WorldWideScience

Sample records for double helix dna

  1. Fluctuations in the DNA double helix

    Science.gov (United States)

    Peyrard, M.; López, S. C.; Angelov, D.

    2007-08-01

    DNA is not the static entity suggested by the famous double helix structure. It shows large fluctuational openings, in which the bases, which contain the genetic code, are temporarily open. Therefore it is an interesting system to study the effect of nonlinearity on the physical properties of a system. A simple model for DNA, at a mesoscopic scale, can be investigated by computer simulation, in the same spirit as the original work of Fermi, Pasta and Ulam. These calculations raise fundamental questions in statistical physics because they show a temporary breaking of equipartition of energy, regions with large amplitude fluctuations being able to coexist with regions where the fluctuations are very small, even when the model is studied in the canonical ensemble. This phenomenon can be related to nonlinear excitations in the model. The ability of the model to describe the actual properties of DNA is discussed by comparing theoretical and experimental results for the probability that base pairs open an a given temperature in specific DNA sequences. These studies give us indications on the proper description of the effect of the sequence in the mesoscopic model.

  2. DNA-like double helix formed by peptide nucleic acid

    DEFF Research Database (Denmark)

    Wittung, P; Nielsen, Peter E.; Buchardt, O

    1994-01-01

    Although the importance of the nucleobases in the DNA double helix is well understood, the evolutionary significance of the deoxyribose phosphate backbone and the contribution of this chemical entity to the overall helical structure and stability of the double helix is not so clear. Peptide nucleic...

  3. Extreme bendability of DNA double helix due to bending asymmetry

    NARCIS (Netherlands)

    Salari, H.; Eslami-Mossallam, B.; Nederi, S.; Ejtehadi, M.R.

    2015-01-01

    Experimental data of the DNA cyclization (J-factor) at short length scales exceed the theoretical expectation based on the wormlike chain (WLC) model by several orders of magnitude. Here, we propose that asymmetric bending rigidity of the double helix in the groove direction can be responsible for

  4. The Modular Construction of DNA Double Helix

    Indian Academy of Sciences (India)

    discovery, DNA structure has been able to disseminate knowl- edge of key ... band a. This procedure would place segment a, overlapping with d. Glue securely a ... Because of alignment problems, unless great care is taken, the modules do ...

  5. Discrete instability in the DNA double helix

    International Nuclear Information System (INIS)

    Tabi, Conrad Bertrand; Mohamadou, Alidou; Kofane, Timoleon Crepin

    2009-06-01

    Modulational instability (MI) is explored in the framework of the base-rotor model of DNA dynamics. We show in fact that, the helicoidal coupling introduced in the spin model of DNA reduces the system to a modified discrete sine-Gordon (sG) equation. The MI criterion is thus modified and displays interesting features because of the helicoidal coupling. This is confirmed in the numerical analysis where a critical value of the helicoidal coupling constant is derived. In the simulations, we have found that a train of pulses are generated when the lattice is subjected to MI, in agreement with analytical results obtained in a modified discrete sG equation. Also, the competitive effects of the harmonic longitudinal and helicoidal constants on the dynamics of the system are notably pointed out. In the same way, it is shown that MI can lead to energy localization which is high for some values of the helicoidal coupling constant. (author)

  6. Effect of temperature on DNA double helix: An insight from ...

    Indian Academy of Sciences (India)

    2012-06-25

    Jun 25, 2012 ... We have carried out detailed MD simulations of DNA double ..... Wireframe representation of B-DNA crystal structures with PDB identifier (a) 1EHV, ..... nucleic acid structures, PhD thesis, University of Calcutta, Kolkata.

  7. Effect of temperature on DNA double helix: An insight from ...

    Indian Academy of Sciences (India)

    The three-dimensional structure of DNA contains various sequence-dependent structural information, which control many cellular processes in life, such as replication, transcription, DNA repair, etc. For the above functions, DNA double helices need to unwind or melt locally, which is different from terminal melting, as often ...

  8. Studies of interaction between two alkaloids and double helix DNA

    International Nuclear Information System (INIS)

    Sun, Yantao; Peng, Tingting; Zhao, Lei; Jiang, Dayu; Cui, Yuncheng

    2014-01-01

    This article presents the study on the interaction of two alkaloids (matrine and evodiamine) and hs-DNA by absorption, fluorescence, circular dichroism (CD), DNA melting and viscosity experiments. The spectroscopic studies suggested that two alkaloids can bind to DNA through an intercalative mode. The viscosity measurement and thermal denaturation also indicated that two alkaloids can intercalate to DNA. The binding constants (K A ) and the number of binding sites (n) were determined. At the same time, some significant thermodynamic parameters of the binding of the alkaloids to DNA were obtained. Competitive binding studies revealed that alkaloids had an effect on ethidium bromide (EB) bound DNA. In addition, it was also proved that the fluorescence quenching was influenced by ionic strength. - Highlights: • Interaction between two alkaloids and DNA is studied by spectral methods. • The binding constant and the binding sites between two alkaloids and DNA are obtained. • There are a classical intercalative mode between alkaloids and DNA. • The binding of matrine with DNA is weaker than that of evodiamine. • It is important for us to understand the alkaloids–DNA interactions at a molecular level

  9. 49. Brazilian congress on genetics. DNA double helix. Abstracts

    International Nuclear Information System (INIS)

    2003-01-01

    Use of radioisotopes and ionizing radiations in genetics is presented. Several aspects related to men, animals, plants and microorganisms are reported highlighting biological radiation effects, evolution, mutagenesis and genetic engineering. Genetic mapping, gene mutations, genetic diversity, DNA hybridization, DNA sequencing, plant cultivation and plant grow are studied as well

  10. Wave Propagation of Coupled Modes in the DNA Double Helix

    International Nuclear Information System (INIS)

    Tabi, Conrad B.; Mohamadou, Alidou; Kofane, Timoleon C.

    2010-06-01

    The dynamics of waves propagating along the DNA molecule is described by the coupled nonlinear Schroedinger equations. We consider both the single and the coupled nonlinear excitation modes, and we discuss their biological implications. Furthermore, the characteristics of the coupled mode solution are discussed and we show that such a solution can describe the local opening observed within the transcription and the replication phenomena. (author)

  11. Human telomeric DNA: G-quadruplex, i-motif and Watson–Crick double helix

    Science.gov (United States)

    Phan, Anh Tuân; Mergny, Jean-Louis

    2002-01-01

    Human telomeric DNA composed of (TTAGGG/CCCTAA)n repeats may form a classical Watson–Crick double helix. Each individual strand is also prone to quadruplex formation: the G-rich strand may adopt a G-quadruplex conformation involving G-quartets whereas the C-rich strand may fold into an i-motif based on intercalated C·C+ base pairs. Using an equimolar mixture of the telomeric oligonucleotides d[AGGG(TTAGGG)3] and d[(CCCTAA)3CCCT], we defined which structures existed and which would be the predominant species under a variety of experimental conditions. Under near-physiological conditions of pH, temperature and salt concentration, telomeric DNA was predominantly in a double-helix form. However, at lower pH values or higher temperatures, the G-quadruplex and/or the i-motif efficiently competed with the duplex. We also present kinetic and thermodynamic data for duplex association and for G-quadruplex/i-motif unfolding. PMID:12409451

  12. Double-helix stellarator

    International Nuclear Information System (INIS)

    Moroz, P.E.

    1997-09-01

    A new stellarator configuration, the Double-Helix Stellarator (DHS), is introduced. This novel configuration features a double-helix center post as the only helical element of the stellarator coil system. The DHS configuration has many unique characteristics. One of them is the extreme low plasma aspect ratio, A ∼ 1--1.2. Other advantages include a high enclosed volume, appreciable rotational transform, and a possibility of extreme-high-β MHD equilibria. Moreover, the DHS features improved transport characteristics caused by the absence of the magnetic field ripple on the outboard of the torus. Compactness, simplicity and modularity of the coil system add to the DHS advantages for fusion applications

  13. DNA with Parallel Strand Orientation: A Nanometer Distance Study with Spin Labels in the Watson-Crick and the Reverse Watson-Crick Double Helix.

    Science.gov (United States)

    Wunnicke, Dorith; Ding, Ping; Yang, Haozhe; Seela, Frank; Steinhoff, Heinz-Jürgen

    2015-10-29

    Parallel-stranded (ps) DNA characterized by its sugar-phosphate backbones pointing in the same direction represents an alternative pairing system to antiparallel-stranded (aps) DNA with the potential to inhibit transcription and translation. 25-mer oligonucleotides were selected containing only dA·dT base pairs to compare spin-labeled nucleobase distances over a range of 10 or 15 base pairs in ps DNA with those in aps DNA. By means of the copper(I)-catalyzed Huisgen-Meldal-Sharpless alkyne-azide cycloaddition, the spin label 4-azido-2,2,6,6-tetramethylpiperidine-1-oxyl was clicked to 7-ethynyl-7-deaza-2'-deoxyadenosine or 5-ethynyl-2'-deoxyuridine to yield 25-mer oligonucleotides incorporating two spin labels. The interspin distances between spin labeled residues were determined by pulse EPR spectroscopy. The results reveal that in ps DNA these distances are between 5 and 10% longer than in aps DNA when the labeled DNA segment is located near the center of the double helix. The interspin distance in ps DNA becomes shorter compared with aps DNA when one of the spin labels occupies a position near the end of the double helix.

  14. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone

    DEFF Research Database (Denmark)

    Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.

    2013-01-01

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....

  15. The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.

    Science.gov (United States)

    Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul

    2013-06-17

    Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. [Lethal effect after transmutation of 33P incorporated into bacteriophage S 13 and mechanisms of DNA double helix rupture].

    Science.gov (United States)

    Apelgot, S

    1980-04-01

    The experiments show the lethal effect of the beta decay of 33P incorporated in DNA of bacteriophage S 13. The lethal efficiency is high, 0.72 at 0 degrees C and 0.55 at--197 degrees C. The presence of a radical scavenger like AET has no influence. It was found previously that for such phages with single-stranded DNA, the lethal efficiency of 32P decay is unity, and that the lethal event is a DNA single-strand break, owing to the high energy of the nucleogenic 32S atom. As the recoil energy of the 33S atom is too low to account for such a break, it is suggested that the reorganization of the phosphate molecule into sulphate is able to bring about a DNA single-strand break with an efficiency as high as 0.7, at 0 degrees C. A model for the DNA double-strand-break produced by a transmutation processes is suggested.

  17. The Discovery of the Double Helix

    CERN Multimedia

    CERN. Geneva

    2011-01-01

    Professor James D. Watson has kindly agreed to make a presentation on the 1953 finding of the Double Helix at the Cavendish Laboratory by Francis Crick and himself. Being one of the greatest scientific discoveries in human history, little else needs to be added.

  18. Noncanonical structures and their thermodynamics of DNA and RNA under molecular crowding: beyond the Watson-Crick double helix.

    Science.gov (United States)

    Sugimoto, Naoki

    2014-01-01

    How does molecular crowding affect the stability of nucleic acid structures inside cells? Water is the major solvent component in living cells, and the properties of water in the highly crowded media inside cells differ from that in buffered solution. As it is difficult to measure the thermodynamic behavior of nucleic acids in cells directly and quantitatively, we recently developed a cell-mimicking system using cosolutes as crowding reagents. The influences of molecular crowding on the structures and thermodynamics of various nucleic acid sequences have been reported. In this chapter, we discuss how the structures and thermodynamic properties of nucleic acids differ under various conditions such as highly crowded environments, compartment environments, and in the presence of ionic liquids, and the major determinants of the crowding effects on nucleic acids are discussed. The effects of molecular crowding on the activities of ribozymes and riboswitches on noncanonical structures of DNA- and RNA-like quadruplexes that play important roles in transcription and translation are also described. © 2014 Elsevier Inc. All rights reserved.

  19. Pyrrolo-dC Metal-Mediated Base Pairs in the Reverse Watson-Crick Double Helix: Enhanced Stability of Parallel DNA and Impact of 6-Pyridinyl Residues on Fluorescence and Silver-Ion Binding.

    Science.gov (United States)

    Yang, Haozhe; Mei, Hui; Seela, Frank

    2015-07-06

    Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Portrait of a discovery. Watson, Crick, and the double helix.

    Science.gov (United States)

    de Chadarevian, Soraya

    2003-03-01

    This essay examines an iconic image of twentieth-century science: Antony Barrington Brown's photograph of James Watson, Francis Crick, and the double-helical model of DNA. The detailed reconstruction of the production, reception, and uses of the photograph reveals the central role of the image in making the discovery it portrays. Taken in May 1953, two full months after the scientists built the model, to accompany a report on the structure in Time magazine, the photograph (like the report) was never published. It came into circulation only fifteen years later, as an illustration in Watson's best-selling book The Double Helix. While the image served as a historical document and advertisement for the book, only the book provided the description that made the image as well as the people and the model it represented famous. The history of the image provides insights into the retrospective construction of the discovery, which has since been celebrated as the origin of a new science of life.

  1. Chiral transformation: From single nanowire to double helix

    KAUST Repository

    Wang, Yong

    2011-12-21

    We report a new type of water-soluble ultrathin Au-Ag alloy nanowire (NW), which exhibits unprecedented behavior in a colloidal solution. Upon growth of a thin metal (Pd, Pt, or Au) layer, the NW winds around itself to give a metallic double helix. We propose that the winding originates from the chirality within the as-synthesized Au-Ag NWs, which were induced to untwist upon metal deposition. © 2011 American Chemical Society.

  2. The use of approaches the history of science in the teaching of Biology: A proposal to work the participation of scientist Rosalind Franklin in building the model of the DNA double helix

    Directory of Open Access Journals (Sweden)

    Etiane Ortiz

    2016-04-01

    Full Text Available In this article we present the results of an investigation conducted with academics from a course of Biological Sciences of North University of Paraná. We sought to investigate the virtues and difficulties encountered in the process of contextualization the episode of "discovery" of the DNA double helix. Therefore, an educational proposal was developed with the goal of working context of that episode emphasizing controversies in the history regarding the participation of scientist Rosalind Franklin in the construction of DNA model, based on a traditional approach and alternative in History of Science. Data were collected through questionnaires and records were analyzed according to the procedures of content analysis. The use of an approach based on the History of Science has proven effective in contextualizing the historical episode presented in this study, since, from the analysis of the data, it was observed that the students were able to understand the controversial episode at the end of didactic intervention and knew in general, how to differentiate the two types of approaches in the history of science that were used to treat the historical episode. However, this research also showed that the use of this approach is no easy task, since some difficulties were encountered during the investigation.

  3. Design and synthesis of DNA four-helix bundles

    Energy Technology Data Exchange (ETDEWEB)

    Rangnekar, Abhijit; Gothelf, Kurt V [Department of Chemistry, Centre for DNA Nanotechnology (CDNA) and Interdisciplinary Nanoscience Center (iNANO), Aarhus University, DK-8000 Aarhus C (Denmark); LaBean, Thomas H, E-mail: kvg@chem.au.dk, E-mail: thl@cs.duke.edu [Department of Chemistry, Duke University, Durham, NC 27708 (United States)

    2011-06-10

    The field of DNA nanotechnology has evolved significantly in the past decade. Researchers have succeeded in synthesizing tile-based structures and using them to form periodic lattices in one, two and three dimensions. Origami-based structures have also been used to create nanoscale structures in two and three dimensions. Design and construction of DNA bundles with fixed circumference has added a new dimension to the field. Here we report the design and synthesis of a DNA four-helix bundle. It was found to be extremely rigid and stable. When several such bundles were assembled using appropriate sticky-ends, they formed micrometre-long filaments. However, when creation of two-dimensional sheet-like arrays of the four-helix bundles was attempted, nanoscale rings were observed instead. The exact reason behind the nanoring formation is yet to be ascertained, but it provides an exciting prospect for making programmable circular nanostructures using DNA.

  4. Design and synthesis of DNA four-helix bundles

    International Nuclear Information System (INIS)

    Rangnekar, Abhijit; Gothelf, Kurt V; LaBean, Thomas H

    2011-01-01

    The field of DNA nanotechnology has evolved significantly in the past decade. Researchers have succeeded in synthesizing tile-based structures and using them to form periodic lattices in one, two and three dimensions. Origami-based structures have also been used to create nanoscale structures in two and three dimensions. Design and construction of DNA bundles with fixed circumference has added a new dimension to the field. Here we report the design and synthesis of a DNA four-helix bundle. It was found to be extremely rigid and stable. When several such bundles were assembled using appropriate sticky-ends, they formed micrometre-long filaments. However, when creation of two-dimensional sheet-like arrays of the four-helix bundles was attempted, nanoscale rings were observed instead. The exact reason behind the nanoring formation is yet to be ascertained, but it provides an exciting prospect for making programmable circular nanostructures using DNA.

  5. DNA binding specificity of the basic-helix-loop-helix protein MASH-1.

    Science.gov (United States)

    Meierhan, D; el-Ariss, C; Neuenschwander, M; Sieber, M; Stackhouse, J F; Allemann, R K

    1995-09-05

    Despite the high degree of sequence similarity in their basic-helix-loop-helix (BHLH) domains, MASH-1 and MyoD are involved in different biological processes. In order to define possible differences between the DNA binding specificities of these two proteins, we investigated the DNA binding properties of MASH-1 by circular dichroism spectroscopy and by electrophoretic mobility shift assays (EMSA). Upon binding to DNA, the BHLH domain of MASH-1 underwent a conformational change from a mainly unfolded to a largely alpha-helical form, and surprisingly, this change was independent of the specific DNA sequence. The same conformational transition could be induced by the addition of 20% 2,2,2-trifluoroethanol. The apparent dissociation constants (KD) of the complexes of full-length MASH-1 with various oligonucleotides were determined from half-saturation points in EMSAs. MASH-1 bound as a dimer to DNA sequences containing an E-box with high affinity KD = 1.4-4.1 x 10(-14) M2). However, the specificity of DNA binding was low. The dissociation constant for the complex between MASH-1 and the highest affinity E-box sequence (KD = 1.4 x 10(-14) M2) was only a factor of 10 smaller than for completely unrelated DNA sequences (KD = approximately 1 x 10(-13) M2). The DNA binding specificity of MASH-1 was not significantly increased by the formation of an heterodimer with the ubiquitous E12 protein. MASH-1 and MyoD displayed similar binding site preferences, suggesting that their different target gene specificities cannot be explained solely by differential DNA binding. An explanation for these findings is provided on the basis of the known crystal structure of the BHLH domain of MyoD.

  6. Double helix vortex breakdown in a turbulent swirling annular jet flow

    NARCIS (Netherlands)

    Vanierschot, M.; Perçin, M.; van Oudheusden, B.W.

    2018-01-01

    In this paper, we report on the structure and dynamics of double helix vortex breakdown in a turbulent annular swirling jet. Double helix breakdown has been reported previously for the laminar flow regime, but this structure has rarely been observed in turbulent flow. The flow field is

  7. Double helix vortex breakdown in a turbulent swirling annular jet flow

    Science.gov (United States)

    Vanierschot, M.; Percin, M.; van Oudheusden, B. W.

    2018-03-01

    In this paper, we report on the structure and dynamics of double helix vortex breakdown in a turbulent annular swirling jet. Double helix breakdown has been reported previously for the laminar flow regime, but this structure has rarely been observed in turbulent flow. The flow field is investigated experimentally by means of time-resolved tomographic particle image velocimetry. Notwithstanding the axisymmetric nature of the time-averaged flow, analysis of the instantaneous three-dimensional (3D) vortical structures shows the existence of a vortex core along the central axis which breaks up into a double helix downstream. The winding sense of this double helix is opposite to the swirl direction (m =-2 ) and it is wrapped around a central vortex breakdown bubble. This structure is quite different from double helix breakdown found in laminar flows where the helix is formed in the wake of the bubble and not upstream. The double helix precesses around the central axis of the jet with a precessing frequency corresponding to a Strouhal number of 0.27.

  8. After the double helix: Rosalind Franklin's research on Tobacco mosaic virus.

    Science.gov (United States)

    Creager, Angela N H; Morgan, Gregory J

    2008-06-01

    Rosalind Franklin is best known for her informative X-ray diffraction patterns of DNA that provided vital clues for James Watson and Francis Crick's double-stranded helical model. Her scientific career did not end when she left the DNA work at King's College, however. In 1953 Franklin moved to J. D. Bernal's crystallography laboratory at Birkbeck College, where she shifted her focus to the three-dimensional structure of viruses, obtaining diffraction patterns of Tobacco mosaic virus (TMV) of unprecedented detail and clarity. During the next five years, while making significant headway on the structural determination of TMV, Franklin maintained an active correspondence with both Watson and Crick, who were also studying aspects of virus structure. Developments in TMV research during the 1950s illustrate the connections in the emerging field of molecular biology between structural studies of nucleic acids and of proteins and viruses. They also reveal how the protagonists of the "race for the double helix" continued to interact personally and professionally during the years when Watson and Crick's model for the double-helical structure of DNA was debated and confirmed.

  9. Structural factors involved in the recognition of helix distortions in uv-damaged DNA by model peptides

    Energy Technology Data Exchange (ETDEWEB)

    Lang, H; Zimmer, C [Akademie der Wissenschaften der DDR, Jena. Forschungszentrum fuer Molekularbiologie und Medizin

    1977-02-28

    On the basis of our previous and present results concerning conformational changes of DNA after uv-irradiation some conclusions on the structure of DNA double helix in uv-damaged regions were drawn. From the results it appears that local distortions like denaturation or premelting should be excluded. Furthermore it was shown that the thymine dimerization strongly depends on the adjacent nucleic acid bases. By means of a strong binding effect of the oligopeptide netropsin to DNA irradiated at low uv-doses it is concluded that such local distortions in DNA together with a specific sequence-dependent variation of the conformation could act as recognition sites for endonucleases.

  10. The double helix revisited: a paradox of science and a paradigm of human behaviour

    Directory of Open Access Journals (Sweden)

    Argüelles, Juan Carlos

    2007-06-01

    Full Text Available In the modern history of Science, few breakthroughs have caused an impact comparative to the Double Helix, the three-dimensional structure of DNA proposed by Watson & Crick in 1953, an event whose 50th anniversary was widely celebrated in the non-specialist media, three years ago. Although the discovery had little transcendence at the time, it has unquestionably been of great importance ever since. The Double Helix has underlined the true biological value of nucleic acids compared with proteins, demonstrating that genes are not amorphous entities but have a specific chemical composition and adopt an ordered spatial folding pattern. Elucidation of this key configuration made it possible to establish a direct relationship between the structure and the function of macromolecules, a relationship which is not so clear in the case of proteins. During these last fifty years much has been written and argued about the circumstances surrounding the discovery and about the behaviour and attitudes of many of the protagonists. Besides Watson & Crick, other scientists, whose contribution has not been adequately recognised, played an important part in solving the Double Helix mystery. This article contains some ethical and scientific reflections which revise some of these essential contributions and throws light on the role played in history by these comparatively «unknown soldiers» of science. The Double Helix story is undoubtedly a manifestation of the human side of science and many scientists believe that the available evidence taken as a whole permits an alternative story to be written.

    En la desarrollo histórico de la Ciencia moderna, pocos descubrimientos han causado un impacto comparativo a las repercusiones de la Doble Hélice, la estructura tridimensional del ADN, propuesta por Watson y Crick en 1953. El 50º aniversario de aquel evento fue ampliamente celebrado hace tres años, incluso por los medios no especializados en informaci

  11. Equilibrium shift in solution: molecular shape recognition and precipitation of a synthetic double helix using helicene-grafted silica nanoparticles.

    Science.gov (United States)

    Miyagawa, Masamichi; Ichinose, Wataru; Yamaguchi, Masahiko

    2014-01-27

    Chiral silica nanoparticles (70 nm) grafted with (P)-helicene recognized the molecular shape of double helix and random coil (P)-ethynylhelicene oligomers in solution. A mixture of the (P)-nanoparticles and double helix precipitated much faster than a mixture of the (P)-nanoparticles and random coil, and the precipitate contained only the double helix. The mixture of the (P)-nanoparticles and (P)-ethynylhelicene pentamer reversibly dispersed in trifluoromethylbenzene upon heating at 70 °C and precipitated upon cooling at 25 °C. When a 10:90 equilibrium mixture of the double helix and random coil in solution was treated with the (P)-nanoparticles, the double helix was precipitated in 53% yield and was accompanied by equilibrium shift. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Helix-coil transition of a four-way DNA junction observed by multiple fluorescence parameters.

    Science.gov (United States)

    Vámosi, György; Clegg, Robert M

    2008-10-16

    The thermal denaturation of immobile four-way DNA ("Holliday-") junctions with 17 base pair arms was studied via fluorescence spectroscopic measurements. Two arms of the molecule were labeled at the 5'-end with fluorescein and tetramethylrhodamine, respectively. Melting was monitored by the fluorescence intensity of the dyes, the fluorescence anisotropy of tetramethylrhodamine, and Forster resonance energy transfer (FRET) between fluorescein and rhodamine. To fit the thermal denaturation curves of the four-way junctions, two basic thermodynamic models were tested: (1) all-or-none transitions assuming a molecularity of one, two, or four and (2) a statistical "zipper" model. The all-or-none models correspond to reaction mechanisms assuming that the cooperative melting unit (that is, the structure changing from complete helix to complete coil) consists of (1) one arm, (2) two neighboring arms (which have one continuous strand common to the two arms), or (3) all four arms. In each case, the melting of the cooperative unit takes place in a single step. The tetramolecular reaction model (four-arm melting) yielded unrealistically low van't Hoff enthalpy and entropy values, whereas the monomolecular model (one-arm melting) resulted in a poor fit to the experimental data. The all-or-none bimolecular (two neighboring arm model) fit gave intermediate standard enthalpy change (Delta H) values between those expected for the melting of a duplex with a total length between the helix lengths of one and two arms (17 and 34 base pairs). Simulations according to the zipper model fit the experimental curves best when the length of the simulated duplex was assumed to be 34 base pairs, the length of a single strand. This suggests that the most important parameter determining the melting behavior of the molecule is the end-to-end distance of the strands (34 bases) rather than the length of the individual arms (17 base pairs) and that the equilibrium concentration of partially denatured

  13. DNA binding and unwinding by Hel308 helicase requires dual functions of a winged helix domain.

    Science.gov (United States)

    Northall, Sarah J; Buckley, Ryan; Jones, Nathan; Penedo, J Carlos; Soultanas, Panos; Bolt, Edward L

    2017-09-01

    Hel308 helicases promote genome stability linked to DNA replication in archaea, and have homologues in metazoans. In the crystal structure of archaeal Hel308 bound to a tailed DNA duplex, core helicase domains encircle single-stranded DNA (ssDNA) in a "ratchet" for directional translocation. A winged helix domain (WHD) is also present, but its function is mysterious. We investigated the WHD in full-length Hel308, identifying that mutations in a solvent exposed α-helix resulted in reduced DNA binding and unwinding activities. When isolated from the rest of Hel308, the WHD protein alone bound to duplex DNA but not ssDNA, and DNA binding by WHD protein was abolished by the same mutations as were analyzed in full-length Hel308. Isolated WHD from a human Hel308 homologue (HelQ) also bound to duplex DNA. By disrupting the interface between the Hel308 WHD and a RecA-like domain, a topology typical of Ski2 helicases, we show that this is crucial for ATPase and helicase activities. The data suggest a model in which the WHD promotes activity of Hel308 directly, through binding to duplex DNA that is distinct from ssDNA binding by core helicase, and indirectly through interaction with the RecA-like domain. We propose how the WHD may contribute to ssDNA translocation, resulting in DNA helicase activity or in removal of other DNA bound proteins by "reeling" ssDNA. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Electrochemical DNA probe for Hg(2+) detection based on a triple-helix DNA and Multistage Signal Amplification Strategy.

    Science.gov (United States)

    Wang, Huan; Zhang, Yihe; Ma, Hongmin; Ren, Xiang; Wang, Yaoguang; Zhang, Yong; Wei, Qin

    2016-12-15

    In this work, an ultrasensitive electrochemical sensor was developed for detection of Hg(2+). Gold nanoparticles decorated bovine serum albumin reduction of graphene oxide (AuNP-BSA-rGO) were used as subsurface material for the immobilization of triple-helix DNA. The triple-helix DNA containing a thiol labelled single-stranded DNA (sDNA) and a thymine-rich DNA (T-rich DNA), which could be unwinded in the present of Hg(2+) to form more stable thymine-Hg(2+)-thymine (T-Hg(2+)-T) complex. T-Hg(2+)-T complex was then removed and the sDNA was left on the electrode. At this time, gold nanoparticle carrying thiol labelled cytosine-rich complementary DNA (cDNA-AuNP) could bind with the free sDNA. Meanwhile, the other free cDNA on AuNP could bind with each other in the present of Ag(+) to form the stable cytosine-Ag(+)-cytosine (C-Ag(+)-C) complex and circle amplification. Plenty of C-Ag(+)-C could form silver nanoclusters by electrochemical reduction and the striping signal of Ag could be measured for purpose of the final electrochemical detection of Hg(2+). This sensor could detect Hg(2+) over a wide concentration range from 0.1 to 130nM with a detection limit of 0.03nM. Copyright © 2016 Elsevier B.V. All rights reserved.

  15. A magnetic torsional wave near the Galactic Centre traced by a 'double helix' nebula.

    Science.gov (United States)

    Morris, Mark; Uchida, Keven; Do, Tuan

    2006-03-16

    The magnetic field in the central few hundred parsecs of the Milky Way has a dipolar geometry and is substantially stronger than elsewhere in the Galaxy, with estimates ranging up to a milligauss (refs 1-6). Characterization of the magnetic field at the Galactic Centre is important because it can affect the orbits of molecular clouds by exerting a drag on them, inhibit star formation, and could guide a wind of hot gas or cosmic rays away from the central region. Here we report observations of an infrared nebula having the morphology of an intertwined double helix about 100 parsecs from the Galaxy's dynamical centre, with its axis oriented perpendicular to the Galactic plane. The observed segment is about 25 parsecs in length, and contains about 1.25 full turns of each of the two continuous, helically wound strands. We interpret this feature as a torsional Alfvén wave propagating vertically away from the Galactic disk, driven by rotation of the magnetized circumnuclear gas disk. The direct connection between the circumnuclear disk and the double helix is ambiguous, but the images show a possible meandering channel that warrants further investigation.

  16. A cosmic double helix in the archetypical quasar 3C273.

    Science.gov (United States)

    Lobanov, A P; Zensus, J A

    2001-10-05

    Finding direct evidence for plasma instability in extragalactic jets is crucial for understanding the nature of relativistic outflows from active galactic nuclei. Our radio interferometric observations of the quasar 3C273 made with the orbiting radio telescope, HALCA, and an array of ground telescopes have yielded an image in which the emission across the jet is resolved, revealing two threadlike patterns that form a double helix inside the jet. This double helical structure is consistent with a Kelvin-Helmholtz instability, and at least five different instability modes can be identified and modeled by a light jet with a Lorentz factor of 2 and Mach number of 3.5. The model reproduces in detail the internal structure of the jet on scales of up to 30 milli-arc seconds ( approximately 300 parsecs) and is consistent with the general morphology of the jet on scales of up to 1 kiloparsec.

  17. BuD, a helix–loop–helix DNA-binding domain for genome modification

    Energy Technology Data Exchange (ETDEWEB)

    Stella, Stefano [Spanish National Cancer Research Centre (CNIO), Calle de Melchor Fernández Almagro 3, 28029 Madrid (Spain); University of Copenhagen, Blegdamsvej 3B, 2200 Copenhagen (Denmark); Molina, Rafael; López-Méndez, Blanca [Spanish National Cancer Research Centre (CNIO), Calle de Melchor Fernández Almagro 3, 28029 Madrid (Spain); Juillerat, Alexandre; Bertonati, Claudia; Daboussi, Fayza [Cellectis, 8 Rue de la Croix Jarry, 75013 Paris (France); Campos-Olivas, Ramon [Spanish National Cancer Research Centre (CNIO), Calle de Melchor Fernández Almagro 3, 28029 Madrid (Spain); Duchateau, Phillippe [Cellectis, 8 Rue de la Croix Jarry, 75013 Paris (France); Montoya, Guillermo, E-mail: guillermo.montoya@cpr.ku.dk [Spanish National Cancer Research Centre (CNIO), Calle de Melchor Fernández Almagro 3, 28029 Madrid (Spain); University of Copenhagen, Blegdamsvej 3B, 2200 Copenhagen (Denmark)

    2014-07-01

    Crystal structures of BurrH and the BurrH–DNA complex are reported. DNA editing offers new possibilities in synthetic biology and biomedicine for modulation or modification of cellular functions to organisms. However, inaccuracy in this process may lead to genome damage. To address this important problem, a strategy allowing specific gene modification has been achieved through the addition, removal or exchange of DNA sequences using customized proteins and the endogenous DNA-repair machinery. Therefore, the engineering of specific protein–DNA interactions in protein scaffolds is key to providing ‘toolkits’ for precise genome modification or regulation of gene expression. In a search for putative DNA-binding domains, BurrH, a protein that recognizes a 19 bp DNA target, was identified. Here, its apo and DNA-bound crystal structures are reported, revealing a central region containing 19 repeats of a helix–loop–helix modular domain (BurrH domain; BuD), which identifies the DNA target by a single residue-to-nucleotide code, thus facilitating its redesign for gene targeting. New DNA-binding specificities have been engineered in this template, showing that BuD-derived nucleases (BuDNs) induce high levels of gene targeting in a locus of the human haemoglobin β (HBB) gene close to mutations responsible for sickle-cell anaemia. Hence, the unique combination of high efficiency and specificity of the BuD arrays can push forward diverse genome-modification approaches for cell or organism redesign, opening new avenues for gene editing.

  18. Triple-helix molecular switch-based aptasensors and DNA sensors.

    Science.gov (United States)

    Bagheri, Elnaz; Abnous, Khalil; Alibolandi, Mona; Ramezani, Mohammad; Taghdisi, Seyed Mohammad

    2018-07-15

    Utilization of traditional analytical techniques is limited because they are generally time-consuming and require high consumption of reagents, complicated sample preparation and expensive equipment. Therefore, it is of great interest to achieve sensitive, rapid and simple detection methods. It is believed that nucleic acids assays, especially aptamers, are very important in modern life sciences for target detection and biological analysis. Aptamers and DNA-based sensors have been widely used for the design of various sensors owing to their unique features. In recent years, triple-helix molecular switch (THMS)-based aptasensors and DNA sensors have been broadly utilized for the detection and analysis of different targets. The THMS relies on the formation of DNA triplex via Watson-Crick and Hoogsteen base pairings under optimal conditions. This review focuses on recent progresses in the development and applications of electrochemical, colorimetric, fluorescence and SERS aptasensors and DNA sensors, which are based on THMS. Also, the advantages and drawbacks of these methods are discussed. Copyright © 2018 Elsevier B.V. All rights reserved.

  19. NMR studies of abasic sites in DNA duplexes: Deoxyadenosine stacks into the helix opposite acyclic lesions

    International Nuclear Information System (INIS)

    Kalnik, M.W.; Chang, Chienneng; Johnson, F.; Grollman, A.P.; Patel, D.J.

    1989-01-01

    Proton and phosphorus NMR studies are reported for two complementary nonanucleotide duplexes containing acyclic abasic sites. The first duplex, d(C-A-T-G-A-G-T-A-C)·d(G-T-A-C-P-C-A-T-G), contains an acyclic propanyl moiety, P, located opposite a deoxyadenosine at the center of the helix (designated AP P 9-mer duplex). The second duplex, d(C-A-T-G-A-G-T-A-C-)·d(G-T-A-C-E-C-A-T-G), contains a similarly located acyclic ethanyl moiety, E (designated AP E 9-mer duplex). The ethanyl moiety is one carbon shorter than the natural carbon-phosphodiester backbone of a single nucleotide unit of DNA. The majority of the exchangeable and nonexchangeable base and sugar protons in both the AP P 9-mer and AP E 9-mer duplexes, including those at the abasic site, have been assigned by recording and analyzing two-dimensional phase-sensitive NOESY data sets in H 2 O and D 2 O solution between -5 and 5 degree C. These spectroscopic observations establish that A5 inserts into the helix opposite the abasic site (P14 and El14) and stacks between the flanking G4·C15 and G6·C13 Watson-Crick base pairs in both the AP P 9-mer and AP E 9-mer duplexes. Proton NMR parameters for the Ap P 9-mer and AP E 9-mer duplexes are similar to those reported previously. These proton NMR experiments demonstrate that the structures at abasic sites are very similar whether the five-membered ring is open or closed or whether the phosphodiester backbone is shortened by one carbon atom. Phosphorus spectra of the AP P 9-mer and AP E 9-mer duplexes (5 degree C) indicate that the backbone conformation is similarly perturbed at three phosphodiester backbone torsion angles

  20. Expression of the helix-loop-helix protein inhibitor of DNA binding-1 (ID-1) is activated by all-trans retinoic acid in normal human keratinocytes

    International Nuclear Information System (INIS)

    Villano, C.M.; White, L.A.

    2006-01-01

    The ID (inhibitor of differentiation or DNA binding) helix-loop-helix proteins are important mediators of cellular differentiation and proliferation in a variety of cell types through regulation of gene expression. Overexpression of the ID proteins in normal human keratinocytes results in extension of culture lifespan, indicating that these proteins are important for epidermal differentiation. Our hypothesis is that the ID proteins are targets of the retinoic acid signaling pathway in keratinocytes. Retinoids, vitamin A analogues, are powerful regulators of cell growth and differentiation and are widely used in the prevention and treatment of a variety of cancers in humans. Furthermore, retinoic acid is necessary for the maintenance of epithelial differentiation and demonstrates an inhibitory action on skin carcinogenesis. We examined the effect of all-trans retinoic acid on expression of ID-1, -2, -3, and -4 in normal human keratinocytes and found that exposure of these cells to all-trans retinoic acid causes an increase in both ID-1 and ID-3 gene expression. Furthermore, our data show that this increase is mediated by increased transcription involving several cis-acting elements in the distal portion of the promoter, including a CREB-binding site, an Egr1 element, and an YY1 site. These data demonstrate that the ID proteins are direct targets of the retinoic acid signaling pathway. Given the importance of the ID proteins to epidermal differentiation, these results suggest that IDs may be mediating some of the effects of all-trans retinoic acid in normal human keratinocytes

  1. A double-helix and cross-patterned solenoid used as a wirelessly powered receiver for medical implants

    Science.gov (United States)

    Mao, Shitong; Wang, Hao; Mao, Zhi-Hong; Sun, Mingui

    2018-05-01

    Many medical implants need to be designed in the shape of a cylinder (rod), a cuboid or a capsule in order to adapt to a specific site within the human body or facilitate the implantation procedure. In order to wirelessly power these types of implants, a pair of coils, one is located inside the human body and one is outside, is often used. Since most organs such as major muscles, blood vessels, and nerve bundles are anatomically parallel to the body surface, the most desired wireless power transfer (WPT) direction is from the external power transmission pad (a planar coil) to the lateral surface of the implant. However, to obtain optimal coupling, the currently used solenoid coil requires being positioned perpendicular to the body surface, which is often medically or anatomically unacceptable. In this research, a concentric double-helix (DH) coil with an air core is presented for use in implantable devices. Two helical coils are tilted at opposite angles (±45 degrees) to form a cross pattern. The WPT system is designed using the magnetic resonance concept for wireless power transfer (MR-WPT). The power transfer efficiency (PTE) relies on the near-field magnetic coupling which is closely related to the location and orientation of the DH coil. We explain how the novel structure of the DH solenoid magnifies the mutual inductance with the widely adopted circular planner coil and how the PTE is improved in comparison to the case of the conventional solenoid coil. We also study an important case where the double-helix power reception coil is laterally and angularly misaligned with the transmitter. Finally, our computational study using the finite element method and experimental study with actually constructed prototypes are presented which have proven our new double-helix coil design.

  2. A double-helix and cross-patterned solenoid used as a wirelessly powered receiver for medical implants

    Directory of Open Access Journals (Sweden)

    Shitong Mao

    2018-05-01

    Full Text Available Many medical implants need to be designed in the shape of a cylinder (rod, a cuboid or a capsule in order to adapt to a specific site within the human body or facilitate the implantation procedure. In order to wirelessly power these types of implants, a pair of coils, one is located inside the human body and one is outside, is often used. Since most organs such as major muscles, blood vessels, and nerve bundles are anatomically parallel to the body surface, the most desired wireless power transfer (WPT direction is from the external power transmission pad (a planar coil to the lateral surface of the implant. However, to obtain optimal coupling, the currently used solenoid coil requires being positioned perpendicular to the body surface, which is often medically or anatomically unacceptable. In this research, a concentric double-helix (DH coil with an air core is presented for use in implantable devices. Two helical coils are tilted at opposite angles (±45 degrees to form a cross pattern. The WPT system is designed using the magnetic resonance concept for wireless power transfer (MR-WPT. The power transfer efficiency (PTE relies on the near-field magnetic coupling which is closely related to the location and orientation of the DH coil. We explain how the novel structure of the DH solenoid magnifies the mutual inductance with the widely adopted circular planner coil and how the PTE is improved in comparison to the case of the conventional solenoid coil. We also study an important case where the double-helix power reception coil is laterally and angularly misaligned with the transmitter. Finally, our computational study using the finite element method and experimental study with actually constructed prototypes are presented which have proven our new double-helix coil design.

  3. Correlation of bistranded clustered abasic DNA lesion processing with structural and dynamic DNA helix distortion

    Science.gov (United States)

    Bignon, Emmanuelle; Gattuso, Hugo; Morell, Christophe; Dehez, François; Georgakilas, Alexandros G.; Monari, Antonio; Dumont, Elise

    2016-01-01

    Clustered apurinic/apyrimidinic (AP; abasic) DNA lesions produced by ionizing radiation are by far more cytotoxic than isolated AP lesion entities. The structure and dynamics of a series of seven 23-bp oligonucleotides featuring simple bistranded clustered damage sites, comprising of two AP sites, zero, one, three or five bases 3′ or 5′ apart from each other, were investigated through 400 ns explicit solvent molecular dynamics simulations. They provide representative structures of synthetically engineered multiply damage sites-containing oligonucleotides whose repair was investigated experimentally (Nucl. Acids Res. 2004, 32:5609-5620; Nucl. Acids Res. 2002, 30: 2800–2808). The inspection of extrahelical positioning of the AP sites, bulge and non Watson–Crick hydrogen bonding corroborates the experimental measurements of repair efficiencies by bacterial or human AP endonucleases Nfo and APE1, respectively. This study provides unprecedented knowledge into the structure and dynamics of clustered abasic DNA lesions, notably rationalizing the non-symmetry with respect to 3′ to 5′ position. In addition, it provides strong mechanistic insights and basis for future studies on the effects of clustered DNA damage on the recognition and processing of these lesions by bacterial or human DNA repair enzymes specialized in the processing of such lesions. PMID:27587587

  4. Crystallization and preliminary electron diffraction study to 3. 7 A of DNA helix-destabilizing protein gp32*I

    Energy Technology Data Exchange (ETDEWEB)

    Chiu, W; Hosoda, J

    1978-01-01

    A two-dimensionally large and thin crystal has been obtained from gp32*I, a proteolytically digested product of a DNA helix-destabilizing protein coded by gene 32 in bacteriophage T4. High-resolution electron diffraction patterns (approx. 3.7 A) are recorded from both unstained and stained protein crystals embedded in glucose. The crystal is of orthorhombic space group with a = 62.9 A and b = 47.3 A.

  5. Space confinement and rotation stress induced self-organization of double-helix nanostructure: a nanotube twist with a moving catalyst head.

    Science.gov (United States)

    Zhao, Meng-Qiang; Zhang, Qiang; Tian, Gui-Li; Huang, Jia-Qi; Wei, Fei

    2012-05-22

    Inorganic materials with double-helix structure have attracted intensive attention due to not only their elegant morphology but also their amazing morphology-related potential applications. The investigation on the formation mechanism of the inorganic double-helix nanostructure is the first step for the fundamental studies of their materials or physical properties. Herein, we demonstrated the space confinement and rotation stress induced self-organization mechanism of the carbon nanotube (CNT)-array double helices under scanning electron microscopy by directly observing their formation process from individual layered double hydroxide flakes, which is a kind of hydrotalcite-like material composed of positively charged layers and charge-balancing interlayer anions. Space confinement is considered to be the most important extrinsic factor for the formation of CNT-array double helices. Synchronous growth of the CNT arrays oppositely from LDH flakes with space confinement on both sides at the same time is essential for the growth of CNT-array double helices. Coiling of the as-grown CNT arrays into double helices will proceed by self-organization, tending to the most stable morphology in order to release their internal rotation stress. Based on the demonstrated mechanism, effective routes were carried out to improve the selectivity for CNT-array double helices. The work provides a promising method for the fabrication of double-helix nanostructures with their two helices connected at the end by self-assembly.

  6. A new assay format for NF-kappaB based on a DNA triple helix and a fluorescence resonance energy transfer.

    Science.gov (United States)

    Altevogt, Dominik; Hrenn, Andrea; Kern, Claudia; Clima, Lilia; Bannwarth, Willi; Merfort, Irmgard

    2009-10-07

    Herein we report a feasibility study for a new concept to detect DNA binding protein NF-kappaB based on a DNA triple helix formation in combination with a fluorescence resonance energy transfer (FRET). The new principle avoids expensive antibodies and radioactivity and might have implications for assays of other DNA binding proteins.

  7. Fragmentation in DNA double-strand breaks

    International Nuclear Information System (INIS)

    Wei Zhiyong; Suzhou Univ., Suzhou; Zhang Lihui; Li Ming; Fan Wo; Xu Yujie

    2005-01-01

    DNA double strand breaks are important lesions induced by irradiations. Random breakage model or quantification supported by this concept is suitable to analyze DNA double strand break data induced by low LET radiation, but deviation from random breakage model is more evident in high LET radiation data analysis. In this work we develop a new method, statistical fragmentation model, to analyze the fragmentation process of DNA double strand breaks. After charged particles enter the biological cell, they produce ionizations along their tracks, and transfer their energies to the cells and break the cellular DNA strands into fragments. The probable distribution of the fragments is obtained under the condition in which the entropy is maximum. Under the approximation E≅E 0 + E 1 l + E 2 l 2 , the distribution functions are obtained as exp(αl + βl 2 ). There are two components, the one proportional to exp(βl 2 ), mainly contributes to the low mass fragment yields, the other component, proportional to exp(αl), decreases slowly as the mass of the fragments increases. Numerical solution of the constraint equations provides parameters α and β. Experimental data, especially when the energy deposition is higher, support the statistical fragmentation model. (authors)

  8. The basic helix-loop-helix region of the transcriptional repressor hairy and enhancer of split 1 is preorganized to bind DNA

    NARCIS (Netherlands)

    Popovic, Matija; Wienk, Hans; Coglievina, Maristella; Boelens, Rolf; Pongor, Sándor; Pintar, Alessandro

    2014-01-01

    Hairy and enhancer of split 1, one of the main downstream effectors in Notch signaling, is a transcriptional repressor of the basic helix-loop-helix (bHLH) family. Using nuclear magnetic resonance methods, we have determined the structure and dynamics of a recombinant protein, H1H, which includes an

  9. A "bulged" double helix in a RNA-protein contact site

    DEFF Research Database (Denmark)

    Peattie, D A; Douthwaite, S; Garrett, R A

    1981-01-01

    as a singly bulged nucleotide extending the Fox and Woese central helix by two base pairs in the E. coli sequence (to positions 16-23/60-68) as well as in each of 61 (prokaryotic and eukaryotic) aligned 5S RNA sequences. In each case, the single bulged nucleotide is at the relative position of adenosine-66...... in the RNA sequences. The presence of this putative bulged nucleotide appears to have been conserved in 5S RNA sequences throughout evolution, and its identity varies with major phylogenetic divisions. This residue is likely involved in specific 5S RNA-protein recognition or interaction in prokaryotic...... and eukaryotic ribosomes. The uridine-65 to adenosine-66 internucleotide bond is protected from RNase A digestion in the complex, and carbethoxylation of E. coli adenosine-66 prior to L18 binding affects formation of a stable RNA-protein complex. Thus, we identify a region of E. coli 5S RNA protected...

  10. The basic tilted helix bundle domain of the prolyl isomerase FKBP25 is a novel double-stranded RNA binding module

    Science.gov (United States)

    Dilworth, David; Bonnafous, Pierre; Edoo, Amiirah Bibi; Bourbigot, Sarah; Pesek-Jardim, Francy; Gudavicius, Geoff; Serpa, Jason J.; Petrotchenko, Evgeniy V.; Borchers, Christoph H.

    2017-01-01

    Abstract Prolyl isomerases are defined by a catalytic domain that facilitates the cis–trans interconversion of proline residues. In most cases, additional domains in these enzymes add important biological function, including recruitment to a set of protein substrates. Here, we report that the N-terminal basic tilted helix bundle (BTHB) domain of the human prolyl isomerase FKBP25 confers specific binding to double-stranded RNA (dsRNA). This binding is selective over DNA as well as single-stranded oligonucleotides. We find that FKBP25 RNA-association is required for its nucleolar localization and for the vast majority of its protein interactions, including those with 60S pre-ribosome and early ribosome biogenesis factors. An independent mobility of the BTHB and FKBP catalytic domains supports a model by which the N-terminus of FKBP25 is anchored to regions of dsRNA, whereas the FKBP domain is free to interact with neighboring proteins. Apart from the identification of the BTHB as a new dsRNA-binding module, this domain adds to the growing list of auxiliary functions used by prolyl isomerases to define their primary cellular targets. PMID:29036638

  11. Lawyers' delights and geneticists' nightmares: at forty, the double helix shows some wrinkles.

    Science.gov (United States)

    Sgaramella, V

    1993-12-15

    The National Institutes of Health (NIH) request to patent the base sequences of incomplete and uncharacterized fragments of DNA copied on messenger RNAs (cDNAs) extracted from human tissues, the refusal by the patent office, and the appeal placed by NIH, have incited a violent controversy, fueled by rational, as well as emotional elements. In a compromising mode between liberalism and protectionism, I propose that legal protection be considered only for those RNA/DNA sequences, either natural or artificial, which can generate practical applications per se, and not through their expression products. Another controversy is developing around a popular tool for genomic research: the fidelity of yeast artificial chromosome (YAC) libraries being distributed worldwide for physical mapping is being questioned. Some of these libraries have been shown to be affected by surprisingly high levels of co-cloning, in addition to more common gene reshuffling instances. Also in this case, scientific as well as non-scientific components have to be considered. Possible remedies for the underlying problems may be found in the proper use of kinetic, enzymatic and microbiological variables in the production of YACs. Here too, a sharper distinction between the secular and scientific gratifications of research could help.

  12. Building of RNA and DNA double helices into electron density

    Czech Academy of Sciences Publication Activity Database

    Pavelčík, F.; Schneider, Bohdan

    2008-01-01

    Roč. 64, č. 6 (2008), s. 620-626 ISSN 0907-4449 R&D Projects: GA MŠk LC512 Grant - others:VEGA(SK) 1/2333/05; NSF(US) DBI0110076 Institutional research plan: CEZ:AV0Z40550506 Keywords : RNA * double helix * x-ray crystallography Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.943, year: 2008

  13. Polarizability of Six-Helix Bundle and Triangle DNA Origami and Their Escape Characteristics from a Dielectrophoretic Trap.

    Science.gov (United States)

    Gan, Lin; Camacho-Alanis, Fernanda; Ros, Alexandra

    2015-12-15

    DNA nanoassemblies, such as DNA origamis, hold promise in biosensing, drug delivery, nanoelectronic circuits, and biological computing, which require suitable methods for migration and precision positioning. Insulator-based dielectrophoresis (iDEP) has been demonstrated as a powerful migration and trapping tool for μm- and nm-sized colloids as well as DNA origamis. However, little is known about the polarizability of origami species, which is responsible for their dielectrophoretic migration. Here, we report the experimentally determined polarizabilities of the six-helix bundle origami (6HxB) and triangle origami by measuring the migration times through a potential landscape exhibiting dielectrophoretic barriers. The resulting migration times correlate to the depth of the dielectrophoretic potential barrier and the escape characteristics of the origami according to an adapted Kramer's rate model, allowing their polarizabilities to be determined. We found that the 6HxB polarizability is larger than that of the triangle origami, which correlates with the variations in charge density of both origamis. Further, we discuss the orientation of both origami species in the dielectrophoretic trap and discuss the influence of diffusion during the escape process. Our study provides detailed insight into the factors contributing to the migration through dielectrophoretic potential landscapes, which can be exploited for applications with DNA and other nanoassemblies based on dielectrophoresis.

  14. DNA double-strand breaks & poptosis in the testis

    NARCIS (Netherlands)

    Hamer, Geert

    2003-01-01

    During spermatogenesis, DNA damage is a naturally occurring event. At a certain stage, during the first meiotic prophase, DNA breaks are endogenously induced and even required for meiotic recombination. We studied these DNA breaks but also used ionizing radiation (IR) to induce DNA double-strand

  15. The role of the C-domain of bacteriophage T4 gene 32 protein in ssDNA binding and dsDNA helix-destabilization: Kinetic, single-molecule, and cross-linking studies

    Science.gov (United States)

    Pant, Kiran; Anderson, Brian; Perdana, Hendrik; Malinowski, Matthew A.; Win, Aye T.; Williams, Mark C.

    2018-01-01

    The model single-stranded DNA binding protein of bacteriophage T4, gene 32 protein (gp32) has well-established roles in DNA replication, recombination, and repair. gp32 is a single-chain polypeptide consisting of three domains. Based on thermodynamics and kinetics measurements, we have proposed that gp32 can undergo a conformational change where the acidic C-terminal domain binds internally to or near the single-stranded (ss) DNA binding surface in the core (central) domain, blocking ssDNA interaction. To test this model, we have employed a variety of experimental approaches and gp32 variants to characterize this conformational change. Utilizing stopped-flow methods, the association kinetics of wild type and truncated forms of gp32 with ssDNA were measured. When the C-domain is present, the log-log plot of k vs. [NaCl] shows a positive slope, whereas when it is absent (*I protein), there is little rate change with salt concentration, as expected for this model.A gp32 variant lacking residues 292–296 within the C-domain, ΔPR201, displays kinetic properties intermediate between gp32 and *I. The single molecule force-induced DNA helix-destabilizing activitiesas well as the single- and double-stranded DNA affinities of ΔPR201 and gp32 truncated at residue 295 also fall between full-length protein and *I. Finally, chemical cross-linking of recombinant C-domain and gp32 lacking both N- and C-terminal domains is inhibited by increasing concentrations of a short single-stranded oligonucleotide, and the salt dependence of cross-linking mirrors that expected for the model. Taken together, these results provide the first evidence in support of this model that have been obtained through structural probes. PMID:29634784

  16. How quantum entanglement in DNA synchronizes double-strand breakage by type II restriction endonucleases.

    Science.gov (United States)

    Kurian, P; Dunston, G; Lindesay, J

    2016-02-21

    Macroscopic quantum effects in living systems have been studied widely in pursuit of fundamental explanations for biological energy transport and sensing. While it is known that type II endonucleases, the largest class of restriction enzymes, induce DNA double-strand breaks by attacking phosphodiester bonds, the mechanism by which simultaneous cutting is coordinated between the catalytic centers remains unclear. We propose a quantum mechanical model for collective electronic behavior in the DNA helix, where dipole-dipole oscillations are quantized through boundary conditions imposed by the enzyme. Zero-point modes of coherent oscillations would provide the energy required for double-strand breakage. Such quanta may be preserved in the presence of thermal noise by the enzyme's displacement of water surrounding the DNA recognition sequence. The enzyme thus serves as a decoherence shield. Palindromic mirror symmetry of the enzyme-DNA complex should conserve parity, because symmetric bond-breaking ceases when the symmetry of the complex is violated or when physiological parameters are perturbed from optima. Persistent correlations in DNA across longer spatial separations-a possible signature of quantum entanglement-may be explained by such a mechanism. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. Host–Guest Chirality Interplay: A Mutually Induced Formation of a Chiral ZMOF and Its Double-Helix Polymer Guests

    KAUST Repository

    Luo, Xiaolong

    2016-01-12

    A novel homochiral zeolite-like metal-organic framework (ZMOF), [(Cu4I4) (dabco)2]·[Cu2(bbimb)]·3DMF (JLU-Liu23, dabco =1,4-diazabicyclo[2.2.2]-octane, H2bbimb =1,3-bis(2-benzimidazol)benzene, DMF = N,N-dimethylformamide), has been successfully constructed to host unprecedented DNA-like [Cu2(bbimb)]n polymers with double-helicity. The host-guest chirality interplay permitted the induced formation of an unusual gyroid MOF with homochirality and helical channels in the framework for the first time, JLU-Liu23. Importantly, the enantiomeric pairs (23P, 23M) can be promoted and isolated in the presence of appropriate chiral inducing agents, affording enantioselective separation of chiral molecules as well as small gas molecules. © 2016 American Chemical Society.

  18. Induction of protective immune responses in mice by double DNA ...

    African Journals Online (AJOL)

    Purpose: To investigate the efficacy of a double DNA vaccine encoding of Brucella melitensis omp31 gene and of Escherichia coli eae gene in inducing protective immune response in a mouse model. Methods: After performing PCR assays and cloning both the eae and omp31 genes, the generated DNA vaccines were ...

  19. Reaction Path Averaging: Characterizing the Structural Response of the DNA Double Helix to Electron Transfer

    Czech Academy of Sciences Publication Activity Database

    Kolář, Michal H.; Kubař, T.

    2017-01-01

    Roč. 121, č. 7 (2017), s. 1520-1532 ISSN 1520-6106 Institutional support: RVO:61388963 Keywords : excited-state dynamics * excitation energy transfer * solvation dynamics Subject RIV: CF - Physical ; Theoretical Chemistry OBOR OECD: Physical chemistry Impact factor: 3.177, year: 2016

  20. Flexible DNA Path in the MCM Double Hexamer Loaded on DNA.

    Science.gov (United States)

    Hizume, Kohji; Kominami, Hiroaki; Kobayashi, Kei; Yamada, Hirofumi; Araki, Hiroyuki

    2017-05-16

    The formation of the pre-replicative complex (pre-RC) during the G1 phase, which is also called the licensing of DNA replication, is the initial and essential step of faithful DNA replication during the subsequent S phase. It is widely accepted that in the pre-RC, double-stranded DNA passes through the holes of two ring-shaped minichromosome maintenance (MCM) 2-7 hexamers; however, the spatial organization of the DNA and proteins involved in pre-RC formation is unclear. Here we reconstituted the pre-RC from purified DNA and proteins and visualized the complex using atomic force microscopy (AFM). AFM revealed that the MCM double hexamers formed elliptical particles on DNA. Analysis of the angle of binding of DNA to the MCM double hexamer suggests that the DNA does not completely pass through both holes of the MCM hexamers, possibly because the DNA exited from the gap between Mcm2 and Mcm5. A DNA loop fastened by the MCM double hexamer was detected in pre-RC samples reconstituted from purified proteins as well as those purified from yeast cells, suggesting a higher-order architecture of the loaded MCM hexamers and DNA strands.

  1. Nucleic Acid Analogue Induced Transcription of Double Stranded DNA

    DEFF Research Database (Denmark)

    1998-01-01

    RNA is transcribed from a double stranded DNA template by forming a complex by hybridizing to the template at a desired transcription initiation site one or more oligonucleic acid analogues of the PNA type capable of forming a transcription initiation site with the DNA and exposing the complex...... to the action of a DNA dependant RNA polymerase in the presence of nucleoside triphosphates. Equal length transcripts may be obtained by placing a block to transcription downstream from the initiation site or by cutting the template at such a selected location. The initiation site is formed by displacement...... of one strand of the DNA locally by the PNA hybridization....

  2. Francis Crick, DNA, and the Central Dogma

    Science.gov (United States)

    Olby, Robert

    1970-01-01

    This essay describes how Francis Crick, ex-physicist, entered the field of biology and discovered the structure of DNA. Emphasis is upon the double helix, the sequence hypothesis, the central dogma, and the genetic code. (VW)

  3. Binding to the minor groove of the double-strand, tau protein prevents DNA from damage by peroxidation.

    Science.gov (United States)

    Wei, Yan; Qu, Mei-Hua; Wang, Xing-Sheng; Chen, Lan; Wang, Dong-Liang; Liu, Ying; Hua, Qian; He, Rong-Qiao

    2008-07-02

    Tau, an important microtubule associated protein, has been found to bind to DNA, and to be localized in the nuclei of both neurons and some non-neuronal cells. Here, using electrophoretic mobility shifting assay (EMSA) in the presence of DNA with different chain-lengths, we observed that tau protein favored binding to a 13 bp or a longer polynucleotide. The results from atomic force microscopy also showed that tau protein preferred a 13 bp polynucleotide to a 12 bp or shorter polynucleotide. In a competitive assay, a minor groove binder distamycin A was able to replace the bound tau from the DNA double helix, indicating that tau protein binds to the minor groove. Tau protein was able to protect the double-strand from digestion in the presence of DNase I that was bound to the minor groove. On the other hand, a major groove binder methyl green as a negative competitor exhibited little effect on the retardation of tau-DNA complex in EMSA. This further indicates the DNA minor groove as the binding site for tau protein. EMSA with truncated tau proteins showed that both the proline-rich domain (PRD) and the microtubule-binding domain (MTBD) contributed to the interaction with DNA; that is to say, both PRD and MTBD bound to the minor groove of DNA and bent the double-strand, as observed by electron microscopy. To investigate whether tau protein is able to prevent DNA from the impairment by hydroxyl free radical, the chemiluminescence emitted by the phen-Cu/H(2)O(2)/ascorbate was measured. The emission intensity of the luminescence was markedly decreased when tau protein was present, suggesting a significant protection of DNA from the damage in the presence of hydroxyl free radical.

  4. 75 FR 62820 - Screening Framework Guidance for Providers of Synthetic Double-Stranded DNA

    Science.gov (United States)

    2010-10-13

    ... Providers of Synthetic Double- Stranded DNA AGENCY: Department of Health and Human Services, Office of the.... Government has developed Guidance that provides a framework for screening synthetic double-stranded DNA (dsDNA). This document, the Screening Framework Guidance for Providers of Synthetic Double-Stranded DNA...

  5. Human Genome Research: Decoding DNA

    Science.gov (United States)

    dropdown arrow Site Map A-Z Index Menu Synopsis Human Genome Research: Decoding DNA Resources with of the DNA double helix during April 2003. James D. Watson, Francis Crick, and Maurice Wilkins were company Celera announced the completion of a "working draft" reference DNA sequence of the human

  6. Autophosphorylation of DNA-PKCS regulates its dynamics at DNA double-strand breaks.

    Science.gov (United States)

    Uematsu, Naoya; Weterings, Eric; Yano, Ken-ichi; Morotomi-Yano, Keiko; Jakob, Burkhard; Taucher-Scholz, Gisela; Mari, Pierre-Olivier; van Gent, Dik C; Chen, Benjamin P C; Chen, David J

    2007-04-23

    The DNA-dependent protein kinase catalytic subunit (DNA-PK(CS)) plays an important role during the repair of DNA double-strand breaks (DSBs). It is recruited to DNA ends in the early stages of the nonhomologous end-joining (NHEJ) process, which mediates DSB repair. To study DNA-PK(CS) recruitment in vivo, we used a laser system to introduce DSBs in a specified region of the cell nucleus. We show that DNA-PK(CS) accumulates at DSB sites in a Ku80-dependent manner, and that neither the kinase activity nor the phosphorylation status of DNA-PK(CS) influences its initial accumulation. However, impairment of both of these functions results in deficient DSB repair and the maintained presence of DNA-PK(CS) at unrepaired DSBs. The use of photobleaching techniques allowed us to determine that the kinase activity and phosphorylation status of DNA-PK(CS) influence the stability of its binding to DNA ends. We suggest a model in which DNA-PK(CS) phosphorylation/autophosphorylation facilitates NHEJ by destabilizing the interaction of DNA-PK(CS) with the DNA ends.

  7. Targeting abnormal DNA double strand break repair in cancer

    OpenAIRE

    Rassool, Feyruz V.; Tomkinson, Alan E.

    2010-01-01

    A major challenge in cancer treatment is the development of therapies that target cancer cells with little or no toxicity to normal tissues and cells. Alterations in DNA double strand break (DSB) repair in cancer cells include both elevated and reduced levels of key repair proteins and changes in the relative contributions of the various DSB repair pathways. These differences can result in increased sensitivity to DSB-inducing agents and increased genomic instability. The development of agent...

  8. NMR studies of abasic sites in DNA duplexes: deoxyadenosine stacks into the helix opposite the cyclic analog of 2-deoxyribose

    International Nuclear Information System (INIS)

    Kalnik, M.W.; Chang, C.N.; Grollman, A.P.; Patel, D.J.

    1988-01-01

    Proton and phosphorus NMR studies are reported for the complementary d(C-A-T-G-A-G-T-A-C) x d(G-T-A-C-F-C-A-T-G) nonanucleotide duplex (designated AP/sub F/ 9-mer duplex) which contains a stable abasic site analog, F, in the center of the helix. This oligodeoxynucleotide contains a modified tetrahydrofuran moiety, isosteric with 2-deoxyribofuranose, which serves as a structural analog of a natural apurinic/apyrimidinic site. Exchangeable and nonexchangeable base and sugar protons, including those located at the abasic site, have been assigned in the complementary AP/sub F/ 9-mer duplex by recording and analyzing two-dimensional phase-sensitive NOESY data sets in H 2 O and D 2 O solution at low temperature (0 0 C). These studies indicate that A5 inserts into the helix opposite the abasic site F14 and stacks with flanking G4 x C15 and G6 x C13 Watson-Crick base pairs. Base-sugar proton NOE connectivities were measured through G4-A5-G6 on the unmodified strand and between the base protons of C15 and the sugar protons of the 5'-flanking residue F14 on the modified strand. These studies establish that all glycosidic torsion angles are anti and that the helix is right-handed at and adjacent to the abasic site in the AP/sub F/ 9-mer duplex. Two of the 16 phosphodiester groups exhibit phosphorus resonances outside the normal spectral dispersion indicative of altered torsion angles at two of the phosphate groups in the backbone of the AP/sub F/ 9-mer duplex

  9. A 3D-DNA Molecule Made of PlayMais

    Science.gov (United States)

    Caine, Massimo; Horié, Ninon; Zuchuat, Sandrine; Weber, Aurélia; Ducret, Verena; Linder, Patrick; Perron, Karl

    2015-01-01

    More than 60 years have passed since the work of Rosalind Franklin, James Watson, and Francis Crick led to the discovery of the 3D-DNA double-helix structure. Nowadays, due to the simple and elegant architecture of its double helix, the structure of DNA is widely known. The biological role of the DNA molecule (e.g., genetic information), however,…

  10. DNA Polymerases λ and β: The Double-Edged Swords of DNA Repair

    Directory of Open Access Journals (Sweden)

    Elisa Mentegari

    2016-08-01

    Full Text Available DNA is constantly exposed to both endogenous and exogenous damages. More than 10,000 DNA modifications are induced every day in each cell’s genome. Maintenance of the integrity of the genome is accomplished by several DNA repair systems. The core enzymes for these pathways are the DNA polymerases. Out of 17 DNA polymerases present in a mammalian cell, at least 13 are specifically devoted to DNA repair and are often acting in different pathways. DNA polymerases β and λ are involved in base excision repair of modified DNA bases and translesion synthesis past DNA lesions. Polymerase λ also participates in non-homologous end joining of DNA double-strand breaks. However, recent data have revealed that, depending on their relative levels, the cell cycle phase, the ratio between deoxy- and ribo-nucleotide pools and the interaction with particular auxiliary proteins, the repair reactions carried out by these enzymes can be an important source of genetic instability, owing to repair mistakes. This review summarizes the most recent results on the ambivalent properties of these enzymes in limiting or promoting genetic instability in mammalian cells, as well as their potential use as targets for anticancer chemotherapy.

  11. DNA Polymerases λ and β: The Double-Edged Swords of DNA Repair.

    Science.gov (United States)

    Mentegari, Elisa; Kissova, Miroslava; Bavagnoli, Laura; Maga, Giovanni; Crespan, Emmanuele

    2016-08-31

    DNA is constantly exposed to both endogenous and exogenous damages. More than 10,000 DNA modifications are induced every day in each cell's genome. Maintenance of the integrity of the genome is accomplished by several DNA repair systems. The core enzymes for these pathways are the DNA polymerases. Out of 17 DNA polymerases present in a mammalian cell, at least 13 are specifically devoted to DNA repair and are often acting in different pathways. DNA polymerases β and λ are involved in base excision repair of modified DNA bases and translesion synthesis past DNA lesions. Polymerase λ also participates in non-homologous end joining of DNA double-strand breaks. However, recent data have revealed that, depending on their relative levels, the cell cycle phase, the ratio between deoxy- and ribo-nucleotide pools and the interaction with particular auxiliary proteins, the repair reactions carried out by these enzymes can be an important source of genetic instability, owing to repair mistakes. This review summarizes the most recent results on the ambivalent properties of these enzymes in limiting or promoting genetic instability in mammalian cells, as well as their potential use as targets for anticancer chemotherapy.

  12. Breathing, bubbling, and bending: DNA flexibility from multimicrosecond simulations

    Science.gov (United States)

    Zeida, Ari; Machado, Matías Rodrigo; Dans, Pablo Daniel; Pantano, Sergio

    2012-08-01

    Bending of the seemingly stiff DNA double helix is a fundamental physical process for any living organism. Specialized proteins recognize DNA inducing and stabilizing sharp curvatures of the double helix. However, experimental evidence suggests a high protein-independent flexibility of DNA. On the basis of coarse-grained simulations, we propose that DNA experiences thermally induced kinks associated with the spontaneous formation of internal bubbles. Comparison of the protein-induced DNA curvature calculated from the Protein Data Bank with that sampled by our simulations suggests that thermally induced distortions can account for ˜80% of the DNA curvature present in experimentally solved structures.

  13. Breathing, bubbling, and bending: DNA flexibility from multimicrosecond simulations.

    Science.gov (United States)

    Zeida, Ari; Machado, Matías Rodrigo; Dans, Pablo Daniel; Pantano, Sergio

    2012-08-01

    Bending of the seemingly stiff DNA double helix is a fundamental physical process for any living organism. Specialized proteins recognize DNA inducing and stabilizing sharp curvatures of the double helix. However, experimental evidence suggests a high protein-independent flexibility of DNA. On the basis of coarse-grained simulations, we propose that DNA experiences thermally induced kinks associated with the spontaneous formation of internal bubbles. Comparison of the protein-induced DNA curvature calculated from the Protein Data Bank with that sampled by our simulations suggests that thermally induced distortions can account for ~80% of the DNA curvature present in experimentally solved structures.

  14. Role of DNA-PK in cellular responses to DNA double-strand breaks

    International Nuclear Information System (INIS)

    Chen, D.J.

    2003-01-01

    DNA double-strand breaks (DSBs) are probably the most dangerous of the many different types of DNA damage that occur within the cell. DSBs are generated by exogenous agents such as ionizing radiation (IR) or by endogenously generated reactive oxygen species and occur as intermediates during meiotic and V(D)J recombination. The repair of DSBs is of paramount importance to the cell as misrepair of DSBs can lead to cell death or promote tumorigenesis. In eukaryotes there exists two distinct mechanisms for DNA DSB repair: homologous recombination (HR) and non-homologous end joining (NHEJ). In mammalian cells, however, it is clear that nonhomologous repair of DSBs is highly active and plays a major role in conferring radiation resistance to the cell. The NHEJ machinery minimally consists of the DNA-dependent Protein Kinase (DNA-PK) and a complex of XRCC4 and DNA Ligase IV. The DNA-PK complex is composed of a 470 kDa catalytic subunit (DNA-PKcs), and the heterodimeric Ku70 and Ku80 DNA end-binding complex. DNA-PKcs is a PI-3 kinase with homology to ATM and ATR in its C-terminal kinase domain. The DNA-PK complex protects and tethers the ends, and directs assembly and, perhaps, the activation of other NHEJ proteins. We have previously demonstrated that the kinase activity of DNA-PK is essential for DNA DSB repair and V(D)J recombination. It is, therefore, of immense interest to determine the in vivo targets of DNA-PKcs and the mechanisms by which phosphorylation of these targets modulates NHEJ. Recent studies have resulted in the identification of a number of protein targets that are phosphorylated by and/or interact with DNA-PKcs. Our laboratory has recently identified autophosphorylation site(s) on DNA-PKcs. We find that phosphorylation at these sites in vivo is an early and essential response to DSBs and demonstrate, for the first time, the localization of DNA-PKcs to the sites of DNA damage in vivo. Furthermore, mutation of these phosphorylation sites in mammalian

  15. Influence of mobile DNA-protein-DNA bridges on DNA configurations: Coarse-grained Monte-Carlo simulations

    NARCIS (Netherlands)

    Vries, de R.

    2011-01-01

    A large literature exists on modeling the influence of sequence-specific DNA-binding proteins on the shape of the DNA double helix in terms of one or a few fixed constraints. This approach is inadequate for the many proteins that bind DNA sequence independently, and that are present in very large

  16. Current topics in DNA double-strand break repair

    International Nuclear Information System (INIS)

    Kobayashi, Junya; Takata, Minoru; Iwabuchi, Kuniyoshi; Miyagawa, Kiyoshi; Sonoda, Eiichiro; Suzuki, Keiji; Tauchi, Hiroshi

    2008-01-01

    DNA double strand break (DSB) is one of the most critical types of damage which is induced by ionizing radiation. In this review, we summarize current progress in investigations on the function of DSB repair-related proteins. We focused on recent findings in the analysis of the function of proteins such as 53BP1, histone H2AX, Mus81-Eme1, Fanc complex, and UBC13, which are found to be related to homologous recombination repair or to non-homologous end joining. In addition to the function of these proteins in DSB repair, the biological function of nuclear foci formation following DSB induction is discussed. (author)

  17. Radiation induced DNA double-strand breaks in radiology; Strahleninduzierte DNA-Doppelstrangbrueche in der Radiologie

    Energy Technology Data Exchange (ETDEWEB)

    Kuefner, M.A. [Dornbirn Hospital (Austria). Dept. of Radiology; Brand, M.; Engert, C.; Uder, M. [Erlangen University Hospital (Germany). Dept. of Radiology; Schwab, S.A. [Radiologis, Oberasbach (Germany)

    2015-10-15

    Shortly after the discovery of X-rays, their damaging effect on biological tissues was observed. The determination of radiation exposure in diagnostic and interventional radiology is usually based on physical measurements or mathematical algorithms with standardized dose simulations. γ-H2AX immunofluorescence microscopy is a reliable and sensitive method for the quantification of radiation induced DNA double-strand breaks (DSB) in blood lymphocytes. The detectable amount of these DNA damages correlates well with the dose received. However, the biological radiation damage depends not only on dose but also on other individual factors like radiation sensitivity and DNA repair capacity. Iodinated contrast agents can enhance the x-ray induced DNA damage level. After their induction DSB are quickly repaired. A protective effect of antioxidants has been postulated in experimental studies. This review explains the principle of the γ-H2AX technique and provides an overview on studies evaluating DSB in radiologic examinations.

