Kim, Hyungsae
2010-10-05
Dof proteins are transcription factors that have a conserved single zinc finger DNA-binding domain. In this study, we isolated an activation tagging mutant Dof5.1-D exhibiting an upward-curling leaf phenotype due to enhanced expression of the REV gene that is required for establishing adaxialabaxial polarity. Dof5.1-D plants also had reduced transcript levels for IAA6 and IAA19 genes, indicating an altered auxin biosynthesis in Dof5.1-D. An electrophoretic mobility shift assay using the Dof5.1 DNA-binding motif and the REV promoter region indicated that the DNA-binding domain of Dof5.1 binds to a TAAAGT motif located in the 5′-distal promoter region of the REV promoter. Further, transient and chromatin immunoprecipitation assays verified binding activity of the Dof5.1 DNA-binding motif with the REV promoter. Consistent with binding assays, constitutive over-expression of the Dof5.1 DNA-binding domain in wild-type plants caused a downward-curling phenotype, whereas crossing Dof5.1-D to a rev mutant reverted the upward-curling phenotype of the Dof5.1-D mutant leaf to the wild-type. These results suggest that the Dof5.1 protein directly binds to the REV promoter and thereby regulates adaxialabaxial polarity. © 2010 Blackwell Publishing Ltd.
Kim, Hyungsae; Kim, Sungjin; Abbasi, Nazia; Bressan, Ray Anthony; Yun, Daejin; Yoo, Sangdong; Kwon, SukYun; Choi, Sangbong
2010-01-01
Dof proteins are transcription factors that have a conserved single zinc finger DNA-binding domain. In this study, we isolated an activation tagging mutant Dof5.1-D exhibiting an upward-curling leaf phenotype due to enhanced expression of the REV gene that is required for establishing adaxialabaxial polarity. Dof5.1-D plants also had reduced transcript levels for IAA6 and IAA19 genes, indicating an altered auxin biosynthesis in Dof5.1-D. An electrophoretic mobility shift assay using the Dof5.1 DNA-binding motif and the REV promoter region indicated that the DNA-binding domain of Dof5.1 binds to a TAAAGT motif located in the 5′-distal promoter region of the REV promoter. Further, transient and chromatin immunoprecipitation assays verified binding activity of the Dof5.1 DNA-binding motif with the REV promoter. Consistent with binding assays, constitutive over-expression of the Dof5.1 DNA-binding domain in wild-type plants caused a downward-curling phenotype, whereas crossing Dof5.1-D to a rev mutant reverted the upward-curling phenotype of the Dof5.1-D mutant leaf to the wild-type. These results suggest that the Dof5.1 protein directly binds to the REV promoter and thereby regulates adaxialabaxial polarity. © 2010 Blackwell Publishing Ltd.
Directory of Open Access Journals (Sweden)
Yong Guo
Full Text Available The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max. In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.
Directory of Open Access Journals (Sweden)
Hernando-Amado Sara
2012-11-01
Full Text Available Abstract Background Transcription factors (TFs are proteins that have played a central role both in evolution and in domestication, and are major regulators of development in living organisms. Plant genome sequences reveal that approximately 7% of all genes encode putative TFs. The DOF (DNA binding with One Finger TF family has been associated with vital processes exclusive to higher plants and to their close ancestors (algae, mosses and ferns. These are seed maturation and germination, light-mediated regulation, phytohormone and plant responses to biotic and abiotic stresses, etc. In Hordeum vulgare and Oryza sativa, 26 and 30 different Dof genes, respectively, have been annotated. Brachypodium distachyon has been the first Pooideae grass to be sequenced and, due to its genomic, morphological and physiological characteristics, has emerged as the model system for temperate cereals, such as wheat and barley. Results Through searches in the B. distachyon genome, 27 Dof genes have been identified and a phylogenetic comparison with the Oryza sativa and the Hordeum vulgare DOFs has been performed. To explore the evolutionary relationship among these DOF proteins, a combined phylogenetic tree has been constructed with the Brachypodium DOFs and those from rice and barley. This phylogenetic analysis has classified the DOF proteins into four Major Cluster of Orthologous Groups (MCOGs. Using RT-qPCR analysis the expression profiles of the annotated BdDof genes across four organs (leaves, roots, spikes and seeds has been investigated. These results have led to a classification of the BdDof genes into two groups, according to their expression levels. The genes highly or preferentially expressed in seeds have been subjected to a more detailed expression analysis (maturation, dry stage and germination. Conclusions Comparison of the expression profiles of the Brachypodium Dof genes with the published functions of closely related DOF sequences from the cereal
Shaw, Lindsay M; McIntyre, C Lynne; Gresshoff, Peter M; Xue, Gang-Ping
2009-11-01
DNA binding with One Finger (Dof) protein is a plant-specific transcription factor implicated in the regulation of many important plant-specific processes, including photosynthesis and carbohydrate metabolism. This study has identified 31 Dof genes (TaDof) in bread wheat through extensive analysis of current nucleotide databases. Phylogenetic analysis suggests that the TaDof family can be divided into four clades. Expression analysis of the TaDof family across all major organs using quantitative RT-PCR and searches of the wheat genome array database revealed that the majority of TaDof members were predominately expressed in vegetative organs. A large number of TaDof members were down-regulated by drought and/or were responsive to the light and dark cycle. Further expression analysis revealed that light up-regulated TaDof members were highly correlated in expression with a number of genes that are involved in photosynthesis or sucrose transport. These data suggest that the TaDof family may have an important role in light-mediated gene regulation, including involvement in the photosynthetic process.
Directory of Open Access Journals (Sweden)
Hui Li
2016-01-01
Full Text Available Tea plant (Camellia sinensis (L. O. Kuntze is affected by abiotic stress during its growth and development. DNA-binding with one finger (Dof transcription factors (TFs play important roles in abiotic stress tolerance of plants. In this study, a total of 29 putative Dof TFs were identified based on transcriptome of tea plant, and the conserved domains and common motifs of these CsDof TFs were predicted and analyzed. The 29 CsDof proteins were divided into 7 groups (A, B1, B2, C1, C2.1, C2.2, and D2, and the interaction networks of Dof proteins in C. sinensis were established according to the data in Arabidopsis. Gene expression was analyzed in “Yingshuang” and “Huangjinya” under four experimental stresses by qRT-PCR. CsDof genes were expressed differentially and related to different abiotic stress conditions. In total, our results might suggest that there is a potential relationship between CsDof factors and tea plant stress resistance.
Ueki, Toshiyuki; Inouye, Sumiko
2005-12-01
FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development.
Ueki, Toshiyuki; Inouye, Sumiko
2005-01-01
FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development.
Zang, Dandan; Wang, Lina; Zhang, Yiming; Zhao, Huimin; Wang, Yucheng
2017-07-01
Identification of the upstream regulators of a gene is important to characterize the transcriptional pathway and the function of the gene. Previously, we found that a zinc finger protein (ThZFP1) is involved in abiotic stress tolerance of Tamarix hispida. In the present study, we further investigated the transcriptional pathway of ThZFP1. Dof motifs are abundant in the ThZFP1 promoter; therefore, we used them to screen for transcriptional regulators of ThZFP1. A Dof protein, ThDof1.4, binds to the Dof motif specifically, and was hypothesized as the upstream regulator of ThZFP1. Further study showed that overexpression of ThDof1.4 in T. hispida activated the expression of GUS controlled by the ThZFP1 promoter. In T. hispida, transient overexpression of ThDof1.4 increased the transcripts of ThZFP1; conversely, transient RNAi-silencing of ThDof1.4 reduced the expression of ThZFP1. Chromatin immunoprecipitation indicated that ThDof1.4 binds to the ThZFP1 promoter. Additionally, ThDof1.4 and ThZFP1 share similar expression patterns in response to salt or drought stress. Furthermore, like ThZFP1, ThDof1.4 could increase the proline level and enhance ROS scavenging capability to improve salt and osmotic stress tolerance. Together, these results suggested that ThDof1.4 and ThZFP1 form a transcriptional regulatory cascade involved in abiotic stress resistance in T. hispida.
Genome-wide characterization of the SiDof gene family in foxtail millet (Setaria italica).
Zhang, Li; Liu, Baoling; Zheng, Gewen; Zhang, Aiying; Li, Runzhi
2017-01-01
Dof (DNA binding with one finger) proteins, which constitute a class of transcription factors found exclusively in plants, are involved in numerous physiological and biochemical reactions affecting growth and development. A genome-wide analysis of SiDof genes was performed in this study. Thirty five SiDof genes were identified and those genes were unevenly distributed across nine chromosomes in the Seteria italica genome. Protein lengths, molecular weights, and theoretical isoelectric points of SiDofs all vary greatly. Gene structure analysis demonstrated that most SiDof genes lack introns. Phylogenetic analysis of SiDof proteins and Dof proteins from Arabidopsis thaliana, rice, sorghum, and Setaria viridis revealed six major groups. Analysis of RNA-Seq data indicated that SiDof gene expression levels varied across roots, stems, leaves, and spike. In addition, expression profiling of SiDof genes in response to stress suggested that SiDof 7 and SiDof 15 are involved in drought stress signalling. Overall, this study could provide novel information on SiDofs for further investigation in foxtail millet. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Massange-Sánchez, Julio A.; Palmeros-Suárez, Paola A.; Espitia-Rangel, Eduardo; Rodríguez-Arévalo, Isaac; Sánchez-Segura, Lino; Martínez-Gallardo, Norma A.; Alatorre-Cobos, Fulgencio; Tiessen, Axel; Délano-Frier, John P.
2016-01-01
Two grain amaranth transcription factor (TF) genes were overexpressed in Arabidopsis plants. The first, coding for a group VII ethylene response factor TF (i.e., AhERF-VII) conferred tolerance to water-deficit stress (WS) in transgenic Arabidopsis without affecting vegetative or reproductive growth. A significantly lower water-loss rate in detached leaves coupled to a reduced stomatal opening in leaves of plants subjected to WS was associated with this trait. WS tolerance was also associated with an increased antioxidant enzyme activity and the accumulation of putative stress-related secondary metabolites. However, microarray and GO data did not indicate an obvious correlation between WS tolerance, stomatal closure, and abscisic acid (ABA)-related signaling. This scenario suggested that stomatal closure during WS in these plants involved ABA-independent mechanisms, possibly involving reactive oxygen species (ROS). WS tolerance may have also involved other protective processes, such as those employed for methyl glyoxal detoxification. The second, coding for a class A and cluster I DNA binding with one finger TF (i.e., AhDof-AI) provided salt-stress (SS) tolerance with no evident fitness penalties. The lack of an obvious development-related phenotype contrasted with microarray and GO data showing an enrichment of categories and genes related to developmental processes, particularly flowering. SS tolerance also correlated with increased superoxide dismutase activity but not with augmented stomatal closure. Additionally, microarray and GO data indicated that, contrary to AhERF-VII, SS tolerance conferred by AhDof-AI in Arabidopsis involved ABA-dependent and ABA-independent stress amelioration mechanisms. PMID:27749893
Directory of Open Access Journals (Sweden)
Julio A Massange-Sánchez
Full Text Available Two grain amaranth transcription factor (TF genes were overexpressed in Arabidopsis plants. The first, coding for a group VII ethylene response factor TF (i.e., AhERF-VII conferred tolerance to water-deficit stress (WS in transgenic Arabidopsis without affecting vegetative or reproductive growth. A significantly lower water-loss rate in detached leaves coupled to a reduced stomatal opening in leaves of plants subjected to WS was associated with this trait. WS tolerance was also associated with an increased antioxidant enzyme activity and the accumulation of putative stress-related secondary metabolites. However, microarray and GO data did not indicate an obvious correlation between WS tolerance, stomatal closure, and abscisic acid (ABA-related signaling. This scenario suggested that stomatal closure during WS in these plants involved ABA-independent mechanisms, possibly involving reactive oxygen species (ROS. WS tolerance may have also involved other protective processes, such as those employed for methyl glyoxal detoxification. The second, coding for a class A and cluster I DNA binding with one finger TF (i.e., AhDof-AI provided salt-stress (SS tolerance with no evident fitness penalties. The lack of an obvious development-related phenotype contrasted with microarray and GO data showing an enrichment of categories and genes related to developmental processes, particularly flowering. SS tolerance also correlated with increased superoxide dismutase activity but not with augmented stomatal closure. Additionally, microarray and GO data indicated that, contrary to AhERF-VII, SS tolerance conferred by AhDof-AI in Arabidopsis involved ABA-dependent and ABA-independent stress amelioration mechanisms.
Gupta, Supriya; Gupta, Sanjay Mohan; Gupta, Alok Kumar; Gaur, Vikram Singh; Kumar, Anil
2014-08-10
In order to gain insights into the mechanism of high nitrogen use efficiency (NUE) of finger millet (FM) the role of Dof2 transcription factor (TF), which is a repressor of genes involved in C/N metabolism was investigated. The partial cDNA fragment of EcDof2 (912-bp; GenBank acc. no. KF261117) was isolated and characterized from finger millet (FM) that showed 63% and 58% homology with Dof2 of Zea mays at nucleotide and protein level, respectively. Its expression studies were carried out along with the activator EcDof1 in two genotypes (GE3885, high protein genotype (HPG); GE1437, low protein genotype (LPG)) of FM differing in grain protein contents (13.8% and 6.2%) showed that EcDof2 is expressed in both shoot and root tissues with significantly (p≤0.05) higher expression in the roots. The diurnal expression of both EcDof1 and EcDof2 in shoots was differential having different time of peak expression indicating a differential response to diurnal condition. Under continuous dark conditions, expression of EcDof1 and EcDof2 oscillated in both the genotypes whereas on illumination, the fold expression of EcDof1 was higher as compared to EcDof2. Under increasing nitrate concentration, EcDof2 expression increases in roots and shoots of LPG while it remains unchanged in HPG. However, the EcDof1 expression was found to increase in both genotypes. Further, time kinetics studies under single nitrate concentration revealed that EcDof2 was repressed in the roots of both genotypes whereas EcDof1 oscillated with time. The EcDof1/EcDof2 ratio measured showed differential response under different light and nitrogen conditions. It was higher in the roots of HPG indicating higher activation of genes involved in N uptake and assimilation resulting in high grain protein accumulation. The results indicate that both light and nitrogen concentration influence Dof1 and Dof2 expression and suggests a complex pattern of regulation of genes influenced by these plant specific TFs. In
da Silva, Danielle Costenaro; da Silveira Falavigna, Vítor; Fasoli, Marianna; Buffon, Vanessa; Porto, Diogo Denardi; Pappas, Georgios Joannis; Pezzotti, Mario; Pasquali, Giancarlo; Revers, Luís Fernando
2016-01-01
The Dof (DNA-binding with one finger) protein family spans a group of plant transcription factors involved in the regulation of several functions, such as plant responses to stress, hormones and light, phytochrome signaling and seed germination. Here we describe the Dof-like gene family in grapevine (Vitis vinifera L.), which consists of 25 genes coding for Dof. An extensive in silico characterization of the VviDofL gene family was performed. Additionally, the expression of the entire gene family was assessed in 54 grapevine tissues and organs using an integrated approach with microarray (cv Corvina) and real-time PCR (cv Pinot Noir) analyses. The phylogenetic analysis comparing grapevine sequences with those of Arabidopsis, tomato, poplar and already described Dof genes in other species allowed us to identify several duplicated genes. The diversification of grapevine DofL genes during evolution likely resulted in a broader range of biological roles. Furthermore, distinct expression patterns were identified between samples analyzed, corroborating such hypothesis. Our expression results indicate that several VviDofL genes perform their functional roles mainly during flower, berry and seed development, highlighting their importance for grapevine growth and production. The identification of similar expression profiles between both approaches strongly suggests that these genes have important regulatory roles that are evolutionally conserved between grapevine cvs Corvina and Pinot Noir.
Mumma, Joel M; Durso, Francis T; Ferguson, Ashley N; Gipson, Christina L; Casanova, Lisa; Erukunuakpor, Kimberly; Kraft, Colleen S; Walsh, Victoria L; Zimring, Craig; DuBose, Jennifer; Jacob, Jesse T
2018-03-05
Doffing protocols for personal protective equipment (PPE) are critical for keeping healthcare workers (HCWs) safe during care of patients with Ebola virus disease. We assessed the relationship between errors and self-contamination during doffing. Eleven HCWs experienced with doffing Ebola-level PPE participated in simulations in which HCWs donned PPE marked with surrogate viruses (ɸ6 and MS2), completed a clinical task, and were assessed for contamination after doffing. Simulations were video recorded, and a failure modes and effects analysis and fault tree analyses were performed to identify errors during doffing, quantify their risk (risk index), and predict contamination data. Fifty-one types of errors were identified, many having the potential to spread contamination. Hand hygiene and removing the powered air purifying respirator (PAPR) hood had the highest total risk indexes (111 and 70, respectively) and number of types of errors (9 and 13, respectively). ɸ6 was detected on 10% of scrubs and the fault tree predicted a 10.4% contamination rate, likely occurring when the PAPR hood inadvertently contacted scrubs during removal. MS2 was detected on 10% of hands, 20% of scrubs, and 70% of inner gloves and the predicted rates were 7.3%, 19.4%, 73.4%, respectively. Fault trees for MS2 and ɸ6 contamination suggested similar pathways. Ebola-level PPE can both protect and put HCWs at risk for self-contamination throughout the doffing process, even among experienced HCWs doffing with a trained observer. Human factors methodologies can identify error-prone steps, delineate the relationship between errors and self-contamination, and suggest remediation strategies.
The LET Procedure for Prosthetic Myocontrol: Towards Multi-DOF Control Using Single-DOF Activations.
Directory of Open Access Journals (Sweden)
Markus Nowak
Full Text Available Simultaneous and proportional myocontrol of dexterous hand prostheses is to a large extent still an open problem. With the advent of commercially and clinically available multi-fingered hand prostheses there are now more independent degrees of freedom (DOFs in prostheses than can be effectively controlled using surface electromyography (sEMG, the current standard human-machine interface for hand amputees. In particular, it is uncertain, whether several DOFs can be controlled simultaneously and proportionally by exclusively calibrating the intended activation of single DOFs. The problem is currently solved by training on all required combinations. However, as the number of available DOFs grows, this approach becomes overly long and poses a high cognitive burden on the subject. In this paper we present a novel approach to overcome this problem. Multi-DOF activations are artificially modelled from single-DOF ones using a simple linear combination of sEMG signals, which are then added to the training set. This procedure, which we named LET (Linearly Enhanced Training, provides an augmented data set to any machine-learning-based intent detection system. In two experiments involving intact subjects, one offline and one online, we trained a standard machine learning approach using the full data set containing single- and multi-DOF activations as well as using the LET-augmented data set in order to evaluate the performance of the LET procedure. The results indicate that the machine trained on the latter data set obtains worse results in the offline experiment compared to the full data set. However, the online implementation enables the user to perform multi-DOF tasks with almost the same precision as single-DOF tasks without the need of explicitly training multi-DOF activations. Moreover, the parameters involved in the system are statistically uniform across subjects.
Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya
2002-12-01
The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.
Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya
2002-01-01
The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, a...
DOF-binding sites additively contribute to guard cell-specificity of AtMYB60 promoter
Directory of Open Access Journals (Sweden)
Cominelli Eleonora
2011-11-01
Full Text Available Abstract Background We previously demonstrated that the Arabidopsis thaliana AtMYB60 protein is an R2R3MYB transcription factor required for stomatal opening. AtMYB60 is specifically expressed in guard cells and down-regulated at the transcriptional levels by the phytohormone ABA. Results To investigate the molecular mechanisms governing AtMYB60 expression, its promoter was dissected through deletion and mutagenesis analyses. By studying different versions of AtMYB60 promoter::GUS reporter fusions in transgenic plants we were able to demonstrate a modular organization for the AtMYB60 promoter. Particularly we defined: a minimal promoter sufficient to confer guard cell-specific activity to the reporter gene; the distinct roles of different DOF-binding sites organised in a cluster in the minimal promoter in determining guard cell-specific expression; the promoter regions responsible for the enhancement of activity in guard cells; a promoter region responsible for the negative transcriptional regulation by ABA. Moreover from the analysis of single and multiple mutants we could rule out the involvement of a group of DOF proteins, known as CDFs, already characterised for their involvement in flowering time, in the regulation of AtMYB60 expression. Conclusions These findings shed light on the regulation of gene expression in guard cells and provide new promoter modules as useful tools for manipulating gene expression in guard cells, both for physiological studies and future biotechnological applications.
Herlihey, Tracey A; Gelmi, Stefano; Cafazzo, Joseph A; Hall, Trevor N T
2017-06-01
OBJECTIVE To explore the impact of environmental design on doffing personal protective equipment in a simulated healthcare environment. METHODS A mixed-methods approach was used that included human-factors usability testing and qualitative questionnaire responses. A patient room and connecting anteroom were constructed for testing purposes. This experimental doffing area was designed to overcome the environmental failures identified in a previous study and was not constructed based on any generalizable hospital standard. RESULTS In total, 72 healthcare workers from Ontario, Canada, took part in the study and tested the simulated doffing area. The following environmental design changes were tested and were deemed effective: increasing prominence of color-coded zones; securing disinfectant wipes and hand sanitizer; outlining disposal bins locations; providing mirrors to detect possible contamination; providing hand rails to assist with doffing; and restricting the space to doff. Further experimentation and iterative design are required with regard to several important features: positioning the disposal bins for safety, decreasing the risk of contamination and user accessibility; optimal positioning of mirrors for safety; communication within the team; and positioning the secondary team member for optimal awareness. Additional design suggestions also emerged during this study, and they require future investigation. CONCLUSIONS This study highlights the importance of the environment on doffing personal protective equipment in a healthcare setting. Iterative testing and modification of the design of the environment (doffing area) are important to enhancing healthcare worker safety. Infect Control Hosp Epidemiol 2017;38:712-717.
Directory of Open Access Journals (Sweden)
Bin Liu
2014-01-01
Full Text Available It is pivotal to find an effective mathematical model revealing the galloping mechanism. And it is important to compare the difference between the existing mathematical models on the conductor galloping. In this paper, the continuum cable model for transmission lines was proposed using the Hamilton principle. Discrete models of one DOF, two DOFs, and three DOFs were derived from the continuum model by using the Garlekin method. And the three models were compared by analyzing the galloping vertical amplitude and torsional angle with different influence factors. The influence factors include wind velocity, flow density, span length, damping ratio, and initial tension. The three-DOF model is more accurate at calculating the galloping characteristics than the other two models, but the one-DOF and two-DOF models can also present the trend of galloping amplitude change from the point view of qualitative analysis. And the change of the galloping amplitude relative to the main factors was also obtained, which is very essential to the antigalloping design applied in the actual engineering.
Kozić, Ružica; Meštrić, Lucija
2013-01-01
Projekt studentske radionice bio je kontrola DOF-a u mjerilu 1:2000 na području općine Đurđevac. Proveden je terenski dio kontrole točnosti DMR-a, DOF-a, izvedene signalizacije te načina signalizacije. Mjerenja su obavljena 19.travnja 2013. godine. Obavljena je ponovna izmjera GPS točaka homogenog polja Đurđevac RTK metodom u sustavu CROPOS s ciljem kontrole tih točaka, čije su koordinate već određene u sklopu izrade DOF2. Uz trajno stabilizirane točke homogenog polja, RTK metodom snimane su ...
Position calibration of a 3-DOF hand-controller with hybrid structure
Zhu, Chengcheng; Song, Aiguo
2017-09-01
A hand-controller is a human-robot interactive device, which measures the 3-DOF (Degree of Freedom) position of the human hand and sends it as a command to control robot movement. The device also receives 3-DOF force feedback from the robot and applies it to the human hand. Thus, the precision of 3-DOF position measurements is a key performance factor for hand-controllers. However, when using a hybrid type 3-DOF hand controller, various errors occur and are considered originating from machining and assembly variations within the device. This paper presents a calibration method to improve the position tracking accuracy of hybrid type hand-controllers by determining the actual size of the hand-controller parts. By re-measuring and re-calibrating this kind of hand-controller, the actual size of the key parts that cause errors is determined. Modifying the formula parameters with the actual sizes, which are obtained in the calibrating process, improves the end position tracking accuracy of the device.
Bakshi, Madhunita; Oelmüller, Ralf
2014-01-01
WRKY transcription factors are one of the largest families of transcriptional regulators found exclusively in plants. They have diverse biological functions in plant disease resistance, abiotic stress responses, nutrient deprivation, senescence, seed and trichome development, embryogenesis, as well as additional developmental and hormone-controlled processes. WRKYs can act as transcriptional activators or repressors, in various homo- and heterodimer combinations. Here we review recent progress on the function of WRKY transcription factors in Arabidopsis and other plant species such as rice, potato, and parsley, with a special focus on abiotic, developmental, and hormone-regulated processes. PMID:24492469
Nucleocytoplasmic shuttling of transcription factors
DEFF Research Database (Denmark)
Cartwright, P; Helin, K
2000-01-01
To elicit the transcriptional response following intra- or extracellular stimuli, the signals need to be transmitted to their site of action within the nucleus. The nucleocytoplasmic shuttling of transcription factors is a mechanism mediating this process. The activation and inactivation...... of the transcriptional response is essential for cells to progress through the cell cycle in a normal manner. The involvement of cytoplasmic and nuclear accessory molecules, and the general nuclear membrane transport components, are essential for this process. Although nuclear import and export for different...... transcription factor families are regulated by similar mechanisms, there are several differences that allow for the specific activation of each transcription factor. This review discusses the general import and export pathways found to be common amongst many different transcription factors, and highlights...
Transcriptional regulation by competing transcription factor modules.
Directory of Open Access Journals (Sweden)
Rutger Hermsen
2006-12-01
Full Text Available Gene regulatory networks lie at the heart of cellular computation. In these networks, intracellular and extracellular signals are integrated by transcription factors, which control the expression of transcription units by binding to cis-regulatory regions on the DNA. The designs of both eukaryotic and prokaryotic cis-regulatory regions are usually highly complex. They frequently consist of both repetitive and overlapping transcription factor binding sites. To unravel the design principles of these promoter architectures, we have designed in silico prokaryotic transcriptional logic gates with predefined input-output relations using an evolutionary algorithm. The resulting cis-regulatory designs are often composed of modules that consist of tandem arrays of binding sites to which the transcription factors bind cooperatively. Moreover, these modules often overlap with each other, leading to competition between them. Our analysis thus identifies a new signal integration motif that is based upon the interplay between intramodular cooperativity and intermodular competition. We show that this signal integration mechanism drastically enhances the capacity of cis-regulatory domains to integrate signals. Our results provide a possible explanation for the complexity of promoter architectures and could be used for the rational design of synthetic gene circuits.
The Journey of a Transcription Factor
DEFF Research Database (Denmark)
Pireyre, Marie
Plants have developed astonishing networks regulating their metabolism to adapt to their environment. The complexity of these networks is illustrated by the expansion of families of regulators such as transcription factors in the plant kingdom. Transcription factors specifically impact...... transcriptional networks by integrating exogenous and endogenous stimuli and regulating gene expression accordingly. Regulation of transcription factors and their activation is thus highly important to modulate the transcriptional programs and increase fitness of the plant in a given environment. Plant metabolism....... The biosynthetic machinery of GLS is governed by interplay of six MYB and three bHLH transcription factors. MYB28, MYB29 and MYB76 regulate methionine-derived GLS, and MYB51, MYB34 and MYB122 regulate tryptophan-derived GLS. The three bHLH transcription factors MYC2, MYC3 and MYC4 physically interact with all six...
A novel integrated 4-DOF radial hybrid magnetic bearing for MSCMG
Energy Technology Data Exchange (ETDEWEB)
Jinji, Sun; Ziyan, Ju [School of Instrumentation Science & Opto-electronics Engineering, Beijing University of Aeronautics and Astronautics, Science and Technology on Inertial Laboratory, Beijing 100191 (China); Weitao, Han, E-mail: hanweitaotao@163.com [CRRC Qingdao Sifang CO., LTD, Qingdao 266111 (China); Gang, Liu [School of Instrumentation Science & Opto-electronics Engineering, Beijing University of Aeronautics and Astronautics, Science and Technology on Inertial Laboratory, Beijing 100191 (China)
2017-01-01
This paper proposes a novel integrated radial hybrid magnetic bearing (RHMB) for application with the small-sized magnetically suspended control moment gyroscope (MSCMG), which can control four degrees of freedom (4-DOFs), including two radial translational DOFs and two radial tilting DOFs, and provide the axial passive resilience. The configuration and working principle of the RHMB are introduced. Mathematical models of radial force, axial resilience and moment are established by using equivalent magnetic circuit method (EMCM), from which the radial force–radial displacement, radial force–current relationships are derived, as well as axial resilience–axial displacement, moment–tilting angle and moment–current. Finite element method (FEM) is also applied to analyze the performance and characteristics of the RHMB. The analysis results are in good agreement with that calculated by the EMCM, which is helpful in designing, optimizing and controlling the RHMB. The comparisons between the performances of the integrated 4-DOF RHMB and the traditional 4-DOF RHMB are made. The contrast results indicate that the proposed integrated 4-DOF RHMB possesses better performance compared to the traditional structure, such as copper loss, current stiffness, and tilting current stiffness. - Highlights: • An integrated 4-DOF RHMB is proposed for the small-sized MSCMG. • The 4-DOF RHMB has good linear force–displacement and force–current characteristics. • The RHMB has good linear moment–current and the moment–tilting angle characteristic.
Directing traffic on DNA-How transcription factors relieve or induce transcriptional interference.
Hao, Nan; Palmer, Adam C; Dodd, Ian B; Shearwin, Keith E
2017-03-15
Transcriptional interference (TI) is increasingly recognized as a widespread mechanism of gene control, particularly given the pervasive nature of transcription, both sense and antisense, across all kingdoms of life. Here, we discuss how transcription factor binding kinetics strongly influence the ability of a transcription factor to relieve or induce TI.
Schaefer, Ulf; Schmeier, Sebastian; Bajic, Vladimir B.
2010-01-01
The initiation and regulation of transcription in eukaryotes is complex and involves a large number of transcription factors (TFs), which are known to bind to the regulatory regions of eukaryotic DNA. Apart from TF-DNA binding, protein-protein interaction involving TFs is an essential component of the machinery facilitating transcriptional regulation. Proteins that interact with TFs in the context of transcription regulation but do not bind to the DNA themselves, we consider transcription co-factors (TcoFs). The influence of TcoFs on transcriptional regulation and initiation, although indirect, has been shown to be significant with the functionality of TFs strongly influenced by the presence of TcoFs. While the role of TFs and their interaction with regulatory DNA regions has been well-studied, the association between TFs and TcoFs has so far been given less attention. Here, we present a resource that is comprised of a collection of human TFs and the TcoFs with which they interact. Other proteins that have a proven interaction with a TF, but are not considered TcoFs are also included. Our database contains 157 high-confidence TcoFs and additionally 379 hypothetical TcoFs. These have been identified and classified according to the type of available evidence for their involvement in transcriptional regulation and their presence in the cell nucleus. We have divided TcoFs into four groups, one of which contains high-confidence TcoFs and three others contain TcoFs which are hypothetical to different extents. We have developed the Dragon Database for Human Transcription Co-Factors and Transcription Factor Interacting Proteins (TcoF-DB). A web-based interface for this resource can be freely accessed at http://cbrc.kaust.edu.sa/tcof/ and http://apps.sanbi.ac.za/tcof/. © The Author(s) 2010.
Schaefer, Ulf
2010-10-21
The initiation and regulation of transcription in eukaryotes is complex and involves a large number of transcription factors (TFs), which are known to bind to the regulatory regions of eukaryotic DNA. Apart from TF-DNA binding, protein-protein interaction involving TFs is an essential component of the machinery facilitating transcriptional regulation. Proteins that interact with TFs in the context of transcription regulation but do not bind to the DNA themselves, we consider transcription co-factors (TcoFs). The influence of TcoFs on transcriptional regulation and initiation, although indirect, has been shown to be significant with the functionality of TFs strongly influenced by the presence of TcoFs. While the role of TFs and their interaction with regulatory DNA regions has been well-studied, the association between TFs and TcoFs has so far been given less attention. Here, we present a resource that is comprised of a collection of human TFs and the TcoFs with which they interact. Other proteins that have a proven interaction with a TF, but are not considered TcoFs are also included. Our database contains 157 high-confidence TcoFs and additionally 379 hypothetical TcoFs. These have been identified and classified according to the type of available evidence for their involvement in transcriptional regulation and their presence in the cell nucleus. We have divided TcoFs into four groups, one of which contains high-confidence TcoFs and three others contain TcoFs which are hypothetical to different extents. We have developed the Dragon Database for Human Transcription Co-Factors and Transcription Factor Interacting Proteins (TcoF-DB). A web-based interface for this resource can be freely accessed at http://cbrc.kaust.edu.sa/tcof/ and http://apps.sanbi.ac.za/tcof/. © The Author(s) 2010.
The WRKY transcription factor family in Brachypodium distachyon.
Tripathi, Prateek; Rabara, Roel C; Langum, Tanner J; Boken, Ashley K; Rushton, Deena L; Boomsma, Darius D; Rinerson, Charles I; Rabara, Jennifer; Reese, R Neil; Chen, Xianfeng; Rohila, Jai S; Rushton, Paul J
2012-06-22
A complete assembled genome sequence of wheat is not yet available. Therefore, model plant systems for wheat are very valuable. Brachypodium distachyon (Brachypodium) is such a system. The WRKY family of transcription factors is one of the most important families of plant transcriptional regulators with members regulating important agronomic traits. Studies of WRKY transcription factors in Brachypodium and wheat therefore promise to lead to new strategies for wheat improvement. We have identified and manually curated the WRKY transcription factor family from Brachypodium using a pipeline designed to identify all potential WRKY genes. 86 WRKY transcription factors were found, a total higher than all other current databases. We therefore propose that our numbering system (BdWRKY1-BdWRKY86) becomes the standard nomenclature. In the JGI v1.0 assembly of Brachypodium with the MIPS/JGI v1.0 annotation, nine of the transcription factors have no gene model and eleven gene models are probably incorrectly predicted. In total, twenty WRKY transcription factors (23.3%) do not appear to have accurate gene models. To facilitate use of our data, we have produced The Database of Brachypodium distachyon WRKY Transcription Factors. Each WRKY transcription factor has a gene page that includes predicted protein domains from MEME analyses. These conserved protein domains reflect possible input and output domains in signaling. The database also contains a BLAST search function where a large dataset of WRKY transcription factors, published genes, and an extensive set of wheat ESTs can be searched. We also produced a phylogram containing the WRKY transcription factor families from Brachypodium, rice, Arabidopsis, soybean, and Physcomitrella patens, together with published WRKY transcription factors from wheat. This phylogenetic tree provides evidence for orthologues, co-orthologues, and paralogues of Brachypodium WRKY transcription factors. The description of the WRKY transcription factor
Fatty Acid–Regulated Transcription Factors in the Liver
Jump, Donald B.; Tripathy, Sasmita; Depner, Christopher M.
2014-01-01
Fatty acid regulation of hepatic gene transcription was first reported in the early 1990s. Several transcription factors have been identified as targets of fatty acid regulation. This regulation is achieved by direct fatty acid binding to the transcription factor or by indirect mechanisms where fatty acids regulate signaling pathways controlling the expression of transcription factors or the phosphorylation, ubiquitination, or proteolytic cleavage of the transcription factor. Although dietary fatty acids are well-established regulators of hepatic transcription factors, emerging evidence indicates that endogenously generated fatty acids are equally important in controlling transcription factors in the context of glucose and lipid homeostasis. Our first goal in this review is to provide an up-to-date examination of the molecular and metabolic bases of fatty acid regulation of key transcription factors controlling hepatic metabolism. Our second goal is to link these mechanisms to nonalcoholic fatty liver disease (NAFLD), a growing health concern in the obese population. PMID:23528177
The Transcription Factor Encyclopedia
DEFF Research Database (Denmark)
Yusuf, Dimas; Butland, Stefanie L; Swanson, Magdalena I
2012-01-01
mini review articles on pertinent human, mouse and rat TFs. Notable features of the TFe website include a high-quality PDF generator and web API for programmatic data retrieval. TFe aims to rapidly educate scientists about the TFs they encounter through the delivery of succinct summaries written......ABSTRACT: Here we present the Transcription Factor Encyclopedia (TFe), a new web-based compendium of mini review articles on transcription factors (TFs) that is founded on the principles of open access and collaboration. Our consortium of over 100 researchers has collectively contributed over 130...
IKO: A Five Actuated DoF Upper Limb Exoskeleton Oriented to Workplace Assistance
Directory of Open Access Journals (Sweden)
Felix Martinez
2009-01-01
Full Text Available IKerlan’s Orthosis (IKO is an upper limb exoskeleton oriented to increasing human force during routine activity at the workplace. Therefore, it can be considered as a force-amplification device conceived to work in collaboration with the human arm and implementing biomimetic principles. The aim of the proposed design is to find the best compromise between maximum reachable workspace and minimum moving mass, which are the key factors for obtaining an ergonomic, wearable exoskeleton. It consists of five actuated degree of freedom (DoF to move the human arm and three non-actuated DoF between the back and shoulder to allow relative displacement of the sterno-clavicular joint. Conventional electrical motors are used for most of the DoF and pneumatic muscles for one of them (forearm rotation. Power transmission is based on Bowden cables. This paper presents the IKO design, the mechanical structure of a first prototype and the redesign process from an aesthetic point of view. Controller set-up and control strategies are also shown, together with dynamic performance from experimental results.
Effect of suspension kinematic on 14 DOF vehicle model
Wongpattananukul, T.; Chantharasenawong, C.
2017-12-01
Computer simulations play a major role in shaping modern science and engineering. They reduce time and resource consumption in new studies and designs. Vehicle simulations have been studied extensively to achieve a vehicle model used in minimum lap time solution. Simulation result accuracy depends on the abilities of these models to represent real phenomenon. Vehicles models with 7 degrees of freedom (DOF), 10 DOF and 14 DOF are normally used in optimal control to solve for minimum lap time. However, suspension kinematics are always neglected on these models. Suspension kinematics are defined as wheel movements with respect to the vehicle body. Tire forces are expressed as a function of wheel slip and wheel position. Therefore, the suspension kinematic relation is appended to the 14 DOF vehicle model to investigate its effects on the accuracy of simulate trajectory. Classical 14 DOF vehicle model is chosen as baseline model. Experiment data is collected from formula student style car test runs as baseline data for simulation and comparison between baseline model and model with suspension kinematic. Results show that in a single long turn there is an accumulated trajectory error in baseline model compared to model with suspension kinematic. While in short alternate turns, the trajectory error is much smaller. These results show that suspension kinematic had an effect on the trajectory simulation of vehicle. Which optimal control that use baseline model will result in inaccuracy control scheme.
TH-AB-202-11: Spatial and Rotational Quality Assurance of 6DOF Patient Tracking Systems
Energy Technology Data Exchange (ETDEWEB)
Belcher, AH; Liu, X; Grelewicz, Z; Wiersma, R [The University of Chicago, Chicago, IL (United States)
2016-06-15
Purpose: External tracking systems used for patient positioning and motion monitoring during radiotherapy are now capable of detecting both translations and rotations (6DOF). In this work, we develop a novel technique to evaluate the 6DOF performance of external motion tracking systems. We apply this methodology to an infrared (IR) marker tracking system and two 3D optical surface mapping systems in a common tumor 6DOF workspace. Methods: An in-house designed and built 6DOF parallel kinematics robotic motion phantom was used to follow input trajectories with sub-millimeter and sub-degree accuracy. The 6DOF positions of the robotic system were then tracked and recorded independently by three optical camera systems. A calibration methodology which associates the motion phantom and camera coordinate frames was first employed, followed by a comprehensive 6DOF trajectory evaluation, which spanned a full range of positions and orientations in a 20×20×16 mm and 5×5×5 degree workspace. The intended input motions were compared to the calibrated 6DOF measured points. Results: The technique found the accuracy of the IR marker tracking system to have maximal root mean square error (RMSE) values of 0.25 mm translationally and 0.09 degrees rotationally, in any one axis, comparing intended 6DOF positions to positions measured by the IR camera. The 6DOF RSME discrepancy for the first 3D optical surface tracking unit yielded maximal values of 0.60 mm and 0.11 degrees over the same 6DOF volume. An earlier generation 3D optical surface tracker was observed to have worse tracking capabilities than both the IR camera unit and the newer 3D surface tracking system with maximal RMSE of 0.74 mm and 0.28 degrees within the same 6DOF evaluation space. Conclusion: The proposed technique was effective at evaluating the performance of 6DOF patient tracking systems. All systems examined exhibited tracking capabilities at the sub-millimeter and sub-degree level within a 6DOF workspace.
NAC transcription factors: structurally distinct, functionally diverse
DEFF Research Database (Denmark)
Olsen, Addie Nina; Ernst, Heidi A; Leggio, Leila Lo
2005-01-01
level and localization, and to the first indications of NAC participation in transcription factor networks. The recent determination of the DNA and protein binding NAC domain structure offers insight into the molecular functions of the protein family. Research into NAC transcription factors has......NAC proteins constitute one of the largest families of plant-specific transcription factors, and the family is present in a wide range of land plants. Here, we summarize the biological and molecular functions of the NAC family, paying particular attention to the intricate regulation of NAC protein...
Comparative study of 2-DOF micromirrors for precision light manipulation
Young, Johanna I.; Shkel, Andrei M.
2001-08-01
Many industry experts predict that the future of fiber optic telecommunications depends on the development of all-optical components for switching of photonic signals from fiber to fiber throughout the networks. MEMS is a promising technology for providing all-optical switching at high speeds with significant cost reductions. This paper reports on the the analysis of two designs for 2-DOF electrostatically actuated MEMS micromirrors for precision controllable large optical switching arrays. The behavior of the micromirror designs is predicted by coupled-field electrostatic and modal analysis using a finite element analysis (FEA) multi-physics modeling software. The analysis indicates that the commonly used gimbal type mirror design experiences electrostatic interference and would therefore be difficult to precisely control for 2-DOF motion. We propose a new design approach which preserves 2-DOF actuation while minimizing electrostatic interference between the drive electrodes and the mirror. Instead of using two torsional axes, we use one actuator which combines torsional and flexural DOFs. A comparative analysis of the conventional gimbal design and the one proposed in this paper is performed.
A transcription factor active on the epidermal growth factor receptor gene
International Nuclear Information System (INIS)
Kageyama, R.; Merlino, G.T.; Pastan, I.
1988-01-01
The authors have developed an in vitro transcription system for the epidermal growth factor receptor (EGFR) oncogene by using nuclear extracts of A431 human epidermoid carcinoma cells, which overproduce EGFR. They found that a nuclear factor, termed EGFR-specific transcription factor (ETF), specifically stimulated EGFR transcription by 5- to 10-fold. In this report, ETF, purified by using sequence-specific oligonucleotide affinity chromatography, is shown by renaturing material eluted from a NaDodSO 4 /polyacrylamide gel to be a protein with a molecular mass of 120 kDa. ETF binds to the promoter region, as measured by DNase I footprinting and gel-mobility-shift assays, and specifically stimulates the transcription of the EGFR gene in a reconstituted in vitro transcription system. These results suggest that ETF could play a role in the overexpression of the cellular oncogene EGFR
Thermal Actuation Based 3-DoF Non-Resonant Microgyroscope Using MetalMUMPs
Directory of Open Access Journals (Sweden)
Muhammad Masood ul Hassan
2009-04-01
Full Text Available High force, large displacement and low voltage consumption are a primary concern for microgyroscopes. The chevron-shaped thermal actuators are unique in terms of high force generation combined with the large displacements at a low operating voltage in comparison with traditional electrostatic actuators. A Nickel based 3-DoF micromachined gyroscope comprising 2-DoF drive mode and 1-DoF sense mode oscillator utilizing the chevron-shaped thermal actuators is presented here. Analytical derivations and finite element simulations are carried out to predict the performance of the proposed device using the thermo-physical properties of electroplated nickel. The device sensitivity is improved by utilizing the dynamical amplification of the oscillation in 2-DoF drive mode using an active-passive mass configuration. A comprehensive theoretical description, dynamics and mechanical design considerations of the proposed gyroscopes model are discussed in detail. Parametric optimization of gyroscope, its prototype modeling and fabrication using MetalMUMPs has also been investigated. Dynamic transient simulation results predicted that the sense mass of the proposed device achieved a drive displacement of 4.1µm when a sinusoidal voltage of 0.5V is applied at 1.77 kHz exhibiting a mechanical sensitivity of 1.7μm /o/s in vacuum. The wide bandwidth frequency response of the 2-DoF drive mode oscillator consists of two resonant peaks and a flat region of 2.11 kHz between the peaks defining the operational frequency region. The sense mode resonant frequency can lie anywhere within this region and therefore the amplitude of the response is insensitive to structural parameter variations, enhancing device robustness against such variations. The proposed device has a size of 2.2 x 2.6 mm2, almost one third in comparison with existing M-DoF vibratory gyroscope with an estimated power consumption of 0.26 Watts. These predicted results illustrate that the chevron
DNA residence time is a regulatory factor of transcription repression
Clauß, Karen; Popp, Achim P.; Schulze, Lena; Hettich, Johannes; Reisser, Matthias; Escoter Torres, Laura; Uhlenhaut, N. Henriette
2017-01-01
Abstract Transcription comprises a highly regulated sequence of intrinsically stochastic processes, resulting in bursts of transcription intermitted by quiescence. In transcription activation or repression, a transcription factor binds dynamically to DNA, with a residence time unique to each factor. Whether the DNA residence time is important in the transcription process is unclear. Here, we designed a series of transcription repressors differing in their DNA residence time by utilizing the modular DNA binding domain of transcription activator-like effectors (TALEs) and varying the number of nucleotide-recognizing repeat domains. We characterized the DNA residence times of our repressors in living cells using single molecule tracking. The residence times depended non-linearly on the number of repeat domains and differed by more than a factor of six. The factors provoked a residence time-dependent decrease in transcript level of the glucocorticoid receptor-activated gene SGK1. Down regulation of transcription was due to a lower burst frequency in the presence of long binding repressors and is in accordance with a model of competitive inhibition of endogenous activator binding. Our single molecule experiments reveal transcription factor DNA residence time as a regulatory factor controlling transcription repression and establish TALE-DNA binding domains as tools for the temporal dissection of transcription regulation. PMID:28977492
Runx transcription factors in neuronal development
Directory of Open Access Journals (Sweden)
Shiga Takashi
2008-08-01
Full Text Available Abstract Runt-related (Runx transcription factors control diverse aspects of embryonic development and are responsible for the pathogenesis of many human diseases. In recent years, the functions of this transcription factor family in the nervous system have just begun to be understood. In dorsal root ganglion neurons, Runx1 and Runx3 play pivotal roles in the development of nociceptive and proprioceptive sensory neurons, respectively. Runx appears to control the transcriptional regulation of neurotrophin receptors, numerous ion channels and neuropeptides. As a consequence, Runx contributes to diverse aspects of the sensory system in higher vertebrates. In this review, we summarize recent progress in determining the role of Runx in neuronal development.
Research of a New 6-Dof Force Feedback Hand Controller System
Directory of Open Access Journals (Sweden)
Xin Gao
2014-01-01
Full Text Available The field of teleoperation with force telepresence has expanded its scope to include manipulation at different scales and in virtual worlds, and the key component of which is force feedback hand controller. This paper presents a novel force feedback hand controller system, including a 3-dof translational and 3-dof rotational hand controllers, respectively, to implement position and posture teleoperation of the robot end effector. The 3-dof translational hand controller adopts innovative three-axes decoupling structure based on the linear motor; the 3-dof rotational hand controller adopts serial mechanism based on three-axes intersecting at one point, improving its overall stiffness. Based on the kinematics, statics, and dynamics analyses for two platforms separately, the system applies big closed-loop force control method based on the zero force/torque, improving the feedback force/torque accuracy effectively. Experimental results show that self-developed 6-dof force feedback hand controller has good mechanical properties. The translational hand controller has the following advantages: simple kinematics solver, fast dynamic response, and better than 0.05 mm accuracy of three-axis end positioning, while the advantages of the rotational hand controller are wide turning space, larger than 1 Nm feedback, greater than 180 degrees of operating space of three axes, respectively, and high operation precision.
Xin Wang; Qiuzhi Song; Xiaoguang Wang; Pengzhan Liu
2018-01-01
The contradiction between self-weight and load capacity of a power-assisted upper-limb exoskeleton for material hanging is unresolved. In this paper, a non-anthropomorphic 3-degree of freedom (DOF) upper-limb exoskeleton with an internally rotated elbow joint is proposed based on an anthropomorphic 5-DOF upper-limb exoskeleton for power-assisted activity. The proposed 3-DOF upper-limb exoskeleton contains a 2-DOF shoulder joint and a 1-DOF internally rotated elbow joint. The structural parame...
Potential Role of Activating Transcription Factor 5 during Osteogenesis
Directory of Open Access Journals (Sweden)
Luisa Vicari
2016-01-01
Full Text Available Human adipose-derived stem cells are an abundant population of stem cells readily isolated from human adipose tissue that can differentiate into connective tissue lineages including bone, cartilage, fat, and muscle. Activating transcription factor 5 is a transcription factor of the ATF/cAMP response element-binding protein (CREB family. It is transcribed in two types of mRNAs (activating transcription factor 5 isoform 1 and activating transcription factor 5 isoform 2, encoding the same single 30-kDa protein. Although it is well demonstrated that it regulates the proliferation, differentiation, and apoptosis, little is known about its potential role in osteogenic differentiation. The aim of this study was to evaluate the expression levels of the two isoforms and protein during osteogenic differentiation of human adipose-derived stem cells. Our data indicate that activating transcription factor 5 is differentially expressed reaching a peak of expression at the stage of bone mineralization. These findings suggest that activating transcription factor 5 could play an interesting regulatory role during osteogenesis, which would provide a powerful tool to study bone physiology.
Potential Role of Activating Transcription Factor 5 during Osteogenesis.
Vicari, Luisa; Calabrese, Giovanna; Forte, Stefano; Giuffrida, Raffaella; Colarossi, Cristina; Parrinello, Nunziatina Laura; Memeo, Lorenzo
2016-01-01
Human adipose-derived stem cells are an abundant population of stem cells readily isolated from human adipose tissue that can differentiate into connective tissue lineages including bone, cartilage, fat, and muscle. Activating transcription factor 5 is a transcription factor of the ATF/cAMP response element-binding protein (CREB) family. It is transcribed in two types of mRNAs (activating transcription factor 5 isoform 1 and activating transcription factor 5 isoform 2), encoding the same single 30-kDa protein. Although it is well demonstrated that it regulates the proliferation, differentiation, and apoptosis, little is known about its potential role in osteogenic differentiation. The aim of this study was to evaluate the expression levels of the two isoforms and protein during osteogenic differentiation of human adipose-derived stem cells. Our data indicate that activating transcription factor 5 is differentially expressed reaching a peak of expression at the stage of bone mineralization. These findings suggest that activating transcription factor 5 could play an interesting regulatory role during osteogenesis, which would provide a powerful tool to study bone physiology.
Application of 2DOF controller for reactor power control. Verification by numerical simulation
International Nuclear Information System (INIS)
Ishikawa, Nobuyuki; Suzuki, Katsuo
1996-09-01
In this report the usefulness of the two degree of freedom (2DOF) control is discussed to improve the reference response characteristics and robustness for reactor power control system. The 2DOF controller consists of feedforward and feedback elements. The feedforward element was designed by model matching method and the feedback element by solving the mixed sensitivity problem of H ∞ control. The 2DOF control gives good performance in both reference response and robustness to disturbance and plant perturbation. The simulation of reactor power control was performed by digitizing the 2DOF controller with the digital control periods of 10[msec]. It is found that the control period of 10[msec] is enough not to make degradation of the control performance by digitizing. (author)
Design and implementation of a 2-DOF PID compensation for magnetic levitation systems.
Ghosh, Arun; Rakesh Krishnan, T; Tejaswy, Pailla; Mandal, Abhisek; Pradhan, Jatin K; Ranasingh, Subhakant
2014-07-01
This paper employs a 2-DOF (degree of freedom) PID controller for compensating a physical magnetic levitation system. It is shown that because of having a feedforward gain in the proposed 2-DOF PID control, the transient performance of the compensated system can be changed in a desired manner unlike the conventional 1-DOF PID control. It is also shown that for a choice of PID parameters, although the theoretical loop robustness is the same for both the compensated systems, in real-time, 2-DOF PID control may provide superior robustness if a suitable choice of the feedforward parameter is made. The results are verified through simulations and experiments. Copyright © 2014 ISA. Published by Elsevier Ltd. All rights reserved.
Polyphenol Compound as a Transcription Factor Inhibitor.
Park, Seyeon
2015-10-30
A target-based approach has been used to develop novel drugs in many therapeutic fields. In the final stage of intracellular signaling, transcription factor-DNA interactions are central to most biological processes and therefore represent a large and important class of targets for human therapeutics. Thus, we focused on the idea that the disruption of protein dimers and cognate DNA complexes could impair the transcriptional activation and cell transformation regulated by these proteins. Historically, natural products have been regarded as providing the primary leading compounds capable of modulating protein-protein or protein-DNA interactions. Although their mechanism of action is not fully defined, polyphenols including flavonoids were found to act mostly as site-directed small molecule inhibitors on signaling. There are many reports in the literature of screening initiatives suggesting improved drugs that can modulate the transcription factor interactions responsible for disease. In this review, we focus on polyphenol compound inhibitors against dimeric forms of transcription factor components of intracellular signaling pathways (for instance, c-jun/c-fos (Activator Protein-1; AP-1), c-myc/max, Nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) and β-catenin/T cell factor (Tcf)).
SoyDB: a knowledge database of soybean transcription factors
Directory of Open Access Journals (Sweden)
Valliyodan Babu
2010-01-01
Full Text Available Abstract Background Transcription factors play the crucial rule of regulating gene expression and influence almost all biological processes. Systematically identifying and annotating transcription factors can greatly aid further understanding their functions and mechanisms. In this article, we present SoyDB, a user friendly database containing comprehensive knowledge of soybean transcription factors. Description The soybean genome was recently sequenced by the Department of Energy-Joint Genome Institute (DOE-JGI and is publicly available. Mining of this sequence identified 5,671 soybean genes as putative transcription factors. These genes were comprehensively annotated as an aid to the soybean research community. We developed SoyDB - a knowledge database for all the transcription factors in the soybean genome. The database contains protein sequences, predicted tertiary structures, putative DNA binding sites, domains, homologous templates in the Protein Data Bank (PDB, protein family classifications, multiple sequence alignments, consensus protein sequence motifs, web logo of each family, and web links to the soybean transcription factor database PlantTFDB, known EST sequences, and other general protein databases including Swiss-Prot, Gene Ontology, KEGG, EMBL, TAIR, InterPro, SMART, PROSITE, NCBI, and Pfam. The database can be accessed via an interactive and convenient web server, which supports full-text search, PSI-BLAST sequence search, database browsing by protein family, and automatic classification of a new protein sequence into one of 64 annotated transcription factor families by hidden Markov models. Conclusions A comprehensive soybean transcription factor database was constructed and made publicly accessible at http://casp.rnet.missouri.edu/soydb/.
Modeling and controller design of a 6-DOF precision positioning system
Cai, Kunhai; Tian, Yanling; Liu, Xianping; Fatikow, Sergej; Wang, Fujun; Cui, Liangyu; Zhang, Dawei; Shirinzadeh, Bijan
2018-05-01
A key hurdle to meet the needs of micro/nano manipulation in some complex cases is the inadequate workspace and flexibility of the operation ends. This paper presents a 6-degree of freedom (DOF) serial-parallel precision positioning system, which consists of two compact type 3-DOF parallel mechanisms. Each parallel mechanism is driven by three piezoelectric actuators (PEAs), guided by three symmetric T-shape hinges and three elliptical flexible hinges, respectively. It can extend workspace and improve flexibility of the operation ends. The proposed system can be assembled easily, which will greatly reduce the assembly errors and improve the positioning accuracy. In addition, the kinematic and dynamic model of the 6-DOF system are established, respectively. Furthermore, in order to reduce the tracking error and improve the positioning accuracy, the Discrete-time Model Predictive Controller (DMPC) is applied as an effective control method. Meanwhile, the effectiveness of the DMCP control method is verified. Finally, the tracking experiment is performed to verify the tracking performances of the 6-DOF stage.
Radiation activation of transcription factors in mammalian cells
International Nuclear Information System (INIS)
Kraemer, M.; Stein, B.; Mai, S.; Kunz, E.; Koenig, H.; Ponta, H.; Herrlich, P.; Rahmsdorf, H.J.; Loferer, H.; Grunicke, H.H.
1990-01-01
In mammalian cells radiation induces the enhanced transcription of several genes. The cis acting elements in the control region of inducible genes have been delimited by site directed mutagenesis. Several different elements have been found in different genes. They do not only activate gene transcription in response to radiation but also in response to growth factors and to tumor promoter phorbol esters. The transcription factors binding to these elements are present also in non-irradiated cells, but their DNA binding activity and their transactivating capability is increased upon irradiation. The signal chain linking the primary radiation induced signal (damaged DNA) to the activation of transcription factors involves the action of (a) protein kinase(s). (orig.)
Development of 6-DOF painting robot control system
Huang, Junbiao; Liu, Jianqun; Gao, Weiqiang
2017-01-01
With the development of society, the spraying technology of manufacturing industry in China has changed from the manual operation to the 6-DOF (Degree Of Freedom)robot automatic spraying. Spraying painting robot can not only complete the work which does harm to human being, but also improve the production efficiency and save labor costs. Control system is the most critical part of the 6-DOF robots, however, there is still a lack of relevant technology research in China. It is very necessary to study a kind of control system of 6-DOF spraying painting robots which is easy to operation, and has high efficiency and stable performance. With Googol controller platform, this paper develops programs based on Windows CE embedded systems to control the robot to finish the painting work. Software development is the core of the robot control system, including the direct teaching module, playback module, motion control module, setting module, man-machine interface, alarm module, log module, etc. All the development work of the entire software system has been completed, and it has been verified that the entire software works steady and efficient.
On non-linear dynamics of coupled 1+1DOF versus 1+1/2DOF Electro-Mechanical System
DEFF Research Database (Denmark)
Darula, Radoslav; Sorokin, Sergey
2014-01-01
The electro-mechanical systems (EMS) are used from nano-/micro-scale (NEMS/MEMS) up to macro-scale applications. From mathematical view point, they are modelled with the second order differential equation (or a set of equations) for mechanical system, which is nonlinearly coupled with the second...... or the first order differential equation (or a set of equations) for electrical system, depending on properties of the electrical circuit. For the sake of brevity, we assume a 1DOF mechanical system, coupled to 1 or 1/2DOF electrical system (depending whether the capacitance is, or is not considered......). In the paper, authors perform a parametric study to identify operation regimes, where the capacitance term contributes to the non-linear behaviour of the coupled system. To accomplish this task, the classical method of multiple scales is used. The parametric study allows us to assess for which applications...
Comparison of Transcription Factor Binding Site Models
Bhuyan, Sharifulislam
2012-05-01
Modeling of transcription factor binding sites (TFBSs) and TFBS prediction on genomic sequences are important steps to elucidate transcription regulatory mechanism. Dependency of transcription regulation on a great number of factors such as chemical specificity, molecular structure, genomic and epigenetic characteristics, long distance interaction, makes this a challenging problem. Different experimental procedures generate evidence that DNA-binding domains of transcription factors show considerable DNA sequence specificity. Probabilistic modeling of TFBSs has been moderately successful in identifying patterns from a family of sequences. In this study, we compare performances of different probabilistic models and try to estimate their efficacy over experimental TFBSs data. We build a pipeline to calculate sensitivity and specificity from aligned TFBS sequences for several probabilistic models, such as Markov chains, hidden Markov models, Bayesian networks. Our work, containing relevant statistics and evaluation for the models, can help researchers to choose the most appropriate model for the problem at hand.
DELLA-induced early transcriptional changes during etiolated development in Arabidopsis thaliana.
Directory of Open Access Journals (Sweden)
Javier Gallego-Bartolomé
Full Text Available The hormones gibberellins (GAs control a wide variety of processes in plants, including stress and developmental responses. This task largely relies on the activity of the DELLA proteins, nuclear-localized transcriptional regulators that do not seem to have DNA binding capacity. The identification of early target genes of DELLA action is key not only to understand how GAs regulate physiological responses, but also to get clues about the molecular mechanisms by which DELLAs regulate gene expression. Here, we have investigated the global, early transcriptional response triggered by the Arabidopsis DELLA protein GAI during skotomorphogenesis, a developmental program tightly regulated by GAs. Our results show that the induction of GAI activity has an almost immediate effect on gene expression. Although this transcriptional regulation is largely mediated by the PIFs and HY5 transcription factors based on target meta-analysis, additional evidence points to other transcription factors that would be directly involved in DELLA regulation of gene expression. First, we have identified cis elements recognized by Dofs and type-B ARRs among the sequences enriched in the promoters of GAI targets; and second, an enrichment in additional cis elements appeared when this analysis was extended to a dataset of early targets of the DELLA protein RGA: CArG boxes, bound by MADS-box proteins, and the E-box CACATG that links the activity of DELLAs to circadian transcriptional regulation. Finally, Gene Ontology analysis highlights the impact of DELLA regulation upon the homeostasis of the GA, auxin, and ethylene pathways, as well as upon pre-existing transcriptional networks.
Polyphenol Compound as a Transcription Factor Inhibitor
Directory of Open Access Journals (Sweden)
Seyeon Park
2015-10-01
Full Text Available A target-based approach has been used to develop novel drugs in many therapeutic fields. In the final stage of intracellular signaling, transcription factor–DNA interactions are central to most biological processes and therefore represent a large and important class of targets for human therapeutics. Thus, we focused on the idea that the disruption of protein dimers and cognate DNA complexes could impair the transcriptional activation and cell transformation regulated by these proteins. Historically, natural products have been regarded as providing the primary leading compounds capable of modulating protein–protein or protein-DNA interactions. Although their mechanism of action is not fully defined, polyphenols including flavonoids were found to act mostly as site-directed small molecule inhibitors on signaling. There are many reports in the literature of screening initiatives suggesting improved drugs that can modulate the transcription factor interactions responsible for disease. In this review, we focus on polyphenol compound inhibitors against dimeric forms of transcription factor components of intracellular signaling pathways (for instance, c-jun/c-fos (Activator Protein-1; AP-1, c-myc/max, Nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB and β-catenin/T cell factor (Tcf.
Kinematics and Workspace of a 4-DOF Hybrid Palletizing Robot
Directory of Open Access Journals (Sweden)
Yong Tao
2014-06-01
Full Text Available We presented the kinematical analysis of a 4-DOF hybrid palletizing robot. The palletizing robot structure was proposed and the arm model of the robot was presented. The kinematical analysis of the end robotic manipulator was given. As a result, the position, velocity, and acceleration curves as well as the maximum workspace were demonstrated by simulation in Matlab. This study would be useful for the kinematical characteristics of the 4-DOF palletizing robot in space.
Rocking motion of structures under earthquakes. Overturning of 2-DOF system
International Nuclear Information System (INIS)
Kobayashi, Koichi; Watanabe, Tetsuya; Tanaka, Kihachiro; Tomoda, Akinori
2011-01-01
In recent years, huge earthquakes happen, for example, The South Hyogo prefecture Earthquake in 1995, The Mid Niigata Prefecture Earthquake in 2004, The Iwate-Miyagi Nairiku Earthquake in 2008. In The Niigataken Chuetsu-oki Earthquake in 2007, hundreds of drums fell down and water spilled out. A lot of studies about rocking behavior of rigid body had been performed from 1960's. However, these studies were only for a specific condition of the structure size or input vibration characteristics. Therefore, generalizes fall condition for earthquake is required. This paper deals with the analytical and the experimental study of the rocking vibration of 1-DOF rocking system, 2-DOF vibration-rocking system and 2-DOF rocking system under earthquakes. In this study, the equation of motion for each rocking systems are developed. The numerical model of 2-DOF rocking system is evaluated by free rocking experiment. In this paper, 'Overturning Map' which can distinguish whether structures falls or not is proposed. The overturning map of each rocking systems excited by the artificial earthquake wave calculated from the design spectrum is shown. As the result, overturning condition of structures is clarified. (author)
Protein-protein interactions in the regulation of WRKY transcription factors.
Chi, Yingjun; Yang, Yan; Zhou, Yuan; Zhou, Jie; Fan, Baofang; Yu, Jing-Quan; Chen, Zhixiang
2013-03-01
It has been almost 20 years since the first report of a WRKY transcription factor, SPF1, from sweet potato. Great progress has been made since then in establishing the diverse biological roles of WRKY transcription factors in plant growth, development, and responses to biotic and abiotic stress. Despite the functional diversity, almost all analyzed WRKY proteins recognize the TTGACC/T W-box sequences and, therefore, mechanisms other than mere recognition of the core W-box promoter elements are necessary to achieve the regulatory specificity of WRKY transcription factors. Research over the past several years has revealed that WRKY transcription factors physically interact with a wide range of proteins with roles in signaling, transcription, and chromatin remodeling. Studies of WRKY-interacting proteins have provided important insights into the regulation and mode of action of members of the important family of transcription factors. It has also emerged that the slightly varied WRKY domains and other protein motifs conserved within each of the seven WRKY subfamilies participate in protein-protein interactions and mediate complex functional interactions between WRKY proteins and between WRKY and other regulatory proteins in the modulation of important biological processes. In this review, we summarize studies of protein-protein interactions for WRKY transcription factors and discuss how the interacting partners contribute, at different levels, to the establishment of the complex regulatory and functional network of WRKY transcription factors.
Emerging Functions of Transcription Factors in Malaria Parasite
Directory of Open Access Journals (Sweden)
Renu Tuteja
2011-01-01
Full Text Available Transcription is a process by which the genetic information stored in DNA is converted into mRNA by enzymes known as RNA polymerase. Bacteria use only one RNA polymerase to transcribe all of its genes while eukaryotes contain three RNA polymerases to transcribe the variety of eukaryotic genes. RNA polymerase also requires other factors/proteins to produce the transcript. These factors generally termed as transcription factors (TFs are either associated directly with RNA polymerase or add in building the actual transcription apparatus. TFs are the most common tools that our cells use to control gene expression. Plasmodium falciparum is responsible for causing the most lethal form of malaria in humans. It shows most of its characteristics common to eukaryotic transcription but it is assumed that mechanisms of transcriptional control in P. falciparum somehow differ from those of other eukaryotes. In this article we describe the studies on the main TFs such as myb protein, high mobility group protein and ApiA2 family proteins from malaria parasite. These studies show that these TFs are slowly emerging to have defined roles in the regulation of gene expression in the parasite.
Directory of Open Access Journals (Sweden)
Xin Wang
2018-03-01
Full Text Available The contradiction between self-weight and load capacity of a power-assisted upper-limb exoskeleton for material hanging is unresolved. In this paper, a non-anthropomorphic 3-degree of freedom (DOF upper-limb exoskeleton with an internally rotated elbow joint is proposed based on an anthropomorphic 5-DOF upper-limb exoskeleton for power-assisted activity. The proposed 3-DOF upper-limb exoskeleton contains a 2-DOF shoulder joint and a 1-DOF internally rotated elbow joint. The structural parameters of the 3-DOF upper-limb exoskeleton were determined, and the differences and singularities of the two exoskeletons were analyzed. The workspace, the joint torques and the power consumption of two exoskeletons were analyzed by kinematics and dynamics, and an exoskeleton prototype experiment was performed. The results showed that, compared with a typical anthropomorphic upper-limb exoskeleton, the non-anthropomorphic 3-DOF upper-limb exoskeleton had the same actual workspace; eliminated singularities within the workspace; improved the elbow joint force situation; and the maximum elbow joint torque, elbow external-flexion/internal-extension and shoulder flexion/extension power consumption were significantly reduced. The proposed non-anthropomorphic 3-DOF upper-limb exoskeleton can be applied to a power-assisted upper-limb exoskeleton in industrial settings.
