WorldWideScience

Sample records for dof protein dag1

  1. Arabidopsis CDS blastp result: AK288349 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK288349 J090023P19 At2g46590.1 68415.m05811 Dof zinc finger protein DAG2 / Dof affecting germination... 2 (DAG2) identical to SP|Q9ZPY0 DOF zinc finger protein DAG2 (Dof affecting germination 2) {Arabidopsis thaliana} 1e-23 ...

  2. Arabidopsis CDS blastp result: AK241364 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK241364 J065152E11 At2g46590.1 68415.m05811 Dof zinc finger protein DAG2 / Dof affecting germination... 2 (DAG2) identical to SP|Q9ZPY0 DOF zinc finger protein DAG2 (Dof affecting germination 2) {Arabidopsis thaliana} 2e-20 ...

  3. DAG1, no gene for RNA regulation?

    Science.gov (United States)

    Brancaccio, Andrea

    2012-04-10

    DAG1 encodes for a precursor protein that liberates the two subunits featured by the dystroglycan (DG) adhesion complex that are involved in an increasing number of cellular functions in a wide variety of cells and tissues. Aside from the proteolytic events producing the α and β subunits, especially the former undergoes extensive "post-production" modifications taking place within the ER/Golgi where its core protein is both N- and O-decorated with sugars. These post-translational events, that are mainly orchestrated by a plethora of certified, or putative, glycosyltransferases, prelude to the excocytosis-mediated trafficking and targeting of the DG complex to the plasma membrane. Extensive genetic and biochemical evidences have been accumulated so far on α-DG glycosylation, while little is know on possible regulatory events underlying the chromatine activation, transcription or post-transcription (splicing and escape from the nucleus) of DAG1 or of its mRNA. A scenario is envisaged in which cells would use a sort of preferential, and scarcely regulated, route for DAG1 activation, that would imply fast mRNA transcription, maturation and export to the cytosol, and would prelude to the multiple time-consuming enzymatic post-translational activities needed for its glycosylation. Such a provocative view might be helpful to trigger future work aiming at disclosing the complete molecular mechanisms underlying DAG1 activation and at improving our knowledge of any pre-translational step that is involved in dystroglycan regulation. Copyright © 2012 Elsevier B.V. All rights reserved.

  4. The DOF transcription factor Dof5.1 influences leaf axial patterning by promoting Revoluta transcription in Arabidopsis

    KAUST Repository

    Kim, Hyungsae

    2010-10-05

    Dof proteins are transcription factors that have a conserved single zinc finger DNA-binding domain. In this study, we isolated an activation tagging mutant Dof5.1-D exhibiting an upward-curling leaf phenotype due to enhanced expression of the REV gene that is required for establishing adaxialabaxial polarity. Dof5.1-D plants also had reduced transcript levels for IAA6 and IAA19 genes, indicating an altered auxin biosynthesis in Dof5.1-D. An electrophoretic mobility shift assay using the Dof5.1 DNA-binding motif and the REV promoter region indicated that the DNA-binding domain of Dof5.1 binds to a TAAAGT motif located in the 5′-distal promoter region of the REV promoter. Further, transient and chromatin immunoprecipitation assays verified binding activity of the Dof5.1 DNA-binding motif with the REV promoter. Consistent with binding assays, constitutive over-expression of the Dof5.1 DNA-binding domain in wild-type plants caused a downward-curling phenotype, whereas crossing Dof5.1-D to a rev mutant reverted the upward-curling phenotype of the Dof5.1-D mutant leaf to the wild-type. These results suggest that the Dof5.1 protein directly binds to the REV promoter and thereby regulates adaxialabaxial polarity. © 2010 Blackwell Publishing Ltd.

  5. The DOF transcription factor Dof5.1 influences leaf axial patterning by promoting Revoluta transcription in Arabidopsis

    KAUST Repository

    Kim, Hyungsae; Kim, Sungjin; Abbasi, Nazia; Bressan, Ray Anthony; Yun, Daejin; Yoo, Sangdong; Kwon, SukYun; Choi, Sangbong

    2010-01-01

    Dof proteins are transcription factors that have a conserved single zinc finger DNA-binding domain. In this study, we isolated an activation tagging mutant Dof5.1-D exhibiting an upward-curling leaf phenotype due to enhanced expression of the REV gene that is required for establishing adaxialabaxial polarity. Dof5.1-D plants also had reduced transcript levels for IAA6 and IAA19 genes, indicating an altered auxin biosynthesis in Dof5.1-D. An electrophoretic mobility shift assay using the Dof5.1 DNA-binding motif and the REV promoter region indicated that the DNA-binding domain of Dof5.1 binds to a TAAAGT motif located in the 5′-distal promoter region of the REV promoter. Further, transient and chromatin immunoprecipitation assays verified binding activity of the Dof5.1 DNA-binding motif with the REV promoter. Consistent with binding assays, constitutive over-expression of the Dof5.1 DNA-binding domain in wild-type plants caused a downward-curling phenotype, whereas crossing Dof5.1-D to a rev mutant reverted the upward-curling phenotype of the Dof5.1-D mutant leaf to the wild-type. These results suggest that the Dof5.1 protein directly binds to the REV promoter and thereby regulates adaxialabaxial polarity. © 2010 Blackwell Publishing Ltd.

  6. Direct activation of Transient Receptor Potential Vanilloid 1(TRPV1 by Diacylglycerol (DAG

    Directory of Open Access Journals (Sweden)

    Oh Seog

    2008-10-01

    Full Text Available Abstract The capsaicin receptor, known as transient receptor potential channel vanilloid subtype 1 (TRPV1, is activated by a wide range of noxious stimulants and putative ligands such as capsaicin, heat, pH, anandamide, and phosphorylation by protein kinase C (PKC. However, the identity of endogenous activators for TRPV1 under physiological condition is still debated. Here, we report that diacylglycerol (DAG directly activates TRPV1 channel in a membrane-delimited manner in rat dorsal root ganglion (DRG neurons. 1-oleoyl-2-acetyl-sn-glycerol (OAG, a membrane-permeable DAG analog, elicited intracellular Ca2+ transients, cationic currents and cobalt uptake that were blocked by TRPV1-selective antagonists, but not by inhibitors of PKC and DAG lipase in rat DRG neurons or HEK 293 cells heterologously expressing TRPV1. OAG induced responses were about one fifth of capsaicin induced signals, suggesting that OAG displays partial agonism. We also found that endogenously produced DAG can activate rat TRPV1 channels. Mutagenesis of rat TRPV1 revealed that DAG-binding site is at Y511, the same site for capsaicin binding, and PtdIns(4,5P2binding site may not be critical for the activation of rat TRPV1 by DAG in heterologous system. We propose that DAG serves as an endogenous ligand for rat TRPV1, acting as an integrator of Gq/11-coupled receptors and receptor tyrosine kinases that are linked to phospholipase C.

  7. Fluctuation of Dof1/Dof2 expression ratio under the influence of varying nitrogen and light conditions: involvement in differential regulation of nitrogen metabolism in two genotypes of finger millet (Eleusine coracana L.).

    Science.gov (United States)

    Gupta, Supriya; Gupta, Sanjay Mohan; Gupta, Alok Kumar; Gaur, Vikram Singh; Kumar, Anil

    2014-08-10

    In order to gain insights into the mechanism of high nitrogen use efficiency (NUE) of finger millet (FM) the role of Dof2 transcription factor (TF), which is a repressor of genes involved in C/N metabolism was investigated. The partial cDNA fragment of EcDof2 (912-bp; GenBank acc. no. KF261117) was isolated and characterized from finger millet (FM) that showed 63% and 58% homology with Dof2 of Zea mays at nucleotide and protein level, respectively. Its expression studies were carried out along with the activator EcDof1 in two genotypes (GE3885, high protein genotype (HPG); GE1437, low protein genotype (LPG)) of FM differing in grain protein contents (13.8% and 6.2%) showed that EcDof2 is expressed in both shoot and root tissues with significantly (p≤0.05) higher expression in the roots. The diurnal expression of both EcDof1 and EcDof2 in shoots was differential having different time of peak expression indicating a differential response to diurnal condition. Under continuous dark conditions, expression of EcDof1 and EcDof2 oscillated in both the genotypes whereas on illumination, the fold expression of EcDof1 was higher as compared to EcDof2. Under increasing nitrate concentration, EcDof2 expression increases in roots and shoots of LPG while it remains unchanged in HPG. However, the EcDof1 expression was found to increase in both genotypes. Further, time kinetics studies under single nitrate concentration revealed that EcDof2 was repressed in the roots of both genotypes whereas EcDof1 oscillated with time. The EcDof1/EcDof2 ratio measured showed differential response under different light and nitrogen conditions. It was higher in the roots of HPG indicating higher activation of genes involved in N uptake and assimilation resulting in high grain protein accumulation. The results indicate that both light and nitrogen concentration influence Dof1 and Dof2 expression and suggests a complex pattern of regulation of genes influenced by these plant specific TFs. In

  8. ThDof1.4 and ThZFP1 constitute a transcriptional regulatory cascade involved in salt or osmotic stress in Tamarix hispida.

    Science.gov (United States)

    Zang, Dandan; Wang, Lina; Zhang, Yiming; Zhao, Huimin; Wang, Yucheng

    2017-07-01

    Identification of the upstream regulators of a gene is important to characterize the transcriptional pathway and the function of the gene. Previously, we found that a zinc finger protein (ThZFP1) is involved in abiotic stress tolerance of Tamarix hispida. In the present study, we further investigated the transcriptional pathway of ThZFP1. Dof motifs are abundant in the ThZFP1 promoter; therefore, we used them to screen for transcriptional regulators of ThZFP1. A Dof protein, ThDof1.4, binds to the Dof motif specifically, and was hypothesized as the upstream regulator of ThZFP1. Further study showed that overexpression of ThDof1.4 in T. hispida activated the expression of GUS controlled by the ThZFP1 promoter. In T. hispida, transient overexpression of ThDof1.4 increased the transcripts of ThZFP1; conversely, transient RNAi-silencing of ThDof1.4 reduced the expression of ThZFP1. Chromatin immunoprecipitation indicated that ThDof1.4 binds to the ThZFP1 promoter. Additionally, ThDof1.4 and ThZFP1 share similar expression patterns in response to salt or drought stress. Furthermore, like ThZFP1, ThDof1.4 could increase the proline level and enhance ROS scavenging capability to improve salt and osmotic stress tolerance. Together, these results suggested that ThDof1.4 and ThZFP1 form a transcriptional regulatory cascade involved in abiotic stress resistance in T. hispida.

  9. Kokkos' Task DAG Capabilities.

    Energy Technology Data Exchange (ETDEWEB)

    Edwards, Harold C. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Ibanez, Daniel Alejandro [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2017-09-01

    This report documents the ASC/ATDM Kokkos deliverable "Production Portable Dy- namic Task DAG Capability." This capability enables applications to create and execute a dynamic task DAG ; a collection of heterogeneous computational tasks with a directed acyclic graph (DAG) of "execute after" dependencies where tasks and their dependencies are dynamically created and destroyed as tasks execute. The Kokkos task scheduler executes the dynamic task DAG on the target execution resource; e.g. a multicore CPU, a manycore CPU such as Intel's Knights Landing (KNL), or an NVIDIA GPU. Several major technical challenges had to be addressed during development of Kokkos' Task DAG capability: (1) portability to a GPU with it's simplified hardware and micro- runtime, (2) thread-scalable memory allocation and deallocation from a bounded pool of memory, (3) thread-scalable scheduler for dynamic task DAG, (4) usability by applications.

  10. Diagnostic Analyzer for Gearboxes (DAG): User's Guide. Version 3.1 for Microsoft Windows 3.1

    Science.gov (United States)

    Jammu, Vinay B.; Kourosh, Danai

    1997-01-01

    This documentation describes the Diagnostic Analyzer for Gearboxes (DAG) software for performing fault diagnosis of gearboxes. First, the user would construct a graphical representation of the gearbox using the gear, bearing, shaft, and sensor tools contained in the DAG software. Next, a set of vibration features obtained by processing the vibration signals recorded from the gearbox using a signal analyzer is required. Given this information, the DAG software uses an unsupervised neural network referred to as the Fault Detection Network (FDN) to identify the occurrence of faults, and a pattern classifier called Single Category-Based Classifier (SCBC) for abnormality scaling of individual vibration features. The abnormality-scaled vibration features are then used as inputs to a Structure-Based Connectionist Network (SBCN) for identifying faults in gearbox subsystems and components. The weights of the SBCN represent its diagnostic knowledge and are derived from the structure of the gearbox graphically presented in DAG. The outputs of SBCN are fault possibility values between 0 and 1 for individual subsystems and components in the gearbox with a 1 representing a definite fault and a 0 representing normality. This manual describes the steps involved in creating the diagnostic gearbox model, along with the options and analysis tools of the DAG software.

  11. On non-linear dynamics of coupled 1+1DOF versus 1+1/2DOF Electro-Mechanical System

    DEFF Research Database (Denmark)

    Darula, Radoslav; Sorokin, Sergey

    2014-01-01

    The electro-mechanical systems (EMS) are used from nano-/micro-scale (NEMS/MEMS) up to macro-scale applications. From mathematical view point, they are modelled with the second order differential equation (or a set of equations) for mechanical system, which is nonlinearly coupled with the second...... or the first order differential equation (or a set of equations) for electrical system, depending on properties of the electrical circuit. For the sake of brevity, we assume a 1DOF mechanical system, coupled to 1 or 1/2DOF electrical system (depending whether the capacitance is, or is not considered......). In the paper, authors perform a parametric study to identify operation regimes, where the capacitance term contributes to the non-linear behaviour of the coupled system. To accomplish this task, the classical method of multiple scales is used. The parametric study allows us to assess for which applications...

  12. The family of DOF transcription factors in Brachypodium distachyon: phylogenetic comparison with rice and barley DOFs and expression profiling

    Directory of Open Access Journals (Sweden)

    Hernando-Amado Sara

    2012-11-01

    Full Text Available Abstract Background Transcription factors (TFs are proteins that have played a central role both in evolution and in domestication, and are major regulators of development in living organisms. Plant genome sequences reveal that approximately 7% of all genes encode putative TFs. The DOF (DNA binding with One Finger TF family has been associated with vital processes exclusive to higher plants and to their close ancestors (algae, mosses and ferns. These are seed maturation and germination, light-mediated regulation, phytohormone and plant responses to biotic and abiotic stresses, etc. In Hordeum vulgare and Oryza sativa, 26 and 30 different Dof genes, respectively, have been annotated. Brachypodium distachyon has been the first Pooideae grass to be sequenced and, due to its genomic, morphological and physiological characteristics, has emerged as the model system for temperate cereals, such as wheat and barley. Results Through searches in the B. distachyon genome, 27 Dof genes have been identified and a phylogenetic comparison with the Oryza sativa and the Hordeum vulgare DOFs has been performed. To explore the evolutionary relationship among these DOF proteins, a combined phylogenetic tree has been constructed with the Brachypodium DOFs and those from rice and barley. This phylogenetic analysis has classified the DOF proteins into four Major Cluster of Orthologous Groups (MCOGs. Using RT-qPCR analysis the expression profiles of the annotated BdDof genes across four organs (leaves, roots, spikes and seeds has been investigated. These results have led to a classification of the BdDof genes into two groups, according to their expression levels. The genes highly or preferentially expressed in seeds have been subjected to a more detailed expression analysis (maturation, dry stage and germination. Conclusions Comparison of the expression profiles of the Brachypodium Dof genes with the published functions of closely related DOF sequences from the cereal

  13. Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

    Science.gov (United States)

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-12-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

  14. Genome-wide characterization of the SiDof gene family in foxtail millet (Setaria italica).

    Science.gov (United States)

    Zhang, Li; Liu, Baoling; Zheng, Gewen; Zhang, Aiying; Li, Runzhi

    2017-01-01

    Dof (DNA binding with one finger) proteins, which constitute a class of transcription factors found exclusively in plants, are involved in numerous physiological and biochemical reactions affecting growth and development. A genome-wide analysis of SiDof genes was performed in this study. Thirty five SiDof genes were identified and those genes were unevenly distributed across nine chromosomes in the Seteria italica genome. Protein lengths, molecular weights, and theoretical isoelectric points of SiDofs all vary greatly. Gene structure analysis demonstrated that most SiDof genes lack introns. Phylogenetic analysis of SiDof proteins and Dof proteins from Arabidopsis thaliana, rice, sorghum, and Setaria viridis revealed six major groups. Analysis of RNA-Seq data indicated that SiDof gene expression levels varied across roots, stems, leaves, and spike. In addition, expression profiling of SiDof genes in response to stress suggested that SiDof 7 and SiDof 15 are involved in drought stress signalling. Overall, this study could provide novel information on SiDofs for further investigation in foxtail millet. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  15. Dag

    African Journals Online (AJOL)

    USER

    2017-01-24

    Jan 24, 2017 ... Dag HammarskjЎld Institute for Peace and Conflict Studies, Copperbelt University, P.O. ... There was little or no participation of all stakeholders in the programme leading to ... world views are incorporated. ..... communities of their very livelihoods. .... Eviction for Conservation: A Global ... Ministry of Tourism,.

  16. Can we believe the DAGs?

    DEFF Research Database (Denmark)

    Aalen, O. O.; Røysland, K.; Gran, J. M.

    2016-01-01

    Directed acyclic graphs (DAGs) play a large role in the modern approach to causal inference. DAGs describe the relationship between measurements taken at various discrete times including the effect of interventions. The causal mechanisms, on the other hand, would naturally be assumed to be a cont...

  17. Transcriptome-Based Analysis of Dof Family Transcription Factors and Their Responses to Abiotic Stress in Tea Plant (Camellia sinensis

    Directory of Open Access Journals (Sweden)

    Hui Li

    2016-01-01

    Full Text Available Tea plant (Camellia sinensis (L. O. Kuntze is affected by abiotic stress during its growth and development. DNA-binding with one finger (Dof transcription factors (TFs play important roles in abiotic stress tolerance of plants. In this study, a total of 29 putative Dof TFs were identified based on transcriptome of tea plant, and the conserved domains and common motifs of these CsDof TFs were predicted and analyzed. The 29 CsDof proteins were divided into 7 groups (A, B1, B2, C1, C2.1, C2.2, and D2, and the interaction networks of Dof proteins in C. sinensis were established according to the data in Arabidopsis. Gene expression was analyzed in “Yingshuang” and “Huangjinya” under four experimental stresses by qRT-PCR. CsDof genes were expressed differentially and related to different abiotic stress conditions. In total, our results might suggest that there is a potential relationship between CsDof factors and tea plant stress resistance.

  18. DAG tales: the multiple faces of diacylglycerol--stereochemistry, metabolism, and signaling.

    Science.gov (United States)

    Eichmann, Thomas Oliver; Lass, Achim

    2015-10-01

    The neutral lipids diacylglycerols (DAGs) are involved in a plethora of metabolic pathways. They function as components of cellular membranes, as building blocks for glycero(phospho)lipids, and as lipid second messengers. Considering their central role in multiple metabolic processes and signaling pathways, cellular DAG levels require a tight regulation to ensure a constant and controlled availability. Interestingly, DAG species are versatile in their chemical structure. Besides the different fatty acid species esterified to the glycerol backbone, DAGs can occur in three different stereo/regioisoforms, each with unique biological properties. Recent scientific advances have revealed that DAG metabolizing enzymes generate and distinguish different DAG isoforms, and that only one DAG isoform holds signaling properties. Herein, we review the current knowledge of DAG stereochemistry and their impact on cellular metabolism and signaling. Further, we describe intracellular DAG turnover and its stereochemistry in a 3-pool model to illustrate the spatial and stereochemical separation and hereby the diversity of cellular DAG metabolism.

  19. Hvad betyder Holocaust i dag?

    DEFF Research Database (Denmark)

    Wæhrens, Anne

    2013-01-01

    Holocaust er del af europæernes fælles arv, men hvilken betydning har folkedrabet i dag? Hvorfor bliver Holocaust stadig mindet, og er der andre dele af historiens skyggesider, som også bør blive mindet?......Holocaust er del af europæernes fælles arv, men hvilken betydning har folkedrabet i dag? Hvorfor bliver Holocaust stadig mindet, og er der andre dele af historiens skyggesider, som også bør blive mindet?...

  20. Kontrola kvalitete DOF 2

    OpenAIRE

    Kozić, Ružica; Meštrić, Lucija

    2013-01-01

    Projekt studentske radionice bio je kontrola DOF-a u mjerilu 1:2000 na području općine Đurđevac. Proveden je terenski dio kontrole točnosti DMR-a, DOF-a, izvedene signalizacije te načina signalizacije. Mjerenja su obavljena 19.travnja 2013. godine. Obavljena je ponovna izmjera GPS točaka homogenog polja Đurđevac RTK metodom u sustavu CROPOS s ciljem kontrole tih točaka, čije su koordinate već određene u sklopu izrade DOF2. Uz trajno stabilizirane točke homogenog polja, RTK metodom snimane su ...

  1. VPipe: Virtual Pipelining for Scheduling of DAG Stream Query Plans

    Science.gov (United States)

    Wang, Song; Gupta, Chetan; Mehta, Abhay

    There are data streams all around us that can be harnessed for tremendous business and personal advantage. For an enterprise-level stream processing system such as CHAOS [1] (Continuous, Heterogeneous Analytic Over Streams), handling of complex query plans with resource constraints is challenging. While several scheduling strategies exist for stream processing, efficient scheduling of complex DAG query plans is still largely unsolved. In this paper, we propose a novel execution scheme for scheduling complex directed acyclic graph (DAG) query plans with meta-data enriched stream tuples. Our solution, called Virtual Pipelined Chain (or VPipe Chain for short), effectively extends the "Chain" pipelining scheduling approach to complex DAG query plans.

  2. Genome-wide analysis of the Dof transcription factor gene family reveals soybean-specific duplicable and functional characteristics.

    Directory of Open Access Journals (Sweden)

    Yong Guo

    Full Text Available The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max. In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.

  3. Development of diacyltetrol lipids as activators for the C1 domain of protein kinase C.

    Science.gov (United States)

    Mamidi, Narsimha; Gorai, Sukhamoy; Mukherjee, Rakesh; Manna, Debasis

    2012-04-01

    The protein kinase C (PKC) family of serine/threonine kinases is an attractive drug target for the treatment of cancer and other diseases. Diacylglycerol (DAG), phorbol esters and others act as ligands for the C1 domain of PKC isoforms. Inspection of the crystal structure of the PKCδ C1b subdomain in complex with phorbol-13-O-acetate shows that one carbonyl group and two hydroxyl groups play pivotal roles in recognition of the C1 domain. To understand the importance of two hydroxyl groups of phorbol esters in PKC binding and to develop effective PKC activators, we synthesized DAG like diacyltetrols (DATs) and studied binding affinities with C1b subdomains of PKCδ and PKCθ. DATs, with the stereochemistry of natural DAGs at the sn-2 position, were synthesized from (+)-diethyl L-tartrate in four to seven steps as single isomers. The calculated EC(50) values for the short and long chain DATs varied in the range of 3-6 μM. Furthermore, the fluorescence anisotropy values of the proteins were increased in the presence of DATs in a similar manner to that of DAGs. Molecular docking of DATs (1b-4b) with PKCδ C1b showed that the DATs form hydrogen bonds with the polar residues and backbone of the protein, at the same binding site, as that of DAG and phorbol esters. Our findings reveal that DATs represent an attractive group of C1 domain ligands that can be used as research tools or further structurally modified for potential drug development.

  4. The LET Procedure for Prosthetic Myocontrol: Towards Multi-DOF Control Using Single-DOF Activations.

    Directory of Open Access Journals (Sweden)

    Markus Nowak

    Full Text Available Simultaneous and proportional myocontrol of dexterous hand prostheses is to a large extent still an open problem. With the advent of commercially and clinically available multi-fingered hand prostheses there are now more independent degrees of freedom (DOFs in prostheses than can be effectively controlled using surface electromyography (sEMG, the current standard human-machine interface for hand amputees. In particular, it is uncertain, whether several DOFs can be controlled simultaneously and proportionally by exclusively calibrating the intended activation of single DOFs. The problem is currently solved by training on all required combinations. However, as the number of available DOFs grows, this approach becomes overly long and poses a high cognitive burden on the subject. In this paper we present a novel approach to overcome this problem. Multi-DOF activations are artificially modelled from single-DOF ones using a simple linear combination of sEMG signals, which are then added to the training set. This procedure, which we named LET (Linearly Enhanced Training, provides an augmented data set to any machine-learning-based intent detection system. In two experiments involving intact subjects, one offline and one online, we trained a standard machine learning approach using the full data set containing single- and multi-DOF activations as well as using the LET-augmented data set in order to evaluate the performance of the LET procedure. The results indicate that the machine trained on the latter data set obtains worse results in the offline experiment compared to the full data set. However, the online implementation enables the user to perform multi-DOF tasks with almost the same precision as single-DOF tasks without the need of explicitly training multi-DOF activations. Moreover, the parameters involved in the system are statistically uniform across subjects.

  5. Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

    OpenAIRE

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-01-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, a...

  6. Members of the Dof transcription factor family in Triticum aestivum are associated with light-mediated gene regulation.

    Science.gov (United States)

    Shaw, Lindsay M; McIntyre, C Lynne; Gresshoff, Peter M; Xue, Gang-Ping

    2009-11-01

    DNA binding with One Finger (Dof) protein is a plant-specific transcription factor implicated in the regulation of many important plant-specific processes, including photosynthesis and carbohydrate metabolism. This study has identified 31 Dof genes (TaDof) in bread wheat through extensive analysis of current nucleotide databases. Phylogenetic analysis suggests that the TaDof family can be divided into four clades. Expression analysis of the TaDof family across all major organs using quantitative RT-PCR and searches of the wheat genome array database revealed that the majority of TaDof members were predominately expressed in vegetative organs. A large number of TaDof members were down-regulated by drought and/or were responsive to the light and dark cycle. Further expression analysis revealed that light up-regulated TaDof members were highly correlated in expression with a number of genes that are involved in photosynthesis or sucrose transport. These data suggest that the TaDof family may have an important role in light-mediated gene regulation, including involvement in the photosynthetic process.

  7. Mineral, protein and nitrate contents in leaves of Pereskia aculeata subjected to nitrogen fertilization

    Directory of Open Access Journals (Sweden)

    Maria Regina de Miranda Souza

    2016-03-01

    Full Text Available Considering that nitrogen is directly related to leaf protein content, the nitrogen fertilization in Pereskia aculeata plants may affect the protein content and increase its nutritional potential. This study aimed at assessing the effect of nitrogen fertilization on mineral, protein and nitrate contents, as well as the yield of P. aculeata leaves. A randomized blocks design was used, with three replications and five treatments, consisting of increasing topdressing nitrogen doses (0-400 kg ha-1, in soil with organic matter content of 4.0 dag kg-1. Three harvests were performed for leaf analysis. No significant effect was observed for mineral and protein content or leaf fresh mass yield. The mean values for mineral composition were: 3.52 dag kg-1 of N, 0.47 dag kg-1 of P, 4.65 dag kg-1 of Ca, 0.71 dag kg-1 of Mg, 0.25 dag kg-1 of S, 36.64 mg kg-1 of Zn and 174.13 mg kg-1 of Fe. The mean content for protein was 21.86 % and the leaf fresh mass yield was 0.971 kg plant-1. K levels decreased from 50 kg ha-1 of N. Nitrate increased linearly with the nitrogen fertilization, reaching a maximum value of 78.2 mg kg-1 of fresh mass, well below the health risk threshold. It was concluded that a soil with high organic matter content does not require nitrogen fertilization. However, doses up to 400 kg ha-1 of nitrogen ensure adequate leaf yield and protein and mineral contents within the desired range for the species, being a food rich in proteins, iron and calcium.

  8. DigDag

    DEFF Research Database (Denmark)

    Knudsen, Bo Nissen

    , e.g. boundary changes, name changes as well as changes in administrative structures. Seen over centuries, public and ecclesiastical administration becomes increasingly complex, resulting in ever increasing needs for updates in administrative divisions. A substantial number of digitised archival...... registers in Denmark use, among others, geographical/administrative entrances. The entrance is usually a topographical code (e.g. settlement, parish) or local authority jurisdiction (e.g. customs service, police districts). Due to changes in the administrative divisions, most of the geocodes are unique...... to each archive, or archival system. The DigDag project establishes a uniform research infrastructure through a webGIS within history, archaeology, place-names, statistics and geography: a digital cartographical skeleton for thematic mapping and analysis which will generate new interdisciplinary research...

  9. Directed acyclic graphs (DAGs): an aid to assess confounding in dental research.

    Science.gov (United States)

    Merchant, Anwar T; Pitiphat, Waranuch

    2002-12-01

    Confounding, a special type of bias, occurs when an extraneous factor is associated with the exposure and independently affects the outcome. In order to get an unbiased estimate of the exposure-outcome relationship, we need to identify potential confounders, collect information on them, design appropriate studies, and adjust for confounding in data analysis. However, it is not always clear which variables to collect information on and adjust for in the analyses. Inappropriate adjustment for confounding can even introduce bias where none existed. Directed acyclic graphs (DAGs) provide a method to select potential confounders and minimize bias in the design and analysis of epidemiological studies. DAGs have been used extensively in expert systems and robotics. Robins (1987) introduced the application of DAGs in epidemiology to overcome shortcomings of traditional methods to control for confounding, especially as they related to unmeasured confounding. DAGs provide a quick and visual way to assess confounding without making parametric assumptions. We introduce DAGs, starting with definitions and rules for basic manipulation, stressing more on applications than theory. We then demonstrate their application in the control of confounding through examples of observational and cross-sectional epidemiological studies.

  10. Bloei-inductie bij Chrysant onder lange dag : toepassing van LED-licht technologie

    NARCIS (Netherlands)

    Ieperen, van W.; Hogewoning, S.W.; Dam, ten E.

    2011-01-01

    Deze publicatie beschrijft een onderzoek naar daglengte verlenging tijdens de korte dag bij chrysant met behoud van bloei door sturing met speciale LED belichting. In klimaatkamerproeven met LEDs (zonder natuurlijk licht) kon bij Chrysant bloemknopaanleg worden geïnduceerd onder een lange dag (LD),

  11. 60 kvinnor per dag undersoeks nu med vaerldsunikt digitalt mammografisystem fraan Sectra

    CERN Multimedia

    2003-01-01

    "Helsingborgs kvinnor faar kraftigt saenkt straaldos fraan mammografi60 kvinnor per dag undersoeks nu med vaerldsunikt digitalt mammografisystem fraan SectraSectras digitala mammografisystem, Sectra MicroDose Mammography, har nu passerat 1.500 undersoekta kvinnor inom Helsingborgs Lasaretts screeningprogram foer mammografi" (1 page).

  12. Alcohol binding in the C1 (C1A + C1B) domain of protein kinase C epsilon

    Science.gov (United States)

    Pany, Satyabrata; Das, Joydip

    2015-01-01

    Background Alcohol regulates the expression and function of protein kinase C epsilon (PKCε). In a previous study we identified an alcohol binding site in the C1B, one of the twin C1 subdomains of PKCε. Methods In this study, we investigated alcohol binding in the entire C1 domain (combined C1A and C1B) of PKCε. Fluorescent phorbol ester, SAPD and fluorescent diacylglycerol (DAG) analog, dansyl-DAG were used to study the effect of ethanol, butanol, and octanol on the ligand binding using fluorescence resonance energy transfer (FRET). To identify alcohol binding site(s), PKCεC1 was photolabeled with 3-azibutanol and 3-azioctanol, and analyzed by mass spectrometry. The effects of alcohols and the azialcohols on PKCε were studied in NG108-15 cells. Results In the presence of alcohol, SAPD and dansyl-DAG showed different extent of FRET, indicating differential effects of alcohol on the C1A and C1B subdomains. Effects of alcohols and azialcohols on PKCε in NG108-15 cells were comparable. Azialcohols labeled Tyr-176 of C1A and Tyr-250 of C1B. Inspection of the model structure of PKCεC1 reveals that these residues are 40 Å apart from each other indicating that these residues form two different alcohol binding sites. Conclusions The present results provide evidence for the presence of multiple alcohol-binding sites on PKCε and underscore the importance of targeting this PKC isoform in developing alcohol antagonists. PMID:26210390

  13. The DAG1 transcription factor negatively regulates the seed-to-seedling transition in Arabidopsis acting on ABA and GA levels

    Czech Academy of Sciences Publication Activity Database

    Boccaccini, A.; Lorrai, R.; Ruta, V.; Frey, A.; Mercey-Boutet, S.; Marion-Poll, F.; Tarkowská, Danuše; Strnad, Miroslav; Costantino, P.; Vittorioso, P.

    2016-01-01

    Roč. 16, SEP 9 (2016), s. 198 ISSN 1471-2229 R&D Projects: GA MŠk LK21306; GA MŠk(CZ) LO1204; GA ČR GA14-34792S Institutional support: RVO:61389030 Keywords : DAG1 * Seed development * Chromatin remodelling Subject RIV: EF - Botanics Impact factor: 3.964, year: 2016

  14. Phosphorylation of synaptotagmin-1 controls a post-priming step in PKC-dependent presynaptic plasticity

    DEFF Research Database (Denmark)

    de Jong, Arthur P H; Meijer, Marieke; Saarloos, Ingrid

    2016-01-01

    Presynaptic activation of the diacylglycerol (DAG)/protein kinase C (PKC) pathway is a central event in short-term synaptic plasticity. Two substrates, Munc13-1 and Munc18-1, are essential for DAG-induced potentiation of vesicle priming, but the role of most presynaptic PKC substrates is not unde......Presynaptic activation of the diacylglycerol (DAG)/protein kinase C (PKC) pathway is a central event in short-term synaptic plasticity. Two substrates, Munc13-1 and Munc18-1, are essential for DAG-induced potentiation of vesicle priming, but the role of most presynaptic PKC substrates...... is not understood. Here, we show that a mutation in synaptotagmin-1 (Syt1(T112A)), which prevents its PKC-dependent phosphorylation, abolishes DAG-induced potentiation of synaptic transmission in hippocampal neurons. This mutant also reduces potentiation of spontaneous release, but only if alternative Ca(2+)sensors...

  15. Kinematics and Dynamics Analysis of a 3-DOF Upper-Limb Exoskeleton with an Internally Rotated Elbow Joint

    OpenAIRE

    Xin Wang; Qiuzhi Song; Xiaoguang Wang; Pengzhan Liu

    2018-01-01

    The contradiction between self-weight and load capacity of a power-assisted upper-limb exoskeleton for material hanging is unresolved. In this paper, a non-anthropomorphic 3-degree of freedom (DOF) upper-limb exoskeleton with an internally rotated elbow joint is proposed based on an anthropomorphic 5-DOF upper-limb exoskeleton for power-assisted activity. The proposed 3-DOF upper-limb exoskeleton contains a 2-DOF shoulder joint and a 1-DOF internally rotated elbow joint. The structural parame...

  16. Multiple sources of 1,2-diacylglycerol in isolated rat pancreatic acini stimulated by cholecystokinin. Involvement of phosphatidylinositol bisphosphate and phosphatidylcholine hydrolysis

    International Nuclear Information System (INIS)

    Matozaki, T.; Williams, J.A.

    1989-01-01

    Changes in the cellular content of 1,2-diacylglycerol (DAG) in isolated rat pancreatic acini in response to agonist stimulation were studied using a sensitive mass assay. When acini were stimulated by 10 nM COOH-terminal cholecystokinin-octapeptide (CCK8), the increase in DAG was biphasic, consisting of an early peak at 5 s and a second, larger, gradual increase that was maximal by 15 min. The basal level of DAG in acini was 1.04 nmol/mg of protein, which was increased to 1.24 nmol/mg of protein at 5 s and 2.76 nmol/mg of protein at 30 min. In comparison, the increase in DAG stimulated by 30 pM CCK8, a submaximal concentration for amylase release, was monophasic, increasing without an early peak but sustained to 60 min. Other Ca2+-mobilizing secretagogues such as carbamylcholine and bombesin increased DAG in acini, whereas vasoactive intestinal peptide, which acts to increase cAMP, had no effect. Phorbol ester and Ca2+ ionophore also stimulated DAG production. Analysis of the mass level of inositol 1,4,5-trisphosphate (1,4,5-IP3) showed that the generation of 1,4,5-IP3 stimulated by 10 nM CCK8 peaked at 5 s, a finding consistent with the early peak of DAG. The basal level was 4.7 pmol/mg of protein, which was increased to 144.6 pmol/mg of protein at 5 s by 10 nM CCK8. The levels of 1,4,5-IP3 then returned toward basal in contrast to the gradual and sustained increase of DAG. The dose dependencies of 1,4,5-IP3 and DAG formation at 5 s with respect to CCK8 were almost identical. This suggests that phosphatidylinositol 4,5-bisphosphate hydrolysis is a major source of the early increase in DAG but not of the sustained increase in DAG. Therefore, a possible contribution of phosphatidylcholine hydrolysis to DAG formation was examined utilizing acini prelabeled with [3H]choline. CCK8 (1 nM) maximally increased [3H]choline metabolite release by 133% of control at 30 min

  17. I dag er eleven altid måske-egnet

    DEFF Research Database (Denmark)

    Hamre, Bjørn

    2013-01-01

    "Måske-egnet" er i nutiden blevet ophøjet til et pædagogisk ideal, som elever inkluderes og ekskluderes efter. Det ses i de helt særlige forestillinger, der er knyttet til at manifestere sig som lærerende i skolen i dag. Forestillingen om læring ses ikke alene i skolen, men afspejles i en...... samfundsdiskurs, hvor livslang læring er blevet et bærende ideal. Elever i skolen fikseres i en måske-egnethed, der betyder at de aldrig for alvor dømmes ude, men heller aldrig kan føles sig sikre på at være indenfor. Hvor elever tidligere blev dømt ude på grund af manglende evner, omfattes elever i dag af et...

  18. Transcriptome analyses of the Dof-like gene family in grapevine reveal its involvement in berry, flower and seed development.

    Science.gov (United States)

    da Silva, Danielle Costenaro; da Silveira Falavigna, Vítor; Fasoli, Marianna; Buffon, Vanessa; Porto, Diogo Denardi; Pappas, Georgios Joannis; Pezzotti, Mario; Pasquali, Giancarlo; Revers, Luís Fernando

    2016-01-01

    The Dof (DNA-binding with one finger) protein family spans a group of plant transcription factors involved in the regulation of several functions, such as plant responses to stress, hormones and light, phytochrome signaling and seed germination. Here we describe the Dof-like gene family in grapevine (Vitis vinifera L.), which consists of 25 genes coding for Dof. An extensive in silico characterization of the VviDofL gene family was performed. Additionally, the expression of the entire gene family was assessed in 54 grapevine tissues and organs using an integrated approach with microarray (cv Corvina) and real-time PCR (cv Pinot Noir) analyses. The phylogenetic analysis comparing grapevine sequences with those of Arabidopsis, tomato, poplar and already described Dof genes in other species allowed us to identify several duplicated genes. The diversification of grapevine DofL genes during evolution likely resulted in a broader range of biological roles. Furthermore, distinct expression patterns were identified between samples analyzed, corroborating such hypothesis. Our expression results indicate that several VviDofL genes perform their functional roles mainly during flower, berry and seed development, highlighting their importance for grapevine growth and production. The identification of similar expression profiles between both approaches strongly suggests that these genes have important regulatory roles that are evolutionally conserved between grapevine cvs Corvina and Pinot Noir.

  19. DAG-based attack and defense modeling: don’t miss the forest for the attack trees

    NARCIS (Netherlands)

    Kordy, Barbara; Piètre-Cambacédès, Ludovic; Schweitzer, Patrick

    2015-01-01

    This paper presents the current state of the art on attack and defense modeling approaches that are based on directed acyclic graphs (DAGs). DAGs allow for a hierarchical decomposition of complex scenarios into simple, easily understandable and quantifiable actions. Methods based on threat trees and

  20. Partial disruption of lipolysis increases postexercise insulin sensitivity in skeletal muscle despite accumulation of DAG

    DEFF Research Database (Denmark)

    Serup, Annette Karen Lundbeck; Alsted, Thomas Junker; Jordy, Andreas Børsting

    2016-01-01

    reactivity in vitro, we investigated if the described function of DAGs as mediators of lipid-induced insulin resistance was depending on the different DAG-isomers. We measured insulin stimulated glucose uptake in hormone sensitive lipase (HSL) knock out (KO) mice after treadmill exercise to stimulate...

  1. Design and implementation of a 2-DOF PID compensation for magnetic levitation systems.

    Science.gov (United States)

    Ghosh, Arun; Rakesh Krishnan, T; Tejaswy, Pailla; Mandal, Abhisek; Pradhan, Jatin K; Ranasingh, Subhakant

    2014-07-01

    This paper employs a 2-DOF (degree of freedom) PID controller for compensating a physical magnetic levitation system. It is shown that because of having a feedforward gain in the proposed 2-DOF PID control, the transient performance of the compensated system can be changed in a desired manner unlike the conventional 1-DOF PID control. It is also shown that for a choice of PID parameters, although the theoretical loop robustness is the same for both the compensated systems, in real-time, 2-DOF PID control may provide superior robustness if a suitable choice of the feedforward parameter is made. The results are verified through simulations and experiments. Copyright © 2014 ISA. Published by Elsevier Ltd. All rights reserved.

  2. A novel integrated 4-DOF radial hybrid magnetic bearing for MSCMG

    Energy Technology Data Exchange (ETDEWEB)

    Jinji, Sun; Ziyan, Ju [School of Instrumentation Science & Opto-electronics Engineering, Beijing University of Aeronautics and Astronautics, Science and Technology on Inertial Laboratory, Beijing 100191 (China); Weitao, Han, E-mail: hanweitaotao@163.com [CRRC Qingdao Sifang CO., LTD, Qingdao 266111 (China); Gang, Liu [School of Instrumentation Science & Opto-electronics Engineering, Beijing University of Aeronautics and Astronautics, Science and Technology on Inertial Laboratory, Beijing 100191 (China)

    2017-01-01

    This paper proposes a novel integrated radial hybrid magnetic bearing (RHMB) for application with the small-sized magnetically suspended control moment gyroscope (MSCMG), which can control four degrees of freedom (4-DOFs), including two radial translational DOFs and two radial tilting DOFs, and provide the axial passive resilience. The configuration and working principle of the RHMB are introduced. Mathematical models of radial force, axial resilience and moment are established by using equivalent magnetic circuit method (EMCM), from which the radial force–radial displacement, radial force–current relationships are derived, as well as axial resilience–axial displacement, moment–tilting angle and moment–current. Finite element method (FEM) is also applied to analyze the performance and characteristics of the RHMB. The analysis results are in good agreement with that calculated by the EMCM, which is helpful in designing, optimizing and controlling the RHMB. The comparisons between the performances of the integrated 4-DOF RHMB and the traditional 4-DOF RHMB are made. The contrast results indicate that the proposed integrated 4-DOF RHMB possesses better performance compared to the traditional structure, such as copper loss, current stiffness, and tilting current stiffness. - Highlights: • An integrated 4-DOF RHMB is proposed for the small-sized MSCMG. • The 4-DOF RHMB has good linear force–displacement and force–current characteristics. • The RHMB has good linear moment–current and the moment–tilting angle characteristic.

  3. Research of a New 6-Dof Force Feedback Hand Controller System

    Directory of Open Access Journals (Sweden)

    Xin Gao

    2014-01-01

    Full Text Available The field of teleoperation with force telepresence has expanded its scope to include manipulation at different scales and in virtual worlds, and the key component of which is force feedback hand controller. This paper presents a novel force feedback hand controller system, including a 3-dof translational and 3-dof rotational hand controllers, respectively, to implement position and posture teleoperation of the robot end effector. The 3-dof translational hand controller adopts innovative three-axes decoupling structure based on the linear motor; the 3-dof rotational hand controller adopts serial mechanism based on three-axes intersecting at one point, improving its overall stiffness. Based on the kinematics, statics, and dynamics analyses for two platforms separately, the system applies big closed-loop force control method based on the zero force/torque, improving the feedback force/torque accuracy effectively. Experimental results show that self-developed 6-dof force feedback hand controller has good mechanical properties. The translational hand controller has the following advantages: simple kinematics solver, fast dynamic response, and better than 0.05 mm accuracy of three-axis end positioning, while the advantages of the rotational hand controller are wide turning space, larger than 1 Nm feedback, greater than 180 degrees of operating space of three axes, respectively, and high operation precision.

  4. TH-EF-BRB-08: Robotic Motion Compensation for Radiation Therapy: A 6DOF Phantom Study

    Energy Technology Data Exchange (ETDEWEB)

    Belcher, AH; Liu, X; Wiersma, R [The University of Chicago, Chicago, IL (United States)

    2016-06-15

    Purpose: The high accuracy of frame-based stereotactic radiosurgery (SRS), which uses a rigid frame fixed to the patient’s skull, is offset by potential drawbacks of poor patient compliance and clinical workflow restrictions. Recent research into frameless SRS has so far resulted in reduced accuracy. In this study, we investigate the use of a novel 6 degree-of-freedom (6DOF) robotic head motion cancellation system that continuously detects and compensates for patient head motions during a SRS delivery. This approach has the potential to reduce invasiveness while still achieving accuracies better or equal to traditional frame-based SRS. Methods: A 6DOF parallel kinematics robotics stage was constructed, and controlled using an inverse kinematics-based motion compensation algorithm. A 6DOF stereoscopic infrared (IR) marker tracking system was used to monitor real-time motions at sub-millimeter and sub-degree levels. A novel 6DOF calibration technique was first applied to properly orient the camera coordinate frame to match that of the LINAC and robotic control frames. Simulated head motions were measured by the system, and the robotic stage responded to these 6DOF motions automatically, returning the reflective marker coordinate frame to its original position. Results: After the motions were introduced to the system in the phantom-based study, the robotic stage automatically and rapidly returned the phantom to LINAC isocenter. When errors exceeded the compensation lower threshold of 0.25 mm or 0.25 degrees, the system registered the 6DOF error and generated a cancellation trajectory. The system responded in less than 0.5 seconds and returned all axes to less than 0.1 mm and 0.1 degree after the 6DOF compensation was performed. Conclusion: The 6DOF real-time motion cancellation system was found to be effective at compensating for translational and rotational motions to current SRS requirements. This system can improve frameless SRS by automatically returning

  5. TH-EF-BRB-08: Robotic Motion Compensation for Radiation Therapy: A 6DOF Phantom Study

    International Nuclear Information System (INIS)

    Belcher, AH; Liu, X; Wiersma, R

    2016-01-01

    Purpose: The high accuracy of frame-based stereotactic radiosurgery (SRS), which uses a rigid frame fixed to the patient’s skull, is offset by potential drawbacks of poor patient compliance and clinical workflow restrictions. Recent research into frameless SRS has so far resulted in reduced accuracy. In this study, we investigate the use of a novel 6 degree-of-freedom (6DOF) robotic head motion cancellation system that continuously detects and compensates for patient head motions during a SRS delivery. This approach has the potential to reduce invasiveness while still achieving accuracies better or equal to traditional frame-based SRS. Methods: A 6DOF parallel kinematics robotics stage was constructed, and controlled using an inverse kinematics-based motion compensation algorithm. A 6DOF stereoscopic infrared (IR) marker tracking system was used to monitor real-time motions at sub-millimeter and sub-degree levels. A novel 6DOF calibration technique was first applied to properly orient the camera coordinate frame to match that of the LINAC and robotic control frames. Simulated head motions were measured by the system, and the robotic stage responded to these 6DOF motions automatically, returning the reflective marker coordinate frame to its original position. Results: After the motions were introduced to the system in the phantom-based study, the robotic stage automatically and rapidly returned the phantom to LINAC isocenter. When errors exceeded the compensation lower threshold of 0.25 mm or 0.25 degrees, the system registered the 6DOF error and generated a cancellation trajectory. The system responded in less than 0.5 seconds and returned all axes to less than 0.1 mm and 0.1 degree after the 6DOF compensation was performed. Conclusion: The 6DOF real-time motion cancellation system was found to be effective at compensating for translational and rotational motions to current SRS requirements. This system can improve frameless SRS by automatically returning

  6. Rocking motion of structures under earthquakes. Overturning of 2-DOF system

    International Nuclear Information System (INIS)

    Kobayashi, Koichi; Watanabe, Tetsuya; Tanaka, Kihachiro; Tomoda, Akinori

    2011-01-01

    In recent years, huge earthquakes happen, for example, The South Hyogo prefecture Earthquake in 1995, The Mid Niigata Prefecture Earthquake in 2004, The Iwate-Miyagi Nairiku Earthquake in 2008. In The Niigataken Chuetsu-oki Earthquake in 2007, hundreds of drums fell down and water spilled out. A lot of studies about rocking behavior of rigid body had been performed from 1960's. However, these studies were only for a specific condition of the structure size or input vibration characteristics. Therefore, generalizes fall condition for earthquake is required. This paper deals with the analytical and the experimental study of the rocking vibration of 1-DOF rocking system, 2-DOF vibration-rocking system and 2-DOF rocking system under earthquakes. In this study, the equation of motion for each rocking systems are developed. The numerical model of 2-DOF rocking system is evaluated by free rocking experiment. In this paper, 'Overturning Map' which can distinguish whether structures falls or not is proposed. The overturning map of each rocking systems excited by the artificial earthquake wave calculated from the design spectrum is shown. As the result, overturning condition of structures is clarified. (author)

  7. The Dag Hammarskjold Library Reaches Out to the World.

    Science.gov (United States)

    Chepesiuk, Ron

    1998-01-01

    Describes services offered at the Dag Hammarskjold Library at the United Nations (UN). Highlights include adopting new technology for a virtual library; the international law collection which is now accessible through the World Wide Web; UN depository libraries; material available on the Internet; the Optical Disk System, a storage/retrieval…

  8. Control of 4-DOF MR haptic master for medical application

    Science.gov (United States)

    Oh, Jong-Seok; Choi, Seung-Hyun; Choi, Seung-Bok

    2014-03-01

    In this work, magnetorheological (MR) based haptic master for robot-assisted minimally invasive surgery (RMIS) is proposed and analyzed. Using a controllable MR fluid, the masters can generate a reflection force with the 4-DOF motion. The proposed master consists of two actuators: MR clutch featuring gimbal mechanism for 2-DOF rotational motion (X and Y axes) and MR clutch attached at gripper of gimbal structures for 1-DOF rotational motion (Z axis) and 1-DOF translational motion. After analyzing the dynamic motion by integrating mechanical and physical properties of the actuators, torque model of the proposed haptic master is derived. For realization of master-slave system, an encoder which can measure position information is integrated with the MR haptic master. In the RMIS system, the measured position is converted as a command signal and sent to the slave robot. In this work, slave and organ of patient are modeled in virtual space. In order to embody a human organ into virtual space, a volumetric deformable object is mathematically formulated by a shape retaining chain linked (S-chain) model. Accordingly, the haptic architecture is established by incorporating the virtual slave with the master device in which the reflection force and desired position originated from the object of the virtual slave and operator of the master, respectively, are transferred to each other. In order to achieve the desired force trajectories, a proportional-integral-derivative (PID) controller is designed and implemented. It has been demonstrated that the effective tracking control performance for the desired motion of reflection force is well presented in time domain.

  9. Kinematics and Dynamics Analysis of a 3-DOF Upper-Limb Exoskeleton with an Internally Rotated Elbow Joint

    Directory of Open Access Journals (Sweden)

    Xin Wang

    2018-03-01

    Full Text Available The contradiction between self-weight and load capacity of a power-assisted upper-limb exoskeleton for material hanging is unresolved. In this paper, a non-anthropomorphic 3-degree of freedom (DOF upper-limb exoskeleton with an internally rotated elbow joint is proposed based on an anthropomorphic 5-DOF upper-limb exoskeleton for power-assisted activity. The proposed 3-DOF upper-limb exoskeleton contains a 2-DOF shoulder joint and a 1-DOF internally rotated elbow joint. The structural parameters of the 3-DOF upper-limb exoskeleton were determined, and the differences and singularities of the two exoskeletons were analyzed. The workspace, the joint torques and the power consumption of two exoskeletons were analyzed by kinematics and dynamics, and an exoskeleton prototype experiment was performed. The results showed that, compared with a typical anthropomorphic upper-limb exoskeleton, the non-anthropomorphic 3-DOF upper-limb exoskeleton had the same actual workspace; eliminated singularities within the workspace; improved the elbow joint force situation; and the maximum elbow joint torque, elbow external-flexion/internal-extension and shoulder flexion/extension power consumption were significantly reduced. The proposed non-anthropomorphic 3-DOF upper-limb exoskeleton can be applied to a power-assisted upper-limb exoskeleton in industrial settings.

  10. Sphingomyelin synthases regulate protein trafficking and secretion.

    Directory of Open Access Journals (Sweden)

    Marimuthu Subathra

    Full Text Available Sphingomyelin synthases (SMS1 and 2 represent a class of enzymes that transfer a phosphocholine moiety from phosphatidylcholine onto ceramide thus producing sphingomyelin and diacylglycerol (DAG. SMS1 localizes at the Golgi while SMS2 localizes both at the Golgi and the plasma membrane. Previous studies from our laboratory showed that modulation of SMS1 and, to a lesser extent, of SMS2 affected the formation of DAG at the Golgi apparatus. As a consequence, down-regulation of SMS1 and SMS2 reduced the localization of the DAG-binding protein, protein kinase D (PKD, to the Golgi. Since PKD recruitment to the Golgi has been implicated in cellular secretion through the trans golgi network (TGN, the effect of down-regulation of SMSs on TGN-to-plasma membrane trafficking was studied. Down regulation of either SMS1 or SMS2 significantly retarded trafficking of the reporter protein vesicular stomatitis virus G protein tagged with GFP (VSVG-GFP from the TGN to the cell surface. Inhibition of SMSs also induced tubular protrusions from the trans Golgi network reminiscent of inhibited TGN membrane fission. Since a recent study demonstrated the requirement of PKD activity for insulin secretion in beta cells, we tested the function of SMS in this model. Inhibition of SMS significantly reduced insulin secretion in rat INS-1 cells. Taken together these results provide the first direct evidence that both enzymes (SMS1 and 2 are capable of regulating TGN-mediated protein trafficking and secretion, functions that are compatible with PKD being a down-stream target for SMSs in the Golgi.

  11. Production of DagA and ethanol by sequential utilization of sugars in a mixed-sugar medium simulating microalgal hydrolysate.

    Science.gov (United States)

    Park, Juyi; Hong, Soon-Kwang; Chang, Yong Keun

    2015-09-01

    A novel two-step fermentation process using a mixed-sugar medium mimicking microalgal hydrolysate has been proposed to avoid glucose repression and thus to maximize substrate utilization efficiency. When DagA, a β-agarase was produced in one step in the mixed-sugar medium by using a recombinant Streptomyces lividans, glucose was found to have negative effects on the consumption of the other sugars and DagA biosynthesis causing low substrate utilization efficiency and low DagA productivity. To overcome such difficulties, a new strategy of sequential substrate utilization was developed. In the first step, glucose was consumed by Saccharomyces cerevisiae together with galactose and mannose producing ethanol, after which DagA was produced from the remaining sugars of xylose, rhamnose and ribose. Fucose was not consumed. By adopting this two-step process, the overall substrate utilization efficiency was increased approximately 3-fold with a nearly 2-fold improvement of DagA production, let alone the additional benefit of ethanol production. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Advances in natural deduction a celebration of Dag Prawitz's work

    CERN Document Server

    Haeusler, Edward; Paiva, Valeria

    2014-01-01

    This collection of papers celebrating the contributions of Swedish logician Dag Prawitz to Proof Theory, has been assembled from those presented at the Natural Deduction conference organized in Rio de Janeiro to honour his  seminal  research. Dag Prawitz’s work forms the basis of intuitionistic type theory and his inversion principle constitutes the foundation of most modern accounts of proof-theoretic semantics in Logic, Linguistics and  Theoretical Computer Science. The range of contributions includes material on the extension of natural deduction with higher-order rules, as opposed to higher-order connectives, and a paper discussing the application of natural deduction rules to dealing with equality in predicate calculus. The volume continues with a key chapter summarizing work on the extension of the Curry-Howard isomorphism (itself a by-product of the work on natural deduction), via methods of category theory that have been successfully applied to linear logic, as well as many other contributions fr...

  13. Effect of suspension kinematic on 14 DOF vehicle model

    Science.gov (United States)

    Wongpattananukul, T.; Chantharasenawong, C.

    2017-12-01

    Computer simulations play a major role in shaping modern science and engineering. They reduce time and resource consumption in new studies and designs. Vehicle simulations have been studied extensively to achieve a vehicle model used in minimum lap time solution. Simulation result accuracy depends on the abilities of these models to represent real phenomenon. Vehicles models with 7 degrees of freedom (DOF), 10 DOF and 14 DOF are normally used in optimal control to solve for minimum lap time. However, suspension kinematics are always neglected on these models. Suspension kinematics are defined as wheel movements with respect to the vehicle body. Tire forces are expressed as a function of wheel slip and wheel position. Therefore, the suspension kinematic relation is appended to the 14 DOF vehicle model to investigate its effects on the accuracy of simulate trajectory. Classical 14 DOF vehicle model is chosen as baseline model. Experiment data is collected from formula student style car test runs as baseline data for simulation and comparison between baseline model and model with suspension kinematic. Results show that in a single long turn there is an accumulated trajectory error in baseline model compared to model with suspension kinematic. While in short alternate turns, the trajectory error is much smaller. These results show that suspension kinematic had an effect on the trajectory simulation of vehicle. Which optimal control that use baseline model will result in inaccuracy control scheme.

  14. TH-AB-202-11: Spatial and Rotational Quality Assurance of 6DOF Patient Tracking Systems

    Energy Technology Data Exchange (ETDEWEB)

    Belcher, AH; Liu, X; Grelewicz, Z; Wiersma, R [The University of Chicago, Chicago, IL (United States)

    2016-06-15

    Purpose: External tracking systems used for patient positioning and motion monitoring during radiotherapy are now capable of detecting both translations and rotations (6DOF). In this work, we develop a novel technique to evaluate the 6DOF performance of external motion tracking systems. We apply this methodology to an infrared (IR) marker tracking system and two 3D optical surface mapping systems in a common tumor 6DOF workspace. Methods: An in-house designed and built 6DOF parallel kinematics robotic motion phantom was used to follow input trajectories with sub-millimeter and sub-degree accuracy. The 6DOF positions of the robotic system were then tracked and recorded independently by three optical camera systems. A calibration methodology which associates the motion phantom and camera coordinate frames was first employed, followed by a comprehensive 6DOF trajectory evaluation, which spanned a full range of positions and orientations in a 20×20×16 mm and 5×5×5 degree workspace. The intended input motions were compared to the calibrated 6DOF measured points. Results: The technique found the accuracy of the IR marker tracking system to have maximal root mean square error (RMSE) values of 0.25 mm translationally and 0.09 degrees rotationally, in any one axis, comparing intended 6DOF positions to positions measured by the IR camera. The 6DOF RSME discrepancy for the first 3D optical surface tracking unit yielded maximal values of 0.60 mm and 0.11 degrees over the same 6DOF volume. An earlier generation 3D optical surface tracker was observed to have worse tracking capabilities than both the IR camera unit and the newer 3D surface tracking system with maximal RMSE of 0.74 mm and 0.28 degrees within the same 6DOF evaluation space. Conclusion: The proposed technique was effective at evaluating the performance of 6DOF patient tracking systems. All systems examined exhibited tracking capabilities at the sub-millimeter and sub-degree level within a 6DOF workspace.

  15. The Meaning-making of Dag Hammarskjöld

    Directory of Open Access Journals (Sweden)

    Kristian Stålne

    2011-10-01

    Full Text Available Dag Hammarskjöld, United Nations’ second Secretary-General 1954-1961, is getting recent attention for two reasons: he is going to front the new Swedish 1000-kronor note, the highest value; and this September it was 50 years since he was killed in an airplane crash in UN service in Congo. With that event, the most successful career in an international service that a Swede has ever had was terminated prematurely, a service that would set an unmistakable imprint on the UN organization as well as on the world stage of politics. But what made Dag Hammarskjöld such an exceptional leader and how did he view the world and his role in it? He was not only exceptional as a leader and world-centric visionary; he was also a mystic and an aesthetician with a highly analytic mind. What is unique is the fact that large parts of his thinking and personal struggling are available to the world through a dense material of his speeches and personal writings. This has made it possible to analyse the stages of development represented in them. Using ego development theory, described by Jane Loevinger as well as Robert Kegan, I offer the analysis that his writings, including during his most severe personal crisis, indicate he passed through a transition between the individualist and autonomous stages.

  16. The DAG project, a 4m class telescope: the telescope main structure performances

    Science.gov (United States)

    Marchiori, G.; Busatta, A.; Ghedin, L.; Marcuzzi, E.; Manfrin, C.; Battistel, C.; Pirnay, O.; Flebus, Carlo; Yeşilyaprak, C.; Keskin, O.; Yerli, S.

    2016-07-01

    Dogu Anatolu Gözlemevi (DAG-Eastern Anatolia Observatory) Project is a 4m class optical, near-infrared Telescope and suitable enclosure which will be located at an altitude of 3.170m in Erzurum, Turkey. The DAG telescope is a project fully funded by Turkish Ministry of Development and the Atatürk University of Astrophysics Research Telescope - ATASAM. The Project is being developed by the Belgian company AMOS (project leader), which is also the optics supplier and EIE GROUP, the Telescope Main Structure supplier and responsible for the final site integration. The design of the Telescope Main Structure fits in the EIE TBO Program which aims at developing a Dome/Telescope systemic optimization process for both performances and competitive costs based on previous project commitments like NTT, VLT, VST and ASTRI. The optical Configuration of the DAG Telescope is a Ritchey-Chretien with two Nasmyth foci and a 4m primary thin mirror controlled in shape and position by an Active Optic System. The main characteristics of the Telescope Main Structure are an Altitude-Azimuth light and rigid structure system with Direct Drive Systems for both axis, AZ Hydrostatic Bearing System and Altitude standard bearing system; both axes are equipped with Tape Encoder System. An innovative Control System characterizes the telescope performance.

