on finding a harmonized solution for activation of the peak load reserves in the market. An agreement accepted by the relevant authorities was reached in early January 2009, and the arrangement has been implemented since 19th January 2009. NordREG views that the proposed Nordel guidelines have served as a starting point for the presently agreed procedure. However, NordREG does not see any need to further develop the Nordel guidelines for peak load arrangements. NordREG agrees with Nordel that the market should be designed to solve peak load problems through proper incentives to market players. NordREG presumes that the relevant authorities in each country will take decisions on the need for any peak load arrangement to ensure security of supply. NordREG proposes that such decisions should be

  4. An innovation and policy agenda for commercially competitive plug-in hybrid electric vehicles

    International Nuclear Information System (INIS)

    Lemoine, D M; Kammen, D M; Farrell, A E

    2008-01-01

    Plug-in hybrid electric vehicles (PHEVs) can use both grid-supplied electricity and liquid fuels. We show that under recent conditions, millions of PHEVs could have charged economically in California during both peak and off-peak hours even with modest gasoline prices and real-time electricity pricing. Special electricity rate tariffs already in place for electric vehicles could successfully render on-peak charging uneconomical and off-peak charging very attractive. However, unless battery prices fall by at least a factor of two, or gasoline prices double, the present value of fuel savings is smaller than the marginal vehicle costs, likely slowing PHEV market penetration in California. We also find that assumptions about how PHEVs are charged strongly influence the number of PHEVs that can be charged before the electric power system must be expanded. If most PHEVs are charged after the workday, and thus after the time of peak electricity demand, our forecasts suggest that several million PHEVs could be deployed in California without requiring new generation capacity, and we also find that the state's PHEV fleet is unlikely to reach into the millions within the current electricity sector planning cycle. To ensure desirable outcomes, appropriate technologies and incentives for PHEV charging will be needed if PHEV adoption becomes mainstream

  5. An innovation and policy agenda for commercially competitive plug-in hybrid electric vehicles

    Science.gov (United States)

    Lemoine, D. M.; Kammen, D. M.; Farrell, A. E.

    2008-01-01

    Plug-in hybrid electric vehicles (PHEVs) can use both grid-supplied electricity and liquid fuels. We show that under recent conditions, millions of PHEVs could have charged economically in California during both peak and off-peak hours even with modest gasoline prices and real-time electricity pricing. Special electricity rate tariffs already in place for electric vehicles could successfully render on-peak charging uneconomical and off-peak charging very attractive. However, unless battery prices fall by at least a factor of two, or gasoline prices double, the present value of fuel savings is smaller than the marginal vehicle costs, likely slowing PHEV market penetration in California. We also find that assumptions about how PHEVs are charged strongly influence the number of PHEVs that can be charged before the electric power system must be expanded. If most PHEVs are charged after the workday, and thus after the time of peak electricity demand, our forecasts suggest that several million PHEVs could be deployed in California without requiring new generation capacity, and we also find that the state's PHEV fleet is unlikely to reach into the millions within the current electricity sector planning cycle. To ensure desirable outcomes, appropriate technologies and incentives for PHEV charging will be needed if PHEV adoption becomes mainstream.

  6. Safety Evaluation Report related to the operation of Comanche Peak Steam Electric Station, Units 1 and 2 (Docket Nos. 50-445 and 50-446). Supplement No. 9

    International Nuclear Information System (INIS)

    1985-03-01

    This supplement addresses TUEC's analyses in support of its request to amend the Comanche Peak Final Safety Analysis Report to eliminate the commitment that coatings inside the reactor Containment Building be qualified for Units 1 and 2. In addition, this supplement provides the results of the staff's evaluation and resolution of 62 technical concerns and allegations in the coatings area for Unit 1. Because of the favorable resolution of the items discussed in this report, the staff concludes for the issues considered herein, that there is reasonable assurance that the facility can be operated by TUEC without endangering the health and safety of the public

  7. Capacitive behavior studies on electrical double layer capacitor using poly (vinyl alcohol)–lithium perchlorate based polymer electrolyte incorporated with TiO{sub 2}

    Energy Technology Data Exchange (ETDEWEB)

    Lim, Chin-Shen; Teoh, K.H.; Liew, Chiam-Wen; Ramesh, S., E-mail: rameshtsubra@gmail.com

    2014-01-15

    Electric double layer capacitors (EDLCs) based on activated carbon electrodes and poly (vinyl alcohol)–lithium perchlorate (PVA–LiClO{sub 4})-nanosized titania (TiO{sub 2}) doped polymer electrolyte have been fabricated. Incorporation of TiO{sub 2} into PVA–LiClO{sub 4} system increases the ionic conductivity. The highest ionic conductivity of 1.3 × 10{sup −4} S cm{sup −1} is achieved at ambient temperature upon inclusion of 8 wt.% of TiO{sub 2}. Differential scanning calorimetry (DSC) analyses reveal that addition of TiO{sub 2} into polymer system increases the flexibility of polymer chain and favors the ion migration. Scanning electron microscopy (SEM) analyses display the surface morphology of the nanocomposite polymer electrolytes. The electrochemical stability window of composite polymer electrolyte is in the range of −2.3 V to 2.3 V as shown in cyclic voltammetry (CV) studies. The performance of EDLC is evaluated by electrochemical impedance spectroscopy (EIS), CV and galvanostatic charge–discharge technique. CV test discloses a nearly rectangular shape, which signifies the capacitive behavior of an ELDC. The EDLC containing composite polymer electrolyte gives higher specific capacitance value of 12.5 F g{sup −1} compared to non-composite polymer electrolyte with capacitance value of 3.0 F g{sup −1} in charge–discharge technique. The obtained specific capacitance of EDLC is in good agreement with each method used in this present work. Inclusion of filler into the polymer electrolyte enhances the electrochemical stability of EDLC. - Highlights: • PVA–LiClO{sub 4}–TiO{sub 2} possesses ionic conductivity value of 1.30 × 10{sup −4} S cm{sup −1}. • CV indicates the electrochemical stability window in the range of −2.3 V to 2.3 V. • The EDLC gives specific capacitance value of 12.5 F g{sup −1}.

  8. Solid-state electric double layer capacitors fabricated with plastic crystal based flexible gel polymer electrolytes: Effective role of electrolyte anions

    International Nuclear Information System (INIS)

    Suleman, Mohd; Kumar, Yogesh; Hashmi, S.A.

    2015-01-01

    Flexible gel polymer electrolyte (GPE) thick films incorporated with solutions of lithium trifluoromethanesulfonate (Li-triflate or LiTf) and lithium bis trifluoromethane-sulfonimide (LiTFSI) in a plastic crystal succinonitrile (SN), entrapped in poly(vinylidine fluoride-co-hexafluoropropylene) (PVdF-HFP) have been prepared and characterized. The films have been used as electrolytes in the electrical double layer capacitors (EDLCs). Coconut-shell derived activated carbon with high specific surface area (∼2100 m 2 g −1 ) and mixed (micro- and meso-) porosity has been used as EDLC electrodes. The structural, thermal, and electrochemical characterization of the GPEs have been performed using scanning electron microscopy (SEM), X-ray diffraction (XRD), differential scanning calorimetry (DSC), impedance measurements and cyclic voltammetry. The high ionic conductivity (∼10 −3 S cm −1 at 25 °C), good electrochemical stability window (>4.0 V) and flexible nature of the free-standing films of GPEs show their competence in the fabrication of EDLCs. The EDLCs have been tested using electrochemical impedance spectroscopy, cyclic voltammetry, and charge–discharge studies. The EDLCs using LiTf based electrolyte have been found to give higher values of specific capacitance, specific energy, power density (240–280 F g −1 , ∼39 Wh kg −1 and ∼19 kW kg −1 , respectively) than the EDLC cell with LiTFSI based gel electrolyte. EDLCs have been found to show stable performance for ∼10 4 charge–discharge cycles. The comparative studies indicate the effective role of electrolyte anions on the capacitive performance of the solid-state EDLCs. - Graphical abstract: Display Omitted - Highlights: • Flexible EDLCs with succinonitrile based gel electrolyte membranes are reported. • Anionic size of salts in gel electrolytes plays important role on capacitive performance. • Li-triflate incorporated gel electrolyte shows better performance over LiTFSI-based gel.

  9. Electrical properties and scaling behaviour of rare earth based Ho{sub 2}CoZrO{sub 6} double perovskite ceramics

    Energy Technology Data Exchange (ETDEWEB)

    Mahato, Dev K., E-mail: drdevkumar@yahoo.com [Department of Physics, National Institute of Technology Patna, Patna 800005 (India); Dutta, Alo; Sinha, T.P. [Department of Physics, Bose Institute, 93/1, Acharya Prafulla Chandra Road, Kolkata 700 009 (India)

    2012-12-15

    Graphical abstract: The X-ray diffraction analysis suggests that the compound crystallizes in monoclinic phase at room temperature with β = 108.51 ± 0.021° (a = 8.1858 ± 0.0023 Å, b = 5.2599 ± 0.0027 Å, c = 7.9874 ± 0.0031 Å) and cell volume = 324.17 Å{sup 3}. The SEM image indicates the uniformity of the grains in the samples. The grain size of the microstructure of HCZ is found to be ∼0.48 μm on average. Display Omitted Highlights: ► The conduction mechanism in HCZ may be due to hopping of small polaron. ► The material shows semiconducting behaviour. ► Conductivity obeys Jonscher's power law with high frequency dispersion. ► Both long-range and localized relaxation are present. -- Abstract: The Ho{sub 2}CoZrO{sub 6} (HCZ) double perovskite has been prepared in polycrystalline form by solid state reaction technique. The analysis of the X-ray powder diffraction pattern indicates that the crystal structure is monoclinic at room temperature with cell parameters a = 8.1858 ± 0.0023 Å, b = 5.2599 ± 0.0027 Å, c = 7.9874 ± 0.0031 Å and β = 108.51 ± 0.021°. The compound shows significant frequency dispersion in its dielectric properties. The Cole–Cole model is used to determine the polydispersive nature of dielectric relaxation. The scaling behaviour of dielectric loss and imaginary electric modulus suggest that the relaxation describe same mechanism at various temperatures. Impedance data presented in the Nyquist plot (Z″ versus Z′) are used to identify an equivalent circuit and to know the bulk and interface contributions. The complex impedance analysis of HCZ exhibits the appearance of both the grain and the grain-boundary contribution. The frequency dependent conductivity spectra follow the universal power law. The magnitude of the activation energy indicates that the carrier transport is due to the hopping conduction.