Transcription Factor Functional Protein-Protein Interactions in Plant Defense Responses
Directory of Open Access Journals (Sweden)
Murilo S. Alves
2014-03-01
Full Text Available Responses to biotic stress in plants lead to dramatic reprogramming of gene expression, favoring stress responses at the expense of normal cellular functions. Transcription factors are master regulators of gene expression at the transcriptional level, and controlling the activity of these factors alters the transcriptome of the plant, leading to metabolic and phenotypic changes in response to stress. The functional analysis of interactions between transcription factors and other proteins is very important for elucidating the role of these transcriptional regulators in different signaling cascades. In this review, we present an overview of protein-protein interactions for the six major families of transcription factors involved in plant defense: basic leucine zipper containing domain proteins (bZIP, amino-acid sequence WRKYGQK (WRKY, myelocytomatosis related proteins (MYC, myeloblastosis related proteins (MYB, APETALA2/ ETHYLENE-RESPONSIVE ELEMENT BINDING FACTORS (AP2/EREBP and no apical meristem (NAM, Arabidopsis transcription activation factor (ATAF, and cup-shaped cotyledon (CUC (NAC. We describe the interaction partners of these transcription factors as molecular responses during pathogen attack and the key components of signal transduction pathways that take place during plant defense responses. These interactions determine the activation or repression of response pathways and are crucial to understanding the regulatory networks that modulate plant defense responses.
NUR TRANSCRIPTION FACTORS IN STRESS AND ADDICTION
Directory of Open Access Journals (Sweden)
Danae eCampos-Melo
2013-12-01
Full Text Available The Nur transcription factors Nur77 (NGFI-B, NR4A1, Nurr1 (NR4A2 and Nor-1 (NR4A3 are a sub-family of orphan members of the nuclear receptor superfamily. These transcription factors are products of immediate early genes, whose expression is rapidly and transiently induced in the central nervous system by several types of stimuli. Nur factors are present throughout the hypothalamus-pituitary-adrenal axis where are prominently induced in response to stress. Drugs of abuse and stress also induce the expression of Nur factors in nuclei of the motivation/reward circuit of the brain, indicating their participation in the process of drug addiction and in non-hypothalamic responses to stress. Repeated use of addictive drugs and chronic stress induce long-lasting dysregulation of the brain motivation/reward circuit, due to reprogramming of gene expression and enduring alterations in neuronal function. Here, we review the data supporting that Nur transcription factors are key players in the molecular basis of the dysregulation of neuronal circuits involved in chronic stress and addiction.
Simulated Energy Usage for a Novel 6 DOF Articulated Robot
International Nuclear Information System (INIS)
Shaik, A A; Tlale, N; Bright, G
2014-01-01
The serial robot architecture is widespread in modern day manufacturing, and over the last few decades the technology has matured and settled to its current state. One drawback from the architecture however is the location of motors and gearboxes which are either at the joint it controls or close by. A novel hybrid 6 DOF robot was designed to move all the actuators to the robot base, and to control the desired axis through a set of connected links and gears, while maintaining the same workspace and dexterity. This would reduce the inertia of the movable part of the robot and some of the moment arms on the 3 axes required for translation of the 3 DOF spherical wrist. Doing so would decrease the energy requirements when compared to a 6 DOF serial robot. This paper focuses on the mathematical modelling and simulation of the novel hybrid machine design and compares it to an equivalent serial robot
TH-EF-BRB-08: Robotic Motion Compensation for Radiation Therapy: A 6DOF Phantom Study
Energy Technology Data Exchange (ETDEWEB)
Belcher, AH; Liu, X; Wiersma, R [The University of Chicago, Chicago, IL (United States)
2016-06-15
Purpose: The high accuracy of frame-based stereotactic radiosurgery (SRS), which uses a rigid frame fixed to the patient’s skull, is offset by potential drawbacks of poor patient compliance and clinical workflow restrictions. Recent research into frameless SRS has so far resulted in reduced accuracy. In this study, we investigate the use of a novel 6 degree-of-freedom (6DOF) robotic head motion cancellation system that continuously detects and compensates for patient head motions during a SRS delivery. This approach has the potential to reduce invasiveness while still achieving accuracies better or equal to traditional frame-based SRS. Methods: A 6DOF parallel kinematics robotics stage was constructed, and controlled using an inverse kinematics-based motion compensation algorithm. A 6DOF stereoscopic infrared (IR) marker tracking system was used to monitor real-time motions at sub-millimeter and sub-degree levels. A novel 6DOF calibration technique was first applied to properly orient the camera coordinate frame to match that of the LINAC and robotic control frames. Simulated head motions were measured by the system, and the robotic stage responded to these 6DOF motions automatically, returning the reflective marker coordinate frame to its original position. Results: After the motions were introduced to the system in the phantom-based study, the robotic stage automatically and rapidly returned the phantom to LINAC isocenter. When errors exceeded the compensation lower threshold of 0.25 mm or 0.25 degrees, the system registered the 6DOF error and generated a cancellation trajectory. The system responded in less than 0.5 seconds and returned all axes to less than 0.1 mm and 0.1 degree after the 6DOF compensation was performed. Conclusion: The 6DOF real-time motion cancellation system was found to be effective at compensating for translational and rotational motions to current SRS requirements. This system can improve frameless SRS by automatically returning
TH-EF-BRB-08: Robotic Motion Compensation for Radiation Therapy: A 6DOF Phantom Study
International Nuclear Information System (INIS)
Belcher, AH; Liu, X; Wiersma, R
2016-01-01
Purpose: The high accuracy of frame-based stereotactic radiosurgery (SRS), which uses a rigid frame fixed to the patient’s skull, is offset by potential drawbacks of poor patient compliance and clinical workflow restrictions. Recent research into frameless SRS has so far resulted in reduced accuracy. In this study, we investigate the use of a novel 6 degree-of-freedom (6DOF) robotic head motion cancellation system that continuously detects and compensates for patient head motions during a SRS delivery. This approach has the potential to reduce invasiveness while still achieving accuracies better or equal to traditional frame-based SRS. Methods: A 6DOF parallel kinematics robotics stage was constructed, and controlled using an inverse kinematics-based motion compensation algorithm. A 6DOF stereoscopic infrared (IR) marker tracking system was used to monitor real-time motions at sub-millimeter and sub-degree levels. A novel 6DOF calibration technique was first applied to properly orient the camera coordinate frame to match that of the LINAC and robotic control frames. Simulated head motions were measured by the system, and the robotic stage responded to these 6DOF motions automatically, returning the reflective marker coordinate frame to its original position. Results: After the motions were introduced to the system in the phantom-based study, the robotic stage automatically and rapidly returned the phantom to LINAC isocenter. When errors exceeded the compensation lower threshold of 0.25 mm or 0.25 degrees, the system registered the 6DOF error and generated a cancellation trajectory. The system responded in less than 0.5 seconds and returned all axes to less than 0.1 mm and 0.1 degree after the 6DOF compensation was performed. Conclusion: The 6DOF real-time motion cancellation system was found to be effective at compensating for translational and rotational motions to current SRS requirements. This system can improve frameless SRS by automatically returning
Kulakovskiy, Ivan V.; Belostotsky, A. A.; Kasianov, Artem S.; Esipova, Natalia G.; Medvedeva, Yulia; Eliseeva, Irina A.; Makeev, Vsevolod J.
2011-01-01
Motivation: Modern experimental methods provide substantial information on protein-DNA recognition. Studying arrangements of transcription factor binding sites (TFBSs) of interacting transcription factors (TFs) advances understanding
Particularities of fully-parallel manipulators in 6-DOFs robots design: a review of critical aspects
Directory of Open Access Journals (Sweden)
Milica Lucian
2017-01-01
Full Text Available A whole range of industrial applications requires the presence of parallel mechanisms with six degrees of freedom (6-DOF which have been developed in the last fifteen years, and one of the reasons why they still are a current topic is that present-day computers are capable of performing real-time motion laws of great complexity associated with these types of parallel mechanisms. The present work underlines particularities of parallel manipulators and their importance in the design of 6-DOF robots. The paper reveals the progress made in the last twenty years in the development of 6-DOF parallel manipulators, which increasingly find a wide scope of applications in different industrial areas such as robotics, manufacture and assisted medicine. It also emphasizes the need to determine singular configurations and the effect of cinematic redundancy which can increase the working space of the manipulators by adding active joints in one or more branches of the manipulator. Throughout the work, there were outlined three types of singularities encountered in the modelling of different types of parallel manipulators, and three types of redundancy. Furthermore, an analysis was made of the dimension of the workspace for a series of parallel manipulators, highlighting a number of factors that influence its size.
Factor requirements for transcription in the Archaeon Sulfolobus shibatae.
Qureshi, S A; Bell, S D; Jackson, S P
1997-05-15
Archaea (archaebacteria) constitute a domain of life that is distinct from Bacteria (eubacteria) and Eucarya (eukaryotes). Although archaeal cells share many morphological features with eubacteria, their transcriptional apparatus is more akin to eukaryotic RNA polymerases I, II and III than it is to eubacterial transcription systems. Thus, in addition to possessing a 10 subunit RNA polymerase and a homologue of the TATA-binding protein (TBP), Archaea possess a polypeptide termed TFB that is homologous to eukaryotic TFIIB. Here, we investigate the factor requirements for transcription of several promoters of the archaeon Sulfolobus shibatae and its associated virus SSV. Through in vitro transcription and immunodepletion, we demonstrate that S. shibatae TBP, TFB and RNA polymerase are not complexed tightly with one another and that each is required for efficient transcription of all promoters tested. Furthermore, full transcription is restored by supplementing respective depleted extracts with recombinant TBP or TFB, indicating that TBP-associated factors or TFB-associated factors are not required. Indeed, gel-filtration suggests that Sulfolobus TBP and TFB are not associated stably with other proteins. Finally, all promoters analysed are transcribed accurately and efficiently in an in vitro system comprising recombinant TBP and TFB, together with essentially homogeneous preparation of RNA polymerase. Transcription in Archaea is therefore fundamentally homologous to that in eukaryotes, although factor requirements appear to be much less complex.
Transcription factor-based biosensor
Dietrich, Jeffrey A; Keasling, Jay D
2013-10-08
The present invention provides for a system comprising a BmoR transcription factor, a .sigma..sup.54-RNA polymerase, and a pBMO promoter operatively linked to a reporter gene, wherein the pBMO promoter is capable of expression of the reporter gene with an activated form of the BmoR and the .sigma..sup.54-RNA polymerase.
Detecting Differential Transcription Factor Activity from ATAC-Seq Data
Directory of Open Access Journals (Sweden)
Ignacio J. Tripodi
2018-05-01
Full Text Available Transcription factors are managers of the cellular factory, and key components to many diseases. Many non-coding single nucleotide polymorphisms affect transcription factors, either by directly altering the protein or its functional activity at individual binding sites. Here we first briefly summarize high-throughput approaches to studying transcription factor activity. We then demonstrate, using published chromatin accessibility data (specifically ATAC-seq, that the genome-wide profile of TF recognition motifs relative to regions of open chromatin can determine the key transcription factor altered by a perturbation. Our method of determining which TFs are altered by a perturbation is simple, is quick to implement, and can be used when biological samples are limited. In the future, we envision that this method could be applied to determine which TFs show altered activity in response to a wide variety of drugs and diseases.
Design Optimization of a Cable-Driven Two-DOF Flexible Joint Module
Directory of Open Access Journals (Sweden)
Zhao Zhang
2012-11-01
Full Text Available This paper focuses on the kinematics, kinetostatics and design optimization of a 2-DOF cable-driven flexible joint module. Based on the motion characteristics of the 2-DOF joint module, the concept of instantaneous screw axis in conjunction with the Product-Of-Exponentials (POE formula is proposed to formulate its kinematic model. However, as the instantaneous screw axis is unfixed, the Lie group method is employed to derive the instantaneous kinematic model of the joint module. In order to generate the feasible workspace subject to positive tension constraint, the kinetostatics of the joint module is addressed, where the stiffness resulting from both the driving cables and the flexible backbone are considered. A numerical orientation workspace evaluation method is proposed based on an equi-volumetric partition in its parametric space and the volume-element associated integral factor. A global singular value (GSV index, which considers the minimum singular value of the stiffness matrix of joint module over the achievable workspace, is employed to optimize the geometric size of joint module. The simulation results demonstrate the effectiveness of the proposed GSV optimization algorithm.
Functional Profiling of Transcription Factor Genes in Neurospora crassa
Directory of Open Access Journals (Sweden)
Alexander J. Carrillo
2017-09-01
Full Text Available Regulation of gene expression by DNA-binding transcription factors is essential for proper control of growth and development in all organisms. In this study, we annotate and characterize growth and developmental phenotypes for transcription factor genes in the model filamentous fungus Neurospora crassa. We identified 312 transcription factor genes, corresponding to 3.2% of the protein coding genes in the genome. The largest class was the fungal-specific Zn2Cys6 (C6 binuclear cluster, with 135 members, followed by the highly conserved C2H2 zinc finger group, with 61 genes. Viable knockout mutants were produced for 273 genes, and complete growth and developmental phenotypic data are available for 242 strains, with 64% possessing at least one defect. The most prominent defect observed was in growth of basal hyphae (43% of mutants analyzed, followed by asexual sporulation (38%, and the various stages of sexual development (19%. Two growth or developmental defects were observed for 21% of the mutants, while 8% were defective in all three major phenotypes tested. Analysis of available mRNA expression data for a time course of sexual development revealed mutants with sexual phenotypes that correlate with transcription factor transcript abundance in wild type. Inspection of this data also implicated cryptic roles in sexual development for several cotranscribed transcription factor genes that do not produce a phenotype when mutated.
International Nuclear Information System (INIS)
Liu Wenjin; Sun Maoyun; Jiang Jianhai; Shen Xiaoyun; Sun Qing; Liu Weicheng; Shen Hailian; Gu Jianxin
2004-01-01
The Cyclin D3 protein is a member of the D-type cyclins. Besides serving as cell cycle regulators, D-type cyclins have been reported to be able to interact with several transcription factors and modulate their transcriptional activations. Here we report that human activating transcription factor 5 (hATF5) is a new interacting partner of Cyclin D3. The interaction was confirmed by in vivo coimmunoprecipitation and in vitro binding analysis. Neither interaction between Cyclin D1 and hATF5 nor interaction between Cyclin D2 and hATF5 was observed. Confocal microscopy analysis showed that Cyclin D3 could colocalize with hATF5 in the nuclear region. Cyclin D3 could potentiate hATF5 transcriptional activity independently of its Cdk4 partner. But Cyclin D1 and Cyclin D2 had no effect on hATF5 transcriptional activity. These data provide a new clue to understand the new role of Cyclin D3 as a transcriptional regulator
Modulation of DNA binding by gene-specific transcription factors.
Schleif, Robert F
2013-10-01
The transcription of many genes, particularly in prokaryotes, is controlled by transcription factors whose activity can be modulated by controlling their DNA binding affinity. Understanding the molecular mechanisms by which DNA binding affinity is regulated is important, but because forming definitive conclusions usually requires detailed structural information in combination with data from extensive biophysical, biochemical, and sometimes genetic experiments, little is truly understood about this topic. This review describes the biological requirements placed upon DNA binding transcription factors and their consequent properties, particularly the ways that DNA binding affinity can be modulated and methods for its study. What is known and not known about the mechanisms modulating the DNA binding affinity of a number of prokaryotic transcription factors, including CAP and lac repressor, is provided.
Transcriptional repression of BODENLOS by HD-ZIP transcription factor HB5 in Arabidopsis thaliana.
Smet, De I.; Lau, S.; Ehrismann, J.S.; Axiotis, I.; Kolb, M.; Kientz, M.; Weijers, D.; Jürgens, G.
2013-01-01
In Arabidopsis thaliana, the phytohormone auxin is an important patterning agent during embryogenesis and post-embryonic development, exerting effects through transcriptional regulation. The main determinants of the transcriptional auxin response machinery are AUXIN RESPONSE FACTOR (ARF)
BALCO 6/7-DoF trajectory model
Wey, P.; Corriveau, D.; Saitz, T.A.; Ruijter, W. de; Strömbäck, P.
2016-01-01
BALCO is a six- and seven-degree-of-freedom trajectory simulation program based on the mathematical model defined by the NATO Standardization Recommendation 4618. The primary goal of BALCO is to compute high-fidelity trajectories for both conventional and precision-guided projectiles. The 6-DoF
Directory of Open Access Journals (Sweden)
Ranjith Ambili
2017-01-01
Full Text Available Periodontal disease is initiated by microorganisms in dental plaque, and host immunoinflammatory response to the microbial challenge helps in disease progression. Conventional periodontal therapy was mainly targeted on the elimination of microbial component. However, a better understanding of molecular aspects in host response will enable the clinicians to formulate effective host modulation therapy (HMT for the periodontal management. Inflammatory mediators were the main targets for HMT in the past. Transcription factors can regulate the production of multiple mediators simultaneously, and inhibition of these factors will be more beneficial than blocking individual molecule. Two important transcription factors implicated in chronic inflammatory diseases are nuclear factor kappa B (NF-κB and signal transducers and activators of transcription 3. The role of these factors in periodontal disease is a less explored area. This comprehensive review is aimed at unveiling the critical role of NF-κB and signal transducers and activators of transcription 3 in periodontal pathogenesis. An online search was performed using MEDLINE/PubMed database. All publications till 2016 related to NF-κB, signal transducer and activator of transcription 3 (STAT3, and inflammation were included in writing this review. A total of 27,390 references were published based on the search terms used. Out of these, 507 were related to the periodontal research published in English till 2016. Relevant papers were chosen after carefully reading the abstract. This review has attempted to comprehend the existing knowledge regarding the role of transcription factors NF-κB and STAT3 in periodontal disease. Moreover, it also provides a connecting molecular link for the periodontal medicine concept.
Towards frameless maskless SRS through real-time 6DoF robotic motion compensation
Belcher, Andrew H.; Liu, Xinmin; Chmura, Steven; Yenice, Kamil; Wiersma, Rodney D.
2017-12-01
Stereotactic radiosurgery (SRS) uses precise dose placement to treat conditions of the CNS. Frame-based SRS uses a metal head ring fixed to the patient’s skull to provide high treatment accuracy, but patient comfort and clinical workflow may suffer. Frameless SRS, while potentially more convenient, may increase uncertainty of treatment accuracy and be physiologically confining to some patients. By incorporating highly precise robotics and advanced software algorithms into frameless treatments, we present a novel frameless and maskless SRS system where a robot provides real-time 6DoF head motion stabilization allowing positional accuracies to match or exceed those of traditional frame-based SRS. A 6DoF parallel kinematics robot was developed and integrated with a real-time infrared camera in a closed loop configuration. A novel compensation algorithm was developed based on an iterative closest-path correction approach. The robotic SRS system was tested on six volunteers, whose motion was monitored and compensated for in real-time over 15 min simulated treatments. The system’s effectiveness in maintaining the target’s 6DoF position within preset thresholds was determined by comparing volunteer head motion with and without compensation. Comparing corrected and uncorrected motion, the 6DoF robotic system showed an overall improvement factor of 21 in terms of maintaining target position within 0.5 mm and 0.5 degree thresholds. Although the system’s effectiveness varied among the volunteers examined, for all volunteers tested the target position remained within the preset tolerances 99.0% of the time when robotic stabilization was used, compared to 4.7% without robotic stabilization. The pre-clinical robotic SRS compensation system was found to be effective at responding to sub-millimeter and sub-degree cranial motions for all volunteers examined. The system’s success with volunteers has demonstrated its capability for implementation with frameless and
Towards frameless maskless SRS through real-time 6DoF robotic motion compensation.
Belcher, Andrew H; Liu, Xinmin; Chmura, Steven; Yenice, Kamil; Wiersma, Rodney D
2017-11-13
Stereotactic radiosurgery (SRS) uses precise dose placement to treat conditions of the CNS. Frame-based SRS uses a metal head ring fixed to the patient's skull to provide high treatment accuracy, but patient comfort and clinical workflow may suffer. Frameless SRS, while potentially more convenient, may increase uncertainty of treatment accuracy and be physiologically confining to some patients. By incorporating highly precise robotics and advanced software algorithms into frameless treatments, we present a novel frameless and maskless SRS system where a robot provides real-time 6DoF head motion stabilization allowing positional accuracies to match or exceed those of traditional frame-based SRS. A 6DoF parallel kinematics robot was developed and integrated with a real-time infrared camera in a closed loop configuration. A novel compensation algorithm was developed based on an iterative closest-path correction approach. The robotic SRS system was tested on six volunteers, whose motion was monitored and compensated for in real-time over 15 min simulated treatments. The system's effectiveness in maintaining the target's 6DoF position within preset thresholds was determined by comparing volunteer head motion with and without compensation. Comparing corrected and uncorrected motion, the 6DoF robotic system showed an overall improvement factor of 21 in terms of maintaining target position within 0.5 mm and 0.5 degree thresholds. Although the system's effectiveness varied among the volunteers examined, for all volunteers tested the target position remained within the preset tolerances 99.0% of the time when robotic stabilization was used, compared to 4.7% without robotic stabilization. The pre-clinical robotic SRS compensation system was found to be effective at responding to sub-millimeter and sub-degree cranial motions for all volunteers examined. The system's success with volunteers has demonstrated its capability for implementation with frameless and maskless SRS
Arabidopsis transcription factors: genome-wide comparative analysis among eukaryotes.
Riechmann, J L; Heard, J; Martin, G; Reuber, L; Jiang, C; Keddie, J; Adam, L; Pineda, O; Ratcliffe, O J; Samaha, R R; Creelman, R; Pilgrim, M; Broun, P; Zhang, J Z; Ghandehari, D; Sherman, B K; Yu, G
2000-12-15
The completion of the Arabidopsis thaliana genome sequence allows a comparative analysis of transcriptional regulators across the three eukaryotic kingdoms. Arabidopsis dedicates over 5% of its genome to code for more than 1500 transcription factors, about 45% of which are from families specific to plants. Arabidopsis transcription factors that belong to families common to all eukaryotes do not share significant similarity with those of the other kingdoms beyond the conserved DNA binding domains, many of which have been arranged in combinations specific to each lineage. The genome-wide comparison reveals the evolutionary generation of diversity in the regulation of transcription.
Design and characterization of an ocean wave powered lifejacket using 2DOF floating boards
Mi, Jia; Xu, Lin; Yang, Yaling; Zuo, Lei
2018-04-01
Lifejacket is an indispensable life-saving equipment for ships and airplanes. Traditional lifejacket is designed to prevent human from drowning. However, the water temperature is usually low, especially in winter, which significantly reduces the human body temperature and leads to death. Meanwhile, power is critical for drowning people to use emergency communication equipment. This paper proposed an ocean wave powered lifejacket using 2DOF floating boards to provide both buoyance and electricity for drowning people. Hence, they can use this continuous electric power to keep key body warm and send distress signal. This lifejacket is featured with two 2DOF floating boards and the mechanical motion rectifier (MMR) can convert the 2-DOF motions to the unidirectional rotation of generator. The design principle is illustrated and the dynamic modelling for the 2-DOF motions has been analyzed. Bench test and lake test have been conducted to validate the design concept.
Control of 4-DOF MR haptic master for medical application
Oh, Jong-Seok; Choi, Seung-Hyun; Choi, Seung-Bok
2014-03-01
In this work, magnetorheological (MR) based haptic master for robot-assisted minimally invasive surgery (RMIS) is proposed and analyzed. Using a controllable MR fluid, the masters can generate a reflection force with the 4-DOF motion. The proposed master consists of two actuators: MR clutch featuring gimbal mechanism for 2-DOF rotational motion (X and Y axes) and MR clutch attached at gripper of gimbal structures for 1-DOF rotational motion (Z axis) and 1-DOF translational motion. After analyzing the dynamic motion by integrating mechanical and physical properties of the actuators, torque model of the proposed haptic master is derived. For realization of master-slave system, an encoder which can measure position information is integrated with the MR haptic master. In the RMIS system, the measured position is converted as a command signal and sent to the slave robot. In this work, slave and organ of patient are modeled in virtual space. In order to embody a human organ into virtual space, a volumetric deformable object is mathematically formulated by a shape retaining chain linked (S-chain) model. Accordingly, the haptic architecture is established by incorporating the virtual slave with the master device in which the reflection force and desired position originated from the object of the virtual slave and operator of the master, respectively, are transferred to each other. In order to achieve the desired force trajectories, a proportional-integral-derivative (PID) controller is designed and implemented. It has been demonstrated that the effective tracking control performance for the desired motion of reflection force is well presented in time domain.
BACH transcription factors in innate and adaptive immunity.
Igarashi, Kazuhiko; Kurosaki, Tomohiro; Roychoudhuri, Rahul
2017-07-01
BTB and CNC homology (BACH) proteins are transcriptional repressors of the basic region leucine zipper (bZIP) transcription factor family. Recent studies indicate widespread roles of BACH proteins in controlling the development and function of the innate and adaptive immune systems, including the differentiation of effector and memory cells of the B and T cell lineages, CD4 + regulatory T cells and macrophages. Here, we emphasize similarities at a molecular level in the cell-type-specific activities of BACH factors, proposing that competitive interactions of BACH proteins with transcriptional activators of the bZIP family form a common mechanistic theme underlying their diverse actions. The findings contribute to a general understanding of how transcriptional repressors shape lineage commitment and cell-type-specific functions through repression of alternative lineage programmes.
Thirty-seven transcription factor genes differentially respond to a ...
Indian Academy of Sciences (India)
Plant transcription factors and insect defence si. Thirty-seven transcription factor genes differentially respond to a harpin protein and affect resistance to the green peach aphid in Arabidopsis. HUNLIN. PIN. RUOXUE LIŲ, BEIBEI LÜ, XIAOMENG WANG, CHUNLING ZHANG, SHUPING ZHANG, JUN QIAN, LEI CHEN,.
Structural Fingerprints of Transcription Factor Binding Site Regions
Directory of Open Access Journals (Sweden)
Peter Willett
2009-03-01
Full Text Available Fourier transforms are a powerful tool in the prediction of DNA sequence properties, such as the presence/absence of codons. We have previously compiled a database of the structural properties of all 32,896 unique DNA octamers. In this work we apply Fourier techniques to the analysis of the structural properties of human chromosomes 21 and 22 and also to three sets of transcription factor binding sites within these chromosomes. We find that, for a given structural property, the structural property power spectra of chromosomes 21 and 22 are strikingly similar. We find common peaks in their power spectra for both Sp1 and p53 transcription factor binding sites. We use the power spectra as a structural fingerprint and perform similarity searching in order to find transcription factor binding site regions. This approach provides a new strategy for searching the genome data for information. Although it is difficult to understand the relationship between specific functional properties and the set of structural parameters in our database, our structural fingerprints nevertheless provide a useful tool for searching for function information in sequence data. The power spectrum fingerprints provide a simple, fast method for comparing a set of functional sequences, in this case transcription factor binding site regions, with the sequences of whole chromosomes. On its own, the power spectrum fingerprint does not find all transcription factor binding sites in a chromosome, but the results presented here show that in combination with other approaches, this technique will improve the chances of identifying functional sequences hidden in genomic data.
NAC Transcription Factors in Stress Responses and Senescence
DEFF Research Database (Denmark)
O'Shea, Charlotte
Plant-specific NAM/ATAF/CUC (NAC) transcription factors have recently received considerable attention due to their significant roles in plant development and stress signalling. This interest has resulted in a number of physiological, genetic and cell biological studies of their functions. Some...... of these studies have also revealed emerging gene regulatory networks and protein-protein interaction networks. However, structural studies relating structure to function are lagging behind. Structure-function analysis of the NAC transcription factors has therefore been the main focus of this PhD thesis...... not involve significant folding-upon-binding but fuzziness or an extended ANAC046 region. The ANAC046 regulatory domain functions as an entropic chain with a bait for interactions with for example RCD1. RCD1 interacts with transcription factors from several different families, and the large stress...
Cross-Family Transcription Factor Interactions
Bemer, Marian; Dijk, van Aalt-Jan; Immink, Richard G.H.; Angenent, Gerco C.
2017-01-01
Specific and dynamic gene expression strongly depends on transcription factor (TF) activity and most plant TFs function in a combinatorial fashion. They can bind to DNA and control the expression of the corresponding gene in an additive fashion or cooperate by physical interactions, forming larger
Transcription factor interplay in T helper cell differentiation
Evans, Catherine M.
2013-01-01
The differentiation of CD4 helper T cells into specialized effector lineages has provided a powerful model for understanding immune cell differentiation. Distinct lineages have been defined by differential expression of signature cytokines and the lineage-specifying transcription factors necessary and sufficient for their production. The traditional paradigm of differentiation towards Th1 and Th2 subtypes driven by T-bet and GATA3, respectively, has been extended to incorporate additional T cell lineages and transcriptional regulators. Technological advances have expanded our view of these lineage-specifying transcription factors to the whole genome and revealed unexpected interplay between them. From these data, it is becoming clear that lineage specification is more complex and plastic than previous models might have suggested. Here, we present an overview of the different forms of transcription factor interplay that have been identified and how T cell phenotypes arise as a product of this interplay within complex regulatory networks. We also suggest experimental strategies that will provide further insight into the mechanisms that underlie T cell lineage specification and plasticity. PMID:23878131
Transcription factor interplay in T helper cell differentiation.
Evans, Catherine M; Jenner, Richard G
2013-11-01
The differentiation of CD4 helper T cells into specialized effector lineages has provided a powerful model for understanding immune cell differentiation. Distinct lineages have been defined by differential expression of signature cytokines and the lineage-specifying transcription factors necessary and sufficient for their production. The traditional paradigm of differentiation towards Th1 and Th2 subtypes driven by T-bet and GATA3, respectively, has been extended to incorporate additional T cell lineages and transcriptional regulators. Technological advances have expanded our view of these lineage-specifying transcription factors to the whole genome and revealed unexpected interplay between them. From these data, it is becoming clear that lineage specification is more complex and plastic than previous models might have suggested. Here, we present an overview of the different forms of transcription factor interplay that have been identified and how T cell phenotypes arise as a product of this interplay within complex regulatory networks. We also suggest experimental strategies that will provide further insight into the mechanisms that underlie T cell lineage specification and plasticity.
Type synthesis for 4-DOF parallel press mechanism using GF set theory
He, Jun; Gao, Feng; Meng, Xiangdun; Guo, Weizhong
2015-07-01
Parallel mechanisms is used in the large capacity servo press to avoid the over-constraint of the traditional redundant actuation. Currently, the researches mainly focus on the performance analysis for some specific parallel press mechanisms. However, the type synthesis and evaluation of parallel press mechanisms is seldom studied, especially for the four degrees of freedom(DOF) press mechanisms. The type synthesis of 4-DOF parallel press mechanisms is carried out based on the generalized function(GF) set theory. Five design criteria of 4-DOF parallel press mechanisms are firstly proposed. The general procedure of type synthesis of parallel press mechanisms is obtained, which includes number synthesis, symmetrical synthesis of constraint GF sets, decomposition of motion GF sets and design of limbs. Nine combinations of constraint GF sets of 4-DOF parallel press mechanisms, ten combinations of GF sets of active limbs, and eleven combinations of GF sets of passive limbs are synthesized. Thirty-eight kinds of press mechanisms are presented and then different structures of kinematic limbs are designed. Finally, the geometrical constraint complexity( GCC), kinematic pair complexity( KPC), and type complexity( TC) are proposed to evaluate the press types and the optimal press type is achieved. The general methodologies of type synthesis and evaluation for parallel press mechanism are suggested.
Integrated 6-DOF Orbit-Attitude Dynamical Modeling and Control Using Geometric Mechanics
Directory of Open Access Journals (Sweden)
Ling Jiang
2017-01-01
Full Text Available The integrated 6-DOF orbit-attitude dynamical modeling and control have shown great importance in various missions, for example, formation flying and proximity operations. The integrated approach yields better performances than the separate one in terms of accuracy, efficiency, and agility. One challenge in the integrated approach is to find a unified representation for the 6-DOF motion with configuration space SE(3. Recently, exponential coordinates of SE(3 have been used in dynamics and control of the 6-DOF motion, however, only on the kinematical level. In this paper, we will improve the current method by adopting exponential coordinates on the dynamical level, by giving the relation between the second-order derivative of exponential coordinates and spacecraft’s accelerations. In this way, the 6-DOF motion in terms of exponential coordinates can be written as a second-order system with a quite compact form, to which a broader range of control theories, such as higher-order sliding modes, can be applied. For a demonstration purpose, a simple asymptotic tracking control law with almost global convergence is designed. Finally, the integrated modeling and control are applied to the body-fixed hovering over an asteroid and verified by a simulation, in which absolute motions of the spacecraft and asteroid are simulated separately.
Pawlus, Matthew R; Hu, Cheng-Jun
2013-09-01
Hypoxia is a prevalent attribute of the solid tumor microenvironment that promotes the expression of genes through posttranslational modifications and stabilization of alpha subunits (HIF1α and HIF2α) of hypoxia-inducible factors (HIFs). Despite significant similarities, HIF1 (HIF1α/ARNT) and HIF2 (HIF2α/ARNT) activate common as well as unique target genes and exhibit different functions in cancer biology. More surprisingly, accumulating data indicates that the HIF1- and/or HIF2-mediated hypoxia responses can be oncogenic as well as tumor suppressive. While the role of HIF in the hypoxia response is well established, recent data support the concept that HIF is necessary, but not sufficient for the hypoxic response. Other transcription factors that are activated by hypoxia are also required for the HIF-mediated hypoxia response. HIFs, other transcription factors, co-factors and RNA poll II recruited by HIF and other transcription factors form multifactorial enhanceosome complexes on the promoters of HIF target genes to activate hypoxia inducible genes. Importantly, HIF1 or HIF2 requires distinct partners in activating HIF1 or HIF2 target genes. Because HIF enhanceosome formation is required for the gene activation and distinct functions of HIF1 and HIF2 in tumor biology, disruption of the HIF1 or HIF2 specific enhanceosome complex may prove to be a beneficial strategy in tumor treatment in which tumor growth is specifically dependent upon HIF1 or HIF2 activity. Copyright © 2013 Elsevier Inc. All rights reserved.
Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H.; Rothblum, Katrina; Schneider, David A.; Rothblum, Lawrence I.
2013-01-01
The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382–400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I. PMID:23393135
Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H; Rothblum, Katrina; Schneider, David A; Rothblum, Lawrence I
2013-03-29
The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382-400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I.
TrSDB: a proteome database of transcription factors
Hermoso, Antoni; Aguilar, Daniel; Aviles, Francesc X.; Querol, Enrique
2004-01-01
TrSDB—TranScout Database—(http://ibb.uab.es/trsdb) is a proteome database of eukaryotic transcription factors based upon predicted motifs by TranScout and data sources such as InterPro and Gene Ontology Annotation. Nine eukaryotic proteomes are included in the current version. Extensive and diverse information for each database entry, different analyses considering TranScout classification and similarity relationships are offered for research on transcription factors or gene expression. PMID:14681387
Kinematic Analysis of 3-DOF Planer Robot Using Artificial Neural Network
Directory of Open Access Journals (Sweden)
Jolly Atit Shah
2012-07-01
Full Text Available Automatic control of the robotic manipulator involves study of kinematics and dynamics as a major issue. This paper involves the forward and inverse kinematics of 3-DOF robotic manipulator with revolute joints. In this study the Denavit- Hartenberg (D-H model is used to model robot links and joints. Also forward and inverse kinematics solution has been achieved using Artificial Neural Networks for 3-DOF robotic manipulator. It shows that by using artificial neural network the solution we get is faster, acceptable and has zero error.
Using TESS to predict transcription factor binding sites in DNA sequence.
Schug, Jonathan
2008-03-01
This unit describes how to use the Transcription Element Search System (TESS). This Web site predicts transcription factor binding sites (TFBS) in DNA sequence using two different kinds of models of sites, strings and positional weight matrices. The binding of transcription factors to DNA is a major part of the control of gene expression. Transcription factors exhibit sequence-specific binding; they form stronger bonds to some DNA sequences than to others. Identification of a good binding site in the promoter for a gene suggests the possibility that the corresponding factor may play a role in the regulation of that gene. However, the sequences transcription factors recognize are typically short and allow for some amount of mismatch. Because of this, binding sites for a factor can typically be found at random every few hundred to a thousand base pairs. TESS has features to help sort through and evaluate the significance of predicted sites.
Microarray-Based Identification of Transcription Factor Target Genes
Gorte, M.; Horstman, A.; Page, R.B.; Heidstra, R.; Stromberg, A.; Boutilier, K.A.
2011-01-01
Microarray analysis is widely used to identify transcriptional changes associated with genetic perturbation or signaling events. Here we describe its application in the identification of plant transcription factor target genes with emphasis on the design of suitable DNA constructs for controlling TF
Chen, Huei-Mei; Rosebrock, Adam P; Khan, Sohail R; Futcher, Bruce; Leatherwood, Janet K
2012-01-01
In S. pombe, about 5% of genes are meiosis-specific and accumulate little or no mRNA during vegetative growth. Here we use Affymetrix tiling arrays to characterize transcripts in vegetative and meiotic cells. In vegetative cells, many meiotic genes, especially those induced in mid-meiosis, have abundant antisense transcripts. Disruption of the antisense transcription of three of these mid-meiotic genes allowed vegetative sense transcription. These results suggest that antisense transcription represses sense transcription of meiotic genes in vegetative cells. Although the mechanism(s) of antisense mediated transcription repression need to be further explored, our data indicates that RNAi machinery is not required for repression. Previously, we and others used non-strand specific methods to study splicing regulation of meiotic genes and concluded that 28 mid-meiotic genes are spliced only in meiosis. We now demonstrate that the "unspliced" signal in vegetative cells comes from the antisense RNA, not from unspliced sense RNA, and we argue against the idea that splicing regulates these mid-meiotic genes. Most of these mid-meiotic genes are induced in mid-meiosis by the forkhead transcription factor Mei4. Interestingly, deletion of a different forkhead transcription factor, Fkh2, allows low levels of sense expression of some mid-meiotic genes in vegetative cells. We propose that vegetative expression of mid-meiotic genes is repressed at least two independent ways: antisense transcription and Fkh2 repression.
Exploring the utility of organo-polyoxometalate hybrids to inhibit SOX transcription factors.
Narasimhan, Kamesh; Micoine, Kevin; Lacôte, Emmanuel; Thorimbert, Serge; Cheung, Edwin; Hasenknopf, Bernold; Jauch, Ralf
2014-01-01
SOX transcription factors constitute an attractive target class for intervention with small molecules as they play a prominent role in the field of regenerative biomedicine and cancer biology. However, rationally engineering specific inhibitors that interfere with transcription factor DNA interfaces continues to be a monumental challenge in the field of transcription factor chemical biology. Polyoxometalates (POMs) are inorganic compounds that were previously shown to target the high-mobility group (HMG) of SOX proteins at nanomolar concentrations. In continuation of this work, we carried out an assessment of the selectivity of a panel of newly synthesized organo-polyoxometalate hybrids in targeting different transcription factor families to enable the usage of polyoxometalates as specific SOX transcription factor drugs. The residual DNA-binding activities of 15 different transcription factors were measured after treatment with a panel of diverse polyoxometalates. Polyoxometalates belonging to the Dawson structural class were found to be more potent inhibitors than the Keggin class. Further, organically modified Dawson polyoxometalates were found to be the most potent in inhibiting transcription factor DNA binding activity. The size of the polyoxometalates and its derivitization were found to be the key determinants of their potency. Polyoxometalates are highly potent, nanomolar range inhibitors of the DNA binding activity of the Sox-HMG family. However, binding assays involving a limited subset of structurally diverse polyoxometalates revealed a low selectivity profile against different transcription factor families. Further progress in achieving selectivity and deciphering structure-activity relationship of POMs require the identification of POM binding sites on transcription factors using elaborate approaches like X-ray crystallography and multidimensional NMR. In summary, our report reaffirms that transcription factors are challenging molecular architectures
Schmeier, Sebastian; Alam, Tanvir; Essack, Magbubah; Bajic, Vladimir B.
2016-01-01
Transcription factors (TFs) play a pivotal role in transcriptional regulation, making them crucial for cell survival and important biological functions. For the regulation of transcription, interactions of different regulatory proteins known as transcription co-factors (TcoFs) and TFs are essential in forming necessary protein complexes. Although TcoFs themselves do not bind DNA directly, their influence on transcriptional regulation and initiation, although indirect, has been shown to be significant, with the functionality of TFs strongly influenced by the presence of TcoFs. In the TcoF-DB v2 database, we collect information on TcoFs. In this article, we describe updates and improvements implemented in TcoF-DB v2. TcoF-DB v2 provides several new features that enables exploration of the roles of TcoFs. The content of the database has significantly expanded, and is enriched with information from Gene Ontology, biological pathways, diseases and molecular signatures. TcoF-DB v2 now includes many more TFs; has substantially increased the number of human TcoFs to 958, and now includes information on mouse (418 new TcoFs). TcoF-DB v2 enables the exploration of information on TcoFs and allows investigations into their influence on transcriptional regulation in humans and mice. TcoF-DB v2 can be accessed at http://tcofdb.org/.
Schmeier, Sebastian
2016-10-17
Transcription factors (TFs) play a pivotal role in transcriptional regulation, making them crucial for cell survival and important biological functions. For the regulation of transcription, interactions of different regulatory proteins known as transcription co-factors (TcoFs) and TFs are essential in forming necessary protein complexes. Although TcoFs themselves do not bind DNA directly, their influence on transcriptional regulation and initiation, although indirect, has been shown to be significant, with the functionality of TFs strongly influenced by the presence of TcoFs. In the TcoF-DB v2 database, we collect information on TcoFs. In this article, we describe updates and improvements implemented in TcoF-DB v2. TcoF-DB v2 provides several new features that enables exploration of the roles of TcoFs. The content of the database has significantly expanded, and is enriched with information from Gene Ontology, biological pathways, diseases and molecular signatures. TcoF-DB v2 now includes many more TFs; has substantially increased the number of human TcoFs to 958, and now includes information on mouse (418 new TcoFs). TcoF-DB v2 enables the exploration of information on TcoFs and allows investigations into their influence on transcriptional regulation in humans and mice. TcoF-DB v2 can be accessed at http://tcofdb.org/.
Yousaf, Nasim; Gould, David
2017-01-01
Confirming the binding of a transcription factor with a particular DNA sequence may be important in characterizing interactions with a synthetic promoter. Electrophoretic mobility shift assay is a powerful approach to demonstrate the specific DNA sequence that is bound by a transcription factor and also to confirm the specific transcription factor involved in the interaction. In this chapter we describe a method we have successfully used to demonstrate interactions of endogenous transcription factors with sequences derived from endogenous and synthetic promoters.
Chen, Huei-Mei; Rosebrock, Adam P.; Khan, Sohail R.; Futcher, Bruce; Leatherwood, Janet K.
2012-01-01
In S. pombe, about 5% of genes are meiosis-specific and accumulate little or no mRNA during vegetative growth. Here we use Affymetrix tiling arrays to characterize transcripts in vegetative and meiotic cells. In vegetative cells, many meiotic genes, especially those induced in mid-meiosis, have abundant antisense transcripts. Disruption of the antisense transcription of three of these mid-meiotic genes allowed vegetative sense transcription. These results suggest that antisense transcription represses sense transcription of meiotic genes in vegetative cells. Although the mechanism(s) of antisense mediated transcription repression need to be further explored, our data indicates that RNAi machinery is not required for repression. Previously, we and others used non-strand specific methods to study splicing regulation of meiotic genes and concluded that 28 mid-meiotic genes are spliced only in meiosis. We now demonstrate that the “unspliced” signal in vegetative cells comes from the antisense RNA, not from unspliced sense RNA, and we argue against the idea that splicing regulates these mid-meiotic genes. Most of these mid-meiotic genes are induced in mid-meiosis by the forkhead transcription factor Mei4. Interestingly, deletion of a different forkhead transcription factor, Fkh2, allows low levels of sense expression of some mid-meiotic genes in vegetative cells. We propose that vegetative expression of mid-meiotic genes is repressed at least two independent ways: antisense transcription and Fkh2 repression. PMID:22238674
Directory of Open Access Journals (Sweden)
Huei-Mei Chen
Full Text Available In S. pombe, about 5% of genes are meiosis-specific and accumulate little or no mRNA during vegetative growth. Here we use Affymetrix tiling arrays to characterize transcripts in vegetative and meiotic cells. In vegetative cells, many meiotic genes, especially those induced in mid-meiosis, have abundant antisense transcripts. Disruption of the antisense transcription of three of these mid-meiotic genes allowed vegetative sense transcription. These results suggest that antisense transcription represses sense transcription of meiotic genes in vegetative cells. Although the mechanism(s of antisense mediated transcription repression need to be further explored, our data indicates that RNAi machinery is not required for repression. Previously, we and others used non-strand specific methods to study splicing regulation of meiotic genes and concluded that 28 mid-meiotic genes are spliced only in meiosis. We now demonstrate that the "unspliced" signal in vegetative cells comes from the antisense RNA, not from unspliced sense RNA, and we argue against the idea that splicing regulates these mid-meiotic genes. Most of these mid-meiotic genes are induced in mid-meiosis by the forkhead transcription factor Mei4. Interestingly, deletion of a different forkhead transcription factor, Fkh2, allows low levels of sense expression of some mid-meiotic genes in vegetative cells. We propose that vegetative expression of mid-meiotic genes is repressed at least two independent ways: antisense transcription and Fkh2 repression.
Alexandrov, Boian S.; Gelev, Vladimir; Yoo, Sang Wook; Alexandrov, Ludmil B.; Fukuyo, Yayoi; Bishop, Alan R.; Rasmussen, Kim ?.; Usheva, Anny
2009-01-01
We assess the role of DNA breathing dynamics as a determinant of promoter strength and transcription start site (TSS) location. We compare DNA Langevin dynamic profiles of representative gene promoters, calculated with the extended non-linear PBD model of DNA with experimental data on transcription factor binding and transcriptional activity. Our results demonstrate that DNA dynamic activity at the TSS can be suppressed by mutations that do not affect basal transcription factor binding–DNA co...
The logic of communication: roles for mobile transcription factors in plants.
Long, Yuchen; Scheres, Ben; Blilou, Ikram
2015-02-01
Mobile transcription factors play many roles in plant development. Here, we compare the use of mobile transcription factors as signals with some canonical signal transduction processes in prokaryotes and eukaryotes. After an initial survey, we focus on the SHORT-ROOT pathway in Arabidopsis roots to show that, despite the simplicity of the concept of mobile transcription factor signalling, many lines of evidence reveal a surprising complexity in control mechanisms linked to this process. We argue that these controls bestow precision, robustness, and versatility on mobile transcription factor signalling. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Transcription factor NF-kB as a potential biomarker for oxidative stress
Berg, R. van den; Haenen, G.R.M.M.; Berg, H. van den; Bast, A.
2001-01-01
There is increasing interest in the involvement of transcription factors, such as of the transcription factor NF-κB (nuclear factor-κB), in the pathogenesis of various diseases. NF-κB is involved in the control of the transcription of a variety of cellular genes that regulate the inflammatory
Transcription factor binding sites prediction based on modified nucleosomes.
Directory of Open Access Journals (Sweden)
Mohammad Talebzadeh
Full Text Available In computational methods, position weight matrices (PWMs are commonly applied for transcription factor binding site (TFBS prediction. Although these matrices are more accurate than simple consensus sequences to predict actual binding sites, they usually produce a large number of false positive (FP predictions and so are impoverished sources of information. Several studies have employed additional sources of information such as sequence conservation or the vicinity to transcription start sites to distinguish true binding regions from random ones. Recently, the spatial distribution of modified nucleosomes has been shown to be associated with different promoter architectures. These aligned patterns can facilitate DNA accessibility for transcription factors. We hypothesize that using data from these aligned and periodic patterns can improve the performance of binding region prediction. In this study, we propose two effective features, "modified nucleosomes neighboring" and "modified nucleosomes occupancy", to decrease FP in binding site discovery. Based on these features, we designed a logistic regression classifier which estimates the probability of a region as a TFBS. Our model learned each feature based on Sp1 binding sites on Chromosome 1 and was tested on the other chromosomes in human CD4+T cells. In this work, we investigated 21 histone modifications and found that only 8 out of 21 marks are strongly correlated with transcription factor binding regions. To prove that these features are not specific to Sp1, we combined the logistic regression classifier with the PWM, and created a new model to search TFBSs on the genome. We tested the model using transcription factors MAZ, PU.1 and ELF1 and compared the results to those using only the PWM. The results show that our model can predict Transcription factor binding regions more successfully. The relative simplicity of the model and capability of integrating other features make it a superior method
Genome Binding and Gene Regulation by Stem Cell Transcription Factors
J.H. Brandsma (Johan)
2016-01-01
markdownabstractNearly all cells of an individual organism contain the same genome. However, each cell type transcribes a different set of genes due to the presence of different sets of cell type-specific transcription factors. Such transcription factors bind to regulatory regions such as promoters
Modulation of transcription factors by curcumin.
Shishodia, Shishir; Singh, Tulika; Chaturvedi, Madan M
2007-01-01
Curcumin is the active ingredient of turmeric that has been consumed as a dietary spice for ages. Turmeric is widely used in traditional Indian medicine to cure biliary disorders, anorexia, cough, diabetic wounds, hepatic disorders, rheumatism, and sinusitis. Extensive investigation over the last five decades has indicated that curcumin reduces blood cholesterol, prevents low-density lipoprotein oxidation, inhibits platelet aggregation, suppresses thrombosis and myocardial infarction, suppresses symptoms associated with type II diabetes, rheumatoid arthritis, multiple sclerosis, and Alzheimer's disease, inhibits HIV replication, enhances wound healing, protects from liver injury, increases bile secretion, protects from cataract formation, and protects from pulmonary toxicity and fibrosis. Evidence indicates that the divergent effects of curcumin are dependent on its pleiotropic molecular effects. These include the regulation of signal transduction pathways and direct modulation of several enzymatic activities. Most of these signaling cascades lead to the activation of transcription factors. Curcumin has been found to modulate the activity of several key transcription factors and, in turn, the cellular expression profiles. Curcumin has been shown to elicit vital cellular responses such as cell cycle arrest, apoptosis, and differentiation by activating a cascade of molecular events. In this chapter, we briefly review the effects of curcumin on transcription factors NF-KB, AP-1, Egr-1, STATs, PPAR-gamma, beta-catenin, nrf2, EpRE, p53, CBP, and androgen receptor (AR) and AR-related cofactors giving major emphasis to the molecular mechanisms of its action.
Membrane-bound transcription factors: regulated release by RIP or RUP.
Hoppe, T; Rape, M; Jentsch, S
2001-06-01
Regulated nuclear transport of transcription factors from cytoplasmic pools is a major route by which eukaryotes control gene expression. Exquisite examples are transcription factors that are kept in a dormant state in the cytosol by membrane anchors; such proteins are released from membranes by proteolytic cleavage, which enables these transcription factors to enter the nucleus. Cleavage can be mediated either by regulated intramembrane proteolysis (RIP) catalysed by specific membrane-bound proteases or by regulated ubiquitin/proteasome-dependent processing (RUP). In both cases processing can be controlled by cues that originate at or in the vicinity of the membrane.
Transcription Factors in Heart: Promising Therapeutic Targets in Cardiac Hypertrophy
Kohli, Shrey; Ahuja, Suchit; Rani, Vibha
2011-01-01
Regulation of gene expression is central to cell growth, differentiation and diseases. Context specific and signal dependent regulation of gene expression is achieved to a large part by transcription factors. Cardiac transcription factors regulate heart development and are also involved in stress regulation of the adult heart, which may lead to cardiac hypertrophy. Hypertrophy of cardiac myocytes is an outcome of the imbalance between prohypertrophic factors and anti-hypertrophic factors. Thi...
Hydrogen peroxide sensing, signaling and regulation of transcription factors
Directory of Open Access Journals (Sweden)
H. Susana Marinho
2014-01-01
Full Text Available The regulatory mechanisms by which hydrogen peroxide (H2O2 modulates the activity of transcription factors in bacteria (OxyR and PerR, lower eukaryotes (Yap1, Maf1, Hsf1 and Msn2/4 and mammalian cells (AP-1, NRF2, CREB, HSF1, HIF-1, TP53, NF-κB, NOTCH, SP1 and SCREB-1 are reviewed. The complexity of regulatory networks increases throughout the phylogenetic tree, reaching a high level of complexity in mammalians. Multiple H2O2 sensors and pathways are triggered converging in the regulation of transcription factors at several levels: (1 synthesis of the transcription factor by upregulating transcription or increasing both mRNA stability and translation; (ii stability of the transcription factor by decreasing its association with the ubiquitin E3 ligase complex or by inhibiting this complex; (iii cytoplasm–nuclear traffic by exposing/masking nuclear localization signals, or by releasing the transcription factor from partners or from membrane anchors; and (iv DNA binding and nuclear transactivation by modulating transcription factor affinity towards DNA, co-activators or repressors, and by targeting specific regions of chromatin to activate individual genes. We also discuss how H2O2 biological specificity results from diverse thiol protein sensors, with different reactivity of their sulfhydryl groups towards H2O2, being activated by different concentrations and times of exposure to H2O2. The specific regulation of local H2O2 concentrations is also crucial and results from H2O2 localized production and removal controlled by signals. Finally, we formulate equations to extract from typical experiments quantitative data concerning H2O2 reactivity with sensor molecules. Rate constants of 140 M−1 s−1 and ≥1.3 × 103 M−1 s−1 were estimated, respectively, for the reaction of H2O2 with KEAP1 and with an unknown target that mediates NRF2 protein synthesis. In conclusion, the multitude of H2O2 targets and mechanisms provides an opportunity for
Transcription factor cooperativity in early adipogenic hotspots and super-enhancers
DEFF Research Database (Denmark)
Siersbæk, Rasmus; Rabiee, Atefeh; Nielsen, Ronni
2014-01-01
. Using a combination of advanced proteomics and genomics approaches, we identify ∼12,000 transcription factor hotspots (∼400 bp) in the early phase of adipogenesis, and we find evidence of both simultaneous and sequential binding of transcription factors at these regions. We demonstrate that hotspots...
Regulation of the yeast metabolic cycle by transcription factors with periodic activities
Directory of Open Access Journals (Sweden)
Pellegrini Matteo
2011-10-01
Full Text Available Abstract Background When growing budding yeast under continuous, nutrient-limited conditions, over half of yeast genes exhibit periodic expression patterns. Periodicity can also be observed in respiration, in the timing of cell division, as well as in various metabolite levels. Knowing the transcription factors involved in the yeast metabolic cycle is helpful for determining the cascade of regulatory events that cause these patterns. Results Transcription factor activities were estimated by linear regression using time series and genome-wide transcription factor binding data. Time-translation matrices were estimated using least squares and were used to model the interactions between the most significant transcription factors. The top transcription factors have functions involving respiration, cell cycle events, amino acid metabolism and glycolysis. Key regulators of transitions between phases of the yeast metabolic cycle appear to be Hap1, Hap4, Gcn4, Msn4, Swi6 and Adr1. Conclusions Analysis of the phases at which transcription factor activities peak supports previous findings suggesting that the various cellular functions occur during specific phases of the yeast metabolic cycle.
Regulation of cell proliferation by the E2F transcription factors
DEFF Research Database (Denmark)
Helin, K
1998-01-01
Experimental data generated in the past year have further emphasized the essential role for the E2F transcription factors in the regulation of cell proliferation. Genetic studies have shown that E2F activity is required for normal development in fruitflies, and the generation of E2F-1(-/-) mice h......Fs in the proteasomes. Novel target genes for the E2F transcription factors have been identified that link the E2Fs directly to the initiation of DNA replication.......Experimental data generated in the past year have further emphasized the essential role for the E2F transcription factors in the regulation of cell proliferation. Genetic studies have shown that E2F activity is required for normal development in fruitflies, and the generation of E2F-1(-/-) mice has...... demonstrated that individual members of the E2F transcription factor family are likely to have distinct roles in mammalian development and homeostasis. Additional mechanisms regulating the activity of the E2F transcription factors have been reported, including subcellular localization and proteolysis of the E2...
In, K H; Asano, K; Beier, D; Grobholz, J; Finn, P W; Silverman, E K; Silverman, E S; Collins, T; Fischer, A R; Keith, T P; Serino, K; Kim, S W; De Sanctis, G T; Yandava, C; Pillari, A; Rubin, P; Kemp, J; Israel, E; Busse, W; Ledford, D; Murray, J J; Segal, A; Tinkleman, D; Drazen, J M
1997-03-01
Five lipoxygenase (5-LO) is the first committed enzyme in the metabolic pathway leading to the synthesis of the leukotrienes. We examined genomic DNA isolated from 25 normal subjects and 31 patients with asthma (6 of whom had aspirin-sensitive asthma) for mutations in the known transcription factor binding regions and the protein encoding region of the 5-LO gene. A family of mutations in the G + C-rich transcription factor binding region was identified consisting of the deletion of one, deletion of two, or addition of one zinc finger (Sp1/Egr-1) binding sites in the region 176 to 147 bp upstream from the ATG translation start site where there are normally 5 Sp1 binding motifs in tandem. Reporter gene activity directed by any of the mutant forms of the transcription factor binding region was significantly (P < 0.05) less effective than the activity driven by the wild type transcription factor binding region. Electrophoretic mobility shift assays (EMSAs) demonstrated the capacity of wild type and mutant transcription factor binding regions to bind nuclear extracts from human umbilical vein endothelial cells (HUVECs). These data are consistent with a family of mutations in the 5-LO gene that can modify reporter gene transcription possibly through differences in Sp1 and Egr-1 transactivation.
The evolution of WRKY transcription factors.
Rinerson, Charles I; Rabara, Roel C; Tripathi, Prateek; Shen, Qingxi J; Rushton, Paul J
2015-02-27
The availability of increasing numbers of sequenced genomes has necessitated a re-evaluation of the evolution of the WRKY transcription factor family. Modern day plants descended from a charophyte green alga that colonized the land between 430 and 470 million years ago. The first charophyte genome sequence from Klebsormidium flaccidum filled a gap in the available genome sequences in the plant kingdom between unicellular green algae that typically have 1-3 WRKY genes and mosses that contain 30-40. WRKY genes have been previously found in non-plant species but their occurrence has been difficult to explain. Only two WRKY genes are present in the Klebsormidium flaccidum genome and the presence of a Group IIb gene was unexpected because it had previously been thought that Group IIb WRKY genes first appeared in mosses. We found WRKY transcription factor genes outside of the plant lineage in some diplomonads, social amoebae, fungi incertae sedis, and amoebozoa. This patchy distribution suggests that lateral gene transfer is responsible. These lateral gene transfer events appear to pre-date the formation of the WRKY groups in flowering plants. Flowering plants contain proteins with domains typical for both resistance (R) proteins and WRKY transcription factors. R protein-WRKY genes have evolved numerous times in flowering plants, each type being restricted to specific flowering plant lineages. These chimeric proteins contain not only novel combinations of protein domains but also novel combinations and numbers of WRKY domains. Once formed, R protein WRKY genes may combine different components of signalling pathways that may either create new diversity in signalling or accelerate signalling by short circuiting signalling pathways. We propose that the evolution of WRKY transcription factors includes early lateral gene transfers to non-plant organisms and the occurrence of algal WRKY genes that have no counterparts in flowering plants. We propose two alternative hypotheses
Bilateral, Misalignment-Compensating, Full-DOF Hip Exoskeleton: Design and Kinematic Validation
Directory of Open Access Journals (Sweden)
Karen Junius
2017-01-01
Full Text Available A shared design goal for most robotic lower limb exoskeletons is to reduce the metabolic cost of locomotion for the user. Despite this, only a limited amount of devices was able to actually reduce user metabolic consumption. Preservation of the natural motion kinematics was defined as an important requirement for a device to be metabolically beneficial. This requires the inclusion of all human degrees of freedom (DOF in a design, as well as perfect alignment of the rotation axes. As perfect alignment is impossible, compensation for misalignment effects should be provided. A misalignment compensation mechanism for a 3-DOF system is presented in this paper. It is validated by the implementation in a bilateral hip exoskeleton, resulting in a compact and lightweight device that can be donned fast and autonomously, with a minimum of required adaptations. Extensive testing of the prototype has shown that hip range of motion of the user is maintained while wearing the device and this for all three hip DOFs. This allowed the users to maintain their natural motion patterns when they are walking with the novel hip exoskeleton.
Bilateral, Misalignment-Compensating, Full-DOF Hip Exoskeleton: Design and Kinematic Validation
Degelaen, Marc; Lefeber, Nina; Swinnen, Eva; Vanderborght, Bram; Lefeber, Dirk
2017-01-01
A shared design goal for most robotic lower limb exoskeletons is to reduce the metabolic cost of locomotion for the user. Despite this, only a limited amount of devices was able to actually reduce user metabolic consumption. Preservation of the natural motion kinematics was defined as an important requirement for a device to be metabolically beneficial. This requires the inclusion of all human degrees of freedom (DOF) in a design, as well as perfect alignment of the rotation axes. As perfect alignment is impossible, compensation for misalignment effects should be provided. A misalignment compensation mechanism for a 3-DOF system is presented in this paper. It is validated by the implementation in a bilateral hip exoskeleton, resulting in a compact and lightweight device that can be donned fast and autonomously, with a minimum of required adaptations. Extensive testing of the prototype has shown that hip range of motion of the user is maintained while wearing the device and this for all three hip DOFs. This allowed the users to maintain their natural motion patterns when they are walking with the novel hip exoskeleton. PMID:28790799
Czech Academy of Sciences Publication Activity Database
Jansa, Petr; Burek, C.; Sander, E. E.; Grummt, I.
2001-01-01
Roč. 29, č. 2 (2001), s. 423-429 ISSN 0305-1048 Institutional research plan: CEZ:AV0Z5052915 Keywords : rDNA transcription * PTRF * transcription reinitiation Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 6.373, year: 2001
Adaptive evolution of transcription factor binding sites
Directory of Open Access Journals (Sweden)
Berg Johannes
2004-10-01
Full Text Available Abstract Background The regulation of a gene depends on the binding of transcription factors to specific sites located in the regulatory region of the gene. The generation of these binding sites and of cooperativity between them are essential building blocks in the evolution of complex regulatory networks. We study a theoretical model for the sequence evolution of binding sites by point mutations. The approach is based on biophysical models for the binding of transcription factors to DNA. Hence we derive empirically grounded fitness landscapes, which enter a population genetics model including mutations, genetic drift, and selection. Results We show that the selection for factor binding generically leads to specific correlations between nucleotide frequencies at different positions of a binding site. We demonstrate the possibility of rapid adaptive evolution generating a new binding site for a given transcription factor by point mutations. The evolutionary time required is estimated in terms of the neutral (background mutation rate, the selection coefficient, and the effective population size. Conclusions The efficiency of binding site formation is seen to depend on two joint conditions: the binding site motif must be short enough and the promoter region must be long enough. These constraints on promoter architecture are indeed seen in eukaryotic systems. Furthermore, we analyse the adaptive evolution of genetic switches and of signal integration through binding cooperativity between different sites. Experimental tests of this picture involving the statistics of polymorphisms and phylogenies of sites are discussed.
Hurst, H C; Masson, N; Jones, N C; Lee, K A
1990-01-01
Promoter elements containing the sequence motif CGTCA are important for a variety of inducible responses at the transcriptional level. Multiple cellular factors specifically bind to these elements and are encoded by a multigene family. Among these factors, polypeptides termed activating transcription factor 43 (ATF-43) and ATF-47 have been purified from HeLa cells and a factor referred to as cyclic AMP response element-binding protein (CREB) has been isolated from PC12 cells and rat brain. We...
Adaptive Controller for 6-DOF Parallel Robot Using T-S Fuzzy Inference
Directory of Open Access Journals (Sweden)
Xue Jian
2013-02-01
Full Text Available 6-DOF parallel robot always appears in the form of Stewart platform. It has been widely used in industry for the benefits such as strong structural stiffness, high movement accuracy and so on. Space docking technology makes higher requirements of motion accuracy and dynamic performance to the control method on 6-DOF parallel robot. In this paper, a hydraulic 6-DOF parallel robot was used to simulate the docking process. Based on this point, this paper gave a thorough study on the design of an adaptive controller to eliminate the asymmetric of controlled plant and uncertain load force interference. Takagi-Sugeno (T-S fuzzy inference model was used to build the fuzzy adaptive controller. With T-S model, the controller directly imposes adaptive control signal on the plant to make sure that the output of plant could track the reference model output. The controller has simple structure and is easy to implement. Experiment results show that the controller can eliminate asymmetric and achieve good dynamic performance, and has good robustness to load interference.
Establishing an Improved Kane Dynamic Model for the 7-DOF Reconfigurable Modular Robot
Directory of Open Access Journals (Sweden)
Xiao Li
2017-01-01
Full Text Available We propose an improved Kane dynamic model theory for the 7-DOF modular robot in this paper, and the model precision is improved by the improved function T′it. We designed three types of progressive modular joints for reconfigurable modular robot that can be used in industrial robot, space robot, and special robot. The Kane dynamic model and the solid dynamic model are established, respectively, for the 7-DOF modular robot. After that, the experimental results are obtained from the simulation experiment of typical task in the established dynamic models. By the analysis model of error, the equation of the improved torque T′it is derived and proposed. And the improved Kane dynamic model is established for the modular robot that used T′it. Based on the experimental data, the undetermined coefficient matrix is five-order linear that was proved in 7-DOF modular robot. And the explicit formulation is solved of the Kane dynamic model and can be used in control system.
Structural Synthesis of 3-DoF Spatial Fully Parallel Manipulators
Directory of Open Access Journals (Sweden)
Alfonso Hernandez
2014-07-01
Full Text Available In this paper, the architectures of three degrees of freedom (3-DoF spatial, fully parallel manipulators (PMs, whose limbs are structurally identical, are obtained systematically. To do this, the methodology followed makes use of the concepts of the displacement group theory of rigid body motion. This theory works with so-called ‘motion generators’. That is, every limb is a kinematic chain that produces a certain type of displacement in the mobile platform or end-effector. The laws of group algebra will determine the actual motion pattern of the end-effector. The structural synthesis is a combinatorial process of different kinematic chains’ topologies employed in order to get all of the 3-DoF motion pattern possibilities in the end-effector of the fully parallel manipulator.
International Nuclear Information System (INIS)
Sahijdak, W.M.; Yang, Chin-Rang; Zuckerman, J.S.; Meyers, M.; Boothman, D.A.