  17. Thermal Actuation Based 3-DoF Non-Resonant Microgyroscope Using MetalMUMPs

    Directory of Open Access Journals (Sweden)

    Muhammad Masood ul Hassan

    2009-04-01

    Full Text Available High force, large displacement and low voltage consumption are a primary concern for microgyroscopes. The chevron-shaped thermal actuators are unique in terms of high force generation combined with the large displacements at a low operating voltage in comparison with traditional electrostatic actuators. A Nickel based 3-DoF micromachined gyroscope comprising 2-DoF drive mode and 1-DoF sense mode oscillator utilizing the chevron-shaped thermal actuators is presented here. Analytical derivations and finite element simulations are carried out to predict the performance of the proposed device using the thermo-physical properties of electroplated nickel. The device sensitivity is improved by utilizing the dynamical amplification of the oscillation in 2-DoF drive mode using an active-passive mass configuration. A comprehensive theoretical description, dynamics and mechanical design considerations of the proposed gyroscopes model are discussed in detail. Parametric optimization of gyroscope, its prototype modeling and fabrication using MetalMUMPs has also been investigated. Dynamic transient simulation results predicted that the sense mass of the proposed device achieved a drive displacement of 4.1µm when a sinusoidal voltage of 0.5V is applied at 1.77 kHz exhibiting a mechanical sensitivity of 1.7μm /o/s in vacuum. The wide bandwidth frequency response of the 2-DoF drive mode oscillator consists of two resonant peaks and a flat region of 2.11 kHz between the peaks defining the operational frequency region. The sense mode resonant frequency can lie anywhere within this region and therefore the amplitude of the response is insensitive to structural parameter variations, enhancing device robustness against such variations. The proposed device has a size of 2.2 x 2.6 mm2, almost one third in comparison with existing M-DoF vibratory gyroscope with an estimated power consumption of 0.26 Watts. These predicted results illustrate that the chevron

  18. Comparative study of 2-DOF micromirrors for precision light manipulation

    Science.gov (United States)

    Young, Johanna I.; Shkel, Andrei M.

    2001-08-01

    Many industry experts predict that the future of fiber optic telecommunications depends on the development of all-optical components for switching of photonic signals from fiber to fiber throughout the networks. MEMS is a promising technology for providing all-optical switching at high speeds with significant cost reductions. This paper reports on the the analysis of two designs for 2-DOF electrostatically actuated MEMS micromirrors for precision controllable large optical switching arrays. The behavior of the micromirror designs is predicted by coupled-field electrostatic and modal analysis using a finite element analysis (FEA) multi-physics modeling software. The analysis indicates that the commonly used gimbal type mirror design experiences electrostatic interference and would therefore be difficult to precisely control for 2-DOF motion. We propose a new design approach which preserves 2-DOF actuation while minimizing electrostatic interference between the drive electrodes and the mirror. Instead of using two torsional axes, we use one actuator which combines torsional and flexural DOFs. A comparative analysis of the conventional gimbal design and the one proposed in this paper is performed.

  19. "Ekspeditsioon Wunderlich" = "Expedition Wunderlich" / Carl-Dag Lige, Hannes Praks ; kommenteerinud Triin Ojari

    Index Scriptorium Estoniae

    Lige, Carl-Dag, 1982-

    2016-01-01

    Näitus "Ekspeditsioon Wunderlich" Eesti Arhitektuurimuuseumis. Autorid Katrin Talvik, Merilin Tee, Sabine Suuster, Martin Saar, Karl Taul, Alden Jõgisuu, Tõnu Lensment, Aadam Kaarma, Cael-Dag Lige, Hannes Praks. Näitus on Eesti Kunstiakadeemia ja Eesti Arhitektuurimuuseumi ühisprojekt

  20. Position calibration of a 3-DOF hand-controller with hybrid structure

    Science.gov (United States)

    Zhu, Chengcheng; Song, Aiguo

    2017-09-01

    A hand-controller is a human-robot interactive device, which measures the 3-DOF (Degree of Freedom) position of the human hand and sends it as a command to control robot movement. The device also receives 3-DOF force feedback from the robot and applies it to the human hand. Thus, the precision of 3-DOF position measurements is a key performance factor for hand-controllers. However, when using a hybrid type 3-DOF hand controller, various errors occur and are considered originating from machining and assembly variations within the device. This paper presents a calibration method to improve the position tracking accuracy of hybrid type hand-controllers by determining the actual size of the hand-controller parts. By re-measuring and re-calibrating this kind of hand-controller, the actual size of the key parts that cause errors is determined. Modifying the formula parameters with the actual sizes, which are obtained in the calibrating process, improves the end position tracking accuracy of the device.

  1. DAG expression: high-throughput gene expression analysis of real-time PCR data using standard curves for relative quantification.

    Directory of Open Access Journals (Sweden)

    María Ballester

    Full Text Available BACKGROUND: Real-time quantitative PCR (qPCR is still the gold-standard technique for gene-expression quantification. Recent technological advances of this method allow for the high-throughput gene-expression analysis, without the limitations of sample space and reagent used. However, non-commercial and user-friendly software for the management and analysis of these data is not available. RESULTS: The recently developed commercial microarrays allow for the drawing of standard curves of multiple assays using the same n-fold diluted samples. Data Analysis Gene (DAG Expression software has been developed to perform high-throughput gene-expression data analysis using standard curves for relative quantification and one or multiple reference genes for sample normalization. We discuss the application of DAG Expression in the analysis of data from an experiment performed with Fluidigm technology, in which 48 genes and 115 samples were measured. Furthermore, the quality of our analysis was tested and compared with other available methods. CONCLUSIONS: DAG Expression is a freely available software that permits the automated analysis and visualization of high-throughput qPCR. A detailed manual and a demo-experiment are provided within the DAG Expression software at http://www.dagexpression.com/dage.zip.

  2. A Contrast on Conductor Galloping Amplitude Calculated by Three Mathematical Models with Different DOFs

    Directory of Open Access Journals (Sweden)

    Bin Liu

    2014-01-01

    Full Text Available It is pivotal to find an effective mathematical model revealing the galloping mechanism. And it is important to compare the difference between the existing mathematical models on the conductor galloping. In this paper, the continuum cable model for transmission lines was proposed using the Hamilton principle. Discrete models of one DOF, two DOFs, and three DOFs were derived from the continuum model by using the Garlekin method. And the three models were compared by analyzing the galloping vertical amplitude and torsional angle with different influence factors. The influence factors include wind velocity, flow density, span length, damping ratio, and initial tension. The three-DOF model is more accurate at calculating the galloping characteristics than the other two models, but the one-DOF and two-DOF models can also present the trend of galloping amplitude change from the point view of qualitative analysis. And the change of the galloping amplitude relative to the main factors was also obtained, which is very essential to the antigalloping design applied in the actual engineering.

  3. Mechanisms whereby insulin increases diacylglycerol in BC3H-1 myocytes.

    Science.gov (United States)

    Farese, R V; Cooper, D R; Konda, T S; Nair, G; Standaert, M L; Davis, J S; Pollet, R J

    1988-01-01

    We previously suggested that insulin increases diacylglycerol (DAG) in BC3H-1 myocytes, both by increases in synthesis de novo of phosphatidic acid (PA) and by hydrolysis of non-inositol-containing phospholipids, such as phosphatidylcholine (PC) and phosphatidylethanolamine (PE). We have now evaluated these insulin effects more thoroughly, and several potential mechanisms for their induction. In studies of the effect on PA synthesis de novo, insulin stimulated [2-3H]glycerol incorporation into PA, DAG, PC/PE and total glycerolipids of BC3H-1 myocytes, regardless of whether insulin was added simultaneously with, or after 2 h or 3 or 10 days of prelabelling with, [2-3H]glycerol. In prelabelled cells, time-related changes in [2-3H]glycerol labelling of DAG correlated well with increases in DAG content: both were maximal in 30-60 s and persisted for 20-30 min. [2-3H]Glycerol labelling of glycerol 3-phosphate, on the other hand, was decreased by insulin, presumably reflecting increased utilization for PA synthesis. Glycerol 3-phosphate concentrations were 0.36 and 0.38 mM before and 1 min after insulin treatment, and insulin effects could not be explained by increases in glycerol 3-phosphate specific radioactivity. In addition to that of [2-3H]glycerol, insulin increased [U-14C]glucose and [1,2,3-3H]glycerol incorporation into DAG and other glycerolipids. Effects of insulin on [2-3H]glycerol incorporation into DAG and other glycerolipids were half-maximal and maximal at 2 nM- and 20 nM-insulin respectively, and were not dependent on glucose concentration in the medium, extracellular Ca2+ or protein synthesis. Despite good correlation between [3H]DAG and DAG content, calculated increases in DAG content from glycerol 3-phosphate specific radioactivity (i.e. via the pathway of PA synthesis de novo) could account for only 15-30% of the observed increases in DAG content. In addition to increases in [3H]glycerol labelling of PC/PE, insulin rapidly (within 30 s) increased PC

  4. Application of 2DOF controller for reactor power control. Verification by numerical simulation

    International Nuclear Information System (INIS)

    Ishikawa, Nobuyuki; Suzuki, Katsuo

    1996-09-01

    In this report the usefulness of the two degree of freedom (2DOF) control is discussed to improve the reference response characteristics and robustness for reactor power control system. The 2DOF controller consists of feedforward and feedback elements. The feedforward element was designed by model matching method and the feedback element by solving the mixed sensitivity problem of H ∞ control. The 2DOF control gives good performance in both reference response and robustness to disturbance and plant perturbation. The simulation of reactor power control was performed by digitizing the 2DOF controller with the digital control periods of 10[msec]. It is found that the control period of 10[msec] is enough not to make degradation of the control performance by digitizing. (author)

  5. Some aspects of floor spectra of 1DOF nonlinear primary structures

    International Nuclear Information System (INIS)

    Politopoulos, I.; Feau, C.

    2007-01-01

    In this paper the influence of the nonlinear behaviour of the primary structure on floor spectra is investigated by means of simple models. The general trends of floor spectra for different types of nonlinear behaviour of one degree of freedom (1DOF) primary structure are shown and we point out their common futures and their differences. A special attention is given to the cases of elastoplastic and nonlinear elastic behaviours and methods to determine an equivalent linear oscillator are proposed. The properties (frequency and damping) of this equivalent linear oscillator are quite different from the properties of equivalent linear oscillators commonly considered in practice. In particular, in the case of elastoplastic behaviour, there is no frequency shift and damping is smaller than assumed by other methods commonly used. In the case of nonlinear elastic behaviour, the concept of an equivalent frequency which is a random variable is used. Finally, a design floor spectrum of primary structures, exhibiting energy dissipating nonlinear behaviour is proposed. (authors)

  6. Modeling and controller design of a 6-DOF precision positioning system

    Science.gov (United States)

    Cai, Kunhai; Tian, Yanling; Liu, Xianping; Fatikow, Sergej; Wang, Fujun; Cui, Liangyu; Zhang, Dawei; Shirinzadeh, Bijan

    2018-05-01

    A key hurdle to meet the needs of micro/nano manipulation in some complex cases is the inadequate workspace and flexibility of the operation ends. This paper presents a 6-degree of freedom (DOF) serial-parallel precision positioning system, which consists of two compact type 3-DOF parallel mechanisms. Each parallel mechanism is driven by three piezoelectric actuators (PEAs), guided by three symmetric T-shape hinges and three elliptical flexible hinges, respectively. It can extend workspace and improve flexibility of the operation ends. The proposed system can be assembled easily, which will greatly reduce the assembly errors and improve the positioning accuracy. In addition, the kinematic and dynamic model of the 6-DOF system are established, respectively. Furthermore, in order to reduce the tracking error and improve the positioning accuracy, the Discrete-time Model Predictive Controller (DMPC) is applied as an effective control method. Meanwhile, the effectiveness of the DMCP control method is verified. Finally, the tracking experiment is performed to verify the tracking performances of the 6-DOF stage.

  7. Adaptive tuning of a 2DOF controller for robust cell manipulation using IPMC actuators

    International Nuclear Information System (INIS)

    McDaid, A J; Aw, K C; Haemmerle, E; Xie, S Q; Shahinpoor, M

    2011-01-01

    Rapid advancement in medicine and bioscience is causing demand for faster, more accurate and dexterous as well as safer and more reliable micro-manipulators capable of handling biological cells. Current micro-manipulation techniques commonly damage cell walls and membranes due to their stiffness and rigidity. Ionic polymer-metal composite (IPMC) actuators have inherent compliance and with their ability to operate well in fluid and cellular environments they present a unique solution for safe cell manipulation. The reason for the downfall of IPMCs is that their complex behaviour makes them hard to control precisely in unknown environments and in the presence of sizeable external disturbances. This paper presents a novel scheme for adaptively tuning IPMC actuators for precise and robust micro-manipulation of biological cells. A two-degree-of-freedom (2DOF) controller is developed to allow optimal performance for both disturbance rejection (DR) and set point (SP) tracking. These criteria are optimized using a proposed IFT algorithm which adaptively updates the controller parameters, with no model or prior knowledge of the operating conditions, to achieve a compliant manipulation system which can precisely track targets in the presence of large external disturbances, as will be encountered in real biological environments. Experiments are presented showing the performance optimization of an IPMC actuator in the presence of external mechanical disturbances as well as the optimization of the SP tracking. The IFT algorithm successfully tunes the DR and SP to an 85% and 69% improvement, respectively. Results are also presented for a one-degree-of-freedom (1DOF) controller tuned first for DR and then for SP, for a comparison with the 2DOF controller. Validation has been undertaken to verify that the 2DOF controller does indeed outperform both 1DOF controllers over a variety of operating conditions.

  8. Development of 6-DOF painting robot control system

    Science.gov (United States)

    Huang, Junbiao; Liu, Jianqun; Gao, Weiqiang

    2017-01-01

    With the development of society, the spraying technology of manufacturing industry in China has changed from the manual operation to the 6-DOF (Degree Of Freedom)robot automatic spraying. Spraying painting robot can not only complete the work which does harm to human being, but also improve the production efficiency and save labor costs. Control system is the most critical part of the 6-DOF robots, however, there is still a lack of relevant technology research in China. It is very necessary to study a kind of control system of 6-DOF spraying painting robots which is easy to operation, and has high efficiency and stable performance. With Googol controller platform, this paper develops programs based on Windows CE embedded systems to control the robot to finish the painting work. Software development is the core of the robot control system, including the direct teaching module, playback module, motion control module, setting module, man-machine interface, alarm module, log module, etc. All the development work of the entire software system has been completed, and it has been verified that the entire software works steady and efficient.

  9. Comparison of FOLFOX and DOF regimens as first-line treatment in East Asian patients with advanced gastric cancer

    Directory of Open Access Journals (Sweden)

    Liu M

    2018-01-01

    Full Text Available Mengyao Liu,1,2 Guofang Hu,2 Yuan Wang,2 Jun Guo,2 Liyan Liu,2 Xiao Han,2 Zhehai Wang2 1School of Medicine and Life Sciences, University of Jinan-Shandong Academy of Medical Sciences, Jinan, Shandong, 2Department of Oncology, Shandong Cancer Hospital, affiliated to Shandong University, Shandong Academy of Medical Sciences, Jinan, Shandong, People’s Republic of China Background: Our study retrospectively assesses the safety and efficacy of the FOLFOX (oxaliplatin, fluorouracil, and leucovorin versus DOF (docetaxel, oxaliplatin, and fluorouracil regimens in untreated locally advanced gastric cancer (AGC.Patients and methods: A total of 108 patients underwent DOF (N=58 and FOLFOX (N=50 regimens. The end points were overall response rate (ORR, survival, and toxicity. Kaplan–Meier curve was used to estimate overall survival (OS and progression-free survival (PFS and Cox regression for multivariate analysis.Results: The ORRs were 50% for DOF and 30% for FOLFOX groups (P<0.05, and disease control rates were 91.4% and 72%, respectively. The median PFS and OS in DOF group were significantly better than FOLFOX group (8.2 versus 6.4 months, P<0.05; 16.3 versus 11.2 months, P<0.001. Both groups showed acceptable toxicity; all grades and grade 3–4 toxicity had no significant differences (P=0.071; P=0.247. However, the incidence of grade 3–4 peripheral neuropathy was significantly higher in DOF group (10.3% versus 2%, P<0.05. In the subgroup analysis for elderly AGC patients (≥65 years, administration of DOF also resulted in a superior PFS (8.5 versus 5.9 months; P=0.038 and OS (15.3 versus 9.8 months; P=0.004 compared with FOLFOX. However, DOF regimen was associated with more neutropenia (67% versus 30%; P<0.05, thrombocytopenia (61% versus 52%; P<0.05, and peripheral neuropathy (49% versus 22%; P<0.05.Conclusion: DOF regimen was more effective than FOLFOX for AGC, both in younger and older patients. The adverse effects of the two regimens were

  10. Kinematics and Workspace of a 4-DOF Hybrid Palletizing Robot

    Directory of Open Access Journals (Sweden)

    Yong Tao

    2014-06-01

    Full Text Available We presented the kinematical analysis of a 4-DOF hybrid palletizing robot. The palletizing robot structure was proposed and the arm model of the robot was presented. The kinematical analysis of the end robotic manipulator was given. As a result, the position, velocity, and acceleration curves as well as the maximum workspace were demonstrated by simulation in Matlab. This study would be useful for the kinematical characteristics of the 4-DOF palletizing robot in space.

  11. Simulated Energy Usage for a Novel 6 DOF Articulated Robot

    International Nuclear Information System (INIS)

    Shaik, A A; Tlale, N; Bright, G

    2014-01-01

    The serial robot architecture is widespread in modern day manufacturing, and over the last few decades the technology has matured and settled to its current state. One drawback from the architecture however is the location of motors and gearboxes which are either at the joint it controls or close by. A novel hybrid 6 DOF robot was designed to move all the actuators to the robot base, and to control the desired axis through a set of connected links and gears, while maintaining the same workspace and dexterity. This would reduce the inertia of the movable part of the robot and some of the moment arms on the 3 axes required for translation of the 3 DOF spherical wrist. Doing so would decrease the energy requirements when compared to a 6 DOF serial robot. This paper focuses on the mathematical modelling and simulation of the novel hybrid machine design and compares it to an equivalent serial robot

  12. COSPEDTree: COuplet Supertree by Equivalence Partitioning of Taxa Set and DAG Formation.

    Science.gov (United States)

    Bhattacharyya, Sourya; Mukherjee, Jayanta

    2015-01-01

    From a set of phylogenetic trees with overlapping taxa set, a supertree exhibits evolutionary relationships among all input taxa. The key is to resolve the contradictory relationships with respect to input trees, between individual taxa subsets. Formulation of this NP hard problem employs either local search heuristics to reduce tree search space, or resolves the conflicts with respect to fixed or varying size subtree level decompositions. Different approximation techniques produce supertrees with considerable performance variations. Moreover, the majority of the algorithms involve high computational complexity, thus not suitable for use on large biological data sets. Current study presents COSPEDTree, a novel method for supertree construction. The technique resolves source tree conflicts by analyzing couplet (taxa pair) relationships for each source trees. Subsequently, individual taxa pairs are resolved with a single relation. To prioritize the consensus relations among individual taxa pairs for resolving them, greedy scoring is employed to assign higher score values for the consensus relations among a taxa pair. Selected set of relations resolving individual taxa pairs is subsequently used to construct a directed acyclic graph (DAG). Vertices of DAG represents a taxa subset inferred from the same speciation event. Thus, COSPEDTree can generate non-binary supertrees as well. Depth first traversal on this DAG yields final supertree. According to the performance metrics on branch dissimilarities (such as FP, FN and RF), COSPEDTree produces mostly conservative, well resolved supertrees. Specifically, RF metrics are mostly lower compared to the reference approaches, and FP values are lower apart from only strictly conservative (or veto) approaches. COSPEDTree has worst case time and space complexities of cubic and quadratic order, respectively, better or comparable to the reference approaches. Such high performance and low computational costs enable COSPEDTree to be

  13. 3D Orthorhombic Elastic Wave Propagation Pre-Test Simulation of SPE DAG-1 Test

    Science.gov (United States)

    Jensen, R. P.; Preston, L. A.

    2017-12-01

    A more realistic representation of many geologic media can be characterized as a dense system of vertically-aligned microfractures superimposed on a finely-layered horizontal geology found in shallow crustal rocks. This seismic anisotropy representation lends itself to being modeled as an orthorhombic elastic medium comprising three mutually orthogonal symmetry planes containing nine independent moduli. These moduli can be determined by observing (or prescribing) nine independent P-wave and S-wave phase speeds along different propagation directions. We have developed an explicit time-domain finite-difference (FD) algorithm for simulating 3D elastic wave propagation in a heterogeneous orthorhombic medium. The components of the particle velocity vector and the stress tensor are governed by a set of nine, coupled, first-order, linear, partial differential equations (PDEs) called the velocity-stress system. All time and space derivatives are discretized with centered and staggered FD operators possessing second- and fourth-order numerical accuracy, respectively. Additionally, we have implemented novel perfectly matched layer (PML) absorbing boundary conditions, specifically designed for orthorhombic media, to effectively suppress grid boundary reflections. In support of the Source Physics Experiment (SPE) Phase II, a series of underground chemical explosions at the Nevada National Security Site, the code has been used to perform pre-test estimates of the Dry Alluvium Geology - Experiment 1 (DAG-1). Based on literature searches, realistic geologic structure and values for orthorhombic P-wave and S-wave speeds have been estimated. Results and predictions from the simulations are presented.

  14. BALCO 6/7-DoF trajectory model

    NARCIS (Netherlands)

    Wey, P.; Corriveau, D.; Saitz, T.A.; Ruijter, W. de; Strömbäck, P.

    2016-01-01

    BALCO is a six- and seven-degree-of-freedom trajectory simulation program based on the mathematical model defined by the NATO Standardization Recommendation 4618. The primary goal of BALCO is to compute high-fidelity trajectories for both conventional and precision-guided projectiles. The 6-DoF

  15. DOF-binding sites additively contribute to guard cell-specificity of AtMYB60 promoter

    Directory of Open Access Journals (Sweden)

    Cominelli Eleonora

    2011-11-01

    Full Text Available Abstract Background We previously demonstrated that the Arabidopsis thaliana AtMYB60 protein is an R2R3MYB transcription factor required for stomatal opening. AtMYB60 is specifically expressed in guard cells and down-regulated at the transcriptional levels by the phytohormone ABA. Results To investigate the molecular mechanisms governing AtMYB60 expression, its promoter was dissected through deletion and mutagenesis analyses. By studying different versions of AtMYB60 promoter::GUS reporter fusions in transgenic plants we were able to demonstrate a modular organization for the AtMYB60 promoter. Particularly we defined: a minimal promoter sufficient to confer guard cell-specific activity to the reporter gene; the distinct roles of different DOF-binding sites organised in a cluster in the minimal promoter in determining guard cell-specific expression; the promoter regions responsible for the enhancement of activity in guard cells; a promoter region responsible for the negative transcriptional regulation by ABA. Moreover from the analysis of single and multiple mutants we could rule out the involvement of a group of DOF proteins, known as CDFs, already characterised for their involvement in flowering time, in the regulation of AtMYB60 expression. Conclusions These findings shed light on the regulation of gene expression in guard cells and provide new promoter modules as useful tools for manipulating gene expression in guard cells, both for physiological studies and future biotechnological applications.

  16. Development of a simple system for simultaneously measuring 6DOF geometric motion errors of a linear guide.

    Science.gov (United States)

    Qibo, Feng; Bin, Zhang; Cunxing, Cui; Cuifang, Kuang; Yusheng, Zhai; Fenglin, You

    2013-11-04

    A simple method for simultaneously measuring the 6DOF geometric motion errors of the linear guide was proposed. The mechanisms for measuring straightness and angular errors and for enhancing their resolution are described in detail. A common-path method for measuring the laser beam drift was proposed and it was used to compensate the errors produced by the laser beam drift in the 6DOF geometric error measurements. A compact 6DOF system was built. Calibration experiments with certain standard measurement meters showed that our system has a standard deviation of 0.5 µm in a range of ± 100 µm for the straightness measurements, and standard deviations of 0.5", 0.5", and 1.0" in the range of ± 100" for pitch, yaw, and roll measurements, respectively.

  17. Design and characterization of an ocean wave powered lifejacket using 2DOF floating boards

    Science.gov (United States)

    Mi, Jia; Xu, Lin; Yang, Yaling; Zuo, Lei

    2018-04-01

    Lifejacket is an indispensable life-saving equipment for ships and airplanes. Traditional lifejacket is designed to prevent human from drowning. However, the water temperature is usually low, especially in winter, which significantly reduces the human body temperature and leads to death. Meanwhile, power is critical for drowning people to use emergency communication equipment. This paper proposed an ocean wave powered lifejacket using 2DOF floating boards to provide both buoyance and electricity for drowning people. Hence, they can use this continuous electric power to keep key body warm and send distress signal. This lifejacket is featured with two 2DOF floating boards and the mechanical motion rectifier (MMR) can convert the 2-DOF motions to the unidirectional rotation of generator. The design principle is illustrated and the dynamic modelling for the 2-DOF motions has been analyzed. Bench test and lake test have been conducted to validate the design concept.

  18. DigDag, Digitalt atlas over Danmarks historisk-administrative geografi

    DEFF Research Database (Denmark)

    Knudsen, Bo Nissen; Gammeltoft, Peder

    2012-01-01

    Administrative geografiske enheder ses ofte som stabile over tid. Det er imidlertid ikke tilfældet. Der kan forekomme en række af rumlige, sociale – og sproglige – ændringer; eksempelvis navneskift, ændrede grænsedragninger og ændringer i den administrative struktur. Dette betyder at forskning som...... tager udgangspunkt i geografisk relaterede eller ordnede data, kan komme i problemer så snart geografien på dataindsamlingstidspunktet ikke svarer til den nuværende geografi, og den 'gamle' geografi ikke er umiddelbart til at få rede på. DigDag-projektet adresserer denne udfordring for forskere inden...

  19. MEMS 3-DoF gyroscope design, modeling and simulation through equivalent circuit lumped parameter model

    International Nuclear Information System (INIS)

    Mian, Muhammad Umer; Khir, M. H. Md.; Tang, T. B.; Dennis, John Ojur; Riaz, Kashif; Iqbal, Abid; Bazaz, Shafaat A.

    2015-01-01

    Pre-fabrication, behavioural and performance analysis with computer aided design (CAD) tools is a common and fabrication cost effective practice. In light of this we present a simulation methodology for a dual-mass oscillator based 3 Degree of Freedom (3-DoF) MEMS gyroscope. 3-DoF Gyroscope is modeled through lumped parameter models using equivalent circuit elements. These equivalent circuits consist of elementary components which are counterpart of their respective mechanical components, used to design and fabricate 3-DoF MEMS gyroscope. Complete designing of equivalent circuit model, mathematical modeling and simulation are being presented in this paper. Behaviors of the equivalent lumped models derived for the proposed device design are simulated in MEMSPRO T-SPICE software. Simulations are carried out with the design specifications following design rules of the MetalMUMPS fabrication process. Drive mass resonant frequencies simulated by this technique are 1.59 kHz and 2.05 kHz respectively, which are close to the resonant frequencies found by the analytical formulation of the gyroscope. The lumped equivalent circuit modeling technique proved to be a time efficient modeling technique for the analysis of complex MEMS devices like 3-DoF gyroscopes. The technique proves to be an alternative approach to the complex and time consuming couple field analysis Finite Element Analysis (FEA) previously used

  20. MEMS 3-DoF gyroscope design, modeling and simulation through equivalent circuit lumped parameter model

    Energy Technology Data Exchange (ETDEWEB)

    Mian, Muhammad Umer, E-mail: umermian@gmail.com; Khir, M. H. Md.; Tang, T. B. [Department of Electrical and Electronic Engineering, Universiti Teknologi PETRONAS, Tronoh, Perak (Malaysia); Dennis, John Ojur [Department of Fundamental & Applied Sciences, Universiti Teknologi PETRONAS, Tronoh, Perak (Malaysia); Riaz, Kashif; Iqbal, Abid [Faculty of Electronics Engineering, GIK Institute of Engineering Sciences and Technology, Topi, Khyber Pakhtunkhaw (Pakistan); Bazaz, Shafaat A. [Department of Computer Science, Center for Advance Studies in Engineering, Islamabad (Pakistan)

    2015-07-22

    Pre-fabrication, behavioural and performance analysis with computer aided design (CAD) tools is a common and fabrication cost effective practice. In light of this we present a simulation methodology for a dual-mass oscillator based 3 Degree of Freedom (3-DoF) MEMS gyroscope. 3-DoF Gyroscope is modeled through lumped parameter models using equivalent circuit elements. These equivalent circuits consist of elementary components which are counterpart of their respective mechanical components, used to design and fabricate 3-DoF MEMS gyroscope. Complete designing of equivalent circuit model, mathematical modeling and simulation are being presented in this paper. Behaviors of the equivalent lumped models derived for the proposed device design are simulated in MEMSPRO T-SPICE software. Simulations are carried out with the design specifications following design rules of the MetalMUMPS fabrication process. Drive mass resonant frequencies simulated by this technique are 1.59 kHz and 2.05 kHz respectively, which are close to the resonant frequencies found by the analytical formulation of the gyroscope. The lumped equivalent circuit modeling technique proved to be a time efficient modeling technique for the analysis of complex MEMS devices like 3-DoF gyroscopes. The technique proves to be an alternative approach to the complex and time consuming couple field analysis Finite Element Analysis (FEA) previously used.

  1. Type synthesis for 4-DOF parallel press mechanism using GF set theory

    Science.gov (United States)

    He, Jun; Gao, Feng; Meng, Xiangdun; Guo, Weizhong

    2015-07-01

    Parallel mechanisms is used in the large capacity servo press to avoid the over-constraint of the traditional redundant actuation. Currently, the researches mainly focus on the performance analysis for some specific parallel press mechanisms. However, the type synthesis and evaluation of parallel press mechanisms is seldom studied, especially for the four degrees of freedom(DOF) press mechanisms. The type synthesis of 4-DOF parallel press mechanisms is carried out based on the generalized function(GF) set theory. Five design criteria of 4-DOF parallel press mechanisms are firstly proposed. The general procedure of type synthesis of parallel press mechanisms is obtained, which includes number synthesis, symmetrical synthesis of constraint GF sets, decomposition of motion GF sets and design of limbs. Nine combinations of constraint GF sets of 4-DOF parallel press mechanisms, ten combinations of GF sets of active limbs, and eleven combinations of GF sets of passive limbs are synthesized. Thirty-eight kinds of press mechanisms are presented and then different structures of kinematic limbs are designed. Finally, the geometrical constraint complexity( GCC), kinematic pair complexity( KPC), and type complexity( TC) are proposed to evaluate the press types and the optimal press type is achieved. The general methodologies of type synthesis and evaluation for parallel press mechanism are suggested.

  2. Integrated 6-DOF Orbit-Attitude Dynamical Modeling and Control Using Geometric Mechanics

    Directory of Open Access Journals (Sweden)

    Ling Jiang

    2017-01-01

    Full Text Available The integrated 6-DOF orbit-attitude dynamical modeling and control have shown great importance in various missions, for example, formation flying and proximity operations. The integrated approach yields better performances than the separate one in terms of accuracy, efficiency, and agility. One challenge in the integrated approach is to find a unified representation for the 6-DOF motion with configuration space SE(3. Recently, exponential coordinates of SE(3 have been used in dynamics and control of the 6-DOF motion, however, only on the kinematical level. In this paper, we will improve the current method by adopting exponential coordinates on the dynamical level, by giving the relation between the second-order derivative of exponential coordinates and spacecraft’s accelerations. In this way, the 6-DOF motion in terms of exponential coordinates can be written as a second-order system with a quite compact form, to which a broader range of control theories, such as higher-order sliding modes, can be applied. For a demonstration purpose, a simple asymptotic tracking control law with almost global convergence is designed. Finally, the integrated modeling and control are applied to the body-fixed hovering over an asteroid and verified by a simulation, in which absolute motions of the spacecraft and asteroid are simulated separately.

  3. Electrical coupling suppression and transient response improvement for a microgyroscope using ascending frequency drive with a 2-DOF PID controller

    International Nuclear Information System (INIS)

    Cui, J; Guo, Z Y; Yang, Z C; Hao, Y L; Yan, G Z

    2011-01-01

    In this paper, we demonstrate a novel control strategy for the drive mode of a microgyroscope using ascending frequency drive (AFD) with an AGC-2DOF PID controller, which drives a resonator with a modulation signal not at the resonant frequency and senses the vibration signal at the resonant frequency, thus realizing the isolation between the actual mechanical response and electrical coupling signal. This approach holds the following three advantages: (1) it employs the AFD signal instead of the resonant frequency drive signal to excite the gyroscope in the drive direction, suppressing the electrical coupling from the drive electrode to the sense electrode; (2) it can reduce the noise at low frequency and resonant frequency by shifting flicker noise to the high-frequency part; (3) it can effectively improve the performance of the transient response of the closed-loop control with a 2-DOF (degree of freedom) PID controller compared with the conventional 1-DOF PID. The stability condition of the whole loop is investigated by utilizing the averaging and linearization method. The control approach is applied to drive a lateral tuning fork microgyroscope. Test results show good agreement with the theoretical and simulation results. The non-ideal electrical antiresonance peak is removed and the resonant peak height increases by approximately 10 dB over a 400 Hz span with a flicker noise reduction of 30 dB within 100 Hz using AFD. The percent overshoot is reduced from 36.2% (1DOF PID) to 8.95% (2DOF PID, about 75.3% overshoot suppression) with 15.3% improvement in setting time

  4. Kinematic Analysis of 3-DOF Planer Robot Using Artificial Neural Network

    Directory of Open Access Journals (Sweden)

    Jolly Atit Shah

    2012-07-01

    Full Text Available Automatic control of the robotic manipulator involves study of kinematics and dynamics as a major issue. This paper involves the forward and inverse kinematics of 3-DOF robotic manipulator with revolute joints. In this study the Denavit- Hartenberg (D-H model is used to model robot links and joints. Also forward and inverse kinematics solution has been achieved using Artificial Neural Networks for 3-DOF robotic manipulator. It shows that by using artificial neural network the solution we get is faster, acceptable and has zero error.

  5. Effects of a meal rich in 1,3-diacylglycerol on postprandial cardiovascular risk factors and the glucose-dependent insulinotropic polypeptide in subjects with high fasting triacylglycerol concentrations.

    Science.gov (United States)

    Shoji, Kentaro; Mizuno, Tomohito; Shiiba, Daisuke; Kawagoe, Tadanobu; Mitsui, Yuuki

    2012-03-14

    It was previously reported that compared to triacylglycerol (TAG) oil, diacylglycerol (DAG) oil improves postprandial lipid response. However, the effects of DAG oil on postprandial hyperglycemia and incretin response have not yet been determined. In this study, the effects of DAG oil on both postprandial hyperlipidemia and hyperglycemia and the response to the glucose-dependent insulinotropic polypeptide (GIP) were studied. This randomized, double-blind, crossover study analyzed data for 41 individuals with high fasting triacylglycerol concentrations. The subjects ingested test meals (30.3 g of protein, 18.6 g of fat, and 50.1 g of carbohydrate) containing 10 g of DAG oil (DAG meal) or TAG oil (TAG meal) after fasting for at least 12 h. Blood samples were collected prior to and 0.5, 2, 3, 4, and 6 h after ingestion of the test meal. Postprandial TAG concentrations were significantly lower after the DAG meal compared with the TAG meal. Postprandial TAG, insulin, and GIP concentrations were significantly lower after the DAG meal compared with the TAG meal in 26 subjects with fasting serum TAG levels between 1.36 and 2.83 mmol/L. DAG-oil-based meals, as a replacement for TAG oil, may provide cardiovascular benefits in high-risk individuals by limiting lipid and insulin excursions.

  6. Võitlus Baltikumi pärast - 15 aastat hiljem / Dag Sebastian Ahlander ; interv. Allan Alaküla

    Index Scriptorium Estoniae

    Ahlander, Dag Sebastian

    2006-01-01

    Endine Rootsi peakonsul Leningradis Dag Sebastian Ahlander teeb tagasivaate 1991. aasta sündmustele ning annab omapoolse hinnangu tänapäeva Baltimaadele. Praegu juhib autor Rootsi välisministeeriumi protokollitööd ning kandideerib ka parlamenti

  7. Insener Heinrich Laul ja Eesti XX sajandi ehituskultuur / Maris Suits, Carl-Dag Lige

    Index Scriptorium Estoniae

    Suits, Maris

    2010-01-01

    Näitus "Heinrich Laul 100" Tallinna Tehnikaülikoolis 10. sept.-4. okt. 2010. Näituse koostajad: Maris Suits (Eesti Kunstiakadeemia), Carl-Dag Lige (Helsingi Ülikool), Milvi Vahtra (TTÜ), näituse korraldajad: Signe Jantson ja Karl Õiger (TTÜ). Ehitusinsenerist ja -teadlasest Heinrich Laulust, tema tegevusest, seostest August Komendandiga. Koorikute koolkonnast ja teaduspõhisest ehituspraktikast. Tallinna laululavast. Seminarist ja H. Laulu artiklikogumikust

  8. Bilateral, Misalignment-Compensating, Full-DOF Hip Exoskeleton: Design and Kinematic Validation

    Directory of Open Access Journals (Sweden)

    Karen Junius

    2017-01-01

    Full Text Available A shared design goal for most robotic lower limb exoskeletons is to reduce the metabolic cost of locomotion for the user. Despite this, only a limited amount of devices was able to actually reduce user metabolic consumption. Preservation of the natural motion kinematics was defined as an important requirement for a device to be metabolically beneficial. This requires the inclusion of all human degrees of freedom (DOF in a design, as well as perfect alignment of the rotation axes. As perfect alignment is impossible, compensation for misalignment effects should be provided. A misalignment compensation mechanism for a 3-DOF system is presented in this paper. It is validated by the implementation in a bilateral hip exoskeleton, resulting in a compact and lightweight device that can be donned fast and autonomously, with a minimum of required adaptations. Extensive testing of the prototype has shown that hip range of motion of the user is maintained while wearing the device and this for all three hip DOFs. This allowed the users to maintain their natural motion patterns when they are walking with the novel hip exoskeleton.

  9. Bilateral, Misalignment-Compensating, Full-DOF Hip Exoskeleton: Design and Kinematic Validation

    Science.gov (United States)

    Degelaen, Marc; Lefeber, Nina; Swinnen, Eva; Vanderborght, Bram; Lefeber, Dirk

    2017-01-01

    A shared design goal for most robotic lower limb exoskeletons is to reduce the metabolic cost of locomotion for the user. Despite this, only a limited amount of devices was able to actually reduce user metabolic consumption. Preservation of the natural motion kinematics was defined as an important requirement for a device to be metabolically beneficial. This requires the inclusion of all human degrees of freedom (DOF) in a design, as well as perfect alignment of the rotation axes. As perfect alignment is impossible, compensation for misalignment effects should be provided. A misalignment compensation mechanism for a 3-DOF system is presented in this paper. It is validated by the implementation in a bilateral hip exoskeleton, resulting in a compact and lightweight device that can be donned fast and autonomously, with a minimum of required adaptations. Extensive testing of the prototype has shown that hip range of motion of the user is maintained while wearing the device and this for all three hip DOFs. This allowed the users to maintain their natural motion patterns when they are walking with the novel hip exoskeleton. PMID:28790799

  10. Human Factors Risk Analyses of a Doffing Protocol for Ebola-Level Personal Protective Equipment: Mapping Errors to Contamination.

    Science.gov (United States)

    Mumma, Joel M; Durso, Francis T; Ferguson, Ashley N; Gipson, Christina L; Casanova, Lisa; Erukunuakpor, Kimberly; Kraft, Colleen S; Walsh, Victoria L; Zimring, Craig; DuBose, Jennifer; Jacob, Jesse T

    2018-03-05

    Doffing protocols for personal protective equipment (PPE) are critical for keeping healthcare workers (HCWs) safe during care of patients with Ebola virus disease. We assessed the relationship between errors and self-contamination during doffing. Eleven HCWs experienced with doffing Ebola-level PPE participated in simulations in which HCWs donned PPE marked with surrogate viruses (ɸ6 and MS2), completed a clinical task, and were assessed for contamination after doffing. Simulations were video recorded, and a failure modes and effects analysis and fault tree analyses were performed to identify errors during doffing, quantify their risk (risk index), and predict contamination data. Fifty-one types of errors were identified, many having the potential to spread contamination. Hand hygiene and removing the powered air purifying respirator (PAPR) hood had the highest total risk indexes (111 and 70, respectively) and number of types of errors (9 and 13, respectively). ɸ6 was detected on 10% of scrubs and the fault tree predicted a 10.4% contamination rate, likely occurring when the PAPR hood inadvertently contacted scrubs during removal. MS2 was detected on 10% of hands, 20% of scrubs, and 70% of inner gloves and the predicted rates were 7.3%, 19.4%, 73.4%, respectively. Fault trees for MS2 and ɸ6 contamination suggested similar pathways. Ebola-level PPE can both protect and put HCWs at risk for self-contamination throughout the doffing process, even among experienced HCWs doffing with a trained observer. Human factors methodologies can identify error-prone steps, delineate the relationship between errors and self-contamination, and suggest remediation strategies.

  11. Adaptive Controller for 6-DOF Parallel Robot Using T-S Fuzzy Inference

    Directory of Open Access Journals (Sweden)

    Xue Jian

    2013-02-01

    Full Text Available 6-DOF parallel robot always appears in the form of Stewart platform. It has been widely used in industry for the benefits such as strong structural stiffness, high movement accuracy and so on. Space docking technology makes higher requirements of motion accuracy and dynamic performance to the control method on 6-DOF parallel robot. In this paper, a hydraulic 6-DOF parallel robot was used to simulate the docking process. Based on this point, this paper gave a thorough study on the design of an adaptive controller to eliminate the asymmetric of controlled plant and uncertain load force interference. Takagi-Sugeno (T-S fuzzy inference model was used to build the fuzzy adaptive controller. With T-S model, the controller directly imposes adaptive control signal on the plant to make sure that the output of plant could track the reference model output. The controller has simple structure and is easy to implement. Experiment results show that the controller can eliminate asymmetric and achieve good dynamic performance, and has good robustness to load interference.

  12. Establishing an Improved Kane Dynamic Model for the 7-DOF Reconfigurable Modular Robot

    Directory of Open Access Journals (Sweden)

    Xiao Li

    2017-01-01

    Full Text Available We propose an improved Kane dynamic model theory for the 7-DOF modular robot in this paper, and the model precision is improved by the improved function T′it. We designed three types of progressive modular joints for reconfigurable modular robot that can be used in industrial robot, space robot, and special robot. The Kane dynamic model and the solid dynamic model are established, respectively, for the 7-DOF modular robot. After that, the experimental results are obtained from the simulation experiment of typical task in the established dynamic models. By the analysis model of error, the equation of the improved torque T′it is derived and proposed. And the improved Kane dynamic model is established for the modular robot that used T′it. Based on the experimental data, the undetermined coefficient matrix is five-order linear that was proved in 7-DOF modular robot. And the explicit formulation is solved of the Kane dynamic model and can be used in control system.

  13. Structural Synthesis of 3-DoF Spatial Fully Parallel Manipulators

    Directory of Open Access Journals (Sweden)

    Alfonso Hernandez

    2014-07-01

    Full Text Available In this paper, the architectures of three degrees of freedom (3-DoF spatial, fully parallel manipulators (PMs, whose limbs are structurally identical, are obtained systematically. To do this, the methodology followed makes use of the concepts of the displacement group theory of rigid body motion. This theory works with so-called ‘motion generators’. That is, every limb is a kinematic chain that produces a certain type of displacement in the mobile platform or end-effector. The laws of group algebra will determine the actual motion pattern of the end-effector. The structural synthesis is a combinatorial process of different kinematic chains’ topologies employed in order to get all of the 3-DoF motion pattern possibilities in the end-effector of the fully parallel manipulator.

  14. Proposed Robot Scheme with 5 DoF and Dynamic Modelling Using Maple Software

    Directory of Open Access Journals (Sweden)

    Shala Ahmet

    2017-11-01

    Full Text Available In this paper is represented Dynamical Modelling of robots which is commonly first important step of Modelling, Analysis and Control of robotic systems. This paper is focused on using Denavit-Hartenberg (DH convention for kinematics and Newton-Euler Formulations for dynamic modelling of 5 DoF - Degree of Freedom of 3D robot. The process of deriving of dynamical model is done using Software Maple. Derived Dynamical Model of 5 DoF robot is converted for Matlab use for future analysis, control and simulations.

  15. Scale-up for model verification; design, modeling and control of an elastic parallel kinematic 6-DOFs manipulator

    NARCIS (Netherlands)

    Huijts, Martijn; Brouwer, Dannis Michel; van Dijk, Johannes

    2009-01-01

    Manipulators with guidance constructions based on elastic mechanisms are of interest for the increasing number of precision vacuum applications. Previously, the design of an elastic MEMS-based 6-DOFs manipulator was presented. Characterization in six degrees of freedom (DOFs) of a manipulator the

  16. Automated optimal coordination of multiple-DOF neuromuscular actions in feedforward neuroprostheses.

    Science.gov (United States)

    Lujan, J Luis; Crago, Patrick E

    2009-01-01

    This paper describes a new method for designing feedforward controllers for multiple-muscle, multiple-DOF, motor system neural prostheses. The design process is based on experimental measurement of the forward input/output properties of the neuromechanical system and numerical optimization of stimulation patterns to meet muscle coactivation criteria, thus resolving the muscle redundancy (i.e., overcontrol) and the coupled DOF problems inherent in neuromechanical systems. We designed feedforward controllers to control the isometric forces at the tip of the thumb in two directions during stimulation of three thumb muscles as a model system. We tested the method experimentally in ten able-bodied individuals and one patient with spinal cord injury. Good control of isometric force in both DOFs was observed, with rms errors less than 10% of the force range in seven experiments and statistically significant correlations between the actual and target forces in all ten experiments. Systematic bias and slope errors were observed in a few experiments, likely due to the neuromuscular fatigue. Overall, the tests demonstrated the ability of a general design approach to satisfy both control and coactivation criteria in multiple-muscle, multiple-axis neuromechanical systems, which is applicable to a wide range of neuromechanical systems and stimulation electrodes.

  17. A Novel Integral 5-DOFs Hybrid Magnetic Bearing with One Permanent Magnet Ring Used for Turboexpander

    Directory of Open Access Journals (Sweden)

    Bangcheng Han

    2014-01-01

    Full Text Available We propose a novel combined five-degrees-of-freedom (5-DOFs hybrid magnetic bearing (HMB with only one permanent magnet ring (PMR used for turboexpanders. It has two radial magnetic bearing (RMB units; each has four poles and one thrust magnetic bearing (TMB to control 5-DOFs. Based on one PMR, the bias flux of the two radial magnetic bearing units and the one thrust magnetic bearing unit is constructed. As a result, ultra-high-speed, lower power loss, small size, and low cost can be achieved. Furthermore, the equivalent magnetic circuit method and 3D finite element method (FEM are used to model and analyze the combined 5-DOFs HMB. The force-current, force-position, torque-coil currents, the torque-angle position, and the stiffness models of the combined 5-DOFs HMB are given. Moreover, its coupling problems between the RMB units and the AMB unit are also proposed in this paper. An example is given to clarify the mathematical models and the coupling problems, and the linearized models are proposed for the follow-up controller design.

  18. Stair Climbing Control for 4-DOF Tracked Vehicle Based on Internal Sensors

    Directory of Open Access Journals (Sweden)

    Daisuke Endo

    2017-01-01

    Full Text Available In search-and-rescue missions, multi-degrees-of-freedom (DOF tracked robots that are equipped with subtracks are commonly used. These types of robots have superior locomotion performance on rough terrain. However, in teleoperated missions, the performance of tracked robots depends largely on the operators’ ability to control every subtrack appropriately. Therefore, an autonomous traversal function can significantly help in the teleoperation of such robots. In this paper, we propose a planning and control method for 4-DOF tracked robots climbing up/down known stairs automatically based on internal sensors. Experimental results obtained using mockup stairs verify the effectiveness of the proposed method.

  19. Quantum wave packet study of D+OF reaction

    International Nuclear Information System (INIS)

    Kurban, M.; Karabulut, E.; Tutuk, R.; Goektas, F.

    2010-01-01

    The quantum dynamics of the D+OF reaction on the adiabatic potential energy surface of the ground 1 3 A ' state has been studied by using a time-dependent quantum real wave packet method. The state-to-state and state-to-all reaction probabilities for total angular momentum J = 0 have been calculated. The probabilities for J > 0 have been calculated by J-shifting the J = 0 results by means of capture model. Then, the integral cross sections and initial state selected rate constants have been calculated. The initial state-selected reaction probabilities and reaction cross section show threshold but not manifest any resonances and the initial state selected rate constants are sensitive to the temperature.

  20. IKO: A Five Actuated DoF Upper Limb Exoskeleton Oriented to Workplace Assistance

    Directory of Open Access Journals (Sweden)

    Felix Martinez

    2009-01-01

    Full Text Available IKerlan’s Orthosis (IKO is an upper limb exoskeleton oriented to increasing human force during routine activity at the workplace. Therefore, it can be considered as a force-amplification device conceived to work in collaboration with the human arm and implementing biomimetic principles. The aim of the proposed design is to find the best compromise between maximum reachable workspace and minimum moving mass, which are the key factors for obtaining an ergonomic, wearable exoskeleton. It consists of five actuated degree of freedom (DoF to move the human arm and three non-actuated DoF between the back and shoulder to allow relative displacement of the sterno-clavicular joint. Conventional electrical motors are used for most of the DoF and pneumatic muscles for one of them (forearm rotation. Power transmission is based on Bowden cables. This paper presents the IKO design, the mechanical structure of a first prototype and the redesign process from an aesthetic point of view. Controller set-up and control strategies are also shown, together with dynamic performance from experimental results.

  1. Hand-held multi-DOF robotic forceps for neurosurgery designed for dexterous manipulation in deep and narrow space.

    Science.gov (United States)

    Okubo, Takuro; Harada, Kanako; Fujii, Masahiro; Tanaka, Shinichi; Ishimaru, Tetsuya; Iwanaka, Tadashi; Nakatomi, Hirohumi; Sora, Sigeo; Morita, Akio; Sugita, Naohiko; Mitsuishi, Mamoru

    2014-01-01

    Neurosurgical procedures require precise and dexterous manipulation of a surgical suture in narrow and deep spaces in the brain. This is necessary for surgical tasks such as the anastomosis of microscopic blood vessels and dura mater suturing. A hand-held multi-degree of freedom (DOF) robotic forceps was developed to aid the performance of such difficult tasks. The diameter of the developed robotic forceps is 3.5 mm, and its tip has three DOFs, namely, bending, rotation, and grip. Experimental results showed that the robotic forceps had an average needle insertion force of 1.7 N. Therefore, an increase in the needle insertion force is necessary for practical application of the developed device.

  2. Structural Design of a 6-DoF Hip Exoskeleton using Linear Series Elastic Actuators

    OpenAIRE

    Li, Xiao

    2017-01-01

    A novel hip exoskeleton with six degrees of freedom (DoF) was developed, and multiple prototypes of this product were created in this thesis. The device was an upper level of the 12-DoF lower-body exoskeleton project, which was known as the Orthotic Lower-body Locomotion Exoskeleton (OLL-E). The hip exoskeleton had three motions per leg, which were roll, yaw, and pitch. Currently, the sufferers of hemiplegia and paraplegia can be addressed by using a wheelchair or operating an exoskeleton wi...

  3. EFSA Panel on Dietetic Products, Nutrition and Allergies (NDA); Scientific Opinion on the substantiation of a health claim related to diacylglycerol (DAG) oil and reduction of body weight pursuant to Article 13(5) of Regulation (EC) No 1924/2006

    DEFF Research Database (Denmark)

    Tetens, Inge

    claim related to diacylglycerol oil and reduction of body weight. The food constituent, diacylglycerol (DAG) oil, and the food constituents, vegetable oils of similar fatty acid composition containing mostly (>90%) triacylglycerol (TAG), which DAG oil should replace in order to obtain the claimed effect...... conclusions to be drawn for the scientific substantiation of the claim. The results from six RCTs with respect to the effect of DAG oil (as a replacement of TAG oils) on body weight are inconsistent and apparently unrelated to the DAG dose, study size or study duration, and the evidence provided in support...... of mechanisms by which DAG oil could exert the claimed effect in humans under the proposed conditions of use is not convincing. One unpublished meta-analysis on the effects of DAG oil (as compared to TAG oils) on body weight in humans which included data from all these RCTs was also provided. The meta...

  4. CQPSO scheduling algorithm for heterogeneous multi-core DAG task model

    Science.gov (United States)

    Zhai, Wenzheng; Hu, Yue-Li; Ran, Feng

    2017-07-01

    Efficient task scheduling is critical to achieve high performance in a heterogeneous multi-core computing environment. The paper focuses on the heterogeneous multi-core directed acyclic graph (DAG) task model and proposes a novel task scheduling method based on an improved chaotic quantum-behaved particle swarm optimization (CQPSO) algorithm. A task priority scheduling list was built. A processor with minimum cumulative earliest finish time (EFT) was acted as the object of the first task assignment. The task precedence relationships were satisfied and the total execution time of all tasks was minimized. The experimental results show that the proposed algorithm has the advantage of optimization abilities, simple and feasible, fast convergence, and can be applied to the task scheduling optimization for other heterogeneous and distributed environment.

  5. Reference trajectory tracking for a multi-DOF robot arm

    Directory of Open Access Journals (Sweden)

    Krasňanský Róbert

    2015-12-01

    Full Text Available This paper presents the problem of tracking the generated reference trajectory by the simulation model of a multi-DOF robot arm. The kinematic transformation between task space and joint configuration coordinates is nonlinear and configuration dependent. To obtain the solution of the forward kinematics problem, the homogeneous transformation matrix is used. A solution to the inverse kinematics is a vector of joint configuration coordinates calculated using of pseudoinverse Jacobian technique. These coordinates correspond to a set of task space coordinates. The algorithm is presented which uses iterative solution and is simplified by considering stepper motors in robot arm joints. The reference trajectory in Cartesian coordinate system is generated on-line by the signal generator previously developed in MS Excel. Dynamic Data Exchange communication protocol allows sharing data with Matlab-Simulink. These data represent the reference tracking trajectory of the end effector. Matlab-Simulink software is used to calculate the representative joint rotations. The proposed algorithm is demonstrated experimentally on the model of 7-DOF robot arm system.

  6. The Impact of Environmental Design on Doffing Personal Protective Equipment in a Healthcare Environment: A Formative Human Factors Trial.

    Science.gov (United States)

    Herlihey, Tracey A; Gelmi, Stefano; Cafazzo, Joseph A; Hall, Trevor N T

    2017-06-01

    OBJECTIVE To explore the impact of environmental design on doffing personal protective equipment in a simulated healthcare environment. METHODS A mixed-methods approach was used that included human-factors usability testing and qualitative questionnaire responses. A patient room and connecting anteroom were constructed for testing purposes. This experimental doffing area was designed to overcome the environmental failures identified in a previous study and was not constructed based on any generalizable hospital standard. RESULTS In total, 72 healthcare workers from Ontario, Canada, took part in the study and tested the simulated doffing area. The following environmental design changes were tested and were deemed effective: increasing prominence of color-coded zones; securing disinfectant wipes and hand sanitizer; outlining disposal bins locations; providing mirrors to detect possible contamination; providing hand rails to assist with doffing; and restricting the space to doff. Further experimentation and iterative design are required with regard to several important features: positioning the disposal bins for safety, decreasing the risk of contamination and user accessibility; optimal positioning of mirrors for safety; communication within the team; and positioning the secondary team member for optimal awareness. Additional design suggestions also emerged during this study, and they require future investigation. CONCLUSIONS This study highlights the importance of the environment on doffing personal protective equipment in a healthcare setting. Iterative testing and modification of the design of the environment (doffing area) are important to enhancing healthcare worker safety. Infect Control Hosp Epidemiol 2017;38:712-717.

  7. A statically balanced and bi-stable compliant end effector combined with a laparoscopic 2DoF robotic arm

    NARCIS (Netherlands)

    Lassooij, J.; Tolou, N.; Tortora, G.; Caccavaro, S.; Menciassi, A.; Herder, J.L.

    2012-01-01

    This article presents the design of a newly developed 2DoF robotic arm with a novel statically balanced and bi-stable compliant grasper as the end effector for laparoscopic surgery application. The arm is based on internal motors actuating 2 rotational DoFs: pitch and roll. The positive stiffness of

  8. Development of an Underactuated 2-DOF Wrist Joint using McKibben PAMs

    Science.gov (United States)

    Rajagopal, S. P.; Jain, S.; Ramasubramanian, S. N.; Johnson, B. V.; Dwivedy, S. K.

    2014-10-01

    In this work, model of an underactuated 2-DOF wrist joint with pneumatically actuated muscles is proposed. For the joint, McKibben-type artificial muscles are used in parallel configuration for the actuation. For each Degree of Freedom (DOF) one agonist-antagonist pair arrangement is usually used with a pulley mechanism. A mathematical model of wrist joint is derived using conventional forward kinematic analysis. The static model relating pressure in the muscle with the orientation of the wrist joint is obtained by combining the experimental data and mathematical model. Regulation of pressure can be achieved by pulse width modulation control of on/off solenoid valves. A set of free vibration experiments are done for the dynamic identification of the muscle characteristics.

  9. A NEW GENERAL 3DOF QUASI-STEADY AERODYNAMIC INSTABILITY MODEL

    DEFF Research Database (Denmark)

    Gjelstrup, Henrik; Larsen, Allan; Georgakis, Christos

    2008-01-01

    but can generally be applied for aerodynamic instability prediction for prismatic bluff bodies. The 3DOF, which make up the movement of the model, are the displacements in the XY-plane and the rotation around the bluff body’s rotational axis. The proposed model incorporates inertia coupling between...

  10. Design of human controlled 1 DOF right hand exoskeleton using electromyography signal

    Science.gov (United States)

    Azzam, M.; Wijaya, S. K.; Prawito

    2017-07-01

    Exoskeleton in general is a structure that is anatomically designed to be able to accommodate the physical movement of its user and provide additional strength. The use of EMG signal to control a 1 DOF right arm exoskeleton is evaluated in this research. This research aims to achieve optimum control using EMG signal. EMG signal is a variation of voltage that occurs when muscle contracts hence its strong correlation with the user's intention of movement. The RMS values of each EMG signal that originates from bicep and tricep muscle are calculated and processed to determine the direction and speed of rotation of a DC motor that actuates the exoskeleton. The RMS calculation is conducted at various array length that will theoretically affect its accuracy. The difference between those two RMS values is then calculated and interpreted as the intention of flexion or extension movement that will control the DC motor rotational direction. The absolute value of the RMS difference multiplied with a gain factor is used to regulate the duty cycle of a PWM signal that is used to control the rotational speed of the DC motor. To achieve the smallest settling time, array length and gain factor were varied. The test was conducted in two stages, static and dynamic tests. The test result shows a trend where the settling time decreases when array length is shortened and gain is increased. It shows that optimum control can be achieved by selecting the right array length and gain.

  11. G-protein mediated signaling pathways in myogenic responsiveness of mouse mesenteric artery

    DEFF Research Database (Denmark)

    Jensen, Lars Jørn; Joseph, Philomeena Daphne; Haanes, Kristian Agmund

    2015-01-01

    of PLA2 (AACOCF3, 5 µM), DAG lipase (RHC80267, 20 µM), PI3-kinase (wortmannin, 0.03 µM), CYP4A (HET0016, 10 µM), and TRPC channels (SKF96365, 10 µM) had no effects. Gq/11 and G12 mRNA and protein were expressed in MA. The Gα/q inhibitor YM-254890 (0.1 µM) and the AT1-R blocker valsartan (0.3 µ...

  12. Pertussis toxin treatment attenuates some effects of insulin in BC3H-1 murine myocytes

    International Nuclear Information System (INIS)

    Luttrell, L.M.; Hewlett, E.L.; Romero, G.; Rogol, A.D.

    1988-01-01

    The effects of pertussis toxin (PT) treatment on insulin-stimulated myristoyl-diacylglycerol (DAG) generation, hexose transport, and thymidine incorporation were studied in differentiated BC3H-1 mycocytes. Insulin treatment caused a biphasic increase in myristoyl-DAG production which was abolished in myocytes treated with PT. There was no effect of PT treatment on basal (nonstimulated) myristoyl-DAG production. Insulin-stimulated hydrolysis of a membrane phosphatidylinositol glycan was blocked by PT treatment. ADP-ribosylation of BC3H-1 plasma membranes with [ 32 P]NAD revealed a 40-kDa protein as the major PT substrate in vivo and in vitro. The time course and dose dependence of the effects of PT on diacylglycerol generation correlated with the in vivo ADP-ribosylation of the 40-kDa substrate. Pertussis toxin treatment resulted in a 71% attenuation of insulin-stimulated hexose uptake without effect on either basal or phorbol ester-stimulated uptake. The stimulatory effects of insulin and fetal calf serum on [ 3 H]thymidine incorporation into quiescent myocytes were attenuated by 61 and 59%, respectively, when PT was added coincidently with the growth factors. Nonstimulated and EGF-stimulated [ 3 H]thymidine incorporation was unaffected by PT treatment. These data suggest that a PT-sensitive G protein is involved in the cellular signaling mechanisms of insulin

  13. Real-time control of the 3-DOF sled dynamics of a null-flux Maglev System with a passive sled

    NARCIS (Netherlands)

    Boeij, de J.; Steinbuch, M.; Gutierrez, H.M.