  10. Solid-state electric double layer capacitors fabricated with plastic crystal based flexible gel polymer electrolytes: Effective role of electrolyte anions

    Energy Technology Data Exchange (ETDEWEB)

    Suleman, Mohd; Kumar, Yogesh; Hashmi, S.A., E-mail: sahashmi@physics.du.ac.in

    2015-08-01

    Flexible gel polymer electrolyte (GPE) thick films incorporated with solutions of lithium trifluoromethanesulfonate (Li-triflate or LiTf) and lithium bis trifluoromethane-sulfonimide (LiTFSI) in a plastic crystal succinonitrile (SN), entrapped in poly(vinylidine fluoride-co-hexafluoropropylene) (PVdF-HFP) have been prepared and characterized. The films have been used as electrolytes in the electrical double layer capacitors (EDLCs). Coconut-shell derived activated carbon with high specific surface area (∼2100 m{sup 2} g{sup −1}) and mixed (micro- and meso-) porosity has been used as EDLC electrodes. The structural, thermal, and electrochemical characterization of the GPEs have been performed using scanning electron microscopy (SEM), X-ray diffraction (XRD), differential scanning calorimetry (DSC), impedance measurements and cyclic voltammetry. The high ionic conductivity (∼10{sup −3} S cm{sup −1} at 25 °C), good electrochemical stability window (>4.0 V) and flexible nature of the free-standing films of GPEs show their competence in the fabrication of EDLCs. The EDLCs have been tested using electrochemical impedance spectroscopy, cyclic voltammetry, and charge–discharge studies. The EDLCs using LiTf based electrolyte have been found to give higher values of specific capacitance, specific energy, power density (240–280 F g{sup −1}, ∼39 Wh kg{sup −1} and ∼19 kW kg{sup −1}, respectively) than the EDLC cell with LiTFSI based gel electrolyte. EDLCs have been found to show stable performance for ∼10{sup 4} charge–discharge cycles. The comparative studies indicate the effective role of electrolyte anions on the capacitive performance of the solid-state EDLCs. - Graphical abstract: Display Omitted - Highlights: • Flexible EDLCs with succinonitrile based gel electrolyte membranes are reported. • Anionic size of salts in gel electrolytes plays important role on capacitive performance. • Li-triflate incorporated gel electrolyte shows better

  11. Peak capacity and peak capacity per unit time in capillary and microchip zone electrophoresis.

    Science.gov (United States)

    Foley, Joe P; Blackney, Donna M; Ennis, Erin J

    2017-11-10

    The origins of the peak capacity concept are described and the important contributions to the development of that concept in chromatography and electrophoresis are reviewed. Whereas numerous quantitative expressions have been reported for one- and two-dimensional separations, most are focused on chromatographic separations and few, if any, quantitative unbiased expressions have been developed for capillary or microchip zone electrophoresis. Making the common assumption that longitudinal diffusion is the predominant source of zone broadening in capillary electrophoresis, analytical expressions for the peak capacity are derived, first in terms of migration time, diffusion coefficient, migration distance, and desired resolution, and then in terms of the remaining underlying fundamental parameters (electric field, electroosmotic and electrophoretic mobilities) that determine the migration time. The latter expressions clearly illustrate the direct square root dependence of peak capacity on electric field and migration distance and the inverse square root dependence on solute diffusion coefficient. Conditions that result in a high peak capacity will result in a low peak capacity per unit time and vice-versa. For a given symmetrical range of relative electrophoretic mobilities for co- and counter-electroosmotic species (cations and anions), the peak capacity increases with the square root of the electric field even as the temporal window narrows considerably, resulting in a significant reduction in analysis time. Over a broad relative electrophoretic mobility interval [-0.9, 0.9], an approximately two-fold greater amount of peak capacity can be generated for counter-electroosmotic species although it takes about five-fold longer to do so, consistent with the well-known bias in migration time and resolving power for co- and counter-electroosmotic species. The optimum lower bound of the relative electrophoretic mobility interval [μ r,Z , μ r,A ] that provides the maximum

  12. Relaxation peak near 200 K in NiTi alloy

    Science.gov (United States)

    Zhu, J. S.; Schaller, R.; Benoit, W.

    1989-10-01

    Internal friction (IF), frequency ( f), electrical resistance ( R) and zero point movement of the torsion pendulum (ɛ) have been measured in near equi-atomic NiTi alloy in order to clarify the mechanism for the relaxation peak near 200 K. The height of the relaxation peak decreases successively with thermal cycling and settles down to a lower stable value in running 15 cycles. However, the electrical resistance of the sample shows a variation in contrast with the internal friction. Both of them will return to the initial state after a single annealing at 773 K for 1 h. The probable mechanism of this relaxation peak was discussed.

  13. Study on reduction of consumption and peak demand of electric power used in residential houses with solar heating and PV systems; Solar house no fuka heijunka to energy sakugen koka ni kansuru kenkyu

    Energy Technology Data Exchange (ETDEWEB)

    Udagawa, M.; Endo, T. [Kogakuin University, Tokyo (Japan)

    1994-12-08

    A model house was simulated to reduce the consumption and peak demand for the photovoltaic power generation system, and solar heat air heating and hot water supply system in the solar house. As a type of construction, both wooden construction and reinforced concrete (RC) construction were selected with a total floor area of 125m{sup 2}. All the rooms were equipped with an air conditioner by heat pump from the air thermal source. A solar heat floor heater was simultaneously installed on the first floor. The hot water supply load was 4.8MWh per year. A commercial grid-connected on-site system was applied to the photovoltaic power generation with a 20m{sup 2} wide monocrystalline Si solar cell panel. As for the fluctuation in power load, the peak at the time of rising is more reduced in the RC house than in the wooden house, because the former is smaller in temperature fluctuation than the latter during the intermittence of air conditioning (as per the specified operational schedule). Therefore, the power is more leveled off in the former than in the latter. Between both, difference was hardly made in energy consumption per year. The ratio of dependency was 47% upon the photovoltaic power generation system, while it was 50% and 77%, under the air heating power load and hot water supply power load, respectively, upon the solar heat air heating and hot water supply system, so that both systems were considerably effective in saving the energy. 5 refs., 7 figs., 1 tab.

  14. Electrical conductivity of Sr{sub 2−x}VMoO{sub 6−y} (x = 0.0, 0.1, 0.2) double perovskites

    Energy Technology Data Exchange (ETDEWEB)

    Childs, Nicholas B.; Smith, Richard; Key, Camas [Department of Physics, EPS 264, Montana State University, Bozeman, Montana 59717 (United States); Weisenstein, Adam; Sofie, Stephen [Department of Mechanical Engineering, Roberts 220, Montana State University, Bozeman, Montana 59717 (United States)

    2013-06-28

    Electrical conductivity of Sr{sub 2-x}VMoO{sub 6-y} (x = 0.0, 0.1, 0.2) double perovskites has been investigated in a reducing atmosphere at temperatures up to 800 °C. This material has a key application in solid oxide fuel cell anodes as a mixed ion and electron conductor. A solid state synthesis technique was used to fabricate materials and crystal structure was verified through x-ray diffraction. Subsequent to conventional sintering in a reducing environment, elemental valence states were indentified through x-ray photoemission spectroscopy on the double perovskite material before and after annealing in a hydrogen environment. Samples exhibited metallic like conduction with electrical conductivities of 1250 S/cm (Sr{sub 2}VMoO{sub 6-y′}), 2530 S/cm (Sr{sub 1.8}VMoO{sub 6-y″}), and 3610 S/cm (Sr{sub 1.9}VMoO{sub 6-y‴}) at 800 °C in 5% H{sub 2}/95% N{sub 2}, with a substantial increase in conductivity upon cooling to room temperature. Room temperature electrical conductivity values for Sr{sub 1.9}VMoO{sub 6-y‴} make it a candidate as the highest electrically conductive oxide known. Highly insulating secondary surface phases, Sr{sub 3}V{sub 2}O{sub 8}, and SrMoO{sub 4}, begin to reduce at 400 °C in a hydrogen environment, as confirmed by X-ray photoemission and thermal gravimetric analysis. This reduction, from V{sup 5+} and Mo{sup 6+} to lower valence states, leads to a large increase in sample electrical conductivity.

  15. Impact of Smart Grid Technologies on Peak Load to 2050

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2011-07-01

    The IEA's Smart Grids Technology Roadmap identified five global trends that could be effectively addressed by deploying smart grids. These are: increasing peak load (the maximum power that the grid delivers during peak hours), rising electricity consumption, electrification of transport, deployment of variable generation technologies (e.g. wind and solar PV) and ageing infrastructure. Along with this roadmap, a new working paper -- Impact of Smart Grid Technologies on Peak Load to 2050 -- develops a methodology to estimate the evolution of peak load until 2050. It also analyses the impact of smart grid technologies in reducing peak load for four key regions; OECD North America, OECD Europe, OECD Pacific and China. This working paper is a first IEA effort in an evolving modelling process of smart grids that is considering demand response in residential and commercial sectors as well as the integration of electric vehicles.

  16. Superconductivity in bundles of double-wall carbon nanotubes.

    Science.gov (United States)

    Shi, Wu; Wang, Zhe; Zhang, Qiucen; Zheng, Yuan; Ieong, Chao; He, Mingquan; Lortz, Rolf; Cai, Yuan; Wang, Ning; Zhang, Ting; Zhang, Haijing; Tang, Zikang; Sheng, Ping; Muramatsu, Hiroyuki; Kim, Yoong Ahm; Endo, Morinobu; Araujo, Paulo T; Dresselhaus, Mildred S

    2012-01-01

    We present electrical and thermal specific heat measurements that show superconductivity in double-wall carbon nanotube (DWCNT) bundles. Clear evidence, comprising a resistance drop as a function of temperature, magnetoresistance and differential resistance signature of the supercurrent, suggest an intrinsic superconducting transition below 6.8 K for one particular sample. Additional electrical data not only confirm the existence of superconductivity, but also indicate the T(c) distribution that can arise from the diversity in the diameter and chirality of the DWCNTs. A broad superconducting anomaly is observed in the specific heat of a bulk DWCNT sample, which yields a T(c) distribution that correlates well with the range of the distribution obtained from the electrical data. As quasi one dimensionality of the DWCNTs dictates the existence of electronic density of state peaks, confirmation of superconductivity in this material system opens the exciting possibility of tuning the T(c) through the application of a gate voltage.

  17. Central peaking of magnetized gas discharges

    International Nuclear Information System (INIS)

    Chen, Francis F.; Curreli, Davide

    2013-01-01

    Partially ionized gas discharges used in industry are often driven by radiofrequency (rf) power applied at the periphery of a cylinder. It is found that the plasma density n is usually flat or peaked on axis even if the skin depth of the rf field is thin compared with the chamber radius a. Previous attempts at explaining this did not account for the finite length of the discharge and the boundary conditions at the endplates. A simple 1D model is used to focus on the basic mechanism: the short-circuit effect. It is found that a strong electric field (E-field) scaled to electron temperature T e , drives the ions inward. The resulting density profile is peaked on axis and has a shape independent of pressure or discharge radius. This “universal” profile is not affected by a dc magnetic field (B-field) as long as the ion Larmor radius is larger than a

  18. Carrier doping into a superconducting BaPb0.7Bi0.3O3‑δ epitaxial film using an electric double-layer transistor structure

    Science.gov (United States)

    Komori, S.; Kakeya, I.