1994-01-01
We analyzed alterations in transcription factor binding to specific, known promoter DNA consensus sequences between irradiated and unirradiated radioresistant human melanoma (U1-Mel) cells. The goal of this study was to begin to investigate which transcription factors and DNA-binding sites are responsible for the induction of specific transcripts and proteins after ionizing radiation. Transcription factor binding was observed using DNA band-shift assays and oligonucleotide competition analyses. Confluence-arrested U1-Mel cells were irradiated (4.5 Gy) and harvested at 4 h. Double-stranded oligonucleotides containing known DNA-binding consensus sites for specific transcription factors were used. Increased DNA binding activity after ionizing radiation was noted with oligonucleotides containing the CREB, NF-kB and Sp1 consensus sites. No changes in protein binding to AP-1, AP-2, AP-3, or CTF/NF1, GRE or Oct-1 consensus sequences were noted. X-ray activation of select transcription factors, which bind certain consensus sites in promoters, may cause specific induction or repression of gene transcription. 22 refs., 2 figs
Noda, Chieko; Narita, Yohei; Watanabe, Takahiro; Yoshida, Masahiro; Ashio, Keiji; Sato, Yoshitaka; Goshima, Fumi; Kanda, Teru; Yoshiyama, Hironori; Tsurumi, Tatsuya; Kimura, Hiroshi
2016-01-01
ABSTRACT Latent membrane protein 1 (LMP1) is a major oncogene essential for primary B cell transformation by Epstein-Barr virus (EBV). Previous studies suggested that some transcription factors, such as PU.1, RBP-Jκ, NF-κB, and STAT, are involved in this expression, but the underlying mechanism is unclear. Here, we identified binding sites for PAX5, AP-2, and EBF in the proximal LMP1 promoter (ED-L1p). We first confirmed the significance of PU.1 and POU domain transcription factor binding for activation of the promoter in latency III. We then focused on the transcription factors AP-2 and early B cell factor (EBF). Interestingly, among the three AP-2-binding sites in the LMP1 promoter, two motifs were also bound by EBF. Overexpression, knockdown, and mutagenesis in the context of the viral genome indicated that AP-2 plays an important role in LMP1 expression in latency II in epithelial cells. In latency III B cells, on the other hand, the B cell-specific transcription factor EBF binds to the ED-L1p and activates LMP1 transcription from the promoter. IMPORTANCE Epstein-Barr virus (EBV) latent membrane protein 1 (LMP1) is crucial for B cell transformation and oncogenesis of other EBV-related malignancies, such as nasopharyngeal carcinoma and T/NK lymphoma. Its expression is largely dependent on the cell type or condition, and some transcription factors have been implicated in its regulation. However, these previous reports evaluated the significance of specific factors mostly by reporter assay. In this study, we prepared point-mutated EBV at the binding sites of such transcription factors and confirmed the importance of AP-2, EBF, PU.1, and POU domain factors. Our results will provide insight into the transcriptional regulation of the major oncogene LMP1. PMID:26819314
Proposed Robot Scheme with 5 DoF and Dynamic Modelling Using Maple Software
Directory of Open Access Journals (Sweden)
Shala Ahmet
2017-11-01
Full Text Available In this paper is represented Dynamical Modelling of robots which is commonly first important step of Modelling, Analysis and Control of robotic systems. This paper is focused on using Denavit-Hartenberg (DH convention for kinematics and Newton-Euler Formulations for dynamic modelling of 5 DoF - Degree of Freedom of 3D robot. The process of deriving of dynamical model is done using Software Maple. Derived Dynamical Model of 5 DoF robot is converted for Matlab use for future analysis, control and simulations.
Huijts, Martijn; Brouwer, Dannis Michel; van Dijk, Johannes
2009-01-01
Manipulators with guidance constructions based on elastic mechanisms are of interest for the increasing number of precision vacuum applications. Previously, the design of an elastic MEMS-based 6-DOFs manipulator was presented. Characterization in six degrees of freedom (DOFs) of a manipulator the
Ishihama, Akira; Shimada, Tomohiro; Yamazaki, Yukiko
2016-03-18
Bacterial genomes are transcribed by DNA-dependent RNA polymerase (RNAP), which achieves gene selectivity through interaction with sigma factors that recognize promoters, and transcription factors (TFs) that control the activity and specificity of RNAP holoenzyme. To understand the molecular mechanisms of transcriptional regulation, the identification of regulatory targets is needed for all these factors. We then performed genomic SELEX screenings of targets under the control of each sigma factor and each TF. Here we describe the assembly of 156 SELEX patterns of a total of 116 TFs performed in the presence and absence of effector ligands. The results reveal several novel concepts: (i) each TF regulates more targets than hitherto recognized; (ii) each promoter is regulated by more TFs than hitherto recognized; and (iii) the binding sites of some TFs are located within operons and even inside open reading frames. The binding sites of a set of global regulators, including cAMP receptor protein, LeuO and Lrp, overlap with those of the silencer H-NS, suggesting that certain global regulators play an anti-silencing role. To facilitate sharing of these accumulated SELEX datasets with the research community, we compiled a database, 'Transcription Profile of Escherichia coli' (www.shigen.nig.ac.jp/ecoli/tec/). © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Automated optimal coordination of multiple-DOF neuromuscular actions in feedforward neuroprostheses.
Lujan, J Luis; Crago, Patrick E
2009-01-01
This paper describes a new method for designing feedforward controllers for multiple-muscle, multiple-DOF, motor system neural prostheses. The design process is based on experimental measurement of the forward input/output properties of the neuromechanical system and numerical optimization of stimulation patterns to meet muscle coactivation criteria, thus resolving the muscle redundancy (i.e., overcontrol) and the coupled DOF problems inherent in neuromechanical systems. We designed feedforward controllers to control the isometric forces at the tip of the thumb in two directions during stimulation of three thumb muscles as a model system. We tested the method experimentally in ten able-bodied individuals and one patient with spinal cord injury. Good control of isometric force in both DOFs was observed, with rms errors less than 10% of the force range in seven experiments and statistically significant correlations between the actual and target forces in all ten experiments. Systematic bias and slope errors were observed in a few experiments, likely due to the neuromuscular fatigue. Overall, the tests demonstrated the ability of a general design approach to satisfy both control and coactivation criteria in multiple-muscle, multiple-axis neuromechanical systems, which is applicable to a wide range of neuromechanical systems and stimulation electrodes.
Identification of transcription-factor genes expressed in the Arabidopsis female gametophyte
Directory of Open Access Journals (Sweden)
Kang Il-Ho
2010-06-01
Full Text Available Abstract Background In flowering plants, the female gametophyte is typically a seven-celled structure with four cell types: the egg cell, the central cell, the synergid cells, and the antipodal cells. These cells perform essential functions required for double fertilization and early seed development. Differentiation of these distinct cell types likely involves coordinated changes in gene expression regulated by transcription factors. Therefore, understanding female gametophyte cell differentiation and function will require dissection of the gene regulatory networks operating in each of the cell types. These efforts have been hampered because few transcription factor genes expressed in the female gametophyte have been identified. To identify such genes, we undertook a large-scale differential expression screen followed by promoter-fusion analysis to detect transcription-factor genes transcribed in the Arabidopsis female gametophyte. Results Using quantitative reverse-transcriptase PCR, we analyzed 1,482 Arabidopsis transcription-factor genes and identified 26 genes exhibiting reduced mRNA levels in determinate infertile 1 mutant ovaries, which lack female gametophytes, relative to ovaries containing female gametophytes. Spatial patterns of gene transcription within the mature female gametophyte were identified for 17 transcription-factor genes using promoter-fusion analysis. Of these, ten genes were predominantly expressed in a single cell type of the female gametophyte including the egg cell, central cell and the antipodal cells whereas the remaining seven genes were expressed in two or more cell types. After fertilization, 12 genes were transcriptionally active in the developing embryo and/or endosperm. Conclusions We have shown that our quantitative reverse-transcriptase PCR differential-expression screen is sufficiently sensitive to detect transcription-factor genes transcribed in the female gametophyte. Most of the genes identified in this
Directory of Open Access Journals (Sweden)
Katie L Lannan
2015-02-01
Full Text Available Platelets are small anucleate blood cells derived from megakaryocytes. In addition to their pivotal roles in hemostasis, platelets are the smallest, yet most abundant, immune cell and regulate inflammation, immunity, and disease progression. Although platelets lack DNA, and thus no functional transcriptional activities, they are nonetheless rich sources of RNAs, possess an intact spliceosome, and are thus capable of synthesizing proteins. Previously, it was thought that platelet RNAs and translational machinery were remnants from the megakaryocyte. We now know that the initial description of platelets as cellular fragments is an antiquated notion, as mounting evidence suggests otherwise. Therefore, it is reasonable to hypothesize that platelet transcription factors are not vestigial remnants from megakaryoctes, but have important, if only partly understood functions. Proteins play multiple cellular roles to minimize energy expenditure for maximum cellular function; thus, the same can be expected for transcription factors. In fact, numerous transcription factors have non-genomic roles, both in platelets and in nucleated cells. Our lab and others have discovered the presence and nongenomic roles of transcription factors in platelets, such as the nuclear factor kappa β (NFκB family of proteins and peroxisome proliferator activated receptor gamma (PPARγ. In addition to numerous roles in regulating platelet activation, functional transcription factors can be transferred to vascular and immune cells through platelet microparticles. This method of transcellular delivery of key immune molecules may be a vital mechanism by which platelet transcription factors regulate inflammation and immunity. At the very least, platelets are an ideal model cell to dissect out the nongenomic roles of transcription factors in nucleated cells. There is abundant evidence to suggest that transcription factors in platelets play key roles in regulating inflammatory and
O-GlcNAc inhibits interaction between Sp1 and Elf-1 transcription factors
International Nuclear Information System (INIS)
Lim, Kihong; Chang, Hyo-Ihl
2009-01-01
The novel protein modification, O-linked N-acetylglucosamine (O-GlcNAc), plays an important role in various aspects of cell regulation. Although most of nuclear transcription regulatory factors are modified by O-GlcNAc, O-GlcNAc effects on transcription remain largely undefined yet. In this study, we show that O-GlcNAc inhibits a physical interaction between Sp1 and Elf-1 transcription factors, and negatively regulates transcription of placenta and embryonic expression oncofetal protein gene (Pem). These findings suggest that O-GlcNAc inhibits Sp1-mediated gene transcription possibly by interrupting Sp1 interaction with its cooperative factor.
Eukaryotic transcription factors
DEFF Research Database (Denmark)
Staby, Lasse; O'Shea, Charlotte; Willemoës, Martin
2017-01-01
Gene-specific transcription factors (TFs) are key regulatory components of signaling pathways, controlling, for example, cell growth, development, and stress responses. Their biological functions are determined by their molecular structures, as exemplified by their structured DNA-binding domains...... regions with function-related, short sequence motifs and molecular recognition features with structural propensities. This review focuses on molecular aspects of TFs, which represent paradigms of ID-related features. Through specific examples, we review how the ID-associated flexibility of TFs enables....... It is furthermore emphasized how classic biochemical concepts like allostery, conformational selection, induced fit, and feedback regulation are undergoing a revival with the appreciation of ID. The review also describes the most recent advances based on computational simulations of ID-based interaction mechanisms...
The transcription fidelity factor GreA impedes DNA break repair.
Sivaramakrishnan, Priya; Sepúlveda, Leonardo A; Halliday, Jennifer A; Liu, Jingjing; Núñez, María Angélica Bravo; Golding, Ido; Rosenberg, Susan M; Herman, Christophe
2017-10-12
Homologous recombination repairs DNA double-strand breaks and must function even on actively transcribed DNA. Because break repair prevents chromosome loss, the completion of repair is expected to outweigh the transcription of broken templates. However, the interplay between DNA break repair and transcription processivity is unclear. Here we show that the transcription factor GreA inhibits break repair in Escherichia coli. GreA restarts backtracked RNA polymerase and hence promotes transcription fidelity. We report that removal of GreA results in markedly enhanced break repair via the classic RecBCD-RecA pathway. Using a deep-sequencing method to measure chromosomal exonucleolytic degradation, we demonstrate that the absence of GreA limits RecBCD-mediated resection. Our findings suggest that increased RNA polymerase backtracking promotes break repair by instigating RecA loading by RecBCD, without the influence of canonical Chi signals. The idea that backtracked RNA polymerase can stimulate recombination presents a DNA transaction conundrum: a transcription fidelity factor that compromises genomic integrity.
Rudnik, Radoslaw; Bulcha, Jote Tafese; Reifschneider, Elena; Ellersiek, Ulrike; Baier, Margarete
2017-08-23
The Arabidopsis ERFIb / RAP2.4 transcription factor family consists of eight members with highly conserved DNA binding domains. Selected members have been characterized individually, but a systematic comparison is pending. The redox-sensitive transcription factor RAP2.4a mediates chloroplast-to-nucleus redox signaling and controls induction of the three most prominent chloroplast peroxidases, namely 2-Cys peroxiredoxin A (2CPA) and thylakoid- and stromal ascorbate peroxidase (tAPx and sAPx). To test the specificity and redundancy of RAP2.4 transcription factors in the regulation of genes for chloroplast peroxidases, we compared the DNA-binding sites of the transcription factors in tertiary structure models, analyzed transcription factor and target gene regulation by qRT-PCR in RAP2.4, 2-Cys peroxiredoxin and ascorbate peroxidase T-DNA insertion lines and RAP2.4 overexpressing lines of Arabidopsis thaliana and performed promoter binding studies. All RAP2.4 proteins bound the tAPx promoter, but only the four RAP2.4 proteins with identical DNA contact sites, namely RAP2.4a, RAP2.4b, RAP2.4d and RAP2.4h, interacted stably with the redox-sensitive part of the 2CPA promoter. Gene expression analysis in RAP2.4 knockout lines revealed that RAP2.4a is the only one supporting 2CPA and chloroplast APx expression. Rap2.4h binds to the same promoter region as Rap2.4a and antagonizes 2CPA expression. Like the other six RAP2.4 proteins, Rap2.4 h promotes APx mRNA accumulation. Chloroplast ROS signals induced RAP2.4b and RAP2.4d expression, but these two transcription factor genes are (in contrast to RAP2.4a) insensitive to low 2CP availability, and their expression decreased in APx knockout lines. RAP2.4e and RAP2.4f gradually responded to chloroplast APx availability and activated specifically APx expression. These transcription factors bound, like RAP2.4c and RAP2.4g, the tAPx promoter, but hardly the 2CPA promoter. The RAP2.4 transcription factors form an environmentally and
Reactivation of Latent HIV-1 Expression by Engineered TALE Transcription Factors.
Perdigão, Pedro; Gaj, Thomas; Santa-Marta, Mariana; Barbas, Carlos F; Goncalves, Joao
2016-01-01
The presence of replication-competent HIV-1 -which resides mainly in resting CD4+ T cells--is a major hurdle to its eradication. While pharmacological approaches have been useful for inducing the expression of this latent population of virus, they have been unable to purge HIV-1 from all its reservoirs. Additionally, many of these strategies have been associated with adverse effects, underscoring the need for alternative approaches capable of reactivating viral expression. Here we show that engineered transcriptional modulators based on customizable transcription activator-like effector (TALE) proteins can induce gene expression from the HIV-1 long terminal repeat promoter, and that combinations of TALE transcription factors can synergistically reactivate latent viral expression in cell line models of HIV-1 latency. We further show that complementing TALE transcription factors with Vorinostat, a histone deacetylase inhibitor, enhances HIV-1 expression in latency models. Collectively, these findings demonstrate that TALE transcription factors are a potentially effective alternative to current pharmacological routes for reactivating latent virus and that combining synthetic transcriptional activators with histone deacetylase inhibitors could lead to the development of improved therapies for latent HIV-1 infection.
Reactivation of Latent HIV-1 Expression by Engineered TALE Transcription Factors.
Directory of Open Access Journals (Sweden)
Pedro Perdigão
Full Text Available The presence of replication-competent HIV-1 -which resides mainly in resting CD4+ T cells--is a major hurdle to its eradication. While pharmacological approaches have been useful for inducing the expression of this latent population of virus, they have been unable to purge HIV-1 from all its reservoirs. Additionally, many of these strategies have been associated with adverse effects, underscoring the need for alternative approaches capable of reactivating viral expression. Here we show that engineered transcriptional modulators based on customizable transcription activator-like effector (TALE proteins can induce gene expression from the HIV-1 long terminal repeat promoter, and that combinations of TALE transcription factors can synergistically reactivate latent viral expression in cell line models of HIV-1 latency. We further show that complementing TALE transcription factors with Vorinostat, a histone deacetylase inhibitor, enhances HIV-1 expression in latency models. Collectively, these findings demonstrate that TALE transcription factors are a potentially effective alternative to current pharmacological routes for reactivating latent virus and that combining synthetic transcriptional activators with histone deacetylase inhibitors could lead to the development of improved therapies for latent HIV-1 infection.
Directory of Open Access Journals (Sweden)
Bangcheng Han
2014-01-01
Full Text Available We propose a novel combined five-degrees-of-freedom (5-DOFs hybrid magnetic bearing (HMB with only one permanent magnet ring (PMR used for turboexpanders. It has two radial magnetic bearing (RMB units; each has four poles and one thrust magnetic bearing (TMB to control 5-DOFs. Based on one PMR, the bias flux of the two radial magnetic bearing units and the one thrust magnetic bearing unit is constructed. As a result, ultra-high-speed, lower power loss, small size, and low cost can be achieved. Furthermore, the equivalent magnetic circuit method and 3D finite element method (FEM are used to model and analyze the combined 5-DOFs HMB. The force-current, force-position, torque-coil currents, the torque-angle position, and the stiffness models of the combined 5-DOFs HMB are given. Moreover, its coupling problems between the RMB units and the AMB unit are also proposed in this paper. An example is given to clarify the mathematical models and the coupling problems, and the linearized models are proposed for the follow-up controller design.
Adaptive tuning of a 2DOF controller for robust cell manipulation using IPMC actuators
International Nuclear Information System (INIS)
McDaid, A J; Aw, K C; Haemmerle, E; Xie, S Q; Shahinpoor, M
2011-01-01
Rapid advancement in medicine and bioscience is causing demand for faster, more accurate and dexterous as well as safer and more reliable micro-manipulators capable of handling biological cells. Current micro-manipulation techniques commonly damage cell walls and membranes due to their stiffness and rigidity. Ionic polymer-metal composite (IPMC) actuators have inherent compliance and with their ability to operate well in fluid and cellular environments they present a unique solution for safe cell manipulation. The reason for the downfall of IPMCs is that their complex behaviour makes them hard to control precisely in unknown environments and in the presence of sizeable external disturbances. This paper presents a novel scheme for adaptively tuning IPMC actuators for precise and robust micro-manipulation of biological cells. A two-degree-of-freedom (2DOF) controller is developed to allow optimal performance for both disturbance rejection (DR) and set point (SP) tracking. These criteria are optimized using a proposed IFT algorithm which adaptively updates the controller parameters, with no model or prior knowledge of the operating conditions, to achieve a compliant manipulation system which can precisely track targets in the presence of large external disturbances, as will be encountered in real biological environments. Experiments are presented showing the performance optimization of an IPMC actuator in the presence of external mechanical disturbances as well as the optimization of the SP tracking. The IFT algorithm successfully tunes the DR and SP to an 85% and 69% improvement, respectively. Results are also presented for a one-degree-of-freedom (1DOF) controller tuned first for DR and then for SP, for a comparison with the 2DOF controller. Validation has been undertaken to verify that the 2DOF controller does indeed outperform both 1DOF controllers over a variety of operating conditions.
Directory of Open Access Journals (Sweden)
Liu M
2018-01-01
Full Text Available Mengyao Liu,1,2 Guofang Hu,2 Yuan Wang,2 Jun Guo,2 Liyan Liu,2 Xiao Han,2 Zhehai Wang2 1School of Medicine and Life Sciences, University of Jinan-Shandong Academy of Medical Sciences, Jinan, Shandong, 2Department of Oncology, Shandong Cancer Hospital, affiliated to Shandong University, Shandong Academy of Medical Sciences, Jinan, Shandong, People’s Republic of China Background: Our study retrospectively assesses the safety and efficacy of the FOLFOX (oxaliplatin, fluorouracil, and leucovorin versus DOF (docetaxel, oxaliplatin, and fluorouracil regimens in untreated locally advanced gastric cancer (AGC.Patients and methods: A total of 108 patients underwent DOF (N=58 and FOLFOX (N=50 regimens. The end points were overall response rate (ORR, survival, and toxicity. Kaplan–Meier curve was used to estimate overall survival (OS and progression-free survival (PFS and Cox regression for multivariate analysis.Results: The ORRs were 50% for DOF and 30% for FOLFOX groups (P<0.05, and disease control rates were 91.4% and 72%, respectively. The median PFS and OS in DOF group were significantly better than FOLFOX group (8.2 versus 6.4 months, P<0.05; 16.3 versus 11.2 months, P<0.001. Both groups showed acceptable toxicity; all grades and grade 3–4 toxicity had no significant differences (P=0.071; P=0.247. However, the incidence of grade 3–4 peripheral neuropathy was significantly higher in DOF group (10.3% versus 2%, P<0.05. In the subgroup analysis for elderly AGC patients (≥65 years, administration of DOF also resulted in a superior PFS (8.5 versus 5.9 months; P=0.038 and OS (15.3 versus 9.8 months; P=0.004 compared with FOLFOX. However, DOF regimen was associated with more neutropenia (67% versus 30%; P<0.05, thrombocytopenia (61% versus 52%; P<0.05, and peripheral neuropathy (49% versus 22%; P<0.05.Conclusion: DOF regimen was more effective than FOLFOX for AGC, both in younger and older patients. The adverse effects of the two regimens were
Stair Climbing Control for 4-DOF Tracked Vehicle Based on Internal Sensors
Directory of Open Access Journals (Sweden)
Daisuke Endo
2017-01-01
Full Text Available In search-and-rescue missions, multi-degrees-of-freedom (DOF tracked robots that are equipped with subtracks are commonly used. These types of robots have superior locomotion performance on rough terrain. However, in teleoperated missions, the performance of tracked robots depends largely on the operators’ ability to control every subtrack appropriately. Therefore, an autonomous traversal function can significantly help in the teleoperation of such robots. In this paper, we propose a planning and control method for 4-DOF tracked robots climbing up/down known stairs automatically based on internal sensors. Experimental results obtained using mockup stairs verify the effectiveness of the proposed method.
DEFF Research Database (Denmark)
Iankova, Irena; Petersen, Rasmus K; Annicotte, Jean-Sébastien
2006-01-01
Positive transcription elongation factor b (P-TEFb) phosphorylates the C-terminal domain of RNA polymerase II, facilitating transcriptional elongation. In addition to its participation in general transcription, P-TEFb is recruited to specific promoters by some transcription factors such as c......-Myc or MyoD. The P-TEFb complex is composed of a cyclin-dependent kinase (cdk9) subunit and a regulatory partner (cyclin T1, cyclin T2, or cyclin K). Because cdk9 has been shown to participate in differentiation processes, such as muscle cell differentiation, we studied a possible role of cdk9...... with and phosphorylation of peroxisome proliferator-activated receptor gamma (PPARgamma), which is the master regulator of this process, on the promoter of PPARgamma target genes. PPARgamma-cdk9 interaction results in increased transcriptional activity of PPARgamma and therefore increased adipogenesis....
Determination of specificity influencing residues for key transcription factor families
DEFF Research Database (Denmark)
Patel, Ronak Y.; Garde, Christian; Stormo, Gary D.
2015-01-01
Transcription factors (TFs) are major modulators of transcription and subsequent cellular processes. The binding of TFs to specific regulatory elements is governed by their specificity. Considering the gap between known TFs sequence and specificity, specificity prediction frameworks are highly de...
A transcript cleavage factor of Mycobacterium tuberculosis important for its survival.
Directory of Open Access Journals (Sweden)
Arnab China
Full Text Available After initiation of transcription, a number of proteins participate during elongation and termination modifying the properties of the RNA polymerase (RNAP. Gre factors are one such group conserved across bacteria. They regulate transcription by projecting their N-terminal coiled-coil domain into the active center of RNAP through the secondary channel and stimulating hydrolysis of the newly synthesized RNA in backtracked elongation complexes. Rv1080c is a putative gre factor (MtbGre in the genome of Mycobacterium tuberculosis. The protein enhanced the efficiency of promoter clearance by lowering abortive transcription and also rescued arrested and paused elongation complexes on the GC rich mycobacterial template. Although MtbGre is similar in domain organization and shares key residues for catalysis and RNAP interaction with the Gre factors of Escherichia coli, it could not complement an E. coli gre deficient strain. Moreover, MtbGre failed to rescue E. coli RNAP stalled elongation complexes, indicating the importance of specific protein-protein interactions for transcript cleavage. Decrease in the level of MtbGre reduced the bacterial survival by several fold indicating its essential role in mycobacteria. Another Gre homolog, Rv3788 was not functional in transcript cleavage activity indicating that a single Gre is sufficient for efficient transcription of the M. tuberculosis genome.
Inhibition of factor-dependent transcription termination in ...
Indian Academy of Sciences (India)
Inhibition of factor-dependent transcription termination in Escherichia coli might relieve xenogene silencing by abrogating. H-NS-DNA interactions in vivo. DEEPTI CHANDRAPRAKASH and ASWIN SAI NARAIN SESHASAYEE. Chromatin immunoprecipitation. MG1655 hns::3xFLAG cells were grown in liquid LB me-.
Structural Design of a 6-DoF Hip Exoskeleton using Linear Series Elastic Actuators
Li, Xiao
2017-01-01
A novel hip exoskeleton with six degrees of freedom (DoF) was developed, and multiple prototypes of this product were created in this thesis. The device was an upper level of the 12-DoF lower-body exoskeleton project, which was known as the Orthotic Lower-body Locomotion Exoskeleton (OLL-E). The hip exoskeleton had three motions per leg, which were roll, yaw, and pitch. Currently, the sufferers of hemiplegia and paraplegia can be addressed by using a wheelchair or operating an exoskeleton wi...
Reference trajectory tracking for a multi-DOF robot arm
Directory of Open Access Journals (Sweden)
Krasňanský Róbert
2015-12-01
Full Text Available This paper presents the problem of tracking the generated reference trajectory by the simulation model of a multi-DOF robot arm. The kinematic transformation between task space and joint configuration coordinates is nonlinear and configuration dependent. To obtain the solution of the forward kinematics problem, the homogeneous transformation matrix is used. A solution to the inverse kinematics is a vector of joint configuration coordinates calculated using of pseudoinverse Jacobian technique. These coordinates correspond to a set of task space coordinates. The algorithm is presented which uses iterative solution and is simplified by considering stepper motors in robot arm joints. The reference trajectory in Cartesian coordinate system is generated on-line by the signal generator previously developed in MS Excel. Dynamic Data Exchange communication protocol allows sharing data with Matlab-Simulink. These data represent the reference tracking trajectory of the end effector. Matlab-Simulink software is used to calculate the representative joint rotations. The proposed algorithm is demonstrated experimentally on the model of 7-DOF robot arm system.
Transcription factor FoxO1 is essential for enamel biomineralization.
Directory of Open Access Journals (Sweden)
Ross A Poché
Full Text Available The Transforming growth factor β (Tgf-β pathway, by signaling via the activation of Smad transcription factors, induces the expression of many diverse downstream target genes thereby regulating a vast array of cellular events essential for proper development and homeostasis. In order for a specific cell type to properly interpret the Tgf-β signal and elicit a specific cellular response, cell-specific transcriptional co-factors often cooperate with the Smads to activate a discrete set of genes in the appropriate temporal and spatial manner. Here, via a conditional knockout approach, we show that mice mutant for Forkhead Box O transcription factor FoxO1 exhibit an enamel hypomaturation defect which phenocopies that of the Smad3 mutant mice. Furthermore, we determined that both the FoxO1 and Smad3 mutant teeth exhibit changes in the expression of similar cohort of genes encoding enamel matrix proteins required for proper enamel development. These data raise the possibility that FoxO1 and Smad3 act in concert to regulate a common repertoire of genes necessary for complete enamel maturation. This study is the first to define an essential role for the FoxO family of transcription factors in tooth development and provides a new molecular entry point which will allow researchers to delineate novel genetic pathways regulating the process of biomineralization which may also have significance for studies of human tooth diseases such as amelogenesis imperfecta.
Uncovering Transcriptional Regulatory Networks by Sparse Bayesian Factor Model
Directory of Open Access Journals (Sweden)
Qi Yuan(Alan
2010-01-01
Full Text Available Abstract The problem of uncovering transcriptional regulation by transcription factors (TFs based on microarray data is considered. A novel Bayesian sparse correlated rectified factor model (BSCRFM is proposed that models the unknown TF protein level activity, the correlated regulations between TFs, and the sparse nature of TF-regulated genes. The model admits prior knowledge from existing database regarding TF-regulated target genes based on a sparse prior and through a developed Gibbs sampling algorithm, a context-specific transcriptional regulatory network specific to the experimental condition of the microarray data can be obtained. The proposed model and the Gibbs sampling algorithm were evaluated on the simulated systems, and results demonstrated the validity and effectiveness of the proposed approach. The proposed model was then applied to the breast cancer microarray data of patients with Estrogen Receptor positive ( status and Estrogen Receptor negative ( status, respectively.
Myocardin-related transcription factors are required for cardiac development and function
Mokalled, Mayssa H.; Carroll, Kelli J.; Cenik, Bercin K.; Chen, Beibei; Liu, Ning; Olson, Eric N.; Bassel-Duby, Rhonda
2015-01-01
Myocardin-Related Transcription Factors A and B (MRTF-A and MRTF-B) are highly homologous proteins that function as powerful coactivators of serum response factor (SRF), a ubiquitously expressed transcription factor essential for cardiac development. The SRF/MRTF complex binds to CArG boxes found in the control regions of genes that regulate cytoskeletal dynamics and muscle contraction, among other processes. While SRF is required for heart development and function, the role of MRTFs in the d...
Exploring the utility of organo-polyoxometalate hybrids to inhibit SOX transcription factors
Directory of Open Access Journals (Sweden)
Kamesh Narasimhan
2014-01-01
Conclusion: Polyoxometalates are highly potent, nanomolar range inhibitors of the DNA binding activity of the Sox-HMG family. However, binding assays involving a limited subset of structurally diverse polyoxometalates revealed a low selectivity profile against different transcription factor families. Further progress in achieving selectivity and deciphering structure-activity relationship of POMs require the identification of POM binding sites on transcription factors using elaborate approaches like X-ray crystallography and multidimensional NMR. In summary, our report reaffirms that transcription factors are challenging molecular architectures and that future polyoxometalate chemistry must consider further modification strategies, to address the substantial challenges involved in achieving target selectivity.
Role of Transcription Factor Modifications in the Pathogenesis of Insulin Resistance
Directory of Open Access Journals (Sweden)
Mi-Young Kim
2012-01-01
Full Text Available Non-alcoholic fatty liver disease (NAFLD is characterized by fat accumulation in the liver not due to alcohol abuse. NAFLD is accompanied by variety of symptoms related to metabolic syndrome. Although the metabolic link between NAFLD and insulin resistance is not fully understood, it is clear that NAFLD is one of the main cause of insulin resistance. NAFLD is shown to affect the functions of other organs, including pancreas, adipose tissue, muscle and inflammatory systems. Currently efforts are being made to understand molecular mechanism of interrelationship between NAFLD and insulin resistance at the transcriptional level with specific focus on post-translational modification (PTM of transcription factors. PTM of transcription factors plays a key role in controlling numerous biological events, including cellular energy metabolism, cell-cycle progression, and organ development. Cell type- and tissue-specific reversible modifications include lysine acetylation, methylation, ubiquitination, and SUMOylation. Moreover, phosphorylation and O-GlcNAcylation on serine and threonine residues have been shown to affect protein stability, subcellular distribution, DNA-binding affinity, and transcriptional activity. PTMs of transcription factors involved in insulin-sensitive tissues confer specific adaptive mechanisms in response to internal or external stimuli. Our understanding of the interplay between these modifications and their effects on transcriptional regulation is growing. Here, we summarize the diverse roles of PTMs in insulin-sensitive tissues and their involvement in the pathogenesis of insulin resistance.
Chu, Xin-Ling; Dong, Wei-Xia; Ding, Jin-Li; Feng, Ming-Guang; Ying, Sheng-Hua
2018-02-01
Oxidation tolerance is an important determinant to predict the virulence and biocontrol potential of Beauveria bassiana, a well-known entomopathogenic fungus. As a transcriptional coactivator, multiprotein bridging factor 1 mediates the activity of transcription factor in diverse physiological processes, and its homolog in B. bassiana (BbMBF1) contributes to fungal oxidation tolerance. In this study, the BbMBF1-interactomes under oxidative stress and normal growth condition were deciphered by mass spectrometry integrated with the immunoprecipitation. BbMBF1p factor has a broad interaction with proteins that are involved in various cellular processes, and this interaction is dynamically regulated by oxidative stress. Importantly, a B. bassiana homolog of yeast AP-1-like transcription factor (BbAP-1) was specifically associated with the BbMBF1-interactome under oxidation and significantly contributed to fungal oxidation tolerance. In addition, qPCR analysis revealed that several antioxidant genes are jointly controlled by BbAP-1 and BbMBF1. Conclusively, it is proposed that BbMBF1p protein mediates BbAP-1p factor to transcribe the downstream antioxidant genes in B. bassiana under oxidative stress. This study demonstrates for the first time a proteomic view of the MBF1-interactome in fungi, and presents an initial framework to probe the transcriptional mechanism involved in fungal response to oxidation, which will provide a new strategy to improve the biocontrol efficacy of B. bassiana.
Emerging roles and regulation of MiT/TFE transcriptional factors.
Yang, Min; Liu, En; Tang, Li; Lei, Yuanyuan; Sun, Xuemei; Hu, Jiaxi; Dong, Hui; Yang, Shi-Ming; Gao, Mingfa; Tang, Bo
2018-06-15
The MiT/TFE transcription factors play a pivotal role in the regulation of autophagy and lysosomal biogenesis. The subcellular localization and activity of MiT/TFE proteins are primarily regulated through phosphorylation. And the phosphorylated protein is retained in the cytoplasm and subsequently translocates to the nucleus upon dephosphorylation, where it stimulates the expression of hundreds of genes, leading to lysosomal biogenesis and autophagy induction. The transcription factor-mediated lysosome-to-nucleus signaling can be directly controlled by several signaling molecules involved in the mTORC1, PKC, and AKT pathways. MiT/TFE family members have attracted much attention owing to their intracellular clearance of pathogenic factors in numerous diseases. Recently, multiple studies have also revealed the MiT/TFE proteins as master regulators of cellular metabolic reprogramming, converging on autophagic and lysosomal function and playing a critical role in cancer, suggesting that novel therapeutic strategies could be based on the modulation of MiT/TFE family member activity. Here, we present an overview of the latest research on MiT/TFE transcriptional factors and their potential mechanisms in cancer.
Energy Technology Data Exchange (ETDEWEB)
Xu, Ren; Spencer, Virginia A.; Bissell, Mina J.
2006-05-25
Extracellular cues play crucial roles in the transcriptional regulation of tissue-specific genes, but whether and how these signals lead to chromatin remodeling is not understood and subject to debate. Using chromatin immunoprecipitation (ChIP) assays and mammary-specific genes as models, we show here that extracellular matrix (ECM) molecules and prolactin cooperate to induce histone acetylation and binding of transcription factors and the SWI/SNF complex to the {beta}- and ?-casein promoters. Introduction of a dominant negative Brg1, an ATPase subunit of SWI/SNF complex, significantly reduced both {beta}- and ?-casein expression, suggesting that SWI/SNF-dependent chromatin remodeling is required for transcription of mammary-specific genes. ChIP analyses demonstrated that the ATPase activity of SWI/SNF is necessary for recruitment of RNA transcriptional machinery, but not for binding of transcription factors or for histone acetylation. Coimmunoprecipitation analyses showed that the SWI/SNF complex is associated with STAT5, C/EBP{beta}, and glucocorticoid receptor (GR). Thus, ECM- and prolactin-regulated transcription of the mammary-specific casein genes requires the concerted action of chromatin remodeling enzymes and transcription factors.
International Nuclear Information System (INIS)
Mian, Muhammad Umer; Khir, M. H. Md.; Tang, T. B.; Dennis, John Ojur; Riaz, Kashif; Iqbal, Abid; Bazaz, Shafaat A.
2015-01-01
Pre-fabrication, behavioural and performance analysis with computer aided design (CAD) tools is a common and fabrication cost effective practice. In light of this we present a simulation methodology for a dual-mass oscillator based 3 Degree of Freedom (3-DoF) MEMS gyroscope. 3-DoF Gyroscope is modeled through lumped parameter models using equivalent circuit elements. These equivalent circuits consist of elementary components which are counterpart of their respective mechanical components, used to design and fabricate 3-DoF MEMS gyroscope. Complete designing of equivalent circuit model, mathematical modeling and simulation are being presented in this paper. Behaviors of the equivalent lumped models derived for the proposed device design are simulated in MEMSPRO T-SPICE software. Simulations are carried out with the design specifications following design rules of the MetalMUMPS fabrication process. Drive mass resonant frequencies simulated by this technique are 1.59 kHz and 2.05 kHz respectively, which are close to the resonant frequencies found by the analytical formulation of the gyroscope. The lumped equivalent circuit modeling technique proved to be a time efficient modeling technique for the analysis of complex MEMS devices like 3-DoF gyroscopes. The technique proves to be an alternative approach to the complex and time consuming couple field analysis Finite Element Analysis (FEA) previously used
Energy Technology Data Exchange (ETDEWEB)
Mian, Muhammad Umer, E-mail: umermian@gmail.com; Khir, M. H. Md.; Tang, T. B. [Department of Electrical and Electronic Engineering, Universiti Teknologi PETRONAS, Tronoh, Perak (Malaysia); Dennis, John Ojur [Department of Fundamental & Applied Sciences, Universiti Teknologi PETRONAS, Tronoh, Perak (Malaysia); Riaz, Kashif; Iqbal, Abid [Faculty of Electronics Engineering, GIK Institute of Engineering Sciences and Technology, Topi, Khyber Pakhtunkhaw (Pakistan); Bazaz, Shafaat A. [Department of Computer Science, Center for Advance Studies in Engineering, Islamabad (Pakistan)
2015-07-22
Pre-fabrication, behavioural and performance analysis with computer aided design (CAD) tools is a common and fabrication cost effective practice. In light of this we present a simulation methodology for a dual-mass oscillator based 3 Degree of Freedom (3-DoF) MEMS gyroscope. 3-DoF Gyroscope is modeled through lumped parameter models using equivalent circuit elements. These equivalent circuits consist of elementary components which are counterpart of their respective mechanical components, used to design and fabricate 3-DoF MEMS gyroscope. Complete designing of equivalent circuit model, mathematical modeling and simulation are being presented in this paper. Behaviors of the equivalent lumped models derived for the proposed device design are simulated in MEMSPRO T-SPICE software. Simulations are carried out with the design specifications following design rules of the MetalMUMPS fabrication process. Drive mass resonant frequencies simulated by this technique are 1.59 kHz and 2.05 kHz respectively, which are close to the resonant frequencies found by the analytical formulation of the gyroscope. The lumped equivalent circuit modeling technique proved to be a time efficient modeling technique for the analysis of complex MEMS devices like 3-DoF gyroscopes. The technique proves to be an alternative approach to the complex and time consuming couple field analysis Finite Element Analysis (FEA) previously used.
Physical interactions among plant MADS-box transcription factors and their biological relevance
Nougalli Tonaco, I.A.
2008-01-01
The biological interpretation of the genome starts from transcription, and many different signaling pathways are integrated at this level. Transcription factors play a central role in the transcription process, because they select the down-stream genes and determine their spatial and temporal
Cooperative binding of transcription factors promotes bimodal gene expression response.
Directory of Open Access Journals (Sweden)
Pablo S Gutierrez
Full Text Available In the present work we extend and analyze the scope of our recently proposed stochastic model for transcriptional regulation, which considers an arbitrarily complex cis-regulatory system using only elementary reactions. Previously, we determined the role of cooperativity on the intrinsic fluctuations of gene expression for activating transcriptional switches, by means of master equation formalism and computer simulation. This model allowed us to distinguish between two cooperative binding mechanisms and, even though the mean expression levels were not affected differently by the acting mechanism, we showed that the associated fluctuations were different. In the present generalized model we include other regulatory functions in addition to those associated to an activator switch. Namely, we introduce repressive regulatory functions and two theoretical mechanisms that account for the biphasic response that some cis-regulatory systems show to the transcription factor concentration. We have also extended our previous master equation formalism in order to include protein production by stochastic translation of mRNA. Furthermore, we examine the graded/binary scenarios in the context of the interaction energy between transcription factors. In this sense, this is the first report to show that the cooperative binding of transcription factors to DNA promotes the "all-or-none" phenomenon observed in eukaryotic systems. In addition, we confirm that gene expression fluctuation levels associated with one of two cooperative binding mechanism never exceed the fluctuation levels of the other.
Kulakovskiy, Ivan V.
2011-08-18
Motivation: Modern experimental methods provide substantial information on protein-DNA recognition. Studying arrangements of transcription factor binding sites (TFBSs) of interacting transcription factors (TFs) advances understanding of the transcription regulatory code. Results: We constructed binding motifs for TFs forming a complex with HIF-1α at the erythropoietin 3\\'-enhancer. Corresponding TFBSs were predicted in the segments around transcription start sites (TSSs) of all human genes. Using the genome-wide set of regulatory regions, we observed several strongly preferred distances between hypoxia-responsive element (HRE) and binding sites of a particular cofactor protein. The set of preferred distances was called as a preferred pair distance template (PPDT). PPDT dramatically depended on the TF and orientation of its binding sites relative to HRE. PPDT evaluated from the genome-wide set of regulatory sequences was used to detect significant PPDT-consistent binding site pairs in regulatory regions of hypoxia-responsive genes. We believe PPDT can help to reveal the layout of eukaryotic regulatory segments. © The Author 2011. Published by Oxford University Press. All rights reserved.
Specification of jaw identity by the Hand2 transcription factor
Funato, Noriko; Kokubo, Hiroki; Nakamura, Masataka; Yanagisawa, Hiromi; Saga, Yumiko
2016-01-01
Acquisition of the lower jaw (mandible) was evolutionarily important for jawed vertebrates. In humans, syndromic craniofacial malformations often accompany jaw anomalies. The basic helix-loop-helix transcription factor Hand2, which is conserved among jawed vertebrates, is expressed in the neural crest in the mandibular process but not in the maxillary process of the first branchial arch. Here, we provide evidence that Hand2 is sufficient for upper jaw (maxilla)-to-mandible transformation by regulating the expression of homeobox transcription factors in mice. Altered Hand2 expression in the neural crest transformed the maxillae into mandibles with duplicated Meckel’s cartilage, which resulted in an absence of the secondary palate. In Hand2-overexpressing mutants, non-Hox homeobox transcription factors were dysregulated. These results suggest that Hand2 regulates mandibular development through downstream genes of Hand2 and is therefore a major determinant of jaw identity. Hand2 may have influenced the evolutionary acquisition of the mandible and secondary palate. PMID:27329940
Lassooij, J.; Tolou, N.; Tortora, G.; Caccavaro, S.; Menciassi, A.; Herder, J.L.
2012-01-01
This article presents the design of a newly developed 2DoF robotic arm with a novel statically balanced and bi-stable compliant grasper as the end effector for laparoscopic surgery application. The arm is based on internal motors actuating 2 rotational DoFs: pitch and roll. The positive stiffness of
In vivo bioimaging with tissue-specific transcription factor activated luciferase reporters.
Buckley, SM; Delhove, JM; Perocheau, DP; Karda, R; Rahim, AA; Howe, SJ; Ward, NJ; Birrell, MA; Belvisi, MG; Arbuthnot, P; Johnson, MR; Waddington, SN; McKay, TR
2015-01-01
The application of transcription factor activated luciferase reporter cassettes in vitro is widespread but potential for in vivo application has not yet been realized. Bioluminescence imaging enables non-invasive tracking of gene expression in transfected tissues of living rodents. However the mature immune response limits luciferase expression when delivered in adulthood. We present a novel approach of tissue-targeted delivery of transcription factor activated luciferase reporter lentiviruse...
Development of an Underactuated 2-DOF Wrist Joint using McKibben PAMs
Rajagopal, S. P.; Jain, S.; Ramasubramanian, S. N.; Johnson, B. V.; Dwivedy, S. K.
2014-10-01
In this work, model of an underactuated 2-DOF wrist joint with pneumatically actuated muscles is proposed. For the joint, McKibben-type artificial muscles are used in parallel configuration for the actuation. For each Degree of Freedom (DOF) one agonist-antagonist pair arrangement is usually used with a pulley mechanism. A mathematical model of wrist joint is derived using conventional forward kinematic analysis. The static model relating pressure in the muscle with the orientation of the wrist joint is obtained by combining the experimental data and mathematical model. Regulation of pressure can be achieved by pulse width modulation control of on/off solenoid valves. A set of free vibration experiments are done for the dynamic identification of the muscle characteristics.
A NEW GENERAL 3DOF QUASI-STEADY AERODYNAMIC INSTABILITY MODEL
DEFF Research Database (Denmark)
Gjelstrup, Henrik; Larsen, Allan; Georgakis, Christos
2008-01-01
but can generally be applied for aerodynamic instability prediction for prismatic bluff bodies. The 3DOF, which make up the movement of the model, are the displacements in the XY-plane and the rotation around the bluff body’s rotational axis. The proposed model incorporates inertia coupling between...
Directory of Open Access Journals (Sweden)
David Warrilow
Full Text Available Recent work suggests a role for multiple host factors in facilitating HIV-1 reverse transcription. Previously, we identified a cellular activity which increases the efficiency of HIV-1 reverse transcription in vitro. Here, we describe aspects of the activity which shed light on its function. The cellular factor did not affect synthesis of strong-stop DNA but did improve downstream DNA synthesis. The stimulatory activity was isolated by gel filtration in a single fraction of the exclusion volume. Velocity-gradient purified HIV-1, which was free of detectable RNase activity, showed poor reverse transcription efficiency but was strongly stimulated by partially purified cell proteins. Hence, the cell factor(s did not inactivate an RNase activity that might degrade the viral genomic RNA and block completion of reverse transcription. Instead, the cell factor(s enhanced first strand transfer and synthesis of late reverse transcription suggesting it stabilized the reverse transcription complex. The factor did not affect lysis of HIV-1 by Triton X-100 in the endogenous reverse transcription (ERT system, and ERT reactions with HIV-1 containing capsid mutations, which varied the biochemical stability of viral core structures and impeded reverse transcription in cells, showed no difference in the ability to be stimulated by the cell factor(s suggesting a lack of involvement of the capsid in the in vitro assay. In addition, reverse transcription products were found to be resistant to exogenous DNase I activity when the active fraction was present in the ERT assay. These results indicate that the cell factor(s may improve reverse transcription by facilitating DNA strand transfer and DNA synthesis. It also had a protective function for the reverse transcription products, but it is unclear if this is related to improved DNA synthesis.
Barbon, Elena; Pignani, Silvia; Branchini, Alessio; Bernardi, Francesco; Pinotti, Mirko; Bovolenta, Matteo
2016-06-24
Tailored approaches to restore defective transcription responsible for severe diseases have been poorly explored. We tested transcription activator-like effectors fused to an activation domain (TALE-TFs) in a coagulation factor VII (FVII) deficiency model. In this model, the deficiency is caused by the -94C > G or -61T > G mutation, which abrogate the binding of Sp1 or HNF-4 transcription factors. Reporter assays in hepatoma HepG2 cells naturally expressing FVII identified a single TALE-TF (TF4) that, by targeting the region between mutations, specifically trans-activated both the variant (>100-fold) and wild-type (20-40-fold) F7 promoters. Importantly, in the genomic context of transfected HepG2 and transduced primary hepatocytes, TF4 increased F7 mRNA and protein levels (2- to 3-fold) without detectable off-target effects, even for the homologous F10 gene. The ectopic F7 expression in renal HEK293 cells was modestly affected by TF4 or by TALE-TF combinations. These results provide experimental evidence for TALE-TFs as gene-specific tools useful to counteract disease-causing promoter mutations.
Characterization of senscence-associated NAC transcription factors in Barley (Hordeum Vulgare L.)
DEFF Research Database (Denmark)
Podzimska, Dagmara Agata
, such as yield, biomass production and nutrient quality, and NAC (NAM, ATAF1/2 and CUC2) transcription factors are promising targets for the breeding. The aim of this thesis was thus to assess the role of NAC transcription factors in regulation of senescence in barley (Hordeum vulgare L.) and to contribute...
O’Brown, Zach K.; Van Nostrand, Eric L.; Higgins, John P.; Kim, Stuart K.
2015-01-01
Human kidney function declines with age, accompanied by stereotyped changes in gene expression and histopathology, but the mechanisms underlying these changes are largely unknown. To identify potential regulators of kidney aging, we compared age-associated transcriptional changes in the human kidney with genome-wide maps of transcription factor occupancy from ChIP-seq datasets in human cells. The strongest candidates were the inflammation-associated transcription factors NFκB, STAT1 and STAT3, the activities of which increase with age in epithelial compartments of the renal cortex. Stimulation of renal tubular epithelial cells with the inflammatory cytokines IL-6 (a STAT3 activator), IFNγ (a STAT1 activator), or TNFα (an NFκB activator) recapitulated age-associated gene expression changes. We show that common DNA variants in RELA and NFKB1, the two genes encoding subunits of the NFκB transcription factor, associate with kidney function and chronic kidney disease in gene association studies, providing the first evidence that genetic variation in NFκB contributes to renal aging phenotypes. Our results suggest that NFκB, STAT1 and STAT3 underlie transcriptional changes and chronic inflammation in the aging human kidney. PMID:26678048
Negi, Sanjana; Tak, Himanshu; Ganapathi, T R
2018-03-01
MusaSNAC1 function in H 2 O 2 mediated stomatal closure and promote drought tolerance by directly binding to CGT[A/G] motif in regulatory region of multiple stress-related genes. Drought is a abiotic stress-condition, causing reduced plant growth and diminished crop yield. Guard cells of the stomata control photosynthesis and transpiration by regulating CO 2 exchange and water loss, thus affecting growth and crop yield. Roles of NAC (NAM, ATAF1/2 and CUC2) protein in regulation of stress-conditions has been well documented however, their control over stomatal aperture is largely unknown. In this study we report a banana NAC protein, MusaSNAC1 which induced stomatal closure by elevating H 2 O 2 content in guard cells during drought stress. Overexpression of MusaSNAC1 in banana resulted in higher number of stomata closure causing reduced water loss and thus elevated drought-tolerance. During drought, expression of GUS (β-glucuronidase) under P MusaSNAC1 was remarkably elevated in guard cells of stomata which correlated with its function as a transcription factor regulating stomatal aperture closing. MusaSNAC1 is a transcriptional activator belonging to SNAC subgroup and its 5'-upstream region contain multiple Dof1 elements as well as stress-associated cis-elements. Moreover, MusaSNAC1 also regulate multiple stress-related genes by binding to core site of NAC-proteins CGT[A/G] in their 5'-upstream region. Results indicated an interesting mechanism of drought tolerance through stomatal closure by H 2 O 2 generation in guard cells, regulated by a NAC-protein in banana.
Problem-Solving Test: The Mechanism of Transcription Termination by the Rho Factor
Szeberenyi, Jozsef
2012-01-01
Transcription termination comes in two forms in "E. coli" cells. Rho-dependent termination requires the binding of a termination protein called Rho factor to the transcriptional machinery at the terminator region, whereas Rho-independent termination is achieved by conformational changes in the transcript itself. This article presents a test…
Pharmacological targeting of the transcription factor SOX18 delays breast cancer in mice
Overman, Jeroen; Fontaine, Frank; Moustaqil, Mehdi; Mittal, Deepak; Sierecki, Emma; Sacilotto, Natalia; Zuegg, Johannes; Robertson, Avril AB; Holmes, Kelly; Salim, Angela A; Mamidyala, Sreeman; Butler, Mark S; Robinson, Ashley S; Lesieur, Emmanuelle; Johnston, Wayne; Alexandrov, Kirill; Black, Brian L; Hogan, Benjamin M; De Val, Sarah; Capon, Robert J; Carroll, Jason S; Bailey, Timothy L; Koopman, Peter; Jauch, Ralf; Smyth, Mark J; Cooper, Matthew A; Gambin, Yann; Francois, Mathias
2017-01-01
Pharmacological targeting of transcription factors holds great promise for the development of new therapeutics, but strategies based on blockade of DNA binding, nuclear shuttling, or individual protein partner recruitment have yielded limited success to date. Transcription factors typically engage in complex interaction networks, likely masking the effects of specifically inhibiting single protein-protein interactions. Here, we used a combination of genomic, proteomic and biophysical methods to discover a suite of protein-protein interactions involving the SOX18 transcription factor, a known regulator of vascular development and disease. We describe a small-molecule that is able to disrupt a discrete subset of SOX18-dependent interactions. This compound selectively suppressed SOX18 transcriptional outputs in vitro and interfered with vascular development in zebrafish larvae. In a mouse pre-clinical model of breast cancer, treatment with this inhibitor significantly improved survival by reducing tumour vascular density and metastatic spread. Our studies validate an interactome-based molecular strategy to interfere with transcription factor activity, for the development of novel disease therapeutics. DOI: http://dx.doi.org/10.7554/eLife.21221.001 PMID:28137359
Mitochondrial transcription factor A protects human retinal ...
African Journals Online (AJOL)
Purpose: To investigate the impact of mitochondrial transcription factor A (TFAM), as a modulator of NF-κB, on proliferation of hypoxia-induced human retinal endothelial cell (HREC), and the probable mechanism. Methods: After exposure to hypoxia (1 % O2) for 5 days, cell proliferation and cell cycle of HREC were ...
Proteopedia: 3D Visualization and Annotation of Transcription Factor-DNA Readout Modes
Dantas Machado, Ana Carolina; Saleebyan, Skyler B.; Holmes, Bailey T.; Karelina, Maria; Tam, Julia; Kim, Sharon Y.; Kim, Keziah H.; Dror, Iris; Hodis, Eran; Martz, Eric; Compeau, Patricia A.; Rohs, Remo
2012-01-01
3D visualization assists in identifying diverse mechanisms of protein-DNA recognition that can be observed for transcription factors and other DNA binding proteins. We used Proteopedia to illustrate transcription factor-DNA readout modes with a focus on DNA shape, which can be a function of either nucleotide sequence (Hox proteins) or base pairing…
Qibo, Feng; Bin, Zhang; Cunxing, Cui; Cuifang, Kuang; Yusheng, Zhai; Fenglin, You
2013-11-04
A simple method for simultaneously measuring the 6DOF geometric motion errors of the linear guide was proposed. The mechanisms for measuring straightness and angular errors and for enhancing their resolution are described in detail. A common-path method for measuring the laser beam drift was proposed and it was used to compensate the errors produced by the laser beam drift in the 6DOF geometric error measurements. A compact 6DOF system was built. Calibration experiments with certain standard measurement meters showed that our system has a standard deviation of 0.5 µm in a range of ± 100 µm for the straightness measurements, and standard deviations of 0.5", 0.5", and 1.0" in the range of ± 100" for pitch, yaw, and roll measurements, respectively.
E2F1 and p53 Transcription Factors as Accessory Factors for Nucleotide Excision Repair
Directory of Open Access Journals (Sweden)
David G. Johnson
2012-10-01
Full Text Available Many of the biochemical details of nucleotide excision repair (NER have been established using purified proteins and DNA substrates. In cells however, DNA is tightly packaged around histones and other chromatin-associated proteins, which can be an obstacle to efficient repair. Several cooperating mechanisms enhance the efficiency of NER by altering chromatin structure. Interestingly, many of the players involved in modifying chromatin at sites of DNA damage were originally identified as regulators of transcription. These include ATP-dependent chromatin remodelers, histone modifying enzymes and several transcription factors. The p53 and E2F1 transcription factors are well known for their abilities to regulate gene expression in response to DNA damage. This review will highlight the underappreciated, transcription-independent functions of p53 and E2F1 in modifying chromatin structure in response to DNA damage to promote global NER.
Park, Jong-Sug; Kim, Jung-Bong; Cho, Kang-Jin; Cheon, Choong-Ill; Sung, Mi-Kyung; Choung, Myoung-Gun; Roh, Kyung-Hee
2008-06-01
The MYB transcription factors play important roles in the regulation of many secondary metabolites at the transcriptional level. We evaluated the possible roles of the Arabidopsis R2R3-MYB transcription factors in flavonoid biosynthesis because they are induced by UV-B irradiation but their associated phenotypes are largely unexplored. We isolated their genes by RACE-PCR, and performed transgenic approach and metabolite analyses in lettuce (Lactuca sativa). We found that one member of this protein family, AtMYB60, inhibits anthocyanin biosynthesis in the lettuce plant. Wild-type lettuce normally accumulates anthocyanin, predominantly cyanidin and traces of delphinidin, and develops a red pigmentation. However, the production and accumulation of anthocyanin pigments in AtMYB60-overexpressing lettuce was inhibited. Using RT-PCR analysis, we also identified the complete absence or reduction of dihydroflavonol 4-reductase (DFR) transcripts in AtMYB60- overexpressing lettuce (AtMYB60-117 and AtMYB60-112 lines). The correlation between the overexpression of AtMYB60 and the inhibition of anthocyanin accumulation suggests that the transcription factorAtMYB60 controls anthocyanin biosynthesis in the lettuce leaf. Clarification of the roles of the AtMYB60 transcription factor will facilitate further studies and provide genetic tools to better understand the regulation in plants of the genes controlled by the MYB-type transcription factors. Furthermore, the characterization of AtMYB60 has implications for the development of new varieties of lettuce and other commercially important plants with metabolic engineering approaches.
The mitochondrial transcription factor A functions in mitochondrial base excision repair
DEFF Research Database (Denmark)
Canugovi, Chandrika; Maynard, Scott; Bayne, Anne-Cécile V
2010-01-01
Mitochondrial transcription factor A (TFAM) is an essential component of mitochondrial nucleoids. TFAM plays an important role in mitochondrial transcription and replication. TFAM has been previously reported to inhibit nucleotide excision repair (NER) in vitro but NER has not yet been detected i...
Interaction between FMDV Lpro and transcription factor ADNP is required for viral replication
The foot-and-mouth disease virus (FMDV) leader protease (Lpro) inhibits host translation and transcription affecting the expression of several factors involved in innate immunity. In this study, we have identified the host transcription factor ADNP (activity dependent neuroprotective protein) as an ...
WRKY transcription factor superfamily: Structure, origin and functions
African Journals Online (AJOL)
terminal ends contain the WRKYGQR amino acid sequence and a zinc-finger motif. WRKY transcription factors can regulate the expression of target genes that contain the W-box elements (C/T)TGAC(C/T) in the promoter regions by specifically ...
Posttranslational modifications of Forkhead box O transcription factors
Horst, Aart Arno van der
2006-01-01
FOXO transcription factors play an important role in essential biological processes such as differentiation, proliferation, apoptosis, DNA repair, metabolism and stress resistance. Phosphorylation is the modification that was first found on FOXOs and much of the subsequent studies focused on this
Transcription factor trapping by RNA in gene regulatory elements.
Sigova, Alla A; Abraham, Brian J; Ji, Xiong; Molinie, Benoit; Hannett, Nancy M; Guo, Yang Eric; Jangi, Mohini; Giallourakis, Cosmas C; Sharp, Phillip A; Young, Richard A
2015-11-20
Transcription factors (TFs) bind specific sequences in promoter-proximal and -distal DNA elements to regulate gene transcription. RNA is transcribed from both of these DNA elements, and some DNA binding TFs bind RNA. Hence, RNA transcribed from regulatory elements may contribute to stable TF occupancy at these sites. We show that the ubiquitously expressed TF Yin-Yang 1 (YY1) binds to both gene regulatory elements and their associated RNA species across the entire genome. Reduced transcription of regulatory elements diminishes YY1 occupancy, whereas artificial tethering of RNA enhances YY1 occupancy at these elements. We propose that RNA makes a modest but important contribution to the maintenance of certain TFs at gene regulatory elements and suggest that transcription of regulatory elements produces a positive-feedback loop that contributes to the stability of gene expression programs. Copyright © 2015, American Association for the Advancement of Science.
G = MAT: linking transcription factor expression and DNA binding data.
Tretyakov, Konstantin; Laur, Sven; Vilo, Jaak
2011-01-31
Transcription factors are proteins that bind to motifs on the DNA and thus affect gene expression regulation. The qualitative description of the corresponding processes is therefore important for a better understanding of essential biological mechanisms. However, wet lab experiments targeted at the discovery of the regulatory interplay between transcription factors and binding sites are expensive. We propose a new, purely computational method for finding putative associations between transcription factors and motifs. This method is based on a linear model that combines sequence information with expression data. We present various methods for model parameter estimation and show, via experiments on simulated data, that these methods are reliable. Finally, we examine the performance of this model on biological data and conclude that it can indeed be used to discover meaningful associations. The developed software is available as a web tool and Scilab source code at http://biit.cs.ut.ee/gmat/.
G = MAT: Linking Transcription Factor Expression and DNA Binding Data
Tretyakov, Konstantin; Laur, Sven; Vilo, Jaak
2011-01-01
Transcription factors are proteins that bind to motifs on the DNA and thus affect gene expression regulation. The qualitative description of the corresponding processes is therefore important for a better understanding of essential biological mechanisms. However, wet lab experiments targeted at the discovery of the regulatory interplay between transcription factors and binding sites are expensive. We propose a new, purely computational method for finding putative associations between transcription factors and motifs. This method is based on a linear model that combines sequence information with expression data. We present various methods for model parameter estimation and show, via experiments on simulated data, that these methods are reliable. Finally, we examine the performance of this model on biological data and conclude that it can indeed be used to discover meaningful associations. The developed software is available as a web tool and Scilab source code at http://biit.cs.ut.ee/gmat/. PMID:21297945
Susanna, KA; van der Werff, AF; den Hengst, CD; Calles, B; Salas, M; Venema, G; Hamoen, LW; Kuipers, OP
The development of genetic competence in Bacillus subtilis is regulated by a complex signal transduction cascade, which results in the synthesis of the competence transcription factor, encoded by comK. ComK is required for the transcription of the late competence genes that encode the DNA binding
Real-time control of the 3-DOF sled dynamics of a null-flux Maglev System with a passive sled
Boeij, de J.; Steinbuch, M.; Gutierrez, H.M.
2006-01-01
The real-time control of the three degrees of freedom (DOF) dynamics of an electrodynamic (EDS) Maglev vehicle is presented. The design is based on a 5-DOF state-space model of the sled dynamics that uses a simple algebraic model to describe the interaction between the -flux coils on the track and
In, K H; Asano, K; Beier, D; Grobholz, J; Finn, P W; Silverman, E K; Silverman, E S; Collins, T; Fischer, A R; Keith, T P; Serino, K; Kim, S W; De Sanctis, G T; Yandava, C; Pillari, A
1997-01-01
Five lipoxygenase (5-LO) is the first committed enzyme in the metabolic pathway leading to the synthesis of the leukotrienes. We examined genomic DNA isolated from 25 normal subjects and 31 patients with asthma (6 of whom had aspirin-sensitive asthma) for mutations in the known transcription factor binding regions and the protein encoding region of the 5-LO gene. A family of mutations in the G + C-rich transcription factor binding region was identified consisting of the deletion of one, delet...
A Six-DOF Buoyancy Tank Microgravity Test Bed with Active Drag Compensation
Sun, Chong; Chen, Shiyu; Yuan, Jianping; Zhu, Zhanxia
2017-10-01
Ground experiment under microgravity is very essential because it can verify the space enabling technologies before applied in space missions. In this paper, a novel ground experiment system that can provide long duration, large scale and high microgravity level for the six degree of freedom (DOF) spacecraft trajectory tracking is presented. In which, the most gravity of the test body is balanced by the buoyancy, and the small residual gravity is offset by the electromagnetic force. Because the electromagnetic force on the test body can be adjusted in the electromagnetic system, it can significantly simplify the balancing process using the proposed microgravity test bed compared to the neutral buoyance system. Besides, a novel compensation control system based on the active disturbance rejection control (ADRC) method is developed to estimate and compensate the water resistance online, in order to improve the fidelity of the ground experiment. A six-DOF trajectory tracking in the microgravity system is applied to testify the efficiency of the proposed compensation controller, and the experimental simulation results are compared to that obtained using the classic proportional-integral-derivative (PID) method. The simulation results demonstrated that, for the six-DOF motion ground experiment, the microgravity level can reach to 5 × 10-4 g. And, because the water resistance has been estimated and compensated, the performance of the presented controller is much better than the PID controller. The presented ground microgravity system can be applied in on-orbit service and other related technologies in future.
Advanced Glycation End-Products affect transcription factors regulating insulin gene expression
International Nuclear Information System (INIS)
Puddu, A.; Storace, D.; Odetti, P.; Viviani, G.L.
2010-01-01
Advanced Glycation End-Products (AGEs) are generated by the covalent interaction of reducing sugars with proteins, lipids or nucleic acids. AGEs are implicated in diabetic complications and pancreatic β-cell dysfunction. We previously demonstrated that exposure of the pancreatic islet cell line HIT-T15 to high concentrations of AGEs leads to a significant decrease of insulin secretion and content. Insulin gene transcription is positively regulated by the beta cell specific transcription factor PDX-1 (Pancreatic and Duodenal Homeobox-1). On the contrary, the forkhead transcription factor FoxO1 inhibits PDX-1 gene transcription. Activity of FoxO1 is regulated by post-translational modifications: phosphorylation deactivates FoxO1, and acetylation prevents FoxO1 ubiquitination. In this work we investigated whether AGEs affect expression and subcellular localization of PDX-1 and FoxO1. HIT-T15 cells were cultured for 5 days in presence of AGEs. Cells were then lysed and processed for subcellular fractionation. We determined intracellular insulin content, then we assessed the expression and subcellular localization of PDX-1, FoxO1, phosphoFoxO1 and acetylFoxO1. As expected intracellular insulin content was lower in HIT-T15 cells cultured with AGEs. The results showed that AGEs decreased expression and nuclear localization of PDX-1, reduced phosphorylation of FoxO1, and increased expression and acetylation of FoxO1. These results suggest that AGEs decrease insulin content unbalancing transcription factors regulating insulin gene expression.
G = MAT: linking transcription factor expression and DNA binding data.
Directory of Open Access Journals (Sweden)
Konstantin Tretyakov
Full Text Available Transcription factors are proteins that bind to motifs on the DNA and thus affect gene expression regulation. The qualitative description of the corresponding processes is therefore important for a better understanding of essential biological mechanisms. However, wet lab experiments targeted at the discovery of the regulatory interplay between transcription factors and binding sites are expensive. We propose a new, purely computational method for finding putative associations between transcription factors and motifs. This method is based on a linear model that combines sequence information with expression data. We present various methods for model parameter estimation and show, via experiments on simulated data, that these methods are reliable. Finally, we examine the performance of this model on biological data and conclude that it can indeed be used to discover meaningful associations. The developed software is available as a web tool and Scilab source code at http://biit.cs.ut.ee/gmat/.
DNA repair helicase: a component of BTF2 (TFIIH) basic transcription factor. (research article)
L. Schaeffer; R. Roy (Richard); S. Humbert; V. Moncollin; W. Vermeulen (Wim); J.H.J. Hoeijmakers (Jan); P. Chambon; J-M. Egly (Jean-Marc)
1993-01-01
textabstractThe human BTF2 basic transcription factor (also called TFIIH), which is similar to the delta factor in rat and factor b in yeast, is required for class II gene transcription. A strand displacement assay was used to show that highly purified preparation of BTF2 had an adenosine
Asap: a framework for over-representation statistics for transcription factor binding sites
DEFF Research Database (Denmark)
Marstrand, Troels T; Frellsen, Jes; Moltke, Ida
2008-01-01
-founded choice. METHODOLOGY: We introduce a software package, Asap, for fast searching with position weight matrices that include several standard methods for assessing over-representation. We have compared the ability of these methods to detect over-represented transcription factor binding sites in artificial......BACKGROUND: In studies of gene regulation the efficient computational detection of over-represented transcription factor binding sites is an increasingly important aspect. Several published methods can be used for testing whether a set of hypothesised co-regulated genes share a common regulatory...... regime based on the occurrence of the modelled transcription factor binding sites. However there is little or no information available for guiding the end users choice of method. Furthermore it would be necessary to obtain several different software programs from various sources to make a well...
Valproic acid disrupts the oscillatory expression of core circadian rhythm transcription factors.