    2006-01-01

    The real-time control of the three degrees of freedom (DOF) dynamics of an electrodynamic (EDS) Maglev vehicle is presented. The design is based on a 5-DOF state-space model of the sled dynamics that uses a simple algebraic model to describe the interaction between the -flux coils on the track and

  14. A Six-DOF Buoyancy Tank Microgravity Test Bed with Active Drag Compensation

    Science.gov (United States)

    Sun, Chong; Chen, Shiyu; Yuan, Jianping; Zhu, Zhanxia

    2017-10-01

    Ground experiment under microgravity is very essential because it can verify the space enabling technologies before applied in space missions. In this paper, a novel ground experiment system that can provide long duration, large scale and high microgravity level for the six degree of freedom (DOF) spacecraft trajectory tracking is presented. In which, the most gravity of the test body is balanced by the buoyancy, and the small residual gravity is offset by the electromagnetic force. Because the electromagnetic force on the test body can be adjusted in the electromagnetic system, it can significantly simplify the balancing process using the proposed microgravity test bed compared to the neutral buoyance system. Besides, a novel compensation control system based on the active disturbance rejection control (ADRC) method is developed to estimate and compensate the water resistance online, in order to improve the fidelity of the ground experiment. A six-DOF trajectory tracking in the microgravity system is applied to testify the efficiency of the proposed compensation controller, and the experimental simulation results are compared to that obtained using the classic proportional-integral-derivative (PID) method. The simulation results demonstrated that, for the six-DOF motion ground experiment, the microgravity level can reach to 5 × 10-4 g. And, because the water resistance has been estimated and compensated, the performance of the presented controller is much better than the PID controller. The presented ground microgravity system can be applied in on-orbit service and other related technologies in future.

  15. System for simultaneously measuring 6DOF geometric motion errors using a polarization maintaining fiber-coupled dual-frequency laser.

    Science.gov (United States)

    Cui, Cunxing; Feng, Qibo; Zhang, Bin; Zhao, Yuqiong

    2016-03-21

    A novel method for simultaneously measuring six degree-of-freedom (6DOF) geometric motion errors is proposed in this paper, and the corresponding measurement instrument is developed. Simultaneous measurement of 6DOF geometric motion errors using a polarization maintaining fiber-coupled dual-frequency laser is accomplished for the first time to the best of the authors' knowledge. Dual-frequency laser beams that are orthogonally linear polarized were adopted as the measuring datum. Positioning error measurement was achieved by heterodyne interferometry, and other 5DOF geometric motion errors were obtained by fiber collimation measurement. A series of experiments was performed to verify the effectiveness of the developed instrument. The experimental results showed that the stability and accuracy of the positioning error measurement are 31.1 nm and 0.5 μm, respectively. For the straightness error measurements, the stability and resolution are 60 and 40 nm, respectively, and the maximum deviation of repeatability is ± 0.15 μm in the x direction and ± 0.1 μm in the y direction. For pitch and yaw measurements, the stabilities are 0.03″ and 0.04″, the maximum deviations of repeatability are ± 0.18″ and ± 0.24″, and the accuracies are 0.4″ and 0.35″, respectively. The stability and resolution of roll measurement are 0.29″ and 0.2″, respectively, and the accuracy is 0.6″.

  16. Towards frameless maskless SRS through real-time 6DoF robotic motion compensation

    Science.gov (United States)

    Belcher, Andrew H.; Liu, Xinmin; Chmura, Steven; Yenice, Kamil; Wiersma, Rodney D.

    2017-12-01

    Stereotactic radiosurgery (SRS) uses precise dose placement to treat conditions of the CNS. Frame-based SRS uses a metal head ring fixed to the patient’s skull to provide high treatment accuracy, but patient comfort and clinical workflow may suffer. Frameless SRS, while potentially more convenient, may increase uncertainty of treatment accuracy and be physiologically confining to some patients. By incorporating highly precise robotics and advanced software algorithms into frameless treatments, we present a novel frameless and maskless SRS system where a robot provides real-time 6DoF head motion stabilization allowing positional accuracies to match or exceed those of traditional frame-based SRS. A 6DoF parallel kinematics robot was developed and integrated with a real-time infrared camera in a closed loop configuration. A novel compensation algorithm was developed based on an iterative closest-path correction approach. The robotic SRS system was tested on six volunteers, whose motion was monitored and compensated for in real-time over 15 min simulated treatments. The system’s effectiveness in maintaining the target’s 6DoF position within preset thresholds was determined by comparing volunteer head motion with and without compensation. Comparing corrected and uncorrected motion, the 6DoF robotic system showed an overall improvement factor of 21 in terms of maintaining target position within 0.5 mm and 0.5 degree thresholds. Although the system’s effectiveness varied among the volunteers examined, for all volunteers tested the target position remained within the preset tolerances 99.0% of the time when robotic stabilization was used, compared to 4.7% without robotic stabilization. The pre-clinical robotic SRS compensation system was found to be effective at responding to sub-millimeter and sub-degree cranial motions for all volunteers examined. The system’s success with volunteers has demonstrated its capability for implementation with frameless and

  17. Towards frameless maskless SRS through real-time 6DoF robotic motion compensation.

    Science.gov (United States)

    Belcher, Andrew H; Liu, Xinmin; Chmura, Steven; Yenice, Kamil; Wiersma, Rodney D

    2017-11-13

    Stereotactic radiosurgery (SRS) uses precise dose placement to treat conditions of the CNS. Frame-based SRS uses a metal head ring fixed to the patient's skull to provide high treatment accuracy, but patient comfort and clinical workflow may suffer. Frameless SRS, while potentially more convenient, may increase uncertainty of treatment accuracy and be physiologically confining to some patients. By incorporating highly precise robotics and advanced software algorithms into frameless treatments, we present a novel frameless and maskless SRS system where a robot provides real-time 6DoF head motion stabilization allowing positional accuracies to match or exceed those of traditional frame-based SRS. A 6DoF parallel kinematics robot was developed and integrated with a real-time infrared camera in a closed loop configuration. A novel compensation algorithm was developed based on an iterative closest-path correction approach. The robotic SRS system was tested on six volunteers, whose motion was monitored and compensated for in real-time over 15 min simulated treatments. The system's effectiveness in maintaining the target's 6DoF position within preset thresholds was determined by comparing volunteer head motion with and without compensation. Comparing corrected and uncorrected motion, the 6DoF robotic system showed an overall improvement factor of 21 in terms of maintaining target position within 0.5 mm and 0.5 degree thresholds. Although the system's effectiveness varied among the volunteers examined, for all volunteers tested the target position remained within the preset tolerances 99.0% of the time when robotic stabilization was used, compared to 4.7% without robotic stabilization. The pre-clinical robotic SRS compensation system was found to be effective at responding to sub-millimeter and sub-degree cranial motions for all volunteers examined. The system's success with volunteers has demonstrated its capability for implementation with frameless and maskless SRS

  18. Hybrid Taguchi DNA Swarm Intelligence for Optimal Inverse Kinematics Redundancy Resolution of Six-DOF Humanoid Robot Arms

    Directory of Open Access Journals (Sweden)

    Hsu-Chih Huang

    2014-01-01

    Full Text Available This paper presents a hybrid Taguchi deoxyribonucleic acid (DNA swarm intelligence for solving the inverse kinematics redundancy problem of six degree-of-freedom (DOF humanoid robot arms. The inverse kinematics problem of the multi-DOF humanoid robot arm is redundant and has no general closed-form solutions or analytical solutions. The optimal joint configurations are obtained by minimizing the predefined performance index in DNA algorithm for real-world humanoid robotics application. The Taguchi method is employed to determine the DNA parameters to search for the joint solutions of the six-DOF robot arms more efficiently. This approach circumvents the disadvantage of time-consuming tuning procedure in conventional DNA computing. Simulation results are conducted to illustrate the effectiveness and merit of the proposed methods. This Taguchi-based DNA (TDNA solver outperforms the conventional solvers, such as geometric solver, Jacobian-based solver, genetic algorithm (GA solver and ant, colony optimization (ACO solver.

  19. “Mai, inteso nominare”. La citazione in “Dio ne scampi dagli Orsenigo"

    Directory of Open Access Journals (Sweden)

    Sandra Carapezza

    2015-06-01

    Full Text Available In Dio ne scampi dagli Orsenigo Vittorio Imbriani grapples with the form of the novel. In a dialectical fashion, explicit quotations (frequently from French sources clarify his position towards generic paradigms. This article attempts to group these quotations on the basis of their literary genres in order to stress the complexities of an inclusive and versatile text. The intertextual network, ranging from feuilleton literature to academic preciosity, in the last instance reveals itself as an ironic antidote to Romantic identification. This trend is confirmed by the remarkable increase in the number of quotations from the first edition (1876 to the second publication in volume form in 1883.

  20. Radiometric compensation for cooperative distributed multi-projection system through 2-DOF distributed control.

    Science.gov (United States)

    Tsukamoto, Jun; Iwai, Daisuke; Kashima, Kenji

    2015-11-01

    This paper proposes a novel radiometric compensation technique for cooperative projection system based-on distributed optimization. To achieve high scalability and robustness, we assume cooperative projection environments such that 1. each projector does not have information about other projectors as well as target images, 2. the camera does not have information about the projectors either, while having the target images, and 3. only a broadcast communication from the camera to the projectors is allowed to suppress the data transfer bandwidth. To this end, we first investigate a distributed optimization based feedback mechanism that is suitable for the required decentralized information processing environment. Next, we show that this mechanism works well for still image projection, however not necessary for moving images due to the lack of dynamic responsiveness. To overcome this issue, we propose to implement an additional feedforward mechanism. Such a 2 Degree Of Freedom (2-DOF) control structure is well-known in control engineering community as a typical method to enhance not only disturbance rejection but also reference tracking capability, simultaneously. We theoretically guarantee and experimentally demonstrate that this 2-DOF structure yields the moving image projection accuracy that is overwhelming the best achievable performance only by the distributed optimization mechanisms.

  1. Chattering-Free Neuro-Sliding Mode Control of 2-DOF Planar Parallel Manipulators

    Directory of Open Access Journals (Sweden)

    Tien Dung Le

    2013-01-01

    Full Text Available This paper proposes a novel chattering free neuro-sliding mode controller for the trajectory tracking control of two degrees of freedom (DOF parallel manipulators which have a complicated dynamic model, including modelling uncertainties, frictional uncertainties and external disturbances. A feedforward neural network (NN is combined with an error estimator to completely compensate the large nonlinear uncertainties and external disturbances of the parallel manipulators. The online weight tuning algorithms of the NN and the structure of the error estimator are derived with the strict theoretical stability proof of the Lyapunov theorem. The upper bound of uncertainties and the upper bound of the approximation errors are not required to be known in advance in order to guarantee the stability of the closed-loop system. The example simulation results show the effectiveness of the proposed control strategy for the tracking control of a 2-DOF parallel manipulator. It results in its being chattering-free, very small tracking errors and its robustness against uncertainties and external disturbances.

  2. Activation of a development-specific gene, dofA, by FruA, an essential transcription factor for development of Myxococcus xanthus.

    Science.gov (United States)

    Ueki, Toshiyuki; Inouye, Sumiko

    2005-12-01

    FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development.

  3. Activation of a Development-Specific Gene, dofA, by FruA, an Essential Transcription Factor for Development of Myxococcus xanthus

    OpenAIRE

    Ueki, Toshiyuki; Inouye, Sumiko

    2005-01-01

    FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development.

  4. Troglitazone stimulates β-arrestin-dependent cardiomyocyte contractility via the angiotensin II type 1A receptor

    International Nuclear Information System (INIS)

    Tilley, Douglas G.; Nguyen, Anny D.; Rockman, Howard A.

    2010-01-01

    Peroxisome proliferator-activated receptor γ (PPARγ) agonists are commonly used to treat cardiovascular diseases, and are reported to have several effects on cardiovascular function that may be due to PPARγ-independent signaling events. Select angiotensin receptor blockers (ARBs) interact with and modulate PPARγ activity, thus we hypothesized that a PPARγ agonist may exert physiologic effects via the angiotensin II type 1 A receptor (AT1 A R). In AT1 A R-overexpressing HEK 293 cells, both angiotensin II (Ang II) and the PPARγ agonist troglitazone (Trog) enhanced AT1 A R internalization and recruitment of endogenous β-arrestin1/2 (βarr1/2) to the AT1 A R. A fluorescence assay to measure diacylglycerol (DAG) accumulation showed that although Ang II induced AT1 A R-G q protein-mediated DAG accumulation, Trog had no impact on DAG generation. Trog-mediated recruitment of βarr1/2 was selective to AT1 A R as the response was prevented by an ARB- and Trog-mediated βarr1/2 recruitment to β1-adrenergic receptor (β1AR) was not observed. In isolated mouse cardiomyocytes, Trog increased both % and rate of cell shortening to a similar extent as Ang II, effects which were blocked with an ARB. Additionally, these effects were found to be βarr2-dependent, as cardiomyocytes isolated from βarr2-KO mice showed blunted contractile responses to Trog. These findings show for the first time that the PPARγ agonist Trog acts at the AT1 A R to simultaneously block G q protein activation and induce the recruitment of βarr1/2, which leads to an increase in cardiomyocyte contractility.

  5. Diacylglycerol kinase α mediates 17-β-estradiol-induced proliferation, motility, and anchorage-independent growth of Hec-1A endometrial cancer cell line through the G protein-coupled estrogen receptor GPR30.

    Science.gov (United States)

    Filigheddu, Nicoletta; Sampietro, Sara; Chianale, Federica; Porporato, Paolo E; Gaggianesi, Miriam; Gregnanin, Ilaria; Rainero, Elena; Ferrara, Michele; Perego, Beatrice; Riboni, Francesca; Baldanzi, Gianluca; Graziani, Andrea; Surico, Nicola

    2011-12-01

    Increased levels of endogenous and/or exogenous estrogens are one of the well known risk factors of endometrial cancer. Diacylglycerol kinases (DGKs) are a family of enzymes which phosphorylate diacylglycerol (DAG) to produce phosphatidic acid (PA), thus turning off and on DAG-mediated and PA-mediated signaling pathways, respectively. DGK α activity is stimulated by growth factors and oncogenes and is required for chemotactic, proliferative, and angiogenic signaling in vitro. Herein, using either specific siRNAs or the pharmacological inhibitor R59949, we demonstrate that DGK α activity is required for 17-β-estradiol (E2)-induced proliferation, motility, and anchorage-independent growth of Hec-1A endometrial cancer cell line. Impairment of DGK α activity also influences basal cell proliferation and growth in soft agar of Hec-1A, while it has no effects on basal cell motility. Moreover, we show that DGK α activity induced by E2, as well as its observed effects, are mediated by the G protein-coupled estrogen receptor GPR30 (GPER). These findings suggest that DGK α may be a potential target in endometrial cancer therapy. Copyright © 2011 Elsevier Inc. All rights reserved.

  6. Experimental Analysis and Full Prediction Model of a 5-DOF Motorized Spindle

    Directory of Open Access Journals (Sweden)

    Weiyu Zhang

    2017-01-01

    Full Text Available The cost and power consumption of DC power amplifiers are much greater than that of AC power converters. Compared to a motorized spindle supported with DC magnetic bearings, a motorized spindle supported with AC magnetic bearings is inexpensive and more efficient. This paper studies a five-degrees-of-freedom (5-DOF motorized spindle supported with AC hybrid magnetic bearings (HMBs. Most models of suspension forces, except a “switching model”, are quite accurate, but only in a particular operating area and not in regional coverage. If a “switching model” is applied to a 5-DOF motorized spindle, the real-time performance of the control system can be significantly decreased due to the large amount of data processing for both displacement and current. In order to solve this defect, experiments based on the “switching model” are performed, and the resulting data are analyzed. Using the data analysis results, a “full prediction model” based on the operating state is proposed to improve real-time performance and precision. Finally, comparative, verification and stiffness tests are conducted to verify the improvement of the proposed model. Results of the tests indicate that the rotor has excellent characteristics, such as good real-time performance, superior anti-interference performance with load and the accuracy of the model in full zone. The satisfactory experimental results demonstrate the effectiveness of the “full prediction model” applied to the control system under different operating stages. Therefore, the results of the experimental analysis and the proposed full prediction model can provide a control system of a 5-DOF motorized spindle with the most suitable mathematical models of the suspension force.

  7. On Virtual Integrated Model of a 6DoF Manipulator Arm for Emergency Cases Interventions

    Directory of Open Access Journals (Sweden)

    Gigi Naidin

    2011-09-01

    Full Text Available This research deals with a virtual integrated model for a 6DoF manipulator arm dedicated to use for emergency situations intervention. The virtual model can simulates both the entire structural and mechanical configuration of the manipulator, and the driving system with automated command unit. The basic idea supposes to develop a complex simulator for kinematical and dynamic behavior analysis of 6DoF robot manipulator, and for facilely cross correlation and comparative evaluation between essential parameters and extremely bearing cases defining the manipulator working state. The analysis was developed in Matlab© - SimScape© software. The conclusions dignify the main functional capability of the manipulator supposing the capacity of driving system and mechanical structure.

  8. Synchronized motion control and precision positioning compensation of a 3-DOFs macro-micro parallel manipulator fully actuated by piezoelectric actuators

    Science.gov (United States)

    Zhang, Quan; Li, Chaodong; Zhang, Jiantao; Zhang, Xu

    2017-11-01

    The macro-micro combined approach, as an effective way to realize trans-scale nano-precision positioning with multi-dimensions and high velocity, plays a significant role in integrated circuit manufacturing field. A 3-degree-of-freedoms (3-DOFs) macro-micro manipulator is designed and analyzed to compromise the conflictions among the large stroke, high precision and multi-DOFs. The macro manipulator is a 3-Prismatic-Revolute-Revolute (3-PRR) structure parallel manipulator which is driven by three linear ultrasonic motors. The dynamic model and the cross-coupling error based synchronized motion controller of the 3-PRR parallel manipulator are theoretical analyzed and experimental tested. To further improve the positioning accuracy, a 3-DOFs monolithic compliant manipulator actuated by three piezoelectric stack actuators is designed. Then a multilayer BP neural network based inverse kinematic model identifier is developed to perform the positioning control. Finally, by forming the macro-micro structure, the dual stage manipulator successfully achieved the positioning task from the point (2 mm, 2 mm, 0 rad) back to the original point (0 mm, 0 mm, 0 rad) with the translation errors in X and Y directions less than ±50 nm and the rotation error around Z axis less than ±1 μrad, respectively.

  9. A study of the influence of charged residues on β-hairpin formation by nuclear magnetic resonance and molecular dynamics.

    Science.gov (United States)

    Makowska, Joanna; Zmudzińska, Wioletta; Uber, Dorota; Chmurzyński, Lech

    2014-12-01

    Chain reversals are often nucleation sites in protein folding. The β-hairpins of FBP28 WW domain and IgG are stable and have been proved to initiate the folding and are, therefore, suitable for studying the influence of charged residues on β-hairpin conformation. In this paper, we carried out NMR examination of the conformations in solution of two fragments from the FPB28 protein (PDB code: 1E0L) (N-terminal part) namely KTADGKT-NH2 (1E0L 12-18, D7) and YKTADGKTY-NH2 (1E0L 11-19, D9), one from the B3 domain of the protein G (PDB code: 1IGD), namely DDATKT-NH2 (1IGD 51-56) (Dag1), and three variants of Dag1 peptide: DVATKT-NH2 (Dag2), OVATKT-NH2 (Dag3) and KVATKT-NH2 (Dag4), respectively, in which the original charged residue were replaced with non-polar residues or modified charged residues. It was found that both the D7 and D9 peptides form a large fraction bent conformations. However, no hydrophobic contacts between the terminal Tyr residues of D9 occur, which suggests that the presence of a pair of like-charged residues stabilizes chain reversal. Conversely, only the Dag1 and Dag2 peptides exhibit some chain reversal; replacing the second aspartic-acid residue with a valine and the first one with a basic residue results in a nearly extended conformation. These results suggest that basic residues farther away in sequence can result in stabilization of chain reversal owing to screening of the non-polar core. Conversely, smaller distance in sequence prohibits this screening, while the presence oppositely-charged residues can stabilize a turn because of salt-bridge formation.

  10. Particularities of fully-parallel manipulators in 6-DOFs robots design: a review of critical aspects

    Directory of Open Access Journals (Sweden)

    Milica Lucian

    2017-01-01

    Full Text Available A whole range of industrial applications requires the presence of parallel mechanisms with six degrees of freedom (6-DOF which have been developed in the last fifteen years, and one of the reasons why they still are a current topic is that present-day computers are capable of performing real-time motion laws of great complexity associated with these types of parallel mechanisms. The present work underlines particularities of parallel manipulators and their importance in the design of 6-DOF robots. The paper reveals the progress made in the last twenty years in the development of 6-DOF parallel manipulators, which increasingly find a wide scope of applications in different industrial areas such as robotics, manufacture and assisted medicine. It also emphasizes the need to determine singular configurations and the effect of cinematic redundancy which can increase the working space of the manipulators by adding active joints in one or more branches of the manipulator. Throughout the work, there were outlined three types of singularities encountered in the modelling of different types of parallel manipulators, and three types of redundancy. Furthermore, an analysis was made of the dimension of the workspace for a series of parallel manipulators, highlighting a number of factors that influence its size.

  11. Insulin stimulates phospholipase D-dependent phosphatidylcholine hydrolysis, Rho translocation, de novo phospholipid synthesis, and diacylglycerol/protein kinase C signaling in L6 myotubes.

    Science.gov (United States)

    Standaert, M L; Bandyopadhyay, G; Zhou, X; Galloway, L; Farese, R V

    1996-07-01

    Previous studies have provided conflicting findings on whether insulin activates certain, potentially important, phospholipid signaling systems in skeletal muscle preparations. In particular, insulin effects on the hydrolysis of phosphatidylcholine (PC) and subsequent activation of protein kinase C (PKC) have not been apparent in some studies. Presently, we examined insulin effects on phospholipid signaling systems, diacylglycerol (DAG) production, and PKC translocation/activation in L6 myotubes. We found that insulin provoked rapid increases in phospholipase D (PLD)-dependent hydrolysis of PC, as evidenced by increases in choline release and phosphatidylethanol production in cells incubated in the presence of ethanol. In association with PC-PLD activation, Rho, a small G protein that is known to activate PC-PLD activation, translocated from the cytosol to the membrane fraction in response to insulin treatment. PC-PLD activation was also accompanied by increases in total DAG production and increases in the translocation of both PKC enzyme activity and DAG-sensitive PKC-alpha, -beta, -delta, and -epsilon from the cytosol to the membrane fraction. A potential role for PKC or a related protein kinase in insulin action was suggested by the finding that RO 31-8220 inhibited both PKC enzyme activity and insulin-stimulated [3H]2-deoxyglucose uptake. Our findings provide the first evidence that insulin stimulates Rho translocation and activates PC-PLD in L6 skeletal muscle cells. Moreover, this signaling system appears to lead to increases in DAG/PKC signaling, which, along with other related signaling factors, may regulate certain metabolic processes, such as glucose transport, in these cells.

  12. Design Optimization of a Cable-Driven Two-DOF Flexible Joint Module

    Directory of Open Access Journals (Sweden)

    Zhao Zhang

    2012-11-01

    Full Text Available This paper focuses on the kinematics, kinetostatics and design optimization of a 2-DOF cable-driven flexible joint module. Based on the motion characteristics of the 2-DOF joint module, the concept of instantaneous screw axis in conjunction with the Product-Of-Exponentials (POE formula is proposed to formulate its kinematic model. However, as the instantaneous screw axis is unfixed, the Lie group method is employed to derive the instantaneous kinematic model of the joint module. In order to generate the feasible workspace subject to positive tension constraint, the kinetostatics of the joint module is addressed, where the stiffness resulting from both the driving cables and the flexible backbone are considered. A numerical orientation workspace evaluation method is proposed based on an equi-volumetric partition in its parametric space and the volume-element associated integral factor. A global singular value (GSV index, which considers the minimum singular value of the stiffness matrix of joint module over the achievable workspace, is employed to optimize the geometric size of joint module. The simulation results demonstrate the effectiveness of the proposed GSV optimization algorithm.

  13. Design of a 7-DOF slave robot integrated with a magneto-rheological haptic master

    Science.gov (United States)

    Hwang, Yong-Hoon; Cha, Seung-Woo; Kang, Seok-Rae; Choi, Seung-Bok

    2017-04-01

    In this study, a 7-DOF slave robot integrated with the haptic master is designed and its dynamic motion is controlled. The haptic master is made using a controllable magneto-rheological (MR) clutch and brake and it provides the surgeon with a sense of touch by using both kinetic and kinesthetic information. Due to the size constraint of the slave robot, a wire actuating is adopted to make the desired motion of the end-effector which has 3-DOF instead of a conventional direct-driven motor. Another motions of the link parts that have 4-DOF use direct-driven motor. In total system, for working as a haptic device, the haptic master need to receive the information of repulsive forces applied on the slave robot. Therefore, repulsive forces on the end-effector are sensed by using three uniaxial torque transducer inserted in the wire actuating system and another repulsive forces applied on link part are sensed by using 6-axis transducer that is able to sense forces and torques. Using another 6-axis transducer, verify the reliability of force information on final end of slave robot. Lastly, integrated with a MR haptic master, psycho-physical test is conducted by different operators who can feel the different repulsive force or torque generated from the haptic master which is equivalent to the force or torque occurred on the end-effector to demonstrate the effectiveness of the proposed system.

  14. Protein Kinase D Enzymes as Regulators of EMT and Cancer Cell Invasion

    Directory of Open Access Journals (Sweden)

    Nisha Durand

    2016-02-01

    Full Text Available The Protein Kinase D (PKD isoforms PKD1, PKD2, and PKD3 are effectors of the novel Protein Kinase Cs (nPKCs and diacylglycerol (DAG. PKDs impact diverse biological processes like protein transport, cell migration, proliferation, epithelial to mesenchymal transition (EMT and apoptosis. PKDs however, have distinct effects on these functions. While PKD1 blocks EMT and cell migration, PKD2 and PKD3 tend to drive both processes. Given the importance of EMT and cell migration to the initiation and progression of various malignancies, abnormal expression of PKDs has been reported in multiple types of cancers, including breast, pancreatic and prostate cancer. In this review, we discuss how EMT and cell migration are regulated by PKD isoforms and the significance of this regulation in the context of cancer development.

  15. Adaptive PSO for optimal LQR tracking control of 2 DoF laboratory helicopter

    NARCIS (Netherlands)

    Vinodh Kumar, E.; Ganapathy Subramanian, R.; Jerome, J.

    2016-01-01

    This paper deals with the attitude tracking control problem for a 2 DoF laboratory helicopter using optimal linear quadratic regulator (LQR). As the performance of the LQR controller greatly depends on the weighting matrices (Q and R), it is important to select them optimally. However, normally the

  16. Operation analysis of a Chebyshev-Pantograph leg mechanism for a single DOF biped robot

    Science.gov (United States)

    Liang, Conghui; Ceccarelli, Marco; Takeda, Yukio

    2012-12-01

    In this paper, operation analysis of a Chebyshev-Pantograph leg mechanism is presented for a single degree of freedom (DOF) biped robot. The proposed leg mechanism is composed of a Chebyshev four-bar linkage and a pantograph mechanism. In contrast to general fully actuated anthropomorphic leg mechanisms, the proposed leg mechanism has peculiar features like compactness, low-cost, and easy-operation. Kinematic equations of the proposed leg mechanism are formulated for a computer oriented simulation. Simulation results show the operation performance of the proposed leg mechanism with suitable characteristics. A parametric study has been carried out to evaluate the operation performance as function of design parameters. A prototype of a single DOF biped robot equipped with two proposed leg mechanisms has been built at LARM (Laboratory of Robotics and Mechatronics). Experimental test shows practical feasible walking ability of the prototype, as well as drawbacks are discussed for the mechanical design.

  17. Towards Kilo-Hertz 6-DoF Visual Tracking Using an Egocentric Cluster of Rolling Shutter Cameras.

    Science.gov (United States)

    Bapat, Akash; Dunn, Enrique; Frahm, Jan-Michael

    2016-11-01

    To maintain a reliable registration of the virtual world with the real world, augmented reality (AR) applications require highly accurate, low-latency tracking of the device. In this paper, we propose a novel method for performing this fast 6-DOF head pose tracking using a cluster of rolling shutter cameras. The key idea is that a rolling shutter camera works by capturing the rows of an image in rapid succession, essentially acting as a high-frequency 1D image sensor. By integrating multiple rolling shutter cameras on the AR device, our tracker is able to perform 6-DOF markerless tracking in a static indoor environment with minimal latency. Compared to state-of-the-art tracking systems, this tracking approach performs at significantly higher frequency, and it works in generalized environments. To demonstrate the feasibility of our system, we present thorough evaluations on synthetically generated data with tracking frequencies reaching 56.7 kHz. We further validate the method's accuracy on real-world images collected from a prototype of our tracking system against ground truth data using standard commodity GoPro cameras capturing at 120 Hz frame rate.

  18. Robust design of a 2-DOF GMV controller: a direct self-tuning and fuzzy scheduling approach.

    Science.gov (United States)

    Silveira, Antonio S; Rodríguez, Jaime E N; Coelho, Antonio A R

    2012-01-01

    This paper presents a study on self-tuning control strategies with generalized minimum variance control in a fixed two degree of freedom structure-or simply GMV2DOF-within two adaptive perspectives. One, from the process model point of view, using a recursive least squares estimator algorithm for direct self-tuning design, and another, using a Mamdani fuzzy GMV2DOF parameters scheduling technique based on analytical and physical interpretations from robustness analysis of the system. Both strategies are assessed by simulation and real plants experimentation environments composed of a damped pendulum and an under development wind tunnel from the Department of Automation and Systems of the Federal University of Santa Catarina. Copyright © 2011 ISA. Published by Elsevier Ltd. All rights reserved.

  19. Torque Measurement of 3-DOF Haptic Master Operated by Controllable Electrorheological Fluid

    Directory of Open Access Journals (Sweden)

    Oh Jong-Seok

    2015-02-01

    Full Text Available This work presents a torque measurement method of 3-degree-of-freedom (3-DOF haptic master featuring controllable electrorheological (ER fluid. In order to reflect the sense of an organ for a surgeon, the ER haptic master which can generate the repulsive torque of an organ is utilized as a remote controller for a surgery robot. Since accurate representation of organ feeling is essential for the success of the robot-assisted surgery, it is indispensable to develop a proper torque measurement method of 3-DOF ER haptic master. After describing the structural configuration of the haptic master, the torque models of ER spherical joint are mathematically derived based on the Bingham model of ER fluid. A new type of haptic device which has pitching, rolling, and yawing motions is then designed and manufactured using a spherical joint mechanism. Subsequently, the field-dependent parameters of the Bingham model are identified and generating repulsive torque according to applied electric field is measured. In addition, in order to verify the effectiveness of the proposed torque model, a comparative work between simulated and measured torques is undertaken.

  20. Novel Adaptive Forward Neural MIMO NARX Model for the Identification of Industrial 3-DOF Robot Arm Kinematics

    Directory of Open Access Journals (Sweden)

    Ho Pham Huy Anh

    2012-10-01

    Full Text Available In this paper, a novel forward adaptive neural MIMO NARX model is used for modelling and identifying the forward kinematics of an industrial 3-DOF robot arm system. The nonlinear features of the forward kinematics of the industrial robot arm drive are thoroughly modelled based on the forward adaptive neural NARX model-based identification process using experimental input-output training data. This paper proposes a novel use of a back propagation (BP algorithm to generate the forward neural MIMO NARX (FNMN model for the forward kinematics of the industrial 3-DOF robot arm. The results show that the proposed adaptive neural NARX model trained by a Back Propagation learning algorithm yields outstanding performance and perfect accuracy.

  1. Decoupled Sliding Mode Control for a Novel 3-DOF Parallel Manipulator with Actuation Redundancy

    Directory of Open Access Journals (Sweden)

    Niu Xuemei

    2015-05-01

    Full Text Available This paper presents a decoupled nonsingular terminal sliding mode controller (DNTSMC for a novel 3-DOF parallel manipulator with actuation redundancy. According to kinematic analysis, the inverse dynamic model for a novel 3-DOF redundantly actuated parallel manipulator is formulated in the task space using Lagrangian formalism and decoupled into three entirely independent subsystems under generalized coordinates to significantly reduce system complexity. Based on the dynamic model, a decoupled sliding mode control strategy is proposed for the parallel manipulator; the idea behind this strategy is to design a nonsingular terminal sliding mode controller for each subsystem, which can drive states of three subsystems to the original equilibrium points simultaneously by two intermediate variables. Additionally, a RBF neural network is used to compensate the cross-coupling force and gravity to enhance the control precision. Simulation and experimental results show that the proposed DNTSMC can achieve better control performances compared with the conventional sliding mode controller (SMC and the DNTSMC without compensator.

  2. Design of a planar 3-DOF parallel micromanipulator

    International Nuclear Information System (INIS)

    Lee, Jeong Jae; Dong, Yanlu; Jeon, Yong Ho; Lee, Moon Gu

    2013-01-01

    A planar three degree-of-freedom (DOF) parallel manipulator is proposed to be applied for alignment during assembly of microcomponents. It adopts a PRR (prismatic-revolute-revolute) mechanism to meet the requirements of high precision for assembly and robustness against disturbance. The mechanism was designed to have a large workspace and good dexterity because parallel mechanisms usually have a narrow range and singularity of motion compared to serial mechanisms. Inverse kinematics and a simple closed-loop algorithm of the parallel manipulator are presented to control it. Experimental tests have been carried out with high-resolution capacitance sensors to verify the performance of the mechanism. The results of experiments show that the manipulator has a large workspace of ±1.0 mm, ±1.0 mm, and ±10 mrad in the X-, Y-, and θ-directions, respectively. This is a large workspace when considering it adopts a parallel mechanism and has a small size, 100 ´ 100 ´ 100 mm3 . It also has a good precision of 2 μm, 3 μm, and 0.2 mrad, in the X-, Y-, and θ- axes, respectively. These are high resolutions considering the manipulator adopts conventional joints. The manipulator is expected to have good dexterity.

  3. Sliding mode control of a "Soft" 2-DOF Planar Pneumatic Manipulator

    Science.gov (United States)

    Van Damme, M.; Vanderborght, B.; Beyl, P.; Versluys, R.; Vanderniepen, I.; Van Ham, R.; Cherelle, P.; Daerden, F.; Lefeber, D.

    2008-10-01

    This paper presents a sliding mode controller for a "Soft" 2-DOF Planar Pneumatic Manipulator actuated by pleated pneumatic artificial muscle actuators. Since actuator dynamics is not negligible, an approximate model for pressure dynamics was taken into account, which made it necessary to perform full input-output feedback linearization in order to design a sliding mode controller. The design of the controller is presented in detail, and experimental results obtained by implementing the controller are discussed

  4. Studies on the substrate and stereo/regioselectivity of adipose triglyceride lipase, hormone-sensitive lipase, and diacylglycerol-O-acyltransferases.

    Science.gov (United States)

    Eichmann, Thomas O; Kumari, Manju; Haas, Joel T; Farese, Robert V; Zimmermann, Robert; Lass, Achim; Zechner, Rudolf

    2012-11-30

    Adipose triglyceride lipase (ATGL) is rate-limiting for the initial step of triacylglycerol (TAG) hydrolysis, generating diacylglycerol (DAG) and fatty acids. DAG exists in three stereochemical isoforms. Here we show that ATGL exhibits a strong preference for the hydrolysis of long-chain fatty acid esters at the sn-2 position of the glycerol backbone. The selectivity of ATGL broadens to the sn-1 position upon stimulation of the enzyme by its co-activator CGI-58. sn-1,3 DAG is the preferred substrate for the consecutive hydrolysis by hormone-sensitive lipase. Interestingly, diacylglycerol-O-acyltransferase 2, present at the endoplasmic reticulum and on lipid droplets, preferentially esterifies sn-1,3 DAG. This suggests that ATGL and diacylglycerol-O-acyltransferase 2 act coordinately in the hydrolysis/re-esterification cycle of TAGs on lipid droplets. Because ATGL preferentially generates sn-1,3 and sn-2,3, it suggests that TAG-derived DAG cannot directly enter phospholipid synthesis or activate protein kinase C without prior isomerization.

  5. Modeling the 3-DOF dynamics of an electrodynamic Maglev suspension system with a passive sled

    NARCIS (Netherlands)

    Boeij, de J.; Gutierrez, H.M.; Agarwal, R.; Steinbuch, M.

    2003-01-01

    A model that describes the 3-DOF dynamics of a passively levitated electro-dynamic maglevsystem is presented. The model is based on the flux-current-force interactions and the geometricrelationships between the levitation coils and the permanent magnets on the sled. The model ispresented in a

  6. Kinematic modelling of a five-DOFs spatial manipulator used in robot-assisted surgery

    Directory of Open Access Journals (Sweden)

    Shakti Singh

    2016-09-01

    Full Text Available Since last three decades, research in the field of robot kinematics is boosted-up among different researchers worldwide. This is mainly due to their increased use in various challenging fields of engineering and science. One such challenging application is the use of master–slave concept in a robot-assisted surgery. The authors have already performed the kinematic study and gravity balancing of seven degrees-of-freedom (DOFs surgeon-side manipulator (Singh et al., 2015a, 2015b. To meet these challenging demands, the most important aspect of a robotic manipulator is to develop an accurate kinematic model. In this direction, different researchers in the literature have made significant contributions. Out of these, the most prominent one is D–H parameters method, which was proposed by Denavit and Hartenberg in 1955. In the present work, this method is applied to a five-DOFs spatial manipulator, named as patient-side manipulator, which tracks the motion of surgeon-side manipulator during a robot-assisted surgery. The prototype considered in this work is a spatial serial manipulator, being developed at CSIR-CSIO Chandigarh. Experimental validations are performed and results are found to be in close agreement.

  7. An ER protein functionally couples neutral lipid metabolism on lipid droplets to membrane lipid synthesis in the ER.

    Science.gov (United States)

    Markgraf, Daniel F; Klemm, Robin W; Junker, Mirco; Hannibal-Bach, Hans K; Ejsing, Christer S; Rapoport, Tom A

    2014-01-16

    Eukaryotic cells store neutral lipids such as triacylglycerol (TAG) in lipid droplets (LDs). Here, we have addressed how LDs are functionally linked to the endoplasmic reticulum (ER). We show that, in S. cerevisiae, LD growth is sustained by LD-localized enzymes. When LDs grow in early stationary phase, the diacylglycerol acyl-transferase Dga1p moves from the ER to LDs and is responsible for all TAG synthesis from diacylglycerol (DAG). During LD breakdown in early exponential phase, an ER membrane protein (Ice2p) facilitates TAG utilization for membrane-lipid synthesis. Ice2p has a cytosolic domain with affinity for LDs and is required for the efficient utilization of LD-derived DAG in the ER. Ice2p breaks a futile cycle on LDs between TAG degradation and synthesis, promoting the rapid relocalization of Dga1p to the ER. Our results show that Ice2p functionally links LDs with the ER and explain how cells switch neutral lipid metabolism from storage to consumption. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  8. An ER Protein Functionally Couples Neutral Lipid Metabolism on Lipid Droplets to Membrane Lipid Synthesis in the ER

    Directory of Open Access Journals (Sweden)

    Daniel F. Markgraf

    2014-01-01

    Full Text Available Eukaryotic cells store neutral lipids such as triacylglycerol (TAG in lipid droplets (LDs. Here, we have addressed how LDs are functionally linked to the endoplasmic reticulum (ER. We show that, in S. cerevisiae, LD growth is sustained by LD-localized enzymes. When LDs grow in early stationary phase, the diacylglycerol acyl-transferase Dga1p moves from the ER to LDs and is responsible for all TAG synthesis from diacylglycerol (DAG. During LD breakdown in early exponential phase, an ER membrane protein (Ice2p facilitates TAG utilization for membrane-lipid synthesis. Ice2p has a cytosolic domain with affinity for LDs and is required for the efficient utilization of LD-derived DAG in the ER. Ice2p breaks a futile cycle on LDs between TAG degradation and synthesis, promoting the rapid relocalization of Dga1p to the ER. Our results show that Ice2p functionally links LDs with the ER and explain how cells switch neutral lipid metabolism from storage to consumption.

  9. New Jacobian Matrix and Equations of Motion for a 6 d.o.f Cable-Driven Robot

    Directory of Open Access Journals (Sweden)

    Ali Afshari

    2007-03-01

    Full Text Available In this paper, we introduce a new method and new motion variables to study kinematics and dynamics of a 6 d.o.f cable-driven robot. Using these new variables and Lagrange equations, we achieve new equations of motion which are different in appearance and several aspects from conventional equations usually used to study 6 d.o.f cable robots. Then, we introduce a new Jacobian matrix which expresses kinematical relations of the robot via a new approach and is basically different from the conventional Jacobian matrix. One of the important characteristics of the new method is computational efficiency in comparison with the conventional method. It is demonstrated that using the new method instead of the conventional one, significantly reduces the computation time required to determine workspace of the robot as well as the time required to solve the equations of motion.

  10. Phosphorylation of Dgk1 Diacylglycerol Kinase by Casein Kinase II Regulates Phosphatidic Acid Production in Saccharomyces cerevisiae.

    Science.gov (United States)

    Qiu, Yixuan; Hassaninasab, Azam; Han, Gil-Soo; Carman, George M

    2016-12-16

    In the yeast Saccharomyces cerevisiae, Dgk1 diacylglycerol (DAG) kinase catalyzes the CTP-dependent phosphorylation of DAG to form phosphatidic acid (PA). The enzyme in conjunction with Pah1 PA phosphatase controls the levels of PA and DAG for the synthesis of triacylglycerol and membrane phospholipids, the growth of the nuclear/endoplasmic reticulum membrane, and the formation of lipid droplets. Little is known about how DAG kinase activity is regulated by posttranslational modification. In this work, we examined the phosphorylation of Dgk1 DAG kinase by casein kinase II (CKII). When phosphate groups were globally reduced using nonspecific alkaline phosphatase, Triton X-100-solubilized membranes from DGK1-overexpressing cells showed a 7.7-fold reduction in DAG kinase activity; the reduced enzyme activity could be increased 5.5-fold by treatment with CKII. Dgk1(1-77) expressed heterologously in Escherichia coli was phosphorylated by CKII on a serine residue, and its phosphorylation was dependent on time as well as on the concentrations of CKII, ATP, and Dgk1(1-77). We used site-specific mutagenesis, coupled with phosphorylation analysis and phosphopeptide mapping, to identify Ser-45 and Ser-46 of Dgk1 as the CKII target sites, with Ser-46 being the major phosphorylation site. In vivo, the S46A and S45A/S46A mutations of Dgk1 abolished the stationary phase-dependent stimulation of DAG kinase activity. In addition, the phosphorylation-deficient mutations decreased Dgk1 function in PA production and in eliciting pah1Δ phenotypes, such as the expansion of the nuclear/endoplasmic reticulum membrane, reduced lipid droplet formation, and temperature sensitivity. This work demonstrates that the CKII-mediated phosphorylation of Dgk1 regulates its function in the production of PA. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. Phosphorylation of Dgk1 Diacylglycerol Kinase by Casein Kinase II Regulates Phosphatidic Acid Production in Saccharomyces cerevisiae*

    Science.gov (United States)

    Qiu, Yixuan; Hassaninasab, Azam; Han, Gil-Soo; Carman, George M.

    2016-01-01

    In the yeast Saccharomyces cerevisiae, Dgk1 diacylglycerol (DAG) kinase catalyzes the CTP-dependent phosphorylation of DAG to form phosphatidic acid (PA). The enzyme in conjunction with Pah1 PA phosphatase controls the levels of PA and DAG for the synthesis of triacylglycerol and membrane phospholipids, the growth of the nuclear/endoplasmic reticulum membrane, and the formation of lipid droplets. Little is known about how DAG kinase activity is regulated by posttranslational modification. In this work, we examined the phosphorylation of Dgk1 DAG kinase by casein kinase II (CKII). When phosphate groups were globally reduced using nonspecific alkaline phosphatase, Triton X-100-solubilized membranes from DGK1-overexpressing cells showed a 7.7-fold reduction in DAG kinase activity; the reduced enzyme activity could be increased 5.5-fold by treatment with CKII. Dgk1(1–77) expressed heterologously in Escherichia coli was phosphorylated by CKII on a serine residue, and its phosphorylation was dependent on time as well as on the concentrations of CKII, ATP, and Dgk1(1–77). We used site-specific mutagenesis, coupled with phosphorylation analysis and phosphopeptide mapping, to identify Ser-45 and Ser-46 of Dgk1 as the CKII target sites, with Ser-46 being the major phosphorylation site. In vivo, the S46A and S45A/S46A mutations of Dgk1 abolished the stationary phase-dependent stimulation of DAG kinase activity. In addition, the phosphorylation-deficient mutations decreased Dgk1 function in PA production and in eliciting pah1Δ phenotypes, such as the expansion of the nuclear/endoplasmic reticulum membrane, reduced lipid droplet formation, and temperature sensitivity. This work demonstrates that the CKII-mediated phosphorylation of Dgk1 regulates its function in the production of PA. PMID:27834677

  12. Experimental Investigation on the Positioning Accuracy of the Translation Module of a 6-DOF Industrial Robot

    Directory of Open Access Journals (Sweden)

    Zoltan-Iosif Korka

    2016-12-01

    Full Text Available The paper presents an experimental investigation regarding the positioning accuracy and kinematical parameters of the base translation module of a 6-DOF industrial robot. The positioning error of the translation module was computed for two cases: one way movement and reversed movement.

  13. Effect of α1-adrenergic stimulation on phosphoinositide metabolism and protein kinase C (PK-C) in rat cardiomyocytes

    International Nuclear Information System (INIS)

    Kaku, T.; Lakatta, E.; Filburn, C.R.

    1986-01-01

    Alpha 1 -adrenergic stimulation is known to enhance membrane phospholipid metabolism resulting in increases in inositol phosphates (IP's) and diacylglycerol (DAG). Cardiomyocytes prelabeled with 3 H-myo-inositol were treated with norepinephrine (NE) for 1-15 min, acid extracted, and IP's separated by ion exchange chromatography. Addition of NE (10 -5 M) in the presence of propranolol (10 -5 M) and LiCl (9 mM) enhanced the accumulation of IP's, linearly with time up to 15 min, and reached 7.3, and 1.5-fold at 15 min for IP 1 , IP 2 , and IP 3 , respectively. KCl at 30 mM had no effect on accumulation of IP's, but augmented the effect of NE. PK-C activity was measured in both cytosol (S) and particulate (P) fractions of treated cells. NE alone had a negligible effect on membrane PK-C, while 30 mM KCl caused a small increase. However, pretreatment with KCl followed by NE produced a significant increase above that seen with KCl alone. Dioctanoylglycerol also stimulated membrane association of PK-C in these cells. These data suggest that α 1 -adrenergic stimulation of membrane association of myocardial PK-C is mediated by DAG but may be dependent on membrane potential and/or the extent of Ca 2+ loading

  14. Improved Inverse Kinematics Algorithm Using Screw Theory for a Six-DOF Robot Manipulator

    Directory of Open Access Journals (Sweden)

    Qingcheng Chen

    2015-10-01

    Full Text Available Based on screw theory, a novel improved inverse-kinematics approach for a type of six-DOF serial robot, “Qianjiang I”, is proposed in this paper. The common kinematics model of the robot is based on the Denavit-Hartenberg (D-H notation method while its inverse kinematics has inefficient calculation and complicated solution, which cannot meet the demands of online real-time application. To solve this problem, this paper presents a new method to improve the efficiency of the inverse kinematics solution by introducing the screw theory. Unlike other methods, the proposed method only establishes two coordinates, namely the inertial coordinate and the tool coordinate; the screw motion of each link is carried out based on the inertial coordinate, ensuring definite geometric meaning. Furthermore, we adopt a new inverse kinematics algorithm, developing an improved sub-problem method along with Paden-Kahan sub-problems. This method has high efficiency and can be applied in real-time industrial operation. It is convenient to select the desired solutions directly from among multiple solutions by examining clear geometric meaning. Finally, the effectiveness and reliability performance of the new algorithm are analysed and verified in comparative experiments carried out on the six-DOF serial robot “Qianjiang I”.

  15. In Vivo Imaging of Diacylglycerol at the Cytoplasmic Leaflet of Plant Membranes.

    Science.gov (United States)

    Vermeer, Joop E M; van Wijk, Ringo; Goedhart, Joachim; Geldner, Niko; Chory, Joanne; Gadella, Theodorus W J; Munnik, Teun

    2017-07-01

    Diacylglycerol (DAG) is an important intermediate in lipid biosynthesis and plays key roles in cell signaling, either as a second messenger itself or as a precursor of phosphatidic acid. Methods to identify distinct DAG pools have proven difficult because biochemical fractionation affects the pools, and concentrations are limiting. Here, we validate the use of a genetically encoded DAG biosensor in living plant cells. The sensor is composed of a fusion between yellow fluorescent protein and the C1a domain of protein kinase C (YFP-C1aPKC) that specifically binds DAG, and was stably expressed in suspension-cultured tobacco BY-2 cells and whole Arabidopsis thaliana plants. Confocal imaging revealed that the majority of the YFP-C1aPKC fluorescence did not locate to membranes but was present in the cytosol and nucleus. Treatment with short-chain DAG or PMA (phorbol-12-myristate-13-acetate), a phorbol ester that binds the C1a domain of PKC, caused the recruitment of the biosensor to the plasma membrane. These results indicate that the biosensor works and that the basal DAG concentration in the cytoplasmic leaflet of membranes (i.e. accessible to the biosensor) is in general too low, and confirms that the known pools in plastids, the endoplasmic reticulum and mitochondria are located at the luminal face of these compartments (i.e. inaccessible to the biosensor). Nevertheless, detailed further analysis of different cells and tissues discovered four novel DAG pools, namely at: (i) the trans-Golgi network; (ii) the cell plate during cytokinesis; (iii) the plasma membrane of root epidermal cells in the transition zone, and (iv) the apex of growing root hairs. The results provide new insights into the spatiotemporal dynamics of DAG in plants and offer a new tool to monitor this in vivo. © The Author 2017. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  16. Davras Dagı (Isparta ve Çevresinin Orman ve Çalı Vejetasyonu

    Directory of Open Access Journals (Sweden)

    Coşkun SAĞLAM

    2009-04-01

    Full Text Available Bu vejetasyon çalısması, 2002-2005 yılları arasında Batı Toroslar'da yer alan Davras Dagı ve çevresinde gerçeklestirildi. Vejetasyon Braun-Blanquet (1964 metoduna göre analiz edilerek orman ve çalı vejetasyonuna ait yedi birlik tespit edildi. Bunlardan bes tanesi yenidir. Orman vejetasyonu: Sınıf : Quercetea pubescentis (Oberd, 1948 Doing Kraft, 1955 Ordo : Querco – Cedretalia libani Barbéro, Loisel ve Quézel, 1974 1. Minuartio globulosi – Juniperetum excelsae ass. nova 2. Sileno squamigeri – Quercetum cerridis ass. nova 3. Astragalo oxytropifolii – Pinetum caramanicae ass. nova Alyans : Lonicero nummulariaefoliae – Cedrion libani Quézel, Barbéro ve Akman 1978 4. Veronico syriaci – Cedretum libani ass. nova 5. Diantho cibrarii – Quercetum vulcanicae Kurt et al. 1996 Sınıf : Quercetea ilicis Br.-Bl., 1947 Ordo : Quercetalia ilicis Br.-Bl., 1947, Rivaz Martinez, 1974 Alyans : Quercion cocciferae Quézel, Barbéro, Akman, 1978 6. Hyperico polyphylli – Pinetum brutiae ass. nova Çalı Vejetasyonu: Sınıf : Quercetea pubescentis (Oberd, 1948 Doing Kraft, 1955 Ordo : Querco – Cedretalia libani Barbéro, Loisel ve Quézel, 1974 7. Astragalo atropurpureus– Quercetum cocciferae Kargıoglu, 19

  17. Composite Material Testing Data Reduction to Adjust for the Systematic 6-DOF Testing Machine Aberrations

    Science.gov (United States)

    Athanasios lliopoulos; John G. Michopoulos; John G. C. Hermanson

    2012-01-01

    This paper describes a data reduction methodology for eliminating the systematic aberrations introduced by the unwanted behavior of a multiaxial testing machine, into the massive amounts of experimental data collected from testing of composite material coupons. The machine in reference is a custom made 6-DoF system called NRL66.3 and developed at the NAval...

  18. Geometric technique for the kinematic modeling of a 5 DOF redundant manipulator

    CSIR Research Space (South Africa)

    Makondo, N

    2012-11-01

    Full Text Available ,? Dipartimento di Elettronica, Informatica e Sistemistica (DEIS), Universit a di Bologna [Online]; Available at: http://www- lar.deis.unibo.it/people/cmelchiorri/Files Robotica/FIR 04 Kinem.pdf[31 October 2012] [18] Manocha, D.; Canny, J.F.; , ?Efficient... to the inverse kinematics of the Pioneer 2 robotic arm ?, Robotica, 2005, vol.23, pp.123, DOI: 10.1017/S0263574704000529 [20] De Xu, Carlos A. Acosta Calderon, John Q. Gan etc .An Analysis of the Inverse Kinematics for a 5-DOF Manipulator, International...

  19. Sistem Kontrol Robot Arm 5 DOF Berbasis Pengenalan Pola Suara Menggunakan Mel-Frequency Cepstrum Coefficients (MFCC dan Adaptive Neuro-Fuzzy Inference System (ANFIS

    Directory of Open Access Journals (Sweden)

    WS Mada Sanjaya

    2016-12-01

    Full Text Available Telah dilakukan penelitian yang menggambarkan implementasi pengenalan pola suara untuk mengontrol gerak robot arm 5 DoF dalam mengambil dan menyimpan benda. Dalam penelitian ini metode yang digunakan adalah Mel-Frequency Cepstrum Coefficients (MFCC dan Adaptive Neuro-Fuzzy Inferense System (ANFIS. Metode MFCC digunakan untuk ekstraksi ciri sinyal suara, sedangkan ANFIS digunakan sebagai metode pembelajaran untuk pengenalan pola suara. Pada proses pembelajaran ANFIS data latih yang digunakan sebanyak 6 ciri. Data suara terlatih dan data suara tak terlatih digunakan untuk pengujian sistem pengenalan pola suara. Hasil pengujian menunjukkan tingkat keberhasilan, untuk data suara terlatih sebesar 87,77% dan data tak terlatih sebesar 78,53%. Sistem pengenalan pola suara ini telah diaplikasikan dengan baik untuk mengerakan robot arm 5 DoF berbasis mikrokontroler Arduino. Have been implemented of sound pattern recognition to control 5 DoF of Arm Robot to pick and place an object. In this research used Mel-Frequency Cepstrum Coefficients (MFCC and Adaptive Neuro-Fuzzy Interferense System (ANFIS methods. MFCC method used for features extraction of sound signal, meanwhile ANFIS used to learn sound pattern recognition. On ANFIS method data learning use 6 features. Trained and not trained data used to examine the system of sound pattern identification. The result show the succesfull level, for trained data 87.77% and for not trained data 78.53%. Sound pattern identification system was appliedto controlled 5 DoF arm robot based Arduino microcontroller.

  20. The Functional Characterization of Long Noncoding RNA SPRY4-IT1 in Human Melanoma Cells

    OpenAIRE

    Mazar, Joseph; Zhao, Wei; Khalil, Ahmad M.; Lee, Bongyong; Shelley, John; Govindarajan, Subramaniam S.; Yamamoto, Fumiko; Ratnam, Maya; Aftab, Muhammad Nauman; Collins, Sheila; Finck, Brian N.; Han, Xianlin; Mattick, John S.; Dinger, Marcel E.; Perera, Ranjan J.

    2014-01-01

    Expression of the long noncoding RNA (lncRNA) SPRY4-IT1 is low in normal human melanocytes but high in melanoma cells. siRNA knockdown of SPRY4-IT1 blocks melanoma cell invasion and proliferation, and increases apoptosis. To investigate its function further, we affinity purified SPRY4-IT1 from melanoma cells and used mass spectrometry to identify the protein lipin 2, an enzyme that converts phosphatidate to diacylglycerol (DAG), as a major binding partner. SPRY4-IT1 knockdown increases the ac...

  1. A 3-DOF haptic master device for minimally invasive surgery

    Science.gov (United States)

    Nguyen, Phuong-Bac; Oh, Jong-Seok; Choi, Seung-Bok

    2012-04-01

    This paper introduces a novel 3-DOF haptic master device for minimally invasive surgery featuring magneto-rheological (MR) fluid. It consists of three rotational motions. These motions are constituted by two bi-directional MR (BMR) plus one conventional MR brakes. The BMR brake used in the system possesses a salient advantage that its range of braking torque varies from negative to positive values. Therefore, the device is expected to be able sense in a wide environment from very soft tissues to bones. In this paper, overall of the design of the device is presented from idea, modeling, optimal design, manufacturing to control of the device. Moreover, experimental investigation is undertaken to validate the effectiveness of the device.

  2. Effects of uniformities of deposition of respirable particles on filters on determining their quartz contents by using the direct on-filter X-ray diffraction (DOF XRD) method

    International Nuclear Information System (INIS)

    Chen, Ching-Hwa; Tsaia, Perng-Jy; Lai, Chane-Yu; Peng, Ya-Lian; Soo, Jhy-Charm; Chen, Cheng-Yao; Shih, Tung-Sheng

    2010-01-01

    In this study, field samplings were conducted in three workplaces of a foundry plant, including the molding, demolding, and bead blasting, respectively. Three respirable aerosol samplers (including a 25-mm aluminum cyclone, nylon cyclone, and IOSH cyclone) were used side-by-side to collect samples from each selected workplace. For each collected sample, the uniformity of the deposition of respirable dusts on the filter was measured and its free silica content was determined by both the DOF XRD method and NIOSH 7500 XRD method (i.e., the reference method). A same trend in measured uniformities can be found in all selected workplaces: 25-mm aluminum cyclone > nylon cyclone > IOSH cyclone. Even for samples collected by the sampler with the highest uniformity (i.e., 25-mm aluminum cyclone), the use of the DOF XRD method would lead to the measured free silica concentrations 1.15-2.89 times in magnitude higher than that of the reference method. A new filter holder should be developed with the minimum uniformity comparable to that of NIOSH 7500 XRD method (=0.78) in the future. The use of conversion factors for correcting quartz concentrations obtained from the DOF XRD method based on the measured uniformities could be suitable for the foundry industry at this stage.

  3. Mathematical model of the 5-DOF sled dynamics of an electrodynamic Maglev system with a passive sled

    NARCIS (Netherlands)

    Boeij, de J.; Steinbuch, M.; Gutierrez, H.M.

    2005-01-01

    A model that describes the five-degrees-of-freedom (5-DOF) dynamics of a passively levitated electrodynamic maglev system is presented. The model is based on the flux-current-force interactions and the geometric relationships between the levitation coils and the permanent magnets on the sled. The

  4. Telerobotic control of a dextrous manipulator using master and six-DOF hand-controllers for space assembly and servicing tasks

    Science.gov (United States)

    O'Hara, John M.

    1987-01-01

    Two studies were conducted evaluating methods of controlling a telerobot; bilateral force reflecting master controllers and proportional rate six degrees of freedom (DOF) hand controllers. The first study compared the controllers on performance of single manipulator arm tasks, a peg-in-the-hole task, and simulated satellite orbital replacement unit changeout. The second study, a Space Station truss assembly task, required simultaneous operation of both manipulator arms (all 12 DOFs) and complex multiaxis slave arm movements. Task times were significantly longer and fewer errors were committed with the hand controllers. The hand controllers were also rated significantly higher in cognitive and manual control workload on the two-arm task. The master controllers were rated significantly higher in physical workload. There were no significant differences in ratings of manipulator control quality.

  5. Estimation of continuous multi-DOF finger joint kinematics from surface EMG using a multi-output Gaussian Process.

    Science.gov (United States)

    Ngeo, Jimson; Tamei, Tomoya; Shibata, Tomohiro

    2014-01-01

    Surface electromyographic (EMG) signals have often been used in estimating upper and lower limb dynamics and kinematics for the purpose of controlling robotic devices such as robot prosthesis and finger exoskeletons. However, in estimating multiple and a high number of degrees-of-freedom (DOF) kinematics from EMG, output DOFs are usually estimated independently. In this study, we estimate finger joint kinematics from EMG signals using a multi-output convolved Gaussian Process (Multi-output Full GP) that considers dependencies between outputs. We show that estimation of finger joints from muscle activation inputs can be improved by using a regression model that considers inherent coupling or correlation within the hand and finger joints. We also provide a comparison of estimation performance between different regression methods, such as Artificial Neural Networks (ANN) which is used by many of the related studies. We show that using a multi-output GP gives improved estimation compared to multi-output ANN and even dedicated or independent regression models.

  6. A simple 5-DoF MR-compatible motion signal measurement system.

    Science.gov (United States)

    Chung, Soon-Cheol; Kim, Hyung-Sik; Yang, Jae-Woong; Lee, Su-Jeong; Choi, Mi-Hyun; Kim, Ji-Hye; Yeon, Hong-Won; Park, Jang-Yeon; Yi, Jeong-Han; Tack, Gye-Rae

    2011-09-01

    The purpose of this study was to develop a simple motion measurement system with magnetic resonance (MR) compatibility and safety. The motion measurement system proposed here can measure 5-DoF motion signals without deteriorating the MR images, and it has no effect on the intense and homogeneous main magnetic field, the temporal-gradient magnetic field (which varies rapidly with time), the transceiver radio frequency (RF) coil, and the RF pulse during MR data acquisition. A three-axis accelerometer and a two-axis gyroscope were used to measure 5-DoF motion signals, and Velcro was used to attach a sensor module to a finger or wrist. To minimize the interference between the MR imaging system and the motion measurement system, nonmagnetic materials were used for all electric circuit components in an MR shield room. To remove the effect of RF pulse, an amplifier, modulation circuit, and power supply were located in a shielded case, which was made of copper and aluminum. The motion signal was modulated to an optic signal using pulse width modulation, and the modulated optic signal was transmitted outside the MR shield room using a high-intensity light-emitting diode and an optic cable. The motion signal was recorded on a PC by demodulating the transmitted optic signal into an electric signal. Various kinematic variables, such as angle, acceleration, velocity, and jerk, can be measured or calculated by using the motion measurement system developed here. This system also enables motion tracking by extracting the position information from the motion signals. It was verified that MR images and motion signals could reliably be measured simultaneously.