    2018-06-01

    Doping evolution of the unconventional superconducting properties in BaBiO3-based compounds has yet to be clarified in detail due to the significant change of the oxygen concentration accompanied by the chemical substitution. We suggest that the carrier concentration of an unconventional superconductor, BaPb0.7Bi0.3O3‑δ , is controllable without inducing chemical or structural changes using an electric double-layer transistor structure. The critical temperature is found to decrease systematically with increasing carrier concentration.

  19. Resonant tunneling through double-barrier structures on graphene

    International Nuclear Information System (INIS)

    Deng Wei-Yin; Zhu Rui; Deng Wen-Ji; Xiao Yun-Chang

    2014-01-01

    Quantum resonant tunneling behaviors of double-barrier structures on graphene are investigated under the tight-binding approximation. The Klein tunneling and resonant tunneling are demonstrated for the quasiparticles with energy close to the Dirac points. The Klein tunneling vanishes by increasing the height of the potential barriers to more than 300 meV. The Dirac transport properties continuously change to the Schrödinger ones. It is found that the peaks of resonant tunneling approximate to the eigen-levels of graphene nanoribbons under appropriate boundary conditions. A comparison between the zigzag- and armchair-edge barriers is given. (condensed matter: electronic structure, electrical, magnetic, and optical properties)

  20. SISGR: Improved Electrical Energy Storage with Electrochemical Double Layer Capacitance Based on Novel Carbon Electrodes, New Electrolytes, and Thorough Development of a Strong Science Base

    Energy Technology Data Exchange (ETDEWEB)

    Ruoff, Rodney S. [PI; Alam, Todd M. [co-PI; Bielawski, Christopher W. [co-PI; Chabal, Yves [co-PI; Hwang, Gyeong [co-PI; Ishii, Yoshitaka [co-PI; Rogers, Robin [co-PI

    2014-07-23

    The broad objective of the SISGR program is to advance the fundamental scientific understanding of electrochemical double layer capacitance (EDLC) and thus of ultracapacitor systems composed of a new type of electrode based on chemically modified graphene (CMG) and (primarily) with ionic liquids (ILs) as the electrolyte. Our team has studied the interplay between graphene-based and graphene-derived carbons as the electrode materials in electrochemical double layer capacitors (EDLC) systems on the one hand, and electrolytes including novel ionic liquids (ILs), on the other, based on prior work on the subject.

  1. Octant vectorcardiography - the evaluation by peaks.

    Science.gov (United States)

    Laufberger, V

    1982-01-01

    From the Frank lead potentials a computer prints out an elementary table. Therein, the electrical space of left ventricle depolarization is divided into eight spatial parts labelled by numbers 1-8 and called octants. Within these octants six peaks are determined labelled with letters ALPR-IS. Their localization is described by six-digit topograms characteristic for each patient. From 300 cases of patients after myocardial infarction, three data bases were compiled enabling every case to be classified into classes, subclasses and types. The follow up of patients according to these principles gives an objective and detailed image about the progress of coronary artery disease.

  2. Cut Electric Bills by Controlling Demand

    Science.gov (United States)

    Grumman, David L.

    1974-01-01

    Electric bills can be reduced by lowering electric consumption and by controlling demand -- the amount of electricity used at a certain point in time. Gives tips to help reduce electric demand at peak power periods. (Author/DN)

  3. High precision 16K, 16 channel peak sensing CAMAC ADC

    International Nuclear Information System (INIS)

    Jain, Mamta; Subramaniam, E.T

    2013-01-01

    A high density, peak sensing, analog to digital converter (ADC) double width module with CAMAC back plane has been developed for nuclear physics experiments with a large number of detectors. This module has sixteen independent channels in plug-in daughter card mother board mode

  4. Peak loads and network investments in sustainable energy transitions

    Energy Technology Data Exchange (ETDEWEB)

    Blokhuis, Erik, E-mail: e.g.j.blokhuis@tue.nl [Eindhoven University of Technology, Department of Architecture, Building and Planning, Vertigo 8.11, P.O. Box 513, 5600MB Eindhoven (Netherlands); Brouwers, Bart [Eindhoven University of Technology, Department of Architecture, Building and Planning, Vertigo 8.11, P.O. Box 513, 5600MB Eindhoven (Netherlands); Putten, Eric van der [Endinet, Gas and Electricity Network Operations, P.O. Box 2005, 5600CA Eindhoven (Netherlands); Schaefer, Wim [Eindhoven University of Technology, Department of Architecture, Building and Planning, Vertigo 8.11, P.O. Box 513, 5600MB Eindhoven (Netherlands)

    2011-10-15

    Current energy distribution networks are often not equipped for facilitating expected sustainable transitions. Major concerns for future electricity networks are the possibility of peak load increases and the expected growth of decentralized energy generation. In this article, we focus on peak load increases; the effects of possible future developments on peak loads are studied, together with the consequences for the network. The city of Eindhoven (the Netherlands) is used as reference city, for which a scenario is developed in which the assumed future developments adversely influence the maximum peak loads on the network. In this scenario, the total electricity peak load in Eindhoven is expected to increase from 198 MVA in 2009 to 591-633 MVA in 2040. The necessary investments for facilitating the expected increased peak loads are estimated at 305-375 million Euros. Based upon these projections, it is advocated that - contrary to current Dutch policy - choices regarding sustainable transitions should be made from the viewpoint of integral energy systems, evaluating economic implications of changes to generation, grid development, and consumption. Recently applied and finished policies on energy demand reduction showed to be effective; however, additional and connecting policies on energy generation and distribution should be considered on short term. - Highlights: > Sustainable energy transitions can result in major electricity peak load increases. > Introduction of heat pumps and electrical vehicles requires network expansion. > Under worst case assumptions, peak loads in Eindhoven increase with 200% until 2040. > The necessary investment for facilitating this 2040 peak demand is Euro 305-375 million. > Future policy choices should be made from the viewpoint of the integral energy system.

  5. Peak loads and network investments in sustainable energy transitions

    International Nuclear Information System (INIS)

    Blokhuis, Erik; Brouwers, Bart; Putten, Eric van der; Schaefer, Wim

    2011-01-01

    Current energy distribution networks are often not equipped for facilitating expected sustainable transitions. Major concerns for future electricity networks are the possibility of peak load increases and the expected growth of decentralized energy generation. In this article, we focus on peak load increases; the effects of possible future developments on peak loads are studied, together with the consequences for the network. The city of Eindhoven (the Netherlands) is used as reference city, for which a scenario is developed in which the assumed future developments adversely influence the maximum peak loads on the network. In this scenario, the total electricity peak load in Eindhoven is expected to increase from 198 MVA in 2009 to 591-633 MVA in 2040. The necessary investments for facilitating the expected increased peak loads are estimated at 305-375 million Euros. Based upon these projections, it is advocated that - contrary to current Dutch policy - choices regarding sustainable transitions should be made from the viewpoint of integral energy systems, evaluating economic implications of changes to generation, grid development, and consumption. Recently applied and finished policies on energy demand reduction showed to be effective; however, additional and connecting policies on energy generation and distribution should be considered on short term. - Highlights: → Sustainable energy transitions can result in major electricity peak load increases. → Introduction of heat pumps and electrical vehicles requires network expansion. → Under worst case assumptions, peak loads in Eindhoven increase with 200% until 2040. → The necessary investment for facilitating this 2040 peak demand is Euro 305-375 million. → Future policy choices should be made from the viewpoint of the integral energy system.

  6. Electricity pricing policy and rational energy use and conservation

    International Nuclear Information System (INIS)

    Faure-Mallen, A.

    1995-01-01

    With a threefold combination of rate system /R and D industrial policy/ communication and information for customers, the French electrical system appears as a major actor in Demand Side Management. Especially, the electricity tariffs are a cost reflective rate system which had been implemented and adapted over several decades with an efficient impact on national electricity load curve. As a part of IRP (integrated resources planning), within the global regulation of the energy supply and demand system, tariffs based on marginal costs have a double function: 1) tariffs reflect costs of different kind of supplies; 2) tariffs are an economic signal for customers. These pricing principles alone provide incentive for energy savings through peak-day-demand-reduction of transfer to less costly off-peak period, when they are economically sound

  7. Upper limit of peak area

    International Nuclear Information System (INIS)

    Helene, O.A.M.

    1982-08-01

    The determination of the upper limit of peak area in a multi-channel spectra, with a known significance level is discussed. This problem is specially important when the peak area is masked by the background statistical fluctuations. The problem is exactly solved and, thus, the results are valid in experiments with small number of events. The results are submitted to a Monte Carlo test and applied to the 92 Nb beta decay. (Author) [pt

  8. Market Designs : A Survey and Analysis of Methods to Ensure Peak Capacity

    OpenAIRE

    Gullberg, Erik

    2008-01-01

    The production and consumption of electricity must be in balance in order to maintain the frequency in an electrical grid. During peak loads this may be troublesome to achieve due to lack of adequate production capabilities. Competitive electricity markets with price caps have a problem - insufficient revenues for peak production units which lead to mothballing or decommissioning of power plants. Inadequate production capability is solved through design of the electricity markets which render...

  9. Particle in cell simulation of peaking switch for breakdown evaluation

    Energy Technology Data Exchange (ETDEWEB)

    Umbarkar, Sachin B.; Bindu, S.; Mangalvedekar, H.A.; Saxena, A.; Singh, N.M., E-mail: sachin.b.umbarkar@gmail.com [Department of Electric Engineering, Veermata Jijabai Technological Institute, Mumbai (India); Sharma, Archana; Saroj, P.C.; Mittal, K.C. [Accelerator Pulse Power Division, Bhabha Atomic Research Centre, Mumbai (India)

    2014-07-01

    Marx generator connected to peaking capacitor and peaking switch can generate Ultra-Wideband (UWB) radiation. A new peaking switch is designed for converting the existing nanosecond Marx generator to a UWB source. The paper explains the particle in cell (PIC) simulation for this peaking switch, using MAGIC 3D software. This peaking switch electrode is made up of copper tungsten material and is fixed inside the hermitically sealed derlin material. The switch can withstand a gas pressure up to 13.5 kg/cm{sup 2}. The lower electrode of the switch is connected to the last stage of the Marx generator. Initially Marx generator (without peaking stage) in air; gives the output pulse with peak amplitude of 113.75 kV and pulse rise time of 25 ns. Thus, we design a new peaking switch to improve the rise time of output pulse and to pressurize this peaking switch separately (i.e. Marx and peaking switch is at different pressure). The PIC simulation gives the particle charge density, current density, E counter plot, emitted electron current, and particle energy along the axis of gap between electrodes. The charge injection and electric field dependence on ionic dissociation phenomenon are briefly analyzed using this simulation. The model is simulated with different gases (N{sub 2}, H{sub 2}, and Air) under different pressure (2 kg/cm{sup 2}, 5 kg/cm{sup 2}, 10 kg/cm{sup 2}). (author)

  10. Electrical and optical properties of a n-type ZnO thin film deposited on a Si substrate by using a double RF Co-sputtering method

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Jonghyun; Choi, Wonjoon; Kim, Chaeok; Hong, Jinpyo; Nahm, Tschanguh [Hanyang University, Seoul (Korea, Republic of); Cheong, Hyeonsik [Sogang University, Seoul (Korea, Republic of)

    2006-09-15

    Outstanding n-type ZnO thin films were prepared on Si substrates by utilizing a double RF cosputtering method. Our unique double RF technique has many attractive merits for synthesizing ZnO thin films with excellent optoelectronic properties at various temperatures. The ZnO thin films were also post-annealed at various temperatures. The X-ray diffraction patterns and X-ray photoelectron spectroscopy indicated well-grown ZnO films with a (002) orientation and with gorgeous chemically bond states, respectively. In addition, photoluminescence measurements indicated a band-gap of 3.4 eV in the ZnO films. The scanning electron microscopy images showed that the as-grown ZnO thin film had hexagonal column shapes, such as hexagonal rods. The ZnO film exhibited an UV light response with a cut-off wavelength of {approx}370 nm at room temperature.