  18. The yeast Saccharomyces cerevisiae DNA polymerase IV: possible involvement in double strand break DNA repair.

    Science.gov (United States)

    Leem, S H; Ropp, P A; Sugino, A

    1994-08-11

    We identified and purified a new DNA polymerase (DNA polymerase IV), which is similar to mammalian DNA polymerase beta, from Saccharomyces cerevisiae and suggested that it is encoded by YCR14C (POLX) on chromosome III. Here, we provided a direct evidence that the purified DNA polymerase IV is indeed encoded by POLX. Strains harboring a pol4 deletion mutation exhibit neither mitotic growth defect nor a meiosis defect, suggesting that DNA polymerase IV participates in nonessential functions in DNA metabolism. The deletion strains did not exhibit UV-sensitivity. However, they did show weak sensitivity to MMS-treatment and exhibited a hyper-recombination phenotype when intragenic recombination was measured during meiosis. Furthermore, MAT alpha pol4 delta segregants had a higher frequency of illegitimate mating with a MAT alpha tester strain than that of wild-type cells. These results suggest that DNA polymerase IV participates in a double-strand break repair pathway. A 3.2kb of the POL4 transcript was weakly expressed in mitotically growing cells. During meiosis, a 2.2 kb POL4 transcript was greatly induced, while the 3.2 kb transcript stayed at constant levels. This induction was delayed in a swi4 delta strain during meiosis, while no effect was observed in a swi6 delta strain.

  19. Double-Strand DNA Break Repair in Mycobacteria.

    Science.gov (United States)

    Glickman, Michael S

    2014-10-01

    Discontinuity of both strands of the chromosome is a lethal event in all living organisms because it compromises chromosome replication. As such, a diversity of DNA repair systems has evolved to repair double-strand DNA breaks (DSBs). In part, this diversity of DSB repair systems has evolved to repair breaks that arise in diverse physiologic circumstances or sequence contexts, including cellular states of nonreplication or breaks that arise between repeats. Mycobacteria elaborate a set of three genetically distinct DNA repair pathways: homologous recombination, nonhomologous end joining, and single-strand annealing. As such, mycobacterial DSB repair diverges substantially from the standard model of prokaryotic DSB repair and represents an attractive new model system. In addition, the presence in mycobacteria of a DSB repair system that can repair DSBs in nonreplicating cells (nonhomologous end joining) or when DSBs arise between repeats (single-strand annealing) has clear potential relevance to Mycobacterium tuberculosis pathogenesis, although the exact role of these systems in M. tuberculosis pathogenesis is still being elucidated. In this article we will review the genetics of mycobacterial DSB repair systems, focusing on recent insights.

  20. DNA double strand break repair in a radioresistant cell line

    International Nuclear Information System (INIS)

    Koval, T.M.; Kazmar, E.R.

    1987-01-01

    TN-368 lepidopteran insect cells are on the order of 100 times more resistant to the lethal effects of ionizing radiation than cultured mammalian cells. DNA double strand breaks (DSB) are believed by many to be the critical molecular lesion leading to cell death. The authors therefore measured the rejoining of DSB in TN-368 and V79 Chinese hamster cells. Cells were irradiated on ice with /sup 137/Cs γ rays at a dose rate of 2.5 Gy/min, incubated for various periods of time, and assayed for DNA DSB using the method of neutral elution. The kinetics of DSB rejoining following a dose of 90.2 Gy are similar for both cell lines. Approximately 80% of the DSB are rejoined in both lines by 1 hr postirradiation. However, no further rejoining occurs in the TN-368 cells through at least 6 hr postirradiation, whereas 90% of the DSB are rejoined in the V79 cells by 2 hr postirradiation. Other studies (from 22.6 to 226 Gy) demonstrate that the amount of rejoining of DSB varies inversely with dose for the V79 cells but remains constant for the TN-368 cells. These findings do not support the hypothesis that unrejoined DNA DSB represent the major lesion resulting in cell death

  1. Ku recruits XLF to DNA double-strand breaks.

    Science.gov (United States)

    Yano, Ken-ichi; Morotomi-Yano, Keiko; Wang, Shih-Ya; Uematsu, Naoya; Lee, Kyung-Jong; Asaithamby, Aroumougame; Weterings, Eric; Chen, David J

    2008-01-01

    XRCC4-like factor (XLF)--also known as Cernunnos--has recently been shown to be involved in non-homologous end-joining (NHEJ), which is the main pathway for the repair of DNA double-strand breaks (DSBs) in mammalian cells. XLF is likely to enhance NHEJ by stimulating XRCC4-ligase IV-mediated joining of DSBs. Here, we report mechanistic details of XLF recruitment to DSBs. Live cell imaging combined with laser micro-irradiation showed that XLF is an early responder to DSBs and that Ku is essential for XLF recruitment to DSBs. Biochemical analysis showed that Ku-XLF interaction occurs on DNA and that Ku stimulates XLF binding to DNA. Unexpectedly, XRCC4 is dispensable for XLF recruitment to DSBs, although photobleaching analysis showed that XRCC4 stabilizes the binding of XLF to DSBs. Our observations showed the direct involvement of XLF in the dynamic assembly of the NHEJ machinery and provide mechanistic insights into DSB recognition.

  2. Protected DNA strand displacement for enhanced single nucleotide discrimination in double-stranded DNA

    OpenAIRE

    Khodakov, Dmitriy A.; Khodakova, Anastasia S.; Huang, David M.; Linacre, Adrian; Ellis, Amanda V.

    2015-01-01

    Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within doubl...

  3. Mechanisms of DNA Packaging by Large Double-Stranded DNA Viruses

    Science.gov (United States)

    Rao, Venigalla B.; Feiss, Michael

    2016-01-01

    Translocation of viral double-stranded DNA (dsDNA) into the icosahedral prohead shell is catalyzed by TerL, a motor protein that has ATPase, endonuclease, and translocase activities. TerL, following endonucleolytic cleavage of immature viral DNA concatemer recognized by TerS, assembles into a pentameric ring motor on the prohead’s portal vertex and uses ATP hydrolysis energy for DNA translocation. TerL’s N-terminal ATPase is connected by a hinge to the C-terminal endonuclease. Inchworm models propose that modest domain motions accompanying ATP hydrolysis are amplified, through changes in electrostatic interactions, into larger movements of the C-terminal domain bound to DNA. In phage φ29, four of the five TerL subunits sequentially hydrolyze ATP, each powering translocation of 2.5 bp. After one viral genome is encapsidated, the internal pressure signals termination of packaging and ejection of the motor. Current focus is on the structures of packaging complexes and the dynamics of TerL during DNA packaging, endonuclease regulation, and motor mechanics. PMID:26958920

  4. The Human L1 Element Causes DNA Double-Strand Breaks in Breast Cancer

    Science.gov (United States)

    2006-08-01

    cancer is complex. However, defects in DNA repair genes in the double-strand break repair pathway are cancer predisposing. My lab has characterized...a new potentially important source of double-strand breaks (DSBs) in human cells and are interested in characterizing which DNA repair genes act on...this particular source of DNA damage. Selfish DNA accounts for 45% of the human genome. We have recently demonstrated that one particular selfish

  5. Protected DNA strand displacement for enhanced single nucleotide discrimination in double-stranded DNA.

    Science.gov (United States)

    Khodakov, Dmitriy A; Khodakova, Anastasia S; Huang, David M; Linacre, Adrian; Ellis, Amanda V

    2015-03-04

    Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within double-stranded DNA generated from real-life human mitochondrial DNA samples. Aside from the potential diagnostic value, the current study represents an additional way to control the strand displacement reaction rate without altering other reaction parameters and provides new insights into the influence of single nucleotide substitutions on 3- and 4-way branch migration efficiency and kinetics.

  6. Cyclic perylene diimide: Selective ligand for tetraplex DNA binding over double stranded DNA.

    Science.gov (United States)

    Vasimalla, Suresh; Sato, Shinobu; Takenaka, Fuminori; Kurose, Yui; Takenaka, Shigeori

    2017-12-15

    Synthesized cyclic perylene diimide, cPDI, showed the binding constant of 6.3 × 10 6  M -1 with binding number of n = 2 with TA-core as a tetraplex DNA in 50 mM Tris-HCl buffer (pH = 7.4) containing 100 mM KCl using Schatchard analysis and showed a higher preference for tetraplex DNA than for double stranded DNA with over 10 3 times. CD spectra showed that TA-core induced its antiparallel conformation upon addition of cPDI in the absence or presence of K + or Na + ions. The cPDI inhibits the telomerase activity with IC 50 of 0.3 µM using TRAP assay which is potential anti-cancer drug with low side effect. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Torsional regulation of hRPA-induced unwinding of double-stranded DNA

    NARCIS (Netherlands)

    De Vlaminck, I.; Vidic, I.; Van Loenhout, M.T.J.; Kanaar, R.; Lebbink, J.H.G.; Dekker, C.

    2010-01-01

    All cellular single-stranded (ss) DNA is rapidly bound and stabilized by single stranded DNA-binding proteins (SSBs). Replication protein A, the main eukaryotic SSB, is able to unwind double-stranded (ds) DNA by binding and stabilizing transiently forming bubbles of ssDNA. Here, we study the

  8. The DNA-dependent protein kinase: a multifunctional protein kinase with roles in DNA double strand break repair and mitosis

    Science.gov (United States)

    Jette, Nicholas; Lees-Miller, Susan P.

    2015-01-01

    The DNA-dependent protein kinase (DNA-PK) is a serine/threonine protein kinase composed of a large catalytic subunit (DNA-PKcs) and the Ku70/80 heterodimer. Over the past two decades, significant progress has been made in elucidating the role of DNA-PK in non-homologous end joining (NHEJ), the major pathway for repair of ionizing radiation-induced DNA double strand breaks in human cells and recently, additional roles for DNA-PK have been reported. In this review, we will describe the biochemistry, structure and function of DNA-PK, its roles in DNA double strand break repair and its newly described roles in mitosis and other cellular processes. PMID:25550082

  9. Protein kinase CK2 localizes to sites of DNA double-strand break regulating the cellular response to DNA damage

    Directory of Open Access Journals (Sweden)

    Olsen Birgitte B

    2012-03-01

    Full Text Available Abstract Background The DNA-dependent protein kinase (DNA-PK is a nuclear complex composed of a large catalytic subunit (DNA-PKcs and a heterodimeric DNA-targeting subunit Ku. DNA-PK is a major component of the non-homologous end-joining (NHEJ repair mechanism, which is activated in the presence of DNA double-strand breaks induced by ionizing radiation, reactive oxygen species and radiomimetic drugs. We have recently reported that down-regulation of protein kinase CK2 by siRNA interference results in enhanced cell death specifically in DNA-PKcs-proficient human glioblastoma cells, and this event is accompanied by decreased autophosphorylation of DNA-PKcs at S2056 and delayed repair of DNA double-strand breaks. Results In the present study, we show that CK2 co-localizes with phosphorylated histone H2AX to sites of DNA damage and while CK2 gene knockdown is associated with delayed DNA damage repair, its overexpression accelerates this process. We report for the first time evidence that lack of CK2 destabilizes the interaction of DNA-PKcs with DNA and with Ku80 at sites of genetic lesions. Furthermore, we show that CK2 regulates the phosphorylation levels of DNA-PKcs only in response to direct induction of DNA double-strand breaks. Conclusions Taken together, these results strongly indicate that CK2 plays a prominent role in NHEJ by facilitating and/or stabilizing the binding of DNA-PKcs and, possibly other repair proteins, to the DNA ends contributing to efficient DNA damage repair in mammalian cells.

  10. Triple Helix going abroad?

    DEFF Research Database (Denmark)

    Sørensen, Olav Jull; Hu, Yimei

    2014-01-01

    The aim of the article is to explore to what extent the Tripple helix is being internationalized. Each of the helixes have their own internationalization rationale but the article show by small example that the helix itself is being internationalized and integrated with the host country tripple h...

  11. Colocalization of multiple DNA double-strand breaks at a single Rad52 repair centre

    DEFF Research Database (Denmark)

    Lisby, M.; Mortensen, Uffe Hasbro; Rothstein, R.

    2003-01-01

    DNA double-strand break repair (DSBR) is an essential process for preserving genomic integrity in all organisms. To investigate this process at the cellular level, we engineered a system of fluorescently marked DNA double-strand breaks (DSBs) in the yeast Saccharomyces cerevisiae to visualize in ...

  12. SIRT6 stabilizes DNA-dependent protein kinase at chromatin for DNA double-strand break repair

    DEFF Research Database (Denmark)

    McCord, Ronald A; Michishita, Eriko; Hong, Tao

    2009-01-01

    -PKcs) to chromatin in response to DNA damage and stabilizes DNA-PKcs at chromatin adjacent to an induced site-specific DSB. Abrogation of these SIRT6 activities leads to impaired resolution of DSBs. Together, these findings elucidate a mechanism whereby regulation of dynamic interaction of a DNA repair factor......-dependent protein kinase) and promotes DNA DSB repair. In response to DSBs, SIRT6 associates dynamically with chromatin and is necessary for an acute decrease in global cellular acetylation levels on histone H3 Lysine 9. Moreover, SIRT6 is required for mobilization of the DNA-PK catalytic subunit (DNA......, and SIRT6 knockout cells exhibit genomic instability and DNA damage hypersensitivity. However, the molecular mechanisms underlying these defects are not fully understood. Here, we show that SIRT6 forms a macromolecular complex with the DNA double-strand break (DSB) repair factor DNA-PK (DNA...

  13. The DNA-dependent protein kinase: a multifunctional protein kinase with roles in DNA double strand break repair and mitosis

    OpenAIRE

    Jette, Nicholas; Lees-Miller, Susan P.

    2014-01-01

    The DNA-dependent protein kinase (DNA-PK) is a serine/threonine protein kinase composed of a large catalytic subunit (DNA-PKcs) and the Ku70/80 heterodimer. Over the past two decades, significant progress has been made in elucidating the role of DNA-PK in non-homologous end joining (NHEJ), the major pathway for repair of ionizing radiation-induced DNA double strand breaks in human cells and recently, additional roles for DNA-PK have been reported. In this review, we will describe the biochemi...

  14. Twist–radial normal mode analysis in double-stranded DNA chains

    International Nuclear Information System (INIS)

    Torrellas, Germán; Maciá, Enrique

    2012-01-01

    We study the normal modes of a duplex DNA chain at low temperatures. We consider the coupling between the hydrogen-bond radial oscillations and the twisting motion of each base pair within the Peyrard–Bishop–Dauxois model. The coupling is mediated by the stacking interaction between adjacent base pairs along the helix. We explicitly consider different mass values for different nucleotides, extending previous works. We disclose several resonance conditions of interest, determined by the fine-tuning of certain model parameters. The role of these dynamical effects on the DNA chain charge transport properties is discussed.

  15. Double strand breaks in DNA in vivo and in vitro after 60Co-γ-irradiation

    International Nuclear Information System (INIS)

    Huelsewede, J.W.

    1985-01-01

    The questions of what the correlation is between double strand breaks in DNA in the cell and lethal radiation damage and by means of which possible mechanisms DNA double strand breaks could occur were studied. E. coli served as test system. In addition to this the molecular weight of the DNA from irradiated E. coli as a function of the radiation dose under various conditions was measured. This data was compared on the one hand to the survival of the cell and on the other hand to the formation of DNA double strand breaks in an aqueous buffer system, which in its ionic characteristics was similar to cell fluids. (orig./MG) [de

  16. In vivo quantification of DNA double strand breaks

    International Nuclear Information System (INIS)

    Simonsson, M.; Qvarnstroem, F.; Turesson, I.; Johansson, K.-A.; Nyman, J.; Hermansson, I.; Oden, A.; Book, M.

    2003-01-01

    DNA double strand breaks (DSBs) can be introduced in the genome by exposure to exogenous agents such as ionising radiation and radio-mimetic chemicals. The biological importance of these breaks is significant even at low numbers. Inaccurate repair or lack of repair of a single DSB has the potential to kill a cell or lead to tumourigenesis. Thus the induction and repair of DSBs are crucial events in the onset of malignancies. Following the induction of DSBs, the core histone H2AX is rapidly phosphorylated at residue serine 139. This phosphorylated form of H2AX is referred to as gH2AX. Histones wrapped in megabase regions flanking these breaks are involved in this process, which results in the formation of discrete nuclear foci. It has previously been shown that a single DSB is sufficient to produce a detectable focus. So far there has been a lack of methods capable of measuring the amount of DSBs at clinically relevant quantities. Such a method would embrace a wide field of applications. It could be applied as a biological dosimeter when studying carcinogenic effects and provide the basis for an assay predicting individual radiosensitivity. We describe a measurement procedure that detects and quantifies small amounts of DSBs in vivo. This is accomplished using immunofluorescence detection of the molecular marker gH2AX. The gH2AX foci are quantified in histological sections using basic digital image analysis methods as the main component. In a primary assessment of the procedure we analysed the in vivo dose response of prostate cancer patients in clinical practice undergoing radiotherapy. Epidermal nucleated cells in skin biopsies taken 30 minutes following the first single dose delivered show linear dose response for low doses ranging from 0 - 1.2 Gy. The described procedure for double strand break quantification can detect dose changes as low as 0.18 Gy

  17. Study in regularities in the formation of double stranded DNA breaks in irradiated rat thymocytes

    International Nuclear Information System (INIS)

    Ivannik, B.P.; ProskuryakoV, S.Ya.; Ryabchenko, N.I.

    1979-01-01

    Using low-gradient viscosimetry of neutral detergent nuclear lysates a study was made of postradiation changes in the molecular weight of double-stranded DNA of thymocytes. It was established that 375 eV are needed for one double-stranded break to appear, and a dose of 1 rad is required for 0.275 double-stranded break to occur at the site of DNA with m.w. 10 12 dalton. The repair of double-stranded breaks is only observed when rats are exposed to a dose of 500 R. It is assumed that the absence of repair of double-stranded DNA breaks and the presence of secondary postradiation degradation of DNA are responsible for thymocyte death

  18. Enzymatic induction of DNA double-strand breaks in γ-irradiated Escherichia coli K-12

    International Nuclear Information System (INIS)

    Bonura, T.; Smith, K.C.; Kaplan, H.S.

    1975-01-01

    The polA1 mutation increases the sensitivity of E. coli K-12 to killing by γ-irradiation in air by a factor of 2.9 and increases the yield of DNA double-strand breaks by a factor of 2.5. These additional DNA double-strand breaks appear to be due to the action of nucleases in the polA1 strain rather than to the rejoining of radiation-induced double-strand breaks in the pol + strain. This conclusion is based upon the observation that γ-irradiation at 3 0 did not affect the yield of DNA double-strand breaks in the pol + strain, but decreased the yield in the polA1 strain by a factor of 2.2. Irradiation of the polA1 strain at 3 0 followed by incubation at 3 0 for 20 min before plating resulted in approximately a 1.5-fold increase in the D 0 . The yield of DNA double-strand breaks was reduced by a factor of 1.5. The pol + strain, however, did not show the protective effect of the low temperature incubation upon either survival or DNA double-strand breakage. We suggest that the increased yield of DNA double-strand breaks in the polA 1 strain may be the result of the unsuccessful excision repair of ionizing radiation-induced dna base damage

  19. Force-induced rupture of double-stranded DNA in the absence and presence of covalently bonded anti-tumor drugs: Insights from molecular dynamics simulations

    Science.gov (United States)

    Upadhyaya, Anurag; Nath, Shesh; Kumar, Sanjay

    2018-06-01

    DNA intra-strand cross-link (ICL) agents are widely used in the treatment of cancer. ICLs are thought to form a link between the same strand (intra-strand) or complimentary strand (inter-strand) and thereby increase the stability of DNA, which forbids the processes like replication and transcription. As a result, cell death occurs. In this work, we have studied the enhanced stability of a double stranded DNA in the presence of ICLs and compared our findings with the results obtained in the absence of these links. Using atomistic simulations with explicit solvent, a force is applied along and perpendicular to the direction of the helix and we measured the rupture force and the unzipping force of DNA-ICL complexes. Our results show that the rupture and the unzipping forces increase significantly in the presence of these links. The ICLs bind to the minor groove of DNA, which enhance the DNA stabilisation. Such information may be used to design alternative drugs that can stall replication and transcription that are critical to a growing number of anticancer drug discovery efforts.

  20. Preparation of a differentially expressed, full-length cDNA expression library by RecA-mediated triple-strand formation with subtractively enriched cDNA fragments

    NARCIS (Netherlands)

    Hakvoort, T. B.; Spijkers, J. A.; Vermeulen, J. L.; Lamers, W. H.

    1996-01-01

    We have developed a fast and general method to obtain an enriched, full-length cDNA expression library with subtractively enriched cDNA fragments. The procedure relies on RecA-mediated triple-helix formation of single-stranded cDNA fragments with a double-stranded cDNA plasmid library. The complexes

  1. DNA Double-Strand Break Rejoining in Complex Normal Tissues

    International Nuclear Information System (INIS)

    Ruebe, Claudia E.; Dong, Xiaorong; Kuehne, Martin; Fricke, Andreas; Kaestner, Lars; Lipp, Peter; Ruebe, Christian

    2008-01-01

    Purpose: The clinical radiation responses of different organs vary widely and likely depend on the intrinsic radiosensitivities of their different cell populations. Double-strand breaks (DSBs) are the most deleterious form of DNA damage induced by ionizing radiation, and the cells' capacity to rejoin radiation-induced DSBs is known to affect their intrinsic radiosensitivity. To date, only little is known about the induction and processing of radiation-induced DSBs in complex normal tissues. Using an in vivo model with repair-proficient mice, the highly sensitive γH2AX immunofluorescence was established to investigate whether differences in DSB rejoining could account for the substantial differences in clinical radiosensitivity observed among normal tissues. Methods and Materials: After whole body irradiation of C57BL/6 mice (0.1, 0.5, 1.0, and 2.0 Gy), the formation and rejoining of DSBs was analyzed by enumerating γH2AX foci in various organs representative of both early-responding (small intestine) and late-responding (lung, brain, heart, kidney) tissues. Results: The linear dose correlation observed in all analyzed tissues indicated that γH2AX immunofluorescence allows for the accurate quantification of DSBs in complex organs. Strikingly, the various normal tissues exhibited identical kinetics for γH2AX foci loss, despite their clearly different clinical radiation responses. Conclusion: The identical kinetics of DSB rejoining measured in different organs suggest that tissue-specific differences in radiation responses are independent of DSB rejoining. This finding emphasizes the fundamental role of DSB repair in maintaining genomic integrity, thereby contributing to cellular viability and functionality and, thus, tissue homeostasis

  2. Balancing Pathways in DNA Double Strand Break Repair

    NARCIS (Netherlands)

    I. Brandsma (Inger)

    2016-01-01

    markdownabstractAll information a cell needs to live and survive is stored in the genomic DNA. Maintenance of an intact and uncompromised genome is of vital importance for cell survival. Damaged DNA can block transcription and replication, processes essential for cell viability. Persistent DNA

  3. DNA packing in chromatine, a manifestation of the Bonnet transformation.

    Science.gov (United States)

    Blum, Z; Lidin, S

    1988-08-01

    The packing of DNA is described using the formalism of differential geometry. Winding of the DNA double helix around the histone 2-5 octamer forming a nucleosome and the condensation of the so-formed bead-on-a-string chromatine aided by histone 1 is interpreted as two consecutive isometric, i.e. Bonnet, transformations. The DNA double helix can be approximated to a helicoid which can be transformed isometrically to a catenoid, an approximation of the nucleosome. Owing to the organization of the histone octamer the extended chromatine takes a helicoidal shape allowing a second Bonnet transformation to consummate the condensation into a chromatine fibre.

  4. Highly Stable Double-Stranded DNA Containing Sequential Silver(I)-Mediated 7-Deazaadenine/Thymine Watson-Crick Base Pairs.

    Science.gov (United States)

    Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A

    2016-05-17

    The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. The logic of DNA replication in double-stranded DNA viruses: insights from global analysis of viral genomes.

    Science.gov (United States)

    Kazlauskas, Darius; Krupovic, Mart; Venclovas, Česlovas

    2016-06-02

    Genomic DNA replication is a complex process that involves multiple proteins. Cellular DNA replication systems are broadly classified into only two types, bacterial and archaeo-eukaryotic. In contrast, double-stranded (ds) DNA viruses feature a much broader diversity of DNA replication machineries. Viruses differ greatly in both completeness and composition of their sets of DNA replication proteins. In this study, we explored whether there are common patterns underlying this extreme diversity. We identified and analyzed all major functional groups of DNA replication proteins in all available proteomes of dsDNA viruses. Our results show that some proteins are common to viruses infecting all domains of life and likely represent components of the ancestral core set. These include B-family polymerases, SF3 helicases, archaeo-eukaryotic primases, clamps and clamp loaders of the archaeo-eukaryotic type, RNase H and ATP-dependent DNA ligases. We also discovered a clear correlation between genome size and self-sufficiency of viral DNA replication, the unanticipated dominance of replicative helicases and pervasive functional associations among certain groups of DNA replication proteins. Altogether, our results provide a comprehensive view on the diversity and evolution of replication systems in the DNA virome and uncover fundamental principles underlying the orchestration of viral DNA replication. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Extracellular DNA and histones: double-edged swords in immunothrombosis.

    Science.gov (United States)

    Gould, T J; Lysov, Z; Liaw, P C

    2015-06-01

    The existence of extracellular DNA in human plasma, also known as cell-free DNA (cfDNA), was first described in the 1940s. In recent years, there has been a resurgence of interest in the functional significance of cfDNA, particularly in the context of neutrophil extracellular traps (NETs). cfDNA and histones are key components of NETs that aid in the host response to infection and inflammation. However, cfDNA and histones may also exert harmful effects by triggering coagulation, inflammation, and cell death and by impairing fibrinolysis. In this article, we will review the pathologic nature of cfDNA and histones in macrovascular and microvascular thrombosis, including venous thromboembolism, cancer, sepsis, and trauma. We will also discuss the prognostic value of cfDNA and histones in these disease states. Understanding the molecular and cellular pathways regulated by cfDNA and histones may provide novel insights to prevent pathological thrombus formation and vascular occlusion. © 2015 International Society on Thrombosis and Haemostasis.

  7. Visualization of DNA double-strand break repair: From molecules to cells

    NARCIS (Netherlands)

    Krawczyk, Przemek M.; Stap, Jan; Aten, Jacob A.

    2008-01-01

    DNA double-strand break (DSB) signaling and repair processes are positioned at the crossroad of nuclear pathways that regulate DNA replication, cell division, senescence and apoptosis. Importantly, errors in DSB repair may lead to lethal or potentially tumorigenic chromosome rearrangements.

  8. The role of DNA double-strand breaks in spontaneous homologous recombination in S. cerevisiae

    DEFF Research Database (Denmark)

    Lettier, Gaëlle; Feng, Q.; Mayolo, A.A. de

    2006-01-01

    of meiosis and result from the induction of a large number of DNA double-strand breaks (DSBs). By analogy, it is generally believed that the rare spontaneous mitotic HR events are due to repair of DNA DSBs that accidentally occur during mitotic growth. Here we provide the first direct evidence that most...

  9. The Ku Heterodimer and the Metabolism of Single-Ended DNA Double-Strand Breaks

    NARCIS (Netherlands)

    A. Balestrini (Alessia); D. Ristic (Dejan); I. Dionne (Isabelle); X.Z. Liu (Xiao); C. Wyman (Claire); R.J. Wellinger (Raymund); J.H.J. Petrini (John)

    2013-01-01

    textabstractSingle-ended double-strand breaks (DSBs) are a common form of spontaneous DNA break, generated when the replisome encounters a discontinuity in the DNA template. Given their prevalence, understanding the mechanisms governing the fate(s) of single-ended DSBs is important. We describe the

  10. Assembly and function of DNA double-strand break repair foci in mammalian cells

    DEFF Research Database (Denmark)

    Bekker-Jensen, Simon; Mailand, Niels

    2010-01-01

    DNA double-strand breaks (DSBs) are among the most cytotoxic types of DNA damage, which if left unrepaired can lead to mutations or gross chromosomal aberrations, and promote the onset of diseases associated with genomic instability such as cancer. One of the most discernible hallmarks...

  11. Chromatin mobility is increased at sites of DNA double-strand breaks

    NARCIS (Netherlands)

    Krawczyk, P. M.; Borovski, T.; Stap, J.; Cijsouw, T.; ten Cate, R.; Medema, J. P.; Kanaar, R.; Franken, N. A. P.; Aten, J. A.

    2012-01-01

    DNA double-strand breaks (DSBs) can efficiently kill cancer cells, but they can also produce unwanted chromosome rearrangements when DNA ends from different DSBs are erroneously joined. Movement of DSB-containing chromatin domains might facilitate these DSB interactions and promote the formation of

  12. Regulation of DNA double-strand break repair by ubiquitin and ubiquitin-like modifiers

    DEFF Research Database (Denmark)

    Schwertman, Petra; Bekker-Jensen, Simon; Mailand, Niels

    2016-01-01

    DNA double-strand breaks (DSBs) are highly cytotoxic DNA lesions. The swift recognition and faithful repair of such damage is crucial for the maintenance of genomic stability, as well as for cell and organismal fitness. Signalling by ubiquitin, SUMO and other ubiquitin-like modifiers (UBLs...

  13. Push back to respond better: regulatory inhibition of the DNA double-strand break response.

    Science.gov (United States)

    Panier, Stephanie; Durocher, Daniel

    2013-10-01

    Single DNA lesions such as DNA double-strand breaks (DSBs) can cause cell death or trigger genome rearrangements that have oncogenic potential, and so the pathways that mend and signal DNA damage must be highly sensitive but, at the same time, selective and reversible. When initiated, boundaries must be set to restrict the DSB response to the site of the lesion. The integration of positive and, crucially, negative control points involving post-translational modifications such as phosphorylation, ubiquitylation and acetylation is key for building fast, effective responses to DNA damage and for mitigating the impact of DNA lesions on genome integrity.

  14. A critical role for topoisomerase IIb and DNA double strand breaks in transcription.

    Science.gov (United States)

    Calderwood, Stuart K

    2016-05-26

    Recent studies have indicated a novel role for topoisomerase IIb in transcription. Transcription of heat shock genes, serum-induced immediate early genes and nuclear receptor-activated genes, each required DNA double strands generated by topoisomerase IIb. Such strand breaks seemed both necessary and sufficient for transcriptional activation. In addition, such transcription was associated with initiation of the DNA damage response pathways, including the activation of the enzymes: ataxia-telangiectasia mutated (ATM), DNA-dependent protein kinase and poly (ADP ribose) polymerase 1. DNA damage response signaling was involved both in transcription and in repair of DNA breaks generated by topoisomerase IIb.

  15. Induction of protective immune responses in mice by double DNA ...

    African Journals Online (AJOL)

    Keywords: Multiple DNA vaccine, Omp31 gene, Brucella melitensis, Eae gene, Escherichia ... Abstract, Chemical Abstracts, Embase, Index Copernicus, EBSCO, African .... a 1 % agarose gel in 1× TBE buffer, followed by ... manufacturer's protocol, the recombinant ..... Moreno S, Timon M. DNA vaccination: an immunological.

  16. Three methods to determine the yields of DNA double-strand breaks

    International Nuclear Information System (INIS)

    Erzgraeber, G.; Lapidus, I.L.

    1985-01-01

    A possibility of determining the yield of DNA double-strand breaks in cells of the Chinese hamster (V79-4) by finding the amount of DNA released as a result of breaks and by determining the relative sedimentation velocity of DNA-membrane complexes affected by ionizing radiations with different physical characteristics is discussed. Results of the analysis are compared with the data obtained by a traditional method of sedimentation in the neutral sucrose density gradient. Comparative characterization of the methods is discussed. The yields of DNA double-strand breaks determined by the suggested independent methods are in good agreement, which opens possibilities of studying induction and repair of double-strand breaks by means of simpler and more reliable methods

  17. [DNA extraction from decomposed tissue by double-digest and magnetic beads methods].

    Science.gov (United States)

    Yang, Dian; Liu, Chao; Liu, Hong

    2011-12-01

    To study the effect of the double-digest and magnetic beads method for DNA extraction from 3 types of decomposed tissues. DNA of cartilages, nails and joint capsule in 91 highly decomposed corpses which had not been extracted by common magnetic beads method, were prepared with the double-digest and magnetic beads methods, and quantified with Quantifiler kit, followed by amplification with Sinofiler kit or Minifiler kit. DNA concentration extracted from the 91 highly decomposed cartilages, nails and joint capsule samples was 0-0.225 ng/microL. Sixty-two samples whose DNA concentration were more than 0.020 ng/microL had obtained 9 or more STR loci successfully. The detection rate was 68.13%. The successful rate of STR genotyping for the 3 types of decomposed tissues can be significantly improved by the double-digest and magnetic beads methods.

  18. Towards quantitative viromics for both double-stranded and single-stranded DNA viruses

    Directory of Open Access Journals (Sweden)

    Simon Roux

    2016-12-01

    Full Text Available Background Viruses strongly influence microbial population dynamics and ecosystem functions. However, our ability to quantitatively evaluate those viral impacts is limited to the few cultivated viruses and double-stranded DNA (dsDNA viral genomes captured in quantitative viral metagenomes (viromes. This leaves the ecology of non-dsDNA viruses nearly unknown, including single-stranded DNA (ssDNA viruses that have been frequently observed in viromes, but not quantified due to amplification biases in sequencing library preparations (Multiple Displacement Amplification, Linker Amplification or Tagmentation. Methods Here we designed mock viral communities including both ssDNA and dsDNA viruses to evaluate the capability of a sequencing library preparation approach including an Adaptase step prior to Linker Amplification for quantitative amplification of both dsDNA and ssDNA templates. We then surveyed aquatic samples to provide first estimates of the abundance of ssDNA viruses. Results Mock community experiments confirmed the biased nature of existing library preparation methods for ssDNA templates (either largely enriched or selected against and showed that the protocol using Adaptase plus Linker Amplification yielded viromes that were ±1.8-fold quantitative for ssDNA and dsDNA viruses. Application of this protocol to community virus DNA from three freshwater and three marine samples revealed that ssDNA viruses as a whole represent only a minor fraction (<5% of DNA virus communities, though individual ssDNA genomes, both eukaryote-infecting Circular Rep-Encoding Single-Stranded DNA (CRESS-DNA viruses and bacteriophages from the Microviridae family, can be among the most abundant viral genomes in a sample. Discussion Together these findings provide empirical data for a new virome library preparation protocol, and a first estimate of ssDNA virus abundance in aquatic systems.

  19. Deficiency of Double-Strand DNA Break Repair Does Not Impair Mycobacterium tuberculosis Virulence in Multiple Animal Models of Infection

    OpenAIRE

    Heaton, Brook E.; Barkan, Daniel; Bongiorno, Paola; Karakousis, Petros C.; Glickman, Michael S.

    2014-01-01

    Mycobacterium tuberculosis persistence within its human host requires mechanisms to resist the effector molecules of host immunity, which exert their bactericidal effects through damaging pathogen proteins, membranes, and DNA. Substantial evidence indicates that bacterial pathogens, including M. tuberculosis, require DNA repair systems to repair the DNA damage inflicted by the host during infection, but the role of double-strand DNA break (DSB) repair systems is unclear. Double-strand DNA bre...

  20. DNA Damage by Ionizing Radiation: Tandem Double Lesions by Charged Particles

    Science.gov (United States)

    Huo, Winifred M.; Chaban, Galina M.; Wang, Dunyou; Dateo, Christopher E.

    2005-01-01

    Oxidative damages by ionizing radiation are the source of radiation-induced carcinogenesis, damage to the central nervous system, lowering of the immune response, as well as other radiation-induced damages to human health. Monte Carlo track simulations and kinetic modeling of radiation damages to the DNA employ available molecular and cellular data to simulate the biological effect of high and low LET radiation io the DNA. While the simulations predict single and double strand breaks and base damages, so far all complex lesions are the result of stochastic coincidence from independent processes. Tandem double lesions have not yet been taken into account. Unlike the standard double lesions that are produced by two separate attacks by charged particles or radicals, tandem double lesions are produced by one single attack. The standard double lesions dominate at the high dosage regime. On the other hand, tandem double lesions do not depend on stochastic coincidences and become important at the low dosage regime of particular interest to NASA. Tandem double lesions by hydroxyl radical attack of guanine in isolated DNA have been reported at a dosage of radiation as low as 10 Gy. The formation of two tandem base lesions was found to be linear with the applied doses, a characteristic of tandem lesions. However, tandem double lesions from attack by a charged particle have not been reported.

  1. Targeting DNA double strand break repair with hyperthermia and DNA-PKcs inhibition to enhance the effect of radiation treatment.

    Science.gov (United States)

    van Oorschot, Bregje; Granata, Giovanna; Di Franco, Simone; Ten Cate, Rosemarie; Rodermond, Hans M; Todaro, Matilde; Medema, Jan Paul; Franken, Nicolaas A P

    2016-10-04

    Radiotherapy is based on the induction of lethal DNA damage, primarily DNA double-strand breaks (DSB). Efficient DSB repair via Non-Homologous End Joining or Homologous Recombination can therefore undermine the efficacy of radiotherapy. By suppressing DNA-DSB repair with hyperthermia (HT) and DNA-PKcs inhibitor NU7441 (DNA-PKcsi), we aim to enhance the effect of radiation.The sensitizing effect of HT for 1 hour at 42°C and DNA-PKcsi [1 μM] to radiation treatment was investigated in cervical and breast cancer cells, primary breast cancer sphere cells (BCSCs) enriched for cancer stem cells, and in an in vivo human tumor model. A significant radio-enhancement effect was observed for all cell types when DNA-PKcsi and HT were applied separately, and when both were combined, HT and DNA-PKcsi enhanced radio-sensitivity to an even greater extent. Strikingly, combined treatment resulted in significantly lower survival rates, 2 to 2.5 fold increase in apoptosis, more residual DNA-DSB 6 h post treatment and a G2-phase arrest. In addition, tumor growth analysis in vivo showed significant reduction in tumor growth and elevated caspase-3 activity when radiation was combined with HT and DNA-PKcsi compared to radiation alone. Importantly, no toxic side effects of HT or DNA-PKcsi were found.In conclusion, inhibiting DNA-DSB repair using HT and DNA-PKcsi before radiotherapy leads to enhanced cytotoxicity in cancer cells. This effect was even noticed in the more radio-resistant BCSCs, which are clearly sensitized by combined treatment. Therefore, the addition of HT and DNA-PKcsi to conventional radiotherapy is promising and might contribute to more efficient tumor control and patient outcome.

  2. Normal formation and repair of γ-radiation-induced single and double strand DNA breaks in Down syndrome fibroblasts

    International Nuclear Information System (INIS)

    Steiner, M.E.; Woods, W.G.

    1982-01-01

    Fibroblasts from patients with Down syndrome (Trisomy 21) were examined for repair capability of γ-radiation-induced single strand and double strand DNA breaks. Formation and repair of DNA breaks were determined by DNA alkaline and non-denaturing elution techniques. Down syndrome fibroblasts were found to repair single strand and double strand breaks as well as fibroblasts from normal controls. (orig.)

  3. DNA hybrids suggesting a recombination process repairing radiation-induced DNA double-strand breaks in Ehrlich Ascites tumor cells

    International Nuclear Information System (INIS)

    Barthel, H.R.

    1984-01-01

    The results presented suggest the possibility of repair of DNA double-strand breaks by recombination, at least in the S and G 2 -phases of the cell cycle, in mammalian cells. Further experiments with synchronized cell cultures will have to show whether this process may also occur in the G 1 -phase of the cell cycle. (orig./AJ) [de

  4. Measurement of anti-double-stranded DNA antibodies in major immunoglobulin classes

    Energy Technology Data Exchange (ETDEWEB)

    Aotsuka, S; Okawa, M; Ikebe, K; Yokohari, R [Division of Clinical Immunology, Clinical Research Institute, National Medical Center Hospital, Shinjuku-ku, Tokyo, Japan

    1979-07-10

    A solid-phase radioimmunoassay for quantitating anti-double-stranded deoxyribonucleic acid antibodies (anti-dsDNA) in IgG, IgM and IgA classes has been devised. A distinct feature of the method is an application of polystyrene tubes coated with poly-L-lysine, through which dsDNA could be bound firmly to a solid phase. Studies on patients sera as well as normal sera revealed that anti-dsDNA was not qualitatively but quantitatively characteristic of systematic lupus erythematosus (SLE) and that IgG anti-dsDNA levels correlated well with the disease activity.

  5. The yeast Saccharomyces cerevisiae DNA polymerase IV: possible involvement in double strand break DNA repair.

    OpenAIRE

    Leem, S H; Ropp, P A; Sugino, A

    1994-01-01

    We identified and purified a new DNA polymerase (DNA polymerase IV), which is similar to mammalian DNA polymerase beta, from Saccharomyces cerevisiae and suggested that it is encoded by YCR14C (POLX) on chromosome III. Here, we provided a direct evidence that the purified DNA polymerase IV is indeed encoded by POLX. Strains harboring a pol4 deletion mutation exhibit neither mitotic growth defect nor a meiosis defect, suggesting that DNA polymerase IV participates in nonessential functions in ...

  6. Repair and gamma radiation-induced single- and double-strand breaks in DNA of Escherichia coli

    International Nuclear Information System (INIS)

    Petrov, S.I.

    1981-01-01

    Studies in the kinetics of repair of γ-radiation-induced single- and double-strand breaks in DNA of E. coli cells showed that double-strand DNA breaks are rejoined by the following two ways. The first way is conditioned by repair of single-strand breaks and represents the repair of ''oblique'' double-strand breaks in DNA, whereas the second way is conditioned by functioning of the recombination mechanisms and, to all appearance, represents the repair of ''direct'' double-strand breaks in DNA

  7. X-ray induced DNA double strand break production and repair in mammalian cells as measured by neutral filter elution

    Energy Technology Data Exchange (ETDEWEB)

    Bradley, M O; Kohn, K W [National Institutes of Health, Bethesda, MD (USA)

    1979-10-01

    A neutral filter elution method was used for detecting DNA double strand breaks in mouse L1210 cells after X-ray. The assay detected the number of double strand breaks induced by as little as 1000 rad of X-ray. The rate of DNA elution through the filters under neutral conditions increased with X-ray dose. Certain conditions for deproteinization, pH, and filter type were shown to increase the assay's sensitivity. Hydrogen peroxide and Bleomycin also induced apparent DNA double strand breaks, although the ratios of double to single strand breaks varied from those produced by X-ray. The introduction of double strand cuts by HpA I restriction endonuclease in DNA lysed on filters resulted in a rapid rate of elution under neutral conditions, implying that the method can detect double strand breaks if they exist in the DNA. The eluted DNA banded with a double stranded DNA marker in cesium chloride. This evidence suggested that the assay detected DNA double strand breaks. L1210 cells were shown to rejoin most of the DNA double strand breaks induced by 5-10 krad of X-ray with a half-time of about 40 minutes. (author).

  8. Postreplicational formation and repair of DNA double-strand breaks in UV-irradiated Escherichia coli uvrB cells

    International Nuclear Information System (INIS)

    Wang, Tzuchien V.; Smith, K.C.

    1986-01-01

    The number of DNA double-strand breaks formed in UV-irradiated uvrB recF recB cells correlates with the number of unrepaired DNA daughter-strand gaps, and is dependent on DNA synthesis after UV-irradiation. These results are consistent with the model that the DNA double-strand breaks that are produced in UV-irradiated excision-deficient cells occur as the result of breaks in the parental DNA opposite unrepaired DNA daughter-strand gaps. By employing a temperature-sensitive recA200 mutation, we have devised an improved assay for studying the formation and repair of these DNA double-strand breaks. Possible mechanisms for the postreplication repair of DNA double-strand breaks are discussed. (Auth.)

  9. On the linearity of the dose-effect relationship of DNA double strand breaks

    International Nuclear Information System (INIS)

    Chadwick, K.H.; Leenhouts, H.P.

    1994-01-01

    Most radiation biologists believe that DNA double-strand breaks are induced linearly with radiation dose for all types of radiation. Since 1985, with the advent of elution and gel electrophoresis techniques which permit the measurement of DNA double-strand breaks induced in mammalian cells at doses having radiobiological relevance, the true nature of the dose-effect relationship has been brought into some doubt. Many investigators measured curvilinear dose-effect relationships and a few found good correlations between the induction of the DNA double-strand breaks and cell survival. We approach the problem pragmatically by assuming that the induction of DNA double-strand breaks by 125 I Auger electron emitters incorporated into the DNA of the cells is a linear function of the number of 125 I decays, and by comparing the dose-effect relationship for sparsely ionizing radiation against this standard. The conclusion drawn that the curvilinear dose-effect relationships and the correlations with survival are real. (Author)

  10. GC-Rich Extracellular DNA Induces Oxidative Stress, Double-Strand DNA Breaks, and DNA Damage Response in Human Adipose-Derived Mesenchymal Stem Cells.

    Science.gov (United States)

    Kostyuk, Svetlana; Smirnova, Tatiana; Kameneva, Larisa; Porokhovnik, Lev; Speranskij, Anatolij; Ershova, Elizaveta; Stukalov, Sergey; Izevskaya, Vera; Veiko, Natalia

    2015-01-01

    Cell free DNA (cfDNA) circulates throughout the bloodstream of both healthy people and patients with various diseases. CfDNA is substantially enriched in its GC-content as compared with human genomic DNA. Exposure of haMSCs to GC-DNA induces short-term oxidative stress (determined with H2DCFH-DA) and results in both single- and double-strand DNA breaks (comet assay and γH2AX, foci). As a result in the cells significantly increases the expression of repair genes (BRCA1 (RT-PCR), PCNA (FACS)) and antiapoptotic genes (BCL2 (RT-PCR and FACS), BCL2A1, BCL2L1, BIRC3, and BIRC2 (RT-PCR)). Under the action of GC-DNA the potential of mitochondria was increased. Here we show that GC-rich extracellular DNA stimulates adipocyte differentiation of human adipose-derived mesenchymal stem cells (haMSCs). Exposure to GC-DNA leads to an increase in the level of RNAPPARG2 and LPL (RT-PCR), in the level of fatty acid binding protein FABP4 (FACS analysis) and in the level of fat (Oil Red O). GC-rich fragments in the pool of cfDNA can potentially induce oxidative stress and DNA damage response and affect the direction of mesenchymal stem cells differentiation in human adipose-derived mesenchymal stem cells. Such a response may be one of the causes of obesity or osteoporosis.

  11. Double strand DNA breaks response in Huntington´s disease

    Czech Academy of Sciences Publication Activity Database

    Šolc, Petr; Valášek, Jan; Rausová, Petra; Juhásová, Jana; Juhás, Štefan; Motlík, Jan

    2015-01-01

    Roč. 78, Suppl 2 (2015), s. 15-15 ISSN 1210-7859. [Conference on Animal Models for neurodegenerative Diseases /3./. 08.11.2015-10.11.2015, Liblice] R&D Projects: GA MŠk ED2.1.00/03.0124; GA MŠk(CZ) 7F14308 Institutional support: RVO:67985904 Keywords : Huntington ´s disease * DNA damage * double strand DNA breaks Subject RIV: FH - Neurology

  12. Structural and functional aspects of winged-helix domains at the core of transcription initiation complexes.

    Science.gov (United States)

    Teichmann, Martin; Dumay-Odelot, Hélène; Fribourg, Sébastien

    2012-01-01

    The winged helix (WH) domain is found in core components of transcription systems in eukaryotes and prokaryotes. It represents a sub-class of the helix-turn-helix motif. The WH domain participates in establishing protein-DNA and protein-protein-interactions. Here, we discuss possible explanations for the enrichment of this motif in transcription systems.

  13. What is DNA damage? Risk of double-strand break and its individual variation

    International Nuclear Information System (INIS)

    Hanaoka, Fumio

    2011-01-01

    The author discusses about the title subject in an aspect of possible spreading of Fukushima radioactive substances mainly in eastern north area of Japan where carcinogenic incidence may be increased as the ionizing radiation injures the gene (DNA). At first, explained is that cancer is a disease of genes with infinitive proliferation of cells, there are systems to prevent it by repairing the damaged DNA and by other mechanisms like exclusion of cells damaged too much or killing cancer cells with immunity, and individual difference of the repairing capability exists. DNA is always damaged even under ordinary living conditions by sunlight UV ray, cosmic radiation and chemicals externally and by active oxygen species and thermal water movement internally. Concomitantly, DNA damaged by many mechanisms like deletion, dimmer formation, chemical modification of bases, single and double strand breaks is always repaired by concerned enzymes. Double-strand damage by high-energy radiation like gamma ray is quite risky because its repair sometimes accompanies error as concerned enzymes are from more multiple genes. There are many syndromes derived from gene deficit of those repairing enzymes. The diseases concerned with repair of the double-strand damage teach that fetus and infant are more sensitive to radiation than adult as their young body cells are more actively synthesizing DNA, during which, if DNA is injured by radiation, risk of repairing error is higher as the double strand break more frequently occurs. It cannot be simply said that a certain radiation dose limit is generally permissible. There is an individual difference of radiation sensitivity and a possible method to find out an individual weak to radiation is the lymphocyte screening in vitro using anticancer bleomycin which breaks the double strand. (T.T.)

  14. Analysis of native cellular DNA after heavy ion irradiation: DNA double-strand breaks in CHO-K1 cells

    International Nuclear Information System (INIS)

    Heilmann, J.; Taucher-Scholz, G.; Kraft, G.

    1994-11-01

    A fast assay for the detection of DNA double-strand breaks was developed involving constant field gel electrophoresis (Taucher-Scholz et al., 1994) and densitometric scanning of agarose gels stained with ethidium bromide. With this technique, DSB induction was investigated after irradiation of CHO cells with carbon ions with LET values between 14 keV/μm and 400 keV/μm. In parallel, a computer code was developed to simulate both the principle of the electrophoretic detection of DNA double-strand breaks and the action of radiations of different ionization density. The results of the experiments and the calculations are presented here and compared with each other. (orig./HSI)

  15. ATM and checkpoint responses to DNA double strand breaks

    International Nuclear Information System (INIS)

    Khanna, K.K.

    2003-01-01

    DNA damage checkpoints can be classified into G1/S, intra-S and G2/M checkpoints, so named according to the cell cycle transitions that they regulate. DNA damage incurred during the G1 or G2 phase of the cell cycle leads to growth arrest at the G1/S and G2/M phase boundaries, respectively, whereas genotoxic stress during S phase results in the transient suppression of DNA synthesis. In mammals, ATM (ataxia-telangiectasia mutated) is a protein kinase that controls all checkpoint responses to DNA damage. ATM is a versatile kinase which uses various means to regulate a given checkpoint pathway. It has been shown to act upon several proteins within the same pathway, many times controlling several different modifications of the same protein or using several different targets to arrive at the same end point. Some of the ATM targets act as adaptors by recruiting additional substrates for ATM. ATM controls two types of responses in G1. The p53-dependent responses inhibit Cyclin/Cdk activity by transcriptional induction of p21, whereas p53-independent responses inhibit CDKs through degradation of Cdc25A to maintain CdK2 inhibitory phosphorylation. In regulating p53, ATM directly phosphorylates p53 on Ser15, which likely causes p53 transcriptional activation, concurrently activating other kinases that phosphorylate p53 at other sites such as Ser20, which reduces the ability of MDM2 to bind p53, thus promoting its stability. ATM further ensures p53 stability by phosphorylating MDM2. At least six ATM targets, namely CHK2, CHK1, NBS1, BRCA1, SMC1 and FANCD2, have been implicated in the control of S-phase checkpoint. Cdc25A is the downstream effector of CHK1 and CHK2, though the underlying mechanism for control of intra S-phase checkpoint by other targets remain obscure. G2 checkpoint prevents mitotic entry solely through inhibitory phosphorylation of Cdc2/Cdk1. Several ATM targets including CHK1, CHK2, BRCA1, MDC1 and p53BP1 have been implicated in the control of G2/M

  16. Influence of XRCC1 Genetic Polymorphisms on Ionizing Radiation-Induced DNA Damage and Repair

    OpenAIRE

    Sterpone, Silvia; Cozzi, Renata

    2010-01-01

    It is well known that ionizing radiation (IR) can damage DNA through a direct action, producing single- and double-strand breaks on DNA double helix, as well as an indirect effect by generating oxygen reactive species in the cells. Mammals have evolved several and distinct DNA repair pathways in order to maintain genomic stability and avoid tumour cell transformation. This review reports important data showing a huge interindividual variability on sensitivity to IR and in susceptibility to de...

  17. DN2 Thymocytes Activate a Specific Robust DNA Damage Response to Ionizing Radiation-Induced DNA Double-Strand Breaks

    Directory of Open Access Journals (Sweden)

    Irene Calvo-Asensio

    2018-06-01

    Full Text Available For successful bone marrow transplantation (BMT, a preconditioning regime involving chemo and radiotherapy is used that results in DNA damage to both hematopoietic and stromal elements. Following radiation exposure, it is well recognized that a single wave of host-derived thymocytes reconstitutes the irradiated thymus, with donor-derived thymocytes appearing about 7 days post BMT. Our previous studies have demonstrated that, in the presence of donor hematopoietic cells lacking T lineage potential, these host-derived thymocytes are able to generate a polyclonal cohort of functionally mature peripheral T cells numerically comprising ~25% of the peripheral T cell pool of euthymic mice. Importantly, we demonstrated that radioresistant CD44+ CD25+ CD117+ DN2 progenitors were responsible for this thymic auto-reconstitution. Until recently, the mechanisms underlying the radioresistance of DN2 progenitors were unknown. Herein, we have used the in vitro “Plastic Thymus” culture system to perform a detailed investigation of the mechanisms responsible for the high radioresistance of DN2 cells compared with radiosensitive hematopoietic stem cells. Our results indicate that several aspects of DN2 biology, such as (i rapid DNA damage response (DDR activation in response to ionizing radiation-induced DNA damage, (ii efficient repair of DNA double-strand breaks, and (iii induction of a protective G1/S checkpoint contribute to promoting DN2 cell survival post-irradiation. We have previously shown that hypoxia increases the radioresistance of bone marrow stromal cells in vitro, at least in part by enhancing their DNA double-strand break (DNA DSB repair capacity. Since the thymus is also a hypoxic environment, we investigated the potential effects of hypoxia on the DDR of DN2 thymocytes. Finally, we demonstrate for the first time that de novo DN2 thymocytes are able to rapidly repair DNA DSBs following thymic irradiation in vivo.

  18. SAMHD1 Sheds Moonlight on DNA Double-Strand Break Repair.

    Science.gov (United States)

    Cabello-Lobato, Maria Jose; Wang, Siyue; Schmidt, Christine Katrin

    2017-12-01

    SAMHD1 (sterile α motif and histidine (H) aspartate (D) domain-containing protein 1) is known for its antiviral activity of hydrolysing deoxynucleotides required for virus replication. Daddacha et al. identify a hydrolase-independent, moonlighting function of SAMHD1 that facilitates homologous recombination of DNA double-strand breaks (DSBs) by promoting recruitment of C-terminal binding protein interacting protein (CTIP), a DNA-end resection factor, to damaged DNA. These findings could benefit anticancer treatment. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  19. Mouse RAD54 affects DNA double-strand break repair and sister chromatid exchange

    NARCIS (Netherlands)

    H.B. Beverloo (Berna); R.D. Johnson (Roger); M. Jasin (Maria); R. Kanaar (Roland); J.H.J. Hoeijmakers (Jan); M.L.G. Dronkert (Mies)

    2000-01-01

    textabstractCells can achieve error-free repair of DNA double-strand breaks (DSBs) by homologous recombination through gene conversion with or without crossover. In contrast, an alternative homology-dependent DSB repair pathway, single-strand annealing (SSA), results in deletions. In this study, we

  20. Meta-analysis of DNA double-strand break response kinetics

    NARCIS (Netherlands)

    Kochan, Jakub A.; Desclos, Emilie C. B.; Bosch, Ruben; Meister, Luna; Vriend, Lianne E. M.; Attikum, Haico V.; Krawczyk, Przemek M.

    2017-01-01

    Most proteins involved in the DNA double-strand break response (DSBR) accumulate at the damage sites, where they perform functions related to damage signaling, chromatin remodeling and repair. Over the last two decades, studying the accumulation of many DSBR proteins provided information about their

  1. Different responses to muon implantation in single- and double-stranded DNA

    International Nuclear Information System (INIS)

    Hubbard, Penny L.; Tani, Akiko; Oganesyan, Vasily S.; Butt, Julea N.; Cottrell, Stephen P.; Jayasooriya, Upali A.

    2006-01-01

    A model-free analysis of the longitudinal muon spin relaxation of muons implanted into single- and double-stranded DNA samples is reported. These samples show distinctly different responses to implanted muons with discontinuities of the integrated asymmetries at temperatures where these molecules are likely to have onset of molecular and electron dynamics

  2. REV7 counteracts DNA double-strand break resection and affects PARP inhibition

    NARCIS (Netherlands)

    Xu, Guotai; Chapman, J. Ross; Brandsma, Inger; Yuan, Jingsong; Mistrik, Martin; Bouwman, Peter; Bartkova, Jirina; Gogola, Ewa; Warmerdam, Daniël; Barazas, Marco; Jaspers, Janneke E.; Watanabe, Kenji; Pieterse, Mark; Kersbergen, Ariena; Sol, Wendy; Celie, Patrick H. N.; Schouten, Philip C.; van den Broek, Bram; Salman, Ahmed; Nieuwland, Marja; de Rink, Iris; de Ronde, Jorma; Jalink, Kees; Boulton, Simon J.; Chen, Junjie; van Gent, Dik C.; Bartek, Jiri; Jonkers, Jos; Borst, Piet; Rottenberg, Sven

    2015-01-01

    Error-free repair of DNA double-strand breaks (DSBs) is achieved by homologous recombination (HR), and BRCA1 is an important factor for this repair pathway(1). In the absence of BRCA1-mediated HR, the administration of PARP inhibitors induces synthetic lethality of tumour cells of patients with

  3. DNA double-strand break rejoining in human follicular lymphoma and glioblastoma tumor cells

    NARCIS (Netherlands)

    Macann, AMJ; Britten, RA; Poppema, S; Pearcey, R; Rosenberg, E; Allalunis-Turner, MJ; Murray, D

    2000-01-01

    Follicle center cell lymphoma is among the most radioresponsive of human cancers. To assess whether this radioresponsiveness might be a result of a compromised ability of the tumor cells to accomplish the biologically-effective repair of DNA double-strand breaks (DSBs), we have measured i) the

  4. Multiple pathways of DNA double-strand break processing in a mutant Indian muntjac cell line

    International Nuclear Information System (INIS)

    Bouffler, S.D.; Jha, B.; Johnson, R.T.

    1990-01-01

    DNA break processing is compared in the Indian muntjac cell lines, SVM and DM. The initial frequencies and resealing of X-ray generated single- and double-strand breaks are similar in the two cell lines. Inhibiting the repair of UV damage leads to greater double-strand breakage in SVM than in DM, and some of these breaks are not repaired; however, repair-associated single-strand breakage and resealing are normal. Dimethylsulfate also induces excess double-strand breakage in SVM, and these breaks are irreparable. Restricted plasmids are reconstituted correctly in SVM at approximately 30% of the frequency observed in DM. Thus SVM has a reduced capacity to repair certain types of double-strand break. This defect is not due to a DNA ligase deficiency. We conclude that DNA double-strand breaks are repaired by a variety of pathways within mammalian cells and that the structure of the break or its mode of formation determines its subsequent fate

  5. Use of RAPD and PCR double amplification in the study of ancient DNA

    Directory of Open Access Journals (Sweden)

    F. Balzano

    2011-01-01

    Full Text Available This project analysed the DNA extracted from bones of ancient sheep which have been brought to light in Sardinian different archaeological sites. In order to better analyse this highly fragmented DNA, a double amplification technique was chosen. The first approach consisted of RAPD-PCR abd the second one in classic PCR. The RAPD-PCR amplified random fragments and allowed the production of numerous amplicons. The products of RAPD amplification have been amplified, more specifically, by the second PCR using primers for a sequence of 176 bp of mitochondrial D-loop region. These DNA fragments have been sequenced and the sequence analysis has confirmed that it belonged to Ovis aries. Consequently, this provedure can be considered a valid tool to perform amplification of degraded DNA, such as ancient DNA.

  6. APOBEC3 cytidine deaminases in double-strand DNA break repair and cancer promotion.

    Science.gov (United States)

    Nowarski, Roni; Kotler, Moshe

    2013-06-15

    High frequency of cytidine to thymidine conversions was identified in the genome of several types of cancer cells. In breast cancer cells, these mutations are clustered in long DNA regions associated with single-strand DNA (ssDNA), double-strand DNA breaks (DSB), and genomic rearrangements. The observed mutational pattern resembles the deamination signature of cytidine to uridine carried out by members of the APOBEC3 family of cellular deaminases. Consistently, APOBEC3B (A3B) was recently identified as the mutational source in breast cancer cells. A3G is another member of the cytidine deaminases family predominantly expressed in lymphoma cells, where it is involved in mutational DSB repair following ionizing radiation treatments. This activity provides us with a new paradigm for cancer cell survival and tumor promotion and a mechanistic link between ssDNA, DSBs, and clustered mutations. Cancer Res; 73(12); 3494-8. ©2013 AACR. ©2013 AACR.

  7. Carbon ion induced DNA double-strand breaks in melanophore B{sub 16}

    Energy Technology Data Exchange (ETDEWEB)

    Zengquan, Wei; Guangming, Zhou; Jufang, Wang; Jing, He; Qiang, Li; Wenjian, Li; Hongmei, Xie; Xichen, Cai; Huang, Tao; Bingrong, Dang; Guangwu, Han [Chinese Academy of Sciences, Lanzhou (China). Inst. of Modern Physics; Qingxiang, Gao [Lanzhou Univ. (China)

    1997-09-01

    DNA double-strand breaks (DSBs) in melanophore B{sub 16} induced by plateau and extended Bragg peak of 75 MeV/u {sup 12}C{sup 6+} ions were studied by using a technique of inverse pulsed-field gel electrophoresis (PIGE). DNA fragment lengths were distributed in two ranges: the larger in 1.4 Mbp-3.2 Mbp and the smaller in less than 1.2 Mbp. It indicates that distribution of DNA fragments induced by heavy ion irradiation is not stochastic and there probably are sensitive sites to heavy ions in DNA molecules of B{sub 16}. Percentage of DNA released from plug (PR) increased and trended towards a quasi-plateau {proportional_to}85% as dose increased. Content of the larger fragments decreased and flattened with increasing dose while content of the smaller ones increased and trended towards saturation. (orig.)

  8. Carbon ion induced DNA double-strand breaks in melanophore B16

    International Nuclear Information System (INIS)

    Wei Zengquan; Zhou Guangming; Wang Jufang; He Jing; Li Qiang; Li Wenjian; Xie Hongmei; Cai Xichen; Tao Huang; Dang Bingrong; Han Guangwu

    1997-01-01

    DNA double-strand breaks (DSBs) in melanophore B 16 induced by plateau and extended Bragg peak of 75 MeV/u 12 C 6+ ions were studied by using a technique of inverse pulsed-field gel electrophoresis (PIGE). DNA fragment lengths were distributed in two ranges: the larger in 1.4 Mbp-3.2 Mbp and the smaller in less than 1.2 Mbp. It indicates that distribution of DNA fragments induced by heavy ion irradiation is not stochastic and there probably are sensitive sites to heavy ions in DNA molecules of B 16 . Percentage of DNA released from plug (PR) increased and trended towards a quasi-plateau ∝85% as dose increased. Content of the larger fragments decreased and flattened with increasing dose while content of the smaller ones increased and trended towards saturation. (orig.)

  9. DNA Mapping Made Simple: An Intellectual Activity about the Genetic Modification of Organisms

    Science.gov (United States)

    Marques, Miguel; Arrabaca, Joao; Chagas, Isabel

    2004-01-01

    Since the discovery of the DNA double helix (in 1953 by Watson and Crick), technologies have been developed that allow scientists to manipulate the genome of bacteria to produce human hormones, as well as the genome of crop plants to achieve high yield and enhanced flavor. The universality of the genetic code has allowed DNA isolated from a…

  10. On the identification techniques for ionizing radiation structure breaks in the DNA molecule

    International Nuclear Information System (INIS)

    Kamluk, A.N.; Shirko, A.V.; Zhavarankau, I.S.

    2012-01-01

    In this paper, we propose a theoretical method for evaluation of the number and locations of single-strand breaks in DNA using a change in the passage of a longitudinal wave along the double helix. A linear chain of n interacting particles connected by a pair of springs is taken as a model of the DNA molecule. (authors)

  11. Nucleic acid helices: I. Structure of M1 RNA from E. coli as determined bypsoralen crosslinking. II. Thermodynamics of the helix-coil transition of DNA oligonucleotides in solutions containing 3.0 M tetramethylammonium chloride

    International Nuclear Information System (INIS)

    Lipson, S.E.

    1987-01-01

    This work includes two different investigations examining nucleic acid helices. The first study discusses secondary and tertiary interactions in the RNA moiety of ribonuclease P from Escherichia coli. The second study discusses the thermodynamics of the helix-coil transition of DNA oligonucleotides in solutions containing tetramethylammonium chloride. The RNA moiety of ribonuclease P from Escherichia coli (M1 RNA) has been photoreacted with 4'-hydroxymethyl-4,5'8-trimethylpsoralen and long wave UV light (320-380 nm) in a buffer in which the M1 RNA alone acts as a true catalyst of tRNA processing. Limited specific digestion followed by two dimensional gel electrophoresis yields fragments crosslinked by HMT. The positions of the crosslinks have been determined to within ±15 nucleotides by photoreversal of the isolated crosslinked fragments and enzymatic sequencing of the resulting RNA. Further assignments of the exact locations of the crosslinks have been made on the known photoreactivity of the psoralen with different bases

  12. Correlation between residual level of DNA double-strand breaks and the radiosensitivity of cancer cells

    International Nuclear Information System (INIS)

    Sun Jianxiang; Sun Weijian; Sui Jianli; Zhou Pingkun

    2008-01-01

    Objective: To understand the variation of the DNA double-strand break rejoining capacity among different cultured cancer cell lines and the primary cancer cells from brain cancer patients, and to explore the predictor of radiotherapy responses of cancers. Methods: DNA double-strand breaks (DSBs) were induced by 60 Co γ-irradiation. Pulsed-field gel electrophoresis was used to analyze the initial production and rejoining of DNA DSBs. Radiosensitivity was determined by in vitro assay of clonogenic-forming capacity. Results: A wide variation of radiosensitivity, e.g. the survival parameter of Do varied from 0.65 to 2.15 Gy, was displayed among the eight cell lines derived from different type of cancers. Although differential level of initial DNA DSBs induced by 20 Gy γ-rays was observed among various cell lines, it was not correlated with the radiosensitivity. The deficiency of DNA DSB rejoining in radiosensitive cell lines was shown either in the early rapid-rejoining phase (SX-10 cells) or in the late slow-rejoining phase (A2780 cells). A significant relationship was observed between the residual level of DNA DSBs measured at 2 h post-20 Gy irradiation and the cellular radiosensitivity (D 0 or SF 2 ). The kinetic curves of rejoining DNA DSBs in the primary human brain tumor cells indicated a variation on DSB rejoining capacity among different individual tumor. The residual level of DNA DSBs after 2 h of rejoining post 20 Gy irradiation in primary human brain tumor cells is compatible to the results obtained in vitro culture cancer cell lines. Conclusions: The residual level of DNA DSBs is correlated with radioresistance of cancer cells, and the residual DNA damage is a useful parameter in predicting the response of tumor tissue to radiotherapy. (authors)

  13. A method for filling in the cohesive ends of double-stranded DNA using Pfu DNA polymerase.

    Science.gov (United States)

    Yang, Shaohui; Li, Xin; Ding, Dongfeng; Hou, Jianhua; Jin, Zhaoxia; Yu, Xinchun; Bo, Tao; Li, Weidong; Li, Minggang

    2005-12-01

    The present paper reports a highly efficient method of making blunt ends from cohesive ends of double-stranded DNA. Klenow fragment and Pfu DNA polymerases were used to fill in the cohesive ends. Since the transformation efficiency can directly reflect the filling-in efficiency, similar ligation and transformation conditions were used, and the filling-in efficiency was compared with the corresponding transformation efficiency. The results indicate that the filling-in efficiency of Pfu DNA polymerase was 1.96 times that of Klenow fragment and its efficiency was markedly higher than that of Klenow fragment (P<0.01). The optimization experiments on reaction conditions indicate, when the pH is 8.5 and the temperature is 74 degrees C, that the filling-in efficiency was highest upon using a buffer containing 3 mM MgSO4 and 300 microM dNTP.

  14. A model treating the DNA double-strand break repair inhibition by damage clustering

    International Nuclear Information System (INIS)

    Rosemann, M.; Abel, H.; Regel, K.

    1992-01-01

    A microdosimetric model for the interpretation of radiation induced irreparable DNA double-strand breaks was applied to the biological endpoint of chromosomal aberrations. The model explains irreparable DNA double-strand breaks in terms of break clustering in DNA subunits. The model predicts quite good chromosomal aberrations in gamma- and X-ray irradiated V79 cells and human lymphocytes. In the case of α-particle irradiation the presumption had to be made, that only the cells with indirect events in the nucleus (due to delta-electrons) reach the metaphase and are analysed. With the help of this model we are able to explain the peculiar effectiveness of ultrasoft C-X-rays in human lymphocytes. In addition, an interpretation of experiments with accelerated and spatially correlated particles is given. (author)

  15. DNA methylation alteration is a major consequence of genome doubling in autotetraploid Brassica rapa

    Directory of Open Access Journals (Sweden)

    Xu Yanhao

    2017-01-01

    Full Text Available Polyploids are typically classified as autopolyploids or allopolyploids based on the origin of their chromosome sets. Autopolyploidy is much more common than traditionally believed. Allopolyploidization, accompanied by genomic and transcriptomic changes, has been well investigated. In this study, genetic, DNA methylation and gene expression changes in autotetraploid Brassica rapa were investigated. No genetic alteration was detected using an amplified fragment length polymorphism (AFLP approach. Using a cDNA-AFLP approach, approximately 0.58% of fragments showed changes in gene expression in autotetraploid B. rapa. The methylation-sensitive amplification polymorphism (MSAP analysis showed that approximately 1.7% of the fragments underwent DNA methylation changes upon genome doubling, with hypermethylation and demethylation changes equally affected. Fragments displaying changes in gene expression and methylation status were isolated and then sequenced and characterized, respectively. This study showed that variation in cytosine methylation is a major consequence of genome doubling in autotetraploid Brassica rapa.

  16. DNA hydration studied by neutron fiber diffraction

    Energy Technology Data Exchange (ETDEWEB)

    Fuller, W.; Forsyth, V.T.; Mahendrasingam, A.; Langan, P.; Pigram, W.J. [Keele Univ. (United Kingdom)] [and others

    1994-12-31

    The development of neutron high angle fiber diffraction to investigate the location of water around the deoxyribonucleic acid (DNA) double-helix is described. The power of the technique is illustrated by its application to the D and A conformations of DNA using the single crystal diffractometer, D19, at the Institute Laue-Langevin, Grenoble and the time of flight diffractometer, SXD, at the Rutherford Appleton ISIS Spallation Neutron Source. These studies show the existence of bound water closely associated with the DNA. The patterns of hydration in these two DNA conformations are quite distinct and are compared to those observed in X-ray single crystal studies of two-stranded oligodeoxynucleotides. Information on the location of water around the DNA double-helix from the neutron fiber diffraction studies is combined with that on the location of alkali metal cations from complementary X-ray high angle fiber diffraction studies at the Daresbury Laboratory SRS using synchrotron radiation. These analyses emphasize the importance of viewing DNA, water and ions as a single system with specific interactions between the three components and provide a basis for understanding the effect of changes in the concentration of water and ions in inducing conformations] transitions in the DNA double-helix.

  17. DNA hydration studied by neutron fiber diffraction

    International Nuclear Information System (INIS)

    Fuller, W.; Forsyth, V.T.; Mahendrasingam, A.; Langan, P.; Pigram, W.J.

    1994-01-01

    The development of neutron high angle fiber diffraction to investigate the location of water around the deoxyribonucleic acid (DNA) double-helix is described. The power of the technique is illustrated by its application to the D and A conformations of DNA using the single crystal diffractometer, D19, at the Institute Laue-Langevin, Grenoble and the time of flight diffractometer, SXD, at the Rutherford Appleton ISIS Spallation Neutron Source. These studies show the existence of bound water closely associated with the DNA. The patterns of hydration in these two DNA conformations are quite distinct and are compared to those observed in X-ray single crystal studies of two-stranded oligodeoxynucleotides. Information on the location of water around the DNA double-helix from the neutron fiber diffraction studies is combined with that on the location of alkali metal cations from complementary X-ray high angle fiber diffraction studies at the Daresbury Laboratory SRS using synchrotron radiation. These analyses emphasize the importance of viewing DNA, water and ions as a single system with specific interactions between the three components and provide a basis for understanding the effect of changes in the concentration of water and ions in inducing conformations] transitions in the DNA double-helix

  18. Temperature-dependent conformations of exciton-coupled Cy3 dimers in double-stranded DNA

    Science.gov (United States)

    Kringle, Loni; Sawaya, Nicolas P. D.; Widom, Julia; Adams, Carson; Raymer, Michael G.; Aspuru-Guzik, Alán; Marcus, Andrew H.

    2018-02-01

    Understanding the properties of electronically interacting molecular chromophores, which involve internally coupled electronic-vibrational motions, is important to the spectroscopy of many biologically relevant systems. Here we apply linear absorption, circular dichroism, and two-dimensional fluorescence spectroscopy to study the polarized collective excitations of excitonically coupled cyanine dimers (Cy3)2 that are rigidly positioned within the opposing sugar-phosphate backbones of the double-stranded region of a double-stranded (ds)-single-stranded (ss) DNA fork construct. We show that the exciton-coupling strength of the (Cy3)2-DNA construct can be systematically varied with temperature below the ds-ss DNA denaturation transition. We interpret spectroscopic measurements in terms of the Holstein vibronic dimer model, from which we obtain information about the local conformation of the (Cy3)2 dimer, as well as the degree of static disorder experienced by the Cy3 monomer and the (Cy3)2 dimer probe locally within their respective DNA duplex environments. The properties of the (Cy3)2-DNA construct we determine suggest that it may be employed as a useful model system to test fundamental concepts of protein-DNA interactions and the role of electronic-vibrational coherence in electronic energy migration within exciton-coupled bio-molecular arrays.