  7. Improved Inverse Kinematics Algorithm Using Screw Theory for a Six-DOF Robot Manipulator

    OpenAIRE

    Chen, Qingcheng; Zhu, Shiqiang; Zhang, Xuequn

    2015-01-01

    Based on screw theory, a novel improved inverse-kinematics approach for a type of six-DOF serial robot, “Qianjiang I”, is proposed in this paper. The common kinematics model of the robot is based on the Denavit-Hartenberg (D-H) notation method while its inverse kinematics has inefficient calculation and complicated solution, which cannot meet the demands of online real-time application. To solve this problem, this paper presents a new method to improve the efficiency of the inverse kinematics...

  8. Fragile X syndrome: Are signaling lipids the missing culprits?

    Science.gov (United States)

    Tabet, Ricardos; Vitale, Nicolas; Moine, Hervé

    2016-11-01

    Fragile X syndrome (FXS) is the most common cause of inherited intellectual disability and autism. FXS results from the absence of FMRP, an RNA binding protein associated to ribosomes that influences the translation of specific mRNAs in post-synaptic compartments of neurons. The main molecular consequence of the absence of FMRP is an excessive translation of neuronal protein in several areas of the brain. This local protein synthesis deregulation is proposed to underlie the defect in synaptic plasticity responsible for FXS. Recent findings in neurons of the fragile X mouse model (Fmr1-KO) uncovered another consequence of the lack of FMRP: a deregulation of the diacylglycerol (DAG)/phosphatidic acid (PA) homeostasis. DAG and PA are two interconvertible lipids that influence membrane architecture and that act as essential signaling molecules that activate various downstream effectors, including master regulators of local protein synthesis and actin polymerization. As a consequence, DAG and PA govern a variety of cellular processes, including cell proliferation, vesicle/membrane trafficking and cytoskeletal organization. At the synapse, the level of these lipids is proposed to influence the synaptic activation status. FMRP appears as a master regulator of this neuronal process by controlling the translation of a diacylglycerol kinase enzyme that converts DAG into PA. The deregulated levels of DAG and PA caused by the absence of FMRP could represent a novel therapeutic target for the treatment of FXS. Copyright © 2016 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

  9. Design of a novel 6-DOF planar maglev system

    International Nuclear Information System (INIS)

    Lai, Y.-C.; Yen, J.-Y.

    2006-01-01

    This paper describes a novel single-deck and six degree-of-freedom (DOF) planar maglev positioning system design. The proposed design uses an array of solenoids to levitate and to hold a permanent magnet carrier in place. The solenoids are excited separately to generate restoring forces when the permanent magnet carrier is displaced from its equilibrium position. The research uses the ANSOFT finite element analysis simulation to analyze the solenoid restoring forces and to motivate a suitable permanent magnets arrangement. Active control on the solenoid currents is then used to maintain the carrier position. The system identification is carried out by perturbing the experimental set-up from its equilibrium position. The simulation results based on the identification models show that simple control is effective for maintaining the carrier position. Initial implementation has also showed that the concept is feasible

  10. End-Effector Position Analysis Using Forward Kinematics For 5 Dof Pravak Robot Arm

    OpenAIRE

    Jolly Atit Shah; S.S. Rattan; B.C. Nakra

    2013-01-01

    Automatic control of the robotic manipulator involves study of kinematics and dynamics as a major issue. This paper involves the kinematic analysis of a Pravak Robot arm which is used for doing successful robotic manipulation task in its workspace. The Pravak Robot Arm is a 5-DOF robot having all the joints revolute. The kinematics problem is defined as the transformation from the Cartesian space to the joint space and vice versa. In this study the Denavit- Hartenberg (D-H) model is used to m...

  11. Effects of uniformities of deposition of respirable particles on filters on determining their quartz contents by using the direct on-filter X-ray diffraction (DOF XRD) method.

    Science.gov (United States)

    Chen, Ching-Hwa; Tsaia, Perng-Jy; Lai, Chane-Yu; Peng, Ya-Lian; Soo, Jhy-Charm; Chen, Cheng-Yao; Shih, Tung-Sheng

    2010-04-15

    In this study, field samplings were conducted in three workplaces of a foundry plant, including the molding, demolding, and bead blasting, respectively. Three respirable aerosol samplers (including a 25-mm aluminum cyclone, nylon cyclone, and IOSH cyclone) were used side-by-side to collect samples from each selected workplace. For each collected sample, the uniformity of the deposition of respirable dusts on the filter was measured and its free silica content was determined by both the DOF XRD method and NIOSH 7500 XRD method (i.e., the reference method). A same trend in measured uniformities can be found in all selected workplaces: 25-mm aluminum cyclone>nylon cyclone>IOSH cyclone. Even for samples collected by the sampler with the highest uniformity (i.e., 25-mm aluminum cyclone), the use of the DOF XRD method would lead to the measured free silica concentrations 1.15-2.89 times in magnitude higher than that of the reference method. A new filter holder should be developed with the minimum uniformity comparable to that of NIOSH 7500 XRD method (=0.78) in the future. The use of conversion factors for correcting quartz concentrations obtained from the DOF XRD method based on the measured uniformities could be suitable for the foundry industry at this stage. 2009 Elsevier B.V. All rights reserved.

  12. Development of 3 DOF manipulator using ER fluid clutches for reduction of collision force

    Science.gov (United States)

    Boku, Kazuhiko; Nakamura, Taro

    2009-02-01

    .With robots and users more commonly sharing space such as in the fields of medicine and home automation, the possibility of a physical collision has increased, even though many robots use actuators with high-ratio gear trains to minimize the effects of impact. We developed a 3-DOF manipulator having a smart flexible joint using an ER fluid and a sensor-equipped pneumatic cushion. Results of position control and collision experiments using the manipulator demonstrated its effectiveness.

  13. Development of 3 DOF manipulator using ER fluid clutches for reduction of collision force

    International Nuclear Information System (INIS)

    Boku, Kazuhiko; Nakamura, Taro

    2009-01-01

    Abstract.With robots and users more commonly sharing space such as in the fields of medicine and home automation, the possibility of a physical collision has increased, even though many robots use actuators with high-ratio gear trains to minimize the effects of impact. We developed a 3-DOF manipulator having a smart flexible joint using an ER fluid and a sensor-equipped pneumatic cushion. Results of position control and collision experiments using the manipulator demonstrated its effectiveness.

  14. Development of 3 DOF manipulator using ER fluid clutches for reduction of collision force

    Energy Technology Data Exchange (ETDEWEB)

    Boku, Kazuhiko; Nakamura, Taro [Chuo University, Faculty of Science and Engineering, Department of Precision Mechanics, 1-13-27 Kasuga, Bunkyo-ku, Tokyo 112-8551 (Japan)], E-mail: k_boku@bio.mech.chuo-u.ac.jp

    2009-02-01

    Abstract.With robots and users more commonly sharing space such as in the fields of medicine and home automation, the possibility of a physical collision has increased, even though many robots use actuators with high-ratio gear trains to minimize the effects of impact. We developed a 3-DOF manipulator having a smart flexible joint using an ER fluid and a sensor-equipped pneumatic cushion. Results of position control and collision experiments using the manipulator demonstrated its effectiveness.

  15. Multi-Mode Vibration Suppression in MIMO Systems by Extending the Zero Placement Input Shaping Technique: Applications to a 3-DOF Piezoelectric Tube Actuator

    Directory of Open Access Journals (Sweden)

    Yasser Al Hamidi

    2016-04-01

    Full Text Available Piezoelectric tube actuators are extensively used in scanning probe microscopes to provide dynamic scanning motions in open-loop operations. Furthermore, they are employed as micropositioners due to their high bandwidth, high resolution and ease of excitation. However, these piezoelectric micropositioners exhibit badly damped vibrations that occur when the input excites the dynamic response, which tends to degrade positioning accuracy and performance. This paper deals with vibrations’ feedforward control of a multi-degrees of freedom (DOF piezoelectric micropositioner in order to damp the vibrations in the direct axes and to reduce the cross-couplings. The novelty in this paper relative to the existing vibrations feedforward controls is the simplicity in design approach, the minimal number of shaper impulses for each input required to damp all modes of vibration at each output, and the account for the strong cross-couplings which only occur in multi-DOF cases. A generalization to a multiple degrees of freedom actuator is first proposed. Then simulation runs on a 3-DOF piezoelectric tube micropositioner have been effectuated to demonstrate the efficiency of the proposed method. Finally, experimental tests were carried out to validate and to confirm the predicted simulation.

  16. A 6-DOF vibration isolation system for hydraulic hybrid vehicles

    Science.gov (United States)

    Nguyen, The; Elahinia, Mohammad; Olson, Walter W.; Fontaine, Paul

    2006-03-01

    This paper presents the results of vibration isolation analysis for the pump/motor component of hydraulic hybrid vehicles (HHVs). The HHVs are designed to combine gasoline/diesel engine and hydraulic power in order to improve the fuel efficiency and reduce the pollution. Electric hybrid technology is being applied to passenger cars with small and medium engines to improve the fuel economy. However, for heavy duty vehicles such as large SUVs, trucks, and buses, which require more power, the hydraulic hybridization is a more efficient choice. In function, the hydraulic hybrid subsystem improves the fuel efficiency of the vehicle by recovering some of the energy that is otherwise wasted in friction brakes. Since the operation of the main component of HHVs involves with rotating parts and moving fluid, noise and vibration are an issue that affects both passengers (ride comfort) as well as surrounding people (drive-by noise). This study looks into the possibility of reducing the transmitted noise and vibration from the hydraulic subsystem to the vehicle's chassis by using magnetorheological (MR) fluid mounts. To this end, the hydraulic subsystem is modeled as a six degree of freedom (6-DOF) rigid body. A 6-DOF isolation system, consisting of five mounts connected to the pump/motor at five different locations, is modeled and simulated. The mounts are designed by combining regular elastomer components with MR fluids. In the simulation, the real loading and working conditions of the hydraulic subsystem are considered and the effects of both shock and vibration are analyzed. The transmissibility of the isolation system is monitored in a wide range of frequencies. The geometry of the isolation system is considered in order to sustain the weight of the hydraulic system without affecting the design of the chassis and the effectiveness of the vibration isolating ability. The simulation results shows reduction in the transmitted vibration force for different working cycles of

  17. Output Error Analysis of Planar 2-DOF Five-bar Mechanism

    Science.gov (United States)

    Niu, Kejia; Wang, Jun; Ting, Kwun-Lon; Tao, Fen; Cheng, Qunchao; Wang, Quan; Zhang, Kaiyang

    2018-03-01

    Aiming at the mechanism error caused by clearance of planar 2-DOF Five-bar motion pair, the method of equivalent joint clearance of kinematic pair to virtual link is applied. The structural error model of revolute joint clearance is established based on the N-bar rotation laws and the concept of joint rotation space, The influence of the clearance of the moving pair is studied on the output error of the mechanis. and the calculation method and basis of the maximum error are given. The error rotation space of the mechanism under the influence of joint clearance is obtained. The results show that this method can accurately calculate the joint space error rotation space, which provides a new way to analyze the planar parallel mechanism error caused by joint space.

  18. Principal components analysis based control of a multi-dof underactuated prosthetic hand

    Directory of Open Access Journals (Sweden)

    Magenes Giovanni

    2010-04-01

    Full Text Available Abstract Background Functionality, controllability and cosmetics are the key issues to be addressed in order to accomplish a successful functional substitution of the human hand by means of a prosthesis. Not only the prosthesis should duplicate the human hand in shape, functionality, sensorization, perception and sense of body-belonging, but it should also be controlled as the natural one, in the most intuitive and undemanding way. At present, prosthetic hands are controlled by means of non-invasive interfaces based on electromyography (EMG. Driving a multi degrees of freedom (DoF hand for achieving hand dexterity implies to selectively modulate many different EMG signals in order to make each joint move independently, and this could require significant cognitive effort to the user. Methods A Principal Components Analysis (PCA based algorithm is used to drive a 16 DoFs underactuated prosthetic hand prototype (called CyberHand with a two dimensional control input, in order to perform the three prehensile forms mostly used in Activities of Daily Living (ADLs. Such Principal Components set has been derived directly from the artificial hand by collecting its sensory data while performing 50 different grasps, and subsequently used for control. Results Trials have shown that two independent input signals can be successfully used to control the posture of a real robotic hand and that correct grasps (in terms of involved fingers, stability and posture may be achieved. Conclusions This work demonstrates the effectiveness of a bio-inspired system successfully conjugating the advantages of an underactuated, anthropomorphic hand with a PCA-based control strategy, and opens up promising possibilities for the development of an intuitively controllable hand prosthesis.

  19. Caloric restriction and intermittent fasting alter hepatic lipid droplet proteome and diacylglycerol species and prevent diabetes in NZO mice.

    Science.gov (United States)

    Baumeier, Christian; Kaiser, Daniel; Heeren, Jörg; Scheja, Ludger; John, Clara; Weise, Christoph; Eravci, Murat; Lagerpusch, Merit; Schulze, Gunnar; Joost, Hans-Georg; Schwenk, Robert Wolfgang; Schürmann, Annette

    2015-05-01

    Caloric restriction and intermittent fasting are known to improve glucose homeostasis and insulin resistance in several species including humans. The aim of this study was to unravel potential mechanisms by which these interventions improve insulin sensitivity and protect from type 2 diabetes. Diabetes-susceptible New Zealand Obese mice were either 10% calorie restricted (CR) or fasted every other day (IF), and compared to ad libitum (AL) fed control mice. AL mice showed a diabetes prevalence of 43%, whereas mice under CR and IF were completely protected against hyperglycemia. Proteomic analysis of hepatic lipid droplets revealed significantly higher levels of PSMD9 (co-activator Bridge-1), MIF (macrophage migration inhibitor factor), TCEB2 (transcription elongation factor B (SIII), polypeptide 2), ACY1 (aminoacylase 1) and FABP5 (fatty acid binding protein 5), and a marked reduction of GSTA3 (glutathione S-transferase alpha 3) in samples of CR and IF mice. In addition, accumulation of diacylglycerols (DAGs) was significantly reduced in livers of IF mice (P=0.045) while CR mice showed a similar tendency (P=0.062). In particular, 9 DAG species were significantly reduced in response to IF, of which DAG-40:4 and DAG-40:7 also showed significant effects after CR. This was associated with a decreased PKCε activation and might explain the improved insulin sensitivity. In conclusion, our data indicate that protection against diabetes upon caloric restriction and intermittent fasting associates with a modulation of lipid droplet protein composition and reduction of intracellular DAG species. Copyright © 2015. Published by Elsevier B.V.

  20. Trajectory Planning of 7-DOF Space Manipulator for Minimizing Base Disturbance

    Directory of Open Access Journals (Sweden)

    Qiang Zhang

    2016-03-01

    Full Text Available In the free-floating mode, there is intense dynamic coupling existing between the space manipulator and the base, and the base attitude may change while performing a motion with its manipulator. Therefore, it is necessary to reduce the interference that resulted from the manipulator movement. For planning trajectories of the space manipulator with 7 degrees of freedom (7-DOF, simulated annealing particle swarm optimization (SAPSO algorithm is presented in the paper. Firstly, kinematics equations are setup. Secondly, the joint functions are parameterized by sinusoidal functions, and the objective function is defined according to the motion constraints of manipulator and accuracy requirements of the base attitude. Finally, SAPSO algorithm is used to search the optimal trajectory. The simulation results verify the proposed method.

  1. Measurement system and model for simultaneously measuring 6DOF geometric errors.

    Science.gov (United States)

    Zhao, Yuqiong; Zhang, Bin; Feng, Qibo

    2017-09-04

    A measurement system to simultaneously measure six degree-of-freedom (6DOF) geometric errors is proposed. The measurement method is based on a combination of mono-frequency laser interferometry and laser fiber collimation. A simpler and more integrated optical configuration is designed. To compensate for the measurement errors introduced by error crosstalk, element fabrication error, laser beam drift, and nonparallelism of two measurement beam, a unified measurement model, which can improve the measurement accuracy, is deduced and established using the ray-tracing method. A numerical simulation using the optical design software Zemax is conducted, and the results verify the correctness of the model. Several experiments are performed to demonstrate the feasibility and effectiveness of the proposed system and measurement model.

  2. Workspace optimization and kinematic performance evaluation of 2-DOF parallel mechanisms

    International Nuclear Information System (INIS)

    Nam, Yun Joo; Park, Myeong Kwan

    2006-01-01

    This paper presents the kinematics and workspace optimization of the two different 2-DOF (Degrees-of-Freedom) planar parallel mechanisms: one (called 2-RPR mechanism) with translational actuators and the other (called 2-RRR mechanism) with rotational ones. First of all, the inverse kinematics and Jacobian matrix for each mechanism are derived analytically. Then, the workspace including the output-space and the joint-space is systematically analyzed in order to determine the geometric parameters and the operating range of the actuators. Finally, the kinematic optimization of the mechanisms is performed in consideration of their dexterity and rigidity. It is expected that the optimization results can be effectively used as a basic material for the applications of the presented mechanisms to more industrial fields

  3. Designing, Fabrication and Controlling Of Multipurpose3-DOF Robotic Arm

    Science.gov (United States)

    Nabeel, Hafiz Muhammad; Azher, Anum; Usman Ali, Syed M.; Wahab Mughal, Abdul

    2013-12-01

    In the present work, we have successfully designed and developed a 3-DOF articulated Robotic Arm capable of performing typical industrial tasks such as painting or spraying, assembling and handling automobiles parts and etc., in resemblance to a human arm. The mechanical assembly is designed on SOLIDWORKS and aluminum grade 6061 -T6 is used for its fabrication in order to reduce the structure weight. We have applied inverse kinematics to determine the joint angles, equations are fed into an efficient microcontroller ATMEGA16 which performs all the calculations to determine the joint angles on the basis of given coordinates to actuate the joints through motorized control. Good accuracy was obtained with quadrature optical encoders installed in each joint to achieve the desired position and a LabVIEW based GUI is designed to provide human machine interface.

  4. Designing, Fabrication and Controlling Of Multipurpose3-DOF Robotic Arm

    International Nuclear Information System (INIS)

    Nabeel, Hafiz Muhammad; Azher, Anum; Ali, Syed M Usman; Mughal, Abdul Wahab

    2013-01-01

    In the present work, we have successfully designed and developed a 3-DOF articulated Robotic Arm capable of performing typical industrial tasks such as painting or spraying, assembling and handling automobiles parts and etc., in resemblance to a human arm. The mechanical assembly is designed on SOLIDWORKS and aluminum grade 6061 -T6 is used for its fabrication in order to reduce the structure weight. We have applied inverse kinematics to determine the joint angles, equations are fed into an efficient microcontroller ATMEGA16 which performs all the calculations to determine the joint angles on the basis of given coordinates to actuate the joints through motorized control. Good accuracy was obtained with quadrature optical encoders installed in each joint to achieve the desired position and a LabVIEW based GUI is designed to provide human machine interface

  5. Evaluation of head-collision safety of a 7-DOF manipulator according to posture variation

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Ki Hong, E-mail: rome582@khu.ac.kr; Park, In Jun, E-mail: demianjun@gmail.com; Choi, Jin-Hwan, E-mail: jhchoi@khu.ac.kr; Rhim, Sungsoo, E-mail: ssrhim@khu.ac.kr [Kyung Hee University, Department of Mechanical Engineering (Korea, Republic of)

    2016-05-15

    As the need for the improvement of the productivity in the manufacturing process grows, industrial robots are brought out of the safety fences and used in the direct collaborative operation with human workers. Consequently, the intended and/or unintended contact between the human and the robot in the collaborative operation is no longer an extraordinary event and is a mundane possibility. The level of the risk of the collision depends on various quantities associated with the collision, for example, inertia, velocity, stiffness, and so on. MSI (manipulator safety index) which is based on HIC (head injury criteria) conventionally used in the automotive industry is one of the practically available measures to estimate the risk of the collision between the human and the manipulator. In this paper MSI is applied to evaluate the collision safety of a 7-DOF articulated human-arm-like manipulator. The risk of the collision could be reduced by choosing different postures without deviating from the given end-effector trajectory using the redundant degree of freedom in the 7-DOF manipulator. The paper shows how the redundant degree of the freedom is utilized to design safer trajectories and/or safer manipulator configurations among many available. A parametric analysis and simulation results for a given trajectory illustrate the usefulness of the concept of the trajectory design for alleviating the risk of the manipulator operation in the human–robot coexisting workspace.

  6. Effects of water deficit on breadmaking quality and storage protein compositions in bread wheat (Triticum aestivum L.).

    Science.gov (United States)

    Zhou, Jiaxing; Liu, Dongmiao; Deng, Xiong; Zhen, Shoumin; Wang, Zhimin; Yan, Yueming

    2018-03-12

    Water deficiency affects grain proteome dynamics and storage protein compositions, resulting in changes in gluten viscoelasticity. In this study, the effects of field water deficit on wheat breadmaking quality and grain storage proteins were investigated. Water deficiency produced a shorter grain-filling period, a decrease in grain number, grain weight and grain yield, a reduced starch granule size and increased protein content and glutenin macropolymer contents, resulting in superior dough properties and breadmaking quality. Reverse phase ultra-performance liquid chromatography analysis showed that the total gliadin and glutenin content and the accumulation of individual components were significantly increased by water deficiency. Two-dimensional gel electrophoresis detected 144 individual storage protein spots with significant accumulation changes in developing grains under water deficit. Comparative proteomic analysis revealed that water deficiency resulted in significant upregulation of 12 gliadins, 12 high-molecular-weight glutenin subunits and 46 low-molecular-weight glutenin subunits. Quantitative real-time polymerase chain reaction analysis revealed that the expression of storage protein biosynthesis-related transcription factors Dof and Spa was upregulated by water deficiency. The present results illustrated that water deficiency leads to increased accumulation of storage protein components and upregulated expression of Dof and Spa, resulting in an improvement in glutenin strength and breadmaking quality. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.

  7. Nucleotide sequence of the coat protein gene of the Skierniewice isolate of plum pox virus (PPV)

    International Nuclear Information System (INIS)

    Wypijewski, K.; Musial, W.; Augustyniak, J.; Malinowski, T.

    1994-01-01

    The coat protein (CP) gene of the Skierniewice isolate of plum pox virus (PPV-S) has been amplified using the reverse transcription - polymerase chain reaction (RT-PCR), cloned and sequenced. The nucleotide sequence of the gene and the deduced amino-acid sequences of PPV-S CP were compared with those of other PPV strains. The nucleotide sequence showed very high homology to most of the published sequences. The motif: Asp-Ala-Gly (DAG), important for the aphid transmissibility, was present in the amino-acid sequence. Our isolate did not react in ELISA with monoclonal antibodies MAb06 supposed to be specific for PPV-D. (author). 32 refs, 1 fig., 2 tabs

  8. Implementation of impedance trajectory control on a 6-DoF manipulator

    Directory of Open Access Journals (Sweden)

    Shardyko Igor

    2018-01-01

    Full Text Available Aiming at enhancing the performance of a robotic system, i.e. of a robot manipulator, it is extremely important to ensure the safety of its functioning and the convenience of operating it. Special attention is required if there is a possibility of a collision, especially with costly equipment or with a person. Among the different means and approaches to prevent or react to such situations, implementation of forcetorque control is considered in this paper. A trajectory task is analysed and an impedance control law is employed to achieve the desired robot behaviour. The effectiveness of the approach has been verified by using a 6-DoF elbow manipulator to perform two types of operations: a peg-in-hole task and path execution with obstacles on the way.

  9. Development of a 6 DOF force-reflecting master input device

    International Nuclear Information System (INIS)

    Yoon, Ji Sup; Yoon, Ho Sik

    1999-05-01

    The teleoperator is a very effective tool for various tasks of nuclear application in that it can reduce the operators' exposure to the radiation. For the utmost performances of the teleoperator, the force reflection capability is essential. This capability represents a function of transmitting the contact force of teleoperator with the object to the human operator. With this function the human operator in the remote area can effectively guide the motion of the teleoperator so that it can follow a safety guaranteed path. In this research a fully force reflectible input device 96 axis) is developed. To develop the force reflecting device, the state of art is surveyed. Based on this survey, the 6 DOF manipulator which controls a power manipulator is fabricated and its performance is investigated. Also, various force reflection algorithms analyzed and the enhanced algorithm is proposed. (author). 18 refs., 4 tabs., 26 figs

  10. Development of a 6 DOF force-reflecting master input device

    Energy Technology Data Exchange (ETDEWEB)

    Yoon, Ji Sup; Yoon, Ho Sik

    1999-05-01

    The teleoperator is a very effective tool for various tasks of nuclear application in that it can reduce the operators' exposure to the radiation. For the utmost performances of the teleoperator, the force reflection capability is essential. This capability represents a function of transmitting the contact force of teleoperator with the object to the human operator. With this function the human operator in the remote area can effectively guide the motion of the teleoperator so that it can follow a safety guaranteed path. In this research a fully force reflectible input device 96 axis is developed. To develop the force reflecting device, the state of art is surveyed. Based on this survey, the 6 DOF manipulator which controls a power manipulator is fabricated and its performance is investigated. Also, various force reflection algorithms analyzed and the enhanced algorithm is proposed. (author). 18 refs., 4 tabs., 26 fi0008.

  11. Development of a 6 DOF force-reflecting master input device

    Energy Technology Data Exchange (ETDEWEB)

    Yoon, Ji Sup; Yoon, Ho Sik

    1999-05-01

    The teleoperator is a very effective tool for various tasks of nuclear application in that it can reduce the operators' exposure to the radiation. For the utmost performances of the teleoperator, the force reflection capability is essential. This capability represents a function of transmitting the contact force of teleoperator with the object to the human operator. With this function the human operator in the remote area can effectively guide the motion of the teleoperator so that it can follow a safety guaranteed path. In this research a fully force reflectible input device 96 axis is developed. To develop the force reflecting device, the state of art is surveyed. Based on this survey, the 6 DOF manipulator which controls a power manipulator is fabricated and its performance is investigated. Also, various force reflection algorithms analyzed and the enhanced algorithm is proposed. (author). 18 refs., 4 tabs., 26 fi0008.

  12. Therapeutic Application of Diacylglycerol Oil for Obesity: Serotonin Hypothesis

    Directory of Open Access Journals (Sweden)

    Yuji Hirowatari

    2012-01-01

    Full Text Available ABSTRACT: Characteristics for the serum lipid abnormalities in the obesity/metabolic syndrome are elevated fasting, postprandial triglyceride (TG, and decreased high-density lipoprotein-cholesterol (HDL-C. Diacylglycerol (DAG oil ingestion has been reported to ameliorate postprandial hyperlipidemia and prevent obesity by increasing energy expenditure, due to the intestinal physiochemical dynamics that differ from triacylglycerol (TAG. Our study demonstrated that DAG suppresses postprandial increase in TG-rich lipoprotein, very low-density lipoprotein (VLDL, and insulin, as compared with TAG in young, healthy individuals. Interestingly, our study also presented that DAG significantly increases plasma serotonin, which is mostly present in the intestine, and mediates thermogenesis, proposing a possible mechanism for a postprandial increase in energy expenditure by DAG. Our other study demonstrated that DAG suppresses postprandial increase in TG, VLDL-C, and remnant-like particle-cholesterol, in comparison with TAG in an apolipoprotein C-II deficient subject, suggesting that DAG suppresses postprandial TG-rich lipoprotein independently of lipoprotein lipase. Further, to understand the molecular mechanisms for DAG-mediated increase in serotonin and energy expenditure, we studied the effects of 1-monoacylglycerol and 2(1:1-10 2-monoacylglycerol, distinct digestive products of DAG and TAG, respectively, on serotonin release from the Caco-2 cells, the human intestinal cell line. We also studied effects of 1- and 2-monoacylglycerol, and serotonin on the expression of mRNA associated with â-oxidation, fatty acids metabolism, and thermogenesis, in the Caco-2 cells. 1-monoacylglycerol significantly increased serotonin release from the Caco-2 cells, compared with 2-monoacylglycerol by approximately 40%. The expression of mRNA of acyl-CoA oxidase (ACO, fatty acid translocase (FAT, and uncoupling protein-2 (UCP-2, was significantly higher in 1-MOG

  13. Dimensional synthesis of a 3-DOF parallel manipulator with full circle rotation

    Science.gov (United States)

    Ni, Yanbing; Wu, Nan; Zhong, Xueyong; Zhang, Biao

    2015-07-01

    Parallel robots are widely used in the academic and industrial fields. In spite of the numerous achievements in the design and dimensional synthesis of the low-mobility parallel robots, few research efforts are directed towards the asymmetric 3-DOF parallel robots whose end-effector can realize 2 translational and 1 rotational(2T1R) motion. In order to develop a manipulator with the capability of full circle rotation to enlarge the workspace, a new 2T1R parallel mechanism is proposed. The modeling approach and kinematic analysis of this proposed mechanism are investigated. Using the method of vector analysis, the inverse kinematic equations are established. This is followed by a vigorous proof that this mechanism attains an annular workspace through its circular rotation and 2 dimensional translations. Taking the first order perturbation of the kinematic equations, the error Jacobian matrix which represents the mapping relationship between the error sources of geometric parameters and the end-effector position errors is derived. With consideration of the constraint conditions of pressure angles and feasible workspace, the dimensional synthesis is conducted with a goal to minimize the global comprehensive performance index. The dimension parameters making the mechanism to have optimal error mapping and kinematic performance are obtained through the optimization algorithm. All these research achievements lay the foundation for the prototype building of such kind of parallel robots.

  14. Design and Calibration of a New 6 DOF Haptic Device

    Directory of Open Access Journals (Sweden)

    Huanhuan Qin

    2015-12-01

    Full Text Available For many applications such as tele-operational robots and interactions with virtual environments, it is better to have performance with force feedback than without. Haptic devices are force reflecting interfaces. They can also track human hand positions simultaneously. A new 6 DOF (degree-of-freedom haptic device was designed and calibrated in this study. It mainly contains a double parallel linkage, a rhombus linkage, a rotating mechanical structure and a grasping interface. Benefited from the unique design, it is a hybrid structure device with a large workspace and high output capability. Therefore, it is capable of multi-finger interactions. Moreover, with an adjustable base, operators can change different postures without interrupting haptic tasks. To investigate the performance regarding position tracking accuracy and static output forces, we conducted experiments on a three-dimensional electric sliding platform and a digital force gauge, respectively. Displacement errors and force errors are calculated and analyzed. To identify the capability and potential of the device, four application examples were programmed.

  15. Design and Calibration of a New 6 DOF Haptic Device

    Science.gov (United States)

    Qin, Huanhuan; Song, Aiguo; Liu, Yuqing; Jiang, Guohua; Zhou, Bohe

    2015-01-01

    For many applications such as tele-operational robots and interactions with virtual environments, it is better to have performance with force feedback than without. Haptic devices are force reflecting interfaces. They can also track human hand positions simultaneously. A new 6 DOF (degree-of-freedom) haptic device was designed and calibrated in this study. It mainly contains a double parallel linkage, a rhombus linkage, a rotating mechanical structure and a grasping interface. Benefited from the unique design, it is a hybrid structure device with a large workspace and high output capability. Therefore, it is capable of multi-finger interactions. Moreover, with an adjustable base, operators can change different postures without interrupting haptic tasks. To investigate the performance regarding position tracking accuracy and static output forces, we conducted experiments on a three-dimensional electric sliding platform and a digital force gauge, respectively. Displacement errors and force errors are calculated and analyzed. To identify the capability and potential of the device, four application examples were programmed. PMID:26690449

  16. Kinematics and optimization of 2-DOF parallel manipulator with revolute actuators and a passive leg

    International Nuclear Information System (INIS)

    Nam, Yun Joo; Park, Myeong Kwan

    2006-01-01

    In this paper, a 2-DOF planar parallel manipulator with two revolute actuators and one passive constraining leg. The kinematic analysis of the mechanism is analytically performed : the inverse and forward kinematics problems are solved in closed forms, the workspace is derived systematically, and the three kinds of singular configurations are found. The optimal design to determine the geometric parameters and the operating limits of the actuated legs is performed considering the kinematic manipulability and workspace size. These results of the paper show the effectiveness of the presented manipulator

  17. Diacylglycerol Kinases: Shaping Diacylglycerol and Phosphatidic Acid Gradients to Control Cell Polarity

    Directory of Open Access Journals (Sweden)

    Gianluca Baldanzi

    2016-11-01

    Full Text Available Diacylglycerol kinases (DGKs terminate diacylglycerol (DAG signaling and promote phosphatidic acid (PA production. Isoform specific regulation of DGKs activity and localization allows DGKs to shape the DAG and PA gradients. The capacity of DGKs to constrain the areas of DAG signaling is exemplified by their role in defining the contact interface between T cells and antigen presenting cells: the immune synapse. Upon T cell receptor engagement, both DGK α and ζ metabolize DAG at the immune synapse thus constraining DAG signaling. Interestingly, their activity and localization are not fully redundant because DGKζ activity metabolizes the bulk of DAG in the cell, whereas DGKα limits the DAG signaling area localizing specifically at the periphery of the immune synapse.When DGKs terminate DAG signaling, the local PA production defines a new signaling domain, where PA recruits and activates a second wave of effector proteins. The best-characterized example is the role of DGKs in protrusion elongation and cell migration. Indeed, upon growth factor stimulation, several DGK isoforms, such as α, ζ, and γ, are recruited and activated at the plasma membrane. Here, local PA production controls cell migration by finely modulating cytoskeletal remodeling and integrin recycling. Interestingly, DGK-produced PA also controls the localization and activity of key players in cell polarity such as aPKC, Par3, and integrin β1. Thus, T cell polarization and directional migration may be just two instances of the general contribution of DGKs to the definition of cell polarity by local specification of membrane identity signaling.

  18. 6-DOF Pose Estimation of a Robotic Navigation Aid by Tracking Visual and Geometric Features.

    Science.gov (United States)

    Ye, Cang; Hong, Soonhac; Tamjidi, Amirhossein

    2015-10-01

    This paper presents a 6-DOF Pose Estimation (PE) method for a Robotic Navigation Aid (RNA) for the visually impaired. The RNA uses a single 3D camera for PE and object detection. The proposed method processes the camera's intensity and range data to estimates the camera's egomotion that is then used by an Extended Kalman Filter (EKF) as the motion model to track a set of visual features for PE. A RANSAC process is employed in the EKF to identify inliers from the visual feature correspondences between two image frames. Only the inliers are used to update the EKF's state. The EKF integrates the egomotion into the camera's pose in the world coordinate system. To retain the EKF's consistency, the distance between the camera and the floor plane (extracted from the range data) is used by the EKF as the observation of the camera's z coordinate. Experimental results demonstrate that the proposed method results in accurate pose estimates for positioning the RNA in indoor environments. Based on the PE method, a wayfinding system is developed for localization of the RNA in a home environment. The system uses the estimated pose and the floorplan to locate the RNA user in the home environment and announces the points of interest and navigational commands to the user through a speech interface. This work was motivated by the limitations of the existing navigation technology for the visually impaired. Most of the existing methods use a point/line measurement sensor for indoor object detection. Therefore, they lack capability in detecting 3D objects and positioning a blind traveler. Stereovision has been used in recent research. However, it cannot provide reliable depth data for object detection. Also, it tends to produce a lower localization accuracy because its depth measurement error quadratically increases with the true distance. This paper suggests a new approach for navigating a blind traveler. The method uses a single 3D time-of-flight camera for both 6-DOF PE and 3D object

  19. Novel Adaptive Forward Neural MIMO NARX Model for the Identification of Industrial 3-DOF Robot Arm Kinematics

    OpenAIRE

    Ho Pham Huy Anh; Nguyen Thanh Nam

    2012-01-01

    In this paper, a novel forward adaptive neural MIMO NARX model is used for modelling and identifying the forward kinematics of an industrial 3‐DOF robot arm system. The nonlinear features of the forward kinematics of the industrial robot arm drive are thoroughly modelled based on the forward adaptive neural NARX model‐based identification process using experimental input‐output training data. This paper proposes a novel use of a back propagation (BP) algorithm to generate the forward neural M...

  20. The Microsoft Visual Studio Software Development For 5 DOF Nuclear Malaysia Robot Arm V2 Control System

    International Nuclear Information System (INIS)

    Mohd Zaid Hassan; Anwar Abdul Rahman; Azraf Azman; Mohd Rizal Mamat; Mohd Arif Hamzah

    2014-01-01

    This paper presents the Microsoft visual studio development for 5DOF Nuclear Malaysia Robot Arm V2 control system. The kinematics analysis is the study of the relationship between the individual joints of robot manipulator, the position and orientation of the end-effector. The Denavit-Hartenberg (DH) model is used to model the robot links and joints. Both forward and inverse kinematic are presented. The simulation software has been developed by using Microsoft visual studio to solve the robot arms kinematic behavior. (author)

  1. An ER Protein Functionally Couples Neutral Lipid Metabolism on Lipid Droplets to Membrane Lipid Synthesis in the ER

    DEFF Research Database (Denmark)

    Markgraf, Daniel F; Klemm, Robin W; Junker, Mirco

    2014-01-01

    Eukaryotic cells store neutral lipids such as triacylglycerol (TAG) in lipid droplets (LDs). Here, we have addressed how LDs are functionally linked to the endoplasmic reticulum (ER). We show that, in S. cerevisiae, LD growth is sustained by LD-localized enzymes. When LDs grow in early stationary...... phase, the diacylglycerol acyl-transferase Dga1p moves from the ER to LDs and is responsible for all TAG synthesis from diacylglycerol (DAG). During LD breakdown in early exponential phase, an ER membrane protein (Ice2p) facilitates TAG utilization for membrane-lipid synthesis. Ice2p has a cytosolic...... and explain how cells switch neutral lipid metabolism from storage to consumption....

  2. Adaptive control of 5 DOF upper-limb exoskeleton robot with improved safety.

    Science.gov (United States)

    Kang, Hao-Bo; Wang, Jian-Hui

    2013-11-01

    This paper studies an adaptive control strategy for a class of 5 DOF upper-limb exoskeleton robot with a special safety consideration. The safety requirement plays a critical role in the clinical treatment when assisting patients with shoulder, elbow and wrist joint movements. With the objective of assuring the tracking performance of the pre-specified operations, the proposed adaptive controller is firstly designed to be robust to the model uncertainties. To further improve the safety and fault-tolerance in the presence of unknown large parameter variances or even actuator faults, the adaptive controller is on-line updated according to the information provided by an adaptive observer without additional sensors. An output tracking performance is well achieved with a tunable error bound. The experimental example also verifies the effectiveness of the proposed control scheme. © 2013 ISA. Published by ISA. All rights reserved.

  3. A redundant, 6-DOF parallel manipulator structure with improved workspace and dexterity

    International Nuclear Information System (INIS)

    Stoughton, R.S.; Salerno, R.; Canfield, S.; Reinholtz, C.

    1994-08-01

    This paper presents a novel manipulator structure which combines two known parallel manipulator structures--a Stewart Platform (SP), and a double octahedral Variable Geometry Truss (VGT). The combined VGT + SP structure is redundant, using nine actuators to realize six-DOF motion. Combining the two structures allows the translational and orientational workspaces of the two individual structures to sum together to a much larger workspace than is generally achievable with parallel manipulator structures. In addition, the VGT portion of the structure allows the configuration of the Stewart Platform to be changed ''on the fly'' from one with a large workspace to one with high dexterity. A useful application of this structure is at the distal end of a truss-based manipulator, where it can serve as a dexterous wrist while preserving an internal passageway for cabling and/or conveyance systems

  4. Role of diacylglycerol in adrenergic-stimulated sup 86 Rb uptake by proximal tubules

    Energy Technology Data Exchange (ETDEWEB)

    Baines, A.D.; Drangova, R.; Ho, P. (Univ. of Toronto, Ontario (Canada))

    1990-05-01

    We used rat proximal tubule fragments purified by Percoll centrifugation to examine the role of diacylglycerol (DAG) in noradrenergic-stimulated Na+ reabsorption. Tubular DAG concentration and ouabain-inhibitable 86Rb uptake increased within 30 s after adding norepinephrine (NE) and remained elevated for at least 5 min. NE (1 microM) increased DAG content 17% and ouabain-inhibitable 86Rb uptake 23%. Cirazoline-stimulated 86Rb uptake was not inhibited by BaCl, quinidine, or bumetanide (1-10 microM) or by the omission of HCO3- or Cl- from the medium, but it was completely inhibited by ouabain and furosemide. Oleoyl-acetyl glycerol, L-alpha-1,2-dioctanoylglycerol, and L-alpha-1,2-dioleoylglycerol (DOG) increased total 86Rb uptake 8-11%. 12-O-tetradecanoylphorbol-13-acetate (TPA) (5 nM) increased uptake by only 4%. Staurosporine at 5 nM inhibited DOG stimulation completely, whereas 50 nM staurosporine was required to inhibit NE stimulation completely. Sphingosine inhibited DOG stimulation by 66% but did not inhibit NE stimulation. Amiloride (1 mM) completely blocked DOG stimulation. Monensin increased 86Rb uptake 31% and completely blocked the DOG effect but reduced the NE effect by only 26% (P = 0.08). In tubules from salt-loaded rats, NE did not increase DAG concentration, but NE-stimulated 86Rb uptake was reduced by only 23% (P = 0.15). Thus DAG released by NE may stimulate Na+ entry through Na(+)-H+ exchange. NE predominantly stimulates Na(+)-K(+)-adenosinetriphosphatase (ATPase) by activating a protein kinase that is insensitive to DAG and TPA and is inhibited by staurosporine but not by sphingosine. NE may also stimulate K+ efflux through a BaCl-insensitive K+ channel that is inhibited by millimolar furosemide.

  5. Training Does Not Alter Muscle Ceramide and Diacylglycerol in Offsprings of Type 2 Diabetic Patients Despite Improved Insulin Sensitivity

    DEFF Research Database (Denmark)

    Sogaard, Ditte; Ostergard, Torben; Blachnio-Zabielska, Agnieszka U.

    2016-01-01

    not change in response to the endurance training except for an overall reduction in C22:0-Cer (). Finally, the intervention induced an increase in AKT protein expression (Off: %; Con: %, ). This study showed no relation between insulin sensitivity and ceramide or DAG content suggesting that ceramide and DAG...

  6. The preliminary of software development for the kinematics analysis of 5 DOF Nuclear Malaysia robot arm v2

    International Nuclear Information System (INIS)

    Mohd Zaid Hassan; Anwar Abdul Rahman; Rosli Darmawan; Mohd Arif Hamzah

    2010-01-01

    This paper presents the preliminary software development for the kinematics analysis of 5 DOF rescue robot. The kinematics analysis is the study of relationship between the individual joints of the robot manipulator, the position and orientation of the end-effector. The Denavit-Hartenberg (DH) model is used to model the robot links and joints. Both forward and inverse kinematic are presented. The simulation software has been developed by using MATLAB to solve the robot arms kinematic behavior. (author)

  7. A method of reactor power decrease by 2DOF control system during BWR power oscillation

    International Nuclear Information System (INIS)

    Ishikawa, Nobuyuki; Suzuki, Katsuo

    1998-09-01

    Occurrence of power oscillation events caused by void feedback effects in BWRs operated at low-flow and high-power condition has been reported. After thoroughly examining these events, BWRs have been equipped with the SRI (Selected Rod Insertion) system to avoid the power oscillation by decreasing the power under such reactor condition. This report presents a power control method for decreasing the reactor power stably by a two degree of freedom (2DOF) control. Performing a numerical simulation by utilizing a simple reactor dynamics model, it is found that the control system designed attains a satisfactory control performance of power decrease from a viewpoint of setting time and oscillation. (author)

  8. Simulation and training of lumbar punctures using haptic volume rendering and a 6DOF haptic device

    Science.gov (United States)

    Färber, Matthias; Heller, Julika; Handels, Heinz

    2007-03-01

    The lumbar puncture is performed by inserting a needle into the spinal chord of the patient to inject medicaments or to extract liquor. The training of this procedure is usually done on the patient guided by experienced supervisors. A virtual reality lumbar puncture simulator has been developed in order to minimize the training costs and the patient's risk. We use a haptic device with six degrees of freedom (6DOF) to feedback forces that resist needle insertion and rotation. An improved haptic volume rendering approach is used to calculate the forces. This approach makes use of label data of relevant structures like skin, bone, muscles or fat and original CT data that contributes information about image structures that can not be segmented. A real-time 3D visualization with optional stereo view shows the punctured region. 2D visualizations of orthogonal slices enable a detailed impression of the anatomical context. The input data consisting of CT and label data and surface models of relevant structures is defined in an XML file together with haptic rendering and visualization parameters. In a first evaluation the visible human male data has been used to generate a virtual training body. Several users with different medical experience tested the lumbar puncture trainer. The simulator gives a good haptic and visual impression of the needle insertion and the haptic volume rendering technique enables the feeling of unsegmented structures. Especially, the restriction of transversal needle movement together with rotation constraints enabled by the 6DOF device facilitate a realistic puncture simulation.

  9. Identification of a third protein 4.1 tumor suppressor, protein 4.1R, in meningioma pathogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Robb, Victoria A.; Li, Wen; Gascard, Philippe; Perry, Arie; Mohandas, Narla; Gutmann, David H.

    2003-06-11

    Meningiomas are common tumors of the central nervous system, however, the mechanisms under lying their pathogenesis are largely undefined. Two members of the Protein 4.1 super family, the neuro fibromatosis 2 (NF2) gene product (merlin/schwannomin) and Protein 4.1B have been implicated as meningioma tumor suppressors. In this report, we demonstrate that another Protein 4.1 family member, Protein 4.1R, also functions as a meningioma tumor suppressor. Based on the assignment of the Protein 4.1R gene to chromosome 1p32-36, a common region of deletion observed in meningiomas, we analyzed Protein 4.1R expression in meningioma cell lines and surgical tumor specimens. We observed loss of Protein 4.1R protein expression in two meningioma cell lines (IOMM-Lee, CH157-MN) by Western blotting as well as in 6 of 15 sporadic meningioma as by immuno histo chemistry (IHC). Analysis of a subset of these sporadic meningiomas by fluorescent in situ hybridization (FISH) with a Protein 4.1R specific probe demonstrated 100 percent concordance with the IHC results. In support of a meningioma tumor suppressor function, over expression of Protein 4.1R resulted in suppression of IOMM-Lee and CH157MN cell proliferation. Similar to the Protein 4.1B and merlin meningioma tumor suppressors, Protein 4.1R localization in the membrane fraction increased significantly under conditions of growth arrest in vitro. Lastly, Protein 4.1R interacted with some known merlin/Protein 4.1B interactors such as CD44 and bII-spectrin, but did not associate with the Protein 4.1B interactors 14-3-3 and PRMT3 or the merlin binding proteins SCHIP-1 and HRS. Collectively, these results suggest that Protein 4.1R functions as an important tumor suppressor important in the molecular pathogenesis of meningioma.

  10. Development of a 6DOF robotic motion phantom for radiation therapy

    International Nuclear Information System (INIS)

    Belcher, Andrew H.; Liu, Xinmin; Grelewicz, Zachary; Pearson, Erik; Wiersma, Rodney D.

    2014-01-01

    Purpose: The use of medical technology capable of tracking patient motion or positioning patients along 6 degree-of-freedom (6DOF) has steadily increased in the field of radiation therapy. However, due to the complex nature of tracking and performing 6DOF motion, it is critical that such technology is properly verified to be operating within specifications in order to ensure patient safety. In this study, a robotic motion phantom is presented that can be programmed to perform highly accurate motion along any X (left–right), Y (superior–inferior), Z (anterior–posterior), pitch (around X), roll (around Y), and yaw (around Z) axes. In addition, highly synchronized motion along all axes can be performed in order to simulate the dynamic motion of a tumor in 6D. The accuracy and reproducibility of this 6D motion were characterized. Methods: An in-house designed and built 6D robotic motion phantom was constructed following the Stewart–Gough parallel kinematics platform archetype. The device was controlled using an inverse kinematics formulation, and precise movements in all 6 degrees-of-freedom (X, Y, Z, pitch, roll, and yaw) were performed, both simultaneously and separately for each degree-of-freedom. Additionally, previously recorded 6D cranial and prostate motions were effectively executed. The robotic phantom movements were verified using a 15 fps 6D infrared marker tracking system and the measured trajectories were compared quantitatively to the intended input trajectories. The workspace, maximum 6D velocity, backlash, and weight load capabilities of the system were also established. Results: Evaluation of the 6D platform demonstrated translational root mean square error (RMSE) values of 0.14, 0.22, and 0.08 mm over 20 mm in X and Y and 10 mm in Z, respectively, and rotational RMSE values of 0.16°, 0.06°, and 0.08° over 10° of pitch, roll, and yaw, respectively. The robotic stage also effectively performed controlled 6D motions, as well as reproduced

  11. dag hammarskjöld 1. introductio

    African Journals Online (AJOL)

    Nevertheless, we may also easily get ourselves talked or manipulated into essentials in which case we yield to social pressure or lapse into ..... children of God, and should be met and treated by us as our masters in God. The relationship with ...

  12. Control Architecture of a 10 DOF Lower Limbs Exoskeleton for Gait Rehabilitation

    Directory of Open Access Journals (Sweden)

    Natasa Koceska

    2013-01-01

    Full Text Available This paper describes the control architecture of a 10 DOF (Degrees of Freedom lower limbs exoskeleton for the gait rehabilitation of patients with gait dysfunction. The system has 4 double-acting rod pneumatic actuators (two for each leg that control the hip and knee joints. The motion of each cylinder's piston is controlled by two proportional pressure valves, connected to both cylinder chambers. The control strategy has been specifically designed in order to ensure a proper trajectory control for guiding patient's legs along a fixed reference gait pattern. An adaptive fuzzy controller which is capable of compensating for the influence of the dry friction was successfully designed, implemented and tested on an embedded real-time PC/104. In order to verify the proposed control architecture, laboratory experiments without a patient were carried out and the results are reported here and discussed.

  13. Targeting protein-protein interaction between MLL1 and reciprocal proteins for leukemia therapy.

    Science.gov (United States)

    Wang, Zhi-Hui; Li, Dong-Dong; Chen, Wei-Lin; You, Qi-Dong; Guo, Xiao-Ke

    2018-01-15

    The mixed lineage leukemia protein-1 (MLL1), as a lysine methyltransferase, predominantly regulates the methylation of histone H3 lysine 4 (H3K4) and functions in hematopoietic stem cell (HSC) self-renewal. MLL1 gene fuses with partner genes that results in the generation of MLL1 fusion proteins (MLL1-FPs), which are frequently detected in acute leukemia. In the progress of leukemogenesis, a great deal of proteins cooperate with MLL1 to form multiprotein complexes serving for the dysregulation of H3K4 methylation, the overexpression of homeobox (HOX) cluster genes, and the consequent generation of leukemia. Hence, disrupting the interactions between MLL1 and the reciprocal proteins has been considered to be a new treatment strategy for leukemia. Here, we reviewed potential protein-protein interactions (PPIs) between MLL1 and its reciprocal proteins, and summarized the inhibitors to target MLL1 PPIs. The druggability of MLL1 PPIs for leukemia were also discussed. Copyright © 2017. Published by Elsevier Ltd.

  14. An analytical study of non-linear behaviour of coupled 2+2x0.5 DOF electro-magneto-mechanical system by a method of multiple scales

    DEFF Research Database (Denmark)

    Darula, Radoslav; Sorokin, Sergey

    2013-01-01

    An electro-magneto-mechanical system combines three physical domains - a mechanical structure, a magnetic field and an electric circuit. The interaction between these domains is analysed for a structure with two degrees of freedom (translational and rotational) and two electrical circuits. Each...... electrical circuit is described by a differential equation of the 1st order, which is considered to contribute to the coupled system by 0.5 DOF. The electrical and mechanical systems are coupled via a magnetic circuit, which is inherently non-linear, due to a non-linear nature of the electro-magnetic force...

  15. Differential effects of pertussis toxin on insulin-stimulated phosphatidylcholine hydrolysis and glycerolipid synthesis de novo. Studies in BC3H-1 myocytes and rat adipocytes

    International Nuclear Information System (INIS)

    Hoffman, J.M.; Standaert, M.L.; Nair, G.P.; Farese, R.V.

    1991-01-01

    Insulin-induced increases in diacylglycerol (DAG) have been suggested to result from stimulation of de novo phosphatidic acid (PA) synthesis and phosphatidylcholine (PC) hydrolysis. Presently, the authors found that insulin decreased PC levels of BC3H-1 myocytes and rat adipocytes by approximately 10-25% within 30 s. These decreases were rapidly reversed in both cell types, apparently because of increased PC synthesis de novo. In BC3H-1 myocytes, pertussis toxin inhibited PC resynthesis and insulin effects on the pathway of de novo PA-DAG-PC synthesis, as evidenced by changes in [ 3 H]glycerol incorporation, but did not inhibit insulin-stimulated PC hydrolysis. Pertussis toxin also blocked the later, but not the initial, increase in DAG production in the myocytes. Phorbol esters activated PC hydrolysis in both myocytes and adipocytes, but insulin-induced stimulation of PC hydrolysis was not dependent upon activation of PKC, since this hydrolysis was not inhibited by 500 μM sangivamycin, an effective PKC inhibitor. The results indicate that insulin increases DAG by pertussis toxin sensitive and insensitive (PC hydrolysis) mechanisms, which are mechanistically separate, but functionally interdependent and integrated. PC hydrolysis may contribute importantly to initial increases in DAG, but later sustained increases are apparently largely dependent on insulin-induced stimulation of the pathway of de novo phospholipid synthesis

  16. Differential effects of pertussis toxin on insulin-stimulated phosphatidylcholine hydrolysis and glycerolipid synthesis de novo. Studies in BC3H-1 myocytes and rat adipocytes

    Energy Technology Data Exchange (ETDEWEB)

    Hoffman, J.M.; Standaert, M.L.; Nair, G.P.; Farese, R.V. (Univ. of South Florida, Tampa (USA))

    1991-04-02

    Insulin-induced increases in diacylglycerol (DAG) have been suggested to result from stimulation of de novo phosphatidic acid (PA) synthesis and phosphatidylcholine (PC) hydrolysis. Presently, the authors found that insulin decreased PC levels of BC3H-1 myocytes and rat adipocytes by approximately 10-25% within 30 s. These decreases were rapidly reversed in both cell types, apparently because of increased PC synthesis de novo. In BC3H-1 myocytes, pertussis toxin inhibited PC resynthesis and insulin effects on the pathway of de novo PA-DAG-PC synthesis, as evidenced by changes in ({sup 3}H)glycerol incorporation, but did not inhibit insulin-stimulated PC hydrolysis. Pertussis toxin also blocked the later, but not the initial, increase in DAG production in the myocytes. Phorbol esters activated PC hydrolysis in both myocytes and adipocytes, but insulin-induced stimulation of PC hydrolysis was not dependent upon activation of PKC, since this hydrolysis was not inhibited by 500 {mu}M sangivamycin, an effective PKC inhibitor. The results indicate that insulin increases DAG by pertussis toxin sensitive and insensitive (PC hydrolysis) mechanisms, which are mechanistically separate, but functionally interdependent and integrated. PC hydrolysis may contribute importantly to initial increases in DAG, but later sustained increases are apparently largely dependent on insulin-induced stimulation of the pathway of de novo phospholipid synthesis.

  17. Diacylglycerol kinases in the coordination of synaptic plasticity

    Directory of Open Access Journals (Sweden)

    Dongwon Lee

    2016-08-01

    Full Text Available Synaptic plasticity is activity-dependent modification of the efficacy of synaptic transmission. Although detailed mechanisms underlying synaptic plasticity are diverse and vary at different types of synapses, diacylglycerol (DAG-associated signaling has been considered as an important regulator of many forms of synaptic plasticity, including long-term potentiation (LTP and long-term depression (LTD. Recent evidence indicate that DAG kinases (DGKs, which phosphorylate DAG to phosphatidic acid to terminate DAG signaling, are important regulators of LTP and LTD, as supported by the results from mice lacking specific DGK isoforms. This review will summarize these studies and discuss how specific DGK isoforms distinctly regulate different forms of synaptic plasticity at pre- and postsynaptic sites. In addition, we propose a general role of DGKs as coordinators of synaptic plasticity that make local synaptic environments more permissive for synaptic plasticity by regulating DAG concentration and interacting with other synaptic proteins.

  18. End-Effector Position Analysis Using Forward Kinematics For 5 Dof Pravak Robot Arm

    Directory of Open Access Journals (Sweden)

    Jolly Atit Shah

    2013-03-01

    Full Text Available Automatic control of the robotic manipulator involves study of kinematics and dynamics as a major issue. This paper involves the kinematic analysis of a Pravak Robot arm which is used for doing successful robotic manipulation task in its workspace. The Pravak Robot Arm is a 5-DOF robot having all the joints revolute. The kinematics problem is defined as the transformation from the Cartesian space to the joint space and vice versa. In this study the Denavit- Hartenberg (D-H model is used to model robot links and joints. Pravak Robot Arm is a simple and safe robotic system designed for laboratory training and research applications. This robot allows to gain theoretical and practical experience in robotics, automation and control systems. The MATLAB R2007 is used to analyse end effectors position for a set of joint parameter.

  19. Optimal Design of a 3-DOF Cable-Driven Upper Arm Exoskeleton

    Directory of Open Access Journals (Sweden)

    Zhu-Feng Shao

    2014-04-01

    Full Text Available With outstanding advantages, such as large workspace, flexibility, and lightweight and low inertia, cable-driven parallel manipulator shows great potential for application as the exoskeleton rehabilitation robot. However, the optimal design is still a challenging problem to be solved. In this paper, the optimal design of a 3-DOF (3-degree-of-freedom cable-driven upper arm exoskeleton is accomplished considering the force exerted on the arm. After analysis of the working conditions, two promising configurations of the cable-driven upper arm exoskeleton are put forward and design parameters are simplified. Then, candidate ranges of two angle parameters are determined with the proposed main workspace requirement. Further, global force indices are defined to evaluate the force applied to the arm by the exoskeleton, in order to enhance the system safety and comfort. Finally, the optimal design of each configuration is obtained with proposed force indices. In addition, atlases and charts given in this paper well illustrate trends of workspace and force with different values of design parameters.

  20. Protein 4.1, a component of the erythrocyte membrane skeleton and its related homologue proteins forming the protein 4.1/FERM superfamily.

    Directory of Open Access Journals (Sweden)

    Aleksander F Sikorski

    2007-01-01

    Full Text Available The review is focused on the domain structure and function of protein 4.1, one of the proteins belonging to the membrane skeleton. The protein 4.1 of the red blood cells (4.1R is a multifunctional protein that localizes to the membrane skeleton and stabilizes erythrocyte shape and membrane mechanical properties, such as deformability and stability, via lateral interactions with spectrin, actin, glycophorin C and protein p55. Protein 4.1 binding is modulated through the action of kinases and/or calmodulin-Ca2+. Non-erythroid cells express the 4.1R homologues: 4.1G (general type, 4.1B (brain type, and 4.1N (neuron type, and the whole group belongs to the protein 4.1 superfamily, which is characterized by the presence of a highly conserved FERM domain at the N-terminus of the molecule. Proteins 4.1R, 4.1G, 4.1N and 4.1B are encoded by different genes. Most of the 4.1 superfamily proteins also contain an actin-binding domain. To date, more than 40 members have been identified. They can be divided into five groups: protein 4.1 molecules, ERM proteins, talin-related molecules, protein tyrosine phosphatase (PTPH proteins and NBL4 proteins. We have focused our attention on the main, well known representatives of 4.1 superfamily and tried to choose the proteins which are close to 4.1R or which have distinct functions. 4.1 family proteins are not just linkers between the plasma membrane and membrane skeleton; they also play an important role in various processes. Some, such as focal adhesion kinase (FAK, non-receptor tyrosine kinase that localizes to focal adhesions in adherent cells, play the role in cell adhesion. The other members control or take part in tumor suppression, regulation of cell cycle progression, inhibition of cell proliferation, downstream signaling of the glutamate receptors, and establishment of cell polarity; some are also involved in cell proliferation, cell motility, and/or cell-to-cell communication.

  1. Spacecraft attitude maneuver control using two parallel mounted 3-DOF spherical actuators

    Directory of Open Access Journals (Sweden)

    Guidan Li

    2017-02-01

    Full Text Available A parallel configuration using two 3-degree-of-freedom (3-DOF spherical electromagnetic momentum exchange actuators is investigated for large angle spacecraft attitude maneuvers. First, the full dynamic equations of motion for the spacecraft system are derived by the Newton-Euler method. To facilitate computation, virtual gimbal coordinate frames are established. Second, a nonlinear control law in terms of quaternions is developed via backstepping method. The proposed control law compensates the coupling torques arising from the spacecraft rotation, and is robust against the external disturbances. Then, the singularity problem is analyzed. To avoid singularities, a modified weighed Moore-Pseudo inverse velocity steering law based on null motion is proposed. The weighted matrices are carefully designed to switch the actuators and redistribute the control torques. The null motion is used to reorient the rotor away from the tilt angle saturation state. Finally, numerical simulations of rest-to-rest maneuvers are performed to validate the effectiveness of the proposed method.

  2. Protein phosphatase PPM1G regulates protein translation and cell growth by dephosphorylating 4E binding protein 1 (4E-BP1).