  11. Peak Oil and other threatening peaks-Chimeras without substance

    International Nuclear Information System (INIS)

    Radetzki, Marian

    2010-01-01

    The Peak Oil movement has widely spread its message about an impending peak in global oil production, caused by an inadequate resource base. On closer scrutiny, the underlying analysis is inconsistent, void of a theoretical foundation and without support in empirical observations. Global oil resources are huge and expanding, and pose no threat to continuing output growth within an extended time horizon. In contrast, temporary or prolonged supply crunches are indeed plausible, even likely, on account of growing resource nationalism denying access to efficient exploitation of the existing resource wealth.

  12. Ultrasonic Transducer Peak-to-Peak Optical Measurement

    Directory of Open Access Journals (Sweden)

    Pavel Skarvada

    2012-01-01

    Full Text Available Possible optical setups for measurement of the peak-to-peak value of an ultrasonic transducer are described in this work. The Michelson interferometer with the calibrated nanopositioner in reference path and laser Doppler vibrometer were used for the basic measurement of vibration displacement. Langevin type of ultrasonic transducer is used for the purposes of Electro-Ultrasonic Nonlinear Spectroscopy (EUNS. Parameters of produced mechanical vibration have to been well known for EUNS. Moreover, a monitoring of mechanical vibration frequency shift with a mass load and sample-transducer coupling is important for EUNS measurement.

  13. Extragalactic Peaked-spectrum Radio Sources at Low Frequencies

    Energy Technology Data Exchange (ETDEWEB)

    Callingham, J. R.; Gaensler, B. M.; Sadler, E. M.; Lenc, E. [Sydney Institute for Astronomy (SIfA), School of Physics, The University of Sydney, NSW 2006 (Australia); Ekers, R. D.; Bell, M. E. [CSIRO Astronomy and Space Science (CASS), Marsfield, NSW 2122 (Australia); Line, J. L. B.; Hancock, P. J.; Kapińska, A. D.; McKinley, B.; Procopio, P. [ARC Centre of Excellence for All-Sky Astrophysics (CAASTRO) (Australia); Hurley-Walker, N.; Tingay, S. J.; Franzen, T. M. O.; Morgan, J. [International Centre for Radio Astronomy Research (ICRAR), Curtin University, Bentley, WA 6102 (Australia); Dwarakanath, K. S. [Raman Research Institute (RRI), Bangalore 560080 (India); For, B.-Q. [International Centre for Radio Astronomy Research (ICRAR), The University of Western Australia, Crawley, WA 6009 (Australia); Hindson, L.; Johnston-Hollitt, M. [School of Chemical and Physical Sciences, Victoria University of Wellington, Wellington 6140 (New Zealand); Offringa, A. R., E-mail: joseph.callingham@sydney.edu.au [Netherlands Institute for Radio Astronomy (ASTRON), Dwingeloo (Netherlands); and others

    2017-02-20

    We present a sample of 1483 sources that display spectral peaks between 72 MHz and 1.4 GHz, selected from the GaLactic and Extragalactic All-sky Murchison Widefield Array (GLEAM) survey. The GLEAM survey is the widest fractional bandwidth all-sky survey to date, ideal for identifying peaked-spectrum sources at low radio frequencies. Our peaked-spectrum sources are the low-frequency analogs of gigahertz-peaked spectrum (GPS) and compact-steep spectrum (CSS) sources, which have been hypothesized to be the precursors to massive radio galaxies. Our sample more than doubles the number of known peaked-spectrum candidates, and 95% of our sample have a newly characterized spectral peak. We highlight that some GPS sources peaking above 5 GHz have had multiple epochs of nuclear activity, and we demonstrate the possibility of identifying high-redshift ( z > 2) galaxies via steep optically thin spectral indices and low observed peak frequencies. The distribution of the optically thick spectral indices of our sample is consistent with past GPS/CSS samples but with a large dispersion, suggesting that the spectral peak is a product of an inhomogeneous environment that is individualistic. We find no dependence of observed peak frequency with redshift, consistent with the peaked-spectrum sample comprising both local CSS sources and high-redshift GPS sources. The 5 GHz luminosity distribution lacks the brightest GPS and CSS sources of previous samples, implying that a convolution of source evolution and redshift influences the type of peaked-spectrum sources identified below 1 GHz. Finally, we discuss sources with optically thick spectral indices that exceed the synchrotron self-absorption limit.

  14. Peak-load management, the security of supply warranty

    International Nuclear Information System (INIS)

    2010-01-01

    Even if France owns an efficient power generation park, largely exporting and clean (90% with no CO 2 emission), it encounters some difficulties during peak-load periods. The successive peak power demand records which are recorded each year represent as many alerts about a possible collapse of the power system. In order to warrant the electricity supply, the present day regulatory framework must be changed to allow the industrial players to carry out the necessary investments

  15. Automatic fitting of Gaussian peaks using abductive machine learning

    Science.gov (United States)

    Abdel-Aal, R. E.

    1998-02-01

    Analytical techniques have been used for many years for fitting Gaussian peaks in nuclear spectroscopy. However, the complexity of the approach warrants looking for machine-learning alternatives where intensive computations are required only once (during training), while actual analysis on individual spectra is greatly simplified and quickened. This should allow the use of simple portable systems for fast and automated analysis of large numbers of spectra, particularly in situations where accuracy may be traded for speed and simplicity. This paper proposes the use of abductive networks machine learning for this purpose. The Abductory Induction Mechanism (AIM) tool was used to build models for analyzing both single and double Gaussian peaks in the presence of noise depicting statistical uncertainties in collected spectra. AIM networks were synthesized by training on 1000 representative simulated spectra and evaluated on 500 new spectra. A classifier network determines the multiplicity of single/double peaks with an accuracy of 5.8%. With statistical uncertainties corresponding to a peak count of 100, average percentage absolute errors for the height, position, and width of single peaks are 4.9, 2.9, and 4.2%, respectively. For double peaks, these average errors are within 7.0, 3.1, and 5.9%, respectively. Models have been developed which account for the effect of a linear background on a single peak. Performance is compared with a neural network application and with an analytical curve-fitting routine, and the new technique is applied to actual data of an alpha spectrum.

  16. Automatic fitting of Gaussian peaks using abductive machine learning

    International Nuclear Information System (INIS)

    Abdel-Aal, R.E.

    1998-01-01

    Analytical techniques have been used for many years for fitting Gaussian peaks in nuclear spectroscopy. However, the complexity of the approach warrants looking for machine-learning alternatives where intensive computations are required only once (during training), while actual analysis on individual spectra is greatly simplified and quickened. This should allow the use of simple portable systems for fast and automated analysis of large numbers of spectra, particularly in situations where accuracy may be traded for speed and simplicity. This paper proposes the use of abductive networks machine learning for this purpose. The Abductory Induction Mechanism (AIM) tool was used to build models for analyzing both single and double Gaussian peaks in the presence of noise depicting statistical uncertainties in collected spectra. AIM networks were synthesized by training on 1,000 representative simulated spectra and evaluated on 500 new spectra. A classifier network determines the multiplicity of single/double peaks with an accuracy of 98%. With statistical uncertainties corresponding to a peak count of 100, average percentage absolute errors for the height, position, and width of single peaks are 4.9, 2.9, and 4.2%, respectively. For double peaks, these average errors are within 7.0, 3.1, and 5.9%, respectively. Models have been developed which account for the effect of a linear background on a single peak. Performance is compared with a neural network application and with an analytical curve-fitting routine, and the new technique is applied to actual data of an alpha spectrum

  17. Peaking-factor of PWR

    International Nuclear Information System (INIS)

    Morioka, Noboru; Kato, Yasuji; Yokoi, M.

    1975-01-01

    Output peaking factor often plays an important role in the safety and operation of nuclear reactors. The meaning of the peaking factor of PWRs is categorized into two features or the peaking factor in core (FQ-core) and the peaking factor on the basis of accident analysis (or FQ-limit). FQ-core is the actual peaking factor realized in nuclear core at the time of normal operation, and FQ-limit should be evaluated from loss of coolant accident and other abnormal conditions. If FQ-core is lower than FQ-limit, the reactor may be operated at full load, but if FQ-core is larger than FQ-limit, reactor output should be controlled lower than FQ-limit. FQ-core has two kinds of values, or the one on the basis of nuclear design, and the other actually measured in reactor operation. The first FQ-core should be named as FQ-core-design and the latter as FQ-core-measured. The numerical evaluation of FQ-core-design is as follows; FQ-core-design of three-dimensions is synthesized with FQ-core horizontal value (X-Y) and FQ-core vertical value, the former one is calculated with ASSY-CORE code, and the latter one with one dimensional diffusion code. For the evaluation of FQ-core-measured, on-site data observation from nuclear reactor instrumentation or off-site data observation is used. (Iwase, T.)

  18. How to use your peak flow meter

    Science.gov (United States)

    ... meter - how to use; Asthma - peak flow meter; Reactive airway disease - peak flow meter; Bronchial asthma - peak ... 2014:chap 55. National Asthma Education and Prevention Program website. How to use a peak flow meter. ...

  19. Aluminum and gallium nuclei as microscopic probes for pulsed electron-nuclear double resonance diagnostics of electric-field gradient and spin density in garnet ceramics doped with paramagnetic ions

    Science.gov (United States)

    Uspenskaya, Yu. A.; Mamin, G. V.; Babunts, R. A.; Badalyan, A. G.; Edinach, E. V.; Asatryan, H. R.; Romanov, N. G.; Orlinskii, S. B.; Khanin, V. M.; Wieczorek, H.; Ronda, C.; Baranov, P. G.