Griggs, Chanel A; Malm, Scott W; Jaime-Frias, Rosa; Smith, Catharine L
2018-01-15
Valproic acid (VPA) is a well-established therapeutic used in treatment of seizure and mood disorders as well as migraines and a known hepatotoxicant. About 50% of VPA users experience metabolic disruptions, including weight gain, hyperlipidemia, and hyperinsulinemia, among others. Several of these metabolic abnormalities are similar to the effects of circadian rhythm disruption. In the current study, we examine the effect of VPA exposure on the expression of core circadian transcription factors that drive the circadian clock via a transcription-translation feedback loop. In cells with an unsynchronized clock, VPA simultaneously upregulated the expression of genes encoding core circadian transcription factors that regulate the positive and negative limbs of the feedback loop. Using low dose glucocorticoid, we synchronized cultured fibroblast cells to a circadian oscillatory pattern. Whether VPA was added at the time of synchronization or 12h later at CT12, we found that VPA disrupted the oscillatory expression of multiple genes encoding essential transcription factors that regulate circadian rhythm. Therefore, we conclude that VPA has a potent effect on the circadian rhythm transcription-translation feedback loop that may be linked to negative VPA side effects in humans. Furthermore, our study suggests potential chronopharmacology implications of VPA usage. Copyright © 2017. Published by Elsevier Inc.
The transcription factor KLF2 restrains CD4⁺ T follicular helper cell differentiation.
Lee, June-Yong; Skon, Cara N; Lee, You Jeong; Oh, Soohwan; Taylor, Justin J; Malhotra, Deepali; Jenkins, Marc K; Rosenfeld, M Geoffrey; Hogquist, Kristin A; Jameson, Stephen C
2015-02-17
T follicular helper (Tfh) cells are essential for efficient B cell responses, yet the factors that regulate differentiation of this CD4(+) T cell subset are incompletely understood. Here we found that the KLF2 transcription factor serves to restrain Tfh cell generation. Induced KLF2 deficiency in activated CD4(+) T cells led to increased Tfh cell generation and B cell priming, whereas KLF2 overexpression prevented Tfh cell production. KLF2 promotes expression of the trafficking receptor S1PR1, and S1PR1 downregulation is essential for efficient Tfh cell production. However, KLF2 also induced expression of the transcription factor Blimp-1, which repressed transcription factor Bcl-6 and thereby impaired Tfh cell differentiation. Furthermore, KLF2 induced expression of the transcription factors T-bet and GATA3 and enhanced Th1 differentiation. Hence, our data indicate KLF2 is pivotal for coordinating CD4(+) T cell differentiation through two distinct and complementary mechanisms: via control of T cell localization and by regulation of lineage-defining transcription factors. Copyright © 2015 Elsevier Inc. All rights reserved.
DOT/FAA Human Factors Workshop on Aviation (5th). Transcript.
1982-01-01
This document is a verbatim transcript of the proceedings of the Fifth Human Factors Workshop held at the Mike Monroney Aeronautical Center in Oklahoma City, Oklahoma, on July 7-9, 1981. The Sixth Human Factors Workshop was held at the same facility ...
Functionally significant, rare transcription factor variants in tetralogy of Fallot.
Directory of Open Access Journals (Sweden)
Ana Töpf
Full Text Available Rare variants in certain transcription factors involved in cardiac development cause Mendelian forms of congenital heart disease. The purpose of this study was to systematically assess the frequency of rare transcription factor variants in sporadic patients with the cardiac outflow tract malformation tetralogy of Fallot (TOF.We sequenced the coding, 5'UTR, and 3'UTR regions of twelve transcription factor genes implicated in cardiac outflow tract development (NKX2.5, GATA4, ISL1, TBX20, MEF2C, BOP/SMYD1, HAND2, FOXC1, FOXC2, FOXH, FOXA2 and TBX1 in 93 non-syndromic, non-Mendelian TOF cases. We also analysed Illumina Human 660W-Quad SNP Array data for copy number variants in these genes; none were detected. Four of the rare variants detected have previously been shown to affect transactivation in in vitro reporter assays: FOXC1 p.P297S, FOXC2 p.Q444R, FOXH1 p.S113T and TBX1 p.P43_G61del PPPPRYDPCAAAAPGAPGP. Two further rare variants, HAND2 p.A25_A26insAA and FOXC1 p.G378_G380delGGG, A488_491delAAAA, affected transactivation in in vitro reporter assays. Each of these six functionally significant variants was present in a single patient in the heterozygous state; each of the four for which parental samples were available were maternally inherited. Thus in the 93 TOF cases we identified six functionally significant mutations in the secondary heart field transcriptional network.This study indicates that rare genetic variants in the secondary heart field transcriptional network with functional effects on protein function occur in 3-13% of patients with TOF. This is the first report of a functionally significant HAND2 mutation in a patient with congenital heart disease.
Directory of Open Access Journals (Sweden)
James Claudine G
2006-09-01
Full Text Available Abstract Background Coordinated chondrocyte proliferation and differentiation are required for normal endochondral bone growth. Transcription factors binding to the cyclicAMP response element (CRE are known to regulate these processes. One member of this family, Activating Tanscription Factor 3 (ATF3, is expressed during skeletogenesis and acts as a transcriptional repressor, but the function of this protein in chondrogenesis is unknown. Results Here we demonstrate that Atf3 mRNA levels increase during mouse chondrocyte differentiation in vitro and in vivo. In addition, Atf3 mRNA levels are increased in response to cytochalasin D treatment, an inducer of chondrocyte maturation. This is accompanied by increased Atf3 promoter activity in cytochalasin D-treated chondrocytes. We had shown earlier that transcription of the cell cycle genes cyclin D1 and cyclin A in chondrocytes is dependent on CREs. Here we demonstrate that overexpression of ATF3 in primary mouse chondrocytes results in reduced transcription of both genes, as well as decreased activity of a CRE reporter plasmid. Repression of cyclin A transcription by ATF3 required the CRE in the cyclin A promoter. In parallel, ATF3 overexpression reduces the activity of a SOX9-dependent promoter and increases the activity of a RUNX2-dependent promoter. Conclusion Our data suggest that transcriptional induction of the Atf3 gene in maturing chondrocytes results in down-regulation of cyclin D1 and cyclin A expression as well as activation of RUNX2-dependent transcription. Therefore, ATF3 induction appears to facilitate cell cycle exit and terminal differentiation of chondrocytes.
Transcription factors as readers and effectors of DNA methylation.
Zhu, Heng; Wang, Guohua; Qian, Jiang
2016-08-01
Recent technological advances have made it possible to decode DNA methylomes at single-base-pair resolution under various physiological conditions. Many aberrant or differentially methylated sites have been discovered, but the mechanisms by which changes in DNA methylation lead to observed phenotypes, such as cancer, remain elusive. The classical view of methylation-mediated protein-DNA interactions is that only proteins with a methyl-CpG binding domain (MBD) can interact with methylated DNA. However, evidence is emerging to suggest that transcription factors lacking a MBD can also interact with methylated DNA. The identification of these proteins and the elucidation of their characteristics and the biological consequences of methylation-dependent transcription factor-DNA interactions are important stepping stones towards a mechanistic understanding of methylation-mediated biological processes, which have crucial implications for human development and disease.
Ikeda, Takako; Uno, Masaharu; Honjoh, Sakiko; Nishida, Eisuke
2017-08-09
The well-known link between longevity and the Sir2 histone deacetylase family suggests that histone deacetylation, a modification associated with repressed chromatin, is beneficial to longevity. However, the molecular links between histone acetylation and longevity remain unclear. Here, we report an unexpected finding that the MYST family histone acetyltransferase complex (MYS-1/TRR-1 complex) promotes rather than inhibits stress resistance and longevity in Caenorhabditis elegans Our results show that these beneficial effects are largely mediated through transcriptional up-regulation of the FOXO transcription factor DAF-16. MYS-1 and TRR-1 are recruited to the promoter regions of the daf-16 gene, where they play a role in histone acetylation, including H4K16 acetylation. Remarkably, we also find that the human MYST family Tip60/TRRAP complex promotes oxidative stress resistance by up-regulating the expression of FOXO transcription factors in human cells. Tip60 is recruited to the promoter regions of the foxo1 gene, where it increases H4K16 acetylation levels. Our results thus identify the evolutionarily conserved role of the MYST family acetyltransferase as a key epigenetic regulator of DAF-16/FOXO transcription factors. © 2017 The Authors.
Incorporating evolution of transcription factor binding sites into ...
Indian Academy of Sciences (India)
PRAKASH KUMAR
Identifying transcription factor binding sites (TFBSs) is essential to elucidate ... alignments with parts annotated as gap lessly aligned TFBSs (pair-profile hits) are generated. Moreover, the pair- profile related parameters are derived in a sound statistical framework. ... Much research has gone into the study of the evolution of.
Directory of Open Access Journals (Sweden)
Kanako Komaki-Yasuda
Full Text Available The mechanisms of stage-specific gene regulation in the malaria parasite Plasmodium falciparum are largely unclear, with only a small number of specific regulatory transcription factors (AP2 family having been identified. In particular, the transcription factors that function in the intraerythrocytic stage remain to be elucidated. Previously, as a model case for stage-specific transcription in the P. falciparum intraerythrocytic stage, we analyzed the transcriptional regulation of pf1-cys-prx, a trophozoite/schizont-specific gene, and suggested that some nuclear factors bind specifically to the cis-element of pf1-cys-prx and enhance transcription. In the present study, we purified nuclear factors from parasite nuclear extract by 5 steps of chromatography, and identified a factor termed PREBP. PREBP is not included in the AP2 family, and is a novel protein with four K-homology (KH domains. The KH domain is known to be found in RNA-binding or single-stranded DNA-binding proteins. PREBP is well conserved in Plasmodium species and partially conserved in phylum Apicomplexa. To evaluate the effects of PREBP overexpression, we used a transient overexpression and luciferase assay combined approach. Overexpression of PREBP markedly enhanced luciferase expression under the control of the pf1-cys-prx cis-element. These results provide the first evidence of a novel transcription factor that activates the gene expression in the malaria parasite intraerythrocytic stage. These findings enhance our understanding of the evolution of specific transcription machinery in Plasmodium and other eukaryotes.
Biological effects of tolerable level chronic boron intake on transcription factors.
Orenay Boyacioglu, Seda; Korkmaz, Mehmet; Kahraman, Erkan; Yildirim, Hatice; Bora, Selin; Ataman, Osman Yavuz
2017-01-01
The mechanism of boron effect on human transcription and translation has not been fully understood. In the current study it was aimed to reveal the role of boron on the expression of certain transcription factors that play key roles in many cellular pathways on human subjects chronically exposed to low amounts of boron. The boron concentrations in drinking water samples were 1.57±0.06mg/l for boron group while the corresponding value for the control group was 0.016±0.002mg/l. RNA isolation was performed using PAX gene RNA kit on the blood samples from the subjects. The RNA was then reverse transcribed into cDNA and analyzed using the Human Transcription Factors RT 2 Profiler™ PCR Arrays. While the boron amount in urine was detected as 3.56±1.47mg/day in the boron group, it was 0.72±0.30mg/day in the control group. Daily boron intake of the boron and control groups were calculated to be 6.98±3.39 and 1.18±0.41mg/day, respectively. The expression levels of the transcription factor genes were compared between the boron and control groups and no statistically significant difference was detected (P>0.05). The data suggest that boron intake at 6.98±3.39mg/day, which is the dose at which beneficial effects might be seen, does not result in toxicity at molecular level since the expression levels of transcription factors are not changed. Although boron intake over this level will seem to increase RNA synthesis, further examination of the topic is needed using new molecular epidemiological data. Copyright © 2016 Elsevier GmbH. All rights reserved.
Directory of Open Access Journals (Sweden)
Carles eMarco Llorca
2014-04-01
Full Text Available bZIPs and WRKYs are two important plant transcription factor families regulating diverse developmental and stress-related processes. Since a partial overlap in these biological processes is obvious, it can be speculated that they fulfill non-redundant functions in a complex regulatory network. Here, we focus on the regulatory mechanisms that are so far described for bZIPs and WRKYs. bZIP factors need to heterodimerize for DNA-binding and regulation of transcription, and based on a bioinformatics approach, bZIPs can build up more than the double of protein interactions than WRKYs. In contrast, an enrichment of the WRKY DNA-binding motifs can be found in WRKY promoters, a phenomenon which is not observed for the bZIP family. Thus, the two transcription factor families follow two different functional strategies in which WRKYs regulate each other’s transcription in a transcriptional network whereas bZIP action relies on intensive heterodimerization.
Cisplatin- and UV-damaged DNA lure the basal transcription factor TFIID/TBP.
P. Vichi; F. Coin (Frédéric); J-P. Renaud (Jean-Paul); W. Vermeulen (Wim); J.H.J. Hoeijmakers (Jan); D. Moras; J-M. Egly (Jean-Marc)
1997-01-01
textabstractA connection between transcription and DNA repair was demonstrated previously through the characterization of TFIIH. Using filter binding as well as in vitro transcription challenge competition assays, we now show that the promoter recognition factor TATA box-binding protein (TBP)/TFIID
Luo, Wei; Wang, Junxia; Xu, Dengfeng; Bai, Huili; Zhang, Yangli; Zhang, Yuhong; Li, Xiaosong
2018-04-01
In the present study, an artificial zinc-finger transcription factor eukaryotic expression vector specifically recognizing and binding to the hepatitis B virus (HBV) enhancer (Enh) was constructed, which inhibited the replication and expression of HBV DNA. The HBV EnhI‑specific pcDNA3.1‑artificial transcription factor (ATF) vector was successfully constructed, and then transformed or injected into HepG2.2.15 cells and HBV transgenic mice, respectively. The results demonstrated that the HBV EnhI (1,070‑1,234 bp)‑specific ATF significantly inhibited the replication and transcription of HBV DNA in vivo and in vitro. The HBV EnhI‑specific ATF may be a meritorious component of progressive combination therapies for eliminating HBV DNA in infected patients. A radical cure for chronic HBV infection may become feasible by using this bioengineering technology.
Smaczniak, C.D.
2013-01-01
Protein-protein and protein-DNA interactions are essential for the molecular action of transcription factors. By combinatorial binding to target gene promoters, transcription factors are able to up- or down-regulate the expression of these genes. MADS-domain proteins comprise a large family of
Directory of Open Access Journals (Sweden)
Hsu-Chih Huang
2014-01-01
Full Text Available This paper presents a hybrid Taguchi deoxyribonucleic acid (DNA swarm intelligence for solving the inverse kinematics redundancy problem of six degree-of-freedom (DOF humanoid robot arms. The inverse kinematics problem of the multi-DOF humanoid robot arm is redundant and has no general closed-form solutions or analytical solutions. The optimal joint configurations are obtained by minimizing the predefined performance index in DNA algorithm for real-world humanoid robotics application. The Taguchi method is employed to determine the DNA parameters to search for the joint solutions of the six-DOF robot arms more efficiently. This approach circumvents the disadvantage of time-consuming tuning procedure in conventional DNA computing. Simulation results are conducted to illustrate the effectiveness and merit of the proposed methods. This Taguchi-based DNA (TDNA solver outperforms the conventional solvers, such as geometric solver, Jacobian-based solver, genetic algorithm (GA solver and ant, colony optimization (ACO solver.
NAC Transcription Factors of Barley (Hordeum vulgare L.) and their Involvement in Leaf Senescence
DEFF Research Database (Denmark)
Wagner, Michael
parts of the senescence process. The specific aims of this study were therefore (1) to establish and characterise the NAC transcription factors of the model cereal crop barley (Hordeum vulgare L.) (2) to identify and study putative barley NAC transcription factors involved in the regulation of leaf...
Goswami, S; Yee, SW; Stocker, S; Mosley, JD; Kubo, M; Castro, R; Mefford, JA; Wen, C; Liang, X; Witte, J; Brett, C; Maeda, S; Simpson, MD; Hedderson, MM; Davis, RL; Roden, DM; Giacomini, KM; Savic, RM
2014-01-01
One-third of type 2 diabetes patients do not respond to metformin. Genetic variants in metformin transporters have been extensively studied as a likely contributor to this high failure rate. Here, we investigate, for the first time, the effect of genetic variants in transcription factors on metformin pharmacokinetics (PK) and response. Overall, 546 patients and healthy volunteers contributed their genome-wide, pharmacokinetic (235 subjects), and HbA1c data (440 patients) for this analysis. Five variants in specificity protein 1 (SP1), a transcription factor that modulates the expression of metformin transporters, were associated with changes in treatment HbA1c (P < 0.01) and metformin secretory clearance (P < 0.05). Population pharmacokinetic modeling further confirmed a 24% reduction in apparent clearance in homozygous carriers of one such variant, rs784888. Genetic variants in other transcription factors, peroxisome proliferator–activated receptor-α and hepatocyte nuclear factor 4-α, were significantly associated with HbA1c change only. Overall, our study highlights the importance of genetic variants in transcription factors as modulators of metformin PK and response. PMID:24853734
Pluripotency transcription factors and Tet1/2 maintain Brd4-independent stem cell identity.
Finley, Lydia W S; Vardhana, Santosha A; Carey, Bryce W; Alonso-Curbelo, Direna; Koche, Richard; Chen, Yanyang; Wen, Duancheng; King, Bryan; Radler, Megan R; Rafii, Shahin; Lowe, Scott W; Allis, C David; Thompson, Craig B
2018-05-01
A robust network of transcription factors and an open chromatin landscape are hallmarks of the naive pluripotent state. Recently, the acetyllysine reader Brd4 has been implicated in stem cell maintenance, but the relative contribution of Brd4 to pluripotency remains unclear. Here, we show that Brd4 is dispensable for self-renewal and pluripotency of embryonic stem cells (ESCs). When maintained in their ground state, ESCs retain transcription factor binding and chromatin accessibility independent of Brd4 function or expression. In metastable ESCs, Brd4 independence can be achieved by increased expression of pluripotency transcription factors, including STAT3, Nanog or Klf4, so long as the DNA methylcytosine oxidases Tet1 and Tet2 are present. These data reveal that Brd4 is not essential for ESC self-renewal. Rather, the levels of pluripotency transcription factor abundance and Tet1/2 function determine the extent to which bromodomain recognition of protein acetylation contributes to the maintenance of gene expression and cell identity.
Function of the PHA-4/FOXA transcription factor during C. elegans post-embryonic development
Directory of Open Access Journals (Sweden)
Chen Di
2008-02-01
Full Text Available Abstract Background pha-4 encodes a forkhead box (FOX A transcription factor serving as the C. elegans pharynx organ identity factor during embryogenesis. Using Serial Analysis of Gene Expression (SAGE, comparison of gene expression profiles between growing stages animals and long-lived, developmentally diapaused dauer larvae revealed that pha-4 transcription is increased in the dauer stage. Results Knocking down pha-4 expression by RNAi during post-embryonic development showed that PHA-4 is essential for dauer recovery, gonad and vulva development. daf-16, which encodes a FOXO transcription factor regulated by insulin/IGF-1 signaling, shows overlapping expression patterns and a loss-of-function post-embryonic phenotype similar to that of pha-4 during dauer recovery. pha-4 RNAi and daf-16 mutations have additive effects on dauer recovery, suggesting these two regulators may function in parallel pathways. Gene expression studies using RT-PCR and GFP reporters showed that pha-4 transcription is elevated under starvation, and a conserved forkhead transcription factor binding site in the second intron of pha-4 is important for the neuronal expression. The vulval transcription of lag-2, which encodes a ligand for the LIN-12/Notch lateral signaling pathway, is inhibited by pha-4 RNAi, indicating that LAG-2 functions downstream of PHA-4 in vulva development. Conclusion Analysis of PHA-4 during post-embryonic development revealed previously unsuspected functions for this important transcriptional regulator in dauer recovery, and may help explain the network of transcriptional control integrating organogenesis with the decision between growth and developmental arrest at the dauer entry and exit stages.
Nuclear factor ETF specifically stimulates transcription from promoters without a TATA box.
Kageyama, R; Merlino, G T; Pastan, I
1989-09-15
Transcription factor ETF stimulates the expression of the epidermal growth factor receptor (EGFR) gene which does not have a TATA box in the promoter region. Here, we show that ETF recognizes various GC-rich sequences including stretches of deoxycytidine or deoxyguanosine residues and GC boxes with similar affinities. ETF also binds to TATA boxes but with a lower affinity. ETF stimulated in vitro transcription from several promoters without TATA boxes but had little or no effect on TATA box-containing promoters even though they had strong ETF-binding sites. These inactive ETF-binding sites became functional when placed upstream of the EGFR promoter whose own ETF-binding sites were removed. Furthermore, when a TATA box was introduced into the EGFR promoter, the responsiveness to ETF was abolished. These results indicate that ETF is a specific transcription factor for promoters which do not contain TATA elements.
Survival-related profile, pathways, and transcription factors in ovarian cancer.
Directory of Open Access Journals (Sweden)
Anne P G Crijns
2009-02-01
Full Text Available BACKGROUND: Ovarian cancer has a poor prognosis due to advanced stage at presentation and either intrinsic or acquired resistance to classic cytotoxic drugs such as platinum and taxoids. Recent large clinical trials with different combinations and sequences of classic cytotoxic drugs indicate that further significant improvement in prognosis by this type of drugs is not to be expected. Currently a large number of drugs, targeting dysregulated molecular pathways in cancer cells have been developed and are introduced in the clinic. A major challenge is to identify those patients who will benefit from drugs targeting these specific dysregulated pathways.The aims of our study were (1 to develop a gene expression profile associated with overall survival in advanced stage serous ovarian cancer, (2 to assess the association of pathways and transcription factors with overall survival, and (3 to validate our identified profile and pathways/transcription factors in an independent set of ovarian cancers. METHODS AND FINDINGS: According to a randomized design, profiling of 157 advanced stage serous ovarian cancers was performed in duplicate using approximately 35,000 70-mer oligonucleotide microarrays. A continuous predictor of overall survival was built taking into account well-known issues in microarray analysis, such as multiple testing and overfitting. A functional class scoring analysis was utilized to assess pathways/transcription factors for their association with overall survival. The prognostic value of genes that constitute our overall survival profile was validated on a fully independent, publicly available dataset of 118 well-defined primary serous ovarian cancers. Furthermore, functional class scoring analysis was also performed on this independent dataset to assess the similarities with results from our own dataset. An 86-gene overall survival profile discriminated between patients with unfavorable and favorable prognosis (median survival, 19
Molecular architecture of transcription factor hotspots in early adipogenesis
DEFF Research Database (Denmark)
Siersbæk, Rasmus; Baek, Songjoon; Rabiee, Atefeh
2014-01-01
motif on chromatin, and we suggest that this may be a general mechanism for integrating external signals on chromatin. Furthermore, we find evidence of extensive recruitment of transcription factors to hotspots through alternative mechanisms not involving their known motifs and demonstrate...
Chattering-Free Neuro-Sliding Mode Control of 2-DOF Planar Parallel Manipulators
Directory of Open Access Journals (Sweden)
Tien Dung Le
2013-01-01
Full Text Available This paper proposes a novel chattering free neuro-sliding mode controller for the trajectory tracking control of two degrees of freedom (DOF parallel manipulators which have a complicated dynamic model, including modelling uncertainties, frictional uncertainties and external disturbances. A feedforward neural network (NN is combined with an error estimator to completely compensate the large nonlinear uncertainties and external disturbances of the parallel manipulators. The online weight tuning algorithms of the NN and the structure of the error estimator are derived with the strict theoretical stability proof of the Lyapunov theorem. The upper bound of uncertainties and the upper bound of the approximation errors are not required to be known in advance in order to guarantee the stability of the closed-loop system. The example simulation results show the effectiveness of the proposed control strategy for the tracking control of a 2-DOF parallel manipulator. It results in its being chattering-free, very small tracking errors and its robustness against uncertainties and external disturbances.
A transcription factor for cold sensation!
Directory of Open Access Journals (Sweden)
Milbrandt Jeffrey
2005-03-01
Full Text Available Abstract The ability to feel hot and cold is critical for animals and human beings to survive in the natural environment. Unlike other sensations, the physiology of cold sensation is mostly unknown. In the present study, we use genetically modified mice that do not express nerve growth factor-inducible B (NGFIB to investigate the possible role of NGFIB in cold sensation. We found that genetic deletion of NGFIB selectively affected behavioral responses to cold stimuli while behavioral responses to noxious heat or mechanical stimuli were normal. Furthermore, behavioral responses remained reduced or blocked in NGFIB knockout mice even after repetitive application of cold stimuli. Our results provide strong evidence that the first transcription factor NGFIB determines the ability of animals to respond to cold stimulation.
Joosten, Paul H. L. J.; Toepoel, Mascha; van Oosterhout, Dirk; Afink, Gijs B.; van Zoelen, Everardus J. J.
2002-01-01
We have previously shown that deregulated expression of the platelet-derived growth factor alpha-receptor (PDGFRA) can be associated with neural tube defects (NTDs) in both men and mice. In the present study, we have investigated the transcription factors that control the up-regulation of PDGFRA
DEFF Research Database (Denmark)
Jensen, Michael Krogh; Rung, Jesper Henrik; Gregersen, Per Langkjaer
2007-01-01
Pathogens induce the expression of many genes encoding plant transcription factors, though specific knowledge of the biological function of individual transcription factors remains scarce. NAC transcription factors are encoded in plants by a gene family with proposed functions in both abiotic...... and biotic stress adaptation, as well as in developmental processes. In this paper, we provide convincing evidence that a barley NAC transcription factor has a direct role in regulating basal defence. The gene transcript was isolated by differential display from barley leaves infected with the biotrophic...... powdery mildew fungus, Blumeria graminis f.sp. hordei (Bgh). The full-length cDNA clone was obtained using 5'-RACE and termed HvNAC6, due to its high similarity to the rice homologue, OsNAC6. Gene silencing of HvNAC6 during Bgh inoculation compromises penetration resistance in barley epidermal cells...
Regulation of endogenous human gene expression by ligand-inducible TALE transcription factors.
Mercer, Andrew C; Gaj, Thomas; Sirk, Shannon J; Lamb, Brian M; Barbas, Carlos F
2014-10-17
The construction of increasingly sophisticated synthetic biological circuits is dependent on the development of extensible tools capable of providing specific control of gene expression in eukaryotic cells. Here, we describe a new class of synthetic transcription factors that activate gene expression in response to extracellular chemical stimuli. These inducible activators consist of customizable transcription activator-like effector (TALE) proteins combined with steroid hormone receptor ligand-binding domains. We demonstrate that these ligand-responsive TALE transcription factors allow for tunable and conditional control of gene activation and can be used to regulate the expression of endogenous genes in human cells. Since TALEs can be designed to recognize any contiguous DNA sequence, the conditional gene regulatory system described herein will enable the design of advanced synthetic gene networks.
DEFF Research Database (Denmark)
Zhao, Jian; Yuan, Xuejun; Frödin, Morten
2003-01-01
-specific transcription initiation factor TIF-IA. Activation of TIF-IA and ribosomal gene transcription is sensitive to PD98059, indicating that TIF-IA is targeted by MAPK in vivo. Phosphopeptide mapping and mutational analysis reveals two serine residues (S633 and S649) that are phosphorylated by ERK and RSK kinases....... Replacement of S649 by alanine inactivates TIF-IA, inhibits pre-rRNA synthesis, and retards cell growth. The results provide a link between growth factor signaling, ribosome production, and cell growth, and may have a major impact on the mechanism of cell transformation....
Zhao, Yingke; Liu, Yue
2018-04-01
The abnormalities of transcription factors, such as NF-κB, STAT, estrogen receptor, play a critical role in the initiation and progression of breast cancer. Due to the limitation of current treatment, transcription factors could be promising therapeutic targets, which have received close attention. In this review, we introduced herbal medicines, as well as botanical compounds that had been verified with anti-tumor properties via regulating transcription factors. Herbs, compounds, as well as formulae reported with various transcriptional targets, were summarized thoroughly, to provide implication for the future research on basic experiment and clinical application. Copyright © 2017 Elsevier Ltd. All rights reserved.
Ai, Trinh Ngoc; Naing, Aung Htay; Arun, Muthukrishnan; Lim, Sun-Hyung; Kim, Chang Kil
2016-11-01
The effects of three different sucrose concentrations on plant growth and anthocyanin accumulation were examined in non-transgenic (NT) and transgenic (T 2 ) specimens of the Petunia hybrida cultivar 'Mirage rose' that carried the anthocyanin regulatory transcription factors B-Peru+mPAP1 or RsMYB1. Anthocyanin accumulation was not observed in NT plants in any treatments, whereas a range of anthocyanin accumulation was observed in transgenic plants. The anthocyanin content detected in transgenic plants expressing the anthocyanin regulatory transcription factors (B-Peru+mPAP1 or RsMYB1) was higher than that in NT plants. In addition, increasing sucrose concentration strongly enhanced anthocyanin content as shown by quantitative real-time polymerase chain reaction (qRT-PCR) analysis, wherein increased concentrations of sucrose enhanced transcript levels of the transcription factors that are responsible for the induction of biosynthetic genes involved in anthocyanin synthesis; this pattern was not observed in NT plants. In addition, sucrose affected plant growth, although the effects were different between NT and transgenic plants. Taken together, the application of sucrose could enhance anthocyanin production in vegetative tissue of transgenic Petunia carrying anthocyanin regulatory transcription factors, and this study provides insights about interactive effects of sucrose and transcription factors in anthocyanin biosynthesis in the transgenic plant. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Nuclear exclusion of transcription factors associated with apoptosis in developing nervous tissue
Directory of Open Access Journals (Sweden)
R. Linden
1999-07-01
Full Text Available Programmed cell death in the form of apoptosis involves a network of metabolic events and may be triggered by a variety of stimuli in distinct cells. The nervous system contains several neuron and glial cell types, and developmental events are strongly dependent on selective cell interactions. Retinal explants have been used as a model to investigate apoptosis in nervous tissue. This preparation maintains the structural complexity and cell interactions similar to the retina in situ, and contains cells in all stages of development. We review the finding of nuclear exclusion of several transcription factors during apoptosis in retinal cells. The data reviewed in this paper suggest a link between apoptosis and a failure in the nucleo-cytoplasmic partition of transcription factors. It is argued that the nuclear exclusion of transcription factors may be an integral component of apoptosis both in the nervous system and in other types of cells and tissues.
Experimental Analysis and Full Prediction Model of a 5-DOF Motorized Spindle
Directory of Open Access Journals (Sweden)
Weiyu Zhang
2017-01-01
Full Text Available The cost and power consumption of DC power amplifiers are much greater than that of AC power converters. Compared to a motorized spindle supported with DC magnetic bearings, a motorized spindle supported with AC magnetic bearings is inexpensive and more efficient. This paper studies a five-degrees-of-freedom (5-DOF motorized spindle supported with AC hybrid magnetic bearings (HMBs. Most models of suspension forces, except a “switching model”, are quite accurate, but only in a particular operating area and not in regional coverage. If a “switching model” is applied to a 5-DOF motorized spindle, the real-time performance of the control system can be significantly decreased due to the large amount of data processing for both displacement and current. In order to solve this defect, experiments based on the “switching model” are performed, and the resulting data are analyzed. Using the data analysis results, a “full prediction model” based on the operating state is proposed to improve real-time performance and precision. Finally, comparative, verification and stiffness tests are conducted to verify the improvement of the proposed model. Results of the tests indicate that the rotor has excellent characteristics, such as good real-time performance, superior anti-interference performance with load and the accuracy of the model in full zone. The satisfactory experimental results demonstrate the effectiveness of the “full prediction model” applied to the control system under different operating stages. Therefore, the results of the experimental analysis and the proposed full prediction model can provide a control system of a 5-DOF motorized spindle with the most suitable mathematical models of the suspension force.
On Virtual Integrated Model of a 6DoF Manipulator Arm for Emergency Cases Interventions
Directory of Open Access Journals (Sweden)
Gigi Naidin
2011-09-01
Full Text Available This research deals with a virtual integrated model for a 6DoF manipulator arm dedicated to use for emergency situations intervention. The virtual model can simulates both the entire structural and mechanical configuration of the manipulator, and the driving system with automated command unit. The basic idea supposes to develop a complex simulator for kinematical and dynamic behavior analysis of 6DoF robot manipulator, and for facilely cross correlation and comparative evaluation between essential parameters and extremely bearing cases defining the manipulator working state. The analysis was developed in Matlab© - SimScape© software. The conclusions dignify the main functional capability of the manipulator supposing the capacity of driving system and mechanical structure.
Engineering synthetic TALE and CRISPR/Cas9 transcription factors for regulating gene expression.
Kabadi, Ami M; Gersbach, Charles A
2014-09-01
Engineered DNA-binding proteins that can be targeted to specific sites in the genome to manipulate gene expression have enabled many advances in biomedical research. This includes generating tools to study fundamental aspects of gene regulation and the development of a new class of gene therapies that alter the expression of endogenous genes. Designed transcription factors have entered clinical trials for the treatment of human diseases and others are in preclinical development. High-throughput and user-friendly platforms for designing synthetic DNA-binding proteins present innovative methods for deciphering cell biology and designing custom synthetic gene circuits. We review two platforms for designing synthetic transcription factors for manipulating gene expression: Transcription activator-like effectors (TALEs) and the RNA-guided clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 system. We present an overview of each technology and a guide for designing and assembling custom TALE- and CRISPR/Cas9-based transcription factors. We also discuss characteristics of each platform that are best suited for different applications. Copyright © 2014 Elsevier Inc. All rights reserved.
NF-κB Transcription Factor Role in Consolidation and Reconsolidation of Persistent Memories
Directory of Open Access Journals (Sweden)
Verónica ede la Fuente
2015-09-01
Full Text Available Transcriptional regulation is an important molecular process required for long-term neural plasticity and long-term memory formation. Thus, one main interest in molecular neuroscience in the last decades has been the identification of transcription factors that are involved in memory processes. Among them, the NF-κB family of transcription factors has gained interest due to a significant body of evidence that supports a key role of these proteins in synaptic plasticity and memory. In recent years, the interest was particularly reinforced because NF-κB was characterized as an important regulator of synaptogenesis. This function may be explained by its participation in synapse to nucleus communication, as well as a possible local role at the synapse. This review provides an overview of experimental work obtained in the last years, showing the essential role of this transcription factor in memory processes in different learning tasks in mammals. We focus the review on the consolidation and reconsolidation memory phases as well as on the regulation of immediate-early and late genes by epigenetic mechanisms that determine enduring forms of memories.
Tripathi, Prateek; Rabara, Roel C; Rushton, Paul J
2014-02-01
Drought is one of the major challenges affecting crop productivity and yield. However, water stress responses are notoriously multigenic and quantitative with strong environmental effects on phenotypes. It is also clear that water stress often does not occur alone under field conditions but rather in conjunction with other abiotic stresses such as high temperature and high light intensities. A multidisciplinary approach with successful integration of a whole range of -omics technologies will not only define the system, but also provide new gene targets for both transgenic approaches and marker-assisted selection. Transcription factors are major players in water stress signaling and some constitute major hubs in the signaling webs. The main transcription factors in this network include MYB, bHLH, bZIP, ERF, NAC, and WRKY transcription factors. The role of WRKY transcription factors in abiotic stress signaling networks is just becoming apparent and systems biology approaches are starting to define their places in the signaling network. Using systems biology approaches, there are now many transcriptomic analyses and promoter analyses that concern WRKY transcription factors. In addition, reports on nuclear proteomics have identified WRKY proteins that are up-regulated at the protein level by water stress. Interactomics has started to identify different classes of WRKY-interacting proteins. What are often lacking are connections between metabolomics, WRKY transcription factors, promoters, biosynthetic pathways, fluxes and downstream responses. As more levels of the system are characterized, a more detailed understanding of the roles of WRKY transcription factors in drought responses in crops will be obtained.
Fang, Xin; Sastry, Anand; Mih, Nathan; Kim, Donghyuk; Tan, Justin; Lloyd, Colton J.; Gao, Ye; Yang, Laurence; Palsson, Bernhard O.
2017-01-01
Transcriptional regulatory networks (TRNs) have been studied intensely for >25 y. Yet, even for the Escherichia coli TRN—probably the best characterized TRN—several questions remain. Here, we address three questions: (i) How complete is our knowledge of the E. coli TRN; (ii) how well can we predict gene expression using this TRN; and (iii) how robust is our understanding of the TRN? First, we reconstructed a high-confidence TRN (hiTRN) consisting of 147 transcription factors (TFs) regulating 1,538 transcription units (TUs) encoding 1,764 genes. The 3,797 high-confidence regulatory interactions were collected from published, validated chromatin immunoprecipitation (ChIP) data and RegulonDB. For 21 different TF knockouts, up to 63% of the differentially expressed genes in the hiTRN were traced to the knocked-out TF through regulatory cascades. Second, we trained supervised machine learning algorithms to predict the expression of 1,364 TUs given TF activities using 441 samples. The algorithms accurately predicted condition-specific expression for 86% (1,174 of 1,364) of the TUs, while 193 TUs (14%) were predicted better than random TRNs. Third, we identified 10 regulatory modules whose definitions were robust against changes to the TRN or expression compendium. Using surrogate variable analysis, we also identified three unmodeled factors that systematically influenced gene expression. Our computational workflow comprehensively characterizes the predictive capabilities and systems-level functions of an organism’s TRN from disparate data types. PMID:28874552
Transcription Factors Expressed in Lateral Organ Boundaries: Identification of Downstream Targets
Energy Technology Data Exchange (ETDEWEB)
Springer, Patricia S
2010-07-12
The processes of lateral organ initiation and patterning are central to the generation of mature plant form. Characterization of the molecular mechanisms underlying these processes is essential to our understanding of plant development. Communication between the shoot apical meristem and initiating organ primordia is important both for functioning of the meristem and for proper organ patterning, and very little is known about this process. In particular, the boundary between meristem and leaf is emerging as a critical region that is important for SAM maintenance and regulation of organogenesis. The goal of this project was to characterize three boundary-expressed genes that encode predicted transcription factors. Specifically, we have studied LATERAL ORGAN BOUNDARIES (LOB), LATERAL ORGAN FUSION1 (LOF1), and LATERAL ORGAN FUSION2 (LOF2). LOB encodes the founding member of the LOB-DOMAIN (LBD) plant-specific DNA binding transcription factor family and LOF1 and LOF2 encode paralogous MYB-domain transcription factors. We characterized the genetic relationship between these three genes and other boundary and meristem genes. We also used an ectopic inducible expression system to identify direct targets of LOB.
Evidence for site-specific occupancy of the mitochondrial genome by nuclear transcription factors.
Directory of Open Access Journals (Sweden)
Georgi K Marinov
Full Text Available Mitochondria contain their own circular genome, with mitochondria-specific transcription and replication systems and corresponding regulatory proteins. All of these proteins are encoded in the nuclear genome and are post-translationally imported into mitochondria. In addition, several nuclear transcription factors have been reported to act in mitochondria, but there has been no comprehensive mapping of their occupancy patterns and it is not clear how many other factors may also be found in mitochondria. Here we address these questions by using ChIP-seq data from the ENCODE, mouseENCODE and modENCODE consortia for 151 human, 31 mouse and 35 C. elegans factors. We identified 8 human and 3 mouse transcription factors with strong localized enrichment over the mitochondrial genome that was usually associated with the corresponding recognition sequence motif. Notably, these sites of occupancy are often the sites with highest ChIP-seq signal intensity within both the nuclear and mitochondrial genomes and are thus best explained as true binding events to mitochondrial DNA, which exist in high copy number in each cell. We corroborated these findings by immunocytochemical staining evidence for mitochondrial localization. However, we were unable to find clear evidence for mitochondrial binding in ENCODE and other publicly available ChIP-seq data for most factors previously reported to localize there. As the first global analysis of nuclear transcription factors binding in mitochondria, this work opens the door to future studies that probe the functional significance of the phenomenon.
The transcription factor MEF2C mediates cardiomyocyte hypertrophy induced by IGF-1 signaling
Energy Technology Data Exchange (ETDEWEB)
Munoz, Juan Pablo; Collao, Andres; Chiong, Mario; Maldonado, Carola; Adasme, Tatiana; Carrasco, Loreto; Ocaranza, Paula; Bravo, Roberto; Gonzalez, Leticia; Diaz-Araya, Guillermo [Centro FONDAP Estudios Moleculares de la Celula, Facultad de Medicina, Universidad de Chile, Santiago 8380492 (Chile); Facultad de Ciencias Quimicas y Farmaceuticas, Facultad de Medicina, Universidad de Chile, Santiago 8380492 (Chile); Hidalgo, Cecilia [Centro FONDAP Estudios Moleculares de la Celula, Facultad de Medicina, Universidad de Chile, Santiago 8380492 (Chile); Instituto de Ciencias Biomedicas, Facultad de Medicina, Universidad de Chile, Santiago 8380492 (Chile); Lavandero, Sergio, E-mail: slavander@uchile.cl [Centro FONDAP Estudios Moleculares de la Celula, Facultad de Medicina, Universidad de Chile, Santiago 8380492 (Chile); Facultad de Ciencias Quimicas y Farmaceuticas, Facultad de Medicina, Universidad de Chile, Santiago 8380492 (Chile); Instituto de Ciencias Biomedicas, Facultad de Medicina, Universidad de Chile, Santiago 8380492 (Chile)
2009-10-09
Myocyte enhancer factor 2C (MEF2C) plays an important role in cardiovascular development and is a key transcription factor for cardiac hypertrophy. Here, we describe MEF2C regulation by insulin-like growth factor-1 (IGF-1) and its role in IGF-1-induced cardiac hypertrophy. We found that IGF-1 addition to cultured rat cardiomyocytes activated MEF2C, as evidenced by its increased nuclear localization and DNA binding activity. IGF-1 stimulated MEF2 dependent-gene transcription in a time-dependent manner, as indicated by increased MEF2 promoter-driven reporter gene activity; IGF-1 also induced p38-MAPK phosphorylation, while an inhibitor of p38-MAPK decreased both effects. Additionally, inhibitors of phosphatidylinositol 3-kinase and calcineurin prevented IGF-1-induced MEF2 transcriptional activity. Via MEF2C-dependent signaling, IGF-1 also stimulated transcription of atrial natriuretic factor and skeletal {alpha}-actin but not of fos-lux reporter genes. These novel data suggest that MEF2C activation by IGF-1 mediates the pro-hypertrophic effects of IGF-1 on cardiac gene expression.
The transcription factor MEF2C mediates cardiomyocyte hypertrophy induced by IGF-1 signaling
International Nuclear Information System (INIS)
Munoz, Juan Pablo; Collao, Andres; Chiong, Mario; Maldonado, Carola; Adasme, Tatiana; Carrasco, Loreto; Ocaranza, Paula; Bravo, Roberto; Gonzalez, Leticia; Diaz-Araya, Guillermo; Hidalgo, Cecilia; Lavandero, Sergio
2009-01-01
Myocyte enhancer factor 2C (MEF2C) plays an important role in cardiovascular development and is a key transcription factor for cardiac hypertrophy. Here, we describe MEF2C regulation by insulin-like growth factor-1 (IGF-1) and its role in IGF-1-induced cardiac hypertrophy. We found that IGF-1 addition to cultured rat cardiomyocytes activated MEF2C, as evidenced by its increased nuclear localization and DNA binding activity. IGF-1 stimulated MEF2 dependent-gene transcription in a time-dependent manner, as indicated by increased MEF2 promoter-driven reporter gene activity; IGF-1 also induced p38-MAPK phosphorylation, while an inhibitor of p38-MAPK decreased both effects. Additionally, inhibitors of phosphatidylinositol 3-kinase and calcineurin prevented IGF-1-induced MEF2 transcriptional activity. Via MEF2C-dependent signaling, IGF-1 also stimulated transcription of atrial natriuretic factor and skeletal α-actin but not of fos-lux reporter genes. These novel data suggest that MEF2C activation by IGF-1 mediates the pro-hypertrophic effects of IGF-1 on cardiac gene expression.
Negative transcriptional regulation of mitochondrial transcription factor A (TFAM) by nuclear TFAM
International Nuclear Information System (INIS)
Lee, Eun Jin; Kang, Young Cheol; Park, Wook-Ha; Jeong, Jae Hoon; Pak, Youngmi Kim
2014-01-01
Highlights: • TFAM localizes in nuclei and mitochondria of neuronal cells. • Nuclear TFAM does not bind the Tfam promoter. • Nuclear TFAM reduced the Tfam promoter activity via suppressing NRF-1 activity. • A novel self-negative feedback regulation of Tfam gene expression is explored. • FAM may play different roles depending on its subcellular localizations. - Abstract: The nuclear DNA-encoded mitochondrial transcription factor A (TFAM) is synthesized in cytoplasm and transported into mitochondria. TFAM enhances both transcription and replication of mitochondrial DNA. It is unclear, however, whether TFAM plays a role in regulating nuclear gene expression. Here, we demonstrated that TFAM was localized to the nucleus and mitochondria by immunostaining, subcellular fractionation, and TFAM-green fluorescent protein hybrid protein studies. In HT22 hippocampal neuronal cells, human TFAM (hTFAM) overexpression suppressed human Tfam promoter-mediated luciferase activity in a dose-dependent manner. The mitochondria targeting sequence-deficient hTFAM also repressed Tfam promoter activity to the same degree as hTFAM. It indicated that nuclear hTFAM suppressed Tfam expression without modulating mitochondrial activity. The repression required for nuclear respiratory factor-1 (NRF-1), but hTFAM did not bind to the NRF-1 binding site of its promoter. TFAM was co-immunoprecipitated with NRF-1. Taken together, we suggest that nuclear TFAM down-regulate its own gene expression as a NRF-1 repressor, showing that TFAM may play different roles depending on its subcellular localizations
International Nuclear Information System (INIS)
Cui, J; Guo, Z Y; Yang, Z C; Hao, Y L; Yan, G Z
2011-01-01
In this paper, we demonstrate a novel control strategy for the drive mode of a microgyroscope using ascending frequency drive (AFD) with an AGC-2DOF PID controller, which drives a resonator with a modulation signal not at the resonant frequency and senses the vibration signal at the resonant frequency, thus realizing the isolation between the actual mechanical response and electrical coupling signal. This approach holds the following three advantages: (1) it employs the AFD signal instead of the resonant frequency drive signal to excite the gyroscope in the drive direction, suppressing the electrical coupling from the drive electrode to the sense electrode; (2) it can reduce the noise at low frequency and resonant frequency by shifting flicker noise to the high-frequency part; (3) it can effectively improve the performance of the transient response of the closed-loop control with a 2-DOF (degree of freedom) PID controller compared with the conventional 1-DOF PID. The stability condition of the whole loop is investigated by utilizing the averaging and linearization method. The control approach is applied to drive a lateral tuning fork microgyroscope. Test results show good agreement with the theoretical and simulation results. The non-ideal electrical antiresonance peak is removed and the resonant peak height increases by approximately 10 dB over a 400 Hz span with a flicker noise reduction of 30 dB within 100 Hz using AFD. The percent overshoot is reduced from 36.2% (1DOF PID) to 8.95% (2DOF PID, about 75.3% overshoot suppression) with 15.3% improvement in setting time
Directory of Open Access Journals (Sweden)
Chun Ye
2009-03-01
Full Text Available Understanding the relationship between genetic variation and gene expression is a central question in genetics. With the availability of data from high-throughput technologies such as ChIP-Chip, expression, and genotyping arrays, we can begin to not only identify associations but to understand how genetic variations perturb the underlying transcription regulatory networks to induce differential gene expression. In this study, we describe a simple model of transcription regulation where the expression of a gene is completely characterized by two properties: the concentrations and promoter affinities of active transcription factors. We devise a method that extends Network Component Analysis (NCA to determine how genetic variations in the form of single nucleotide polymorphisms (SNPs perturb these two properties. Applying our method to a segregating population of Saccharomyces cerevisiae, we found statistically significant examples of trans-acting SNPs located in regulatory hotspots that perturb transcription factor concentrations and affinities for target promoters to cause global differential expression and cis-acting genetic variations that perturb the promoter affinities of transcription factors on a single gene to cause local differential expression. Although many genetic variations linked to gene expressions have been identified, it is not clear how they perturb the underlying regulatory networks that govern gene expression. Our work begins to fill this void by showing that many genetic variations affect the concentrations of active transcription factors in a cell and their affinities for target promoters. Understanding the effects of these perturbations can help us to paint a more complete picture of the complex landscape of transcription regulation. The software package implementing the algorithms discussed in this work is available as a MATLAB package upon request.
Analysis of functional redundancies within the Arabidopsis TCP transcription factor family
Danisman, S.; Dijk, van A.D.J.; Bimbo, A.; Wal, van der F.; Hennig, L.; Folter, de S.; Angenent, G.C.; Immink, R.G.H.
2013-01-01
Analyses of the functions of TEOSINTE-LIKE1, CYCLOIDEA, and ROLIFERATING CELL FACTOR1 (TCP) transcription factors have been hampered by functional redundancy between its individual members. In general, putative functionally redundant genes are predicted based on sequence similarity and confirmed by
Protein intrinsic disorder in Arabidopsis NAC transcription factors
DEFF Research Database (Denmark)
O'Shea, Charlotte; Jensen, Mikael Kryger; Stender, Emil G.P.
2015-01-01
of differences in binding mechanisms. Although substitution of both hydrophobic and acidic residues of the ANAC046 MoRF region abolished binding, substitution of other residues, even with α-helix-breaking proline, was less disruptive. Together, the biophysical analyses suggest that RCD1-ANAC046 complex formation......Protein ID (intrinsic disorder) plays a significant, yet relatively unexplored role in transcription factors (TFs). In the present paper, analysis of the transcription regulatory domains (TRDs) of six phylogenetically representative, plant-specific NAC [no apical meristem, ATAF (Arabidopsis...
Adamus, Tomasz; Konieczny, Paweł; Sekuła, Małgorzata; Sułkowski, Maciej; Majka, Marcin
2014-01-01
The main goal in gene therapy and biomedical research is an efficient transcription factors (TFs) delivery system. SNAIL, a zinc finger transcription factor, is strongly involved in tumor, what makes its signaling pathways an interesting research subject. The necessity of tracking activation of intracellular pathways has prompted fluorescent proteins usage as localization markers. Advanced molecular cloning techniques allow to generate fusion proteins from fluorescent markers and transcription factors. Depending on fusion strategy, the protein expression levels and nuclear transport ability are significantly different. The P2A self-cleavage motif through its cleavage ability allows two single proteins to be simultaneously expressed. The aim of this study was to compare two strategies for introducing a pair of genes using expression vector system. We have examined GFP and SNAI1 gene fusions by comprising common nucleotide polylinker (multiple cloning site) or P2A motif in between them, resulting in one fusion or two independent protein expressions respectively. In each case transgene expression levels and translation efficiency as well as nuclear localization of expressed protein have been analyzed. Our data showed that usage of P2A motif provides more effective nuclear transport of SNAIL transcription factor than conventional genes linker. At the same time the fluorescent marker spreads evenly in subcellular space.
Transcriptional factor influence on OTA production and the quelling ...
African Journals Online (AJOL)
This study determined the influence of some transcriptional factors on ochratoxin A production as well as investigates the quelling attributes of some designed siRNA on the OTA producing Aspergillus section Nigri using standard recommended techniques. Results obtained following comparison of the pks gene promoter ...
Occupancy classification of position weight matrix-inferred transcription factor binding sites.
Directory of Open Access Journals (Sweden)
Hollis Wright
Full Text Available BACKGROUND: Computational prediction of Transcription Factor Binding Sites (TFBS from sequence data alone is difficult and error-prone. Machine learning techniques utilizing additional environmental information about a predicted binding site (such as distances from the site to particular chromatin features to determine its occupancy/functionality class show promise as methods to achieve more accurate prediction of true TFBS in silico. We evaluate the Bayesian Network (BN and Support Vector Machine (SVM machine learning techniques on four distinct TFBS data sets and analyze their performance. We describe the features that are most useful for classification and contrast and compare these feature sets between the factors. RESULTS: Our results demonstrate good performance of classifiers both on TFBS for transcription factors used for initial training and for TFBS for other factors in cross-classification experiments. We find that distances to chromatin modifications (specifically, histone modification islands as well as distances between such modifications to be effective predictors of TFBS occupancy, though the impact of individual predictors is largely TF specific. In our experiments, Bayesian network classifiers outperform SVM classifiers. CONCLUSIONS: Our results demonstrate good performance of machine learning techniques on the problem of occupancy classification, and demonstrate that effective classification can be achieved using distances to chromatin features. We additionally demonstrate that cross-classification of TFBS is possible, suggesting the possibility of constructing a generalizable occupancy classifier capable of handling TFBS for many different transcription factors.
Reconstitution of the yeast RNA polymerase III transcription system with all recombinant factors.
Ducrot, Cécile; Lefebvre, Olivier; Landrieux, Emilie; Guirouilh-Barbat, Josée; Sentenac, André; Acker, Joel
2006-04-28
Transcription factor TFIIIC is a multisubunit complex required for promoter recognition and transcriptional activation of class III genes. We describe here the reconstitution of complete recombinant yeast TFIIIC and the molecular characterization of its two DNA-binding domains, tauA and tauB, using the baculovirus expression system. The B block-binding module, rtauB, was reconstituted with rtau138, rtau91, and rtau60 subunits. rtau131, rtau95, and rtau55 formed also a stable complex, rtauA, that displayed nonspecific DNA binding activity. Recombinant rTFIIIC was functionally equivalent to purified yeast TFIIIC, suggesting that the six recombinant subunits are necessary and sufficient to reconstitute a transcriptionally active TFIIIC complex. The formation and the properties of rTFIIIC-DNA complexes were affected by dephosphorylation treatments. The combination of complete recombinant rTFIIIC and rTFIIIB directed a low level of basal transcription, much weaker than with the crude B'' fraction, suggesting the existence of auxiliary factors that could modulate the yeast RNA polymerase III transcription system.
Transcription elongation factor GreA has functional chaperone activity.
Li, Kun; Jiang, Tianyi; Yu, Bo; Wang, Limin; Gao, Chao; Ma, Cuiqing; Xu, Ping; Ma, Yanhe
2012-01-01
Bacterial GreA is an indispensable factor in the RNA polymerase elongation complex. It plays multiple roles in transcriptional elongation, and may be implicated in resistance to various stresses. In this study, we show that Escherichia coli GreA inhibits aggregation of several substrate proteins under heat shock condition. GreA can also effectively promote the refolding of denatured proteins. These facts reveal that GreA has chaperone activity. Distinct from many molecular chaperones, GreA does not form stable complexes with unfolded substrates. GreA overexpression confers the host cells with enhanced resistance to heat shock and oxidative stress. Moreover, GreA expression in the greA/greB double mutant could suppress the temperature-sensitive phenotype, and dramatically alleviate the in vivo protein aggregation. The results suggest that bacterial GreA may act as chaperone in vivo. These results suggest that GreA, in addition to its function as a transcription factor, is involved in protection of cellular proteins against aggregation.
Directory of Open Access Journals (Sweden)
Timothy R. Gershon
2005-06-01
Full Text Available Neuroectodermal tumor cells, like neural crest (NC cells, are pluripotent, proliferative, and migratory. We tested the hypothesis that genetic programs essential to NC development are activated in neuroectodermal tumors. We examined the expression of transcription factors PAX3, PAX7, AP-2α, and SOX10 in human embryos and neuroectodermal tumors: neurofibroma, schwannoma, neuroblastoma, malignant nerve sheath tumor, melanoma, medulloblastoma, supratentorial primitive neuroectodermal tumor, and Ewing's sarcoma. We also examined the expression of P0, ERBB3, and STX, targets of SOX10, AP-2α, and PAX3, respectively. PAX3, AP-2α, and SOX10 were expressed sequentially in human NC development, whereas PAX7 was restricted to mesoderm. Tumors expressed PAX3, AP-2α, SOX10, and PAX7 in specific combinations. SOX10 and AP-2α were expressed in relatively differentiated neoplasms. The early NC marker, PAX3, and its homologue, PAX7, were detected in poorly differentiated tumors and tumors with malignant potential. Expression of NC transcription factors and target genes correlated. Transcription factors essential to NC development are thus present in neuroectodermal tumors. Correlation of specific NC transcription factors with phenotype, and with expression of specific downstream genes, provides evidence that these transcription factors actively influence gene expression and tumor behavior. These findings suggest that PAX3, PAX7, AP-2α, and SOX10 are potential markers of prognosis and targets for therapeutic intervention.
Regulation of basophil and mast cell development by transcription factors
Directory of Open Access Journals (Sweden)
Haruka Sasaki
2016-04-01
Full Text Available Basophils and mast cells play important roles in host defense against parasitic infections and allergic responses. Several progenitor populations, either shared or specific, for basophils and/or mast cells have been identified, thus elucidating the developmental pathways of these cells. Multiple transcription factors essential for their development and the relationships between them have been also revealed. For example, IRF8 induces GATA2 expression to promote the generation of both basophils and mast cells. The STAT5-GATA2 axis induces C/EBPα and MITF expression, facilitating the differentiation into basophils and mast cells, respectively. In addition, C/EBPα and MITF mutually suppress each other's expression. This review provides an overview of recent advances in our understanding of how transcription factors regulate the development of basophils and mast cells.
In vitro fluorescence studies of transcription factor IIB-DNA interaction.
Górecki, Andrzej; Figiel, Małgorzata; Dziedzicka-Wasylewska, Marta
2015-01-01
General transcription factor TFIIB is one of the basal constituents of the preinitiation complex of eukaryotic RNA polymerase II, acting as a bridge between the preinitiation complex and the polymerase, and binding promoter DNA in an asymmetric manner, thereby defining the direction of the transcription. Methods of fluorescence spectroscopy together with circular dichroism spectroscopy were used to observe conformational changes in the structure of recombinant human TFIIB after binding to specific DNA sequence. To facilitate the exploration of the structural changes, several site-directed mutations have been introduced altering the fluorescence properties of the protein. Our observations showed that binding of specific DNA sequences changed the protein structure and dynamics, and TFIIB may exist in two conformational states, which can be described by a different microenvironment of W52. Fluorescence studies using both intrinsic and exogenous fluorophores showed that these changes significantly depended on the recognition sequence and concerned various regions of the protein, including those interacting with other transcription factors and RNA polymerase II. DNA binding can cause rearrangements in regions of proteins interacting with the polymerase in a manner dependent on the recognized sequences, and therefore, influence the gene expression.
A systems biology approach to transcription factor binding site prediction.
Directory of Open Access Journals (Sweden)
Xiang Zhou
2010-03-01
Full Text Available The elucidation of mammalian transcriptional regulatory networks holds great promise for both basic and translational research and remains one the greatest challenges to systems biology. Recent reverse engineering methods deduce regulatory interactions from large-scale mRNA expression profiles and cross-species conserved regulatory regions in DNA. Technical challenges faced by these methods include distinguishing between direct and indirect interactions, associating transcription regulators with predicted transcription factor binding sites (TFBSs, identifying non-linearly conserved binding sites across species, and providing realistic accuracy estimates.We address these challenges by closely integrating proven methods for regulatory network reverse engineering from mRNA expression data, linearly and non-linearly conserved regulatory region discovery, and TFBS evaluation and discovery. Using an extensive test set of high-likelihood interactions, which we collected in order to provide realistic prediction-accuracy estimates, we show that a careful integration of these methods leads to significant improvements in prediction accuracy. To verify our methods, we biochemically validated TFBS predictions made for both transcription factors (TFs and co-factors; we validated binding site predictions made using a known E2F1 DNA-binding motif on E2F1 predicted promoter targets, known E2F1 and JUND motifs on JUND predicted promoter targets, and a de novo discovered motif for BCL6 on BCL6 predicted promoter targets. Finally, to demonstrate accuracy of prediction using an external dataset, we showed that sites matching predicted motifs for ZNF263 are significantly enriched in recent ZNF263 ChIP-seq data.Using an integrative framework, we were able to address technical challenges faced by state of the art network reverse engineering methods, leading to significant improvement in direct-interaction detection and TFBS-discovery accuracy. We estimated the accuracy
A human transcription factor in search mode.
Hauser, Kevin; Essuman, Bernard; He, Yiqing; Coutsias, Evangelos; Garcia-Diaz, Miguel; Simmerling, Carlos
2016-01-08
Transcription factors (TF) can change shape to bind and recognize DNA, shifting the energy landscape from a weak binding, rapid search mode to a higher affinity recognition mode. However, the mechanism(s) driving this conformational change remains unresolved and in most cases high-resolution structures of the non-specific complexes are unavailable. Here, we investigate the conformational switch of the human mitochondrial transcription termination factor MTERF1, which has a modular, superhelical topology complementary to DNA. Our goal was to characterize the details of the non-specific search mode to complement the crystal structure of the specific binding complex, providing a basis for understanding the recognition mechanism. In the specific complex, MTERF1 binds a significantly distorted and unwound DNA structure, exhibiting a protein conformation incompatible with binding to B-form DNA. In contrast, our simulations of apo MTERF1 revealed significant flexibility, sampling structures with superhelical pitch and radius complementary to the major groove of B-DNA. Docking these structures to B-DNA followed by unrestrained MD simulations led to a stable complex in which MTERF1 was observed to undergo spontaneous diffusion on the DNA. Overall, the data support an MTERF1-DNA binding and recognition mechanism driven by intrinsic dynamics of the MTERF1 superhelical topology. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
DEFF Research Database (Denmark)
Lindemose, Søren; Jensen, Michael Krogh; de Velde, Jan Van
2014-01-01
regulatory networks of 12 NAC transcription factors. Our data offer specific single-base resolution fingerprints for most TFs studied and indicate that NAC DNA-binding specificities might be predicted from their DNA-binding domain's sequence. The developed methodology, including the application......Target gene identification for transcription factors is a prerequisite for the systems wide understanding of organismal behaviour. NAM-ATAF1/2-CUC2 (NAC) transcription factors are amongst the largest transcription factor families in plants, yet limited data exist from unbiased approaches to resolve...... the DNA-binding preferences of individual members. Here, we present a TF-target gene identification workflow based on the integration of novel protein binding microarray data with gene expression and multi-species promoter sequence conservation to identify the DNA-binding specificities and the gene...
Directory of Open Access Journals (Sweden)
Jinyi Liu
Full Text Available Growth regulating factors (GRFs are a conserved class of transcription factor in seed plants. GRFs are involved in various aspects of tissue differentiation and organ development. The implication of GRFs in biotic stress response has also been recently reported, suggesting a role of these transcription factors in coordinating the interaction between developmental processes and defense dynamics. However, the molecular mechanisms by which GRFs mediate the overlaps between defense signaling and developmental pathways are elusive. Here, we report large scale identification of putative target candidates of Arabidopsis GRF1 and GRF3 by comparing mRNA profiles of the grf1/grf2/grf3 triple mutant and those of the transgenic plants overexpressing miR396-resistant version of GRF1 or GRF3. We identified 1,098 and 600 genes as putative targets of GRF1 and GRF3, respectively. Functional classification of the potential target candidates revealed that GRF1 and GRF3 contribute to the regulation of various biological processes associated with defense response and disease resistance. GRF1 and GRF3 participate specifically in the regulation of defense-related transcription factors, cell-wall modifications, cytokinin biosynthesis and signaling, and secondary metabolites accumulation. GRF1 and GRF3 seem to fine-tune the crosstalk between miRNA signaling networks by regulating the expression of several miRNA target genes. In addition, our data suggest that GRF1 and GRF3 may function as negative regulators of gene expression through their association with other transcription factors. Collectively, our data provide new insights into how GRF1 and GRF3 might coordinate the interactions between defense signaling and plant growth and developmental pathways.
Zhu, Jufen; Yu, Xinxu; Xie, Baogui; Gu, Xiaokui; Zhang, Zhenying; Li, Shaojie
2013-06-01
To gain insight into the regulatory mechanisms of oxidative stress responses in filamentous fungi, the genome-wide transcriptional response of Neurospora crassa to menadione was analysed by digital gene expression (DGE) profiling, which identified 779 upregulated genes and 576 downregulated genes. Knockout mutants affecting 130 highly-upregulated genes were tested for menadione sensitivity, which revealed that loss of the transcription factor siderophore regulation (SRE) (a transcriptional repressor for siderophore biosynthesis), catatase-3, cytochrome c peroxidase or superoxide dismutase 1 copper chaperone causes hypersensitivity to menadione. Deletion of sre dramatically increased transcription of the siderophore biosynthesis gene ono and the siderophore iron transporter gene sit during menadione stress, suggesting that SRE is required for repression of iron uptake under oxidative stress conditions. Contrary to its phenotype, the sre deletion mutant showed higher transcriptional levels of genes encoding reactive oxygen species (ROS) scavengers than wild type during menadione stress, which implies that the mutant suffers a higher level of oxidative stress than wild type. Uncontrolled iron uptake in the sre mutant might exacerbate cellular oxidative stress. This is the first report of a negative regulator of iron assimilation participating in the fungal oxidative stress response. In addition to SRE, eight other transcription factor genes were also menadione-responsive but their single gene knockout mutants showed wild-type menadione sensitivity. Two of them, named as mit-2 (menadione induced transcription factor-2) and mit-4 (menadione induced transcription factor-4), were selected for double mutant analysis. The double mutant was hypersensitive to menadione. Similarly, the double mutation of mit-2 and sre also had additive effects on menadione sensitivity, suggesting multiple transcription factors mediate oxidative stress resistance in an additive manner
Step out of the groove : epigenetic gene control systems and engineered transcription factors
Verschure, P.J.; Visser, A.E.; Rots, M.G.
2006-01-01
At the linear DNA level, gene activity is believed to be driven by binding of transcription factors, which subsequently recruit the RNA polymerase to the gene promoter region. However, it has become clear that transcriptional activation involves large complexes of many different proteins, which not
Effects of cytosine methylation on transcription factor binding sites
Medvedeva, Yulia A
2014-03-26
Background: DNA methylation in promoters is closely linked to downstream gene repression. However, whether DNA methylation is a cause or a consequence of gene repression remains an open question. If it is a cause, then DNA methylation may affect the affinity of transcription factors (TFs) for their binding sites (TFBSs). If it is a consequence, then gene repression caused by chromatin modification may be stabilized by DNA methylation. Until now, these two possibilities have been supported only by non-systematic evidence and they have not been tested on a wide range of TFs. An average promoter methylation is usually used in studies, whereas recent results suggested that methylation of individual cytosines can also be important.Results: We found that the methylation profiles of 16.6% of cytosines and the expression profiles of neighboring transcriptional start sites (TSSs) were significantly negatively correlated. We called the CpGs corresponding to such cytosines " traffic lights" We observed a strong selection against CpG " traffic lights" within TFBSs. The negative selection was stronger for transcriptional repressors as compared with transcriptional activators or multifunctional TFs as well as for core TFBS positions as compared with flanking TFBS positions.Conclusions: Our results indicate that direct and selective methylation of certain TFBS that prevents TF binding is restricted to special cases and cannot be considered as a general regulatory mechanism of transcription. 2013 Medvedeva et al.; licensee BioMed Central Ltd.
Design of a 7-DOF slave robot integrated with a magneto-rheological haptic master
Hwang, Yong-Hoon; Cha, Seung-Woo; Kang, Seok-Rae; Choi, Seung-Bok
2017-04-01
In this study, a 7-DOF slave robot integrated with the haptic master is designed and its dynamic motion is controlled. The haptic master is made using a controllable magneto-rheological (MR) clutch and brake and it provides the surgeon with a sense of touch by using both kinetic and kinesthetic information. Due to the size constraint of the slave robot, a wire actuating is adopted to make the desired motion of the end-effector which has 3-DOF instead of a conventional direct-driven motor. Another motions of the link parts that have 4-DOF use direct-driven motor. In total system, for working as a haptic device, the haptic master need to receive the information of repulsive forces applied on the slave robot. Therefore, repulsive forces on the end-effector are sensed by using three uniaxial torque transducer inserted in the wire actuating system and another repulsive forces applied on link part are sensed by using 6-axis transducer that is able to sense forces and torques. Using another 6-axis transducer, verify the reliability of force information on final end of slave robot. Lastly, integrated with a MR haptic master, psycho-physical test is conducted by different operators who can feel the different repulsive force or torque generated from the haptic master which is equivalent to the force or torque occurred on the end-effector to demonstrate the effectiveness of the proposed system.