    Science.gov (United States)

    Liu, Jianyu; Stevens, Payton D; Eshleman, Nichole E; Gao, Tianyan

    2013-08-09

    Protein translation initiation is a tightly controlled process responding to nutrient availability and mitogen stimulation. Serving as one of the most important negative regulators of protein translation, 4E binding protein 1 (4E-BP1) binds to translation initiation factor 4E and inhibits cap-dependent translation in a phosphorylation-dependent manner. Although it has been demonstrated previously that the phosphorylation of 4E-BP1 is controlled by mammalian target of rapamycin in the mammalian target of rapamycin complex 1, the mechanism underlying the dephosphorylation of 4E-BP1 remains elusive. Here, we report the identification of PPM1G as the phosphatase of 4E-BP1. A coimmunoprecipitation experiment reveals that PPM1G binds to 4E-BP1 in cells and that purified PPM1G dephosphorylates 4E-BP1 in vitro. Knockdown of PPM1G in 293E and colon cancer HCT116 cells results in an increase in the phosphorylation of 4E-BP1 at both the Thr-37/46 and Ser-65 sites. Furthermore, the time course of 4E-BP1 dephosphorylation induced by amino acid starvation or mammalian target of rapamycin inhibition is slowed down significantly in PPM1G knockdown cells. Functionally, the amount of 4E-BP1 bound to the cap-dependent translation initiation complex is decreased when the expression of PPM1G is depleted. As a result, the rate of cap-dependent translation, cell size, and protein content are increased in PPM1G knockdown cells. Taken together, our study has identified protein phosphatase PPM1G as a novel regulator of cap-dependent protein translation by negatively controlling the phosphorylation of 4E-BP1.

  3. A molecular mechanism for diacylglycerol-mediated promotion of negative caloric balance

    Directory of Open Access Journals (Sweden)

    Yanai H

    2009-12-01

    Full Text Available Hidekatsu Yanai1,2, Yoshiharu Tomono3, Kumie Ito1,2, Yuji Hirowatari4, Hiroshi Yoshida1,5, Norio Tada1,21Department of Internal Medicine, 2Institute of Clinical Medicine and Research, 3Department of Nutrition, 5Department of Laboratory Medicine, Jikei University School of Medicine, chiba, Japan; 4Bioscience Division, Tosoh Corporation, Kanagawa, JapanAims: A substitution of diacylglycerol (DAG oil for triacylglycerol (TAG oil in diet has been reported to reduce body fat and body weight, possibly by increasing postprandial energy expenditure (EE. We have previously studied plasma serotonin, which increases EE and exists in the small intestine, in individuals who ingested TAG and DAG oil, and found that DAG ingestion elevates plasma serotonin levels by about 50% compared with TAG ingestion. We studied the molecular mechanisms for DAG-mediated increase in serotonin and EE.Methods: We studied effects of 1-monoacylglycerol and 2-monoacylglycerol, distinct digestive products of DAG and TAG, respectively, on serotonin release from the Caco-2 cells (the human intestinal cell line, n = 8. Further, we studied effects of 1- and 2-monoacylglycerol, and serotonin on expression of mRNA associated with β-oxidation, FA metabolism, and thermogenesis, in the Caco-2 cells (n = 5.Results: 1-monoacylglycerol (100 µM 1-monooleyl glycerol [1-MOG] significantly increased serotonin release from the Caco-2 cells compared with 2-monoacylglycerol (100 µM 2-MOG by 36.6%. Expression of mRNA of acyl-CoA oxidase (ACO, fatty acid translocase (FAT, and uncoupling protein-2 (UCP-2 were significantly higher in 100 µM 1-MOG-treated Caco-2 cells than 100 µM 2-MOG-treated cells by 12.8%, 23.7%, and 35.1%, respectively. Further, expression of mRNA of ACO, medium-chain acyl-CoA dehydrogenase, FAT, and UCP-2 were significantly elevated in serotonin (400 nM-treated Caco-2 cells compared with cells incubated without serotonin by 28.7%, 30.1%, and 39.2%, respectively.Conclusions: Our

  4. Selective Inhibitors of Kv11.1 Regulate IL-6 Expression by Macrophages in Response to TLR/IL-1R Ligands

    Directory of Open Access Journals (Sweden)

    Cheryl Hunter

    2010-01-01

    Full Text Available The mechanism by which the platelet-endothelial cell adhesion molecule PECAM-1 regulates leukodiapedesis, vascular endothelial integrity, and proinflammatory cytokine expression in vivo is not known. We recently identified PECAM-1 as a negative regulator of Kv11.1, a specific voltage-gated potassium channel that functioned in human macrophages to reset a resting membrane potential following depolarization. We demonstrate here that dofetilide (DOF, a selective inhibitor of the Kv11.1 current, had a profound inhibitory effect on neutrophil recruitment in mice following TLR/IL-1R–elicited peritonitis or intrascrotal injection of IL-1β, but had no effect on responses seen with TNFα. Furthermore, inhibitors of Kv11.1 (DOF, E4031, and astemizole, but not Kv1.3 (margatoxin, suppressed the expression of IL-6 and MCP-1 cytokines by murine resident peritoneal macrophages, while again having no effect on TNFα. In contrast, IL-6 expression by peritoneal mesothelial cells was unaffected. Using murine P388 cells, which lack endogenous C/EBPβexpression and are unresponsive to LPS for the expression of both IL-6 and MCP-1, we observed that DOF inhibited LPS-induced expression of IL-6 mRNA following ectopic expression of wild-type C/EBPβ, but not a serine-64 point mutant. Finally, DOF inhibited the constitutive activation of cdk2 in murine peritoneal macrophages; cdk2 is known to phosphorylate C/EBPβ at serine-64. Taken together, our results implicate a potential role for Kv11.1 in regulating cdk2 and C/EBPβ activity, where robust transactivation of both IL-6 and MCP-1 transcription is known to be dependent on serine-64 of C/EBPβ. Our data might also explain the altered phenotypes displayed by PECAM-1 knockout mice in several disease models.

  5. Platelet activation by bacterial phospholipase C involves phosphoinositide turnover and phosphorylation of 47,000 dalton but not 20,000 dalton protein

    International Nuclear Information System (INIS)

    Huzoor-Akbar; Anwer, K.

    1986-01-01

    This study was conducted to examine the role of phosphoinositides (PIns) and phosphorylation of 47,000 dalton (P47) and 20,000 dalton (P20) proteins in platelet activation by bacterial phospholipase C (PLC). PLC induced serotonin secretion (SS) and platelet aggregation (PA) in a concentration dependent manner. PLC (0.02 U/ml) caused phosphorylation of P47 in a time dependent manner (27% at 0.5 min to 378% at 7 min). PLC did not induce more than 15% phosphorylation of P20 by 7 min. Aspirin (500 μM) blocked phosphorylation of P20 but did not inhibit SS, PA or phosphorylation of P47. PLC (0.04 U/ml) decreased radioactivity (cpm) in 32 P labeled phosphatidylinositol (PI), PI-4,5-bis-PO4 (PIP2) and PI-4-PO4 (PIP) by 20%, 12% and 7.5% respectively at 15 sec. The level of PI but not that of PIP2 returned to base line in 3 min. PIP level increased above control values within one min. PLC increased phosphatidic acid level (75% at 0.5 min. to 1545% at 3 min). In other experiments PLC produced diacylglycerol (DAG) in a time and concentration dependent manner. However, no DAG was detectable in the first 60 sec. These data suggest that: (a) PIns turnover and phosphorylation of P47 but not that of P20 is involved in platelet activation by PLC; and (b) DAG production from outer membrane phospholipids is not a prerequisite for platelet activation by PLC

  6. Absorption difference between diacylglycerol oil and butter blend containing diacylglycerol oil

    DEFF Research Database (Denmark)

    Kristensen, Janni Brogaard; Jørgensen, Henry; Mu, Huiling

    2012-01-01

    butter blend (BDAG), triacylglycerol (TAG) butter blend (BTAG), DAG oil (ODAG) or TAG oil (OTAG) were prepared, and each was fed to a group of 8 male Wistar rats. The design of the experiment was a combined balance and feeding experiment. The rats fed the BTAG and ODAG‐diets had a significantly higher......This study aims at investigating whether the intake of butter blends containing diacylglycerol (DAG) oil may result in reduced fat accumulation, in similarity to DAG oil, and the potential metabolic differences between butter blends and DAG oil. Four experimental diets containing either 10 wt% DAG...... protein content than rats fed the BDAG and OTAG‐diets, and the fat content was significantly lower in rats fed the ODAG‐diet as compared to rats fed the OTAG and BDAG‐diets. A significantly higher content of ash was observed in rats fed the two TAG diets. The ratio of abdominal fat weight/body weight...

  7. Arabidopsis Yak1 protein (AtYak1) is a dual specificity protein kinase

    KAUST Repository

    Kim, Dongjin; Ntui, Valentine Otang; Zhang, Nianshu; Xiong, Liming

    2015-01-01

    Yak1 is a member of dual-specificity Tyr phosphorylation-regulated kinases (DYRKs) that are evolutionarily conserved. The downstream targets of Yak1 and their functions are largely unknown. Here, a homologous protein AtYAK1 was identified in Arabidopsis thaliana and the phosphoprotein profiles of the wild type and an atyak1 mutant were compared on two-dimensional gel following Pro-Q Diamond phosphoprotein gel staining. Annexin1, Annexin2 and RBD were phosphorylated at serine/ threonine residues by the AtYak1 kinase. Annexin1, Annexin2 and Annexin4 were also phosphorylated at tyrosine residues. Our study demonstrated that AtYak1 is a dual specificity protein kinase in Arabidopsis that may regulate the phosphorylation status of the annexin family proteins.

  8. Arabidopsis Yak1 protein (AtYak1) is a dual specificity protein kinase

    KAUST Repository

    Kim, Dongjin

    2015-10-09

    Yak1 is a member of dual-specificity Tyr phosphorylation-regulated kinases (DYRKs) that are evolutionarily conserved. The downstream targets of Yak1 and their functions are largely unknown. Here, a homologous protein AtYAK1 was identified in Arabidopsis thaliana and the phosphoprotein profiles of the wild type and an atyak1 mutant were compared on two-dimensional gel following Pro-Q Diamond phosphoprotein gel staining. Annexin1, Annexin2 and RBD were phosphorylated at serine/ threonine residues by the AtYak1 kinase. Annexin1, Annexin2 and Annexin4 were also phosphorylated at tyrosine residues. Our study demonstrated that AtYak1 is a dual specificity protein kinase in Arabidopsis that may regulate the phosphorylation status of the annexin family proteins.

  9. Protein disulfide isomerase-like protein 1-1 controls endosperm development through regulation of the amount and composition of seed proteins in rice.

    Directory of Open Access Journals (Sweden)

    Yeon Jeong Kim

    Full Text Available Protein disulfide isomerase (PDI is a chaperone protein involved in oxidative protein folding by acting as a catalyst and assisting folding in the endoplasmic reticulum (ER. A genome database search showed that rice contains 19 PDI-like genes. However, their functions are not clearly identified. This paper shows possible functions of rice PDI-like protein 1-1 (PDIL1-1 during seed development. Seeds of the T-DNA insertion PDIL1-1 mutant, PDIL1-1Δ, identified by genomic DNA PCR and western blot analysis, display a chalky phenotype and a thick aleurone layer. Protein content per seed was significantly lower and free sugar content higher in PDIL1-1Δ mutant seeds than in the wild type. Proteomic analysis of PDIL1-1Δ mutant seeds showed that PDIL1-1 is post-translationally regulated, and its loss causes accumulation of many types of seed proteins including glucose/starch metabolism- and ROS (reactive oxygen species scavenging-related proteins. In addition, PDIL1-1 strongly interacts with the cysteine protease OsCP1. Our data indicate that the opaque phenotype of PDIL1-1Δ mutant seeds results from production of irregular starch granules and protein body through loss of regulatory activity for various proteins involved in the synthesis of seed components.

  10. Interaction between a plasma membrane-localized ankyrin-repeat protein ITN1 and a nuclear protein RTV1

    Energy Technology Data Exchange (ETDEWEB)

    Sakamoto, Hikaru [Department of Bioproduction, Faculty of Bioindustry, Tokyo University of Agriculture, 196 Yasaka, Abashiri-shi, Hokkaido 093-2422 (Japan); Sakata, Keiko; Kusumi, Kensuke [Department of Biology, Faculty of Sciences, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan); Kojima, Mikiko; Sakakibara, Hitoshi [RIKEN Plant Science Center, 1-7-22 Suehiro-cho, Tsurumi-ku, Yokohama 230-0045 (Japan); Iba, Koh, E-mail: koibascb@kyushu-u.org [Department of Biology, Faculty of Sciences, Kyushu University, 6-10-1 Hakozaki, Higashi-ku, Fukuoka 812-8581 (Japan)

    2012-06-29

    Highlights: Black-Right-Pointing-Pointer ITN1, a plasma membrane ankyrin protein, interacts with a nuclear DNA-binding protein RTV1. Black-Right-Pointing-Pointer The nuclear transport of RTV1 is partially inhibited by interaction with ITN1. Black-Right-Pointing-Pointer RTV1 can promote the nuclear localization of ITN1. Black-Right-Pointing-Pointer Both overexpression of RTV1 and the lack of ITN1 increase salicylic acids sensitivity in plants. -- Abstract: The increased tolerance to NaCl 1 (ITN1) protein is a plasma membrane (PM)-localized protein involved in responses to NaCl stress in Arabidopsis. The predicted structure of ITN1 is composed of multiple transmembrane regions and an ankyrin-repeat domain that is known to mediate protein-protein interactions. To elucidate the molecular functions of ITN1, we searched for interacting partners using a yeast two-hybrid assay, and a nuclear-localized DNA-binding protein, RTV1, was identified as a candidate. Bimolecular fluorescence complementation analysis revealed that RTV1 interacted with ITN1 at the PM and nuclei in vivo. RTV1 tagged with red fluorescent protein localized to nuclei and ITN1 tagged with green fluorescent protein localized to PM; however, both proteins localized to both nuclei and the PM when co-expressed. These findings suggest that RTV1 and ITN1 regulate the subcellular localization of each other.

  11. Protein: MPA1 [TP Atlas

    Lifescience Database Archive (English)

    Full Text Available MPA1 TLR signaling molecules MAVS IPS1, KIAA1271, VISA VISA_(gene) Mitochondrial antiviral-signaling pr...otein CARD adapter inducing interferon beta, Interferon beta promoter stimulator protein... 1, Putative NF-kappa-B-activating protein 031N, Virus-induced-signaling adapter 9606 Homo sapiens Q7Z434 57506 2VGQ 57506 ...

  12. Huntingtin-associated protein-1 (HAP1) regulates endocytosis and interacts with multiple trafficking-related proteins.

    Science.gov (United States)

    Mackenzie, Kimberly D; Lim, Yoon; Duffield, Michael D; Chataway, Timothy; Zhou, Xin-Fu; Keating, Damien J

    2017-07-01

    Huntingtin-associated protein 1 (HAP1) was initially identified as a binding partner of huntingtin, mutations in which underlie Huntington's disease. Subcellular localization and protein interaction data indicate that HAP1 may be important in vesicle trafficking, cell signalling and receptor internalization. In this study, a proteomics approach was used for the identification of novel HAP1-interacting partners to attempt to shed light on the physiological function of HAP1. Using affinity chromatography with HAP1-GST protein fragments bound to Sepharose columns, this study identified a number of trafficking-related proteins that bind to HAP1. Interestingly, many of the proteins that were identified by mass spectrometry have trafficking-related functions and include the clathrin light chain B and Sec23A, an ER to Golgi trafficking vesicle coat component. Using co-immunoprecipitation and GST-binding assays the association between HAP1 and clathrin light chain B has been validated in vitro. This study also finds that HAP1 co-localizes with clathrin light chain B. In line with a physiological function of the HAP1-clathrin interaction this study detected a dramatic reduction in vesicle retrieval and endocytosis in adrenal chromaffin cells. Furthermore, through examination of transferrin endocytosis in HAP1 -/- cortical neurons, this study has determined that HAP1 regulates neuronal endocytosis. In this study, the interaction between HAP1 and Sec23A was also validated through endogenous co-immunoprecipitation in rat brain homogenate. Through the identification of novel HAP1 binding partners, many of which have putative trafficking roles, this study provides us with new insights into the mechanisms underlying the important physiological function of HAP1 as an intracellular trafficking protein through its protein-protein interactions. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Stimulation of phosphatidylcholine breakdown and diacylglycerol production by growth factors in Swiss-3T3 cells.

    Science.gov (United States)

    Price, B D; Morris, J D; Hall, A

    1989-01-01

    The effect of a number of growth factors on phosphatidylcholine (PtdCho) turnover in Swiss-3T3 cells was studied. Phorbol 12-myristate 13-acetate (PMA), bombesin, platelet-derived growth factor (PDGF) and vasopressin rapidly stimulated PtdCho hydrolysis, diacylglycerol (DAG) production, and PtdCho synthesis. Insulin and prostaglandin F2 alpha (PGF2 alpha) stimulated PtdCho synthesis, but not its breakdown, whereas epidermal growth factor (EGF) and bradykinin were without effect. Stimulation of PtdCho hydrolysis by the above ligands resulted in increased production of phosphocholine and DAG (due to phospholipase C activity) and significant amounts of choline, suggesting activation of a phospholipase D as well. CDP-choline and glycerophosphocholine levels were unchanged. Down-regulation of protein kinase C with PMA (400 nM, 40 h) abolished the stimulation of PtdCho hydrolysis and PtdCho synthesis by PMA, bombesin, PDGF and vasopressin, but not the stimulation of PtdCho synthesis by insulin and PGF2 alpha. PtdCho hydrolysis therefore occurs predominantly by activation of protein kinase C (either by PMA or PtdIns hydrolysis) leading to elevation of DAG levels derived from non-PtdIns(4,5)P2 sources. PtdCho synthesis occurs by both a protein kinase C-dependent pathway (stimulated by PMA, PDGF, bombesin and vasopressin) and a protein kinase C-independent pathway (stimulated by insulin and PGF2 alpha). DAG production from PtdCho hydrolysis is not the primary signal to activate protein kinase C, but may contribute to long-term activation of this kinase. PMID:2690829

  14. The mechanism of phospholipase Cγ1 activation

    Directory of Open Access Journals (Sweden)

    Paweł Krawczyk

    2011-08-01

    Full Text Available Phospholipase C is an enzyme which catalyzes the hydrolysis of phosphatidylinositol-4,5-bisphosphate (PI(4,5P2 into second messengers inositol-1,4,5-triphosphate (Ins(1,4,5P3 and diacylglycerol (DAG. These messengers then promote the activation of protein kinase C and release of Ca2 from intracellular stores, initiating numerous cellular events including proliferation, differentiation, signal transduction, endocytosis, cytoskeletal reorganization or activation of ion channels. There have been identified 14 isozymes of PLC among which PLCγ1 and PLCγ2 are of particular interest. PLC contains catalytic region XY and a few regulatory domains: PH, EF and C2. The most unique features of these two enzymes are the Src homology domains (SH2, SH3 and split PH domain within the catalytic barrel. PLC1 and PLCγ2 have an identical domain structure, but they differ in their function and occurrence. Phospholipase Cγ1 is expressed ubiquitously, especially in the brain, thymus and lungs.PLCγ1 can be activated by receptor tyrosine kinases (i.e.: PDGFR, EGFR, FGFR, Trk, as well as non-receptor protein kinases (Src, Syk, Tec or phosphatidic acid, tau protein and its analogue.The molecular mechanism of PLCγ1 activation includes membrane recruitment, phosphorylation, rearrangements and activation in the presence of growth factors.In reference to PLCγ1 regulation, a number of positive and negative modulators have been considered. The most important positive modulator is phosphatidylinositol-3,4,5-trisphosphate (PI(3,4,5P2. Protein kinase A and C, tyrosine phosphatases (SHP-1, PTP-1B and Cbl, Grb2, Jak2/PTP-1B complex proteins have been described as negative regulators of PLCγ1 activation.

  15. Optimal design of an alignment-free two-DOF rehabilitation robot for the shoulder complex.

    Science.gov (United States)

    Galinski, Daniel; Sapin, Julien; Dehez, Bruno

    2013-06-01

    This paper presents the optimal design of an alignment-free exoskeleton for the rehabilitation of the shoulder complex. This robot structure is constituted of two actuated joints and is linked to the arm through passive degrees of freedom (DOFs) to drive the flexion-extension and abduction-adduction movements of the upper arm. The optimal design of this structure is performed through two steps. The first step is a multi-objective optimization process aiming to find the best parameters characterizing the robot and its position relative to the patient. The second step is a comparison process aiming to select the best solution from the optimization results on the basis of several criteria related to practical considerations. The optimal design process leads to a solution outperforming an existing solution on aspects as kinematics or ergonomics while being more simple.

  16. Protein Profiling Reveals Novel Proteins in Pollen and Pistil of W22 (ga1; Ga1 in Maize

    Directory of Open Access Journals (Sweden)

    Jin Yu

    2014-05-01

    Full Text Available Gametophytic factors mediate pollen-pistil interactions in maize (Zea mays L. and play active roles in limiting gene flow among maize populations and between maize and teosinte. This study was carried out to identify proteins and investigate the mechanism of gametophytic factors using protein analysis. W22 (ga1; which did not carry a gametophytic factor and W22 (Ga1, a near iso-genic line, were used for the proteome investigation. SDS-PAGE was executed to investigate proteins in the pollen and pistil of W22 (ga1 and W22 (Ga1. A total of 44 differentially expressed proteins were identified in the pollen and pistil on SDS-PAGE using LTQ-FTICR MS. Among the 44 proteins, a total of 24 proteins were identified in the pollen of W22 (ga1 and W22 (Ga1 whereas 20 differentially expressed proteins were identified from the pistil of W22 (ga1 and W22 (Ga1. However, in pollen, 2 proteins were identified only in the W22 (ga1 and 12 proteins only in the W22 (Ga1 whereas 10 proteins were confirmed from the both of W22 (ga1 and W22 (Ga1. In contrary, 10 proteins were appeared only in the pistil of W22 (ga1 and 7 proteins from W22 (Ga1 while 3 proteins confirmed in the both of W22 (ga1 and W22 (Ga1. Moreover, the identified proteins were generally involved in hydrolase activity, nucleic acid binding and nucleotide binding. These results help to reveal the mechanism of gametophytic factors and provide a valuable clue for the pollen and pistil research in maize.

  17. Insulin-sensitive phospholipid signaling systems and glucose transport. Update II.

    Science.gov (United States)

    Farese, R V

    2001-04-01

    Insulin provokes rapid changes in phospholipid metabolism and thereby generates biologically active lipids that serve as intracellular signaling factors that regulate glucose transport and glycogen synthesis. These changes include: (i) activation of phosphatidylinositol 3-kinase (PI3K) and production of PIP3; (ii) PIP3-dependent activation of atypical protein kinase Cs (PKCs); (iii) PIP3-dependent activation of PKB; (iv) PI3K-dependent activation of phospholipase D and hydrolysis of phosphatidylcholine with subsequent increases in phosphatidic acid (PA) and diacylglycerol (DAG); (v) PI3K-independent activation of glycerol-3-phosphate acylytansferase and increases in de novo synthesis of PA and DAG; and (vi) activation of DAG-sensitive PKCs. Recent findings suggest that atypical PKCs and PKB serve as important positive regulators of insulin-stimulated glucose metabolism, whereas mechanisms that result in the activation of DAG-sensitive PKCs serve mainly as negative regulators of insulin signaling through PI3K. Atypical PKCs and PKB are rapidly activated by insulin in adipocytes, liver, skeletal muscles, and other cell types by a mechanism requiring PI3K and its downstream effector, 3-phosphoinositide-dependent protein kinase-1 (PDK-1), which, in conjunction with PIP3, phosphorylates critical threonine residues in the activation loops of atypical PKCs and PKB. PIP3 also promotes increases in autophosphorylation and allosteric activation of atypical PKCs. Atypical PKCs and perhaps PKB appear to be required for insulin-induced translocation of the GLUT 4 glucose transporter to the plasma membrane and subsequent glucose transport. PKB also appears to be the major regulator of glycogen synthase. Together, atypical PKCs and PKB serve as a potent, integrated PI3K/PDK-1-directed signaling system that is used by insulin to regulate glucose metabolism.

  18. Analysis and experiments of a novel and compact 3-DOF precision positioning platform

    International Nuclear Information System (INIS)

    Huang, Hu; Zhao, Hongwei; Fan, Zunqiang; Zhang, Hui; Ma, Zhichao; Yang, Zhaojun

    2013-01-01

    A novel 3-DOF precision positioning platform with dimensions of 48 mm X 50 mm X 35 mm was designed by integrating piezo actuators and flexure hinges. The platform has a compact structure but it can do high precision positioning in three axes. The dynamic model of the platform in a single direction was established. Stiffness of the flexure hinges and modal characteristics of the flexure hinge mechanism were analyzed by the finite element method. Output displacements of the platform along three axes were forecasted via stiffness analysis. Output performance of the platform in x and y axes with open-loop control as well as the z-axis with closed-loop control was tested and discussed. The preliminary application of the platform in the field of nanoindentation indicates that the designed platform works well during nanoindentation tests, and the closed-loop control ensures the linear displacement output. With suitable control, the platform has the potential to realize different positioning functions under various working conditions.

  19. Investigation for Synchronization of a Rotor-Pendulum System considering the Multi-DOF Vibration

    Directory of Open Access Journals (Sweden)

    Yongjun Hou

    2016-01-01

    Full Text Available This work is a continuation for our published literature for vibration synchronization. A new mechanism, two rotors coupled with a pendulum rod in a multi-DOF vibration system, is proposed to implement coupling synchronization, and the dynamics equation of mechanism is derived by Lagrange equation. In addition, the coupling relationship between the vibrobody and the pendulum rod is ascertained with the Laplace transformation method, based on the dimensionless equation of the dynamics system. The Poincare method is employed to study the synchronization state between the two unbalanced rotors, which is converted into that of existence and the stability of solutions for synchronization-balance equations. The obtained results are supported by computer simulations. It is demonstrated that the values of the spring stiffness coefficient, the length of the pendulum, and the angular installation of the pendulum are important parameters with respect to the synchronous behavior in the rotor-pendulum system.

  20. Multidrug resistance-associated protein-1 (MRP1 genetic variants, MRP1 protein levels and severity of COPD

    Directory of Open Access Journals (Sweden)

    Rutgers Bea

    2010-05-01

    Full Text Available Abstract Background Multidrug resistance-associated protein-1 (MRP1 protects against oxidative stress and toxic compounds generated by cigarette smoking, which is the main risk factor for chronic obstructive pulmonary disease (COPD. We have previously shown that single nucleotide polymorphisms (SNPs in MRP1 significantly associate with level of FEV1 in two independent population based cohorts. The aim of our study was to assess the associations of MRP1 SNPs with FEV1 level, MRP1 protein levels and inflammatory markers in bronchial biopsies and sputum of COPD patients. Methods Five SNPs (rs212093, rs4148382, rs504348, rs4781699, rs35621 in MRP1 were genotyped in 110 COPD patients. The effects of MRP1 SNPs were analyzed using linear regression models. Results One SNP, rs212093 was significantly associated with a higher FEV1 level and less airway wall inflammation. Another SNP, rs4148382 was significantly associated with a lower FEV1 level, higher number of inflammatory cells in induced sputum and with a higher MRP1 protein level in bronchial biopsies. Conclusions This is the first study linking MRP1 SNPs with lung function and inflammatory markers in COPD patients, suggesting a role of MRP1 SNPs in the severity of COPD in addition to their association with MRP1 protein level in bronchial biopsies.

  1. Five-DOF innovative linear MagLev slider to account for pitch, tilt and load uncertainty

    Science.gov (United States)

    Kao, Yi-Ming; Tsai, Nan-Chyuan; Chiu, Hsin-Lin

    2017-02-01

    This paper is focused at position deviation regulation upon a slider by Fuzzy Sliding Mode Control (FSMC). Five Degrees Of Freedom (DOF) of position deviation are required to be regulated except for the direction (i.e., X-axis) in which the slider moves forward and backward. Totally 8 sets of Magnetic Actuators (MAs) and an Electro-Pneumatic Transducer (EPT) are employed to drive the slider carrying loads under the commands of FSMC. EPT is applied to adjust the pressure of compressed air to counterbalance the weight of slider itself. At first, the system dynamic model of slider, including load uncertainty and load position uncertainty, is established. Intensive computer simulations are undertaken to verify the validity of proposed control strategy. Finally, a prototype of realistic slider position deviation regulation system is successfully built up. According to the experiments by cooperation of pneumatic and magnetic control, the actual linear position deviations of slider can be regulated within ±8 μm and angular position deviations within ±1 mini-degrees. From the viewpoint of energy consumption, the applied currents to 8 sets of MAs are all below 1.2 A. To sum up, the closed-loop levitation system by cooperation of pneumatic and magnetic control is capable to account for load uncertainty and uncertainty of the standing position of load to be carried.

  2. Msp1 Is a Membrane Protein Dislocase for Tail-Anchored Proteins.

    Science.gov (United States)

    Wohlever, Matthew L; Mateja, Agnieszka; McGilvray, Philip T; Day, Kasey J; Keenan, Robert J

    2017-07-20

    Mislocalized tail-anchored (TA) proteins of the outer mitochondrial membrane are cleared by a newly identified quality control pathway involving the conserved eukaryotic protein Msp1 (ATAD1 in humans). Msp1 is a transmembrane AAA-ATPase, but its role in TA protein clearance is not known. Here, using purified components reconstituted into proteoliposomes, we show that Msp1 is both necessary and sufficient to drive the ATP-dependent extraction of TA proteins from the membrane. A crystal structure of the Msp1 cytosolic region modeled into a ring hexamer suggests that active Msp1 contains a conserved membrane-facing surface adjacent to a central pore. Structure-guided mutagenesis of the pore residues shows that they are critical for TA protein extraction in vitro and for functional complementation of an msp1 deletion in yeast. Together, these data provide a molecular framework for Msp1-dependent extraction of mislocalized TA proteins from the outer mitochondrial membrane. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Identification of the gene for disaggregatase from Methanosarcina mazei

    Directory of Open Access Journals (Sweden)

    Naoki Osumi

    2008-01-01

    Full Text Available The gene sequences encoding disaggregatase (Dag, the enzyme responsible for dispersion of cell aggregates of Methanosarcina mazei to single cells, were determined for three strains of M. mazei (S-6T, LYC and TMA. The dag genes of the three strains were 3234 bp in length and had almost the same sequences with 97% amino acid sequence identities. Dag was predicted to comprise 1077 amino acid residues and to have a molecular mass of 120 kDa containing three repeats of the DNRLRE domain in the C terminus, which is specific to the genus Methanosarcina and may be responsible for structural organization and cell wall function. Recombinant Dag was overexpressed in Escherichia coli and preparations of the expressed protein exhibited enzymatic activity. The RT-PCR analysis showed that dag was transcribed to mRNA in M. mazei LYC and indicated that the gene was expressed in vivo. This is the first time the gene involved in the morphological change of Methanosarcina spp. from aggregate to single cells has been identified.

  4. Identification of the gene for disaggregatase from Methanosarcina mazei.

    Science.gov (United States)

    Osumi, Naoki; Kakehashi, Yoshihiro; Matsumoto, Shiho; Nagaoka, Kazunari; Sakai, Junichi; Miyashita, Kiyotaka; Kimura, Makoto; Asakawa, Susumu

    2008-12-01

    The gene sequences encoding disaggregatase (Dag), the enzyme responsible for dispersion of cell aggregates of Methanosarcina mazei to single cells, were determined for three strains of M. mazei (S-6(T), LYC and TMA). The dag genes of the three strains were 3234 bp in length and had almost the same sequences with 97% amino acid sequence identities. Dag was predicted to comprise 1077 amino acid residues and to have a molecular mass of 120 kDa containing three repeats of the DNRLRE domain in the C terminus, which is specific to the genus Methanosarcina and may be responsible for structural organization and cell wall function. Recombinant Dag was overexpressed in Escherichia coli and preparations of the expressed protein exhibited enzymatic activity. The RT-PCR analysis showed that dag was transcribed to mRNA in M. mazei LYC and indicated that the gene was expressed in vivo. This is the first time the gene involved in the morphological change of Methanosarcina spp. from aggregate to single cells has been identified.

  5. An Enhanced Intelligent Handheld Instrument with Visual Servo Control for 2-DOF Hand Motion Error Compensation

    Directory of Open Access Journals (Sweden)

    Yan Naing Aye

    2013-10-01

    Full Text Available The intelligent handheld instrument, ITrem2, enhances manual positioning accuracy by cancelling erroneous hand movements and, at the same time, provides automatic micromanipulation functions. Visual data is acquired from a high speed monovision camera attached to the optical surgical microscope and acceleration measurements are acquired from the inertial measurement unit (IMU on board ITrem2. Tremor estimation and canceling is implemented via Band-limited Multiple Fourier Linear Combiner (BMFLC filter. The piezoelectric actuated micromanipulator in ITrem2 generates the 3D motion to compensate erroneous hand motion. Preliminary bench-top 2-DOF experiments have been conducted. The error motions simulated by a motion stage is reduced by 67% for multiple frequency oscillatory motions and 56.16% for pre-conditioned recorded physiological tremor.

  6. Blood lipid-lowering and antioxidant effects of a structured lipid containing monoacylglyceride enriched with monounsaturated fatty acids in C57BL/6 mice.

    Science.gov (United States)

    Cho, Kyung-Hyun; Lee, Jeung-Hee; Kim, Jin-Man; Park, Sang Hyun; Choi, Myung-Sook; Lee, Yun-Mi; Choi, Inho; Lee, Ki-Teak

    2009-04-01

    We recently reported that a synthetic edible oil-containing monoacylglyceride (MAG) and diacylglyceride (DAG) exerted anti-atherosclerotic effects. In order to further investigate the activities and individual effects of MAG and DAG on the atherosclerotic process, we prepared a structured oil with various MAG and DAG contents and tested them both in vitro and in vivo, using C57BL/6 mice. The structured oil to be tested was mixed (final concentration 5%, wt/wt) with a high-cholesterol high-fat diet (1.2% cholesterol/15% fat/0.5% sodium cholate) and provided to the mice for 7 weeks. After administration, the mice consuming MAG97%-oil and DAG50%/MAG10%-oil evidenced 17% and 24% decreases in plasma total cholesterol (TC) level, respectively, as compared to a group of mice fed on lard. The experimental mice also had reduced plasma triglyceride concentrations and elevated high-density lipoprotein-cholesterol to TC ratios, by up to 31% in the case of the DAG50%/MAG10%-oil fed mice. The mice fed on MAG97%-oil exhibited elevated plasma antioxidant activity and lecithin:cholesterol acyltransferase activity. Histological assessments of the livers of the mice showed that the consumption of MAG-containing oil attenuated the adhesion of inflammatory cells and also ameliorated fatty liver changes, as compared to what was observed in the case of DAG85%-oil consumption. In conclusion, the MAG-containing oil exhibited anti-inflammatory and antioxidant activities in vivo, as well as in vitro inhibitory activity against human cholesteryl ester transfer protein. These results provide us with new insights into MAG-containing oil in terms of hypocholesterolemic effects and antioxidant activities.

  7. Characterization of acyl-coenzyme A:diacylglycerol acyltransferase (DGAT) enzyme of human small intestine.

    Science.gov (United States)

    Hiramine, Yasushi; Tanabe, Toshizumi

    2011-06-01

    Acyl-coenzyme A:diacylglycerol acyltransferase (DGAT) enzyme plays a significant role in dietary triacylglycerol (TAG) absorption in the small intestine. However, the characteristics of human intestinal DGAT enzyme have not been examined in detail. The aim of our study was to characterize the human intestinal DGAT enzyme by examining acyl-CoA specificity, temperature dependency, and selectivity for 1,2-diacylglycerol (DAG) or 1,3-DAG. We detected DGAT activity of human intestinal microsome and found that the acyl-CoA specificity and temperature dependency of intestinal DGAT coincided with those of recombinant human DGAT1. To elucidate the selectivity of human intestinal DGAT to 1,2-DAG or 1,3-DAG, we conducted acyl-coenzyme A:monoacylglycerol acyltransferase assays using 1- or 2-monoacylglycerol (MAG) as substrates. When 2-MAG was used as acyl acceptor, both 1,2-DAG and TAG were generated; however, when 1-MAG was used, 1,3-DAG was predominantly observed and little TAG was detected. These findings suggest that human small intestinal DGAT, which is mainly encoded by DGAT1, utilizes 1,2-DAG as the substrate to form TAG. This study will contribute to understand the lipid absorption profile in the small intestine.

  8. Model remediation of contaminated sites as illustrated by the example of the TNT-remediation project Stadtallendorf, Hessen, Germany. Part 1: Final report; Part 2: Documentation and balancing of the measures; Part 3: Documentation of citizens' participation and public relations activities in Stadtallendorf; Modellhafte Sanierung von Altlasten am Beispiel des TNT-Sanierungsprojektes Stadtallendorf/Hessen. T. 1: Abschlussbericht. T. 2: Dokumentation und Bilanzierung von Auswirkungen der Sanierung. T. 3: Dokumentation der Buergerbeteiligung und Oeffentlichkeitsarbeit in Stadtallendorf

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-07-01

    The project comprised the following stages: 1. Development of a technology for purification of soils contaminated with explosives. The process comprised soil washing, hot steam treatment, and thermal treatment of residues; 2. Projecting, construction and two years of operation of a soil purification plant with a rated throughput of 20 t/h and a total throughput of 130,000 t; 3. Remediation of two representative sites on DAG terrain (TNT production chain and filling stations); 4. Verification of the findings in an accompanying scientific programme. The site under investigation was formerly occupied by the Dynamit AG (DAG) Stadtallendorf, where TNT, contaminated waste water and acids were produced, and contamination levels were high in several areas. Today, the area is a residential area. In addition to the investigations described here, the waste water discharge system of the DAG was modernized. [German] Das FuE-Vorhaben Stadtallendorf wurde mit folgender Zielsetzung begonnen: (1) Entwicklung einer geeigneten und moeglichst umweltvertraeglichen Technik zur Reinigung von Boeden mit sprengstoffspezifischen Kontaminationen; hierzu wurde in Anlehnung an die Ausschreibung des Bundes ein kombiniertes Bodenbehandlungsverfahren vorgesehen, das aus folgenden Komponenten bestand: - Bodenwaesche, - Heissdampfbehandlung, - Thermische Reststoffbehandlung. (2) Planung, Bau und zweijaehriger Betrieb einer entsprechenden grosstechnischen Bodenreinigungsanlage (Nenndurchsatz von 20 t/Stunde; Gesamtdurchsatz 130.000 t). (3) Bodensanierung von zwei repraesentativen Arealen im DAG-Gelaende (TNT-Produktionskette und Fuellstellenbetrieb). (4) Absicherung der Ergebnisse in einem wissenschaftlichen Begleitprogramm. Gegenstand der Phase 2 des Vorhabens war der vollstaendige Prozess der Planung und Umsetzung der Sanierung eines (Teils eines) Planungsraumes des Ruestungsaltstandortes Dynamit AG (DAG) Stadtallendorf. Es handelte sich dabei um einen Bereich, der als Standort fuer TNT

  9. Protein: MPA1 [TP Atlas

    Lifescience Database Archive (English)

    Full Text Available MPA1 TLR signaling molecules Rsad2 Vig1 Radical S-adenosyl methionine domain-containing pr...otein 2 Viperin, Virus inhibitory protein, endoplasmic reticulum-associated, interferon-inducible 10090 Mus musculus 58185 Q8CBB9 21435586 ...

  10. Sensor module design and forward and inverse kinematics analysis of 6-DOF sorting transferring robot

    Science.gov (United States)

    Zhou, Huiying; Lin, Jiajian; Liu, Lei; Tao, Meng

    2017-09-01

    To meet the demand of high strength express sorting, it is significant to design a robot with multiple degrees of freedom that can sort and transfer. This paper uses infrared sensor, color sensor and pressure sensor to receive external information, combine the plan of motion path in advance and the feedback information from the sensors, then write relevant program. In accordance with these, we can design a 6-DOF robot that can realize multi-angle seizing. In order to obtain characteristics of forward and inverse kinematics, this paper describes the coordinate directions and pose estimation by the D-H parameter method and closed solution. On the basis of the solution of forward and inverse kinematics, geometric parameters of links and link parameters are optimized in terms of application requirements. In this way, this robot can identify route, sort and transfer.

  11. A fuzzy PID-controlled SMA actuator for a two-DOF joint

    Directory of Open Access Journals (Sweden)

    Shi Zhenyun

    2014-04-01

    Full Text Available Shape memory alloy (SMA actuator is a potential advanced component for servo-systems of aerospace vehicles and aircraft. This paper presents a joint with two degrees of freedom (DOF and a mobility range close to ±60° when driven by SMA triple wires. The fuzzy proportional-integral-derivative (PID-controlled actuator drive was designed using antagonistic SMA triple wires, and the resistance feedback signal made a closed loop. Experiments showed that, with the driving responding frequency increasing, the overstress became harder to be avoided at the position under the maximum friction force. Furthermore, the hysteresis gap between the heating and cooling paths of the strain-to-resistance curve expanded under this condition. A fuzzy logic control was considered as a solution, and the curves of the wires were then modeled by fitting polynomials so that the measured resistance was used directly to determine the control signal. Accurate control was demonstrated through the step response, and the experimental results showed that under the fuzzy PID-control program, the mean absolute error (MAE of the rotation angle was about 3.147°. In addition, the investigation of the external interference to the system proved the controllable maximum output.

  12. Design of a New 4-DOF Haptic Master Featuring Magnetorheological Fluid

    Directory of Open Access Journals (Sweden)

    Byung-Keun Song

    2014-08-01

    Full Text Available This work presents a novel 4-degree-of-freedom (4-DOF haptic master using magnetorheological (MR fluid which is applicable to a robot-assisted minimally invasive surgery (RMIS system. By using MR fluid, the proposed haptic device can easily generate bidirectional repulsive torque along the directions of the required motions. The proposed master consists of two actuators: an MR bidirectional clutch associated with a planetary gear system and an MR clutch with a bevel gear system. After demonstrating the configuration, the torque models of MR actuators are mathematically derived based on the field-dependent Bingham model. An optimal design that accounts for spatial-limitation and the desired torque constraint is then undertaken. An optimization procedure based on finite element analysis is proposed to determine optimal geometric dimensions. Based on the design procedure, MR haptic master with the optimal parameters has been manufactured. In order to demonstrate the practical feasibility of the proposed haptic master, the field-dependent generating repulsive force is measured. In addition, a proportional-integral-derivative (PID controller is empirically implemented to accomplish the desired torque trajectories. It has been shown that the proposed haptic master can track the desired torque trajectory without a significant error.

  13. The Copper Metabolism MURR1 Domain protein 1 (COMMD1) modulates the aggregation of misfolded protein species in a client-specific manner

    NARCIS (Netherlands)

    W.I.M. Vonk (Willianne I.); V. Kakkar (Vaishali); P. Bartuzi (Paulina); D. Jaarsma (Dick); R. Berger (Ruud); M.A. Hofker (Marten); L.W.J. Klomp (Leo W.); C. Wijmenga (Cisca); H. Kampinga (Harm); B. van de Sluis (Bart)

    2014-01-01

    textabstractThe Copper Metabolism MURR1 domain protein 1 (COMMD1) is a protein involved in multiple cellular pathways, including copper homeostasis, NF-κB and hypoxia signalling. Acting as a scaffold protein, COMMD1 mediates the levels, stability and proteolysis of its substrates (e.g. the

  14. Synchronization of multiple 3-DOF helicopters under actuator faults and saturations with prescribed performance.

    Science.gov (United States)

    Yang, Huiliao; Jiang, Bin; Yang, Hao; Liu, Hugh H T

    2018-04-01

    The distributed cooperative control strategy is proposed to make the networked nonlinear 3-DOF helicopters achieve the attitude synchronization in the presence of actuator faults and saturations. Based on robust adaptive control, the proposed control method can both compensate the uncertain partial loss of control effectiveness and deal with the system uncertainties. To address actuator saturation problem, the control scheme is designed to ensure that the saturation constraint on the actuation will not be violated during the operation in spite of the actuator faults. It is shown that with the proposed control strategy, both the tracking errors of the leading helicopter and the attitude synchronization errors of each following helicopter are bounded in the existence of faulty actuators and actuator saturations. Moreover, the state responses of the entire group would not exceed the predesigned performance functions which are totally independent from the underlaying interaction topology. Simulation results illustrate the effectiveness of the proposed control scheme. Copyright © 2018 ISA. Published by Elsevier Ltd. All rights reserved.

  15. Thioredoxin 1 regulation of protein S-desulfhydration

    Directory of Open Access Journals (Sweden)

    Youngjun Ju

    2016-03-01

    Full Text Available The importance of H2S in biology and medicine has been widely recognized in recent years, and protein S-sulfhydration is proposed to mediate the direct actions of H2S bioactivity in the body. Thioredoxin 1 (Trx1 is an important reducing enzyme that cleaves disulfides in proteins and acts as an S-denitrosylase. The regulation of Trx1 on protein S-sulfhydration is unclear. Here we showed that Trx1 facilitates protein S-desulfhydration. Overexpression of Trx1 attenuated the basal level and H2S-induced protein S-sulfhydration by direct interaction with S-sulfhydrated proteins, i.e., glyceraldehyde 3-phosphate dehydrogenase and pyruvate carboxylase. In contrast, knockdown of Trx1 mRNA expression by short interfering RNA or blockage of Trx1 redox activity with PX12 or 2,4-dinitrochlorobenzene enhanced protein S-sulfhydration. Mutation of cysteine-32 but not cysteine-35 in the Trp–Cys32–Gly–Pro–Cys35 motif eliminated the binding of Trx1 with S-sulfhydrated proteins and abolished the S-desulfhydrating effect of Trx1. All these data suggest that Trx1 acts as an S-desulfhydrase.

  16. Diacylglycerol kinase regulation of protein kinase D during oxidative stress-induced intestinal cell injury

    International Nuclear Information System (INIS)

    Song Jun; Li Jing; Mourot, Joshua M.; Mark Evers, B.; Chung, Dai H.

    2008-01-01

    We recently demonstrated that protein kinase D (PKD) exerts a protective function during oxidative stress-induced intestinal epithelial cell injury; however, the exact role of DAG kinase (DGK)ζ, an isoform expressed in intestine, during this process is unknown. We sought to determine the role of DGK during oxidative stress-induced intestinal cell injury and whether DGK acts as an upstream regulator of PKD. Inhibition of DGK with R59022 compound or DGKζ siRNA transfection decreased H 2 O 2 -induced RIE-1 cell apoptosis as measured by DNA fragmentation and increased PKD phosphorylation. Overexpression of kinase-dead DGKζ also significantly increased PKD phosphorylation. Additionally, endogenous nuclear DGKζ rapidly translocated to the cytoplasm following H 2 O 2 treatment. Our findings demonstrate that DGK is involved in the regulation of oxidative stress-induced intestinal cell injury. PKD activation is induced by DGKζ, suggesting DGK is an upstream regulator of oxidative stress-induced activation of the PKD signaling pathway in intestinal epithelial cells

  17. Duplication of the dystroglycan gene in most branches of teleost fish

    Directory of Open Access Journals (Sweden)

    Giardina Bruno

    2007-05-01

    Full Text Available Abstract Background The dystroglycan (DG complex is a major non-integrin cell adhesion system whose multiple biological roles involve, among others, skeletal muscle stability, embryonic development and synapse maturation. DG is composed of two subunits: α-DG, extracellular and highly glycosylated, and the transmembrane β-DG, linking the cytoskeleton to the surrounding basement membrane in a wide variety of tissues. A single copy of the DG gene (DAG1 has been identified so far in humans and other mammals, encoding for a precursor protein which is post-translationally cleaved to liberate the two DG subunits. Similarly, D. rerio (zebrafish seems to have a single copy of DAG1, whose removal was shown to cause a severe dystrophic phenotype in adult animals, although it is known that during evolution, due to a whole genome duplication (WGD event, many teleost fish acquired multiple copies of several genes (paralogues. Results Data mining of pufferfish (T. nigroviridis and T. rubripes and other teleost fish (O. latipes and G. aculeatus available nucleotide sequences revealed the presence of two functional paralogous DG sequences. RT-PCR analysis proved that both the DG sequences are transcribed in T. nigroviridis. One of the two DG sequences harbours an additional mini-intronic sequence, 137 bp long, interrupting the uncomplicated exon-intron-exon pattern displayed by DAG1 in mammals and D. rerio. A similar scenario emerged also in D. labrax (sea bass, from whose genome we have cloned and sequenced a new DG sequence that also harbours a shorter additional intronic sequence of 116 bp. Western blot analysis confirmed the presence of DG protein products in all the species analysed including two teleost Antarctic species (T. bernacchii and C. hamatus. Conclusion Our evolutionary analysis has shown that the whole-genome duplication event in the Class Actinopterygii (ray-finned fish involved also DAG1. We unravelled new important molecular genetic details

  18. Dual Role of Ancient Ubiquitous Protein 1 (AUP1) in Lipid Droplet Accumulation and Endoplasmic Reticulum (ER) Protein Quality Control

    OpenAIRE

    Klemm, Elizabeth J.; Spooner, Eric; Ploegh, Hidde L.

    2011-01-01

    Quality control of endoplasmic reticulum proteins involves the identification and engagement of misfolded proteins, dislocation of the misfolded protein across the endoplasmic reticulum (ER) membrane, and ubiquitin-mediated targeting to the proteasome for degradation. Ancient ubiquitous protein 1 (AUP1) physically associates with the mammalian HRD1-SEL1L complex, and AUP1 depletion impairs degradation of misfolded ER proteins. One of the functions of AUP1 in ER quality control is to recruit t...

  19. Metabolism of sn-1(3)-Monoacylglycerol and sn-2-Monoacylglycerol in Caecal Enterocytes and Hepatocytes of Brown Trout (Salmo trutta).

    Science.gov (United States)

    Li, Keshuai; Olsen, Rolf Erik

    2017-01-01

    sn-2-Monoacylglycerol (2-MAG) and sn-1(3)-monoacylglycerol [1(3)-MAG] are important but yet little studied intermediates in lipid metabolism. The current study compared the metabolic fate of 2-MAG and 1(3)-MAG in isolated caecal enterocytes and hepatocytes of brown trout (Salmo trutta). 1(3)-Oleoyl [9,10-3H(N)]-glycerol and 2-Oleoyl [9,10-3H(N)]-glycerol were prepared by pancreatic lipase digestion of triolein [9,10-3H(N)]. The 1(3)-MAG and 2-MAG were efficiently absorbed by enterocytes and hepatocytes at similar rates. The 2-MAG was quickly resynthesized into TAG through the monoacylglycerol acyltransferase (EC: 2.3.1.22, MGAT) pathway in both tissues, whereas 1(3)-MAG was processed into TAG and phospholipids at a much slower rate, suggesting 2-MAG was the preferred substrates for MGAT. Further analysis showed that 1(3)-MAG was synthesized into 1,3-DAG, but there were no accumulation of 1,3-DAG in either enterocytes or hepatocytes, which contrasts that of mammalian studies. Some of the 1(3)-MAG may be acylated to 1,2(2,3)-DAG and then utilized for TAG synthesis. Alternatively, 1(3)-MAG can be hydrolyzed to free fatty acid and glycerol, and re-synthesized into TAG through the glycerol-3-phosphate (Gro-3-P) pathway. The overall data suggested that the limiting step of the intracellular 1(3)-MAG metabolism is the conversion of 1(3)-MAG itself.

  20. The heterotrimeric G protein1 interacts with the catalytic subunit of protein phosphatase 1 and modulates G protein-coupled receptor signaling in platelets.

    Science.gov (United States)

    Pradhan, Subhashree; Khatlani, Tanvir; Nairn, Angus C; Vijayan, K Vinod

    2017-08-11

    Thrombosis is caused by the activation of platelets at the site of ruptured atherosclerotic plaques. This activation involves engagement of G protein-coupled receptors (GPCR) on platelets that promote their aggregation. Although it is known that protein kinases and phosphatases modulate GPCR signaling, how serine/threonine phosphatases integrate with G protein signaling pathways is less understood. Because the subcellular localization and substrate specificity of the catalytic subunit of protein phosphatase 1 (PP1c) is dictated by PP1c-interacting proteins, here we sought to identify new PP1c interactors. GPCRs signal via the canonical heterotrimeric Gα and Gβγ subunits. Using a yeast two-hybrid screen, we discovered an interaction between PP1cα and the heterotrimeric G protein1 subunit. Co-immunoprecipitation studies with epitope-tagged PP1c and Gβ 1 revealed that Gβ 1 interacts with the PP1c α, β, and γ1 isoforms. Purified PP1c bound to recombinant Gβ 1 -GST protein, and PP1c co-immunoprecipitated with Gβ 1 in unstimulated platelets. Thrombin stimulation of platelets induced the dissociation of the PP1c-Gβ 1 complex, which correlated with an association of PP1c with phospholipase C β3 (PLCβ3), along with a concomitant dephosphorylation of the inhibitory Ser 1105 residue in PLCβ3. siRNA-mediated depletion of GNB1 (encoding Gβ 1 ) in murine megakaryocytes reduced protease-activated receptor 4, activating peptide-induced soluble fibrinogen binding. Thrombin-induced aggregation was decreased in PP1cα -/- murine platelets and in human platelets treated with a small-molecule inhibitor of Gβγ. Finally, disruption of PP1c-Gβ 1 complexes with myristoylated Gβ 1 peptides containing the PP1c binding site moderately decreased thrombin-induced human platelet aggregation. These findings suggest that Gβ 1 protein enlists PP1c to modulate GPCR signaling in platelets.

  1. Glycosylation analysis and protein structure determination of murine fetal antigen 1 (mFA1)--the circulating gene product of the delta-like protein (dlk), preadipocyte factor 1 (Pref-1) and stromal-cell-derived protein 1 (SCP-1) cDNAs

    DEFF Research Database (Denmark)

    Krogh, T N; Bachmann, E; Teisner, B

    1997-01-01

    By means of sequence analysis, murine fetal antigen 1 (mFA1) isolated from Mus musculus amniotic fluid was shown to be the circulating protein of the delta-like protein, stromal-cell-derived protein 1 (SCP-1) and preadipocyte factor 1 (Pref-1) gene products. The protein contains 36 cysteine...... residues arranged in six epidermal-growth-factor-like domains. The purification of several C-terminal peptides of varying lengths showed mFA1 to be C-terminal heterogeneous. O-linked glycosylations of the NeuNAc alpha2-3Gal beta1-3(NeuNAc alpha2-6)GalNAc type were present on all C-terminal peptides...... at residues Thr235, Thr244 and Thr248, although glycosylation on Thr244 was only partial. Three N-linked glycosylations were localized in mFA1 (Asn77, Asn142 and Asn151), two of which (Asn142 and Asn151) were in the unusual Asn-Xaa-Cys motif. Fucosylated biantennary complex-type and small amounts (less than 5...

  2. Identification of Open Stomata1-Interacting Proteins Reveals Interactions with Sucrose Non-fermenting1-Related Protein Kinases2 and with Type 2A Protein Phosphatases That Function in Abscisic Acid Responses1[OPEN

    Science.gov (United States)

    Waadt, Rainer; Manalansan, Bianca; Rauniyar, Navin; Munemasa, Shintaro; Booker, Matthew A.; Brandt, Benjamin; Waadt, Christian; Nusinow, Dmitri A.; Kay, Steve A.; Kunz, Hans-Henning; Schumacher, Karin; DeLong, Alison; Yates, John R.; Schroeder, Julian I.

    2015-01-01

    The plant hormone abscisic acid (ABA) controls growth and development and regulates plant water status through an established signaling pathway. In the presence of ABA, pyrabactin resistance/regulatory component of ABA receptor proteins inhibit type 2C protein phosphatases (PP2Cs). This, in turn, enables the activation of Sucrose Nonfermenting1-Related Protein Kinases2 (SnRK2). Open Stomata1 (OST1)/SnRK2.6/SRK2E is a major SnRK2-type protein kinase responsible for mediating ABA responses. Arabidopsis (Arabidopsis thaliana) expressing an epitope-tagged OST1 in the recessive ost1-3 mutant background was used for the copurification and identification of OST1-interacting proteins after osmotic stress and ABA treatments. These analyses, which were confirmed using bimolecular fluorescence complementation and coimmunoprecipitation, unexpectedly revealed homo- and heteromerization of OST1 with SnRK2.2, SnRK2.3, OST1, and SnRK2.8. Furthermore, several OST1-complexed proteins were identified as type 2A protein phosphatase (PP2A) subunits and as proteins involved in lipid and galactolipid metabolism. More detailed analyses suggested an interaction network between ABA-activated SnRK2-type protein kinases and several PP2A-type protein phosphatase regulatory subunits. pp2a double mutants exhibited a reduced sensitivity to ABA during seed germination and stomatal closure and an enhanced ABA sensitivity in root growth regulation. These analyses add PP2A-type protein phosphatases as another class of protein phosphatases to the interaction network of SnRK2-type protein kinases. PMID:26175513

  3. Two improvements on numerical simulation of 2-DOF vortex-induced vibration with low mass ratio

    Science.gov (United States)

    Kang, Zhuang; Ni, Wen-chi; Zhang, Xu; Sun, Li-ping

    2017-12-01

    Till now, there have been lots of researches on numerical simulation of vortex-induced vibration. Acceptable results have been obtained for fixed cylinders with low Reynolds number. However, for responses of 2-DOF vortex-induced vibration with low mass ratio, the accuracy is not satisfactory, especially for the maximum amplitudes. In Jauvtis and Williamson's work, the maximum amplitude of the cylinder with low mass ratio m*=2.6 can reach as large as 1.5 D to be called as the "super-upper branch", but from current literatures, few simulation results can achieve such value, even fail to capture the upper branch. Besides, it is found that the amplitude decays too fast in the lower branch with the RANS-based turbulence model. The reason is likely to be the defects of the turbulence model itself in the prediction of unsteady separated flows as well as the unreasonable setting of the numerical simulation parameters. Aiming at above issues, a modified turbulence model is proposed in this paper, and the effect of the acceleration of flow field on the response of vortex-induced vibration is studied based on OpenFOAM. By analyzing the responses of amplitude, phase and trajectory, frequency and vortex mode, it is proved that the vortex-induced vibration can be predicted accurately with the modified turbulence model under appropriate flow field acceleration.

  4. Identification of structural protein-protein interactions of herpes simplex virus type 1.

    Science.gov (United States)

    Lee, Jin H; Vittone, Valerio; Diefenbach, Eve; Cunningham, Anthony L; Diefenbach, Russell J

    2008-09-01

    In this study we have defined protein-protein interactions between the structural proteins of herpes simplex virus type 1 (HSV-1) using a LexA yeast two-hybrid system. The majority of the capsid, tegument and envelope proteins of HSV-1 were screened in a matrix approach. A total of 40 binary interactions were detected including 9 out of 10 previously identified tegument-tegument interactions (Vittone, V., Diefenbach, E., Triffett, D., Douglas, M.W., Cunningham, A.L., and Diefenbach, R.J., 2005. Determination of interactions between tegument proteins of herpes simplex virus type 1. J. Virol. 79, 9566-9571). A total of 12 interactions involving the capsid protein pUL35 (VP26) and 11 interactions involving the tegument protein pUL46 (VP11/12) were identified. The most significant novel interactions detected in this study, which are likely to play a role in viral assembly, include pUL35-pUL37 (capsid-tegument), pUL46-pUL37 (tegument-tegument) and pUL49 (VP22)-pUS9 (tegument-envelope). This information will provide further insights into the pathways of HSV-1 assembly and the identified interactions are potential targets for new antiviral drugs.

  5. Dual Role of Ancient Ubiquitous Protein 1 (AUP1) in Lipid Droplet Accumulation and Endoplasmic Reticulum (ER) Protein Quality Control

    Science.gov (United States)

    Klemm, Elizabeth J.; Spooner, Eric; Ploegh, Hidde L.

    2011-01-01

    Quality control of endoplasmic reticulum proteins involves the identification and engagement of misfolded proteins, dislocation of the misfolded protein across the endoplasmic reticulum (ER) membrane, and ubiquitin-mediated targeting to the proteasome for degradation. Ancient ubiquitous protein 1 (AUP1) physically associates with the mammalian HRD1-SEL1L complex, and AUP1 depletion impairs degradation of misfolded ER proteins. One of the functions of AUP1 in ER quality control is to recruit the soluble E2 ubiquitin-conjugating enzyme UBE2G2. We further show that the CUE domain of AUP1 regulates polyubiquitylation and facilitates the interaction of AUP1 with the HRD1 complex and with dislocation substrates. AUP1 localizes both to the ER and to lipid droplets. The AUP1 expression level affects the abundance of cellular lipid droplets and as such represents the first protein with lipid droplet regulatory activity to be linked to ER quality control. These findings indicate a possible connection between ER protein quality control and lipid droplets. PMID:21857022

  6. Nonlinear Dynamics and Bifurcation Behavior of a 2-DOF Spring Resonator with End Stopper for Energy Harvesting

    Directory of Open Access Journals (Sweden)

    El Aroudi A.

    2014-01-01

    Full Text Available In this paper, the model of a two-degree-of-freedom (2-DOF spring resonator with end stopper for an energy harvesting application is presented. Then we characterize its nonlinear dynamical behavior by numerical simulations when some suitable parameters are varied. The system is formed by two resonators subject to external vibrational excitation and with an end stopper. We present the continuous time dynamical model of the system in the form of a switched fourth order differential equation. Harmonic vibrations are considered as the main ambient energy source for the system and its frequency response representing the RMS value of the displacement is first computed. The dynamical behavior is unveiled by computing state-space trajectories, timedomain series and FFT spectra and frequency response as the excitation amplitude is varied.