    2018-03-01

    The presence of aluminum and gallium isotopes with large nuclear magnetic and quadrupole moments in the nearest environment of impurity ions Mn2+ and Ce3+ in garnets made it possible to use hyperfine and quadrupole interactions with these ions to determine the spatial distribution of the unpaired electron and the gradient of the electric field at the sites of aluminum and gallium in the garnet lattice. High-frequency (94 GHz) electron spin echo detected electron paramagnetic resonance and electron-nuclear double resonance measurements have been performed. Large difference in the electric field gradient and quadrupole splitting at octahedral and tetrahedral sites allowed identifying the positions of aluminum and gallium ions in the garnet lattice and proving that gallium first fills tetrahedral positions in mixed aluminum-gallium garnets. This should be taken into account in the development of garnet-based scintillators and lasers. It is shown that the electric field gradient at aluminum nuclei near Mn2+ possessing an excess negative charge in the garnet lattice is ca. 2.5 times larger than on aluminum nuclei near Ce3+.

  20. Outcome of transcutaneous electrical nerve stimulation in chronic pain: short-term results of a double-blind, randomised, placebo-controlled trial.

    NARCIS (Netherlands)

    Oosterhof, J.; Boo, T.M. de; Oostendorp, R.A.B.; Wilder-Smith, O.H.G.; Crul, B.J.P.

    2006-01-01

    The aim of this study was to test the efficacy of shortterm transcutaneous electrical nerve stimulation (TENS) treatment in chronic pain with respect to pain intensity and patients' satisfaction with treatment results. We therefore performed a randomised controlled trial comparing TENS and sham

  1. Peak effect in twinned superconductors

    International Nuclear Information System (INIS)

    Larkin, A.I.; Marchetti, M.C.; Vinokur, V.M.

    1995-01-01

    A sharp maximum in the critical current J c as a function of temperature just below the melting point of the Abrikosov flux lattice has recently been observed in both low- and high-temperature superconductors. This peak effect is strongest in twinned crystals for fields aligned with the twin planes. We propose that this peak signals the breakdown of the collective pinning regime and the crossover to strong pinning of single vortices on the twin boundaries. This crossover is very sharp and can account for the steep drop of the differential resistivity observed in experiments. copyright 1995 The American Physical Society

  2. Hubbert's Peak -- A Physicist's View

    Science.gov (United States)

    McDonald, Richard

    2011-04-01

    Oil, as used in agriculture and transportation, is the lifeblood of modern society. It is finite in quantity and will someday be exhausted. In 1956, Hubbert proposed a theory of resource production and applied it successfully to predict peak U.S. oil production in 1970. Bartlett extended this work in publications and lectures on the finite nature of oil and its production peak and depletion. Both Hubbert and Bartlett place peak world oil production at a similar time, essentially now. Central to these analyses are estimates of total ``oil in place'' obtained from engineering studies of oil reservoirs as this quantity determines the area under the Hubbert's Peak. Knowing the production history and the total oil in place allows us to make estimates of reserves, and therefore future oil availability. We will then examine reserves data for various countries, in particular OPEC countries, and see if these data tell us anything about the future availability of oil. Finally, we will comment on synthetic oil and the possibility of carbon-neutral synthetic oil for a sustainable future.

  3. Double Trouble

    NARCIS (Netherlands)

    Elsaesser, Thomas; Kievit, Robert; Simons, Jan

    1994-01-01

    Double Trouble highlights the career of Dutch scriptwriter and television producer Chiem van Houweninge, well-known for his long-running TV comedy series and as author of episodes for TV detective series. Double Trouble gives Van Houweninge's own views on writing and filming in television prime

  4. Double layers above the aurora

    International Nuclear Information System (INIS)

    Temerin, M.; Mozer, F.S.

    1987-01-01

    Two different kinds of double layers were found in association with auroral precipitation. One of these is the so-called electrostatic shock, which is oriented at an oblique angle to the magnetic field in such a way that the perpendicular electric field is much larger than the parallel electric field. This type of double layer is often found at the edges of regions of upflowing ion beams and the direction of the electric fields in the shock points toward the ion beam. The potential drop through the shock can be several kV and is comparable to the total potential needed to produce auroral acceleration. Instabilities associated with the shock may generate obliquely propagating Alfven waves, which may accelerate electrons to produce flickering auroras. The flickering aurora provides evidence that the electrostatic shock may have large temporal fluctuations. The other kind of double layer is the small-amplitude double layer found in regions of upward flowing in beams, often in association with electrostatic ion cyclotron waves. The parallel and perpendicular electric fields in these structures are comparable in magnitude. The associated potentials are a few eV. Since many such double layers are found in regions of upward flowing ion beams, the combined potential drop through a set of these double layers can be substantial

  5. Strongly capacitively coupled double quantum dots in GaAs-AlGaAs heterostructures. Preparation and electrical transport; Kapazitativ stark gekoppelte Doppelquantenpunkte in GaAs-AlGaAs-Heterostrukturen. Herstellung und elektrischer Transport

    Energy Technology Data Exchange (ETDEWEB)

    Huebel, A.

    2007-11-22

    In this work, a double quantum dot system is studied whose two dots are electrically insulated from one another and contacted independently with two leads. The geometry is optimized to maximize the capacitive interaction between the dots. The samples are characterized by electrical transport measurements in a dilution refrigerator. It is then studied at different tunnel couplings how the capacitive interaction influences the electrical transport in equilibrium. Under certain conditions correlated tunnel processes can be observed. A simple model is derived that serves to understand these processes. The double quantum dot system is defined in lateral arrangement by reactive ion etching of a two-dimensional electron system located only 50 nm below the surface of a GaAs-AlGaAs heterostructure. The samples are characterized in a dilution refrigerator at 25 mK near the common pinch-off point of all four tunnel barriers. A measurement of the differential equilibrium conductances of both quantum dots as a function of two gate voltages yields a honeycomb-like charge stability diagram. The most important sample characteristic is the ratio between the interaction capacitance and the total capacitance of a single quantum dot. For the optimized sample, this ratio turns out to be larger than one third near the common pinch-off point, with a single-dot charging energy of up to 800 {mu}eV. At more positive gate voltages, the capacitances between the quantum dots and their leads increase more and more, thereby diminishing the charging energy. It is shown for the optimized sample that all capacitance coefficients except the dot-lead capacitances are constant to within considerable accuracy over several Coulomb blockade oscillations. In order to measure correlated electrical transport in equilibrium, special parameter regions are examined in which the charges of both quantum dots cannot fluctuate independently of each other. An analytical formula is derived that describes the

  6. Physical properties of a new Deep Eutectic Solvent based on lithium bis[(trifluoromethyl)sulfonyl]imide and N-methylacetamide as superionic suitable electrolyte for lithium ion batteries and electric double layer capacitors

    International Nuclear Information System (INIS)

    Boisset, Aurélien; Jacquemin, Johan; Anouti, Mérièm

    2013-01-01

    Highlights: • Preparation of new Deep Eutectic Solvent (DES) based on N-methylacetamide and TFSI. • Characterization of conductivity, viscosity and thermal properties of DES. • DES presents a superionic character in Walden classification. • DES is suitable electrolyte for lithium ion batteries and electric double layer capacitors. -- Abstract: Herein we present a study on the physical/chemical properties of a new Deep Eutectic Solvent (DES) based on N-methylacetamide (MAc) and lithium bis[(trifluoromethyl)sulfonyl]imide (LiTFSI). Due to its interesting properties, such as wide liquid-phase range from −60 °C to 280 °C, low vapor pressure, and high ionic conductivity up to 28.4 mS cm −1 at 150 °C and at x LiTFSI = 1/4, this solution can be practically used as electrolyte for electrochemical storage systems such as electric double-layer capacitors (EDLCs) and/or lithium ion batteries (LiBs). Firstly, relationships between its transport properties (conductivity and viscosity) as a function of composition and temperature were discussed through Arrhenius’ Law and Vogel–Tamman–Fulcher (VTF) equations, as well as by using the Walden classification. From this investigation, it appears that this complex electrolyte possesses a number of excellent transport properties, like a superionic character for example. Based on which, we then evaluated its electrochemical performances as electrolyte for EDLCs and LiBs applications by using activated carbon (AC) and lithium iron phosphate (LiFePO 4 ) electrodes, respectively. These results demonstrate that this electrolyte has a good compatibility with both electrodes (AC and LiFePO 4 ) in each testing cell driven also by excellent electrochemical properties in specific capacitance, rate and cycling performances, indicating that the LiTFSI/MAc DES can be a promising electrolyte for EDLCs and LiBs applications especially for those requiring high safety and stability

  7. SPANISH PEAKS PRIMITIVE AREA, MONTANA.

    Science.gov (United States)

    Calkins, James A.; Pattee, Eldon C.

    1984-01-01

    A mineral survey of the Spanish Peaks Primitive Area, Montana, disclosed a small low-grade deposit of demonstrated chromite and asbestos resources. The chances for discovery of additional chrome resources are uncertain and the area has little promise for the occurrence of other mineral or energy resources. A reevaluation, sampling at depth, and testing for possible extensions of the Table Mountain asbestos and chromium deposit should be undertaken in the light of recent interpretations regarding its geologic setting.

  8. Neurofeedback training for peak performance

    OpenAIRE

    Marek Graczyk; Maria Pąchalska; Artur Ziółkowski; Grzegorz Mańko; Beata Łukaszewska; Kazimierz Kochanowicz; Andrzej Mirski; Iurii D. Kropotov

    2014-01-01

    [b]aim[/b]. One of the applications of the Neurofeedback methodology is peak performance in sport. The protocols of the neurofeedback are usually based on an assessment of the spectral parameters of spontaneous EEG in resting state conditions. The aim of the paper was to study whether the intensive neurofeedback training of a well-functioning Olympic athlete who has lost his performance confidence after injury in sport, could change the brain functioning reflected in changes in spontaneou...

  9. Power peaking nuclear reliability factors

    International Nuclear Information System (INIS)

    Hassan, H.A.; Pegram, J.W.; Mays, C.W.; Romano, J.J.; Woods, J.J.; Warren, H.D.

    1977-11-01

    The Calculational Nuclear Reliability Factor (CNRF) assigned to the limiting power density calculated in reactor design has been determined. The CNRF is presented as a function of the relative power density of the fuel assembly and its radial local. In addition, the Measurement Nuclear Reliability Factor (MNRF) for the measured peak hot pellet power in the core has been evaluated. This MNRF is also presented as a function of the relative power density and radial local within the fuel assembly

  10. Evaluation of concurrent peak responses

    International Nuclear Information System (INIS)

    Wang, P.C.; Curreri, J.; Reich, M.

    1983-01-01

    This report deals with the problem of combining two or more concurrent responses which are induced by dynamic loads acting on nuclear power plant structures. Specifically, the acceptability of using the square root of the sum of the squares (SRSS) value of peak values as the combined response is investigated. Emphasis is placed on the establishment of a simplified criterion that is convenient and relatively easy to use by design engineers

  11. Finding two-dimensional peaks

    International Nuclear Information System (INIS)

    Silagadze, Z.K.