  19. A flexible fluorescence correlation spectroscopy based method for quantification of the DNA double labeling efficiency with precision control

    International Nuclear Information System (INIS)

    Hou, Sen; Tabaka, Marcin; Sun, Lili; Trochimczyk, Piotr; Kaminski, Tomasz S; Kalwarczyk, Tomasz; Zhang, Xuzhu; Holyst, Robert

    2014-01-01

    We developed a laser-based method to quantify the double labeling efficiency of double-stranded DNA (dsDNA) in a fluorescent dsDNA pool with fluorescence correlation spectroscopy (FCS). Though, for quantitative biochemistry, accurate measurement of this parameter is of critical importance, before our work it was almost impossible to quantify what percentage of DNA is doubly labeled with the same dye. The dsDNA is produced by annealing complementary single-stranded DNA (ssDNA) labeled with the same dye at 5′ end. Due to imperfect ssDNA labeling, the resulting dsDNA is a mixture of doubly labeled dsDNA, singly labeled dsDNA and unlabeled dsDNA. Our method allows the percentage of doubly labeled dsDNA in the total fluorescent dsDNA pool to be measured. In this method, we excite the imperfectly labeled dsDNA sample in a focal volume of <1 fL with a laser beam and correlate the fluctuations of the fluorescence signal to get the FCS autocorrelation curves; we express the amplitudes of the autocorrelation function as a function of the DNA labeling efficiency; we perform a comparative analysis of a dsDNA sample and a reference dsDNA sample, which is prepared by increasing the total dsDNA concentration c (c > 1) times by adding unlabeled ssDNA during the annealing process. The method is flexible in that it allows for the selection of the reference sample and the c value can be adjusted as needed for a specific study. We express the precision of the method as a function of the ssDNA labeling efficiency or the dsDNA double labeling efficiency. The measurement precision can be controlled by changing the c value. (letter)

  20. Studies of Single Biomolecules, DNA Conformational Dynamics, and Protein Binding

    Science.gov (United States)

    2008-07-11

    Nucleotide Base pairs Hydrogen bonds FIG. 1: Ladder structure of DNA showing the Watson - Crick bonding of the bases A, T, G, and C which are suspended by a...protected against unwanted action of chemicals and proteins. The three-dimensional structure of DNA is the famed Watson - Crick double-helix, the equilibrium...quantitative analysis [88]. [1] A. Kornberg and T. A. Baker, DNA Replication (W. H. Freeman, New York, 1992). [2] J. D. Watson and F. H. C. Crick

  1. GC-Rich Extracellular DNA Induces Oxidative Stress, Double-Strand DNA Breaks, and DNA Damage Response in Human Adipose-Derived Mesenchymal Stem Cells

    Directory of Open Access Journals (Sweden)

    Svetlana Kostyuk

    2015-01-01

    Full Text Available Background. Cell free DNA (cfDNA circulates throughout the bloodstream of both healthy people and patients with various diseases. CfDNA is substantially enriched in its GC-content as compared with human genomic DNA. Principal Findings. Exposure of haMSCs to GC-DNA induces short-term oxidative stress (determined with H2DCFH-DA and results in both single- and double-strand DNA breaks (comet assay and γH2AX, foci. As a result in the cells significantly increases the expression of repair genes (BRCA1 (RT-PCR, PCNA (FACS and antiapoptotic genes (BCL2 (RT-PCR and FACS, BCL2A1, BCL2L1, BIRC3, and BIRC2 (RT-PCR. Under the action of GC-DNA the potential of mitochondria was increased. Here we show that GC-rich extracellular DNA stimulates adipocyte differentiation of human adipose-derived mesenchymal stem cells (haMSCs. Exposure to GC-DNA leads to an increase in the level of RNAPPARG2 and LPL (RT-PCR, in the level of fatty acid binding protein FABP4 (FACS analysis and in the level of fat (Oil Red O. Conclusions. GC-rich fragments in the pool of cfDNA can potentially induce oxidative stress and DNA damage response and affect the direction of mesenchymal stem cells differentiation in human adipose—derived mesenchymal stem cells. Such a response may be one of the causes of obesity or osteoporosis.

  2. The adsorption-desorption transition of double-stranded DNA interacting with an oppositely charged dendrimer induced by multivalent anions.

    Science.gov (United States)

    Jiang, Yangwei; Zhang, Dong; Zhang, Yaoyang; Deng, Zhenyu; Zhang, Linxi

    2014-05-28

    The adsorption-desorption transition of DNA in DNA-dendrimer solutions is observed when high-valence anions, such as hexavalent anions, are added to the DNA-dendrimer solutions. In the DNA-dendrimer solutions with low-valence anions, dendrimers bind tightly with the V-shaped double-stranded DNA. When high-valence anions, such as pentavalent or hexavalent anions, are added to the DNA-dendrimer solutions, the double-stranded DNA chains can be stretched straightly and the dendrimers are released from the double-stranded DNA chains. In fact, adding high-valence anions to the solutions can change the charge spatial distribution in the DNA-dendrimer solutions, and weaken the electrostatic interactions between the positively charged dendrimers and the oppositely charged DNA chains. Adsorption-desorption transition of DNA is induced by the overcharging of dendrimers. This investigation is capable of helping us understand how to control effectively the release of DNA in gene/drug delivery because an effective gene delivery for dendrimers includes non-covalent DNA-dendrimer binding and the effective release of DNA in gene therapy.

  3. Compound Poisson Processes and Clustered Damage of Radiation Induced DNA Double Strand Breaks

    International Nuclear Information System (INIS)

    Gudowska-Nowak, E.; Ritter, S.; Taucher-Scholz, G.; Kraft, G.

    2000-01-01

    Recent experimental data have demonstrated that DNA damage induced by densely ionizing radiation in mammalian cells is distributed along the DNA molecule in the form of clusters. The principal constituent of DNA damage are double-strand breaks (DSB) which are formed when the breaks occur in both DNA strands and are directly opposite or separated by only a few base pairs. DSBs are believed to be most important lesions produced in chromosomes by radiation; interaction between DSBs can lead to cell killing, mutation or carcinogenesis. The paper discusses a model of clustered DSB formation viewed in terms of compound Poisson process along with the predictive essay of the formalism in application to experimental data. (author)

  4. Photosensitization by iodinated DNA minor groove binding ligands: Evaluation of DNA double-strand break induction and repair.

    Science.gov (United States)

    Briggs, Benjamin; Ververis, Katherine; Rodd, Annabelle L; Foong, Laura J L; Silva, Fernando M Da; Karagiannis, Tom C

    2011-05-03

    Iodinated DNA minor groove binding bibenzimidazoles represent a unique class of UVA photosensitizer and their extreme photopotency has been previously characterized. Earlier studies have included a comparison of three isomers, referred to as ortho-, meta- and para-iodoHoechst, which differ only in the location of the iodine substituent in the phenyl ring of the bibenzimidazole. DNA breakage and clonogenic survival studies in human erythroleukemic K562 cells have highlighted the higher photo-efficiency of the ortho-isomer (subsequently designated UV(A)Sens) compared to the meta- and para-isomers. In this study, the aim was to compare the induction and repair of DNA double-strand breaks induced by the three isomers in K562 cells. Further, we examined the effects of the prototypical broad-spectrum histone deacetylase inhibitor, Trichostatin A, on ortho-iodoHoechst/UVA-induced double-strand breaks in K562 cells. Using γH2AX as a molecular marker of the DNA lesions, our findings indicate a disparity in the induction and particularly, in the repair kinetics of double-strand breaks for the three isomers. The accumulation of γH2AX foci induced by the meta- and para-isomers returned to background levels within 24 and 48 h, respectively; the number of γH2AX foci induced by ortho-iodoHoechst remained elevated even after incubation for 96 h post-irradiation. These findings provide further evidence that the extreme photopotency of ortho-iodoHoechst is due to not only to the high quantum yield of dehalogenation, but also to the severity of the DNA lesions which are not readily repaired. Finally, our findings which indicate that Trichostatin A has a remarkable potentiating effect on ortho-iodoHoechst/UVA-induced DNA lesions are encouraging, particularly in the context of cutaneous T-cell lymphoma, for which a histone deacetylase inhibitor is already approved for therapy. This finding prompts further evaluation of the potential of combination therapies. Copyright © 2011

  5. Formation of double-strand breaks in DNA of γ-irradiated bacteria depending on the function of fast repair processes of DNA single-strand breaks

    International Nuclear Information System (INIS)

    Petrov, S.I.; Gaziev, A.I.

    1980-01-01

    The formation of double-strand breaks in DNA of γ-irradiated ( 60 Co)Ex coli bacteria depending on the function of fast repair processes of DNA single-strand breaks, is investigated. The profiles of sedimentation of DNA Ex coli cells, irradiated at 0-2 deg C in the salt medium and in EDTA-borate buffer, are presented. It is shown that when irradiating cells in EDTA-borate buffer, the output of single- and double strand breaks in DNA is much higher than in the case of their irradiation in the minimum salt medium. The dependence of output of single-strand and double-strand breaks depending on the radiatier doze of E coli cells in the salt medium and EDTA-borate buffer, is studied. The supposition is made on the presence of a regulative interaction between the accumulation of DNA single-breaks and their repair with the formation of double-strand breaks. The functionating of fast and superfast repair processes considerably affects the formation of double-strand breaks in DNA of a bacterium cell. A considerable amount of double-breaks registered immediately after irradiation forms due to a close position of single-strand breaks on the opposite DNA strands

  6. A supramolecular ''Double-cable'' structure with a 129{sub 44} helix in a columnar porphyrin-C{sub 60} dyad and its application in polymer solar cells

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Chien-Lung [College of Polymer Science and Polymer Engineering, The University of Akron, Akron, OH (United States); Department of Applied Chemistry, National Chiao Tung University, Hsinchu, Taiwan (China); Zhang, Wen-Bin; Sun, Hao-Jan; Van Horn, Ryan M.; Kulkarni, Rahul R.; Tsai, Chi-Chun; Gong, Xiong; Cheng, Stephen Z.D. [College of Polymer Science and Polymer Engineering, The University of Akron, Akron, OH (United States); Hsu, Chain-Shu [Department of Applied Chemistry, National Chiao Tung University, Hsinchu, Taiwan (China); Lotz, Bernard [Institut Charles Sadron, Strasbourg (France)

    2012-11-15

    A novel porphyrin-C{sub 60} dyad (PCD1) is designed and synthesized to investigate and manipulate the supramolecular structure where geometrically isotropic [such as [60]fullerene (C{sub 60})] and anisotropic [such as porphyrin (Por)] units coexist. It is observed that PCD1 possesses an enantiomeric phase behavior. The melting temperature of the stable PCD1 thermotropic phase is 160 C with a latent heat ({Delta}H) of 18.5 kJ mol{sup -1}. The phase formation is majorly driven by the cooperative intermolecular Por-Por and C{sub 60}-C{sub 60} interactions. Structural analysis reveals that this stable phase possesses a supramolecular ''double-cable'' structure with one p-type Por core columnar channel and three helical n-type C{sub 60} peripheral channels. These ''double-cable'' columns further pack into a hexagonal lattice with a = b = 4.65 nm, c = 41.3 nm, {alpha} = {beta} = 90 , and {gamma} = 120 . The column repeat unit is determined to possess a 129{sub 44} helix. With both donor (D; Pro) and acceptor (A; C{sub 60}) units having their own connecting channels as well as the large D/A interface within the supramolecular ''double-cable'' structure, PCD1 has photogenerated carriers with longer lifetimes compared to the conventional electron acceptor [6,6]-phenyl-C{sub 61}-butyric acid methyl ester. A phase-separated columnar morphology is observed in a bulk-heterojunction (BHJ) material made by the physical blend of a low band-gap conjugated polymer, poly[2,6-(4,4-bis-(2-ethylhexyl)-4H-cyclopenta [2,1-b;3,4-b']-dithiophene)-alt-4,7-(2,1,3-benzothia-diazole)] (PCPDTBT), and PCD1. With a specific phase structure in the solid state and in the blend, PCD1 is shown to be a promising candidate as a new electron acceptor in high performance BHJ polymer solar cells. (Copyright copyright 2012 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  7. Defective double-strand DNA break repair and chromosomal translocations by MYC overexpression.

    Science.gov (United States)

    Karlsson, Asa; Deb-Basu, Debabrita; Cherry, Athena; Turner, Stephanie; Ford, James; Felsher, Dean W

    2003-08-19

    DNA repair mechanisms are essential for the maintenance of genomic integrity. Disruption of gene products responsible for DNA repair can result in chromosomal damage. Improperly repaired chromosomal damage can result in the loss of chromosomes or the generation of chromosomal deletions or translocations, which can lead to tumorigenesis. The MYC protooncogene is a transcription factor whose overexpression is frequently associated with human neoplasia. MYC has not been previously implicated in a role in DNA repair. Here we report that the overexpression of MYC disrupts the repair of double-strand DNA breaks, resulting in a several-magnitude increase in chromosomal breaks and translocations. We found that MYC inhibited the repair of gamma irradiation DNA breaks in normal human cells and blocked the repair of a single double-strand break engineered to occur in an immortal cell line. By spectral karyotypic analysis, we found that MYC even within one cell division cycle resulted in a several-magnitude increase in the frequency of chromosomal breaks and translocations in normal human cells. Hence, MYC overexpression may be a previously undescribed example of a dominant mutator that may fuel tumorigenesis by inducing chromosomal damage.

  8. Activation of a yeast replication origin near a double-stranded DNA break.

    Science.gov (United States)

    Raghuraman, M K; Brewer, B J; Fangman, W L

    1994-03-01

    Irradiation in the G1 phase of the cell cycle delays the onset of DNA synthesis and transiently inhibits the activation of replication origins in mammalian cells. It has been suggested that this inhibition is the result of the loss of torsional tension in the DNA after it has been damaged. Because irradiation causes DNA damage at an undefined number of nonspecific sites in the genome, it is not known how cells respond to limited DNA damage, and how replication origins in the immediate vicinity of a damage site would behave. Using the sequence-specific HO endonuclease, we have created a defined double-stranded DNA break in a centromeric plasmid in G1-arrested cells of the yeast Saccharomyces cerevisiae. We show that replication does initiate at the origin on the cut plasmid, and that the plasmid replicates early in the S phase after linearization in vivo. These observations suggest that relaxation of a supercoiled DNA domain in yeast need not inactivate replication origins within that domain. Furthermore, these observations rule out the possibility that the late replication context associated with chromosomal termini is a consequence of DNA ends.

  9. Methylproamine protects against ionizing radiation by preventing DNA double-strand breaks

    International Nuclear Information System (INIS)

    Sprung, Carl N.; Vasireddy, Raja S.; Karagiannis, Tom C.; Loveridge, Shanon J.; Martin, Roger F.; McKay, Michael J.

    2010-01-01

    Purpose: The majority of cancer patients will receive radiotherapy (RT), therefore, investigations into advances of this modality are important. Conventional RT dose intensities are limited by adverse responses in normal tissues and a primary goal is to ameliorate adverse normal tissue effects. The aim of these experiments is to further our understanding regarding the mechanism of radioprotection by the DNA minor groove binder, methylproamine, in a cellular context at the DNA level. Materials and methods: We used immunocytochemical methods to measure the accumulation of phosphorylated H2AX (γH2AX) foci following ionizing radiation (IR) in patient-derived lymphoblastoid cells exposed to methylproamine. Furthermore, we performed pulsed field gel electrophoresis DNA damage and repair assays to directly interrogate the action of methylproamine on DNA in irradiated cells. Results: We found that methylproamine-treated cells had fewer γH2AX foci after IR compared to untreated cells. Also, the presence of methylproamine decreased the amount of lower molecular weight DNA entering the gel as shown by the pulsed field gel electrophoresis assay. Conclusions: These results suggest that methylproamine acts by preventing the formation of DNA double-strand breaks (dsbs) and support the hypothesis that radioprotection by methylproamine is mediated, at least in part, by decreasing initial DNA damage.

  10. Pathways for double-strand break repair in genetically unstable Z-DNA-forming sequences.

    Science.gov (United States)

    Kha, Diem T; Wang, Guliang; Natrajan, Nithya; Harrison, Lynn; Vasquez, Karen M

    2010-05-14

    DNA can adopt many structures that differ from the canonical B-form, and several of these non-canonical DNA structures have been implicated in genetic instability associated with human disease. Earlier, we found that Z-DNA causes DNA double-strand breaks (DSBs) in mammalian cells that can result in large-scale deletions and rearrangements. In contrast, the same Z-DNA-forming CG repeat in Escherichia coli resulted in only small contractions or expansions within the repeat. This difference in the Z-DNA-induced mutation spectrum between mammals and bacteria might be due to different mechanisms for DSB repair; in mammalian cells, non-homologous end-joining (NHEJ) is a major DSB repair pathway, while E. coli do not contain this system and typically use homologous recombination (HR) to process DSBs. To test the extent to which the different DSB repair pathways influenced the Z-DNA-induced mutagenesis, we engineered bacterial E.coli strains to express an inducible NHEJ system, to mimic the situation in mammalian cells. Mycobacterium tuberculosis NHEJ proteins Ku and ligase D (LigD) were expressed in E.coli cells in the presence or absence of HR, and the Z-DNA-induced mutations were characterized. We found that the presence of the NHEJ mechanism markedly shifted the mutation spectrum from small deletions/insertions to large-scale deletions (from 2% to 24%). Our results demonstrate that NHEJ plays a role in the generation of Z-DNA-induced large-scale deletions, suggesting that this pathway is associated with DNA structure-induced destabilization of genomes from prokaryotes to eukaryotes. (c) 2010 Elsevier Ltd. All rights reserved.

  11. Single helically folded aromatic oligoamides that mimic the charge surface of double-stranded B-DNA

    Science.gov (United States)

    Ziach, Krzysztof; Chollet, Céline; Parissi, Vincent; Prabhakaran, Panchami; Marchivie, Mathieu; Corvaglia, Valentina; Bose, Partha Pratim; Laxmi-Reddy, Katta; Godde, Frédéric; Schmitter, Jean-Marie; Chaignepain, Stéphane; Pourquier, Philippe; Huc, Ivan

    2018-05-01

    Numerous essential biomolecular processes require the recognition of DNA surface features by proteins. Molecules mimicking these features could potentially act as decoys and interfere with pharmacologically or therapeutically relevant protein-DNA interactions. Although naturally occurring DNA-mimicking proteins have been described, synthetic tunable molecules that mimic the charge surface of double-stranded DNA are not known. Here, we report the design, synthesis and structural characterization of aromatic oligoamides that fold into single helical conformations and display a double helical array of negatively charged residues in positions that match the phosphate moieties in B-DNA. These molecules were able to inhibit several enzymes possessing non-sequence-selective DNA-binding properties, including topoisomerase 1 and HIV-1 integrase, presumably through specific foldamer-protein interactions, whereas sequence-selective enzymes were not inhibited. Such modular and synthetically accessible DNA mimics provide a versatile platform to design novel inhibitors of protein-DNA interactions.

  12. Real Estate in the DNA Damage Response: Ubiquitin and SUMO Ligases Home in on DNA Double-Strand Breaks.

    Science.gov (United States)

    Dantuma, Nico P; Pfeiffer, Annika

    2016-01-01

    Ubiquitin and the ubiquitin-like modifier SUMO are intimately connected with the cellular response to various types of DNA damage. A striking feature is the local accumulation of these proteinaceous post-translational modifications in the direct vicinity to DNA double-strand breaks, which plays a critical role in the formation of ionizing radiation-induced foci. The functional significance of these modifications is the coordinated recruitment and removal of proteins involved in DNA damage signaling and repair in a timely manner. The central orchestrators of these processes are the ubiquitin and SUMO ligases that are responsible for accurately tagging a broad array of chromatin and chromatin-associated proteins thereby changing their behavior or destination. Despite many differences in the mode of action of these enzymes, they share some striking features that are of direct relevance for their function in the DNA damage response. In this review, we outline the molecular mechanisms that are responsible for the recruitment of ubiquitin and SUMO ligases and discuss the importance of chromatin proximity in this process.

  13. In vivo formation and repair of DNA double-strand breaks after computed tomography examinations

    OpenAIRE

    Löbrich, Markus; Rief, Nicole; Kühne, Martin; Heckmann, Martina; Fleckenstein, Jochen; Rübe, Christian; Uder, Michael

    2005-01-01

    Ionizing radiation can lead to a variety of deleterious effects in humans, most importantly to the induction of cancer. DNA double-strand breaks (DSBs) are among the most significant genetic lesions introduced by ionizing radiation that can initiate carcinogenesis. We have enumerated γ-H2AX foci as a measure for DSBs in lymphocytes from individuals undergoing computed tomography examination of the thorax and/or the abdomen. The number of DSBs induced by computed tomography examination was fou...

  14. Effects of heavy ions on inactivation and DNA double strand breaks in Deinococcus radiodurans R1.

    Science.gov (United States)

    Zimmermann, H; Schafer, M; Schmitz, C; Bucker, H

    1994-10-01

    Inactivation and double strand break (dsb) induction after heavy ion irradiation were studied in stationary phase cells of the highly radiation resistant bacterium Deinococcus radiodurans R1. There is evidence that the radiation sensitivity of this bacterium is nearly independent on energy in the range of up to 15 MeV/u for lighter ions (Ar). The responses to dsb induction for charged particles show direct relationship between increasing radiation dose and residual intact DNA.

  15. DNA topology and transcription

    Science.gov (United States)

    Kouzine, Fedor; Levens, David; Baranello, Laura

    2014-01-01

    Chromatin is a complex assembly that compacts DNA inside the nucleus while providing the necessary level of accessibility to regulatory factors conscripted by cellular signaling systems. In this superstructure, DNA is the subject of mechanical forces applied by variety of molecular motors. Rather than being a rigid stick, DNA possesses dynamic structural variability that could be harnessed during critical steps of genome functioning. The strong relationship between DNA structure and key genomic processes necessitates the study of physical constrains acting on the double helix. Here we provide insight into the source, dynamics, and biology of DNA topological domains in the eukaryotic cells and summarize their possible involvement in gene transcription. We emphasize recent studies that might inspire and impact future experiments on the involvement of DNA topology in cellular functions. PMID:24755522

  16. Fine resolution mapping of double-strand break sites for human ribosomal DNA units

    Directory of Open Access Journals (Sweden)

    Bernard J. Pope

    2016-12-01

    Full Text Available DNA breakage arises during a variety of biological processes, including transcription, replication and genome rearrangements. In the context of disease, extensive fragmentation of DNA has been described in cancer cells and during early stages of neurodegeneration (Stephens et al., 2011 Stephens et al. (2011 [5]; Blondet et al., 2001 Blondet et al. (2001 [1]. Stults et al. (2009 Stults et al. (2009 [6] reported that human rDNA gene clusters are hotspots for recombination and that rDNA restructuring is among the most common chromosomal alterations in adult solid tumours. As such, analysis of rDNA regions is likely to have significant prognostic and predictive value, clinically. Tchurikov et al. (2015a, 2016 Tchurikov et al. (2015a, 2016 [7,9] have made major advances in this direction, reporting that sites of human genome double-strand breaks (DSBs occur frequently at sites in rDNA that are tightly linked with active transcription - the authors used a RAFT (rapid amplification of forum termini protocol that selects for blunt-ended sites. They reported the relative frequency of these rDNA DSBs within defined co-ordinate ‘windows’ of varying size and made these data (as well as the relevant ‘raw’ sequencing information available to the public (Tchurikov et al., 2015b. Assay designs targeting rDNA DSB hotspots will benefit greatly from the publication of break sites at greater resolution. Here, we re-analyse public RAFT data and make available rDNA DSB co-ordinates to the single-nucleotide level.

  17. Elevated Subclinical Double-Stranded DNA Antibodies and Future Proliferative Lupus Nephritis

    Science.gov (United States)

    Lee, Jessica J.; Prince, Lisa K.; Baker, Thomas P.; Papadopoulos, Patricia; Edison, Jess; Abbott, Kevin C.

    2013-01-01

    Summary Background and objectives Elevated anti–double-stranded DNA (dsDNA) antibody and C-reactive protein are associated with proliferative lupus nephritis (PLN). Progression of quantitative anti-dsDNA antibody in patients with PLN has not been compared with that in patients with systemic lupus erythematosus (SLE) without LN before diagnosis. The temporal relationship between anti-dsDNA antibody and C-reactive protein elevation has also not been evaluated. Design, setting, participants, & measurements This case-control Department of Defense Serum Repository (established in 1985) study compared longitudinal prediagnostic quantitative anti-dsDNA antibody and C-reactive protein levels in 23 patients with biopsy-proven PLN (Walter Reed Army Medical Center, 1993–2009) with levels in 21 controls with SLE but without LN matched for patient age, sex, race, and age of serum sample. The oldest (median, 2601 days; 25%, 1245 days, 75%, 3075 days), the second to last (368; 212, 635 days), and the last (180; 135, 477 days) serum sample before diagnosis were analyzed. Results More patients with PLN had an elevated anti-dsDNA antibody level than did the matched controls at any point (78% versus 5%; P4 years (33% versus 0%; P=0.04) before diagnosis. A rate of increase >1 IU/ml per year (70% versus 0%; P<0.001) was most specific for PLN. The anti-dsDNA antibody levels increased before C-reactive protein did in most patients with an antecedent elevation (92% versus 8%; P<0.001). Conclusions Elevated anti-dsDNA antibody usually precedes both clinical and subclinical evidence of proliferative LN, which suggests direct pathogenicity. Absolute anti-dsDNA antibody level and rate of increase could better establish risk of future PLN in patients with SLE. PMID:23833315

  18. The Ku heterodimer and the metabolism of single-ended DNA double-strand breaks.

    Science.gov (United States)

    Balestrini, Alessia; Ristic, Dejan; Dionne, Isabelle; Liu, Xiao Z; Wyman, Claire; Wellinger, Raymund J; Petrini, John H J

    2013-06-27

    Single-ended double-strand breaks (DSBs) are a common form of spontaneous DNA break, generated when the replisome encounters a discontinuity in the DNA template. Given their prevalence, understanding the mechanisms governing the fate(s) of single-ended DSBs is important. We describe the influence of the Ku heterodimer and Mre11 nuclease activity on processing of single-ended DSBs. Separation-of-function alleles of yku70 were derived that phenocopy Ku deficiency with respect to single-ended DSBs but remain proficient for NHEJ. The Ku mutants fail to regulate Exo1 activity, and bypass the requirement for Mre11 nuclease activity in the repair of camptothecin-induced single-ended DSBs. Ku mutants exhibited reduced affinity for DNA ends, manifest as both reduced end engagement and enhanced probability of diffusing inward on linear DNA. This study reveals an interplay between Ku and Mre11 in the metabolism of single-ended DSBs that is distinct from repair pathway choice at double-ended DSBs. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.

  19. The Ku Heterodimer and the Metabolism of Single-Ended DNA Double-Strand Breaks

    Directory of Open Access Journals (Sweden)

    Alessia Balestrini

    2013-06-01

    Full Text Available Single-ended double-strand breaks (DSBs are a common form of spontaneous DNA break, generated when the replisome encounters a discontinuity in the DNA template. Given their prevalence, understanding the mechanisms governing the fate(s of single-ended DSBs is important. We describe the influence of the Ku heterodimer and Mre11 nuclease activity on processing of single-ended DSBs. Separation-of-function alleles of yku70 were derived that phenocopy Ku deficiency with respect to single-ended DSBs but remain proficient for NHEJ. The Ku mutants fail to regulate Exo1 activity, and bypass the requirement for Mre11 nuclease activity in the repair of camptothecin-induced single-ended DSBs. Ku mutants exhibited reduced affinity for DNA ends, manifest as both reduced end engagement and enhanced probability of diffusing inward on linear DNA. This study reveals an interplay between Ku and Mre11 in the metabolism of single-ended DSBs that is distinct from repair pathway choice at double-ended DSBs.

  20. Inhibition of DNA-double strand break repair by antimony compounds

    International Nuclear Information System (INIS)

    Takahashi, Sentaro; Sato, Hiroshi; Kubota, Yoshihisa; Utsumi, Hiroshi; Bedford, Joel S.; Okayasu, Ryuichi

    2002-01-01

    DNA double strand breaks (DSBs), induced by γ-irradiation in Chinese hamster ovary cells, were used to examine whether antimony compounds affect the repair of DNA damage. The cells were first incubated with antimony trichloride or antimony potassium tartrate (both Sb(III)) for 2 h, and then irradiated with γ-rays at a dose of 40 Gy. The DNA DSB was quantified with pulsed field gel electrophoresis immediately after irradiation (non-repair group) as well as at 30 min post-irradiation (repair group). The degree of repair inhibition was determined by the differences in the amount of DNA DSB between non-repair and repair groups. Both antimony compounds inhibited repair of DNA DSB in a dose dependent manner. In trichloride, 0.2 mM antimony significantly inhibited the rejoining of DSB, while 0.4 mM was necessary in potassium antimony tartrate. The mean lethal doses, D 0 , for the treatment with antimony trichloride and antimony potassium tartrate, were approximately 0.21 and 0.12 mM, respectively. This indicates that the repair inhibition by antimony trichloride occurred in the dose range near D 0 , but the antimony potassium tartrate inhibited the repair at doses where most cells lost their proliferating ability. This is the first report to indicate that antimony compounds may inhibit the repair of radiation-induced DNA DSB

  1. Two pathways of DNA double-strand break repair in G1 cells of Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Glazunov, A.V.

    1988-01-01

    The G1 cells of the diploid yeast Saccharomyces cerevislae are known to be capable of a slow repair of DNA double-strand breaks (DSB) during holding the cells in a non-nutrient medium. In the present paper, it has been shown that S. cerevislae cells γ-irradiated in the G1 phase of cell cycle are capable of fast repair of DNA DSB; this process is completed within 30-40 min of holding the cells in water at 28 deg C. For this reason, the kinetics of DNA DSB repair during holding the cells in a non-nutrient medium are biphasic, i.e., the first, ''fast'' phase is completed within 30-40 min; wheras the second, ''slow'' one, within 48 h. Mutations rad51, rad52, rad54 and rad55 inhibit the fast repair of DNA DSB, whereas mutations rad50, rad53 and rad57 do not practically influence this process. It has been shown that the observed fast and slow repair of DNA DSB in the G1 diploid cells of S, cerevislae are separate pathways of DNA DSB repair in yeast

  2. Ionizing-radiation induced DNA double-strand breaks: A direct and indirect lighting up

    International Nuclear Information System (INIS)

    Vignard, Julien; Mirey, Gladys; Salles, Bernard

    2013-01-01

    The occurrence of DNA double-strand breaks (DSBs) induced by ionizing radiation has been extensively studied by biochemical or cell imaging techniques. Cell imaging development relies on technical advances as well as our knowledge of the cell DNA damage response (DDR) process. The DDR involves a complex network of proteins that initiate and coordinate DNA damage signaling and repair activities. As some DDR proteins assemble at DSBs in an established spatio-temporal pattern, visible nuclear foci are produced. In addition, post-translational modifications are important for the signaling and the recruitment of specific partners at damaged chromatin foci. We briefly review here the most widely used methods to study DSBs. We also discuss the development of indirect methods, using reporter expression or intra-nuclear antibodies, to follow the production of DSBs in real time and in living cells

  3. Single-Molecule Manipulation of Double-Stranded DNA Using Optical Tweezers: Interaction Studies of DNA with RecA and YOYO-1

    NARCIS (Netherlands)

    Bennink, Martin L.; Scharer, Orlando D.; Kanaar, Ronald; Sakata-Sogawa, Kumiko; Schins, J.M.; Kanger, Johannes S.; de Grooth, B.G.; Greve, Jan

    1999-01-01

    By using optical tweezers and a specially designed flow cell with an integrated glass micropipette, we constructed a setup similar to that of Smith et al. (Science 271:795-799, 1996) in which an individual double-stranded DNA (dsDNA) molecule can be captured between two polystyrene beads. The first

  4. Concentric Titled Double-Helix Dipole Magnets

    International Nuclear Information System (INIS)

    Rainer Meinke, Ph.D; Carl Goodzeit; Millicent Ball, Ph.D

    2003-01-01

    The high magnetic fields required for future accelerator magnets can only be achieved with Nb3Sn, other A15 or HTS type conductors, which are brittle and sensitive to mechanical strain. The traditional ''cosine-theta'' dipole configuration has intrinsic drawbacks that make it difficult and expensive to employ such conductors in these designs. Some of these problems involve (1) difficulty in applying enough pre-stress to counteract Lorentz forces without compromising conductor performance; (2) small minimum bend radii of the conductor necessitating the intricate wind-and-react coil fabrication; (3) complex spacers in particular for coil ends and expensive tooling for coil fabrication; (4) typically only 2/3 of the coil aperture can be used with achievable field uniformity

  5. Genetic polymorphisms of DNA double-strand break repair pathway genes and glioma susceptibility

    International Nuclear Information System (INIS)

    Zhao, Peng; Zou, Peng; Zhao, Lin; Yan, Wei; Kang, Chunsheng; Jiang, Tao; You, Yongping

    2013-01-01

    Genetic variations in DNA double-strand break repair genes can influence the ability of a cell to repair damaged DNA and alter an individual’s susceptibility to cancer. We studied whether polymorphisms in DNA double-strand break repair genes are associated with an increased risk of glioma development. We genotyped 10 potentially functional single nucleotide polymorphisms (SNPs) in 7 DNA double-strand break repair pathway genes (XRCC3, BRCA2, RAG1, XRCC5, LIG4, XRCC4 and ATM) in a case–control study including 384 glioma patients and 384 cancer-free controls in a Chinese Han population. Genotypes were determined using the OpenArray platform. In the single-locus analysis there was a significant association between gliomas and the LIG4 rs1805388 (Ex2 +54C>T, Thr9Ile) TT genotype (adjusted OR, 3.27; 95% CI, 1.87-5.71), as well as the TC genotype (adjusted OR, 1.62; 95% CI, 1.20-2.18). We also found that the homozygous variant genotype (GG) of XRCC4 rs1805377 (IVS7-1A>G, splice-site) was associated with a significantly increased risk of gliomas (OR, 1.77; 95% CI, 1.12-2.80). Interestingly, we detected a significant additive and multiplicative interaction effect between the LIG4 rs1805388 and XRCC4 rs1805377 polymorphisms with an increasing risk of gliomas. When we stratified our analysis by smoking status, LIG4 rs1805388 was associated with an increased glioma risk among smokers. These results indicate for the first time that LIG4 rs1805388 and XRCC4 rs1805377, alone or in combination, are associated with a risk of gliomas

  6. Molecular Basis for DNA Double-Strand Break Annealing and Primer Extension by an NHEJ DNA Polymerase

    Directory of Open Access Journals (Sweden)

    Nigel C. Brissett

    2013-11-01

    Full Text Available Nonhomologous end-joining (NHEJ is one of the major DNA double-strand break (DSB repair pathways. The mechanisms by which breaks are competently brought together and extended during NHEJ is poorly understood. As polymerases extend DNA in a 5′-3′ direction by nucleotide addition to a primer, it is unclear how NHEJ polymerases fill in break termini containing 3′ overhangs that lack a primer strand. Here, we describe, at the molecular level, how prokaryotic NHEJ polymerases configure a primer-template substrate by annealing the 3′ overhanging strands from opposing breaks, forming a gapped intermediate that can be extended in trans. We identify structural elements that facilitate docking of the 3′ ends in the active sites of adjacent polymerases and reveal how the termini act as primers for extension of the annealed break, thus explaining how such DSBs are extended in trans. This study clarifies how polymerases couple break-synapsis to catalysis, providing a molecular mechanism to explain how primer extension is achieved on DNA breaks.

  7. UVA-induced DNA double-strand breaks result from the repair of clustered oxidative DNA damages

    Science.gov (United States)

    Greinert, R.; Volkmer, B.; Henning, S.; Breitbart, E. W.; Greulich, K. O.; Cardoso, M. C.; Rapp, Alexander

    2012-01-01

    UVA (320–400 nm) represents the main spectral component of solar UV radiation, induces pre-mutagenic DNA lesions and is classified as Class I carcinogen. Recently, discussion arose whether UVA induces DNA double-strand breaks (dsbs). Only few reports link the induction of dsbs to UVA exposure and the underlying mechanisms are poorly understood. Using the Comet-assay and γH2AX as markers for dsb formation, we demonstrate the dose-dependent dsb induction by UVA in G1-synchronized human keratinocytes (HaCaT) and primary human skin fibroblasts. The number of γH2AX foci increases when a UVA dose is applied in fractions (split dose), with a 2-h recovery period between fractions. The presence of the anti-oxidant Naringin reduces dsb formation significantly. Using an FPG-modified Comet-assay as well as warm and cold repair incubation, we show that dsbs arise partially during repair of bi-stranded, oxidative, clustered DNA lesions. We also demonstrate that on stretched chromatin fibres, 8-oxo-G and abasic sites occur in clusters. This suggests a replication-independent formation of UVA-induced dsbs through clustered single-strand breaks via locally generated reactive oxygen species. Since UVA is the main component of solar UV exposure and is used for artificial UV exposure, our results shine new light on the aetiology of skin cancer. PMID:22941639

  8. Comparative study of DNA encapsulation into PLGA microparticles using modified double emulsion methods and spray drying techniques.

    Science.gov (United States)

    Oster, C G; Kissel, T

    2005-05-01

    Recently, several research groups have shown the potential of microencapsulated DNA as adjuvant for DNA immunization and in tissue engineering approaches. Among techniques generally used for microencapsulation of hydrophilic drug substances into hydrophobic polymers, modified WOW double emulsion method and spray drying of water-in-oil dispersions take a prominent position. The key parameters for optimized microspheres are particle size, encapsulation efficiency, continuous DNA release and stabilization of DNA against enzymatic and mechanical degradation. This study investigates the possibility to encapsulate DNA avoiding shear forces which readily degrade DNA during this microencapsulation. DNA microparticles were prepared with polyethylenimine (PEI) as a complexation agent for DNA. Polycations are capable of stabilizing DNA against enzymatic, as well as mechanical degradation. Further, complexation was hypothesized to facilitate the encapsulation by reducing the size of the macromolecule. This study additionally evaluated the possibility of encapsulating lyophilized DNA and lyophilized DNA/PEI complexes. For this purpose, the spray drying and double emulsion techniques were compared. The size of the microparticles was characterized by laser diffractometry and the particles were visualized by scanning electron microscopy (SEM). DNA encapsulation efficiencies were investigated photometrically after complete hydrolysis of the particles. Finally, the DNA release characteristics from the particles were studied. Particles with a size of <10 microm which represent the threshold for phagocytic uptake could be prepared with these techniques. The encapsulation efficiency ranged from 100-35% for low theoretical DNA loadings. DNA complexation with PEI 25?kDa prior to the encapsulation process reduced the initial burst release of DNA for all techniques used. Spray-dried particles without PEI exhibited high burst releases, whereas double emulsion techniques showed continuous

  9. Repair pathways for heavy ion-induced complex DNA double strand breaks

    International Nuclear Information System (INIS)

    Yajima, Hirohiko; Nakajima, Nakako; Hirakawa, Hirokazu; Murakami, Takeshi; Okayasu, Ryuichi; Fujimori, Akira

    2012-01-01

    DNA double strand break (DSB) induced by ionizing radiation (IR) is a deleterious damage leading to cell death and genome instability if not properly repaired. It is well known that DSB is repaired by two major pathways, non-homologous end-joining (NHEJ) and homologous recombination (HR). It is also known that NHEJ is dominant throughout the cell cycle after X- or gamma-ray irradiation in mammalian cells, Meanwhile, it is thought that heavy-ion radiation (e.g., carbon-ions, iron-ions) gives rise to clustered DNA damages consisting of not only strand breaks but also aberrant bases in the vicinity of DSBs (complex DSBs). Our previous work suggested that the efficiency of NHEJ is diminished for repair of complex DSBs induced by heavy-ion radiation. We thought that this difficulty in NHEJ process associated with heavy ion induced complex DNA damage might be extended to HR process in cells exposed to heavy ions. In order to find out if this notion is true or not, exposed human cells to X-rays and heavy-ions, and studied HR associated processes at the molecular level. Our result indicates that complex DSBs induced by heavy ions effectively evoke DNA end resection activity during the HR process. Together with our results, a relevant recent progress in the field of DNA DSB repair will be discussed. (author)

  10. Sequence specific electronic conduction through polyion-stabilized double-stranded DNA in nanoscale break junctions

    International Nuclear Information System (INIS)

    Mahapatro, Ajit K; Jeong, Kyung J; Lee, Gil U; Janes, David B

    2007-01-01

    This paper presents a study of sequence specific electronic conduction through short (15-base-pair) double-stranded (ds) DNA molecules, measured by immobilizing 3 ' -thiol-derivatized DNAs in nanometre scale gaps between gold electrodes. The polycation spermidine was used to stabilize the ds-DNA structure, allowing electrical measurements to be performed in a dry state. For specific sequences, the conductivity was observed to scale with the surface density of immobilized DNA, which can be controlled by the buffer concentration. A series of 15-base DNA oligonucleotide pairs, in which the centre sequence of five base pairs was changed from G:C to A:T pairs, has been studied. The conductivity per molecule is observed to decrease exponentially with the number of adjacent A:T pairs replacing G:C pairs, consistent with a barrier at the A:T sites. Conductance-based devices for short DNA sequences could provide sensing approaches with direct electrical readout, as well as label-free detection

  11. Thermodynamics for the Formation of Double-Stranded DNA-Single-Walled Carbon Nanotube Hybrids.

    Science.gov (United States)

    Shiraki, Tomohiro; Tsuzuki, Akiko; Toshimitsu, Fumiyuki; Nakashima, Naotoshi

    2016-03-24

    For the first time, the thermodynamics are described for the formation of double-stranded DNA (ds-DNA)-single-walled carbon nanotube (SWNT) hybrids. This treatment is applied to the exchange reaction of sodium cholate (SC) molecules on SWNTs and the ds-DNAs d(A)20 -d(T)20 and nuclear factor (NF)-κB decoy. UV/Vis/near-IR spectroscopy with temperature variations was used for analyzing the exchange reaction on the SWNTs with four different chiralities: (n,m)=(8,3), (6,5), (7,5), and (8,6). Single-stranded DNAs (ss-DNAs), including d(A)20 and d(T)20, are also used for comparison. The d(A)20-d(T)20 shows a drastic change in its thermodynamic parameters around the melting temperature (Tm ) of the DNA oligomer. No such Tm dependency was measured, owing to high Tm in the NF-κB decoy DNA and no Tm in the ss-DNA. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Mycobacterial nonhomologous end joining mediates mutagenic repair of chromosomal double-strand DNA breaks.

    Science.gov (United States)

    Stephanou, Nicolas C; Gao, Feng; Bongiorno, Paola; Ehrt, Sabine; Schnappinger, Dirk; Shuman, Stewart; Glickman, Michael S

    2007-07-01

    Bacterial nonhomologous end joining (NHEJ) is a recently described DNA repair pathway best characterized in mycobacteria. Bacterial NHEJ proteins LigD and Ku have been analyzed biochemically, and their roles in linear plasmid repair in vivo have been verified genetically; yet the contributions of NHEJ to repair of chromosomal DNA damage are unknown. Here we use an extensive set of NHEJ- and homologous recombination (HR)-deficient Mycobacterium smegmatis strains to probe the importance of HR and NHEJ in repairing diverse types of chromosomal DNA damage. An M. smegmatis Delta recA Delta ku double mutant has no apparent growth defect in vitro. Loss of the NHEJ components Ku and LigD had no effect on sensitivity to UV radiation, methyl methanesulfonate, or quinolone antibiotics. NHEJ deficiency had no effect on sensitivity to ionizing radiation in logarithmic- or early-stationary-phase cells but was required for ionizing radiation resistance in late stationary phase in 7H9 but not LB medium. In addition, NHEJ components were required for repair of I-SceI mediated chromosomal double-strand breaks (DSBs), and in the absence of HR, the NHEJ pathway rapidly mutates the chromosomal break site. The molecular outcomes of NHEJ-mediated chromosomal DSB repair involve predominantly single-nucleotide insertions at the break site, similar to previous findings using plasmid substrates. These findings demonstrate that prokaryotic NHEJ is specifically required for DSB repair in late stationary phase and can mediate mutagenic repair of homing endonuclease-generated chromosomal DSBs.

  13. Evidence for multiple repair pathways of double-strand DNA breaks in Chinese hamster cells

    International Nuclear Information System (INIS)

    Giaccia, A.J.; Weistein, R.; Stamato, T.D.; Roosa, R.

    1984-01-01

    XR-1 is a mutant of the Chinese hamster cell (CHO-K1) which is abnormally sensitive to killing by gamma rays in G/sub 1/ (D37 = 27 rads vs. 318 for parent) and early S phases of the cell cycle but has near normal resistance in late S and early G/sub 2/ (Somatic Cell Genetics, 9:165-173, 1983). Complementation studies between XR-1 and its parent indicate that this sensitivity to gamma rays is a recessive phenotype. Both the XR-1 and its parent cell are able to repair single strand DNA breaks. However, in comparison to its parental cell, the XR-1 cell is markedly deficient in the repair of double strand DNA breaks introduced by gamma irradiation during the sensitive G/sub 1/-early S period, while in the late S-G/sub 2/ resistant period the repair is similar in both cells. This correlation suggests that an unrepaired double strand DNA break is the lethal lesion and that at least two pathways for the repair of these lesions exist in mammalian cells

  14. Calibration of pulsed field gel electrophoresis for measurement of DNA double-strand breaks

    International Nuclear Information System (INIS)

    Ager, D.D.; Dewey, W.C.

    1990-01-01

    Pulsed field gel electrophoresis (PFGE) assay was calibrated for the measurement of X-ray induced DNA double-strand breaks in Chinese hamster ovary (CHO) cells. Calibration was conducted by incorporating [ 125 I] deoxyuridine into DNA, which induces one double-strand break for every disintegration that occurs in frozen cells. Based on the percentage of DNA migrating into the gel, the number of breaks/dalton/Gy was estimated to be (9.3±1.0) x 10 -12 . This value is close to (10 to 12) x 10 -12 determined by neutral filter elution using similar cell lysis procedures at 24 o C and at pH8.0. The estimate is in good agreement with the value of (11.7±2) x 10 -12 breaks/dalton/Gy as measured in Ehrlich ascites tumour cells using the neutral sucrose gradient method (Bloecher 1988), and (6 to 9) x 10 -12 breaks/dalton/Gy as measured in mouse L and Chinese hamster V79 cells using neutral filter elution (Radford and Hodgson 1985). (author)

  15. DNA double strand breaks in the acute phase after synchrotron pencilbeam irradiation

    International Nuclear Information System (INIS)

    Fernandez-Palomo, C; Trippel, M; Schroll, C; Nikkhah, G; Schültke, E; Bräuer-Krisch, E; Requardt, H; Bartzsch, S

    2013-01-01

    Introduction. At the biomedical beamline of the European Synchrotron Radiation Facility (ESRF), we have established a method to study pencilbeam irradiation in-vivoin small animal models. The pencilbeam irradiation technique is based on the principle of microbeam irradiation, a concept of spatially fractionated high-dose irradiation. Using γH2AX as marker, we followed the development of DNA double strand breaks over 48 hrs after whole brain irradiation with the pencilbeam technique. Method. Almost square pencilbeams with an individual size of 51 × 50 μm were produced with an MSC collimator using a step and shoot approach, while the animals were moved vertically through the beam. The center-to-center distance (ctc) was 400 μm, with a peak-to-valley dose ratio (PVDR) of about 400. Five groups of healthy adult mice received peak irradiation doses of either 330 Gy or 2,460 Gy and valley doses of 0.82 Gy and 6.15 Gy, respectively. Animals were sacrificed at 2, 12 and 48 hrs after irradiation. Results. DNA double strand breaks are observed in the path of the pencilbeam. The size of the damaged volume undergoes changes within the first 48 hours after irradiation. Conclusions. The extent of DNA damage caused by pencilbeam irradiation, as assessed by H2AX antibody staining, is dose- dependent

  16. The Molecular Basis of Double-Strand DNA Break Repair: The Critical Structure of the RAD52/RPA Complex

    National Research Council Canada - National Science Library

    Jackson, Dobra

    2001-01-01

    .... RAD52 has specific interactions with RAD51, RPA and DNA (1,2,3). The binding of RAD52 to ends of double-strand breaks has been found to be a key initiation step to DNA repair by homologous recombination...

  17. Combined Triplex/Duplex Invasion of Double-Stranded DNA by "Tail-Clamp" Peptide Nucleic Acid

    DEFF Research Database (Denmark)

    Bentin, Thomas; Larsen, H. J.; Nielsen, Peter E.

    2003-01-01

    as determined by T-m measurements. Binding to double-stranded (ds) DNA occurred by combined triplex and duplex invasion as analyzed by permanganate probing. Furthermore, C-50 measurements revealed that tail-clamp PNAs consistently bound the dsDNA target more efficiently, and kinetics experiments revealed...

  18. Nucleic acid helices: I. Structure of M1 RNA from E. coli as determined bypsoralen crosslinking. II. Thermodynamics of the helix-coil transition of DNA oligonucleotides in solutions containing 3. 0 M tetramethylammonium chloride

    Energy Technology Data Exchange (ETDEWEB)

    Lipson, S.E.

    1987-01-01

    This work includes two different investigations examining nucleic acid helices. The first study discusses secondary and tertiary interactions in the RNA moiety of ribonuclease P from Escherichia coli. The second study discusses the thermodynamics of the helix-coil transition of DNA oligonucleotides in solutions containing tetramethylammonium chloride. The RNA moiety of ribonuclease P from Escherichia coli (M1 RNA) has been photoreacted with 4{prime}-hydroxymethyl-4,5{prime}8-trimethylpsoralen and long wave UV light (320-380 nm) in a buffer in which the M1 RNA alone acts as a true catalyst of tRNA processing. Limited specific digestion followed by two dimensional gel electrophoresis yields fragments crosslinked by HMT. The positions of the crosslinks have been determined to within {plus minus}15 nucleotides by photoreversal of the isolated crosslinked fragments and enzymatic sequencing of the resulting RNA. Further assignments of the exact locations of the crosslinks have been made on the known photoreactivity of the psoralen with different bases.

  19. On the helix equation

    Directory of Open Access Journals (Sweden)

    Taouil Hajer

    2012-08-01

    Full Text Available This paper is devoted to the helices processes, i.e. the solutions H : ℝ × Ω → ℝd, (t, ω ↦ H(t, ω of the helix equation egin{eqnarray} H(0,o=0; quad H(s+t,o= H(s,Phi(t,o +H(t,oonumber end{eqnarray} H ( 0 ,ω = 0 ;   H ( s + t,ω = H ( s, Φ ( t,ω + H ( t,ω where Φ : ℝ × Ω → Ω, (t, ω ↦ Φ(t, ω is a dynamical system on a measurable space (Ω, ℱ. More precisely, we investigate dominated solutions and non differentiable solutions of the helix equation. For the last case, the Wiener helix plays a fundamental role. Moreover, some relations with the cocycle equation defined by Φ, are investigated. Ce papier est consacré aux hélices, c’est-à-dire les solutions H : ℝ × Ω → ℝd, (t, ω ↦ H(t, ω de l’équation fonctionnelle egin{eqnarray} H(0,o=0; quad H(s+t,o= H(s,Phi(t,o +H(t,o onumber end{eqnarray} H ( 0 ,ω = 0 ;   H ( s + t,ω = H ( s, Φ ( t,ω + H ( t,ω où Φ : ℝ × Ω → Ω, (t, ω ↦ Φ(t, ω est un système dynamique défini sur un espace mesurable (Ω, ℱ. Plus présisément, nous déterminons d’abord les hélices dominées puis nous caractérisons les hélices non différentiables. Dans ce dernier cas, l’hélice de Wiener joue un rôle important. Nous précisons aussi quelques relations des hélices avec les cocycles définis par Φ.

  20. Use of orthogonal field alternational gel electrophoresis (OFAGE) for studying DNA double strand breakage and repair

    International Nuclear Information System (INIS)

    Contopoulou, C.R.; Cook, V.; Mortimer, R.K.

    1987-01-01

    The study of DNA double strand breakage and repair has normally been carried by using neutral sucrose gradient or neutral elution techniques. The authors have applied OFAGE procedures to study x-ray induced double strand breaks and repair. Breakage of chromosomes is seen by a decrease in intensity of individual chromosome bands; as expected, this decrease becomes more pronounced as chromosome size increases. The fragments of broken chromosomes appears as a broad smear in the size range 100 kb to 1000 kb. Following repair, these fragments partially disappear and the chromosomal bands increase in intensity. In four repair deficient mutants, rad51, rad52, rad54, rad55, no increase in chromosomal band intensity was seen. These results have been confirmed by blotting for a specific chromosome

  1. Importance of the efficiency of double-stranded DNA formation in cDNA synthesis for the imprecision of microarray expression analysis.

    Science.gov (United States)

    Thormar, Hans G; Gudmundsson, Bjarki; Eiriksdottir, Freyja; Kil, Siyoen; Gunnarsson, Gudmundur H; Magnusson, Magnus Karl; Hsu, Jason C; Jonsson, Jon J

    2013-04-01

    The causes of imprecision in microarray expression analysis are poorly understood, limiting the use of this technology in molecular diagnostics. Two-dimensional strandness-dependent electrophoresis (2D-SDE) separates nucleic acid molecules on the basis of length and strandness, i.e., double-stranded DNA (dsDNA), single-stranded DNA (ssDNA), and RNA·DNA hybrids. We used 2D-SDE to measure the efficiency of cDNA synthesis and its importance for the imprecision of an in vitro transcription-based microarray expression analysis. The relative amount of double-stranded cDNA formed in replicate experiments that used the same RNA sample template was highly variable, ranging between 0% and 72% of the total DNA. Microarray experiments showed an inverse relationship between the difference between sample pairs in probe variance and the relative amount of dsDNA. Approximately 15% of probes showed between-sample variation (P cDNA synthesized can be an important component of the imprecision in T7 RNA polymerase-based microarray expression analysis. © 2013 American Association for Clinical Chemistry

  2. More efficient repair of DNA double-strand breaks in skeletal muscle stem cells compared to their committed progeny

    OpenAIRE

    Leyla Vahidi Ferdousi; Pierre Rocheteau; Romain Chayot; Benjamin Montagne; Zayna Chaker; Patricia Flamant; Shahragim Tajbakhsh; Miria Ricchetti

    2014-01-01

    International audience; The loss of genome integrity in adult stem cells results in accelerated tissue aging and is possibly cancerogenic. Adult stem cells in different tissues appear to react robustly to DNA damage. We report that adult skeletal stem (satellite) cells do not primarily respond to radiation-induced DNA double-strand breaks (DSBs) via differentiation and exhibit less apoptosis compared to other myogenic cells. Satellite cells repair these DNA lesions more efficiently than their...

  3. Evaluation of the neutral comet assay for detection of alpha-particle induced DNA-double-strand-breaks

    International Nuclear Information System (INIS)

    Hofbauer, Daniela

    2010-01-01

    Aim of this study was to differentiate DNA-double-strand-breaks from DNA-single-strand-breaks on a single cell level, using the comet assay after α- and γ-irradiation. Americium-241 was used as a alpha-irradiation-source, Caesium-137 was used for γ-irradiation. Because of technical problems with both the neutral and alkaline comet assay after irradiation of gastric cancer cells and human lymphocytes, no definite differentiation of DNA-damage was possible.

  4. Radiation-induced DNA double strand breaks in Ehrlich ascites tumour cells and their possible effects on cell survival

    International Nuclear Information System (INIS)

    Bloecher, D.

    1981-01-01

    A method to prepare high-molecular, pure DNA with the aid of enzymes, detergents, and heat treatment is presented. A sedimentation technique with neutral density gradients has been introduced which permits mass separation and molecular mass analysis of high-molecular DNA (msub(r) 10 ). Using this method, the induction of DNA double strand breaks (DSB) in the dose range between 10 Gy [de

  5. Regulation of TCF ETS-domain transcription factors by helix-loop-helix motifs.

    Science.gov (United States)

    Stinson, Julie; Inoue, Toshiaki; Yates, Paula; Clancy, Anne; Norton, John D; Sharrocks, Andrew D

    2003-08-15

    DNA binding by the ternary complex factor (TCF) subfamily of ETS-domain transcription factors is tightly regulated by intramolecular and intermolecular interactions. The helix-loop-helix (HLH)-containing Id proteins are trans-acting negative regulators of DNA binding by the TCFs. In the TCF, SAP-2/Net/ERP, intramolecular inhibition of DNA binding is promoted by the cis-acting NID region that also contains an HLH-like motif. The NID also acts as a transcriptional repression domain. Here, we have studied the role of HLH motifs in regulating DNA binding and transcription by the TCF protein SAP-1 and how Cdk-mediated phosphorylation affects the inhibitory activity of the Id proteins towards the TCFs. We demonstrate that the NID region of SAP-1 is an autoinhibitory motif that acts to inhibit DNA binding and also functions as a transcription repression domain. This region can be functionally replaced by fusion of Id proteins to SAP-1, whereby the Id moiety then acts to repress DNA binding in cis. Phosphorylation of the Ids by cyclin-Cdk complexes results in reduction in protein-protein interactions between the Ids and TCFs and relief of their DNA-binding inhibitory activity. In revealing distinct mechanisms through which HLH motifs modulate the activity of TCFs, our results therefore provide further insight into the role of HLH motifs in regulating TCF function and how the inhibitory properties of the trans-acting Id HLH proteins are themselves regulated by phosphorylation.

  6. hnRNP-U is a specific DNA-dependent protein kinase substrate phosphorylated in response to DNA double-strand breaks

    International Nuclear Information System (INIS)

    Berglund, Fredrik M.; Clarke, Paul R.

    2009-01-01

    Cellular responses to DNA damage are orchestrated by the large phosphoinositol-3-kinase related kinases ATM, ATR and DNA-PK. We have developed a cell-free system to dissect the biochemical mechanisms of these kinases. Using this system, we identify heterogeneous nuclear ribonucleoprotein U (hnRNP-U), also termed scaffold attachment factor A (SAF-A), as a specific substrate for DNA-PK. We show that hnRNP-U is phosphorylated at Ser59 by DNA-PK in vitro and in cells in response to DNA double-strand breaks. Phosphorylation of hnRNP-U suggests novel functions for DNA-PK in the response to DNA damage.

  7. Conformational changes in DNA caused by DNA-ase I, gamma and ultraviolet radiation as revealed by differential pulse polarography

    International Nuclear Information System (INIS)

    Vorlickova, M.

    1979-01-01

    The height, potential and half width of differential pulse-polarographic peaks of DNA were investigated in dependence on degradation by DNA-ase I and gamma and UV radiation. It was found that in all cases studied growth of peak II (reflecting conformational changes in the DNA double helix) was limited, and only after it reached a certain height further degradation induced the appearance of peak III of single-stranded DNA. This course is explained as reflecting the limited extent of conformational changes in the framework of the double helix, which probably follows from a limited number of sites that can undergo certain types of conformational changes. The character of the conformational changes is dependent on the chemical nature of the damage. (author)

  8. A role for small RNAs in DNA double-strand break repair

    DEFF Research Database (Denmark)

    Wei, W.; Ba, Z.; Wu, Y.

    2012-01-01

    Eukaryotes have evolved complex mechanisms to repair DNA double-strand breaks (DSBs) through coordinated actions of protein sensors, transducers, and effectors. Here we show that ∼21-nucleotide small RNAs are produced from the sequences in the vicinity of DSB sites in Arabidopsis and in human cells....... We refer to these as diRNAs for DSB-induced small RNAs. In Arabidopsis, the biogenesis of diRNAs requires the PI3 kinase ATR, RNA polymerase IV (Pol IV), and Dicer-like proteins. Mutations in these proteins as well as in Pol V cause significant reduction in DSB repair efficiency. In Arabidopsis, di...

  9. Biological defense mechanisms against DNA double-strand break and their possible medical applications

    International Nuclear Information System (INIS)

    Matsumoto, Yoshihisa

    2011-01-01

    Radiation is now widely used for clinical diagnosis and therapeutics. On the other hand, radiation influences various tissues represented by immunological and reproductive systems, and is also recognized as one of the cause of carcinogenesis. Such pleiotropic effects of radiation are mediated through generation of damages on DNA molecule, vitally important genetic macromolecule. Among various types of DNA damages, double-strand break (DSB) is considered most critical and, therefore, responsible for biological effects. DSB is repaired mainly through two pathways: non-homologous end joining (NHEJ) and homologous recombination (HR). Understanding of these mechanisms has been greatly deepened in past 20 years and is now providing a promising approach toward cancer therapy. We have studied the mechanisms of NHEJ, focusing especially on the role of phosphorylation and the assembly of machinery therein, which will be introduced below. (author)

  10. Double-stranded DNA-dependent ATPase Irc3p is directly involved in mitochondrial genome maintenance.

    Science.gov (United States)

    Sedman, Tiina; Gaidutšik, Ilja; Villemson, Karin; Hou, YingJian; Sedman, Juhan

    2014-12-01

    Nucleic acid-dependent ATPases are involved in nearly all aspects of DNA and RNA metabolism. Previous studies have described a number of mitochondrial helicases. However, double-stranded DNA-dependent ATPases, including translocases or enzymes remodeling DNA-protein complexes, have not been identified in mitochondria of the yeast Saccharomyces cerevisae. Here, we demonstrate that Irc3p is a mitochondrial double-stranded DNA-dependent ATPase of the Superfamily II. In contrast to the other mitochondrial Superfamily II enzymes Mss116p, Suv3p and Mrh4p, which are RNA helicases, Irc3p has a direct role in mitochondrial DNA (mtDNA) maintenance. Specific Irc3p-dependent mtDNA metabolic intermediates can be detected, including high levels of double-stranded DNA breaks that accumulate in irc3Δ mutants. irc3Δ-related topology changes in rho- mtDNA can be reversed by the deletion of mitochondrial RNA polymerase RPO41, suggesting that Irc3p counterbalances adverse effects of transcription on mitochondrial genome stability. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Quantitation of the repair of gamma-radiation-induced double-strand DNA breaks in human fibroblasts

    International Nuclear Information System (INIS)

    Woods, W.G.

    1981-01-01

    The quantitation and repair of double-strand DNA breaks in human fibroblasts has been determined using a method involving the nondenaturing elution of DNA from a filter. DNA from cells from two human fibroblast lines exposed to γ-radiation from 0 to 10000 rad showed increasing retention on a filter with decreasing radiation dose, and the data suggest a linear relationship between double-strand breaks induced and radiation dose. The ability of normal human fibroblasts to repair double-strand breaks with various doses of radiation was demonstrated, with a tsub(1/2) of 10 min for repair of 5000 rad exposure and 39 min for repair of 10000 rad damage. The kinetics of the DNA rejoining were not linear and suggest that, as in the repair of single-strand breaks, both an initial fast and a later slow mechanism may be involved. (Auth.)

  12. Cascade of chromosomal rearrangements caused by a heterogeneous T-DNA integration supports the double-stranded break repair model for T-DNA integration.

    Science.gov (United States)

    Hu, Yufei; Chen, Zhiyu; Zhuang, Chuxiong; Huang, Jilei

    2017-06-01

    Transferred DNA (T-DNA) from Agrobacterium tumefaciens can be integrated into the plant genome. The double-stranded break repair (DSBR) pathway is a major model for T-DNA integration. From this model, we expect that two ends of a T-DNA molecule would invade into a single DNA double-stranded break (DSB) or independent DSBs in the plant genome. We call the later phenomenon a heterogeneous T-DNA integration, which has never been observed. In this work, we demonstrated it in an Arabidopsis T-DNA insertion mutant seb19. To resolve the chromosomal structural changes caused by T-DNA integration at both the nucleotide and chromosome levels, we performed inverse PCR, genome resequencing, fluorescence in situ hybridization and linkage analysis. We found, in seb19, a single T-DNA connected two different chromosomal loci and caused complex chromosomal rearrangements. The specific break-junction pattern in seb19 is consistent with the result of heterogeneous T-DNA integration but not of recombination between two T-DNA insertions. We demonstrated that, in seb19, heterogeneous T-DNA integration evoked a cascade of incorrect repair of seven DSBs on chromosomes 4 and 5, and then produced translocation, inversion, duplication and deletion. Heterogeneous T-DNA integration supports the DSBR model and suggests that two ends of a T-DNA molecule could be integrated into the plant genome independently. Our results also show a new origin of chromosomal abnormalities. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  13. True Lies: The Double Life of the Nucleotide Excision Repair Factors in Transcription and DNA Repair

    Directory of Open Access Journals (Sweden)

    Nicolas Le May

    2010-01-01

    Full Text Available Nucleotide excision repair (NER is a major DNA repair pathway in eukaryotic cells. NER removes structurally diverse lesions such as pyrimidine dimers, arising upon UV irradiation or bulky chemical adducts, arising upon exposure to carcinogens and some chemotherapeutic drugs. NER defects lead to three genetic disorders that result in predisposition to cancers, accelerated aging, neurological and developmental defects. During NER, more than 30 polypeptides cooperate to recognize, incise, and excise a damaged oligonucleotide from the genomic DNA. Recent papers reveal an additional and unexpected role for the NER factors. In the absence of a genotoxic attack, the promoters of RNA polymerases I- and II-dependent genes recruit XPA, XPC, XPG, and XPF to initiate gene expression. A model that includes the growth arrest and DNA damage 45α protein (Gadd45α and the NER factors, in order to maintain the promoter of active genes under a hypomethylated state, has been proposed but remains controversial. This paper focuses on the double life of the NER factors in DNA repair and transcription and describes the possible roles of these factors in the RNA synthesis process.

  14. Nanoneedle insertion into the cell nucleus does not induce double-strand breaks in chromosomal DNA.

    Science.gov (United States)

    Ryu, Seunghwan; Kawamura, Ryuzo; Naka, Ryohei; Silberberg, Yaron R; Nakamura, Noriyuki; Nakamura, Chikashi

    2013-09-01

    An atomic force microscope probe can be formed into an ultra-sharp cylindrical shape (a nanoneedle) using micro-fabrication techniques such as focused ion beam etching. This nanoneedle can be effectively inserted through the plasma membrane of a living cell to not only access the cytosol, but also to penetrate through the nuclear membrane. This technique shows great potential as a tool for performing intranuclear measurements and manipulations. Repeated insertions of a nanoneedle into a live cell were previously shown not to affect cell viability. However, the effect of nanoneedle insertion on the nucleus and nuclear components is still unknown. DNA is the most crucial component of the nucleus for proper cell function and may be physically damaged by a nanoneedle. To investigate the integrity of DNA following nanoneedle insertion, the occurrence of DNA double-strand breaks (DSBs) was assessed. The results showed that there was no chromosomal DNA damage due to nanoneedle insertion into the nucleus, as indicated by the expression level of γ-H2AX, a molecular marker of DSBs. Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  15. Virtual Cross-Linking of the Active Nemorubicin Metabolite PNU-159682 to Double-Stranded DNA.

    Science.gov (United States)

    Scalabrin, Matteo; Quintieri, Luigi; Palumbo, Manlio; Riccardi Sirtori, Federico; Gatto, Barbara

    2017-02-20

    The DNA alkylating mechanism of PNU-159682 (PNU), a highly potent metabolite of the anthracycline nemorubicin, was investigated by gel-electrophoretic, HPLC-UV, and micro-HPLC/mass spectrometry (MS) measurements. PNU quickly reacted with double-stranded oligonucleotides, but not with single-stranded sequences, to form covalent adducts which were detectable by denaturing polyacrylamide gel electrophoresis (DPAGE). Ion-pair reverse-phase HPLC-UV analysis on CG rich duplex sequences having a 5'-CCCGGG-3' central core showed the formation of two types of adducts with PNU, which were stable and could be characterized by micro-HPLC/MS. The first type contained one alkylated species (and possibly one reversibly bound species), and the second contained two alkylated species per duplex DNA. The covalent adducts were found to produce effective bridging of DNA complementary strands through the formation of virtual cross-links reminiscent of those produced by classical anthracyclines in the presence of formaldehyde. Furthermore, the absence of reactivity of PNU with CG-rich sequence containing a TA core (CGTACG), and the minor reactivity between PNU and CGC sequences (TACGCG·CGCGTA) pointed out the importance of guanine sequence context in modulating DNA alkylation.

  16. Analysis of DNA double-strand break repair pathways in mice

    International Nuclear Information System (INIS)

    Brugmans, Linda; Kanaar, Roland; Essers, Jeroen

    2007-01-01

    During the last years significant new insights have been gained into the mechanism and biological relevance of DNA double-strand break (DSB) repair in relation to genome stability. DSBs are a highly toxic DNA lesion, because they can lead to chromosome fragmentation, loss and translocations, eventually resulting in cancer. DSBs can be induced by cellular processes such as V(D)J recombination or DNA replication. They can also be introduced by exogenous agents DNA damaging agents such as ionizing radiation or mitomycin C. During evolution several pathways have evolved for the repair of these DSBs. The most important DSB repair mechanisms in mammalian cells are nonhomologous end-joining and homologous recombination. By using an undamaged repair template, homologous recombination ensures accurate DSB repair, whereas the untemplated nonhomologous end-joining pathway does not. Although both pathways are active in mammals, the relative contribution of the two repair pathways to genome stability differs in the different cell types. Given the potential differences in repair fidelity, it is of interest to determine the relative contribution of homologous recombination and nonhomologous end-joining to DSB repair. In this review, we focus on the biological relevance of DSB repair in mammalian cells and the potential overlap between nonhomologous end-joining and homologous recombination in different tissues

  17. Quantification and genome-wide mapping of DNA double-strand breaks.

    Science.gov (United States)

    Grégoire, Marie-Chantal; Massonneau, Julien; Leduc, Frédéric; Arguin, Mélina; Brazeau, Marc-André; Boissonneault, Guylain

    2016-12-01

    DNA double-strand breaks (DSBs) represent a major threat to the genetic integrity of the cell. Knowing both their genome-wide distribution and number is important for a better assessment of genotoxicity at a molecular level. Available methods may have underestimated the extent of DSBs as they are based on markers specific to those undergoing active repair or may not be adapted for the large diversity of naturally occurring DNA ends. We have established conditions for an efficient first step of DNA nick and gap repair (NGR) allowing specific determination of DSBs by end labeling with terminal transferase. We used DNA extracted from HeLa cells harboring an I-SceI cassette to induce a targeted nick or DSB and demonstrated by immunocapture of 3'-OH that a prior step of NGR allows specific determination of loci-specific or genome wide DSBs. This method can be applied to the global determination of DSBs using radioactive end labeling and can find several applications aimed at understanding the distribution and kinetics of DSBs formation and repair. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. DNA double strand breaks and Hsp70 expression in proton irradiated living cells

    International Nuclear Information System (INIS)

    Fiedler, Anja; Reinert, Tilo; Tanner, Judith; Butz, Tilman

    2007-01-01

    DNA double strand breaks (DSBs) in living cells can be directly provoked by ionising radiation. DSBs can be visualized by immunostaining the phosphorylated histone γH2AX. Our concern was to test the feasibility of γH2AX staining for a direct visualization of single proton hits. If single protons produce detectable foci, DNA DSBs could be used as 'biological track detectors' for protons. Ionising radiation can also damage proteins indirectly by inducing free radicals. Heat shock proteins (Hsp) help to refold or even degrade the damaged proteins. The level of the most famous heat shock protein Hsp70 is increased by ionising radiation. We investigated the expression of γH2AX and Hsp70 after cross and line patterned irradiation with counted numbers of 2.25 MeV protons on primary human skin fibroblasts. The proton induced DSBs appear more delocalised than it was expected by the ion hit accuracy. Cooling the cells before the irradiation reduces the delocalisation of DNA DSBs, which is probably caused by the reduced diffusion of DNA damaging agents. Proton irradiation seems to provoke protein damages mainly in the cytoplasm indicated by cytoplasmic Hsp70 aggregates. On the contrary, in control heat shocked cells the Hsp70 was predominantly localized in the cell nucleus. However, the irradiated area could not be recognized, all cells on the Si 3 N 4 window showed a homogenous Hsp70 expression pattern

  19. DNA double strand breaks and Hsp70 expression in proton irradiated living cells

    Energy Technology Data Exchange (ETDEWEB)

    Fiedler, Anja [Institute for Experimental Physics II, University of Leipzig (Germany) and Faculty of Biology, Pharmacy and Psychology, University of Leipzig (Germany)]. E-mail: afiedler@uni-leipzig.de; Reinert, Tilo [Institute for Experimental Physics II, University of Leipzig (Germany); Tanner, Judith [Clinic and Polyclinic for Radiation Oncology, University of Halle-Wittenberg (Germany); Butz, Tilman [Institute for Experimental Physics II, University of Leipzig (Germany)

    2007-07-15

    DNA double strand breaks (DSBs) in living cells can be directly provoked by ionising radiation. DSBs can be visualized by immunostaining the phosphorylated histone {gamma}H2AX. Our concern was to test the feasibility of {gamma}H2AX staining for a direct visualization of single proton hits. If single protons produce detectable foci, DNA DSBs could be used as 'biological track detectors' for protons. Ionising radiation can also damage proteins indirectly by inducing free radicals. Heat shock proteins (Hsp) help to refold or even degrade the damaged proteins. The level of the most famous heat shock protein Hsp70 is increased by ionising radiation. We investigated the expression of {gamma}H2AX and Hsp70 after cross and line patterned irradiation with counted numbers of 2.25 MeV protons on primary human skin fibroblasts. The proton induced DSBs appear more delocalised than it was expected by the ion hit accuracy. Cooling the cells before the irradiation reduces the delocalisation of DNA DSBs, which is probably caused by the reduced diffusion of DNA damaging agents. Proton irradiation seems to provoke protein damages mainly in the cytoplasm indicated by cytoplasmic Hsp70 aggregates. On the contrary, in control heat shocked cells the Hsp70 was predominantly localized in the cell nucleus. However, the irradiated area could not be recognized, all cells on the Si{sub 3}N{sub 4} window showed a homogenous Hsp70 expression pattern.

  20. The occurrence of double strand DNA breaks is not the sole condition for meiotic crossing over in Drosophila melanogaster.

    Science.gov (United States)

    Portin, P; Rantanen, M

    2000-01-01

    Analysis of the interchromosomal effects of In(2L + 2R)Cy, In(3L + 3R)LVM and their joint effect on the frequencies of single and double crossovers in the cv-v-f region of the X chromosome as well as interference showed that both inversions, occurring separately, increased the frequency of single as well as double crossovers and the coefficient of coincidence. However, when the inversions occurred together the frequencies of single crossovers no longer increased, but the frequency of double crossovers, as well as the coefficient of coincidence did increase. These results indicate firstly that the interchromosomal effects influence some precondition of exchange, but that this precondition is not an occurrence of double strand DNA breaks. Thus, the occurrence of double strand DNA breaks is not the sole condition for crossing over in Drosophila melanogaster.

  1. DNA-dependent protein kinase (DAN-PK), a key enzyme in the re-ligation of DNA double-strand breaks

    International Nuclear Information System (INIS)

    Hennequin, C.; Averbeck, D.