Directory of Open Access Journals (Sweden)
Stewart T G Burgess
Full Text Available BACKGROUND: Sheep scab, caused by infestation with the ectoparasitic mite Psoroptes ovis, results in the rapid development of cutaneous inflammation and leads to the crusted skin lesions characteristic of the disease. We described previously the global host transcriptional response to infestation with P. ovis, elucidating elements of the inflammatory processes which lead to the development of a rapid and profound immune response. However, the mechanisms by which this response is instigated remain unclear. To identify novel methods of intervention a better understanding of the early events involved in triggering the immune response is essential. The objective of this study was to gain a clearer understanding of the mechanisms and signaling pathways involved in the instigation of the immediate pro-inflammatory response. RESULTS: Through a combination of transcription factor binding site enrichment and pathway analysis we identified key roles for a number of transcription factors in the instigation of cutaneous inflammation. In particular, defined roles were elucidated for the transcription factors NF-kB and AP-1 in the orchestration of the early pro-inflammatory response, with these factors being implicated in the activation of a suite of inflammatory mediators. CONCLUSIONS: Interrogation of the host temporal response to P. ovis infestation has enabled the further identification of the mechanisms underlying the development of the immediate host pro-inflammatory response. This response involves key regulatory roles for the transcription factors NF-kB and AP-1. Pathway analysis demonstrated that the activation of these transcription factors may be triggered following a host LPS-type response, potentially involving TLR4-signalling and also lead to the intriguing possibility that this could be triggered by a P. ovis allergen.
Distinct patterns of epigenetic marks and transcription factor binding ...
Indian Academy of Sciences (India)
Distinct patterns of epigenetic marks and transcription factor binding sites across promoters of sense-intronic long noncoding RNAs. Sourav Ghosh, Satish Sati, Shantanu Sengupta and Vinod Scaria. J. Genet. 94, 17–25. Gencode V9 lncRNA gene : 11004. Known lncRNA : 1175. Novel lncRNA : 5898. Putative lncRNA :.
Genomewide analysis of TCP transcription factor gene family in ...
Indian Academy of Sciences (India)
Home; Journals; Journal of Genetics; Volume 93; Issue 3. Genomewide ... Teosinte branched1/cycloidea/proliferating cell factor1 (TCP) proteins are a large family of transcriptional regulators in angiosperms. They are ... To the best of our knowledge, this is the first study of a genomewide analysis of apple TCP gene family.
Ito, Maiko; Shien, Tadahiko; Omori, Masako; Mizoo, Taeko; Iwamoto, Takayuki; Nogami, Tomohiro; Motoki, Takayuki; Taira, Naruto; Doihara, Hiroyoshi; Miyoshi, Shinichiro
2016-05-01
Aldehyde dehydrogenase 1 (ALDH1) is a marker of breast cancer stem cells, and the expression of ALDH1 may be a prognostic factor of poor clinical outcome. The epithelial-mesenchymal transition may produce cells with stem-cell-like properties promoted by transcription factors. We investigated the expression of ALDH1 and transcription factors in both primary and metastatic lesions, and prognostic value of them in breast cancer patients with axillary lymph node metastasis (ALNM). Forty-seven breast cancer patients with ALNM who underwent surgery at Okayama University Hospital from 2002 to 2008 were enrolled. We retrospectively evaluated the levels of ALDH1 and transcription factors, such as Snail, Slug and Twist, in both primary and metastatic lesions by immunohistochemistry. In primary lesions, the positive rate of ALDH1, Snail, Slug and Twist was 19, 49, 40 and 26%, respectively. In lymph nodes, that of ALDH1, Snail, Slug and Twist was 21, 32, 13 and 23%, respectively. The expression of ALDH1 or transcription factors alone was not significantly associated with a poor prognosis. However, co-expression of ALDH1 and Slug in primary lesions was associated with a shorter DFS (P = 0.009). The evaluation of the co-expression of ALDH1 and transcription factors in primary lesions may be useful in prognosis of node-positive breast cancers.
Directory of Open Access Journals (Sweden)
Estruch Francisco
2012-09-01
Full Text Available Abstract Background The various steps of mRNP biogenesis (transcription, processing and export are interconnected. It has been shown that the transcription machinery plays a pivotal role in mRNP assembly, since several mRNA export factors are recruited during transcription and physically interact with components of the transcription machinery. Although the shuttling DEAD-box protein Dbp5p is concentrated on the cytoplasmic fibrils of the NPC, previous studies demonstrated that it interacts physically and genetically with factors involved in transcription initiation. Results We investigated the effect of mutations affecting various components of the transcription initiation apparatus on the phenotypes of mRNA export mutant strains. Our results show that growth and mRNA export defects of dbp5 and mex67 mutant strains can be suppressed by mutation of specific transcription initiation components, but suppression was not observed for mutants acting in the very first steps of the pre-initiation complex (PIC formation. Conclusions Our results indicate that mere reduction in the amount of mRNP produced is not sufficient to suppress the defects caused by a defective mRNA export factor. Suppression occurs only with mutants affecting events within a narrow window of the mRNP biogenesis process. We propose that reducing the speed with which transcription converts from initiation and promoter clearance to elongation may have a positive effect on mRNP formation by permitting more effective recruitment of partially-functional mRNP proteins to the nascent mRNP.
Directory of Open Access Journals (Sweden)
Peng Zhang
2014-03-01
Full Text Available Hypoxia-inducible factors (HIFs play key roles in the cellular response to hypoxia. It is widely accepted that whereas HIF-1 and HIF-2 function as transcriptional activators, HIF-3 inhibits HIF-1/2α action. Contrary to this idea, we show that zebrafish Hif-3α has strong transactivation activity. Hif-3α is degraded under normoxia. Mutation of P393, P493, and L503 inhibits this oxygen-dependent degradation. Transcriptomics and chromatin immunoprecipitation analyses identify genes that are regulated by Hif-3α, Hif-1α, or both. Under hypoxia or when overexpressed, Hif-3α binds to its target gene promoters and upregulates their expression. Dominant-negative inhibition and knockdown of Hif-3α abolish hypoxia-induced Hif-3α-promoter binding and gene expression. Hif-3α not only mediates hypoxia-induced growth and developmental retardation but also possesses hypoxia-independent activities. Importantly, transactivation activity is conserved and human HIF-3α upregulates similar genes in human cells. These findings suggest that Hif-3 is an oxygen-dependent transcription factor and activates a distinct transcriptional response to hypoxia.
Babbitt, G A
2010-10-15
The spurious (or nonfunctional) binding of transcription factors (TF) to the wrong locations on DNA presents a formidable challenge to genomes given the relatively low ceiling for sequence complexity within the short lengths of most binding motifs. The high potential for the occurrence of random motifs and subsequent nonfunctional binding of many transcription factors should theoretically lead to natural selection against the occurrence of spurious motif throughout the genome. However, because of the active role that chromatin can influence over eukaryotic gene regulation, it may also be expected that many supposed spurious binding sites could escape purifying selection if (A) they simply occur in regions of high nucleosome occupancy or (B) their surrounding chromatin was dynamically involved in their identity and function. We compared nucleosome occupancy and the presence/absence of functionally conserved chromatin context to the strength of selection against spurious binding of various TF binding motifs in Saccharomyces yeast. While we find no direct relationship with nucleosome occupancy, we find strong evidence that transcription factors spatially associated with evolutionarily conserved chromatin states are under relaxed selection against accidental binding. Transcription factors (with/without) a conserved chromatin context were found to occur on average, (87.7%/49.3%) of their expected frequencies. Functional binding motifs with conserved chromatin contexts were also significantly shorter in length and more often clustered. These results indicate a role of chromatin context dependency in relaxing selection against spurious binding in nearly half of all TF binding motifs throughout the yeast genome. 2010 Elsevier B.V. All rights reserved.
Screening Driving Transcription Factors in the Processing of Gastric Cancer
Directory of Open Access Journals (Sweden)
Guangzhong Xu
2016-01-01
Full Text Available Background. Construction of the transcriptional regulatory network can provide additional clues on the regulatory mechanisms and therapeutic applications in gastric cancer. Methods. Gene expression profiles of gastric cancer were downloaded from GEO database for integrated analysis. All of DEGs were analyzed by GO enrichment and KEGG pathway enrichment. Transcription factors were further identified and then a global transcriptional regulatory network was constructed. Results. By integrated analysis of the six eligible datasets (340 cases and 43 controls, a bunch of 2327 DEGs were identified, including 2100 upregulated and 227 downregulated DEGs. Functional enrichment analysis of DEGs showed that digestion was a significantly enriched GO term for biological process. Moreover, there were two important enriched KEGG pathways: cell cycle and homologous recombination. Furthermore, a total of 70 differentially expressed TFs were identified and the transcriptional regulatory network was constructed, which consisted of 566 TF-target interactions. The top ten TFs regulating most downstream target genes were BRCA1, ARID3A, EHF, SOX10, ZNF263, FOXL1, FEV, GATA3, FOXC1, and FOXD1. Most of them were involved in the carcinogenesis of gastric cancer. Conclusion. The transcriptional regulatory network can help researchers to further clarify the underlying regulatory mechanisms of gastric cancer tumorigenesis.
International Nuclear Information System (INIS)
Xiao, Xiao; Gang, Yi; Wang, Honghong; Wang, Jiayin; Zhao, Lina; Xu, Li; Liu, Zhiguo
2015-01-01
Highlights: • A shRNA vector based transcription factor decoy, VB-ODN, was designed. • VB-ODN for NF-κB inhibited cell viability in HEK293 cells. • VB-ODN inhibited expression of downstream genes of target transcription factors. • VB-ODN may enhance nuclear entry ratio for its feasibility of virus production. - Abstract: In this study, we designed a short hairpin RNA vector-based oligodeoxynucleotide (VB-ODN) carrying transcription factor (TF) consensus sequence which could function as a decoy to block TF activity. Specifically, VB-ODN for Nuclear factor-κB (NF-κB) could inhibit cell viability and decrease downstream gene expression in HEK293 cells without affecting expression of NF-κB itself. The specific binding between VB-ODN produced double-stranded RNA and NF-κB was evidenced by electrophoretic mobility shift assay. Moreover, similar VB-ODNs designed for three other TFs also inhibit their downstream gene expression but not that of themselves. Our study provides a new design of decoy for blocking TF activity
Energy Technology Data Exchange (ETDEWEB)
Xiao, Xiao [State Key Laboratory of Cancer Biology and Xijing Hospital of Digestive Diseases, Xijing Hospital, Fourth Military Medical University, Xi’an 710032, Shaanxi Province (China); Gang, Yi [State Key Laboratory of Cancer Biology and Xijing Hospital of Digestive Diseases, Xijing Hospital, Fourth Military Medical University, Xi’an 710032, Shaanxi Province (China); Department of Infectious Diseases, Tangdu Hospital, Fourth Military Medical University, Xi’an 710038, Shaanxi Province (China); Wang, Honghong [No. 518 Hospital of Chinese People’s Liberation Army, Xi’an 710043, Shaanxi Province (China); Wang, Jiayin [The Genome Institute, Washington University in St. Louis, St. Louis, MO 63108 (United States); Zhao, Lina [Department of Radiation Oncology, Xijing Hospital, Fourth Military Medical University, Xi’an 710032, Shaanxi Province (China); Xu, Li, E-mail: lxuhelen@163.com [State Key Laboratory of Cancer Biology and Xijing Hospital of Digestive Diseases, Xijing Hospital, Fourth Military Medical University, Xi’an 710032, Shaanxi Province (China); Liu, Zhiguo, E-mail: liuzhiguo@fmmu.edu.cn [State Key Laboratory of Cancer Biology and Xijing Hospital of Digestive Diseases, Xijing Hospital, Fourth Military Medical University, Xi’an 710032, Shaanxi Province (China)
2015-02-06
Highlights: • A shRNA vector based transcription factor decoy, VB-ODN, was designed. • VB-ODN for NF-κB inhibited cell viability in HEK293 cells. • VB-ODN inhibited expression of downstream genes of target transcription factors. • VB-ODN may enhance nuclear entry ratio for its feasibility of virus production. - Abstract: In this study, we designed a short hairpin RNA vector-based oligodeoxynucleotide (VB-ODN) carrying transcription factor (TF) consensus sequence which could function as a decoy to block TF activity. Specifically, VB-ODN for Nuclear factor-κB (NF-κB) could inhibit cell viability and decrease downstream gene expression in HEK293 cells without affecting expression of NF-κB itself. The specific binding between VB-ODN produced double-stranded RNA and NF-κB was evidenced by electrophoretic mobility shift assay. Moreover, similar VB-ODNs designed for three other TFs also inhibit their downstream gene expression but not that of themselves. Our study provides a new design of decoy for blocking TF activity.
Birkenbihl, Rainer P; Kracher, Barbara; Somssich, Imre E
2017-01-01
During microbial-associated molecular pattern-triggered immunity (MTI), molecules derived from microbes are perceived by cell surface receptors and upon signaling to the nucleus initiate a massive transcriptional reprogramming critical to mount an appropriate host defense response. WRKY transcription factors play an important role in regulating these transcriptional processes. Here, we determined on a genome-wide scale the flg22-induced in vivo DNA binding dynamics of three of the most prominent WRKY factors, WRKY18, WRKY40, and WRKY33. The three WRKY factors each bound to more than 1000 gene loci predominantly at W-box elements, the known WRKY binding motif. Binding occurred mainly in the 500-bp promoter regions of these genes. Many of the targeted genes are involved in signal perception and transduction not only during MTI but also upon damage-associated molecular pattern-triggered immunity, providing a mechanistic link between these functionally interconnected basal defense pathways. Among the additional targets were genes involved in the production of indolic secondary metabolites and in modulating distinct plant hormone pathways. Importantly, among the targeted genes were numerous transcription factors, encoding predominantly ethylene response factors, active during early MTI, and WRKY factors, supporting the previously hypothesized existence of a WRKY subregulatory network. Transcriptional analysis revealed that WRKY18 and WRKY40 function redundantly as negative regulators of flg22-induced genes often to prevent exaggerated defense responses. © 2016 American Society of Plant Biologists. All rights reserved.
Transcription Factors Bind Thousands of Active and InactiveRegions in the Drosophila Blastoderm
Energy Technology Data Exchange (ETDEWEB)
Li, Xiao-Yong; MacArthur, Stewart; Bourgon, Richard; Nix, David; Pollard, Daniel A.; Iyer, Venky N.; Hechmer, Aaron; Simirenko, Lisa; Stapleton, Mark; Luengo Hendriks, Cris L.; Chu, Hou Cheng; Ogawa, Nobuo; Inwood, William; Sementchenko, Victor; Beaton, Amy; Weiszmann, Richard; Celniker, Susan E.; Knowles, David W.; Gingeras, Tom; Speed, Terence P.; Eisen, Michael B.; Biggin, Mark D.
2008-01-10
Identifying the genomic regions bound by sequence-specific regulatory factors is central both to deciphering the complex DNA cis-regulatory code that controls transcription in metazoans and to determining the range of genes that shape animal morphogenesis. Here, we use whole-genome tiling arrays to map sequences bound in Drosophila melanogaster embryos by the six maternal and gap transcription factors that initiate anterior-posterior patterning. We find that these sequence-specific DNA binding proteins bind with quantitatively different specificities to highly overlapping sets of several thousand genomic regions in blastoderm embryos. Specific high- and moderate-affinity in vitro recognition sequences for each factor are enriched in bound regions. This enrichment, however, is not sufficient to explain the pattern of binding in vivo and varies in a context-dependent manner, demonstrating that higher-order rules must govern targeting of transcription factors. The more highly bound regions include all of the over forty well-characterized enhancers known to respond to these factors as well as several hundred putative new cis-regulatory modules clustered near developmental regulators and other genes with patterned expression at this stage of embryogenesis. The new targets include most of the microRNAs (miRNAs) transcribed in the blastoderm, as well as all major zygotically transcribed dorsal-ventral patterning genes, whose expression we show to be quantitatively modulated by anterior-posterior factors. In addition to these highly bound regions, there are several thousand regions that are reproducibly bound at lower levels. However, these poorly bound regions are, collectively, far more distant from genes transcribed in the blastoderm than highly bound regions; are preferentially found in protein-coding sequences; and are less conserved than highly bound regions. Together these observations suggest that many of these poorly-bound regions are not involved in early
Adaptive PSO for optimal LQR tracking control of 2 DoF laboratory helicopter
Vinodh Kumar, E.; Ganapathy Subramanian, R.; Jerome, J.
2016-01-01
This paper deals with the attitude tracking control problem for a 2 DoF laboratory helicopter using optimal linear quadratic regulator (LQR). As the performance of the LQR controller greatly depends on the weighting matrices (Q and R), it is important to select them optimally. However, normally the
Transcription factor Oct1 is a somatic and cancer stem cell determinant.
Directory of Open Access Journals (Sweden)
Jessica Maddox
Full Text Available Defining master transcription factors governing somatic and cancer stem cell identity is an important goal. Here we show that the Oct4 paralog Oct1, a transcription factor implicated in stress responses, metabolic control, and poised transcription states, regulates normal and pathologic stem cell function. Oct1(HI cells in the colon and small intestine co-express known stem cell markers. In primary malignant tissue, high Oct1 protein but not mRNA levels strongly correlate with the frequency of CD24(LOCD44(HI cancer-initiating cells. Reducing Oct1 expression via RNAi reduces the proportion of ALDH(HI and dye efflux(HI cells, and increasing Oct1 increases the proportion of ALDH(HI cells. Normal ALDH(HI cells harbor elevated Oct1 protein but not mRNA levels. Functionally, we show that Oct1 promotes tumor engraftment frequency and promotes hematopoietic stem cell engraftment potential in competitive and serial transplants. In addition to previously described Oct1 transcriptional targets, we identify four Oct1 targets associated with the stem cell phenotype. Cumulatively, the data indicate that Oct1 regulates normal and cancer stem cell function.
Directory of Open Access Journals (Sweden)
Fabian Machens
2017-10-01
Full Text Available Orthogonal systems for heterologous protein expression as well as for the engineering of synthetic gene regulatory circuits in hosts like Saccharomyces cerevisiae depend on synthetic transcription factors (synTFs and corresponding cis-regulatory binding sites. We have constructed and characterized a set of synTFs based on either transcription activator-like effectors or CRISPR/Cas9, and corresponding small synthetic promoters (synPs with minimal sequence identity to the host’s endogenous promoters. The resulting collection of functional synTF/synP pairs confers very low background expression under uninduced conditions, while expression output upon induction of the various synTFs covers a wide range and reaches induction factors of up to 400. The broad spectrum of expression strengths that is achieved will be useful for various experimental setups, e.g., the transcriptional balancing of expression levels within heterologous pathways or the construction of artificial regulatory networks. Furthermore, our analyses reveal simple rules that enable the tuning of synTF expression output, thereby allowing easy modification of a given synTF/synP pair. This will make it easier for researchers to construct tailored transcriptional control systems.
International Nuclear Information System (INIS)
Chen, Ching-Hwa; Tsaia, Perng-Jy; Lai, Chane-Yu; Peng, Ya-Lian; Soo, Jhy-Charm; Chen, Cheng-Yao; Shih, Tung-Sheng
2010-01-01
In this study, field samplings were conducted in three workplaces of a foundry plant, including the molding, demolding, and bead blasting, respectively. Three respirable aerosol samplers (including a 25-mm aluminum cyclone, nylon cyclone, and IOSH cyclone) were used side-by-side to collect samples from each selected workplace. For each collected sample, the uniformity of the deposition of respirable dusts on the filter was measured and its free silica content was determined by both the DOF XRD method and NIOSH 7500 XRD method (i.e., the reference method). A same trend in measured uniformities can be found in all selected workplaces: 25-mm aluminum cyclone > nylon cyclone > IOSH cyclone. Even for samples collected by the sampler with the highest uniformity (i.e., 25-mm aluminum cyclone), the use of the DOF XRD method would lead to the measured free silica concentrations 1.15-2.89 times in magnitude higher than that of the reference method. A new filter holder should be developed with the minimum uniformity comparable to that of NIOSH 7500 XRD method (=0.78) in the future. The use of conversion factors for correcting quartz concentrations obtained from the DOF XRD method based on the measured uniformities could be suitable for the foundry industry at this stage.
Utrophin up-regulation by an artificial transcription factor in transgenic mice.
Directory of Open Access Journals (Sweden)
Elisabetta Mattei
2007-08-01
Full Text Available Duchenne Muscular Dystrophy (DMD is a severe muscle degenerative disease, due to absence of dystrophin. There is currently no effective treatment for DMD. Our aim is to up-regulate the expression level of the dystrophin related gene utrophin in DMD, complementing in this way the lack of dystrophin functions. To this end we designed and engineered several synthetic zinc finger based transcription factors. In particular, we have previously shown that the artificial three zinc finger protein named Jazz, fused with the appropriate effector domain, is able to drive the transcription of a test gene from the utrophin promoter "A". Here we report on the characterization of Vp16-Jazz-transgenic mice that specifically over-express the utrophin gene at the muscular level. A Chromatin Immunoprecipitation assay (ChIP demonstrated the effective access/binding of the Jazz protein to active chromatin in mouse muscle and Vp16-Jazz was shown to be able to up-regulate endogenous utrophin gene expression by immunohistochemistry, western blot analyses and real-time PCR. To our knowledge, this is the first example of a transgenic mouse expressing an artificial gene coding for a zinc finger based transcription factor. The achievement of Vp16-Jazz transgenic mice validates the strategy of transcriptional targeting of endogenous genes and could represent an exclusive animal model for use in drug discovery and therapeutics.
Wei, Kai-Fa; Chen, Juan; Chen, Yan-Feng; Wu, Ling-Juan; Xie, Dao-Xin
2012-04-01
The WRKY transcription factors function in plant growth and development, and response to the biotic and abiotic stresses. Although many studies have focused on the functional identification of the WRKY transcription factors, much less is known about molecular phylogenetic and global expression analysis of the complete WRKY family in maize. In this study, we identified 136 WRKY proteins coded by 119 genes in the B73 inbred line from the complete genome and named them in an orderly manner. Then, a comprehensive phylogenetic analysis of five species was performed to explore the origin and evolutionary patterns of these WRKY genes, and the result showed that gene duplication is the major driving force for the origin of new groups and subgroups and functional divergence during evolution. Chromosomal location analysis of maize WRKY genes indicated that 20 gene clusters are distributed unevenly in the genome. Microarray-based expression analysis has revealed that 131 WRKY transcripts encoded by 116 genes may participate in the regulation of maize growth and development. Among them, 102 transcripts are stably expressed with a coefficient of variation (CV) value of WRKY genes with the CV value of >15% are further analysed to discover new organ- or tissue-specific genes. In addition, microarray analyses of transcriptional responses to drought stress and fungal infection showed that maize WRKY proteins are involved in stress responses. All these results contribute to a deep probing into the roles of WRKY transcription factors in maize growth and development and stress tolerance.
Kang, Byung Young; Lee, Ki-Hwan; Lee, Yong Sung; Hong, Il; Lee, Mi-Ock; Min, Daejin; Chang, Ihseop; Hwang, Jae Sung; Park, Jun Seong; Kim, Duck Hee
2008-01-01
Kaempferol is the major flavonol in green tea and exhibits many biomedically useful properties such as antioxidative, cytoprotective and anti-apoptotic activities. To elucidate its effects on the skin, we investigated the transcriptional profiles of kaempferol-treated HaCaT cells using cDNA microarray analysis and identified 147 transcripts that exhibited significant changes in expression. Of these, 18 were up-regulated and 129 were down-regulated. These transcripts were then classified into 12 categories according to their functional roles: cell adhesion/cytoskeleton, cell cycle, redox homeostasis, immune/defense responses, metabolism, protein biosynthesis/modification, intracellular transport, RNA processing, DNA modification/ replication, regulation of transcription, signal transduction and transport. We then analyzed the promoter sequences of differentially-regulated genes and identified over-represented regulatory sites and candidate transcription factors (TFs) for gene regulation by kaempferol. These included c-REL, SAP-1, Ahr-ARNT, Nrf-2, Elk-1, SPI-B, NF-κB and p65. In addition, we validated the microarray results and promoter analyses using conventional methods such as real-time PCR and ELISA-based transcription factor assay. Our microarray analysis has provided useful information for determining the genetic regulatory network affected by kaempferol, and this approach will be useful for elucidating gene-phytochemical interactions. PMID:18446059
Identification of transcription factors linked to cell cycle regulation in Arabidopsis
Dehghan Nayeri, Fatemeh
2014-01-01
Cell cycle is an essential process in growth and development of living organisms consists of the replication and mitotic phases separated by 2 gap phases; G1 and G2. It is tightly controlled at the molecular level and especially at the level of transcription. Precise regulation of the cell cycle is of central significance for plant growth and development and transcription factors are global regulators of gene expression playing essential roles in cell cycle regulation. This study has uncovere...
DOT/FAA Human Factors Workshop on Aviation (6th). Transcript.
1982-05-01
This document is a verbatim transcript of the proceedings of the DOT/FAA Sixth Human Factors Workshop on Aviation held at the Mike Monroney Aeronautical Center, Oklahoma City, Oklahoma on July 7-8, 1981. The subject of the workshop was aviation maint...
Regulation of archicortical arealization by the transcription factor Zbtb20
DEFF Research Database (Denmark)
Rosenthal, Eva Helga; Tonchev, Anton B; Stoykova, Anastassia
2012-01-01
The molecular mechanisms of regionalization of the medial pallium (MP), the anlage of the hippocampus, and transitional (cingulate and retrosplenial) cortices are largely unknown. Previous analyses have outlined an important role of the transcription factor (TF) Zbtb20 for hippocampal CA1 field...
Operation analysis of a Chebyshev-Pantograph leg mechanism for a single DOF biped robot
Liang, Conghui; Ceccarelli, Marco; Takeda, Yukio
2012-12-01
In this paper, operation analysis of a Chebyshev-Pantograph leg mechanism is presented for a single degree of freedom (DOF) biped robot. The proposed leg mechanism is composed of a Chebyshev four-bar linkage and a pantograph mechanism. In contrast to general fully actuated anthropomorphic leg mechanisms, the proposed leg mechanism has peculiar features like compactness, low-cost, and easy-operation. Kinematic equations of the proposed leg mechanism are formulated for a computer oriented simulation. Simulation results show the operation performance of the proposed leg mechanism with suitable characteristics. A parametric study has been carried out to evaluate the operation performance as function of design parameters. A prototype of a single DOF biped robot equipped with two proposed leg mechanisms has been built at LARM (Laboratory of Robotics and Mechatronics). Experimental test shows practical feasible walking ability of the prototype, as well as drawbacks are discussed for the mechanical design.
A role for the transcription factor HEY1 in glioblastoma
DEFF Research Database (Denmark)
Hulleman, Esther; Quarto, Micaela; Vernell, Richard
2009-01-01
Glioblastoma multiforme (GBM), the highest-grade glioma, is the most frequent tumour of the brain with a very poor prognosis and limited therapeutic options. Although little is known about the molecular mechanisms that underlie glioblastoma formation, a number of signal transduction routes......, such as the Notch and Ras signalling pathways, seem to play an important role in the formation of GBM. In the present study, we show by in situ hybridization on primary tumour material that the transcription factor HEY1, a target of the Notch signalling pathway, is specifically upregulated in glioma...... and that expression of HEY1 in GBM correlates with tumour-grade and survival. In addition, we show by chromatin immunoprecipitations, luciferase assays and Northern blot experiments that HEY1 is a bona fide target of the E2F family of transcription factors, connecting the Ras and Notch signalling pathways. Finally...
Directory of Open Access Journals (Sweden)
Jolly Emmitt R
2005-11-01
Full Text Available Abstract Background A major challenge in computational genomics is the development of methodologies that allow accurate genome-wide prediction of the regulatory targets of a transcription factor. We present a method for target identification that combines experimental characterization of binding requirements with computational genomic analysis. Results Our method identified potential target genes of the transcription factor Ndt80, a key transcriptional regulator involved in yeast sporulation, using the combined information of binding affinity, positional distribution, and conservation of the binding sites across multiple species. We have also developed a mathematical approach to compute the false positive rate and the total number of targets in the genome based on the multiple selection criteria. Conclusion We have shown that combining biochemical characterization and computational genomic analysis leads to accurate identification of the genome-wide targets of a transcription factor. The method can be extended to other transcription factors and can complement other genomic approaches to transcriptional regulation.
van der Does, H. Charlotte; Schmidt, Sarah M.; Langereis, Léon; Hughes, Timothy R.
2016-01-01
Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called ‘effectors’. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the ‘pathogenicity’ chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol
DEFF Research Database (Denmark)
Dossani, Zain Y.; Apel, Amanda Reider; Szmidt-Middleton, Heather
2018-01-01
regions, we have built a library of hybrid promoters that are regulated by a synthetic transcription factor. The hybrid promoters consist of native S. cerevisiae promoters, in which the operator regions have been replaced with sequences that are recognized by the bacterial LexA DNA binding protein....... Correspondingly, the synthetic transcription factor (TF) consists of the DNA binding domain of the LexA protein, fused with the human estrogen binding domain and the viral activator domain, VP16. The resulting system with a bacterial DNA binding domain avoids the transcription of native S. cerevisiae genes...... levels, using the same synthetic TF and a given estradiol. This set of promoters, in combination with our synthetic TF, has the potential to regulate numerous genes or pathways simultaneously, to multiple desired levels, in a single strain....
Directory of Open Access Journals (Sweden)
Paolo Kunderfranco
2010-05-01
Full Text Available ETS transcription factors regulate important signaling pathways involved in cell differentiation and development in many tissues and have emerged as important players in prostate cancer. However, the biological impact of ETS factors in prostate tumorigenesis is still debated.We performed an analysis of the ETS gene family using microarray data and real-time PCR in normal and tumor tissues along with functional studies in normal and cancer cell lines to understand the impact in prostate tumorigenesis and identify key targets of these transcription factors. We found frequent dysregulation of ETS genes with oncogenic (i.e., ERG and ESE1 and tumor suppressor (i.e., ESE3 properties in prostate tumors compared to normal prostate. Tumor subgroups (i.e., ERG(high, ESE1(high, ESE3(low and NoETS tumors were identified on the basis of their ETS expression status and showed distinct transcriptional and biological features. ERG(high and ESE3(low tumors had the most robust gene signatures with both distinct and overlapping features. Integrating genomic data with functional studies in multiple cell lines, we demonstrated that ERG and ESE3 controlled in opposite direction transcription of the Polycomb Group protein EZH2, a key gene in development, differentiation, stem cell biology and tumorigenesis. We further demonstrated that the prostate-specific tumor suppressor gene Nkx3.1 was controlled by ERG and ESE3 both directly and through induction of EZH2.These findings provide new insights into the role of the ETS transcriptional network in prostate tumorigenesis and uncover previously unrecognized links between aberrant expression of ETS factors, deregulation of epigenetic effectors and silencing of tumor suppressor genes. The link between aberrant ETS activity and epigenetic gene silencing may be relevant for the clinical management of prostate cancer and design of new therapeutic strategies.
International Nuclear Information System (INIS)
Mehmood, Rashid; Yasuhara, Noriko; Oe, Souichi; Nagai, Masahiro; Yoneda, Yoshihiro
2009-01-01
The transition from undifferentiated pluripotent cells to terminally differentiated neurons is coordinated by a repertoire of transcription factors. NeuroD1 is a type II basic helix loop helix (bHLH) transcription factor that plays critical roles in neuronal differentiation and maintenance in the central nervous system. Its dimerization with E47, a type I bHLH transcription factor, leads to the transcriptional regulation of target genes. Mounting evidence suggests that regulating the localization of transcription factors contributes to the regulation of their activity during development as defects in their localization underlie a variety of developmental disorders. In this study, we attempted to understand the nuclear import mannerisms of NeuroD1 and E47. We found that the nuclear import of NeuroD1 and E47 is energy-dependent and involves the Ran-mediated pathway. Herein, we demonstrate that NeuroD1 and E47 can dimerize inside the cytoplasm before their nuclear import. Moreover, this dimerization promotes nuclear import as the nuclear accumulation of NeuroD1 was enhanced in the presence of E47 in an in vitro nuclear import assay, and NLS-deficient NeuroD1 was successfully imported into the nucleus upon E47 overexpression. NeuroD1 also had a similar effect on the nuclear accumulation of NLS-deficient E47. These findings suggest a novel role for dimerization that may promote, at least partially, the nuclear import of transcription factors allowing them to function efficiently in the nucleus.
Orgeur, Mickael; Martens, Marvin; Leonte, Georgeta; Nassari, Sonya; Bonnin, Marie-Ange; Börno, Stefan T; Timmermann, Bernd; Hecht, Jochen; Duprez, Delphine; Stricker, Sigmar
2018-03-29
Connective tissues support organs and play crucial roles in development, homeostasis and fibrosis, yet our understanding of their formation is still limited. To gain insight into the molecular mechanisms of connective tissue specification, we selected five zinc-finger transcription factors - OSR1, OSR2, EGR1, KLF2 and KLF4 - based on their expression patterns and/or known involvement in connective tissue subtype differentiation. RNA-seq and ChIP-seq profiling of chick limb micromass cultures revealed a set of common genes regulated by all five transcription factors, which we describe as a connective tissue core expression set. This common core was enriched with genes associated with axon guidance and myofibroblast signature, including fibrosis-related genes. In addition, each transcription factor regulated a specific set of signalling molecules and extracellular matrix components. This suggests a concept whereby local molecular niches can be created by the expression of specific transcription factors impinging on the specification of local microenvironments. The regulatory network established here identifies common and distinct molecular signatures of limb connective tissue subtypes, provides novel insight into the signalling pathways governing connective tissue specification, and serves as a resource for connective tissue development. © 2018. Published by The Company of Biologists Ltd.
Allen, K.E.; Luna, S. de la; Kerkhoven, R.M.; Bernards, R.A.; Thangue, N.B. La
1997-01-01
Transcription factor E2F plays an important role in coordinating and integrating early cell cycle progression with the transcription apparatus. It is known that physiological E2F arises when a member of two families of proteins, E2F and DP, interact as E2F/DP heterodimers and that transcriptional
DEFF Research Database (Denmark)
Kjaerulff, Søren; Andersen, Nicoline Resen; Borup, Mia Trolle
2007-01-01
Eukaryotic cells normally differentiate from G(1); here we investigate the mechanism preventing expression of differentiation-specific genes outside G(1). In fission yeast, induction of the transcription factor Ste11 triggers sexual differentiation. We find that Ste11 is only active in G(1) when...... Cdk activity is low. In the remaining part of the cell cycle, Ste11 becomes Cdk-phosphorylated at Thr 82 (T82), which inhibits its DNA-binding activity. Since the ste11 gene is autoregulated and the Ste11 protein is highly unstable, this Cdk switch rapidly extinguishes Ste11 activity when cells enter...... S phase. When we mutated T82 to aspartic acid, mimicking constant phosphorylation, cells no longer underwent differentiation. Conversely, changing T82 to alanine rendered Ste11-controlled transcription constitutive through the cell cycle, and allowed mating from S phase with increased frequency...
A Role for the NF-kb/Rel Transcription Factors in Human Breast Cancer
National Research Council Canada - National Science Library
Baldwin, Albert
1998-01-01
Human breast cancer is characterized by the inappropriate expression of growth factors, kinases and possibly certain transcription factors Our project has focused on the regulation of the NF-kB family...
A Genome-Scale Resource for the Functional Characterization of Arabidopsis Transcription Factors
Directory of Open Access Journals (Sweden)
Jose L. Pruneda-Paz
2014-07-01
Full Text Available Extensive transcriptional networks play major roles in cellular and organismal functions. Transcript levels are in part determined by the combinatorial and overlapping functions of multiple transcription factors (TFs bound to gene promoters. Thus, TF-promoter interactions provide the basic molecular wiring of transcriptional regulatory networks. In plants, discovery of the functional roles of TFs is limited by an increased complexity of network circuitry due to a significant expansion of TF families. Here, we present the construction of a comprehensive collection of Arabidopsis TFs clones created to provide a versatile resource for uncovering TF biological functions. We leveraged this collection by implementing a high-throughput DNA binding assay and identified direct regulators of a key clock gene (CCA1 that provide molecular links between different signaling modules and the circadian clock. The resources introduced in this work will significantly contribute to a better understanding of the transcriptional regulatory landscape of plant genomes.
Florez, Sergio L; Erwin, Rachel L; Maximova, Siela N; Guiltinan, Mark J; Curtis, Wayne R
2015-05-16
Theobroma cacao, the chocolate tree, is an important economic crop in East Africa, South East Asia, and South and Central America. Propagation of elite varieties has been achieved through somatic embryogenesis (SE) but low efficiencies and genotype dependence still presents a significant limitation for its propagation at commercial scales. Manipulation of transcription factors has been used to enhance the formation of SEs in several other plant species. This work describes the use of the transcription factor Baby Boom (BBM) to promote the transition of somatic cacao cells from the vegetative to embryonic state. An ortholog of the Arabidopsis thaliana BBM gene (AtBBM) was characterized in T. cacao (TcBBM). TcBBM expression was observed throughout embryo development and was expressed at higher levels during SE as compared to zygotic embryogenesis (ZE). TcBBM overexpression in A. thaliana and T. cacao led to phenotypes associated with SE that did not require exogenous hormones. While transient ectopic expression of TcBBM provided only moderate enhancements in embryogenic potential, constitutive overexpression dramatically increased SE proliferation but also appeared to inhibit subsequent development. Our work provides validation that TcBBM is an ortholog to AtBBM and has a specific role in both somatic and zygotic embryogenesis. Furthermore, our studies revealed that TcBBM transcript levels could serve as a biomarker for embryogenesis in cacao tissue. Results from transient expression of TcBBM provide confirmation that transcription factors can be used to enhance SE without compromising plant development and avoiding GMO plant production. This strategy could compliment a hormone-based method of reprogramming somatic cells and lead to more precise manipulation of SE at the regulatory level of transcription factors. The technology would benefit the propagation of elite varieties with low regeneration potential as well as the production of transgenic plants, which
Robust design of a 2-DOF GMV controller: a direct self-tuning and fuzzy scheduling approach.
Silveira, Antonio S; Rodríguez, Jaime E N; Coelho, Antonio A R
2012-01-01
This paper presents a study on self-tuning control strategies with generalized minimum variance control in a fixed two degree of freedom structure-or simply GMV2DOF-within two adaptive perspectives. One, from the process model point of view, using a recursive least squares estimator algorithm for direct self-tuning design, and another, using a Mamdani fuzzy GMV2DOF parameters scheduling technique based on analytical and physical interpretations from robustness analysis of the system. Both strategies are assessed by simulation and real plants experimentation environments composed of a damped pendulum and an under development wind tunnel from the Department of Automation and Systems of the Federal University of Santa Catarina. Copyright © 2011 ISA. Published by Elsevier Ltd. All rights reserved.
Nieuwenhuizen, Niels J; Chen, Xiuyin; Wang, Mindy Y; Matich, Adam J; Perez, Ramon Lopez; Allan, Andrew C; Green, Sol A; Atkinson, Ross G
2015-04-01
Two kiwifruit (Actinidia) species with contrasting terpene profiles were compared to understand the regulation of fruit monoterpene production. High rates of terpinolene production in ripe Actinidia arguta fruit were correlated with increasing gene and protein expression of A. arguta terpene synthase1 (AaTPS1) and correlated with an increase in transcript levels of the 2-C-methyl-D-erythritol 4-phosphate pathway enzyme 1-deoxy-D-xylulose-5-phosphate synthase (DXS). Actinidia chinensis terpene synthase1 (AcTPS1) was identified as part of an array of eight tandemly duplicated genes, and AcTPS1 expression and terpene production were observed only at low levels in developing fruit. Transient overexpression of DXS in Nicotiana benthamiana leaves elevated monoterpene synthesis by AaTPS1 more than 100-fold, indicating that DXS is likely to be the key step in regulating 2-C-methyl-D-erythritol 4-phosphate substrate flux in kiwifruit. Comparative promoter analysis identified potential NAC (for no apical meristem [NAM], Arabidopsis transcription activation factor [ATAF], and cup-shaped cotyledon [CUC])-domain transcription factor) and ETHYLENE-INSENSITIVE3-like transcription factor (TF) binding sites in the AaTPS1 promoter, and cloned members of both TF classes were able to activate the AaTPS1 promoter in transient assays. Electrophoretic mobility shift assays showed that AaNAC2, AaNAC3, and AaNAC4 bind a 28-bp fragment of the proximal NAC binding site in the AaTPS1 promoter but not the A. chinensis AcTPS1 promoter, where the NAC binding site was mutated. Activation could be restored by reintroducing multiple repeats of the 12-bp NAC core-binding motif. The absence of NAC transcriptional activation in ripe A. chinensis fruit can account for the low accumulation of AcTPS1 transcript, protein, and monoterpene volatiles in this species. These results indicate the importance of NAC TFs in controlling monoterpene production and other traits in ripening fruits. © 2015 American
Energy Technology Data Exchange (ETDEWEB)
Long, Cong; Wang, Jingchao [Department of Pathogen Biology, School of Basic Medical Sciences, Wuhan University, Wuhan, 430071 (China); Guo, Wei [Department of Pathology and Physiology, School of Basic Medical Sciences, Wuhan University, Wuhan, 430071 (China); Wang, Huan; Wang, Chao; Liu, Yu [Department of Pathogen Biology, School of Basic Medical Sciences, Wuhan University, Wuhan, 430071 (China); Sun, Xiaoping, E-mail: xsun6@whu.edu.cn [Department of Pathogen Biology, School of Basic Medical Sciences, Wuhan University, Wuhan, 430071 (China); State Key Laboratory of Virology, Wuhan University, Wuhan, 430072 (China)
2016-01-01
Primary effusion lymphoma (PEL) is a rare and aggressive non-Hodgkin's lymphoma. Human telomerase reverse transcriptase (hTERT), a key component responsible for the regulation of telomerase activity, plays important roles in cellular immortalization and cancer development. Triptolide purified from Tripterygium extracts displays a broad-spectrum bioactivity profile, including immunosuppressive, anti-inflammatory, and anti-tumor. In this study, it is investigated whether triptolide reduces hTERT expression and suppresses its activity in PEL cells. The mRNA and protein levels of hTERT were examined by real time-PCR and Western blotting, respectively. The activity of hTERT promoter was determined by Dual luciferase reporter assay. Our results demonstrated that triptolide decreased expression of hTERT at both mRNA and protein levels. Further gene sequence analysis indicated that the activity of hTERT promoter was suppressed by triptolide. Triptolide also reduced the half-time of hTERT. Additionally, triptolide inhibited the expression of transcription factor specificity protein 1(Sp1) in PEL cells. Furthermore, knock-down of Sp1 by using specific shRNAs resulted in down-regulation of hTERT transcription and protein expression levels. Inhibition of Sp1 by specific shRNAs enhanced triptolide-induced cell growth inhibition and apoptosis. Collectively, our results demonstrate that the inhibitory effect of triptolide on hTERT transcription is possibly mediated by inhibition of transcription factor Sp1 in PEL cells. - Highlights: • Triptolide reduces expression of hTERT by decreasing its transcription level. • Triptolide reduces promoter activity and stability of hTERT. • Triptolide down-regulates expression of Sp1. • Special Sp1 shRNAs inhibit transcription and protein expression of hTERT. • Triptolide and Sp1 shRNA2 induce cell proliferation inhibition and apoptosis.
Kroes, R A; Abravaya, K; Seidenfeld, J; Morimoto, R I
1991-01-01
Treatment of cultured human tumor cells with the chloroethylnitrosourea antitumor drug 1,3-bis(2-chloroethyl)-1-nitrosourea (BCNU) selectively induces transcription and protein synthesis of a subset of the human heat shock or stress-induced genes (HSP90 and HSP70) with little effect on other stress genes or on expression of the c-fos, c-myc, or beta-actin genes. The active component of BCNU and related compounds appears to be the isocyanate moiety that causes carbamoylation of proteins and nucleic acids. Transcriptional activation of the human HSP70 gene by BCNU is dependent on the heat shock element and correlates with the level of heat shock transcription factor and its binding to the heat shock element in vivo. Unlike activation by heat or heavy metals, BCNU-mediated activation is strongly dependent upon new protein synthesis. This suggests that BCNU-induced, isocyanate-mediated damage to newly synthesized protein(s) may be responsible for activation of the heat shock transcription factor and increased transcription of the HSP90 and HSP70 genes. Images PMID:2052560
Quantum wave packet study of D+OF reaction
International Nuclear Information System (INIS)
Kurban, M.; Karabulut, E.; Tutuk, R.; Goektas, F.
2010-01-01
The quantum dynamics of the D+OF reaction on the adiabatic potential energy surface of the ground 1 3 A ' state has been studied by using a time-dependent quantum real wave packet method. The state-to-state and state-to-all reaction probabilities for total angular momentum J = 0 have been calculated. The probabilities for J > 0 have been calculated by J-shifting the J = 0 results by means of capture model. Then, the integral cross sections and initial state selected rate constants have been calculated. The initial state-selected reaction probabilities and reaction cross section show threshold but not manifest any resonances and the initial state selected rate constants are sensitive to the temperature.
International Nuclear Information System (INIS)
Thomassen, Mads; Tan, Qihua; Kruse, Torben A
2008-01-01
Metastasis is believed to progress in several steps including different pathways but the determination and understanding of these mechanisms is still fragmentary. Microarray analysis of gene expression patterns in breast tumors has been used to predict outcome in recent studies. Besides classification of outcome, these global expression patterns may reflect biological mechanisms involved in metastasis of breast cancer. Our purpose has been to investigate pathways and transcription factors involved in metastasis by use of gene expression data sets. We have analyzed 8 publicly available gene expression data sets. A global approach, 'gene set enrichment analysis' as well as an approach focusing on a subset of significantly differently regulated genes, GenMAPP, has been applied to rank pathway gene sets according to differential regulation in metastasizing tumors compared to non-metastasizing tumors. Meta-analysis has been used to determine overrepresentation of pathways and transcription factors targets, concordant deregulated in metastasizing breast tumors, in several data sets. The major findings are up-regulation of cell cycle pathways and a metabolic shift towards glucose metabolism reflected in several pathways in metastasizing tumors. Growth factor pathways seem to play dual roles; EGF and PDGF pathways are decreased, while VEGF and sex-hormone pathways are increased in tumors that metastasize. Furthermore, migration, proteasome, immune system, angiogenesis, DNA repair and several signal transduction pathways are associated to metastasis. Finally several transcription factors e.g. E2F, NFY, and YY1 are identified as being involved in metastasis. By pathway meta-analysis many biological mechanisms beyond major characteristics such as proliferation are identified. Transcription factor analysis identifies a number of key factors that support central pathways. Several previously proposed treatment targets are identified and several new pathways that may
Directory of Open Access Journals (Sweden)
Kinyui Alice Lo
Full Text Available The growing epidemic of obesity and metabolic diseases calls for a better understanding of adipocyte biology. The regulation of transcription in adipocytes is particularly important, as it is a target for several therapeutic approaches. Transcriptional outcomes are influenced by both histone modifications and transcription factor binding. Although the epigenetic states and binding sites of several important transcription factors have been profiled in the mouse 3T3-L1 cell line, such data are lacking in human adipocytes. In this study, we identified H3K56 acetylation sites in human adipocytes derived from mesenchymal stem cells. H3K56 is acetylated by CBP and p300, and deacetylated by SIRT1, all are proteins with important roles in diabetes and insulin signaling. We found that while almost half of the genome shows signs of H3K56 acetylation, the highest level of H3K56 acetylation is associated with transcription factors and proteins in the adipokine signaling and Type II Diabetes pathways. In order to discover the transcription factors that recruit acetyltransferases and deacetylases to sites of H3K56 acetylation, we analyzed DNA sequences near H3K56 acetylated regions and found that the E2F recognition sequence was enriched. Using chromatin immunoprecipitation followed by high-throughput sequencing, we confirmed that genes bound by E2F4, as well as those by HSF-1 and C/EBPα, have higher than expected levels of H3K56 acetylation, and that the transcription factor binding sites and acetylation sites are often adjacent but rarely overlap. We also discovered a significant difference between bound targets of C/EBPα in 3T3-L1 and human adipocytes, highlighting the need to construct species-specific epigenetic and transcription factor binding site maps. This is the first genome-wide profile of H3K56 acetylation, E2F4, C/EBPα and HSF-1 binding in human adipocytes, and will serve as an important resource for better understanding adipocyte
Torque Measurement of 3-DOF Haptic Master Operated by Controllable Electrorheological Fluid
Directory of Open Access Journals (Sweden)
Oh Jong-Seok
2015-02-01
Full Text Available This work presents a torque measurement method of 3-degree-of-freedom (3-DOF haptic master featuring controllable electrorheological (ER fluid. In order to reflect the sense of an organ for a surgeon, the ER haptic master which can generate the repulsive torque of an organ is utilized as a remote controller for a surgery robot. Since accurate representation of organ feeling is essential for the success of the robot-assisted surgery, it is indispensable to develop a proper torque measurement method of 3-DOF ER haptic master. After describing the structural configuration of the haptic master, the torque models of ER spherical joint are mathematically derived based on the Bingham model of ER fluid. A new type of haptic device which has pitching, rolling, and yawing motions is then designed and manufactured using a spherical joint mechanism. Subsequently, the field-dependent parameters of the Bingham model are identified and generating repulsive torque according to applied electric field is measured. In addition, in order to verify the effectiveness of the proposed torque model, a comparative work between simulated and measured torques is undertaken.
The transcription factor c-Maf controls touch receptor development and function.
Wende, Hagen; Lechner, Stefan G; Cheret, Cyril; Bourane, Steeve; Kolanczyk, Maria E; Pattyn, Alexandre; Reuter, Katja; Munier, Francis L; Carroll, Patrick; Lewin, Gary R; Birchmeier, Carmen
2012-03-16
The sense of touch relies on detection of mechanical stimuli by specialized mechanosensory neurons. The scarcity of molecular data has made it difficult to analyze development of mechanoreceptors and to define the basis of their diversity and function. We show that the transcription factor c-Maf/c-MAF is crucial for mechanosensory function in mice and humans. The development and function of several rapidly adapting mechanoreceptor types are disrupted in c-Maf mutant mice. In particular, Pacinian corpuscles, a type of mechanoreceptor specialized to detect high-frequency vibrations, are severely atrophied. In line with this, sensitivity to high-frequency vibration is reduced in humans carrying a dominant mutation in the c-MAF gene. Thus, our work identifies a key transcription factor specifying development and function of mechanoreceptors and their end organs.
Reconstruction of the core and extended regulons of global transcription factors.
Directory of Open Access Journals (Sweden)
Yann S Dufour
2010-07-01
Full Text Available The processes underlying the evolution of regulatory networks are unclear. To address this question, we used a comparative genomics approach that takes advantage of the large number of sequenced bacterial genomes to predict conserved and variable members of transcriptional regulatory networks across phylogenetically related organisms. Specifically, we developed a computational method to predict the conserved regulons of transcription factors across alpha-proteobacteria. We focused on the CRP/FNR super-family of transcription factors because it contains several well-characterized members, such as FNR, FixK, and DNR. While FNR, FixK, and DNR are each proposed to regulate different aspects of anaerobic metabolism, they are predicted to recognize very similar DNA target sequences, and they occur in various combinations among individual alpha-proteobacterial species. In this study, the composition of the respective FNR, FixK, or DNR conserved regulons across 87 alpha-proteobacterial species was predicted by comparing the phylogenetic profiles of the regulators with the profiles of putative target genes. The utility of our predictions was evaluated by experimentally characterizing the FnrL regulon (a FNR-type regulator in the alpha-proteobacterium Rhodobacter sphaeroides. Our results show that this approach correctly predicted many regulon members, provided new insights into the biological functions of the respective regulons for these regulators, and suggested models for the evolution of the corresponding transcriptional networks. Our findings also predict that, at least for the FNR-type regulators, there is a core set of target genes conserved across many species. In addition, the members of the so-called extended regulons for the FNR-type regulators vary even among closely related species, possibly reflecting species-specific adaptation to environmental and other factors. The comparative genomics approach we developed is readily applicable to other
Zhang, Liyuan; Gu, Lingkun; Ringler, Patricia; Smith, Stanley; Rushton, Paul J; Shen, Qingxi J
2015-07-01
Members of the WRKY transcription factor superfamily are essential for the regulation of many plant pathways. Functional redundancy due to duplications of WRKY transcription factors, however, complicates genetic analysis by allowing single-mutant plants to maintain wild-type phenotypes. Our analyses indicate that three group I WRKY genes, OsWRKY24, -53, and -70, act in a partially redundant manner. All three showed characteristics of typical WRKY transcription factors: each localized to nuclei and yeast one-hybrid assays indicated that they all bind to W-boxes, including those present in their own promoters. Quantitative real time-PCR (qRT-PCR) analyses indicated that the expression levels of the three WRKY genes varied in the different tissues tested. Particle bombardment-mediated transient expression analyses indicated that all three genes repress the GA and ABA signaling in a dosage-dependent manner. Combination of all three WRKY genes showed additive antagonism of ABA and GA signaling. These results suggest that these WRKY proteins function as negative transcriptional regulators of GA and ABA signaling. However, different combinations of these WRKY genes can lead to varied strengths in suppression of their targets. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
Perdigoto, Carolina N; Bardot, Evan S; Valdes, Victor J; Santoriello, Francis J; Ezhkova, Elena
2014-12-01
Merkel cell-neurite complexes are located in touch-sensitive areas of the mammalian skin and are involved in recognition of the texture and shape of objects. Merkel cells are essential for these tactile discriminations, as they generate action potentials in response to touch stimuli and induce the firing of innervating afferent nerves. It has been shown that Merkel cells originate from epidermal stem cells, but the cellular and molecular mechanisms of their development are largely unknown. In this study, we analyzed Merkel cell differentiation during development and found that it is a temporally regulated maturation process characterized by a sequential activation of Merkel cell-specific genes. We uncovered key transcription factors controlling this process and showed that the transcription factor Atoh1 is required for initial Merkel cell specification. The subsequent maturation steps of Merkel cell differentiation are controlled by cooperative function of the transcription factors Sox2 and Isl1, which physically interact and work to sustain Atoh1 expression. These findings reveal the presence of a robust transcriptional network required to produce functional Merkel cells that are required for tactile discrimination. © 2014. Published by The Company of Biologists Ltd.
Transcription factors: normal and malignant development of blood cells
National Research Council Canada - National Science Library
Ravid, Katya; Licht, Jonathan
2001-01-01
... and the Development of the Erythroid Lineage James J. Bieker 71 II TRANSCRIPTION FACTORS AND THE MYELOID LINEAGE 85 6 RUNX1(AML1) and CBFB: Genes Required for the Development of All Definitive Hematopoietic Lineages 87 Nancy A. Speck and Elaine Dzierzak 7 PU.1 and the Development of the Myeloid Lineage Daniel G. Tenen 103 vvi CONTENTS 8 CCAAT/Enhancer-...
Okubo, Takuro; Harada, Kanako; Fujii, Masahiro; Tanaka, Shinichi; Ishimaru, Tetsuya; Iwanaka, Tadashi; Nakatomi, Hirohumi; Sora, Sigeo; Morita, Akio; Sugita, Naohiko; Mitsuishi, Mamoru
2014-01-01
Neurosurgical procedures require precise and dexterous manipulation of a surgical suture in narrow and deep spaces in the brain. This is necessary for surgical tasks such as the anastomosis of microscopic blood vessels and dura mater suturing. A hand-held multi-degree of freedom (DOF) robotic forceps was developed to aid the performance of such difficult tasks. The diameter of the developed robotic forceps is 3.5 mm, and its tip has three DOFs, namely, bending, rotation, and grip. Experimental results showed that the robotic forceps had an average needle insertion force of 1.7 N. Therefore, an increase in the needle insertion force is necessary for practical application of the developed device.
Directory of Open Access Journals (Sweden)
Ho Pham Huy Anh
2012-10-01
Full Text Available In this paper, a novel forward adaptive neural MIMO NARX model is used for modelling and identifying the forward kinematics of an industrial 3-DOF robot arm system. The nonlinear features of the forward kinematics of the industrial robot arm drive are thoroughly modelled based on the forward adaptive neural NARX model-based identification process using experimental input-output training data. This paper proposes a novel use of a back propagation (BP algorithm to generate the forward neural MIMO NARX (FNMN model for the forward kinematics of the industrial 3-DOF robot arm. The results show that the proposed adaptive neural NARX model trained by a Back Propagation learning algorithm yields outstanding performance and perfect accuracy.
The forkhead transcription factor FoxY regulates Nanos.
Song, Jia L; Wessel, Gary M
2012-10-01
FoxY is a member of the forkhead transcription factor family that appeared enriched in the presumptive germ line of sea urchins (Ransick et al. Dev Biol 2002;246:132). Here, we test the hypothesis that FoxY is involved in germ line determination in this animal. We found two splice forms of FoxY that share the same DNA-binding domain, but vary in the carboxy-terminal trans-activation/repression domain. Both forms of the FoxY protein are present in the egg and in the early embryo, and their mRNAs accumulate to their highest levels in the small micromeres and adjacent non-skeletogenic mesoderm. Knockdown of FoxY resulted in a dramatic decrease in Nanos mRNA and protein levels as well as a loss of coelomic pouches in 2-week-old larvae. Our results indicate that FoxY positively regulates Nanos at the transcriptional level and is essential for reproductive potential in this organism. Copyright © 2012 Wiley Periodicals, Inc.
Wu, Zhi-Jun; Li, Xing-Hui; Liu, Zhi-Wei; Li, Hui; Wang, Yong-Xin; Zhuang, Jing
2016-02-01
Tea plant [Camellia sinensis (L.) O. Kuntze] is a leaf-type healthy non-alcoholic beverage crop, which has been widely introduced worldwide. Tea is rich in various secondary metabolites, which are important for human health. However, varied climate and complex geography have posed challenges for tea plant survival. The WRKY gene family in plants is a large transcription factor family that is involved in biological processes related to stress defenses, development, and metabolite synthesis. Therefore, identification and analysis of WRKY family transcription factors in tea plant have a profound significance. In the present study, 50 putative C. sinensis WRKY proteins (CsWRKYs) with complete WRKY domain were identified and divided into three Groups (Group I-III) on the basis of phylogenetic analysis results. The distribution of WRKY family transcription factors among plantae, fungi, and protozoa showed that the number of WRKY genes increased in higher plant, whereas the number of these genes did not correspond to the evolutionary relationships of different species. Structural feature and annotation analysis results showed that CsWRKY proteins contained WRKYGQK/WRKYGKK domains and C2H2/C2HC-type zinc-finger structure: D-X18-R-X1-Y-X2-C-X4-7-C-X23-H motif; CsWRKY proteins may be associated with the biological processes of abiotic and biotic stresses, tissue development, and hormone and secondary metabolite biosynthesis. Temperature stresses suggested that the candidate CsWRKY genes were involved in responses to extreme temperatures. The current study established an extensive overview of the WRKY family transcription factors in tea plant. This study also provided a global survey of CsWRKY transcription factors and a foundation of future functional identification and molecular breeding.
Decoupled Sliding Mode Control for a Novel 3-DOF Parallel Manipulator with Actuation Redundancy
Directory of Open Access Journals (Sweden)
Niu Xuemei
2015-05-01
Full Text Available This paper presents a decoupled nonsingular terminal sliding mode controller (DNTSMC for a novel 3-DOF parallel manipulator with actuation redundancy. According to kinematic analysis, the inverse dynamic model for a novel 3-DOF redundantly actuated parallel manipulator is formulated in the task space using Lagrangian formalism and decoupled into three entirely independent subsystems under generalized coordinates to significantly reduce system complexity. Based on the dynamic model, a decoupled sliding mode control strategy is proposed for the parallel manipulator; the idea behind this strategy is to design a nonsingular terminal sliding mode controller for each subsystem, which can drive states of three subsystems to the original equilibrium points simultaneously by two intermediate variables. Additionally, a RBF neural network is used to compensate the cross-coupling force and gravity to enhance the control precision. Simulation and experimental results show that the proposed DNTSMC can achieve better control performances compared with the conventional sliding mode controller (SMC and the DNTSMC without compensator.
Weng, Lin; Bai, Xiaodong; Zhao, Fangfang; Li, Rong; Xiao, Han
2016-12-01
Flowering of higher plants is orchestrated by complex regulatory networks through integration of various environmental signals such as photoperiod, temperature, light quality and developmental cues. In Arabidopsis, transcription of the flowering integrator gene FLOWERING LOCUS T (FT) that several flowering pathways converge to is directly regulated by more than ten transcription factors. However, very little is known about the transcriptional regulation of the FT homolog SINGLE FLOWER TRUESS (SFT) in the day-neutral plant tomato (Solanum lycopersicum). Previously, we showed that the zinc finger transcription factor SlZFP2 plays important roles in regulation of seed germination and fruit ripening in tomato and also found that overexpression of SlZFP2 impacted flowering and branching. Here, we characterized in detail the early flowering and high branching phenotypes by overexpression of this transcription factor. Our data showed that overexpression of SlZFP2 accelerated flowering in an SFT-dependent manner as demonstrated by elevated SFT expression in the leaves and the transcription factor's binding ability to SFT promoter in vitro and in vivo. Furthermore, overexpression of the SlZFP2 gene in the sft plants failed to rescue the mutant's late flowering. Through analysis of grafting phenotype, growth response of branches to auxin application and transcriptome profiling by RNA sequencing, we also showed that overexpression of SlZFP2 affected shoot apical dominance through multiple regulatory pathways. Our results suggest that the transcription factor SlZFP2 has potential applications in genetic modification of plant architecture and flowering time for tomato production and other crops as well. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Hua eCassan-Wang
2013-06-01
Full Text Available The presence of lignin in secondary cell walls (SCW is a major factor preventing hydrolytic enzymes from gaining access to cellulose, thereby limiting the saccharification potential of plant biomass. To understand how lignification is regulated is a prerequisite for selecting plant biomass better adapted to bioethanol production. Because transcriptional regulation is a major mechanism controlling the expression of genes involved in lignin biosynthesis, our aim was to identify novel transcription factors dictating lignin profiles in the model plant Arabidopsis. To this end, we have developed a post-genomic approach by combining four independent in-house SCW-related transcriptome datasets obtained from (i the fiber cell wall-deficient wat1 Arabidopsis mutant, (ii Arabidopsis lines over-expressing either the master regulatory activator EgMYB2 or (iii the repressor EgMYB1 and finally (iv Arabidopsis orthologs of Eucalyptus xylem-expressed genes. This allowed us to identify 502 up- or down-regulated transcription factors. We preferentially selected those present in more than one dataset and further analyzed their in silico expression patterns as an additional selection criteria. This selection process led to 80 candidates. Notably, 16 of them were already proven to regulate SCW formation, thereby validating the overall strategy. Then, we phenotyped 43 corresponding mutant lines focusing on histological observations of xylem and interfascicular fibers. This phenotypic screen revealed six mutant lines exhibiting altered lignification patterns. Two of them (blh6 and a zinc finger transcription factor presented hypolignified SCW. Three others (myb52, myb-like TF, hb5 showed hyperlignified SCW whereas the last one (hb15 showed ectopic lignification. In addition, our meta-analyses highlighted a reservoir of new potential regulators adding to the gene network regulating SCW but also opening new avenues to ultimately improve SCW composition for biofuel
Basic aspects of tumor cell fatty acid-regulated signaling and transcription factors.
Comba, Andrea; Lin, Yi-Hui; Eynard, Aldo Renato; Valentich, Mirta Ana; Fernandez-Zapico, Martín Ernesto; Pasqualini, Marìa Eugenia
2011-12-01
This article reviews the current knowledge and experimental research about the mechanisms by which fatty acids and their derivatives control specific gene expression involved during carcinogenesis. Changes in dietary fatty acids, specifically the polyunsaturated fatty acids of the ω-3 and ω-6 families and some derived eicosanoids from lipoxygenases, cyclooxygenases, and cytochrome P-450, seem to control the activity of transcription factor families involved in cancer cell proliferation or cell death. Their regulation may be carried out either through direct binding to DNA as peroxisome proliferator-activated receptors or via modulation in an indirect manner of signaling pathway molecules (e.g., protein kinase C) and other transcription factors (nuclear factor kappa B and sterol regulatory element binding protein). Knowledge of the mechanisms by which fatty acids control specific gene expression may identify important risk factors for cancer and provide insight into the development of new therapeutic strategies for a better management of whole body lipid metabolism.
Control of cellulose biosynthesis by overexpression of a transcription factor
Energy Technology Data Exchange (ETDEWEB)
Han, Kyung-Hwan; Ko, Jae-Heung; Kim, Won-Chan; Kim; , Joo-Yeol
2017-05-16
The invention relates to the over-expression of a transcription factor selected from the group consisting of MYB46, HAM1, HAM2, MYB112, WRKY11, ERF6, and any combination thereof in a plant, which can modulate and thereby modulating the cellulose content of the plant.
Energy Technology Data Exchange (ETDEWEB)
Sollome, James; Martin, Elizabeth [Department of Environmental Science & Engineering, Gillings School of Global Public Health, University of North Carolina, Chapel Hill (United States); Sethupathy, Praveen [Department of Genetics, School of Medicine, University of North Carolina, Chapel Hill, NC (United States); Fry, Rebecca C., E-mail: rfry@unc.edu [Department of Environmental Science & Engineering, Gillings School of Global Public Health, University of North Carolina, Chapel Hill (United States); Curriculum in Toxicology, School of Medicine, University of North Carolina, Chapel Hill, NC (United States)
2016-12-01
MicroRNAs (miRNAs) regulate gene expression by binding mRNA and inhibiting translation and/or inducing degradation of the associated transcripts. Expression levels of miRNAs have been shown to be altered in response to environmental toxicants, thus impacting cellular function and influencing disease risk. Transcription factors (TFs) are known to be altered in response to environmental toxicants and play a critical role in the regulation of miRNA expression. To date, environmentally-responsive TFs that are important for regulating miRNAs remain understudied. In a state-of-the-art analysis, we utilized an in silico bioinformatic approach to characterize potential transcriptional regulators of environmentally-responsive miRNAs. Using the miRStart database, genomic sequences of promoter regions for all available human miRNAs (n = 847) were identified and promoter regions were defined as − 1000/+500 base pairs from the transcription start site. Subsequently, the promoter region sequences of environmentally-responsive miRNAs (n = 128) were analyzed using enrichment analysis to determine overrepresented TF binding sites (TFBS). While most (56/73) TFs differed across environmental contaminants, a set of 17 TFs was enriched for promoter binding among miRNAs responsive to numerous environmental contaminants. Of these, one TF was common to miRNAs altered by the majority of environmental contaminants, namely SWI/SNF-related, matrix-associated, actin-dependent regulator of chromatin, subfamily A, member 3 (SMARCA3). These identified TFs represent candidate common transcriptional regulators of miRNAs perturbed by environmental toxicants. - Highlights: • Transcription factors that regulate environmentally-modulated miRNA expression are understudied • Transcription factor binding sites (TFBS) located within DNA promoter regions of miRNAs were identified. • Specific transcription factors may serve as master regulators of environmentally-mediated microRNA expression.
International Nuclear Information System (INIS)
Sollome, James; Martin, Elizabeth; Sethupathy, Praveen; Fry, Rebecca C.