    2007-01-01

    Two-dimensional generalization of the original peak finding algorithm suggested earlier is given. The ideology of the algorithm emerged from the well-known quantum mechanical tunneling property which enables small bodies to penetrate through narrow potential barriers. We merge this 'quantum' ideology with the philosophy of Particle Swarm Optimization to get the global optimization algorithm which can be called Quantum Swarm Optimization. The functionality of the newborn algorithm is tested on some benchmark optimization problems

  12. Modeling and optimization of a double-well double-barrier GaN/AlGaN/GaN/AlGaN resonant tunneling diode

    Science.gov (United States)

    Liu, Yang; Gao, Bo; Gong, Min; Shi, Ruiying

    2017-06-01

    The influence of a GaN layer as a sub-quantum well for an AlGaN/GaN/AlGaN double barrier resonant tunneling diode (RTD) on device performance has been investigated by means of numerical simulation. The introduction of the GaN layer as the sub-quantum well turns the dominant transport mechanism of RTD from the 3D-2D model to the 2D-2D model and increases the energy difference between tunneling energy levels. It can also lower the effective height of the emitter barrier. Consequently, the peak current and peak-to-valley current difference of RTD have been increased. The optimal GaN sub-quantum well parameters are found through analyzing the electrical performance, energy band, and transmission coefficient of RTD with different widths and depths of the GaN sub-quantum well. The most pronounced electrical parameters, a peak current density of 5800 KA/cm2, a peak-to-valley current difference of 1.466 A, and a peak-to-valley current ratio of 6.35, could be achieved by designing RTD with the active region structure of GaN/Al0.2Ga0.8 N/GaN/Al0.2Ga0.8 N (3 nm/1.5 nm/1.5 nm/1.5 nm).

  13. Iodine ion adsorption and the electric double layer structure at a mercury electrode in aqueous potassium iodide solutions containing 0,05 M thiourea

    International Nuclear Information System (INIS)

    Damaskin, B.B.; Polyanovskaya, N.S.

    1988-01-01

    Electrocapillary measurements were used to obtain isotherms of specific adsorption of I - anions on the Hg/H 2 O boundary from KI+0.05 M of thiourea (TU) solutions. Is is shown that these data can be described by a simple varial isotherm, but disagree with Grahame-Parsons model. It follows from the suggested model interpretation of obtained results that electric centers of specifically adsorbed anions are displaced during coadsorption of TU molecules to the side of Helmholtz external plane, leading to disappearance of Esin-Markov effect

  14. Drivers of peak sales for pharmaceutical brands

    NARCIS (Netherlands)

    Fischer, Marc; Leeflang, Peter S. H.; Verhoef, Peter C.

    2010-01-01

    Peak sales are an important metric in the pharmaceutical industry. Specifically, managers are focused on the height-of-peak-sales and the time required achieving peak sales. We analyze how order of entry and quality affect the level of peak sales and the time-to-peak-sales of pharmaceutical brands.

  15. Splitting of the resistive transition of copper oxide superconductors: Intrinsic double superconducting transitions versus extrinsic effects

    International Nuclear Information System (INIS)

    Pomar, A.; Curras, S.R.; Veira, J.A.; Vidal, F.

    1996-01-01

    To prove the possible existence of an intrinsic double superconducting transition in the high-temperature copper oxide superconductors (HTSC), an effect recently attributed by various groups to different intrinsic properties of these materials (including unconventional wave pairing), we present in this paper high resolution data of the electrical resistivity, ρ(T), around the superconducting transition of different single crystal and polycrystal YBa 2 Cu 3 O 7-δ samples. The analysis of the temperature derivative of these ρ(T) data strongly suggests that (i) with a temperature resolution well to within 20 mK, the intrinsic resistive transition of the HTSC does not present any double transition anomaly and (ii) the double peak structure observed in dρ(T)/dT by some authors is probably an extrinsic effect (associated with stoichiometric inhomogeneities in some cases, and with experimental artifacts in other cases). copyright 1996 The American Physical Society

  16. Automatic acquisition and shape analysis of metastable peaks

    International Nuclear Information System (INIS)

    Maendli, H.; Robbiani, R.; Kuster, Th.; Seibl, J.

    1979-01-01

    A method for automatic acquisition and evaluation of metastable peaks due to transitions in the first field-free region of a double focussing mass spectrometer is presented. The data are acquired by computer-controlled repetitive scanning of the accelerating voltage and concomitant accumulation, the evaluation made by a mathematical derivatization of the resulting curve. Examples for application of the method are given. (Auth.)

  17. Electric field-induced valley degeneracy lifting in uniaxial strained graphene: evidence from magnetophonon resonance

    OpenAIRE

    Assili, Mohamed; Haddad, Sonia; Kang, Woun

    2015-01-01

    A double peak structure in the magneto-phonon resonance (MPR) spectrum of uniaxial strained graphene, under crossed electric and magnetic fields, is predicted. We focus on the $\\Gamma$ point optical phonon modes coupled to the inter-Landau level transitions $0 \\leftrightarrows \\pm 1$ where MPR is expected to be more pronounced at high magnetic field. We derive the frequency shifts and the broadenings of the longitudinal (LO) and transverse (TO) optical phonon modes taking into account the eff...

  18. The cost of electrolytic hydrogen from off-peak power

    International Nuclear Information System (INIS)

    Stucki, S.

    1991-01-01

    The cost of electrolytic hydrogen depends on the capacity factor of the plant and the cost of electricity. Both these parameters are correlated if off-peak power is to be used for hydrogen production. Based on assumptions regarding the correlation between the electricity price and the availability of electric power, optimizations were run using a simple cost model for the electrolysis plant. The current density at which the electrolysis plant would be run is taken as a variable for optimization as well as the annual time of availability of electric power. The results of the optimizations show for a number of hypothetical electrolyser types that the optimum operation time or electricity price do not depend much on the technology used. Production cost of electrolytic hydrogen can, however, be cut by 30% by using advanced electrolysis technology. (author)

  19. Charge reversal and surface charge amplification in asymmetric valence restricted primitive model planar electric double layers in the modified Poisson-Boltzmann theory

    Directory of Open Access Journals (Sweden)

    L.B. Bhuiyan

    2017-12-01

    Full Text Available The modified Poisson-Boltzmann theory of the restricted primitive model double layer is revisited and recast in a fresh, slightly broader perspective. Derivation of relevant equations follow the techniques utilized in the earlier MPB4 and MPB5 formulations and clarifies the relationship between these. The MPB4, MPB5, and a new formulation of the theory are employed in an analysis of the structure and charge reversal phenomenon in asymmetric 2:1/1:2 valence electrolytes. Furthermore, polarization induced surface charge amplification is studied in 3:1/1:3 systems. The results are compared to the corresponding Monte Carlo simulations. The theories are seen to predict the "exact" simulation data to varying degrees of accuracy ranging from qualitative to almost quantitative. The results from a new version of the theory are found to be of comparable accuracy as the MPB5 results in many situations. However, in some cases involving low electrolyte concentrations, theoretical artifacts in the form of un-physical "shoulders" in the singlet ionic distribution functions are observed.

  20. Internal friction peaks observed in explosively deformed polycrystalline Mo, Nb, and Cu

    Science.gov (United States)

    Rieu, G. E.; Grimes, H. H.; Romain, J. P.; Defouquet, J.

    1974-01-01

    Explosive deformation (50 kbar range) induced, in Cu, Mo and Nb, internal friction peaks identical to those observed after large normal deformation. The variation of the peaks with pressure for Mo and Nb lead to an explanation of these processes in terms of double kink generation in screw and edge dislocations.

  1. The Parameters Optimizing Design of Double Suspension Arm Torsion Bar in the Electric Sight-Seeing Car by Random Vibration Analyzing Method

    Directory of Open Access Journals (Sweden)

    Shui-Ting Zhou

    2017-01-01

    Full Text Available This study is about the impact of the performance and the sensitivity analysis for parameters of the torsion bar suspension in the electric sight-seeing car, which the authors’ laboratory designed and which is used in the authors’ university. The suspension stiffness was calculated by using the virtual work principle, the vector algebra, and tensor of finite rotation methods and was verified by the ADAMS software. Based on the random vibration analysis method, the paper analyzed the dynamic tire load (DTL, suspension working space (SWS, and comfort performance parameters. For the purpose of decreasing the displacement of the suspension and limiting the frequency of impacting the stop block, the paper examined the three parameters and optimized the basic parameters of the torsion bar. The results show that the method achieves a great effect and contributes an accurate value for the general layout design.

  2. Electric field-induced valley degeneracy lifting in uniaxial strained graphene: Evidence from magnetophonon resonance

    Science.gov (United States)

    Assili, Mohamed; Haddad, Sonia; Kang, Woun

    2015-03-01

    A double peak structure in the magnetophonon resonance (MPR) spectrum of uniaxial strained graphene, under crossed electric and magnetic fields, is predicted. We focus on the Γ point optical phonon modes coupled to the inter-Landau level transitions 0 ⇆±1 where MPR is expected to be more pronounced at high magnetic field. We derive the frequency shifts and the broadenings of the longitudinal and transverse optical phonon modes taking into account the effect of the strain modified electronic spectrum on the electron-phonon coupling. We show that the MPR line for a given phonon mode acquires a double peak structure originating from the twofold valley degeneracy lifting. The latter is due to the different Landau level spacings in the two Dirac valleys resulting from the simultaneous action of the inplane electric field and the strain-induced Dirac cone tilt. We discuss the role of some key parameters such as disorder, strain, doping, and electric field amplitude on the emergence of the double peak structure.

  3. Mesure de la capacité différencielle de la double couche électrique en milieu hydrocarbure. Etude de l'interface métal-additifs pour lubrifiants. Première partie Measuring the Differential Capacity of the Electric Double Layer in a Hydrocarbon Medium. Analysis of the Metal Additive Interface for Lubricants. Part One

    Directory of Open Access Journals (Sweden)

    Hipeaux J. C.