    1999-01-01

    Repair pathways of DNA are now defined and some important findings have been discovered in the last few years. DNA non-homologous end-joining (NEH) is a crucial process in the repair of radiation-induced double-strand breaks (DSBs). NHEj implies at least three steps: the DNA free-ends must get closer, preparation of the free-ends by exonucleases and then a transient hybridization in a region of DNA with weak homology. DNA-dependent protein kinase (DNA-PK) is the key enzyme in this process. DNA-PK is a nuclear serine/threonine kinase that comprises three components: a catalytic subunit (DNA-PK cs ) and two regulatory subunits, DNA-binding proteins, Ku80 and Ku70. The severe combined immuno-deficient (scid) mice are deficient in DNA-PK cs : this protein is involved both in DNA repair and in the V(D)J recombination of immunoglobulin and T-cell receptor genes. It is a protein-kinase of the P13-kinase family and which can phosphorylate Ku proteins, p53 and probably some other proteins still unknown. DNA-PK is an important actor of DSBs repair (induced by ionising radiations or by drugs like etoposide), but obviously it is not the only mechanism existing in the cell for this function. Some others, like homologous recombination, seem also to have a great importance for cell survival. (authors)

  2. A Classification of Basic Helix-Loop-Helix Transcription Factors of Soybean

    Directory of Open Access Journals (Sweden)

    Karen A. Hudson

    2015-01-01

    Full Text Available The complete genome sequence of soybean allows an unprecedented opportunity for the discovery of the genes controlling important traits. In particular, the potential functions of regulatory genes are a priority for analysis. The basic helix-loop-helix (bHLH family of transcription factors is known to be involved in controlling a wide range of systems critical for crop adaptation and quality, including photosynthesis, light signalling, pigment biosynthesis, and seed pod development. Using a hidden Markov model search algorithm, 319 genes with basic helix-loop-helix transcription factor domains were identified within the soybean genome sequence. These were classified with respect to their predicted DNA binding potential, intron/exon structure, and the phylogeny of the bHLH domain. Evidence is presented that the vast majority (281 of these 319 soybean bHLH genes are expressed at the mRNA level. Of these soybean bHLH genes, 67% were found to exist in two or more homeologous copies. This dataset provides a framework for future studies on bHLH gene function in soybean. The challenge for future research remains to define functions for the bHLH factors encoded in the soybean genome, which may allow greater flexibility for genetic selection of growth and environmental adaptation in this widely grown crop.

  3. Protection against {sup 131}I-induced Double Strand DNA Breaks in Thyroid Cells

    Energy Technology Data Exchange (ETDEWEB)

    Hershman, J.M.; Okunyan, A.; Cannon, S.; Hogen, V. [Endocrinology, UCLA-VA, Los Angeles (United States); Rivina, Y. [Radiation Biology, UCLA, Los Angeles (United States)

    2012-07-01

    Radioiodine-131 (I{sup 131}) released from nuclear reactor accidents has dramatically increased the incidence of papillary thyroid cancer in exposed individuals, especially young children. The accepted measure for prevention of radiation-induced thyroid cancer is potassium iodide tablets that contain 100 mg iodide taken daily to block thyroid uptake of I{sup 131}. The deposition of ionizing radiation in cells results in double-strand DNA breaks (DSB) at fragile sites, and this early event can generate oncogenic rearrangements that eventually cause the cancer. We have developed a thyroid cell model to quantify the mitogenic effect of I{sup 131}. I{sup 131} causes double strand DNA breaks in FRTL-5 cells detected by 53BP1 or gamma H2AX and had no effect on cells that do not transport iodide. Perchlorate, iodide, and thiocyanate protect against DSB induced by I{sup 131}. Preincubation with the anion or radioprotective compounds prevents DSB; delayed addition of the anion is much less effective. These data provide a basis for studies of radioprotection against DSB induced by I{sup 131} in animals in order to refine the prevention of thyroid cancer resulting from nuclear fallout

  4. MO-AB-BRA-04: Radiation Measurements with a DNA Double-Strand-Break Dosimeter

    International Nuclear Information System (INIS)

    Obeidat, M; Cline, K; Stathakis, S; Papanikolaou, N; Rasmussen, K; Gutierrez, A; Ha, CS; Lee, SE; Shim, EY; Kirby, N

    2016-01-01

    Purpose: Many types of dosimeters are used to measure radiation, but none of them directly measures the biological effect of this dose. The purpose here is to create a dosimeter that can measure the probability of double-strand breaks (DSB) for DNA, which is directly related to the biological effect of radiation. Methods: The dosimeter has DNA strands, which are labeled on one end with biotin and on the other with fluorescein. The biotin attaches these strands to magnetic beads. We suspended the DNA dosimeter in phosphate-buffered saline (PBS) as it matches the internal environment of the body. We placed small volumes (50µL) of the DNA dosimeter into tubes and irradiated these samples in a water-equivalent plastic phantom with several doses (three samples per dose). After irradiating the samples, a magnet was placed against the tubes. The fluorescein attached to broken DNA strands was extracted (called the supernatant) and placed into a different tube. The fluorescein on the unbroken strands remained attached to the beads in the tube and was re-suspended with 50µL of PBS. A fluorescence reader was used to measure the fluorescence for both the re-suspended beads and supernatant. To prove that we are measuring DSB, we tested dosimeter response with two different lengths of attached DNA strands (1 and 4 kilo-base pair). Results: The probability of DSB at the dose levels of 5, 10, 25, and 50 Gy were 0.05, 0.08, 0.12, and 0.19, respectively, while the coefficients of variation were 0.14, 0.07, 0.02, and 0.01, respectively. The 4 kilo-base-pair dosimeter produced 5.3 times the response of the 1 kilo-base-pair dosimeter. Conclusion: The DNA dosimeter yields a measurable response to dose that scales with the DNA strand length. The goal now is to refine the dosimeter fabrication to reproducibly create a low coefficient of variation for the lower doses. This work was supported in part by Yarmouk University (Irbid, Jordan) and CPRIT (RP140105)

  5. MO-AB-BRA-04: Radiation Measurements with a DNA Double-Strand-Break Dosimeter

    Energy Technology Data Exchange (ETDEWEB)

    Obeidat, M; Cline, K; Stathakis, S; Papanikolaou, N; Rasmussen, K; Gutierrez, A; Ha, CS; Lee, SE; Shim, EY; Kirby, N [University of Texas HSC SA, San Antonio, TX (United States)

    2016-06-15

    Purpose: Many types of dosimeters are used to measure radiation, but none of them directly measures the biological effect of this dose. The purpose here is to create a dosimeter that can measure the probability of double-strand breaks (DSB) for DNA, which is directly related to the biological effect of radiation. Methods: The dosimeter has DNA strands, which are labeled on one end with biotin and on the other with fluorescein. The biotin attaches these strands to magnetic beads. We suspended the DNA dosimeter in phosphate-buffered saline (PBS) as it matches the internal environment of the body. We placed small volumes (50µL) of the DNA dosimeter into tubes and irradiated these samples in a water-equivalent plastic phantom with several doses (three samples per dose). After irradiating the samples, a magnet was placed against the tubes. The fluorescein attached to broken DNA strands was extracted (called the supernatant) and placed into a different tube. The fluorescein on the unbroken strands remained attached to the beads in the tube and was re-suspended with 50µL of PBS. A fluorescence reader was used to measure the fluorescence for both the re-suspended beads and supernatant. To prove that we are measuring DSB, we tested dosimeter response with two different lengths of attached DNA strands (1 and 4 kilo-base pair). Results: The probability of DSB at the dose levels of 5, 10, 25, and 50 Gy were 0.05, 0.08, 0.12, and 0.19, respectively, while the coefficients of variation were 0.14, 0.07, 0.02, and 0.01, respectively. The 4 kilo-base-pair dosimeter produced 5.3 times the response of the 1 kilo-base-pair dosimeter. Conclusion: The DNA dosimeter yields a measurable response to dose that scales with the DNA strand length. The goal now is to refine the dosimeter fabrication to reproducibly create a low coefficient of variation for the lower doses. This work was supported in part by Yarmouk University (Irbid, Jordan) and CPRIT (RP140105)

  6. Radiation-induced double-strand breaks in mammalian DNA: influence of temperature and DMSO.

    Science.gov (United States)

    Elmroth, K; Nygren, J; Erkell, L J; Hultborn, R

    2000-11-01

    To investigate the effects of subphysiological irradiation temperature (2 28 degrees C) and the influence of the radical scavenger DMSO on the induction of double-strand breaks (DSB) in chromosomal DNA from a human breast cancer cell line (MCF-7) as well as in intact cells. The rejoining of DSB in cells irradiated at 2 degrees C or 37 degrees C was also investigated. Agarose plugs with [14C]thymidine labelled MCF-7 cells were lysed in EDTA-NLS-proteinase-K buffer. The plugs containing chromosomal DNA were irradiated with X-rays under different temperatures and scavenging conditions. Intact MCF-7 cells were irradiated in Petri dishes and plugs were made. The cells were then lysed in EDTA-NLS-proteinase-K buffer. The induction of DSB was studied by constant field gel electrophoresis and expressed as DSB/100/Mbp, calculated from the fraction of activity released into the gel. The induction of DSB in chromosomal DNA was reduced by a decrease in temperature. This protective effect of low temperature was inhibited when the DNA was irradiated in the presence of DMSO. No difference was found when intact cells were irradiated at different temperatures. However, the rapid phase of rejoining was slower in cells irradiated at 37 degrees C than at 2 degrees C. The induction of DSB in naked DNA was reduced by hypothermic irradiation. The temperature had no influence on the induction of DSB in the presence of a high concentration of DMSO, indicating that the temperature effect is mediated via the indirect effects of ionizing radiation. Results are difficult to interpret in intact cells. Rejoining during irradiation at the higher temperature may counteract an increased induction. The difference in rejoining may be interpreted in terms of qualitative differences between breaks induced at the two temperatures.

  7. Accumulation of DNA Double-Strand Breaks in Normal Tissues After Fractionated Irradiation

    International Nuclear Information System (INIS)

    Ruebe, Claudia E.; Fricke, Andreas; Wendorf, Juliane; Stuetzel, Annika; Kuehne, Martin; Ong, Mei Fang; Lipp, Peter; Ruebe, Christian

    2010-01-01

    Purpose: There is increasing evidence that genetic factors regulating the recognition and/or repair of DNA double-strand breaks (DSBs) are responsible for differences in radiosensitivity among patients. Genetically defined DSB repair capacities are supposed to determine patients' individual susceptibility to develop adverse normal tissue reactions after radiotherapy. In a preclinical murine model, we analyzed the impact of different DSB repair capacities on the cumulative DNA damage in normal tissues during the course of fractionated irradiation. Material and Methods: Different strains of mice with defined genetic backgrounds (SCID -/- homozygous, ATM -/- homozygous, ATM +/- heterozygous, and ATM +/+ wild-type mice) were subjected to single (2 Gy) or fractionated irradiation (5 x 2 Gy). By enumerating γH2AX foci, the formation and rejoining of DSBs were analyzed in organs representative of both early-responding (small intestine) and late-responding tissues (lung, kidney, and heart). Results: In repair-deficient SCID -/- and ATM -/- homozygous mice, large proportions of radiation-induced DSBs remained unrepaired after each fraction, leading to the pronounced accumulation of residual DNA damage after fractionated irradiation, similarly visible in early- and late-responding tissues. The slight DSB repair impairment of ATM +/- heterozygous mice was not detectable after single-dose irradiation but resulted in a significant increase in unrepaired DSBs during the fractionated irradiation scheme. Conclusions: Radiation-induced DSBs accumulate similarly in acute- and late-responding tissues during fractionated irradiation, whereas the whole extent of residual DNA damage depends decisively on the underlying genetically defined DSB repair capacity. Moreover, our data indicate that even minor impairments in DSB repair lead to exceeding DNA damage accumulation during fractionated irradiation and thus may have a significant impact on normal tissue responses in clinical

  8. Induction and repair of double- and single-strand DNA breaks in bacteriophage lambda superinfecting Escherichia coli

    International Nuclear Information System (INIS)

    Boye, E.; Krisch, R.E.

    1980-01-01

    Induction and repair of double-and single-strand DNA breaks have been measured after decays of 125 I and 3 H incorporated into the DNA and after external irradiation with 4 MeV electrons. For the decay experiments, cells of wild type Escherichia coli K-12 were superinfected with bacteriophage lambda DNA labelled with 5'-( 125 I)iodo-2'-deoxyuridine or with (methyl- 3 H)thymidine and frozen in liquid nitrogen. Aliquots were thawed at intervals and lysed at neutral pH, and the phage DNA was assayed for double- and single-strand breakage by neutral sucrose gradient centrifugation. The gradients used allowed measurements of both kinds of breaks in the same gradient. Decays of 125 I induced 0.39 single-strand breaks per double-strand break. No repair of either break type could be detected. Each 3 H disintegration caused 0.20 single-strand breaks and very few double-strand breaks. The single-strand breaks were rapidly rejoined after the cells were thawed. For irradiation with 4 MeV electrons, cells of wild type E. coli K-12 were superinfected with phage lambda and suspended in growth medium. Irradiation induced 42 single-strand breaks per double-strand break. The rates of break induction were 6.75 x 10 -14 (double-strand breaks) and 2.82 x 10 -12 (single-strand breaks) per rad and per dalton. The single-strand breaks were rapidly repaired upon incubation whereas the double-strand breaks seemed to remain unrepaired. It is concluded that double-strand breaks in superinfecting bacteriophage lambda DNA are repaired to a very small extent, if at all. (Author)

  9. Inhibition of APOBEC3G activity impedes double-stranded DNA repair.

    Science.gov (United States)

    Prabhu, Ponnandy; Shandilya, Shivender M D; Britan-Rosich, Elena; Nagler, Adi; Schiffer, Celia A; Kotler, Moshe

    2016-01-01

    The cellular cytidine deaminase APOBEC3G (A3G) was first described as an anti-HIV-1 restriction factor, acting by directly deaminating reverse transcripts of the viral genome. HIV-1 Vif neutralizes the activity of A3G, primarily by mediating degradation of A3G to establish effective infection in host target cells. Lymphoma cells, which express high amounts of A3G, can restrict Vif-deficient HIV-1. Interestingly, these cells are more stable in the face of treatments that result in double-stranded DNA damage, such as ionizing radiation and chemotherapies. Previously, we showed that the Vif-derived peptide (Vif25-39) efficiently inhibits A3G deamination, and increases the sensitivity of lymphoma cells to ionizing radiation. In the current study, we show that additional peptides derived from Vif, A3G, and APOBEC3F, which contain the LYYF motif, inhibit deamination activity. Each residue in the Vif25-39 sequence moderately contributes to the inhibitory effect, whereas replacing a single residue in the LYYF motif completely abrogates inhibition of deamination. Treatment of A3G-expressing lymphoma cells exposed to ionizing radiation with the new inhibitory peptides reduces double-strand break repair after irradiation. Incubation of cultured irradiated lymphoma cells with peptides that inhibit double-strand break repair halts their propagation. These results suggest that A3G may be a potential therapeutic target that is amenable to peptide and peptidomimetic inhibition. © 2015 FEBS.

  10. DNA Double Strand Break Response and Limited Repair Capacity in Mouse Elongated Spermatids

    Directory of Open Access Journals (Sweden)

    Emad A. Ahmed

    2015-12-01

    Full Text Available Spermatids are extremely sensitive to genotoxic exposures since during spermiogenesis only error-prone non homologous end joining (NHEJ repair pathways are available. Hence, genomic damage may accumulate in sperm and be transmitted to the zygote. Indirect, delayed DNA fragmentation and lesions associated with apoptotic-like processes have been observed during spermatid elongation, 27 days after irradiation. The proliferating spermatogonia and early meiotic prophase cells have been suggested to retain a memory of a radiation insult leading later to this delayed fragmentation. Here, we used meiotic spread preparations to localize phosphorylate histone H2 variant (γ-H2AX foci marking DNA double strand breaks (DSBs in elongated spermatids. This technique enabled us to determine the background level of DSB foci in elongated spermatids of RAD54/RAD54B double knockout (dko mice, severe combined immunodeficiency SCID mice, and poly adenosine diphosphate (ADP-ribose polymerase 1 (PARP1 inhibitor (DPQ-treated mice to compare them with the appropriate wild type controls. The repair kinetics data and the protein expression patterns observed indicate that the conventional NHEJ repair pathway is not available for elongated spermatids to repair the programmed and the IR-induced DSBs, reflecting the limited repair capacity of these cells. However, although elongated spermatids express the proteins of the alternative NHEJ, PARP1-inhibition had no effect on the repair kinetics after IR, suggesting that DNA damage may be passed onto sperm. Finally, our genetic mutant analysis suggests that an incomplete or defective meiotic recombinational repair of Spo11-induced DSBs may lead to a carry-over of the DSB damage or induce a delayed nuclear fragmentation during the sensitive programmed chromatin remodeling occurring in elongated spermatids.

  11. Zinc Finger Nuclease induced DNA double stranded breaks and rearrangements in MLL

    International Nuclear Information System (INIS)

    Do, To Uyen; Ho, Bay; Shih, Shyh-Jen; Vaughan, Andrew

    2012-01-01

    Highlights: ► A Zinc Finger Nuclease (ZFN) targeting a leukemogenic hot spot for rearrangement in MLL is created. ► The novel ZFN efficiently cleaves MLL exon 13. ► Despite MLL cleavage and evidence of mis-repair, no leukemogenic translocations were produced. ► MLL cleavage alone is insufficient to generate leukemogenic translocations. - Abstract: Radiation treatment or chemotherapy has been linked with a higher risk of secondary cancers such as therapy related Acute Myeloid Leukemia (tAML). Several of these cancers have been shown to be correlated to the introduction of double stranded breaks (DSB) and rearrangements within the Mixed Lineage Leukemia (MLL) gene. We used Zinc Finger Nucleases (ZFNs) to introduce precise cuts within MLL to examine how a single DNA DSB might lead to chromosomal rearrangements. A ZFN targeting exon 13 within the Breakpoint Cluster Region of MLL was transiently expressed in a human lymphoblast cell line originating from a CML patient. Although FISH analysis showed ZFN DSB at this region increased the rate of MLL fragmentation, we were unable to detect leukemogenic rearrangements or translocations via inverse PCR. Interestingly, gene fragmentation as well as small interstitial deletions, insertions and base substitutions increased with the inhibition of DNA-PK, suggesting repair of this particular DSB is linked to non-homologous end joining (NHEJ). Although mis-repair of DSBs may be necessary for the initiation of leukemogenic translocations, a MLL targeted DNA break alone is insufficient

  12. Fine-tuning the ubiquitin code at DNA double-strand breaks: deubiquitinating enzymes at work

    Directory of Open Access Journals (Sweden)

    Elisabetta eCitterio

    2015-09-01

    Full Text Available Ubiquitination is a reversible protein modification broadly implicated in cellular functions. Signaling processes mediated by ubiquitin are crucial for the cellular response to DNA double-strand breaks (DSBs, one of the most dangerous types of DNA lesions. In particular, the DSB response critically relies on active ubiquitination by the RNF8 and RNF168 ubiquitin ligases at the chromatin, which is essential for proper DSB signaling and repair. How this pathway is fine-tuned and what the functional consequences are of its deregulation for genome integrity and tissue homeostasis are subject of intense investigation. One important regulatory mechanism is by reversal of substrate ubiquitination through the activity of specific deubiquitinating enzymes (DUBs, as supported by the implication of a growing number of DUBs in DNA damage response (DDR processes. Here, we discuss the current knowledge of how ubiquitin-mediated signaling at DSBs is controlled by deubiquitinating enzymes, with main focus on DUBs targeting histone H2A and on their recent implication in stem cell biology and cancer.

  13. Zinc Finger Nuclease induced DNA double stranded breaks and rearrangements in MLL

    Energy Technology Data Exchange (ETDEWEB)

    Do, To Uyen [Graduate Group in Immunology, University of California Davis, Davis, CA 95616 (United States); Department of Radiation Oncology, University of California Davis, Sacramento CA 95817 (United States); Ho, Bay; Shih, Shyh-Jen [Department of Radiation Oncology, University of California Davis, Sacramento CA 95817 (United States); Vaughan, Andrew, E-mail: Andrew.vaughan@ucdmc.ucdavis.edu [Graduate Group in Immunology, University of California Davis, Davis, CA 95616 (United States); Department of Radiation Oncology, University of California Davis, Sacramento CA 95817 (United States)

    2012-12-15

    Highlights: ► A Zinc Finger Nuclease (ZFN) targeting a leukemogenic hot spot for rearrangement in MLL is created. ► The novel ZFN efficiently cleaves MLL exon 13. ► Despite MLL cleavage and evidence of mis-repair, no leukemogenic translocations were produced. ► MLL cleavage alone is insufficient to generate leukemogenic translocations. - Abstract: Radiation treatment or chemotherapy has been linked with a higher risk of secondary cancers such as therapy related Acute Myeloid Leukemia (tAML). Several of these cancers have been shown to be correlated to the introduction of double stranded breaks (DSB) and rearrangements within the Mixed Lineage Leukemia (MLL) gene. We used Zinc Finger Nucleases (ZFNs) to introduce precise cuts within MLL to examine how a single DNA DSB might lead to chromosomal rearrangements. A ZFN targeting exon 13 within the Breakpoint Cluster Region of MLL was transiently expressed in a human lymphoblast cell line originating from a CML patient. Although FISH analysis showed ZFN DSB at this region increased the rate of MLL fragmentation, we were unable to detect leukemogenic rearrangements or translocations via inverse PCR. Interestingly, gene fragmentation as well as small interstitial deletions, insertions and base substitutions increased with the inhibition of DNA-PK, suggesting repair of this particular DSB is linked to non-homologous end joining (NHEJ). Although mis-repair of DSBs may be necessary for the initiation of leukemogenic translocations, a MLL targeted DNA break alone is insufficient.

  14. Electromagnetic and optical characteristics of Nb5+-doped double-crossover and salmon DNA thin films

    Science.gov (United States)

    Babu Mitta, Sekhar; Reddy Dugasani, Sreekantha; Jung, Soon-Gil; Vellampatti, Srivithya; Park, Tuson; Park, Sung Ha

    2017-10-01

    We report the fabrication and physical characteristics of niobium ion (Nb5+)-doped double-crossover DNA (DX-DNA) and salmon DNA (SDNA) thin films. Different concentrations of Nb5+ ([Nb5+]) are coordinated into the DNA molecules, and the thin films are fabricated via substrate-assisted growth (DX-DNA) and drop-casting (SDNA) on oxygen plasma treated substrates. We conducted atomic force microscopy to estimate the optimum concentration of Nb5+ ([Nb5+]O = 0.08 mM) in Nb5+-doped DX-DNA thin films, up to which the DX-DNA lattices maintain their structures without deformation. X-ray photoelectron spectroscopy (XPS) was performed to probe the chemical nature of the intercalated Nb5+ in the SDNA thin films. The change in peak intensities and the shift in binding energy were witnessed in XPS spectra to explicate the binding and charge transfer mechanisms between Nb5+ and SDNA molecules. UV-visible, Raman, and photoluminescence (PL) spectra were measured to determine the optical properties and thus investigate the binding modes, Nb5+ coordination sites in Nb5+-doped SDNA thin films, and energy transfer mechanisms, respectively. As [Nb5+] increases, the absorbance peak intensities monotonically increase until ˜[Nb5+]O and then decrease. However, from the Raman measurements, the peak intensities gradually decrease with an increase in [Nb5+] to reveal the binding mechanism and binding sites of metal ions in the SDNA molecules. From the PL, we observe the emission intensities to reduce them at up to ˜[Nb5+]O and then increase after that, expecting the energy transfer between the Nb5+ and SDNA molecules. The current-voltage measurement shows a significant increase in the current observed as [Nb5+] increases in the SDNA thin films when compared to that of pristine SDNA thin films. Finally, we investigate the temperature dependent magnetization in which the Nb5+-doped SDNA thin films reveal weak ferromagnetism due to the existence of tiny magnetic dipoles in the Nb5+-doped SDNA

  15. End-specific strategies of attachment of long double stranded DNA onto gold-coated nanofiber arrays

    International Nuclear Information System (INIS)

    Peckys, Diana B; De Jonge, Niels; Simpson, Michael L; McKnight, Timothy E

    2008-01-01

    We report the effective and site-specific binding of long double stranded (ds)DNA to high aspect ratio carbon nanofiber arrays. The carbon nanofibers were first coated with a thin gold layer to provide anchorage for two controllable binding methods. One method was based on the direct binding of thiol end-labeled dsDNA. The second and enhanced method used amine end-labeled dsDNA bound with crosslinkers to a carboxyl-terminated self-assembled monolayer. The bound dsDNA was first visualized with a fluorescent, dsDNA-intercalating dye. The specific binding onto the carbon nanofiber was verified by a high resolution detection method using scanning electron microscopy in combination with the binding of neutravidin-coated fluorescent microspheres to the immobilized and biotinylated dsDNA. Functional activity of thiol end-labeled dsDNA on gold-coated nanofiber arrays was verified with a transcriptional assay, whereby Chinese hamster lung cells (V79) were impaled upon the DNA-modified nanofibers and scored for transgene expression of the tethered template. Thiol end-labeled dsDNA demonstrated significantly higher expression levels than nanofibers prepared with control dsDNA that lacked a gold-binding end-label. Employing these site-specific and robust techniques of immobilization of dsDNA onto nanodevices can be of advantage for the study of DNA/protein interactions and for gene delivery applications.

  16. Double-stranded DNA translocase activity of transcription factor TFIIH and the mechanism of RNA polymerase II open complex formation.

    Science.gov (United States)

    Fishburn, James; Tomko, Eric; Galburt, Eric; Hahn, Steven

    2015-03-31

    Formation of the RNA polymerase II (Pol II) open complex (OC) requires DNA unwinding mediated by the transcription factor TFIIH helicase-related subunit XPB/Ssl2. Because XPB/Ssl2 binds DNA downstream from the location of DNA unwinding, it cannot function using a conventional helicase mechanism. Here we show that yeast TFIIH contains an Ssl2-dependent double-stranded DNA translocase activity. Ssl2 tracks along one DNA strand in the 5' → 3' direction, implying it uses the nontemplate promoter strand to reel downstream DNA into the Pol II cleft, creating torsional strain and leading to DNA unwinding. Analysis of the Ssl2 and DNA-dependent ATPase activity of TFIIH suggests that Ssl2 has a processivity of approximately one DNA turn, consistent with the length of DNA unwound during transcription initiation. Our results can explain why maintaining the OC requires continuous ATP hydrolysis and the function of TFIIH in promoter escape. Our results also suggest that XPB/Ssl2 uses this translocase mechanism during DNA repair rather than physically wedging open damaged DNA.

  17. PFGE analysis of DNA double-strand breaks and DNA repair process in human osteosarcoma cells irradiated by X-ray

    International Nuclear Information System (INIS)

    Cao Jianping; Majima, H.; Yamaguchi, C.

    2000-01-01

    Objective: To study the induction of DNA double-strand breaks (DSBs) in human osteosarcoma cells irradiated by X-ray, the DNA DSBs repair process and the tumour cell radiosensitivity. Methods: Two cell lines of human osteosarcoma, Rho0 and 143. B were used. Initial DNA damage of DSBs by X-ray irradiation was measured using clamped homogeneous electrical field (CHEF) electrophoresis. Results: X-ray-induced DNA DSBs of human osteosarcoma cells after CHEF-electrophoresis increased linearly with the irradiation dose between 0 and 50 Gy. The repair of DNA DSBs in human osteosarcoma cells increased with the post-irradiation incubation time. In contrast to 14.3B cell line at the same dose point, much more DNA DSBs were induced in Rho0 cell line after X-ray irradiation. Conclusion: CHEF pulsed-field gel electrophoresis (PEGE) is a sensitive method for the determination of radiation-induced DNA DSBs in high molecular weight DNA of human osteosarcoma cells. Radiation-induced DNA DSBs of osteosarcoma increase with the dose in a linear manner. After incubation, both Rho0 cell line and 143. B cell line can repair the DNA DSBs. Between two cell lines of human osteosarcoma, Rho0 and 143.B, Rho0 cell line is more sensitive to ionizing radiation than 143.B line

  18. CD133 positive U87 glioma stem cell radiosensitivity and DNA double-strand break repair

    International Nuclear Information System (INIS)

    Li Ping; Zong Tianzhou; Ji Xiaoqin; Lu Xueguan

    2013-01-01

    Objective: To explore the radiosensitivity and DNA double-strand break repair of CD133 + U87 glioma stem cell. Methods: CD133 + and CD133 - cells were isolated from glioma U87 cell lines by flow cytometry sorter system. After irradiated vertically by 4 Gy X-rays, the radiosensitivity of cells was determined by clonogenic assay. The radiation-induced DNA double-strand break repair of CD133 + and CD133 - cells was determined by the neutral comet assay,and the expression of phosphorylated histone H2AX (γ-H2AX) and Rad51 foci were measured by immunofluorescence. Results: The clone forming rate of CD133 + cells was higher than CD133 - cells (t=3.66, P<0.01) with no radiation. The clone forming rate of CD133 + cells irradiated by 4 Gy X-rays has no significant changes compared to that of the non-irradiation cells (t=0.71, P>0.05), but for CD133 - cells, it decreased compared to non-irradiation cells (t=2.91, P<0.05). The tailmoment between CD133 + cells and CD133 - cells had no difference at 0.5 h after irradiation (t=1.44, P>0.05); the tailmoment of CD133 + cells was lower than CD133 - cells at 6 and 24 h after irradiation,respectively (t=5.31 and 8.09, P<0.01). There was no significant difference in the expression of γ-H2AX foci between CD133 + and CD133 - cells at 0.5 and 6 h after irradiation (t=0.12 and 0.99, P>0.05), γ-H2AX foci of CD133 + cells was significantly decreased compared to CD133 - cells at 24 h after irradiation (t=4.99, P<0.01). For Rad 51 foci, there was no difference between CD133 + and CD133 - cells at 0.5 h after irradiation (t=1.12, P>0.05). The expression of Rad 51 foci of CD133 - cells was decreased compared to that of CD133 + cells at 6 and 24 h after irradiation,respectively (t=22.88 and 12.43, P<0.01). And the expression of Rad51 foci of CD133 + cells had no significant changes at 6-24 h after irradiation. Conclusions: Glioma stem cells is more radioresistive than glioma non-stem cells. The probable mechanism is that the DNA double

  19. The generalized model of polypeptide chain describing the helix-coil transition in biopolymers

    International Nuclear Information System (INIS)

    Mamasakhlisov, E.S.; Badasyan, A.V.; Tsarukyan, A.V.; Grigoryan, A.V.; Morozov, V.F.

    2005-07-01

    In this paper we summarize some results of our theoretical investigations of helix-coil transition both in single-strand (polypeptides) and two-strand (polynucleotides) macromolecules. The Hamiltonian of the Generalized Model of Polypeptide Chain (GMPC) is introduced to describe the system in which the conformations are correlated over some dimensional range Δ (it equals 3 for polypeptide, because one H-bond fixes three pairs of rotation, for double strand DNA it equals to one chain rigidity because of impossibility of loop formation on the scale less than Δ). The Hamiltonian does not contain any parameter designed especially for helix-coil transition and uses pure molecular microscopic parameters (the energy of hydrogen bond formation, reduced partition function of repeated unit, the number of repeated units fixed by one hydrogen bond, the energies of interaction between the repeated units and the solvent molecules). To calculate averages we evaluate the partition function using the transfer-matrix approach. The GMPC allowed to describe the influence of a number of factors, affecting the transition, basing on a unified microscopic approach. Thus we obtained, that solvents change transition temperature and interval in different ways, depending on type of solvent and on energy of solvent- macromolecule interaction; stacking on the background of H-bonding increases stability and decreases cooperativity of melting. For heterogeneous DNA we could analytically derive well known formulae for transition temperature and interval. In the framework of GMPC we calculate and show the difference of two order parameters of helix-coil transition - the helicity degree, and the average fraction of repeated units in helical conformation. Given article has the aim to review the results obtained during twenty years in the context of GMPC. (author)

  20. Mycobacteria exploit three genetically distinct DNA double-strand break repair pathways.

    Science.gov (United States)

    Gupta, Richa; Barkan, Daniel; Redelman-Sidi, Gil; Shuman, Stewart; Glickman, Michael S

    2011-01-01

    Bacterial pathogens rely on their DNA repair pathways to resist genomic damage inflicted by the host. DNA double-strand breaks (DSBs) are especially threatening to bacterial viability. DSB repair by homologous recombination (HR) requires nucleases that resect DSB ends and a strand exchange protein that facilitates homology search. RecBCD and RecA perform these functions in Escherichia coli and constitute the major pathway of error-free DSB repair. Mycobacteria, including the human pathogen M. tuberculosis, elaborate an additional error-prone pathway of DSB repair via non-homologous end-joining (NHEJ) catalysed by Ku and DNA ligase D (LigD). Little is known about the relative contributions of HR and NHEJ to mycobacterial chromosome repair, the factors that dictate pathway choice, or the existence of additional DSB repair pathways. Here we demonstrate that Mycobacterium smegmatis has three DSB repair pathway options: HR, NHEJ and a novel mechanism of single-strand annealing (SSA). Inactivation of NHEJ or SSA is compensated by elevated HR. We find that mycobacterial RecBCD does not participate in HR or confer resistance to ionizing radiation (IR), but is required for the RecA-independent SSA pathway. In contrast, the mycobacterial helicase-nuclease AdnAB participates in the RecA-dependent HR pathway, and is a major determinant of resistance to IR and oxidative DNA damage. These findings reveal distinctive features of mycobacterial DSB repair, most notably the dedication of the RecBCD and AdnAB helicase-nuclease machines to distinct repair pathways. © 2010 Blackwell Publishing Ltd.

  1. Repair of DNA double-strand breaks and cell killing by charged particles

    Science.gov (United States)

    Eguchi-Kasai, K.; Murakami, M.; Itsukaichi, H.; Fukutsu, K.; Yatagai, F.; Kanai, T.; Ohara, H.; Sato, K.

    It has been suggested that it is not simple double-strand breaks (dsb) but the non-reparable breaks which correlate well with the high biological effectiveness of high LET radiations for cell killing. We have compared the effects of charged particles on cell death in 3 pairs of cell lines which are normal or defective in the repair of DNA dsbs. For the cell lines SL3-147, M10, and SX10 which are deficient in DNA dsb repair, RBE values were close to unity for cell killing induced by charged particles with linear energy transfer (LET) up to 200 keV/mum and were even smaller than unity for the LET region greater than 300 keV/mum. The inactivation cross section (ICS) increased with LET for all 3 pairs. The ICS of dsb repair deficient mutants was always larger than that of their parents for all the LET ranges, but with increasing LET the difference in ICS between the mutant and its parent became smaller. Since a small difference in ICS remained at LET of about 300 keV/mum, dsb repair may still take place at this high LET, even if its role is apparently small. These results suggest that the DNA repair system does not play a major role in protection against the attack of high LET radiations and that a main cause of cell death is non-reparable dsb which are produced at a higher yield compared with low LET radiations. No correlation was observed between DNA content or nuclear area and ICS.

  2. Differences in heavy-ion-induced DNA double-strand breaks in a mouse DNA repair-deficient mutant cell line (SL3-147) before and after chromatin proteolysis

    International Nuclear Information System (INIS)

    Murakami, Masahiro; Eguchi-Kasai, Kiyomi; Sato, Koki; Minohara, Shinichi; Kanai, Tatsuaki; Yatagai, Fumio.

    1995-01-01

    DNA double-strand breaks induced by X- or neon beam-irradiation in a DNA double-strand break-repair-deficient mutant cell line (SL3-147) were examined. The increase in the number of DNA double-strand breaks was dose-depend after irradiation with X-rays and neon beams and was enhanced by chromatin-proteolysis treatment before irradiation. These results suggest that the induction of DNA double-strand breaks by ionizing radiation, including heavy-ions, is influenced by the chromatin structure. (author)

  3. Spontaneous formation of non-uniform double helices for elastic rods under torsion

    International Nuclear Information System (INIS)

    Li, Hongyuan; Zhao, Shumin; Xia, Minggang; He, Siyu; Yang, Qifan; Yan, Yuming; Zhao, Hanqiao

    2017-01-01

    The spontaneous formation of double helices for filaments under torsion is common and significant. For example, the research on the supercoiling of DNA is helpful for understanding the replication and transcription of DNA. Similar double helices can appear in carbon nanotube yarns, cables, telephone wires and so forth. We noticed that non-uniform double helices can be produced due to the surface friction induced by the self-contact. Therefore an ideal model was presented to investigate the formation of double helices for elastic rods under torque. A general equilibrium condition which is valid for both the smooth surface and the rough surface situations is derived by using the variational method. By adding further constraints, the smooth and rough surface situations are investigated in detail respectively. Additionally, the model showed that the specific process of how to twist and slack the rod can determine the surface friction and hence influence the configuration of the double helix formed by rods with rough surfaces. Based on this principle, a method of manufacturing double helices with designed configurations was proposed and demonstrated. Finally, experiments were performed to verify the model and the results agreed well with the theory. - Highlights: • An ideal model is conceived to investigate the spontaneous formation of double helices for rods under torsion. • Variational method is used to obtain a universal result for the double helix formation process • Self-contact and surface friction is considered to analyze the non-uniform double helix. • A novel method of producing double helix with arbitrary configuration is proposed and demonstrated. • The experiment results agree well with the theory.

  4. Spontaneous formation of non-uniform double helices for elastic rods under torsion

    Energy Technology Data Exchange (ETDEWEB)

    Li, Hongyuan [Department of Applied Physics, School of Science, Xi' an Jiaotong University, Shaanxi 710049 (China); Zhao, Shumin, E-mail: zhaosm@mail.xjtu.edu.cn [Department of Applied Physics, School of Science, Xi' an Jiaotong University, Shaanxi 710049 (China); Xia, Minggang [Department of Optical Information Science and Technology, School of Science, Xi' an Jiaotong University, 710049 (China); Laboratory of Nanostructure and Physics Properties, School of Science, Xi' an Jiaotong University, 710049 (China); He, Siyu [Department of Applied Physics, School of Science, Xi' an Jiaotong University, Shaanxi 710049 (China); Yang, Qifan [Department of Biomedical Engineering, School of Life Science and Technology, Xi' an Jiaotong University, Shaanxi 710049 (China); Yan, Yuming [Department of Electrical Engineering and Automation, School of Electrical Engineering, Xi' an Jiaotong University, Shaanxi 710049 (China); Zhao, Hanqiao [Department of Biomedical Engineering, School of Life Science and Technology, Xi' an Jiaotong University, Shaanxi 710049 (China)

    2017-02-19

    The spontaneous formation of double helices for filaments under torsion is common and significant. For example, the research on the supercoiling of DNA is helpful for understanding the replication and transcription of DNA. Similar double helices can appear in carbon nanotube yarns, cables, telephone wires and so forth. We noticed that non-uniform double helices can be produced due to the surface friction induced by the self-contact. Therefore an ideal model was presented to investigate the formation of double helices for elastic rods under torque. A general equilibrium condition which is valid for both the smooth surface and the rough surface situations is derived by using the variational method. By adding further constraints, the smooth and rough surface situations are investigated in detail respectively. Additionally, the model showed that the specific process of how to twist and slack the rod can determine the surface friction and hence influence the configuration of the double helix formed by rods with rough surfaces. Based on this principle, a method of manufacturing double helices with designed configurations was proposed and demonstrated. Finally, experiments were performed to verify the model and the results agreed well with the theory. - Highlights: • An ideal model is conceived to investigate the spontaneous formation of double helices for rods under torsion. • Variational method is used to obtain a universal result for the double helix formation process • Self-contact and surface friction is considered to analyze the non-uniform double helix. • A novel method of producing double helix with arbitrary configuration is proposed and demonstrated. • The experiment results agree well with the theory.

  5. Accelerated heavy ions induced DNA double-strand breaks in yeast cells

    International Nuclear Information System (INIS)

    Akpa, T.C.

    1993-01-01

    Yeast cells of strain cerevisiae, were irradiated with monoenergetic heavy ions, X-rays and α particles and assayed for DNA double-strand breaks and cell survival. The method of neutral sucrose gradient velocity sedimentation was used for all heavy-ion experiments because it is a well established technique.The method of pulsed-field gel electrophoresis was used for X-rays, α particles and argon ions. Results show that within the range of LET of the particles used (300 - 10 5 KeV/μm) the induction cross-section for DNA double-strand break is constant between 300 and around 7000 KeV/μm and increases at higher LET values. The inactivation cross-section follow the same trend. The DSB-induction and inactivation cross-section was shown to be linearly related with a slope of (1.01±0.15)/109 gmol-i. The RBE for DSB -induced decreases with LET and tails off at high LET values also. These results when compared with results from literature shows that the trend of induction is first monotonic rise of rate of DSB-induction up to 100keV/μm, followed by a plateau and a further rise which is due to increased effect of energetic γ-rays formed as shown for survival studies and predicted is possible to separate the cell DNA contents into 13 to 15 chromosome bands. The relative decrease in DNA content of the first band as determined by ethidium bromide-UV fluorescence decreases exponentially. The cross-section for DSB-induction determined by this method are (9.8±0.01)dsb/10 12 gmol - 1 Gy - 1, for 80 kV X-rays in haploid 211 yeast strain; (0.04+0.003)dsb/109gmol - 1μm 2 for Am-radioisotope α particles in haploid cells, (0.184±0.034) dsb/10 9 gmol - 1μm 2 in diploid 211*B cells and (0.55±0.04) dsb/10 9 gmol - 1μm 2 for 7MeV Argon ion in the diploid cells. The values are comparable to those obtained with velocity sedimentation technique. However, the reason for the low value obtained for a particle induced DSB in haploid cells is not clear

  6. Excess single-stranded DNA inhibits meiotic double-strand break repair.

    Directory of Open Access Journals (Sweden)

    Rebecca Johnson

    2007-11-01

    Full Text Available During meiosis, self-inflicted DNA double-strand breaks (DSBs are created by the protein Spo11 and repaired by homologous recombination leading to gene conversions and crossovers. Crossover formation is vital for the segregation of homologous chromosomes during the first meiotic division and requires the RecA orthologue, Dmc1. We analyzed repair during meiosis of site-specific DSBs created by another nuclease, VMA1-derived endonuclease (VDE, in cells lacking Dmc1 strand-exchange protein. Turnover and resection of the VDE-DSBs was assessed in two different reporter cassettes that can repair using flanking direct repeat sequences, thereby obviating the need for a Dmc1-dependent DNA strand invasion step. Access of the single-strand binding complex replication protein A, which is normally used in all modes of DSB repair, was checked in chromatin immunoprecipitation experiments, using antibody against Rfa1. Repair of the VDE-DSBs was severely inhibited in dmc1Delta cells, a defect that was associated with a reduction in the long tract resection required to initiate single-strand annealing between the flanking repeat sequences. Mutants that either reduce Spo11-DSB formation or abolish resection at Spo11-DSBs rescued the repair block. We also found that a replication protein A component, Rfa1, does not accumulate to expected levels at unrepaired single-stranded DNA (ssDNA in dmc1Delta cells. The requirement of Dmc1 for VDE-DSB repair using flanking repeats appears to be caused by the accumulation of large quantities of ssDNA that accumulate at Spo11-DSBs when Dmc1 is absent. We propose that these resected DSBs sequester both resection machinery and ssDNA binding proteins, which in wild-type cells would normally be recycled as Spo11-DSBs repair. The implication is that repair proteins are in limited supply, and this could reflect an underlying mechanism for regulating DSB repair in wild-type cells, providing protection from potentially harmful effects

  7. Conservation of the rad21 Schizosaccharomyces pombe DNA double-strand break repair gene in mammals

    International Nuclear Information System (INIS)

    McKay, Michael J.; Spek, Peter van der; Kanaar, Roland; Smit, Bep; Bootsma, Dirk; Hoeijmakers, Jan H. J.

    1996-01-01

    Purpose/Objective: Genetic factors are likely to be major determinants of human cellular ionizing radiation sensitivity. DNA double strand breaks (dsbs) are significant ionizing radiation-induced lesions; cellular DNA dsb processing is also important in a number of other contexts. To further the understanding of DNA dsb processing in mammalian cells, we cloned and sequenced mammalian homologs of the rad21 Schizosaccharomyces pombe DNA dsb repair gene. Materials and Methods: The genes were cloned by evolutionary walking, exploiting sequence homology between the yeast and mammalian genes. Results: No major motifs indicative of a particular function were present in the predicted amino acid sequences of the mammalian genes. Alignment of the Rad21 amino acid sequence with its putative homologs showed that similarity was distributed across the length of the proteins, with more highly conserved regions at both termini. The mHR21 sp (mouse homolog ofR ad21, S. pombe) and hHR21 sp (humanh omolog of Rad21, S. pombe) predicted proteins were 96% identical, whereas the human and S. pombe proteins were 25% identical and 47% similar. RNA blot analysis showed that mHR21 sp mRNA was abundant in all adult mouse tissues examined, with highest expression in testis and thymus. In addition to a 3.1kb mRNA transcript in all tissues, an additional 2.2kb transcript was present at a high level in post-meiotic spermatids, white expression of the 3.1kb mRNA in testis was confined to the meiotic compartment. hHR21 sp mRNA was cell cycle regulated in human cells, increasing in late S phase to a peak in G2 phase. The level of hHR21 sp transcripts was not altered by exposure of normal diploid fibroblasts to 10 Gy ionizing radiation. In situ hybridization showed mHR21 sp resided on chromosome 15D3, whereashHR21 sp localized to the syntenic 8q24 region. Conclusion: Cloning these novel mammalian genes and characterization of their protein products should contribute to the understanding of cellular

  8. Opposing roles of RNF8/RNF168 and deubiquitinating enzymes in ubiquitination-dependent DNA double-strand break response signaling and DNA-repair pathway choice

    International Nuclear Information System (INIS)

    Nakada, Shinichiro

    2016-01-01

    The E3 ubiquitin ligases ring finger protein (RNF) 8 and RNF168 transduce the DNA double-strand break (DSB) response (DDR) signal by ubiquitinating DSB sites. The depletion of RNF8 or RNF168 suppresses the accumulation of DNA-repair regulating factors such as 53BP1 and RAP80 at DSB sites, suggesting roles for RNF8- and RNF168-mediated ubiquitination in DSB repair. This mini-review provides a brief overview of the RNF8- and RNF168-dependent DDR-signaling and DNA-repair pathways. The choice of DNA-repair pathway when RNF8- and RNF168-mediated ubiquitination-dependent DDR signaling is negatively regulated by deubiquitinating enzymes (DUBs) is reviewed to clarify how the opposing roles of RNF8/RNF168 and DUBs regulate ubiquitination-dependent DDR signaling and the choice of DNA-repair pathway

  9. A polycomb group protein, PHF1, is involved in the response to DNA double-strand breaks in human cell

    OpenAIRE

    Hong, Zehui; Jiang, Jie; Lan, Li; Nakajima, Satoshi; Kanno, Shin-ichiro; Koseki, Haruhiko; Yasui, Akira

    2008-01-01

    DNA double-strand breaks (DSBs) represent the most toxic DNA damage arisen from endogenous and exogenous genotoxic stresses and are known to be repaired by either homologous recombination or nonhomologous end-joining processes. Although many proteins have been identified to participate in either of the processes, the whole processes still remain elusive. Polycomb group (PcG) proteins are epigenetic chromatin modifiers involved in gene silencing, cancer development and the maintenance of embry...

  10. Micromechanics of base pair unzipping in the DNA duplex

    International Nuclear Information System (INIS)

    Volkov, Sergey N; Paramonova, Ekaterina V; Yakubovich, Alexander V; Solov’yov, Andrey V

    2012-01-01

    All-atom molecular dynamics (MD) simulations of DNA duplex unzipping in a water environment were performed. The investigated DNA double helix consists of a Drew-Dickerson dodecamer sequence and a hairpin (AAG) attached to the end of the double-helix chain. The considered system is used to examine the process of DNA strand separation under the action of an external force. This process occurs in vivo and now is being intensively investigated in experiments with single molecules. The DNA dodecamer duplex is consequently unzipped pair by pair by means of the steered MD. The unzipping trajectories turn out to be similar for the duplex parts with G⋅C content and rather distinct for the parts with A⋅T content. It is shown that during the unzipping each pair experiences two types of motion: relatively quick rotation together with all the duplex and slower motion in the frame of the unzipping fork. In the course of opening, the complementary pair passes through several distinct states: (i) the closed state in the double helix, (ii) the metastable preopened state in the unzipping fork and (iii) the unbound state. The performed simulations show that water molecules participate in the stabilization of the metastable states of the preopened base pairs in the DNA unzipping fork. (paper)

  11. γ-ray dose rate effect in DNA double-strand break repair deficient murine cells

    International Nuclear Information System (INIS)

    Li Liya; Li Peiwen

    2002-01-01

    Objective: To analyze the dose rate effect and potentially lethal damage repair in DNA double-strand break repair deficient murine cells (SCID) irradiated by γ-ray. Methods: The wild type (CB.17+/+) and SCID cells were exposed to γ-ray at high and low dose rates. The high dose rate exposure was fractionated into two equal doses at 24 h intervals. The survival rates of irradiated cells were calculated by clone-forming analysis. Results: When γ-ray was given to wild type (CB.17+/+) cells in two fractions at 24 h intervals, the survival rate was significantly higher than that when the same total dose was given singly. In contrast, there was no difference in the survival rates between the single and fractionated exposure in SCID cells. SCID cells were more sensitive than CB.17+/+ cells to both low and high dose rates γ-ray exposure for cell killing. The survival rate by low dose rate exposure was significantly higher than that by high dose rate exposure, not only in CB.17+/+ cells but also in SCID cells. Conclusions: SCID cells are deficient in repairing γ-ray induced double-strand breaks. There is dose rate effect in both SCID and CB.17+/+ cells

  12. Poly(ADP-ribose polymerase (PARP-1 is not involved in DNA double-strand break recovery

    Directory of Open Access Journals (Sweden)

    Fernet Marie

    2003-07-01

    Full Text Available Abstract Background The cytotoxicity and the rejoining of DNA double-strand breaks induced by γ-rays, H2O2 and neocarzinostatin, were investigated in normal and PARP-1 knockout mouse 3T3 fibroblasts to determine the role of poly(ADP-ribose polymerase (PARP-1 in DNA double-strand break repair. Results PARP-1-/- were considerably more sensitive than PARP-1+/+ 3T3s to induced cell kill by γ-rays and H2O2. However, the two cell lines did not show any significant difference in the susceptibility to neocarzinostatin below 1.5 nM drug. Restoration of PARP-1 expression in PARP-1-/- 3T3s by retroviral transfection of the full PARP-1 cDNA did not induce any change in neocarzinostatin response. Moreover the incidence and the rejoining kinetics of neocarzinostatin-induced DNA double-strand breaks were identical in PARP-1+/+ and PARP-1-/- 3T3s. Poly(ADP-ribose synthesis following γ-rays and H2O2 was observed in PARP-1-proficient cells only. In contrast neocarzinostatin, even at supra-lethal concentration, was unable to initiate PARP-1 activation yet it induced H2AX histone phosphorylation in both PARP1+/+ and PARP-1-/- 3T3s as efficiently as γ-rays and H2O2. Conclusions The results show that PARP-1 is not a major determinant of DNA double-strand break recovery with either strand break rejoining or cell survival as an endpoint. Even though both PARP-1 and ATM activation are major determinants of the cell response to γ-rays and H2O2, data suggest that PARP-1-dependent poly(ADP-ribose synthesis and ATM-dependent H2AX phosphorylation, are not inter-related in the repair pathway of neocarzinostatin-induced DNA double-strand breaks.

  13. Large-scale chromosome folding versus genomic DNA sequences: A discrete double Fourier transform technique.

    Science.gov (United States)

    Chechetkin, V R; Lobzin, V V

    2017-08-07

    Using state-of-the-art techniques combining imaging methods and high-throughput genomic mapping tools leaded to the significant progress in detailing chromosome architecture of various organisms. However, a gap still remains between the rapidly growing structural data on the chromosome folding and the large-scale genome organization. Could a part of information on the chromosome folding be obtained directly from underlying genomic DNA sequences abundantly stored in the databanks? To answer this question, we developed an original discrete double Fourier transform (DDFT). DDFT serves for the detection of large-scale genome regularities associated with domains/units at the different levels of hierarchical chromosome folding. The method is versatile and can be applied to both genomic DNA sequences and corresponding physico-chemical parameters such as base-pairing free energy. The latter characteristic is closely related to the replication and transcription and can also be used for the assessment of temperature or supercoiling effects on the chromosome folding. We tested the method on the genome of E. coli K-12 and found good correspondence with the annotated domains/units established experimentally. As a brief illustration of further abilities of DDFT, the study of large-scale genome organization for bacteriophage PHIX174 and bacterium Caulobacter crescentus was also added. The combined experimental, modeling, and bioinformatic DDFT analysis should yield more complete knowledge on the chromosome architecture and genome organization. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Radiation dose determines the method for quantification of DNA double strand breaks

    International Nuclear Information System (INIS)

    Bulat, Tanja; Keta, Olitija; Korićanac, Lela; Žakula, Jelena; Petrović, Ivan; Ristić-Fira, Aleksandra; Todorović, Danijela

    2016-01-01

    Ionizing radiation induces DNA double strand breaks (DSBs) that trigger phosphorylation of the histone protein H2AX (γH2AX). Immunofluorescent staining visualizes formation of γH2AX foci, allowing their quantification. This method, as opposed to Western blot assay and Flow cytometry, provides more accurate analysis, by showing exact position and intensity of fluorescent signal in each single cell. In practice there are problems in quantification of γH2AX. This paper is based on two issues: the determination of which technique should be applied concerning the radiation dose, and how to analyze fluorescent microscopy images obtained by different microscopes. HTB140 melanoma cells were exposed to γ-rays, in the dose range from 1 to 16 Gy. Radiation effects on the DNA level were analyzed at different time intervals after irradiation by Western blot analysis and immunofluorescence microscopy. Immunochemically stained cells were visualized with two types of microscopes: AxioVision (Zeiss, Germany) microscope, comprising an ApoTome software, and AxioImagerA1 microscope (Zeiss, Germany). Obtained results show that the level of γH2AX is time and dose dependent. Immunofluorescence microscopy provided better detection of DSBs for lower irradiation doses, while Western blot analysis was more reliable for higher irradiation doses. AxioVision microscope containing ApoTome software was more suitable for the detection of γH2AX foci. (author)

  15. The Heterochromatic Barrier to DNA Double Strand Break Repair: How to Get the Entry Visa

    Directory of Open Access Journals (Sweden)

    Aaron A. Goodarzi

    2012-09-01

    Full Text Available Over recent decades, a deep understanding of pathways that repair DNA double strand breaks (DSB has been gained from biochemical, structural, biophysical and cellular studies. DNA non-homologous end-joining (NHEJ and homologous recombination (HR represent the two major DSB repair pathways, and both processes are now well understood. Recent work has demonstrated that the chromatin environment at a DSB significantly impacts upon DSB repair and that, moreover, dramatic modifications arise in the chromatin surrounding a DSB. Chromatin is broadly divided into open, transcriptionally active, euchromatin (EC and highly compacted, transcriptionally inert, heterochromatin (HC, although these represent extremes of a spectrum. The HC superstructure restricts both DSB repair and damage response signaling. Moreover, DSBs within HC (HC-DSBs are rapidly relocalized to the EC-HC interface. The damage response protein kinase, ataxia telangiectasia mutated (ATM, is required for HC-DSB repair but is dispensable for the relocalization of HC-DSBs. It has been proposed that ATM signaling enhances HC relaxation in the DSB vicinity and that this is a prerequisite for HC-DSB repair. Hence, ATM is essential for repair of HC-DSBs. Here, we discuss how HC impacts upon the response to DSBs and how ATM overcomes the barrier that HC poses to repair.

  16. Radiation dose determines the method for quantification of DNA double strand breaks

    Energy Technology Data Exchange (ETDEWEB)

    Bulat, Tanja; Keta, Olitija; Korićanac, Lela; Žakula, Jelena; Petrović, Ivan; Ristić-Fira, Aleksandra [University of Belgrade, Vinča Institute of Nuclear Sciences, Belgrade (Serbia); Todorović, Danijela, E-mail: dtodorovic@medf.kg.ac.rs [University of Kragujevac, Faculty of Medical Sciences, Kragujevac (Serbia)

    2016-03-15

    Ionizing radiation induces DNA double strand breaks (DSBs) that trigger phosphorylation of the histone protein H2AX (γH2AX). Immunofluorescent staining visualizes formation of γH2AX foci, allowing their quantification. This method, as opposed to Western blot assay and Flow cytometry, provides more accurate analysis, by showing exact position and intensity of fluorescent signal in each single cell. In practice there are problems in quantification of γH2AX. This paper is based on two issues: the determination of which technique should be applied concerning the radiation dose, and how to analyze fluorescent microscopy images obtained by different microscopes. HTB140 melanoma cells were exposed to γ-rays, in the dose range from 1 to 16 Gy. Radiation effects on the DNA level were analyzed at different time intervals after irradiation by Western blot analysis and immunofluorescence microscopy. Immunochemically stained cells were visualized with two types of microscopes: AxioVision (Zeiss, Germany) microscope, comprising an ApoTome software, and AxioImagerA1 microscope (Zeiss, Germany). Obtained results show that the level of γH2AX is time and dose dependent. Immunofluorescence microscopy provided better detection of DSBs for lower irradiation doses, while Western blot analysis was more reliable for higher irradiation doses. AxioVision microscope containing ApoTome software was more suitable for the detection of γH2AX foci. (author)

  17. Detection of heavy ion induced DNA double-strand breaks using static-field gel electrophoresis

    International Nuclear Information System (INIS)

    Taucher-Scholz, G.; Heilmann, J.; Schneider, G.; Kraft, G.

    1994-11-01

    Radiation induced DNA double-strand breaks (DSBs) were measured in Chinese hamster ovary cells (CHO-K1) using an experimental protocol involving static-field gel electrophoresis following exposure to various accelerated ions. Dose-effect curves were set up and relative biological efficiencies (RBEs) for DSB induction were determined for different radiation qualities. RBEs around 1 were obtained for low energy deuterons (6-7 keV/μm), while for high energy oxygen ions (20 keV/μm) an RBE value slightly greater than 1 was determined. Low energetic oxygen ions (LET ∼ 250 keV/μm) were found to show RBEs substantially below unity, and for higher LET particles (≥ 250 keV/μm) RBEs for DSB induction were generally found to be smaller than 1. The data presented here are in line with the generally accepted view that not induced DSBs, but misrepaired or unrepaired DNA-lesions are related to cellular inactivation. (orig.)

  18. Cisplatin enhances the formation of DNA single- and double-strand breaks by hydrated electrons and hydroxyl radicals.

    Science.gov (United States)

    Rezaee, Mohammad; Sanche, Léon; Hunting, Darel J

    2013-03-01

    The synergistic interaction of cisplatin with ionizing radiation is the clinical rationale for the treatment of several cancers including head and neck, cervical and lung cancer. The underlying molecular mechanism of the synergy has not yet been identified, although both DNA damage and repair processes are likely involved. Here, we investigate the indirect effect of γ rays on strand break formation in a supercoiled plasmid DNA (pGEM-3Zf-) covalently modified by cisplatin. The yields of single- and double-strand breaks were determined by irradiation of DNA and cisplatin/DNA samples with (60)Co γ rays under four different scavenging conditions to examine the involvement of hydrated electrons and hydroxyl radicals in inducing the DNA damage. At 5 mM tris in an N2 atmosphere, the presence of an average of two cisplatins per plasmid increased the yields of single- and double-strand breaks by factors of 1.9 and 2.2, respectively, relative to the irradiated unmodified DNA samples. Given that each plasmid of 3,200 base pairs contained an average of two cisplatins, this represents an increase in radiosensitivity of 3,200-fold on a per base pair basis. When hydrated electrons were scavenged by saturating the samples with N2O, these enhancement factors decreased to 1.5 and 1.2, respectively, for single- and double-strand breaks. When hydroxyl radicals were scavenged using 200 mM tris, the respective enhancement factors were 1.2 and 1.6 for single- and double-strand breaks, respectively. Furthermore, no enhancement in DNA damage by cisplatin was observed after scavenging both hydroxyl radicals and hydrated electrons. These findings show that hydrated electrons can induce both single- and double-strand breaks in the platinated DNA, but not in unmodified DNA. In addition, cisplatin modification is clearly an extremely efficient means of increasing the formation of both single- and double-strand breaks by the hydrated electrons and hydroxyl radicals created by ionizing

  19. Bioelectrochemical sensing of promethazine with bamboo-type multiwalled carbon nanotubes dispersed in calf-thymus double stranded DNA.

    Science.gov (United States)

    Primo, Emiliano N; Oviedo, M Belén; Sánchez, Cristián G; Rubianes, María D; Rivas, Gustavo A

    2014-10-01

    We report the quantification of promethazine (PMZ) using glassy carbon electrodes (GCE) modified with bamboo-like multi-walled carbon nanotubes (bCNT) dispersed in double stranded calf-thymus DNA (dsDNA) (GCE/bCNT-dsDNA). Cyclic voltammetry measurements demonstrated that PMZ presents a thin film-confined redox behavior at GCE/bCNT-dsDNA, opposite to the irreversibly-adsorbed behavior obtained at GCE modified with bCNT dispersed in ethanol (GCE/bCNT). Differential pulse voltammetry-adsorptive stripping with medium exchange experiments performed with GCE/bCNT-dsDNA and GCE modified with bCNTs dispersed in single-stranded calf-thymus DNA (ssDNA) confirmed that the interaction between PMZ and bCNT-dsDNA is mainly hydrophobic. These differences are due to the intercalation of PMZ within the dsDNA that supports the bCNTs, as evidenced from the bathochromic displacement of UV-Vis absorption spectra of PMZ and quantum dynamics calculations at DFTB level. The efficient accumulation of PMZ at GCE/bCNT-dsDNA made possible its sensitive quantification at nanomolar levels (sensitivity: (3.50±0.05)×10(8) μA·cm(-2)·M(-1) and detection limit: 23 nM). The biosensor was successfully used for the determination of PMZ in a pharmaceutical product with excellent correlation. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. Detection and Repair of Ionizing Radiation-Induced DNA Double Strand Breaks: New Developments in Nonhomologous End Joining

    International Nuclear Information System (INIS)

    Wang, Chen; Lees-Miller, Susan P.

    2013-01-01

    DNA damage can occur as a result of endogenous metabolic reactions and replication stress or from exogenous sources such as radiation therapy and chemotherapy. DNA double strand breaks are the most cytotoxic form of DNA damage, and defects in their repair can result in genome instability, a hallmark of cancer. The major pathway for the repair of ionizing radiation-induced DSBs in human cells is nonhomologous end joining. Here we review recent advances on the mechanism of nonhomologous end joining, as well as new findings on its component proteins and regulation

  1. Detection and Repair of Ionizing Radiation-Induced DNA Double Strand Breaks: New Developments in Nonhomologous End Joining

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Chen [Departments of Biochemistry and Molecular Biology and Oncology, and Southern Alberta Cancer Research Institute, University of Calgary, Calgary (Canada); Lees-Miller, Susan P., E-mail: leesmill@ucalgary.ca [Departments of Biochemistry and Molecular Biology and Oncology, and Southern Alberta Cancer Research Institute, University of Calgary, Calgary (Canada)

    2013-07-01

    DNA damage can occur as a result of endogenous metabolic reactions and replication stress or from exogenous sources such as radiation therapy and chemotherapy. DNA double strand breaks are the most cytotoxic form of DNA damage, and defects in their repair can result in genome instability, a hallmark of cancer. The major pathway for the repair of ionizing radiation-induced DSBs in human cells is nonhomologous end joining. Here we review recent advances on the mechanism of nonhomologous end joining, as well as new findings on its component proteins and regulation.

  2. Smoking cessation reverses DNA double-strand breaks in human mononuclear cells.

    Directory of Open Access Journals (Sweden)

    Mari Ishida

    Full Text Available OBJECTIVE: Cigarette smoking is a major risk factor for atherosclerotic cardiovascular disease, which is responsible for a significant proportion of smoking-related deaths. However, the precise mechanism whereby smoking induces this pathology has not been fully delineated. Based on observation of DNA double-strand breaks (DSBs, the most harmful type of DNA damage, in atherosclerotic lesions, we hypothesized that there is a direct association between smoking and DSBs. The goal of this study was to investigate whether smoking induces DSBs and smoking cessation reverses DSBs in vivo through examination of peripheral mononuclear cells (MNCs. APPROACH AND RESULTS: Immunoreactivity of oxidative modification of DNA and DSBs were increased in human atherosclerotic lesions but not in the adjacent normal area. DSBs in human MNCs isolated from the blood of volunteers can be detected as cytologically visible "foci" using an antibody against the phosphorylated form of the histone H2AX (γ-H2AX. Young healthy active smokers (n = 15 showed increased γ-H2AX foci number when compared with non-smokers (n = 12 (foci number/cell: median, 0.37/cell; interquartile range [IQR], 0.31-0.58 vs. 4.36/cell; IQR, 3.09-7.39, p<0.0001. Smoking cessation for 1 month reduced the γ-H2AX foci number (median, 4.44/cell; IQR, 4.36-5.24 to 0.28/cell; IQR, 0.12-0.53, p<0.05. A positive correlation was noted between γ-H2AX foci number and exhaled carbon monoxide levels (r = 0.75, p<0.01. CONCLUSIONS: Smoking induces DSBs in human MNCs in vivo, and importantly, smoking cessation for 1 month resulted in a decrease in DSBs to a level comparable to that seen in non-smokers. These data reinforce the notion that the cigarette smoking induces DSBs and highlight the importance of smoking cessation.

  3. The contribution of alu elements to mutagenic DNA double-strand break repair.

    Science.gov (United States)

    Morales, Maria E; White, Travis B; Streva, Vincent A; DeFreece, Cecily B; Hedges, Dale J; Deininger, Prescott L

    2015-03-01

    Alu elements make up the largest family of human mobile elements, numbering 1.1 million copies and comprising 11% of the human genome. As a consequence of evolution and genetic drift, Alu elements of various sequence divergence exist throughout the human genome. Alu/Alu recombination has been shown to cause approximately 0.5% of new human genetic diseases and contribute to extensive genomic structural variation. To begin understanding the molecular mechanisms leading to these rearrangements in mammalian cells, we constructed Alu/Alu recombination reporter cell lines containing Alu elements ranging in sequence divergence from 0%-30% that allow detection of both Alu/Alu recombination and large non-homologous end joining (NHEJ) deletions that range from 1.0 to 1.9 kb in size. Introduction of as little as 0.7% sequence divergence between Alu elements resulted in a significant reduction in recombination, which indicates even small degrees of sequence divergence reduce the efficiency of homology-directed DNA double-strand break (DSB) repair. Further reduction in recombination was observed in a sequence divergence-dependent manner for diverged Alu/Alu recombination constructs with up to 10% sequence divergence. With greater levels of sequence divergence (15%-30%), we observed a significant increase in DSB repair due to a shift from Alu/Alu recombination to variable-length NHEJ which removes sequence between the two Alu elements. This increase in NHEJ deletions depends on the presence of Alu sequence homeology (similar but not identical sequences). Analysis of recombination products revealed that Alu/Alu recombination junctions occur more frequently in the first 100 bp of the Alu element within our reporter assay, just as they do in genomic Alu/Alu recombination events. This is the first extensive study characterizing the influence of Alu element sequence divergence on DNA repair, which will inform predictions regarding the effect of Alu element sequence divergence on both

  4. Repair response for DNA double-strand damage through ubiquitylation of chromatin

    International Nuclear Information System (INIS)

    Nakada, Shinichiro

    2011-01-01

    The chromatin modulation (remodeling) via lysine63 (K63)-linked ubiquitin (U) has been found important in the repair response for DNA double-strand damage, and the sequential signaling events at the damage site are explained. As the first step of the repair, MRN (MRE11, RAD50 and nibrin) complex recognizes the damage site and binds to it followed by many linked reactions by recruited and activated enzymes of various protein kinases and phosphatases, which resulting in the enhanced early signaling. As well, gamma-H2AX (phosphorylated histone H2AX) is yielded by the process, to which phosphorylated MDC1 (mediator of DNA-damage checkpoint 1) binds to produce their complex. Then further binding of RNF8-HERC2-UBC13 (ring finger protein 8, hect domain and RCC1 (CHC1)-like domain, and U conjugating enzyme E2N, respectively) occurs for starting the cumulative ubiquitylation of H2AX via K63 as the middle phase response. Signaling in the late phase occurs on the U chain formed at the damage site by binding of RAP (receptor-associated protein) 80 and other recruited 5 proteins like BRCA1 (breast cancer 1, early onset) to repair DNA by the homologous recombination after 53BP1 (tumor protein p53 binding protein) binding followed by methylation of histone H4. In a case of human compound heterozygous RNF168 defect, RIDDLE syndrome (radiosensitivity, immunodeficiency, dysmorphic features and learning difficulties), cells have no and slight abnormality of G2/M and intra-S checkpoint, respectively. Another defecting case with homozygous nonsense mutation has high radiosensitivity, intra-S checkpoint abnormality and others. Abnormality of immuno-globulins observed in both cases is similar to that in the RNF8-knockout mouse. Many tasks in chromatin ubiquitylation in the repair are still remained to be solved for protection and treatment of related diseases. (T.T.)

  5. Role of XRCC4 phosphorylation by DNA-PK in the regulation of NHEJ repair pathway of DNA double strand break

    International Nuclear Information System (INIS)

    Sharma, Mukesh Kumar; Imamichi, Shoji; Fukuchi, Mikoto; Kamdar, Radhika P.; Sicheng, Liu; Wanotayan, Rujira; Matsumoto, Yoshihisa

    2014-01-01

    Non-homologous end-joining (NHEJ) is the predominant pathway of DNA double strand breaks in higher eukaryotes and is active throughout the cell cycle. NHEJ repair includes many factors as Ku70/86, DNA-PKcs, XRCC4-Ligase IV complex and XLF (also known as Cernunnos). In these factors, DNA-PKcs acts as central regulator in NHEJ repair. It recruited at the DNA damages site after DNA damage and after association with Ku its kinase activity is activated. It phosphorylates many of important NHEJ proteins in vitro including XRCC4, Ku 70/86, Artemis, and even DNA-PKcs but till now, very less studies have been done to know the role and significance of phosphorylation in the NHEJ repair. Studies by other researchers identified various phosphorylation sites in XRCC4 by DNA-PK using mass spectrometry but these phosphorylation sites were shown to be dispensable for DSB repair. In the present investigation, we identified 3 serine and one new threonine phosphorylation sites in XRCC4 protein by DNA-PK. In vivo phosphorylation at these sites was verified by generating phosphorylation specific antibodies and the requirement for DNA-PK therein was verified by using DNA-PK inhibitor and DNA-PK proficient and deficient cell lines in response to radiation and zeocin treatment. We have also found that phosphorylation at these sites showed dose dependency in response to radiation treatment. The two serine and one threonine phosphorylation site is also biological important as their mutation into alanine significantly elevated radiosensitivity as measured by colony formation assay. Neutral comet assay showed delayed kinetics in DSB repair of these mutants. Furthermore, we have found a protein, with putative DSB repair function, which interacts with domain including the phosphorylation sites.These results indicate that these phosphorylation sites would mediate functional link between XRCC4 and DNA-PK. (author)

  6. Molecular characterization of a complex site-specific radiation-induced DNA double-strand break

    International Nuclear Information System (INIS)

    Datta, K.; Dizdaroglu, M.; Jaruga, P.; Neumann, R.D.; Winters, T.A.

    2003-01-01

    Radiation lethality is a function of radiation-induced DNA double-strand breaks (DSB). Current models propose the lethality of a DSB to be a function of its structural complexity. We present here for the first time a map of damage associated with a site-specific double-strand break produced by decay of 125 I in a plasmid bound by a 125 I-labeled triplex forming oligonucleotide ( 125 I-TFO). The E. coli DNA repair enzymes, endonuclease IV (endo IV), endonuclease III (endo III), and formamidopyrimidine-DNA glycosylase (Fpg), which recognize AP sites, and pyrimidine and purine base damage respectively, were used as probes in this study. 125 I-TFO bound plasmid was incubated with and without DMSO at -80 deg C for 1 month. No significant difference in DSB yield was observed under these conditions. A 32 base pair fragment from the upstream side of the decay site was isolated by restriction digestion and enzymatically probed to identify damage sites. Endo IV treatment of the 5'-end labeled upper strand indicated clustering of AP sites within 3 bases downstream and 7 bases upstream of the targeted base. Also, repeated experiments consistently detected an AP site 4 bases upstream of the 125 Itarget base. This was further supported by complementary results with the 3'-end labeled upper strand. Endo IV analysis of the lower strand also shows clustering of AP sites near the DSB end. Endo III and Fpg probing demonstrated that base damage is also clustered near the targeted break site. DSBs produced in the absence of DMSO displayed a different pattern of enzyme sensitive damage than those produced in the presence of DMSO. Identification of specific base damage types within the restriction fragment containing the DSB end was achieved with GC/MS. Base damage consisted of 8-hydroguanine, 8-hydroxyadenine, and 5-hydroxycytosine. These lesions were observed at relative yields of 8-hydroguanine and 5-hydroxycytosine to 8-hydroxyadenine of 7.4:1 and 4.7:1, respectively, in the absence

  7. An alternative mechanism for radioprotection by dimethyl sulfoxide. Possible facilitation of DNA double-strand break repair

    International Nuclear Information System (INIS)

    Kashino, Genro; Liu, Yong; Suzuki, Minoru; Masunaga, Shin-ichiro; Kinashi, Yuko; Ono, Koji; Tano, Keizo; Watanabe, Masami

    2010-01-01

    The radioprotective effects of dimethyl sulfoxide (DMSO) have been known for many years, and the suppression of hydroxyl (OH) radicals induced by ionizing radiation has been thought to be the main cause of this effect. However, the DMSO concentration used was very high, and might be toxic, in earlier studies. In the present study, we administered a lower, non-toxic concentration (0.5%, id est (i.e.), 64 mM) of DMSO before irradiation and examined its radioprotective effects. Colony formation assay and micronucleus assay showed significant radioprotective effects in Chinese hamster ovary (CHO), but not in xrs5, which is defective in the repair function of DNA double-strand breaks. The levels of phosphorylated H2AX and the formation of 53BP1 foci 15 minutes after irradiation, which might reflect initial DNA double-strand breaks, in DMSO-treated CHO cells were similar to those in non-treated cells, suggesting that the radioprotective effects were not attributable to the suppression of general indirect action in the lower concentration of DMSO. On the other hand, 2 hours after irradiation, the average number of 53BP1 foci, which might reflect residual DNA double-strand breaks, was significantly decreased in DMSO-treated CHO cells compared to non-treated cells. The results indicated that low concentration of DMSO exerts radioprotective effects through the facilitation of DNA double-strand break repair rather than through the suppression of indirect action. (author)

  8. An alternative mechanism for radioprotection by dimethyl sulfoxide; possible facilitation of DNA double-strand break repair.