  7. Tumor protein 53-induced nuclear protein 1 (TP53INP1 enhances p53 function and represses tumorigenesis

    Directory of Open Access Journals (Sweden)

    Jeyran eShahbazi

    2013-05-01

    Full Text Available Tumor protein 53-induced nuclear protein 1 (TP53INP1 is a stress-induced p53 target gene whose expression is modulated by transcription factors such as p53, p73 and E2F1. TP53INP1 gene encodes two isoforms of TP53INP1 proteins, TP53INP1α and TP53INP1β, both of which appear to be key elements in p53 function. When associated with homeodomain-interacting protein kinase-2 (HIPK2, TP53INP1 phosphorylates p53 protein at Serine 46, enhances p53 protein stability and its transcriptional activity, leading to transcriptional activation of p53 target genes such as p21, PIG-3 and MDM2, cell growth arrest and apoptosis upon DNA damage stress. The anti-proliferative and pro-apoptotic activities of TP53INP1 indicate that TP53INP1 has an important role in cellular homeostasis and DNA damage response. Deficiency in TP53INP1 expression results in increased tumorigenesis; while TP53INP1 expression is repressed during early stages of cancer by factors such as miR-155. This review aims to summarize the roles of TP53INP1 in blocking tumor progression through p53-dependant and p53-independent pathways, as well as the elements which repress TP53INP1 expression, hence highlighting its potential as a therapeutic target in cancer treatment.

  8. Design of a 7-DOF haptic master using a magneto-rheological devices for robot surgery

    Science.gov (United States)

    Kang, Seok-Rae; Choi, Seung-Bok; Hwang, Yong-Hoon; Cha, Seung-Woo

    2017-04-01

    This paper presents a 7 degrees-of-freedom (7-DOF) haptic master which is applicable to the robot-assisted minimally invasive surgery (RMIS). By utilizing a controllable magneto-rheological (MR) fluid, the haptic master can provide force information to the surgeon during surgery. The proposed haptic master consists of three degrees motions of X, Y, Z and four degrees motions of the pitch, yaw, roll and grasping. All of them have force feedback capability. The proposed haptic master can generate the repulsive forces or torques by activating MR clutch and MR brake. Both MR clutch and MR brake are designed and manufactured with consideration of the size and output torque which is usable to the robotic surgery. A proportional-integral-derivative (PID) controller is then designed and implemented to achieve torque/force tracking trajectories. It is verified that the proposed haptic master can track well the desired torque and force occurred in the surgical place by controlling the input current applied to MR clutch and brake.

  9. Diabetes mellitus type 1

    OpenAIRE

    Desta, Semere Tekeste

    2017-01-01

    Høgskulen på Vestlandet Avdeling for helsefag for sykepleiere Tittel: Diabetes type 1 Bakgrunn for val av tema: I 2000 var det ca. 130 000 personer i Norge med diabetes, av disse hadde ca. 20 000 diabetes type 1. I dag er det ca. 230 000 personer som har diabetes i Norge. Av disse ca. 28 000 type 1 diabetes. Tallet viser hvor alvorlig sykdommen er, fordi det har vært og fortsatt er, en økning av antall diabetikere i Norge. Type 1 diabetes kan komme i alle aldersgrupper, men vanligvis...

  10. Carbon-11 labeled diacylglycerol for signal transduction imaging by positron CT. Evaluation of the quality and safety for clinical use

    Energy Technology Data Exchange (ETDEWEB)

    Fujii, Ryou [Nishijin Hospital, Kyoto (Japan); Imahori, Yoshio; Ido, Tatsuo [and others

    1995-02-01

    To elucidate the synaptic transmission in the neural system, we have been developing fundamental studies for intracellular signaling. For clinical application of carbon-11 labeled diacylglycerol (1-[1-{sup 11}C]butyryl-2-palmitoyl-rac-glycerol: {sup 11}C-DAG) using positron emission computed tomography (PET), we evaluated the quality and the safety of {sup 11}C-DAG as the solution for injection. As a result, {sup 11}C-DAG was synthesized within 50 minutes, including the preparation step for injection. The half life time and energy spectrum of {sup 11}C-DAG were the same as the physical character of carbon-11, and other radioisotopes were not detected. In the quality control, {sup 11}C-DAG solution was negative in the examination of bacterial contamination and the pyrogen test in three successive synthesis procedures. In the acute toxicity test by administration of {sup 11}C-DAG and 100 {mu}mol/kg of non-radioactive DAG to the rat intravenously, the systemic condition of the rat was not changed and no abnormalities were found in any organ 24 hours after administration. These findings indicated the safety of {sup 11}C-DAG solution. Clinical application of {sup 11}C-DAG using positron emission tomography may be useful to elucidate the dysfunction of intracellular signaling in disorders of higher cortical function such as Alzheimer disease. (author).

  11. Molecular characterization of a phloem-specific gene encoding the filament protein, phloem protein 1 (PP1), from Cucurbita maxima.

    Science.gov (United States)

    Clark, A M; Jacobsen, K R; Bostwick, D E; Dannenhoffer, J M; Skaggs, M I; Thompson, G A

    1997-07-01

    Sieve elements in the phloem of most angiosperms contain proteinaceous filaments and aggregates called P-protein. In the genus Cucurbita, these filaments are composed of two major proteins: PP1, the phloem filament protein, and PP2, the phloem lactin. The gene encoding the phloem filament protein in pumpkin (Cucurbita maxima Duch.) has been isolated and characterized. Nucleotide sequence analysis of the reconstructed gene gPP1 revealed a continuous 2430 bp protein coding sequence, with no introns, encoding an 809 amino acid polypeptide. The deduced polypeptide had characteristics of PP1 and contained a 15 amino acid sequence determined by N-terminal peptide sequence analysis of PP1. The sequence of PP1 was highly repetitive with four 200 amino acid sequence domains containing structural motifs in common with cysteine proteinase inhibitors. Expression of the PP1 gene was detected in roots, hypocotyls, cotyledons, stems, and leaves of pumpkin plants. PP1 and its mRNA accumulated in pumpkin hypocotyls during the period of rapid hypocotyl elongation after which mRNA levels declined, while protein levels remained elevated. PP1 was immunolocalized in slime plugs and P-protein bodies in sieve elements of the phloem. Occasionally, PP1 was detected in companion cells. PP1 mRNA was localized by in situ hybridization in companion cells at early stages of vascular differentiation. The developmental accumulation and localization of PP1 and its mRNA paralleled the phloem lactin, further suggesting an interaction between these phloem-specific proteins.

  12. A combined vision-inertial fusion approach for 6-DoF object pose estimation

    Science.gov (United States)

    Li, Juan; Bernardos, Ana M.; Tarrío, Paula; Casar, José R.

    2015-02-01

    The estimation of the 3D position and orientation of moving objects (`pose' estimation) is a critical process for many applications in robotics, computer vision or mobile services. Although major research efforts have been carried out to design accurate, fast and robust indoor pose estimation systems, it remains as an open challenge to provide a low-cost, easy to deploy and reliable solution. Addressing this issue, this paper describes a hybrid approach for 6 degrees of freedom (6-DoF) pose estimation that fuses acceleration data and stereo vision to overcome the respective weaknesses of single technology approaches. The system relies on COTS technologies (standard webcams, accelerometers) and printable colored markers. It uses a set of infrastructure cameras, located to have the object to be tracked visible most of the operation time; the target object has to include an embedded accelerometer and be tagged with a fiducial marker. This simple marker has been designed for easy detection and segmentation and it may be adapted to different service scenarios (in shape and colors). Experimental results show that the proposed system provides high accuracy, while satisfactorily dealing with the real-time constraints.

  13. A Tabular Format for Computing Inverse Kinematic Equations for a 3DOF Robot Leg

    Directory of Open Access Journals (Sweden)

    F. Nickols

    2009-09-01

    Full Text Available A method is presented for accurately computing the three servomechanism angles that place the leg tip of a 3DOF robot leg in cylindrical coordinate space, R, θ, Z. The method is characterized by (i a multivariable integer power series for each degree of freedom that can be used to replace traditional trigonometrical functions, and, (ii only integer numbers are used. A technique is shown that derives the coefficients, Ci j k, of each of the terms in the series that represents a servomechanism angle, S. This power series method has the advantage of; (i satisfying accuracy requirements, (ii producing a unique solution, (iii high speed realtime computation, (iv low memory requirement and (v implementation into a generic algorithm or hardware such as a field programmable gate array. The series can represent many continuous kinematic systems just by changing the values of the coefficients. The coefficients are rapidly computed via a spreadsheet. The method can be extended to more than three degrees of freedom and also mapped into other coordinate frames such as a Cartesian or spherical.

  14. Co-simulation of Six DOF Wire Driven Parallel Mechanism Based on ADAMS and Matlab

    Directory of Open Access Journals (Sweden)

    Tang Aofei

    2015-01-01

    Full Text Available The dynamic model of the 6 DOF Wire Driven Parallel Mechanism (WDPM system is introduced. Based on MATLAB system, the simulation of the inverse dynamic model is achieved. According to the simulation result, the mechanical model for the WDPM system is reasonable. Using ADAMS system, the dynamic model of the virtual prototype is verified by the simulation analysis. The combined control model based on ADAMS/Simulink is derived. The WDPM control system is designed with MATLAB/Simulink. The torque control method is selected for the outer ring and the PD control method for the inner ring. Combined with the ADAMS control model and control law design, the interactive simulation analysis of the WDPM system is completed. According to the simulation results of the spatial circle tracking and line tracking at the end of the moving platform, the tracking error can be reduced by the designed control algorithm. The minimum tracking error is 0.2 mm to 0.3 mm. Therefore, the theoretical foundation for designing hardware systems of the WDPM control system is established.

  15. Integration of computer-assisted fracture reduction system and a hybrid 3-DOF-RPS mechanism for assisting the orthopedic surgery

    Science.gov (United States)

    Irwansyah; Sinh, N. P.; Lai, J. Y.; Essomba, T.; Asbar, R.; Lee, P. Y.

    2018-02-01

    In this paper, we present study to integrate virtual fracture bone reduction simulation tool with a novel hybrid 3-DOF-RPS external fixator to relocate back bone fragments into their anatomically original position. A 3D model of fractured bone was reconstructed and manipulated using 3D design and modeling software, PhysiGuide. The virtual reduction system was applied to reduce a bilateral femoral shaft fracture type 32-A3. Measurement data from fracture reduction and fixation stages were implemented to manipulate the manipulator pose in patient’s clinical case. The experimental result presents that by merging both of those techniques will give more possibilities to reduce virtual bone reduction time, improve facial and shortest healing treatment.

  16. Specific T-cell recognition of the merozoite proteins rhoptry-associated protein 1 and erythrocyte-binding antigen 1 of Plasmodium falciparum

    DEFF Research Database (Denmark)

    Jakobsen, P H; Hviid, L; Theander, T G

    1993-01-01

    The merozoite proteins merozoite surface protein 1 (MSP-1) and rhoptry-associated protein 1 (RAP-1) and synthetic peptides containing sequences of MSP-1, RAP-1, and erythrocyte-binding antigen 1, induced in vitro proliferative responses of lymphocytes collected from Ghanaian blood donors living i...... by individuals living in an area with a high transmission rate of malaria. Most of the donor plasma samples tested contained immunoglobulin G (IgG) and IgM antibodies recognizing the merozoite proteins, while only a minority showed high IgG reactivity to the synthetic peptides.......The merozoite proteins merozoite surface protein 1 (MSP-1) and rhoptry-associated protein 1 (RAP-1) and synthetic peptides containing sequences of MSP-1, RAP-1, and erythrocyte-binding antigen 1, induced in vitro proliferative responses of lymphocytes collected from Ghanaian blood donors living...

  17. The significance of different diacylgycerol synthesis pathways on plant oil composition and bioengineering

    Directory of Open Access Journals (Sweden)

    Philip David Bates

    2012-07-01

    Full Text Available The unique properties of vegetable oils from different plants utilized for food, industrial feedstocks, and fuel is dependent on the fatty acid (FA composition of triacylglycerol (TAG. Plants can use two main pathways to produce diacylglycerol (DAG, the immediate precursor molecule to TAG synthesis: 1 De novo DAG synthesis, and 2 conversion of the membrane lipid phosphatidylcholine (PC to DAG. The FA esterified to PC are also the substrate for FA modification (e.g. desaturation, hydroxylation, etc., such that the FA composition of PC-derived DAG can be substantially different than that of de novo DAG. Since DAG provides two of the three FA in TAG, the relative flux of TAG synthesis from de novo DAG or PC-derived DAG can greatly affect the final oil FA composition. Here we review how the fluxes through these two alternate pathways of DAG/TAG synthesis are determined and present evidence that suggests which pathway is utilized in different plants. Additionally, we present examples of how the endogenous DAG synthesis pathway in a transgenic host plant can produce bottlenecks for engineering of plant oil FA composition, and discuss alternative strategies to overcome these bottlenecks to produce crop plants with designer vegetable oil compositions.

  18. Protein 4.1 and its interaction with other cytoskeletal proteins in Xenopus laevis oogenesis.

    Science.gov (United States)

    Carotenuto, Rosa; Petrucci, Tamara C; Correas, Isabel; Vaccaro, Maria C; De Marco, Nadia; Dale, Brian; Wilding, Martin

    2009-06-01

    In human red blood cells, protein 4.1 (4.1R) is an 80-kDa polypeptide that stabilizes the spectrin-actin network and anchors it to the plasma membrane. In non-erythroid cells there is a great variety of 4.1R isoforms, mainly generated by alternative pre-mRNA splicing, which localize at various intracellular sites, including the nucleus. We studied protein 4.1R distribution in relation to beta-spectrin, actin and cytokeratin during Xenopus oogenesis. Immunoprecipitation experiments indicate that at least two isoforms of protein 4.1R are present in Xenopus laevis oocytes: a 56-kDa form in the cytoplasm and a 37-kDa form in the germinal vesicle (GV). Antibodies to beta-spectrin reveal two bands of 239 and 100 kDa in the cytoplasm. Coimmunoprecipitation experiments indicate that both the 37- and 56-kDa isoforms of protein 4.1R associate with the 100-kDa isoform of beta-spectrin. Moreover, the 56-kDa form coimmunoprecipitates with a cytokeratin of the same molecular weight. Confocal immunolocalization shows that protein 4.1R distribution is in the peripheral cytoplasm, in the mitochondrial cloud (MC) and in the GV of previtellogenic oocytes. In the cytoplasm of vitellogenic oocytes, a loose network of fibers stained by the anti-protein 4.1R antibody spreads across the cytoplasm. beta-Spectrin has a similar distribution. Protein 4.1R was found to colocalize with actin in the cortex of oocytes in the form of fluorescent dots. Double immunolocalization of protein 4.1R and cytokeratin depicts two separate networks that overlap throughout the whole cytoplasm. Protein 4.1R filaments partially colocalize with cytokeratin in both the animal and vegetal hemispheres. We hypothesize that protein 4.1R could function as a linker protein between cytokeratin and the actin-based cytoskeleton.

  19. DSS1/Sem1, a multifunctional and intrinsically disordered protein

    DEFF Research Database (Denmark)

    Kragelund, Birthe Brandt; Schenstrøm, Signe Marie; Rebula, Caio A.

    2016-01-01

    DSS1/Sem1 is a versatile intrinsically disordered protein. Besides being a bona fide subunit of the 26S proteasome, DSS1 associates with other protein complexes, including BRCA2-RPA, involved in homologous recombination; the Csn12-Thp3 complex, involved in RNA splicing; the integrator, involved...

  20. Characterization of the honeybee venom proteins C1q-like protein and PVF1 and their allergenic potential

    DEFF Research Database (Denmark)

    Russkamp, Dennis; Van Vaerenbergh, Matthias; Etzold, Stefanie

    2018-01-01

    -like protein (C1q) and PDGF/VEGF-like factor 1 (PVF1). C1q and PVF1 were produced as recombinant proteins in insect cells. Their allergenic properties were examined by determining the level of specific IgE antibodies in the sera of HBV-allergic patients (n = 26) as well as by their capacity to activate...... frugiperda insect cells exhibited specific IgE reactivity with approximately 38.5% of sera of HBV-allergic patients. Interestingly, both proteins were unable to activate basophils of the patients, questioning their role in the context of clinically relevant sensitization. Recombinant C1q and PVF1 can build...

  1. Induction of osteogenic markers in differentially treated cultures of embryonic stem cells

    Directory of Open Access Journals (Sweden)

    Ommerborn Michelle A

    2008-06-01

    Full Text Available Abstract Background Facial trauma or tumor surgery in the head and face area often lead to massive destruction of the facial skeleton. Cell-based bone reconstruction therapies promise to offer new therapeutic opportunities for the repair of bone damaged by disease or injury. Currently, embryonic stem cells (ESCs are discussed to be a potential cell source for bone tissue engineering. The purpose of this study was to investigate various supplements in culture media with respect to the induction of osteogenic differentiation. Methods Murine ESCs were cultured in the presence of LIF (leukemia inhibitory factor, DAG (dexamethasone, ascorbic acid and β-glycerophosphate or bone morphogenetic protein-2 (BMP-2. Microscopical analyses were performed using von Kossa staining, and expression of osteogenic marker genes was determined by real time PCR. Results ESCs cultured with DAG showed by far the largest deposition of calcium phosphate-containing minerals. Starting at day 9 of culture, a strong increase in collagen I mRNA expression was detected in the DAG-treated cells. In BMP-2-treated ESCs the collagen I mRNA induction was less increased. Expression of osteocalcin, a highly specific marker for osteogentic differentiation, showed a double-peaked curve in DAG-treated cells. ESCs cultured in the presence of DAG showed a strong increase in osteocalcin mRNA at day 9 followed by a second peak starting at day 17. Conclusion Supplementation of ESC cell cultures with DAG is effective in inducing osteogenic differentiation and appears to be more potent than stimulation with BMP-2 alone. Thus, DAG treatment can be recommended for generating ESC populations with osteogenic differentiation that are intended for use in bone tissue engineering.

  2. Differential effects of phorbol 12-myristate 13-acetate and diacylglycerols on thromboxane A2-independent phospholipase A2 activation in collage-stimulated human platelets.

    Science.gov (United States)

    Reddy, S; Rao, G H; Murthy, M

    1994-04-01

    We investigated the priming effects of protein kinase C (PKC) activators such as phorbol 12-myristate 13-acetate (PMA), 1,2-DiC8 and OAG, and 1,3-DiC8 (a poor activator of PKC) on thromboxane A2 (TxA2)-independent phospholipase A2 (PLA2) activation in human platelets using collagen and A23187 as agonists. We measured PLA2 activation in collagen-stimulated platelets in the presence of BW755C, which abolished TxA2 synthesis, rise in cytosolic Ca2+, and aggregation. In the presence of PMA (50 nM), the amount of arachidonic acid (AA) released in platelets stimulated with collagen and A23187 represented 300% (13.85 nmol versus 4.5 nmol) and 400% (28 nmol versus 7 nmol) of controls (without PMA), respectively, while 1,2-DiC8, OAG, and 1,3-DiC8 increased TxA2-independent AA release by 50% in A23187-stimulated platelets and had no effect on the release of AA in collagen-stimulated platelets. Interestingly, 1,3-DiC8, which is a poor activator of PKC, was as effective as the other two DAGs (OAG and 1,2-DiC8) in priming TxA2-independent PLA2 activation, but was less effective than PMA in platelets stimulated with A23187. These results suggest that the TXA2-dependent IP3-mediated rise in cytosolic Ca2+ may not be obligatory for priming PLA2 activation in the presence of PMA in collagen-stimulated platelets. In contrast, 1,2-DiC8, OAG, and 1,3-DiC8 likely enhanced PLA2 activation via intracellular Ca2+ as they selectively affect this enzyme only in A23187-stimulated platelets. We also observed a significant increase in both saturated (palmitic and stearic acids) and unsaturated fatty acids (oleic and linoleic acids) in platelets stimulated by collagen or A23187 in the presence of PMA (50 nM), but not in the presence of DAGs. These findings imply that PMA may also affect the activation of DAG/MAG lipases, PLA1, or nonspecific PLA2. Since both 1,2-DiC8 and OAG exert no significant effect on the release of these fatty acids, the effects observed with PMA on DAG lipase/PLA1 may not

  3. Myocardial ischemic preconditioning upregulated protein 1(Mipu1):zinc finger protein 667 - a multifunctional KRAB/C{sub 2}H{sub 2} zinc finger protein

    Energy Technology Data Exchange (ETDEWEB)

    Han, D.; Zhang, C. [Institute of Cardiovascular Disease, Key Lab for Arteriosclerology of Hunan Province, Post-doctoral Mobile Stations for Basic Medicine, University of South China, Hengyang City, Hunan Province (China); Fan, W.J. [Institute of Cardiovascular Disease, Key Lab for Arteriosclerology of Hunan Province, Post-doctoral Mobile Stations for Basic Medicine, University of South China, Hengyang City, Hunan Province (China); The Second Affiliated Hospital, University of South China, Hengyang City, Hunan Province (China); Pan, W.J.; Feng, D.M.; Qu, S.L.; Jiang, Z.S. [Institute of Cardiovascular Disease, Key Lab for Arteriosclerology of Hunan Province, Post-doctoral Mobile Stations for Basic Medicine, University of South China, Hengyang City, Hunan Province (China)

    2014-10-31

    Myocardial ischemic preconditioning upregulated protein 1 (Mipu1) is a newly discovered upregulated gene produced in rats during the myocardial ischemic preconditioning process. Mipu1 cDNA contains a 1824-base pair open reading frame and encodes a 608 amino acid protein with an N-terminal Krüppel-associated box (KRAB) domain and classical zinc finger C{sub 2}H{sub 2} motifs in the C-terminus. Mipu1 protein is located in the cell nucleus. Recent studies found that Mipu1 has a protective effect on the ischemia-reperfusion injury of heart, brain, and other organs. As a nuclear factor, Mipu1 may perform its protective function through directly transcribing and repressing the expression of proapoptotic genes to repress cell apoptosis. In addition, Mipu1 also plays an important role in regulating the gene expression of downstream inflammatory mediators by inhibiting the activation of activator protein-1 and serum response element.

  4. Martian Pyroxenes in the Shergottite Meteorites; Zagami, SAU005, DAG476 and EETA79001

    Science.gov (United States)

    Stephen, N.; Benedix, G. K.; Bland, P.; Hamilton, V. E.

    2010-12-01

    The geology and surface mineralogy of Mars is characterised using remote sensing techniques such as thermal emission spectroscopy (TES) from instruments on a number of spacecraft currently orbiting Mars or gathered from roving missions on the Martian surface. However, the study of Martian meteorites is also important in efforts to further understand the geological history of Mars or to interpret mission data as they are believed to be the only available samples that give us direct clues as to Martian igneous processes [1]. We have recently demonstrated that the spectra of Martian-specific minerals can be determined using micro-spectroscopy [2] and that these spectra can be reliably obtained from thin sections of Martian meteorites [3]. Accurate modal mineralogy of these meteorites is also important [4]. In this study we are using a variety of techniques to build upon previous studies of these particular samples in order to fully characterise the nature of the 2 common pyroxenes found in Martian Shergottites; pigeonite and augite [5], [6]. Previous studies have shown that the Shergottite meteorites are dominated by pyroxene (pigeonite and augite in varying quantities) [4], [5], commonly but not always olivine, plagioclase or maskelynite/glass and also hydrous minerals, which separate the Martian meteorites from other achondrites [7]. Our microprobe study of meteorites Zagami, EETA79001, SAU005 and DAG476 in thin-section at the Natural History Museum, London shows a chemical variability within both the pigeonite and augite composition across individual grains in all thin sections; variation within either Mg or Ca concentration varies from core to rim within the grains. This variation can also be seen in modal mineralogy maps using SEM-derived element maps and the Photoshop® technique previously described [4], and in new micro-spectroscopy data, particularly within the Zagami meteorite. New mineral spectra have been gathered from the Shergottite thin-sections by

  5. CC1, a novel crenarchaeal DNA binding protein.

    Science.gov (United States)

    Luo, Xiao; Schwarz-Linek, Uli; Botting, Catherine H; Hensel, Reinhard; Siebers, Bettina; White, Malcolm F

    2007-01-01

    The genomes of the related crenarchaea Pyrobaculum aerophilum and Thermoproteus tenax lack any obvious gene encoding a single-stranded DNA binding protein (SSB). SSBs are essential for DNA replication, recombination, and repair and are found in all other genomes across the three domains of life. These two archaeal genomes also have only one identifiable gene encoding a chromatin protein (the Alba protein), while most other archaea have at least two different abundant chromatin proteins. We performed a biochemical screen for novel nucleic acid binding proteins present in cell extracts of T. tenax. An assay for proteins capable of binding to a single-stranded DNA oligonucleotide resulted in identification of three proteins. The first protein, Alba, has been shown previously to bind single-stranded DNA as well as duplex DNA. The two other proteins, which we designated CC1 (for crenarchaeal chromatin protein 1), are very closely related to one another, and homologs are restricted to the P. aerophilum and Aeropyrum pernix genomes. CC1 is a 6-kDa, monomeric, basic protein that is expressed at a high level in T. tenax. This protein binds single- and double-stranded DNAs with similar affinities. These properties are consistent with a role for CC1 as a crenarchaeal chromatin protein.

  6. The coat protein complex II, COPII, protein Sec13 directly interacts with presenilin-1

    International Nuclear Information System (INIS)

    Nielsen, Anders Lade

    2009-01-01

    Mutations in the human gene encoding presenilin-1, PS1, account for most cases of early-onset familial Alzheimer's disease. PS1 has nine transmembrane domains and a large loop orientated towards the cytoplasm. PS1 locates to cellular compartments as endoplasmic reticulum (ER), Golgi apparatus, vesicular structures, and plasma membrane, and is an integral member of γ-secretase, a protein protease complex with specificity for intra-membranous cleavage of substrates such as β-amyloid precursor protein. Here, an interaction between PS1 and the Sec13 protein is described. Sec13 takes part in coat protein complex II, COPII, vesicular trafficking, nuclear pore function, and ER directed protein sequestering and degradation control. The interaction maps to the N-terminal part of the large hydrophilic PS1 loop and the first of the six WD40-repeats present in Sec13. The identified Sec13 interaction to PS1 is a new candidate interaction for linking PS1 to secretory and protein degrading vesicular circuits.

  7. The coat protein complex II, COPII, protein Sec13 directly interacts with presenilin-1

    Energy Technology Data Exchange (ETDEWEB)

    Nielsen, Anders Lade, E-mail: aln@humgen.au.dk [Department of Human Genetics, The Bartholin Building, University of Aarhus, DK-8000 Aarhus C (Denmark)

    2009-10-23

    Mutations in the human gene encoding presenilin-1, PS1, account for most cases of early-onset familial Alzheimer's disease. PS1 has nine transmembrane domains and a large loop orientated towards the cytoplasm. PS1 locates to cellular compartments as endoplasmic reticulum (ER), Golgi apparatus, vesicular structures, and plasma membrane, and is an integral member of {gamma}-secretase, a protein protease complex with specificity for intra-membranous cleavage of substrates such as {beta}-amyloid precursor protein. Here, an interaction between PS1 and the Sec13 protein is described. Sec13 takes part in coat protein complex II, COPII, vesicular trafficking, nuclear pore function, and ER directed protein sequestering and degradation control. The interaction maps to the N-terminal part of the large hydrophilic PS1 loop and the first of the six WD40-repeats present in Sec13. The identified Sec13 interaction to PS1 is a new candidate interaction for linking PS1 to secretory and protein degrading vesicular circuits.

  8. A new methodology of second messenger imaging for higher cortical functions by positron emission tomography

    International Nuclear Information System (INIS)

    Imahori, Yoshio; Ueda, Satoshi

    1992-01-01

    Neuronal manifestations are driven by second messenger systems in central nervous system through the neuronal transmission process. Receptor-mediated phosphatidylinositol (PI) response images may reflect neuronal activation in higher cortical function with a high sensitivity based on the common amplifying mechanism of the second messenger. Many bioactive compounds related to PI turnover have simple carbohydrate structures without amines and [ 11 C]ethylketene acylation has been found as the most effective labeling method of these compounds for positron emission tomography. [ 11 C]ethylketene was produced by the pyrolytic decomposition of [1- 11 C]butyric acid. This new method was made possible by the reaction under the no-carrier-added condition. To visualize the response in vivo, we synthesized sn-1,2-[ 11 C]diacylglycerols (DAGs) as a specific tracer for the PI response and [ 11 C]phorbol esters as a ligand for protein kinase C. In autoradiographic studies it was demonstrated that sn-1,2-[ 11 C]DAGs incorporation sites were discretely localized especially in the neocortex, which were concomitant with columnar structures. These results suggested that sn-1,2-[ 11 C]DAG can serve as an extrinsic substrate for the PI turnover by the phosphorylation mechanism and intensive neuronal processing, as a higher cortical function, occurs in these areas on the basis of receptor-mediated PI response. (author)

  9. Fibulin-1C, C1 esterase inhibitor and glucose regulated protein 75 interact with the CREC proteins, calumenin and reticulocalbin

    DEFF Research Database (Denmark)

    Hansen, Gry Aune Westergaard; Ludvigsen, Maja; Jacobsen, Christian

    2015-01-01

    Affinity purification, immunoprecipitation, gel electrophoresis and mass spectrometry were used to identify fibulin-1C, C1 esterase inhibitor and glucose regulated protein 75, grp75, as binding partners of the CREC proteins, calumenin and reticulocalbin. Surface plasmon resonance was used to verify...... the interaction of all three proteins with each of the CREC proteins. Fibulin-1C interacts with calumenin and reticulocalbin with an estimated dissociation constant around 50-60 nM. The interaction, at least for reticulocalbin, was not dependent upon the presence of Ca2+. C1 esterase inhibitor interacted...

  10. Inhibitory effects of herbal constituents on P-glycoprotein in vitro and in vivo: Herb–drug interactions mediated via P-gp

    Energy Technology Data Exchange (ETDEWEB)

    Li, Xue, E-mail: lixue@imm.ac.cn; Hu, Jinping, E-mail: hujp@imm.ac.cn; Wang, Baolian, E-mail: wangbaolian@imm.ac.cn; Sheng, Li, E-mail: shengli@imm.ac.cn; Liu, Zhihao, E-mail: liuzhihao@imm.ac.cn; Yang, Shuang, E-mail: yangsh@imm.ac.cn; Li, Yan, E-mail: yanli@imm.ac.cn

    2014-03-01

    Modulation of drug transporters via herbal medicines which have been widely used in combination with conventional prescription drugs may result in herb–drug interactions in clinical practice. The present study was designed to investigate the inhibitory effects of 50 major herbal constituents on P-glycoprotein (P-gp) in vitro and in vivo as well as related inhibitory mechanisms. Among these herbal medicines, four constituents, including emodin, 18β-glycyrrhetic acid (18β-GA), dehydroandrographolide (DAG), and 20(S)-ginsenoside F{sub 1} [20(S)-GF{sub 1}] exhibited significant inhibition (> 50%) on P-gp in MDR1-MDCKII and Caco-2 cells. Emodin was the strongest inhibitor of P-gp (IC{sub 50} = 9.42 μM), followed by 18β-GA (IC{sub 50} = 21.78 μM), 20(S)-GF{sub 1} (IC{sub 50} = 76.08 μM) and DAG (IC{sub 50} = 77.80 μM). P-gp ATPase activity, which was used to evaluate the affinity of substrates to P-gp, was stimulated by emodin and DAG with K{sub m} and V{sub max} values of 48.61, 29.09 μM and 71.29, 38.45 nmol/min/mg protein, respectively. However, 18β-GA and 20(S)-GF{sub 1} exhibited significant inhibition on both basal and verapamil-stimulated P-gp ATPase activities at high concentration. Molecular docking analysis (CDOCKER) further elucidated the mechanism for structure–inhibition relationships of herbal constituents with P-gp. When digoxin was co-administered to male SD rats with emodin or 18β-GA, the AUC{sub 0−t} and Cmax of digoxin were increased by approximately 51% and 58%, respectively. Furthermore, 18β-GA, DAG, 20(S)-GF{sub 1} and Rh{sub 1} at 10 μM significantly inhibited CYP3A4/5 activity, while emodin activated the metabolism of midazolam in human liver microsomes. In conclusion, four herbal constituents demonstrated inhibition of P-gp to specific extents in vitro and in vivo. Taken together, our findings provided the basis for the reliable assessment of the potential risks of herb–drug interactions in humans. - Highlights: • Emodin, 18

  11. Inhibitory effects of herbal constituents on P-glycoprotein in vitro and in vivo: Herb–drug interactions mediated via P-gp

    International Nuclear Information System (INIS)

    Li, Xue; Hu, Jinping; Wang, Baolian; Sheng, Li; Liu, Zhihao; Yang, Shuang; Li, Yan

    2014-01-01

    Modulation of drug transporters via herbal medicines which have been widely used in combination with conventional prescription drugs may result in herb–drug interactions in clinical practice. The present study was designed to investigate the inhibitory effects of 50 major herbal constituents on P-glycoprotein (P-gp) in vitro and in vivo as well as related inhibitory mechanisms. Among these herbal medicines, four constituents, including emodin, 18β-glycyrrhetic acid (18β-GA), dehydroandrographolide (DAG), and 20(S)-ginsenoside F 1 [20(S)-GF 1 ] exhibited significant inhibition (> 50%) on P-gp in MDR1-MDCKII and Caco-2 cells. Emodin was the strongest inhibitor of P-gp (IC 50 = 9.42 μM), followed by 18β-GA (IC 50 = 21.78 μM), 20(S)-GF 1 (IC 50 = 76.08 μM) and DAG (IC 50 = 77.80 μM). P-gp ATPase activity, which was used to evaluate the affinity of substrates to P-gp, was stimulated by emodin and DAG with K m and V max values of 48.61, 29.09 μM and 71.29, 38.45 nmol/min/mg protein, respectively. However, 18β-GA and 20(S)-GF 1 exhibited significant inhibition on both basal and verapamil-stimulated P-gp ATPase activities at high concentration. Molecular docking analysis (CDOCKER) further elucidated the mechanism for structure–inhibition relationships of herbal constituents with P-gp. When digoxin was co-administered to male SD rats with emodin or 18β-GA, the AUC 0−t and Cmax of digoxin were increased by approximately 51% and 58%, respectively. Furthermore, 18β-GA, DAG, 20(S)-GF 1 and Rh 1 at 10 μM significantly inhibited CYP3A4/5 activity, while emodin activated the metabolism of midazolam in human liver microsomes. In conclusion, four herbal constituents demonstrated inhibition of P-gp to specific extents in vitro and in vivo. Taken together, our findings provided the basis for the reliable assessment of the potential risks of herb–drug interactions in humans. - Highlights: • Emodin, 18β-GA, DAG, and 20(S)-GF 1 significantly inhibited P-gp in vitro

  12. New insights into potential functions for the protein 4.1superfamily of proteins in kidney epithelium

    Energy Technology Data Exchange (ETDEWEB)

    Calinisan, Venice; Gravem, Dana; Chen, Ray Ping-Hsu; Brittin,Sachi; Mohandas, Narla; Lecomte, Marie-Christine; Gascard, Philippe

    2005-06-17

    Members of the protein 4.1 family of adapter proteins are expressed in a broad panel of tissues including various epithelia where they likely play an important role in maintenance of cell architecture and polarity and in control of cell proliferation. We have recently characterized the structure and distribution of three members of the protein 4.1 family, 4.1B, 4.1R and 4.1N, in mouse kidney. We describe here binding partners for renal 4.1 proteins, identified through the screening of a rat kidney yeast two-hybrid system cDNA library. The identification of putative protein 4.1-based complexes enables us to envision potential functions for 4.1 proteins in kidney: organization of signaling complexes, response to osmotic stress, protein trafficking, and control of cell proliferation. We discuss the relevance of these protein 4.1-based interactions in kidney physio-pathology in the context of their previously identified functions in other cells and tissues. Specifically, we will focus on renal 4.1 protein interactions with beta amyloid precursor protein (beta-APP), 14-3-3 proteins, and the cell swelling-activated chloride channel pICln. We also discuss the functional relevance of another member of the protein 4.1 superfamily, ezrin, in kidney physiopathology.

  13. Saccharomyces cerevisiae SSB1 protein and its relationship to nucleolar RNA-binding proteins.

    Science.gov (United States)

    Jong, A Y; Clark, M W; Gilbert, M; Oehm, A; Campbell, J L

    1987-08-01

    To better define the function of Saccharomyces cerevisiae SSB1, an abundant single-stranded nucleic acid-binding protein, we determined the nucleotide sequence of the SSB1 gene and compared it with those of other proteins of known function. The amino acid sequence contains 293 amino acid residues and has an Mr of 32,853. There are several stretches of sequence characteristic of other eucaryotic single-stranded nucleic acid-binding proteins. At the amino terminus, residues 39 to 54 are highly homologous to a peptide in calf thymus UP1 and UP2 and a human heterogeneous nuclear ribonucleoprotein. Residues 125 to 162 constitute a fivefold tandem repeat of the sequence RGGFRG, the composition of which suggests a nucleic acid-binding site. Near the C terminus, residues 233 to 245 are homologous to several RNA-binding proteins. Of 18 C-terminal residues, 10 are acidic, a characteristic of the procaryotic single-stranded DNA-binding proteins and eucaryotic DNA- and RNA-binding proteins. In addition, examination of the subcellular distribution of SSB1 by immunofluorescence microscopy indicated that SSB1 is a nuclear protein, predominantly located in the nucleolus. Sequence homologies and the nucleolar localization make it likely that SSB1 functions in RNA metabolism in vivo, although an additional role in DNA metabolism cannot be excluded.

  14. Diabetes mellitus type 1

    OpenAIRE

    Tøraasen, Lisa Vangen; Al-Sultan, Zainab

    2014-01-01

    Bacheloroppgave i sykepleie, 2014 Hvert år blir rundt 600 nordmenn diagnostisert med sykdommen diabetes type 1, og Norge er et av landene i verden med størst andel av barnediabetes. I dag er det 15 000- 20 000 personer i Norge som har diabetes type 1, og antall barn som får diabetes har fordoblet seg de siste 30 årene (Diabetesforbundet, 2014). Problemstillingen vår gikk ut på hvordan sykepleiere kan veilede og undervise ungdom med nyoppdaget diabetes type på sykehus. Ut i fra litteraturst...

  15. Diabetes mellitus type 1

    OpenAIRE

    Tøraasen, Lisa Vangen; Al-Sultan, Zainab

    2014-01-01

    Hvert år blir rundt 600 nordmenn diagnostisert med sykdommen diabetes type 1, og Norge er et av landene i verden med størst andel av barnediabetes. I dag er det 15 000- 20 000 personer i Norge som har diabetes type 1, og antall barn som får diabetes har fordoblet seg de siste 30 årene (Diabetesforbundet, 2014). Problemstillingen vår gikk ut på hvordan sykepleiere kan veilede og undervise ungdom med nyoppdaget diabetes type på sykehus. Ut i fra litteraturstudiet har vi arbeidet oss frem for å ...

  16. The PDZ and band 4.1 containing protein Frmpd1 regulates the subcellular location of activator of G-protein signaling 3 and its interaction with G-proteins.

    Science.gov (United States)

    An, Ningfei; Blumer, Joe B; Bernard, Michael L; Lanier, Stephen M

    2008-09-05

    Activator of G-protein signaling 3 (AGS3) is one of nine mammalian proteins containing one or more G-protein regulatory (GPR) motifs that stabilize the GDP-bound conformation of Galphai. Such proteins have revealed unexpected functional diversity for the "G-switch" in the control of events within the cell independent of the role of heterotrimeric G-proteins as transducers for G-protein-coupled receptors at the cell surface. A key question regarding this class of proteins is what controls their subcellular positioning and interaction with G-proteins. We conducted a series of yeast two-hybrid screens to identify proteins interacting with the tetratricopeptide repeat (TPR) of AGS3, which plays an important role in subcellular positioning of the protein. We report the identification of Frmpd1 (FERM and PDZ domain containing 1) as a regulatory binding partner of AGS3. Frmpd1 binds to the TPR domain of AGS3 and coimmunoprecipitates with AGS3 from cell lysates. Cell fractionation indicated that Frmpd1 stabilizes AGS3 in a membrane fraction. Upon cotransfection of COS7 cells with Frmpd1-GFP and AGS3-mRFP, AGS3-mRFP is observed in regions of the cell cortex and also in membrane extensions or processes where it appears to be colocalized with Frmpd1-GFP based upon the merged fluorescent signals. Frmpd1 knockdown (siRNA) in Cath.a-differentiated neuronal cells decreased the level of endogenous AGS3 in membrane fractions by approximately 50% and enhanced the alpha2-adrenergic receptor-mediated inhibition of forskolin-induced increases in cAMP. The coimmunoprecipitation of Frmpd1 with AGS3 is lost as the amount of Galphai3 in the cell is increased and AGS3 apparently switches its binding partner from Frmpd1 to Galphai3 indicating that the interaction of AGS3 with Frmpd1 and Galphai3 is mutually exclusive. Mechanistically, Frmpd1 may position AGS3 in a membrane environment where it then interacts with Galphai in a regulated manner.

  17. A 2-Dof LQR based PID controller for integrating processes considering robustness/performance tradeoff.

    Science.gov (United States)

    Srivastava, Saurabh; Pandit, V S

    2017-11-01

    This paper focuses on the analytical design of a Proportional Integral and Derivative (PID) controller together with a unique set point filter that makes the overall Two-Degree of-Freedom (2-Dof) control system for integrating processes with time delay. The PID controller tuning is based on the Linear Quadratic Regulator (LQR) using dominant pole placement approach to obtain good regulatory response. The set point filter is designed with the calculated PID parameters and using a single filter time constant (λ) to precisely control the servo response. The effectiveness of the proposed methodology is demonstrated through a series of illustrative examples using real industrial integrated process models. The whole range of PID parameters is obtained for each case in a tradeoff between the robustness of the closed loop system measured in terms of Maximum Sensitivity (M s ) and the load disturbance measured in terms of Integral of Absolute Errors (IAE). Results show improved closed loop response in terms of regulatory and servo responses with less control efforts when compared with the latest PID tuning methods of integrating systems. Copyright © 2017 ISA. Published by Elsevier Ltd. All rights reserved.

  18. MAVS protein is attenuated by rotavirus nonstructural protein 1.

    Directory of Open Access Journals (Sweden)

    Satabdi Nandi

    Full Text Available Rotavirus is the single, most important agent of infantile gastroenteritis in many animal species, including humans. In developing countries, rotavirus infection attributes approximately 500,000 deaths annually. Like other viruses it establishes an intimate and complex interaction with the host cell to counteract the antiviral responses elicited by the cell. Among various pattern recognition receptors (PAMPs of the host, the cytosolic RNA helicases interact with viral RNA to activate the Mitochondrial Antiviral Signaling protein (MAVS, which regulates cellular interferon response. With an aim to identify the role of different PAMPs in rotavirus infected cell, MAVS was found to degrade in a time dependent and strain independent manner. Rotavirus non-structural protein 1 (NSP1 which is a known IFN antagonist, interacted with MAVS and degraded it in a strain independent manner, resulting in a complete loss of RNA sensing machinery in the infected cell. To best of our knowledge, this is the first report on NSP1 functionality where a signaling protein is targeted unanimously in all strains. In addition NSP1 inhibited the formation of detergent resistant MAVS aggregates, thereby averting the antiviral signaling cascade. The present study highlights the multifunctional role of rotavirus NSP1 and reinforces the fact that the virus orchestrates the cellular antiviral response to its own benefit by various back up strategies.

  19. The redox protein thioredoxin-1 (Trx-1) increases hypoxia-inducible factor 1alpha protein expression: Trx-1 overexpression results in increased vascular endothelial growth factor production and enhanced tumor angiogenesis.

    Science.gov (United States)

    Welsh, Sarah J; Bellamy, William T; Briehl, Margaret M; Powis, Garth

    2002-09-01

    Hypoxia-inducible factor 1 (HIF-1), a heterodimer of HIF-1alpha and HIF-1beta subunits, is a transcriptional activator central to the cellular response to low oxygen that includes metabolic adaptation, angiogenesis, metastasis, and inhibited apoptosis. Thioredoxin-1 (Trx-1) is a small redox protein overexpressed in a number of human primary tumors. We have examined the effects of Trx-1 on HIF activity and the activation of downstream genes. Stable transfection of human breast carcinoma MCF-7 cells with human Trx-1 caused a significant increase in HIF-1alpha protein levels under both normoxic (20% oxygen) and hypoxic (1% oxygen) conditions. Trx-1 increased hypoxia-induced HIF-1 transactivation activity measured using a luciferase reporter under the control of the hypoxia response element. Changes in HIF-1alpha mRNA levels did not account for the changes observed at the protein level, and HIF-1beta protein levels did not change. Trx-1 transfection also caused a significant increase in the protein products of hypoxia-responsive genes, including vascular endothelial growth factor (VEGF) and nitric oxide synthase 2 in a number of different cell lines (MCF-7 human breast and HT29 human colon carcinomas and WEHI7.2 mouse lymphoma cells) under both normoxic and hypoxic conditions. The pattern of expression of the different isoforms of VEGF was not changed by Trx-1. Transfection of a redox-inactive Trx-1 (C32S/C35S) markedly decreased levels of HIF-1alpha protein, HIF-1 transactivating activity, and VEGF protein in MCF-7 cells compared with empty vector controls. In vivo studies using WEHI7.2 cells transfected with Trx-1 showed significantly increased tumor VEGF and angiogenesis. The results suggest that Trx-1 increases HIF-1alpha protein levels in cancer cells and increases VEGF production and tumor angiogenesis.

  20. Activation of the polyomavirus enhancer by a murine activator protein 1 (AP1) homolog and two contiguous proteins.

    OpenAIRE

    Martin, M E; Piette, J; Yaniv, M; Tang, W J; Folk, W R

    1988-01-01

    The polyomavirus enhancer is composed of multiple DNA sequence elements serving as binding sites for proteins present in mouse nuclear extracts that activate transcription and DNA replication. We have identified three such proteins and their binding sites and correlate them with enhancer function. Mutation of nucleotide (nt) 5140 in the enhancer alters the binding site (TGACTAA, nt 5139-5145) for polyomavirus enhancer A binding protein 1 (PEA1), a murine homolog of the human transcription fac...

  1. A 90-day repeated-dose toxicity study of dietary alpha linolenic acid-enriched diacylglycerol oil in rats.

    Science.gov (United States)

    Bushita, Hiroto; Ito, Yuichi; Saito, Tetsuji; Nukada, Yuko; Ikeda, Naohiro; Nakagiri, Hideaki; Saito, Kazutoshi; Morita, Osamu

    2018-05-31

    Diets supplemented with alpha-linolenic acid (ALA)-enriched diacylglycerol (DAG) oil-which mainly consists of oleic and linolenic, linoleic acids-have potential health benefits in terms of preventing or managing obesity. Although safety of DAG oil has been extensively investigated, toxicity of ALA-DAG oil has not been well understood. Hence, the present study was conducted to clarify the potential adverse effects, if any, of ALA-DAG oil in rats (10/sex/group) fed diets containing 1.375%, 2.75%, or 5.5% ALA-DAG oil for 90 days. Compared to control rats fed rapeseed oil or ALA-triacylglycerol oil (flaxseed oil), rats receiving ALA-DAG oil did not reveal any toxicologically significant treatment-related changes as evaluated by clinical signs, functional observational battery, body weight, food consumption, ophthalmology, urinalysis, hematology, clinical chemistry, organ weight, necropsy and histopathology. The no observed adverse effect levels for dietary exposure to ALA-DAG oil for male and female rats were 2916 and 3326 mg/kg body weight/day, respectively, the highest dose tested. The findings from this study suggest that consumption of ALA-DAG oil is unlikely to cause adverse effects. Copyright © 2018. Published by Elsevier Inc.

  2. Protein arginine methyltransferase 6 specifically methylates the nonhistone chromatin protein HMGA1a

    International Nuclear Information System (INIS)

    Miranda, Tina Branscombe; Webb, Kristofor J.; Edberg, Dale D.; Reeves, Raymond; Clarke, Steven

    2005-01-01

    The HMGA family proteins HMGA1a and HMGA1b are nuclear nonhistone species implicated in a wide range of cellular processes including inducible gene transcription, modulation of chromosome structure through nucleosome and chromosome remodeling, and neoplastic transformation. HMGA proteins are highly modified, and changes in their phosphorylation states have been correlated with the phase of the cell cycle and changes in their transcriptional activity. HMGA1a is also methylated in the first DNA-binding AT-hook at Arg25 and other sites, although the enzyme or enzymes responsible have not been identified. We demonstrate here that a GST fusion of protein arginine methyltransferase 6 (PRMT6) specifically methylates full-length recombinant HMGA1a protein in vitro. Although GST fusions of PRMT1 and PRMT3 were also capable of methylating the full-length HMGA1a polypeptide, they recognize its proteolytic degradation products much better. GST fusions of PRMT4 or PRMT7 were unable to methylate the full-length protein or its degradation products. We conclude that PRMT6 is a good candidate for the endogenous enzyme responsible for HGMA1a methylation

  3. Mammal (Mammalia Fauna of Kapıdağ Peninsula

    Directory of Open Access Journals (Sweden)

    Erdem HIZAL

    2008-01-01

    Full Text Available The number of studies on mammals of Kapıdag Peninsula is insufficent. The present study is based on mammal species collected and observed in Kapıdag Peninsula. Kapıdag Peninsula was visited as a total of 226 days between 2001-2007. Field collections yielded 32 mammal species from 6 orders: Insectivora (5, Chiroptera (9,Lagomorpha (1, Rodentia (7, Carnivora (7, Artiodactyla (3. Of the species recorded in this study are rare for Kapıdag Peninsula: Lynx lynx and Felis silvestris.

  4. Role of CC chemokines (macrophage inflammatory protein-1 beta, monocyte chemoattractant protein-1, RANTES) in acute lung injury in rats

    DEFF Research Database (Denmark)

    Bless, N M; Huber-Lang, M; Guo, R F

    2000-01-01

    The role of the CC chemokines, macrophage inflammatory protein-1 beta (MIP-1 beta), monocyte chemotactic peptide-1 (MCP-1), and RANTES, in acute lung inflammatory injury induced by intrapulmonary deposition of IgG immune complexes injury in rats was determined. Rat MIP-1 beta, MCP-1, and RANTES...... were cloned, the proteins were expressed, and neutralizing Abs were developed. mRNA and protein expression for MIP-1 beta and MCP-1 were up-regulated during the inflammatory response, while mRNA and protein expression for RANTES were constitutive and unchanged during the inflammatory response....... Treatment of rats with anti-MIP-1 beta Ab significantly decreased vascular permeability by 37% (p = 0.012), reduced neutrophil recruitment into lung by 65% (p = 0.047), and suppressed levels of TNF-alpha in bronchoalveolar lavage fluids by 61% (p = 0.008). Treatment of rats with anti-rat MCP-1 or anti...

  5. Genome-wide identification, sequence characterization, and protein-protein interaction properties of DDB1 (damaged DNA binding protein-1)-binding WD40-repeat family members in Solanum lycopersicum.

    Science.gov (United States)

    Zhu, Yunye; Huang, Shengxiong; Miao, Min; Tang, Xiaofeng; Yue, Junyang; Wang, Wenjie; Liu, Yongsheng

    2015-06-01

    One hundred DDB1 (damaged DNA binding protein-1)-binding WD40-repeat domain (DWD) family genes were identified in the S. lycopersicum genome. The DWD genes encode proteins presumably functioning as the substrate recognition subunits of the cullin4-ring ubiquitin E3 ligase complex. These findings provide candidate genes and a research platform for further gene functionality and molecular breeding study. A subclass of DDB1 (damaged DNA binding protein-1)-binding WD40-repeat domain (DWD) family proteins has been demonstrated to function as the substrate recognition subunits of the cullin4-ring ubiquitin E3 ligase complex. However, little information is available about the cognate subfamily genes in tomato (S. lycopersicum). In this study, based on the recently released tomato genome sequences, 100 tomato genes encoding DWD proteins that potentially interact with DDB1 were identified and characterized, including analyses of the detailed annotations, chromosome locations and compositions of conserved amino acid domains. In addition, a phylogenetic tree, which comprises of three main groups, of the subfamily genes was constructed. The physical interaction between tomato DDB1 and 14 representative DWD proteins was determined by yeast two-hybrid and co-immunoprecipitation assays. The subcellular localization of these 14 representative DWD proteins was determined. Six of them were localized in both nucleus and cytoplasm, seven proteins exclusively in cytoplasm, and one protein either in nucleus and cytoplasm, or exclusively in cytoplasm. Comparative genomic analysis demonstrated that the expansion of these subfamily members in tomato predominantly resulted from two whole-genome triplication events in the evolution history.

  6. Proportionate Dwarfism in Mice Lacking Heterochromatin Protein 1 Binding Protein 3 (HP1BP3) Is Associated With Alterations in the Endocrine IGF-1 Pathway

    OpenAIRE

    Garfinkel, Benjamin P.; Arad, Shiri; Le, Phuong T.; Bustin, Michael; Rosen, Clifford J.; Gabet, Yankel; Orly, Joseph

    2015-01-01

    Heterochromatin protein 1 binding protein 3 (HP1BP3) is a recently described histone H1-related protein with roles in chromatin structure and transcriptional regulation. To explore the potential physiological role of HP1BP3, we have previously described an Hp1bp3?/? mouse model with reduced postnatal viability and growth. We now find that these mice are proportionate dwarfs, with reduction in body weight, body length, and organ weight. In addition to their small size, microcomputed tomography...

  7. hnRNP A2/B1 interacts with influenza A viral protein NS1 and inhibits virus replication potentially through suppressing NS1 RNA/protein levels and NS1 mRNA nuclear export

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Yimeng; Zhou, Jianhong; Du, Yuchun, E-mail: ydu@uark.edu

    2014-01-20

    The NS1 protein of influenza viruses is a major virulence factor and exerts its function through interacting with viral/cellular RNAs and proteins. In this study, we identified heterogeneous nuclear ribonucleoprotein A2/B1 (hnRNP A2/B1) as an interacting partner of NS1 proteins by a proteomic method. Knockdown of hnRNP A2/B1 by small interfering RNA (siRNA) resulted in higher levels of NS vRNA, NS1 mRNA, and NS1 protein in the virus-infected cells. In addition, we demonstrated that hnRNP A2/B1 proteins are associated with NS1 and NS2 mRNAs and that knockdown of hnRNP A2/B1 promotes transport of NS1 mRNA from the nucleus to the cytoplasm in the infected cells. Lastly, we showed that knockdown of hnRNP A2/B1 leads to enhanced virus replication. Our results suggest that hnRNP A2/B1 plays an inhibitory role in the replication of influenza A virus in host cells potentially through suppressing NS1 RNA/protein levels and NS1 mRNA nucleocytoplasmic translocation. - Highlights: • Cellular protein hnRNP A2/B1 interacts with influenza viral protein NS1. • hnRNP A2/B1 suppresses the levels of NS1 protein, vRNA and mRNA in infected cells. • hnRNP A2/B1 protein is associated with NS1 and NS2 mRNAs. • hnRNP A2/B1 inhibits the nuclear export of NS1 mRNAs. • hnRNP A2/B1 inhibits influenza virus replication.

  8. Fibulin-1C, C1 Esterase Inhibitor and Glucose Regulated Protein 75 Interact with the CREC Proteins, Calumenin and Reticulocalbin.

    Directory of Open Access Journals (Sweden)

    Gry Aune Westergaard Hansen

    Full Text Available Affinity purification, immunoprecipitation, gel electrophoresis and mass spectrometry were used to identify fibulin-1C, C1 esterase inhibitor and glucose regulated protein 75, grp75, as binding partners of the CREC proteins, calumenin and reticulocalbin. Surface plasmon resonance was used to verify the interaction of all three proteins with each of the CREC proteins. Fibulin-1C interacts with calumenin and reticulocalbin with an estimated dissociation constant around 50-60 nM. The interaction, at least for reticulocalbin, was not dependent upon the presence of Ca2+. C1 esterase inhibitor interacted with both proteins with an estimated dissociation constant at 1 μM for reticulocalbin and 150 nM for calumenin. The interaction, at least for calumenin, was dependent upon the presence of Ca2+ with strong interaction at 3.5 mM while no detectable interaction could be found at 0.1 mM. Grp75 binds with an affinity of approximately 3-7 nM with reticulocalbin as well as with calumenin. These interactions suggest functional participation of the CREC proteins in chaperone activity, cell proliferation and transformation, cellular aging, haemostasis and thrombosis as well as modulation of the complement system in fighting bacterial infection.

  9. Immunomodulatory effect of APS and PSP is mediated by Ca2+-cAMP and TLR4/NF-κB signaling pathway in macrophage.

    Science.gov (United States)

    Wang, Zhixue; Liu, Zijing; Zhou, Lijng; Long, Tingting; Zhou, Xing; Bao, Yixi

    2017-01-01

    This study is to investigate the role of second messengers and TLR4/NF-κB signaling pathway in the immunomodulatory activities of Astragalus polysaccharide (APS) and Polysaccharopeptide (PSP) in macrophages. RAW 264.7 macrophage cells were treated with APS, PSP, lipopolysaccharide (LPS), or NiCl 2 . Power-spectral method was used to detect protein kinase C (PKC) and Griess reaction to detect nitric oxide (NO). ELISA was conducted to detect cyclic adenosine monophosphate (cAMP), diglycerides (DAG), inositol 1, 4, 5-triphosphate (IP3), tumor necrosis factor-α (TNF-α) and interleukin-6 (IL-6). Confocal laser scanning microscopy was performed to detect calcium level. qRT-PCR and Western blot was used to detect mRNA and protein expression of NF-κB. APS and PSP significantly increased the concentrations of intracellular second messengers (NO, cAMP, DAG, IP3, Ca 2+ ) and the activity of PKC in macrophages (pAPS and PSP (pAPS and PSP mediated immunomodulatory activities in macrophages. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Bluetongue virus non-structural protein 1 is a positive regulator of viral protein synthesis

    Directory of Open Access Journals (Sweden)

    Boyce Mark

    2012-08-01

    Full Text Available Abstract Background Bluetongue virus (BTV is a double-stranded RNA (dsRNA virus of the Reoviridae family, which encodes its genes in ten linear dsRNA segments. BTV mRNAs are synthesised by the viral RNA-dependent RNA polymerase (RdRp as exact plus sense copies of the genome segments. Infection of mammalian cells with BTV rapidly replaces cellular protein synthesis with viral protein synthesis, but the regulation of viral gene expression in the Orbivirus genus has not been investigated. Results Using an mRNA reporter system based on genome segment 10 of BTV fused with GFP we identify the protein characteristic of this genus, non-structural protein 1 (NS1 as sufficient to upregulate translation. The wider applicability of this phenomenon among the viral genes is demonstrated using the untranslated regions (UTRs of BTV genome segments flanking the quantifiable Renilla luciferase ORF in chimeric mRNAs. The UTRs of viral mRNAs are shown to be determinants of the amount of protein synthesised, with the pre-expression of NS1 increasing the quantity in each case. The increased expression induced by pre-expression of NS1 is confirmed in virus infected cells by generating a replicating virus which expresses the reporter fused with genome segment 10, using reverse genetics. Moreover, NS1-mediated upregulation of expression is restricted to mRNAs which lack the cellular 3′ poly(A sequence identifying the 3′ end as a necessary determinant in specifically increasing the translation of viral mRNA in the presence of cellular mRNA. Conclusions NS1 is identified as a positive regulator of viral protein synthesis. We propose a model of translational regulation where NS1 upregulates the synthesis of viral proteins, including itself, and creates a positive feedback loop of NS1 expression, which rapidly increases the expression of all the viral proteins. The efficient translation of viral reporter mRNAs among cellular mRNAs can account for the observed

  11. Bluetongue virus non-structural protein 1 is a positive regulator of viral protein synthesis.

    Science.gov (United States)

    Boyce, Mark; Celma, Cristina C P; Roy, Polly

    2012-08-29

    Bluetongue virus (BTV) is a double-stranded RNA (dsRNA) virus of the Reoviridae family, which encodes its genes in ten linear dsRNA segments. BTV mRNAs are synthesised by the viral RNA-dependent RNA polymerase (RdRp) as exact plus sense copies of the genome segments. Infection of mammalian cells with BTV rapidly replaces cellular protein synthesis with viral protein synthesis, but the regulation of viral gene expression in the Orbivirus genus has not been investigated. Using an mRNA reporter system based on genome segment 10 of BTV fused with GFP we identify the protein characteristic of this genus, non-structural protein 1 (NS1) as sufficient to upregulate translation. The wider applicability of this phenomenon among the viral genes is demonstrated using the untranslated regions (UTRs) of BTV genome segments flanking the quantifiable Renilla luciferase ORF in chimeric mRNAs. The UTRs of viral mRNAs are shown to be determinants of the amount of protein synthesised, with the pre-expression of NS1 increasing the quantity in each case. The increased expression induced by pre-expression of NS1 is confirmed in virus infected cells by generating a replicating virus which expresses the reporter fused with genome segment 10, using reverse genetics. Moreover, NS1-mediated upregulation of expression is restricted to mRNAs which lack the cellular 3' poly(A) sequence identifying the 3' end as a necessary determinant in specifically increasing the translation of viral mRNA in the presence of cellular mRNA. NS1 is identified as a positive regulator of viral protein synthesis. We propose a model of translational regulation where NS1 upregulates the synthesis of viral proteins, including itself, and creates a positive feedback loop of NS1 expression, which rapidly increases the expression of all the viral proteins. The efficient translation of viral reporter mRNAs among cellular mRNAs can account for the observed replacement of cellular protein synthesis with viral protein

  12. RasGRP3 regulates the migration of glioma cells via interaction with Arp3

    Science.gov (United States)

    Lee, Hae Kyung; Finniss, Susan; Cazacu, Simona; Xiang, Cunli; Poisson, Laila M.; Blumberg, Peter M.; Brodie, Chaya

    2015-01-01

    Glioblastoma (GBM), the most aggressive primary brain tumors, are highly infiltrative. Although GBM express high Ras activity and Ras proteins have been implicated in gliomagenesis, Ras-activating mutations are not frequent in these tumors. RasGRP3, an important signaling protein responsive to diacylglycerol (DAG), increases Ras activation. Here, we examined the expression and functions of RasGRP3 in GBM and glioma cells. RasGRP3 expression was upregulated in GBM specimens and glioma stem cells compared with normal brains and neural stem cells, respectively. RasGRP3 activated Ras and Rap1 in glioma cells and increased cell migration and invasion partially via Ras activation. Using pull-down assay and mass spectroscopy we identified the actin-related protein, Arp3, as a novel interacting protein of RasGRP3. The interaction of RasGRP3 and Arp3 was validated by immunofluorescence staining and co-immunoprecipitation, and PMA, which activates RasGRP3 and induces its translocation to the peri-nuclear region, increased the association of Arp3 and RasGRP3. Arp3 was upregulated in GBM, regulated cell spreading and migration and its silencing partially decreased these effects of RasGRP3 in glioma cells. In summary, RasGRP3 acts as an important integrating signaling protein of the DAG and Ras signaling pathways and actin polymerization and represents an important therapeutic target in GBM. PMID:25682201

  13. Inhibition of the neutrophil oxidative burst by sphingoid long-chain bases: role of protein kinase C in the activation of the burst

    International Nuclear Information System (INIS)

    Wilson, E.; Olcott, M.C.; Bell, R.M.; Merrill, A.H.; Lambeth, J.D.