    2006-11-01

    Full Text Available Le phénomène d'adsorption d'additifs détergents-dispersants contenus dans les huiles lubrifiantes est à la base de l'action de ces produits. L'existence d'une double couche électrique est un des paramètres envisagés lors de l'étude de l'interface métal-milieu hydrocarbure. La structure de cette double couche en liaison avec le phénomène d'adsorption à l'interface (courbe électrocapillaire, énergie libre de surface, charge, capacité différentielle sont abordés. L'importance de la connaissance du potentiel de charge nulle est montrée. Une revue bibliographique des moyens d'accès à la mesure des capacités différentielles de la double couche est farte, l'objectif à atteindre étant le choix d'une technique de mesure possible en milieu hydrocarbure, sur électrode solide. Une méthode, basée sur l'étude du début de la charge de la double couche électrique et utilisant la superposition d'une tension carrée à une tension continue maintenue constante, est développée et l'étude théorique du circuit réalisée. Des courbes capacité différentielle = f (tension de polarisation sont tracées pour des solutions dans l'heptane de différents additifs utilisés en lubrification. Une réflexion sur les mécanismes d'adsorption est faite à partir de l'exploitation de ces courbes expérimentales. A titre de comparaison quelques tracés de courbes de capacité différentielle sont effectués avec un produit antistatique rendant fortement conducteur les hydrocarbures et un produit antiusure. Enfin un système de référence utilisant une électrode au calomel est proposé. The adsorption phenomena of detergent-dispersant additives contained in lubricating ails is behind for the action of such products. The existence of an electrical double layer is one of the parameters token into consideration when analyzing the métal/hydrocarbon medium interface. The structure of this double layer in connection with the adsorption phenomenon on

  4. Economic effects of peak oil

    International Nuclear Information System (INIS)

    Lutz, Christian; Lehr, Ulrike; Wiebe, Kirsten S.

    2012-01-01

    Assuming that global oil production peaked, this paper uses scenario analysis to show the economic effects of a possible supply shortage and corresponding rise in oil prices in the next decade on different sectors in Germany and other major economies such as the US, Japan, China, the OPEC or Russia. Due to the price-inelasticity of oil demand the supply shortage leads to a sharp increase in oil prices in the second scenario, with high effects on GDP comparable to the magnitude of the global financial crises in 2008/09. Oil exporting countries benefit from high oil prices, whereas oil importing countries are negatively affected. Generally, the effects in the third scenario are significantly smaller than in the second, showing that energy efficiency measures and the switch to renewable energy sources decreases the countries' dependence on oil imports and hence reduces their vulnerability to oil price shocks on the world market. - Highlights: ► National and sectoral economic effects of peak oil until 2020 are modelled. ► The price elasticity of oil demand is low resulting in high price fluctuations. ► Oil shortage strongly affects transport and indirectly all other sectors. ► Global macroeconomic effects are comparable to the 2008/2009 crisis. ► Country effects depend on oil imports and productivity, and economic structures.

  5. Experimental study on the double barrier structure at room temperature

    Energy Technology Data Exchange (ETDEWEB)

    Sheng, H Y; Chua, S J [Centre for Optoelectronics, Dept. of Electrical Engineering, National Univ. of Singapore (Singapore)

    1994-06-15

    An experimental study of AlAs / GaAs / AlAs double barrier structure is carried out. The double barrier and quantum well structure are grown by MBE. The peak-to-valley ratio 2.6 : 1 with peak current density of 1.6 kA/cm/sup 2 at room temperature have been achieved. (authors)

  6. Core fueling to produce peaked density profiles in large tokamaks

    International Nuclear Information System (INIS)

    Mikkelsen, D.R.; McGuire, K.M.; Schmidt, G.L.; Zweben, S.J.

    1994-06-01

    Peaking the density profile increases the usable bootstrap current and the average fusion power density; this could reduce the current drive power and increase the net output of power producing tokamaks. The use of neutral beams and pellet injection to produce peaked density profiles is assessed. We show that with radially ''hollow'' diffusivity profiles (and no particle pinch) moderately peaked density profiles can be produced by particle source profiles which are peaked off-axis. The fueling penetration requirements can therefore be relaxed and this greatly improves the feasibility of generating peaked density profiles in large tokamaks. In particular, neutral beam fueling does not require MeV particle energy. Even with beam voltages of ∼200 keV, however, exceptionally good particle confinement, τ p much-gt τ E is required to achieve net electrical power generation. In system with no power production requirement (e.g., neutron sources) neutral beam fueling should be capable of producing peaked density profiles in devices as large as ITER. Fueling systems with low energy cost per particle (such as cryogenic pellet injection) must be used in power producing tokamaks when τ p ∼ τ E . Simulations with pellet injection speeds of 7 km/sec show the peaking factor, n eo /left-angle n e right-angle, approaching 2

  7. Core fuelling to produce peaked density profiles in large tokamaks

    International Nuclear Information System (INIS)

    Mikkelsen, D.R.; McGuire, K.M.; Schmidt, G.L.; Zweben, S.J.

    1995-01-01

    Peaking the density profile increases the usable bootstrap current and the average fusion power density; this could reduce the current drive power and increase the net output of power producing tokamaks. The use of neutral beams and pellet injection to produce peaked density profiles is assessed. It is shown that with radially 'hollow' diffusivity profiles (and no particle pinch) moderately peaked density profiles can be produced by particle source profiles that are peaked off-axis. The fuelling penetration requirements can therefore be relaxed and this greatly improves the feasibility of generating peaked density profiles in large tokamaks. In particular, neutral beam fuelling does not require Megavolt particle energies. Even with beam voltages of ∼ 200 keV, however, exceptionally good particle confinement is needed to achieve net electrical power generation. The required ratio of particle to thermal diffusivities is an order of magnitude outside the range reported for tokamaks. In a system with no power production requirement (e.g., neutron sources) neutral beam fuelling should be capable of producing peaked density profiles in devices as large as ITER. Fuelling systems with low energy cost per particle - such as cryogenic pellet injection - must be used in power producing tokamaks when τ P ∼ τ E . Simulations with pellet injection speeds of 7 km/s show that the peaking factor, n e0 / e >, approaches 2. (author). 65 refs, 8 figs

  8. Two-dimensional carbon crystals. Electrical transport in single- and double-layer graphene; Zweidimensionale Kohlenstoffkristalle. Elektrischer Transport in Einzel- und Doppellagen-Graphen

    Energy Technology Data Exchange (ETDEWEB)

    Schmidt, Hennrik

    2012-02-03

    In his work atomically thin layers of carbon, socalled graphene, are investigated. These systems exhibit outstanding electronic properties which are analysed using magnetotransport measurements. For this purpose, different types of samples are prepared, analysed and discussed. In addition to conventional single layer and single crystal bilayer systems, folded flakes with twisted planes are examined. Since monolayer graphene is a two dimensional crystal in which every atom sits at the surface, it is very sensitive to any type of perturbation. Three different cases are investigated: Firstly, dopants are removed from the surface and the change in transport properties is monitored. Secondly, the regime of small carrier concentrations is used to observe field induced recharging of inhomogeneities. Thirdly, an atomic force microscope is used to alter the graphene itself in a defined region. The implications of this modification are again investigated using magnetotransport measurements. The influence of one layer on another one is studied in decoupled two layer samples. A folded sample with separatly contacted layers is used to show transport through the folded region. For jointly contacted layers parallel transport measurements are performed to analyse screening effects of an applied electric field and substrate influence. The interaction of the two layers is shown by a significant reduction of the Fermivelocity.

  9. Preparation of activated carbon aerogel and its application to electrode material for electric double layer capacitor in organic electrolyte: Effect of activation temperature

    Energy Technology Data Exchange (ETDEWEB)

    Kwon, Soon Hyung; Lee, Eunji; Kim, Myung-Soo; Jung, Ji Chul [Myongji University, Yongin (Korea, Republic of); Kim, Bum-Soo; Kim, Sang-Gil; Lee, Byung-Jun [Vitzrocell Co., Yesan (Korea, Republic of)

    2015-02-15

    Carbon aerogel was chemically activated with KOH at various activation temperatures with the aim of improving the electrochemical performance of carbon aerogel for EDLC electrode. Electrochemical performance of activated carbon aerogel electrode was determined by cyclic voltammetry and galvanostatic charge/discharge methods using coin-type EDLC cell in organic electrolyte. Activation temperature played an important role in determining the electrochemical performance of activated carbon aerogel for EDLC electrode. Specific capacitance of activated carbon aerogel at a high current density (5 A/g) showed a volcano-shaped curve with respect to activation temperature. Excessively high activation temperature could have an adverse effect on the electrochemical properties of activated carbon aerogel due to the low electrical conductivity caused by a collapse of characteristic structure of carbon aerogel. Among the carbon samples, carbon aerogel activated at 800 .deg. C with a high surface area and a well-developed porous structure exhibited the highest specific capacitance. In addition, carbon aerogel activated at 800 .deg. C retained a considerable specific capacitance at a high current density even after 1000 cycles of charge/discharge. Therefore, it is concluded that carbon aerogel activated with KOH at 800 .deg. C can serve as an efficient electrode material for commercial EDLC with a high power density.

  10. Development of an Android OS Based Controller of a Double Motor Propulsion System for Connected Electric Vehicles and Communication Delays Analysis

    Directory of Open Access Journals (Sweden)

    Pedro Daniel Urbina Coronado

    2015-01-01

    Full Text Available Developments of technologies that facilitate vehicle connectivity represent a market demand. In particular, mobile device (MD technology provides advanced user interface, customization, and upgradability characteristics that can facilitate connectivity and possibly aid in the goal of autonomous driving. This work explores the use of a MD in the control system of a conceptual electric vehicle (EV. While the use of MD for real-time control and monitoring has been reported, proper consideration has not been given to delays in data flow and their effects on system performance. The motor of a novel propulsion system for an EV was conditioned to be controlled in a wireless local area network by an ecosystem that includes a MD and an electronic board. An intended accelerator signal is predefined and sent to the motor and rotational speed values produced in the motor are sent back to the MD. Sample periods in which the communication really occurs are registered. Delays in the sample periods and produced errors in the accelerator and rotational speed signals are presented and analyzed. Maximum delays found in communications were of 0.2 s, while the maximum error produced in the accelerator signal was of 3.54%. Delays are also simulated, with a response that is similar to the behavior observed in the experiments.

  11. Ultrasound combined transcutaneous electrical nerve stimulation (UltraTENS) versus phonophoresis of piroxicam (PhP) in symptomatic knee osteoarthritis: A randomized double-blind, controlled trial.

    Science.gov (United States)

    Boonhong, Jariya; Suntornpiyapan, Phitsanu; Piriyajarukul, Apatchanee

    2018-02-02

    Ultrasound combined with transcutaneous electrical nerve stimulation (UltraTENS) and phonophoresis of piroxicam (PhP) are combined modality therapy that frequently used in musculoskeletal pain including knee osteoarthritis (OA). But it is lack of a good clinical trial to prove and compare their effects. To compare the effects of UltraTENS with PhP on mild to moderate degree of symptomatic knee OA. Sixty-one patients (55 women), mean age of 63.4 ± 8.1 y, 50-90 mm VAS of knee pain and Kellgren-Lawrence score of grade I-III were randomly allocated into UltraTENS and PhP (N = 31 and 30, respectively). The UltraTENS group received a combined ultrasound with TENS program and a non-drug gel, whereas the PhP group got an ultrasound program with piroxicam gel and sham TENS. All patients were treated for a total of 10 sessions, consisting of five times per week and 10 min per session. Before and after treatment, patients were evaluated knee pain by using the 100-mm VAS and functional performance by Western Ontario and McMaster Universities Osteoarthritis (WOMAC) index. The UltraTENS and PhP groups experienced considerable improvement in both VAS and total WOMAC scores post-treatment (PPhP had better VAS of pain and WOMAC scores but no statistical significance. Results show that UltraTENS and PhP were effective for relieving pain and improve functionality knee OA without significant differences between their effects.