    Science.gov (United States)

    Kashino, Genro; Liu, Yong; Suzuki, Minoru; Masunaga, Shin-ichiro; Kinashi, Yuko; Ono, Koji; Tano, Keizo; Watanabe, Masami

    2010-01-01

    The radioprotective effects of dimethyl sulfoxide (DMSO) have been known for many years, and the suppression of hydroxyl (OH) radicals induced by ionizing radiation has been thought to be the main cause of this effect. However, the DMSO concentration used was very high, and might be toxic, in earlier studies. In the present study, we administered a lower, non-toxic concentration (0.5%, i.e., 64 mM) of DMSO before irradiation and examined its radioprotective effects. Colony formation assay and micronucleus assay showed significant radioprotective effects in CHO, but not in xrs5, which is defective in the repair function of DNA double-strand breaks. The levels of phosphorylated H2AX and the formation of 53BP1 foci 15 minutes after irradiation, which might reflect initial DNA double-strand breaks, in DMSO-treated CHO cells were similar to those in non-treated cells, suggesting that the radioprotective effects were not attributable to the suppression of general indirect action in the lower concentration of DMSO. On the other hand, 2 hours after irradiation, the average number of 53BP1 foci, which might reflect residual DNA double-strand breaks, was significantly decreased in DMSO-treated CHO cells compared to non-treated cells. The results indicated that low concentration of DMSO exerts radioprotective effects through the facilitation of DNA double-strand break repair rather than through the suppression of indirect action.

  9. The ubiquitin-selective segregase VCP/p97 orchestrates the response to DNA double-strand breaks

    DEFF Research Database (Denmark)

    Meerang, Mayura; Ritz, Danilo; Paliwal, Shreya

    2011-01-01

    Unrepaired DNA double-strand breaks (DSBs) cause genetic instability that leads to malignant transformation or cell death. Cells respond to DSBs with the ordered recruitment of signalling and repair proteins to the site of lesion. Protein modification with ubiquitin is crucial for the signalling ...

  10. Induction of DNA double-strand breaks in hepatoma cell SMMC-7721 by accelerated carbon ion 12C6+

    International Nuclear Information System (INIS)

    Lei Suwen; Su Xu; Wang Jufang; Zhao Jing; Li Wenjian

    2004-01-01

    DNA lesions, especially DNA double-strand breaks (dsbs), are looked upon as the dominant molecular effect of radiation action. Dsbs mark the beginning of a cascade of cellular processes that either results in complete repair of the DNA damage or lead to deleterious stages such as mutation, transformation or even cell death. Changing the radiation quality can influence the radiosensitivity of cells in culture. Accelerated particles provide an excellent means of varying the ionization density of the test radiation. With ion beams, the molecular mechanisms underlying the biological consequences of high linear energy transfer (LET) irradiation can be studied and describing radiation action with biophysical models can be tested. In this paper, radiation-induced DNA double-strand breaks (dsbs) were measured in hepatoma SMMC-7721 cells by means of an experimental approach involving pulsed-field gel electrophoresis and densitometric scanning of ethidium bromide stained gels. With this set-up, the induction of dsbs was investigated in SMMC-7721 cells after irradiation with accelerated carbon ions with specific LET 70 keV/μm. The fraction of DNA retained was taken as quantitative measure to calculate absolute yields of induced DNA dsbs. Experimental data shows that the induction of DNA dsbs increasing with the dose of irradiation. Data are compared with published results on dsbs induction in mammalian cells by radiations of comparable LET

  11. The birth and development of the DNA theory of inheritance: sixty years since the discovery of the structure of DNA.

    Science.gov (United States)

    Portin, Petter

    2014-04-01

    The development of the DNA theory of inheritance culminated in the publication of the molecular structure of DNA 60 years ago. This paper describes this development, beginning with the discovery of DNA as a chemical substance by Friedrich Miescher in 1869, followed by its basic chemical analysis and demonstration of its participation in the structure of chromosomes. Subsequently it was discovered by Oswald Avery in 1944 that DNA was the genetic material, and then Erwin Chargaff showed that the proportions of the bases included in the structure of DNA followed a certain law. These findings, in association with the biophysical studies of Maurice Wilkins and Rosalind Franklin with Raymond Gosling, led James Watson and Francis Crick to the discovery of the double-helical structure of DNA in 1953. The paper ends with a short description of the development of the DNA theory of inheritance after the discovery of the double helix.

  12. Possible role(s) of nuclear matrix and DNA loop organization in fixation or repair of DNA double-strand breaks

    International Nuclear Information System (INIS)

    Malyapa, R.S.; Wright, W.D.; Roti Roti, J.L.

    1995-01-01

    DNA double-strand breaks produced by ionizing radiation are considered to be a critical radiation-induced lesion responsible, in part, for cell killing. However, the manner in which structures within the nucleus involving DNA organization contribute to the balance between fixation or repair of these critical lesions remains largely obscure. The repair process requires both functional enzymes and substrate availability, i.e., access to and orientation of damage sites. Therefore, the ability to repair damaged DNA could be influenced not only by DNA integrity but also by the spatial organization of DNA. Therefore, the authors investigated the possibility that radiation-induced DNA damage differentially affects DNA supercoiling ability in cells of differing radiosensitivities using radioresistant and radiosensitive mutants of different origins. This study was also designed to determine if differences in the composition of the nuclear matrix exist between cell lines of each origin. Results from these studies indicate that differences in the composition of the nuclear matrix proteins and DNA stability might be related to intrinsic radiation resistance

  13. IDN2 Interacts with RPA and Facilitates DNA Double-Strand Break Repair by Homologous Recombination in Arabidopsis.

    Science.gov (United States)

    Liu, Mingming; Ba, Zhaoqing; Costa-Nunes, Pedro; Wei, Wei; Li, Lanxia; Kong, Fansi; Li, Yan; Chai, Jijie; Pontes, Olga; Qi, Yijun

    2017-03-01

    Repair of DNA double-strand breaks (DSBs) is critical for the maintenance of genome integrity. We previously showed that DSB-induced small RNAs (diRNAs) facilitate homologous recombination-mediated DSB repair in Arabidopsis thaliana Here, we show that INVOLVED IN DE NOVO2 (IDN2), a double-stranded RNA binding protein involved in small RNA-directed DNA methylation, is required for DSB repair in Arabidopsis. We find that IDN2 interacts with the heterotrimeric replication protein A (RPA) complex. Depletion of IDN2 or the diRNA binding ARGONAUTE2 leads to increased accumulation of RPA at DSB sites and mislocalization of the recombination factor RAD51. These findings support a model in which IDN2 interacts with RPA and facilitates the release of RPA from single-stranded DNA tails and subsequent recruitment of RAD51 at DSB sites to promote DSB repair. © 2017 American Society of Plant Biologists. All rights reserved.

  14. Fumarase is involved in DNA double-strand break resection through a functional interaction with Sae2

    DEFF Research Database (Denmark)

    Leshets, Michael; Ramamurthy, Dharanidharan; Lisby, Michael

    2018-01-01

    One of the most severe forms of DNA damage is the double-strand break (DSB). Failure to properly repair the damage can cause mutation, gross chromosomal rearrangements and lead to the development of cancer. In eukaryotes, homologous recombination (HR) and non-homologous end joining (NHEJ) are the......One of the most severe forms of DNA damage is the double-strand break (DSB). Failure to properly repair the damage can cause mutation, gross chromosomal rearrangements and lead to the development of cancer. In eukaryotes, homologous recombination (HR) and non-homologous end joining (NHEJ......) are the main DSB repair pathways. Fumarase is a mitochondrial enzyme which functions in the tricarboxylic acid cycle. Intriguingly, the enzyme can be readily detected in the cytosolic compartment of all organisms examined, and we have shown that cytosolic fumarase participates in the DNA damage response...

  15. Performance Characteristics of Different Anti-Double-Stranded DNA Antibody Assays in the Monitoring of Systemic Lupus Erythematosus

    Directory of Open Access Journals (Sweden)

    Michael Mahler

    2017-01-01

    Full Text Available Objective. We sought to evaluate different anti-double-stranded DNA assays for their performance characteristics in monitoring disease activity fluctuations in systemic lupus erythematosus (SLE. Methods. 36 active SLE patients were followed monthly. At each study visit (total n=371, blood was collected and disease activity was scored using the SELENA-SLEDAI (excluding anti-dsDNA or complement components and by a physician’s global assessment (PGA. Four anti-dsDNA tests were compared. Linear mixed-effects models with random intercept and fixed slopes were used to evaluate the relationship between the longitudinal fluctuations of disease activity and anti-dsDNA titers. Results. At enrollment, positivity for QUANTA Lite and high-avidity anti-dsDNA assay was both 64% and significantly lower than anti-dsDNA positivity by QUANTA Flash (83% and CLIFT (96%. Linear mixed-effects modeling indicated that the change in clinical SELENA-SLEDAI scores was associated with the titers of all anti-dsDNA with QUANTA Flash yielding the highest marginal R2 (0.15; p<0.01. QUANTA Flash was the only anti-dsDNA assay significantly associated with the change in PGA (marginal R2=0.05; p<0.01. Conclusion. These data indicate that anti-dsDNA antibodies determined by QUANTA Flash have a value in monitoring SLE disease activity.

  16. Trex2 enables spontaneous sister chromatid exchanges without facilitating DNA double-strand break repair.

    Science.gov (United States)

    Dumitrache, Lavinia C; Hu, Lingchuan; Son, Mi Young; Li, Han; Wesevich, Austin; Scully, Ralph; Stark, Jeremy; Hasty, Paul

    2011-08-01

    Trex2 is a 3' → 5' exonuclease that removes 3'-mismatched sequences in a biochemical assay; however, its biological function remains unclear. To address biology we previously generated trex2(null) mouse embryonic stem (ES) cells and expressed in these cells wild-type human TREX2 cDNA (Trex2(hTX2)) or cDNA with a single-amino-acid change in the catalytic domain (Trex2(H188A)) or in the DNA-binding domain (Trex2(R167A)). We found the trex2(null) and Trex2(H188A) cells exhibited spontaneous broken chromosomes and trex2(null) cells exhibited spontaneous chromosomal rearrangements. We also found ectopically expressed human TREX2 was active at the 3' ends of I-SceI-induced chromosomal double-strand breaks (DSBs). Therefore, we hypothesized Trex2 participates in DNA DSB repair by modifying 3' ends. This may be especially important for ends with damaged nucleotides. Here we present data that are unexpected and prompt a new model. We found Trex2-altered cells (null, H188A, and R167A) were not hypersensitive to camptothecin, a type-1 topoisomerase inhibitor that induces DSBs at replication forks. In addition, Trex2-altered cells were not hypersensitive to γ-radiation, an agent that causes DSBs throughout the cell cycle. This observation held true even in cells compromised for one of the two major DSB repair pathways: homology-directed repair (HDR) or nonhomologous end joining (NHEJ). Trex2 deletion also enhanced repair of an I-SceI-induced DSB by both HDR and NHEJ without affecting pathway choice. Interestingly, however, trex2(null) cells exhibited reduced spontaneous sister chromatid exchanges (SCEs) but this was not due to a defect in HDR-mediated crossing over. Therefore, reduced spontaneous SCE could be a manifestation of the same defect that caused spontaneous broken chromosomes and spontaneous chromosomal rearrangements. These unexpected data suggest Trex2 does not enable DSB repair and prompt a new model that posits Trex2 suppresses the formation of broken

  17. A newly identified DNA ligase of Saccharomyces cerevisiae involved in RAD52-independent repair of DNA double-strand breaks

    Science.gov (United States)

    Schär, Primo; Herrmann, Gernot; Daly, Graham; Lindahl, Tomas

    1997-01-01

    Eukaryotic DNA ligases are ATP-dependent DNA strand-joining enzymes that participate in DNA replication, repair, and recombination. Whereas mammalian cells contain several different DNA ligases, encoded by at least three distinct genes, only one DNA ligase has been detected previously in either budding yeast or fission yeast. Here, we describe a newly identified nonessential Saccharomyces cerevisiae gene that encodes a DNA ligase distinct from the CDC9 gene product. This DNA ligase shares significant amino acid sequence homology with human DNA ligase IV; accordingly, we designate the yeast gene LIG4. Recombinant LIG4 protein forms a covalent enzyme-AMP complex and can join a DNA single-strand break in a DNA/RNA hybrid duplex, the preferred substrate in vitro. Disruption of the LIG4 gene causes only marginally increased cellular sensitivity to several DNA damaging agents, and does not further sensitize cdc9 or rad52 mutant cells. In contrast, lig4 mutant cells have a 1000-fold reduced capacity for correct recircularization of linearized plasmids by illegitimate end-joining after transformation. Moreover, homozygous lig4 mutant diploids sporulate less efficiently than isogenic wild-type cells, and show retarded progression through meiotic prophase I. Spore viability is normal, but lig4 mutants appear to produce a higher proportion of tetrads with only three viable spores. The mutant phenotypes are consistent with functions of LIG4 in an illegitimate DNA end-joining pathway and ensuring efficient meiosis. PMID:9271115

  18. The opportunistic pathogen Pseudomonas aeruginosa activates the DNA double-strand break signaling and repair pathway in infected cells

    International Nuclear Information System (INIS)

    Elsen, S.; Collin-Faure, V.; Gidrol, X.; Lemercier, C.

    2013-01-01

    Highly hazardous DNA double-strand breaks can be induced in eukaryotic cells by a number of agents including pathogenic bacterial strains. We have investigated the genotoxic potential of Pseudomonas aeruginosa, an opportunistic pathogen causing devastating nosocomial infections in cystic fibrosis or immunocompromised patients. Our data revealed that infection of immune or epithelial cells by P. aeruginosa triggered DNA strand breaks and phosphorylation of histone H2AX (γH2AX), a marker of DNA double-strand breaks. Moreover, it induced formation of discrete nuclear repair foci similar to gamma-irradiation-induced foci, and containing γH2AX and 53BP1, an adaptor protein mediating the DNA-damage response pathway. Gene deletion, mutagenesis, and complementation in P. aeruginosa identified ExoS bacterial toxin as the major factor involved in γH2AX induction. Chemical inhibition of several kinases known to phosphorylate H2AX demonstrated that Ataxia Telangiectasia Mutated (ATM) was the principal kinase in P. aeruginosa-induced H2AX phosphorylation. Finally, infection led to ATM kinase activation by an auto-phosphorylation mechanism. Together, these data show for the first time that infection by P. aeruginosa activates the DNA double-strand break repair machinery of the host cells. This novel information sheds new light on the consequences of P. aeruginosa infection in mammalian cells. As pathogenic Escherichia coli or carcinogenic Helicobacter pylori can alter genome integrity through DNA double-strand breaks, leading to chromosomal instability and eventually cancer, our findings highlight possible new routes for further investigations of P. aeruginosa in cancer biology and they identify ATM as a potential target molecule for drug design. (authors)

  19. Induction of double-strand breaks in DNA of prokaryotes and eukaryotes and their repair. 1. Application of elastoviscosimetry for studying double-strand breaks in DNA of Escherichia coli induced by. gamma. -irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Bresler, S E; Noskin, L A; Suslov, A V [AN SSSR, Leningrad. Inst. Yadernoj Fiziki

    1980-11-01

    It is shown that the method of elastoviscosimetry gives a possibility to record the formation of DNA double-strand breaks in Escherichia coli cells induced by ..gamma.. irradiation at doses close to D/sub 37/. The dependence of changes of elastoviscosity parameter on the dose (tau/sub 0/) passes through the maximum. It is shown that the ascending section of this curve (at minimum ..gamma.. irradiation doses) characterizes the relaxation process of the superspiralised chromosome in nucleotide of the E. coli. This relaxation is observed due to ..gamma.. induced damages which are not double-strand breaks. By the maximum position one can judge on a dose yield of the first DNA double-strand break, the descending part of the dose curve describes the kinetics of accumulation of breaks with the dose increase. The analysis of the data obtained gives the possibility to come to the conclusion that when applying a usual technique of irradiation and lysis of cells not providing for special measures on inhibition of endo-and exonuclease activity in ..gamma.. irradiated cells, the dose yield of double-strand breaks noticeably increases (by 4.2 times). In the case of an essential, though incomplete, inhibition of nuclease activities in ..gamma.. irradiated cells the dose yield of breaks approximately corresponds to the dose curve of inactivation of these cells (D/sub 37/12.5+-3.0 krad, the first double-strand break -at 14.5+-2.4 krad).

  20. Induction of double-strand breaks in DNA of prokaryotes and eukaryotes and their repair. 1. Application of elastoviscosimetry for studying double-strand breaks in DNA of Escherichia coli induced by γ-irradiation

    International Nuclear Information System (INIS)

    Bresler, S.E.; Noskin, L.A.; Suslov, A.V.

    1980-01-01

    It is shown that the method of elastoviscosimetry gives a possibility to record the formation of DNA double-strand breaks in Escherichia coli cells induced by γ irradiation at doses close to D 37 . The dependence of changes of elastoviscosity parameter on the dose (tau 0 ) passes through the maximum. It is shown that the ascending section of this curve (at minimum γ irradiation doses) characterizes the relaxation process of the superspiralised chromosome in nucleotide of the E. coli. This relaxation is observed due to γ induced damages which are not double-strand breaks. By the maximum position one can judge on a dose yield of the first DNA double-strand break, the descending part of the dose curve describes the kinetics of accumulation of breaks with the dose increase. The analysis of the data obtained gives the possibility to come to the conclusion that when applying a usual technique of irradiation and lysis of cells not providing for special measures on inhibition of endo-and exonuclease activity in γ irradiated cells, the dose yield of double-strand breaks noticeably increases (by 4.2 times). In the case of an essential, though incomplete, inhibition of nuclease activities in γ irradiated cells the dose yield of breaks approximately corresponds to the dose curve of inactivation of these cells (D 37 12.5+-3.0 krad, the first double-strand break -at 14.5+-2.4 krad)

  1. Rapid purification of circular DNA by triplex-mediated affinity capture

    Science.gov (United States)

    Ji, H.; Smith, L.M.

    1997-01-07

    A single-step capture of a target supercoiled double-stranded DNA molecule is accomplished by forming a local triple-helix among two strands of the supercoiled circular DNA and an oligonucleotide probe. The oligonucleotide is bound to an immobilizing support which facilitates the immobilization and purification of target DNA molecules. Non-target DNA molecules and other contaminating cellular material are easily removed by washing. The triple-helical structure is destabilized by raising the pH, leaving purified target DNA in the supernatant and reusable affinity capture oligonucleotide secured to the immobilizing support. 3 figs.

  2. Elucidaton of DNA methylation changes in response to ionizng radiation induced double strand breaks

    International Nuclear Information System (INIS)

    Herrlitz, Maren Linda

    2014-01-01

    would be an effect of overexpression or be indicative of a possible function in these nuclear subcompartments is yet to be elucidated. Additionally, by using flow cytometry analysis, exposure to IR and concomitant overexpression of TET2CD-GFP strongly induced 5hmC formation, therefore suggesting a function of TET2 in response to irradiation. Recruitment analysis showed that the TET2 catalytic domain was recruited to UV laser-induced but not X-rays- or heavy ion-induced damage sites. Endogenous TET2, which was analyzed in high TET2 expressing human fibroblasts, was recruited to damage sites after irradiation with heavy ions or X-rays. As 5hmC is the direct product of the catalytic activity of TET enzymes, local 5hmC formation and abundance at damage sites was investigated. It was observed that 5hmC accumulated at heavy ion- as well as X-ray-induced DNA double strand breaks (DSBs). In addition, investigating 5hmC foci over time after irradiation with X-rays revealed that 5hmC formation and kinetics is similar to that of γH2AX foci, whereby every 5hmC focus co-localized with γH2AX. However, this did not hold true for all γH2AX foci, whose total number was always higher than that of 5hmC. Furthermore, 5hmC (and γH2AX) foci formation was almost unaffected by the inhibition of DNA-PKcs' enzymatic activity. Conversely, 5hmC and γH2AX foci persistence was significantly delayed after DNA-PKcs inhibition. Results obtained in this thesis show that DNA methylation changes (5hmC formation) take place within the time frame of one replication cycle after exposure to IR and that these changes can be observed at sites of DSBs. 5hmC at DSBs might be formed by the oxidative function of TET2, which was shown to be recruited to DSBs. However, involvement of the other TET enzymes in 5hmC production cannot be excluded. Therefore, these results suggest a role of 5hmC in the response to IR induced DSBs, whereby the here presented data suggest that the fast, radiation induced demethylation

  3. Elucidaton of DNA methylation changes in response to ionizng radiation induced double strand breaks

    Energy Technology Data Exchange (ETDEWEB)

    Herrlitz, Maren Linda

    2014-07-04

    would be an effect of overexpression or be indicative of a possible function in these nuclear subcompartments is yet to be elucidated. Additionally, by using flow cytometry analysis, exposure to IR and concomitant overexpression of TET2CD-GFP strongly induced 5hmC formation, therefore suggesting a function of TET2 in response to irradiation. Recruitment analysis showed that the TET2 catalytic domain was recruited to UV laser-induced but not X-rays- or heavy ion-induced damage sites. Endogenous TET2, which was analyzed in high TET2 expressing human fibroblasts, was recruited to damage sites after irradiation with heavy ions or X-rays. As 5hmC is the direct product of the catalytic activity of TET enzymes, local 5hmC formation and abundance at damage sites was investigated. It was observed that 5hmC accumulated at heavy ion- as well as X-ray-induced DNA double strand breaks (DSBs). In addition, investigating 5hmC foci over time after irradiation with X-rays revealed that 5hmC formation and kinetics is similar to that of γH2AX foci, whereby every 5hmC focus co-localized with γH2AX. However, this did not hold true for all γH2AX foci, whose total number was always higher than that of 5hmC. Furthermore, 5hmC (and γH2AX) foci formation was almost unaffected by the inhibition of DNA-PKcs' enzymatic activity. Conversely, 5hmC and γH2AX foci persistence was significantly delayed after DNA-PKcs inhibition. Results obtained in this thesis show that DNA methylation changes (5hmC formation) take place within the time frame of one replication cycle after exposure to IR and that these changes can be observed at sites of DSBs. 5hmC at DSBs might be formed by the oxidative function of TET2, which was shown to be recruited to DSBs. However, involvement of the other TET enzymes in 5hmC production cannot be excluded. Therefore, these results suggest a role of 5hmC in the response to IR induced DSBs, whereby the here presented data suggest that the fast, radiation induced

  4. γH2AX foci as a marker for DNA double-strand breaks

    International Nuclear Information System (INIS)

    Deckbar, Dorothee

    2009-01-01

    Full text: The DNA double-strand break (DSB) is the most deleterious lesion of all DNA damages. Left unrepaired or being mis-rejoined it can lead to chromosome aberrations which compromise the genomic stability and carry the potential to initiate carcinogenesis. So DSB repair mechanisms are under intensive investigation for many years. As older techniques had to utilize non-physiological doses to monitor DSB repair, they did not allow repair studies on the cellular level or after in vivo irradiation. But during the last years, an upcoming method allows the detection of a single DSB after physiologically relevant doses. To maintain the genomic integrity after the occurrence of a DSB, cellular mechanisms have evolved that detect and repair DSBs and even halt cell cycle progression to provide time for repair. In these processes, one of the first steps is the phosphorylation of the histone H2AX at serine 139 (γH2AX). Within minutes after DSB induction, large numbers of H2AX molecules are phosphorylated around the break site leading to the accumulation of proteins involved in chromatin remodelling, to damage signal amplification, and eventually to checkpoint activation and DSB repair. The finding that DSB-surrounding proteins can be visualized as foci in immunofluorescence microscopy opened up new opportunities in cancer biology and radiation biology. It was now for the first time possible to measure DSB repair after physiologically relevant doses of ionizing radiation, i.e. after doses used for therapeutic as well as for diagnostic purposes. First reports even describe the measurement of DSB repair after in vivo irradiation in mice and humans. This did not only improve the basic research investigating the mechanisms of DSB repair but also the research on low-dose effects and radiation protection. So the potential of γH2AX foci analysis as a predictive marker for radiosensitivity or radiation induced side effects is actually discussed. (author)

  5. DNA double-strand break response in stem cells: mechanisms to maintain genomic integrity.

    Science.gov (United States)

    Nagaria, Pratik; Robert, Carine; Rassool, Feyruz V

    2013-02-01

    Embryonic stem cells (ESCs) represent the point of origin of all cells in a given organism and must protect their genomes from both endogenous and exogenous genotoxic stress. DNA double-strand breaks (DSBs) are one of the most lethal forms of damage, and failure to adequately repair DSBs would not only compromise the ability of SCs to self-renew and differentiate, but will also lead to genomic instability and disease. Herein, we describe the mechanisms by which ESCs respond to DSB-inducing agents such as reactive oxygen species (ROS) and ionizing radiation, compared to somatic cells. We will also discuss whether the DSB response is fully reprogrammed in induced pluripotent stem cells (iPSCs) and the role of the DNA damage response (DDR) in the reprogramming of these cells. ESCs have distinct mechanisms to protect themselves against DSBs and oxidative stress compared to somatic cells. The response to damage and stress is crucial for the maintenance of self-renewal and differentiation capacity in SCs. iPSCs appear to reprogram some of the responses to genotoxic stress. However, it remains to be determined if iPSCs also retain some DDR characteristics of the somatic cells of origin. The mechanisms regulating the genomic integrity in ESCs and iPSCs are critical for its safe use in regenerative medicine and may shed light on the pathways and factors that maintain genomic stability, preventing diseases such as cancer. This article is part of a Special Issue entitled Biochemistry of Stem Cells. Copyright © 2012 Elsevier B.V. All rights reserved.

  6. 125I-induced DNA double strand breaks: use in calibration of the neutral filter elution technique and comparison with X-ray induced breaks

    International Nuclear Information System (INIS)

    Radford, I.R.; Hodgson, G.S.

    1985-01-01

    The neutral filter elution assay, for measurement of DNA double strand breakage, has been calibrated using mouse L cells and Chinese hamster V79 cells labelled with [ 125 I]dUrd and then held at liquid nitrogen temperature to accumulate decays. The basis of the calibration is the observation that each 125 I decay, occurring in DNA, produces a DNA double strand break. Linear relationships between 125 I decays per cell and lethal lesions per cell (minus natural logarithm survival) and the level of elution, were found. Using the calibration data, it was calculated that the yield of DNA double strand breaks after X-irradiation of both cell types was from 6 to 9 x 10 -12 DNA double strand breaks per Gy per dalton of DNA, for doses greater than 6 Gy. Neutral filter elution and survival data for X-irradiated and 125 I-labelled cells suggested that the relationships between lethal lesions and DNA double strand breakage were significantly different for both cell types. An attempt was made to study the repair kinetics for 125 I-induced DNA double strand breaks, but was frustrated by the rapid DNA degradation which occurs in cells that have been killed by the freezing-thawing process. (author)

  7. DNA-incorporated 125I induces more than one double-strand break per decay in mammalian cells.

    Science.gov (United States)

    Elmroth, Kecke; Stenerlöw, Bo

    2005-04-01

    The Auger-electron emitter 125I releases cascades of 20 electrons per decay that deposit a great amount of local energy, and for DNA-incorporated 125I, approximately one DNA double-strand break (DSB) is produced close to the decay site. To investigate the potential of 125I to induce additional DSBs within adjacent chromatin structures in mammalian cells, we applied DNA fragment-size analysis based on pulsed-field gel electrophoresis (PFGE) of hamster V79-379A cells exposed to DNA-incorporated 125IdU. After accumulation of decays at -70 degrees C in the presence of 10% DMSO, there was a non-random distribution of DNA fragments with an excess of fragments even higher. In contrast, using a conventional low-resolution assay without measurement of smaller DNA fragments, the yield was close to one DSB/decay. We conclude that a large fraction of the DSBs induced by DNA-incorporated 125I are nonrandomly distributed and that significantly more than one DSB/decay is induced in an intact cell. Thus, in addition to DSBs produced close to the decay site, DSBs may also be induced within neighboring chromatin fibers, releasing smaller DNA fragments that are not detected by conventional DSB assays.

  8. Lyn tyrosine kinase promotes silencing of ATM-dependent checkpoint signaling during recovery from DNA double-strand breaks

    International Nuclear Information System (INIS)

    Fukumoto, Yasunori; Kuki, Kazumasa; Morii, Mariko; Miura, Takahito; Honda, Takuya; Ishibashi, Kenichi; Hasegawa, Hitomi; Kubota, Sho; Ide, Yudai; Yamaguchi, Noritaka; Nakayama, Yuji; Yamaguchi, Naoto

    2014-01-01

    Highlights: • Inhibition of Src family kinases decreased γ-H2AX signal. • Inhibition of Src family increased ATM-dependent phosphorylation of Chk2 and Kap1. • shRNA-mediated knockdown of Lyn increased phosphorylation of Kap1 by ATM. • Ectopic expression of Src family kinase suppressed ATM-mediated Kap1 phosphorylation. • Src is involved in upstream signaling for inactivation of ATM signaling. - Abstract: DNA damage activates the DNA damage checkpoint and the DNA repair machinery. After initial activation of DNA damage responses, cells recover to their original states through completion of DNA repair and termination of checkpoint signaling. Currently, little is known about the process by which cells recover from the DNA damage checkpoint, a process called checkpoint recovery. Here, we show that Src family kinases promote inactivation of ataxia telangiectasia mutated (ATM)-dependent checkpoint signaling during recovery from DNA double-strand breaks. Inhibition of Src activity increased ATM-dependent phosphorylation of Chk2 and Kap1. Src inhibition increased ATM signaling both in G2 phase and during asynchronous growth. shRNA knockdown of Lyn increased ATM signaling. Src-dependent nuclear tyrosine phosphorylation suppressed ATM-mediated Kap1 phosphorylation. These results suggest that Src family kinases are involved in upstream signaling that leads to inactivation of the ATM-dependent DNA damage checkpoint

  9. Phenotypic Analysis of ATM Protein Kinase in DNA Double-Strand Break Formation and Repair.

    Science.gov (United States)

    Mian, Elisabeth; Wiesmüller, Lisa

    2017-01-01

    Ataxia telangiectasia mutated (ATM) encodes a serine/threonine protein kinase, which is involved in various regulatory processes in mammalian cells. Its best-known role is apical activation of the DNA damage response following generation of DNA double-strand breaks (DSBs). When DSBs appear, sensor and mediator proteins are recruited, activating transducers such as ATM, which in turn relay a widespread signal to a multitude of downstream effectors. ATM mutation causes Ataxia telangiectasia (AT), whereby the disease phenotype shows differing characteristics depending on the underlying ATM mutation. However, all phenotypes share progressive neurodegeneration and marked predisposition to malignancies at the organismal level and sensitivity to ionizing radiation and chromosome aberrations at the cellular level. Expression and localization of the ATM protein can be determined via western blotting and immunofluorescence microscopy; however, detection of subtle alterations such as resulting from amino acid exchanges rather than truncating mutations requires functional testing. Previous studies on the role of ATM in DSB repair, which connects with radiosensitivity and chromosomal stability, gave at first sight contradictory results. To systematically explore the effects of clinically relevant ATM mutations on DSB repair, we engaged a series of lymphoblastoid cell lines (LCLs) derived from AT patients and controls. To examine DSB repair both in a quantitative and qualitative manners, we used an EGFP-based assay comprising different substrates for distinct DSB repair mechanisms. In this way, we demonstrated that particular signaling defects caused by individual ATM mutations led to specific DSB repair phenotypes. To explore the impact of ATM on carcinogenic chromosomal aberrations, we monitored chromosomal breakage at a breakpoint cluster region hotspot within the MLL gene that has been associated with therapy-related leukemia. PCR-based MLL-breakage analysis of HeLa cells

  10. Constitutional chromothripsis rearrangements involve clustered double-stranded DNA breaks and nonhomologous repair mechanisms.

    Science.gov (United States)

    Kloosterman, Wigard P; Tavakoli-Yaraki, Masoumeh; van Roosmalen, Markus J; van Binsbergen, Ellen; Renkens, Ivo; Duran, Karen; Ballarati, Lucia; Vergult, Sarah; Giardino, Daniela; Hansson, Kerstin; Ruivenkamp, Claudia A L; Jager, Myrthe; van Haeringen, Arie; Ippel, Elly F; Haaf, Thomas; Passarge, Eberhard; Hochstenbach, Ron; Menten, Björn; Larizza, Lidia; Guryev, Victor; Poot, Martin; Cuppen, Edwin

    2012-06-28

    Chromothripsis represents a novel phenomenon in the structural variation landscape of cancer genomes. Here, we analyze the genomes of ten patients with congenital disease who were preselected to carry complex chromosomal rearrangements with more than two breakpoints. The rearrangements displayed unanticipated complexity resembling chromothripsis. We find that eight of them contain hallmarks of multiple clustered double-stranded DNA breaks (DSBs) on one or more chromosomes. In addition, nucleotide resolution analysis of 98 breakpoint junctions indicates that break repair involves nonhomologous or microhomology-mediated end joining. We observed that these eight rearrangements are balanced or contain sporadic deletions ranging in size between a few hundred base pairs and several megabases. The two remaining complex rearrangements did not display signs of DSBs and contain duplications, indicative of rearrangement processes involving template switching. Our work provides detailed insight into the characteristics of chromothripsis and supports a role for clustered DSBs driving some constitutional chromothripsis rearrangements. Copyright © 2012 The Authors. Published by Elsevier Inc. All rights reserved.

  11. Physical and biological parameters affecting DNA double strand break misrejoining in mammalian cells

    International Nuclear Information System (INIS)

    Kuehne, M.; Rothkamm, K.; Loebrich, M.

    2002-01-01

    In an attempt to investigate the effect of radiation quality, dose and specific repair pathways on correct and erroneous rejoining of DNA double strand breaks (DSBs), an assay was applied that allows the identification and quantification of incorrectly rejoined DSB ends produced by ionising radiation. While substantial misrejoining occurs in mammalian cells after high acute irradiation doses, decreasing misrejoining frequencies were observed in dose fractionation experiments with X rays. In line with this finding, continuous irradiation with gamma rays at low dose rate leads to non detectable misrejoining. This indicates that the probability for a DSB to be misrejoined decreases drastically when DSBs are separated in time and space. The same dose fractionation approach was applied to determine DSB misrejoining after a particle exposure. In contrast to the results with X rays, there was no significant decrease in DSB misrejoining with increasing fractionation. This suggests that DSB misrejoining after a irradiation is not significantly affected by a separation of particle tracks. To identify the enzymatic pathways that are involved in DSB misrejoining, cell lines deficient in non-homologous end-joining (NHEJ) were examined. After high X ray doses, DSB misrejoining is considerable reduced in NHEJ mutants. Low dose rate experiments show elevated DSB misrejoining in NHEJ mutants compared with wild-type cells. The authors propose that NHEJ serves as an efficient pathway for rejoining correct break ends in situations of separated breaks but generates genomic rearrangements if DSBs are close in time and space. (author)

  12. Inhibition of APOBEC3G Activity Impedes Double-Strand DNA Repair

    Science.gov (United States)

    Prabhu, Ponnandy; Shandilya, Shivender; Britan-Rosich, Elena; Nagler, Adi; Schiffer, Celia A.; Kotler, Moshe

    2015-01-01

    The cellular cytidine deaminase APOBEC3G (A3G) was first described as an anti-HIV-1 restriction factor by directly deaminating reverse transcripts of the viral genome. HIV-1 Vif neutralizes the activity of A3G, primarily by mediating degradation of A3G to establish effective infection in host target cells. Lymphoma cells, which express high amounts of A3G, can restrict Vif-deficient HIV-1. Interestingly, these cells are more stable in the face of treatments that result in dsDNA damage, such as ionizing irradiation (IR) and chemotherapies. Previously, we showed that the Vif-derived peptide (Vif25-39) efficiently inhibits A3G deamination, and increases sensitivity of lymphoma cells to IR. In the current study, we show that additional peptides derived from Vif, A3G and A3F, which contain the LYYF motif, inhibit deamination activity. Each residue in the Vif25-39 sequence moderately contributes to the inhibitory effect, while, replacing a single amino acid in the LYYF motif completely abrogate inhibition of deamination. Treatment of A3G-expressing lymphoma cells exposed to ionizing radiation with the new inhibitory peptides reduces double-strand break (DSB) repair after radiation. Incubation of cultured irradiated lymphoma cells with peptides that inhibit DSB repair halts their propagation. These results suggest that A3G may be a potential therapeutic target amenable to peptide and peptidomimetic inhibition. PMID:26460502

  13. Dissimilar kinetic behavior of electrically manipulated single- and double-stranded DNA tethered to a gold surface.

    Science.gov (United States)

    Rant, Ulrich; Arinaga, Kenji; Tornow, Marc; Kim, Yong Woon; Netz, Roland R; Fujita, Shozo; Yokoyama, Naoki; Abstreiter, Gerhard

    2006-05-15

    We report on the electrical manipulation of single- and double-stranded oligodeoxynucleotides that are end tethered to gold surfaces in electrolyte solution. The response to alternating repulsive and attractive electric surface fields is studied by time-resolved fluorescence measurements, revealing markedly distinct dynamics for the flexible single-stranded and stiff double-stranded DNA, respectively. Hydrodynamic simulations rationalize this finding and disclose two different kinetic mechanisms: stiff polymers undergo rotation around the anchoring pivot point; flexible polymers, on the other hand, are pulled onto the attracting surface segment by segment.

  14. Repair on the go: E. coli maintains a high proliferation rate while repairing a chronic DNA double-strand break.

    Directory of Open Access Journals (Sweden)

    Elise Darmon

    Full Text Available DNA damage checkpoints exist to promote cell survival and the faithful inheritance of genetic information. It is thought that one function of such checkpoints is to ensure that cell division does not occur before DNA damage is repaired. However, in unicellular organisms, rapid cell multiplication confers a powerful selective advantage, leading to a dilemma. Is the activation of a DNA damage checkpoint compatible with rapid cell multiplication? By uncoupling the initiation of DNA replication from cell division, the Escherichia coli cell cycle offers a solution to this dilemma. Here, we show that a DNA double-strand break, which occurs once per replication cycle, induces the SOS response. This SOS induction is needed for cell survival due to a requirement for an elevated level of expression of the RecA protein. Cell division is delayed, leading to an increase in average cell length but with no detectable consequence on mutagenesis and little effect on growth rate and viability. The increase in cell length caused by chronic DNA double-strand break repair comprises three components: two types of increase in the unit cell size, one independent of SfiA and SlmA, the other dependent of the presence of SfiA and the absence of SlmA, and a filamentation component that is dependent on the presence of either SfiA or SlmA. These results imply that chronic checkpoint induction in E. coli is compatible with rapid cell multiplication. Therefore, under conditions of chronic low-level DNA damage, the SOS checkpoint operates seamlessly in a cell cycle where the initiation of DNA replication is uncoupled from cell division.

  15. Early models of DNA damage formation

    International Nuclear Information System (INIS)

    Śmiałek, Małgorzata A

    2012-01-01

    Quantification of DNA damage, induced by various types of incident radiation as well as chemical agents, has been the subject of many theoretical and experimental studies, supporting the development of modern cancer therapy. The primary observations showed that many factors can lead to damage of DNA molecules. It became clear that the development of experimental techniques for exploring this phenomenon is required. Another problem was simultaneously dealt with, anticipating on how the damage is distributed within the double helix of the DNA molecule and how the single strand break formation and accumulation can influence the lethal double strand break formation. In this work the most important probabilistic models for DNA strand breakage and damage propagation are summarized and compared.

  16. Visual characterization and quantitative measurement of artemisinin-induced DNA breakage

    Energy Technology Data Exchange (ETDEWEB)

    Cai Huaihong [Bionanotechnology Lab, and Department of Chemistry, Jinan University, Guangzhou 510632 (China); Yang Peihui [Bionanotechnology Lab, and Department of Chemistry, Jinan University, Guangzhou 510632 (China)], E-mail: typh@jnu.edu.cn; Chen Jianan [Bionanotechnology Lab, and Department of Chemistry, Jinan University, Guangzhou 510632 (China); Liang Zhihong [Experiment and Technology Center, Jinan University, Guangzhou 510632 (China); Chen Qiongyu [Institute of Genetic Engineering, Jinan University, Guangzhou 510632 (China); Cai Jiye [Bionanotechnology Lab, and Department of Chemistry, Jinan University, Guangzhou 510632 (China)], E-mail: tjycai@jnu.edu.cn

    2009-05-01

    DNA conformational change and breakage induced by artemisinin, a traditional Chinese herbal medicine, have been visually characterized and quantitatively measured by the multiple tools of electrochemistry, UV-vis absorption spectroscopy, atomic force microscopy (AFM), and DNA electrophoresis. Electrochemical and spectroscopic results confirm that artemisinin can intercalate into DNA double helix, which causes DNA conformational changes. AFM imaging vividly demonstrates uneven DNA strand breaking induced by QHS interaction. To assess these DNA breakages, quantitative analysis of the extent of DNA breakage has been performed by analyzing AFM images. Basing on the statistical analysis, the occurrence of DNA breaks is found to depend on the concentration of artemisinin. DNA electrophoresis further validates that the intact DNA molecules are unwound due to the breakages occur at the single strands. A reliable scheme is proposed to explain the process of artemisinin-induced DNA cleavage. These results can provide further information for better understanding the anticancer activity of artemisinin.

  17. scid mutation in mice confers hypersensitivity to ionizing radiation and a deficiency in DNA double-strand break repair

    International Nuclear Information System (INIS)

    Biedermann, K.A.; Sun, J.R.; Giaccia, A.J.; Tosto, L.M.; Brown, J.M.

    1991-01-01

    C.B-17 severe combined immunodeficient (scid) mice carry the scid mutation and are severely deficient in both T cell- and B cell-mediated immunity, apparently as a result of defective V(D)J joining of the immunoglobulin and T-cell receptor gene elements. In the present studies, we have defined the tissue, cellular, and molecular basis of another characteristic of these mice: their hypersensitivity to ionizing radiation. Bone marrow stem cells, intestinal crypt cells, and epithelial skin cells from scid mice are 2- to 3-fold more sensitive when irradiated in situ than are congenic BALB/c or C.B-17 controls. Two independently isolated embryo fibroblastic scid mouse cell lines display similar hypersensitivities to gamma-rays. In addition, these cell lines are sensitive to cell killing by bleomycin, which also produces DNA strand breaks, but not by the DNA crosslinking agent mitomycin C or UV irradiation. Measurement of the rejoining of gamma-ray-induced DNA double-strand breaks by pulsed-field gel electrophoresis indicates that these animals are defective in this repair system. This suggests that the gamma-ray sensitivity of the scid mouse fibroblasts could be the result of reduced repair of DNA double-strand breaks. Therefore, a common factor may participate in both the repair of DNA double-strand breaks as well as V(D)J rejoining during lymphocyte development. This murine autosomal recessive mutation should prove extremely useful in fundamental studies of radiation-induced DNA damage and repair

  18. DNA and protein binding, double-strand DNA cleavage and cytotoxicity of mixed ligand copper(II) complexes of the antibacterial drug nalidixic acid.

    Science.gov (United States)

    Loganathan, Rangasamy; Ganeshpandian, Mani; Bhuvanesh, Nattamai S P; Palaniandavar, Mallayan; Muruganantham, Amsaveni; Ghosh, Swapan K; Riyasdeen, Anvarbatcha; Akbarsha, Mohammad Abdulkader

    2017-09-01

    The water soluble mixed ligand complexes [Cu(nal)(diimine)(H 2 O)](ClO 4 ) 1-4, where H(nal) is nalidixic acid and diimine is 2,2'-bipyridine (1), 1,10-phenanthroline (2), 5,6-dimethyl-1,10-phenanthroline (3), and 3,4,7,8-tetramethyl-1,10-phenanthroline (4), have been isolated. The coordination geometry around Cu(II) in 1 and that in the Density Functional Theory optimized structures of 1-4 has been assessed as square pyramidal. The trend in DNA binding constants (K b ) determined using absorption spectral titration (K b : 1, 0.79±0.1base pair. In contrast, 3 and 4 are involved in intimate hydrophobic interaction with DNA through the methyl substituents on phen ring, which is supported by viscosity and protein binding studies. DNA docking studies imply that 4 is involved preferentially in DNA major groove binding while 1-3 in minor groove binding and that all the complexes, upon removing the axially coordinated water molecule, bind in the major groove. Interestingly, 3 and 4 display prominent double-strand DNA cleavage while 1 and 2 effect only single-strand DNA cleavage in the absence of an activator. The complexes 3 and 4 show cytotoxicity higher than 1 and 2 against human breast cancer cell lines (MCF-7). The complex 4 induces apoptotic mode of cell death in cancer cells. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Rotational symmetry and the transformation of innovation systems in a Triple Helix of university-industry-government relations

    NARCIS (Netherlands)

    Ivanova, I.A.; Leydesdorff, L.

    2014-01-01

    Using a mathematical model, we show that a Triple Helix (TH) system contains self-interaction, and therefore self-organization of innovations can be expected in waves, whereas a Double Helix (DH) remains determined by its linear constituents. (The mathematical model is fully elaborated in the

  20. Induction of DNA damage in γ-irradiated nuclei stripped of nuclear protein classes: differential modulation of double-strand break and DNA-protein crosslink formation

    International Nuclear Information System (INIS)

    Xue, L.-Y.; Friedman, L.R.; Oleinick, N.L.; Chiu, S.-M.

    1994-01-01

    The influence of chromatin proteins on the induction of DNA double-strand breaks (dsb) and DNA-protein crosslinks (dpc) by γ-radiation was investigated. Low molecular weight non-histone proteins and classes of histones were extracted with increasing concentrations of NaC1, whereas nuclear matrix proteins were not extractable even by 2.0 M NACl. The yield of dsb increased with progressive removal of proteins from chromatin. The data support our previous conclusion that nuclear matrix protein rather than the majority of the histones are the predominant substrates for dpc production, although the involvement of a subset of tightly bound histones (H3 and H4) has not been excluded. This finding demonstrates that chromatin proteins can differentially modify the yield of two types of radiation-induced DNA lesions. (author)

  1. Repair of Clustered Damage and DNA Polymerase Iota.

    Science.gov (United States)

    Belousova, E A; Lavrik, O I

    2015-08-01

    Multiple DNA lesions occurring within one or two turns of the DNA helix known as clustered damage are a source of double-stranded DNA breaks, which represent a serious threat to the cells. Repair of clustered lesions is accomplished in several steps. If a clustered lesion contains oxidized bases, an individual DNA lesion is repaired by the base excision repair (BER) mechanism involving a specialized DNA polymerase after excising DNA damage. Here, we investigated DNA synthesis catalyzed by DNA polymerase iota using damaged DNA templates. Two types of DNA substrates were used as model DNAs: partial DNA duplexes containing breaks of different length, and DNA duplexes containing 5-formyluracil (5-foU) and uracil as a precursor of apurinic/apyrimidinic sites (AP) in opposite DNA strands. For the first time, we showed that DNA polymerase iota is able to catalyze DNA synthesis using partial DNA duplexes having breaks of different length as substrates. In addition, we found that DNA polymerase iota could catalyze DNA synthesis during repair of clustered damage via the BER system by using both undamaged and 5-foU-containing templates. We found that hPCNA (human proliferating cell nuclear antigen) increased efficacy of DNA synthesis catalyzed by DNA polymerase iota.

  2. The Mismatch-Binding Factor MutSβ Can Mediate ATR Activation in Response to DNA Double-Strand Breaks

    Czech Academy of Sciences Publication Activity Database

    Burdová, Kamila; Mihaljevic, B.; Sturzenegger, A.; Chappidi, N.; Janščák, Pavel

    2015-01-01

    Roč. 59, č. 4 (2015), s. 603-614 ISSN 1097-2765 R&D Projects: GA ČR GAP305/10/0281; GA ČR(CZ) GA14-05743S Grant - others:Oncosuisse(CH) KLS-02344-02-2009; Swiss National Science Foundation(CH) 31003A_146206; Novartis Foundation for Medical and Biological Research(CH) 11A16 Institutional support: RVO:68378050 Keywords : Ataxia telangiectasia-mutated and Rad3-related (ATR) protein kinase * DNA-damage response * DNA Double-Strand Breaks Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 13.958, year: 2015

  3. Enhancement of fluorescence quenching and exciplex formation in DNA major groove by double incorporation of modified fluorescent deoxyuridines.

    Science.gov (United States)

    Tanaka, Makiko; Oguma, Kazuhiro; Saito, Yoshio; Saito, Isao

    2012-06-15

    5-(1-Naphthalenylethynyl)-2'-deoxyuridine ((N)U) and 5-[(4-cyano-1-naphthalenyl)ethynyl]-2'-deoxyuridine ((CN)U) were synthesized and incorporated into oligodeoxynucleotides. Fluorescence emissions of modified duplexes containing double (N)U were efficiently quenched depending upon the sequence pattern of the naphthalenes in DNA major groove, as compared to the duplex possessing single (N)U. When one of the naphthalene moieties has a cyano substituent, the exciplex emission from the chromophores in DNA major groove was observed at longer wavelength. Copyright © 2012 Elsevier Ltd. All rights reserved.

  4. Iodination as a probe for small regions of disrupted secondary structure in double-stranded DNA

    DEFF Research Database (Denmark)

    Jensen, Kaj Frank; Nes, Ingolf F.; Wells, Robert D.

    1976-01-01

    Conditions were established where the thallium-catalyzed iodination of random coil DNA proceeded 100–200 times faster than for native DNA. This reaction was explored as a probe for localized regions of disrupted base pairs in duplex DNA. A heteroduplex was constructed between DNA fragments produced...

  5. Flexible double-headed cytosine-linked 2'-deoxycytidine nucleotides. Synthesis, polymerase incorporation to DNA and interaction with DNA methyltransferases

    Czech Academy of Sciences Publication Activity Database

    Kielkowski, Pavel; Cahová, Hana; Pohl, Radek; Hocek, Michal

    2016-01-01

    Roč. 24, č. 6 (2016), s. 1268-1276 ISSN 0968-0896 R&D Projects: GA ČR GBP206/12/G151 Institutional support: RVO:61388963 Keywords : nucleosides * nucleotides * pyrimidines * DNA methyltransferases * DNA polymerases Subject RIV: CC - Organic Chemistry Impact factor: 2.930, year: 2016

  6. Arabidopsis DNA polymerase lambda mutant is mildly sensitive to DNA double strand breaks but defective in integration of a transgene

    Czech Academy of Sciences Publication Activity Database

    Furukawa, T.; Angelis, Karel; Britt, A.B.

    2015-01-01

    Roč. 6, MAY 27 (2015) ISSN 1664-462X R&D Projects: GA ČR GA13-06595S Institutional support: RVO:61389030 Keywords : DNA polymerase * DNA repair * Non homologous end joining Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.495, year: 2015

  7. The influence of bromodeoxyuridine on the induction and repair of DNA double-strand breaks in glioblastoma cells

    International Nuclear Information System (INIS)

    Nusser, N.N.; Bartkowiak, D.; Roettinger, E.M.

    2002-01-01

    Aims: To examine the dose response of DNA damage and its modification by the radiosensitizer, 5-bromo-2'-deoxyuridine (BrdU). The sensitizing mechanism is analyzed with regard to its influence on the induction and repair of DNA double-strand breaks (DSBs). Material and Methods: Cells from three different human glioblastoma lines, A7, LH and U87MG, were X-irradiated with and without exposure to BrdU. DNA fragments were separated by field-inversion gel electrophoresis (FIGE) and quantified by fluorometry immediately and 24 h after irradiation. Results: In all cell lines, the dose response followed a linear-quadratic rather than a purely linear function. BrdU-treated cells exhibited a significantly higher amount of mobile DNA. In repair experiments with and without BrdU, the amount of mobile DNA fell close to control values within 24 h. Conclusions: The linear-quadratic model appropriately describes the X-ray induced fragmentation of DNA. BrdU sensitizing acts predominantly by increasing DNA fragility, and not by impairing damage repair. The amount of DSBs persistent after 24 h of repair is minimal, even after highly cytotoxic doses. However, it appears to depend on the extent of initial damage, causing sensitized cells to retain more DSBs than unsensitized cells. (orig.)

  8. DNA double strand break repair is enhanced by P53 following induction by DNA damage and is dependent on the C-terminal domain of P53

    International Nuclear Information System (INIS)

    Wei Tang; Powell, Simon N.

    1996-01-01

    Purpose: The tumor suppressor gene p53 can mediate cell cycle arrest or apoptosis in response to DNA damage. Accumulating evidence suggests that it may also directly or indirectly influence the DNA repair machinery. In the present study, we investigated whether p53, induced by DNA damage, could enhance the rejoining of double-strand DNA breaks. Materials and Methods: DNA double-strand breaks (dsb) were made by restriction enzyme digestion of a plasmid, between a promoter and a 'reporter' gene: luciferase (LUC) or chloramphenicol acetyl-transferase (CAT). Linear or circular plasmid DNA (LUC or CAT) was co-transfected with circular β-Gal plasmid (to normalize for uptake) into mouse embryonic fibroblasts genetically matched to be (+/+) or (-/-) for p53. Their ability to rejoin linearized plasmid was measured by the luciferase or CAT activity detected in rescued plasmids. The activity detected in cells transfected with linear plasmid was scored relative to the activity detected in cells transfected with circular plasmid. Results: Ionizing radiation (IR, 2 Gy) enhanced the dsb repair activity in wild type p53 cells; however, p53 null cells lose this effect, indicating that the enhancement of dsb repair was p53-dependent. REF cells with dominant-negative mutant p53 showed a similar induction compared with the parental REF cells with wild-type p53. This ala-143 mutant p53 prevents cell cycle arrest and transactivation of p21 WAF1/cip1) following IR, indicating that the p53-dependent enhancement of DNA repair is distinct from transactivation. Immortalized murine embryonic fibroblasts, 10(1)VasK1 cells, which express p53 cDNA encoding a temperature-sensitive mutant in the DNA sequence specific binding domain (ala135 to val135) with an alternatively spliced C-terminal domain (ASp53: amino-acids 360-381) and, 10(1)Val5 cells, which express the normal spliced p53 (NSp53) with the same temperature-sensitive mutant were compared. It was found that 10(1)VasK1 cells showed no DNA

  9. Differential gene expression in a DNA double-strand-break repair mutant XRS-5 defective in Ku80. Analysis by cDNA microarray

    Energy Technology Data Exchange (ETDEWEB)

    Chan, John Y.H.; Chen, Lung-Kun; Chang, Jui-Feng [National Yang Ming Univ., Taipei, Taiwan (China). Inst. of Radiological Sciences] (and others)

    2001-12-01

    The ability of cells to rejoin DNA double-strand breaks (DSBs) usually correlates with their radiosensitivity. This correlation has been demonstrated in radiosensitive cells, including the Chinese hamster ovary mutant XRS-5. XRS-5 is defective in a DNA end-binding protein, Ku80, which is a component of a DNA-dependent protein kinase complex used for joining strand breaks. However, Ku80-deficient cells are known to be retarded in cell proliferation and growth as well as other yet to be identified defects. Using custom-made 600-gene cDNA microarray filters, we found differential gene expressions between the wild-type and XRS-5 cells. Defective Ku80 apparently affects the expression of several repair genes, including topoisomerase-I and -IIA, ERCC5, MLH1, and ATM. In contrast, other DNA repair-associated genes, such as GADD45A, EGR1 MDM2 and p53, were not affected. In addition, for large numbers of growth-associated genes, such as cyclins and clks, the growth factors and cytokines were also affected. Down-regulated expression was also found in several categories of seemingly unrelated genes, including apoptosis, angiogenesis, kinase and signaling, phosphatase, stress protein, proto-oncogenes and tumor suppressors, transcription and translation factors. A RT-PCR analysis confirmed that the XRS-5 cells used were defective in Ku80 expression. The diversified groups of genes being affected could mean that Ku80, a multi-functional DNA-binding protein, not only affects DNA repair, but is also involved in transcription regulation. Our data, taken together, indicate that there are specific genes being modulated in Ku80- deficient cells, and that some of the DNA repair pathways and other biological functions are apparently linked, suggesting that a defect in one gene could have global effects on many other processes. (author)

  10. Differential gene expression in a DNA double-strand-break repair mutant XRS-5 defective in Ku80. Analysis by cDNA microarray

    International Nuclear Information System (INIS)

    Chan, John Y.H.; Chen, Lung-Kun; Chang, Jui-Feng

    2001-01-01

    The ability of cells to rejoin DNA double-strand breaks (DSBs) usually correlates with their radiosensitivity. This correlation has been demonstrated in radiosensitive cells, including the Chinese hamster ovary mutant XRS-5. XRS-5 is defective in a DNA end-binding protein, Ku80, which is a component of a DNA-dependent protein kinase complex used for joining strand breaks. However, Ku80-deficient cells are known to be retarded in cell proliferation and growth as well as other yet to be identified defects. Using custom-made 600-gene cDNA microarray filters, we found differential gene expressions between the wild-type and XRS-5 cells. Defective Ku80 apparently affects the expression of several repair genes, including topoisomerase-I and -IIA, ERCC5, MLH1, and ATM. In contrast, other DNA repair-associated genes, such as GADD45A, EGR1 MDM2 and p53, were not affected. In addition, for large numbers of growth-associated genes, such as cyclins and clks, the growth factors and cytokines were also affected. Down-regulated expression was also found in several categories of seemingly unrelated genes, including apoptosis, angiogenesis, kinase and signaling, phosphatase, stress protein, proto-oncogenes and tumor suppressors, transcription and translation factors. A RT-PCR analysis confirmed that the XRS-5 cells used were defective in Ku80 expression. The diversified groups of genes being affected could mean that Ku80, a multi-functional DNA-binding protein, not only affects DNA repair, but is also involved in transcription regulation. Our data, taken together, indicate that there are specific genes being modulated in Ku80- deficient cells, and that some of the DNA repair pathways and other biological functions are apparently linked, suggesting that a defect in one gene could have global effects on many other processes. (author)

  11. Contribution of sleep to the repair of neuronal DNA double-strand breaks: evidence from flies and mice

    OpenAIRE

    Bellesi, Michele; Bushey, Daniel; Chini, Mattia; Tononi, Giulio; Cirelli, Chiara

    2016-01-01

    Exploration of a novel environment leads to neuronal DNA double-strand breaks (DSBs). These DSBs are generated by type 2 topoisomerase to relieve topological constrains that limit transcription of plasticity-related immediate early genes. If not promptly repaired, however, DSBs may lead to cell death. Since the induction of plasticity-related genes is higher in wake than in sleep, we asked whether it is specifically wake associated with synaptic plasticity that leads to DSBs, and whether slee...

  12. Induction and repair of DNA double-strand breaks in rat cerebellar cortex exposed to 60Co γ-rays

    Science.gov (United States)

    Bulanova, T. S.; Zadneprianetc, M. G.; Ježková, L.; Kruglyakova, E. A.; Smirnova, E. V.; Boreyko, A. V.

    2018-01-01

    The induction and repair of DNA double-strand breaks are studied using the immunohistochemical staining procedure of paraffin-embedded rat cerebellum tissues after exposure to γ-rays of 60Co. The dose dependence of radiation-induced colocalized γH2AX/53BP1 foci is studied and its linear character is established. It is shown that these foci are efficiently eliminated 24 h after irradiation.

  13. Double-helical - ladder structural transition in the B-DNA is induced by a loss of dispersion energy

    Czech Academy of Sciences Publication Activity Database

    Černý, Jiří; Kabeláč, Martin; Hobza, Pavel

    2008-01-01

    Roč. 130, č. 47 (2008), s. 16055-16059 ISSN 0002-7863 R&D Projects: GA MŠk LC512; GA AV ČR IAA400550808 Institutional research plan: CEZ:AV0Z40550506 Keywords : B-DNA * double-helical structure * ladder-like structure Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 8.091, year: 2008

  14. DNA conformational analysis in solution by uranyl mediated photocleavage

    DEFF Research Database (Denmark)

    Nielsen, Peter E.; Møllegaard, N E; Jeppesen, C

    1990-01-01

    Uranyl mediated photocleavage of double stranded DNA is proposed as a general probing for DNA helix conformation in terms of minor groove width/electronegative potential. Specifically, it is found that A/T-tracts known to constitute strong distamycin binding sites are preferentially photocleaved ......, uranyl photocleavage of the internal control region (ICR) of the 5S-RNA gene yields a cleavage modulation pattern fully compatible with that obtained by DNase I which also--in a more complex way--senses DNA minor groove width....

  15. Beyond repair foci: DNA double-strand break repair in euchromatic and heterochromatic compartments analyzed by transmission electron microscopy.

    Directory of Open Access Journals (Sweden)

    Yvonne Lorat

    Full Text Available DNA double-strand breaks (DSBs generated by ionizing radiation pose a serious threat to the preservation of genetic and epigenetic information. The known importance of local chromatin configuration in DSB repair raises the question of whether breaks in different chromatin environments are recognized and repaired by the same repair machinery and with similar efficiency. An essential step in DSB processing by non-homologous end joining is the high-affinity binding of Ku70-Ku80 and DNA-PKcs to double-stranded DNA ends that holds the ends in physical proximity for subsequent repair.Using transmission electron microscopy to localize gold-labeled pKu70 and pDNA-PKcs within nuclear ultrastructure, we monitored the formation and repair of actual DSBs within euchromatin (electron-lucent and heterochromatin (electron-dense in cortical neurons of irradiated mouse brain.While DNA lesions in euchromatin (characterized by two pKu70-gold beads, reflecting the Ku70-Ku80 heterodimer are promptly sensed and rejoined, DNA packaging in heterochromatin appears to retard DSB processing, due to the time needed to unravel higher-order chromatin structures. Complex pKu70-clusters formed in heterochromatin (consisting of 4 or ≥ 6 gold beads may represent multiple breaks in close proximity caused by ionizing radiation of highly-compacted DNA. All pKu70-clusters disappeared within 72 hours post-irradiation, indicating efficient DSB rejoining. However, persistent 53BP1 clusters in heterochromatin (comprising ≥ 10 gold beads, occasionally co-localizing with γH2AX, but not pKu70 or pDNA-PKcs, may reflect incomplete or incorrect restoration of chromatin structure rather than persistently unrepaired DNA damage.Higher-order organization of chromatin determines the accessibility of DNA lesions to repair complexes, defining how readily DSBs are detected and processed. DNA lesions in heterochromatin appear to be more complex, with multiple breaks in spatial vicinity inducing

  16. Analysis of DNA Double-Strand Breaks and Cytotoxicity after 7 Tesla Magnetic Resonance Imaging of Isolated Human Lymphocytes

    Science.gov (United States)

    Guttek, Karina; Hartig, Roland; Godenschweger, Frank; Roggenbuck, Dirk; Ricke, Jens; Reinhold, Dirk; Speck, Oliver

    2015-01-01

    The global use of magnetic resonance imaging (MRI) is constantly growing and the field strengths increasing. Yet, only little data about harmful biological effects caused by MRI exposure are available and published research analyzing the impact of MRI on DNA integrity reported controversial results. This in vitro study aimed to investigate the genotoxic and cytotoxic potential of 7 T ultra-high-field MRI on isolated human peripheral blood mononuclear cells. Hence, unstimulated mononuclear blood cells were exposed to 7 T static magnetic field alone or in combination with maximum permissible imaging gradients and radiofrequency pulses as well as to ionizing radiation during computed tomography and γ-ray exposure. DNA double-strand breaks were quantified by flow cytometry and automated microscopy analysis of immunofluorescence stained γH2AX. Cytotoxicity was studied by CellTiter-Blue viability assay and [3H]-thymidine proliferation assay. Exposure of unstimulated mononuclear blood cells to 7 T static magnetic field alone or combined with varying gradient magnetic fields and pulsed radiofrequency fields did not induce DNA double-strand breaks, whereas irradiation with X- and γ-rays led to a dose-dependent induction of γH2AX foci. The viability assay revealed a time- and dose-dependent decrease in metabolic activity only among samples exposed to γ-radiation. Further, there was no evidence for altered proliferation response after cells were exposed to 7 T MRI or low doses of ionizing radiation (≤ 0.2 Gy). These findings confirm the acceptance of MRI as a safe non-invasive diagnostic imaging tool, but whether MRI can induce other types of DNA lesions or DNA double-strand breaks during altered conditions still needs to be investigated. PMID:26176601

  17. In vivo formation and repair of DNA double-strand breaks after computed tomography examinations.

    Science.gov (United States)

    Löbrich, Markus; Rief, Nicole; Kühne, Martin; Heckmann, Martina; Fleckenstein, Jochen; Rübe, Christian; Uder, Michael

    2005-06-21

    Ionizing radiation can lead to a variety of deleterious effects in humans, most importantly to the induction of cancer. DNA double-strand breaks (DSBs) are among the most significant genetic lesions introduced by ionizing radiation that can initiate carcinogenesis. We have enumerated gamma-H2AX foci as a measure for DSBs in lymphocytes from individuals undergoing computed tomography examination of the thorax and/or the abdomen. The number of DSBs induced by computed tomography examination was found to depend linearly on the dose-length product, a radiodiagnostic unit that is proportional to both the local dose delivered and the length of the body exposed. Analysis of lymphocytes sampled up to 1 day postirradiation provided kinetics for the in vivo loss of gamma-H2AX foci that correlated with DSB repair. Interestingly, in contrast to results obtained in vitro, normal individuals repair DSBs to background levels. A patient who had previously shown severe side effects after radiotherapy displayed levels of gamma-H2AX foci at various sampling times postirradiation that were several times higher than those of normal individuals. Gamma-H2AX and pulsed-field gel electrophoresis analysis of fibroblasts obtained from this patient confirmed a substantial DSB repair defect. Additionally, these fibroblasts showed significant in vitro radiosensitivity. These data show that the in vivo induction and repair of DSBs can be assessed in individuals exposed to low radiation doses, adding a further dimension to DSB repair studies and providing the opportunity to identify repair-compromised individuals after diagnostic irradiation procedures.

  18. DNA Charge Transport: From Chemical Principles to the Cell

    Science.gov (United States)

    Arnold, Anna R.; Grodick, Michael A.; Barton, Jacqueline K.

    2016-01-01

    The DNA double helix has captured the imagination of many, bringing it to the forefront of biological research. DNA has unique features that extend our interest into areas of chemistry, physics, material science and engineering. Our laboratory has focused on studies of DNA charge transport (CT), wherein charges can efficiently travel long molecular distances through the DNA helix while maintaining an exquisite sensitivity to base pair π-stacking. Because DNA CT chemistry reports on the integrity of the DNA duplex, this property may be exploited to develop electrochemical devices to detect DNA lesions and DNA-binding proteins. Furthermore, studies now indicate that DNA CT may also be used in the cell by, for example, DNA repair proteins, as a cellular diagnostic, in order to scan the genome to localize efficiently to damage sites. In this review, we describe this evolution of DNA CT chemistry from the discovery of fundamental chemical principles to applications in diagnostic strategies and possible roles in biology. PMID:26933744

  19. Mycobacterial UvrD1 is a Ku-dependent DNA helicase that plays a role in multiple DNA repair events, including double-strand break repair.

    Science.gov (United States)

    Sinha, Krishna Murari; Stephanou, Nicolas C; Gao, Feng; Glickman, Michael S; Shuman, Stewart

    2007-05-18

    Mycobacterium tuberculosis and other bacterial pathogens have a Ku-dependent nonhomologous end joining pathway of DNA double-strand break repair. Here we identify mycobacterial UvrD1 as a novel interaction partner for Ku in a genome-wide yeast two-hybrid screen. UvrD1 per se is a vigorous DNA-dependent ATPase but a feeble DNA helicase. Ku stimulates UvrD1 to catalyze ATP-dependent unwinding of 3'-tailed DNAs. UvrD1, Ku, and DNA form a stable ternary complex in the absence of ATP. The Ku binding determinants are located in the distinctive C-terminal segment of UvrD1. A second mycobacterial paralog, UvrD2, is a vigorous Ku-independent DNA helicase. Ablation of UvrD1 sensitizes Mycobacterium smegmatis to killing by ultraviolet and ionizing radiation and to a single chromosomal break generated by I-SceI endonuclease. The physical and functional interactions of bacterial Ku and UvrD1 highlight the potential for cross-talk between components of nonhomologous end joining and nucleotide excision repair pathways.

  20. JNK Phosphorylates SIRT6 to Stimulate DNA Double-Strand Break Repair in Response to Oxidative Stress by Recruiting PARP1 to DNA Breaks

    Directory of Open Access Journals (Sweden)

    Michael Van Meter

    2016-09-01

    Full Text Available The accumulation of damage caused by oxidative stress has been linked to aging and to the etiology of numerous age-related diseases. The longevity gene, sirtuin 6 (SIRT6, promotes genome stability by facilitating DNA repair, especially under oxidative stress conditions. Here we uncover the mechanism by which SIRT6 is activated by oxidative stress to promote DNA double-strand break (DSB repair. We show that the stress-activated protein kinase, c-Jun N-terminal kinase (JNK, phosphorylates SIRT6 on serine 10 in response to oxidative stress. This post-translational modification facilitates the mobilization of SIRT6 to DNA damage sites and is required for efficient recruitment of poly (ADP-ribose polymerase 1 (PARP1 to DNA break sites and for efficient repair of DSBs. Our results demonstrate a post-translational mechanism regulating SIRT6, and they provide the link between oxidative stress signaling and DNA repair pathways that may be critical for hormetic response and longevity assurance.

  1. Relative frequency of formation of base radioproduct, single and double strand breaks on irradiation of diluted aqueous solution of DNA

    International Nuclear Information System (INIS)

    Ryznar, L.; Drasil, V.

    1975-01-01

    Diluted aqueous solution of DNA labelled with 6- 3 H-TdR was irradiated in the absence of oxygen and numbers of formed single and double strand breaks and the 5,6-dihydrothymine (DHT) yield were determined. The results indicate that, under given conditions, a molecule of a base radioproduct is formed approximately 10 times more frequently than one single strand break. The occurence of a single strand break is 20 times higher than that of a double strand break. The DNA labelled with 6- 3 H-TdR was isolated from mice fibroblasts of L-strain according to Marmur (specific activity 3.0 MBq/82 μCi/mg DNA, molecular weight M/sub n/=9.32x10 6 dalton). Solution of DNA was irradiated in the absence of oxygen (180 Gy /1.8x10 4 rads/, absorbed dose rate 0.3 Gy/s). It was lyophilized with an addition of non-labelled thymine, thymidine and DHT and then hydrolysed with 90% formic acid. The dried hydrolysate was chromatographed with irradiated non-labelled thymine added as a carrier. (F.G.)

  2. Adaptation of the neutral bacterial comet assay to assess antimicrobial-mediated DNA double-strand breaks in Escherichia coli

    Science.gov (United States)

    SOLANKY, DIPESH; HAYDEL, SHELLEY E.

    2012-01-01

    This study aimed to determine the mechanism of action of a natural antibacterial clay mineral mixture, designated CB, by investigating the induction of DNA double-strand breaks (DSBs) in Escherichia coli. To quantify DNA damage upon exposure to soluble antimicrobial compounds, we modified a bacterial neutral comet assay, which primarily associates the general length of an electrophoresed chromosome, or comet, with the degree of DSB-associated DNA damage. To appropriately account for antimicrobial-mediated strand fragmentation, suitable control reactions consisting of exposures to water, ethanol, kanamycin, and bleomycin were developed and optimized for the assay. Bacterial exposure to the CB clay resulted in significantly longer comet lengths, compared to water and kanamycin exposures, suggesting that the induction of DNA DSBs contributes to the killing activity of this antibacterial clay mineral mixture. The comet assay protocol described herein provides a general technique for evaluating soluble antimicrobial-derived DNA damage and for comparing DNA fragmentation between experimental and control assays. PMID:22940101

  3. The effect of polyamines on the photochemical reactivity of DNA

    International Nuclear Information System (INIS)

    Ben-Hur, E.; Hebrew Univ., Jerusalem

    1975-01-01

    The effects of diaminopentane (cadaverine), diaminoethane and the polyamine, spermine, on the photoreactions of 4,5', 8-trimethylpsoralen with DNA were studied. Near ultraviolet (UV) light (360 nm) irradiation of psoralen with DNA results in the formation of psoralen monoadducts with pyrimidine bases and DNA interstrand crosslinks. The polyamines studied reduced the rate of both photoreactions to the same extent by a factor of 1.5-2.0. The magnitude of the effect increased with polyamine concentration. Effectiveness was in the order spermine > cadaverine > diaminoethane. This is also the same order for stabilization of the DNA double-helix. Under conditions of higher DNA stability (higher ionic strength), higher polyamine concentrations were required to obtain an effect which was smaller than at low ionic strength. It is concluded that the photoreactions of psoralen with pyrimidines in DNA require some distortion of the double-helix. This distortion is made more difficult in the presence of stabilizing agents like polyamines and therefore the rate of the reaction is reduced. If crosslinking of DNA by psoralen is a two-step reaction then it must be concluded that the second step does not require further distortion. Consistently with the above, polyamines also reduced the UV-induced dimerization of thymine in DNA, although to a lesser extent. (author)

  4. Repair of the double-strand breaks produced by /sup 125/I disintegrations in the DNA of micrococcus radiodurans

    Energy Technology Data Exchange (ETDEWEB)

    Myers, D K [Atomic Energy of Canada Ltd., Chalk River, Ontario. Chalk River Nuclear Labs.

    1978-01-01

    Wild-type M. radiodurans and two radiosensitive mutants were used to study the lethal effects of /sup 125/I disintegrations in their DNA. The relative sensitivities of these three strains to inactivation by ..gamma..-radiation were reflected in their relative sensitivities to inactivation by /sup 125/I decay. The number of double-strand (ds) breaks in the DNA appeared to be similar at levels of ..gamma..-radiation and of /sup 125/I decay that reduced survival to 10%. All three strains of M. radiodurans rapidly repaired ds breaks produced in their DNA by either ..gamma..-radiation or /sup 125/I disintegrations. If one ds break per cell is a lethal event (Krisch. et al., 1975), cells of the three strains tested would die when they had left unrepaired one ds break out of an initial 45, 600 or 1800 ds breaks per single cell.

  5. DNA double strand breaks as the critical type of damage with regard to inactivation of cells through ionizing radiation

    International Nuclear Information System (INIS)

    Frankenberg, D.

    1985-01-01

    This report presents the results of an investigation into the effects of ionizing radiation on eukaryotic cells, aimed at revealing the molecular mechanisms leading to cell inactivation as a result of ionizing radiation. The quantitative determination of radiation-induced double strand breaks (DSB) is done via sedimentation of the DNA released from the cells in a neutral saccharose gradient in a preparative ultracentrifuge. The 'experimental mass spectrum' of DNA molecules thus obtained, the mean number of DSB per cell is calculated using a special computer program which simulates the stochastic induction of DSB in the DNA of non-irradiated cells and links the 'simulated' mass spectrum with the 'experimental' one on the basis of the least square fit. The experimental and theoretical studies with the eukaryote yeast on the whole allow insight into the relation between energy absorption and the inactivation of irradiated cells. (orig./MG) [de

  6. Deficiency of double-strand DNA break repair does not impair Mycobacterium tuberculosis virulence in multiple animal models of infection.