    1986-01-01

    The neutrophil oxidative burst is triggered by a variety of both particulate (opsonized zymosan) and soluble agonists [formylmethionylleucylphenylalanine (FMLP), arachidonate, short-chained diacylglycerols (DAG) and phorbol myristate acetate (PMA)]. The authors show that the long-chain lipid bases sphinganine and sphingosine block activation of the burst in human neutrophils. Inhibition is reversible, does not alter cell viability, and does not affect phagocytosis. The inhibition affects the activation mechanism rather than the NADPH-oxidase enzyme. The structural requirements for inhibition include a hydrophobic carbon chain and an amino-containing headgroup, and the naturally occurring erythro sphinganine was more potent than the threo isomer. Activation of the oxidative burst by a variety of agonists was blocked by the same concentration of sphinganine indicating a common inhibited step. The authors suggest that the common step is protein kinase C, as evidenced by the following: 1) long-chain bases inhibit PKC in a micelle reconstituted system, 2) PMA-induced phophorylation is inhibited by sphinganine, and 3) sphinganine competes with ( 3 H)-phorbol dibutyrate for its cytosolic receptor (i.e. protein kinase C). The authors suggest that sphingoid long-chain bases play a role in the cellular regulations

  14. RACK1, A Multifaceted Scaffolding Protein: Structure and Function

    LENUS (Irish Health Repository)

    Adams, David R

    2011-10-06

    Abstract The Receptor for Activated C Kinase 1 (RACK1) is a member of the tryptophan-aspartate repeat (WD-repeat) family of proteins and shares significant homology to the β subunit of G-proteins (Gβ). RACK1 adopts a seven-bladed β-propeller structure which facilitates protein binding. RACK1 has a significant role to play in shuttling proteins around the cell, anchoring proteins at particular locations and in stabilising protein activity. It interacts with the ribosomal machinery, with several cell surface receptors and with proteins in the nucleus. As a result, RACK1 is a key mediator of various pathways and contributes to numerous aspects of cellular function. Here, we discuss RACK1 gene and structure and its role in specific signaling pathways, and address how posttranslational modifications facilitate subcellular location and translocation of RACK1. This review condenses several recent studies suggesting a role for RACK1 in physiological processes such as development, cell migration, central nervous system (CN) function and circadian rhythm as well as reviewing the role of RACK1 in disease.

  15. A 6-DOF parallel bone-grinding robot for cervical disc replacement surgery.

    Science.gov (United States)

    Tian, Heqiang; Wang, Chenchen; Dang, Xiaoqing; Sun, Lining

    2017-12-01

    Artificial cervical disc replacement surgery has become an effective and main treatment method for cervical disease, which has become a more common and serious problem for people with sedentary work. To improve cervical disc replacement surgery significantly, a 6-DOF parallel bone-grinding robot is developed for cervical bone-grinding by image navigation and surgical plan. The bone-grinding robot including mechanical design and low level control is designed. The bone-grinding robot navigation is realized by optical positioning with spatial registration coordinate system defined. And a parametric robot bone-grinding plan and high level control have been developed for plane grinding for cervical top endplate and tail endplate grinding by a cylindrical grinding drill and spherical grinding for two articular surfaces of bones by a ball grinding drill. Finally, the surgical flow for a robot-assisted cervical disc replacement surgery procedure is present. The final experiments results verified the key technologies and performance of the robot-assisted surgery system concept excellently, which points out a promising clinical application with higher operability. Finally, study innovations, study limitations, and future works of this present study are discussed, and conclusions of this paper are also summarized further. This bone-grinding robot is still in the initial stage, and there are many problems to be solved from a clinical point of view. Moreover, the technique is promising and can give a good support for surgeons in future clinical work.

  16. A 3-DOF parallel robot with spherical motion for the rehabilitation and evaluation of balance performance.

    Science.gov (United States)

    Patanè, Fabrizio; Cappa, Paolo

    2011-04-01

    In this paper a novel electrically actuated parallel robot with three degrees-of-freedom (3 DOF) for dynamic postural studies is presented. The design has been described, the solution to the inverse kinematics has been found, and a numerical solution for the direct kinematics has been proposed. The workspace of the implemented robot is characterized by an angular range of motion of about ±10° for roll and pitch when yaw is in the range ±15°. The robot was constructed and the orientation accuracy was tested by means of an optoelectronic system and by imposing a sinusoidal input, with a frequency of 1 Hz and amplitude of 10°, along the three axes, in sequence. The collected data indicated a phase delay of 1° and an amplitude error of 0.5%-1.5%; similar values were observed for cross-axis sensitivity errors. We also conducted a clinical application on a group of normal subjects, who were standing in equilibrium on the robot base with eyes open (EO) and eyes closed (EC), which was rotated with a tri-axial sinusoidal trajectory with a frequency of 0.5 Hz and amplitude 5° for roll and pitch and 10° for the yaw. The postural configuration of the subjects was recorded with an optoelectronic system. However, due to the mainly technical nature of this paper, only initial validation outcomes are reported here. The clinical application showed that only the tilt and displacement on the sagittal pane of head, trunk, and pelvis in the trials conducted with eyes closed were affected by drift and that the reduction of the yaw rotation and of the mediolateral translation was not a controlled parameter, as happened, instead, for the other anatomical directions.

  17. DGAT1 Expression Increases Heart Triglyceride Content but Ameliorates Lipotoxicity*

    OpenAIRE

    Liu, Li; Shi, XiaoJing; Bharadwaj, Kalyani G.; Ikeda, Shota; Yamashita, Haruyo; Yagyu, Hiroaki; Schaffer, Jean E.; Yu, Yi-Hao; Goldberg, Ira J.

    2009-01-01

    Intracellular lipid accumulation in the heart is associated with cardiomyopathy, yet the precise role of triglyceride (TG) remains unclear. With exercise, wild type hearts develop physiologic hypertrophy. This was associated with greater TG stores and a marked induction of the TG-synthesizing enzyme diacylglycerol (DAG) acyltransferase 1 (DGAT1). Transgenic overexpression of DGAT1 in the heart using the cardiomyocyte- specific α-myosin heavy chain (MHC) promoter led to approximately a doublin...

  18. PI3-kinase γ promotes Rap1a-mediated activation of myeloid cell integrin α4β1, leading to tumor inflammation and growth.

    Directory of Open Access Journals (Sweden)

    Michael C Schmid

    Full Text Available Tumor inflammation, the recruitment of myeloid lineage cells into the tumor microenvironment, promotes angiogenesis, immunosuppression and metastasis. CD11b+Gr1lo monocytic lineage cells and CD11b+Gr1hi granulocytic lineage cells are recruited from the circulation by tumor-derived chemoattractants, which stimulate PI3-kinase γ (PI3Kγ-mediated integrin α4 activation and extravasation. We show here that PI3Kγ activates PLCγ, leading to RasGrp/CalDAG-GEF-I&II mediated, Rap1a-dependent activation of integrin α4β1, extravasation of monocytes and granulocytes, and inflammation-associated tumor progression. Genetic depletion of PLCγ, CalDAG-GEFI or II, Rap1a, or the Rap1 effector RIAM was sufficient to prevent integrin α4 activation by chemoattractants or activated PI3Kγ (p110γCAAX, while activated Rap (RapV12 promoted constitutive integrin activation and cell adhesion that could only be blocked by inhibition of RIAM or integrin α4β1. Similar to blockade of PI3Kγ or integrin α4β1, blockade of Rap1a suppressed both the recruitment of monocytes and granulocytes to tumors and tumor progression. These results demonstrate critical roles for a PI3Kγ-Rap1a-dependent pathway in integrin activation during tumor inflammation and suggest novel avenues for cancer therapy.

  19. Design and analysis of a 3-DOF planar micromanipulation stage with large rotational displacement for micromanipulation system

    Directory of Open Access Journals (Sweden)

    B. Ding

    2017-05-01

    Full Text Available Flexure-based mechanisms have been widely used for scanning tunneling microscopy, nanoimprint lithography, fast servo tool system and micro/nano manipulation. In this paper, a novel planar micromanipulation stage with large rotational displacement is proposed. The designed monolithic manipulator has three degrees of freedom (DOF, i.e. two translations along the X and Y axes and one rotation around Z axis. In order to get a large workspace, the lever mechanism is adopted to magnify the stroke of the piezoelectric actuators and also the leaf beam flexure is utilized due to its large rotational scope. Different from conventional pre-tightening mechanism, a modified pre-tightening mechanism, which is less harmful to the stacked actuators, is proposed in this paper. Taking the circular flexure hinges and leaf beam flexures hinges as revolute joints, the forward kinematics and inverse kinematics models of this stage are derived. The workspace of the micromanipulator is finally obtained, which is based on the derived kinematic models.

  20. PENGKLONAN DAN PERUNUTAN NUKLEOTIDA GEN SELUBUNG PROTEIN DAN 3’UTR (untranslated region PEANUT STRIPE VIRUS

    Directory of Open Access Journals (Sweden)

    Hasriadi Mat Akin

    2011-10-01

    Full Text Available Cloning and sequencing of coat protein gene and 3’UTR (untranslated region of peanut stripe virus. The cDNA of 3' terminal of peanut stripe virus genomic RNA was cloned and sequenced. The cDNA was ligated with plasmid vector pGEM-T Easy and transformed to competent cells of Escherichia coli. The 3' terminal of PstV genomic RNA contained 1195 nucleotides (nts.  The region included the nucleotide sequences of NIb (nuclear inclusion body (129 nts, CP gene (coat protein gene (861 nts, and 3'UTR (untranslated region (205 nts. The nucleotide sequence of a CP gene contained one long uninterrupted open reading frame (ORF without a start codon, which ended a UAG stop codon. The 287 amino acid residues of PStV coat protein were predicted from the CP gene.  The amino acid was analyzed for the presence of consensus polyprotein cleavage site for maturation of potyvirus polyprotein.  A putative cleavage site was found at position 43 (Q/S following the Valine (V residue at -4 position.  This isolate of PstV can be expected to be aphid transmissible because the coat protein contained a DAG triplet at position 53-55.

  1. Role of fruA and csgA genes in gene expression during development of Myxococcus xanthus. Analysis by two-dimensional gel electrophoresis.

    Science.gov (United States)

    Horiuchi, Takayuki; Taoka, Masato; Isobe, Toshiaki; Komano, Teruya; Inouye, Sumiko

    2002-07-26

    Two genes, fruA and csgA, encoding a putative transcription factor and C-factor, respectively, are essential for fruiting body formation of Myxococcus xanthus. To investigate the role of fruA and csgA genes in developmental gene expression, developing cells as well as vegetative cells of M. xanthus wild-type, fruA::Tc, and csgA731 strains were pulse-labeled with [(35)S]methionine, and the whole cell proteins were analyzed using two-dimensional immobilized pH gradient/SDS-PAGE. Differences in protein synthesis patterns among more than 700 protein spots were detected during development of the three strains. Fourteen proteins showing distinctly different expression patterns in mutant cells were analyzed in more detail. Five of the 14 proteins were identified as elongation factor Tu (EF-Tu), Dru, DofA, FruA, and protein S by immunoblot analysis and mass spectroscopy. A gene encoding DofA was cloned and sequenced. Although both fruA and csgA genes regulate early development of M. xanthus, they were found to differently regulate expression of several developmental genes. The production of six proteins, including DofA and protein S, was dependent on fruA, whereas the production of two proteins was dependent on csgA, and one protein was dependent on both fruA and csgA. To explain the present findings, a new model was presented in which different levels of FruA phosphorylation may distinctively regulate the expression of two groups of developmental genes.

  2. PINK1-Interacting Proteins: Proteomic Analysis of Overexpressed PINK1

    Directory of Open Access Journals (Sweden)

    Aleksandar Rakovic

    2011-01-01

    Full Text Available Recent publications suggest that the Parkinson's disease- (PD- related PINK1/Parkin pathway promotes elimination of dysfunctional mitochondria by autophagy. We used tandem affinity purification (TAP, SDS-PAGE, and mass spectrometry as a first step towards identification of possible substrates for PINK1. The cellular abundance of selected identified interactors was investigated by Western blotting. Furthermore, one candidate gene was sequenced in 46 patients with atypical PD. In addition to two known binding partners (HSP90, CDC37, 12 proteins were identified using the TAP assay; four of which are mitochondrially localized (GRP75, HSP60, LRPPRC, and TUFM. Western blot analysis showed no differences in cellular abundance of these proteins comparing PINK1 mutant and control fibroblasts. When sequencing LRPPRC, four exonic synonymous changes and 20 polymorphisms in noncoding regions were detected. Our study provides a list of putative PINK1 binding partners, confirming previously described interactions, but also introducing novel mitochondrial proteins as potential components of the PINK1/Parkin mitophagy pathway.

  3. Structural studies of human glioma pathogenesis-related protein 1

    Energy Technology Data Exchange (ETDEWEB)

    Asojo, Oluwatoyin A., E-mail: oasojo@unmc.edu [College of Medicine, Nebraska Medical Center, Omaha, NE 68198-6495 (United States); Koski, Raymond A.; Bonafé, Nathalie [L2 Diagnostics LLC, 300 George Street, New Haven, CT 06511 (United States); College of Medicine, Nebraska Medical Center, Omaha, NE 68198-6495 (United States)

    2011-10-01

    Structural analysis of a truncated soluble domain of human glioma pathogenesis-related protein 1, a membrane protein implicated in the proliferation of aggressive brain cancer, is presented. Human glioma pathogenesis-related protein 1 (GLIPR1) is a membrane protein that is highly upregulated in brain cancers but is barely detectable in normal brain tissue. GLIPR1 is composed of a signal peptide that directs its secretion, a conserved cysteine-rich CAP (cysteine-rich secretory proteins, antigen 5 and pathogenesis-related 1 proteins) domain and a transmembrane domain. GLIPR1 is currently being investigated as a candidate for prostate cancer gene therapy and for glioblastoma targeted therapy. Crystal structures of a truncated soluble domain of the human GLIPR1 protein (sGLIPR1) solved by molecular replacement using a truncated polyalanine search model of the CAP domain of stecrisp, a snake-venom cysteine-rich secretory protein (CRISP), are presented. The correct molecular-replacement solution could only be obtained by removing all loops from the search model. The native structure was refined to 1.85 Å resolution and that of a Zn{sup 2+} complex was refined to 2.2 Å resolution. The latter structure revealed that the putative binding cavity coordinates Zn{sup 2+} similarly to snake-venom CRISPs, which are involved in Zn{sup 2+}-dependent mechanisms of inflammatory modulation. Both sGLIPR1 structures have extensive flexible loop/turn regions and unique charge distributions that were not observed in any of the previously reported CAP protein structures. A model is also proposed for the structure of full-length membrane-bound GLIPR1.

  4. Identification of a 34 kDa protein altered in the LF-1 mutant as the herbicide-binding D1 protein of photosystem II

    International Nuclear Information System (INIS)

    Metz, J.; Pakrasi, H.; Seibert, M.; Arntzen, C.

    1986-01-01

    The LF-1 mutant of Scenedesmus has a complete block on the oxidizing side of its PSII reaction center. However, the reaction center as well as the reducing side of PSII is fully functional in this mutant. Compared to the wildtype (WT) the only detected protein difference in the PSII complex of LF-1 is the change in mobility of a 34 kDa protein to 36 kDa. This protein has been implicated to have a major role in Mn-binding and water-oxidation. The authors have recently shown that photoaffinity labeling of thylakoids with azido-[ 14 C]-atrazine tags the 34 kDa protein in WT and the 36 kDa protein in LF-1. It has been shown that the azido-atrazine labeled protein, called D1, functions in herbicide binding and Q/sub A/ to Q/sub B/ electron transfer on the reducing side of PSII. Polyclonal antibodies directed against the D1 protein of Amaranthus hybridus (Ohad, et al., EMBOJ 1985) were found to recognize the Scenedesmus 34 kDa (WT) and 36 kDa (LF-1) proteins. The implied dual function for the D1 protein on the reducing as well as the oxidizing side of PSII reaction center will be discussed

  5. Analysis of Select Herpes Simplex Virus 1 (HSV-1) Proteins for Restriction of Human Immunodeficiency Virus Type 1 (HIV-1): HSV-1 gM Protein Potently Restricts HIV-1 by Preventing Intracellular Transport and Processing of Env gp160.

    Science.gov (United States)

    Polpitiya Arachchige, Sachith; Henke, Wyatt; Pramanik, Ankita; Kalamvoki, Maria; Stephens, Edward B

    2018-01-15

    Virus-encoded proteins that impair or shut down specific host cell functions during replication can be used as probes to identify potential proteins/pathways used in the replication of viruses from other families. We screened nine proteins from herpes simplex virus 1 (HSV-1) for the ability to enhance or restrict human immunodeficiency virus type 1 (HIV-1) replication. We show that several HSV-1 proteins (glycoprotein M [gM], US3, and UL24) potently restricted the replication of HIV-1. Unlike UL24 and US3, which reduced viral protein synthesis, we observed that gM restriction of HIV-1 occurred through interference with the processing and transport of gp160, resulting in a significantly reduced level of mature gp120/gp41 released from cells. Finally, we show that an HSV-1 gM mutant lacking the majority of the C-terminal domain (HA-gM[Δ345-473]) restricted neither gp160 processing nor the release of infectious virus. These studies identify proteins from heterologous viruses that can restrict viruses through novel pathways. IMPORTANCE HIV-1 infection of humans results in AIDS, characterized by the loss of CD4 + T cells and increased susceptibility to opportunistic infections. Both HIV-1 and HSV-1 can infect astrocytes and microglia of the central nervous system (CNS). Thus, the identification of HSV-1 proteins that directly restrict HIV-1 or interfere with pathways required for HIV-1 replication could lead to novel antiretroviral strategies. The results of this study show that select viral proteins from HSV-1 can potently restrict HIV-1. Further, our results indicate that the gM protein of HSV-1 restricts HIV-1 through a novel pathway by interfering with the processing of gp160 and its incorporation into virus maturing from the cell. Copyright © 2018 American Society for Microbiology.

  6. Expression of Insoluble Influenza Neuraminidase Type 1 (NA1 Protein in Tobacco

    Directory of Open Access Journals (Sweden)

    Teen Lee Pua

    2012-12-01

    Full Text Available The avian influenza virus, particularly H5N1 strain, is highly virulent to poultry and mankind. Several expression systems, like yeast, baculovirus and mammalian cells, have been adopted to produce vaccine candidate for this lethal disease. The present research aimed at developing a recombinant vaccine candidate, neuraminidase type 1 (NA1, for the Malaysia isolate of H5N1 in Nicotiana benthamiana. The NA1 gene was fused directly in-frame in cowpea mosaic virus (CPMV-based pEAQ-HT vector with C-terminal polyhistidine-tag incorporated to ease the subsequent purification step. The expression of the NA1 gene in tobacco was confirmed at RNA and protein levels at 6 days post-infiltration (Dpi. From the insoluble fraction of the protein, a recombinant glycosylated NA1 protein with a molecular weight of ~56 kDa was immunogenically detected by a specific anti-NA polyclonal antibody. We report for the first time the insolubility of the plant-made NA1 protein where a native sequence was used for its expression. This study signifies the necessity of the use of optimised sequences for expression work and provides great opportunity for the exploration of plant-manufactured NA1 protein as vaccine candidate.

  7. Characteristics of energy exchange between inter- and intramolecular degrees of freedom in crystalline 1,3,5-triamino-2,4,6-trinitrobenzene (TATB) with implications for coarse-grained simulations of shock waves in polyatomic molecular crystals.

    Science.gov (United States)

    Kroonblawd, Matthew P; Sewell, Thomas D; Maillet, Jean-Bernard

    2016-02-14

    In this report, we characterize the kinetics and dynamics of energy exchange between intramolecular and intermolecular degrees of freedom (DoF) in crystalline 1,3,5-triamino-2,4,6-trinitrobenzene (TATB). All-atom molecular dynamics (MD) simulations are used to obtain predictions for relaxation from certain limiting initial distributions of energy between the intra- and intermolecular DoF. The results are used to parameterize a coarse-grained Dissipative Particle Dynamics at constant Energy (DPDE) model for TATB. Each TATB molecule in the DPDE model is represented as an all-atom, rigid-molecule mesoparticle, with explicit external (molecular translational and rotational) DoF and coarse-grained implicit internal (vibrational) DoF. In addition to conserving linear and angular momentum, the DPDE equations of motion conserve the total system energy provided that particles can exchange energy between their external and internal DoF. The internal temperature of a TATB molecule is calculated using an internal equation of state, which we develop here, and the temperatures of the external and internal DoF are coupled using a fluctuation-dissipation relation. The DPDE force expression requires specification of the input parameter σ that determines the rate at which energy is exchanged between external and internal DoF. We adjusted σ based on the predictions for relaxation processes obtained from MD simulations. The parameterized DPDE model was employed in large-scale simulations of shock compression of TATB. We show that the rate of energy exchange governed by σ can significantly influence the transient behavior of the system behind the shock.

  8. Characteristics of energy exchange between inter- and intramolecular degrees of freedom in crystalline 1,3,5-triamino-2,4,6-trinitrobenzene (TATB) with implications for coarse-grained simulations of shock waves in polyatomic molecular crystals

    International Nuclear Information System (INIS)

    Kroonblawd, Matthew P.; Sewell, Thomas D.; Maillet, Jean-Bernard

    2016-01-01

    In this report, we characterize the kinetics and dynamics of energy exchange between intramolecular and intermolecular degrees of freedom (DoF) in crystalline 1,3,5-triamino-2,4,6-trinitrobenzene (TATB). All-atom molecular dynamics (MD) simulations are used to obtain predictions for relaxation from certain limiting initial distributions of energy between the intra- and intermolecular DoF. The results are used to parameterize a coarse-grained Dissipative Particle Dynamics at constant Energy (DPDE) model for TATB. Each TATB molecule in the DPDE model is represented as an all-atom, rigid-molecule mesoparticle, with explicit external (molecular translational and rotational) DoF and coarse-grained implicit internal (vibrational) DoF. In addition to conserving linear and angular momentum, the DPDE equations of motion conserve the total system energy provided that particles can exchange energy between their external and internal DoF. The internal temperature of a TATB molecule is calculated using an internal equation of state, which we develop here, and the temperatures of the external and internal DoF are coupled using a fluctuation-dissipation relation. The DPDE force expression requires specification of the input parameter σ that determines the rate at which energy is exchanged between external and internal DoF. We adjusted σ based on the predictions for relaxation processes obtained from MD simulations. The parameterized DPDE model was employed in large-scale simulations of shock compression of TATB. We show that the rate of energy exchange governed by σ can significantly influence the transient behavior of the system behind the shock

  9. Characteristics of energy exchange between inter- and intramolecular degrees of freedom in crystalline 1,3,5-triamino-2,4,6-trinitrobenzene (TATB) with implications for coarse-grained simulations of shock waves in polyatomic molecular crystals

    Science.gov (United States)

    Kroonblawd, Matthew P.; Sewell, Thomas D.; Maillet, Jean-Bernard

    2016-02-01

    In this report, we characterize the kinetics and dynamics of energy exchange between intramolecular and intermolecular degrees of freedom (DoF) in crystalline 1,3,5-triamino-2,4,6-trinitrobenzene (TATB). All-atom molecular dynamics (MD) simulations are used to obtain predictions for relaxation from certain limiting initial distributions of energy between the intra- and intermolecular DoF. The results are used to parameterize a coarse-grained Dissipative Particle Dynamics at constant Energy (DPDE) model for TATB. Each TATB molecule in the DPDE model is represented as an all-atom, rigid-molecule mesoparticle, with explicit external (molecular translational and rotational) DoF and coarse-grained implicit internal (vibrational) DoF. In addition to conserving linear and angular momentum, the DPDE equations of motion conserve the total system energy provided that particles can exchange energy between their external and internal DoF. The internal temperature of a TATB molecule is calculated using an internal equation of state, which we develop here, and the temperatures of the external and internal DoF are coupled using a fluctuation-dissipation relation. The DPDE force expression requires specification of the input parameter σ that determines the rate at which energy is exchanged between external and internal DoF. We adjusted σ based on the predictions for relaxation processes obtained from MD simulations. The parameterized DPDE model was employed in large-scale simulations of shock compression of TATB. We show that the rate of energy exchange governed by σ can significantly influence the transient behavior of the system behind the shock.

  10. Robotic-based carbon ion therapy and patient positioning in 6 degrees of freedom: setup accuracy of two standard immobilization devices used in carbon ion therapy and IMRT.

    Science.gov (United States)

    Jensen, Alexandra D; Winter, Marcus; Kuhn, Sabine P; Debus, Jürgen; Nairz, Olaf; Münter, Marc W

    2012-03-29

    To investigate repositioning accuracy in particle radiotherapy in 6 degrees of freedom (DOF) and intensity-modulated radiotherapy (IMRT, 3 DOF) for two immobilization devices (Scotchcast masks vs thermoplastic head masks) currently in use at our institution for fractionated radiation therapy in head and neck cancer patients. Position verifications in patients treated with carbon ion therapy and IMRT for head and neck malignancies were evaluated. Most patients received combined treatment regimen (IMRT plus carbon ion boost), immobilization was achieved with either Scotchcast or thermoplastic head masks. Position corrections in robotic-based carbon ion therapy allowing 6 DOF were compared to IMRT allowing corrections in 3 DOF for two standard immobilization devices. In total, 838 set-up controls of 38 patients were analyzed. Robotic-based position correction including correction of rotations was well tolerated and without discomfort. Standard deviations of translational components were between 0.5 and 0.8 mm for Scotchcast and 0.7 and 1.3 mm for thermoplastic masks in 6 DOF and 1.2-1.4 mm and 1.0-1.1 mm in 3 DOF respectively. Mean overall displacement vectors were between 2.1 mm (Scotchcast) and 2.9 mm (thermoplastic masks) in 6 DOF and 3.9-3.0 mm in 3 DOF respectively. Displacement vectors were lower when correction in 6 DOF was allowed as opposed to 3 DOF only, which was maintained at the traditional action level of >3 mm for position correction in the pre-on-board imaging era. Setup accuracy for both systems was within the expected range. Smaller shifts were required when 6 DOF were available for correction as opposed to 3 DOF. Where highest possible positioning accuracy is required, frequent image guidance is mandatory to achieve best possible plan delivery and maintenance of sharp gradients and optimal normal tissue sparing inherent in carbon ion therapy.

  11. Proteomic analysis of the herpes simplex virus 1 virion protein 16 transactivator protein in infected cells.

    Science.gov (United States)

    Suk, Hyung; Knipe, David M

    2015-06-01

    The herpes simplex virus 1 virion protein 16 (VP16) tegument protein forms a transactivation complex with the cellular proteins host cell factor 1 (HCF-1) and octamer-binding transcription factor 1 (Oct-1) upon entry into the host cell. VP16 has also been shown to interact with a number of virion tegument proteins and viral glycoprotein H to promote viral assembly, but no comprehensive study of the VP16 proteome has been performed at early times postinfection. We therefore performed a proteomic analysis of VP16-interacting proteins at 3 h postinfection. We confirmed the interaction of VP16 with HCF-1 and a large number of cellular Mediator complex proteins, but most surprisingly, we found that the major viral protein associating with VP16 is the infected cell protein 4 (ICP4) immediate-early (IE) transactivator protein. These results raise the potential for a new function for VP16 in associating with the IE ICP4 and playing a role in transactivation of early and late gene expression, in addition to its well-documented function in transactivation of IE gene expression. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Production of recombinant dengue non-structural 1 (NS1) proteins from clinical virus isolates.

    Science.gov (United States)

    Yohan, Benediktus; Wardhani, Puspa; Aryati; Trimarsanto, Hidayat; Sasmono, R Tedjo

    2017-01-01

    Dengue is a febrile disease caused by infection of dengue virus (DENV). Early diagnosis of dengue infection is important for better management of the disease. The DENV Non-Structural Protein 1 (NS1) antigen has been routinely used for the early dengue detection. In dengue epidemic countries such as Indonesia, clinicians are increasingly relying on the NS1 detection for confirmation of dengue infection. Various NS1 diagnostic tests are commercially available, however different sensitivities and specificities were observed in various settings. This study was aimed to generate dengue NS1 recombinant protein for the development of dengue diagnostic tests. Four Indonesian DENV isolates were used as the source of the NS1 gene cloning, expression, and purification in bacterial expression system. Recombinant NS1 proteins were successfully purified and their antigenicities were assessed. Immunization of mice with recombinant proteins observed the immunogenicity of the NS1 protein. The generated recombinant proteins can be potentially used in the development of NS1 diagnostic test. With minimal modifications, this method can be used for producing NS1 recombinant proteins from isolates obtained from other geographical regions. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Dephosphorylation of chicken cardiac myofibril C-protein by protein phosphatases 1 and 2A

    International Nuclear Information System (INIS)

    Thysseril, T.J.; Hegazy, M.G.; Schlender, K.K.

    1987-01-01

    C-Protein, which is a regulatory component of cardiac muscle myofibrils, is phosphorylated in response to β-adrenergic agonists by a cAMP-dependent mechanism and dephosphorylated in response to cholinergic agonists. It is believed that the cAMP-dependent phosphorylation is due to cAMP-dependent protein kinase. The protein phosphatase(s) involved in the dephosphorylation of C-protein has not been determined. In this study, chicken cardiac C-protein was phosphorylated with the cAMP-dependent protein kinase to about 3 mol phosphate/mol C-protein. Incubation of [ 32 P]C-protein with the catalytic subunit of protein phosphatase 1 or 2A rapidly removed 30-40% of 32 [P]. Phosphopeptide maps and phosphoamino acid analysis revealed that the major site(s) dephosphorylated by either phosphatase was a phosphothreonine residue(s) located on the same tryptic peptide and on the same CNBr fragment. Increasing the incubation period or the phosphatase concentration did not result in any further dephosphorylation of C-protein by phosphatase 1, but phosphatase 2A completely dephosphorylated C-protein. Preliminary studies showed that the major protein phosphatase associated with the myofibril was phosphatase 2A. These results indicate the phosphatase 2A may be important in the regulation of the phosphorylation state of C-protein

  14. Ontologies and tag-statistics

    Science.gov (United States)

    Tibély, Gergely; Pollner, Péter; Vicsek, Tamás; Palla, Gergely

    2012-05-01

    Due to the increasing popularity of collaborative tagging systems, the research on tagged networks, hypergraphs, ontologies, folksonomies and other related concepts is becoming an important interdisciplinary area with great potential and relevance for practical applications. In most collaborative tagging systems the tagging by the users is completely ‘flat’, while in some cases they are allowed to define a shallow hierarchy for their own tags. However, usually no overall hierarchical organization of the tags is given, and one of the interesting challenges of this area is to provide an algorithm generating the ontology of the tags from the available data. In contrast, there are also other types of tagged networks available for research, where the tags are already organized into a directed acyclic graph (DAG), encapsulating the ‘is a sub-category of’ type of hierarchy between each other. In this paper, we study how this DAG affects the statistical distribution of tags on the nodes marked by the tags in various real networks. The motivation for this research was the fact that understanding the tagging based on a known hierarchy can help in revealing the hidden hierarchy of tags in collaborative tagging systems. We analyse the relation between the tag-frequency and the position of the tag in the DAG in two large sub-networks of the English Wikipedia and a protein-protein interaction network. We also study the tag co-occurrence statistics by introducing a two-dimensional (2D) tag-distance distribution preserving both the difference in the levels and the absolute distance in the DAG for the co-occurring pairs of tags. Our most interesting finding is that the local relevance of tags in the DAG (i.e. their rank or significance as characterized by, e.g., the length of the branches starting from them) is much more important than their global distance from the root. Furthermore, we also introduce a simple tagging model based on random walks on the DAG, capable of

  15. Ontologies and tag-statistics

    International Nuclear Information System (INIS)

    Tibély, Gergely; Vicsek, Tamás; Pollner, Péter; Palla, Gergely

    2012-01-01

    Due to the increasing popularity of collaborative tagging systems, the research on tagged networks, hypergraphs, ontologies, folksonomies and other related concepts is becoming an important interdisciplinary area with great potential and relevance for practical applications. In most collaborative tagging systems the tagging by the users is completely ‘flat’, while in some cases they are allowed to define a shallow hierarchy for their own tags. However, usually no overall hierarchical organization of the tags is given, and one of the interesting challenges of this area is to provide an algorithm generating the ontology of the tags from the available data. In contrast, there are also other types of tagged networks available for research, where the tags are already organized into a directed acyclic graph (DAG), encapsulating the ‘is a sub-category of’ type of hierarchy between each other. In this paper, we study how this DAG affects the statistical distribution of tags on the nodes marked by the tags in various real networks. The motivation for this research was the fact that understanding the tagging based on a known hierarchy can help in revealing the hidden hierarchy of tags in collaborative tagging systems. We analyse the relation between the tag-frequency and the position of the tag in the DAG in two large sub-networks of the English Wikipedia and a protein-protein interaction network. We also study the tag co-occurrence statistics by introducing a two-dimensional (2D) tag-distance distribution preserving both the difference in the levels and the absolute distance in the DAG for the co-occurring pairs of tags. Our most interesting finding is that the local relevance of tags in the DAG (i.e. their rank or significance as characterized by, e.g., the length of the branches starting from them) is much more important than their global distance from the root. Furthermore, we also introduce a simple tagging model based on random walks on the DAG, capable of

  16. Loss of aphid transmissibility of plum pox virus isolates

    NARCIS (Netherlands)

    Kamenova, I.; Lohuis, H.; Peters, D.

    2002-01-01

    The aphid transmissibility of seven Plum pox virus (PPV) isolates and the amino acid sequences of their coat proteins were analysed Two aphid transmissible isolates PPV-A and PPV-P contained the DAG amino triplet, while DAL or NAG replaced this triplet in the coat proteins of non-aphid transmissible

  17. Displacement affinity chromatography of protein phosphatase one (PP1 complexes

    Directory of Open Access Journals (Sweden)

    Gourlay Robert

    2008-11-01

    Full Text Available Abstract Background Protein phosphatase one (PP1 is a ubiquitously expressed, highly conserved protein phosphatase that dephosphorylates target protein serine and threonine residues. PP1 is localized to its site of action by interacting with targeting or regulatory proteins, a majority of which contains a primary docking site referred to as the RVXF/W motif. Results We demonstrate that a peptide based on the RVXF/W motif can effectively displace PP1 bound proteins from PP1 retained on the phosphatase affinity matrix microcystin-Sepharose. Subsequent co-immunoprecipitation experiments confirmed that each identified binding protein was either a direct PP1 interactor or was in a complex that contains PP1. Our results have linked PP1 to numerous new nuclear functions and proteins, including Ki-67, Rif-1, topoisomerase IIα, several nuclear helicases, NUP153 and the TRRAP complex. Conclusion This modification of the microcystin-Sepharose technique offers an effective means of purifying novel PP1 regulatory subunits and associated proteins and provides a simple method to uncover a link between PP1 and additional cellular processes.

  18. Nitrate signals determine the sensing of nitrogen through differential expression of genes involved in nitrogen uptake and assimilation in finger millet.

    Science.gov (United States)

    Gupta, Alok Kumar; Gaur, Vikram Singh; Gupta, Sanjay; Kumar, Anil

    2013-06-01

    In order to understand the molecular basis of high nitrogen use efficiency of finger millet, five genes (EcHNRT2, EcLNRT1, EcNADH-NR, EcGS, and EcFd-GOGAT) involved in nitrate uptake and assimilation were isolated using conserved primer approaches. Expression profiles of these five genes along with the previously isolated EcDof1 was studied under increased KNO3 concentrations (0.15 to 1,500 μM) for 2 h as well as at 1.5 μM for 24 h in the roots and shoots of 25 days old nitrogen deprived two contrasting finger millet genotypes (GE-3885 and GE-1437) differing in grain protein content (13.76 and 6.15 %, respectively). Time kinetics experiment revealed that, all the five genes except EcHNRT2 in the leaves of GE-3885 were induced within 30 min of nitrate exposure indicating that there might be a greater nitrogen deficit in leaves and therefore quick transportation of nitrate signals to the leaves. Exposing the plants to increasing nitrate concentrations for 2 h showed that in roots of GE-3885, NR was strongly induced while GS was repressed; however, the pattern was found to be reversed in leaves of GE-1437 indicating that in GE-3885, most of the nitrate might be reduced in the roots but assimilated in leaves and vice-versa. Furthermore, compared with the low-protein genotype, expression of HNRT2 was strongly induced in both roots and shoots of high-protein genotype at the least nitrate concentration supplied. This further indicates that GE-3885 is a quick sensor of nitrogen compared with the low-protein genotype. Furthermore, expression of EcDof1 was also found to overlap the expression of NR, GS, and GOGAT indicating that Dof1 probably regulates the expression of these genes under different conditions by sensing the nitrogen fluctuations around the root zone.

  19. Saccharomyces cerevisiae SSB1 protein and its relationship to nucleolar RNA-binding proteins.

    OpenAIRE

    Jong, A Y; Clark, M W; Gilbert, M; Oehm, A; Campbell, J L

    1987-01-01

    To better define the function of Saccharomyces cerevisiae SSB1, an abundant single-stranded nucleic acid-binding protein, we determined the nucleotide sequence of the SSB1 gene and compared it with those of other proteins of known function. The amino acid sequence contains 293 amino acid residues and has an Mr of 32,853. There are several stretches of sequence characteristic of other eucaryotic single-stranded nucleic acid-binding proteins. At the amino terminus, residues 39 to 54 are highly ...

  20. Depletion of WRN protein causes RACK1 to activate several protein kinase C isoforms

    DEFF Research Database (Denmark)

    Massip, L; Garand, C; Labbé, A

    2010-01-01

    show that a knock down of the WRN protein in normal human fibroblasts induces phosphorylation and activation of several protein kinase C (PKC) enzymes. Using a tandem affinity purification strategy, we found that WRN physically and functionally interacts with receptor for activated C-kinase 1 (RACK1......), a highly conserved anchoring protein involved in various biological processes, such as cell growth and proliferation. RACK1 binds strongly to the RQC domain of WRN and weakly to its acidic repeat region. Purified RACK1 has no impact on the helicase activity of WRN, but selectively inhibits WRN exonuclease...... activity in vitro. Interestingly, knocking down RACK1 increased the cellular frequency of DNA breaks. Depletion of the WRN protein in return caused a fraction of nuclear RACK1 to translocate out of the nucleus to bind and activate PKCdelta and PKCbetaII in the membrane fraction of cells. In contrast...

  1. Neutral sphingomyelinase (SMPD3) deficiency disrupts the Golgi secretory pathway and causes growth inhibition

    Science.gov (United States)

    Stoffel, Wilhelm; Hammels, Ina; Jenke, Bitta; Binczek, Erika; Schmidt-Soltau, Inga; Brodesser, Susanne; Schauss, Astrid; Etich, Julia; Heilig, Juliane; Zaucke, Frank

    2016-01-01

    Systemic loss of neutral sphingomyelinase (SMPD3) in mice leads to a novel form of systemic, juvenile hypoplasia (dwarfism). SMPD3 deficiency in mainly two growth regulating cell types contributes to the phenotype, in chondrocytes of skeletal growth zones to skeletal malformation and chondrodysplasia, and in hypothalamic neurosecretory neurons to systemic hypothalamus–pituitary–somatotropic hypoplasia. The unbiased smpd3−/− mouse mutant and derived smpd3−/− primary chondrocytes were instrumental in defining the enigmatic role underlying the systemic and cell autonomous role of SMPD3 in the Golgi compartment. Here we describe the unprecedented role of SMPD3. SMPD3 deficiency disrupts homeostasis of sphingomyelin (SM), ceramide (Cer) and diacylglycerol (DAG) in the Golgi SMPD3-SMS1 (SM-synthase1) cycle. Cer and DAG, two fusogenic intermediates, modify the membrane lipid bilayer for the initiation of vesicle formation and transport. Dysproteostasis, unfolded protein response, endoplasmic reticulum stress and apoptosis perturb the Golgi secretory pathway in the smpd3−/− mouse. Secretion of extracellular matrix proteins is arrested in chondrocytes and causes skeletal malformation and chondrodysplasia. Similarly, retarded secretion of proteo-hormones in hypothalamic neurosecretory neurons leads to hypothalamus induced combined pituitary hormone deficiency. SMPD3 in the regulation of the protein vesicular secretory pathway may become a diagnostic target in the etiology of unknown forms of juvenile growth and developmental inhibition. PMID:27882938

  2. Radioiodinated diacylglycerol analogue: a potential imaging agent for single-photon emission tomographic investigations of cerebral ischaemia

    Energy Technology Data Exchange (ETDEWEB)

    Ohmori, Y. [Department of Neurosurgery, Kyoto Prefectural University of Medicine, Kyoto (Japan); Imahori, Y. [Department of Neurosurgery, Kyoto Prefectural University of Medicine, Kyoto (Japan); Ueda, S. [Department of Neurosurgery, Kyoto Prefectural University of Medicine, Kyoto (Japan); Fujii, R. [Nishijin Hospital, Kyoto (Japan); Wakita, K. [Nishijin Hospital, Kyoto (Japan); Inoue, M. [Daiichi Radioisotope Laboratories, Chiba (Japan); Tazawa, S. [Daiichi Radioisotope Laboratories, Chiba (Japan)

    1996-03-01

    Phospholipid metabolism is closely related to membrane perturbation in cerebral ischaemia. We investigated in vivo topographical lipid metabolism using an iodine-123-labelled diacylglycerol analogue, (1-(15-(4-iodine-123-iodophenyl)-pentadecanoyl)-2-stearoyl-rac-glycerol) ({sup 123}I-labelled DAG), in a middle cerebral artery (MCA) occlusion model with the aim of positive imaging of ischaemic insult. Sprague-Dawley rats underwent coagulation of the MCA to induce permanent occlusion. MCA occlusion times prior to injection of {sup 123}I-labelled DAG ranged from 15 min to 14 days. Each rat was injected with 11-37 MBq of {sup 123}I-labelled DAG. After 30 min, in vivo autoradiographs were reconstructed. Scanning of the living rat brain in this MCA occlusion model was performed. Cerebral infarctions were recognized in the frontal cortex, the parietal cortex and the lateral portion of the caudate-putamen by 2, 3, 5-triphenyltetrazolium hydrochloride staining. In infarcted regions (region 1), {sup 123}I-labelled DAG incorporation showed a decrease up to 12 h; it then increased up to 6 days and decreased thereafter. In peri-infarcted regions (region 2), the incorporation showed almost no change up to 12 h, then increased up to 5-6 days and decreased thereafter. In other regions (region 3), the incorporation showed no change. Lipid analysis showed that {sup 123}I-labelled DAG was metabolized to 15-(4-iodine-123-iodophenyl)-pentadecanoic acid by DAG lipase and to {sup 123}I-labelled phosphatidylcholine. Scanning of the ischaemic region showed higher accumulation than on the non-lesioned side. We established a method to visualize ischaemic foci as positive images. The early changes in {sup 123}I-labelled DAG incorporation were related to DAG lipase, which degraded the accumulated intrinsic DAG, and increased {sup 123}I-labelled DAG incorporation in the chronic stage involves several aspects of neural destruction in the process of autolysis.

  3. Radioiodinated diacylglycerol analogue: a potential imaging agent for single-photon emission tomographic investigations of cerebral ischaemia

    International Nuclear Information System (INIS)

    Ohmori, Y.; Imahori, Y.; Ueda, S.; Fujii, R.; Wakita, K.; Inoue, M.; Tazawa, S.

    1996-01-01

    Phospholipid metabolism is closely related to membrane perturbation in cerebral ischaemia. We investigated in vivo topographical lipid metabolism using an iodine-123-labelled diacylglycerol analogue, (1-(15-(4-iodine-123-iodophenyl)-pentadecanoyl)-2-stearoyl-rac-glycerol) ( 123 I-labelled DAG), in a middle cerebral artery (MCA) occlusion model with the aim of positive imaging of ischaemic insult. Sprague-Dawley rats underwent coagulation of the MCA to induce permanent occlusion. MCA occlusion times prior to injection of 123 I-labelled DAG ranged from 15 min to 14 days. Each rat was injected with 11-37 MBq of 123 I-labelled DAG via a tail vein. After 30 min, in vivo autoradiographs were reconstructed. Scanning of the living rat brain in this MCA occlusion model was performed using a gamma camera with a pinhole collimator. Cerebral infarctions were recognized in the frontal cortex, the parietal cortex and the lateral portion of the caudate-putamen by 2, 3, 5-triphenyltetrazolium hydrochloride staining. In infarcted regions (region 1), 123 I-labelled DAG incorporation showed a slight decrease up to 12 h; it then increased up to 6 days and decreased thereafter. In peri-infarcted regions (region 2), the incorporation showed almost no change up to 12 h, then increased up to 5-6 days and decreased thereafter. In other regions (region 3), the incorporation showed no change. Lipid analysis showed that 123 I-labelled DAG was metabolized to 15-(4-iodine-123-iodophenyl)-pentadecanoic acid by DAG lipase and to 123 I-labelled phosphatidylcholine. Scanning of the ischaemic region showed higher accumulation than on the non-lesioned side. We established a method to visualize ischaemic foci as positive images. The early changes in 123 I-labelled DAG incorporation were closely related to DAG lipase, which degraded the accumulated intrinsic DAG, and increased 123 I-labelled DAG incorporation in the chronic stage involves several aspects of neural destruction in the process of

  4. A comprehensive lipidomic screen of pancreatic β-cells using mass spectroscopy defines novel features of glucose-stimulated turnover of neutral lipids, sphingolipids and plasmalogens

    Directory of Open Access Journals (Sweden)

    Gemma L. Pearson

    2016-06-01

    Full Text Available Objective: Glucose promotes lipid remodelling in pancreatic β-cells, and this is thought to contribute to the regulation of insulin secretion, but the metabolic pathways and potential signalling intermediates have not been fully elaborated. Methods: Using mass spectrometry (MS we quantified changes in approximately 300 lipid metabolites in MIN6 β-cells and isolated mouse islets following 1 h stimulation with glucose. Flux through sphingolipid pathways was also assessed in 3H-sphinganine-labelled cells using TLC. Results: Glucose specifically activates the conversion of triacylglycerol (TAG to diacylglycerol (DAG. This leads indirectly to the formation of 18:1 monoacylglycerol (MAG, via degradation of saturated/monounsaturated DAG species, such as 16:0_18:1 DAG, which are the most abundant, immediate products of glucose-stimulated TAG hydrolysis. However, 16:0-containing, di-saturated DAG species are a better direct marker of TAG hydrolysis since, unlike the 18:1-containing DAGs, they are predominately formed via this route. Using multiple reaction monitoring, we confirmed that in islets under basal conditions, 18:1 MAG is the most abundant species. We further demonstrated a novel site of glucose to enhance the conversion of ceramide to sphingomyelin (SM and galactosylceramide (GalCer. Flux and product:precursor analyses suggest regulation of the enzyme SM synthase, which would constitute a separate mechanism for localized generation of DAG in response to glucose. Phosphatidylcholine (PC plasmalogen (P species, specifically those containing 20:4, 22:5 and 22:6 side chains, were also diminished in the presence of glucose, whereas the more abundant phosphatidylethanolamine plasmalogens were unchanged. Conclusion: Our results highlight 18:1 MAG, GalCer, PC(P and DAG/SM as potential contributors to metabolic stimulus-secretion coupling. Author Video: Author Video Watch what authors say about their articles Keywords: Pancreatic β-cell, Insulin

  5. Pengurangan Kadar Digliserida dan Asam Lemak Bebas dalam Minyak Sawit Kasar Menggunakan Adsorben

    Directory of Open Access Journals (Sweden)

    Khoerul Bariyah

    2017-03-01

    Full Text Available Indonesia is the world’s largest crude palm oil (CPO producer and consumer in 2014. Components that affect the quality of CPO are diglycerides (DAGs and free fatty acids (FFA. DAGs in palm oil are known as the precursor of 3-MCPD esters, while higher content of FFA could influence the oil stability. The contact of CPO with adsorbent could affect the present of DAG and FFA in CPO. The purpose of this study was to determine the best type of adsorbent in reducing DAGs and FFA in CPO with emphasis on the characteristics of the adsorbent and adsorbate. This study was carried out by using three different types of CPO quality and six different types of adsorbent (carbon active, MgO, Magnesol R-60, and 3 types of bleaching earth. The contact process of CPO with different adsorbents were carried out at a temperature of 50-60 °C (without vacuum for adsorbents selection and 90 °C (under vacuum for 30 minutes at a dose of adsorbent 1 and 3 %. The contact process of different adsorbents with CPO have not been able to reduce both DAGs and FFA significantly at the non vacuum condition in three differents CPO sample. The combination of MgO and bleaching earth type 1 could reduce FFA up to 70 % reaching the content of 14 % at vacuum conditions, but did not reduce DAGs of CPO. Different CPO quality and adsorbent characteristics will affect the reduction process of FFA and DAGs.   ABSTRAK Indonesia merupakan negara produsen sekaligus konsumen minyak sawit kasar (Crude Palm Oil/CPO terbesar di dunia pada tahun 2014. Salah satu komponen yang mempengaruhi kualitas CPO adalah digliserida (DAG dan asam lemak bebas (ALB. DAG dalam minyak sawit adalah prekursor pembentuk senyawa karsinogen 3-MCPD ester, sedangkan ALB yang tinggi dapat mempengaruhi stabilitas minyak. Proses kontak adsorben ke dalam CPO akan mempengaruhi keberadaan kedua komponen tersebut. Tujuan penelitian ini adalah untuk menentukan jenis adsorben yang paling baik dalam mengadsorp digliserida dan

  6. mTORC1-independent reduction of retinal protein synthesis in type 1 diabetes.

    Science.gov (United States)

    Fort, Patrice E; Losiewicz, Mandy K; Pennathur, Subramaniam; Jefferson, Leonard S; Kimball, Scot R; Abcouwer, Steven F; Gardner, Thomas W

    2014-09-01

    Poorly controlled diabetes has long been known as a catabolic disorder with profound loss of muscle and fat body mass resulting from a simultaneous reduction in protein synthesis and enhanced protein degradation. By contrast, retinal structure is largely maintained during diabetes despite reduced Akt activity and increased rate of cell death. Therefore, we hypothesized that retinal protein turnover is regulated differently than in other insulin-sensitive tissues, such as skeletal muscle. Ins2(Akita) diabetic mice and streptozotocin-induced diabetic rats exhibited marked reductions in retinal protein synthesis matched by a concomitant reduction in retinal protein degradation associated with preserved retinal mass and protein content. The reduction in protein synthesis depended on both hyperglycemia and insulin deficiency, but protein degradation was only reversed by normalization of hyperglycemia. The reduction in protein synthesis was associated with diminished protein translation efficiency but, surprisingly, not with reduced activity of the mTORC1/S6K1/4E-BP1 pathway. Instead, diabetes induced a specific reduction of mTORC2 complex activity. These findings reveal distinctive responses of diabetes-induced retinal protein turnover compared with muscle and liver that may provide a new means to ameliorate diabetic retinopathy. © 2014 by the American Diabetes Association. Readers may use this article as long as the work is properly cited, the use is educational and not for profit, and the work is not altered.

  7. Genetic regulation ofmethylation and IL1RL1-a protein levels in asthma

    NARCIS (Netherlands)

    Dijk, F Nicole; Xu, Chengjian; Melén, Erik; Carsin, Anne-Elie; Kumar, Asish; Nolte, Ilja M; Gruzieva, Olena; Pershagen, Goran; Grotenboer, Neomi S; Savenije, Olga E M; Antó, Josep Maria; Lavi, Iris; Dobaño, Carlota; Bousquet, Jean; van der Vlies, Pieter; van der Valk, Ralf J P; de Jongste, Johan C; Nawijn, Martijn C; Guerra, Stefano; Postma, Dirkje S; Koppelman, Gerard H

    2018-01-01

    Interleukin-1 receptor-like 1 (IL1RL1) is an important asthma gene. (Epi)genetic regulation ofIL1RL1protein expression has not been established. We assessed the association betweenIL1RL1single nucleotide polymorphisms (SNPs),IL1RL1methylation and serum IL1RL1-a protein levels, and aimed to identify

  8. Identification of novel putative-binding proteins for cellular prion protein and a specific interaction with the STIP1 homology and U-Box-containing protein 1

    Science.gov (United States)

    Gimenez, Ana Paula Lappas; Richter, Larissa Morato Luciani; Atherino, Mariana Campos; Beirão, Breno Castello Branco; Fávaro, Celso; Costa, Michele Dietrich Moura; Zanata, Silvio Marques; Malnic, Bettina; Mercadante, Adriana Frohlich

    2015-01-01

    ABSTRACT Prion diseases involve the conversion of the endogenous cellular prion protein, PrPC, into a misfolded infectious isoform, PrPSc. Several functions have been attributed to PrPC, and its role has also been investigated in the olfactory system. PrPC is expressed in both the olfactory bulb (OB) and olfactory epithelium (OE) and the nasal cavity is an important route of transmission of diseases caused by prions. Moreover, Prnp−/− mice showed impaired behavior in olfactory tests. Given the high PrPC expression in OE and its putative role in olfaction, we screened a mouse OE cDNA library to identify novel PrPC-binding partners. Ten different putative PrPC ligands were identified, which were involved in functions such as cellular proliferation and apoptosis, cytoskeleton and vesicle transport, ubiquitination of proteins, stress response, and other physiological processes. In vitro binding assays confirmed the interaction of PrPC with STIP1 homology and U-Box containing protein 1 (Stub1) and are reported here for the first time. Stub1 is a co-chaperone with ubiquitin E3-ligase activity, which is associated with neurodegenerative diseases characterized by protein misfolding and aggregation. Physiological and pathological implications of PrPC-Stub1 interaction are under investigation. The PrPC-binding proteins identified here are not exclusive to the OE, suggesting that these interactions may occur in other tissues and play general biological roles. These data corroborate the proposal that PrPC is part of a multiprotein complex that modulates several cellular functions and provide a platform for further studies on the physiological and pathological roles of prion protein. PMID:26237451

  9. Integration of mouse and human genome-wide association data identifies KCNIP4 as an asthma gene.

    Directory of Open Access Journals (Sweden)

    Blanca E Himes

    Full Text Available Asthma is a common chronic respiratory disease characterized by airway hyperresponsiveness (AHR. The genetics of asthma have been widely studied in mouse and human, and homologous genomic regions have been associated with mouse AHR and human asthma-related phenotypes. Our goal was to identify asthma-related genes by integrating AHR associations in mouse with human genome-wide association study (GWAS data. We used Efficient Mixed Model Association (EMMA analysis to conduct a GWAS of baseline AHR measures from males and females of 31 mouse strains. Genes near or containing SNPs with EMMA p-values <0.001 were selected for further study in human GWAS. The results of the previously reported EVE consortium asthma GWAS meta-analysis consisting of 12,958 diverse North American subjects from 9 study centers were used to select a subset of homologous genes with evidence of association with asthma in humans. Following validation attempts in three human asthma GWAS (i.e., Sepracor/LOCCS/LODO/Illumina, GABRIEL, DAG and two human AHR GWAS (i.e., SHARP, DAG, the Kv channel interacting protein 4 (KCNIP4 gene was identified as nominally associated with both asthma and AHR at a gene- and SNP-level. In EVE, the smallest KCNIP4 association was at rs6833065 (P-value 2.9e-04, while the strongest associations for Sepracor/LOCCS/LODO/Illumina, GABRIEL, DAG were 1.5e-03, 1.0e-03, 3.1e-03 at rs7664617, rs4697177, rs4696975, respectively. At a SNP level, the strongest association across all asthma GWAS was at rs4697177 (P-value 1.1e-04. The smallest P-values for association with AHR were 2.3e-03 at rs11947661 in SHARP and 2.1e-03 at rs402802 in DAG. Functional studies are required to validate the potential involvement of KCNIP4 in modulating asthma susceptibility and/or AHR. Our results suggest that a useful approach to identify genes associated with human asthma is to leverage mouse AHR association data.

  10. Human Cementum Protein 1 induces expression of bone and cementum proteins by human gingival fibroblasts

    International Nuclear Information System (INIS)

    Carmona-Rodriguez, Bruno; Alvarez-Perez, Marco Antonio; Narayanan, A. Sampath; Zeichner-David, Margarita; Reyes-Gasga, Jose; Molina-Guarneros, Juan; Garcia-Hernandez, Ana Lilia; Suarez-Franco, Jose Luis; Chavarria, Ivet Gil; Villarreal-Ramirez, Eduardo; Arzate, Higinio

    2007-01-01

    We recently presented evidence showing that a human cementoblastoma-derived protein, named Cementum Protein 1 (CEMP1) may play a role as a local regulator of cementoblast differentiation and cementum-matrix mineralization. This protein was shown to be expressed by cementoblasts and progenitor cells localized in the periodontal ligament. In this study we demonstrate that transfection of CEMP1 into human gingival fibroblasts (HGF) induces mineralization and expression of bone and cementum-matrix proteins. The transfected HGF cells had higher alkaline phosphatase activity and proliferation rate and they expressed genes for alkaline phosphatase, bone sialoprotein, osteocalcin, osteopontin, the transcription factor Runx2/Cbfa1, and cementum attachment protein (CAP). They also produced biological-type hydroxyapatite. These findings indicate that the CEMP1 might participate in differentiation and mineralization of nonosteogenic cells, and that it might have a potential function in cementum and bone formation

  11. Solution structure of the human signaling protein RACK1

    Directory of Open Access Journals (Sweden)

    Papa Priscila F

    2010-06-01

    Full Text Available Abstract Background The adaptor protein RACK1 (receptor of activated kinase 1 was originally identified as an anchoring protein for protein kinase C. RACK1 is a 36 kDa protein, and is composed of seven WD repeats which mediate its protein-protein interactions. RACK1 is ubiquitously expressed and has been implicated in diverse cellular processes involving: protein translation regulation, neuropathological processes, cellular stress, and tissue development. Results In this study we performed a biophysical analysis of human RACK1 with the aim of obtaining low resolution structural information. Small angle X-ray scattering (SAXS experiments demonstrated that human RACK1 is globular and monomeric in solution and its low resolution structure is strikingly similar to that of an homology model previously calculated by us and to the crystallographic structure of RACK1 isoform A from Arabidopsis thaliana. Both sedimentation velocity and sedimentation equilibrium analytical ultracentrifugation techniques showed that RACK1 is predominantly a monomer of around 37 kDa in solution, but also presents small amounts of oligomeric species. Moreover, hydrodynamic data suggested that RACK1 has a slightly asymmetric shape. The interaction of RACK1 and Ki-1/57 was tested by sedimentation equilibrium. The results suggested that the association between RACK1 and Ki-1/57(122-413 follows a stoichiometry of 1:1. The binding constant (KB observed for RACK1-Ki-1/57(122-413 interaction was of around (1.5 ± 0.2 × 106 M-1 and resulted in a dissociation constant (KD of (0.7 ± 0.1 × 10-6 M. Moreover, the fluorescence data also suggests that the interaction may occur in a cooperative fashion. Conclusion Our SAXS and analytical ultracentrifugation experiments indicated that RACK1 is predominantly a monomer in solution. RACK1 and Ki-1/57(122-413 interact strongly under the tested conditions.

  12. Model of a DNA-protein complex of the architectural monomeric protein MC1 from Euryarchaea.

    Directory of Open Access Journals (Sweden)

    Françoise Paquet

    Full Text Available In Archaea the two major modes of DNA packaging are wrapping by histone proteins or bending by architectural non-histone proteins. To supplement our knowledge about the binding mode of the different DNA-bending proteins observed across the three domains of life, we present here the first model of a complex in which the monomeric Methanogen Chromosomal protein 1 (MC1 from Euryarchaea binds to the concave side of a strongly bent DNA. In laboratory growth conditions MC1 is the most abundant architectural protein present in Methanosarcina thermophila CHTI55. Like most proteins that strongly bend DNA, MC1 is known to bind in the minor groove. Interaction areas for MC1 and DNA were mapped by Nuclear Magnetic Resonance (NMR data. The polarity of protein binding was determined using paramagnetic probes attached to the DNA. The first structural model of the DNA-MC1 complex we propose here was obtained by two complementary docking approaches and is in good agreement with the experimental data previously provided by electron microscopy and biochemistry. Residues essential to DNA-binding and -bending were highlighted and confirmed by site-directed mutagenesis. It was found that the Arg25 side-chain was essential to neutralize the negative charge of two phosphates that come very close in response to a dramatic curvature of the DNA.