  12. Setting a standard for electricity pilot studies

    International Nuclear Information System (INIS)

    Davis, Alexander L.; Krishnamurti, Tamar; Fischhoff, Baruch; Bruine de Bruin, Wandi

    2013-01-01

    In-home displays, dynamic pricing, and automated devices aim to reduce residential electricity use—overall and during peak hours. We present a meta-analysis of 32 studies of the impacts of these interventions, conducted in the US or Canada. We find that methodological problems are common in the design of these studies, leading to artificially inflated results relative to what one would expect if the interventions were implemented in the general population. Particular problems include having volunteer participants who may have been especially motivated to reduce their electricity use, letting participants choose their preferred intervention, and having high attrition rates. Using estimates of bias from medical clinical trials as a guide, we recalculate impact estimates to adjust for bias, resulting in values that are often less than half of those reported in the reviewed studies. We estimate that in-home displays were the most effective intervention for reducing overall electricity use (∼4% using reported data; ∼3% after adjusting for bias), while dynamic pricing significantly reduced peak demand (∼11% reported; ∼6% adjusted), especially when used in conjunction with home automation (∼25% reported; ∼14% adjusted). We conclude with recommendations that can improve pilot studies and the soundness of decisions based on their results. -- Highlights: •We conduct a meta-analysis of field studies of in-home displays, dynamic pricing, and automation on overall and peak use. •Studies were assessed and adjusted for risk-of-bias from inadequate experimental design. •Most studies were at high risk-of-bias from multiple sources. •In-home displays provided the best overall reduction in energy use, approximately 3% after adjustment for risk-of-bias. •Even after adjustment, automation approximately doubled the effectiveness of dynamic pricing on peak reduction from 6% to 14%

  13. Electrical control of superparamagnetism

    Science.gov (United States)

    Yamada, Kihiro T.; Koyama, Tomohiro; Kakizakai, Haruka; Miwa, Kazumoto; Ando, Fuyuki; Ishibashi, Mio; Kim, Kab-Jin; Moriyama, Takahiro; Ono, Shimpei; Chiba, Daichi; Ono, Teruo

    2017-01-01

    The electric field control of superparamagnetism is realized using a Cu/Ni system, in which the deposited Ni shows superparamagnetic behavior above the blocking temperature. An electric double-layer capacitor (EDLC) with the Cu/Ni electrode and a nonmagnetic counter electrode is fabricated to examine the electric field effect on magnetism in the magnetic electrode. By changing the voltage applied to the EDLC, the blocking temperature of the system is clearly modulated.

  14. Norwegian hydropower a valuable peak power source

    Energy Technology Data Exchange (ETDEWEB)

    Brekke, Hermod

    2010-07-01

    Full text: The paper gives a historical technical review of the development and installation of approximately 20 000 MW of hydraulic turbines in Norway after World War II. The non polluting production of electricity was consumed for lightening and heating for civil consume and the growing electric furnace industry in Norway in addition to export in rainy years. The paper is mainly based on the authors experience in the design of large turbines, and control systems for operation of Francis Turbines and Reversible Pump Turbines for high and medium heads and Pelton turbines for high heads. During the last 15 years the development of small hydro power plants has also given an increasing contribution to the power production. A brief discussion will be given on the choice of equipment for small hydro production with a very small winter production and overload during the summer. The possibility of operation of a small hydropower plants connected to an isolated grid will also briefly be presented. In addition to the general design of turbines and control systems for large hydro plants, a detailed description will be given of the stability analysis for the governing system which was developed for the large high head plants with long high pressure tunnels systems. A discussion will be included on the introduction of the air cushioned surge chambers for fast stable operation of power plants with long tunnels, connected to isolated grids. Also the principle of stabilizing unstable turbine governing system by means of pressure feed back systems, will be presented and discussed. A description of such system developed in 1992, will be given proving that stability could be obtained in a system with long conduits connected to the turbines. However, the 'governing speed' needed for isolated operation could not be fulfilled without a fast by pass pressure relieve system for Francis turbines, which was not installed in the case for the analysis. Finally a discussion will be

  15. Managing peak loads in energy grids: Comparative economic analysis

    International Nuclear Information System (INIS)

    Zhuk, A.; Zeigarnik, Yu.; Buzoverov, E.; Sheindlin, A.

    2016-01-01

    One of the key issues in modern energy technology is managing the imbalance between the generated power and the load, particularly during times of peak demand. The increasing use of renewable energy sources makes this problem even more acute. Various existing technologies, including stationary battery energy storage systems (BESS), can be employed to provide additional power during peak demand times. In the future, integration of on-board batteries of the growing fleet of electric vehicles (EV) and plug-in hybrid electric vehicles (PHEV) into the grid can provide power during peak demand hours (vehicle-to-grid, or V2G technology). This work provides cost estimates of managing peak energy demands using traditional technologies, such as maneuverable power plants, conventional hydroelectric, pumped storage plants and peaker generators, as well as BESS and V2G technologies. The derived estimates provide both per kWh and kW year of energy supplied to the grid. The analysis demonstrates that the use of battery storage is economically justified for short peak demand periods of <1 h. For longer durations, the most suitable technology remains the use of maneuverable steam gas power plants, gas turbine,reciprocating gas engine peaker generators, conventional hydroelectric, pumped storage plants. - Highlights: • Cost of managing peak energy demand employing different technologies are estimated. • Traditional technologies, stationary battery storage and V2G are compared. • Battery storage is economically justified for peak demand periods of <1 h. • V2G appears to have better efficiency than stationary battery storage in low voltage power grids.

  16. Establishment of peak bone mass.

    Science.gov (United States)

    Mora, Stefano; Gilsanz, Vicente

    2003-03-01

    Among the main areas of progress in osteoporosis research during the last decade or so are the general recognition that this condition, which is the cause of so much pain in the elderly population, has its antecedents in childhood and the identification of the structural basis accounting for much of the differences in bone strength among humans. Nevertheless, current understanding of the bone mineral accrual process is far from complete. The search for genes that regulate bone mass acquisition is ongoing, and current results are not sufficient to identify subjects at risk. However, there is solid evidence that BMD measurements can be helpful for the selection of subjects that presumably would benefit from preventive interventions. The questions regarding the type of preventive interventions, their magnitude, and duration remain unanswered. Carefully designed controlled trials are needed. Nevertheless, previous experience indicates that weight-bearing activity and possibly calcium supplements are beneficial if they are begun during childhood and preferably before the onset of puberty. Modification of unhealthy lifestyles and increments in exercise or calcium assumption are logical interventions that should be implemented to improve bone mass gains in all children and adolescents who are at risk of failing to achieve an optimal peak bone mass.

  17. Neurofeedback training for peak performance

    Directory of Open Access Journals (Sweden)

    Marek Graczyk

    2014-11-01

    Full Text Available [b]aim[/b]. One of the applications of the Neurofeedback methodology is peak performance in sport. The protocols of the neurofeedback are usually based on an assessment of the spectral parameters of spontaneous EEG in resting state conditions. The aim of the paper was to study whether the intensive neurofeedback training of a well-functioning Olympic athlete who has lost his performance confidence after injury in sport, could change the brain functioning reflected in changes in spontaneous EEG and event related potentials (ERPs. [b]case study[/b]. The case is presented of an Olympic athlete who has lost his performance confidence after injury in sport. He wanted to resume his activities by means of neurofeedback training. His QEEG/ERP parameters were assessed before and after 4 intensive sessions of neurotherapy. Dramatic and statistically significant changes that could not be explained by error measurement were observed in the patient. [b]conclusion[/b]. Neurofeedback training in the subject under study increased the amplitude of the monitoring component of ERPs generated in the anterior cingulate cortex, accompanied by an increase in beta activity over the medial prefrontal cortex. Taking these changes together, it can be concluded that that even a few sessions of neurofeedback in a high performance brain can significantly activate the prefrontal cortical areas associated with increasing confidence in sport performance.

  18. Reactor power peaking information display

    International Nuclear Information System (INIS)

    Book, T.L.; Kochendarfer, R.A.

    1986-01-01

    This patent describes a system for monitoring operating conditions within a nuclear reactor. The system consists of a method for measuring the operating parameters within the nuclear reactor, including the position of axial power shaping rods and regulating control rod. It also includes a method for determining from the operating parameters the operating limits before a power peaking condition exists within the nuclear reactor, and a method for displaying the operating limits which consists of a visual display permitting the continuous monitoring of the operating conditions within the nuclear reactor as a graph of the shaping rod position vs the regulating rod position having a permissible area and a restricted area. The permissible area is further divided into a recommended operating area for steady state operation and a cursor located on the graph to indicate the present operating condition of the nuclear reactor to allow an operator to view any need for corrective action based on the movement of the cursor out of the recommended operating area and to take any corrective transient action within the permissible area

  19. Neurofeedback training for peak performance.

    Science.gov (United States)

    Graczyk, Marek; Pąchalska, Maria; Ziółkowski, Artur; Mańko, Grzegorz; Łukaszewska, Beata; Kochanowicz, Kazimierz; Mirski, Andrzej; Kropotov, Iurii D

    2014-01-01

    One of the applications of the Neurofeedback methodology is peak performance in sport. The protocols of the neurofeedback are usually based on an assessment of the spectral parameters of spontaneous EEG in resting state conditions. The aim of the paper was to study whether the intensive neurofeedback training of a well-functioning Olympic athlete who has lost his performance confidence after injury in sport, could change the brain functioning reflected in changes in spontaneous EEG and event related potentials (ERPs). The case is presented of an Olympic athlete who has lost his performance confidence after injury in sport. He wanted to resume his activities by means of neurofeedback training. His QEEG/ERP parameters were assessed before and after 4 intensive sessions of neurotherapy. Dramatic and statistically significant changes that could not be explained by error measurement were observed in the patient. Neurofeedback training in the subject under study increased the amplitude of the monitoring component of ERPs generated in the anterior cingulate cortex, accompanied by an increase in beta activity over the medial prefrontal cortex. Taking these changes together, it can be concluded that that even a few sessions of neurofeedback in a high performance brain can significantly activate the prefrontal cortical areas associated with increasing confidence in sport performance.

  20. Double your money

    International Nuclear Information System (INIS)

    Moxon, Suzanne

    1998-01-01

    The government-owned Hydro-Quebec was instructed to take certain actions, one of which was to increase profits. The company has published a report describing its plans for 1998-2002. The company expects to increase sales and double its income over the five years. Hydro-Quebec (which produces or purchases 97% of the electricity consumed in the province) will freeze prices until April 2002. Environmental considerations and liaison with local communities are included in the 5-year plan. The company expects to invest c$1.2B in international markets over the five years and C$20M per year are earmarked for research. (UK)