    Science.gov (United States)

    Heaton, Brook E; Barkan, Daniel; Bongiorno, Paola; Karakousis, Petros C; Glickman, Michael S

    2014-08-01

    Mycobacterium tuberculosis persistence within its human host requires mechanisms to resist the effector molecules of host immunity, which exert their bactericidal effects through damaging pathogen proteins, membranes, and DNA. Substantial evidence indicates that bacterial pathogens, including M. tuberculosis, require DNA repair systems to repair the DNA damage inflicted by the host during infection, but the role of double-strand DNA break (DSB) repair systems is unclear. Double-strand DNA breaks are the most cytotoxic form of DNA damage and must be repaired for chromosome replication to proceed. M. tuberculosis elaborates three genetically distinct DSB repair systems: homologous recombination (HR), nonhomologous end joining (NHEJ), and single-strand annealing (SSA). NHEJ, which repairs DSBs in quiescent cells, may be particularly relevant to M. tuberculosis latency. However, very little information is available about the phenotype of DSB repair-deficient M. tuberculosis in animal models of infection. Here we tested M. tuberculosis strains lacking NHEJ (a Δku ΔligD strain), HR (a ΔrecA strain), or both (a ΔrecA Δku strain) in C57BL/6J mice, C3HeB/FeJ mice, guinea pigs, and a mouse hollow-fiber model of infection. We found no difference in bacterial load, histopathology, or host mortality between wild-type and DSB repair mutant strains in any model of infection. These results suggest that the animal models tested do not inflict DSBs on the mycobacterial chromosome, that other repair pathways can compensate for the loss of NHEJ and HR, or that DSB repair is not required for M. tuberculosis pathogenesis. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  7. Mouse embryonic stem cells, but not somatic cells, predominantly use homologous recombination to repair double-strand DNA breaks.

    Science.gov (United States)

    Tichy, Elisia D; Pillai, Resmi; Deng, Li; Liang, Li; Tischfield, Jay; Schwemberger, Sandy J; Babcock, George F; Stambrook, Peter J

    2010-11-01

    Embryonic stem (ES) cells give rise to all cell types of an organism. Since mutations at this embryonic stage would affect all cells and be detrimental to the overall health of an organism, robust mechanisms must exist to ensure that genomic integrity is maintained. To test this proposition, we compared the capacity of murine ES cells to repair DNA double-strand breaks with that of differentiated cells. Of the 2 major pathways that repair double-strand breaks, error-prone nonhomologous end joining (NHEJ) predominated in mouse embryonic fibroblasts, whereas the high fidelity homologous recombinational repair (HRR) predominated in ES cells. Microhomology-mediated end joining, an emerging repair pathway, persisted at low levels in all cell types examined. The levels of proteins involved in HRR and microhomology-mediated end joining were highly elevated in ES cells compared with mouse embryonic fibroblasts, whereas those for NHEJ were quite variable, with DNA Ligase IV expression low in ES cells. The half-life of DNA Ligase IV protein was also low in ES cells. Attempts to increase the abundance of DNA Ligase IV protein by overexpression or inhibition of its degradation, and thereby elevate NHEJ in ES cells, were unsuccessful. When ES cells were induced to differentiate, however, the level of DNA Ligase IV protein increased, as did the capacity to repair by NHEJ. The data suggest that preferential use of HRR rather than NHEJ may lend ES cells an additional layer of genomic protection and that the limited levels of DNA Ligase IV may account for the low level of NHEJ activity.

  8. De novo-engineered transcription activator-like effector (TALE) hybrid nuclease with novel DNA binding specificity creates double-strand breaks

    KAUST Repository

    Mahfouz, Magdy M.; Li, Lixin; Shamimuzzaman, Md.; Wibowo, Anjar Tri; Fang, Xiaoyun; Zhu, Jian-Kang

    2011-01-01

    Site-specific and rare cutting nucleases are valuable tools for genome engineering. The generation of double-strand DNA breaks (DSBs) promotes homologous recombination in eukaryotes and can facilitate gene targeting, additions, deletions

  9. Direct evidence for sequence-dependent attraction between double-stranded DNA controlled by methylation.

    Science.gov (United States)

    Yoo, Jejoong; Kim, Hajin; Aksimentiev, Aleksei; Ha, Taekjip

    2016-03-22

    Although proteins mediate highly ordered DNA organization in vivo, theoretical studies suggest that homologous DNA duplexes can preferentially associate with one another even in the absence of proteins. Here we combine molecular dynamics simulations with single-molecule fluorescence resonance energy transfer experiments to examine the interactions between duplex DNA in the presence of spermine, a biological polycation. We find that AT-rich DNA duplexes associate more strongly than GC-rich duplexes, regardless of the sequence homology. Methyl groups of thymine acts as a steric block, relocating spermine from major grooves to interhelical regions, thereby increasing DNA-DNA attraction. Indeed, methylation of cytosines makes attraction between GC-rich DNA as strong as that between AT-rich DNA. Recent genome-wide chromosome organization studies showed that remote contact frequencies are higher for AT-rich and methylated DNA, suggesting that direct DNA-DNA interactions that we report here may play a role in the chromosome organization and gene regulation.

  10. Twisting short dsDNA with applied tension

    Science.gov (United States)

    Zoli, Marco

    2018-02-01

    The twisting deformation of mechanically stretched DNA molecules is studied by a coarse grained Hamiltonian model incorporating the fundamental interactions that stabilize the double helix and accounting for the radial and angular base pair fluctuations. The latter are all the more important at short length scales in which DNA fragments maintain an intrinsic flexibility. The presented computational method simulates a broad ensemble of possible molecule conformations characterized by a specific average twist and determines the energetically most convenient helical twist by free energy minimization. As this is done for any external load, the method yields the characteristic twist-stretch profile of the molecule and also computes the changes in the macroscopic helix parameters i.e. average diameter and rise distance. It is predicted that short molecules under stretching should first over-twist and then untwist by increasing the external load. Moreover, applying a constant load and simulating a torsional strain which over-twists the helix, it is found that the average helix diameter shrinks while the molecule elongates, in agreement with the experimental trend observed in kilo-base long sequences. The quantitative relation between percent relative elongation and superhelical density at fixed load is derived. The proposed theoretical model and computational method offer a general approach to characterize specific DNA fragments and predict their macroscopic elastic response as a function of the effective potential parameters of the mesoscopic Hamiltonian.

  11. Modeling the yield of double-strand breaks due to formation of multiply damaged sites in irradiated plasmid DNA

    International Nuclear Information System (INIS)

    Xapsos, M.A.; Pogozelski, W.K.

    1996-01-01

    Although double-strand breaks have long been recognized as an important type of DNa lesion, it is well established that this broad class of damage does not correlate well with indicators of the effectiveness of radiation as the cellular level. Assays of double-strand breaks do not distinguish the degree of complexity or clustering of singly damaged sites produced in a single energy deposition event, which is currently hypothesized to be key to understanding cellular end points. As a step toward this understanding, double-strand breaks that are formed proportionally to dose in plasmid DNA are analyzed from the mechanistic aspect to evaluate the yield that arises from multiply damaged sites as hypothesized by Ward (Prog. Nucleic Acid Res. Mol. Biol. 35, 95-125, 1988) and Goodhead (Int. J. Radiat. Biol. 65, 7-17, 1994) as opposed to the yield that arises form single hydroxyl radicals as hypothesized by Siddiqi and Bothe (Radiat. Res. 112, 449-463, 1987). For low-LET radiation such as γ rays, the importance of multiply damaged sites is shown to increase with the solution's hydroxyl radical scavenging capacity. For moderately high-LET radiation such as 100 keV/μm helium ions, a much different behavior is observed. In this case, a large fraction of double-strand breaks are formed as a result of multiply damaged sties over a broad range of scavenging conditions. Results also indicate that the RBE for common cellular end points correlates more closely with the RBE for common cellular end points correlates more closely with the RBE for multiply damaged sites than with the RBE for total double-strand breaks over a range of LET up to at least 100 keV/μm. 22 refs., 3 figs., 2 tabs

  12. Microdosimetrical calculations of the rate of repairable DNA - double strand breaks based on a model for the interpretation of experiments with different doses and radiation qualities

    International Nuclear Information System (INIS)

    Rosemann, M.; Regel, K.

    1990-01-01

    When comparing various DNA injuries induced by radiation double breaks were shown to play peculiar role in subsequent cell changes such as inactivation, aberrations, mutations and transformations. However it was proved that significant part of radiation-induced double breaks could be repaied within cell. 3 refs

  13. Double-check probing of DNA bending and unwinding by XPA-RPA: an architectural function in DNA repair

    Czech Academy of Sciences Publication Activity Database

    Missura, M.; Buterin, T.; Hindges, R.; Hübscher, U.; Kašpárková, Jana; Brabec, Viktor; Naegeli, H.

    2001-01-01

    Roč. 20, č. 13 (2001), s. 3554-3564 ISSN 0261-4189 Institutional research plan: CEZ:AV0Z5004920 Keywords : damage recognition * DNA repair * xeroderma pigmentosum Subject RIV: BO - Biophysics Impact factor: 12.450, year: 2001

  14. Increased sister chromatid cohesion and DNA damage response factor localization at an enzyme-induced DNA double-strand break in vertebrate cells.

    LENUS (Irish Health Repository)

    Dodson, Helen

    2009-10-01

    The response to DNA damage in vertebrate cells involves successive recruitment of DNA signalling and repair factors. We used light microscopy to monitor the genetic dependencies of such localization to a single, induced DNA double strand break (DSB) in vertebrate cells. We used an inducible version of the rare-cutting I-SceI endonuclease to cut a chromosomally integrated I-SceI site beside a Tet operator array that was visualized by binding a Tet repressor-GFP fusion. Formation of gamma-H2AX foci at a single DSB was independent of ATM or Ku70. ATM-deficient cells showed normal kinetics of 53Bp1 recruitment to DSBs, but Rad51 localization was retarded. 53Bp1 and Rad51 foci formation at a single DSB was greatly reduced in H2AX-null DT40 cells. We also observed decreased inter-sister chromatid distances after DSB induction, suggesting that cohesin loading at DSBs causes elevated sister chromatid cohesion. Loss of ATM reduced DSB-induced cohesion, consistent with cohesin being an ATM target in the DSB response. These data show that the same genetic pathways control how cells respond to single DSBs and to multiple lesions induced by whole-cell DNA damage.

  15. Genetic variation in a DNA double strand break repair gene in saudi population: a comparative study with worldwide ethnic groups.

    Science.gov (United States)

    Areeshi, Mohammed Yahya

    2013-01-01

    DNA repair capacity is crucial in maintaining cellular functions and homeostasis. However, it can be altered based on DNA sequence variations in DNA repair genes and this may lead to the development of many diseases including malignancies. Identification of genetic polymorphisms responsible for reduced DNA repair capacity is necessary for better prevention. Homologous recombination (HR), a major double strand break repair pathway, plays a critical role in maintaining the genome stability. The present study was performed to determine the frequency of the HR gene XRCC3 Exon 7 (C18067T, rs861539) polymorphisms in Saudi Arabian population in comparison with epidemiological studies by "MEDLINE" search to equate with global populations. The variant allelic (T) frequency of XRCC3 (C>T) was found to be 39%. Our results suggest that frequency of XRCC3 (C>T) DNA repair gene exhibits distinctive patterns compared with the Saudi Arabian population and this might be attributed to ethnic variation. The present findings may help in high-risk screening of humans exposed to environmental carcinogens and cancer predisposition in different ethnic groups.

  16. DNA double-strand braks serve as a major factor for the expression of Arabidopsis Argonaute 2

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Sung Beom; Chung, Moon Soo; Lee, Gun Woong; Chung, Byung Yeoup [Advanced Radiation Technology Institute, Korea Atomic Energy Research Institute, Jeongeup (Korea, Republic of)

    2017-02-15

    Argonaute 2 (AtAGO2) is a well characterized effector protein in Arabidopsis for its functionalities associated with DNA double-strand break (DSB)-induced small RNAs (diRNAs) and for its inducible expression upon γ-irradiation. However, its transcriptional regulation depending on the recovery time after the irradiation and on the specific response to DSBs has been poorly understood. We analyzed the 1,313 bp promoter sequence of the AtAGO2 gene (1.3kb{sub pro}) to characterize the transcriptional regulation of AtAGO2 at various recovery times after γ-irradiation. A stable transformant harboring 1.3kbpro fused with GUS gene showed that the AtAGO2 is highly expressed in response to γ-irradiation, after which the expression of the gene is gradually decreased until 5 days of DNA damage recovery. We also confrm that the AtAGO2 expression patterns are similar to that of γ-irradiation after the treatments of radiomimetic genotoxins (bleomycin and zeocin). However, methyl methanesulfonate and mitomycin C, which are associated with the inhibition of DNA replication, do not induce the expression of the AtAGO2, suggesting that the expression of the AtAGO2 is closely related with DNA DSBs rather than DNA replication.

  17. Force fluctuations assist nanopore unzipping of DNA

    International Nuclear Information System (INIS)

    Viasnoff, V; Chiaruttini, N; Muzard, J; Bockelmann, U

    2010-01-01

    We experimentally study the statistical distributions and the voltage dependence of the unzipping time of 45 base-pair-long double-stranded DNA through a nanopore. We then propose a quantitative theoretical description considering the nanopore unzipping process as a random walk of the opening fork through the DNA sequence energy landscape biased by a time-fluctuating force. To achieve quantitative agreement fluctuations need to be correlated over the millisecond range and have an amplitude of order k B T/bp. Significantly slower or faster fluctuations are not appropriate, suggesting that the unzipping process is efficiently enhanced by noise in the kHz range. We further show that the unzipping time of short 15 base-pair hairpins does not always increase with the global stability of the double helix and we theoretically study the role of DNA elasticity on the conversion of the electrical bias into a mechanical unzipping force.

  18. LNA effects on DNA binding and conformation

    DEFF Research Database (Denmark)

    Pabon-Martinez, Y Vladimir; Xu, You; Villa, Alessandra

    2017-01-01

    -substitution in the duplex pyrimidine strand alters the double helix structure, affecting x-displacement, slide and twist favoring triplex formation through enhanced TFO major groove accommodation. Collectively, these findings should facilitate the design of potent anti-gene ONs.......The anti-gene strategy is based on sequence-specific recognition of double-strand DNA by triplex forming (TFOs) or DNA strand invading oligonucleotides to modulate gene expression. To be efficient, the oligonucleotides (ONs) should target DNA selectively, with high affinity. Here we combined...... hybridization analysis and electrophoretic mobility shift assay with molecular dynamics (MD) simulations to better understand the underlying structural features of modified ONs in stabilizing duplex- and triplex structures. Particularly, we investigated the role played by the position and number of locked...

  19. Influence of reduced glutathione on end-joining of DNA double-strand breaks: Cytogenetical and molecular approach

    Energy Technology Data Exchange (ETDEWEB)

    Ghoshal, Nitin [Molecular Genetics Laboratory, Department of Biotechnology & Bioinformatics, North-Eastern Hill University, Shillong, Meghalaya-793022 (India); Sharma, Sheetal [Department of Biochemistry, Indian Institute of Science, Bangalore, 560 012 (India); Banerjee, Atanu; Kurkalang, Sillarine [Molecular Genetics Laboratory, Department of Biotechnology & Bioinformatics, North-Eastern Hill University, Shillong, Meghalaya-793022 (India); Raghavan, Sathees C. [Department of Biochemistry, Indian Institute of Science, Bangalore, 560 012 (India); Chatterjee, Anupam, E-mail: chatterjeeanupam@hotmail.com [Molecular Genetics Laboratory, Department of Biotechnology & Bioinformatics, North-Eastern Hill University, Shillong, Meghalaya-793022 (India)

    2017-01-15

    Highlights: • DNA lesions induced by Blem and radiation interact well and form higher frequency of exchange aberrations. • Cellular level of glutathione does influence such interaction of DNA lesions. • Oligomer-based cell-free assay system demonstrated better end-joining efficiency at higher level of endogenous GSH. - Abstract: Radiation induced DNA double-strand breaks (DSB) are the major initial lesions whose misrejoining may lead to exchange aberrations. However, the role of glutathione (GSH), a major cellular thiol, in regulating cell’s sensitivity to DNA damaging agents is not well understood. Influence of endogenous GSH on the efficiency of X-rays and bleomycin (Blem) induced DNA DSBs end-joining has been tested here cytogenetically, in human lymphocytes and Hct116 cells. In another approach, oligomeric DNA (75 bp) containing 5′-compatible and non-compatible overhangs mimicking the endogenous DSB were for rejoining in presence of cell-free extracts from cells having different endogenous GSH levels. Frequency of aberrations, particularly exchange aberrations, was significantly increased when Blem was combined with radiation. The exchange aberration frequency was further enhanced when combined treatment was given at 4 °C since DNA lesions are poorly repaired at 4 °C so that a higher number of DNA breaks persist and interact when shifted from 4 °C to 37 °C. The exchange aberrations increased further when the combined treatment was given to Glutathione-ester (GE) pre-treated cells, indicating more frequent rejoining of DNA lesions in presence of higher cellular GSH. This is further supported by the drastic reduction in frequency of exchange aberrations but significant increase in incidences of deletions when combined treatment was given to GSH-depleted cells. End-joining efficiency of DNA DSBs with compatible ends was better than for non-compatible ends. End-joining efficiency of testicular and MCF7 cell extracts was better than that of lungs and

  20. Investigation of DNA double strand breaks induced by α particle and 7Li ions

    International Nuclear Information System (INIS)

    Kong Fuquan; Cai Minghui; Zhao Kui; Guo Jiyu; Ni Meinan; Sui Li; Yang Mingjian; Zhan Yong

    2006-01-01

    α particles and Lithium ions were produced by 241 Am radiation source and HI-13 tandem accelerator at China Institute of Atomic Energy (CIAE) respectively to simulate ionizing radiation in Boron Neutron Capture Therapy (BNCT) process. Plasmid DNA in aqueous solution was irradiated and the DNA fragments were imaged by AFM. The image software ImageJ was used to measure the length of DNA fragments. The length distribution and conformation changes of DNA fragments were assessed. Our results showed that the mean length of DNA fragments as well as the fraction of linear and open circle DNA molecules decreased by dose. At higher dose, Lithium ions induced more pronounced relative biological effects than α particles. (author)

  1. Multiple helix ecosystems for sustainable competitiveness

    CERN Document Server

    Ferreira, João; Farinha, Luís; Fernandes, Nuno

    2016-01-01

    This book discusses the main issues, challenges, opportunities, and trends involving the interactions between academia, industry, government and society. Specifically, it aims to explore how these interactions enhance the ways in which companies deliver products and services in order to achieve sustainable competitiveness in the marketplace. Sustainable competitiveness has been widely discussed by academics and practitioners, considering the importance of protecting the environment while sustaining the economic goals of organizations. The Quintuple Helix innovation model is a framework for facilitating knowledge, innovation and sustainable competitive advantage. It embeds the Triple and the Quadruple Helix models by adding a fifth helix, the “natural environment.” The Triple Helix model focuses on the university-industry-government triad, while the Quadruple adds civil society (the media- and culture-driven public) as a fourth helix. The Quintuple Helix model facilitates research, public policy, and pract...

  2. Cyclic GMP-AMP synthase is activated by double-stranded DNA-induced oligomerization.

    Science.gov (United States)

    Li, Xin; Shu, Chang; Yi, Guanghui; Chaton, Catherine T; Shelton, Catherine L; Diao, Jiasheng; Zuo, Xiaobing; Kao, C Cheng; Herr, Andrew B; Li, Pingwei

    2013-12-12

    Cyclic GMP-AMP synthase (cGAS) is a cytosolic DNA sensor mediating innate antimicrobial immunity. It catalyzes the synthesis of a noncanonical cyclic dinucleotide, 2',5' cGAMP, that binds to STING and mediates the activation of TBK1 and IRF-3. Activated IRF-3 translocates to the nucleus and initiates the transcription of the IFN-β gene. The structure of mouse cGAS bound to an 18 bp dsDNA revealed that cGAS interacts with dsDNA through two binding sites, forming a 2:2 complex. Enzyme assays and IFN-β reporter assays of cGAS mutants demonstrated that interactions at both DNA binding sites are essential for cGAS activation. Mutagenesis and DNA binding studies showed that the two sites bind dsDNA cooperatively and that site B plays a critical role in DNA binding. The structure of mouse cGAS bound to dsDNA and 2',5' cGAMP provided insight into the catalytic mechanism of cGAS. These results demonstrated that cGAS is activated by dsDNA-induced oligomerization. Copyright © 2013 Elsevier Inc. All rights reserved.

  3. Bi-directional routing of DNA mismatch repair protein human exonuclease 1 to replication foci and DNA double strand breaks

    DEFF Research Database (Denmark)

    Liberti, Sascha E; Andersen, Sofie Dabros; Wang, Jing

    2011-01-01

    (PIP-box) region on hEXO1 located in its COOH-terminal ((788)QIKLNELW(795)). This motif is essential for PCNA binding and co-localization during S-phase. Recruitment of hEXO1 to DNA DSB sites is dependent on the MMR protein hMLH1. We show that two distinct hMLH1 interaction regions of hEXO1 (residues...

  4. DNA ligase 1 deficient plants display severe growth defects and delayed repair of both DNA single and double strand breaks

    Czech Academy of Sciences Publication Activity Database

    Waterworth, W.M.; Kozák, Jaroslav; Provost, C.M.; Bray, C.M.; Angelis, Karel; West, C.E.

    2009-01-01

    Roč. 9, art.no.79 (2009), s. 1-12 ISSN 1471-2229 R&D Projects: GA MŠk 1M0505; GA MŠk(CZ) LC06004 Institutional research plan: CEZ:AV0Z50380511 Keywords : ARABIDOPSIS-THALIANA * T-DNA * COMET ASSAY Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.774, year: 2009

  5. Changes in properties of DNA caused by gamma and ultraviolet radiation. Dependence of conformational changes on the chemical nature of the damage

    Energy Technology Data Exchange (ETDEWEB)

    Vorlickova, M; Palacek, E [Ceskoslovenska Akademie Ved, Brno. Biofysikalni Ustav

    1978-02-16

    Changes in the pulse-polarographic behaviour and circular dichroism spectra of DNA were investigated after gamma and ultraviolet irradiations and after degradation by DNAase I. It was found that moderate doses of radiation cause local conformational changes in the double helix which are dependent on the chemical nature of the damage. Only the accumulation of structural changes after high doses of the radiations or after extensive enzymic treatment may cause formation of single-standed regions in DNA.

  6. Gefitinib radiosensitizes stem-like glioma cells: inhibition of epidermal growth factor receptor-Akt-DNA-PK signaling, accompanied by inhibition of DNA double-strand break repair.

    Science.gov (United States)

    Kang, Khong Bee; Zhu, Congju; Wong, Yin Ling; Gao, Qiuhan; Ty, Albert; Wong, Meng Cheong

    2012-05-01

    We compared radiosensitivity of brain tumor stem cells (BTSCs) with matched nonstem glioma cells, and determined whether gefitinib enhanced BTSC radiosensitivity by inhibiting epidermal growth factor receptor (EGFR)-Akt-DNA-dependent protein kinase (DNA-PK) signaling, followed by enhanced DNA double-stand breaks (DSBs) and inhibition of DSB repair. Radiosensitivity of stem-like gliomaspheres and nonstem glioma cells (obtained at patient neurosurgical resection) were evaluated by clonogenic assays, γ-H(2)AX immunostaining and cell cycle distribution. Survival of irradiated and nonirradiated NOD-SCID mice intracranially implanted with stem-like gliomaspheres were monitored. Glioma cells treated with gefitinib, irradiation, or both were assayed for clonogenic survival, γ-H(2)AX immunostaining, DNA-PKcs expression, and phosphorylation of EGFR and Akt. Stem-like gliomaspheres displayed BTSC characteristics of self-renewal; differentiation into lineages of neurons, oligodendrocytes, and astrocytes; and initiation of glioma growth in NOD-SCID mice. Irradiation dose-dependently reduced clonogenic survival, induced G(2)/M arrest and increased γ-H(2)AX immunostaining of nonstem glioma cells, but not stem-like gliomaspheres. There was no difference in survival of irradiated and nonirradiated mice implanted with stem-like gliomaspheres. The addition of gefitinib significantly inhibited clonogenic survival, increased γ-H(2)AX immunostaining, and reduced DNA-PKcs expression of irradiated stem-like gliomaspheres, without affecting irradiated-nonstem glioma cells. Gefitinib alone, and when combined with irradiation, inhibited phosphorylation of EGFR (Y1068 and Y1045) and Akt (S473) in stem-like gliomaspheres. In nonstem glioma cells, gefitinib alone inhibited EGFR Y1068 phosphorylation, with further inhibition by combined gefitinib and irradiation. Stem-like gliomaspheres are resistant to irradiation-induced cytotoxicity, G(2)/M arrest, and DNA DSBs, compared with nonstem

  7. Gefitinib Radiosensitizes Stem-Like Glioma Cells: Inhibition of Epidermal Growth Factor Receptor-Akt-DNA-PK Signaling, Accompanied by Inhibition of DNA Double-Strand Break Repair

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Khong Bee, E-mail: dmskkb@nccs.com.sg [Brain Tumour Research Laboratory, Division of Medical Sciences, National Cancer Centre Singapore (Singapore); Zhu Congju; Wong Yinling; Gao Qiuhan; Ty, Albert; Wong, Meng Cheong [Brain Tumour Research Laboratory, Division of Medical Sciences, National Cancer Centre Singapore (Singapore)

    2012-05-01

    Purpose: We compared radiosensitivity of brain tumor stem cells (BTSCs) with matched nonstem glioma cells, and determined whether gefitinib enhanced BTSC radiosensitivity by inhibiting epidermal growth factor receptor (EGFR)-Akt-DNA-dependent protein kinase (DNA-PK) signaling, followed by enhanced DNA double-stand breaks (DSBs) and inhibition of DSB repair. Methods and Materials: Radiosensitivity of stem-like gliomaspheres and nonstem glioma cells (obtained at patient neurosurgical resection) were evaluated by clonogenic assays, {gamma}-H{sub 2}AX immunostaining and cell cycle distribution. Survival of irradiated and nonirradiated NOD-SCID mice intracranially implanted with stem-like gliomaspheres were monitored. Glioma cells treated with gefitinib, irradiation, or both were assayed for clonogenic survival, {gamma}-H{sub 2}AX immunostaining, DNA-PKcs expression, and phosphorylation of EGFR and Akt. Results: Stem-like gliomaspheres displayed BTSC characteristics of self-renewal; differentiation into lineages of neurons, oligodendrocytes, and astrocytes; and initiation of glioma growth in NOD-SCID mice. Irradiation dose-dependently reduced clonogenic survival, induced G{sub 2}/M arrest and increased {gamma}-H{sub 2}AX immunostaining of nonstem glioma cells, but not stem-like gliomaspheres. There was no difference in survival of irradiated and nonirradiated mice implanted with stem-like gliomaspheres. The addition of gefitinib significantly inhibited clonogenic survival, increased {gamma}-H{sub 2}AX immunostaining, and reduced DNA-PKcs expression of irradiated stem-like gliomaspheres, without affecting irradiated-nonstem glioma cells. Gefitinib alone, and when combined with irradiation, inhibited phosphorylation of EGFR (Y1068 and Y1045) and Akt (S473) in stem-like gliomaspheres. In nonstem glioma cells, gefitinib alone inhibited EGFR Y1068 phosphorylation, with further inhibition by combined gefitinib and irradiation. Conclusions: Stem-like gliomaspheres are

  8. Life forms employ different repair strategies of repair single- and double strand DNA breaks caused by different qualities of radiation: criticality of RecA mediated repair system

    International Nuclear Information System (INIS)

    Sharan, R.N.

    2013-01-01

    Different qualities of radiation, either through direct or indirect pathway, induce qualitative different spectrum of damages in DNA, which are also different in in vitro and in vivo systems. The single- and double strand breaks of DNA are of special interest as they lead to serious biological consequences. The implications of such damage to DNA and their processing by various inherent repair pathways together decide the fate of the living form

  9. FMRFamide receptors of Helix aspersa

    International Nuclear Information System (INIS)

    Payza, K.

    1988-01-01

    A receptor binding assay and an isolated heart bioassay were used to identify and characterize the FMRFamide receptors in Helix. In the heart bioassay, FMRFamide increased myocardial contraction force. A potent FMRFamide analog, desaminoTyr-Phe-norLeu-arg-Phe-amide (daYFnLRFamide), was used as a radioiodinated receptor ligand. The high affinity binding of 125 I-daYFnLRFamide at 0 degree C to Helix brain membranes was reversible, saturable, pH-dependent and specific, with a K D of 13-14 nM. A lower affinity (245 nM) site was also observed. Radioligand binding sites were also identified in the heart, male reproductive organs and digestive organs. The structure-activity relations (SAR) of cardiostimulation correlated with the specificity of 125 I-daYFnLRFamide binding to brain and heart receptors. The SAR were similar to those of other molluscan FMRFamide bioassays, except that they showed a marked preference for some analogs with blocked amino-terminals

  10. High-affinity triplex targeting of double stranded DNA using chemically modified peptide nucleic acid oligomers

    DEFF Research Database (Denmark)

    Hansen, Mads E; Bentin, Thomas; Nielsen, Peter E

    2009-01-01

    While sequence-selective dsDNA targeting by triplex forming oligonucleotides has been studied extensively, only very little is known about the properties of PNA-dsDNA triplexes-mainly due to the competing invasion process. Here we show that when appropriately modified using pseudoisocytosine subs...

  11. RNF4 is required for DNA double-strand break repair in vivo

    DEFF Research Database (Denmark)

    Vyas, R; Kumar, R; Clermont, F

    2013-01-01

    for both homologous recombination (HR) and non-homologous end joining repair. To establish a link between Rnf4 and the DNA damage response (DDR) in vivo, we generated an Rnf4 allelic series in mice. We show that Rnf4-deficiency causes persistent ionizing radiation-induced DNA damage and signaling...

  12. Role of the Coulomb interaction in the low-frequency density of states of DNA double helices

    International Nuclear Information System (INIS)

    Garcia, A.E.; Krumhansl, J.A.

    1988-01-01

    The complete vibrational frequency spectrum of several DNA double-helical oligomers is calculated using established pair potentials. Various cutoff values are used for the range of the Coulomb interactions. At very low frequency the integrated density of states shows a noninteger exponent with values ranging from 0.75 to 1.55, depending on the cutoff value for the Coulomb interactions. We conclude that the cumulative densities of states in those molecules depend more on competing interactions than on various proposed universal laws

  13. Effect of cellular glutathione content on the induction of DNA double strand breaks by 25 MeV electrons

    Energy Technology Data Exchange (ETDEWEB)

    Frankenberg, D.; Kistler, M.; Eckhardt-Schupp, F.

    1987-08-01

    The effect of endogenous glutathione (GSH) on the induction of DNA double strand breaks (dsb) by 25 MeV electrons was investigated using stationary haploid yeast cells defective in ..gamma..-glutamyl-cysteine-synthetase (gsh 1) containing less than 5 per cent of the normal GSH content. In gsh 1 cells the induction of dsb is increased by a factor of 1.5 under oxic and 1.8 under anoxic irradiation conditions whereas the oxygen enhancement ratio was only slightly decreased (1.9) compared to wild-type cells (2.4).

  14. Effect of cellular glutathione content on the induction of DNA double strand breaks by 25 MeV electrons

    International Nuclear Information System (INIS)

    Frankenberg, D.; Kistler, M.; Eckhardt-Schupp, F.

    1987-01-01

    The effect of endogenous glutathione (GSH) on the induction of DNA double strand breaks (dsb) by 25 MeV electrons was investigated using stationary haploid yeast cells defective in γ-glutamyl-cysteine-synthetase (gsh 1) containing less than 5 per cent of the normal GSH content. In gsh 1 cells the induction of dsb is increased by a factor of 1.5 under oxic and 1.8 under anoxic irradiation conditions whereas the oxygen enhancement ratio was only slightly decreased (1.9) compared to wild-type cells (2.4). (author)

  15. Human RECQ5 helicase promotes repair of DNA double-strand breaks by synthesis-dependent strand annealing

    Czech Academy of Sciences Publication Activity Database

    Paliwal, S.; Kanagaraj, R.; Sturzenegger, A.; Burdová, Kamila; Janščák, Pavel

    2014-01-01

    Roč. 42, č. 4 (2014), s. 2380-2390 ISSN 0305-1048 R&D Projects: GA ČR GA204/09/0565; GA ČR GAP305/10/0281 Grant - others:Swiss National Science Foundation(CH) 31003A-129747; Swiss National Science Foundation(CH) 31003A_146206 Institutional support: RVO:68378050 Keywords : Human RECQ5 helicase * DNA double-strand breaks * mitotic homologous recombination Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.112, year: 2014

  16. Single and double strand breaks induced by 3H incorporated in DNA of cultured human kidney cells

    International Nuclear Information System (INIS)

    Tisljar-Lentulis, G.; Henneberg, P.; Mielke, T.; Feinendegen, L.E.

    1978-01-01

    In the course of the investigations of the biological effects of radionuclides incorporated in DNA single (SSB) and double strand breaks (DSB) caused tritium-decay were measured and compared with respective data resulting from 125 I. Tritium bound to thymidine and iododeoxyuridine seems to be more effective than tritium bound to other DNA-precursors. On the basis of decay, methyl- 3 H thymidine appears to be more effective with regard to the production of strand breaks than 3 H in position 6 of the pyrimidine ring. Based on the numbers of strand-breaks per rad, position 6 is more effective in accordance with data obtained by F. Krasin et al. The ratio of SSBs to DSBs per tritium decay appears to be approximately 8 in mammlian cells. Not only SSBs but also DSBs induced by 3 H in mammalian cells are reapairable. (orig./AJ) [de

  17. Contribution of sleep to the repair of neuronal DNA double-strand breaks: evidence from flies and mice.

    Science.gov (United States)

    Bellesi, Michele; Bushey, Daniel; Chini, Mattia; Tononi, Giulio; Cirelli, Chiara

    2016-11-10

    Exploration of a novel environment leads to neuronal DNA double-strand breaks (DSBs). These DSBs are generated by type 2 topoisomerase to relieve topological constrains that limit transcription of plasticity-related immediate early genes. If not promptly repaired, however, DSBs may lead to cell death. Since the induction of plasticity-related genes is higher in wake than in sleep, we asked whether it is specifically wake associated with synaptic plasticity that leads to DSBs, and whether sleep provides any selective advantage over wake in their repair. In flies and mice, we find that enriched wake, more than simply time spent awake, induces DSBs, and their repair in mice is delayed or prevented by subsequent wake. In both species the repair of irradiation-induced neuronal DSBs is also quicker during sleep, and mouse genes mediating the response to DNA damage are upregulated in sleep. Thus, sleep facilitates the repair of neuronal DSBs.

  18. Do chromatin changes around a nascent double strand DNA break spread spherically into linearly non-adjacent chromatin?

    Science.gov (United States)

    Savic, Velibor

    2013-01-01

    In the last decade, a lot has been done in elucidating the sequence of events that occur at the nascent double strand DNA break. Nevertheless, the overall structure formed by the DNA damage response (DDR) factors around the break site, the repair focus, remains poorly understood. Although most of the data presented so far only address events that occur in chromatin in cis around the break, there are strong indications that in mammalian systems it may also occur in trans, analogous to the recent findings showing this if budding yeast. There have been attempts to address the issue but the final proof is still missing due to lack of a proper experimental system. If found to be true, the spatial distribution of DDR factors would have a major impact on the neighboring chromatin both in cis and in trans, significantly affecting local chromatin function; gene transcription and potentially other functions.

  19. FBH1 co-operates with MUS81 in inducing DNA double-strand breaks and cell death following replication stress

    DEFF Research Database (Denmark)

    Fugger, Kasper; Chu, Wai Kit; Haahr, Peter

    2013-01-01

    The molecular events occurring following the disruption of DNA replication forks are poorly characterized, despite extensive use of replication inhibitors such as hydroxyurea in the treatment of malignancies. Here, we identify a key role for the FBH1 helicase in mediating DNA double-strand break...... formation following replication inhibition. We show that FBH1-deficient cells are resistant to killing by hydroxyurea, and exhibit impaired activation of the pro-apoptotic factor p53, consistent with decreased DNA double-strand break formation. Similar findings were obtained in murine ES cells carrying...... of replication stress. Our data suggest that FBH1 helicase activity is required to eliminate cells with excessive replication stress through the generation of MUS81-induced DNA double-strand breaks....

  20. Genetic recombination induced by DNA double-strand break in bacteriophage T4: nature of the left/right bias.

    Science.gov (United States)

    Shcherbakov, Victor P; Shcherbakova, Tamara; Plugina, Lidiya; Sizova, Svetlana; Kudryashova, Elena; Granovsky, Igor

    2008-06-01

    The experimental system combining double-strand breaks (DSBs), produced site-specifically by SegC endonuclease, with the famous advantages of the bacteriophage T4 rII mutant recombination analysis was used here to elucidate the origin of the recombination bias on two sides of the DSB, especially pronounced in gene 39 (topoisomerase II) and gene 59 (41-helicase loader) mutants. Three sources were found to contribute to the bias: (1) the SegC endonuclease may remain bound to the end of the broken DNA and thus protect it from exonuclease degradation; (2) in heteroduplex heterozygotes (HHs), arising as the recombinant products in the left-hand crosses, the transcribed strands are of rII mutant phenotype, so they, in contrast to the right-hand HHs, do not produce plaques on the lawn of the lambda-lysogenic host; and (3) the intrinsic polarity of T4 chromosome, reflected in transcription, may be a cause for discrimination of promoter-proximal and promoter-distal DNA sequences. It is shown that the apparent recombination bias does not imply one-sidedness of the DSB repair but just reflects a different depth of the end processing. It is inferred that the cause, underlying the "intrinsic" bias, might be interference between strand exchange and transcription. Topoisomerase and helicase functions are necessary to turn the process in favor of strand exchange. The idea is substantiated that the double-stranded to single-stranded DNA transition edge (not ss-DNA tip) serves as an actual recombinogenic element.

  1. Role for Artemis nuclease in the repair of radiation-induced DNA double strand breaks by alternative end joining.

    Science.gov (United States)

    Moscariello, Mario; Wieloch, Radi; Kurosawa, Aya; Li, Fanghua; Adachi, Noritaka; Mladenov, Emil; Iliakis, George

    2015-07-01

    Exposure of cells to ionizing radiation or radiomimetic drugs generates DNA double-strand breaks that are processed either by homologous recombination repair (HRR), or by canonical, DNA-PKcs-dependent non-homologous end-joining (C-NHEJ). Chemical or genetic inactivation of factors involved in C-NHEJ or HRR, but also their local failure in repair proficient cells, promotes an alternative, error-prone end-joining pathway that serves as backup (A-EJ). There is evidence for the involvement of Artemis endonuclease, a protein deficient in a human radiosensitivity syndrome associated with severe immunodeficiency (RS-SCID), in the processing of subsets of DSBs by HRR or C-NHEJ. It is thought that within HRR or C-NHEJ Artemis processes DNA termini at complex DSBs. Whether Artemis has a role in A-EJ remains unknown. Here, we analyze using pulsed-field gel electrophoresis (PFGE) and specialized reporter assays, DSB repair in wild-type pre-B NALM-6 lymphocytes, as well as in their Artemis(-/-), DNA ligase 4(-/-) (LIG4(-/-)), and LIG4(-/-)/Artemis(-/-) double mutant counterparts, under conditions allowing evaluation of A-EJ. Our results substantiate the suggested roles of Artemis in C-NHEJ and HRR, but also demonstrate a role for the protein in A-EJ that is confirmed in Artemis deficient normal human fibroblasts. We conclude that Artemis is a nuclease participating in DSB repair by all major repair pathways. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Induction and repair of DNA double strand breaks: The increasing spectrum of non-homologous end joining pathways

    International Nuclear Information System (INIS)

    Mladenov, Emil; Iliakis, George

    2011-01-01

    A defining characteristic of damage induced in the DNA by ionizing radiation (IR) is its clustered character that leads to the formation of complex lesions challenging the cellular repair mechanisms. The most widely investigated such complex lesion is the DNA double strand break (DSB). DSBs undermine chromatin stability and challenge the repair machinery because an intact template strand is lacking to assist restoration of integrity and sequence in the DNA molecule. Therefore, cells have evolved a sophisticated machinery to detect DSBs and coordinate a response on the basis of inputs from various sources. A central function of cellular responses to DSBs is the coordination of DSB repair. Two conceptually different mechanisms can in principle remove DSBs from the genome of cells of higher eukaryotes. Homologous recombination repair (HRR) uses as template a homologous DNA molecule and is therefore error-free; it functions preferentially in the S and G2 phases. Non-homologous end joining (NHEJ), on the other hand, simply restores DNA integrity by joining the two ends, is error prone as sequence is only fortuitously preserved and active throughout the cell cycle. The basis of DSB repair pathway choice remains unknown, but cells of higher eukaryotes appear programmed to utilize preferentially NHEJ. Recent work suggests that when the canonical DNA-PK dependent pathway of NHEJ (D-NHEJ), becomes compromised an alternative NHEJ pathway and not HRR substitutes in a quasi-backup function (B-NHEJ). Here, we outline aspects of DSB induction by IR and review the mechanisms of their processing in cells of higher eukaryotes. We place particular emphasis on backup pathways of NHEJ and summarize their increasing significance in various cellular processes, as well as their potential contribution to carcinogenesis.

  3. Variations in the Processing of DNA Double-Strand Breaks Along 60-MeV Therapeutic Proton Beams

    Energy Technology Data Exchange (ETDEWEB)

    Chaudhary, Pankaj; Marshall, Thomas I. [Centre for Cancer Research and Cell Biology, Queen' s University Belfast, Belfast (United Kingdom); Currell, Frederick J. [Centre for Cancer Research and Cell Biology, Queen' s University Belfast, Belfast (United Kingdom); Centre for Plasma Physics, School of Mathematics and Physics, Queen' s University Belfast, Belfast (United Kingdom); Kacperek, Andrzej [Douglas Cyclotron, Clatterbridge Cancer Centre, Bebbington, Wirral (United Kingdom); Schettino, Giuseppe, E-mail: giuseppe.schettino@npl.co.uk [National Physical Laboratory, Teddington (United Kingdom); Prise, Kevin M. [Centre for Cancer Research and Cell Biology, Queen' s University Belfast, Belfast (United Kingdom)

    2016-05-01

    Purpose: To investigate the variations in induction and repair of DNA damage along the proton path, after a previous report on the increasing biological effectiveness along clinically modulated 60-MeV proton beams. Methods and Materials: Human skin fibroblast (AG01522) cells were irradiated along a monoenergetic and a modulated spread-out Bragg peak (SOBP) proton beam used for treating ocular melanoma at the Douglas Cyclotron, Clatterbridge Centre for Oncology, Wirral, Liverpool, United Kingdom. The DNA damage response was studied using the 53BP1 foci formation assay. The linear energy transfer (LET) dependence was studied by irradiating the cells at depths corresponding to entrance, proximal, middle, and distal positions of SOBP and the entrance and peak position for the pristine beam. Results: A significant amount of persistent foci was observed at the distal end of the SOBP, suggesting complex residual DNA double-strand break damage induction corresponding to the highest LET values achievable by modulated proton beams. Unlike the directly irradiated, medium-sharing bystander cells did not show any significant increase in residual foci. Conclusions: The DNA damage response along the proton beam path was similar to the response of X rays, confirming the low-LET quality of the proton exposure. However, at the distal end of SOBP our data indicate an increased complexity of DNA lesions and slower repair kinetics. A lack of significant induction of 53BP1 foci in the bystander cells suggests a minor role of cell signaling for DNA damage under these conditions.

  4. A polycomb group protein, PHF1, is involved in the response to DNA double-strand breaks in human cell

    Science.gov (United States)

    Hong, Zehui; Jiang, Jie; Lan, Li; Nakajima, Satoshi; Kanno, Shin-ichiro; Koseki, Haruhiko; Yasui, Akira

    2008-01-01

    DNA double-strand breaks (DSBs) represent the most toxic DNA damage arisen from endogenous and exogenous genotoxic stresses and are known to be repaired by either homologous recombination or nonhomologous end-joining processes. Although many proteins have been identified to participate in either of the processes, the whole processes still remain elusive. Polycomb group (PcG) proteins are epigenetic chromatin modifiers involved in gene silencing, cancer development and the maintenance of embryonic and adult stem cells. By screening proteins responding to DNA damage using laser micro-irradiation, we found that PHF1, a human homolog of Drosophila polycomb-like, Pcl, protein, was recruited to DSBs immediately after irradiation and dissociated within 10 min. The accumulation at DSBs is Ku70/Ku80-dependent, and knockdown of PHF1 leads to X-ray sensitivity and increases the frequency of homologous recombination in HeLa cell. We found that PHF1 interacts physically with Ku70/Ku80, suggesting that PHF1 promotes nonhomologous end-joining processes. Furthermore, we found that PHF1 interacts with a number of proteins involved in DNA damage responses, RAD50, SMC1, DHX9 and p53, further suggesting that PHF1, besides the function in PcG, is involved in genome maintenance processes. PMID:18385154

  5. Ubiquitin-specific protease 5 is required for the efficient repair of DNA double-strand breaks.

    Directory of Open Access Journals (Sweden)

    Satoshi Nakajima

    Full Text Available During the DNA damage response (DDR, ubiquitination plays an important role in the recruitment and regulation of repair proteins. However, little is known about elimination of the ubiquitination signal after repair is completed. Here we show that the ubiquitin-specific protease 5 (USP5, a deubiquitinating enzyme, is involved in the elimination of the ubiquitin signal from damaged sites and is required for efficient DNA double-strand break (DSB repair. Depletion of USP5 sensitizes cells to DNA damaging agents, produces DSBs, causes delayed disappearance of γH2AX foci after Bleocin treatment, and influences DSB repair efficiency in the homologous recombination pathway but not in the non-homologous end joining pathway. USP5 co-localizes to DSBs induced by laser micro-irradiation in a RAD18-dependent manner. Importantly, polyubiquitin chains at sites of DNA damage remained for longer periods in USP5-depleted cells. Our results show that disassembly of polyubiquitin chains by USP5 at sites of damage is important for efficient DSB repair.

  6. More efficient repair of DNA double-strand breaks in skeletal muscle stem cells compared to their committed progeny

    Directory of Open Access Journals (Sweden)

    Leyla Vahidi Ferdousi

    2014-11-01

    Full Text Available The loss of genome integrity in adult stem cells results in accelerated tissue aging and is possibly cancerogenic. Adult stem cells in different tissues appear to react robustly to DNA damage. We report that adult skeletal stem (satellite cells do not primarily respond to radiation-induced DNA double-strand breaks (DSBs via differentiation and exhibit less apoptosis compared to other myogenic cells. Satellite cells repair these DNA lesions more efficiently than their committed progeny. Importantly, non-proliferating satellite cells and post-mitotic nuclei in the fiber exhibit dramatically distinct repair efficiencies. Altogether, reduction of the repair capacity appears to be more a function of differentiation than of the proliferation status of the muscle cell. Notably, satellite cells retain a high efficiency of DSB repair also when isolated from the natural niche. Finally, we show that repair of DSB substrates is not only very efficient but, surprisingly, also very accurate in satellite cells and that accurate repair depends on the key non-homologous end-joining factor DNA-PKcs.

  7. More efficient repair of DNA double-strand breaks in skeletal muscle stem cells compared to their committed progeny.

    Science.gov (United States)

    Vahidi Ferdousi, Leyla; Rocheteau, Pierre; Chayot, Romain; Montagne, Benjamin; Chaker, Zayna; Flamant, Patricia; Tajbakhsh, Shahragim; Ricchetti, Miria

    2014-11-01

    The loss of genome integrity in adult stem cells results in accelerated tissue aging and is possibly cancerogenic. Adult stem cells in different tissues appear to react robustly to DNA damage. We report that adult skeletal stem (satellite) cells do not primarily respond to radiation-induced DNA double-strand breaks (DSBs) via differentiation and exhibit less apoptosis compared to other myogenic cells. Satellite cells repair these DNA lesions more efficiently than their committed progeny. Importantly, non-proliferating satellite cells and post-mitotic nuclei in the fiber exhibit dramatically distinct repair efficiencies. Altogether, reduction of the repair capacity appears to be more a function of differentiation than of the proliferation status of the muscle cell. Notably, satellite cells retain a high efficiency of DSB repair also when isolated from the natural niche. Finally, we show that repair of DSB substrates is not only very efficient but, surprisingly, also very accurate in satellite cells and that accurate repair depends on the key non-homologous end-joining factor DNA-PKcs. Copyright © 2014. Published by Elsevier B.V.

  8. The foci of DNA double strand break-recognition proteins localize with γH2AX after heat treatment

    International Nuclear Information System (INIS)

    Takahashi, Akihisa; Mori, Eiichiro; Ohnishi, Takeo

    2010-01-01

    Recently, there have been many reports concerning proteins which can recognize DNA double strand break (DSBs), and such proteins include histone H2AX phosphorylated at serine 139 (γH2AX), ataxia telangiectasia mutated (ATM) phospho-serine 1981, DNA-dependent protein kinase catalytic subunit (DNA-PKcs) phospho-threonine 2609, Nijmegen breakage syndrome 1 (NBS1) phospho-serine 343, checkpoint kinase 2 (CHK2), phospho-threonine 68, and structural maintenance of chromosomes 1 (SMC1) phospho-serine 966. Thus, it should be possible to follow the formation of DSBs and their repair using immunohistochemical methods with multiple antibodies to detect these proteins. When normal human fibroblasts (AG1522 cells) were exposed to 3 Gy of X-rays as a control, clearly discernable foci for these proteins were detected, and these foci localized with γH2AX foci. After heat treatment at 45.5 deg C for 20 min, these proteins are partially localized with γH2AX foci. Here we show that there were slight differences in the localization pattern among these proteins, such as a disappearance from the nucleus (phospho-ATM) and translocation to the cytoplasm (phospho-NBS1) at 30 min after heat treatment, and some foci (phospho-DNA-PKcs and phospho-CHK2) appeared at 8 h after heat treatment. These results are discussed from perspectives of heat-induced denaturation of proteins and formation of DSBs. (author)

  9. In Vitro Expansion of Bone Marrow Derived Mesenchymal Stem Cells Alters DNA Double Strand Break Repair of Etoposide Induced DNA Damage

    Directory of Open Access Journals (Sweden)

    Ian Hare

    2016-01-01

    Full Text Available Mesenchymal stem cells (MSCs are of interest for use in diverse cellular therapies. Ex vivo expansion of MSCs intended for transplantation must result in generation of cells that maintain fidelity of critical functions. Previous investigations have identified genetic and phenotypic alterations of MSCs with in vitro passage, but little is known regarding how culturing influences the ability of MSCs to repair double strand DNA breaks (DSBs, the most severe of DNA lesions. To investigate the response to DSB stress with passage in vitro, primary human MSCs were exposed to etoposide (VP16 at various passages with subsequent evaluation of cellular damage responses and DNA repair. Passage number did not affect susceptibility to VP16 or the incidence and repair kinetics of DSBs. Nonhomologous end joining (NHEJ transcripts showed little alteration with VP16 exposure or passage; however, homologous recombination (HR transcripts were reduced following VP16 exposure with this decrease amplified as MSCs were passaged in vitro. Functional evaluations of NHEJ and HR showed that MSCs were unable to activate NHEJ repair following VP16 stress in cells after successive passage. These results indicate that ex vivo expansion of MSCs alters their ability to perform DSB repair, a necessary function for cells intended for transplantation.

  10. In Vitro Expansion of Bone Marrow Derived Mesenchymal Stem Cells Alters DNA Double Strand Break Repair of Etoposide Induced DNA Damage.

    Science.gov (United States)

    Hare, Ian; Gencheva, Marieta; Evans, Rebecca; Fortney, James; Piktel, Debbie; Vos, Jeffrey A; Howell, David; Gibson, Laura F

    2016-01-01

    Mesenchymal stem cells (MSCs) are of interest for use in diverse cellular therapies. Ex vivo expansion of MSCs intended for transplantation must result in generation of cells that maintain fidelity of critical functions. Previous investigations have identified genetic and phenotypic alterations of MSCs with in vitro passage, but little is known regarding how culturing influences the ability of MSCs to repair double strand DNA breaks (DSBs), the most severe of DNA lesions. To investigate the response to DSB stress with passage in vitro, primary human MSCs were exposed to etoposide (VP16) at various passages with subsequent evaluation of cellular damage responses and DNA repair. Passage number did not affect susceptibility to VP16 or the incidence and repair kinetics of DSBs. Nonhomologous end joining (NHEJ) transcripts showed little alteration with VP16 exposure or passage; however, homologous recombination (HR) transcripts were reduced following VP16 exposure with this decrease amplified as MSCs were passaged in vitro. Functional evaluations of NHEJ and HR showed that MSCs were unable to activate NHEJ repair following VP16 stress in cells after successive passage. These results indicate that ex vivo expansion of MSCs alters their ability to perform DSB repair, a necessary function for cells intended for transplantation.

  11. Induction of DNA double-strand breaks by ionizing radiation of different quality and their relevance for cell inactivation

    International Nuclear Information System (INIS)

    Kampf, G.

    1988-01-01

    By investigation of the production of DNA strand breaks and of DNA release from the nuclear membrane complex in Chinese hamster cells using different radiation qualities from 1 to 360 keV/μm, partly also under hypoxic conditions, and by relating the results to the induction of chromosome aberrations and to cell inactivation it has become possible to find connections between the induction of molecular lesions and the expression of this damage on the cellular level. From the studies follows that DNA pieces are cut off from the nuclear membrane complex by DNA double-strand breaks (DSB). The share and size of the released pieces depends on radiation dose and quality as well as on the oxygen conditions. The lesions can partly be repaired. In connection with the DSB rates the results of the DNA release studies led to the conclusion that the DNA in the cells must be organized in superstructure units (MASSUs) with a DNA mass of about 2 x 10 9 g/mol, which are associated to the nuclear membrane in attachment points. The numerical relations show that for a 37% survival probability about 90 DSB per genome are required with sparsely ionizing radiation; this number declines to about 40 by use of more densely ionizing radiation up to 150 keV/μm, and increases again with further rise of the ionization density. Hence, for cell inactivation not simply a certain number of DSB per cell is required but rather seems their cooperation within a small structure section of the DNA to be relevant. These critical structures are with high probability the MASSUs. An irrepairable release of DNA from such a structure unit can bring about a chromosome break detectable in the metaphase and finally lead to cell inactivation. DSB turned out to be the essential lethal events in bacteria as well. The relatively small differences to the eukaryotic cells in the position of the maximum of radiation sensitivity on the LET scale and in the lesion sensitivity towards DSB let suggest that a common critical

  12. TH-CD-201-11: Optimizing the Response and Cost of a DNA Double-Strand Break Dosimeter

    Energy Technology Data Exchange (ETDEWEB)

    Obeidat, M; Cline, K; Stathakis, S; Papanikolaou, N; Rasmussen, K; Gutierrez, A; Ha, CS; Lee, SE; Shim, EY; Kirby, N [University of Texas HSC SA, San Antonio, TX (United States)

    2016-06-15

    Purpose: A DNA double-strand break (DSB) dosimeter was developed to measure the biological effect of radiation. The goal here is to refine the fabrication method of this dosimeter to reproducibly create a low coefficient of variation (CoV) and reduce the cost for the dosimeter. Methods: Our dosimeter consists of 4 kilo-base pair DNA strands (labeled on one end with biotin and on the other with fluorescein) attached to streptavidin magnetic beads. The final step of the DNA dosimeter fabrication is to suspend these attached beads in phosphate-buffered saline (PBS). The amount of PBS used to suspend the attached beads and the relative volume of the DNA strands to the beads both affect the CoV and dosimeter cost. We diluted the beads attached with DNA in different volumes of PBS (100, 200, and 400 µL) to create different concentrations of the DNA dosimeter. Then we irradiated these dosimeters (50 µL samples) in a water-equivalent plastic phantom at 25 and 50 Gy (three samples per dose) and calculated the CoV for each dosimeter concentration. Also, we used different masses of DNA strands (1, 2, 8, 16, 24, and 32 µg) to attach to the same volume of magnetic beads (100 µL) to explore how this affects the cost of the dosimeter. Results: The lowest CoV was produced for the highest concentration of dosimeter (100 µL of PBS), which created CoV of 2.0 and 1.0% for 25 and 50 Gy, respectively. We found that the lowest production cost for the dosimeter occurs by attaching 16 µg of DNA strands with 100 µL of beads. Conclusion: : We optimized the fabrication of the DNA dosimeter to produce low CoV and cost, but we still need to explore ways to further improve the dosimeter for use at lower doses. This work was supported in part by Yarmouk University (Irbid, Jordan) and CPRIT (RP140105)

  13. Cyclic GMP-AMP Synthase is Activated by Double-stranded DNA-Induced Oligomerization

    OpenAIRE

    Li, Xin; Shu, Chang; Yi, Guanghui; Chaton, Catherine T.; Shelton, Catherine L.; Diao, Jiasheng; Zuo, Xiaobing; Kao, C Cheng; Herr, Andrew B.; Li, Pingwei

    2013-01-01

    Cyclic GMP-AMP synthase (cGAS) is a cytosolic DNA sensor mediating innate antimicrobial immunity. It catalyzes the synthesis of a noncanonical cyclic dinucleotide 2′,5′ cGAMP that binds to STING and mediates the activation of TBK1 and IRF-3. Activated IRF-3 translocates to the nucleus and initiates the transcription of the IFN-β gene. The structure of mouse cGAS bound to an 18 bp dsDNA revealed that cGAS interacts with dsDNA through two binding sites, forming a 2:2 complex. Enzyme assays and ...

  14. Trabectedin – the DNA minor groove binder

    Directory of Open Access Journals (Sweden)

    G. A. Belitsky

    2015-01-01

    Full Text Available Trabectedin (ET-743, Yondelis is an alkaloid that was originally isolated from the Caribbean Sea squirt, Ecteinascidia turbinata and is now produced synthetically. Its chemical structure consists in three fused tetrahydroisoquinoline rings. Two of them, A and B, binds covalently to guanine residues in the minor groove of the DNA double helix to bend the molecule toward the major groove and the third ring C protrudes from the DNA duplex, apparently allowing interactions with several nuclear proteins. Binding to the minor groove of DNA, trabectedin trigger a cascade of events that interfere with several transcription factors, DNA binding proteins, and DNA repair pathways in particular nucleotide excision repair. It acts both as a DNA-alkylating drug and topoisomerase poison. Trabectedin-DNA adduct traps the nucleotide excision repair proteins repairing the DNA damage in transcribing genes and induces DNA strand breaks. Cells deficient in homologous recombination pathway which repairs these double-strand breaks show increased sensitivity to trabectedin. The most sensitive of them were myxoid liposarcomas. Trabectedin is also effective in chemotherapy-experienced patients with advanced, recurrent liposarcoma or leiomyosarcoma as well as in women with ovarian cancer and breast cancer with BRCAness phenotype. Besides of tumor cells Trabectedin inhibits inflammatory cells by affecting directly monocytes and tumorassociated macrophages and indirectly by inhibiting production of inflammatory mediators, the cytokines and chemokines. It inhibits also the MDR-1 gene, which is responsible for the resistance of cancer cells to chemotherapeutic agents and strikes tumor angiogenesis.

  15. Damage to cellular DNA from particulate radiations, the efficacy of its processing and the radiosensitivity of mammalian cells. Emphasis on DNA double strand breaks and chromatin breaks

    Science.gov (United States)

    Lett, J. T.

    1992-01-01

    For several years, it has been evident that cellular radiation biology is in a necessary period of consolidation and transition (Lett 1987, 1990; Lett et al. 1986, 1987). Both changes are moving apace, and have been stimulated by studies with heavy charged particles. From the standpoint of radiation chemistry, there is now a consensus of opinion that the DNA hydration shell must be distinguished from bulk water in the cell nucleus and treated as an integral part of DNA (chromatin) (Lett 1987). Concomitantly, sentiment is strengthening for the abandonment of the classical notions of "direct" and "indirect" action (Fielden and O'Neill 1991; O'Neill 1991; O'Neill et al. 1991; Schulte-Frohlinde and Bothe 1991 and references therein). A layer of water molecules outside, or in the outer edge of, the DNA (chromatin) hydration shell influences cellular radiosensitivity in ways not fully understood. Charge and energy transfer processes facilitated by, or involving, DNA hydration must be considered in rigorous theories of radiation action on cells. The induction and processing of double stand breaks (DSBs) in DNA (chromatin) seem to be the predominant determinants of the radiotoxicity of normally radioresistant mammalian cells, the survival curves of which reflect the patterns of damage induced and the damage present after processing ceases, and can be modelled in formal terms by the use of reaction (enzyme) kinetics. Incongruities such as sublethal damage are neither scientifically sound nor relevant to cellular radiation biology (Calkins 1991; Lett 1990; Lett et al. 1987a). Increases in linear energy transfer (LET infinity) up to 100-200 keV micron-1 cause increases in the extents of neighboring chemical and physical damage in DNA denoted by the general term DSB. Those changes are accompanied by decreasing abilities of cells normally radioresistant to sparsely ionizing radiations to process DSBs in DNA and chromatin and to recover from radiation exposure, so they make

  16. Gefitinib Radiosensitizes Stem-Like Glioma Cells: Inhibition of Epidermal Growth Factor Receptor-Akt-DNA-PK Signaling, Accompanied by Inhibition of DNA Double-Strand Break Repair

    International Nuclear Information System (INIS)

    Kang, Khong Bee; Zhu Congju; Wong Yinling; Gao Qiuhan; Ty, Albert; Wong, Meng Cheong

    2012-01-01

    Purpose: We compared radiosensitivity of brain tumor stem cells (BTSCs) with matched nonstem glioma cells, and determined whether gefitinib enhanced BTSC radiosensitivity by inhibiting epidermal growth factor receptor (EGFR)–Akt-DNA–dependent protein kinase (DNA-PK) signaling, followed by enhanced DNA double-stand breaks (DSBs) and inhibition of DSB repair. Methods and Materials: Radiosensitivity of stem-like gliomaspheres and nonstem glioma cells (obtained at patient neurosurgical resection) were evaluated by clonogenic assays, γ-H 2 AX immunostaining and cell cycle distribution. Survival of irradiated and nonirradiated NOD-SCID mice intracranially implanted with stem-like gliomaspheres were monitored. Glioma cells treated with gefitinib, irradiation, or both were assayed for clonogenic survival, γ-H 2 AX immunostaining, DNA-PKcs expression, and phosphorylation of EGFR and Akt. Results: Stem-like gliomaspheres displayed BTSC characteristics of self-renewal; differentiation into lineages of neurons, oligodendrocytes, and astrocytes; and initiation of glioma growth in NOD-SCID mice. Irradiation dose-dependently reduced clonogenic survival, induced G 2 /M arrest and increased γ-H 2 AX immunostaining of nonstem glioma cells, but not stem-like gliomaspheres. There was no difference in survival of irradiated and nonirradiated mice implanted with stem-like gliomaspheres. The addition of gefitinib significantly inhibited clonogenic survival, increased γ-H 2 AX immunostaining, and reduced DNA-PKcs expression of irradiated stem-like gliomaspheres, without affecting irradiated-nonstem glioma cells. Gefitinib alone, and when combined with irradiation, inhibited phosphorylation of EGFR (Y1068 and Y1045) and Akt (S473) in stem-like gliomaspheres. In nonstem glioma cells, gefitinib alone inhibited EGFR Y1068 phosphorylation, with further inhibition by combined gefitinib and irradiation. Conclusions: Stem-like gliomaspheres are resistant to irradiation

  17. Differential regulation of the cellular response to DNA double-strand breaks in G1

    DEFF Research Database (Denmark)

    Barlow, Jacqueline H; Lisby, Michael; Rothstein, Rodney

    2008-01-01

    -induced breaks are recognized by Rfa1 only after the cell enters S phase. This difference is dependent on the DNA end-binding Yku70/Yku80 complex. Cell-cycle regulation is also observed in the DNA damage checkpoint response. Specifically, the 9-1-1 complex is required in G1 cells to recruit the Ddc2 checkpoint...... protein to damaged DNA, while, upon entry into S phase, the cyclin-dependent kinase Cdc28 and the 9-1-1 complex both serve to recruit Ddc2 to foci. Together, these results demonstrate that the DNA repair machinery distinguishes between different types of damage in G1, which translates into different modes...

  18. Mitochondrial DNA double-strand breaks in oligodendrocytes cause demyelination, axonal injury, and CNS inflammation

    DEFF Research Database (Denmark)

    Madsen, Pernille M.; Pinto, Milena; Patel, Shreyans

    2017-01-01

    with time of induction. In addition, after short transient induction of mtDNA DSBs, PLP:mtPstI mice showed an exacerbated response to experimental autoimmune encephalomyelitis. Together, our data demonstrate that mtDNA damage can cause primary oligodendropathy, which in turn triggers demyelination, proving...... forms, which are not accurately reproduced in the models currently available. For this reason, the PLP: mtPstI mouse represents a unique and much needed platform for testing remyelinating therapies....

  19. Structure and dynamics of double helical DNA in torsion angle hyperspace: a molecular mechanics approach.

    Science.gov (United States)

    Borkar, Aditi; Ghosh, Indira; Bhattacharyya, Dhananjay

    2010-04-01

    Analysis of the conformational space populated by the torsion angles and the correlation between the conformational energy and the sequence of DNA are important for fully understanding DNA structure and function. Presence of seven variable torsion angles about single covalent bonds in DNA main chain puts a big challenge for such analysis. We have carried out restrained energy minimization studies for four representative dinucleosides, namely d(ApA):d(TpT), d(CpG):d(CpG), d(GpC):d(GpC) and d(CpA):d(TpG) to determine the energy hyperspace of DNA in context to the values of the torsion angles and the structural properties of the DNA conformations populating the favorable regions of this energy hyperspace. The torsion angles were manipulated by constraining their values at the reference points and then performing energy minimization. The energy minima obtained on the potential energy contour plots mostly correspond to the conformations populated in crystal structures of DNA. Some novel favorable conformations that are not present in crystal structure data are also found. The plots also suggest few low energy routes for conformational transitions or the associated energy barrier heights. Analyses of base pairing and stacking possibility reveal structural changes accompanying these transitions as well as the flexibility of different base steps towards variations in different torsion angles.

  20. Phase, current, absorbance, and photoluminescence of double and triple metal ion-doped synthetic and salmon DNA thin films

    Science.gov (United States)

    Chopade, Prathamesh; Reddy Dugasani, Sreekantha; Reddy Kesama, Mallikarjuna; Yoo, Sanghyun; Gnapareddy, Bramaramba; Lee, Yun Woo; Jeon, Sohee; Jeong, Jun-Ho; Park, Sung Ha

    2017-10-01

    We fabricated synthetic double-crossover (DX) DNA lattices and natural salmon DNA (SDNA) thin films, doped with 3 combinations of double divalent metal ions (M2+)-doped groups (Co2+-Ni2+, Cu2+-Co2+, and Cu2+-Ni2+) and single combination of a triple M2+-doped group (Cu2+-Ni2+-Co2+) at various concentrations of M2+ ([M2+]). We evaluated the optimum concentration of M2+ ([M2+]O) (the phase of M2+-doped DX DNA lattices changed from crystalline (up to ([M2+]O) to amorphous (above [M2+]O)) and measured the current, absorbance, and photoluminescent characteristics of multiple M2+-doped SDNA thin films. Phase transitions (visualized in phase diagrams theoretically as well as experimentally) from crystalline to amorphous for double (Co2+-Ni2+, Cu2+-Co2+, and Cu2+-Ni2+) and triple (Cu2+-Ni2+-Co2+) dopings occurred between 0.8 mM and 1.0 mM of Ni2+ at a fixed 0.5 mM of Co2+, between 0.6 mM and 0.8 mM of Co2+ at a fixed 3.0 mM of Cu2+, between 0.6 mM and 0.8 mM of Ni2+ at a fixed 3.0 mM of Cu2+, and between 0.6 mM and 0.8 mM of Co2+ at fixed 2.0 mM of Cu2+ and 0.8 mM of Ni2+, respectively. The overall behavior of the current and photoluminescence showed increments as increasing [M2+] up to [M2+]O, then decrements with further increasing [M2+]. On the other hand, absorbance at 260 nm showed the opposite behavior. Multiple M2+-doped DNA thin films can be used in specific devices and sensors with enhanced optoelectric characteristics and tunable multi-functionalities.

  1. Relationship between internal dosimetry and DNA double strand breaks in lymphocytes after radionuclide therapy; Zusammenhang zwischen physikalischer Dosimetrie und DNA Doppelstrangbruechen in Lymphozyten nach Radionuklidtherapie

    Energy Technology Data Exchange (ETDEWEB)

    Eberlein, Uta

    2015-09-30

    In radionuclide therapy radiopharmaceuticals are administered mostly systemically. Primarily, beta-emitters are used because of their short range in tissue. As a result the radiopharmaceutical distributes within the human body and accumulates in organs and target structures. Thus, the body is irradiated internally, in contrast to external irradiation in radiotherapy. The pattern of the activity distribution within the human body is determined by the physical and chemical properties of the radiopharmaceutical. Furthermore, the amount of activity and its accumulation in organs or tissues is essential for the calculation of the absorbed dose which defines the energy deposited in the body by ionizing radiation. During internal or external irradiation, patients are exposed to ionizing radiation which does not only destroy the malignant cells but also damages healthy tissue and cells. This is mainly caused by direct and indirect interaction of the radiation with the DNA which damages the DNA structure. Most frequently, there are single strand breaks and base damages. DNA double strand breaks (DSBs) are rare; nevertheless, they are the most critical lesions for cells as repairing the damage is difficult. Unrepaired or misrepaired DNA could cause mutations, chromosomal aberrations or lead to cell death. The formation of a DNA DSB in nuclear chromatin results in the rapid phosphorylation of the histone H2 variant H2AX, then called gamma-H2AX. Furthermore, DSBs also recruit the damage sensor 53BP1 to the chromatin surrounding the DSBs, which leads to 53BP1 and gamma-H2AX co-localization in the chromatin surrounding a DSB. By immunofluorescence staining with gamma-H2AX and 53BP1 antibodies those biomarkers can be addressed by microscopically visible DNA damage protein foci, this is also known as the DNA damage focus assay. With progression of DSB repair, gamma-H2AX and 53BP1 foci disappear. It is assumed that one focus corresponds to one DSB. Therefore, the number of foci per

  2. DNA priming for seasonal influenza vaccine: a phase 1b double-blind randomized clinical trial.

    Directory of Open Access Journals (Sweden)

    Julie E Ledgerwood

    Full Text Available The efficacy of current influenza vaccines is limited in vulnerable populations. DNA vaccines can be produced rapidly, and may offer a potential strategy to improve vaccine immunogenicity, indicated by studies with H5 influenza DNA vaccine prime followed by inactivated vaccine boost.Four sites enrolled healthy adults, randomized to receive 2011/12 seasonal influenza DNA vaccine prime (n=65 or phosphate buffered saline (PBS (n=66 administered intramuscularly with Biojector. All subjects received the 2012/13 seasonal inactivated influenza vaccine, trivalent (IIV3 36 weeks after the priming injection. Vaccine safety and tolerability was the primary objective and measurement of antibody response by hemagglutination inhibition (HAI was the secondary objective.The DNA vaccine prime-IIV3 boost regimen was safe and well tolerated. Significant differences in HAI responses between the DNA vaccine prime and the PBS prime groups were not detected in this study.While DNA priming significantly improved the response to a conventional monovalent H5 vaccine in a previous study, it was not effective in adults using seasonal influenza strains, possibly due to pre-existing immunity to the prime, unmatched prime and boost antigens, or the lengthy 36 week boost interval. Careful optimization of the DNA prime-IIV3 boost regimen as related to antigen matching, interval between vaccinations, and pre-existing immune responses to influenza is likely to be needed in further evaluations of this vaccine strategy. In particular, testing this concept in younger age groups with less prior exposure to seasonal influenza strains may be informative.ClinicalTrials.gov NCT01498718.

  3. DNA double-strand break measurement in mammalian cells by pulsed-field gel electrophoresis: an approach using restriction enzymes and gene probing

    International Nuclear Information System (INIS)

    Loebrich, M.; Ikpeme, S.; Kiefer, J.

    1994-01-01

    DNA samples prepared from human SP 3 cells, which had not been exposed to various doses of X-ray, were treated with NotI restriction endonuclease before being run in a contour-clamped homogeneous electrophoresis system. The restriction enzyme cuts the DNA at defined positions delivering DNA sizes which can be resolved by pulsed-field gel electrophoresis (PFGE). In order to investigate only one of the DNA fragments, a human lactoferrin cDNA, pHL-41, was hybridized to the DNA separated by PFGE. As a result, only the DNA fragment which contains the hybridized gene was detected resulting in a one-band pattern. The decrease of this band was found to be exponential with increasing radiation dose. From the slope, a double-strand break induction rate of (6.3±0.7) x 10 -3 /Mbp/Gy was deduced for 80 kV X-rays. (Author)

  4. Bio-recognitive photonics of a DNA-guided organic semiconductor

    Science.gov (United States)

    Back, Seung Hyuk; Park, Jin Hyuk; Cui, Chunzhi; Ahn, Dong June

    2016-01-01

    Incorporation of duplex DNA with higher molecular weights has attracted attention for a new opportunity towards a better organic light-emitting diode (OLED) capability. However, biological recognition by OLED materials is yet to be addressed. In this study, specific oligomeric DNA-DNA recognition is successfully achieved by tri (8-hydroxyquinoline) aluminium (Alq3), an organic semiconductor. Alq3 rods crystallized with guidance from single-strand DNA molecules show, strikingly, a unique distribution of the DNA molecules with a shape of an `inverted' hourglass. The crystal's luminescent intensity is enhanced by 1.6-fold upon recognition of the perfect-matched target DNA sequence, but not in the case of a single-base mismatched one. The DNA-DNA recognition forming double-helix structure is identified to occur only in the rod's outer periphery. This study opens up new opportunities of Alq3, one of the most widely used OLED materials, enabling biological recognition.

  5. Bio-recognitive photonics of a DNA-guided organic semiconductor.

    Science.gov (United States)

    Back, Seung Hyuk; Park, Jin Hyuk; Cui, Chunzhi; Ahn, Dong June

    2016-01-04

    Incorporation of duplex DNA with higher molecular weights has attracted attention for a new opportunity towards a better organic light-emitting diode (OLED) capability. However, biological recognition by OLED materials is yet to be addressed. In this study, specific oligomeric DNA-DNA recognition is successfully achieved by tri (8-hydroxyquinoline) aluminium (Alq3), an organic semiconductor. Alq3 rods crystallized with guidance from single-strand DNA molecules show, strikingly, a unique distribution of the DNA molecules with a shape of an 'inverted' hourglass. The crystal's luminescent intensity is enhanced by 1.6-fold upon recognition of the perfect-matched target DNA sequence, but not in the case of a single-base mismatched one. The DNA-DNA recognition forming double-helix structure is identified to occur only in the rod's outer periphery. This study opens up new opportunities of Alq3, one of the most widely used OLED materials, enabling biological recognition.