2016-01-01
MicroRNAs (miRNAs) regulate gene expression by binding mRNA and inhibiting translation and/or inducing degradation of the associated transcripts. Expression levels of miRNAs have been shown to be altered in response to environmental toxicants, thus impacting cellular function and influencing disease risk. Transcription factors (TFs) are known to be altered in response to environmental toxicants and play a critical role in the regulation of miRNA expression. To date, environmentally-responsive TFs that are important for regulating miRNAs remain understudied. In a state-of-the-art analysis, we utilized an in silico bioinformatic approach to characterize potential transcriptional regulators of environmentally-responsive miRNAs. Using the miRStart database, genomic sequences of promoter regions for all available human miRNAs (n = 847) were identified and promoter regions were defined as − 1000/+500 base pairs from the transcription start site. Subsequently, the promoter region sequences of environmentally-responsive miRNAs (n = 128) were analyzed using enrichment analysis to determine overrepresented TF binding sites (TFBS). While most (56/73) TFs differed across environmental contaminants, a set of 17 TFs was enriched for promoter binding among miRNAs responsive to numerous environmental contaminants. Of these, one TF was common to miRNAs altered by the majority of environmental contaminants, namely SWI/SNF-related, matrix-associated, actin-dependent regulator of chromatin, subfamily A, member 3 (SMARCA3). These identified TFs represent candidate common transcriptional regulators of miRNAs perturbed by environmental toxicants. - Highlights: • Transcription factors that regulate environmentally-modulated miRNA expression are understudied • Transcription factor binding sites (TFBS) located within DNA promoter regions of miRNAs were identified. • Specific transcription factors may serve as master regulators of environmentally-mediated microRNA expression
Suzuki, Toru; Muto, Shinsuke; Miyamoto, Saku; Aizawa, Kenichi; Horikoshi, Masami; Nagai, Ryozo
2003-08-01
Transcription involves molecular interactions between general and regulatory transcription factors with further regulation by protein-protein interactions (e.g. transcriptional cofactors). Here we describe functional interaction between DNA-binding transcription factor and histone chaperone. Affinity purification of factors interacting with the DNA-binding domain of the transcription factor Sp1 showed Sp1 to interact with the histone chaperone TAF-I, both alpha and beta isoforms. This interaction was specific as Sp1 did not interact with another histone chaperone CIA nor did other tested DNA-binding regulatory factors (MyoD, NFkappaB, p53) interact with TAF-I. Interaction of Sp1 and TAF-I occurs both in vitro and in vivo. Interaction with TAF-I results in inhibition of DNA-binding, and also likely as a result of such, inhibition of promoter activation by Sp1. Collectively, we describe interaction between DNA-binding transcription factor and histone chaperone which results in negative regulation of the former. This novel regulatory interaction advances our understanding of the mechanisms of eukaryotic transcription through DNA-binding regulatory transcription factors by protein-protein interactions, and also shows the DNA-binding domain to mediate important regulatory interactions.
Misra, Vikram A; Wang, Yu; Timko, Michael P
2017-11-22
Cowpea (Vigna unguiculata (L.) Walp.) is the most important food and forage legume in the semi-arid tropics of sub-Saharan Africa where approximately 80% of worldwide production takes place primarily on low-input, subsistence farm sites. Among the major goals of cowpea breeding and improvement programs are the rapid manipulation of agronomic traits for seed size and quality and improved resistance to abiotic and biotic stresses to enhance productivity. Knowing the suite of transcription factors (TFs) and transcriptionally active proteins (TAPs) that control various critical plant cellular processes would contribute tremendously to these improvement aims. We used a computational approach that employed three different predictive pipelines to data mine the cowpea genome and identified over 4400 genes representing 136 different TF and TAP families. We compare the information content of cowpea to two evolutionarily close species common bean (Phaseolus vulgaris), and soybean (Glycine max) to gauge the relative informational content. Our data indicate that correcting for genome size cowpea has fewer TF and TAP genes than common bean (4408 / 5291) and soybean (4408/ 11,065). Members of the GROWTH-REGULATING FACTOR (GRF) and Auxin/indole-3-acetic acid (Aux/IAA) gene families appear to be over-represented in the genome relative to common bean and soybean, whereas members of the MADS (Minichromosome maintenance deficient 1 (MCM1), AGAMOUS, DEFICIENS, and serum response factor (SRF)) and C2C2-YABBY appear to be under-represented. Analysis of the AP2-EREBP APETALA2-Ethylene Responsive Element Binding Protein (AP2-EREBP), NAC (NAM (no apical meristem), ATAF1, 2 (Arabidopsis transcription activation factor), CUC (cup-shaped cotyledon)), and WRKY families, known to be important in defense signaling, revealed changes and phylogenetic rearrangements relative to common bean and soybean that suggest these groups may have evolved different functions. The availability of detailed
Targeting HOX and PBX transcription factors in ovarian cancer
International Nuclear Information System (INIS)
Morgan, Richard; Plowright, Lynn; Harrington, Kevin J; Michael, Agnieszka; Pandha, Hardev S
2010-01-01
Ovarian cancer still has a relatively poor prognosis due to the frequent occurrence of drug resistance, making the identification of new therapeutic targets an important goal. We have studied the role of HOX genes in the survival and proliferation of ovarian cancer cells. These are a family of homeodomain-containing transcription factors that determine cell and tissue identity in the early embryo, and have an anti-apoptotic role in a number of malignancies including lung and renal cancer. We used QPCR to determine HOX gene expression in normal ovary and in the ovarian cancer cell lines SK-OV3 and OV-90. We used a short peptide, HXR9, to disrupt the formation of HOX/PBX dimers and alter transcriptional regulation by HOX proteins. In this study we show that the ovarian cancer derived line SK-OV3, but not OV-90, exhibits highly dysregulated expression of members of the HOX gene family. Disrupting the interaction between HOX proteins and their co-factor PBX induces apoptosis in SK-OV3 cells and retards tumour growth in vivo. HOX/PBX binding is a potential target in ovarian cancer
DAF-16/FOXO Transcription Factor in Aging and Longevity.
Sun, Xiaojuan; Chen, Wei-Dong; Wang, Yan-Dong
2017-01-01
Aging is associated with age-related diseases and an increase susceptibility of cancer. Dissecting the molecular mechanisms that underlie aging and longevity would contribute to implications for preventing and treating the age-dependent diseases or cancers. Multiple signaling pathways such as the insulin/IGF-1 signaling pathway, TOR signaling, AMPK pathway, JNK pathway and germline signaling have been found to be involved in aging and longevity. And DAF-16/FOXO, as a key transcription factor, could integrate different signals from these pathways to modulate aging, and longevity via shuttling from cytoplasm to nucleus. Hence, understanding how DAF-16/FOXO functions will be pivotal to illustrate the processes of aging and longevity. Here, we summarized how DAF-16/FOXO receives signals from these pathways to affect aging and longevity. We also briefly discussed the transcriptional regulation and posttranslational modifications of DAF-16/FOXO, its co-factors as well as its potential downstream targets participating in lifespan according to the published data in C. elegans and in mammals, and in most cases, we may focus on the studies in C. elegans which has been considered to be a very good animal model for longevity research.
Genome wide analysis of stress responsive WRKY transcription factors in Arabidopsis thaliana
Directory of Open Access Journals (Sweden)
Shaiq Sultan
2016-04-01
Full Text Available WRKY transcription factors are a class of DNA-binding proteins that bind with a specific sequence C/TTGACT/C known as W-Box found in promoters of genes which are regulated by these WRKYs. From previous studies, 43 different stress responsive WRKY transcription factors in Arabidopsis thaliana, identified and then categorized in three groups viz., abiotic, biotic and both of these stresses. A comprehensive genome wide analysis including chromosomal localization, gene structure analysis, multiple sequence alignment, phylogenetic analysis and promoter analysis of these WRKY genes was carried out in this study to determine the functional homology in Arabidopsis. This analysis led to the classification of these WRKY family members into 3 major groups and subgroups and showed evolutionary relationship among these groups on the base of their functional WRKY domain, chromosomal localization and intron/exon structure. The proposed groups of these stress responsive WRKY genes and annotation based on their position on chromosomes can also be explored to determine their functional homology in other plant species in relation to different stresses. The result of the present study provides indispensable genomic information for the stress responsive WRKY transcription factors in Arabidopsis and will pave the way to explain the precise role of various AtWRKYs in plant growth and development under stressed conditions.
Sliding mode control of a "Soft" 2-DOF Planar Pneumatic Manipulator
Van Damme, M.; Vanderborght, B.; Beyl, P.; Versluys, R.; Vanderniepen, I.; Van Ham, R.; Cherelle, P.; Daerden, F.; Lefeber, D.
2008-10-01
This paper presents a sliding mode controller for a "Soft" 2-DOF Planar Pneumatic Manipulator actuated by pleated pneumatic artificial muscle actuators. Since actuator dynamics is not negligible, an approximate model for pressure dynamics was taken into account, which made it necessary to perform full input-output feedback linearization in order to design a sliding mode controller. The design of the controller is presented in detail, and experimental results obtained by implementing the controller are discussed
Genome-wide conserved consensus transcription factor binding motifs are hyper-methylated
Directory of Open Access Journals (Sweden)
Down Thomas A
2010-09-01
Full Text Available Abstract Background DNA methylation can regulate gene expression by modulating the interaction between DNA and proteins or protein complexes. Conserved consensus motifs exist across the human genome ("predicted transcription factor binding sites": "predicted TFBS" but the large majority of these are proven by chromatin immunoprecipitation and high throughput sequencing (ChIP-seq not to be biological transcription factor binding sites ("empirical TFBS". We hypothesize that DNA methylation at conserved consensus motifs prevents promiscuous or disorderly transcription factor binding. Results Using genome-wide methylation maps of the human heart and sperm, we found that all conserved consensus motifs as well as the subset of those that reside outside CpG islands have an aggregate profile of hyper-methylation. In contrast, empirical TFBS with conserved consensus motifs have a profile of hypo-methylation. 40% of empirical TFBS with conserved consensus motifs resided in CpG islands whereas only 7% of all conserved consensus motifs were in CpG islands. Finally we further identified a minority subset of TF whose profiles are either hypo-methylated or neutral at their respective conserved consensus motifs implicating that these TF may be responsible for establishing or maintaining an un-methylated DNA state, or whose binding is not regulated by DNA methylation. Conclusions Our analysis supports the hypothesis that at least for a subset of TF, empirical binding to conserved consensus motifs genome-wide may be controlled by DNA methylation.
Eukaryotic Initiation Factor 4H Is under Transcriptional Control of p65/NF-κB
Fiume, Giuseppe; Rossi, Annalisa; de Laurentiis, Annamaria; Falcone, Cristina; Pisano, Antonio; Vecchio, Eleonora; Pontoriero, Marilena; Scala, Iris; Scialdone, Annarita; Masci, Francesca Fasanella; Mimmi, Selena; Palmieri, Camillo; Scala, Giuseppe; Quinto, Ileana
2013-01-01
Protein synthesis is mainly regulated at the initiation step, allowing the fast, reversible and spatial control of gene expression. Initiation of protein synthesis requires at least 13 translation initiation factors to assemble the 80S ribosomal initiation complex. Loss of translation control may result in cell malignant transformation. Here, we asked whether translational initiation factors could be regulated by NF-κB transcription factor, a major regulator of genes involved in cell proliferation, survival, and inflammatory response. We show that the p65 subunit of NF-κB activates the transcription of eIF4H gene, which is the regulatory subunit of eIF4A, the most relevant RNA helicase in translation initiation. The p65-dependent transcriptional activation of eIF4H increased the eIF4H protein content augmenting the rate of global protein synthesis. In this context, our results provide novel insights into protein synthesis regulation in response to NF-κB activation signalling, suggesting a transcription-translation coupled mechanism of control. PMID:23776612
Chen, Ching-Hwa; Tsaia, Perng-Jy; Lai, Chane-Yu; Peng, Ya-Lian; Soo, Jhy-Charm; Chen, Cheng-Yao; Shih, Tung-Sheng
2010-04-15
In this study, field samplings were conducted in three workplaces of a foundry plant, including the molding, demolding, and bead blasting, respectively. Three respirable aerosol samplers (including a 25-mm aluminum cyclone, nylon cyclone, and IOSH cyclone) were used side-by-side to collect samples from each selected workplace. For each collected sample, the uniformity of the deposition of respirable dusts on the filter was measured and its free silica content was determined by both the DOF XRD method and NIOSH 7500 XRD method (i.e., the reference method). A same trend in measured uniformities can be found in all selected workplaces: 25-mm aluminum cyclone>nylon cyclone>IOSH cyclone. Even for samples collected by the sampler with the highest uniformity (i.e., 25-mm aluminum cyclone), the use of the DOF XRD method would lead to the measured free silica concentrations 1.15-2.89 times in magnitude higher than that of the reference method. A new filter holder should be developed with the minimum uniformity comparable to that of NIOSH 7500 XRD method (=0.78) in the future. The use of conversion factors for correcting quartz concentrations obtained from the DOF XRD method based on the measured uniformities could be suitable for the foundry industry at this stage. 2009 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Su Zhen
2011-07-01
Full Text Available Abstract Background Salt stress hinders the growth of plants and reduces crop production worldwide. However, different plant species might possess different adaptive mechanisms to mitigate salt stress. We conducted a detailed pathway analysis of transcriptional dynamics in the roots of Medicago truncatula seedlings under salt stress and selected a transcription factor gene, MtCBF4, for experimental validation. Results A microarray experiment was conducted using root samples collected 6, 24, and 48 h after application of 180 mM NaCl. Analysis of 11 statistically significant expression profiles revealed different behaviors between primary and secondary metabolism pathways in response to external stress. Secondary metabolism that helps to maintain osmotic balance was induced. One of the highly induced transcription factor genes was successfully cloned, and was named MtCBF4. Phylogenetic analysis revealed that MtCBF4, which belongs to the AP2-EREBP transcription factor family, is a novel member of the CBF transcription factor in M. truncatula. MtCBF4 is shown to be a nuclear-localized protein. Expression of MtCBF4 in M. truncatula was induced by most of the abiotic stresses, including salt, drought, cold, and abscisic acid, suggesting crosstalk between these abiotic stresses. Transgenic Arabidopsis over-expressing MtCBF4 enhanced tolerance to drought and salt stress, and activated expression of downstream genes that contain DRE elements. Over-expression of MtCBF4 in M. truncatula also enhanced salt tolerance and induced expression level of corresponding downstream genes. Conclusion Comprehensive transcriptomic analysis revealed complex mechanisms exist in plants in response to salt stress. The novel transcription factor gene MtCBF4 identified here played an important role in response to abiotic stresses, indicating that it might be a good candidate gene for genetic improvement to produce stress-tolerant plants.
2011-01-01
Background Salt stress hinders the growth of plants and reduces crop production worldwide. However, different plant species might possess different adaptive mechanisms to mitigate salt stress. We conducted a detailed pathway analysis of transcriptional dynamics in the roots of Medicago truncatula seedlings under salt stress and selected a transcription factor gene, MtCBF4, for experimental validation. Results A microarray experiment was conducted using root samples collected 6, 24, and 48 h after application of 180 mM NaCl. Analysis of 11 statistically significant expression profiles revealed different behaviors between primary and secondary metabolism pathways in response to external stress. Secondary metabolism that helps to maintain osmotic balance was induced. One of the highly induced transcription factor genes was successfully cloned, and was named MtCBF4. Phylogenetic analysis revealed that MtCBF4, which belongs to the AP2-EREBP transcription factor family, is a novel member of the CBF transcription factor in M. truncatula. MtCBF4 is shown to be a nuclear-localized protein. Expression of MtCBF4 in M. truncatula was induced by most of the abiotic stresses, including salt, drought, cold, and abscisic acid, suggesting crosstalk between these abiotic stresses. Transgenic Arabidopsis over-expressing MtCBF4 enhanced tolerance to drought and salt stress, and activated expression of downstream genes that contain DRE elements. Over-expression of MtCBF4 in M. truncatula also enhanced salt tolerance and induced expression level of corresponding downstream genes. Conclusion Comprehensive transcriptomic analysis revealed complex mechanisms exist in plants in response to salt stress. The novel transcription factor gene MtCBF4 identified here played an important role in response to abiotic stresses, indicating that it might be a good candidate gene for genetic improvement to produce stress-tolerant plants. PMID:21718548
Functional analysis of jasmonate-responsive transcription factors in Arabidopsis thaliana
Zarei, Adel
2007-01-01
The aim of the studies described in this thesis was the functional analysis of JA-responsive transcription factors in Arabidopsis with an emphasis on the interaction with the promoters of their target genes. In short, the following new results were obtained. The promoter of the PDF1.2 gene contains
DEFF Research Database (Denmark)
Ly, Donald L.; Waheed, Faiza; Lodyga, Monika
2013-01-01
Hyperosmotic stress initiates several adaptive responses, including the remodeling of the cytoskeleton. Besides maintaining structural integrity, the cytoskeleton has emerged as an important regulator of gene transcription. Myocardin-related transcription factor (MRTF), an actin-regulated coactiv......Hyperosmotic stress initiates several adaptive responses, including the remodeling of the cytoskeleton. Besides maintaining structural integrity, the cytoskeleton has emerged as an important regulator of gene transcription. Myocardin-related transcription factor (MRTF), an actin......-regulated coactivator of serum response factor, is a major link between the actin skeleton and transcriptional control. We therefore investigated whether MRTF is regulated by hyperosmotic stress. Here we show that hypertonicity induces robust, rapid, and transient translocation of MRTF from the cytosol to the nucleus...... in kidney tubular cells. We found that the hyperosmolarity-triggered MRTF translocation is mediated by the RhoA/Rho kinase (ROK) pathway. Moreover, the Rho guanine nucleotide exchange factor GEF-H1 is activated by hyperosmotic stress, and it is a key contributor to the ensuing RhoA activation and MRTF...
Novel splice mutation in microthalmia-associated transcription factor in Waardenburg Syndrome.
Brenner, Laura; Burke, Kelly; Leduc, Charles A; Guha, Saurav; Guo, Jiancheng; Chung, Wendy K
2011-01-01
Waardenburg Syndrome (WS) is a syndromic form of hearing loss associated with mutations in six different genes. We identified a large family with WS that had previously undergone clinical testing, with no reported pathogenic mutation. Using linkage analysis, a region on 3p14.1 with an LOD score of 6.6 was identified. Microthalmia-Associated Transcription Factor, a gene known to cause WS, is located within this region of linkage. Sequencing of Microthalmia-Associated Transcription Factor demonstrated a c.1212 G>A synonymous variant that segregated with the WS in the family and was predicted to cause a novel splicing site that was confirmed with expression analysis of the mRNA. This case illustrates the need to computationally analyze novel synonymous sequence variants for possible effects on splicing to maximize the clinical sensitivity of sequence-based genetic testing.
The WRKY Transcription Factor Genes in Lotus japonicus
Song, Hui; Wang, Pengfei; Nan, Zhibiao; Wang, Xingjun
2014-01-01
WRKY transcription factor genes play critical roles in plant growth and development, as well as stress responses. WRKY genes have been examined in various higher plants, but they have not been characterized in Lotus japonicus. The recent release of the L. japonicus whole genome sequence provides an opportunity for a genome wide analysis of WRKY genes in this species. In this study, we identified 61 WRKY genes in the L. japonicus genome. Based on the WRKY protein structure, L. japonicus WRKY (...
Zhao, Fengli; Li, Gang; Hu, Panpan; Zhao, Xia; Li, Liangjie; Wei, Wei; Feng, Jiayue; Zhou, Houcheng
2018-01-01
As the second largest transcription factor family in plant, the basic helix-loop-helix (bHLH) transcription factor family, characterized by the conserved bHLH domain, plays a central regulatory role in many biological process. However, the bHLH transcription factor family of strawberry has not been systematically identified, especially for the anthocyanin biosynthesis. Here, we identified a total of 113 bHLH transcription factors and described their chromosomal distribution and bioinformatics...
Sela, Dotan; Chen, Lu; Martin-Brown, Skylar; Washburn, Michael P; Florens, Laurence; Conaway, Joan Weliky; Conaway, Ronald C
2012-06-29
The basic leucine zipper transcription factor ATF6α functions as a master regulator of endoplasmic reticulum (ER) stress response genes. Previous studies have established that, in response to ER stress, ATF6α translocates to the nucleus and activates transcription of ER stress response genes upon binding sequence specifically to ER stress response enhancer elements in their promoters. In this study, we investigate the biochemical mechanism by which ATF6α activates transcription. By exploiting a combination of biochemical and multidimensional protein identification technology-based mass spectrometry approaches, we have obtained evidence that ATF6α functions at least in part by recruiting to the ER stress response enhancer elements of ER stress response genes a collection of RNA polymerase II coregulatory complexes, including the Mediator and multiple histone acetyltransferase complexes, among which are the Spt-Ada-Gcn5 acetyltransferase (SAGA) and Ada-Two-A-containing (ATAC) complexes. Our findings shed new light on the mechanism of action of ATF6α, and they outline a straightforward strategy for applying multidimensional protein identification technology mass spectrometry to determine which RNA polymerase II transcription factors and coregulators are recruited to promoters and other regulatory elements to control transcription.
Directory of Open Access Journals (Sweden)
Ivan Šamija
2010-11-01
Full Text Available Microphthalmia-associated transcription factor (MITF was first discovered as protein coded by gene whose mutations are associated with Waardenburg syndrome. Later, MITF was shown to be key transcription factor regulating melanogenesis. Further studies have shown that in addition to regulating melanogenesis MITF also plays central role in regulation of melanocyte development and survival. MITF gene is amplified in a proportion of melanomas and ectopic MITF expression can transform melanocytes so MITF can function as melanoma “lineage survival” oncogene. Different studies have further revealed MITF’s important but complex role in tumorigenesis and progression of melanoma. As expected from its important role in melanocytes and melanoma MITF is intricately regulated on all the levels from transcription to post-translational modifications. Although complex mechanisms of MITF functioning are still being revealed, MITF already has a valuable role in managing melanoma patients. Immunohistochemical analysis of MITF has shown both diagnostic and prognostic value in patients with melanoma. MITF is also a valuable specific marker for detection of circulating melanoma cells by reverse-transcription – polymerase chain reaction. MITF has recently been investigated as a potential target for melanoma therapy.
Nieuwenhuizen, Niels J.; Chen, Xiuyin; Wang, Mindy Y.; Matich, Adam J.; Perez, Ramon Lopez; Allan, Andrew C.; Green, Sol A.; Atkinson, Ross G.
2015-01-01
Two kiwifruit (Actinidia) species with contrasting terpene profiles were compared to understand the regulation of fruit monoterpene production. High rates of terpinolene production in ripe Actinidia arguta fruit were correlated with increasing gene and protein expression of A. arguta terpene synthase1 (AaTPS1) and correlated with an increase in transcript levels of the 2-C-methyl-d-erythritol 4-phosphate pathway enzyme 1-deoxy-d-xylulose-5-phosphate synthase (DXS). Actinidia chinensis terpene synthase1 (AcTPS1) was identified as part of an array of eight tandemly duplicated genes, and AcTPS1 expression and terpene production were observed only at low levels in developing fruit. Transient overexpression of DXS in Nicotiana benthamiana leaves elevated monoterpene synthesis by AaTPS1 more than 100-fold, indicating that DXS is likely to be the key step in regulating 2-C-methyl-d-erythritol 4-phosphate substrate flux in kiwifruit. Comparative promoter analysis identified potential NAC (for no apical meristem [NAM], Arabidopsis transcription activation factor [ATAF], and cup-shaped cotyledon [CUC])-domain transcription factor) and ETHYLENE-INSENSITIVE3-like transcription factor (TF) binding sites in the AaTPS1 promoter, and cloned members of both TF classes were able to activate the AaTPS1 promoter in transient assays. Electrophoretic mobility shift assays showed that AaNAC2, AaNAC3, and AaNAC4 bind a 28-bp fragment of the proximal NAC binding site in the AaTPS1 promoter but not the A. chinensis AcTPS1 promoter, where the NAC binding site was mutated. Activation could be restored by reintroducing multiple repeats of the 12-bp NAC core-binding motif. The absence of NAC transcriptional activation in ripe A. chinensis fruit can account for the low accumulation of AcTPS1 transcript, protein, and monoterpene volatiles in this species. These results indicate the importance of NAC TFs in controlling monoterpene production and other traits in ripening fruits. PMID:25649633
Inter- and intra-combinatorial regulation by transcription factors and microRNAs
Directory of Open Access Journals (Sweden)
Chang Joseph T
2007-10-01
Full Text Available Abstract Background MicroRNAs (miRNAs are a novel class of non-coding small RNAs. In mammalian cells, miRNAs repress the translation of messenger RNAs (mRNAs or degrade mRNAs. miRNAs play important roles in development and differentiation, and they are also implicated in aging, and oncogenesis. Predictions of targets of miRNAs suggest that they may regulate more than one-third of all genes. The overall functions of mammalian miRNAs remain unclear. Combinatorial regulation by transcription factors alone or miRNAs alone offers a wide range of regulatory programs. However, joining transcriptional and post-transcriptional regulatory mechanisms enables higher complexity regulatory programs that in turn could give cells evolutionary advantages. Investigating coordinated regulation of genes by miRNAs and transcription factors (TFs from a statistical standpoint is a first step that may elucidate some of their roles in various biological processes. Results Here, we studied the nature and scope of coordination among regulators from the transcriptional and miRNA regulatory layers in the human genome. Our findings are based on genome wide statistical assessment of regulatory associations ("interactions" among the sets of predicted targets of miRNAs and sets of putative targets of transcription factors. We found that combinatorial regulation by transcription factor pairs and miRNA pairs is much more abundant than the combinatorial regulation by TF-miRNA pairs. In addition, many of the strongly interacting TF-miRNA pairs involve a subset of master TF regulators that co-regulate genes in coordination with almost any miRNA. Application of standard measures for evaluating the degree of interaction between pairs of regulators show that strongly interacting TF-miRNA, TF-TF or miRNA-miRNA pairs tend to include TFs or miRNAs that regulate very large numbers of genes. To correct for this potential bias we introduced an additional Bayesian measure that incorporates
Directory of Open Access Journals (Sweden)
Yuguang Song
Full Text Available Epigenetic modification contributes to the regulation of gene expression and plant development under salinity stress. Here we describe the identification of 49 soybean transcription factors by microarray analysis as being inducible by salinity stress. A semi-quantitative RT-PCR-based expression assay confirmed the salinity stress inducibility of 45 of these 49 transcription factors, and showed that ten of them were up-regulated when seedlings were exposed to the demethylation agent 5-aza-2-deoxycytidine. Salinity stress was shown to affect the methylation status of four of these ten transcription factors (one MYB, one b-ZIP and two AP2/DREB family members using a combination of bisulfite sequencing and DNA methylation-sensitive DNA gel blot analysis. ChIP analysis indicated that the activation of three of the four DNA methylated transcription factors was correlated with an increased level of histone H3K4 trimethylation and H3K9 acetylation, and/or a reduced level of H3K9 demethylation in various parts of the promoter or coding regions. Our results suggest a critical role for some transcription factors' activation/repression by DNA methylation and/or histone modifications in soybean tolerance to salinity stress.
International Nuclear Information System (INIS)
Murugan, R
2010-01-01
In this paper, we develop a theory on the mechanism of distal action of the transcription factors, which are bound at their respective cis-regulatory enhancer modules on the promoter-RNA polymerase II (PR) complexes to initiate the transcription event in eukaryotes. We consider both the looping and tracking modes of their distal communication and calculate the mean first passage time that is required for the distal interactions of the complex of enhancer and transcription factor with the PR via both these modes. We further investigate how this mean first passage time is dependent on the length of the DNA segment (L, base-pairs) that connects the cis-regulatory binding site and the respective promoter. When the radius of curvature of this connecting segment of DNA is R that was induced upon binding of the transcription factor at the cis-acting element and RNAPII at the promoter in cis-positions, our calculations indicate that the looping mode of distal action will dominate when L is such that L > 2πR and the tracking mode of distal action will be favored when L 2 bps. It seems that the free energy associated with the binding of the transcription factor with its cis-acting element and the distance of this cis-acting element from the corresponding promoter of the gene of interest is negatively correlated. Our results suggest that the looping and tracking modes of distal action are concurrently operating on the transcription activation and the physics that determines the timescales associated with the looping/tracking in the mechanism of action of these transcription factors on the initiation of the transcription event must put a selection pressure on the distribution of the distances of cis-regulatory modules from their respective promoters of the genes. The computational analysis of the upstream sequences of promoters of various genes in the human and mouse genomes for the presence of putative cis-regulatory elements for a set of known transcription factors using
Collu-Marchese, Melania; Shuen, Michael; Pauly, Marion; Saleem, Ayesha; Hood, David A
2015-05-19
The ATP demand required for muscle development is accommodated by elevations in mitochondrial biogenesis, through the co-ordinated activities of the nuclear and mitochondrial genomes. The most important transcriptional activator of the mitochondrial genome is mitochondrial transcription factor A (Tfam); however, the regulation of Tfam expression during muscle differentiation is not known. Thus, we measured Tfam mRNA levels, mRNA stability, protein expression and localization and Tfam transcription during the progression of muscle differentiation. Parallel 2-fold increases in Tfam protein and mRNA were observed, corresponding with 2-3-fold increases in mitochondrial content. Transcriptional activity of a 2051 bp promoter increased during this differentiation period and this was accompanied by a 3-fold greater Tfam mRNA stabilization. Interestingly, truncations of the promoter at 1706 bp, 978 bp and 393 bp promoter all exhibited 2-3-fold higher transcriptional activity than the 2051 bp construct, indicating the presence of negative regulatory elements within the distal 350 bp of the promoter. Activation of AMP kinase augmented Tfam transcription within the proximal promoter, suggesting the presence of binding sites for transcription factors that are responsive to cellular energy state. During differentiation, the accumulating Tfam protein was progressively distributed to the mitochondrial matrix where it augmented the expression of mtDNA and COX (cytochrome c oxidase) subunit I, an mtDNA gene product. Our data suggest that, during muscle differentiation, Tfam protein levels are regulated by the availability of Tfam mRNA, which is controlled by both transcription and mRNA stability. Changes in energy state and Tfam localization also affect Tfam expression and action in differentiating myotubes. © 2015 Authors.
Izhar, Lior; Adamson, Britt; Ciccia, Alberto; Lewis, Jedd; Pontano-Vaites, Laura; Leng, Yumei; Liang, Anthony C; Westbrook, Thomas F; Harper, J Wade; Elledge, Stephen J
2015-06-09
Localization to sites of DNA damage is a hallmark of DNA damage response (DDR) proteins. To identify DDR factors, we screened epitope-tagged proteins for localization to sites of chromatin damaged by UV laser microirradiation and found >120 proteins that localize to damaged chromatin. These include the BAF tumor suppressor complex and the amyotrophic lateral sclerosis (ALS) candidate protein TAF15. TAF15 contains multiple domains that bind damaged chromatin in a poly-(ADP-ribose) polymerase (PARP)-dependent manner, suggesting a possible role as glue that tethers multiple PAR chains together. Many positives were transcription factors; > 70% of randomly tested transcription factors localized to sites of DNA damage, and of these, ∼90% were PARP dependent for localization. Mutational analyses showed that localization to damaged chromatin is DNA-binding-domain dependent. By examining Hoechst staining patterns at damage sites, we see evidence of chromatin decompaction that is PARP dependent. We propose that PARP-regulated chromatin remodeling at sites of damage allows transient accessibility of DNA-binding proteins. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Lior Izhar
2015-06-01
Full Text Available Localization to sites of DNA damage is a hallmark of DNA damage response (DDR proteins. To identify DDR factors, we screened epitope-tagged proteins for localization to sites of chromatin damaged by UV laser microirradiation and found >120 proteins that localize to damaged chromatin. These include the BAF tumor suppressor complex and the amyotrophic lateral sclerosis (ALS candidate protein TAF15. TAF15 contains multiple domains that bind damaged chromatin in a poly-(ADP-ribose polymerase (PARP-dependent manner, suggesting a possible role as glue that tethers multiple PAR chains together. Many positives were transcription factors; > 70% of randomly tested transcription factors localized to sites of DNA damage, and of these, ∼90% were PARP dependent for localization. Mutational analyses showed that localization to damaged chromatin is DNA-binding-domain dependent. By examining Hoechst staining patterns at damage sites, we see evidence of chromatin decompaction that is PARP dependent. We propose that PARP-regulated chromatin remodeling at sites of damage allows transient accessibility of DNA-binding proteins.
Azmi, Peter; Seth, Arun
2005-11-01
Our laboratory has found that the 154aa RING finger protein 11 (RNF11), has modular domains and motifs including a RING-H2 finger domain, a PY motif, an ubiquitin interacting motif (UIM), a 14-3-3 binding sequence and an AKT phosphorylation site. RNF11 represents a unique protein with no other known immediate family members yet described. Comparative genetic analysis has shown that RNF11 is highly conserved throughout evolution. This may indicate a conserved and non-redundant role for the RNF11 protein. Molecular binding assays using RNF11 have shown that RNF11 has important roles in growth factor signalling, ubiquitination and transcriptional regulation. RNF11 has been shown to interact with HECT-type E3 ubiquitin ligases Nedd4, AIP4, Smurf1 and Smurf2, as well as with Cullin1, the core protein in the multi-subunit SCF E3 ubiquitin ligase complex. Work done in our laboratory has shown that RNF11 is capable of antagonizing Smurf2-mediated inhibition of TGFbeta signalling. Furthermore, RNF11 is capable of degrading AMSH, a positive regulator of both TGFbeta and EGFR signalling pathways. Recently, we have found that RNF11 can directly enhance TGFbeta signalling through a direct association with Smad4, the common signal transducer and transcription factor in the TGFbeta, BMP, and Activin pathways. Through its association with Smad4 and other transcription factors, RNF11 may have a role in direct transcriptional regulation. Our laboratory and others have found nearly 80 protein interactions for RNF11, placing RNF11 at the cross-roads of cell signalling and transcriptional regulation. RNF11 is highly expressed in breast tumours. Deregulation of RNF11 function may prove to be harmful to patient therapeutic outcomes. RNF11 may therefore provide a novel target for cancer therapeutics. The purpose of this review is to discuss the role of RNF11 in cell signalling and transcription factor modulation with special attention given to the ubiquitin-proteasomal pathway, TGFbeta
Simplified Method for Predicting a Functional Class of Proteins in Transcription Factor Complexes
Piatek, Marek J.
2013-07-12
Background:Initiation of transcription is essential for most of the cellular responses to environmental conditions and for cell and tissue specificity. This process is regulated through numerous proteins, their ligands and mutual interactions, as well as interactions with DNA. The key such regulatory proteins are transcription factors (TFs) and transcription co-factors (TcoFs). TcoFs are important since they modulate the transcription initiation process through interaction with TFs. In eukaryotes, transcription requires that TFs form different protein complexes with various nuclear proteins. To better understand transcription regulation, it is important to know the functional class of proteins interacting with TFs during transcription initiation. Such information is not fully available, since not all proteins that act as TFs or TcoFs are yet annotated as such, due to generally partial functional annotation of proteins. In this study we have developed a method to predict, using only sequence composition of the interacting proteins, the functional class of human TF binding partners to be (i) TF, (ii) TcoF, or (iii) other nuclear protein. This allows for complementing the annotation of the currently known pool of nuclear proteins. Since only the knowledge of protein sequences is required in addition to protein interaction, the method should be easily applicable to many species.Results:Based on experimentally validated interactions between human TFs with different TFs, TcoFs and other nuclear proteins, our two classification systems (implemented as a web-based application) achieve high accuracies in distinguishing TFs and TcoFs from other nuclear proteins, and TFs from TcoFs respectively.Conclusion:As demonstrated, given the fact that two proteins are capable of forming direct physical interactions and using only information about their sequence composition, we have developed a completely new method for predicting a functional class of TF interacting protein partners
Capsella rubella TGA4, a bZIP transcription factor, causes delayed flowering in Arabidopsis thaliana
Directory of Open Access Journals (Sweden)
Li Maofu
2016-01-01
Full Text Available Flowering time is usually regulated by many environmental factors and endogenous signals. TGA family members are bZIP transcription factors that bind to the octopine synthase element, which has been closely linked to defense/stress responses. Most TGA factors interact with non-expressor of PR1 (NPR1 and plant defense responses are strengthened by this interaction. TGA1and TGA4factors bind to NPR1 only in salicylic acid (SA-induced leaves, suggesting that TGA4 has another function during plant development. Here, we isolated a bZIP transcription factor gene, TGA4, from Capsella rubella. TGA4transcripts were detected in most tissues, with high expression in leaves, low expression in stems and flowering buds, and undetectable in siliques. CruTGA4was over expressed in Arabidopsis thaliana wild typeCol-0 plants. Flowering time and total leaf number in the transgenic plants showed that overexpression of CruTGA4could delay flowering in A. thaliana. Our findings suggest that TGA4 may act as flowering regulator that controls plant flowering.
Park, Mira; Kim, Hye-Ryun; Kim, Yeon Sun; Yang, Seung Chel; Yoon, Jung Ah; Lyu, Sang Woo; Lim, Hyunjung Jade; Hong, Seok-Ho; Song, Haengseok
2018-07-15
Early growth response 1 (Egr1) is a key transcription factor that mediates the action of estrogen (E 2 ) to establish uterine receptivity for embryo implantation. However, few direct target genes of EGR1 have been identified in the uterus. Here, we demonstrated that E 2 induced EGR1-regulated transcription of c-Kit, which plays a crucial role in cell fate decisions. Spatiotemporal expression of c-Kit followed that of EGR1 in uteri of ovariectomized mice at various time points after E 2 treatment. E 2 activated ERK1/2 and p38 to induce EGR1, which then activated c-Kit expression in the uterus. EGR1 transfection produced rapid and transient induction of c-KIT in a time- and dose-dependent manner. Furthermore, luciferase assays to measure c-Kit promoter activity confirmed that a functional EGR1 binding site(s) (EBS) was located within -1 kb of the c-Kit promoter. Site-directed mutagenesis and chromatin immunoprecipitation-PCR for three putative EBS within -1 kb demonstrated that the EBS at -818/-805 was critical for EGR1-dependent c-Kit transcription. c-Kit expression was significantly increased in the uterus on day 4 and administration of Masitinib, a c-Kit inhibitor, effectively interfered with embryo implantation. Collectively, our results showed that estrogen induces transcription factor EGR1 to regulate c-Kit transcription for uterine receptivity for embryo implantation in the mouse uterus. Copyright © 2017 Elsevier B.V. All rights reserved.
Ye, Yusen; Gao, Lin; Zhang, Shihua
2017-01-01
Transcription factors play a key role in transcriptional regulation of genes and determination of cellular identity through combinatorial interactions. However, current studies about combinatorial regulation is deficient due to lack of experimental data in the same cellular environment and extensive existence of data noise. Here, we adopt a Bayesian CANDECOMP/PARAFAC (CP) factorization approach (BCPF) to integrate multiple datasets in a network paradigm for determining precise TF interaction landscapes. In our first application, we apply BCPF to integrate three networks built based on diverse datasets of multiple cell lines from ENCODE respectively to predict a global and precise TF interaction network. This network gives 38 novel TF interactions with distinct biological functions. In our second application, we apply BCPF to seven types of cell type TF regulatory networks and predict seven cell lineage TF interaction networks, respectively. By further exploring the dynamics and modularity of them, we find cell lineage-specific hub TFs participate in cell type or lineage-specific regulation by interacting with non-specific TFs. Furthermore, we illustrate the biological function of hub TFs by taking those of cancer lineage and blood lineage as examples. Taken together, our integrative analysis can reveal more precise and extensive description about human TF combinatorial interactions. PMID:29033978
Brun, R P; Ryan, K; Sollner-Webb, B
1994-01-01
Factor C* is the component of the RNA polymerase I holoenzyme (factor C) that allows specific transcriptional initiation on a factor D (SL1)- and UBF-activated rRNA gene promoter. The in vitro transcriptional capacity of a preincubated rDNA promoter complex becomes exhausted very rapidly upon initiation of transcription. This is due to the rapid depletion of C* activity. In contrast, C* activity is not unstable in the absence of transcription, even in the presence of nucleoside triphosphates ...
Molecular Cloning and Characterization of PnbHLH1 Transcription Factor in Panax notoginseng
Directory of Open Access Journals (Sweden)
Xiang Zhang
2017-07-01
Full Text Available Panax notoginseng has been extensively used as a traditional Chinese medicine. In the current study, molecular cloning and characterization of PnbHLH1 transcription factor were explored in Panax notoginseng. The full length of the PnbHLH1 gene obtained by splicing was 1430 bp, encoding 321 amino acids. Prokaryotic expression vector pET-28a-PnbHLH1 was constructed and transferred into the BL21 prokaryotic expression strain. An electrophoretic mobility shift assay of PnbHLH1 protein binding to E-box cis-acting elements verified that PnbHLH1 belonged to the bHLH class transcription factor which could interact with the promoter region of the E-box core sequence. The expression levels of key genes involved in the biosynthesis of triterpenoid saponins in PnbHLH1 transgenic cells were higher than those in the wild cells. Similarly, the total saponin contents were increased in the PnbHLH1 transgenic cell lines compared with the wild cell lines. Such results suggest that the PnbHLH1 transcription factor is a positive regulator in the biosynthesis of triterpenoid saponins in Panax notoginseng.
NAC transcription factor JUNGBRUNNEN1 enhances drought tolerance in tomato
Thirumalaikumar, Venkatesh P.
2017-06-22
Water deficit (drought stress) massively restricts plant growth and the yield of crops; reducing the deleterious effects of drought is therefore of high agricultural relevance. Drought triggers diverse cellular processes including the inhibition of photosynthesis, the accumulation of cell-damaging reactive oxygen species, and gene expression reprogramming, besides others. Transcription factors (TF) are central regulators of transcriptional reprogramming and expression of many TF genes is affected by drought, including members of the NAC family. Here, we identify the NAC factor JUNGBRUNNEN1 (JUB1) as a regulator of drought tolerance in tomato (Solanum lycopersicum). Expression of tomato JUB1 (SlJUB1) is enhanced by various abiotic stresses, including drought. Inhibiting SlJUB1 by virus-induced gene silencing drastically lowers drought tolerance concomitant with an increase in ion leakage, an elevation of hydrogen peroxide (H2 O2 ) levels, and a decrease of the expression of various drought-responsive genes. In contrast, overexpression of AtJUB1 from Arabidopsis thaliana increases drought tolerance in tomato, alongside with a higher relative leaf water content during drought and reduced H2 O2 levels. AtJUB1 was previously shown to stimulate expression of DREB2A, a TF involved in drought responses, and of the DELLA genes GAI and RGL1. We show here that SlJUB1 similarly controls the expression of the tomato orthologs SlDREB1, SlDREB2, and SlDELLA. Furthermore, AtJUB1 directly binds to the promoters of SlDREB1, SlDREB2 and SlDELLA in tomato. Our study highlights JUB1 as a transcriptional regulator of drought tolerance and suggests considerable conservation of the abiotic stress-related gene regulatory networks controlled by this NAC factor between Arabidopsis and tomato. This article is protected by copyright. All rights reserved.
WRKY Transcription Factors: Key Components in Abscisic Acid Signaling
2011-01-01
networks that take inputs from numerous stimuli and that they are involved in mediating responses to numerous phytohormones including salicylic acid ... jasmonic acid , ABA and GA. These roles in multiple signalling pathways may in turn partly explain the pleiotropic effects commonly seen when TF genes are...Review article WRKY transcription factors: key components in abscisic acid signalling Deena L. Rushton1, Prateek Tripathi1, Roel C. Rabara1, Jun Lin1
Phosphorylation of basic helix-loop-helix transcription factor Twist in development and disease.
Xue, Gongda; Hemmings, Brian A
2012-02-01
The transcription factor Twist plays vital roles during embryonic development through regulating/controlling cell migration. However, postnatally, in normal physiological settings, Twist is either not expressed or inactivated. Increasing evidence shows a strong correlation between Twist reactivation and both cancer progression and malignancy, where the transcriptional activities of Twist support cancer cells to disseminate from primary tumours and subsequently establish a secondary tumour growth in distant organs. However, it is largely unclear how this signalling programme is reactivated or what signalling pathways regulate its activity. The present review discusses recent advances in Twist regulation and activity, with a focus on phosphorylation-dependent Twist activity, potential upstream kinases and the contribution of these factors in transducing biological signals from upstream signalling complexes. The recent advances in these areas have shed new light on how phosphorylation-dependent regulation of the Twist proteins promotes or suppresses Twist activity, leading to differential regulation of Twist transcriptional targets and thereby influencing cell fate.
Motohashi, Hozumi; O'Connor, Tania; Katsuoka, Fumiki; Engel, James Douglas; Yamamoto, Masayuki
2002-07-10
Recent progress in the analysis of transcriptional regulation has revealed the presence of an exquisite functional network comprising the Maf and Cap 'n' collar (CNC) families of regulatory proteins, many of which have been isolated. Among Maf factors, large Maf proteins are important in the regulation of embryonic development and cell differentiation, whereas small Maf proteins serve as obligatory heterodimeric partner molecules for members of the CNC family. Both Maf homodimers and CNC-small Maf heterodimers bind to the Maf recognition element (MARE). Since the MARE contains a consensus TRE sequence recognized by AP-1, Jun and Fos family members may act to compete or interfere with the function of CNC-small Maf heterodimers. Overall then, the quantitative balance of transcription factors interacting with the MARE determines its transcriptional activity. Many putative MARE-dependent target genes such as those induced by antioxidants and oxidative stress are under concerted regulation by the CNC family member Nrf2, as clearly proven by mouse germline mutagenesis. Since these genes represent a vital aspect of the cellular defense mechanism against oxidative stress, Nrf2-null mutant mice are highly sensitive to xenobiotic and oxidative insults. Deciphering the molecular basis of the regulatory network composed of Maf and CNC families of transcription factors will undoubtedly lead to a new paradigm for the cooperative function of transcription factors.
Regulation of the human ADAMTS-4 promoter by transcription factors and cytokines
International Nuclear Information System (INIS)
Thirunavukkarasu, Kannan; Pei, Yong; Moore, Terry L.; Wang, He; Yu, Xiao-peng; Geiser, Andrew G.; Chandrasekhar, Srinivasan
2006-01-01
ADAMTS-4 (aggrecanase-1) is a metalloprotease that plays a role in aggrecan degradation in the cartilage extracellular matrix. In order to understand the regulation of ADAMTS-4 gene expression we have cloned and characterized a functional 4.5 kb human ADAMTS-4 promoter. Sequence analysis of the promoter revealed the presence of putative binding sites for nuclear factor of activated T cells (NFAT) and Runx family of transcription factors that are known to regulate chondrocyte maturation and differentiation. Using promoter-reporter assays and mRNA analysis we have analyzed the role of chondrocyte-expressed transcription factors NFATp and Runx2 and have shown that ADAMTS-4 is a potential downstream target of these two factors. Our results suggest that inhibition of the expression/function of NFATp and/or Runx2 may enable us to modulate aggrecan degradation in normal physiology and/or in degenerative joint diseases. The ADAMTS-4 promoter would serve as a valuable mechanistic tool to better understand the regulation of ADAMTS-4 expression by signaling pathways that modulate cartilage matrix breakdown
Guantes, Raúl; Benedetti, Ilaria; Silva-Rocha, Rafael; de Lorenzo, Víctor
2016-05-01
Transcriptional noise is a necessary consequence of the molecular events that drive gene expression in prokaryotes. However, some environmental microorganisms that inhabit polluted sites, for example, the m-xylene degrading soil bacterium Pseudomonas putida mt-2 seem to have co-opted evolutionarily such a noise for deploying a metabolic diversification strategy that allows a cautious exploration of new chemical landscapes. We have examined this phenomenon under the light of deterministic and stochastic models for activation of the main promoter of the master m-xylene responsive promoter of the system (Pu) by its cognate transcriptional factor (XylR). These analyses consider the role of co-factors for Pu activation and determinants of xylR mRNA translation. The model traces the onset and eventual disappearance of the bimodal distribution of Pu activity along time to the growth-phase dependent abundance of XylR itself, that is, very low in exponentially growing cells and high in stationary. This tenet was validated by examining the behaviour of a Pu-GFP fusion in a P. putida strain in which xylR expression was engineered under the control of an IPTG-inducible system. This work shows how a relatively simple regulatory scenario (for example, growth-phase dependent expression of a limiting transcription factor) originates a regime of phenotypic diversity likely to be advantageous in competitive environmental settings.
pH Modulates the Binding of EGR1 Transcription Factor to DNA
Mikles, David C.; Bhat, Vikas; Schuchardt, Brett J.; Deegan, Brian J.; Seldeen, Kenneth L.; McDonald, Caleb B.; Farooq, Amjad
2013-01-01
EGR1 transcription factor orchestrates a plethora of signaling cascades involved in cellular homeostasis and its down-regulation has been implicated in the development of prostate cancer. Herein, using a battery of biophysical tools, we show that the binding of EGR1 to DNA is tightly regulated by solution pH. Importantly, the binding affinity undergoes an enhancement of more than an order of magnitude with increasing pH from 5 to 8, implying that the deprotonation of an ionizable residue accounts for such behavior. This ionizable residue is identified as H382 by virtue of the fact that its substitution to non-ionizable residues abolishes pH-dependence of the binding of EGR1 to DNA. Notably, H382 inserts into the major groove of DNA and stabilizes the EGR1-DNA interaction via both hydrogen bonding and van der Waals contacts. Remarkably, H382 is predominantly conserved across other members of EGR1 family, implying that histidine protonation-deprotonation may serve as a molecular switch for modulating protein-DNA interactions central to this family of transcription factors. Collectively, our findings uncover an unexpected but a key step in the molecular recognition of EGR1 family of transcription factors and suggest that they may act as sensors of pH within the intracellular environment. PMID:23718776
LENUS (Irish Health Repository)
Keld, R
2011-06-28
Background: Transcription factors often play important roles in tumourigenesis. Members of the PEA3 subfamily of ETS-domain transcription factors fulfil such a role and have been associated with tumour metastasis in several different cancers. Moreover, the activity of the PEA3 subfamily transcription factors is potentiated by Ras-ERK pathway signalling, which is itself often deregulated in tumour cells.\\r\
Mutations and binding sites of human transcription factors
Kamanu, Frederick Kinyua
2012-06-01
Mutations in any genome may lead to phenotype characteristics that determine ability of an individual to cope with adaptation to environmental challenges. In studies of human biology, among the most interesting ones are phenotype characteristics that determine responses to drug treatments, response to infections, or predisposition to specific inherited diseases. Most of the research in this field has been focused on the studies of mutation effects on the final gene products, peptides, and their alterations. Considerably less attention was given to the mutations that may affect regulatory mechanism(s) of gene expression, although these may also affect the phenotype characteristics. In this study we make a pilot analysis of mutations observed in the regulatory regions of 24,667 human RefSeq genes. Our study reveals that out of eight studied mutation types, insertions are the only one that in a statistically significant manner alters predicted transcription factor binding sites (TFBSs). We also find that 25 families of TFBSs have been altered by mutations in a statistically significant manner in the promoter regions we considered. Moreover, we find that the related transcription factors are, for example, prominent in processes related to intracellular signaling; cell fate; morphogenesis of organs and epithelium; development of urogenital system, epithelium, and tube; neuron fate commitment. Our study highlights the significance of studying mutations within the genes regulatory regions and opens way for further detailed investigations on this topic, particularly on the downstream affected pathways. 2012 Kamanu, Medvedeva, Schaefer, Jankovic, Archer and Bajic.
Modeling the 3-DOF dynamics of an electrodynamic Maglev suspension system with a passive sled
Boeij, de J.; Gutierrez, H.M.; Agarwal, R.; Steinbuch, M.
2003-01-01
A model that describes the 3-DOF dynamics of a passively levitated electro-dynamic maglevsystem is presented. The model is based on the flux-current-force interactions and the geometricrelationships between the levitation coils and the permanent magnets on the sled. The model ispresented in a
Auerbach, Raymond K; Chen, Bin; Butte, Atul J
2013-08-01
Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.
MiT/TFE transcription factors are activated during mitophagy downstream of Parkin and Atg5.
Nezich, Catherine L; Wang, Chunxin; Fogel, Adam I; Youle, Richard J
2015-08-03
The kinase PINK1 and ubiquitin ligase Parkin can regulate the selective elimination of damaged mitochondria through autophagy (mitophagy). Because of the demand on lysosomal function by mitophagy, we investigated a role for the transcription factor EB (TFEB), a master regulator of lysosomal biogenesis, in this process. We show that during mitophagy TFEB translocates to the nucleus and displays transcriptional activity in a PINK1- and Parkin-dependent manner. MITF and TFE3, homologues of TFEB belonging to the same microphthalmia/transcription factor E (MiT/TFE) family, are similarly regulated during mitophagy. Unlike TFEB translocation after starvation-induced mammalian target of rapamycin complex 1 inhibition, Parkin-mediated TFEB relocalization required Atg9A and Atg5 activity. However, constitutively active Rag guanosine triphosphatases prevented TFEB translocation during mitophagy, suggesting cross talk between these two MiT/TFE activation pathways. Analysis of clustered regularly interspaced short palindromic repeats-generated TFEB/MITF/TFE3/TFEC single, double, and triple knockout cell lines revealed that these proteins partly facilitate Parkin-mediated mitochondrial clearance. These results illuminate a pathway leading to MiT/TFE transcription factor activation, distinct from starvation-induced autophagy, which occurs during mitophagy.
Kinematic modelling of a five-DOFs spatial manipulator used in robot-assisted surgery
Directory of Open Access Journals (Sweden)
Shakti Singh
2016-09-01
Full Text Available Since last three decades, research in the field of robot kinematics is boosted-up among different researchers worldwide. This is mainly due to their increased use in various challenging fields of engineering and science. One such challenging application is the use of master–slave concept in a robot-assisted surgery. The authors have already performed the kinematic study and gravity balancing of seven degrees-of-freedom (DOFs surgeon-side manipulator (Singh et al., 2015a, 2015b. To meet these challenging demands, the most important aspect of a robotic manipulator is to develop an accurate kinematic model. In this direction, different researchers in the literature have made significant contributions. Out of these, the most prominent one is D–H parameters method, which was proposed by Denavit and Hartenberg in 1955. In the present work, this method is applied to a five-DOFs spatial manipulator, named as patient-side manipulator, which tracks the motion of surgeon-side manipulator during a robot-assisted surgery. The prototype considered in this work is a spatial serial manipulator, being developed at CSIR-CSIO Chandigarh. Experimental validations are performed and results are found to be in close agreement.
Heat shock transcription factors regulate heat induced cell death in a ...
Indian Academy of Sciences (India)
2007-03-29
Mar 29, 2007 ... Heat shock transcription factors regulate heat induced cell death in a rat ... the synthesis of heat shock proteins (Hsps) which is strictly regulated by ... The lack of Hsp synthesis in these cells was due to a failure in HSF1 DNA ...
DEFF Research Database (Denmark)
Poulsen, Lars; Andersen, Mikael Rørdam; Lantz, Anna Eliasson
2012-01-01
exhibiting an oxalate overproducing phenotype were identified. The yield of oxalate was increased up to 158% compared to the wild type and the corresponding transcription factor was therefore entitled Oxalic Acid repression Factor, OafA. Detailed physiological characterization of one of the ΔoafA mutants......, compared to the wild type, showed that both strains produced substantial amounts of gluconic acid, but the mutant strain was more efficient in re-uptake of gluconic acid and converting it to oxalic acid, particularly at high pH (pH 5.0). Transcriptional profiles showed that 241 genes were differentially......Acid formation in Aspergillus niger is known to be subjected to tight regulation, and the acid production profiles are fine-tuned to respond to the ambient pH. Based on transcriptome data, putative trans-acting pH responding transcription factors were listed and through knock out studies, mutants...
Rípodas, Carolina; Clúa, Joaquín; Battaglia, Marina; Baudin, Maël; Niebel, Andreas; Zanetti, María Eugenia; Blanco, Flavio
2014-01-01
Transcription factors are DNA binding proteins that regulate gene expression. The nitrogen fixing symbiosis established between legume plants and soil bacteria is a complex interaction, in which plants need to integrate signals derived from the symbiont and the surrounding environment to initiate the developmental program of nodule organogenesis and the infection process. Several transcription factors that play critical roles in these processes have been reported in the past decade, including proteins of the GRAS and NF-Y families. Recently, we reported the characterization of a new GRAS domain containing-protein that interacts with a member of the C subunit of the NF-Y family, which plays an important role in nodule development and the progression of bacterial infection during the symbiotic interaction. The connection between transcription factors of these families highlights the significance of multimeric complexes in the fabulous capacity of plants to integrate and respond to multiple environmental stimuli.
A new FACS approach isolates hESC derived endoderm using transcription factors.
Directory of Open Access Journals (Sweden)
Yuqiong Pan
2011-03-01
Full Text Available We show that high quality microarray gene expression profiles can be obtained following FACS sorting of cells using combinations of transcription factors. We use this transcription factor FACS (tfFACS methodology to perform a genomic analysis of hESC-derived endodermal lineages marked by combinations of SOX17, GATA4, and CXCR4, and find that triple positive cells have a much stronger definitive endoderm signature than other combinations of these markers. Additionally, SOX17(+ GATA4(+ cells can be obtained at a much earlier stage of differentiation, prior to expression of CXCR4(+ cells, providing an important new tool to isolate this earlier definitive endoderm subtype. Overall, tfFACS represents an advancement in FACS technology which broadly crosses multiple disciplines, most notably in regenerative medicine to redefine cellular populations.
Expression of the Transcription Factor E4BP4 in Human Basophils
DEFF Research Database (Denmark)
Jensen, Bettina Margrethe; Gohr, Maria; Poulsen, Lars Kærgaard
2014-01-01
Rationale The cytokine IL-3 plays an important role for human basophil development, function and survival. IL-3 is also reported to induce the expression of the transcription factor E4BP4, but it is not known whether E4BP4 is expressed in basophils and influences basophil responsiveness. The aim...... by Alcian blue. RNA was extracted (0.005-0.02 µg RNA from 0.5 - 1 x 106 cells), and the corresponding cDNA analyzed by real-time PCR where E4BP4 expression was calculated as 2-(CT(E4BP4) - CT(β-actin)). E4BP4 protein expression was visualized in basophil lysates (107 cells/ml) by Western blot followed...... the transcription factor E4BP4 which might have an impact on basophil histamine release....
Low nucleosome occupancy is encoded around functional human transcription factor binding sites
Directory of Open Access Journals (Sweden)
Daenen Floris
2008-07-01
Full Text Available Abstract Background Transcriptional regulation of genes in eukaryotes is achieved by the interactions of multiple transcription factors with arrays of transcription factor binding sites (TFBSs on DNA and with each other. Identification of these TFBSs is an essential step in our understanding of gene regulatory networks, but computational prediction of TFBSs with either consensus or commonly used stochastic models such as Position-Specific Scoring Matrices (PSSMs results in an unacceptably high number of hits consisting of a few true functional binding sites and numerous false non-functional binding sites. This is due to the inability of the models to incorporate higher order properties of sequences including sequences surrounding TFBSs and influencing the positioning of nucleosomes and/or the interactions that might occur between transcription factors. Results Significant improvement can be expected through the development of a new framework for the modeling and prediction of TFBSs that considers explicitly these higher order sequence properties. It would be particularly interesting to include in the new modeling framework the information present in the nucleosome positioning sequences (NPSs surrounding TFBSs, as it can be hypothesized that genomes use this information to encode the formation of stable nucleosomes over non-functional sites, while functional sites have a more open chromatin configuration. In this report we evaluate the usefulness of the latter feature by comparing the nucleosome occupancy probabilities around experimentally verified human TFBSs with the nucleosome occupancy probabilities around false positive TFBSs and in random sequences. Conclusion We present evidence that nucleosome occupancy is remarkably lower around true functional human TFBSs as compared to non-functional human TFBSs, which supports the use of this feature to improve current TFBS prediction approaches in higher eukaryotes.
Regulation of TCF ETS-domain transcription factors by helix-loop-helix motifs.
Stinson, Julie; Inoue, Toshiaki; Yates, Paula; Clancy, Anne; Norton, John D; Sharrocks, Andrew D
2003-08-15
DNA binding by the ternary complex factor (TCF) subfamily of ETS-domain transcription factors is tightly regulated by intramolecular and intermolecular interactions. The helix-loop-helix (HLH)-containing Id proteins are trans-acting negative regulators of DNA binding by the TCFs. In the TCF, SAP-2/Net/ERP, intramolecular inhibition of DNA binding is promoted by the cis-acting NID region that also contains an HLH-like motif. The NID also acts as a transcriptional repression domain. Here, we have studied the role of HLH motifs in regulating DNA binding and transcription by the TCF protein SAP-1 and how Cdk-mediated phosphorylation affects the inhibitory activity of the Id proteins towards the TCFs. We demonstrate that the NID region of SAP-1 is an autoinhibitory motif that acts to inhibit DNA binding and also functions as a transcription repression domain. This region can be functionally replaced by fusion of Id proteins to SAP-1, whereby the Id moiety then acts to repress DNA binding in cis. Phosphorylation of the Ids by cyclin-Cdk complexes results in reduction in protein-protein interactions between the Ids and TCFs and relief of their DNA-binding inhibitory activity. In revealing distinct mechanisms through which HLH motifs modulate the activity of TCFs, our results therefore provide further insight into the role of HLH motifs in regulating TCF function and how the inhibitory properties of the trans-acting Id HLH proteins are themselves regulated by phosphorylation.
Energy Technology Data Exchange (ETDEWEB)
Murugan, R, E-mail: rmurugan@gmail.co [Department of Biotechnology, Indian Institute of Technology Madras, Chennai 600036 (India)
2010-10-15
In this paper, we develop a theory on the mechanism of distal action of the transcription factors, which are bound at their respective cis-regulatory enhancer modules on the promoter-RNA polymerase II (PR) complexes to initiate the transcription event in eukaryotes. We consider both the looping and tracking modes of their distal communication and calculate the mean first passage time that is required for the distal interactions of the complex of enhancer and transcription factor with the PR via both these modes. We further investigate how this mean first passage time is dependent on the length of the DNA segment (L, base-pairs) that connects the cis-regulatory binding site and the respective promoter. When the radius of curvature of this connecting segment of DNA is R that was induced upon binding of the transcription factor at the cis-acting element and RNAPII at the promoter in cis-positions, our calculations indicate that the looping mode of distal action will dominate when L is such that L > 2{pi}R and the tracking mode of distal action will be favored when L < 2{pi}R. The time required for the distal action will be minimum when L = 2{pi}R where the typical value of R for the binding of histones will be R {approx} 16 bps and L {approx} 10{sup 2} bps. It seems that the free energy associated with the binding of the transcription factor with its cis-acting element and the distance of this cis-acting element from the corresponding promoter of the gene of interest is negatively correlated. Our results suggest that the looping and tracking modes of distal action are concurrently operating on the transcription activation and the physics that determines the timescales associated with the looping/tracking in the mechanism of action of these transcription factors on the initiation of the transcription event must put a selection pressure on the distribution of the distances of cis-regulatory modules from their respective promoters of the genes. The computational analysis
International Nuclear Information System (INIS)
Zhang, Yingyi; Zhao, Yu; Li, Leilei; Shen, Yu; Cai, Xiaoli; Zhang, Xiaodong; Ye, Lihong
2013-01-01
Highlights: •HBXIP is able to upregulate the expression of PDGFB in breast cancer cells. •HBXIP serves as a coactivator of activating transcription factor Sp1. •HBXIP stimulates the PDGFB promoter via activating transcription factor Sp1. •HBXIP promotes the proliferation of breast cancer cell via upregulating PDGFB. -- Abstract: We have reported that the oncoprotein hepatitis B virus X-interacting protein (HBXIP) acts as a novel transcriptional coactivator to promote proliferation and migration of breast cancer cells. Previously, we showed that HBXIP was able to activate nuclear factor-κB (NF-κB) in breast cancer cells. As an oncogene, the platelet-derived growth factor beta polypeptide (PDGFB) plays crucial roles in carcinogenesis. In the present study, we found that both HBXIP and PDGFB were highly expressed in breast cancer cell lines. Interestingly, HBXIP was able to increase transcriptional activity of NF-κB through PDGFB, suggesting that HBXIP is associated with PDGFB in the cells. Moreover, HBXIP was able to upregulate PDGFB at the levels of mRNA, protein and promoter in the cells. Then, we identified that HBXIP stimulated the promoter of PDGFB through activating transcription factor Sp1. In function, HBXIP enhanced the proliferation of breast cancer cells through PDGFB in vitro. Thus, we conclude that HBXIP upregulates PDGFB via activating transcription factor Sp1 to promote proliferation of breast cancer cells
Energy Technology Data Exchange (ETDEWEB)
Zhang, Yingyi; Zhao, Yu; Li, Leilei; Shen, Yu; Cai, Xiaoli [Department of Biochemistry, College of Life Sciences, Nankai University, Tianjin 300071 (China); Zhang, Xiaodong, E-mail: zhangxd@nankai.edu.cn [Department of Cancer Research, Institute for Molecular Biology, College of Life Sciences, Nankai University, Tianjin 300071 (China); Ye, Lihong, E-mail: yelihong@nankai.edu.cn [Department of Biochemistry, College of Life Sciences, Nankai University, Tianjin 300071 (China)
2013-05-03
Highlights: •HBXIP is able to upregulate the expression of PDGFB in breast cancer cells. •HBXIP serves as a coactivator of activating transcription factor Sp1. •HBXIP stimulates the PDGFB promoter via activating transcription factor Sp1. •HBXIP promotes the proliferation of breast cancer cell via upregulating PDGFB. -- Abstract: We have reported that the oncoprotein hepatitis B virus X-interacting protein (HBXIP) acts as a novel transcriptional coactivator to promote proliferation and migration of breast cancer cells. Previously, we showed that HBXIP was able to activate nuclear factor-κB (NF-κB) in breast cancer cells. As an oncogene, the platelet-derived growth factor beta polypeptide (PDGFB) plays crucial roles in carcinogenesis. In the present study, we found that both HBXIP and PDGFB were highly expressed in breast cancer cell lines. Interestingly, HBXIP was able to increase transcriptional activity of NF-κB through PDGFB, suggesting that HBXIP is associated with PDGFB in the cells. Moreover, HBXIP was able to upregulate PDGFB at the levels of mRNA, protein and promoter in the cells. Then, we identified that HBXIP stimulated the promoter of PDGFB through activating transcription factor Sp1. In function, HBXIP enhanced the proliferation of breast cancer cells through PDGFB in vitro. Thus, we conclude that HBXIP upregulates PDGFB via activating transcription factor Sp1 to promote proliferation of breast cancer cells.
International Nuclear Information System (INIS)
Garfinkel, S.; Thompson, J.A.; Cohen, R.B.; Brendler, T.; Safer, B.
1987-01-01
Affinity adsorption, precipitation, and partitioning techniques have been developed to purify and characterize RNA Pol II transcription components from whole cell extracts (WCE) (HeLa) and nuclear extracts (K562). The titration of these extracts with multicopy constructs of the Ad2 MLP but not pUC8, inhibits transcriptional activity. DNA-binding factors precipitated by this technique are greatly enriched by centrifugation. Using this approach, factors binding to the upstream promoter sequence (UPS) of the Ad2 MLP have been rapidly isolated by Mono Q, Mono S, and DNA affinity chromatography. By U.V. crosslinking to nucleotides containing specific 32 P-phosphodiester bonds within the recognition sequence, this factor is identified as a M/sub r/ = 45,000 polypeptide. To generate an assay system for the functional evaluation of single transcription components, a similar approach using synthetic oligonucleotide sequences spanning single promoter binding sites has been developed. The addition of a synthetic 63-mer containing the UPS element of the Ad2 MLP to HeLa WCE inhibited transcription by 60%. The addition of partially purified UPS binding protein, but not RNA Pol II, restored transcriptional activity. The addition of synthetic oligonucleotides containing other regulatory sequences not present in the Ad2 MLP was without effect
Directory of Open Access Journals (Sweden)
Izumi Kaneko
2015-05-01
Full Text Available Stage-specific transcription is a fundamental biological process in the life cycle of the Plasmodium parasite. Proteins containing the AP2 DNA-binding domain are responsible for stage-specific transcriptional regulation and belong to the only known family of transcription factors in Plasmodium parasites. Comprehensive identification of their target genes will advance our understanding of the molecular basis of stage-specific transcriptional regulation and stage-specific parasite development. AP2-O is an AP2 family transcription factor that is expressed in the mosquito midgut-invading stage, called the ookinete, and is essential for normal morphogenesis of this stage. In this study, we identified the genome-wide target genes of AP2-O by chromatin immunoprecipitation-sequencing and elucidate how this AP2 family transcription factor contributes to the formation of this motile stage. The analysis revealed that AP2-O binds specifically to the upstream genomic regions of more than 500 genes, suggesting that approximately 10% of the parasite genome is directly regulated by AP2-O. These genes are involved in distinct biological processes such as morphogenesis, locomotion, midgut penetration, protection against mosquito immunity and preparation for subsequent oocyst development. This direct and global regulation by AP2-O provides a model for gene regulation in Plasmodium parasites and may explain how these parasites manage to control their complex life cycle using a small number of sequence-specific AP2 transcription factors.