  6. Effects of Replication and Transcription on DNA Structure-Related Genetic Instability.

    Science.gov (United States)

    Wang, Guliang; Vasquez, Karen M

    2017-01-05

    Many repetitive sequences in the human genome can adopt conformations that differ from the canonical B-DNA double helix (i.e., non-B DNA), and can impact important biological processes such as DNA replication, transcription, recombination, telomere maintenance, viral integration, transposome activation, DNA damage and repair. Thus, non-B DNA-forming sequences have been implicated in genetic instability and disease development. In this article, we discuss the interactions of non-B DNA with the replication and/or transcription machinery, particularly in disease states (e.g., tumors) that can lead to an abnormal cellular environment, and how such interactions may alter DNA replication and transcription, leading to potential conflicts at non-B DNA regions, and eventually result in genetic stability and human disease.

  7. Measurement of intracellular DNA double-strand break induction and rejoining along the track of carbon and neon particle beams in water

    International Nuclear Information System (INIS)

    Heilmann, Johannes; Taucher-Scholz, Gisela; Haberer, Thomas; Scholz, Michael; Kraft, Gerhard

    1996-01-01

    Purpose: The study was aimed at the measurement of effect-depth distributions of intracellularly induced DNA damage in water as tissue equivalent after heavy ion irradiation with therapy particle beams. Methods and Materials: An assay involving embedding of Chinese hamster ovary (CHO-K1) cells in large agarose plugs and electrophoretic elution of radiation induced DNA fragments by constant field gel electrophoresis was developed. Double-strand break production was quantified by densitometric analysis of DNA-fluorescence after staining with ethidium-bromide and determination of the fraction of DNA eluted out of the agarose plugs. Intracellular double-strand break induction and the effect of a 3 h rejoining incubation were investigated following irradiation with 250 kV x-rays and 190 MeV/u carbon- and 295 MeV/u neon-ions. Results and Conclusion: While the DNA damage induced by x-irradiation decreased continuously with penetration depth, a steady increase in the yield of double-strand breaks was observed for particle radiation, reaching distinct maxima at the position of the physical Bragg peaks. Beyond this, the extent of radiation damage dropped drastically. From comparison of DNA damage and calculated dose profiles, relative biological efficiencies (RBEs) for both double-strand break induction and unrejoined strand breaks after 3 h were determined. While RBE for the induction of DNA double-strand breaks decreased continuously with penetration depth, RBE maxima greater than unity were found with carbon- and neon-ions for double-strand break rejoining near the maximum range of the particles. The method presented here allows for a fast and accurate determination of depth profiles of relevant radiobiological effects for mixed particle fields in tissue equivalent

  8. The mechanism of double-stranded DNA sensing through the cGAS-STING pathway.

    Science.gov (United States)

    Shu, Chang; Li, Xin; Li, Pingwei

    2014-12-01

    Microbial nucleic acids induce potent innate immune responses by stimulating the expression of type I interferons. Cyclic GMP-AMP synthase (cGAS) is a cytosolic dsDNA sensor mediating the innate immunity to microbial DNA. cGAS is activated by dsDNA and catalyze the synthesis of a cyclic dinucleotide cGAMP with 2',5' and 3',5'phosphodiester linkages. cGAMP binds to the adaptor STING located on the endoplasmic reticulum membrane and mediates the recruitment and activation of the protein kinase TBK1 and transcription factor IRF3. Phosphorylated IRF3 translocates to the nucleus and initiates the transcription of the IFN-β gene. The crystal structures of cGAS and its complex with dsDNA, STING and its complex with various cyclic dinucleotides have been determined recently. Here we summarize the results from these structural studies and provide an overview about the mechanism of cGAS activation by dsDNA, the catalytic mechanism of cGAS, and the structural basis of STING activation by cGAMP. Published by Elsevier Ltd.

  9. A simple strategy for subcloning and amplifying random multimegabase subchromosomal acentric DNA fragments as double minute chromosomes

    International Nuclear Information System (INIS)

    Hahn, P.J.; Giddings, L.; Lane, M.J.

    1989-01-01

    Restriction mapping of relatively large genomes (e.g. human) utilizing randomly generated DNA segments requires high mapping redundancy to successfully organize 'contigs' to represent the entire genome. The number of independent DNA segment maps required is dependent on the average size of a mapping segment; the larger the segment, the fewer required. The authors have developed a strategy for subcloning intact multimegabase subchromosomal fragments as double minute chromosomes. Such fragments could serve as primary mapping elements or as adjunct (linking) fragments to rapidly connect already existent contigs generated using yeast artificial chromosomes or cosmids. They present several lines of evidence supporting the viability of this approach. (1) X-ray treated EMT-6 mouse cells (7.5 Gr.) which are selected over several months with increasing levels of methotrexate (MTX) contain highly amplified circular DNA molecules (double minutes) which include the dihydrofolate reductase (DHFR) gene in a size range between 1,000 and 3,500 kilobases as determined by pulsed-field gel electrophoresis and these acentric chromosomal fragments have been stably maintained in culture for at least a year. (2) Preliminary data based on experiments involving fusion of X-irradiated Chinese Hamster Ovary (CH0 DG44) cells containing randomly inserted cotransfected Neomycin resistance and DHFR genes to mouse EMT-6 cells shows that the linked genes can be readily cotransferred as acentric subchromosomal fragment(s) suitable for gene amplification. (3) The studies of CHO cells with cell fusion transferred X-ray induced chromosomal fragments containing the natural CHO DHFR gene suggest that transferred chromosome fragments undergo gene amplification much more readily than nonfragmented endogenous DHFR genes

  10. Production of DNA Double Strand Breaks in Human Cells due to Acute Exposure to Tritiated Water (HTO)

    International Nuclear Information System (INIS)

    Gonen, R.; German, U.; Alfassi, Z. B.; Priel, E.

    2014-01-01

    The average and maximum energies of the beta emission from 3H are 5.69 keV and 18.6 keV respectively. The average range in water (or soft tissues), around 0.5 1/4m (500 nm), is considerably less than the typical diameter of a cell (10-30 1/4m), and even of a cell nucleus (5-10 1/4m), thus the micro-location of the tritium atom may well be crucial in determining its biochemical consequences. Due to the high ionization density of the beta particles emitted by tritium (about 400 ion pairs/1/4m) possible interaction of tritium beta radiation with DNA may play a significant role. Tritiated water (HTO) is the main chemical form in which tritium is found in the environment. In the body it may be retained as organically bound tritium (OBT), binding to biological molecules or remaining as OBT with various degrees of solubility. OBT can be retained in the human body much longer than HTO and therefore the dose arising from OBT can reach 50% of the total tritium dose . Histones are major protein components of chromatin. They function as spools around which DNA winds and play an important role in the regulation of gene expression. In the absence of histones, the DNA in chromosomes would be unmanageably long, as human cells each have about 1.8 m of DNA. During mitosis, DNA is duplicated and condensed, resulting in about 120 1/4m of chromosomes. It was recently reported that the phosphorylation of histone H2AX on serine residue 139 (D 3 -H2AX) is associated with Double Strand Breaks (DSB) sites in DNA), which indicates the possibility of research based on the detection of DSBs in DNA. The phosphorylated megabase chromatin domain surrounding the DSB can be immunostained and visualized as discrete foci by fluorescence microscopy, as each DNA DSB formed produces a visible D 3 -H2AX focus. Since 1 Gy of radiation produces approximately 60 DSBs/cell, doses of a few mGy should be distinguishable from the background, and it was recently shown that the exposure to 1 mGy of X-rays induces

  11. Depletion of the type 1 IGF receptor delays repair of radiation-induced DNA double strand breaks

    International Nuclear Information System (INIS)

    Turney, Benjamin W.; Kerr, Martin; Chitnis, Meenali M.; Lodhia, Kunal; Wang, Yong; Riedemann, Johann; Rochester, Mark; Protheroe, Andrew S.; Brewster, Simon F.; Macaulay, Valentine M.

    2012-01-01

    Background and purpose: IGF-1R depletion sensitizes prostate cancer cells to ionizing radiation and DNA-damaging cytotoxic drugs. This study investigated the hypothesis that IGF-1R regulates DNA double strand break (DSB) repair. Methods: We tested effects of IGF-1R siRNA transfection on the repair of radiation-induced DSBs by immunoblotting and immunofluorescence for γH2AX, and pulsed-field gel electrophoresis. Homologous recombination (HR) was quantified by reporter assays, and cell cycle distribution by flow cytometry. Results: We confirmed that IGF-1R depletion sensitized DU145 and PC3 prostate cancer cells to ionizing radiation. DU145 control transfectants resolved radiation-induced DSBs within 24 h, while IGF-1R depleted cells contained 30–40% unrepaired breaks at 24 h. IGF-1R depletion induced significant reduction in DSB repair by HR, although the magnitude of the repair defect suggests additional contributory factors. Radiation-induced G2-M arrest was attenuated by IGF-1R depletion, potentially suppressing cell cycle-dependent processes required for HR. In contrast, IGF-1R depletion induced only minor radiosensitization in LNCaP cells, and did not influence repair. Cell cycle profiles were similar to DU145, so were unlikely to account for differences in repair responses. Conclusions: These data indicate a role for IGF-1R in DSB repair, at least in part via HR, and support use of IGF-1R inhibitors with DNA damaging cancer treatments.

  12. The Fanconi anemia group A protein modulates homologous repair of DNA double-strand breaks in mammalian cells.

    Science.gov (United States)

    Yang, Yun-Gui; Herceg, Zdenko; Nakanishi, Koji; Demuth, Ilja; Piccoli, Colette; Michelon, Jocelyne; Hildebrand, Gabriele; Jasin, Maria; Digweed, Martin; Wang, Zhao-Qi

    2005-10-01

    Fanconi anemia (FA) cells exhibit hypersensitivity to DNA interstrand cross-links (ICLs) and high levels of chromosome instability. FA gene products have been shown to functionally or physically interact with BRCA1, RAD51 and the MRE11/RAD50/NBS1 complex, suggesting that the FA complex may be involved in the repair of DNA double-strand breaks (DSBs). Here, we have investigated specifically the function of the FA group A protein (FANCA) in the repair of DSBs in mammalian cells. We show that the targeted deletion of Fanca exons 37-39 generates a null for Fanca in mice and abolishes ubiquitination of Fancd2, the downstream effector of the FA complex. Cells lacking Fanca exhibit increased chromosomal aberrations and attenuated accumulation of Brca1 and Rad51 foci in response to DNA damage. The absence of Fanca greatly reduces gene-targeting efficiency in mouse embryonic stem (ES) cells and compromises the survival of fibroblast cells in response to ICL agent treatment. Fanca-null cells exhibit compromised homology-directed repair (HDR) of DSBs, particularly affecting the single-strand annealing pathway. These data identify the Fanca protein as an integral component in the early step of HDR of DSBs and thereby minimizing the genomic instability.

  13. Altered Hematopoiesis in Mice Lacking DNA Polymerase μ Is Due to Inefficient Double-Strand Break Repair

    Science.gov (United States)

    Lucas, Daniel; Escudero, Beatriz; Ligos, José Manuel; Segovia, Jose Carlos; Estrada, Juan Camilo; Terrados, Gloria; Blanco, Luis; Samper, Enrique; Bernad, Antonio

    2009-01-01

    Polymerase mu (Polμ) is an error-prone, DNA-directed DNA polymerase that participates in non-homologous end-joining (NHEJ) repair. In vivo, Polμ deficiency results in impaired Vκ-Jκ recombination and altered somatic hypermutation and centroblast development. In Polμ−/− mice, hematopoietic development was defective in several peripheral and bone marrow (BM) cell populations, with about a 40% decrease in BM cell number that affected several hematopoietic lineages. Hematopoietic progenitors were reduced both in number and in expansion potential. The observed phenotype correlates with a reduced efficiency in DNA double-strand break (DSB) repair in hematopoietic tissue. Whole-body γ-irradiation revealed that Polμ also plays a role in DSB repair in non-hematopoietic tissues. Our results show that Polμ function is required for physiological hematopoietic development with an important role in maintaining early progenitor cell homeostasis and genetic stability in hematopoietic and non-hematopoietic tissues. PMID:19229323

  14. Depletion of the type 1 IGF receptor delays repair of radiation-induced DNA double strand breaks.

    Science.gov (United States)

    Turney, Benjamin W; Kerr, Martin; Chitnis, Meenali M; Lodhia, Kunal; Wang, Yong; Riedemann, Johann; Rochester, Mark; Protheroe, Andrew S; Brewster, Simon F; Macaulay, Valentine M

    2012-06-01

    IGF-1R depletion sensitizes prostate cancer cells to ionizing radiation and DNA-damaging cytotoxic drugs. This study investigated the hypothesis that IGF-1R regulates DNA double strand break (DSB) repair. We tested effects of IGF-1R siRNA transfection on the repair of radiation-induced DSBs by immunoblotting and immunofluorescence for γH2AX, and pulsed-field gel electrophoresis. Homologous recombination (HR) was quantified by reporter assays, and cell cycle distribution by flow cytometry. We confirmed that IGF-1R depletion sensitized DU145 and PC3 prostate cancer cells to ionizing radiation. DU145 control transfectants resolved radiation-induced DSBs within 24 h, while IGF-1R depleted cells contained 30-40% unrepaired breaks at 24 h. IGF-1R depletion induced significant reduction in DSB repair by HR, although the magnitude of the repair defect suggests additional contributory factors. Radiation-induced G2-M arrest was attenuated by IGF-1R depletion, potentially suppressing cell cycle-dependent processes required for HR. In contrast, IGF-1R depletion induced only minor radiosensitization in LNCaP cells, and did not influence repair. Cell cycle profiles were similar to DU145, so were unlikely to account for differences in repair responses. These data indicate a role for IGF-1R in DSB repair, at least in part via HR, and support use of IGF-1R inhibitors with DNA damaging cancer treatments. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  15. TU-H-CAMPUS-TeP2-04: Measurement of Stereotactic Output Factors with DNA Double-Strand Breaks

    Energy Technology Data Exchange (ETDEWEB)

    Cline, K; Obeidat, M; Stathakis, S; Kabat, C; Markovic, M; Papanikolaou, N; Rasmussen, K; Gutierrez, A; Ha, C; Lee, S; Shim, E; Kirby, N [University of Texas HSC SA, San Antonio, TX (United States)

    2016-06-15

    Purpose: Radiotherapy treatment is specified by radiation dose prescriptions, but biological DNA damage actually controls treatment effectiveness. It is impractical to directly measure dose in the clinic, so we measure quantities, such as collected charge, and calculate the relationship to dose. At small fields, such as those in stereotactic radiosurgery (SRS), charged-particle equilibrium (CPE) breaks down and the accuracy of the measurement for delivered dose decreases. By measuring DNA double-strand breaks (DSB) directly, we believe treatment accuracy could improve by providing a more meaningful measurement. Methods: A DNA dosimeter, consisting of magnetic streptavidin beads attached to 4 kilobase pair DNA strands labeled with biotin and fluorescein amidite (FAM) on opposing ends, was suspended in phosphate-buffered saline (PBS). Twenty µL samples were placed in plastic micro-capillary tubes inside a water tank setup and irradiated with 10 cm, 3 cm, 1.25 cm, 0.75 cm, and 0.5 cm radiation field sizes, where the three smallest sizes were cones. After irradiation, the dosimeters were mechanically separated into beads (intact DNA) and supernatant (broken DNA/FAM) using a magnet. The fluorescence was read and the probability of DSB was calculated. This was used to calculate the output factor for an SRS beam and compared to that measured using a diode detector. Results: The output factors relative to a 10 cm field were 0.89±0.07, 0.76±0.08, 0.59±0.04, and 0.78±0.12 for the field sizes of 3 cm, 1.25 cm, 0.75 cm, and 0.5 cm, respectively. Some of the diode measurements do not fall within these uncertainties. Conclusion: This was the first attempt to measure output factors in a water tank with the DNA dosimeter. Although differences compared to the diode were observed, the uncertainty analysis ignored systematic errors. For future work, we will repeat this experiment to quantify and correct systematic errors, such as those caused by positional alignment and sample

  16. Oncogenic ras-driven cancer cell vesiculation leads to emission of double-stranded DNA capable of interacting with target cells

    International Nuclear Information System (INIS)

    Lee, Tae Hoon; Chennakrishnaiah, Shilpa; Audemard, Eric; Montermini, Laura; Meehan, Brian; Rak, Janusz

    2014-01-01

    Highlights: • Oncogenic H-ras stimulates emission of extracellular vesicles containing double-stranded DNA. • Vesicle-associated extracellular DNA contains mutant N-ras sequences. • Vesicles mediate intercellular transfer of mutant H-ras DNA to normal fibroblasts where it remains for several weeks. • Fibroblasts exposed to vesicles containing H-ras DNA exhibit increased proliferation. - Abstract: Cell free DNA is often regarded as a source of genetic cancer biomarkers, but the related mechanisms of DNA release, composition and biological activity remain unclear. Here we show that rat epithelial cell transformation by the human H-ras oncogene leads to an increase in production of small, exosomal-like extracellular vesicles by viable cancer cells. These EVs contain chromatin-associated double-stranded DNA fragments covering the entire host genome, including full-length H-ras. Oncogenic N-ras and SV40LT sequences were also found in EVs emitted from spontaneous mouse brain tumor cells. Disruption of acidic sphingomyelinase and the p53/Rb pathway did not block emission of EV-related oncogenic DNA. Exposure of non-transformed RAT-1 cells to EVs containing mutant H-ras DNA led to the uptake and retention of this material for an extended (30 days) but transient period of time, and stimulated cell proliferation. Thus, our study suggests that H-ras-mediated transformation stimulates vesicular emission of this histone-bound oncogene, which may interact with non-transformed cells

  17. Oncogenic ras-driven cancer cell vesiculation leads to emission of double-stranded DNA capable of interacting with target cells

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Tae Hoon; Chennakrishnaiah, Shilpa [Montreal Children’s Hospital, Research Institute of McGill University Health Centre, McGill University, Montreal, Quebec (Canada); Audemard, Eric [McGill University and Genome Quebec Innovation Centre, Montreal, Quebec (Canada); Montermini, Laura; Meehan, Brian [Montreal Children’s Hospital, Research Institute of McGill University Health Centre, McGill University, Montreal, Quebec (Canada); Rak, Janusz, E-mail: janusz.rak@mcgill.ca [Montreal Children’s Hospital, Research Institute of McGill University Health Centre, McGill University, Montreal, Quebec (Canada)

    2014-08-22

    Highlights: • Oncogenic H-ras stimulates emission of extracellular vesicles containing double-stranded DNA. • Vesicle-associated extracellular DNA contains mutant N-ras sequences. • Vesicles mediate intercellular transfer of mutant H-ras DNA to normal fibroblasts where it remains for several weeks. • Fibroblasts exposed to vesicles containing H-ras DNA exhibit increased proliferation. - Abstract: Cell free DNA is often regarded as a source of genetic cancer biomarkers, but the related mechanisms of DNA release, composition and biological activity remain unclear. Here we show that rat epithelial cell transformation by the human H-ras oncogene leads to an increase in production of small, exosomal-like extracellular vesicles by viable cancer cells. These EVs contain chromatin-associated double-stranded DNA fragments covering the entire host genome, including full-length H-ras. Oncogenic N-ras and SV40LT sequences were also found in EVs emitted from spontaneous mouse brain tumor cells. Disruption of acidic sphingomyelinase and the p53/Rb pathway did not block emission of EV-related oncogenic DNA. Exposure of non-transformed RAT-1 cells to EVs containing mutant H-ras DNA led to the uptake and retention of this material for an extended (30 days) but transient period of time, and stimulated cell proliferation. Thus, our study suggests that H-ras-mediated transformation stimulates vesicular emission of this histone-bound oncogene, which may interact with non-transformed cells.

  18. Investigation on accordance of DNA double-strand break of blood between in vivo and in vitro irradiation using single cell gel electrophoresis

    International Nuclear Information System (INIS)

    Liu Qiang; Jiang Enhai; Li Jin; Tang Weisheng; Wang Zhiquan; Zhao Yongcheng; Fan Feiyue

    2006-01-01

    Objective: To observe the consistency of DNA double-strand break between in vivo and in vitro irradiation, as a prophase study in radiation biodosimetry using single cell gel electrophoresis (SCGE). Methods: Detect DNA double-strand break after whole-body and in vitro radiation in mice lymphocytes using neutral single cell gel electrophoresis. The comet images were processed by CASP software and all the data were analysed by SPSS12.0. Results: There is no difference between in vivo and in vitro irradiation group in HDNA%, TDNA%, CL, TL, TM and OTM. Conclusion: The result of neutral single cell gel electrophoresis shortly after in vitro irradiation can precisely reflect the DNA double-strand break of lymphocytes in whole-body irradiation. (authors)

  19. Efficient Double Fragmentation ChIP-seq Provides Nucleotide Resolution Protein-DNA Binding Profiles

    NARCIS (Netherlands)

    Mokry, Michal; Hatzis, Pantelis; de Bruijn, Ewart; Koster, Jan; Versteeg, Rogier; Schuijers, Jurian; van de Wetering, Marc; Guryev, Victor; Clevers, Hans; Cuppen, Edwin

    2010-01-01

    Immunoprecipitated crosslinked protein-DNA fragments typically range in size from several hundred to several thousand base pairs, with a significant part of chromatin being much longer than the optimal length for next-generation sequencing (NGS) procedures. Because these larger fragments may be

  20. Assembly of Liposomes Controlled by Triple Helix Formation

    DEFF Research Database (Denmark)

    Vogel, Stefan; Jakobsen, Ulla

    2013-01-01

    Attachment of DNA to the surface of different solid nanoparticles (e.g. gold- and silica nanoparticles) is well established and a number of DNA-modified solid nanoparticle systems have been applied to thermal denaturation analysis of oligonucleotides. We report herein the non-covalent immobilizat...... analysis (NTA) and dynamic light scattering (DLS) show independently from ultraviolet spectroscopy experiments the formation of liposome aggregates.......-covalent immobilization of oligonucleotides on the surface of soft nanoparticles (e.g. liposomes) and the subsequent controlled assembly by DNA triple helix formation. The non-covalent approach avoids tedious surface chemistry and necessary purification procedures and can simplify and extend the available methodology...... sequences (G or C-rich) to explore the applicability of the method for different triple helical assembly modes. We demonstrate advantages and limitations of the approach and proof the reversible and reproducible formation of liposome aggregates during thermal denaturation cycles. Nanoparticle tracking...

  1. Coexposure to benzo[a]pyrene plus UVA induced DNA double strand breaks: visualization of Ku assembly in the nucleus having DNA lesions

    International Nuclear Information System (INIS)

    Toyooka, Tatsushi; Ibuki, Yuko; Koike, Manabu; Ohashi, Norio; Takahashi, Sentaro; Goto, Rensuke

    2004-01-01

    Benzo[a]pyrene (BaP) is a ubiquitous environmental pollutant with potential carcinogenicity. It has been shown that BaP, upon UVA irradiation, synergistically induced oxidative DNA damage, but other DNA damage was not confirmed. In this study, we examined whether coexposure to BaP plus UVA induces double strand breaks (DSBs) using xrs-5 cells, deficient in the repair of DSBs (Ku80 mutant), and whether Ku translocates involving the formation of DSBs. BaP plus UVA had a significant cytotoxic effect on CHO-K1 cells and an even more drastic effect on Ku80-deficient, xrs-5 cells, suggesting that the DSBs were generated by coexposure to BaP plus UVA. The DSBs were repaired in CHO-K1 cells within 30 min, but not in xrs-5 cells, indicating the involvement of a non-homologous end joining, which needs Ku proteins. Furthermore, we succeeded in visualizing that Ku80 rapidly assembled to the exposed region, in which DSBs might be generated, and clarified that the presence of both Ku70 and Ku80 was important for their accumulation

  2. X-ray-induced DNA double-strand breaks after angiographic examinations of different anatomic regions; Strahleninduzierte DNA-Doppelstrangbrueche nach Angiografien verschiedener Koerperregionen

    Energy Technology Data Exchange (ETDEWEB)

    Kuefner, M.A.; Schwab, S.A.; Azoulay, S.; Heckmann, M.; Heinrich, M.C.; Uder, M. [Universitaetsklinikum Erlangen (Germany). Radiologisches Inst.; Grudzenski, S.; Lobrich, M. [Technische Univ. Darmstadt (Germany). Strahlenbiologie und DNA-Reparatur

    2009-04-15

    Purpose: The aim of this study was to investigate DNA double-strand breaks (DSBs) in blood lymphocytes as markers of the biological radiation effects in angiography patients. Materials and Methods: The method is based on the phosphorylation of the histone variant H 2AX ({gamma}-H2AX) after formation of DSBs. Blood samples were collected before and up to 24 hours after exposure of 31 patients undergoing angiographies of different body regions. Blood lymphocytes were isolated, fixed, and stained with a specific {gamma}-H2AX antibody. Distinct foci representing DSBs were enumerated using fluorescence microscopy. Additional in-vitro experiments (10 - 100 mGy) were performed for evaluation of DBS repair. Results: 15 minutes after the end of fluoroscopy values between 0.01 and 1.50 DSBs per cell were obtained. The DNA damage level normalized to the dose area product was 0.099 (cardiac angiographies), 0.053 (abdominal angiographies), 0.023 (pelvic/leg angiographies) and 0.004 excess foci/cell/mGym{sup 2} (cerebrovascular angiographies). A linear correlation was found between {gamma}-H2AX foci levels and the dose area product (abdomen: R2 = 0.96; pelvis/legs: R2 = 0.71). In-vivo on average 46 % of DSBs disappeared within 1 hour and 70 % within 2.5 hours. Conclusion: {gamma}-H2AX immunofluorescence microscopy is a sensitive and reliable method for the determination of X-ray-induced DSBs during angiography. The DNA damage level depends on the dose, the exposed anatomic region, and the duration/fractionation of the X-ray exposure. (orig.)

  3. DNA double strand breaks but not interstrand crosslinks prevent progress through meiosis in fully grown mouse oocytes.

    Directory of Open Access Journals (Sweden)

    Wai Shan Yuen

    Full Text Available There is some interest in how mammalian oocytes respond to different types of DNA damage because of the increasing expectation of fertility preservation in women undergoing chemotherapy. Double strand breaks (DSBs induced by ionizing radiation and agents such as neocarzinostatin (NCS, and interstrand crosslinks (ICLs induced by alkylating agents such as mitomycin C (MMC, are toxic DNA lesions that need to be repaired for cell survival. Here we examined the effects of NCS and MMC treatment on oocytes collected from antral follicles in mice, because potentially such oocytes are readily collected from ovaries and do not need to be in vitro grown to achieve meiotic competency. We found that oocytes were sensitive to NCS, such that this ionizing radiation mimetic blocked meiosis I and caused fragmented DNA. In contrast, MMC had no impact on the completion of either meiosis I or II, even at extremely high doses. However, oocytes treated with MMC did show γ-H2AX foci and following their in vitro maturation and parthenogenetic activation the development of the subsequent embryos was severely compromised. Addition of MMC to 1-cell embryos caused a similarly poor level of development, demonstrating oocytes have eventual sensitivity to this ICL-inducing agent but this does not occur during their meiotic division. In oocytes, the association of Fanconi Anemia protein, FANCD2, with sites of ICL lesions was not apparent until entry into the embryonic cell cycle. In conclusion, meiotic maturation of oocytes is sensitive to DSBs but not ICLs. The ability of oocytes to tolerate severe ICL damage and yet complete meiosis, means that this type of DNA lesion goes unrepaired in oocytes but impacts on subsequent embryo quality.

  4. Cell lines derived from a Medaka radiation-sensitive mutant have defects in DNA double-strand break responses

    International Nuclear Information System (INIS)

    Hidaka, Masayuki; Oda, Shoji; Mitani, Hiroshi; Kuwahara, Yoshikazu; Fukumoto, Manabu

    2010-01-01

    It was reported that the radiation-sensitive Medaka mutant 'ric1' has a defect in the repair of DNA double-strand breaks (DSBs) induced by γ-rays during early embryogenesis. To study the cellular response of a ric1 mutant to ionizing radiation (IR), we established the mutant embryonic cell lines RIC1-e9, RIC1-e42, RIC1-e43. Following exposure to γ-irradiation, the DSBs in wild-type cells were repaired within 1 h, while those in RIC1 cells were not rejoined even after 2 h. Cell death was induced in the wild-type cells with cell fragmentation, but only a small proportion of the RIC1 cells underwent cell death, and without cell fragmentation. Although both wild-type and RIC1 cells showed mitotic inhibition immediately after γ-irradiation, cell division was much slower to resume in the wild-type cells (20 h versus 12 h). In both wild-type and RIC1 cells, Ser139 phosphorylated H2AX (γH2AX) foci were formed after γ-irradiation, however, the γH2AX foci disappeared more quickly in the RIC1 cell lines. These results suggest that the instability of γH2AX foci in RIC1 cells cause an aberration of the DNA damage response. As RIC1 cultured cells showed similar defective DNA repair as ric1 embryos and RIC1 cells revealed defective cell death and cell cycle checkpoint, they are useful for investigating DNA damage responses in vitro. (author)

  5. Xrcc1-dependent and Ku-dependent DNA double-strand break repair kinetics in Arabidopsis plants.

    Science.gov (United States)

    Charbonnel, Cyril; Gallego, Maria E; White, Charles I

    2010-10-01

    Double-strand breakage (DSB) of DNA involves loss of information on the two strands of the DNA fibre and thus cannot be repaired by simple copying of the complementary strand which is possible with single-strand DNA damage. Homologous recombination (HR) can precisely repair DSB using another copy of the genome as template and non-homologous recombination (NHR) permits repair of DSB with little or no dependence on DNA sequence homology. In addition to the well-characterised Ku-dependent non-homologous end-joining (NHEJ) pathway, much recent attention has been focused on Ku-independent NHR. The complex interrelationships and regulation of NHR pathways remain poorly understood, even more so in the case of plants, and we present here an analysis of Ku-dependent and Ku-independent repair of DSB in Arabidopsis thaliana. We have characterised an Arabidopsis xrcc1 mutant and developed quantitative analysis of the kinetics of appearance and loss of γ-H2AX foci as a tool to measure DSB repair in dividing root tip cells of γ-irradiated plants in vivo. This approach has permitted determination of DSB repair kinetics in planta following a short pulse of γ-irradiation, establishing the existence of a Ku-independent, Xrcc1-dependent DSB repair pathway. Furthermore, our data show a role for Ku80 during the first minutes post-irradiation and that Xrcc1 also plays such a role, but only in the absence of Ku. The importance of Xrcc1 is, however, clearly visible at later times in the presence of Ku, showing that alternative end-joining plays an important role in DSB repair even in the presence of active NHEJ. © 2010 The Authors. Journal compilation © 2010 Blackwell Publishing Ltd.

  6. DNA repair in modeled microgravity: Double strand break rejoining activity in human lymphocytes irradiated with γ-rays

    International Nuclear Information System (INIS)

    Mognato, Maddalena; Girardi, Cristina; Fabris, Sonia; Celotti, Lucia

    2009-01-01

    Cell response to ionising radiation depends, besides on genetic and physiological features of the biological systems, on environmental conditions occurring during DNA repair. Many data showed that microgravity, experienced by astronauts during space flights or modeled on Earth, causes apoptosis, cytoskeletal alteration, cell growth inhibition, increased frequency of mutations and chromosome aberrations. In this study, we analysed the progression of the rejoining of double strand breaks (DSBs) in human peripheral blood lymphocytes (PBLs) irradiated with γ-rays and incubated in static condition (1g) or in modeled microgravity (MMG). γ-H2AX foci formation and disappearance, monitored during the repair incubation, showed that the kinetics of DSBs rejoining was different in the two gravity conditions. The fraction of foci-positive cells decreased slower in MMG than in 1g at 6 and 24 h after irradiation (P < 0.01) and the mean number of γ-H2AX foci per nucleus was significantly higher in MMG than in 1g at the same time-points (P < 0.001). In the same samples we determined apoptotic level and the rate of DSB rejoining during post-irradiation incubation. A significant induction of apoptosis was observed in MMG at 24 h after irradiation (P < 0.001), whereas at shorter times the level of apoptosis was slightly higher in MMG respect to 1g. In accordance with the kinetics of γ-H2AX foci, the slower rejoining of radiation-induced DSBs in MMG was observed by DNA fragmentation analyses during the repair incubation; the data of pulsed-field gel electrophoresis assay showed that the fraction of DNA released in the gel was significantly higher in PBL incubated in MMG after irradiation with respect to cells maintained in 1g. Our results provide evidences that MMG incubation during DNA repair delayed the rate of radiation-induced DSB rejoining, and increased, as a consequence, the genotoxic effects of ionising radiation.

  7. DNA repair in modeled microgravity: Double strand break rejoining activity in human lymphocytes irradiated with {gamma}-rays

    Energy Technology Data Exchange (ETDEWEB)

    Mognato, Maddalena, E-mail: maddalena.mognato@unipd.it [Dipartimento di Biologia, Universita di Padova, via U. Bassi 58 B, 35121 Padova (Italy); Girardi, Cristina; Fabris, Sonia [Dipartimento di Biologia, Universita di Padova, via U. Bassi 58 B, 35121 Padova (Italy); Celotti, Lucia [Dipartimento di Biologia, Universita di Padova, via U. Bassi 58 B, 35121 Padova (Italy); Laboratori Nazionali di Legnaro, INFN, Padova (Italy)

    2009-04-26

    Cell response to ionising radiation depends, besides on genetic and physiological features of the biological systems, on environmental conditions occurring during DNA repair. Many data showed that microgravity, experienced by astronauts during space flights or modeled on Earth, causes apoptosis, cytoskeletal alteration, cell growth inhibition, increased frequency of mutations and chromosome aberrations. In this study, we analysed the progression of the rejoining of double strand breaks (DSBs) in human peripheral blood lymphocytes (PBLs) irradiated with {gamma}-rays and incubated in static condition (1g) or in modeled microgravity (MMG). {gamma}-H2AX foci formation and disappearance, monitored during the repair incubation, showed that the kinetics of DSBs rejoining was different in the two gravity conditions. The fraction of foci-positive cells decreased slower in MMG than in 1g at 6 and 24 h after irradiation (P < 0.01) and the mean number of {gamma}-H2AX foci per nucleus was significantly higher in MMG than in 1g at the same time-points (P < 0.001). In the same samples we determined apoptotic level and the rate of DSB rejoining during post-irradiation incubation. A significant induction of apoptosis was observed in MMG at 24 h after irradiation (P < 0.001), whereas at shorter times the level of apoptosis was slightly higher in MMG respect to 1g. In accordance with the kinetics of {gamma}-H2AX foci, the slower rejoining of radiation-induced DSBs in MMG was observed by DNA fragmentation analyses during the repair incubation; the data of pulsed-field gel electrophoresis assay showed that the fraction of DNA released in the gel was significantly higher in PBL incubated in MMG after irradiation with respect to cells maintained in 1g. Our results provide evidences that MMG incubation during DNA repair delayed the rate of radiation-induced DSB rejoining, and increased, as a consequence, the genotoxic effects of ionising radiation.

  8. The C-Terminal RpoN Domain of sigma54 Forms an unpredictedHelix-Turn-Helix Motif Similar to domains of sigma70

    Energy Technology Data Exchange (ETDEWEB)

    Doucleff, Michaeleen; Malak, Lawrence T.; Pelton, Jeffrey G.; Wemmer, David E.

    2005-11-01

    The ''{delta}'' subunit of prokaryotic RNA-polymerase allows gene-specific transcription initiation. Two {sigma} families have been identified, {sigma}{sup 70} and {sigma}{sup 54}, which use distinct mechanisms to initiate transcription and share no detectable sequence homology. Although the {sigma}{sup 70}-type factors have been well characterized structurally by x-ray crystallography, no high-resolution structural information is available for the {sigma}{sup 54}-type factors. Here we present the NMR derived structure of the C-terminal domain of {sigma}{sup 54} from Aquifex aeolicus. This domain (Thr323 to Gly389), which contains the highly conserved RpoN box sequence, consists of a poorly structured N-terminal tail followed by a three-helix bundle, which is surprisingly similar to domains of the {sigma}{sup 70}-type proteins. Residues of the RpoN box, which have previously been shown to be critical for DNA binding, form the second helix of an unpredicted helix-turn-helix motif. This structure's homology with other DNA binding proteins, combined with previous biochemical data, suggest how the C-terminal domain of {sigma}{sup 54} binds to DNA.

  9. Forced evolution of a regulatory RNA helix in the HIV-1 genome

    NARCIS (Netherlands)

    Berkhout, B.; Klaver, B.; Das, A. T.

    1997-01-01

    The 5'and 3'end of the HIV-1 RNA genome forms a repeat (R) element that encodes a double stem-loop structure (the TAR and polyA hairpins). Phylogenetic analysis of the polyA hairpin in different human and simian immunodeficiency viruses suggests that the thermodynamic stability of the helix is

  10. Helix-Hopes on Finite Hyperfields

    Directory of Open Access Journals (Sweden)

    Thomas Vougiouklis

    2016-12-01

    Full Text Available Hyperstructure theory can overcome restrictions which ordinary algebraic structures have. A hyperproduct on non-square ordinary matrices can be defined by using the so called helix-hyperoperations. We study the helix-hyperstructures on the representations using ordinary fields. The related theory can be faced by defining the hyperproduct on the set of non square matrices. The main tools of the Hyperstructure Theory are the fundamental relations which connect the largest class of hyperstructures, the Hv-structures, with the corresponding classical ones. We focus on finite dimensional helix-hyperstructures and on small Hv-fields, as well.

  11. Effects of 3-Deoxyadenosine (Cordycepin) on the repair of X-ray-induced DNA single- and double-strand breaks in chinese hamster V79 cells

    International Nuclear Information System (INIS)

    Hiraoka, Wakako; Kuwabara, Mikinori; Sato, Fumiaki

    1990-01-01

    The ability of cordycepin to inhibit the repair of DNA strand breaks was examined with X-irradiated Chinese hamster V79 cells in log-phase culture. A filter elution technique revealed that 70 μM cordycepin did not inhibit the repair of single-strand breaks but inhibited the repair of double-strand breaks. These findings confirmed the fact that the increase in the lethality of cordycepin in X-irradiated cultured mammalian cells was attributable to unrepaired DNA double-strand breaks. (author)

  12. Un-repairable DNA damage in cell due to irradiation

    International Nuclear Information System (INIS)

    Yoshii, Giichi

    1992-01-01

    Radiation-induced cell reproductive deactivation is caused by damage to DNA. In a cell, cellular DNA radical reacts with diffusion controlled rate and generates DNA peroxide radical. The chemical repair of DNA radical with hydrogen donation by thiol competes with the reaction of oxygen with same radicals in the DNA molecules. From the point reaction rates, the prolongation of radical life time is not as great as expected from the reduction in the glutathione content of the cell. This indicates that further reducting compounds (protein bound thiol) are present in the cell. The residual radicals are altered to strand breaks, base damages and so on. The effective lesions for a number of endpoints is un-repaired double strand break, which has been discovered in a cluster. This event gives risk to high LET radiation or to a track end of X-rays. For X- or electron irradiations the strand breaks are frequently induced by the interactions between sublesions on two strands in DNA. A single strand break followed by radical action may be unstable excited state, because of remaining sugar radical action and of having negative charged phosphates, in which strands breaks will be rejoined in a short time to stable state. On the same time, a break in the double helix will be immediately produced if two breaks are on either or approximately opposite locations. The formation of a double strand break in the helix depends on the ion strength of the cell. The potassium ions are largely released from polyanionic strand during irradiation, which results in the induction of denatured region. Double strand break with the denatured region seems to be un-repairable DNA damage. (author)

  13. Unfolding four-helix bundles

    Science.gov (United States)

    Gray, Harry B.; Winkler, Jay R.; Kozak, John J.

    2011-03-01

    A geometrical model has been developed to describe the early stages of unfolding of cytochromes c‧ and c-b562 . Calculations are based on a step-wise extension of the polypeptide chain subject to the constraint that the spatial relationship among the residues of each triplet is fixed by the native-state crystallographic data. The response of each protein to these structural perturbations allows the evolution of each of the four helices in these two proteins to be differentiated. It is found that the two external helices in c‧ unfold before its two internal helices, whereas exactly the opposite behaviour is demonstrated by c-b562 . Each of these cytochromes has an extended, internal, non-helical ('turning') region that initially lags behind the most labile helix but then, at a certain stage (identified for each cytochrome), unravels before any of the four helices present in the native structure. It is believed that these predictions will be useful in guiding future experimental studies on the unfolding of these two cytochromes.

  14. Comparison between pulsed-field and constant-field gel electrophoresis for measurement of DNA double-strand breaks in irradiated Chinese hamster ovary cells

    International Nuclear Information System (INIS)

    Wlodek, D.; Banath, J.; Olive, P.L.

    1991-01-01

    Pulsed-field gel electrophoresis (PFGE) is one of the most sensitive methods for detecting DNA double-strand breaks in mammalian cells. However, it has been observed that constant-field gel electrophoresis (CFGE), when optimized, can detect breaks with equal efficiency. The migration of DNA from the well and the separation of DNA molecules according to size appear to be different processes; only the latter requires the application of PFGE. CFGE is very sensitive and can detect DNA damage produced by less than 5Gy of radiation. Low voltage (ca.0.6V/cm) during electrophoresis appears to be essential for the migration of the largest fraction of DNA from the agarose plug containing the cells; the electrophoresis run time, cell density in the plug, agarose concentration, nature of detergent and extent of radiolabelling are less important. It is concluded that CFGE is equally sensitive but more rapid and economical than PFGE for the measurement of DNA damage. (author)

  15. Modulation of the Singlet Oxygen Generation from the Double Strand DNA-SYBR Green I Complex Mediated by T-Melamine-T Mismatch for Visual Detection of Melamine.

    Science.gov (United States)

    Hu, Hao; Zhang, Jinyi; Ding, Yu; Zhang, Xinfeng; Xu, Kailai; Hou, Xiandeng; Wu, Peng

    2017-05-02

    Singlet oxygen ( 1 O 2 ), generated via photosensitization, has been proved to oxidize chromogenic substrates with neither H 2 O 2 oxidation nor enzyme (horseradish peroxidase, HRP) catalysis. Of the various methods for modulation of the 1 O 2 generation, DNA-controlled photosensitization received great attention. Therefore, integration of the formation/deformation DNA structures with DNA-controlled photosensitization will be extremely appealing in visual biosensor developments. Here, the stable melamine-thymine complex was explored in combination with DNA-controlled photosensitization for visual detection of melamine. A T-rich single stand DNA was utilized as the recognition unit. Upon the formation of the T-M-T complex, double stand DNA was formed, which was ready for the binding of SYBR Green I and activated the photosensitization. Subsequent oxidation of TMB allowed visual detection of melamine in dairy products, with spike-recoveries ranging from 94% to 106%.

  16. Influence of XRCC1 Genetic Polymorphisms on Ionizing Radiation-Induced DNA Damage and Repair

    Directory of Open Access Journals (Sweden)

    Silvia Sterpone

    2010-01-01

    Full Text Available It is well known that ionizing radiation (IR can damage DNA through a direct action, producing single- and double-strand breaks on DNA double helix, as well as an indirect effect by generating oxygen reactive species in the cells. Mammals have evolved several and distinct DNA repair pathways in order to maintain genomic stability and avoid tumour cell transformation. This review reports important data showing a huge interindividual variability on sensitivity to IR and in susceptibility to developing cancer; this variability is principally represented by genetic polymorphisms, that is, DNA repair gene polymorphisms. In particular we have focussed on single nucleotide polymorphisms (SNPs of XRCC1, a gene that encodes for a scaffold protein involved basically in Base Excision Repair (BER. In this paper we have reported and presented recent studies that show an influence of XRCC1 variants on DNA repair capacity and susceptibility to breast cancer.

  17. Influence of XRCC1 Genetic Polymorphisms on Ionizing Radiation-Induced DNA Damage and Repair.

    Science.gov (United States)

    Sterpone, Silvia; Cozzi, Renata

    2010-07-25

    It is well known that ionizing radiation (IR) can damage DNA through a direct action, producing single- and double-strand breaks on DNA double helix, as well as an indirect effect by generating oxygen reactive species in the cells. Mammals have evolved several and distinct DNA repair pathways in order to maintain genomic stability and avoid tumour cell transformation. This review reports important data showing a huge interindividual variability on sensitivity to IR and in susceptibility to developing cancer; this variability is principally represented by genetic polymorphisms, that is, DNA repair gene polymorphisms. In particular we have focussed on single nucleotide polymorphisms (SNPs) of XRCC1, a gene that encodes for a scaffold protein involved basically in Base Excision Repair (BER). In this paper we have reported and presented recent studies that show an influence of XRCC1 variants on DNA repair capacity and susceptibility to breast cancer.

  18. DNA double-strand breaks induced by cavitational mechanical effects of ultrasound in cancer cell lines.

    Directory of Open Access Journals (Sweden)

    Yukihiro Furusawa

    Full Text Available Ultrasonic technologies pervade the medical field: as a long established imaging modality in clinical diagnostics; and, with the emergence of targeted high intensity focused ultrasound, as a means of thermally ablating tumours. In parallel, the potential of [non-thermal] intermediate intensity ultrasound as a minimally invasive therapy is also being rigorously assessed. Here, induction of apoptosis in cancer cells has been observed, although definitive identification of the underlying mechanism has thus far remained elusive. A likely candidate process has been suggested to involve sonochemical activity, where reactive oxygen species (ROS mediate the generation of DNA single-strand breaks. Here however, we provide compelling new evidence that strongly supports a purely mechanical mechanism. Moreover, by a combination of specific assays (neutral comet tail and staining for γH2AX foci formation we demonstrate for the first time that US exposure at even moderate intensities exhibits genotoxic potential, through its facility to generate DNA damage across multiple cancer lines. Notably, colocalization assays highlight that ionizing radiation and ultrasound have distinctly different signatures to their respective γH2AX foci formation patterns, likely reflecting the different stress distributions that initiated damage formation. Furthermore, parallel immuno-blotting suggests that DNA-PKcs have a preferential role in the repair of ultrasound-induced damage.

  19. Application of laser-accelerated protons to the demonstration of DNA double-strand breaks in human cancer cells

    Science.gov (United States)

    Yogo, A.; Sato, K.; Nishikino, M.; Mori, M.; Teshima, T.; Numasaki, H.; Murakami, M.; Demizu, Y.; Akagi, S.; Nagayama, S.; Ogura, K.; Sagisaka, A.; Orimo, S.; Nishiuchi, M.; Pirozhkov, A. S.; Ikegami, M.; Tampo, M.; Sakaki, H.; Suzuki, M.; Daito, I.; Oishi, Y.; Sugiyama, H.; Kiriyama, H.; Okada, H.; Kanazawa, S.; Kondo, S.; Shimomura, T.; Nakai, Y.; Tanoue, M.; Sasao, H.; Wakai, D.; Bolton, P. R.; Daido, H.

    2009-05-01

    We report the demonstrated irradiation effect of laser-accelerated protons on human cancer cells. In vitro (living) A549 cells are irradiated with quasimonoenergetic proton bunches of 0.8-2.4 MeV with a single bunch duration of 15 ns. Irradiation with the proton dose of 20 Gy results in a distinct formation of γ-H2AX foci as an indicator of DNA double-strand breaks generated in the cancer cells. This is a pioneering result that points to future investigations of the radiobiological effects of laser-driven ion beams. Unique high-current and short-bunch features make laser-driven proton bunches an excitation source for time-resolved determination of radical yields.

  20. Cytotoxicity of 125I decay in the DNA double strand break repair deficient mutant cell line, xrs-5

    International Nuclear Information System (INIS)

    Yasui, L.S.

    1992-01-01

    Survival of parental Chinese hamster ovary (CHO) K1 cells and the DNA double strand break (DSB) repair deficient mutant, xrs-5 was determined after accumulation of 125 I decays. Both CHO and xrs-5 cells were extremely sensitive to accumulated 125 I decays. D o values for CHO and xrs-5 cells were 40 and approximately 7 decays per cell, respectively. Difference in cell survival between CHO and xrs-5 cells was not due to differences in overall 125 IUdR incorporation, differences in labelling index (LI) or differences in plating efficiency (PE). Relative biological effectiveness (RBE) values calculated relative to 137 Cs gamma radiation survival values (D o and D 10 ) were higher in xrs-5 cells compared with CHO cells, although both CHO and xrs-5 cells have high RBE values that correspond to a high sensitivity of CHO and xrs-5 cells to 125 I decay. (Author)

  1. Charge Migration in DNA Perspectives from Physics, Chemistry, and Biology

    CERN Document Server

    Chakraborty, Tapash

    2007-01-01

    Charge migration through DNA has been the focus of considerable interest in recent years. A deeper understanding of the nature of charge transfer and transport along the double helix is important in fields as diverse as physics, chemistry and nanotechnology. It has also important implications in biology, in particular in DNA damage and repair. This book presents contributions from an international team of researchers active in this field. It contains a wide range of topics that includes the mathematical background of the quantum processes involved, the role of charge transfer in DNA radiation damage, a new approach to DNA sequencing, DNA photonics, and many others. This book should be of value to researchers in condensed matter physics, chemical physics, physical chemistry, and nanoscale sciences.

  2. Teaching helix and problems connected with helix using GeoGebra

    Science.gov (United States)

    Bímová, Daniela

    2017-12-01

    The contribution presents the dynamic applets created in GeoGebra that show the origin and main properties of a helix and it also presents some constructive problems connected with the helix. There are created the step by step algorithms of some constructions in the chosen applets. Three-dimensional applets include illustrative helix samples and spatial animations that help students better see problems concerning the helix spatially. There is mentioned the website in the contribution on which there is situated GeoGebra book dedicated to the topic "Helix" and containing the mentioned applets. The created applets and materials of the GeoGebra book "Helix" help in teaching and studying the course Constructive Geometry determined for the students of the Faculty of Mechanical Engineering of the Technical University of Liberec.

  3. Photoluminescence Enhancement of Poly(3-methylthiophene Nanowires upon Length Variable DNA Hybridization

    Directory of Open Access Journals (Sweden)

    Jingyuan Huang

    2018-01-01

    Full Text Available The use of low-dimensional inorganic or organic nanomaterials has advantages for DNA and protein recognition due to their sensitivity, accuracy, and physical size matching. In this research, poly(3-methylthiophene (P3MT nanowires (NWs are electrochemically prepared with dopant followed by functionalization with probe DNA (pDNA sequence through electrostatic interaction. Various lengths of pDNA sequences (10-, 20- and 30-mer are conjugated to the P3MT NWs respectively followed with hybridization with their complementary target DNA (tDNA sequences. The nanoscale photoluminescence (PL properties of the P3MT NWs are studied throughout the whole process at solid state. In addition, the correlation between the PL enhancement and the double helix DNA with various lengths is demonstrated.

  4. Contribution of DNA double-strand break repair gene XRCC3 genotypes to oral cancer susceptibility in Taiwan.

    Science.gov (United States)

    Tsai, Chia-Wen; Chang, Wen-Shin; Liu, Juhn-Cherng; Tsai, Ming-Hsui; Lin, Cheng-Chieh; Bau, Da-Tian

    2014-06-01

    The DNA repair gene X-ray repair cross complementing protein 3 (XRCC3) is thought to play a major role in double-strand break repair and in maintaining genomic stability. Very possibly, defective double-strand break repair of cells can lead to carcinogenesis. Therefore, a case-control study was performed to reveal the contribution of XRCC3 genotypes to individual oral cancer susceptibility. In this hospital-based research, the association of XRCC3 rs1799794, rs45603942, rs861530, rs3212057, rs1799796, rs861539, rs28903081 genotypes with oral cancer risk in a Taiwanese population was investigated. In total, 788 patients with oral cancer and 956 age- and gender-matched healthy controls were genotyped. The results showed that there was significant differential distribution among oral cancer and controls in the genotypic (p=0.001428) and allelic (p=0.0013) frequencies of XRCC3 rs861539. As for the other polymorphisms, there was no difference between case and control groups. In gene-lifestyle interaction analysis, we have provided the first evidence showing that there is an obvious joint effect of XRCC3 rs861539 genotype with individual areca chewing habits on oral cancer risk. In conclusion, the T allele of XRCC3 rs861539, which has an interaction with areca chewing habit in oral carcinogenesis, may be an early marker for oral cancer in Taiwanese. Copyright© 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  5. Immediate and repair induced DNA double strand breaks in mammalian cells

    International Nuclear Information System (INIS)

    Bryant, P.E.

    1986-01-01

    It seems logical to postulate that double strand breaks (dsb) arising both at the time of irradiation and via repair processes are potentially equally damaging for a cell in terms of the potential to induce chromosomal aberrations. However, in some cell systems the repair of double es or es-ssb sites may run concurrently with the incision so that these lesions do not remain open for long: hence the lack of accumulation of dsb during repair. The rate of incision will thus determine both the accumulation and the probability of exchanges leading to chromosomal aberrations between these and other frank dsb. Rapid incision leading to a large additional pool of dsb appears to be the case in Chinese hamster V79 cells. Some evidence also exists for the conversion of base damage, via dsb, into deletion type chromatid aberrations which accumulate in irradiated G2 human cells treated with ara C. A small fraction of dsb, probably arising both at the time of irradiation as well as enzymatically during repair of base or sugar damage, appears to be either left unrepaired, yielding deletion type chromosomal aberrations, or is misrepaired, yielding exchange aberrations. The induction of these aberrations appears to be of central importance in the biological effects of ionizing radiation such as mutations, oncogenic transformation, and cell death. 52 refs., 5 figs

  6. Investigation of Double-Band Electrophoretic Pattern of ITS-rDNA Region in Iranian Isolates of Leishmania Tropica

    Directory of Open Access Journals (Sweden)

    MA Ghatee

    2013-06-01

    Full Text Available Background: Leishmania tropica is a genetically divergent species. Amplification of entire internal tran­scribed spacer (ITS region of L. tropica isolates obtained from Bam district, one of the well known focus of anthroponotic cutaneous leishmaniasis ACL( in Iran, revealed a double-band pat­tern in agarose gel electrophoresis. This study explains how this pattern occurs.Methods: Twenty seven L. tropica smear preparations were collected from Bam district, south east Iran, and eight L. major and one L. infantum smear preparations were gathered from Shiraz, south west Iran. Furthermore one L. major and one L. infantum cultured standard strains were tested using entire ITS-PCR to survey their electrophoretic pattern. The ITS sequences of L. tropica, L. major, and L. infantum already deposited in GenBank were analyzed. Analysis of GenBank sequences of L. tropica revealed two groups of sequences based on length size, one group having a 100 bp gap. Therefore, a new re­verse primer namely LITS-MG was designed to exclude this gap in PCR products.Results: Whole ITS fragment amplification resulted in a double-band pattern in all L. tropica cases, while a sharp single band was observed for L. infantum and L. major isolates. This result was correspond­ing to the result obtained from in silico analysis of GenBank sequences. Use of LITS-MG primer was expectedly resulted in a single band including ITS1, 5.8s and partial ITS2 product for L. tropica which is appropriate for following molecular studies such as sequencing or restriction analysis.Conclusion: Sequences analysis of GenBank L. tropica sequences and following practical laboratory tests revealed at least two alleles in L. tropica which were confirmed in Bam isolates. This especial double-band pattern is because of a 100 bp fragment difference within ITS-rDNA alleles

  7. The involvement of human RECQL4 in DNA double-strand break repair

    DEFF Research Database (Denmark)

    Singh, Dharmendra Kumar; Karmakar, Parimal; Aamann, Maria Diget

    2010-01-01

    Rothmund-Thomson syndrome (RTS) is an autosomal recessive hereditary disorder associated with mutation in RECQL4 gene, a member of the human RecQ helicases. The disease is characterized by genomic instability, skeletal abnormalities and predisposition to malignant tumors, especially osteosarcomas......-induced DSBs and remains for a shorter duration than WRN and BLM, indicating its distinct role in repair of DSBs. Endogenous RECQL4 also colocalizes with gammaH2AX at the site of DSBs. The RECQL4 domain responsible for its DNA damage localization has been mapped to the unique N-terminus domain between amino...

  8. Genes Involved in DNA Double-Strand Break Repair: Implications for Breast Cancer.

    Science.gov (United States)

    1996-10-01

    dependent kinase (p350) as a cietv of America Scholar. W.K.R. is a Howard Hughes Medical Insti- candidate gene for the murine SCID defect. Science 267:1178...Howard Hughes Medical Institute (W. K. R.). 26), are rescued by transfection of Ku86 cDNA (27, 28), and have 2 To whom requests for reprints should be... Jackman . J.. Wang. M. G., McBride. 0. W., and Fornace, 40. Papathanasiou. M. A.. Kerr, N. C. K., Robbins, J. H., McBride. 0. W., Alamo, I., A. J

  9. Estimation of strength in different extra Watson-Crick hydrogen bonds in DNA double helices through quantum chemical studies.

    Science.gov (United States)

    Bandyopadhyay, D; Bhattacharyya, D

    2006-10-15

    It was shown earlier, from database analysis, model building studies, and molecular dynamics simulations that formation of cross-strand bifurcated or Extra Watson-Crick hydrogen (EWC) bonds between successive base pairs may lead to extra rigidity to DNA double helices of certain sequences. The strengths of these hydrogen bonds are debatable, however, as they do not have standard linear geometry criterion. We have therefore carried out detailed ab initio quantum chemical studies using RHF/6-31G(2d,2p) and B3LYP/6-31G(2p,2d) basis sets to determine strengths of several bent hydrogen bonds with different donor and acceptors. Interaction energy calculations, corrected for the basis set superposition errors, suggest that N-H...O type bent EWC hydrogen bonds are possible along same strands or across the strands between successive base pairs, leading to significant stability (ca. 4-9 kcal/mol). The N-H...N and C-H...O type interactions, however, are not so stabilizing. Hence, consideration of EWC N-H...O H-bonds can lead to a better understanding of DNA sequence directed structural features. Copyright (c) 2006 Wiley Periodicals, Inc.

  10. Caffeine inhibits homology-directed repair of I-SceI-induced DNA double-strand breaks.

    Science.gov (United States)

    Wang, Huichen; Boecker, Wilfried; Wang, Hongyan; Wang, Xiang; Guan, Jun; Thompson, Larry H; Nickoloff, Jac A; Iliakis, George

    2004-01-22

    We recently reported that two Chinese hamster mutants deficient in the RAD51 paralogs XRCC2 and XRCC3 show reduced radiosensitization after treatment with caffeine, thus implicating homology-directed repair (HDR) of DNA double-strand breaks (DSBs) in the mechanism of caffeine radiosensitization. Here, we investigate directly the effect of caffeine on HDR initiated by DSBs induced by a rare cutting endonuclease (I-SceI) into one of two direct DNA repeats. The results demonstrate a strong inhibition by caffeine of HDR in wild-type cells, and a substantial reduction of this effect in HDR-deficient XRCC3 mutant cells. Inhibition of HDR and cell radiosensitization to killing shows similar dependence on caffeine concentration suggesting a cause-effect relationship between these effects. UCN-01, a kinase inhibitor that effectively abrogates checkpoint activation in irradiated cells, has only a small effect on HDR, indicating that similar to radiosensitization, inhibition of checkpoint signaling is not sufficient for HDR inhibition. Recombination events occurring during treatment with caffeine are characterized by rearrangements reminiscent to those previously reported for the XRCC3 mutant, and immunofluorescence microscopy demonstrates significantly reduced formation of IR-specific RAD51 foci after caffeine treatment. In summary, our results identify inhibition of HDR as a significant contributor to caffeine radiosensitization.

  11. Small Rad51 and Dmc1 Complexes Often Co-occupy Both Ends of a Meiotic DNA Double Strand Break.

    Directory of Open Access Journals (Sweden)

    M Scott Brown

    2015-12-01

    Full Text Available The Eukaryotic RecA-like proteins Rad51 and Dmc1 cooperate during meiosis to promote recombination between homologous chromosomes by repairing programmed DNA double strand breaks (DSBs. Previous studies showed that Rad51 and Dmc1 form partially overlapping co-foci. Here we show these Rad51-Dmc1 co-foci are often arranged in pairs separated by distances of up to 400 nm. Paired co-foci remain prevalent when DSBs are dramatically reduced or when strand exchange or synapsis is blocked. Super-resolution dSTORM microscopy reveals that individual foci observed by conventional light microscopy are often composed of two or more substructures. The data support a model in which the two tracts of ssDNA formed by a single DSB separate from one another by distances of up to 400 nm, with both tracts often bound by one or more short (about 100 nt Rad51 filaments and also by one or more short Dmc1 filaments.

  12. An empirical model for the induction of double strand breaks in DNA by the indirect' action of ionising radiation

    International Nuclear Information System (INIS)

    Watt, D.E.; Hill, S.J.A.

    1994-01-01

    For calculation of radiation effects at low doses near environmental levels it is necessary to model both ''direct'' and ''indirect'' effects along single charged particle tracks in the equilibrium spectrum generated by the radiation field. The modelling approach used here to determine the ''indirect'' contribution to the damage to the DNA in mammalian cells is first to study the transition of damage from the solid to liquid phases at different concentrations of enzyme targets (known to be inactivated by single target, single hit kinetics). The respective contributions from direct and indirect action can then be separated. Results obtained in this laboratory for the inactivation of dihydroorotate dehydrogenase have been supplemented by data taken from the literature. A simple model of the radiation action has been derived. It succeeds in correlating all the data within the range of concentrations, radical scavenger, and LET used. From the results, information is obtained on the role of the dose rate; on diffusion lengths, on the type of radical predominantly responsible (OH·) for the inactivation and on scavenging of radicals. Since water radicals are thought to be the main cause of indirect damage in mammalian cells it is a simple step to deduce from the enzyme results the probability of induction of single and double strand breaks in the DNA by making the assumption that basically the same radical kinetics are involved and then applying Poisson probabilities. (author)

  13. p53 binding protein 1 foci as a biomarker of DNA double strand breaks induced by ionizing radiation

    International Nuclear Information System (INIS)

    Ng, C.K.M.; Wong, M.Y.P.; Lam, R.K.K.; Ho, J.P.Y.; Chiu, S.K.; Yu, K.N.

    2011-01-01

    Foci of p53 binding protein 1 (53 BP1) have been used as a biomarker of DNA double-strand breaks (DSBs) in cells induced by ionizing radiations. 53 BP1 was shown to relocalize into foci shortly after irradiation, with the number of foci closely paralleling the number of DNA DSBs. However, consensus on criteria in terms of the numbers of 53 BP1 foci to define cells damaged by direct irradiation or by bystander signals has not been reached, which is partly due to the presence of 53 BP1 also in normal cells. The objective of the present work was to study the changes in the distribution of cells with different numbers of 53 BP1 foci in a cell population after low-dose ionizing irradiation (<0.1 Gy) provided by alpha particles, with a view to propose feasible criteria for defining cells damaged by direct irradiation or by bystander signals. It was proposed that the change in the percentage of cells with 1-3 foci should be used for such purposes. The underlying reasons were discussed.

  14. A novel automatic quantification method for high-content screening analysis of DNA double strand-break response.

    Science.gov (United States)

    Feng, Jingwen; Lin, Jie; Zhang, Pengquan; Yang, Songnan; Sa, Yu; Feng, Yuanming

    2017-08-29

    High-content screening is commonly used in studies of the DNA damage response. The double-strand break (DSB) is one of the most harmful types of DNA damage lesions. The conventional method used to quantify DSBs is γH2AX foci counting, which requires manual adjustment and preset parameters and is usually regarded as imprecise, time-consuming, poorly reproducible, and inaccurate. Therefore, a robust automatic alternative method is highly desired. In this manuscript, we present a new method for quantifying DSBs which involves automatic image cropping, automatic foci-segmentation and fluorescent intensity measurement. Furthermore, an additional function was added for standardizing the measurement of DSB response inhibition based on co-localization analysis. We tested the method with a well-known inhibitor of DSB response. The new method requires only one preset parameter, which effectively minimizes operator-dependent variations. Compared with conventional methods, the new method detected a higher percentage difference of foci formation between different cells, which can improve measurement accuracy. The effects of the inhibitor on DSB response were successfully quantified with the new method (p = 0.000). The advantages of this method in terms of reliability, automation and simplicity show its potential in quantitative fluorescence imaging studies and high-content screening for compounds and factors involved in DSB response.

  15. Age-dependent decline in rejoining of X-ray-induced DNA double-strand breaks in normal human lymphocytes

    International Nuclear Information System (INIS)

    Mayer, P.J.; Lange, C.S.; Bradley, M.O.; Nichols, W.W.

    1989-01-01

    Unstimulated human peripheral bloodlymphocytes (HPBL), separated by density centrifugation from anticoagulated whole blood, were X-irradiated on ice and incubated in medium at 37 0 C for repair times of 15, 30 and 120 min. Blood donors were 18 normotensive, non-smoking Caucasians aged 23-78, free from overt pathology and not taking any medications. Neutral filter elution was used to assay DNA double-strand break (DSB) induction and completeness of DSB rejoining. After 30 or 120 min repair incubation, the percentage of DSBs rejoined by cells from oder donors was less than half the percentage of DSBs rejoined by cells from younger donors. When data from the 3 age groups were pooled, the age-related decline in percent DSBs rejoined was significant for repair times 30 min and 120 min but not for 15 min. These age-related declines were observed even though DNA from older donors sustained fewer strand breaks as demonstrated by the negative correlation between donor age and DSB induction. These results suggest that the efficacy of X-ray-induced DSB repair diminishes with in vivo age in unstimulated HPBL. (author). 38 refs.; 2 figs.; 1 tab

  16. Cyclen-based double-tailed lipids for DNA delivery: Synthesis and the effect of linking group structures.

    Science.gov (United States)

    Zhang, Yi-Mei; Chang, De-Chun; Zhang, Ji; Liu, Yan-Hong; Yu, Xiao-Qi

    2015-09-01

    The gene transfection efficiency (TE) of cationic lipids is largely influenced by the lipid structure. Six novel 1, 4, 7, 10-tetraazacyclododecane (cyclen)-based cationic lipids L1-L6, which contain double oleyl as hydrophobic tails, were designed and synthesized. The difference between these lipids is their diverse backbone. Liposomes prepared by the lipids and DOPE showed good DNA affinity, and full DNA condensation could be achieved at N/P of 4 to form lipoplexes with proper size and zeta-potentials for gene transfection. Structure-activity relationship of these lipids as non-viral gene delivery vectors was investigated. It was found that minor backbone structural variations, including linking group and the structural symmetry would affect the TE. The diethylenetriamine derived lipid L4 containing amide linking bonds gave the best TE, which was several times higher than commercially available transfection reagent lipofectamine 2000. Besides, these lipids exhibited low cytotoxicity, suggesting their good biocompatibility. Results reveal that such type of cationic lipids might be promising non-viral gene vectors, and also afford us clues for the design of novel vectors with higher TE and biocompatibility. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. Improving DNA double-strand repair inhibitor KU55933 therapeutic index in cancer radiotherapy using nanoparticle drug delivery

    Science.gov (United States)

    Tian, Xi; Lara, Haydee; Wagner, Kyle T.; Saripalli, Srinivas; Hyder, Syed Nabeel; Foote, Michael; Sethi, Manish; Wang, Edina; Caster, Joseph M.; Zhang, Longzhen; Wang, Andrew Z.

    2015-11-01

    Radiotherapy is a key component of cancer treatment. Because of its importance, there has been high interest in developing agents and strategies to further improve the therapeutic index of radiotherapy. DNA double-strand repair inhibitors (DSBRIs) are among the most promising agents to improve radiotherapy. However, their clinical translation has been limited by their potential toxicity to normal tissue. Recent advances in nanomedicine offer an opportunity to overcome this limitation. In this study, we aim to demonstrate the proof of principle by developing and evaluating nanoparticle (NP) formulations of KU55933, a DSBRI. We engineered a NP formulation of KU55933 using nanoprecipitation method with different lipid polymer nanoparticle formulation. NP KU55933 using PLGA formulation has the best loading efficacy as well as prolonged drug release profile. We demonstrated that NP KU55933 is a potent radiosensitizer in vitro using clonogenic assay and is more effective as a radiosensitizer than free KU55933 in vivo using mouse xenograft models of non-small cell lung cancer (NSCLC). Western blots and immunofluorescence showed NP KU55933 exhibited more prolonged inhibition of DNA repair pathway. In addition, NP KU55933 leads to lower skin toxicity than KU55933. Our study supports further investigations using NP to deliver DSBRIs to improve cancer radiotherapy treatment.

  18. A model capturing novel strand symmetries in bacterial DNA

    International Nuclear Information System (INIS)

    Sobottka, Marcelo; Hart, Andrew G.

    2011-01-01

    Highlights: → We propose a simple stochastic model to construct primitive DNA sequences. → The model provide an explanation for Chargaff's second parity rule in primitive DNA sequences. → The model is also used to predict a novel type of strand symmetry in primitive DNA sequences. → We extend the results for bacterial DNA sequences and compare distributional properties intrinsic to the model to statistical estimates from 1049 bacterial genomes. → We find out statistical evidences that the novel type of strand symmetry holds for bacterial DNA sequences. -- Abstract: Chargaff's second parity rule for short oligonucleotides states that the frequency of any short nucleotide sequence on a strand is approximately equal to the frequency of its reverse complement on the same strand. Recent studies have shown that, with the exception of organellar DNA, this parity rule generally holds for double-stranded DNA genomes and fails to hold for single-stranded genomes. While Chargaff's first parity rule is fully explained by the Watson-Crick pairing in the DNA double helix, a definitive explanation for the second parity rule has not yet been determined. In this work, we propose a model based on a hidden Markov process for approximating the distributional structure of primitive DNA sequences. Then, we use the model to provide another possible theoretical explanation for Chargaff's second parity rule, and to predict novel distributional aspects of bacterial DNA sequences.

  19. The N-terminus of RPA large subunit and its spatial position are important for the 5'->3' resection of DNA double-strand breaks.

    Science.gov (United States)

    Tammaro, Margaret; Liao, Shuren; McCane, Jill; Yan, Hong

    2015-10-15

    The first step of homology-dependent repair of DNA double-strand breaks (DSBs) is the resection of the 5' strand to generate 3' ss-DNA. Of the two major nucleases responsible for resection, EXO1 has intrinsic 5'->3' directionality, but DNA2 does not. DNA2 acts with RecQ helicases such as the Werner syndrome protein (WRN) and the heterotrimeric eukaryotic ss-DNA binding protein RPA. We have found that the N-terminus of the RPA large subunit (RPA1N) interacts with both WRN and DNA2 and is essential for stimulating WRN's 3'->5' helicase activity and DNA2's 5'->3' ss-DNA exonuclease activity. A mutant RPA complex that lacks RPA1N is unable to support resection in Xenopus egg extracts and human cells. Furthermore, relocating RPA1N to the middle subunit but not to the small subunit causes severe defects in stimulating DNA2 and WRN and in supporting resection. Together, these findings suggest that RPA1N and its spatial position are critical for restricting the directionality of the WRN-DNA2 resection pathway. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. The N-terminus of RPA large subunit and its spatial position are important for the 5′->3′ resection of DNA double-strand breaks

    Science.gov (United States)

    Tammaro, Margaret; Liao, Shuren; McCane, Jill; Yan, Hong

    2015-01-01

    The first step of homology-dependent repair of DNA double-strand breaks (DSBs) is the resection of the 5′ strand to generate 3′ ss-DNA. Of the two major nucleases responsible for resection, EXO1 has intrinsic 5′->3′ directionality, but DNA2 does not. DNA2 acts with RecQ helicases such as the Werner syndrome protein (WRN) and the heterotrimeric eukaryotic ss-DNA binding protein RPA. We have found that the N-terminus of the RPA large subunit (RPA1N) interacts with both WRN and DNA2 and is essential for stimulating WRN's 3′->5′ helicase activity and DNA2's 5′->3′ ss-DNA exonuclease activity. A mutant RPA complex that lacks RPA1N is unable to support resection in Xenopus egg extracts and human cells. Furthermore, relocating RPA1N to the middle subunit but not to the small subunit causes severe defects in stimulating DNA2 and WRN and in supporting resection. Together, these findings suggest that RPA1N and its spatial position are critical for restricting the directionality of the WRN-DNA2 resection pathway. PMID:26227969

  1. Condensin suppresses recombination and regulates double-strand break processing at the repetitive ribosomal DNA array to ensure proper chromosome segregation during meiosis in budding yeast

    Science.gov (United States)

    Li, Ping; Jin, Hui; Yu, Hong-Guo

    2014-01-01

    During meiosis, homologues are linked by crossover, which is required for bipolar chromosome orientation before chromosome segregation at anaphase I. The repetitive ribosomal DNA (rDNA) array, however, undergoes little or no meiotic recombination. Hyperrecombination can cause chromosome missegregation and rDNA copy number instability. We report here that condensin, a conserved protein complex required for chromosome organization, regulates double-strand break (DSB) formation and repair at the rDNA gene cluster during meiosis in budding yeast. Condensin is highly enriched at the rDNA region during prophase I, released at the prophase I/metaphase I transition, and reassociates with rDNA before anaphase I onset. We show that condensin plays a dual role in maintaining rDNA stability: it suppresses the formation of Spo11-mediated rDNA breaks, and it promotes DSB processing to ensure proper chromosome segregation. Condensin is unnecessary for the export of rDNA breaks outside the nucleolus but required for timely repair of meiotic DSBs. Our work reveals that condensin coordinates meiotic recombination with chromosome segregation at the repetitive rDNA sequence, thereby maintaining genome integrity. PMID:25103240

  2. Double-strand breaks in genome-sized DNA caused by mechanical stress under mixing: Quantitative evaluation through single-molecule observation

    Science.gov (United States)

    Kikuchi, Hayato; Nose, Keiji; Yoshikawa, Yuko; Yoshikawa, Kenichi

    2018-06-01

    It is becoming increasingly apparent that changes in the higher-order structure of genome-sized DNA molecules of more than several tens kbp play important roles in the self-control of genome activity in living cells. Unfortunately, it has been rather difficult to prepare genome-sized DNA molecules without damage or fragmentation. Here, we evaluated the degree of double-strand breaks (DSBs) caused by mechanical mixing by single-molecule observation with fluorescence microscopy. The results show that DNA breaks are most significant for the first second after the initiation of mechanical agitation. Based on such observation, we propose a novel mixing procedure to significantly decrease DSBs.

  3. The cumulative burden of double-stranded DNA virus detection after allogeneic HCT is associated with increased mortality.

    Science.gov (United States)

    Hill, Joshua A; Mayer, Bryan T; Xie, Hu; Leisenring, Wendy M; Huang, Meei-Li; Stevens-Ayers, Terry; Milano, Filippo; Delaney, Colleen; Sorror, Mohamed L; Sandmaier, Brenda M; Nichols, Garrett; Zerr, Danielle M; Jerome, Keith R; Schiffer, Joshua T; Boeckh, Michael

    2017-04-20

    Strategies to prevent active infection with certain double-stranded DNA (dsDNA) viruses after allogeneic hematopoietic cell transplantation (HCT) are limited by incomplete understanding of their epidemiology and clinical impact. We retrospectively tested weekly plasma samples from allogeneic HCT recipients at our center from 2007 to 2014. We used quantitative PCR to test for cytomegalovirus, BK polyomavirus, human herpesvirus 6B, HHV-6A, adenovirus, and Epstein-Barr virus between days 0 and 100 post-HCT. We evaluated risk factors for detection of multiple viruses and association of viruses with mortality through day 365 post-HCT with Cox models. Among 404 allogeneic HCT recipients, including 125 cord blood, 125 HLA-mismatched, and 154 HLA-matched HCTs, detection of multiple viruses was common through day 100: 90% had ≥1, 62% had ≥2, 28% had ≥3, and 5% had 4 or 5 viruses. Risk factors for detection of multiple viruses included cord blood or HLA-mismatched HCT, myeloablative conditioning, and acute graft-versus-host disease ( P values < .01). Absolute lymphocyte count of <200 cells/mm 3 was associated with greater virus exposure on the basis of the maximum cumulative viral load area under the curve (AUC) ( P = .054). The maximum cumulative viral load AUC was the best predictor of early (days 0-100) and late (days 101-365) overall mortality (adjusted hazard ratio [aHR] = 1.36, 95% confidence interval [CI] [1.25, 1.49], and aHR = 1.04, 95% CI [1.0, 1.08], respectively) after accounting for immune reconstitution and graft-versus-host disease. In conclusion, detection of multiple dsDNA viruses was frequent after allogeneic HCT and had a dose-dependent association with increased mortality. These data suggest opportunities to improve outcomes with better antiviral strategies. © 2017 by The American Society of Hematology.

  4. MeHg Developing Exposure Causes DNA Double-Strand Breaks and Elicits Cell Cycle Arrest in Spinal Cord Cells

    Directory of Open Access Journals (Sweden)

    Fabiana F. Ferreira

    2015-01-01

    Full Text Available The neurotoxicity caused by methylmercury (MeHg is well documented; however, the developmental neurotoxicity in spinal cord is still not fully understood. Here we investigated whether MeHg affects the spinal cord layers development. Chicken embryos at E3 were treated in ovo with 0.1 μg MeHg/50 μL saline solution and analyzed at E10. Thus, we performed immunostaining using anti-γ-H2A.X to recognize DNA double-strand breaks and antiphosphohistone H3, anti-p21, and anti-cyclin E to identify cells in proliferation and cell cycle proteins. Also, to identify neuronal cells, we used anti-NeuN and anti-βIII-tubulin antibodies. After the MeHg treatment, we observed the increase on γ-H2A.X in response to DNA damage. MeHg caused a decrease in the proliferating cells and in the thickness of spinal cord layers. Moreover, we verified that MeHg induced an increase in the number of p21-positive cells but did not change the cyclin E-positive cells. A significantly high number of TUNEL-positive cells indicating DNA fragmentation were observed in MeHg-treated embryos. Regarding the neuronal differentiation, MeHg induced a decrease in NeuN expression and did not change the expression of βIII-tubulin. These results showed that in ovo MeHg exposure alters spinal cord development by disturbing the cell proliferation and death, also interfering in early neuronal differentiation.

  5. Impact of charged particle exposure on homologous DNA double-strand break repair in human blood-derived cells

    Directory of Open Access Journals (Sweden)

    Melanie eRall

    2015-11-01

    Full Text Available Ionizing radiation generates DNA double-strand breaks (DSB which, unless faithfully repaired, can generate chromosomal rearrangements in hematopoietic stem and/or progenitor cells (HSPC, potentially priming the cells towards a leukemic phenotype. Using an enhanced green fluorescent protein (EGFP-based reporter system, we recently identified differences in the removal of enzyme-mediated DSB in human HSPC versus mature peripheral blood lymphocytes (PBL, particularly regarding homologous DSB repair (HR. Assessment of chromosomal breaks via premature chromosome condensation or γH2AX foci indicated similar efficiency and kinetics of radiation-induced DSB formation and rejoining in PBL and HSPC. Prolonged persistence of chromosomal breaks was observed for higher LET charged particles which are known to induce more complex DNA damage compared to X rays. Consistent with HR deficiency in HSPC observed in our previous study, we noticed here pronounced focal accumulation of 53BP1 after X-ray and carbon ion exposure (intermediate LET in HSPC versus PBL. For higher LET, 53BP1 foci kinetics were similarly delayed in PBL and HSPC suggesting similar failure to repair complex DNA damage. Data obtained with plasmid reporter systems revealed a dose- and LET-dependent HR increase after X-ray, carbon ion and higher LET exposure, particularly in HR-proficient immortalized and primary lymphocytes, confirming preferential use of conservative HR in PBL for intermediate LET damage repair. HR measured adjacent to the leukemia-associated MLL breakpoint cluster sequence in reporter lines revealed dose-dependency of potentially leukemogenic rearrangements underscoring the risk of leukemia-induction by radiation treatment.

  6. DNA double-strand breaks in human induced pluripotent stem cell reprogramming and long-term in vitro culturing.

    Science.gov (United States)

    Simara, Pavel; Tesarova, Lenka; Rehakova, Daniela; Matula, Pavel; Stejskal, Stanislav; Hampl, Ales; Koutna, Irena

    2017-03-21

    Human induced pluripotent stem cells (hiPSCs) play roles in both disease modelling and regenerative medicine. It is critical that the genomic integrity of the cells remains intact and that the DNA repair systems are fully functional. In this article, we focused on the detection of DNA double-strand breaks (DSBs) by phosphorylated histone H2AX (known as γH2AX) and p53-binding protein 1 (53BP1) in three distinct lines of hiPSCs, their source cells, and one line of human embryonic stem cells (hESCs). We measured spontaneously occurring DSBs throughout the process of fibroblast reprogramming and during long-term in vitro culturing. To assess the variations in the functionality of the DNA repair system among the samples, the number of DSBs induced by γ-irradiation and the decrease over time was analysed. The foci number was detected by fluorescence microscopy separately for the G1 and S/G2 cell cycle phases. We demonstrated that fibroblasts contained a low number of non-replication-related DSBs, while this number increased after reprogramming into hiPSCs and then decreased again after long-term in vitro passaging. The artificial induction of DSBs revealed that the repair mechanisms function well in the source cells and hiPSCs at low passages, but fail to recognize a substantial proportion of DSBs at high passages. Our observations suggest that cellular reprogramming increases the DSB number but that the repair mechanism functions well. However, after prolonged in vitro culturing of hiPSCs, the repair capacity decreases.

  7. Recognition, signaling, and repair of DNA double-strand breaks produced by ionizing radiation in mammalian cells: the molecular choreography.

    Science.gov (United States)

    Thompson, Larry H

    2012-01-01

    The faithful maintenance of chromosome continuity in human cells during DNA replication and repair is critical for preventing the conversion of normal diploid cells to an oncogenic state. The evolution of higher eukaryotic cells endowed them with a large genetic investment in the molecular machinery that ensures chromosome stability. In mammalian and other vertebrate cells, the elimination of double-strand breaks with minimal nucleotide sequence change involves the spatiotemporal orchestration of a seemingly endless number of proteins ranging in their action from the nucleotide level to nucleosome organization and chromosome architecture. DNA DSBs trigger a myriad of post-translational modifications that alter catalytic activities and the specificity of protein interactions: phosphorylation, acetylation, methylation, ubiquitylation, and SUMOylation, followed by the reversal of these changes as repair is completed. "Superfluous" protein recruitment to damage sites, functional redundancy, and alternative pathways ensure that DSB repair is extremely efficient, both quantitatively and qualitatively. This review strives to integrate the information about the molecular mechanisms of DSB repair that has emerged over the last two decades with a focus on DSBs produced by the prototype agent ionizing radiation (IR). The exponential growth of molecular studies, heavily driven by RNA knockdown technology, now reveals an outline of how many key protein players in genome stability and cancer biology perform their interwoven tasks, e.g. ATM, ATR, DNA-PK, Chk1, Chk2, PARP1/2/3, 53BP1, BRCA1, BRCA2, BLM, RAD51, and the MRE11-RAD50-NBS1 complex. Thus, the nature of the intricate coordination of repair processes with cell cycle progression is becoming apparent. This review also links molecular abnormalities to cellular pathology as much a possible and provides a framework of temporal relationships. Copyright © 2012 Elsevier B.V. All rights reserved.

  8. Genetic polymorphisms in DNA double-strand break repair genes XRCC5, XRCC6 and susceptibility to hepatocellular carcinoma.

    Science.gov (United States)

    Li, Rui; Yang, Yuan; An, Yu; Zhou, Yun; Liu, Yanhong; Yu, Qing; Lu, Daru; Wang, Hongyang; Jin, Li; Zhou, Weiping; Qian, Ji; Shugart, Yin Yao

    2011-04-01

    Environmental risk factors cause DNA damages. Imprecise DNA repair leads to chromosome aberrations, genome destabilization and hepatocarcinogenesis. Ku is a key DNA double-strand break repair protein. We hypothesized that the genetic variants in Ku subunits encoding genes, XRCC5/XRCC6, may contribute to hepatocellular carcinoma (HCC) susceptibility. We genotyped 13 common single nucleotide polymorphisms (SNPs) in XRCC5 and XRCC6 and evaluated their associations with HCC risk in 689 pathologically confirmed cases and 690 cancer-free controls from a Chinese population. We found that a significantly reduced risk for HCC was associated with XRCC5 rs16855458 [odds ratio (OR)=0.59; 95% confidence interval (CI)=0.43-0.81; CA+AA versus CC] and a significantly increased risk for HCC was associated with XRCC5 rs9288516 (OR=2.02; 95% CI=1.42-2.86; TA+AA versus TT) even after Bonferroni correction (Pcorrected=0.026 and 0.002, respectively). The effects of rs16855458 (OR=0.57; 95% CI=0.37-0.86, P=0.008) and rs9288516 (OR=1.86; 95% CI=1.19-2.90, P=0.007) were more significant in hepatitis B surface antigen-infected subjects than non-infected subjects. The haplotype-based analysis revealed that in XRCC5, AA in block 1 (OR=0.63; 95% CI=0.48-0.83) and CGGTT in block 2 (OR=0.52; 95% CI=0.39-0.69) were associated with decreased HCC risk (Pcorrected=0.013 and analysis. In conclusion, XRCC5 variants may play a role in determining individual's HCC susceptibility, which warranted validation in larger studies.

  9. NF-κB regulates DNA double-strand break repair in conjunction with BRCA1-CtIP complexes.

    Science.gov (United States)

    Volcic, Meta; Karl, Sabine; Baumann, Bernd; Salles, Daniela; Daniel, Peter; Fulda, Simone; Wiesmüller, Lisa

    2012-01-01

    NF-κB is involved in immune responses, inflammation, oncogenesis, cell proliferation and apoptosis. Even though NF-κB can be activated by DNA damage via Ataxia telangiectasia-mutated (ATM) signalling, little was known about an involvement in DNA repair. In this work, we dissected distinct DNA double-strand break (DSB) repair mechanisms revealing a stimulatory role of NF-κB in homologous recombination (HR). This effect was independent of chromatin context, cell cycle distribution or cross-talk with p53. It was not mediated by the transcriptional NF-κB targets Bcl2, BAX or Ku70, known for their dual roles in apoptosis and DSB repair. A contribution by Bcl-xL was abrogated when caspases were inhibited. Notably, HR induction by NF-κB required the targets ATM and BRCA2. Additionally, we provide evidence that NF-κB interacts with CtIP-BRCA1 complexes and promotes BRCA1 stabilization, and thereby contributes to HR induction. Immunofluorescence analysis revealed accelerated formation of replication protein A (RPA) and Rad51 foci upon NF-κB activation indicating HR stimulation through DSB resection by the interacting CtIP-BRCA1 complex and Rad51 filament formation. Taken together, these results define multiple NF-κB-dependent mechanisms regulating HR induction, and thereby providing a novel intriguing explanation for both NF-κB-mediated resistance to chemo- and radiotherapies as well as for the sensitization by pharmaceutical intervention of NF-κB activation.

  10. A mathematical model for the detection mechanism of DNA double-strand breaks depending on autophosphorylation of ATM.

    Science.gov (United States)

    Mouri, Kazunari; Nacher, Jose C; Akutsu, Tatsuya

    2009-01-01

    After IR stress, DNA double-strand breaks (DSBs) occur and repair proteins (RPs) bind to them, generating DSB-RP complexes (DSBCs), which results in repaired DSBs (RDSBs). In recent experimental studies, it is suggested that the ATM proteins detect these DNA lesions depending on the autophosphorylation of ATM which exists as a dimer before phosphorylation. Interestingly, the ATM proteins can work as a sensor for a small number of DSBs (approximately 18 DSBs in a cell after exposure to IR). Thus the ATM proteins amplify the small input signals based on the phosphorylation of the ATM dimer proteins. The true DSB-detection mechanism depending on ATM autophosphorylation has yet to be clarified. We propose a mathematical model for the detection mechanism of DSBs by ATM. Our model includes both a DSB-repair mechanism and an ATM-phosphorylation mechanism. We model the former mechanism as a stochastic process, and obtain theoretical mean values of DSBs and DSBCs. In the latter mechanism, it is known that ATM autophosphorylates itself, and we find that the autophosphorylation induces bifurcation of the phosphorylated ATM (ATM*). The bifurcation diagram depends on the total concentration of ATM, which makes three types of steady state diagrams of ATM*: monostable, reversible bistable, and irreversible bistable. Bistability exists depending on the Hill coefficient in the equation of ATM autophosphorylation, and it emerges as the total concentration of ATM increases. Combining these two mechanisms, we find that ATM* exhibits switch-like behaviour in the presence of bistability, and the detection time after DNA damage decreases when the total concentration of ATM increases. This work provides a mathematical model that explains the DSB-detection mechanism depending on ATM autophosphorylation. These results indicate that positive auto-regulation works both as a sensor and amplifier of small input signals.

  11. Mobile phone radiofrequency exposure has no effect on DNA double strand breaks (DSB) in human lymphocytes.

    Science.gov (United States)

    Danese, Elisa; Lippi, Giuseppe; Buonocore, Ruggero; Benati, Marco; Bovo, Chiara; Bonaguri, Chiara; Salvagno, Gian Luca; Brocco, Giorgio; Roggenbuck, Dirk; Montagnana, Martina

    2017-07-01

    The use of mobile phones has been associated with an increased risk of developing certain type of cancer, especially in long term users. Therefore, this study was aimed to investigate the potential genotoxic effect of mobile phone radiofrequency exposure on human peripheral blood mononuclear cells in vitro. The study population consisted in 14 healthy volunteers. After collection of two whole blood samples, the former was placed in a plastic rack, 1 cm from the chassis of a commercial mobile phone (900 MHz carrier frequency), which was activated by a 30-min call. The second blood sample was instead maintained far from mobile phones or other RF sources. The influence of mobile phone RF on DNA integrity was assessed by analyzing γ-H2AX foci in lymphocytes using immunofluorescence staining kit on AKLIDES. No measure of γ-H2AX foci was significantly influenced by mobile phone RF exposure, nor mobile phone exposure was associated with significant risk of genetic damages in vitro (odds ratio comprised between 0.27 and 1.00). The results of this experimental study demonstrate that exposure of human lymphocytes to a conventional 900 MHz RF emitted by a commercial mobile phone for 30 min does not significantly impact DNA integrity.

  12. Crystallographic study of one turn of G/C-rich B-DNA.

    Science.gov (United States)

    Heinemann, U; Alings, C

    1989-11-20

    The DNA decamer d(CCAGGCCTGG) has been studied by X-ray crystallography. At a nominal resolution of 1.6 A, the structure was refined to R = 16.9% using stereochemical restraints. The oligodeoxyribonucleotide forms a straight B-DNA double helix with crystallographic dyad symmetry and ten base-pairs per turn. In the crystal lattice, DNA fragments stack end-to-end along the c-axis to form continuous double helices. The overall helical structure and, notably, the groove dimensions of the decamer are more similar to standard, fiber diffraction-determined B-DNA than A-tract DNA. A unique stacking geometry is observed at the CA/TG base-pair step, where an increased rotation about the helix axis and a sliding motion of the base-pairs along their long axes leads to a superposition of the base rings with neighboring carbonyl and amino functions. Three-center (bifurcated) hydrogen bonds are possible at the CC/GG base-pair steps of the decamer. In their common sequence elements, d(CCAGGCCTGG) and the related G.A mismatch decamer d(CCAAGATTGG) show very similar three-dimensional structures, except that d(CCAGGCCTGG) appears to have a less regularly hydrated minor groove. The paucity of minor groove hydration in the center of the decamer may be a general feature of G/C-rich DNA and explain its relative instability in the B-form of DNA.

  13. DNA double-strand break repair: a tale of pathway choices

    Institute of Scientific and Technical Information of China (English)

    Jing Li; Xingzhi Xu

    2016-01-01

    Deoxyribonucleic acid double-strand breaks (DSBs) are cytotoxic lesions that must be repaired either through homologous recombination (HR) or non-homologous end-joining (NHEJ) pathways.DSB repair is critical for genome integrity,cellular homeostasis and also constitutes the biological foundation for radiotherapy and the majority of chemotherapy.The choice between HR and NHEJ is a complex yet not completely understood process that will entail more future efforts.Herein we review our current understandings about how the choice is made over an antagonizing balance between p53-binding protein 1 and breast cancer 1 in the context of cell cycle stages,downstream effects,and distinct chromosomal histone marks.These exciting areas of research will surely bring more mechanistic insights about DSB repair and be utilized in the clinical settings.

  14. Anti-double strand (ds) DNA antibody formation by NZB/W (F1) spleen cells in a microculture system detected by solid phase radioimmunoassay.

    Science.gov (United States)

    Okudaira, H; Terada, E; Ogita, T; Aotsuka, S; Yokohari, R

    1981-01-01

    A solid-phase radioimmunoassay method was devised to detect mouse anti-double strand (ds) DNA antibody. This method could easily detect the anti-dsDNA antibody in 1 : 10,000 dilutions (1 unit) of pooled 9-10-month-old female NZB/W F1 sera. The sensitivity was about 10(3)- and 10(2)-fold higher than that of the modified Farr method and of the double antibody technique respectively. NZB/W mice developed high titer anti-dsDNA antibody as they grew older. Spleen cells brought to a microculture system using flat-bottomed polystyrene plates produced anti-dsDNA antibody clearly detectable by solid-phase radioimmunoassay. Anti-dsDNA antibody produced in vitro (y units) was in close correlation with the anti-dsDNA antibody titer of the spleen donor (x units) (y = 4.8 X 10(-2) x -65, gamma = 0.94, P less than 0.001). A combination of the microculture system and solid-phase radioimmunoassay was recommended for the characterization of anti-dsDNA antibody-forming cells.

  15. Anti-double strand (ds) DNA antibody formation by NZB/W (F1) spleen cells in a microculture system detected by solid-phase radioimmunoassay

    International Nuclear Information System (INIS)

    Okudaira, H.; Terada, E.; Ogita, T.; Aotsuka, S.; Yokohari, R.

    1981-01-01

    A solid-phase radioimmunoassay method was devised to detect mouse anti-double strand (ds) DNA antibody. This method could easily detect the anti-ds DNA antibody in 1 : 10,000 dilutions (1 unit) of pooled 9-10 month-old female NZB/W F1 sera. The sensitivity was about 10 3 and 10 2 -fold higher than that of the modified Farr method and of the double antibody technique respectively. NZB/W mice developed high titer anti-dsDNA antibody as they grew older. Spleen cells brought to a microculture system using flat-bottomed polystyrene plates produced anti-dsDNA antibody clearly detectable by solid-phase radioimmunoassay. Anti-dsDNA antibody produced in vitro (y units) was in close correlation with the anti-dsDNA antibody titer of the spleen donor (x units) (y = 4.8 X 10 -2 x-65, γ = 0.94, P < 0.001). A combination of the microculture system and solid-phase radioimmunoassay was recommended for the characterization of anti-dsDNA antibody-forming cells. (Auth.)

  16. DNA double-strand breaks as potential indicators for the biological effects of ionising radiation exposure from cardiac CT and conventional coronary angiography: a randomised, controlled study

    Energy Technology Data Exchange (ETDEWEB)

    Geisel, Dominik; Zimmermann, Elke; Rief, Matthias; Greupner, Johannes; Hamm, Bernd [Charite Medical School, Department of Radiology, Berlin (Germany); Laule, Michael; Knebel, Fabian [Charite Medical School, Department of Cardiology, Berlin (Germany); Dewey, Marc [Charite Medical School, Department of Radiology, Berlin (Germany); Charite, Institut fuer Radiologie, Berlin (Germany)

    2012-08-15

    To prospectively compare induced DNA double-strand breaks by cardiac computed tomography (CT) and conventional coronary angiography (CCA). 56 patients with suspected coronary artery disease were randomised to undergo either CCA or cardiac CT. DNA double-strand breaks were assessed in fluorescence microscopy of blood lymphocytes as indicators of the biological effects of radiation exposure. Radiation doses were estimated using dose-length product (DLP) and dose-area product (DAP) with conversion factors for CT and CCA, respectively. On average there were 0.12 {+-} 0.06 induced double-strand breaks per lymphocyte for CT and 0.29 {+-} 0.18 for diagnostic CCA (P < 0.001). This relative biological effect of ionising radiation from CCA was 1.9 times higher (P < 0.001) than the effective dose estimated by conversion factors would have suggested. The correlation between the biological effects and the estimated radiation doses was excellent for CT (r = 0.951, P < 0.001) and moderate to good for CCA (r = 0.862, P < 0.001). One day after radiation, a complete repair of double-strand breaks to background levels was found in both groups. Conversion factors may underestimate the relative biological effects of ionising radiation from CCA. DNA double-strand break assessment may provide a strategy for individualised assessments of radiation. (orig.)

  17. Binding of the antitumor drug nogalamycin and its derivatives to DNA: Structural comparison

    International Nuclear Information System (INIS)

    Gao, Yi-Gui; Liaw, Yen-Chywan; Robinson, H.; Wang, A. H.-J.

    1990-01-01

    The three-dimensional molecular structures of the complexes between a novel antitumor drug nogalamycin and its derivative U-58872 with a modified DNA hexamer d[m 5 CGT(pS)Am 5 CG] have been determined at 1.7- and 1.8-angstrom resolution, respectively, by X-ray diffraction analyses. Both structures (in space group P6 1 ) have been refined with constrained refinement procedure to final R factors of 0.208 (3386 reflections) and 0.196 (2143 reflections). In both complexes, two nogalamycins bind to the DNA hexamer double helix in a 2:1 ratio with the elongated aglycon chromophore intercalated between the CpG steps at both ends of the helix. The aglycon chromophore spans across the GC Watson-Crick base pairs with its nogalose lying in the minor groove and the aminoglucose lying in the major groove of the distorted B-DNA double helix. Most of the sugars remain in the C2'-endo pucker family, except three deoxycytidine residues (terminal C1, C7, and internal C5). All nucleotides are in the anti conformation. Specific hydrogen bonds are found in the complex between the drug and guanine-cytosine bases in both grooves of the helix. One hydroxyl group of the aminoglucose donates a hydrogen bond to the N7 of guanine, while the other receives a hydrogen bond from the N4 amino group of cytosine. The orientation of these two hydrogen bonds suggests that nogalamycin prefers a GC base pair with its aglycon chromophore intercalating at the 5'-side of a guanine (between NpG), or at the 3'-side of a cytosine (between CpN) with the sugars pointing toward the GC base pair. The binding of nogalamycin to DNA requires that the base pairs in DNA open up transiently to allow the bulky sugars to go through, suggesting that nogalamycin prefers GC sequences embedded in a stretch of AT sequences

  18. Optimization of Neutral Comet Assay for studying DNA double-strand breaks in pea and wheat

    Directory of Open Access Journals (Sweden)

    Ivelina Nikolova

    2013-01-01

    Full Text Available This study describes an adaptation of the Comet assay under neutral conditions for mono- and dicotyledonous plants pea (Pisum sativum L. and wheat (Triticum aestivum L.. Modifications concern lysis and electrophoresis steps, respectively. Electrophoresis was carried out varying the intensity of the electric field. A linear relationship between the percentages of DNA in the tail from control background with alteration of intensity was found. Trypan blue dye exclusion test was used in order to determine the intactness of nuclear membrane of the isolated nuclei from both plant model systems. Assessment was conducted on non-irradiated and irradiated nuclei on a monolayer with three doses of UVC. It was found that the share of intact nuclei (trypan blue negative ones is about 95% in controls. Gradual dose-related increase of damaged nuclei was observed in both species, reaching statistical significance only at the higher dose applied.

  19. Writers, Readers, and Erasers of Histone Ubiquitylation in DNA Double-Strand Break Repair

    DEFF Research Database (Denmark)

    Smeenk, Godelieve; Mailand, Niels

    2016-01-01

    accurate lesion repair and restoration of genome integrity. In vertebrate cells, ubiquitin-dependent modifications of histones adjacent to DSBs by RNF8, RNF168, and other ubiquitin ligases have a key role in promoting the assembly of repair protein complexes, serving as direct recruitment platforms...... for a range of genome caretaker proteins and their associated factors. These DNA damage-induced chromatin ubiquitylation marks provide an essential component of a histone code for DSB repair that is controlled by multifaceted regulatory circuits, underscoring its importance for genome stability maintenance....... In this review, we provide a comprehensive account of how DSB-induced histone ubiquitylation is sensed, decoded and modulated by an elaborate array of repair factors and regulators. We discuss how these mechanisms impact DSB repair pathway choice and functionality for optimal protection of genome integrity...

  20. Genus-specific protein binding to the large clusters of DNA repeats (short regularly spaced repeats) present in Sulfolobus genomes

    DEFF Research Database (Denmark)

    Peng, Xu; Brügger, Kim; Shen, Biao

    2003-01-01

    terminally modified and corresponds to SSO454, an open reading frame of previously unassigned function. It binds specifically to DNA fragments carrying double and single repeat sequences, binding on one side of the repeat structure, and producing an opening of the opposite side of the DNA structure. It also...... recognizes both main families of repeat sequences in S. solfataricus. The recombinant protein, expressed in Escherichia coli, showed the same binding properties to the SRSR repeat as the native one. The SSO454 protein exhibits a tripartite internal repeat structure which yields a good sequence match...... with a helix-turn-helix DNA-binding motif. Although this putative motif is shared by other archaeal proteins, orthologs of SSO454 were only detected in species within the Sulfolobus genus and in the closely related Acidianus genus. We infer that the genus-specific protein induces an opening of the structure...

  1. Absence of zero-temperature transmission rate of a double-chain tight-binding model for DNA with random sequence of nucleotides in thermodynamic limit

    International Nuclear Information System (INIS)

    Xiong Gang; Wang, X.R.

    2005-01-01

    The zero-temperature transmission rate spectrum of a double-chain tight-binding model for real DNA is calculated. It is shown that a band of extended-like states exists only for finite chain length with strong inter-chain coupling. While the whole spectrum tends to zero in thermodynamic limit, regardless of the strength of inter-chain coupling. It is also shown that a more faithful model for real DNA with periodic sugar-phosphate chains in backbone structures can be mapped into the above simple double-chain tight-binding model. Combined with above results, the transmission rate of real DNA with long random sequence of nucleotides is expected to be poor

  2. Triple helical DNA in a duplex context and base pair opening

    Science.gov (United States)

    Esguerra, Mauricio; Nilsson, Lennart; Villa, Alessandra

    2014-01-01

    It is fundamental to explore in atomic detail the behavior of DNA triple helices as a means to understand the role they might play in vivo and to better engineer their use in genetic technologies, such as antigene therapy. To this aim we have performed atomistic simulations of a purine-rich antiparallel triple helix stretch of 10 base triplets flanked by canonical Watson–Crick double helices. At the same time we have explored the thermodynamic behavior of a flipping Watson–Crick base pair in the context of the triple and double helix. The third strand can be accommodated in a B-like duplex conformation. Upon binding, the double helix changes shape, and becomes more rigid. The triple-helical region increases its major groove width mainly by oversliding in the negative direction. The resulting conformations are somewhere between the A and B conformations with base pairs remaining almost perpendicular to the helical axis. The neighboring duplex regions maintain a B DNA conformation. Base pair opening in the duplex regions is more probable than in the triplex and binding of the Hoogsteen strand does not influence base pair breathing in the neighboring duplex region. PMID:25228466

  3. Hsp90α regulates ATM and NBN functions in sensing and repair of DNA double-strand breaks.

    Science.gov (United States)

    Pennisi, Rosa; Antoccia, Antonio; Leone, Stefano; Ascenzi, Paolo; di Masi, Alessandra

    2017-08-01

    The molecular chaperone heat shock protein 90 (Hsp90α) regulates cell proteostasis and mitigates the harmful effects of endogenous and exogenous stressors on the proteome. Indeed, the inhibition of Hsp90α ATPase activity affects the cellular response to ionizing radiation (IR). Although the interplay between Hsp90α and several DNA damage response (DDR) proteins has been reported, its role in the DDR is still unclear. Here, we show that ataxia-telangiectasia-mutated kinase (ATM) and nibrin (NBN), but not 53BP1, RAD50, and MRE11, are Hsp90α clients as the Hsp90α inhibitor 17-(allylamino)-17-demethoxygeldanamycin (17-AAG) induces ATM and NBN polyubiquitination and proteosomal degradation in normal fibroblasts and lymphoblastoid cell lines. Hsp90α-ATM and Hsp90α-NBN complexes are present in unstressed and irradiated cells, allowing the maintenance of ATM and NBN stability that is required for the MRE11/RAD50/NBN complex-dependent ATM activation and the ATM-dependent phosphorylation of both NBN and Hsp90α in response to IR-induced DNA double-strand breaks (DSBs). Hsp90α forms a complex also with ph-Ser1981-ATM following IR. Upon phosphorylation, NBN dissociates from Hsp90α and translocates at the DSBs, while phThr5/7-Hsp90α is not recruited at the damaged sites. The inhibition of Hsp90α affects nuclear localization of MRE11 and RAD50, impairs DDR signaling (e.g., BRCA1 and CHK2 phosphorylation), and slows down DSBs repair. Hsp90α inhibition does not affect DNA-dependent protein kinase (DNA-PK) activity, which possibly phosphorylates Hsp90α and H2AX after IR. Notably, Hsp90α inhibition causes H2AX phosphorylation in proliferating cells, this possibly indicating replication stress events. Overall, present data shed light on the regulatory role of Hsp90α on the DDR, controlling ATM and NBN stability and influencing the DSBs signaling and repair. © 2017 Federation of European Biochemical Societies.

  4. Double demonstration of oncogenic high risk human papilloma virus DNA and HPV-E7 protein in oral cancers.

    Science.gov (United States)

    Pannone, G; Santoro, A; Carinci, F; Bufo, P; Papagerakis, S M; Rubini, C; Campisi, G; Giovannelli, L; Contaldo, M; Serpico, R; Mazzotta, M; Lo Muzio, L

    2011-01-01

    Oncogenic HPVs are necessarily involved in cervical cancer but their role in oral carcinogenesis is debated. To detect HPV in oral cancer, 38 cases of formalin fixed-paraffin embedded OSCC were studied by both DNA genotyping (MY09/11 L1 consensus primers in combination with GP5-GP6 primer pair followed by sequencing) and immunohistochemistry (monoclonal Abs against capsid protein and HPV-E7 protein, K1H8 DAKO and clone 8C9 INVITROGEN, respectively). HPV-16 tonsil cancer was used as positive control. The overall prevalence of HPV infection in OSCCs was 10.5%. Amplification of DNA samples showed single HPV DNA infection in 3 cases (HPV16; HPV53; HPV70) and double infection in one case of cheek cancer (HPV31/HPV44). The overall HR-HPV prevalence was 7.5%. E-7 antigen was immunohistochemically detected in all HPV-positive cases. HPV+ OSCC cases showed an overall better outcome than HPV negative oral cancers, as evaluated by Kaplan-Meier curves. HPVs exert their oncogenic role after DNA integration, gene expression of E5, E6 and E7 loci and p53/pRb host proteins suppression. This study showed that HPV-E7 protein inactivating pRb is expressed in oral cancer cells infected by oncogenic HPV other than classical HR-HPV-16/18. Interestingly HPV-70, considered a low risk virus with no definite collocation in oncogenic type category, gives rise to the expression of HPV-E7 protein and inactivate pRb in oral cancer. HPV-70, as proved in current literature, is able to inactivates also p53 protein, promoting cell immortalization. HPV-53, classified as a possible high risk virus, expresses E7 protein in OSCC, contributing to oral carcinogenesis. We have identified among OSCCs, a subgroup characterized by HPV infection (10.5%). Finally, we have proved the oncogenic potential of some HPV virus types, not well known in literature.

  5. Spectral analysis of naturally occurring methylxanthines (theophylline, theobromine and caffeine) binding with DNA.

    Science.gov (United States)

    Johnson, Irudayam Maria; Prakash, Halan; Prathiba, Jeyaguru; Raghunathan, Raghavachary; Malathi, Raghunathan

    2012-01-01

    Nucleic acids exist in a dynamic equilibrium with a number of molecules that constantly interact with them and regulate the cellular activities. The inherent nature of the structure and conformational integrity of these macromolecules can lead to altered biological activity through proper targeting of nucleic acids binding ligands or drug molecules. We studied the interaction of naturally occurring methylxanthines such as theophylline, theobromine and caffeine with DNA, using UV absorption and Fourier transform infrared (FTIR) spectroscopic methods, and especially monitored their binding affinity in the presence of Mg(2+) and during helix-coil transitions of DNA by temperature (T(m)) or pH melting profiles. The study indicates that all these molecules effectively bind to DNA in a dose dependent manner. The overall binding constants of DNA-theophylline = 3.5×10(3) M(-1), DNA-theobromine = 1.1×10(3) M(-1), and DNA-Caffeine = 3.8×10(3) M(-1). On the other hand T(m)/pH melting profiles showed 24-35% of enhanced binding activity of methylxanthines during helix-coil transitions of DNA rather than to its native double helical structure. The FTIR analysis divulged that theophylline, theobromine and caffeine interact with all the base pairs of DNA (A-T; G-C) and phosphate group through hydrogen bond (H-bond) interaction. In the presence of Mg(2+), methylxanthines altered the structure of DNA from B to A-family. However, the B-family structure of DNA remained unaltered in DNA-methylxanthines complexes or in the absence of Mg(2+). The spectral analyses indicated the order of binding affinity as "caffeine≥theophylline>theobromine" to the native double helical DNA, and "theophylline≥theobromine>caffeine to the denatured form of DNA and in the presence of divalent metal ions.

  6. Spectral analysis of naturally occurring methylxanthines (theophylline, theobromine and caffeine binding with DNA.

    Directory of Open Access Journals (Sweden)

    Irudayam Maria Johnson

    Full Text Available Nucleic acids exist in a dynamic equilibrium with a number of molecules that constantly interact with them and regulate the cellular activities. The inherent nature of the structure and conformational integrity of these macromolecules can lead to altered biological activity through proper targeting of nucleic acids binding ligands or drug molecules. We studied the interaction of naturally occurring methylxanthines such as theophylline, theobromine and caffeine with DNA, using UV absorption and Fourier transform infrared (FTIR spectroscopic methods, and especially monitored their binding affinity in the presence of Mg(2+ and during helix-coil transitions of DNA by temperature (T(m or pH melting profiles. The study indicates that all these molecules effectively bind to DNA in a dose dependent manner. The overall binding constants of DNA-theophylline = 3.5×10(3 M(-1, DNA-theobromine = 1.1×10(3 M(-1, and DNA-Caffeine = 3.8×10(3 M(-1. On the other hand T(m/pH melting profiles showed 24-35% of enhanced binding activity of methylxanthines during helix-coil transitions of DNA rather than to its native double helical structure. The FTIR analysis divulged that theophylline, theobromine and caffeine interact with all the base pairs of DNA (A-T; G-C and phosphate group through hydrogen bond (H-bond interaction. In the presence of Mg(2+, methylxanthines altered the structure of DNA from B to A-family. However, the B-family structure of DNA remained unaltered in DNA-methylxanthines complexes or in the absence of Mg(2+. The spectral analyses indicated the order of binding affinity as "caffeine≥theophylline>theobromine" to the native double helical DNA, and "theophylline≥theobromine>caffeine to the denatured form of DNA and in the presence of divalent metal ions.

  7. The Double Helix: Why Science Needs Science Fiction.

    Science.gov (United States)

    Andreadis, Athena

    2003-01-01

    Discusses why science needs science fiction, commenting on the author's book about science that draws heavily on the "Star Trek" series. The best science, in spite of popular thinking, comes from leaps of intuition, and science fiction provides a creative spark that encourages participation in science. (SLD)

  8. The swimming of a perfect deforming helix

    Science.gov (United States)

    Koens, Lyndon; Zhang, Hang; Mourran, Ahmed; Lauga, Eric

    2017-11-01

    Many bacteria rotate helical flagellar filaments in order to swim. When at rest or rotated counter-clockwise these flagella are left handed helices but they undergo polymorphic transformations to right-handed helices when the motor is reversed. These helical deformations themselves can generate motion, with for example Rhodobacter sphaeroides using the polymorphic transformation of the flagellum to generate rotation, or Spiroplasma propagating a change of helix handedness across its body's length to generate forward motion. Recent experiments reported on an artificial helical microswimmer generating motion without a propagating change in handedness. Made of a temperature sensitive gel, these swimmers moved by changing the dimensions of the helix in a non-reciprocal way. Inspired by these results and helix's ubiquitous presence in the bacterial world, we investigate how a deforming helix moves within a viscous fluid. Maintaining a single handedness along its entire length, we discuss how a perfect deforming helix can create a non-reciprocal swimming stroke, identify its principle directions of motion, and calculate the swimming kinematics asymptotically.

  9. Synthesis of DNA

    Science.gov (United States)

    Mariella, Jr., Raymond P.

    2008-11-18

    A method of synthesizing a desired double-stranded DNA of a predetermined length and of a predetermined sequence. Preselected sequence segments that will complete the desired double-stranded DNA are determined. Preselected segment sequences of DNA that will be used to complete the desired double-stranded DNA are provided. The preselected segment sequences of DNA are assembled to produce the desired double-stranded DNA.

  10. Mouse but not human embryonic stem cells are deficient in rejoining of ionizing radiation-induced DNA double-strand breaks.

    Science.gov (United States)

    Bañuelos, C A; Banáth, J P; MacPhail, S H; Zhao, J; Eaves, C A; O'Connor, M D; Lansdorp, P M; Olive, P L

    2008-09-01

    Mouse embryonic stem (mES) cells will give rise to all of the cells of the adult mouse, but they failed to rejoin half of the DNA double-strand breaks (dsb) produced by high doses of ionizing radiation. A deficiency in DNA-PK(cs) appears to be responsible since mES cells expressed strand breaks more rapidly. Consistent with more rapid dsb rejoining, H2AX(-/-) mES cells also expressed 6 times more DNA-PK(cs) than wild-type mES cells. Similar results were obtained for ATM(-/-) mES cells. Differentiation of mES cells led to an increase in DNA-PK(cs), an increase in dsb rejoining rate, and a decrease in Ku70/80. Unlike mouse ES, human ES cells were proficient in rejoining of dsb and expressed high levels of DNA-PK(cs). These results confirm the importance of homologous recombination in the accurate repair of double-strand breaks in mES cells, they help explain the chromosome abnormalities associated with deficiencies in H2AX and ATM, and they add to the growing list of differences in the way rodent and human cells deal with DNA damage.

  11. Human RAD18 interacts with ubiquitylated chromatin components and facilitates RAD9 recruitment to DNA double strand breaks.

    Directory of Open Access Journals (Sweden)

    Akiko Inagaki

    Full Text Available RAD18 is an ubiquitin ligase involved in replicative damage bypass and DNA double-strand break (DSB repair processes. We found that RPA is required for the dynamic pattern of RAD18 localization during the cell cycle, and for accumulation of RAD18 at sites of γ-irradiation-induced DNA damage. In addition, RAD18 colocalizes with chromatin-associated conjugated ubiquitin and ubiquitylated H2A throughout the cell cycle and following irradiation. This localization pattern depends on the presence of an intact, ubiquitin-binding Zinc finger domain. Using a biochemical approach, we show that RAD18 directly binds to ubiquitylated H2A and several other unknown ubiquitylated chromatin components. This interaction also depends on the RAD18 Zinc finger, and increases upon the induction of DSBs by γ-irradiation. Intriguingly, RAD18 does not always colocalize with regions that show enhanced H2A ubiquitylation. In human female primary fibroblasts, where one of the two X chromosomes is inactivated to equalize X-chromosomal gene expression between male (XY and female (XX cells, this inactive X is enriched for ubiquitylated H2A, but only rarely accumulates RAD18. This indicates that the binding of RAD18 to ubiquitylated H2A is context-dependent. Regarding the functional relevance of RAD18 localization at DSBs, we found that RAD18 is required for recruitment of RAD9, one of the components of the 9-1-1 checkpoint complex, to these sites. Recruitment of RAD9 requires the functions of the RING and Zinc finger domains of RAD18. Together, our data indicate that association of RAD18 with DSBs through ubiquitylated H2A and other ubiquitylated chromatin components allows recruitment of RAD9, which may function directly in DSB repair, independent of downstream activation of the checkpoint kinases CHK1 and CHK2.

  12. A structural model of the genome packaging process in a membrane-containing double stranded DNA virus.

    Directory of Open Access Journals (Sweden)

    Chuan Hong

    2014-12-01

    Full Text Available Two crucial steps in the virus life cycle are genome encapsidation to form an infective virion and genome exit to infect the next host cell. In most icosahedral double-stranded (ds DNA viruses, the viral genome enters and exits the capsid through a unique vertex. Internal membrane-containing viruses possess additional complexity as the genome must be translocated through the viral membrane bilayer. Here, we report the structure of the genome packaging complex with a membrane conduit essential for viral genome encapsidation in the tailless icosahedral membrane-containing bacteriophage PRD1. We utilize single particle electron cryo-microscopy (cryo-EM and symmetry-free image reconstruction to determine structures of PRD1 virion, procapsid, and packaging deficient mutant particles. At the unique vertex of PRD1, the packaging complex replaces the regular 5-fold structure and crosses the lipid bilayer. These structures reveal that the packaging ATPase P9 and the packaging efficiency factor P6 form a dodecameric portal complex external to the membrane moiety, surrounded by ten major capsid protein P3 trimers. The viral transmembrane density at the special vertex is assigned to be a hexamer of heterodimer of proteins P20 and P22. The hexamer functions as a membrane conduit for the DNA and as a nucleating site for the unique vertex assembly. Our structures show a conformational alteration in the lipid membrane after the P9 and P6 are recruited to the virion. The P8-genome complex is then packaged into the procapsid through the unique vertex while the genome terminal protein P8 functions as a valve that closes the channel once the genome is inside. Comparing mature virion, procapsid, and mutant particle structures led us to propose an assembly pathway for the genome packaging apparatus in the PRD1 virion.

  13. A structural model of the genome packaging process in a membrane-containing double stranded DNA virus.

    Science.gov (United States)

    Hong, Chuan; Oksanen, Hanna M; Liu, Xiangan; Jakana, Joanita; Bamford, Dennis H; Chiu, Wah

    2014-12-01

    Two crucial steps in the virus life cycle are genome encapsidation to form an infective virion and genome exit to infect the next host cell. In most icosahedral double-stranded (ds) DNA viruses, the viral genome enters and exits the capsid through a unique vertex. Internal membrane-containing viruses possess additional complexity as the genome must be translocated through the viral membrane bilayer. Here, we report the structure of the genome packaging complex with a membrane conduit essential for viral genome encapsidation in the tailless icosahedral membrane-containing bacteriophage PRD1. We utilize single particle electron cryo-microscopy (cryo-EM) and symmetry-free image reconstruction to determine structures of PRD1 virion, procapsid, and packaging deficient mutant particles. At the unique vertex of PRD1, the packaging complex replaces the regular 5-fold structure and crosses the lipid bilayer. These structures reveal that the packaging ATPase P9 and the packaging efficiency factor P6 form a dodecameric portal complex external to the membrane moiety, surrounded by ten major capsid protein P3 trimers. The viral transmembrane density at the special vertex is assigned to be a hexamer of heterodimer of proteins P20 and P22. The hexamer functions as a membrane conduit for the DNA and as a nucleating site for the unique vertex assembly. Our structures show a conformational alteration in the lipid membrane after the P9 and P6 are recruited to the virion. The P8-genome complex is then packaged into the procapsid through the unique vertex while the genome terminal protein P8 functions as a valve that closes the channel once the genome is inside. Comparing mature virion, procapsid, and mutant particle structures led us to propose an assembly pathway for the genome packaging apparatus in the PRD1 virion.

  14. Temporal analysis of meiotic DNA double-strand break formation and repair in Drosophila females.

    Science.gov (United States)

    Mehrotra, S; McKim, K S

    2006-11-24

    Using an antibody against the phosphorylated form of His2Av (gamma-His2Av), we have described the time course for the series of events leading from the formation of a double-strand break (DSB) to a crossover in Drosophila female meiotic prophase. MEI-P22 is required for DSB formation and localizes to chromosomes prior to gamma-His2Av foci. Drosophila females, however, are among the group of organisms where synaptonemal complex (SC) formation is not dependent on DSBs. In the absence of two SC proteins, C(3)G and C(2)M, the number of DSBs in oocytes is significantly reduced. This is consistent with the appearance of SC protein staining prior to gamma-His2Av foci. However, SC formation is incomplete or absent in the neighboring nurse cells, and gamma-His2Av foci appear with the same kinetics as in oocytes and do not depend on SC proteins. Thus, competence for DSB formation in nurse cells occurs with a specific timing that is independent of the SC, whereas in the oocytes, some SC proteins may have a regulatory role to counteract the effects of a negative regulator of DSB formation. The SC is not sufficient for DSB formation, however, since DSBs were absent from the heterochromatin even though SC formation occurs in these regions. All gamma-His2Av foci disappear before the end of prophase, presumably as repair is completed and crossovers are formed. However, oocytes in early prophase exhibit a slower response to X-ray-induced DSBs compared to those in the late pachytene stage. Assuming all DSBs appear as gamma-His2Av foci, there is at least a 3:1 ratio of noncrossover to crossover products. From a comparison of the frequency of gamma-His2Av foci and crossovers, it appears that Drosophila females have only a weak mechanism to ensure a crossover in the presence of a low number of DSBs.

  15. Transformation frequency of γ irradiated plasmid DNA and the enzymatic double strand break formation by incubation in a protein extract of Escherichia coli

    International Nuclear Information System (INIS)

    Schulte-Frohlinde, D.; Mark, F.; Ventur, Y.

    1994-01-01

    It was found that incubation of γ-irradiated or DNaseI-treated plasmid DNA in a protein extract of Escherichia coli leads to enzyme-induced formation of double strand breaks (dsb) in competition with repair of precursors of these dsb. A survival curve of the plasmid DNA (as determined by transformation of E. coli) was calculated on the basis of enzyme-induced dsb as well as those produced by irradiation assuming that they are lethal. The calculated D O value was the same as that measured directly by transformation of irradiated plasmid DNA. Two models are presented that fit the experimental survival data as a function of dose. One is based on damage formation in the plasmid DNA including enzymatic conversion of single strand damage into dsb (U-model), the other is an enzymatic repair saturation model based on Michaelis-Menten kinetics. (Author)

  16. Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines.

    Science.gov (United States)

    Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G

    2017-07-19

    Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

  17. A quantitative model of the major pathways for radiation-induced DNA double-strand break repair

    International Nuclear Information System (INIS)

    Belov, O.V.; Krasavin, E.A.; Lyashko, M.S.; Batmunkh, M.; Sweilam, N.H.

    2014-01-01

    We have developed a model approach to simulate the major pathways of DNA double-strand break (DSB) repair in mammalian and human cells. The proposed model shows a possible mechanistic explanation of the basic regularities of DSB processing through the nonhomologous end-joining (NHEJ), homologous recombination (HR), and single-strand annealing (SSA). It reconstructs the time-courses of radiation-induced foci specific to particular repair processes including the major intermediate stages. The model is validated for ionizing radiations of a wide range of linear energy transfer (0.2-236 keV/μm) including a relatively broad spectrum of heavy ions. The appropriate set of reaction rate constants was suggested to satisfy the kinetics of DSB rejoining for the considered types of exposure. The simultaneous assessment of three repair pathways allows one to describe their possible biological relations in response to radiation. With the help of the proposed approach, we reproduce several experimental data sets on γ-H2AX foci remaining in different types of cells including those defective in NHEJ, HR, or SSA functions.

  18. Do Exogenous DNA Double-Strand Breaks Change Incomplete Synapsis and Chiasma Localization in the Grasshopper Stethophyma grossum?

    Directory of Open Access Journals (Sweden)

    Adela Calvente

    Full Text Available Meiotic recombination occurs as a programmed event that initiates by the formation of DNA double-strand breaks (DSBs that give rise to the formation of crossovers that are observed as chiasmata. Chiasmata are essential for the accurate chromosome segregation and the generation of new combinations of parental alleles. Some treatments that provoke exogenous DSBs also lead to alterations in the recombination pattern of some species in which full homologous synapsis is achieved at pachytene. We have carried out a similar approach in males of the grasshopper Stethophyma grossum, whose homologues show incomplete synapsis and proximal chiasma localization. After irradiating males with γ rays we have studied the distribution of both the histone variant γ-H2AX and the recombinase RAD51. These proteins are cytological markers of DSBs at early prophase I. We have inferred synaptonemal complex (SC formation via identification of SMC3 and RAD 21 cohesin subunits. Whereas thick and thin SMC3 filaments would correspond to synapsed and unsynapsed regions, the presence of RAD21 is only restricted to synapsed regions. Results show that irradiated spermatocytes maintain restricted synapsis between homologues. However, the frequency and distribution of chiasmata in metaphase I bivalents is slightly changed and quadrivalents were also observed. These results could be related to the singular nuclear polarization displayed by the spermatocytes of this species.

  19. Do Exogenous DNA Double-Strand Breaks Change Incomplete Synapsis and Chiasma Localization in the Grasshopper Stethophyma grossum?

    Science.gov (United States)

    Calvente, Adela; Santos, Juan Luis; Rufas, Julio S

    2016-01-01

    Meiotic recombination occurs as a programmed event that initiates by the formation of DNA double-strand breaks (DSBs) that give rise to the formation of crossovers that are observed as chiasmata. Chiasmata are essential for the accurate chromosome segregation and the generation of new combinations of parental alleles. Some treatments that provoke exogenous DSBs also lead to alterations in the recombination pattern of some species in which full homologous synapsis is achieved at pachytene. We have carried out a similar approach in males of the grasshopper Stethophyma grossum, whose homologues show incomplete synapsis and proximal chiasma localization. After irradiating males with γ rays we have studied the distribution of both the histone variant γ-H2AX and the recombinase RAD51. These proteins are cytological markers of DSBs at early prophase I. We have inferred synaptonemal complex (SC) formation via identification of SMC3 and RAD 21 cohesin subunits. Whereas thick and thin SMC3 filaments would correspond to synapsed and unsynapsed regions, the presence of RAD21 is only restricted to synapsed regions. Results show that irradiated spermatocytes maintain restricted synapsis between homologues. However, the frequency and distribution of chiasmata in metaphase I bivalents is slightly changed and quadrivalents were also observed. These results could be related to the singular nuclear polarization displayed by the spermatocytes of this species.

  20. Molecular mechanism of protein assembly on DNA double-strand breaks in the non-homologous end-joining pathway

    International Nuclear Information System (INIS)

    Yano, Ken-ichi; Morotomi-Yano, Keiko; Adachi, Noritaka; Akiyama, Hidenori

    2009-01-01

    Non-homologous end-joining (NHEJ) is the major repair pathway for DNA double-strand breaks (DSBs) in mammalian species. Upon DSB induction, a living cell quickly activates the NHEJ pathway comprising of multiple molecular events. However, it has been difficult to analyze the initial phase of DSB responses in living cells, primarily due to technical limitations. Recent advances in real-time imaging and site-directed DSB induction using laser microbeam allow us to monitor the spatiotemporal dynamics of NHEJ factors in the immediate-early phase after DSB induction. These new approaches, together with the use of cell lines deficient in each essential NHEJ factor, provide novel mechanistic insights into DSB recognition and protein assembly on DSBs in the NHEJ pathway. In this review, we provide an overview of recent progresses in the imaging analyses of the NHEJ core factors. These studies strongly suggest that the NHEJ core factors are pre-assembled into a large complex on DSBs prior to the progression of the biochemical reactions in the NHEJ pathway. Instead of the traditional step-by-step assembly model from the static view of NHEJ, a novel model for dynamic protein assembly in the NHEJ pathway is proposed. This new model provides important mechanistic insights into the protein assembly at DSBs and the regulation of DSB repair. (author)

  1. Nitric oxide mediated DNA double strand breaks induced in proliferating bystander cells after {alpha}-particle irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Han Wei [Department of Physics and Materials Science, City University of Hong Kong, Tat Chee Avenue, Kowloon Tong (Hong Kong); Chen Shaopeng [Department of Physics and Materials Science, City University of Hong Kong, Tat Chee Avenue, Kowloon Tong (Hong Kong); Key Laboratory of Ion Beam Bioengineering, Institute of Plasma Physics, Chinese Academy of Sciences, Hefei 230031 (China); Yu, K.N., E-mail: peter.yu@cityu.edu.hk [Department of Physics and Materials Science, City University of Hong Kong, Tat Chee Avenue, Kowloon Tong (Hong Kong); Wu Lijun [Key Laboratory of Ion Beam Bioengineering, Institute of Plasma Physics, Chinese Academy of Sciences, Hefei 230031 (China)

    2010-02-03

    Low-dose {alpha}-particle exposures comprise 55% of the environmental dose to the human population and have been shown to induce bystander responses. Previous studies showed that bystander effect could induce stimulated cell growth or genotoxicity, such as excessive DNA double strand breaks (DSBs), micronuclei (MN), mutation and decreased cell viability, in the bystander cell population. In the present study, the stimulated cell growth, detected with flow cytometry (FCM), and the increased MN and DSB, detected with p53 binding protein 1 (53BP1) immunofluorescence, were observed simultaneously in the bystander cell population, which were co-cultured with cells irradiated by low-dose {alpha}-particles (1-10 cGy) in a mixed system. Further studies indicated that nitric oxide (NO) and transforming growth factor {beta}1 (TGF-{beta}1) played very important roles in mediating cell proliferation and inducing MN and DSB in the bystander population through treatments with NO scavenger and TGF-{beta}1 antibody. Low-concentrations of NO, generated by spermidine, were proved to induce cell proliferation, DSB and MN simultaneously. The proliferation or shortened cell cycle in bystander cells gave them insufficient time to repair DSBs. The increased cell division might increase the probability of carcinogenesis in bystander cells since cell proliferation increased the probability of mutation from the mis-repaired or un-repaired DSBs.

  2. Age-dependent change of HMGB1 and DNA double-strand break accumulation in mouse brain

    International Nuclear Information System (INIS)

    Enokido, Yasushi; Yoshitake, Ayaka; Ito, Hikaru; Okazawa, Hitoshi

    2008-01-01

    HMGB1 is an evolutionarily conserved non-histone chromatin-associated protein with key roles in maintenance of nuclear homeostasis; however, the function of HMGB1 in the brain remains largely unknown. Recently, we found that the reduction of nuclear HMGB1 protein level in the nucleus associates with DNA double-strand break (DDSB)-mediated neuronal damage in Huntington's disease [M.L. Qi, K. Tagawa, Y. Enokido, N. Yoshimura, Y. Wada, K. Watase, S. Ishiura, I. Kanazawa, J. Botas, M. Saitoe, E.E. Wanker, H. Okazawa, Proteome analysis of soluble nuclear proteins reveals that HMGB1/2 suppress genotoxic stress in polyglutamine diseases, Nat. Cell Biol. 9 (2007) 402-414]. In this study, we analyze the region- and cell type-specific changes of HMGB1 and DDSB accumulation during the aging of mouse brain. HMGB1 is localized in the nuclei of neurons and astrocytes, and the protein level changes in various brain regions age-dependently. HMGB1 reduces in neurons, whereas it increases in astrocytes during aging. In contrast, DDSB remarkably accumulates in neurons, but it does not change significantly in astrocytes during aging. These results indicate that HMGB1 expression during aging is differentially regulated between neurons and astrocytes, and suggest that the reduction of nuclear HMGB1 might be causative for DDSB in neurons of the aged brain

  3. Nitric oxide mediated DNA double strand breaks induced in proliferating bystander cells after α-particle irradiation

    International Nuclear Information System (INIS)

    Han Wei; Chen Shaopeng; Yu, K.N.; Wu Lijun

    2010-01-01

    Low-dose α-particle exposures comprise 55% of the environmental dose to the human population and have been shown to induce bystander responses. Previous studies showed that bystander effect could induce stimulated cell growth or genotoxicity, such as excessive DNA double strand breaks (DSBs), micronuclei (MN), mutation and decreased cell viability, in the bystander cell population. In the present study, the stimulated cell growth, detected with flow cytometry (FCM), and the increased MN and DSB, detected with p53 binding protein 1 (53BP1) immunofluorescence, were observed simultaneously in the bystander cell population, which were co-cultured with cells irradiated by low-dose α-particles (1-10 cGy) in a mixed system. Further studies indicated that nitric oxide (NO) and transforming growth factor β1 (TGF-β1) played very important roles in mediating cell proliferation and inducing MN and DSB in the bystander population through treatments with NO scavenger and TGF-β1 antibody. Low-concentrations of NO, generated by spermidine, were proved to induce cell proliferation, DSB and MN simultaneously. The proliferation or shortened cell cycle in bystander cells gave them insufficient time to repair DSBs. The increased cell division might increase the probability of carcinogenesis in bystander cells since cell proliferation increased the probability of mutation from the mis-repaired or un-repaired DSBs.

  4. Transcription-associated processes cause DNA double-strand breaks and translocations in neural stem/progenitor cells.

    Science.gov (United States)

    Schwer, Bjoern; Wei, Pei-Chi; Chang, Amelia N; Kao, Jennifer; Du, Zhou; Meyers, Robin M; Alt, Frederick W

    2016-02-23

    High-throughput, genome-wide translocation sequencing (HTGTS) studies of activated B cells have revealed that DNA double-strand breaks (DSBs) capable of translocating to defined bait DSBs are enriched around the transcription start sites (TSSs) of active genes. We used the HTGTS approach to investigate whether a similar phenomenon occurs in primary neural stem/progenitor cells (NSPCs). We report that breakpoint junctions indeed are enriched around TSSs that were determined to be active by global run-on sequencing analyses of NSPCs. Comparative analyses of transcription profiles in NSPCs and B cells revealed that the great majority of TSS-proximal junctions occurred in genes commonly expressed in both cell types, possibly because this common set has higher transcription levels on average than genes transcribed in only one or the other cell type. In the latter context, among all actively transcribed genes containing translocation junctions in NSPCs, those with junctions located within 2 kb of the TSS show a significantly higher transcription rate on average than genes with junctions in the gene body located at distances greater than 2 kb from the TSS. Finally, analysis of repair junction signatures of TSS-associated translocations in wild-type versus classical nonhomologous end-joining (C-NHEJ)-deficient NSPCs reveals that both C-NHEJ and alternative end-joining pathways can generate translocations by joining TSS-proximal DSBs to DSBs on other chromosomes. Our studies show that the generation of transcription-associated DSBs is conserved across divergent cell types.

  5. Pleolipoviridae, a newly proposed family comprising archaeal pleomorphic viruses with single-stranded or double-stranded DNA genomes.

    Science.gov (United States)

    Pietilä, Maija K; Roine, Elina; Sencilo, Ana; Bamford, Dennis H; Oksanen, Hanna M

    2016-01-01

    Viruses infecting archaea show a variety of virion morphotypes, and they are currently classified into more than ten viral families or corresponding groups. A pleomorphic virus morphotype is very common among haloarchaeal viruses, and to date, several such viruses have been isolated. Here, we propose the classification of eight such viruses and formation of a new family, Pleolipoviridae (from the Greek pleo for more or many and lipos for lipid), containing three genera, Alpha-, Beta-, and Gammapleolipovirus. The proposal is currently under review by the International Committee on Taxonomy of Viruses (ICTV). The members of the proposed family Pleolipoviridae infect halophilic archaea and are nonlytic. They share structural and genomic features and differ from any other classified virus. The virion of pleolipoviruses is composed of a pleomorphic membrane vesicle enclosing the genome. All pleolipoviruses have two major structural protein species, internal membrane and spike proteins. Although the genomes of the pleolipoviruses are single- or double-stranded, linear or circular DNA molecules, they share the same genome organization and gene synteny and show significant similarity at the amino acid level. The canonical features common to all members of the proposed family Pleolipoviridae show that they are closely related and thus form a new viral family.

  6. A look at the effect of sequence complexity on pressure destabilisation of DNA polymers.

    Science.gov (United States)

    Rayan, Gamal; Macgregor, Robert B

    2015-04-01

    Our previous studies on the helix-coil transition of double-stranded DNA polymers have demonstrated that molar volume change (ΔV) accompanying the thermally-induced transition can be positive or negative depending on the experimental conditions, that the pressure-induced transition is more cooperative than the heat-induced transition [Rayan and Macgregor, J Phys Chem B2005, 109, 15558-15565], and that the pressure-induced transition does not occur in the absence of water [Rayan and Macgregor, Biophys Chem, 2009, 144, 62-66]. Additionally, we have shown that ΔV values obtained by pressure-dependent techniques differ from those obtained by ambient pressure techniques such as PPC [Rayan et al. J Phys Chem B2009, 113, 1738-1742] thus shedding light on the effects of pressure on DNA polymers. Herein, we examine the effect of sequence complexity, and hence cooperativity on pressure destabilisation of DNA polymers. Working with Clostridium perfringes DNA under conditions such that the estimated ΔV of the helix-coil transition corresponds to -1.78 mL/mol (base pair) at atmospheric pressure, we do not observe the pressure-induced helix-coil transition of this DNA polymer, whereas synthetic copolymers poly[d(A-T)] and poly[d(I-C)] undergo cooperative pressure-induced transitions at similar ΔV values. We hypothesise that the reason for the lack of pressure-induced helix-coil transition of C. perfringens DNA under these experimental conditions lies in its sequence complexity. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. Rejoining of DNA double-strand breaks in human fibroblasts and its impairment in one ataxia telangiectasia and two Fanconi strains

    International Nuclear Information System (INIS)

    Coquerelle, T.M.; Weibezahn, K.F.

    1981-01-01

    Using the technique of neutral elution through polycarbonate filters as a measure of DNA length, and hence of the number of double-strand breaks incurred as a result of radiation damage, we found that normal human fibroblasts rejoin 50% of all breaks within only 3 min (37 degrees C). This fast rejoining was impaired in fibroblasts from one patient with Ataxia telangiectasia and in fibroblasts from two patients with Fanconi's anemia. Also the number of residual breaks after several hours of repair was higher than in control cells. Other cases with the same diseases were normal in their rejoining of double-strand breaks

  8. A correlation between residual radiation-induced DNA double-strand breaks in cultured fibroblasts and late radiotherapy reactions in breast cancer patients

    International Nuclear Information System (INIS)

    Kiltie, A.E.; Ryan, A.J.; Swindell, R.; Barber, J.B.P.; West, C.M.L.; Magee, B.; Hendry, J.H.

    1999-01-01

    Background and purpose: Prediction of late normal tissue reactions to radiotherapy would permit tailoring of dosage to each patient. Measurement of residual DNA double strand breaks using pulsed field gel electrophoresis (PFGE) shows promise in this field. The aim of this study was to test the predictive potential of PFGE in a group of retrospectively studied breast cancer patients.Materials and methods: Thirty nine patients, treated uniformly for breast cancer 9-15 years previously, with excision of the tumour and radiotherapy to the breast and drainage areas, were assessed clinically using the LENT SOMA scale, and a 5-mm punch biopsy taken from the buttock. Fibroblast cell strains were established and used to study residual DNA double strand breaks, using PFGE.Results: There were significant correlations between the DNA assay results and the fibrosis score (r s =0.46; P=0.003), the combined fibrosis and retraction score (r s =0.45, P=0.004) and the overall LENT score (r s =0.43; P=0.006). Using polychotomous logistic regression, the fibroblast DNA assay result was an independent prognostic factor for fibrosis severity.Conclusions: There is a relationship between residual radiation-induced DNA damage in fibroblasts and the severity of the late normal tissue damage seen in the patients from whom the cells were cultured. (Copyright (c) 1999 Elsevier Science B.V., Amsterdam. All rights reserved.)

  9. Combined quantum-mechanics/molecular-mechanics dynamics simulation of A-DNA double strands irradiated by ultra-low-energy carbon ions

    Energy Technology Data Exchange (ETDEWEB)

    Ngaojampa, C.; Nimmanpipug, P. [Computer Simulation and Modeling Laboratory (CSML), Department of Chemistry and Center for Innovation Chemistry, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Yu, L.D., E-mail: yuld@fnrf.science.cmu.ac.t [Plasma and Beam Physics Research Facility, Department of Physics and Materials Science, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Thailand Center of Excellence in Physics, Commission on Higher Education, 328 Si Ayutthaya Road, Bangkok 10400 (Thailand); Anuntalabhochai, S. [Molecular Biology Laboratory, Department of Biology, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Lee, V.S., E-mail: vannajan@gmail.co [Computer Simulation and Modeling Laboratory (CSML), Department of Chemistry and Center for Innovation Chemistry, Faculty of Science, Chiang Mai University, Chiang Mai 50200 (Thailand); Thailand Center of Excellence in Physics, Commission on Higher Education, 328 Si Ayutthaya Road, Bangkok 10400 (Thailand)

    2011-02-15

    In order to promote understanding of the fundamentals of ultra-low-energy ion interaction with DNA, molecular dynamics simulations using combined quantum-mechanics/molecular-mechanics of poly-AT and poly-GC A-DNA double strands irradiated by <200 eV carbon ions were performed to investigate the molecular implications of mutation bias. The simulations were focused on the responses of the DNA backbones and nitrogenous bases to irradiation. Analyses of the root mean square displacements of the backbones and non-hydrogen atoms of base rings of the simulated DNA structure after irradiation revealed a potential preference of DNA double strand separation, dependent on the irradiating energy. The results show that for the backbones, the large difference in the displacement between poly-GC and poly-AT in the initial time period could be the reason for the backbone breakage; for the nitrogenous base pairs, A-T is 30% more sensitive or vulnerable to ion irradiation than G-C, demonstrating a preferential, instead of random, effect of irradiation-induced mutation.

  10. De novo-engineered transcription activator-like effector (TALE) hybrid nuclease with novel DNA binding specificity creates double-strand breaks

    KAUST Repository

    Mahfouz, Magdy M.

    2011-01-24

    Site-specific and rare cutting nucleases are valuable tools for genome engineering. The generation of double-strand DNA breaks (DSBs) promotes homologous recombination in eukaryotes and can facilitate gene targeting, additions, deletions, and inactivation. Zinc finger nucleases have been used to generate DSBs and subsequently, for genome editing but with low efficiency and reproducibility. The transcription activator-like family of type III effectors (TALEs) contains a central domain of tandem repeats that could be engineered to bind specific DNA targets. Here, we report the generation of a Hax3-based hybrid TALE nuclease with a user-selected DNA binding specificity. We show that the engineered TALE nuclease can bind to its target sequence in vitro and that the homodimeric TALE nuclease can cleave double-stranded DNA in vitro if the DNA binding sites have the proper spacing and orientation. Transient expression assays in tobacco leaves suggest that the hybrid nuclease creates DSB in its target sequence, which is subsequently repaired by nonhomologous end-joining repair. Taken together, our data show the feasibility of engineering TALE-based hybrid nucleases capable of generating site-specific DSBs and the great potential for site-specific genome modification in plants and eukaryotes in general.

  11. Combined quantum-mechanics/molecular-mechanics dynamics simulation of A-DNA double strands irradiated by ultra-low-energy carbon ions

    International Nuclear Information System (INIS)

    Ngaojampa, C.; Nimmanpipug, P.; Yu, L.D.; Anuntalabhochai, S.; Lee, V.S.

    2011-01-01

    In order to promote understanding of the fundamentals of ultra-low-energy ion interaction with DNA, molecular dynamics simulations using combined quantum-mechanics/molecular-mechanics of poly-AT and poly-GC A-DNA double strands irradiated by <200 eV carbon ions were performed to investigate the molecular implications of mutation bias. The simulations were focused on the responses of the DNA backbones and nitrogenous bases to irradiation. Analyses of the root mean square displacements of the backbones and non-hydrogen atoms of base rings of the simulated DNA structure after irradiation revealed a potential preference of DNA double strand separation, dependent on the irradiating energy. The results show that for the backbones, the large difference in the displacement between poly-GC and poly-AT in the initial time period could be the reason for the backbone breakage; for the nitrogenous base pairs, A-T is 30% more sensitive or vulnerable to ion irradiation than G-C, demonstrating a preferential, instead of random, effect of irradiation-induced mutation.

  12. Emerging critical roles of Fe-S clusters in DNA replication and repair

    Science.gov (United States)

    Fuss, Jill O.; Tsai, Chi-Lin; Ishida, Justin P.; Tainer, John A.

    2015-01-01

    Fe-S clusters are partners in the origin of life that predate cells, acetyl-CoA metabolism, DNA, and the RNA world. The double helix solved the mystery of DNA replication by base pairing for accurate copying. Yet, for genome stability necessary to life, the double helix has equally important implications for damage repair. Here we examine striking advances that uncover Fe-S cluster roles both in copying the genetic sequence by DNA polymerases and in crucial repair processes for genome maintenance, as mutational defects cause cancer and degenerative disease. Moreover, we examine an exciting, controversial role for Fe-S clusters in a third element required for life – the long-range coordination and regulation of replication and repair events. By their ability to delocalize electrons over both Fe and S centers, Fe-S clusters have unbeatable features for protein conformational control and charge transfer via double-stranded DNA that may fundamentally transform our understanding of life, replication, and repair. PMID:25655665

  13. Chirality-specific lift forces of helix under shear flows: Helix perpendicular to shear plane.

    Science.gov (United States)

    Zhang, Qi-Yi

    2017-02-01

    Chiral objects in shear flow experience a chirality-specific lift force. Shear flows past helices in a low Reynolds number regime were studied using slender-body theory. The chirality-specific lift forces in the vorticity direction experienced by helices are dominated by a set of helix geometry parameters: helix radius, pitch length, number of turns, and helix phase angle. Its analytical formula is given. The chirality-specific forces are the physical reasons for the chiral separation of helices in shear flow. Our results are well supported by the latest experimental observations. © 2016 Wiley Periodicals, Inc.

  14. Relation between sedimentation behaviour of DNA-membrane complexes and DNA single- and double-strand breaks after irradiation with gamma-rays, pulse neutrons and 12C ions

    International Nuclear Information System (INIS)

    Erzgraber, G.; Lapidus, I.L.

    1985-01-01

    The experimental data on sedimentation behaviour of DNA-membrane complexes at radiation of the Chinese hamster cells (V79-4) in a wide dose range of 127 Cs γ-rays, pulse neutrons (reactor IBR-2, Laboratory of Neutron Physics, JINR, Dubna) are accelerated 12 C ions (cyclotron U-200, Laboratory of Nuclear Reactions, JINR, Dubna) are presented An assumption on the role of DNA single- and double-strend breaks in changing the sedimentation properties of DNA-membrane complexes has been confirmed by the experiments with radiation of different quality. The possibility of estimating induction and repair of DNA breaks on the basis of dependence of the relative sedimentation velocity of complexes on the irradiation does is discussed

  15. Diffraction by DNA, carbon nanotubes and other helical nanostructures

    International Nuclear Information System (INIS)

    Lucas, Amand A; Lambin, Philippe

    2005-01-01

    This review discusses the diffraction patterns of x-rays or electrons scattered by fibres of helical biological molecules and by carbon nanotubes (CNTs) from the unified point of view of the Fourier-Bessel transform of an atomic helix. This paper is intended for scientists who are not professional crystallographers. X-ray fibre diffraction patterns of Pauling's protein α-helix and of Crick and Pauling's protein coiled-coil are revisited. This is followed by a non-technical comparison between the historic x-ray diffraction patterns of the A and B conformations of DNA, which were crucial for the discovery of the double helix. The qualitative analysis of the diffraction images is supported by novel optical simulation experiments designed to pinpoint the gross structural informational content of the patterns. The spectacular helical structure of the tobacco mosaic virus determined by Rosalind Franklin and co-workers will then be described as an early example of the great power of x-ray crystallography in determining the structure of a large biomolecular edifice. After these mostly historical and didactic case studies, this paper will consider electron diffraction and transmission electron microscopy of CNTs of great current interest, focusing particularly on recent data obtained for single-wall, double-wall and scrolled nanotubes. Several points of convergence between the interpretations of the diffraction patterns of biological helices and CNTs will be emphasized

  16. Effect of Chromatin Structure on the Extent and Distribution of DNA Double Strand Breaks Produced by Ionizing Radiation; Comparative Study of hESC and Differentiated Cells Lines.

    Science.gov (United States)

    Venkatesh, Priyanka; Panyutin, Irina V; Remeeva, Evgenia; Neumann, Ronald D; Panyutin, Igor G

    2016-01-02

    Chromatin structure affects the extent of DNA damage and repair. Thus, it has been shown that heterochromatin is more protective against DNA double strand breaks (DSB) formation by ionizing radiation (IR); and that DNA DSB repair may proceed differently in hetero- and euchromatin regions. Human embryonic stem cells (hESC) have a more open chromatin structure than differentiated cells. Here, we study the effect of chromatin structure in hESC on initial DSB formation and subsequent DSB repair. DSB were scored by comet assay; and DSB repair was assessed by repair foci formation via 53BP1 antibody staining. We found that in hESC, heterochromatin is confined to distinct regions, while in differentiated cells it is distributed more evenly within the nuclei. The same dose of ionizing radiation produced considerably more DSB in hESC than in differentiated derivatives, normal human fibroblasts; and one cancer cell line. At the same time, the number of DNA repair foci were not statistically different among these cells. We showed that in hESC, DNA repair foci localized almost exclusively outside the heterochromatin regions. We also noticed that exposure to ionizing radiation resulted in an increase in heterochromatin marker H3K9me3 in cancer HT1080 cells, and to a lesser extent in IMR90 normal fibroblasts, but not in hESCs. These results demonstrate the importance of chromatin conformation for DNA protection and DNA damage repair; and indicate the difference of these processes in hESC.

  17. An Approach to Detect and Study DNA Double-Strand Break Repair by Transcript RNA Using a Spliced-Antisense RNA Template.

    Science.gov (United States)

    Keskin, Havva; Storici, Francesca

    2018-01-01

    A double-strand break (DSB) is one of the most dangerous DNA lesion, and its repair is crucial for genome stability. Homologous recombination is considered the safest way to repair a DNA DSB and requires an identical or nearly identical DNA template, such as a sister chromatid or a homologous chromosome for accurate repair. Can transcript RNA serve as donor template for DSB repair? Here, we describe an approach that we developed to detect and study DNA repair by transcript RNA. Key features of the method are: (i) use of antisense (noncoding) RNA as template for DSB repair by RNA, (ii) use of intron splicing to distinguish the sequence of the RNA template from that of the DNA that generates the RNA templat