Hurst, H C; Masson, N; Jones, N C; Lee, K A
1990-12-01
Promoter elements containing the sequence motif CGTCA are important for a variety of inducible responses at the transcriptional level. Multiple cellular factors specifically bind to these elements and are encoded by a multigene family. Among these factors, polypeptides termed activating transcription factor 43 (ATF-43) and ATF-47 have been purified from HeLa cells and a factor referred to as cyclic AMP response element-binding protein (CREB) has been isolated from PC12 cells and rat brain. We demonstrated that CREB and ATF-47 are identical and that CREB and ATF-43 form protein-protein complexes. We also found that the cis requirements for stable DNA binding by ATF-43 and CREB are different. Using antibodies to ATF-43 we have identified a group of polypeptides (ATF-43) in the size range from 40 to 43 kDa. ATF-43 polypeptides are related by their reactivity with anti-ATF-43, DNA-binding specificity, complex formation with CREB, heat stability, and phosphorylation by protein kinase A. Certain cell types vary in their ATF-43 complement, suggesting that CREB activity is modulated in a cell-type-specific manner through interaction with ATF-43. ATF-43 polypeptides do not appear simply to correspond to the gene products of the ATF multigene family, suggesting that the size of the ATF family at the protein level is even larger than predicted from cDNA-cloning studies.
Directory of Open Access Journals (Sweden)
Lars Poulsen
Full Text Available Acid formation in Aspergillus niger is known to be subjected to tight regulation, and the acid production profiles are fine-tuned to respond to the ambient pH. Based on transcriptome data, putative trans-acting pH responding transcription factors were listed and through knock out studies, mutants exhibiting an oxalate overproducing phenotype were identified. The yield of oxalate was increased up to 158% compared to the wild type and the corresponding transcription factor was therefore entitled Oxalic Acid repression Factor, OafA. Detailed physiological characterization of one of the ΔoafA mutants, compared to the wild type, showed that both strains produced substantial amounts of gluconic acid, but the mutant strain was more efficient in re-uptake of gluconic acid and converting it to oxalic acid, particularly at high pH (pH 5.0. Transcriptional profiles showed that 241 genes were differentially expressed due to the deletion of oafA and this supported the argument of OafA being a trans-acting transcription factor. Furthermore, expression of two phosphoketolases was down-regulated in the ΔoafA mutant, one of which has not previously been described in fungi. It was argued that the observed oxalate overproducing phenotype was a consequence of the efficient re-uptake of gluconic acid and thereby a higher flux through glycolysis. This results in a lower flux through the pentose phosphate pathway, demonstrated by the down-regulation of the phosphoketolases. Finally, the physiological data, in terms of the specific oxygen consumption, indicated a connection between the oxidative phosphorylation and oxalate production and this was further substantiated through transcription analysis.
Directory of Open Access Journals (Sweden)
Aalt D J van Dijk
Full Text Available Protein sequences encompass tertiary structures and contain information about specific molecular interactions, which in turn determine biological functions of proteins. Knowledge about how protein sequences define interaction specificity is largely missing, in particular for paralogous protein families with high sequence similarity, such as the plant MADS domain transcription factor family. In comparison to the situation in mammalian species, this important family of transcription regulators has expanded enormously in plant species and contains over 100 members in the model plant species Arabidopsis thaliana. Here, we provide insight into the mechanisms that determine protein-protein interaction specificity for the Arabidopsis MADS domain transcription factor family, using an integrated computational and experimental approach. Plant MADS proteins have highly similar amino acid sequences, but their dimerization patterns vary substantially. Our computational analysis uncovered small sequence regions that explain observed differences in dimerization patterns with reasonable accuracy. Furthermore, we show the usefulness of the method for prediction of MADS domain transcription factor interaction networks in other plant species. Introduction of mutations in the predicted interaction motifs demonstrated that single amino acid mutations can have a large effect and lead to loss or gain of specific interactions. In addition, various performed bioinformatics analyses shed light on the way evolution has shaped MADS domain transcription factor interaction specificity. Identified protein-protein interaction motifs appeared to be strongly conserved among orthologs, indicating their evolutionary importance. We also provide evidence that mutations in these motifs can be a source for sub- or neo-functionalization. The analyses presented here take us a step forward in understanding protein-protein interactions and the interplay between protein sequences and
Krivoruchko, Anastasia; Storey, Kenneth B
2013-11-01
The forkhead class O (FoxO) transcription factors are important regulators of multiple aspects of cellular metabolism. We hypothesized that activation of these transcription factors could play crucial roles in low oxygen survival in the anoxia-tolerant turtle, Trachemys scripta elegans. Two FoxOs, FoxO1 and FoxO3, were examined in turtle tissues in response to 5 and 20h of anoxic submergence using techniques of RT-PCR, western immunoblotting and DNA-binding assays to assess activation. Transcript levels of FoxO-responsive genes were also quantified using RT-PCR. FoxO1 was anoxia-responsive in the liver, with increases in transcript levels, protein levels, nuclear levels and DNA-binding of 1.7-4.8fold in response to anoxia. Levels of phosphorylated FoxO1 also decreased to 57% of control values in response to 5h of anoxia, indicating activation. FoxO3 was activated in the heart, kidney and liver in response to anoxia, with nuclear levels increasing by 1.5-3.7fold and DNA-binding activity increasing by 1.3-2.9fold. Transcript levels of two FoxO-target genes, p27kip1 and catalase, also rose by 2.4-2.5fold in the turtle liver under anoxia. The results suggest that the FoxO transcription factors are activated in response to anoxia in T. scripta elegans, potentially contributing to the regulation of stress resistance and metabolic depression. This study provides the first demonstration of activation of FoxOs in a natural model for vertebrate anoxia tolerance, further improving understanding of how tissues can survive without oxygen. © 2013.
New Jacobian Matrix and Equations of Motion for a 6 d.o.f Cable-Driven Robot
Directory of Open Access Journals (Sweden)
Ali Afshari
2007-03-01
Full Text Available In this paper, we introduce a new method and new motion variables to study kinematics and dynamics of a 6 d.o.f cable-driven robot. Using these new variables and Lagrange equations, we achieve new equations of motion which are different in appearance and several aspects from conventional equations usually used to study 6 d.o.f cable robots. Then, we introduce a new Jacobian matrix which expresses kinematical relations of the robot via a new approach and is basically different from the conventional Jacobian matrix. One of the important characteristics of the new method is computational efficiency in comparison with the conventional method. It is demonstrated that using the new method instead of the conventional one, significantly reduces the computation time required to determine workspace of the robot as well as the time required to solve the equations of motion.
Clifford, Jacob; Adami, Christoph
2015-09-02
Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.
Forkhead-box transcription factors and their role in the immune system
Coffer, PJ; Burgering, BMT
2004-01-01
It is more than a decade since the discovery of the first forkhead-box (FOX) transcription factor in the fruit fly Drosophila melanogaster. In the intervening time, there has been an explosion in the identification and characterization of members of this family of proteins. Importantly, in the past
Directory of Open Access Journals (Sweden)
Jawad eMerhej
2016-05-01
Full Text Available The yeast Candida glabrata has become the second cause of systemic candidemia in humans. However, relatively few genome-wide studies have been conducted in this organism and our knowledge of its transcriptional regulatory network is quite limited. In the present work, we combined genome-wide chromatin immunoprecipitation (ChIP-seq, transcriptome analyses and DNA binding motif predictions to describe the regulatory interactions of the seven Yap (Yeast AP1 transcription factors of C. glabrata. We described a transcriptional network containing 255 regulatory interactions and 309 potential target genes. We predicted with high confidence the preferred DNA binding sites for 5 of the 7 CgYaps and showed a strong conservation of the Yap DNA binding properties between S. cerevisiae and C. glabrata. We provided reliable functional annotation for 3 of the 7 Yaps and identified for Yap1 and Yap5 a core regulon which is conserved in S. cerevisiae, C. glabrata and C. albicans. We uncovered new roles for CgYap7 in the regulation of iron-sulfur cluster biogenesis, for CgYap1 in the regulation of heme biosynthesis and for CgYap5 in the repression of GRX4 in response to iron starvation. These transcription factors define an interconnected transcriptional network at the cross-roads between redox homeostasis, oxygen consumption and iron metabolism.
Directory of Open Access Journals (Sweden)
Claus eSchwechheimer
2015-02-01
Full Text Available GATA transcription factors are evolutionarily conserved transcriptional regulators that recognize promoter elements with a G-A-T-A core sequence. In comparison to animal genomes, the GATA transcription factor family in plants is comparatively large with approximately 30 members. In spite of a long-standing interest of plant molecular biologists in GATA factors, only research conducted in the last years has led to reliable insights into their functions during plant development. Here, we review the current knowledge on B-GATAs, one of four GATA factor subfamilies from Arabidopsis thaliana. We show that B-GATAs can be subdivided based on structural features and their biological function into family members with a C-terminal LLM- (leucine-leucine-methionine domain or an N-terminal HAN- (HANABA TARANU domain. The paralogous GNC (GATA, NITRATE-INDUCIBLE, CARBON-METABOLISM INVOLVED and CGA1/GNL (CYTOKININ-INDUCED GATA1/GNC-LIKE are introduced as LLM-domain containing B-GATAs from Arabidopsis that control germination, greening, senescence and flowering time downstream from several growth regulatory signals including light and the hormones gibberellin, auxin, and cytokinin. Arabidopsis HAN and its monocot-specific paralogs from rice (NECK LEAF1, maize (TASSEL SHEATH1, and barley (THIRD OUTER GLUME are HAN-domain-containing B-GATAs with a predominant role in embryo development and floral development. We also review GATA23, a regulator of lateral root initiation from Arabidopsis, that is closely related to GNC and GNL but has a degenerate LLM-domain that is seemingly specific for the Brassicaceae family. The Brassicaceae-specific GATA23 together with the above-mentioned monocot-specific HAN-domain GATAs provide evidence that neofunctionalization of the B-GATAs was used during plant evolution to expand the functional repertoire of these transcription factors.
DEFF Research Database (Denmark)
Cano, A; Pérez-Moreno, M A; Rodrigo, I
2000-01-01
The Snail family of transcription factors has previously been implicated in the differentiation of epithelial cells into mesenchymal cells (epithelial-mesenchymal transitions) during embryonic development. Epithelial-mesenchymal transitions are also determinants of the progression of carcinomas......, occurring concomitantly with the cellular acquisition of migratory properties following downregulation of expression of the adhesion protein E-cadherin. Here we show that mouse Snail is a strong repressor of transcription of the E-cadherin gene. Epithelial cells that ectopically express Snail adopt...
CONREAL web server: identification and visualization of conserved transcription factor binding sites
Berezikov, E.; Guryev, V.; Cuppen, E.
2005-01-01
The use of orthologous sequences and phylogenetic footprinting approaches have become popular for the recognition of conserved and potentially functional sequences. Several algorithms have been developed for the identification of conserved transcription factor binding sites (TFBSs), which are
Lei, Qin; Lee, EunKyoung; Keerthisinghe, Sandra; Lai, Lien; Li, Meng; Lucas, Jessica R; Wen, Xiaohong; Ren, Xiaolin; Sack, Fred D
2015-09-01
The FOUR LIPS (FLP) and MYB88 transcription factors, which are closely related in structure and function, control the development of stomata, as well as entry into megasporogenesis in Arabidopsis thaliana. However, other locations where these transcription factors are expressed are poorly described. Documenting additional locations where these genes are expressed might define new functions for these genes. Expression patterns were examined throughout vegetative and reproductive development. The expression from two transcriptional-reporter fusions were visualized with either β-glucuronidase (GUS) or green fluorescence protein (GFP). Both flp and myb88 genes were expressed in many, previously unreported locations, consistent with the possibility of additional functions for FLP and MYB88. Moreover, expression domains especially of FLP display sharp cutoffs or boundaries. In addition to stomatal and reproductive development, FLP and MYB88, which are R2R3 MYB transcription factor genes, are expressed in many locations in cells, tissues, and organs. © 2015 Botanical Society of America.
Modulation of proteostasis by transcription factor NRF2 and impact in neurodegenerative diseases
Directory of Open Access Journals (Sweden)
Marta Pajares
2017-04-01
Full Text Available Neurodegenerative diseases are linked to the accumulation of specific protein aggregates, suggesting an intimate connection between injured brain and loss of proteostasis. Proteostasis refers to all the processes by which cells control the abundance and folding of the proteome thanks to a wide network that integrates the regulation of signaling pathways, gene expression and protein degradation systems. This review attempts to summarize the most relevant findings about the transcriptional modulation of proteostasis exerted by the transcription factor NRF2 (nuclear factor (erythroid-derived 2-like 2. NRF2 has been classically considered as the master regulator of the antioxidant cell response, although it is currently emerging as a key component of the transduction machinery to maintain proteostasis. As we will discuss, NRF2 could be envisioned as a hub that compiles emergency signals derived from misfolded protein accumulation in order to build a coordinated and perdurable transcriptional response. This is achieved by functions of NRF2 related to the control of genes involved in the maintenance of the endoplasmic reticulum physiology, the proteasome and autophagy.
A light- and calcium-gated transcription factor for imaging and manipulating activated neurons.
Wang, Wenjing; Wildes, Craig P; Pattarabanjird, Tanyaporn; Sanchez, Mateo I; Glober, Gordon F; Matthews, Gillian A; Tye, Kay M; Ting, Alice Y
2017-09-01
Activity remodels neurons, altering their molecular, structural, and electrical characteristics. To enable the selective characterization and manipulation of these neurons, we present FLARE, an engineered transcription factor that drives expression of fluorescent proteins, opsins, and other genetically encoded tools only in the subset of neurons that experienced activity during a user-defined time window. FLARE senses the coincidence of elevated cytosolic calcium and externally applied blue light, which together produce translocation of a membrane-anchored transcription factor to the nucleus to drive expression of any transgene. In cultured rat neurons, FLARE gives a light-to-dark signal ratio of 120 and a high- to low-calcium signal ratio of 10 after 10 min of stimulation. Opsin expression permitted functional manipulation of FLARE-marked neurons. In adult mice, FLARE also gave light- and motor-activity-dependent transcription in the cortex. Due to its modular design, minute-scale temporal resolution, and minimal dark-state leak, FLARE should be useful for the study of activity-dependent processes in neurons and other cells that signal with calcium.
Rich, Mélanie K; Courty, Pierre-Emmanuel; Roux, Christophe; Reinhardt, Didier
2017-08-08
Development of arbuscular mycorrhiza (AM) requires a fundamental reprogramming of root cells for symbiosis. This involves the induction of hundreds of genes in the host. A recently identified GRAS-type transcription factor in Petunia hybrida, ATA/RAM1, is required for the induction of host genes during AM, and for morphogenesis of the fungal endosymbiont. To better understand the role of RAM1 in symbiosis, we set out to identify all genes that depend on activation by RAM1 in mycorrhizal roots. We have carried out a transcript profiling experiment by RNAseq of mycorrhizal plants vs. non-mycorrhizal controls in wild type and ram1 mutants. The results show that the expression of early genes required for AM, such as the strigolactone biosynthetic genes and the common symbiosis signalling genes, is independent of RAM1. In contrast, genes that are involved at later stages of symbiosis, for example for nutrient exchange in cortex cells, require RAM1 for induction. RAM1 itself is highly induced in mycorrhizal roots together with many other transcription factors, in particular GRAS proteins. Since RAM1 has previously been shown to be directly activated by the common symbiosis signalling pathway through CYCLOPS, we conclude that it acts as an early transcriptional switch that induces many AM-related genes, among them genes that are essential for the development of arbuscules, such as STR, STR2, RAM2, and PT4, besides hundreds of additional RAM1-dependent genes the role of which in symbiosis remains to be explored. Taken together, these results indicate that the defect in the morphogenesis of the fungal arbuscules in ram1 mutants may be an indirect consequence of functional defects in the host, which interfere with nutrient exchange and possibly other functions on which the fungus depends.
Tea, Joy S.; Chihara, Takahiro; Luo, Liqun
2010-01-01
Compared to the mechanisms of axon guidance, relatively little is known about the transcriptional control of dendrite guidance. The Drosophila olfactory system with its stereotyped organization provides an excellent model to study the transcriptional control of dendrite wiring specificity. Each projection neuron (PN) targets its dendrites to a specific glomerulus in the antennal lobe and its axon stereotypically to higher brain centers. Using a forward genetic screen, we identified a mutation in Rpd3 that disrupts PN targeting specificity. Rpd3 encodes a class I histone deacetylase (HDAC) homologous to mammalian HDAC1 and HDAC2. Rpd3−/− PN dendrites that normally target to a dorsolateral glomerulus mistarget to medial glomeruli in the antennal lobe, and axons exhibit a severe overbranching phenotype. These phenotypes can be rescued by postmitotic expression of Rpd3 but not HDAC3, the only other class I HDAC in Drosophila. Furthermore, disruption of the atypical homeodomain transcription factor Prospero (Pros) yields similar phenotypes, which can be rescued by Pros expression in postmitotic neurons. Strikingly, overexpression of Pros can suppress Rpd3−/− phenotypes. Our study suggests a specific function for the general chromatin remodeling factor Rpd3 in regulating dendrite targeting in neurons, largely through the postmitotic action of the Pros transcription factor. PMID:20660276
GATA transcription factors in testicular adrenal rest tumours
Directory of Open Access Journals (Sweden)
Manon Engels
2017-11-01
Full Text Available Testicular adrenal rest tumours (TARTs are benign adrenal-like testicular tumours that frequently occur in male patients with congenital adrenal hyperplasia. Recently, GATA transcription factors have been linked to the development of TARTs in mice. The aim of our study was to determine GATA expression in human TARTs and other steroidogenic tissues. We determined GATA expression in TARTs (n = 16, Leydig cell tumours (LCTs; n = 7, adrenal (foetal (n = 6 + adult (n = 10 and testis (foetal (n = 13 + adult (n = 8. We found testis-like GATA4, and adrenal-like GATA3 and GATA6 gene expressions by qPCR in human TARTs, indicating mixed testicular and adrenal characteristics of TARTs. Currently, no marker is available to discriminate TARTs from LCTs, leading to misdiagnosis and incorrect treatment. GATA3 and GATA6 mRNAs exhibited excellent discriminative power (area under the curve of 0.908 and 0.816, respectively, while immunohistochemistry did not. GATA genes contain several CREB-binding sites and incubation with 0.1 mM dibutyryl cAMP for 4 h stimulated GATA3, GATA4 and GATA6 expressions in a human foetal testis cell line (hs181.tes. Incubation of adrenocortical cells (H295RA with ACTH, however, did not induce GATA expression in vitro. Although ACTH did not dysregulate GATA expression in the only human ACTH-sensitive in vitro model available, our results do suggest that aberrant expression of GATA transcription factors in human TARTs might be involved in TART formation.
Directory of Open Access Journals (Sweden)
Zoltan-Iosif Korka
2016-12-01
Full Text Available The paper presents an experimental investigation regarding the positioning accuracy and kinematical parameters of the base translation module of a 6-DOF industrial robot. The positioning error of the translation module was computed for two cases: one way movement and reversed movement.
International Nuclear Information System (INIS)
Chen Yao; Zhou Guangjin; Yu Min; He Yungang; Tang Wei; Lai Jianhua; He Jie; Liu Wanguo; Tan Deyong
2005-01-01
Serum plays an important role in the regulation of cell cycle and cell growth. To identify novel serum-inhibitory factors and study their roles in cell cycle regulation, we performed mRNA differential display analysis of U251 cells in the presence or absence of serum and cloned a novel gene encoding the human mitochondrial transcription termination factor-like protein (mTERFL). The full-length mTERFL cDNA has been isolated and the genomic structure determined. The mTERFL gene consists of three exons and encodes 385 amino acids with 52% sequence similarity to the human mitochondrial transcription termination factor (mTERF). However, mTERFL and mTERF have an opposite expression pattern in response to serum. The expression of mTERFL is dramatically inhibited by the addition of serum in serum-starved cells while the mTERF is rather induced. Northern blot analysis detected three mTERFL transcripts of 1.7, 3.2, and 3.5 kb. Besides the 3.2 kb transcript that is unique to skeletal muscle, other two transcripts express predominant in heart, liver, pancreas, and skeletal muscle. Expression of the GFP-mTERFL fusion protein in HeLa cells localized it to the mitochondria. Furthermore, ectopic expression of mTERFL suppresses cell growth and arrests cells in the G1 stage demonstrated by MTT and flow cytometry analysis. Collectively, our data suggest that mTERFL is a novel mTERF family member and a serum-inhibitory factor probably participating in the regulation of cell growth through the modulation of mitochondrial transcription
Regulation of Specialized Metabolism by WRKY Transcription Factors
Schluttenhofer, Craig; Yuan, Ling
2015-01-01
WRKY transcription factors (TFs) are well known for regulating plant abiotic and biotic stress tolerance. However, much less is known about how WRKY TFs affect plant-specialized metabolism. Analysis of WRKY TFs regulating the production of specialized metabolites emphasizes the values of the family outside of traditionally accepted roles in stress tolerance. WRKYs with conserved roles across plant species seem to be essential in regulating specialized metabolism. Overall, the WRKY family plays an essential role in regulating the biosynthesis of important pharmaceutical, aromatherapy, biofuel, and industrial components, warranting considerable attention in the forthcoming years. PMID:25501946
Transcription factors for modification of lignin content in plants
Wang, Huanzhong; Chen, Fang; Dixon, Richard A.
2015-06-02
The invention provides methods for modifying lignin, cellulose, xylan, and hemicellulose content in plants, and for achieving ectopic lignification and, for instance, secondary cell wall synthesis in pith cells, by altered regulation of a WRKY transcription factor. Nucleic acid constructs for altered WRKY-TF expression are described. Transgenic plants are provided that comprise modified pith cell walls, and lignin, cellulose, and hemicellulose content. Plants described herein may be used, for example, as improved biofuel feedstock and as highly digestible forage crops.
Energy Technology Data Exchange (ETDEWEB)
Neff, Michael M.
2011-06-23
This is a final report for Department of Energy Grant No. DE-FG02-08ER15927 entitled “Molecular Genetic Analysis of Activation-Tagged Transcription Factors Thought to be Involved in Photomorphogenesis”. Based on our preliminary photobiological and genetic analysis of the sob1-D mutant, we hypothesized that OBP3 is a transcription factor involved in both phytochrome and cryptochrome-mediated signal transduction. In addition, we hypothesized that OBP3 is involved in auxin signaling and root development. Based on our preliminary photobiological and genetic analysis of the sob2-D mutant, we also hypothesized that a related gene, LEP, is involved in hormone signaling and seedling development.
RNA binding specificity of Ebola virus transcription factor VP30.
Schlereth, Julia; Grünweller, Arnold; Biedenkopf, Nadine; Becker, Stephan; Hartmann, Roland K
2016-09-01
The transcription factor VP30 of the non-segmented RNA negative strand Ebola virus balances viral transcription and replication. Here, we comprehensively studied RNA binding by VP30. Using a novel VP30:RNA electrophoretic mobility shift assay, we tested truncated variants of 2 potential natural RNA substrates of VP30 - the genomic Ebola viral 3'-leader region and its complementary antigenomic counterpart (each ∼155 nt in length) - and a series of other non-viral RNAs. Based on oligonucleotide interference, the major VP30 binding region on the genomic 3'-leader substrate was assigned to the internal expanded single-stranded region (∼ nt 125-80). Best binding to VP30 was obtained with ssRNAs of optimally ∼ 40 nt and mixed base composition; underrepresentation of purines or pyrimidines was tolerated, but homopolymeric sequences impaired binding. A stem-loop structure, particularly at the 3'-end or positioned internally, supports stable binding to VP30. In contrast, dsRNA or RNAs exposing large internal loops flanked by entirely helical arms on both sides are not bound. Introduction of a 5´-Cap(0) structure impaired VP30 binding. Also, ssDNAs bind substantially weaker than isosequential ssRNAs and heparin competes with RNA for binding to VP30, indicating that ribose 2'-hydroxyls and electrostatic contacts of the phosphate groups contribute to the formation of VP30:RNA complexes. Our results indicate a rather relaxed RNA binding specificity of filoviral VP30, which largely differs from that of the functionally related transcription factor of the Paramyxoviridae which binds to ssRNAs as short as 13 nt with a preference for oligo(A) sequences.
The A-myb transcription factor in neoplastic and normal B cells.
Golay, J; Facchinetti, V; Ying, G; Introna, M
1997-07-01
The myb family of transcription factors has been strongly implicated in the regulation of cell growth and differentiation in the haematopoietic system. The v-myb oncogene, carried by avian defective retroviruses, causes leukaemias in the chicken and transforms haematopoietic cells in vitro. Its normal cellular equivalent c-myb, has been shown to promote the proliferation and block the differentiation of haematopoietic cells in several experimental models and is required for fetal haematopoiesis. Two other members of the family have been cloned more recently, A-myb and B-myb, which show sequence homology with c-myb in several domains, of which the DNA binding domain as well as other regulatory domains. Both have been shown to be transcription factors. B-myb is also involved in the control of proliferation and differentiation, but, unlike c-myb, it is expressed in many cell types. The third member of the family, A-myb, shows the most restricted pattern of expression, suggesting a very specific role for this transcription factor. A-myb is expressed in a subpopulation of normal B lymphocytes activated in vivo and localised in the germinal center of peripheral lymphoid organs and is not detected at significant levels in all other mature or immature haematopoietic populations studied, including bone marrow cells, T lymphocytes, granulocytes, monocytes, either at rest or after in vitro activation. These studies indicate that A-myb plays a role during a narrow window of normal B cell differentiation. A-myb expression has also been studied in a wide range of neoplastic B cells, representing the whole spectrum of B cell differentiation. A-myb is strongly expressed in Burkitt's lymphomas (BL) and slg+ B-acute lymphoblastic leukaemias (B-ALL) and not in all other leukaemias/lymphomas tested, with the exception of a subset of CLL (about 25% of cases). It is intriguing that the A-myb genome has been localised relatively close to the c-myc gene on chromosome 8, suggesting that
Improved Inverse Kinematics Algorithm Using Screw Theory for a Six-DOF Robot Manipulator
Directory of Open Access Journals (Sweden)
Qingcheng Chen
2015-10-01
Full Text Available Based on screw theory, a novel improved inverse-kinematics approach for a type of six-DOF serial robot, “Qianjiang I”, is proposed in this paper. The common kinematics model of the robot is based on the Denavit-Hartenberg (D-H notation method while its inverse kinematics has inefficient calculation and complicated solution, which cannot meet the demands of online real-time application. To solve this problem, this paper presents a new method to improve the efficiency of the inverse kinematics solution by introducing the screw theory. Unlike other methods, the proposed method only establishes two coordinates, namely the inertial coordinate and the tool coordinate; the screw motion of each link is carried out based on the inertial coordinate, ensuring definite geometric meaning. Furthermore, we adopt a new inverse kinematics algorithm, developing an improved sub-problem method along with Paden-Kahan sub-problems. This method has high efficiency and can be applied in real-time industrial operation. It is convenient to select the desired solutions directly from among multiple solutions by examining clear geometric meaning. Finally, the effectiveness and reliability performance of the new algorithm are analysed and verified in comparative experiments carried out on the six-DOF serial robot “Qianjiang I”.
Tsukamoto, Jun; Iwai, Daisuke; Kashima, Kenji
2015-11-01
This paper proposes a novel radiometric compensation technique for cooperative projection system based-on distributed optimization. To achieve high scalability and robustness, we assume cooperative projection environments such that 1. each projector does not have information about other projectors as well as target images, 2. the camera does not have information about the projectors either, while having the target images, and 3. only a broadcast communication from the camera to the projectors is allowed to suppress the data transfer bandwidth. To this end, we first investigate a distributed optimization based feedback mechanism that is suitable for the required decentralized information processing environment. Next, we show that this mechanism works well for still image projection, however not necessary for moving images due to the lack of dynamic responsiveness. To overcome this issue, we propose to implement an additional feedforward mechanism. Such a 2 Degree Of Freedom (2-DOF) control structure is well-known in control engineering community as a typical method to enhance not only disturbance rejection but also reference tracking capability, simultaneously. We theoretically guarantee and experimentally demonstrate that this 2-DOF structure yields the moving image projection accuracy that is overwhelming the best achievable performance only by the distributed optimization mechanisms.
Goldie, Belinda J; Fitzsimmons, Chantel; Weidenhofer, Judith; Atkins, Joshua R; Wang, Dan O; Cairns, Murray J
2017-01-01
While the cytoplasmic function of microRNA (miRNA) as post-transcriptional regulators of mRNA has been the subject of significant research effort, their activity in the nucleus is less well characterized. Here we use a human neuronal cell model to show that some mature miRNA are preferentially enriched in the nucleus. These molecules were predominantly primate-specific and contained a sequence motif with homology to the consensus MAZ transcription factor binding element. Precursor miRNA containing this motif were shown to have affinity for MAZ protein in nuclear extract. We then used Ago1/2 RIP-Seq to explore nuclear miRNA-associated mRNA targets. Interestingly, the genes for Ago2-associated transcripts were also significantly enriched with MAZ binding sites and neural function, whereas Ago1-transcripts were associated with general metabolic processes and localized with SC35 spliceosomes. These findings suggest the MAZ transcription factor is associated with miRNA in the nucleus and may influence the regulation of neuronal development through Ago2-associated miRNA induced silencing complexes. The MAZ transcription factor may therefore be important for organizing higher order integration of transcriptional and post-transcriptional processes in primate neurons.
Transcriptional networks controlling adipocyte differentiation
DEFF Research Database (Denmark)
Siersbæk, R; Mandrup, Susanne
2011-01-01
" of the transcription factor networks operating at specific time points during adipogenesis. Using such global "snapshots," we have demonstrated that dramatic remodeling of the chromatin template occurs within the first few hours following adipogenic stimulation and that many of the early transcription factors bind...... in a cooperative fashion to transcription factor hotspots. Such hotspots are likely to represent key chromatin nodes, where many adipogenic signaling pathways converge to drive the adipogenic transcriptional reprogramming....
Czech Academy of Sciences Publication Activity Database
Lake, A.D.; Chaput, A.L.; Novák, Petr; Cherrington, N.J.; Smith, C.L.
2016-01-01
Roč. 122, December 15 (2016), s. 62-71 ISSN 0006-2952 Institutional support: RVO:60077344 Keywords : Transcription factor * Liver * Gene expression * Bioinformatics Subject RIV: CE - Biochemistry Impact factor: 4.581, year: 2016
Nicolas, Pierre; Repoila, Francis; Bardowski, Jacek; Aymerich, Stéphane
2017-01-01
In eukaryotes, RNA species originating from pervasive transcription are regulators of various cellular processes, from the expression of individual genes to the control of cellular development and oncogenesis. In prokaryotes, the function of pervasive transcription and its output on cell physiology is still unknown. Most bacteria possess termination factor Rho, which represses pervasive, mostly antisense, transcription. Here, we investigate the biological significance of Rho-controlled transcription in the Gram-positive model bacterium Bacillus subtilis. Rho inactivation strongly affected gene expression in B. subtilis, as assessed by transcriptome and proteome analysis of a rho–null mutant during exponential growth in rich medium. Subsequent physiological analyses demonstrated that a considerable part of Rho-controlled transcription is connected to balanced regulation of three mutually exclusive differentiation programs: cell motility, biofilm formation, and sporulation. In the absence of Rho, several up-regulated sense and antisense transcripts affect key structural and regulatory elements of these differentiation programs, thereby suppressing motility and biofilm formation and stimulating sporulation. We dissected how Rho is involved in the activity of the cell fate decision-making network, centered on the master regulator Spo0A. We also revealed a novel regulatory mechanism of Spo0A activation through Rho-dependent intragenic transcription termination of the protein kinase kinB gene. Altogether, our findings indicate that distinct Rho-controlled transcripts are functional and constitute a previously unknown built-in module for the control of cell differentiation in B. subtilis. In a broader context, our results highlight the recruitment of the termination factor Rho, for which the conserved biological role is probably to repress pervasive transcription, in highly integrated, bacterium-specific, regulatory networks. PMID:28723971
Chiu, Bill; Melin-Aldana, Hector; Superina, Riccardo A
2007-10-01
A 3-year-old girl developed extrahepatic portal vein obstruction (EHPVO) after a liver transplant. She had sequelae of portal hypertension that required another transplantation. The circumstances allowed for comparison of liver-dependent coagulation factor production between the second donor liver and the explanted liver with EHPVO. Liver samples from the explanted first graft and the second transplant were obtained. Fresh tissue was used to perform reverse transcription-polymerase chain reaction with primers against factors V, VII, as well as VIII, protein C, and paraffin-embedded sections for hepatocyte proliferation using Ki-67 antibody as well as for apoptosis using TUNEL assay. The transcription of factor VII and that of protein C were decreased in the explant as compared with the newly transplanted liver (factor VII, 77% of the donor; protein C, 88% of the donor). The transcription of factor V and that of factor VIII were unchanged. The explant had a greater percentage of proliferating hepatocytes than the new organ (0.85% +/- 0.75% vs 0.11% +/- 0.21%). The percentage of apoptotic cells was similar between the 2 livers (0.09% +/- 0.13% vs 0.09% +/- 0.13%). Idiopathic EHPVO is associated with a reduction in liver-dependent coagulation factor transcription and an increase in hepatocyte proliferation. Portal blood flow deprivation alters hepatic homeostasis and initiates mechanisms that attempt to restore liver-dependent coagulation factors.
Magill, C P; Jackson, S P; Bell, S D
2001-12-14
Archaea possess two general transcription factors that are required to recruit RNA polymerase (RNAP) to promoters in vitro. These are TBP, the TATA-box-binding protein and TFB, the archaeal homologue of TFIIB. Thus, the archaeal and eucaryal transcription machineries are fundamentally related. In both RNAP II and archaeal transcription systems, direct contacts between TFB/TFIIB and the RNAP have been demonstrated to mediate recruitment of the polymerase to the promoter. However the subunit(s) directly contacted by these factors has not been identified. Using systematic yeast two-hybrid and biochemical analyses we have identified an interaction between the N-terminal domain of TFB and an evolutionarily conserved subunit of the RNA polymerase, RpoK. Intriguingly, homologues of RpoK are found in all three nuclear RNA polymerases (Rpb6) and also in the bacterial RNA polymerase (omega-subunit).
A Classification of Basic Helix-Loop-Helix Transcription Factors of Soybean
Directory of Open Access Journals (Sweden)
Karen A. Hudson
2015-01-01
Full Text Available The complete genome sequence of soybean allows an unprecedented opportunity for the discovery of the genes controlling important traits. In particular, the potential functions of regulatory genes are a priority for analysis. The basic helix-loop-helix (bHLH family of transcription factors is known to be involved in controlling a wide range of systems critical for crop adaptation and quality, including photosynthesis, light signalling, pigment biosynthesis, and seed pod development. Using a hidden Markov model search algorithm, 319 genes with basic helix-loop-helix transcription factor domains were identified within the soybean genome sequence. These were classified with respect to their predicted DNA binding potential, intron/exon structure, and the phylogeny of the bHLH domain. Evidence is presented that the vast majority (281 of these 319 soybean bHLH genes are expressed at the mRNA level. Of these soybean bHLH genes, 67% were found to exist in two or more homeologous copies. This dataset provides a framework for future studies on bHLH gene function in soybean. The challenge for future research remains to define functions for the bHLH factors encoded in the soybean genome, which may allow greater flexibility for genetic selection of growth and environmental adaptation in this widely grown crop.
Myocardin-related transcription factors are required for cardiac development and function
Mokalled, Mayssa H.; Carroll, Kelli J.; Cenik, Bercin K.; Chen, Beibei; Liu, Ning; Olson, Eric N.; Bassel-Duby, Rhonda
2016-01-01
Myocardin-Related Transcription Factors A and B (MRTF-A and MRTF-B) are highly homologous proteins that function as powerful coactivators of serum response factor (SRF), a ubiquitously expressed transcription factor essential for cardiac development. The SRF/MRTF complex binds to CArG boxes found in the control regions of genes that regulate cytoskeletal dynamics and muscle contraction, among other processes. While SRF is required for heart development and function, the role of MRTFs in the developing or adult heart has not been explored. Through cardiac-specific deletion of MRTF alleles in mice, we show that either MRTF-A or MRTF-B is dispensable for cardiac development and function, whereas deletion of both MRTF-A and MRTF-B causes a spectrum of structural and functional cardiac abnormalities. Defects observed in MRTF-A/B null mice ranged from reduced cardiac contractility and adult onset heart failure to neonatal lethality accompanied by sarcomere disarray. RNA-seq analysis on neonatal hearts identified the most altered pathways in MRTF double knockout hearts as being involved in cytoskeletal organization. Together, these findings demonstrate redundant but essential roles of the MRTFs in maintenance of cardiac structure and function and as indispensible links in cardiac cytoskeletal gene regulatory networks. PMID:26386146
Wen, Bi-Qing; Xing, Mei-Qing; Zhang, Hua; Dai, Cheng; Xue, Hong-Wei
2011-11-01
Homeobox transcription factors are involved in various aspects of plant development, including maintenance of the biosynthesis and signaling pathways of different hormones. However, few direct targets of homeobox proteins have been identified. We here show that overexpression of rice homeobox gene HOX1a resulted in enhanced gibberellin (GA) response, indicating a positive effect of HOX1a in GA signaling. HOX1a is induced by GA and encodes a homeobox transcription factor with transcription repression activity. In addition, HOX1a suppresses the transcription of early flowering1 (EL1), a negative regulator of GA signaling, and further electrophoretic mobility shift assay and chromatin immunoprecipitation analysis revealed that HOX1a directly bound to the promoter region of EL1 to suppress its expression and stimulate GA signaling. These results demonstrate that HOX1a functions as a positive regulator of GA signaling by suppressing EL1, providing informative hints on the study of GA signaling. © 2011 Institute of Botany, Chinese Academy of Sciences.
A Systematic Approach to Identify Candidate Transcription Factors that Control Cell Identity
Directory of Open Access Journals (Sweden)
Ana C. D’Alessio
2015-11-01
Full Text Available Hundreds of transcription factors (TFs are expressed in each cell type, but cell identity can be induced through the activity of just a small number of core TFs. Systematic identification of these core TFs for a wide variety of cell types is currently lacking and would establish a foundation for understanding the transcriptional control of cell identity in development, disease, and cell-based therapy. Here, we describe a computational approach that generates an atlas of candidate core TFs for a broad spectrum of human cells. The potential impact of the atlas was demonstrated via cellular reprogramming efforts where candidate core TFs proved capable of converting human fibroblasts to retinal pigment epithelial-like cells. These results suggest that candidate core TFs from the atlas will prove a useful starting point for studying transcriptional control of cell identity and reprogramming in many human cell types.
Czech Academy of Sciences Publication Activity Database
Kuchárová-Mahmood, S.; Raška, Ivan; Mechler, B. M.; Farkaš, R.
2002-01-01
Roč. 140, - (2002), s. 67-78 ISSN 1047-8477 R&D Projects: GA ČR GA304/02/0342 Grant - others:GA-(SK) VEGA:2/7194/20 Institutional research plan: CEZ:AV0Z5039906; CEZ:MSM 111100003 Keywords : programmed cell death * BR-C transcription factors * drosophila Subject RIV: EA - Cell Biology Impact factor: 4.194, year: 2002
Chen, Huei-Mei; Rosebrock, Adam P.; Khan, Sohail R.; Futcher, Bruce; Leatherwood, Janet K.
2012-01-01
In S. pombe, about 5% of genes are meiosis-specific and accumulate little or no mRNA during vegetative growth. Here we use Affymetrix tiling arrays to characterize transcripts in vegetative and meiotic cells. In vegetative cells, many meiotic genes, especially those induced in mid-meiosis, have abundant antisense transcripts. Disruption of the antisense transcription of three of these mid-meiotic genes allowed vegetative sense transcription. These results suggest that antisense transcription ...
Fujita, Toshitsugu; Piuz, Isabelle; Schlegel, Werner
2010-05-05
Transcription elongation of many eukaryotic genes is regulated. Two negative transcription elongation factors, 5,6-dichloro-1-beta-D-ribofuranosylbenzimidazole (DRB) sensitivity-inducing factor (DSIF) and negative elongation factor (NELF) are known to stall collaboratively RNA polymerase II promoter proximally. We discovered that DSIF and NELF are linked to hormone expression in rat pituitary GH4C1 cells. When NELF-E, a subunit of NELF or Spt5, a subunit of DSIF was stably knocked-down, prolactin (PRL) expression was increased both at the mRNA and protein levels. In contrast, stable knock-down of only Spt5 abolished growth hormone (GH) expression. Transient NELF-E knock-down increased coincidentally PRL expression and enhanced transcription of a PRL-promoter reporter gene. However, no direct interaction of NELF with the PRL gene could be demonstrated by chromatin immuno-precipitation. Thus, NELF suppressed PRL promoter activity indirectly. In conclusion, transcription regulation by NELF and DSIF is continuously involved in the control of hormone production and may contribute to neuroendocrine cell differentiation. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.
Athanasios lliopoulos; John G. Michopoulos; John G. C. Hermanson
2012-01-01
This paper describes a data reduction methodology for eliminating the systematic aberrations introduced by the unwanted behavior of a multiaxial testing machine, into the massive amounts of experimental data collected from testing of composite material coupons. The machine in reference is a custom made 6-DoF system called NRL66.3 and developed at the NAval...
Evolutionary history of Arecaccea tribe Cocoseae inferred from seven WRKY transcription factors
The Cocoseae is one of 13 tribes of Arecaceae subfam. Arecoideae, and contains a number of palms with significant economic importance, including the monotypic and pantropical Cocos nucifera, the coconut, and African oil palm (Elaeis guineensis). Using seven single copy WRKY transcription factor gen...
Czimmerer, Zsolt; Daniel, Bence; Horvath, Attila; Rückerl, Dominik; Nagy, Gergely; Kiss, Mate; Peloquin, Matthew; Budai, Marietta M.; Cuaranta-Monroy, Ixchelt; Simandi, Zoltan; Steiner, Laszlo; Nagy, Bela; Poliska, Szilard; Banko, Csaba; Bacso, Zsolt
2018-01-01
Summary The molecular basis of signal-dependent transcriptional activation has been extensively studied in macrophage polarization, but our understanding remains limited regarding the molecular determinants of repression. Here we show that IL-4-activated STAT6 transcription factor is required for the direct transcriptional repression of a large number of genes during in vitro and in vivo alternative macrophage polarization. Repression results in decreased lineage-determining transcription fac...
Geometric technique for the kinematic modeling of a 5 DOF redundant manipulator
CSIR Research Space (South Africa)
Makondo, N
2012-11-01
Full Text Available ,? Dipartimento di Elettronica, Informatica e Sistemistica (DEIS), Universit a di Bologna [Online]; Available at: http://www- lar.deis.unibo.it/people/cmelchiorri/Files Robotica/FIR 04 Kinem.pdf[31 October 2012] [18] Manocha, D.; Canny, J.F.; , ?Efficient... to the inverse kinematics of the Pioneer 2 robotic arm ?, Robotica, 2005, vol.23, pp.123, DOI: 10.1017/S0263574704000529 [20] De Xu, Carlos A. Acosta Calderon, John Q. Gan etc .An Analysis of the Inverse Kinematics for a 5-DOF Manipulator, International...
Cross activity of orthologous WRKY transcription factors in wheat and Arabidopsis
Poietti, S.; Bertini, L.; Ent, S. van der; Leon Reyes, H.A.; Pieterse, C.M.J.; Tucci, M.; Caporale, C.; Caruso, C.
2011-01-01
WRKY proteins are transcription factors involved in many plant processes including plant responses to pathogens. Here, the cross activity of TaWRKY78 from the monocot wheat and AtWRKY20 from the dicot Arabidopsis on the cognate promoters of the orthologous PR4-type genes wPR4e and AtHEL of wheat and
The hematopoietic transcription factor PU.1 regulates RANK gene expression in myeloid progenitors
International Nuclear Information System (INIS)
Kwon, Oh Hyung; Lee, Chong-Kil; Lee, Young Ik; Paik, Sang-Gi; Lee, Hyun-Jun
2005-01-01
Osteoclasts are bone resorbing cells of hematopoietic origin. The hematopoietic transcription factor PU.1 is critical for osteoclastogenesis; however, the molecular mechanisms of PU.1-regulated osteoclastogenesis have not been explored. Here, we present evidence that the receptor activator of nuclear factor κB (RANK) gene that has been shown to be crucial for osteoclastogenesis is a transcriptional target of PU.1. The PU.1 -/- progenitor cells failed to express the RANK gene and reconstitution of PU.1 in these cells induced RANK expression. Treatment of the PU.1 reconstituted cells with M-CSF and RANKL further augmented the RANK gene expression. To explore the regulatory mechanism of the RANK gene expression by PU.1, we have cloned the human RANK promoter. Transient transfection assays have revealed that the 2.2-kb RANK promoter was functional in a monocyte line RAW264.7, whereas co-transfection of PU.1 transactivated the RANK promoter in HeLa cells. Taken together, these results suggest that PU.1 regulates the RANK gene transcription and this may represent one of the key roles of PU.1 in osteoclast differentiation
ZNF143 protein is an important regulator of the myeloid transcription factor C/EBP
Czech Academy of Sciences Publication Activity Database
Gonzalez, D.; Luyten, A.; Bartholdy, B.; Zhou, Q.; Kardošová, Miroslava; Ebralidze, A.; Swanson, K.D.; Radomska, H.S.; Zhang, P.; Kobayashi, S.S.; Welner, R.S.; Levantini, E.; Steidl, U.; Chong, G.; Collombet, S.; Choi, M.H.; Friedman, A.D.; Scott, L.M.; Alberich-Jorda, Meritxell; Tenen, D.G.
2017-01-01
Roč. 292, č. 46 (2017), s. 18924-18936 ISSN 0021-9258 Institutional support: RVO:68378050 Keywords : CCAAT-enhancer-binding protein * gene regulation * hematopoiesis * promoter * transcription factor * EBPalpha * ZNF143 Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Cell biology Impact factor: 4.125, year: 2016
Pituitary transcription factors in the aetiology of combined pituitary hormone deficiency.
Pfäffle, R; Klammt, J
2011-02-01
The somatotropic axis is the central postnatal regulator of longitudinal growth. One of its major components--growth hormone--is produced by the anterior lobe of the pituitary, which also expresses and secretes five additional hormones (prolactin, thyroid stimulating hormone, follicle stimulating hormone, luteinizing hormone, adrenocorticotropic hormone). Proper development of the pituitary assures the regulation of critical processes such as metabolic control, puberty and reproduction, stress response and lactation. Ontogeny of the adenohypophysis is orchestrated by inputs from neighbouring tissues, cellular signalling molecules and transcription factors. Perturbation of expression or function of these factors has been implicated in the aetiology of combined pituitary hormone deficiency (CPHD). Mutations within the genes encoding for the transcription factors LHX3, LHX4, PROP1, and POU1F1 (PIT1) that act at different stages of pituitary development result in unique patterns of hormonal deficiencies reflecting their differential expression during organogenesis. In the case of LHX3 and LHX4 the phenotype may include extra-pituitary manifestations due to the function of these genes/proteins outside the pituitary gland. The remarkable variability in the clinical presentation of affected patients indicates the influence of the genetic background, environmental factors and possibly stochastic events. However, in the majority of CPHD cases the aetiology of this heterogeneous disease remains unexplained, which further suggests the involvement of additional genes. Identification of these factors might also help to close the gaps in our understanding of pituitary development, maintenance and function. Copyright © 2010 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
O. M. Raspopova
2017-01-01
Full Text Available The role of transcription factors in the pathogenesis of pituitary adenomas is extremely controversial.The aim of the study was to investigate the role of the transcription factor Neuro D1 in various types of pituitary adenomas.Materials and methods. A comparative clinico-morphological study was carried out with immunohistochemical analysis and confocal microscopy of the expression of the transcription factor NeuroD1, six adenohypophysis hormones and Ki-67 in 40 pituitary adenomas and 9 normal pituitary glands.Results. NeuroD1 was expressed in all cases and types of adenomas. The expression level of the transcription factor in adenomas was significantly different from that in the normal pituitary gland (p = 0.006. The average number of cells with expression of NeuroD1 in all tumors was higher than in the normal pituitary gland.Conclusion. NeuroD1 plays one of the key roles in the pathogenesis of pituitary adenomas, regardless of their hormonal status.
Directory of Open Access Journals (Sweden)
Tony Håndstad
Full Text Available BACKGROUND: Transcription factors are important controllers of gene expression and mapping transcription factor binding sites (TFBS is key to inferring transcription factor regulatory networks. Several methods for predicting TFBS exist, but there are no standard genome-wide datasets on which to assess the performance of these prediction methods. Also, it is believed that information about sequence conservation across different genomes can generally improve accuracy of motif-based predictors, but it is not clear under what circumstances use of conservation is most beneficial. RESULTS: Here we use published ChIP-seq data and an improved peak detection method to create comprehensive benchmark datasets for prediction methods which use known descriptors or binding motifs to detect TFBS in genomic sequences. We use this benchmark to assess the performance of five different prediction methods and find that the methods that use information about sequence conservation generally perform better than simpler motif-scanning methods. The difference is greater on high-affinity peaks and when using short and information-poor motifs. However, if the motifs are specific and information-rich, we find that simple motif-scanning methods can perform better than conservation-based methods. CONCLUSIONS: Our benchmark provides a comprehensive test that can be used to rank the relative performance of transcription factor binding site prediction methods. Moreover, our results show that, contrary to previous reports, sequence conservation is better suited for predicting strong than weak transcription factor binding sites.
Small-Molecule Inhibitors of the SOX18 Transcription Factor.
Fontaine, Frank; Overman, Jeroen; Moustaqil, Mehdi; Mamidyala, Sreeman; Salim, Angela; Narasimhan, Kamesh; Prokoph, Nina; Robertson, Avril A B; Lua, Linda; Alexandrov, Kirill; Koopman, Peter; Capon, Robert J; Sierecki, Emma; Gambin, Yann; Jauch, Ralf; Cooper, Matthew A; Zuegg, Johannes; Francois, Mathias
2017-03-16
Pharmacological modulation of transcription factors (TFs) has only met little success over the past four decades. This is mostly due to standard drug discovery approaches centered on blocking protein/DNA binding or interfering with post-translational modifications. Recent advances in the field of TF biology have revealed a central role of protein-protein interaction in their mode of action. In an attempt to modulate the activity of SOX18 TF, a known regulator of vascular growth in development and disease, we screened a marine extract library for potential small-molecule inhibitors. We identified two compounds, which inspired a series of synthetic SOX18 inhibitors, able to interfere with the SOX18 HMG DNA-binding domain, and to disrupt HMG-dependent protein-protein interaction with RBPJ. These compounds also perturbed SOX18 transcriptional activity in a cell-based reporter gene system. This approach may prove useful in developing a new class of anti-angiogenic compounds based on the inhibition of TF activity. Copyright © 2017 Elsevier Ltd. All rights reserved.
Dekker, Nick; de Haan, Annett; Hochstenbach, Frans
2006-01-01
During the final stage of the cell division cycle in the fission yeast Schizosaccharomyces pombe, transcription factor Ace2p activates expression of genes involved in the separation of newly formed daughter cells, such as agn1+, which encodes the alpha-glucanase Agn1p. The agn1 promoter contains
Directory of Open Access Journals (Sweden)
WS Mada Sanjaya
2016-12-01
Full Text Available Telah dilakukan penelitian yang menggambarkan implementasi pengenalan pola suara untuk mengontrol gerak robot arm 5 DoF dalam mengambil dan menyimpan benda. Dalam penelitian ini metode yang digunakan adalah Mel-Frequency Cepstrum Coefficients (MFCC dan Adaptive Neuro-Fuzzy Inferense System (ANFIS. Metode MFCC digunakan untuk ekstraksi ciri sinyal suara, sedangkan ANFIS digunakan sebagai metode pembelajaran untuk pengenalan pola suara. Pada proses pembelajaran ANFIS data latih yang digunakan sebanyak 6 ciri. Data suara terlatih dan data suara tak terlatih digunakan untuk pengujian sistem pengenalan pola suara. Hasil pengujian menunjukkan tingkat keberhasilan, untuk data suara terlatih sebesar 87,77% dan data tak terlatih sebesar 78,53%. Sistem pengenalan pola suara ini telah diaplikasikan dengan baik untuk mengerakan robot arm 5 DoF berbasis mikrokontroler Arduino. Have been implemented of sound pattern recognition to control 5 DoF of Arm Robot to pick and place an object. In this research used Mel-Frequency Cepstrum Coefficients (MFCC and Adaptive Neuro-Fuzzy Interferense System (ANFIS methods. MFCC method used for features extraction of sound signal, meanwhile ANFIS used to learn sound pattern recognition. On ANFIS method data learning use 6 features. Trained and not trained data used to examine the system of sound pattern identification. The result show the succesfull level, for trained data 87.77% and for not trained data 78.53%. Sound pattern identification system was appliedto controlled 5 DoF arm robot based Arduino microcontroller.
Directory of Open Access Journals (Sweden)
Belinda J. Goldie
2017-08-01
Full Text Available While the cytoplasmic function of microRNA (miRNA as post-transcriptional regulators of mRNA has been the subject of significant research effort, their activity in the nucleus is less well characterized. Here we use a human neuronal cell model to show that some mature miRNA are preferentially enriched in the nucleus. These molecules were predominantly primate-specific and contained a sequence motif with homology to the consensus MAZ transcription factor binding element. Precursor miRNA containing this motif were shown to have affinity for MAZ protein in nuclear extract. We then used Ago1/2 RIP-Seq to explore nuclear miRNA-associated mRNA targets. Interestingly, the genes for Ago2-associated transcripts were also significantly enriched with MAZ binding sites and neural function, whereas Ago1-transcripts were associated with general metabolic processes and localized with SC35 spliceosomes. These findings suggest the MAZ transcription factor is associated with miRNA in the nucleus and may influence the regulation of neuronal development through Ago2-associated miRNA induced silencing complexes. The MAZ transcription factor may therefore be important for organizing higher order integration of transcriptional and post-transcriptional processes in primate neurons.
J.C. Marinoni; R. Roy (Richard); W. Vermeulen (Wim); P. Miniou; Y. Lutz; G. Weeda (Geert); T. Seroz; D.M. Gomez (Denise Molina); J.H.J. Hoeijmakers (Jan); J-M. Egly (Jean-Marc)
1997-01-01
textabstractTFIIH is a multiprotein factor involved in transcription and DNA repair and is implicated in DNA repair/transcription deficiency disorders such as xeroderma pigmentosum, Cockayne syndrome and trichothiodystrophy. Eight out of the nine genes encoding the subunits forming TFIIH have
Zhang, Quan; Li, Chaodong; Zhang, Jiantao; Zhang, Xu
2017-11-01
The macro-micro combined approach, as an effective way to realize trans-scale nano-precision positioning with multi-dimensions and high velocity, plays a significant role in integrated circuit manufacturing field. A 3-degree-of-freedoms (3-DOFs) macro-micro manipulator is designed and analyzed to compromise the conflictions among the large stroke, high precision and multi-DOFs. The macro manipulator is a 3-Prismatic-Revolute-Revolute (3-PRR) structure parallel manipulator which is driven by three linear ultrasonic motors. The dynamic model and the cross-coupling error based synchronized motion controller of the 3-PRR parallel manipulator are theoretical analyzed and experimental tested. To further improve the positioning accuracy, a 3-DOFs monolithic compliant manipulator actuated by three piezoelectric stack actuators is designed. Then a multilayer BP neural network based inverse kinematic model identifier is developed to perform the positioning control. Finally, by forming the macro-micro structure, the dual stage manipulator successfully achieved the positioning task from the point (2 mm, 2 mm, 0 rad) back to the original point (0 mm, 0 mm, 0 rad) with the translation errors in X and Y directions less than ±50 nm and the rotation error around Z axis less than ±1 μrad, respectively.
Cui, Cunxing; Feng, Qibo; Zhang, Bin; Zhao, Yuqiong
2016-03-21
A novel method for simultaneously measuring six degree-of-freedom (6DOF) geometric motion errors is proposed in this paper, and the corresponding measurement instrument is developed. Simultaneous measurement of 6DOF geometric motion errors using a polarization maintaining fiber-coupled dual-frequency laser is accomplished for the first time to the best of the authors' knowledge. Dual-frequency laser beams that are orthogonally linear polarized were adopted as the measuring datum. Positioning error measurement was achieved by heterodyne interferometry, and other 5DOF geometric motion errors were obtained by fiber collimation measurement. A series of experiments was performed to verify the effectiveness of the developed instrument. The experimental results showed that the stability and accuracy of the positioning error measurement are 31.1 nm and 0.5 μm, respectively. For the straightness error measurements, the stability and resolution are 60 and 40 nm, respectively, and the maximum deviation of repeatability is ± 0.15 μm in the x direction and ± 0.1 μm in the y direction. For pitch and yaw measurements, the stabilities are 0.03″ and 0.04″, the maximum deviations of repeatability are ± 0.18″ and ± 0.24″, and the accuracies are 0.4″ and 0.35″, respectively. The stability and resolution of roll measurement are 0.29″ and 0.2″, respectively, and the accuracy is 0.6″.
Flavonoids as Putative Inducers of the Transcription Factors Nrf2, FoxO, and PPARγ
Directory of Open Access Journals (Sweden)
Kathrin Pallauf
2017-01-01
Full Text Available Dietary flavonoids have been shown to extend the lifespan of some model organisms and may delay the onset of chronic ageing-related diseases. Mechanistically, the effects could be explained by the compounds scavenging free radicals or modulating signalling pathways. Transcription factors Nrf2, FoxO, and PPARγ possibly affect ageing by regulating stress response, adipogenesis, and insulin sensitivity. Using Hek-293 cells transfected with luciferase reporter constructs, we tested the potency of flavonoids from different subclasses (flavonols, flavones, flavanols, and isoflavones to activate these transcription factors. Under cell-free conditions (ABTS and FRAP assays, we tested their free radical scavenging activities and used α-tocopherol and ascorbic acid as positive controls. Most of the tested flavonoids, but not the antioxidant vitamins, stimulated Nrf2-, FoxO-, and PPARγ-dependent promoter activities. Flavonoids activating Nrf2 also tended to induce a FoxO and PPARγ response. Interestingly, activation patterns of cellular stress response by flavonoids were not mirrored by their activities in ABTS and FRAP assays, which depended mostly on hydroxylation in the flavonoid B ring and, in some cases, extended that of the vitamins. In conclusion, the free radical scavenging properties of flavonoids do not predict whether these molecules can stimulate a cellular response linked to activation of longevity-associated transcription factors.
Flavonoids as Putative Inducers of the Transcription Factors Nrf2, FoxO, and PPARγ.
Pallauf, Kathrin; Duckstein, Nils; Hasler, Mario; Klotz, Lars-Oliver; Rimbach, Gerald
2017-01-01
Dietary flavonoids have been shown to extend the lifespan of some model organisms and may delay the onset of chronic ageing-related diseases. Mechanistically, the effects could be explained by the compounds scavenging free radicals or modulating signalling pathways. Transcription factors Nrf2, FoxO, and PPAR γ possibly affect ageing by regulating stress response, adipogenesis, and insulin sensitivity. Using Hek-293 cells transfected with luciferase reporter constructs, we tested the potency of flavonoids from different subclasses (flavonols, flavones, flavanols, and isoflavones) to activate these transcription factors. Under cell-free conditions (ABTS and FRAP assays), we tested their free radical scavenging activities and used α -tocopherol and ascorbic acid as positive controls. Most of the tested flavonoids, but not the antioxidant vitamins, stimulated Nrf2-, FoxO-, and PPAR γ -dependent promoter activities. Flavonoids activating Nrf2 also tended to induce a FoxO and PPAR γ response. Interestingly, activation patterns of cellular stress response by flavonoids were not mirrored by their activities in ABTS and FRAP assays, which depended mostly on hydroxylation in the flavonoid B ring and, in some cases, extended that of the vitamins. In conclusion, the free radical scavenging properties of flavonoids do not predict whether these molecules can stimulate a cellular response linked to activation of longevity-associated transcription factors.
[The function of transcription factor P63 and its signaling pathway during limb development].
Ma, Wei; Tian, Wen
2014-08-01
The development of human limb is controlled by several transcription factors and signaling pathways, which are organized in precise time- and space-restricted manners. Recent studies showed that P63 and its signaling pathway play important roles in this process. Transcription factor P63, one member of the P53 family, is characterized by a similar amino acid domain, plays a crucial role in the development of limb and ectoderm differentiation, especially with its DNA binding domain, and sterile alpha motif domains. Mutated P63 gene may produce abnormal transcription factor P63 which can affect the signaling pathway. Furthermore, defective signaling protein in structure and/or quantity is synthesized though the pathway. Eventually, members of the signaling protein family are involved in the regulation of differentiation and development of stem cell, which causes deformity of limbs. In brief, three signaling pathways are related to the digit formation along three axes, including SHH-ZPA, FGFs-AER and Lmx1B-Wnt7a-En1. Each contains numerous signaling molecules which are integrated in self-regulatory modules that assure the acquisition or the correct digit complements. These finding has brought new clues for deciphering the etiology of congenital limb malformation and may provide alternatives for both prevention and treatment.
Danisman, Selahattin
2016-01-01
Plants are sessile and as such their reactions to environmental challenges differ from those of mobile organisms. Many adaptions involve growth responses and hence, growth regulation is one of the most crucial biological processes for plant survival and fitness. The plant-specific TEOSINTE BRANCHED 1, CYCLOIDEA, PCF1 (TCP) transcription factor family is involved in plant development from cradle to grave, i.e., from seed germination throughout vegetative development until the formation of flowers and fruits. TCP transcription factors have an evolutionary conserved role as regulators in a variety of plant species, including orchids, tomatoes, peas, poplar, cotton, rice and the model plant Arabidopsis. Early TCP research focused on the regulatory functions of TCPs in the development of diverse organs via the cell cycle. Later research uncovered that TCP transcription factors are not static developmental regulators but crucial growth regulators that translate diverse endogenous and environmental signals into growth responses best fitted to ensure plant fitness and health. I will recapitulate the research on TCPs in this review focusing on two topics: the discovery of TCPs and the elucidation of their evolutionarily conserved roles across the plant kingdom, and the variety of signals, both endogenous (circadian clock, plant hormones) and environmental (pathogens, light, nutrients), TCPs respond to in the course of their developmental roles.
Unraveling the WRKY transcription factors network in Arabidopsis Thaliana by integrative approach
Directory of Open Access Journals (Sweden)
Mouna Choura
2015-06-01
Full Text Available The WRKY transcription factors superfamily are involved in diverse biological processes in plants including response to biotic and abiotic stresses and plant immunity. Protein-protein interaction network is a useful approach for understanding these complex processes. The availability of Arabidopsis Thaliana interactome offers a good opportunity to do get a global view of protein network. In this work, we have constructed the WRKY transcription factor network by combining different sources of evidence and we characterized its topological features using computational tools. We found that WRKY network is a hub-based network involving multifunctional proteins denoted as hubs such as WRKY 70, WRKY40, WRKY 53, WRKY 60, WRKY 33 and WRKY 51. Functional annotation showed seven functional modules particularly involved in biotic stress and defense responses. Furthermore, the gene ontology and pathway enrichment analysis revealed that WRKY proteins are mainly involved in plant-pathogen interaction pathways and their functions are directly related to the stress response and immune system process.
Susanna, Kim A.; Mironczuk, Aleksandra M.; Smits, Wiep Klaas; Hamoen, Leendert W.; Kuipers, Oscar P.
The competence transcription factor ComK plays a central role in competence development in Bacillus subtilis by activating the transcription of the K regulon. ComK-activated genes are characterized by the presence of a specific sequence to which ComK binds, a K-box, in their upstream DNA region.
Age-dependent regulation of ERF-VII transcription factor activity in Arabidopsis thaliana.
Giuntoli, Beatrice; Shukla, Vinay; Maggiorelli, Federica; Giorgi, Federico M; Lombardi, Lara; Perata, Pierdomenico; Licausi, Francesco
2017-10-01
The Group VII Ethylene Responsive Factors (ERFs-VII) RAP2.2 and RAP2.12 have been mainly characterized with regard to their contribution as activators of fermentation in plants. However, transcriptional changes measured in conditions that stabilize these transcription factors exceed the mere activation of this biochemical pathway, implying additional roles performed by the ERF-VIIs in other processes. We evaluated gene expression in transgenic Arabidopsis lines expressing a stabilized form of RAP2.12, or hampered in ERF-VII activity, and identified genes affected by this transcriptional regulator and its homologs, including some involved in oxidative stress response, which are not universally induced under anaerobic conditions. The contribution of the ERF-VIIs in regulating this set of genes in response to chemically induced or submergence-stimulated mitochondria malfunctioning was found to depend on the plant developmental stage. A similar age-dependent mechanism also restrained ERF-VII activity upon the core-hypoxic genes, independently of the N-end rule pathway, which is accounted for the control of the anaerobic response. To conclude, this study shed new light on a dual role of ERF-VII proteins under submergence: as positive regulators of the hypoxic response and as repressors of oxidative-stress related genes, depending on the developmental stage at which plants are challenged by stress conditions. © 2017 John Wiley & Sons Ltd.
A 3-DOF haptic master device for minimally invasive surgery
Nguyen, Phuong-Bac; Oh, Jong-Seok; Choi, Seung-Bok
2012-04-01
This paper introduces a novel 3-DOF haptic master device for minimally invasive surgery featuring magneto-rheological (MR) fluid. It consists of three rotational motions. These motions are constituted by two bi-directional MR (BMR) plus one conventional MR brakes. The BMR brake used in the system possesses a salient advantage that its range of braking torque varies from negative to positive values. Therefore, the device is expected to be able sense in a wide environment from very soft tissues to bones. In this paper, overall of the design of the device is presented from idea, modeling, optimal design, manufacturing to control of the device. Moreover, experimental investigation is undertaken to validate the effectiveness of the device.
Hua, Ping; Feng, Wenguang; Rezonzew, Gabriel; Chumley, Phillip; Jaimes, Edgar A
2012-06-01
Angiotensin II (ANG II) produced as result of activation of the renin-angiotensin system (RAS) plays a critical role in the pathogenesis of chronic kidney disease via its hemodynamic effects on the renal microcirculation as well as by its nonhemodynamic actions including the production of extracellular matrix proteins such as fibronectin, a multifunctional extracellular matrix protein that plays a major role in cell adhesion and migration as well as in the development of glomerulosclerosis. ETS-1 is an important transcription factor essential for normal kidney development and glomerular integrity. We previously showed that ANG II increases ETS-1 expression and is required for fibronectin production in mesangial cells. In these studies, we determined that ANG II induces phosphorylation of ETS-1 via activation of the type 1 ANG II receptor and that Erk1/2 and Akt/PKB phosphorylation are required for these effects. In addition, we characterized the role of ETS-1 on the transcriptional activation of fibronectin production in mesangial cells. We determined that ETS-1 directly activates the fibronectin promoter and by utilizing gel shift assays and chromatin immunoprecipitation assays identified two different ETS-1 binding sites that promote the transcriptional activation of fibronectin in response to ANG II. In addition, we identified the essential role of CREB and its coactivator p300 on the transcriptional activation of fibronectin by ETS-1. These studies unveil novel mechanisms involved in RAS-induced production of the extracellular matrix protein fibronectin in mesangial cells and establish the role of the transcription factor ETS-1 as a direct mediator of these effects.
Reprogramming of metabolism by the Arabidopsis thaliana bZIP11 transcription factor
Ma, J.
2012-01-01
The Arabidopsis bZIP11 transcription factor is known to regulate amino acid metabolism, and transcriptomic analysis suggests that bZIP11 has a broader regulatory effects in metabolism. Moreover, sucrose controls its translation via its uORF and all the available evidences point to the fact that
Kim, Yoon; Song, Ji-Hye; Park, Seon-U; Jeong, You-Seung; Kim, Soo-Hwan
2017-02-01
Brassinosteroids (BRs) are plant polyhydroxy-steroids that play important roles in plant growth and development via extensive signal integration through direct interactions between regulatory components of different signaling pathways. Recent studies have shown that diverse helix-loop-helix/basic helix-loop-helix (HLH/bHLH) family proteins are actively involved in control of BR signaling pathways and interact with other signaling pathways. In this study, we show that ATBS1-INTERACTING FACTOR 2 (AIF2), a nuclear-localized atypical bHLH transcription factor, specifically interacts with BRASSINOSTEROID-INSENSITIVE 2 (BIN2) among other BR signaling molecules. Overexpression of AIF2 down-regulated transcript expression of growth-promoting genes, thus resulting in retardation of growth. AIF2 renders plants hyposensitive to BR-induced root growth inhibition, but shows little effects on BR-promoted hypocotyl elongation. Notably, AIF2 was dephosphorylated by BR, and the dephosphorylated AIF2 was subject to proteasome-mediated degradation. AIF2 degradation was greatly induced by BR and ABA, but relatively slightly by other hormones such as auxin, gibberellin, cytokinin and ethylene. Moreover, AIF2 transcription was significantly suppressed by a BRI1/BZR1-mediated BR signaling pathway through a direct binding of BRASSINAZOLE RESISTANT 1 (BZR1) to the BR response element (BRRE) region of the AIF2 promoter. In conclusion, our study suggests that BIN2-driven AIF2 phosphorylation could augment the BIN2/AIF2-mediated negative circuit of BR signaling pathways, and the BR-induced transcriptional repression and protein degradation negatively regulate AIF2 transcription factor, reinforcing the BZR1/BES1-mediated positive BR signaling pathway. © The Author 2017. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Mathematical model of the 5-DOF sled dynamics of an electrodynamic Maglev system with a passive sled
Boeij, de J.; Steinbuch, M.; Gutierrez, H.M.
2005-01-01
A model that describes the five-degrees-of-freedom (5-DOF) dynamics of a passively levitated electrodynamic maglev system is presented. The model is based on the flux-current-force interactions and the geometric relationships between the levitation coils and the permanent magnets on the sled. The
Choi, Sunju; Xu, Lu; Sze, Ji Ying
2013-01-01
In Caenorhabditis elegans the Toll-interleukin receptor domain adaptor protein TIR-1 via a conserved mitogen-activated protein kinase (MAPK) signaling cascade induces innate immunity and upregulates serotonin (5-HT) biosynthesis gene tph-1 in a pair of ADF chemosensory neurons in response to infection. Here, we identify transcription factors downstream of the TIR-1 signaling pathway. We show that common transcription factors control the innate immunity and 5-HT biosynthesis. We demonstrate that a cysteine to tyrosine substitution in an ARM motif of the HEAT/Arm repeat region of the TIR-1 protein confers TIR-1 hyperactivation, leading to constitutive tph-1 upregulation in the ADF neurons, increased expression of intestinal antimicrobial genes, and enhanced resistance to killing by the human opportunistic pathogen Pseudomonas aeruginosa PA14. A forward genetic screen for suppressors of the hyperactive TIR-1 led to the identification of DAF-19, an ortholog of regulatory factor X (RFX) transcription factors that are required for human adaptive immunity. We show that DAF-19 concerts with ATF-7, a member of the activating transcription factor (ATF)/cAMP response element-binding B (CREB) family of transcription factors, to regulate tph-1 and antimicrobial genes, reminiscent of RFX-CREB interaction in human immune cells. daf-19 mutants display heightened susceptibility to killing by PA14. Remarkably, whereas the TIR-1-MAPK-DAF-19/ATF-7 pathway in the intestinal immunity is regulated by DKF-2/protein kinase D, we found that the regulation of tph-1 expression is independent of DKF-2 but requires UNC-43/Ca2+/calmodulin-dependent protein kinase (CaMK) II. Our results suggest that pathogenic cues trigger a common core-signaling pathway via tissue-specific mechanisms and demonstrate a novel role for RFX factors in neuronal and innate immune responses to infection. PMID:23505381
O'Hara, John M.
1987-01-01
Two studies were conducted evaluating methods of controlling a telerobot; bilateral force reflecting master controllers and proportional rate six degrees of freedom (DOF) hand controllers. The first study compared the controllers on performance of single manipulator arm tasks, a peg-in-the-hole task, and simulated satellite orbital replacement unit changeout. The second study, a Space Station truss assembly task, required simultaneous operation of both manipulator arms (all 12 DOFs) and complex multiaxis slave arm movements. Task times were significantly longer and fewer errors were committed with the hand controllers. The hand controllers were also rated significantly higher in cognitive and manual control workload on the two-arm task. The master controllers were rated significantly higher in physical workload. There were no significant differences in ratings of manipulator control quality.
Ngeo, Jimson; Tamei, Tomoya; Shibata, Tomohiro
2014-01-01
Surface electromyographic (EMG) signals have often been used in estimating upper and lower limb dynamics and kinematics for the purpose of controlling robotic devices such as robot prosthesis and finger exoskeletons. However, in estimating multiple and a high number of degrees-of-freedom (DOF) kinematics from EMG, output DOFs are usually estimated independently. In this study, we estimate finger joint kinematics from EMG signals using a multi-output convolved Gaussian Process (Multi-output Full GP) that considers dependencies between outputs. We show that estimation of finger joints from muscle activation inputs can be improved by using a regression model that considers inherent coupling or correlation within the hand and finger joints. We also provide a comparison of estimation performance between different regression methods, such as Artificial Neural Networks (ANN) which is used by many of the related studies. We show that using a multi-output GP gives improved estimation compared to multi-output ANN and even dedicated or independent regression models.
Role of the Slug Transcription Factor in Chemically-Induced Skin Cancer
Directory of Open Access Journals (Sweden)
Kristine von Maltzan
2016-02-01
Full Text Available The Slug transcription factor plays an important role in ultraviolet radiation (UVR-induced skin carcinogenesis, particularly in the epithelial-mesenchymal transition (EMT occurring during tumor progression. In the present studies, we investigated the role of Slug in two-stage chemical skin carcinogenesis. Slug and the related transcription factor Snail were expressed at high levels in skin tumors induced by 7,12-dimethylbenz[α]anthracene application followed by 12-O-tetradecanoylphorbol-13-acetate (TPA treatment. TPA-induced transient elevation of Slug and Snail proteins in normal mouse epidermis and studies in Slug transgenic mice indicated that Slug modulates TPA-induced epidermal hyperplasia and cutaneous inflammation. Although Snail family factors have been linked to inflammation via interactions with the cyclooxygenase-2 (COX-2 pathway, a pathway that also plays an important role in skin carcinogenesis, transient TPA induction of Slug and Snail appeared unrelated to COX-2 expression. In cultured human keratinocytes, TPA induced Snail mRNA expression while suppressing Slug expression, and this differential regulation was due specifically to activation of the TPA receptor. These studies show that Slug and Snail exhibit similar patterns of expression during both UVR and chemical skin carcinogenesis, that Slug and Snail can be differentially regulated under some conditions and that in vitro findings may not recapitulate in vivo results.
Directory of Open Access Journals (Sweden)
Zahra Zinati
2017-05-01
Full Text Available Carotenoids, a diverse group of colorful pigments, contribute to the development, light harvesting and photoprotection in plants as well as human health. Due to the interesting properties of carotenoids, enhanced carotenoid biosynthesis has been of ongoing interest. Recent advances in computational biology and bioinformatics make it more feasible to understand the transcriptional regulatory network underlying carotenoid biosynthesis. Studies on carotenoid biosynthesis in corn ( Zea mays L. have indicated the pivotal role of the phytoene synthase gene PSY1 (accession: GRMZM2G300348 in endosperm color and carotenoid accumulation in corn kernels. Computational approaches such as Genomatix, PlantPAN, PlantCARE, PlantTFDB and IGDE6 have been used for promoter prediction, regulatory features and transcription factor identification, as well as pairwise promoter comparisons. Four transcripts have been identified for the PSY1 gene. Based on Genomatix and PlantPAN, the promoter predicted for GRMZM2G300348_T01 was different from that predicted for the other three transcripts (GRMZM2G300348_T02, GRMZM2G300348_T03 and GRMZM2G300348_T04. The results indiated that the promoter of GRMZM2G300348_T01 has more diverse motifs involved in hormonal/environmental stress responses. The most significant result obtained from this study is the discovery of two transcription factors belonging to the HB family that are co-expressed with all four transcripts of PSY1 under environmental stresses. It is, therefore, likely that these transcription factors may act as critical regulators of PSY1 gene expression in corn. Identification of the proteins acting upstream of PSY1 within corn will shed light on the fine tuning of PSY1 expression regulation. Such an understanding would also contribute to metabolic engineering aimed at enhanced carotenoid biosynthesis.
Keilwagen, Jens; Grau, Jan; Paponov, Ivan A; Posch, Stefan; Strickert, Marc; Grosse, Ivo
2011-02-10
Transcription factors are a main component of gene regulation as they activate or repress gene expression by binding to specific binding sites in promoters. The de-novo discovery of transcription factor binding sites in target regions obtained by wet-lab experiments is a challenging problem in computational biology, which has not been fully solved yet. Here, we present a de-novo motif discovery tool called Dispom for finding differentially abundant transcription factor binding sites that models existing positional preferences of binding sites and adjusts the length of the motif in the learning process. Evaluating Dispom, we find that its prediction performance is superior to existing tools for de-novo motif discovery for 18 benchmark data sets with planted binding sites, and for a metazoan compendium based on experimental data from micro-array, ChIP-chip, ChIP-DSL, and DamID as well as Gene Ontology data. Finally, we apply Dispom to find binding sites differentially abundant in promoters of auxin-responsive genes extracted from Arabidopsis thaliana microarray data, and we find a motif that can be interpreted as a refined auxin responsive element predominately positioned in the 250-bp region upstream of the transcription start site. Using an independent data set of auxin-responsive genes, we find in genome-wide predictions that the refined motif is more specific for auxin-responsive genes than the canonical auxin-responsive element. In general, Dispom can be used to find differentially abundant motifs in sequences of any origin. However, the positional distribution learned by Dispom is especially beneficial if all sequences are aligned to some anchor point like the transcription start site in case of promoter sequences. We demonstrate that the combination of searching for differentially abundant motifs and inferring a position distribution from the data is beneficial for de-novo motif discovery. Hence, we make the tool freely available as a component of the open
Structural and functional studies on the pituitary-specific transcription factor Pit-1
Augustijn, K.D.
2002-01-01
Pit-1 is a pituitary specific transcription factor that plays a central role in the development and maintenance of a number of cell lineages in the anterior pituitary gland. In these cell lineages, Pit-1 is required for the selective expression of the growth hormone (GH), prolactin (PRL) and the
Chemically Induced Degradation of the Oncogenic Transcription Factor BCL6
Directory of Open Access Journals (Sweden)
Nina Kerres
2017-09-01
Full Text Available The transcription factor BCL6 is a known driver of oncogenesis in lymphoid malignancies, including diffuse large B cell lymphoma (DLBCL. Disruption of its interaction with transcriptional repressors interferes with the oncogenic effects of BCL6. We used a structure-based drug design to develop highly potent compounds that block this interaction. A subset of these inhibitors also causes rapid ubiquitylation and degradation of BCL6 in cells. These compounds display significantly stronger induction of expression of BCL6-repressed genes and anti-proliferative effects than compounds that merely inhibit co-repressor interactions. This work establishes the BTB domain as a highly druggable structure, paving the way for the use of other members of this protein family as drug targets. The magnitude of effects elicited by this class of BCL6-degrading compounds exceeds that of our equipotent non-degrading inhibitors, suggesting opportunities for the development of BCL6-based lymphoma therapeutics.
A simple 5-DoF MR-compatible motion signal measurement system.
Chung, Soon-Cheol; Kim, Hyung-Sik; Yang, Jae-Woong; Lee, Su-Jeong; Choi, Mi-Hyun; Kim, Ji-Hye; Yeon, Hong-Won; Park, Jang-Yeon; Yi, Jeong-Han; Tack, Gye-Rae
2011-09-01
The purpose of this study was to develop a simple motion measurement system with magnetic resonance (MR) compatibility and safety. The motion measurement system proposed here can measure 5-DoF motion signals without deteriorating the MR images, and it has no effect on the intense and homogeneous main magnetic field, the temporal-gradient magnetic field (which varies rapidly with time), the transceiver radio frequency (RF) coil, and the RF pulse during MR data acquisition. A three-axis accelerometer and a two-axis gyroscope were used to measure 5-DoF motion signals, and Velcro was used to attach a sensor module to a finger or wrist. To minimize the interference between the MR imaging system and the motion measurement system, nonmagnetic materials were used for all electric circuit components in an MR shield room. To remove the effect of RF pulse, an amplifier, modulation circuit, and power supply were located in a shielded case, which was made of copper and aluminum. The motion signal was modulated to an optic signal using pulse width modulation, and the modulated optic signal was transmitted outside the MR shield room using a high-intensity light-emitting diode and an optic cable. The motion signal was recorded on a PC by demodulating the transmitted optic signal into an electric signal. Various kinematic variables, such as angle, acceleration, velocity, and jerk, can be measured or calculated by using the motion measurement system developed here. This system also enables motion tracking by extracting the position information from the motion signals. It was verified that MR images and motion signals could reliably be measured simultaneously.
Design of human controlled 1 DOF right hand exoskeleton using electromyography signal
Azzam, M.; Wijaya, S. K.; Prawito
2017-07-01
Exoskeleton in general is a structure that is anatomically designed to be able to accommodate the physical movement of its user and provide additional strength. The use of EMG signal to control a 1 DOF right arm exoskeleton is evaluated in this research. This research aims to achieve optimum control using EMG signal. EMG signal is a variation of voltage that occurs when muscle contracts hence its strong correlation with the user's intention of movement. The RMS values of each EMG signal that originates from bicep and tricep muscle are calculated and processed to determine the direction and speed of rotation of a DC motor that actuates the exoskeleton. The RMS calculation is conducted at various array length that will theoretically affect its accuracy. The difference between those two RMS values is then calculated and interpreted as the intention of flexion or extension movement that will control the DC motor rotational direction. The absolute value of the RMS difference multiplied with a gain factor is used to regulate the duty cycle of a PWM signal that is used to control the rotational speed of the DC motor. To achieve the smallest settling time, array length and gain factor were varied. The test was conducted in two stages, static and dynamic tests. The test result shows a trend where the settling time decreases when array length is shortened and gain is increased. It shows that optimum control can be achieved by selecting the right array length and gain.
Kooistra, Susanne M.; van den Boom, Vincent; Thummer, Rajkumar P.; Johannes, Frank; Wardenaar, Rene; Tesson, Bruno M.; Veenhoff, Liesbeth M.; Fusetti, Fabrizia; O'Neill, Laura P.; Turner, Bryan M.; de Haan, Gerald; Eggen, Bart J. L.; O’Neill, Laura P.
2010-01-01
Previous reports showed that embryonic stem (ES) cells contain hyperdynamic and globally transcribed chromatin-properties that are important for ES cell pluripotency and differentiation. Here, we demonstrate a role for undifferentiated embryonic cell transcription factor 1 (UTF1) in regulating ES
Improved Inverse Kinematics Algorithm Using Screw Theory for a Six-DOF Robot Manipulator
Chen, Qingcheng; Zhu, Shiqiang; Zhang, Xuequn
2015-01-01
Based on screw theory, a novel improved inverse-kinematics approach for a type of six-DOF serial robot, “Qianjiang I”, is proposed in this paper. The common kinematics model of the robot is based on the Denavit-Hartenberg (D-H) notation method while its inverse kinematics has inefficient calculation and complicated solution, which cannot meet the demands of online real-time application. To solve this problem, this paper presents a new method to improve the efficiency of the inverse kinematics...
Dai, Hanjun; Umarov, Ramzan; Kuwahara, Hiroyuki; Li, Yu; Song, Le; Gao, Xin
2017-01-01
Motivation: An accurate characterization of transcription factor (TF)-DNA affinity landscape is crucial to a quantitative understanding of the molecular mechanisms underpinning endogenous gene regulation. While recent advances in biotechnology have
Isolation and mass spectrometry of transcription factor complexes.
Sebastiaan Winkler, G; Lacomis, Lynne; Philip, John; Erdjument-Bromage, Hediye; Svejstrup, Jesper Q; Tempst, Paul
2002-03-01
Protocols are described that enable the isolation of novel proteins associated with a known protein and the subsequent identification of these proteins by mass spectrometry. We review the basics of nanosample handling and of two complementary approaches to mass analysis, and provide protocols for the entire process. The protein isolation procedure is rapid and based on two high-affinity chromatography steps. The method does not require previous knowledge of complex composition or activity and permits subsequent biochemical characterization of the isolated factor. As an example, we provide the procedures used to isolate and analyze yeast Elongator, a histone acetyltransferase complex important for transcript elongation, which led to the identification of three novel subunits.
Directory of Open Access Journals (Sweden)
Das Sulagna
2010-10-01
Full Text Available Abstract Background Activation of microglia, the resident macrophages of the central nervous system (CNS, is the hallmark of neuroinflammation in neurodegenerative diseases and other pathological conditions associated with CNS infection. The activation of microglia is often associated with bystander neuronal death. Nuclear factor-κB (NF-κB is one of the important transcription factors known to be associated with microglial activation which upregulates the expression of inducible nitric oxide synthase (iNOS, cyclooxygenase-2 (Cox-2 and other pro-inflammatory cytokines. Recent studies have focused on the role of Krüppel-like factor 4 (Klf4, one of the zinc-finger transcription factors, in mediating inflammation. However, these studies were limited to peripheral system and its role in CNS is not understood. Our studies focused on the possible role of Klf4 in mediating CNS inflammation. Methods For in vitro studies, mouse microglial BV-2 cell lines were treated with 500 ng/ml Salmonella enterica lipopolysacchride (LPS. Brain tissues were isolated from BALB/c mice administered with 5 mg/kg body weight of LPS. Expressions of Klf4, Cox-2, iNOS and pNF-κB were evaluated using western blotting, quantitative real time PCR, and reverse transcriptase polymerase chain reactions (RT-PCRs. Klf4 knockdown was carried out using SiRNA specific for Klf4 mRNA and luciferase assays and electromobility shift assay (EMSA were performed to study the interaction of Klf4 to iNOS promoter elements in vitro. Co-immunoprecipitation of Klf4 and pNF-κB was done in order to study a possible interaction between the two transcription factors. Results LPS stimulation increased Klf4 expression in microglial cells in a time- and dose-dependent manner. Knockdown of Klf4 resulted in decreased levels of the pro-inflammatory cytokines TNF-α, MCP-1 and IL-6, along with a significant decrease in iNOS and Cox-2 expression. NO production also decreased as a result of Klf4 knockdown
HOCOMOCO: expansion and enhancement of the collection of transcription factor binding sites models
Kulakovskiy, Ivan V.
2015-11-19
Models of transcription factor (TF) binding sites provide a basis for a wide spectrum of studies in regulatory genomics, from reconstruction of regulatory networks to functional annotation of transcripts and sequence variants. While TFs may recognize different sequence patterns in different conditions, it is pragmatic to have a single generic model for each particular TF as a baseline for practical applications. Here we present the expanded and enhanced version of HOCOMOCO (http://hocomoco.autosome.ru and http://www.cbrc.kaust.edu.sa/hocomoco10), the collection of models of DNA patterns, recognized by transcription factors. HOCOMOCO now provides position weight matrix (PWM) models for binding sites of 601 human TFs and, in addition, PWMs for 396 mouse TFs. Furthermore, we introduce the largest up to date collection of dinucleotide PWM models for 86 (52) human (mouse) TFs. The update is based on the analysis of massive ChIP-Seq and HT-SELEX datasets, with the validation of the resulting models on in vivo data. To facilitate a practical application, all HOCOMOCO models are linked to gene and protein databases (Entrez Gene, HGNC, UniProt) and accompanied by precomputed score thresholds. Finally, we provide command-line tools for PWM and diPWM threshold estimation and motif finding in nucleotide sequences.
Shu, Kai; Zhou, Wenguan; Yang, Wenyu
2018-02-01
The phytohormones abscisic acid (ABA) and gibberellin (GA) antagonistically mediate diverse plant developmental processes including seed dormancy and germination, root development, and flowering time control, and thus the optimal balance between ABA and GA is essential for plant growth and development. Although more than a half and one century have passed since the initial discoveries of ABA and GA, respectively, the precise mechanisms underlying ABA-GA antagonism still need further investigation. Emerging evidence indicates that two APETALA 2 (AP2)-domain-containing transcription factors (ATFs), ABI4 in Arabidopsis and OsAP2-39 in rice, play key roles in ABA and GA antagonism. These two transcription factors precisely regulate the transcription pattern of ABA and GA biosynthesis or inactivation genes, mediating ABA and GA levels. In this Viewpoint article, we try to shed light on the effects of ATFs on ABA-GA antagonism, and summarize the overlapping but distinct biological functions of these ATFs in the antagonism between ABA and GA. Finally, we strongly propose that further research is needed into the detailed roles of additional numerous ATFs in ABA and GA crosstalk, which will improve our understanding of the antagonism between these two phytohormones. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.
National Research Council Canada - National Science Library
Wang, Yong-Dong
1999-01-01
.... The key approach is to prevent the binding of two transcription factors, ESX and AP-2, to the consensus DNA binding sites contained within the Her2/neu promoter resulting in inhibition of transcription factor function...
International Nuclear Information System (INIS)
Mullins, D'Anna N; Crawford, Erin L; Khuder, Sadik A; Hernandez, Dawn-Alita; Yoon, Youngsook; Willey, James C
2005-01-01
Cigarette smoking is the primary cause of bronchogenic carcinoma (BC), yet only 10–15% of heavy smokers develop BC and it is likely that this variation in risk is, in part, genetically determined. We previously reported a set of antioxidant genes for which transcript abundance was lower in normal bronchial epithelial cells (NBEC) of BC individuals compared to non-BC individuals. In unpublished studies of the same NBEC samples, transcript abundance values for several DNA repair genes were correlated with these antioxidant genes. From these data, we hypothesized that antioxidant and DNA repair genes are co-regulated by one or more transcription factors and that inter-individual variation in expression and/or function of one or more of these transcription factors is responsible for inter-individual variation in risk for BC. The putative transcription factor recognition sites common to six of the antioxidant genes were identified through in silico DNA sequence analysis. The transcript abundance values of these transcription factors (n = 6) and an expanded group of antioxidant and DNA repair genes (n = 16) were measured simultaneously by quantitative PCR in NBEC of 24 non-BC and 25 BC individuals. CEBPG transcription factor was significantly (p < 0.01) correlated with eight of the antioxidant or DNA repair genes in non-BC individuals but not in BC individuals. In BC individuals the correlation with CEBPG was significantly (p < 0.01) lower than that of non-BC individuals for four of the genes (XRCC1, ERCC5, GSTP1, and SOD1) and the difference was nearly significant for GPX1. The only other transcription factor correlated with any of these five target genes in non-BC individuals was E2F1. E2F1 was correlated with GSTP1 among non-BC individuals, but in contrast to CEBPG, there was no significant difference in this correlation in non-BC individuals compared to BC individuals. We conclude that CEBPG is the transcription factor primarily responsible for regulating
A Herpesviral Immediate Early Protein Promotes Transcription Elongation of Viral Transcripts.
Fox, Hannah L; Dembowski, Jill A; DeLuca, Neal A
2017-06-13
Herpes simplex virus 1 (HSV-1) genes are transcribed by cellular RNA polymerase II (RNA Pol II). While four viral immediate early proteins (ICP4, ICP0, ICP27, and ICP22) function in some capacity in viral transcription, the mechanism by which ICP22 functions remains unclear. We observed that the FACT complex (comprised of SSRP1 and Spt16) was relocalized in infected cells as a function of ICP22. ICP22 was also required for the association of FACT and the transcription elongation factors SPT5 and SPT6 with viral genomes. We further demonstrated that the FACT complex interacts with ICP22 throughout infection. We therefore hypothesized that ICP22 recruits cellular transcription elongation factors to viral genomes for efficient transcription elongation of viral genes. We reevaluated the phenotype of an ICP22 mutant virus by determining the abundance of all viral mRNAs throughout infection by transcriptome sequencing (RNA-seq). The accumulation of almost all viral mRNAs late in infection was reduced compared to the wild type, regardless of kinetic class. Using chromatin immunoprecipitation sequencing (ChIP-seq), we mapped the location of RNA Pol II on viral genes and found that RNA Pol II levels on the bodies of viral genes were reduced in the ICP22 mutant compared to wild-type virus. In contrast, the association of RNA Pol II with transcription start sites in the mutant was not reduced. Taken together, our results indicate that ICP22 plays a role in recruiting elongation factors like the FACT complex to the HSV-1 genome to allow for efficient viral transcription elongation late in viral infection and ultimately infectious virion production. IMPORTANCE HSV-1 interacts with many cellular proteins throughout productive infection. Here, we demonstrate the interaction of a viral protein, ICP22, with a subset of cellular proteins known to be involved in transcription elongation. We determined that ICP22 is required to recruit the FACT complex and other transcription
Komatsu, Setsuko; Takasaki, Hironori
2009-07-01
Genes regulated by gibberellin (GA) during leaf sheath elongation in rice seedlings were identified using the transcriptome approach. mRNA from the basal regions of leaf sheaths treated with GA3 was analyzed by high-coverage gene expression profiling. 33,004 peaks were detected, and 30 transcripts showed significant changes in the presence of GA3. Among these, basic helix-loop-helix transcription factor (AK073385) was significantly upregulated. Quantitative PCR analysis confirmed that expression of AK073385 was controlled by GA3 in a time- and dose-dependent manner. Basic helix-loop-helix transcription factor (AK073385) is therefore involved in the regulation of gene expression by GA3.
Transcriptional control of megakaryocyte development.
Goldfarb, A N
2007-10-15
Megakaryocytes are highly specialized cells that arise from a bipotent megakaryocytic-erythroid progenitor (MEP). This developmental leap requires coordinated activation of megakaryocyte-specific genes, radical changes in cell cycle properties, and active prevention of erythroid differentiation. These programs result from upregulation of megakaryocyte-selective transcription factors, downregulation of erythroid-selective transcription factors and ongoing mediation of common erythro-megakaryocytic transcription factors. Unlike most developmental programs, no single lineage-unique family of master regulators exerts executive control over the megakaryocytic plan. Rather, an assemblage of non-unique factors and signals converge to determine lineage and differentiation. In human megakaryopoiesis, hereditary disorders of platelet production have confirmed contributions from three distinct transcription factor families. Murine models have extended this repertoire to include multiple additional factors. At a mechanistic level, the means by which these non-unique factors collaborate in the establishment of a perfectly unique cell type remains a central question.
Induction of specific neuron types by overexpression of single transcription factors.
Teratani-Ota, Yusuke; Yamamizu, Kohei; Piao, Yulan; Sharova, Lioudmila; Amano, Misa; Yu, Hong; Schlessinger, David; Ko, Minoru S H; Sharov, Alexei A
2016-10-01
Specific neuronal types derived from embryonic stem cells (ESCs) can facilitate mechanistic studies and potentially aid in regenerative medicine. Existing induction methods, however, mostly rely on the effects of the combined action of multiple added growth factors, which generally tend to result in mixed populations of neurons. Here, we report that overexpression of specific transcription factors (TFs) in ESCs can rather guide the differentiation of ESCs towards specific neuron lineages. Analysis of data on gene expression changes 2 d after induction of each of 185 TFs implicated candidate TFs for further ESC differentiation studies. Induction of 23 TFs (out of 49 TFs tested) for 6 d facilitated neural differentiation of ESCs as inferred from increased proportion of cells with neural progenitor marker PSA-NCAM. We identified early activation of the Notch signaling pathway as a common feature of most potent inducers of neural differentiation. The majority of neuron-like cells generated by induction of Ascl1, Smad7, Nr2f1, Dlx2, Dlx4, Nr2f2, Barhl2, and Lhx1 were GABA-positive and expressed other markers of GABAergic neurons. In the same way, we identified Lmx1a and Nr4a2 as inducers for neurons bearing dopaminergic markers and Isl1, Fezf2, and St18 for cholinergic motor neurons. A time-course experiment with induction of Ascl1 showed early upregulation of most neural-specific messenger RNA (mRNA) and microRNAs (miRNAs). Sets of Ascl1-induced mRNAs and miRNAs were enriched in Ascl1 targets. In further studies, enrichment of cells obtained with the induction of Ascl1, Smad7, and Nr2f1 using microbeads resulted in essentially pure population of neuron-like cells with expression profiles similar to neural tissues and expressed markers of GABAergic neurons. In summary, this study indicates that induction of transcription factors is a promising approach to generate cultures that show the transcription profiles characteristic of specific neural cell types.
Kast, Brigitte; Schori, Christian; Grimm, Christian
2016-05-01
Hypoxic preconditioning protects photoreceptors against light-induced degeneration preserving retinal morphology and function. Although hypoxia inducible transcription factors 1 and 2 (HIF1, HIF2) are the main regulators of the hypoxic response, photoreceptor protection does not depend on HIF1 in rods. Here we used rod-specific Hif2a single and Hif1a;Hif2a double knockout mice to investigate the potential involvement of HIF2 in rods for protection after hypoxic preconditioning. To identify potential HIF2 target genes in rods we determined the retinal transcriptome of hypoxic control and rod-specific Hif2a knockouts by RNA sequencing. We show that rods do not need HIF2 for hypoxia-induced increased survival after light exposure. The transcriptomic analysis revealed a number of genes that are potentially regulated by HIF2 in rods; among those were Htra1, Timp3 and Hmox1, candidates that are interesting due to their connection to human degenerative diseases of the retina. We conclude that neither HIF1 nor HIF2 are required in photoreceptors for protection by hypoxic preconditioning. We hypothesize that HIF transcription factors may be needed in other cells to produce protective factors acting in a paracrine fashion on photoreceptor cells. Alternatively, hypoxic preconditioning induces a rod-intrinsic response that is independent of HIF transcription factors. Copyright © 2015 Elsevier Ltd. All rights reserved.
Srivastava, Ankita; Bhattacharya, Alok; Bhattacharya, Sudha; Jhingan, Gagan Deep
2016-03-01
Initiation of rDNA transcription requires the assembly of a specific multi-protein complex at the rDNA promoter containing the RNA Pol I with auxiliary factors. One of these factors is known as Rrn3P in yeast and Transcription Initiation Factor IA (TIF-IA) in mammals. Rrn3p/TIF-IA serves as a bridge between RNA Pol I and the pre-initiation complex at the promoter. It is phosphorylated at multiple sites and is involved in regulation of rDNA transcription in a growth-dependent manner. In the early branching parasitic protist Entamoeba histolytica, the rRNA genes are present exclusively on circular extra chromosomal plasmids. The protein factors involved in regulation of rDNA transcription in E. histolytica are not known. We have identified the E. histolytica equivalent of TIF-1A (EhTIF-IA) by homology search within the database and was further cloned and expressed. Immuno-localization studies showed that EhTIF-IA co-localized partially with fibrillarin in the peripherally localized nucleolus. EhTIF-IA was shown to interact with the RNA Pol I-specific subunit RPA12 both in vivo and in vitro. Mass spectroscopy data identified RNA Pol I-specific subunits and other nucleolar proteins to be the interacting partners of EhTIF-IA. Our study demonstrates for the first time a conserved putative RNA Pol I transcription factor TIF-IA in E. histolytica.
Design of a novel 6-DOF planar maglev system
International Nuclear Information System (INIS)
Lai, Y.-C.; Yen, J.-Y.
2006-01-01
This paper describes a novel single-deck and six degree-of-freedom (DOF) planar maglev positioning system design. The proposed design uses an array of solenoids to levitate and to hold a permanent magnet carrier in place. The solenoids are excited separately to generate restoring forces when the permanent magnet carrier is displaced from its equilibrium position. The research uses the ANSOFT finite element analysis simulation to analyze the solenoid restoring forces and to motivate a suitable permanent magnets arrangement. Active control on the solenoid currents is then used to maintain the carrier position. The system identification is carried out by perturbing the experimental set-up from its equilibrium position. The simulation results based on the identification models show that simple control is effective for maintaining the carrier position. Initial implementation has also showed that the concept is feasible
Signatures of DNA target selectivity by ETS transcription factors.
Poon, Gregory M K; Kim, Hye Mi
2017-05-27
The ETS family of transcription factors is a functionally heterogeneous group of gene regulators that share a structurally conserved, eponymous DNA-binding domain. DNA target specificity derives from combinatorial interactions with other proteins as well as intrinsic heterogeneity among ETS domains. Emerging evidence suggests molecular hydration as a fundamental feature that defines the intrinsic heterogeneity in DNA target selection and susceptibility to epigenetic DNA modification. This perspective invokes novel hypotheses in the regulation of ETS proteins in physiologic osmotic stress, their pioneering potential in heterochromatin, and the effects of passive and pharmacologic DNA demethylation on ETS regulation.
Mga2 transcription factor regulates an oxygen-responsive lipid homeostasis pathway in fission yeast
DEFF Research Database (Denmark)
Burr, Risa; Stewart, Emerson V; Shao, Wei
2016-01-01
-binding protein (SREBP) transcription factors regulate lipid homeostasis. In mammals, SREBP-2 controls cholesterol biosynthesis, whereas SREBP-1 controls triacylglycerol and glycerophospholipid biosynthesis. In the fission yeast Schizosaccharomyces pombe, the SREBP-2 homolog Sre1 regulates sterol homeostasis....... In the absence of mga2, fission yeast exhibited growth defects under both normoxia and low oxygen conditions. Mga2 transcriptional targets were enriched for lipid metabolism genes, and mga2Δ cells showed disrupted triacylglycerol and glycerophospholipid homeostasis, most notably with an increase in fatty acid...
Yokoyama, Ken Daigoro; Pollock, David D.
2012-01-01
Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins. PMID:23019068
Directory of Open Access Journals (Sweden)
Lee Sanghyuk
2008-09-01
Full Text Available Abstract Background Sox10, a member of the Sry-related HMG-Box gene family, is a critical transcription factor for several important cell lineages, most notably the neural crest stem cells and the derivative peripheral glial cells and melanocytes. Thus far, only a handful of direct target genes are known for this transcription factor limiting our understanding of the biological network it governs. Results We describe identification of multiple direct regulatory target genes of Sox10 through a procedure based on function and conservation. By combining RNA interference technique and DNA microarray technology, we have identified a set of genes that show significant down-regulation upon introduction of Sox10 specific siRNA into Schwannoma cells. Subsequent comparative genomics analyses led to potential binding sites for Sox10 protein conserved across several mammalian species within the genomic region proximal to these genes. Multiple sites belonging to 4 different genes (proteolipid protein, Sox10, extracellular superoxide dismutase, and pleiotrophin were shown to directly interact with Sox10 by chromatin immunoprecipitation assay. We further confirmed the direct regulation through the identified cis-element for one of the genes, extracellular superoxide dismutase, using electrophoretic mobility shift assay and reporter assay. Conclusion In sum, the process of combining differential expression profiling and comparative genomics successfully led to further defining the role of Sox10, a critical transcription factor for the development of peripheral glia. Our strategy utilizing relatively accessible techniques and tools should be applicable to studying the function of other transcription factors.
Transcription Factor Zbtb20 Controls Regional Specification of Mammalian Archicortex
DEFF Research Database (Denmark)
Rosenthal, Eva Helga
2010-01-01
Combinatorial expression of sets of transcription factors (TFs) along the mammalian cortex controls its subdivision into functional areas. Unlike neocortex, only few recent data suggest genetic mechanisms controlling the regionalization of the archicortex. TF Emx2 plays a crucial role in patterning...... later on becoming restricted exclusively to postmitotic neurons of hippocampus (Hi) proper, dentate gyrus (DG), and two transitory zones, subiculum (S) and retrosplenial cortex (Rsp). Analysis of Zbtb20-/- mice revealed altered cortical patterning at the border between neocortex and archicortex...
Directory of Open Access Journals (Sweden)
Regina Augustin
2011-01-01
Full Text Available The molecular mechanisms and genetic risk factors underlying Alzheimer's disease (AD pathogenesis are only partly understood. To identify new factors, which may contribute to AD, different approaches are taken including proteomics, genetics, and functional genomics. Here, we used a bioinformatics approach and found that distinct AD-related genes share modules of transcription factor binding sites, suggesting a transcriptional coregulation. To detect additional coregulated genes, which may potentially contribute to AD, we established a new bioinformatics workflow with known multivariate methods like support vector machines, biclustering, and predicted transcription factor binding site modules by using in silico analysis and over 400 expression arrays from human and mouse. Two significant modules are composed of three transcription factor families: CTCF, SP1F, and EGRF/ZBPF, which are conserved between human and mouse APP promoter sequences. The specific combination of in silico promoter and multivariate analysis can identify regulation mechanisms of genes involved in multifactorial diseases.
Larabee, Jason L; Hocker, James R; Hanas, Jay S
2009-03-01
The anti-inflammatory selenium compounds, ebselen (2-phenyl-1,2-benzisoselenazol-3[2H]-one) and selenite, were found to alter the DNA binding mechanisms and structures of cysteine-rich zinc-finger transcription factors. As assayed by DNase I protection, DNA binding by TFIIIA (transcription factor IIIA, prototypical Cys(2)His(2) zinc finger protein), was inhibited by micromolar amounts of ebselen. In a gel shift assay, ebselen inhibited the Cys(2)His(2) zinc finger-containing DNA binding domain (DBD) of the NF-kappaB mediated transcription factor Sp1. Ebselen also inhibited DNA binding by the p50 subunit of the pro-inflammatory Cys-containing NF-kappaB transcription factor. Electrospray ionization mass spectrometry (ESI-MS) was utilized to elucidate mechanisms of chemical interaction between ebselen and a zinc-bound Cys(2)His(2) zinc finger polypeptide modeled after the third finger of Sp1 (Sp1-3). Exposing Sp1-3 to micromolar amounts of ebselen resulted in Zn(2+) release from this peptide and the formation of a disulfide bond by oxidation of zinc finger SH groups, the likely mechanism for DNA binding inhibition. Selenite was shown by ESI-MS to also eject zinc from Sp1-3 as well as induce disulfide bond formation through SH oxidation. The selenite-dependent inhibition/oxidation mechanism differed from that of ebselen by inducing the formation of a stable selenotrisulfide bond. Selenite-induced selenotrisulfide formation was dependent upon the structure of the Cys(2)His(2) zinc finger as alteration in the finger structure enhanced this reaction as well as selenite-dependent zinc release. Ebselen and selenite-dependent inhibition/oxidation of Cys-rich zinc finger proteins, with concomitant release of zinc and finger structural changes, points to mechanisms at the atomic and protein level for selenium-induced alterations in Cys-rich proteins, and possible amelioration of certain inflammatory, neurodegenerative, and oncogenic responses.
RNA-guided transcriptional regulation in planta via synthetic dCas9-based transcription factors
Piatek, Agnieszka Anna
2014-11-14
Targeted genomic regulation is a powerful approach to accelerate trait discovery and development in agricultural biotechnology. Bacteria and archaea use clustered regularly interspaced short palindromic repeats (CRISPRs) and CRISPR-associated (Cas) regulatory systems for adaptive molecular immunity against foreign nucleic acids introduced by invading phages and conjugative plasmids. The type II CRISPR/Cas system has been adapted for genome editing in many cell types and organisms. A recent study used the catalytically inactive Cas9 (dCas9) protein combined with guide-RNAs (gRNAs) as a DNA-targeting platform to modulate gene expression in bacterial, yeast, and human cells. Here, we modified this DNA-targeting platform for targeted transcriptional regulation in planta by developing chimeric dCas9-based transcriptional activators and repressors. To generate transcriptional activators, we fused the dCas9 C-terminus with the activation domains of EDLL and TAL effectors. To generate a transcriptional repressor, we fused the dCas9 C-terminus with the SRDX repression domain. Our data demonstrate that dCas9 fusion with the EDLL activation domain (dCas9:EDLL) and the TAL activation domain (dCas9:TAD), guided by gRNAs complementary to selected promoter elements, induce strong transcriptional activation on Bs3
RNA-guided transcriptional regulation in planta via synthetic dCas9-based transcription factors
Piatek, Agnieszka Anna; Ali, Zahir; Baazim, Hatoon; Li, Lixin; Abulfaraj, Aala A.; Alshareef, Sahar; Aouida, Mustapha; Mahfouz, Magdy M.
2014-01-01
Targeted genomic regulation is a powerful approach to accelerate trait discovery and development in agricultural biotechnology. Bacteria and archaea use clustered regularly interspaced short palindromic repeats (CRISPRs) and CRISPR-associated (Cas) regulatory systems for adaptive molecular immunity against foreign nucleic acids introduced by invading phages and conjugative plasmids. The type II CRISPR/Cas system has been adapted for genome editing in many cell types and organisms. A recent study used the catalytically inactive Cas9 (dCas9) protein combined with guide-RNAs (gRNAs) as a DNA-targeting platform to modulate gene expression in bacterial, yeast, and human cells. Here, we modified this DNA-targeting platform for targeted transcriptional regulation in planta by developing chimeric dCas9-based transcriptional activators and repressors. To generate transcriptional activators, we fused the dCas9 C-terminus with the activation domains of EDLL and TAL effectors. To generate a transcriptional repressor, we fused the dCas9 C-terminus with the SRDX repression domain. Our data demonstrate that dCas9 fusion with the EDLL activation domain (dCas9:EDLL) and the TAL activation domain (dCas9:TAD), guided by gRNAs complementary to selected promoter elements, induce strong transcriptional activation on Bs3
Roles of Arabidopsis WRKY3 and WRKY4 Transcription Factors in Plant Responses to Pathogens
Directory of Open Access Journals (Sweden)
Fan Baofang
2008-06-01
Full Text Available Abstract Background Plant WRKY DNA-binding transcription factors are involved in plant responses to biotic and abiotic responses. It has been previously shown that Arabidopsis WRKY3 and WRKY4, which encode two structurally similar WRKY transcription factors, are induced by pathogen infection and salicylic acid (SA. However, the role of the two WRKY transcription factors in plant disease resistance has not been directly analyzed. Results Both WRKY3 and WRKY4 are nuclear-localized and specifically recognize the TTGACC W-box sequences in vitro. Expression of WRKY3 and WRKY4 was induced rapidly by stress conditions generated by liquid infiltration or spraying. Stress-induced expression of WRKY4 was further elevated by pathogen infection and SA treatment. To determine directly their role in plant disease resistance, we have isolated T-DNA insertion mutants and generated transgenic overexpression lines for WRKY3 and WRKY4. Both the loss-of-function mutants and transgenic overexpression lines were examined for responses to the biotrophic bacterial pathogen Pseudomonas syringae and the necrotrophic fungal pathogen Botrytis cinerea. The wrky3 and wrky4 single and double mutants exhibited more severe disease symptoms and support higher fungal growth than wild-type plants after Botrytis infection. Although disruption of WRKY3 and WRKY4 did not have a major effect on plant response to P. syringae, overexpression of WRKY4 greatly enhanced plant susceptibility to the bacterial pathogen and suppressed pathogen-induced PR1 gene expression. Conclusion The nuclear localization and sequence-specific DNA-binding activity support that WRKY3 and WRKY4 function as transcription factors. Functional analysis based on T-DNA insertion mutants and transgenic overexpression lines indicates that WRKY3 and WRKY4 have a positive role in plant resistance to necrotrophic pathogens and WRKY4 has a negative effect on plant resistance to biotrophic pathogens.
Kuang, Jian-Fei; Chen, Jian-Ye; Liu, Xun-Cheng; Han, Yan-Chao; Xiao, Yun-Yi; Shan, Wei; Tang, Yang; Wu, Ke-Qiang; He, Jun-Xian; Lu, Wang-Jin
2017-04-01
Fruit ripening is a complex, genetically programmed process involving the action of critical transcription factors (TFs). Despite the established significance of dehydration-responsive element binding (DREB) TFs in plant abiotic stress responses, the involvement of DREBs in fruit ripening is yet to be determined. Here, we identified four genes encoding ripening-regulated DREB TFs in banana (Musa acuminata), MaDREB1, MaDREB2, MaDREB3, and MaDREB4, and demonstrated that they play regulatory roles in fruit ripening. We showed that MaDREB1-MaDREB4 are nucleus-localized, induced by ethylene and encompass transcriptional activation activities. We performed a genome-wide chromatin immunoprecipitation and high-throughput sequencing (ChIP-Seq) experiment for MaDREB2 and identified 697 genomic regions as potential targets of MaDREB2. MaDREB2 binds to hundreds of loci with diverse functions and its binding sites are distributed in the promoter regions proximal to the transcriptional start site (TSS). Most of the MaDREB2-binding targets contain the conserved (A/G)CC(G/C)AC motif and MaDREB2 appears to directly regulate the expression of a number of genes involved in fruit ripening. In combination with transcriptome profiling (RNA sequencing) data, our results indicate that MaDREB2 may serve as both transcriptional activator and repressor during banana fruit ripening. In conclusion, our study suggests a hierarchical regulatory model of fruit ripening in banana and that the MaDREB TFs may act as transcriptional regulators in the regulatory network. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.
Zellmer, Sebastian; Schmidt-Heck, Wolfgang; Godoy, Patricio; Weng, Honglei; Meyer, Christoph; Lehmann, Thomas; Sparna, Titus; Schormann, Wiebke; Hammad, Seddik; Kreutz, Clemens; Timmer, Jens; von Weizsäcker, Fritz; Thürmann, Petra A; Merfort, Irmgard; Guthke, Reinhard; Dooley, Steven; Hengstler, Jan G; Gebhardt, Rolf
2010-12-01
The cellular basis of liver regeneration has been intensely investigated for many years. However, the mechanisms initiating hepatocyte "plasticity" and priming for proliferation are not yet fully clear. We investigated alterations in gene expression patterns during the first 72 hours of C57BL/6N mouse hepatocyte culture on collagen monolayers (CM), which display a high basal frequency of proliferation in the absence of cytokines. Although many metabolic genes were down-regulated, genes related to mitogen-activated protein kinase (MAPK) signaling and cell cycle were up-regulated. The latter genes showed an overrepresentation of transcription factor binding sites (TFBS) for ETF (TEA domain family member 2), E2F1 (E2F transcription factor 1), and SP-1 (Sp1 transcription factor) (P ETF, E2F1, and SP-1 and displayed increased expression of E2F1. Cultivation of murine hepatocytes on CM primes cells for proliferation through cytokine-independent activation of MAPK signaling. The transcription factors ETF, E2F1, and SP-1 seem to play a pronounced role in mediating proliferation-dependent differential gene expression. Similar events, but on a shorter time-scale, occur very early after liver damage in vivo. Copyright © 2010 American Association for the Study of Liver Diseases.
"Hit-and-Run" leaves its mark: catalyst transcription factors and chromatin modification.
Varala, Kranthi; Li, Ying; Marshall-Colón, Amy; Para, Alessia; Coruzzi, Gloria M
2015-08-01
Understanding how transcription factor (TF) binding is related to gene regulation is a moving target. We recently uncovered genome-wide evidence for a "Hit-and-Run" model of transcription. In this model, a master TF "hits" a target promoter to initiate a rapid response to a signal. As the "hit" is transient, the model invokes recruitment of partner TFs to sustain transcription over time. Following the "run", the master TF "hits" other targets to propagate the response genome-wide. As such, a TF may act as a "catalyst" to mount a broad and acute response in cells that first sense the signal, while the recruited TF partners promote long-term adaptive behavior in the whole organism. This "Hit-and-Run" model likely has broad relevance, as TF perturbation studies across eukaryotes show small overlaps between TF-regulated and TF-bound genes, implicating transient TF-target binding. Here, we explore this "Hit-and-Run" model to suggest molecular mechanisms and its biological relevance. © 2015 The Authors. Bioessays published by WILEY Periodicals, Inc.
End-Effector Position Analysis Using Forward Kinematics For 5 Dof Pravak Robot Arm
Jolly Atit Shah; S.S. Rattan; B.C. Nakra
2013-01-01
Automatic control of the robotic manipulator involves study of kinematics and dynamics as a major issue. This paper involves the kinematic analysis of a Pravak Robot arm which is used for doing successful robotic manipulation task in its workspace. The Pravak Robot Arm is a 5-DOF robot having all the joints revolute. The kinematics problem is defined as the transformation from the Cartesian space to the joint space and vice versa. In this study the Denavit- Hartenberg (D-H) model is used to m...
Hohnjec, Natalija; Czaja-Hasse, Lisa F; Hogekamp, Claudia; Küster, Helge
2015-11-23
More than 80 % of all terrestrial plant species establish an arbuscular mycorrhiza (AM) symbiosis with Glomeromycota fungi. This plant-microbe interaction primarily improves phosphate uptake, but also supports nitrogen, mineral, and water aquisition. During the pre-contact stage, the AM symbiosis is controled by an exchange of diffusible factors from either partner. Amongst others, fungal signals were identified as a mix of sulfated and non-sulfated lipochitooligosaccharides (LCOs), being structurally related to rhizobial nodulation (Nod)-factor LCOs that in legumes induce the formation of nitrogen-fixing root nodules. LCO signals are transduced via a common symbiotic signaling pathway (CSSP) that activates a group of GRAS transcription factors (TFs). Using complex gene expression fingerprints as molecular phenotypes, this study primarily intended to shed light on the importance of the GRAS TFs NSP1 and RAM1 for LCO-activated gene expression during pre-symbiotic signaling. We investigated the genome-wide transcriptional responses in 5 days old primary roots of the Medicago truncatula wild type and four symbiotic mutants to a 6 h challenge with LCO signals supplied at 10(-7/-8) M. We were able to show that during the pre-symbiotic stage, sulfated Myc-, non-sulfated Myc-, and Nod-LCO-activated gene expression almost exclusively depends on the LysM receptor kinase NFP and is largely controled by the CSSP, although responses independent of this pathway exist. Our results show that downstream of the CSSP, gene expression activation by Myc-LCOs supplied at 10(-7/-8) M strictly required both the GRAS transcription factors RAM1 and NSP1, whereas those genes either co- or specifically activated by Nod-LCOs displayed a preferential NSP1-dependency. RAM1, a central regulator of root colonization by AM fungi, controled genes activated by non-sulfated Myc-LCOs during the pre-symbiotic stage that are also up-regulated in areas with early physical contact, e.g. hyphopodia and
Schliep, Martin; Ebert, Berit; Simon-Rosin, Ulrike; Zoeller, Daniela; Fisahn, Joachim
2010-05-01
Gene expression levels of several transcription factors from Arabidopsis thaliana that were described previously to be involved in leaf development and trichome formation were analysed in trichome, basal and pavement cells of mature leaves. Single cell samples of these three cells types were collected by glass micro-capillaries. Real-time reverse transcription (RT)-PCR was used to analyse expression patterns of the following transcription factors: MYB23, MYB55, AtHB1, FILAMENTOUS FLOWER (FIL)/YABBY1 (YAB1), TRIPTYCHON (TRY) and CAPRICE (CPC). A difference in the expression patterns of TRY and CPC was revealed. Contrary to the CPC expression pattern, no transcripts of TRY could be detected in pavement cells. FIL/YAB1 was exclusively expressed in trichome cells. AtHB1 was highly expressed throughout all three cell types. MYB55 was higher expressed in basal cells than in trichome and pavement cells. MYB23 showed a pattern of low expression in pavement cells, medium in basal cells and high expression in trichomes. Expression patterns obtained by single cell sampling and real-time RT-PCR were compared to promoter GUS fusions of the selected transcription factors. Therefore, we regenerated two transgenic Arabidopsis lines that expressed the GUS reporter gene under control of the promoters of MYB55 and YAB1. In conclusion, despite their function in leaf morphogenesis, all six transcription factors were detected in mature leaves. Furthermore, single cell sampling and promoter GUS staining patterns demonstrated the predominant presence of MYB55 in basal cells as compared to pavement cells and trichomes.
The metal-responsive transcription factor-1 contributes to HIF-1 activation during hypoxic stress
International Nuclear Information System (INIS)
Murphy, Brian J.; Sato, Barbara G.; Dalton, Timothy P.; Laderoute, Keith R.
2005-01-01
Hypoxia-inducible factor-1 (HIF-1), the major transcriptional regulator of the mammalian cellular response to low oxygen (hypoxia), is embedded within a complex network of signaling pathways. We have been investigating the importance of another stress-responsive transcription factor, MTF-1, for the adaptation of cells to hypoxia. This article reports that MTF-1 plays a central role in hypoxic cells by contributing to HIF-1 activity. Loss of MTF-1 in transformed Mtf1 null mouse embryonic fibroblasts (MEFs) results in an attenuation of nuclear HIF-1α protein accumulation, HIF-1 transcriptional activity, and expression of an established HIF-1 target gene, glucose transporter-1 (Glut1). Mtf1 null (Mtf1 KO) MEFs also have constitutively higher levels of both glutathione (GSH) and the rate-limiting enzyme involved in GSH synthesis-glutamate cysteine ligase catalytic subunit-than wild type cells. The altered cellular redox state arising from increased GSH may perturb oxygen-sensing mechanisms in hypoxic Mtf1 KO cells and decrease the accumulation of HIF-1α protein. Together, these novel findings define a role for MTF-1 in the regulation of HIF-1 activity
Huh, Sung Un; Choi, La Mee; Lee, Gil-Je; Kim, Young Jin; Paek, Kyung-Hee
2012-12-01
WRKY transcription factors regulate biotic, abiotic, and developmental processes. In terms of plant defense, WRKY factors have important roles as positive and negative regulators via transcriptional regulation or protein-protein interaction. Here, we report the characterization of the gene encoding Capsicum annuum WRKY transcription factor d (CaWRKYd) isolated from microarray analysis in the Tobacco mosaic virus (TMV)-P(0)-inoculated hot pepper plants. CaWRKYd belongs to the WRKY IIa group, a very small clade in the WRKY subfamily, and WRKY IIa group has positive/negative regulatory roles in Arabidopsis and rice. CaWRKYd transcripts were induced by various plant defense-related hormone treatments and TMV-P(0) inoculation. Silencing of CaWRKYd affected TMV-P(0)-mediated hypersensitive response (HR) cell death and accumulation of TMV-P(0) coat protein in local and systemic leaves. Furthermore, expression of some pathogenesis-related (PR) genes and HR-related genes was reduced in the CaWRKYd-silenced plants compared with TRV2 vector control plants upon TMV-P(0) inoculation. CaWRKYd was confirmed to bind to the W-box. Thus CaWRKYd is a newly identified Capsicum annuum WRKY transcription factor that appears to be involved in TMV-P(0)-mediated HR cell death by regulating downstream gene expression. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.
Lee, Chih-Yung Sean; Lu, Tu; Seydoux, Geraldine
2017-11-07
Nanos RNA-binding proteins are required for germline development in metazoans, but the underlying mechanisms remain poorly understood. We have profiled the transcriptome of primordial germ cells (PGCs) lacking the nanos homologs nos-1 and nos-2 in C. elegans. nos-1nos-2 PGCs fail to silence hundreds of transcripts normally expressed in oocytes. We find that this misregulation is due to both delayed turnover of maternal transcripts and inappropriate transcriptional activation. The latter appears to be an indirect consequence of delayed turnover of the maternally-inherited transcription factor LIN-15B, a synMuvB class transcription factor known to antagonize PRC2 activity. PRC2 is required for chromatin reprogramming in the germline, and the transcriptome of PGCs lacking PRC2 resembles that of nos-1nos-2 PGCs. Loss of maternal LIN-15B restores fertility to nos-1nos-2 mutants. These findings suggest that Nanos promotes germ cell fate by downregulating maternal RNAs and proteins that would otherwise interfere with PRC2-dependent reprogramming of PGC chromatin.
Prediction of nucleosome positioning based on transcription factor binding sites.
Directory of Open Access Journals (Sweden)
Xianfu Yi
Full Text Available BACKGROUND: The DNA of all eukaryotic organisms is packaged into nucleosomes, the basic repeating units of chromatin. The nucleosome consists of a histone octamer around which a DNA core is wrapped and the linker histone H1, which is associated with linker DNA. By altering the accessibility of DNA sequences, the nucleosome has profound effects on all DNA-dependent processes. Understanding the factors that influence nucleosome positioning is of great importance for the study of genomic control mechanisms. Transcription factors (TFs have been suggested to play a role in nucleosome positioning in vivo. PRINCIPAL FINDINGS: Here, the minimum redundancy maximum relevance (mRMR feature selection algorithm, the nearest neighbor algorithm (NNA, and the incremental feature selection (IFS method were used to identify the most important TFs that either favor or inhibit nucleosome positioning by analyzing the numbers of transcription factor binding sites (TFBSs in 53,021 nucleosomal DNA sequences and 50,299 linker DNA sequences. A total of nine important families of TFs were extracted from 35 families, and the overall prediction accuracy was 87.4% as evaluated by the jackknife cross-validation test. CONCLUSIONS: Our results are consistent with the notion that TFs are more likely to bind linker DNA sequences than the sequences in the nucleosomes. In addition, our results imply that there may be some TFs that are important for nucleosome positioning but that play an insignificant role in discriminating nucleosome-forming DNA sequences from nucleosome-inhibiting DNA sequences. The hypothesis that TFs play a role in nucleosome positioning is, thus, confirmed by the results of this study.
The obesity-associated transcription factor ETV5 modulates circulating glucocorticoids
Gutierrez-Aguilar, Ruth; Thompson, Abigail; Marchand, Nathalie; Dumont, Patrick; Woods, Stephen C.; de Launoit, Yvan; Seeley, Randy J.; Ulrich-Lai, Yvonne M.
2015-01-01
The transcription factor E-twenty-six version 5 (ETV5) has been linked with obesity in genome-wide association studies. Moreover, ETV5-deficient mice (knockout; KO) have reduced body weight, lower fat mass, and are resistant to diet-induced obesity, directly linking ETV5 to the regulation of energy balance and metabolism. ETV5 is expressed in hypothalamic brain regions that regulate both metabolism and HPA axis activity, suggesting that ETV5 may also modulate HPA axis function. In order to test this possibility, plasma corticosterone levels were measured in ETV5 KO and wildtype (WT) mice before (pre-stress) and after (post-stress) a mild stressor (intraperitoneal injection). ETV5 deficiency increased both pre- and post-stress plasma corticosterone, suggesting that loss of ETV5 elevated glucocorticoid tone. Consistent with this idea, ETV5 KO mice have reduced thymus weight, suggestive of increased glucocorticoid-induced thymic involution. ETV5 deficiency also decreased the mRNA expression of glucocorticoid receptor (GR), mineralocorticoid receptor (MR), and vasopressin receptor 1A in the hypothalamus, without altering vasopressin, corticotropin-releasing hormone, or oxytocin mRNA expression. In order to test whether reduced MR and GR expression affected glucocorticoid negative feedback, a dexamethasone suppression test was performed. Dexamethasone reduced plasma corticosterone in both ETV5 KO and WT mice, suggesting that glucocorticoid negative feedback was unaltered by ETV5 deficiency. In summary, these data suggest that the obesity-associated transcription factor ETV5 normally acts to diminish circulating glucocorticoids. This might occur directly via ETV5 actions on HPA-regulatory brain circuitry, and/or indirectly via ETV5-induced alterations in metabolic factors that then influence the HPA axis. PMID:25813907
Conservation of transcription factor binding events predicts gene expression across species
Hemberg, Martin; Kreiman, Gabriel
2011-01-01
Recent technological advances have made it possible to determine the genome-wide binding sites of transcription factors (TFs). Comparisons across species have suggested a relatively low degree of evolutionary conservation of experimentally defined TF binding events (TFBEs). Using binding data for six different TFs in hepatocytes and embryonic stem cells from human and mouse, we demonstrate that evolutionary conservation of TFBEs within orthologous proximal promoters is closely linked to funct...
Wang, Xingchun; Chen, Zhao; Fan, Juan; He, Miaomiao; Han, Yuanhuai; Yang, Zhirong
2015-04-01
Transcriptional regulation is one of the major regulations in plant adventious shoot regeneration, but the exact mechanism remains unclear. In our study, the RNA-seq technology based on the IlluminaHiSeq 2000 sequencing platform was used to identify differentially expressed transcription factor (TF) encoding genes during callus formation stage and adventious shoot regeneration stage between wild type and adventious shoot formation defective mutant be1-3 and during the transition from dedifferentiation to redifferentiation stage in wildtype WS. Results show that 155 TFs were differentially expressed between be1-3 mutant and wild type during callus formation, of which 97 genes were up-regulated, and 58 genes were down-regulated; and that 68 genes were differentially expressed during redifferentiation stage, with 40 genes up-regulated and 28 genes down-regulated; whereas at the transition stage from dedifferentiation to redifferention in WS wild type explants, a total of 231 differentially expressed TF genes were identified, including 160 up-regualted genes and 71 down-regulated genes. Among these TF genes, the adventious shoot related transcription factor 1 (ART1) gene encoding a MYB-related (v-myb avian myeloblastosis viral oncogene homolog) TF, was up-regulated 3 217 folds, and was the highest up-regulated gene during be1-3 callus formation. Over expression of the ART1 gene caused defects in callus formation and shoot regeneration and inhibited seedling growth, indicating that the ART1 gene is a negative regulator of callus formation and shoot regeneration. This work not only enriches our knowledge about the transcriptional regulation mechanism of adventious shoot regeneration, but also provides valuable information on candidate TF genes associated with adventious shoot regeneration for future research.
Hale, T K; Braithwaite, A W
1999-08-20
Expression of the tumor suppressor protein p53 plays an important role in regulating the cellular response to DNA damage. During adenovirus infection, levels of p53 protein also increase. It has been shown that this increase is due not only to increased stability of the p53 protein but to the transcriptional activation of the p53 gene during infection. We demonstrate here that the E1a proteins of adenovirus are responsible for activating the mouse p53 gene and that both major E1a proteins, 243R and 289R, are required for complete activation. E1a brings about the binding of two cellular transcription factors to the mouse p53 promoter. One of these, ETF, binds to three upstream sites in the p53 promoter and one downstream site, whereas E2F binds to one upstream site in the presence of E1a. Our studies indicate that E2F binding is not essential for activation of the p53 promoter but that ETF is. Our data indicate the ETF site located downstream of the start site of transcription is the key site in conferring E1a responsiveness on the p53 promoter.
Jiang, Yanjuan; Yu, Diqiu
2016-08-01
Although necrotrophic pathogens cause many devastating plant diseases, our understanding of the plant defense response to them is limited. Here, we found that loss of function of WRKY57 enhanced the resistance of Arabidopsis (Arabidopsis thaliana) against Botrytis cinerea infection. Further investigation suggested that the negative regulation of WRKY57 against B cinerea depends on the jasmonic acid (JA) signaling pathway. Chromatin immunoprecipitation experiments revealed that WRKY57 directly binds to the promoters of JASMONATE ZIM-DOMAIN1 (JAZ1) and JAZ5, encoding two important repressors of the JA signaling pathway, and activates their transcription. In vivo and in vitro experiments demonstrated that WRKY57 interacts with nuclear-encoded SIGMA FACTOR BINDING PROTEIN1 (SIB1) and SIB2. Further experiments display that the same domain, the VQ motif, of SIB1 and SIB2 interact with WRKY33 and WRKY57. Moreover, transient transcriptional activity assays confirmed that WRKY57 and WRKY33 competitively regulate JAZ1 and JAZ5, SIB1 and SIB2 further enhance these competitions of WRKY57 to WRKY33. Therefore, coordinated regulation of Arabidopsis against B cinerea by transcription activators and repressors would benefit plants by allowing fine regulation of defense. © 2016 American Society of Plant Biologists. All Rights Reserved.
Development of 3 DOF manipulator using ER fluid clutches for reduction of collision force
Boku, Kazuhiko; Nakamura, Taro
2009-02-01
.With robots and users more commonly sharing space such as in the fields of medicine and home automation, the possibility of a physical collision has increased, even though many robots use actuators with high-ratio gear trains to minimize the effects of impact. We developed a 3-DOF manipulator having a smart flexible joint using an ER fluid and a sensor-equipped pneumatic cushion. Results of position control and collision experiments using the manipulator demonstrated its effectiveness.
Development of 3 DOF manipulator using ER fluid clutches for reduction of collision force
International Nuclear Information System (INIS)
Boku, Kazuhiko; Nakamura, Taro
2009-01-01
Abstract.With robots and users more commonly sharing space such as in the fields of medicine and home automation, the possibility of a physical collision has increased, even though many robots use actuators with high-ratio gear trains to minimize the effects of impact. We developed a 3-DOF manipulator having a smart flexible joint using an ER fluid and a sensor-equipped pneumatic cushion. Results of position control and collision experiments using the manipulator demonstrated its effectiveness.
Development of 3 DOF manipulator using ER fluid clutches for reduction of collision force
Energy Technology Data Exchange (ETDEWEB)
Boku, Kazuhiko; Nakamura, Taro [Chuo University, Faculty of Science and Engineering, Department of Precision Mechanics, 1-13-27 Kasuga, Bunkyo-ku, Tokyo 112-8551 (Japan)], E-mail: k_boku@bio.mech.chuo-u.ac.jp
2009-02-01
Abstract.With robots and users more commonly sharing space such as in the fields of medicine and home automation, the possibility of a physical collision has increased, even though many robots use actuators with high-ratio gear trains to minimize the effects of impact. We developed a 3-DOF manipulator having a smart flexible joint using an ER fluid and a sensor-equipped pneumatic cushion. Results of position control and collision experiments using the manipulator demonstrated its effectiveness.
Wild type p53 transcriptionally represses the SALL2 transcription factor under genotoxic stress.
Directory of Open Access Journals (Sweden)
Carlos Farkas
Full Text Available SALL2- a member of the Spalt gene family- is a poorly characterized transcription factor found deregulated in various cancers, which suggests it plays a role in the disease. We previously identified SALL2 as a novel interacting protein of neurotrophin receptors and showed that it plays a role in neuronal function, which does not necessarily explain why or how SALL2 is deregulated in cancer. Previous evidences indicate that SALL2 gene is regulated by the WT1 and AP4 transcription factors. Here, we identified SALL2 as a novel downstream target of the p53 tumor suppressor protein. Bioinformatic analysis of the SALL2 gene revealed several putative p53 half sites along the promoter region. Either overexpression of wild-type p53 or induction of the endogenous p53 by the genotoxic agent doxorubicin repressed SALL2 promoter activity in various cell lines. However R175H, R249S, and R248W p53 mutants, frequently found in the tumors of cancer patients, were unable to repress SALL2 promoter activity, suggesting that p53 specific binding to DNA is important for the regulation of SALL2. Electrophoretic mobility shift assay demonstrated binding of p53 to one of the identified p53 half sites in the Sall2 promoter, and chromatin immunoprecipitation analysis confirmed in vivo interaction of p53 with the promoter region of Sall2 containing this half site. Importantly, by using a p53ER (TAM knockin model expressing a variant of p53 that is completely dependent on 4-hydroxy-tamoxifen for its activity, we show that p53 activation diminished SALL2 RNA and protein levels during genotoxic cellular stress in primary mouse embryo fibroblasts (MEFs and radiosensitive tissues in vivo. Thus, our finding indicates that p53 represses SALL2 expression in a context-specific manner, adding knowledge to the understanding of SALL2 gene regulation, and to a potential mechanism for its deregulation in cancer.