  13. Design and Simulation of 5-DOF Vision-Based Manipulator to Increase Radiation Safety for Industrial Cobalt-60 Irradiators

    International Nuclear Information System (INIS)

    Solyman, A.E.; Keshk, A.B.; Sharshar, K.A.; Roman, M.R.

    2016-01-01

    Robotics has proved its efficiency in nuclear and radiation fields. Computer vision is one of the advanced approaches used to enhance robotic efficiency. The current work investigates the possibility of using a vision-based controlled arm robot to collect the fallen hot Cobalt-60 capsules inside wet storage pool of industrial irradiator. A 5-DOF arm robot is designed and vision algorithms are established to pick the fallen capsules on the bottom surface of the storage pool, read the information printed on its edge (cap) and move it to a safe storage place. Two object detection approaches are studied; RGB-based filter and background subtraction technique. Vision algorithms and camera calibration are done using MATLAB/SIMULINK program. Robot arm forward and inverse kinematics are developed and programmed using an embedded micro controller system. Experiments show the validity of the proposed system and prove its success. The collecting process will be done without interference of operators, hence radiation safety will be increased.

  14. Cytokine-Like Protein 1(Cytl1: A Potential Molecular Mediator in Embryo Implantation.

    Directory of Open Access Journals (Sweden)

    Zhichao Ai

    Full Text Available Cytokine-like protein 1 (Cytl1, originally described as a protein expressed in CD34+ cells, was recently identified as a functional secreted protein involved in chondrogenesis and cartilage development. However, our knowledge of Cytl1 is still limited. Here, we determined the Cytl1 expression pattern regulated by ovarian hormones at both the mRNA and protein levels. We found that the endometrial expression of Cytl1 in mice was low before or on the first day of gestation, significantly increased during embryo implantation, and then decreased at the end of implantation. We investigated the effects of Cytl1 on endometrial cell proliferation, and the effects on the secretion of leukemia inhibitory factor (LIF and heparin-binding epidermal growth factor (HB-EGF. We also explored the effect of Cytl1 on endometrial adhesion properties in cell-cell adhesion assays. Our findings demonstrated that Cytl1 is an ovarian hormone-dependent protein expressed in the endometrium that enhances the proliferation of HEC-1-A and RL95-2 cells, stimulates endometrial secretion of LIF and HB-EGF, and enhances the adhesion of HEC-1-A and RL95-2 cells to JAR spheroids. This study suggests that Cytl1 plays an active role in the regulation of embryo implantation.

  15. Interaction of the amyloid precursor protein-like protein 1 (APLP1) E2 domain with heparan sulfate involves two distinct binding modes

    Energy Technology Data Exchange (ETDEWEB)

    Dahms, Sven O., E-mail: sdahms@fli-leibniz.de [Leibniz Institute for Age Research (FLI), Beutenbergstrasse 11, 07745 Jena (Germany); Mayer, Magnus C. [Freie Universität Berlin, Thielallee 63, 14195 Berlin (Germany); Miltenyi Biotec GmbH, Robert-Koch-Strasse 1, 17166 Teterow (Germany); Roeser, Dirk [Leibniz Institute for Age Research (FLI), Beutenbergstrasse 11, 07745 Jena (Germany); Multhaup, Gerd [McGill University Montreal, Montreal, Quebec H3G 1Y6 (Canada); Than, Manuel E., E-mail: sdahms@fli-leibniz.de [Leibniz Institute for Age Research (FLI), Beutenbergstrasse 11, 07745 Jena (Germany)

    2015-03-01

    Two X-ray structures of APLP1 E2 with and without a heparin dodecasaccharide are presented, revealing two distinct binding modes of the protein to heparan sulfate. The data provide a mechanistic explanation of how APP-like proteins bind to heparan sulfates and how they specifically recognize nonreducing structures of heparan sulfates. Beyond the pathology of Alzheimer’s disease, the members of the amyloid precursor protein (APP) family are essential for neuronal development and cell homeostasis in mammals. APP and its paralogues APP-like protein 1 (APLP1) and APP-like protein 2 (APLP2) contain the highly conserved heparan sulfate (HS) binding domain E2, which effects various (patho)physiological functions. Here, two crystal structures of the E2 domain of APLP1 are presented in the apo form and in complex with a heparin dodecasaccharide at 2.5 Å resolution. The apo structure of APLP1 E2 revealed an unfolded and hence flexible N-terminal helix αA. The (APLP1 E2){sub 2}–(heparin){sub 2} complex structure revealed two distinct binding modes, with APLP1 E2 explicitly recognizing the heparin terminus but also interacting with a continuous heparin chain. The latter only requires a certain register of the sugar moieties that fits to a positively charged surface patch and contributes to the general heparin-binding capability of APP-family proteins. Terminal binding of APLP1 E2 to heparin specifically involves a structure of the nonreducing end that is very similar to heparanase-processed HS chains. These data reveal a conserved mechanism for the binding of APP-family proteins to HS and imply a specific regulatory role of HS modifications in the biology of APP and APP-like proteins.

  16. Conservation of Oxidative Protein Stabilization in an Insect Homologue of Parkinsonism-Associated Protein DJ-1

    Energy Technology Data Exchange (ETDEWEB)

    Lin, Jiusheng; Prahlad, Janani; Wilson, Mark A. (UNL)

    2012-08-21

    DJ-1 is a conserved, disease-associated protein that protects against oxidative stress and mitochondrial damage in multiple organisms. Human DJ-1 contains a functionally essential cysteine residue (Cys106) whose oxidation is important for regulating protein function by an unknown mechanism. This residue is well-conserved in other DJ-1 homologues, including two (DJ-1{alpha} and DJ-1{beta}) in Drosophila melanogaster. Because D. melanogaster is a powerful model system for studying DJ-1 function, we have determined the crystal structure and impact of cysteine oxidation on Drosophila DJ-1{beta}. The structure of D. melanogaster DJ-1{beta} is similar to that of human DJ-1, although two important residues in the human protein, Met26 and His126, are not conserved in DJ-1{beta}. His126 in human DJ-1 is substituted with a tyrosine in DJ-1{beta}, and this residue is not able to compose a putative catalytic dyad with Cys106 that was proposed to be important in the human protein. The reactive cysteine in DJ-1 is oxidized readily to the cysteine-sulfinic acid in both flies and humans, and this may regulate the cytoprotective function of the protein. We show that the oxidation of this conserved cysteine residue to its sulfinate form (Cys-SO{sub 2{sup -}}) results in considerable thermal stabilization of both Drosophila DJ-1{beta} and human DJ-1. Therefore, protein stabilization is one potential mechanism by which cysteine oxidation may regulate DJ-1 function in vivo. More generally, most close DJ-1 homologues are likely stabilized by cysteine-sulfinic acid formation but destabilized by further oxidation, suggesting that they are biphasically regulated by oxidative modification.

  17. Two-degrees-of-freedom piezo-driven fast steering mirror with cross-axis decoupling capability

    Science.gov (United States)

    Shao, Shubao; Tian, Zheng; Song, Siyang; Xu, Minglong

    2018-05-01

    Because mechanical cross coupling between its axes would lead to degradation of the scanning precision of a piezo-driven fast steering mirror (PFSM), a two-degrees-of-freedom (2-DoF) PFSM with a cross-axis decoupling capability, in which 2-DoF flexure hinges are used, is proposed in this work. The overall structure of the proposed PFSM is first introduced and then both static and dynamic models are established analytically; in addition, the decoupling mechanism is described in detail and the low dynamic cross coupling ratios that occur between the two DoFs are shown. Because of the decoupling property of the PFSM, the 2-DoF motion is treated as a combination of two independent one-degree-of-freedom (1-DoF) motions and two independent proportional-integral-derivative controllers are thus used separately in the control of the two DoFs. Based on this control strategy, experiments involving both 1-DoF trajectory tracking and 2-DoF trajectory tracking are implemented. The test results show that the proposed PFSM can achieve the tilt range of ±7 mrad for both axes with the low coupling ratios that are less than 2% (-34 dB), and the bandwidths of both axes are higher than 810 Hz; in addition, the maximal tracking full scale range errors for 1-DoF trajectory tracking and 2-DoF trajectory tracking are less than 0.2% and 1%, respectively, where the larger error of 2-DoF trajectory tracking is mainly caused by the remaining cross coupling between axes.

  18. The G protein Gi1 exhibits basal coupling but not preassembly with G protein-coupled receptors.

    Science.gov (United States)

    Bondar, Alexey; Lazar, Josef

    2017-06-09

    The G i/o protein family transduces signals from a diverse group of G protein-coupled receptors (GPCRs). The observed specificity of G i/o -GPCR coupling and the high rate of G i/o signal transduction have been hypothesized to be enabled by the existence of stable associates between G i/o proteins and their cognate GPCRs in the inactive state (G i/o -GPCR preassembly). To test this hypothesis, we applied the recently developed technique of two-photon polarization microscopy (2PPM) to Gα i1 subunits labeled with fluorescent proteins and four GPCRs: the α 2A -adrenergic receptor, GABA B , cannabinoid receptor type 1 (CB 1 R), and dopamine receptor type 2. Our experiments with non-dissociating mutants of fluorescently labeled Gα i1 subunits (exhibiting impaired dissociation from activated GPCRs) showed that 2PPM is capable of detecting GPCR-G protein interactions. 2PPM experiments with non-mutated fluorescently labeled Gα i1 subunits and α 2A -adrenergic receptor, GABA B , or dopamine receptor type 2 receptors did not reveal any interaction between the G i1 protein and the non-stimulated GPCRs. In contrast, non-stimulated CB 1 R exhibited an interaction with the G i1 protein. Further experiments revealed that this interaction is caused solely by CB 1 R basal activity; no preassembly between CB 1 R and the G i1 protein could be observed. Our results demonstrate that four diverse GPCRs do not preassemble with non-active G i1 However, we also show that basal GPCR activity allows interactions between non-stimulated GPCRs and G i1 (basal coupling). These findings suggest that G i1 interacts only with active GPCRs and that the well known high speed of GPCR signal transduction does not require preassembly between G proteins and GPCRs. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  19. Irradiation of porcine plasma protein powder, 1

    International Nuclear Information System (INIS)

    Hayashi, Toru; Saito, Masayoshi; Todoroki, Setsuko; Tajima, Makoto; Biagio, R.

    1987-01-01

    Recently interest in the use of animal blood protein as a food ingradient has been increasing. A study was conducted on the decontamination effect of gamma rays and electrons beam on plasma protein powder prepared from slaughtered porcine blood. Non irradiated sample was mainly contaminated with heat-resistant becterial spores (B. subtilis) and the total mocrobial count was 9.6 x 10 3 per 1 g of dried powder. The D 10 values of total microbial count for gamma rays and electrons beam were 0.82 kGy and 1.06 kGy, respectively. For B. subtilis, the D 10 values obtained under aerobic condition were 1.40 kGy for gamma rays and 1.45 kGy for electrons beam, with the survival curve for electrons beam showing a shoulder until 0.1 kGy. From these results, both types of irradiation were effective for the decotamination of plasma proteins. (author)

  20. Brain transcriptome-wide screen for HIV-1 Nef protein interaction partners reveals various membrane-associated proteins.

    Directory of Open Access Journals (Sweden)

    Ellen C Kammula

    Full Text Available HIV-1 Nef protein contributes essentially to the pathology of AIDS by a variety of protein-protein-interactions within the host cell. The versatile functionality of Nef is partially attributed to different conformational states and posttranslational modifications, such as myristoylation. Up to now, many interaction partners of Nef have been identified using classical yeast two-hybrid screens. Such screens rely on transcriptional activation of reporter genes in the nucleus to detect interactions. Thus, the identification of Nef interaction partners that are integral membrane proteins, membrane-associated proteins or other proteins that do not translocate into the nucleus is hampered. In the present study, a split-ubiquitin based yeast two-hybrid screen was used to identify novel membrane-localized interaction partners of Nef. More than 80% of the hereby identified interaction partners of Nef are transmembrane proteins. The identified hits are GPM6B, GPM6A, BAP31, TSPAN7, CYB5B, CD320/TCblR, VSIG4, PMEPA1, OCIAD1, ITGB1, CHN1, PH4, CLDN10, HSPA9, APR-3, PEBP1 and B3GNT, which are involved in diverse cellular processes like signaling, apoptosis, neurogenesis, cell adhesion and protein trafficking or quality control. For a subfraction of the hereby identified proteins we present data supporting their direct interaction with HIV-1 Nef. We discuss the results with respect to many phenotypes observed in HIV infected cells and patients. The identified Nef interaction partners may help to further elucidate the molecular basis of HIV-related diseases.

  1. Desacyl Ghrelin Decreases Anxiety-like Behavior in Male Mice.

    Science.gov (United States)

    Mahbod, Parinaz; Smith, Eric P; Fitzgerald, Maureen E; Morano, Rachel L; Packard, Benjamin A; Ghosal, Sriparna; Scheimann, Jessie R; Perez-Tilve, Diego; Herman, James P; Tong, Jenny

    2018-01-01

    Ghrelin is a 28-amino acid polypeptide that regulates feeding, glucose metabolism, and emotionality (stress, anxiety, and depression). Plasma ghrelin circulates as desacyl ghrelin (DAG) or, in an acylated form, acyl ghrelin (AG), through the actions of ghrelin O-acyltransferase (GOAT), exhibiting low or high affinity, respectively, for the growth hormone secretagogue receptor (GHSR) 1a. We investigated the role of endogenous AG, DAG, and GHSR1a signaling on anxiety and stress responses using ghrelin knockout (Ghr KO), GOAT KO, and Ghsr stop-floxed (Ghsr null) mice. Behavioral and hormonal responses were tested in the elevated plus maze and light/dark (LD) box. Mice lacking both AG and DAG (Ghr KO) increased anxiety-like behaviors across tests, whereas anxiety reactions were attenuated in DAG-treated Ghr KO mice and in mice lacking AG (GOAT KO). Notably, loss of GHSR1a (Ghsr null) did not affect anxiety-like behavior in any test. Administration of AG and DAG to Ghr KO mice with lifelong ghrelin deficiency reduced anxiety-like behavior and decreased phospho-extracellular signal-regulated kinase phosphorylation in the Edinger-Westphal nucleus in wild-type mice, a site normally expressing GHSR1a and involved in stress- and anxiety-related behavior. Collectively, our data demonstrate distinct roles for endogenous AG and DAG in regulation of anxiety responses and suggest that the behavioral impact of ghrelin may be context dependent. Copyright © 2018 Endocrine Society.

  2. BRCA1 interacts directly with the Fanconi anemia protein FANCA.

    Science.gov (United States)

    Folias, Alexandra; Matkovic, Mara; Bruun, Donald; Reid, Sonja; Hejna, James; Grompe, Markus; D'Andrea, Alan; Moses, Robb

    2002-10-01

    Fanconi anemia (FA) is a rare autosomal recessive disease characterized by skeletal defects, anemia, chromosomal instability and increased risk of leukemia. At the cellular level FA is characterized by increased sensitivity to agents forming interstrand crosslinks (ICL) in DNA. Six FA genes have been cloned and interactions among individual FANC proteins have been found. The FANCD2 protein co-localizes in nuclear foci with the BRCA1 protein following DNA damage and during S-phase, requiring the FANCA, C, E and G proteins to do so. This finding may reflect a direct role for the BRCA1 protein in double strand break (DSB) repair and interaction with the FANC proteins. Therefore interactions between BRCA1 and the FANC proteins were investigated. Among the known FANC proteins, we find evidence for direct interaction only between the FANCA protein and BRCA1. The evidence rests on three different tests: yeast two-hybrid analysis, coimmunoprecipitation from in vitro synthesis, and coimmunoprecipitation from cell extracts. The amino terminal portion of FANCA and the central part (aa 740-1083) of BRCA1 contain the sites of interaction. The interaction does not depend on DNA damage, thus FANCA and BRCA1 are constitutively interacting. The demonstrated interaction directly connects BRCA1 to the FA pathway of DNA repair.

  3. Trichohyalin-like 1 protein, a member of fused S100 proteins, is expressed in normal and pathologic human skin

    Energy Technology Data Exchange (ETDEWEB)

    Yamakoshi, Takako [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Makino, Teruhiko, E-mail: tmakino@med.u-toyama.ac.jp [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Ur Rehman, Mati; Yoshihisa, Yoko [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Sugimori, Michiya [Department of Integrative Neuroscience, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan); Shimizu, Tadamichi, E-mail: shimizut@med.u-toyama.ac.jp [Department of Dermatology, Graduate School of Medicine and Pharmaceutical Sciences, University of Toyama, Sugitani, Toyama 930-0194 (Japan)

    2013-03-01

    Highlights: ► Trichohyalin-like 1 protein is a member of the fused-type S100 protein gene family. ► Specific antibodies against the C-terminus of the TCHHL1 protein were generated. ► TCHHL1 proteins were expressed in the basal layer of the normal epidermis. ► TCHHL1 proteins were strongly expressed in tumor nests of BCC and SCC. ► The expression of TCHHL1 proteins increased in epidermis of psoriasis vulgaris. - Abstract: Trichohyalin-like 1 (TCHHL1) protein is a novel member of the fused-type S100 protein gene family. The deduced amino acid sequence of TCHHL1 contains an EF-hand domain in the N-terminus, one trans-membrane domain and a nuclear localization signal. We generated specific antibodies against the C-terminus of the TCHHL1 protein and examined the expression of TCHHL1 proteins in normal and pathological human skin. An immunohistochemical study showed that TCHHL1 proteins were expressed in the basal layer of the normal epidermis. In addition, signals of TCHHL1 proteins were observed around the nuclei of cultured growing keratinocytes. Accordingly, TCHHL1 mRNA has been detected in normal skin and cultured growing keratinocytes. Furthermore, TCHHL1 proteins were strongly expressed in the peripheral areas of tumor nests in basal cell carcinomas and squamous cell carcinomas. A dramatic increase in the number of Ki67 positive cells was observed in TCHHL1-expressing areas. The expression of TCHHL1 proteins also increased in non-cancerous hyperproliferative epidermal tissues such as those of psoriasis vulgaris and lichen planus. These findings highlight the possibility that TCHHL1 proteins are expressed in growing keratinocytes of the epidermis and might be associated with the proliferation of keratinocytes.

  4. Trichohyalin-like 1 protein, a member of fused S100 proteins, is expressed in normal and pathologic human skin

    International Nuclear Information System (INIS)

    Yamakoshi, Takako; Makino, Teruhiko; Ur Rehman, Mati; Yoshihisa, Yoko; Sugimori, Michiya; Shimizu, Tadamichi

    2013-01-01

    Highlights: ► Trichohyalin-like 1 protein is a member of the fused-type S100 protein gene family. ► Specific antibodies against the C-terminus of the TCHHL1 protein were generated. ► TCHHL1 proteins were expressed in the basal layer of the normal epidermis. ► TCHHL1 proteins were strongly expressed in tumor nests of BCC and SCC. ► The expression of TCHHL1 proteins increased in epidermis of psoriasis vulgaris. - Abstract: Trichohyalin-like 1 (TCHHL1) protein is a novel member of the fused-type S100 protein gene family. The deduced amino acid sequence of TCHHL1 contains an EF-hand domain in the N-terminus, one trans-membrane domain and a nuclear localization signal. We generated specific antibodies against the C-terminus of the TCHHL1 protein and examined the expression of TCHHL1 proteins in normal and pathological human skin. An immunohistochemical study showed that TCHHL1 proteins were expressed in the basal layer of the normal epidermis. In addition, signals of TCHHL1 proteins were observed around the nuclei of cultured growing keratinocytes. Accordingly, TCHHL1 mRNA has been detected in normal skin and cultured growing keratinocytes. Furthermore, TCHHL1 proteins were strongly expressed in the peripheral areas of tumor nests in basal cell carcinomas and squamous cell carcinomas. A dramatic increase in the number of Ki67 positive cells was observed in TCHHL1-expressing areas. The expression of TCHHL1 proteins also increased in non-cancerous hyperproliferative epidermal tissues such as those of psoriasis vulgaris and lichen planus. These findings highlight the possibility that TCHHL1 proteins are expressed in growing keratinocytes of the epidermis and might be associated with the proliferation of keratinocytes

  5. Small molecule PGC-1α1 protein stabilizers induce adipocyte Ucp1 expression and uncoupled mitochondrial respiration

    Directory of Open Access Journals (Sweden)

    A.T. Pettersson-Klein

    2018-03-01

    Full Text Available Objective: The peroxisome proliferator-activated receptor-γ coactivator-1α1 (PGC-1α1 regulates genes involved in energy metabolism. Increasing adipose tissue energy expenditure through PGC-1α1 activation is potentially beneficial for systemic metabolism. Pharmacological PGC-1α1 activators could be valuable tools in the fight against obesity and metabolic disease. Finding such compounds has been challenging partly because PGC-1α1 is a transcriptional coactivator with no known ligand-binding properties. While, PGC-1α1 activation is regulated by several mechanisms, protein stabilization is a crucial limiting step due to its short half-life under unstimulated conditions. Methods: We designed a cell-based high-throughput screening system to identify PGC-1α1 protein stabilizers. Positive hits were tested for their ability to induce endogenous PGC-1α1 protein accumulation and activate target gene expression in brown adipocytes. Select compounds were analyzed for their effects on global gene expression and cellular respiration in adipocytes. Results: Among 7,040 compounds screened, we highlight four small molecules with high activity as measured by: PGC-1α1 protein accumulation, target gene expression, and uncoupled mitochondrial respiration in brown adipocytes. Conclusions: We identify compounds that induce PGC-1α1 protein accumulation and show that this increases uncoupled respiration in brown adipocytes. This screening platform establishes the foundation for a new class of therapeutics with potential use in obesity and associated disorders. Keywords: Small molecule screening, PGC-1a, PGC-1alpha, PGC-1alpha1, Protein stabilization, UCP1, Mitochondrial respiration, Brown adipose tissue

  6. A comprehensive protein-protein interactome for yeast PAS kinase 1 reveals direct inhibition of respiration through the phosphorylation of Cbf1.

    Science.gov (United States)

    DeMille, Desiree; Bikman, Benjamin T; Mathis, Andrew D; Prince, John T; Mackay, Jordan T; Sowa, Steven W; Hall, Tacie D; Grose, Julianne H

    2014-07-15

    Per-Arnt-Sim (PAS) kinase is a sensory protein kinase required for glucose homeostasis in yeast, mice, and humans, yet little is known about the molecular mechanisms of its function. Using both yeast two-hybrid and copurification approaches, we identified the protein-protein interactome for yeast PAS kinase 1 (Psk1), revealing 93 novel putative protein binding partners. Several of the Psk1 binding partners expand the role of PAS kinase in glucose homeostasis, including new pathways involved in mitochondrial metabolism. In addition, the interactome suggests novel roles for PAS kinase in cell growth (gene/protein expression, replication/cell division, and protein modification and degradation), vacuole function, and stress tolerance. In vitro kinase studies using a subset of 25 of these binding partners identified Mot3, Zds1, Utr1, and Cbf1 as substrates. Further evidence is provided for the in vivo phosphorylation of Cbf1 at T211/T212 and for the subsequent inhibition of respiration. This respiratory role of PAS kinase is consistent with the reported hypermetabolism of PAS kinase-deficient mice, identifying a possible molecular mechanism and solidifying the evolutionary importance of PAS kinase in the regulation of glucose homeostasis. © 2014 DeMille et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  7. GABARAPL1 antibodies: target one protein, get one free!

    Science.gov (United States)

    Le Grand, Jaclyn Nicole; Chakrama, Fatima Zahra; Seguin-Py, Stéphanie; Fraichard, Annick; Delage-Mourroux, Régis; Jouvenot, Michèle; Risold, Pierre-Yves; Boyer-Guittaut, Michaël

    2011-11-01

    Atg8 is a yeast protein involved in the autophagic process and in particular in the elongation of autophagosomes. In mammals, several orthologs have been identified and are classed into two subfamilies: the LC3 subfamily and the GABARAP subfamily, referred to simply as the LC3 or GABARAP families. GABARAPL1 (GABARAP-like protein 1), one of the proteins belonging to the GABARAP (GABA(A) receptor-associated protein) family, is highly expressed in the central nervous system and implicated in processes such as receptor and vesicle transport as well as autophagy. The proteins that make up the GABARAP family demonstrate conservation of their amino acid sequences and protein structures. In humans, GABARAPL1 shares 86% identity with GABARAP and 61% with GABARAPL2 (GATE-16). The identification of the individual proteins is thus very limited when working in vivo due to a lack of unique peptide sequences from which specific antibodies can be developed. Actually, and to our knowledge, there are no available antibodies on the market that are entirely specific to GABARAPL1 and the same may be true of the anti-GABARAP antibodies. In this study, we sought to examine the specificity of three antibodies targeted against different peptide sequences within GABARAPL1: CHEM-CENT (an antibody raised against a short peptide sequence within the center of the protein), PTG-NTER (an antibody raised against the N-terminus of the protein) and PTG-FL (an antibody raised against the full-length protein). The results described in this article demonstrate the importance of testing antibody specificity under the conditions for which it will be used experimentally, a caution that should be taken when studying the expression of the GABARAP family proteins.

  8. Borgring sæson 1 - Vold, brand og ødelæggelse

    DEFF Research Database (Denmark)

    Ulriksen, Jens; Christensen, Jonas; Holm, Nanna

    2017-01-01

    Sæson 1 af Borgringprojektet er overstået – i hvert fald i marken. Efter måneders planlægning, både blandt arkæologer og formidlingsfolk, kunne Hendes Majestæt Dronningen officielt åbne den publikumsorienterede del af forskningsprojektet den sidste dag i maj 2016. Gennem de følgende tre måneder bl...

  9. Structural analysis of intermolecular interactions in the kinesin adaptor complex fasciculation and elongation protein zeta 1/ short coiled-coil protein (FEZ1/SCOCO.

    Directory of Open Access Journals (Sweden)

    Marcos Rodrigo Alborghetti

    Full Text Available Cytoskeleton and protein trafficking processes, including vesicle transport to synapses, are key processes in neuronal differentiation and axon outgrowth. The human protein FEZ1 (fasciculation and elongation protein zeta 1 / UNC-76, in C. elegans, SCOCO (short coiled-coil protein / UNC-69 and kinesins (e.g. kinesin heavy chain / UNC116 are involved in these processes. Exploiting the feature of FEZ1 protein as a bivalent adapter of transport mediated by kinesins and FEZ1 protein interaction with SCOCO (proteins involved in the same path of axonal growth, we investigated the structural aspects of intermolecular interactions involved in this complex formation by NMR (Nuclear Magnetic Resonance, cross-linking coupled with mass spectrometry (MS, SAXS (Small Angle X-ray Scattering and molecular modelling. The topology of homodimerization was accessed through NMR (Nuclear Magnetic Resonance studies of the region involved in this process, corresponding to FEZ1 (92-194. Through studies involving the protein in its monomeric configuration (reduced and dimeric state, we propose that homodimerization occurs with FEZ1 chains oriented in an anti-parallel topology. We demonstrate that the interaction interface of FEZ1 and SCOCO defined by MS and computational modelling is in accordance with that previously demonstrated for UNC-76 and UNC-69. SAXS and literature data support a heterotetrameric complex model. These data provide details about the interaction interfaces probably involved in the transport machinery assembly and open perspectives to understand and interfere in this assembly and its involvement in neuronal differentiation and axon outgrowth.

  10. Scaffold Protein Ahk1, Which Associates with Hkr1, Sho1, Ste11, and Pbs2, Inhibits Cross Talk Signaling from the Hkr1 Osmosensor to the Kss1 Mitogen-Activated Protein Kinase

    Science.gov (United States)

    Nishimura, Akiko; Yamamoto, Katsuyoshi; Oyama, Masaaki; Kozuka-Hata, Hiroko

    2016-01-01

    In the budding yeast Saccharomyces cerevisiae, osmostress activates the Hog1 mitogen-activated protein kinase (MAPK), which regulates diverse osmoadaptive responses. Hkr1 is a large, highly glycosylated, single-path transmembrane protein that is a putative osmosensor in one of the Hog1 upstream pathways termed the HKR1 subbranch. The extracellular region of Hkr1 contains both a positive and a negative regulatory domain. However, the function of the cytoplasmic domain of Hkr1 (Hkr1-cyto) is unknown. Here, using a mass spectrometric method, we identified a protein, termed Ahk1 (Associated with Hkr1), that binds to Hkr1-cyto. Deletion of the AHK1 gene (in the absence of other Hog1 upstream branches) only partially inhibited osmostress-induced Hog1 activation. In contrast, Hog1 could not be activated by constitutively active mutants of the Hog1 pathway signaling molecules Opy2 or Ste50 in ahk1Δ cells, whereas robust Hog1 activation occurred in AHK1+ cells. In addition to Hkr1-cyto binding, Ahk1 also bound to other signaling molecules in the HKR1 subbranch, including Sho1, Ste11, and Pbs2. Although osmotic stimulation of Hkr1 does not activate the Kss1 MAPK, deletion of AHK1 allowed Hkr1 to activate Kss1 by cross talk. Thus, Ahk1 is a scaffold protein in the HKR1 subbranch and prevents incorrect signal flow from Hkr1 to Kss1. PMID:26787842

  11. Glycomic analyses of mouse models of congenital muscular dystrophy.

    Science.gov (United States)

    Stalnaker, Stephanie H; Aoki, Kazuhiro; Lim, Jae-Min; Porterfield, Mindy; Liu, Mian; Satz, Jakob S; Buskirk, Sean; Xiong, Yufang; Zhang, Peng; Campbell, Kevin P; Hu, Huaiyu; Live, David; Tiemeyer, Michael; Wells, Lance

    2011-06-17

    Dystroglycanopathies are a subset of congenital muscular dystrophies wherein α-dystroglycan (α-DG) is hypoglycosylated. α-DG is an extensively O-glycosylated extracellular matrix-binding protein and a key component of the dystrophin-glycoprotein complex. Previous studies have shown α-DG to be post-translationally modified by both O-GalNAc- and O-mannose-initiated glycan structures. Mutations in defined or putative glycosyltransferase genes involved in O-mannosylation are associated with a loss of ligand-binding activity of α-DG and are causal for various forms of congenital muscular dystrophy. In this study, we sought to perform glycomic analysis on brain O-linked glycan structures released from proteins of three different knock-out mouse models associated with O-mannosylation (POMGnT1, LARGE (Myd), and DAG1(-/-)). Using mass spectrometry approaches, we were able to identify nine O-mannose-initiated and 25 O-GalNAc-initiated glycan structures in wild-type littermate control mouse brains. Through our analysis, we were able to confirm that POMGnT1 is essential for the extension of all observed O-mannose glycan structures with β1,2-linked GlcNAc. Loss of LARGE expression in the Myd mouse had no observable effect on the O-mannose-initiated glycan structures characterized here. Interestingly, we also determined that similar amounts of O-mannose-initiated glycan structures are present on brain proteins from α-DG-lacking mice (DAG1) compared with wild-type mice, indicating that there must be additional proteins that are O-mannosylated in the mammalian brain. Our findings illustrate that classical β1,2-elongation and β1,6-GlcNAc branching of O-mannose glycan structures are dependent upon the POMGnT1 enzyme and that O-mannosylation is not limited solely to α-DG in the brain.

  12. BASP1 is a transcriptional cosuppressor for the Wilms' tumor suppressor protein WT1

    DEFF Research Database (Denmark)

    Carpenter, Brian; Hill, Kathryn J; Charalambous, Marika

    2004-01-01

    The Wilms' tumor suppressor protein WT1 is a transcriptional regulator that plays a key role in the development of the kidneys. The transcriptional activation domain of WT1 is subject to regulation by a suppression region within the N terminus of WT1. Using a functional assay, we provide direct...... evidence that this requires a transcriptional cosuppressor, which we identify as brain acid soluble protein 1 (BASP1). WT1 and BASP1 associate within the nuclei of cells that naturally express both proteins. BASP1 can confer WT1 cosuppressor activity in transfection assays, and elimination of endogenous...

  13. Partial dispensability of Djp1's J domain in peroxisomal protein import in Saccharomyces cerevisiae results from genetic redundancy with another class II J protein, Caj1.

    Science.gov (United States)

    Dobriyal, Neha; Tripathi, Prerna; Sarkar, Susrita; Tak, Yogesh; Verma, Amit K; Sahi, Chandan

    2017-05-01

    J proteins are obligate co-chaperones of Hsp70s. Via their signature J domain, all J proteins interact with their partner Hsp70s and stimulate their weak ATPase activity, which is vital for Hsp70 functions. The dependency of J proteins on their J domain is such that mutations in critical amino acids in the J domain often results into a null phenotype for a particular J protein. Here, we show that the J domain of Djp1, a cytosolic J protein important for peroxisomal protein import in Saccharomyces cerevisiae, is partially dispensable. A complete deletion of Djp1 J domain resulted into only partial loss in peroxisomal protein import function. Instead, the C-terminal domain of Djp1 was found to be essential for proper localization of the peroxisomal targeted GFP-PTS1. Furthermore, we show that Caj1, another cytosolic J protein, also has some role in peroxisomal protein import. Caj1 was found to be partially redundant with Djp1 as cells lacking both Djp1 and Caj1 resulted into a much more severe defect in GFP-PTS1 localization. Based on these results, we propose that dispensability of J domains could be attributed to genetic redundancy between different J proteins sharing common structural topology and cellular localization.

  14. Regulation of human protein S gene (PROS1) transcription

    NARCIS (Netherlands)

    Wolf, Cornelia de

    2006-01-01

    This thesis describes the investigation of the transcriptional regulation of the gene for anticoagulant plasma Protein S, PROS1. Protein S is a cofactor for Protein C in the Protein C anticoagulant pathway. The coagulation cascade is negatively regulated by this pathway through inactivation of

  15. Escherichia coli fusion carrier proteins act as solubilizing agents for recombinant uncoupling protein 1 through interactions with GroEL

    International Nuclear Information System (INIS)

    Douette, Pierre; Navet, Rachel; Gerkens, Pascal; Galleni, Moreno; Levy, Daniel; Sluse, Francis E.

    2005-01-01

    Fusing recombinant proteins to highly soluble partners is frequently used to prevent aggregation of recombinant proteins in Escherichia coli. Moreover, co-overexpression of prokaryotic chaperones can increase the amount of properly folded recombinant proteins. To understand the solubility enhancement of fusion proteins, we designed two recombinant proteins composed of uncoupling protein 1 (UCP1), a mitochondrial membrane protein, in fusion with MBP or NusA. We were able to express soluble forms of MBP-UCP1 and NusA-UCP1 despite the high hydrophobicity of UCP1. Furthermore, the yield of soluble fusion proteins depended on co-overexpression of GroEL that catalyzes folding of polypeptides. MBP-UCP1 was expressed in the form of a non-covalent complex with GroEL. MBP-UCP1/GroEL was purified and characterized by dynamic light scattering, gel filtration, and electron microscopy. Our findings suggest that MBP and NusA act as solubilizing agents by forcing the recombinant protein to pass through the bacterial chaperone pathway in the context of fusion protein

  16. Characterization of the CLASP2 Protein Interaction Network Identifies SOGA1 as a Microtubule-Associated Protein

    DEFF Research Database (Denmark)

    Sørensen, Rikke Kruse; Krantz, James; Barker, Natalie

    2017-01-01

    . The GTPase-activating proteins AGAP1 and AGAP3 were also enriched in the CLASP2 interactome, although subsequent AGAP3 and CLIP2 interactome analysis suggests a preference of AGAP3 for CLIP2. Follow-up MARK2 interactome analysis confirmed reciprocal co-IP of CLASP2 and also revealed MARK2 can co-IP SOGA1......, glycogen synthase, and glycogenin. Investigating the SOGA1 interactome confirmed SOGA1 can reciprocal co-IP both CLASP2 and MARK2 as well as glycogen synthase and glycogenin. SOGA1 was confirmed to colocalize with CLASP2 and also with tubulin, which identifies SOGA1 as a new microtubule-associated protein....... These results introduce the metabolic function of these proposed novel protein networks and their relationship with microtubules as new fields of cytoskeleton-associated protein biology....

  17. Lipotoxicity induces hepatic protein inclusions through TBK1-mediated p62/SQSTM1 phosphorylation.

    Science.gov (United States)

    Cho, Chun-Seok; Park, Hwan-Woo; Ho, Allison; Semple, Ian A; Kim, Boyoung; Jang, Insook; Park, Haeli; Reilly, Shannon; Saltiel, Alan R; Lee, Jun Hee

    2017-12-18

    Obesity commonly leads to hepatic steatosis, which often provokes lipotoxic injuries to hepatocytes that cause non-alcoholic steatohepatitis (NASH). NASH in turn is associated with the accumulation of insoluble protein aggregates that are composed of ubiquitinated proteins and ubiquitin adaptor p62/sequestosome 1 (SQSTM1). The formation of p62 inclusions in hepatocytes is the critical marker that distinguishes simple fatty liver from NASH and predicts a poor prognostic outcome for subsequent liver carcinogenesis. However, the molecular mechanism by which lipotoxicity induces protein aggregation is currently unknown. Here we show that upon saturated fatty acid-induced lipotoxicity, Tank-binding protein kinase 1 (TBK1) is activated and phosphorylates p62. The TBK1-mediated p62 phosphorylation is important for lipotoxicity-induced aggregation of ubiquitinated proteins and the formation of large protein inclusions in hepatocytes. In addition, cyclic GMP-AMP synthase (cGAS) and stimulator of interferon genes (STING), upstream regulators of TBK1, are involved in the lipotoxic activation of TBK1 and subsequent p62 phosphorylation in hepatocytes. Furthermore, TBK1 inhibition prevented formation of the ubiquitin-p62 aggregates, not only in cultured hepatocytes, but also in mouse models of obesity and NASH. These results suggest that lipotoxic activation of TBK1 and subsequent p62 phosphorylation are critical steps in the NASH pathology of protein inclusion accumulation in hepatocytes. This mechanism can provide an explanation for how hypernutrition and obesity promote the development of severe liver pathologies, such as steatohepatitis and liver cancer, by facilitating the formation of p62 inclusions. This article is protected by copyright. All rights reserved. © 2017 by the American Association for the Study of Liver Diseases.

  18. Effect of Acylglycerol Composition and Fatty Acyl Chain Length on Lipid Digestion in pH-Stat Digestion Model and Simulated In Vitro Digestion Model.

    Science.gov (United States)

    Qi, Jin F; Jia, Cai H; Shin, Jung A; Woo, Jeong M; Wang, Xiang Y; Park, Jong T; Hong, Soon T; Lee, K-T

    2016-02-01

    In this study, a pH-stat digestion model and a simulated in vitro digestion model were employed to evaluate the digestion degree of lipids depending on different acylglycerols and acyl chain length (that is, diacylglycerol [DAG] compared with soybean oil representing long-chain triacylglycerol compared with medium-chain triacylglycerol [MCT]). In the pH-stat digestion model, differences were observed among the digestion degrees of 3 oils using digestion rate (k), digestion half-time (t1/2 ), and digestion extent (Φmax). The results showed the digestion rate order was MCT > soybean oil > DAG. Accordingly, the order of digestion half-times was MCT digestion model, digestion rates (k') and digestion half-times (t'1/2 ) were also obtained and the results showed a digestion rate order of MCT (k' = 0.068 min(-1) ) > soybean oil (k' = 0.037 min(-1) ) > DAG (k' = 0.024 min(-1) ). Consequently, the order of digestion half-times was MCT (t'1/2 = 10.20 min) digested faster than soybean oil, and that soybean oil was digested faster than DAG. © 2015 Institute of Food Technologists®

  19. Iron oxides and monazite from sands of two beaches in Espirito Santo, Brazil

    International Nuclear Information System (INIS)

    Coelho, Flavia dos Santos; Couceiro, Paulo Rogerio da Costa; Lopes, Ana Lucia; Fabris, Jose Domingos

    2005-01-01

    Sand samples collected from two sampling sites on Guarapari and Iriri beaches, state of Espirito Santo, Brazil, were studied in an attempt to better describe their chemical and mineralogical compositions and radioactive behaviors. The sands were found to contain about 6 (Guarapari) and 2 dag kg -1 (Iriri) of rare earth and thorium that, if allocated to the monazite-(Ce) structure, lead to the averaged formulae Ce 3+ 0,494G d 3+ 0,012 La 3+ 0,209 Nd 3+ 0,177 Pr 3+ 0,040 Sm 3+ 0,024 Th 4+ 0,033 (PO 4 ) and Ce 3+ 0,474 La 3+ 0,227 Nd 3+ 0,190 Pr 3+ 0,044 Sm 3+ 0,032 Th 4+ 0,024 (PO 4 ). From Moessbauer spectroscopy data, the magnetic fractions of these sands were found to contain stoichiometric hematite (47.4 dag kg -1 , from Guarapari, and 25.1 dag kg -1 , from Iriri) and magnetite (44.1 and 58.8 dag kg -1 ). The specific α and β radiation activities were also measured for both samples. (author)

  20. GIT1/βPIX signaling proteins and PAK1 kinase regulate microtubule nucleation.

    Science.gov (United States)

    Černohorská, Markéta; Sulimenko, Vadym; Hájková, Zuzana; Sulimenko, Tetyana; Sládková, Vladimíra; Vinopal, Stanislav; Dráberová, Eduarda; Dráber, Pavel

    2016-06-01

    Microtubule nucleation from γ-tubulin complexes, located at the centrosome, is an essential step in the formation of the microtubule cytoskeleton. However, the signaling mechanisms that regulate microtubule nucleation in interphase cells are largely unknown. In this study, we report that γ-tubulin is in complexes containing G protein-coupled receptor kinase-interacting protein 1 (GIT1), p21-activated kinase interacting exchange factor (βPIX), and p21 protein (Cdc42/Rac)-activated kinase 1 (PAK1) in various cell lines. Immunofluorescence microscopy revealed association of GIT1, βPIX and activated PAK1 with centrosomes. Microtubule regrowth experiments showed that depletion of βPIX stimulated microtubule nucleation, while depletion of GIT1 or PAK1 resulted in decreased nucleation in the interphase cells. These data were confirmed for GIT1 and βPIX by phenotypic rescue experiments, and counting of new microtubules emanating from centrosomes during the microtubule regrowth. The importance of PAK1 for microtubule nucleation was corroborated by the inhibition of its kinase activity with IPA-3 inhibitor. GIT1 with PAK1 thus represent positive regulators, and βPIX is a negative regulator of microtubule nucleation from the interphase centrosomes. The regulatory roles of GIT1, βPIX and PAK1 in microtubule nucleation correlated with recruitment of γ-tubulin to the centrosome. Furthermore, in vitro kinase assays showed that GIT1 and βPIX, but not γ-tubulin, serve as substrates for PAK1. Finally, direct interaction of γ-tubulin with the C-terminal domain of βPIX and the N-terminal domain of GIT1, which targets this protein to the centrosome, was determined by pull-down experiments. We propose that GIT1/βPIX signaling proteins with PAK1 kinase represent a novel regulatory mechanism of microtubule nucleation in interphase cells. Copyright © 2016 Elsevier B.V. All rights reserved.

  1. Signal-dependent hydrolysis of phosphatidylinositol 4,5-bisphosphate without activation of phospholipase C: implications on gating of Drosophila TRPL (transient receptor potential-like) channel.

    Science.gov (United States)

    Lev, Shaya; Katz, Ben; Tzarfaty, Vered; Minke, Baruch

    2012-01-06

    In Drosophila, a phospholipase C (PLC)-mediated signaling cascade, couples photo-excitation of rhodopsin to the opening of the transient receptor potential (TRP) and TRP-like (TRPL) channels. A lipid product of PLC, diacylglycerol (DAG), and its metabolites, polyunsaturated fatty acids (PUFAs) may function as second messengers of channel activation. However, how can one separate between the increase in putative second messengers, change in pH, and phosphatidylinositol 4,5-bisphosphate (PI(4,5)P(2)) depletion when exploring the TRPL gating mechanism? To answer this question we co-expressed the TRPL channels together with the muscarinic (M1) receptor, enabling the openings of TRPL channels via G-protein activation of PLC. To dissect PLC activation of TRPL into its molecular components, we used a powerful method that reduced plasma membrane-associated PI(4,5)P(2) in HEK cells within seconds without activating PLC. Upon the addition of a dimerizing drug, PI(4,5)P(2) was selectively hydrolyzed in the cell membrane without producing DAG, inositol trisphosphate, or calcium signals. We show that PI(4,5)P(2) is not an inhibitor of TRPL channel activation. PI(4,5)P(2) hydrolysis combined with either acidification or application of DAG analogs failed to activate the channels, whereas PUFA did activate the channels. Moreover, a reduction in PI(4,5)P(2) levels or inhibition of DAG lipase during PLC activity suppressed the PLC-activated TRPL current. This suggests that PI(4,5)P(2) is a crucial substrate for PLC-mediated activation of the channels, whereas PUFA may function as the channel activator. Together, this study defines a narrow range of possible mechanisms for TRPL gating.

  2. Oxysterol-Binding Protein-Related Protein 1L Regulates Cholesterol Egress from the Endo-Lysosomal System

    Directory of Open Access Journals (Sweden)

    Kexin Zhao

    2017-05-01

    Full Text Available Lipoprotein cholesterol is delivered to the limiting membrane of late endosomes/lysosomes (LELs by Niemann-Pick C1 (NPC1. However, the mechanism of cholesterol transport from LELs to the endoplasmic reticulum (ER is poorly characterized. We report that oxysterol-binding protein-related protein 1L (ORP1L is necessary for this stage of cholesterol export. CRISPR-mediated knockout of ORP1L in HeLa and HEK293 cells reduced esterification of cholesterol to the level in NPC1 knockout cells, and it increased the expression of sterol-regulated genes and de novo cholesterol synthesis, indicative of a block in cholesterol transport to the ER. In the absence of this transport pathway, cholesterol-enriched LELs accumulated in the Golgi/perinuclear region. Cholesterol delivery to the ER required the sterol-, phosphatidylinositol 4-phosphate-, and vesicle-associated membrane protein-associated protein (VAP-binding activities of ORP1L, as well as NPC1 expression. These results suggest that ORP1L-dependent membrane contacts between LELs and the ER coordinate cholesterol transfer with the retrograde movement of endo-lysosomal vesicles.

  3. Identification of two Th1 cell epitopes on the Babesia bovis-encoded 77-kilodalton merozoite protein (Bb-1) by use of truncated recombinant fusion proteins.

    Science.gov (United States)

    Brown, W C; Zhao, S; Woods, V M; Tripp, C A; Tetzlaff, C L; Heussler, V T; Dobbelaere, D A; Rice-Ficht, A C

    1993-01-01

    Previous studies have demonstrated the serologic and T-cell immunogenicity for cattle of a recombinant form of the apical complex-associated 77-kDa merozite protein of Babesia bovis, designated Bb-1. The present study characterizes the immunogenic epitopes of the Bb-1 protein. A series of recombinant truncated fusion proteins spanning the majority of the Bb-1 protein were expressed in Escherichia coli, and their reactivities with bovine peripheral blood mononuclear cells and T-cell clones derived from B. bovis-immune cattle and with rabbit antibodies were determined. Lymphocytes from two immune cattle were preferentially stimulated by the N-terminal half of the Bb-1 protein (amino acids 23 to 266, termed Bb-1A), localizing the T-cell epitopes to the Bb-1A portion of the molecule. CD4+ T-cell clones derived by stimulation with the intact Bb-1 fusion protein were used to identify two T-cell epitopes in the Bb-1A protein, consisting of amino acids SVVLLSAFSGN VWANEAEVSQVVK and FSDVDKTKSTEKT (residues 23 to 46 and 82 to 94). In contrast, rabbit antiserum raised against the intact fusion protein reacted only with the C-terminal half of the protein (amino acids 267 to 499, termed Bb-1B), which contained 28 tandem repeats of the tetrapeptide PAEK or PAET. Biological assays and Northern (RNA) blot analyses for cytokines revealed that following activation with concanavalin A, T-cell clones reactive against the two Bb-1A epitopes produced interleukin-2, gamma interferon, and tumor necrosis factors beta and alpha, but not interleukin-4, suggesting that the Bb-1 antigen preferentially stimulates the Th1 subset of CD4+ T cells in cattle. The studies described here report for the first time the characterization, by cytokine production, of the Th1 subset of bovine T cells and show that, as in mice, protozoal antigens can induce Th1 cells in ruminants. This first demonstration of B. bovis-encoded Th1 cell epitopes provides a rationale for incorporation of all or part of the Bb-1

  4. HIV-1 Tat protein induces glial cell autophagy through enhancement of BAG3 protein levels.

    Science.gov (United States)

    Bruno, Anna Paola; De Simone, Francesca Isabella; Iorio, Vittoria; De Marco, Margot; Khalili, Kamel; Sariyer, Ilker Kudret; Capunzo, Mario; Nori, Stefania Lucia; Rosati, Alessandra

    2014-01-01

    BAG3 protein has been described as an anti-apoptotic and pro-autophagic factor in several neoplastic and normal cells. We previously demonstrated that BAG3 expression is elevated upon HIV-1 infection of glial and T lymphocyte cells. Among HIV-1 proteins, Tat is highly involved in regulating host cell response to viral infection. Therefore, we investigated the possible role of Tat protein in modulating BAG3 protein levels and the autophagic process itself. In this report, we show that transfection with Tat raises BAG3 levels in glioblastoma cells. Moreover, BAG3 silencing results in highly reducing Tat- induced levels of LC3-II and increasing the appearance of sub G0/G1 apoptotic cells, in keeping with the reported role of BAG3 in modulating the autophagy/apoptosis balance. These results demonstrate for the first time that Tat protein is able to stimulate autophagy through increasing BAG3 levels in human glial cells.

  5. Structural Insight into the 14-3-3 Protein-dependent Inhibition of Protein Kinase ASK1 (Apoptosis Signal-regulating kinase 1)

    Czech Academy of Sciences Publication Activity Database

    Petrvalská, Olivia; Košek, Dalibor; Kukačka, Zdeněk; Tošner, Z.; Man, Petr; Večeř, J.; Herman, P.; Obšilová, Veronika; Obšil, Tomáš

    2016-01-01

    Roč. 291, č. 39 (2016), s. 20753-20765 ISSN 0021-9258 R&D Projects: GA ČR(CZ) GA14-10061S Institutional support: RVO:67985823 ; RVO:61388971 Keywords : 14-3-3 protein * apoptosis signal-regulating kinase 1 (ASK1) * fluorescence * nuclear magnetic resonance (NMR) * protein cross-linking * small-angle x-ray scattering (SAXS) Subject RIV: CE - Biochemistry Impact factor: 4.125, year: 2016

  6. Scaffold protein harmonin (USH1C) provides molecular links between Usher syndrome type 1 and type 2.

    Science.gov (United States)

    Reiners, Jan; van Wijk, Erwin; Märker, Tina; Zimmermann, Ulrike; Jürgens, Karin; te Brinke, Heleen; Overlack, Nora; Roepman, Ronald; Knipper, Marlies; Kremer, Hannie; Wolfrum, Uwe

    2005-12-15

    Usher syndrome (USH) is the most frequent cause of combined deaf-blindness in man. USH is clinically and genetically heterogeneous with at least 11 chromosomal loci assigned to the three USH types (USH1A-G, USH2A-C, USH3A). Although the different USH types exhibit almost the same phenotype in human, the identified USH genes encode for proteins which belong to very different protein classes and families. We and others recently reported that the scaffold protein harmonin (USH1C-gene product) integrates all identified USH1 molecules in a USH1-protein network. Here, we investigated the relationship between the USH2 molecules and this USH1-protein network. We show a molecular interaction between the scaffold protein harmonin (USH1C) and the USH2A protein, VLGR1 (USH2C) and the candidate for USH2B, NBC3. We pinpoint these interactions to interactions between the PDZ1 domain of harmonin and the PDZ-binding motifs at the C-termini of the USH2 proteins and NBC3. We demonstrate that USH2A, VLGR1 and NBC3 are co-expressed with the USH1-protein harmonin in the synaptic terminals of both retinal photoreceptors and inner ear hair cells. In hair cells, these USH proteins are also localized in the signal uptaking stereocilia. Our data indicate that the USH2 proteins and NBC3 are further partners in the supramolecular USH-protein network in the retina and inner ear which shed new light on the function of USH2 proteins and the entire USH-protein network. These findings provide first evidence for a molecular linkage between the pathophysiology in USH1 and USH2. The organization of USH molecules in a mutual 'interactome' related to the disease can explain the common phenotype in USH.

  7. Incorporating functional inter-relationships into protein function prediction algorithms

    Directory of Open Access Journals (Sweden)

    Kumar Vipin

    2009-05-01

    Full Text Available Abstract Background Functional classification schemes (e.g. the Gene Ontology that serve as the basis for annotation efforts in several organisms are often the source of gold standard information for computational efforts at supervised protein function prediction. While successful function prediction algorithms have been developed, few previous efforts have utilized more than the protein-to-functional class label information provided by such knowledge bases. For instance, the Gene Ontology not only captures protein annotations to a set of functional classes, but it also arranges these classes in a DAG-based hierarchy that captures rich inter-relationships between different classes. These inter-relationships present both opportunities, such as the potential for additional training examples for small classes from larger related classes, and challenges, such as a harder to learn distinction between similar GO terms, for standard classification-based approaches. Results We propose a method to enhance the performance of classification-based protein function prediction algorithms by addressing the issue of using these interrelationships between functional classes constituting functional classification schemes. Using a standard measure for evaluating the semantic similarity between nodes in an ontology, we quantify and incorporate these inter-relationships into the k-nearest neighbor classifier. We present experiments on several large genomic data sets, each of which is used for the modeling and prediction of over hundred classes from the GO Biological Process ontology. The results show that this incorporation produces more accurate predictions for a large number of the functional classes considered, and also that the classes benefitted most by this approach are those containing the fewest members. In addition, we show how our proposed framework can be used for integrating information from the entire GO hierarchy for improving the accuracy of

  8. mTORC1 Coordinates Protein Synthesis and Immunoproteasome Formation via PRAS40 to Prevent Accumulation of Protein Stress.

    Science.gov (United States)

    Yun, Young Sung; Kim, Kwan Hyun; Tschida, Barbara; Sachs, Zohar; Noble-Orcutt, Klara E; Moriarity, Branden S; Ai, Teng; Ding, Rui; Williams, Jessica; Chen, Liqiang; Largaespada, David; Kim, Do-Hyung

    2016-02-18

    Reduction of translational fidelity often occurs in cells with high rates of protein synthesis, generating defective ribosomal products. If not removed, such aberrant proteins can be a major source of cellular stress causing human diseases. Here, we demonstrate that mTORC1 promotes the formation of immunoproteasomes for efficient turnover of defective proteins and cell survival. mTORC1 sequesters precursors of immunoproteasome β subunits via PRAS40. When activated, mTORC1 phosphorylates PRAS40 to enhance protein synthesis and simultaneously to facilitate the assembly of the β subunits for forming immunoproteasomes. Consequently, the PRAS40 phosphorylations play crucial roles in clearing aberrant proteins that accumulate due to mTORC1 activation. Mutations of RAS, PTEN, and TSC1, which cause mTORC1 hyperactivation, enhance immunoproteasome formation in cells and tissues. Those mutations increase cellular dependence on immunoproteasomes for stress response and survival. These results define a mechanism by which mTORC1 couples elevated protein synthesis with immunoproteasome biogenesis to protect cells against protein stress. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Proportionate Dwarfism in Mice Lacking Heterochromatin Protein 1 Binding Protein 3 (HP1BP3) Is Associated With Alterations in the Endocrine IGF-1 Pathway.

    Science.gov (United States)

    Garfinkel, Benjamin P; Arad, Shiri; Le, Phuong T; Bustin, Michael; Rosen, Clifford J; Gabet, Yankel; Orly, Joseph

    2015-12-01

    Heterochromatin protein 1 binding protein 3 (HP1BP3) is a recently described histone H1-related protein with roles in chromatin structure and transcriptional regulation. To explore the potential physiological role of HP1BP3, we have previously described an Hp1bp3(-/-) mouse model with reduced postnatal viability and growth. We now find that these mice are proportionate dwarfs, with reduction in body weight, body length, and organ weight. In addition to their small size, microcomputed tomography analysis showed that Hp1bp3(-/-) mice present a dramatic impairment of their bone development and structure. By 3 weeks of age, mice of both sexes have severely impaired cortical and trabecular bone, and these defects persist into adulthood and beyond. Primary cultures of both osteoblasts and osteoclasts from Hp1bp3(-/-) bone marrow and splenocytes, respectively, showed normal differentiation and function, strongly suggesting that the impaired bone accrual is due to noncell autonomous systemic cues in vivo. One major endocrine pathway regulating both body growth and bone acquisition is the IGF regulatory system, composed of IGF-1, the IGF receptors, and the IGF-binding proteins (IGFBPs). At 3 weeks of age, Hp1bp3(-/-) mice exhibited a 60% reduction in circulating IGF-1 and a 4-fold increase in the levels of IGFBP-1 and IGFBP-2. These alterations were reflected in similar changes in the hepatic transcripts of the Igf1, Igfbp1, and Igfbp2 genes. Collectively, these results suggest that HP1BP3 plays a key role in normal growth and bone development by regulating transcription of endocrine IGF-1 components.

  10. Diacylglycerol kinase theta and zeta isoforms : regulation of activity, protein binding partners and physiological functions

    NARCIS (Netherlands)

    Los, Alrik Pieter

    2007-01-01

    Diacylglycerol kinases (DGKs) phosphorylate the second messenger diacylglycerol (DAG) yielding phosphatidic acid (PA). In this thesis, we investigated which structural domains of DGKtheta are required for DGK activity. Furthermore, we showed that DGKzeta binds to and is activated by the

  11. Identification of herpesvirus proteins that contribute to G1/S arrest.

    Science.gov (United States)

    Paladino, Patrick; Marcon, Edyta; Greenblatt, Jack; Frappier, Lori

    2014-04-01

    Lytic infection by herpesviruses induces cell cycle arrest at the G1/S transition. This appears to be a function of multiple herpesvirus proteins, but only a minority of herpesvirus proteins have been examined for cell cycle effects. To gain a more comprehensive understanding of the viral proteins that contribute to G1/S arrest, we screened a library of over 200 proteins from herpes simplex virus type 1, human cytomegalovirus, and Epstein-Barr virus (EBV) for effects on the G1/S interface, using HeLa fluorescent, ubiquitination-based cell cycle indicator (Fucci) cells in which G1/S can be detected colorimetrically. Proteins from each virus were identified that induce accumulation of G1/S cells, predominantly tegument, early, and capsid proteins. The identification of several capsid proteins in this screen suggests that incoming viral capsids may function to modulate cellular processes. The cell cycle effects of selected EBV proteins were further verified and examined for effects on p53 and p21 as regulators of the G1/S transition. Two EBV replication proteins (BORF2 and BMRF1) were found to induce p53 but not p21, while a previously uncharacterized tegument protein (BGLF2) was found to induce p21 protein levels in a p53-independent manner. Proteomic analyses of BGLF2-interacting proteins identified interactions with the NIMA-related protein kinase (NEK9) and GEM-interacting protein (GMIP). Silencing of either NEK9 or GMIP induced p21 without affecting p53 and abrogated the ability of BGLF2 to further induce p21. Collectively, these results suggest multiple viral proteins contribute to G1/S arrest, including BGLF2, which induces p21 levels likely by interfering with the functions of NEK9 and GMIP. Most people are infected with multiple herpesviruses, whose proteins alter the infected cells in several ways. During lytic infection, the viral proteins block cell proliferation just before the cellular DNA replicates. We used a novel screening method to identify proteins

  12. A Ser/Thr protein kinase phosphorylates MA-ACS1 (Musa acuminata 1-aminocyclopropane-1-carboxylic acid synthase 1) during banana fruit ripening.

    Science.gov (United States)

    Choudhury, Swarup Roy; Roy, Sujit; Sengupta, Dibyendu N

    2012-08-01

    1-Aminocyclopropane-1-carboxylic acid synthase (ACS) catalyzes the rate-limiting step in ethylene biosynthesis during ripening. ACS isozymes are regulated both transcriptionally and post-translationally. However, in banana, an important climacteric fruit, little is known about post-translational regulation of ACS. Here, we report the post-translational modification of MA-ACS1 (Musa acuminata ACS1), a ripening inducible isozyme in the ACS family, which plays a key role in ethylene biosynthesis during banana fruit ripening. Immunoprecipitation analyses of phospholabeled protein extracts from banana fruit using affinity-purified anti-MA-ACS1 antibody have revealed phosphorylation of MA-ACS1, particularly in ripe fruit tissue. We have identified the induction of a 41-kDa protein kinase activity in pulp at the onset of ripening. The 41-kDa protein kinase has been identified as a putative protein kinase by MALDI-TOF/MS analysis. Biochemical analyses using partially purified protein kinase fraction from banana fruit have identified the protein kinase as a Ser/Thr family of protein kinase and its possible involvement in MA-ACS1 phosphorylation during ripening. In vitro phosphorylation analyses using synthetic peptides and site-directed mutagenized recombinant MA-ACS1 have revealed that serine 476 and 479 residues at the C-terminal region of MA-ACS1 are phosphorylated. Overall, this study provides important novel evidence for in vivo phosphorylation of MA-ACS1 at the molecular level as a possible mechanism of post-translational regulation of this key regulatory protein in ethylene signaling pathway in banana fruit during ripening.

  13. A Comparison Study on Motion/Force Transmissibility of Two Typical 3-DOF Parallel Manipulators: The Sprint Z3 and A3 Tool Heads

    Directory of Open Access Journals (Sweden)

    Xiang Chen

    2014-01-01

    Full Text Available This paper presents a comparison study of two important three-degree-of-freedom (DOF parallel manipulators, the Sprint Z3 head and the A3 head, both commonly used in industry. As an initial step, the inverse kinematics are derived and an analysis of two classes of limbs is carried out via screw theory. For comparison, three transmission indices are then defined to describe their motion/force transmission performance. Based on the same main parameters, the compared results reveal some distinct characteristics in addition to the similarities between the two parallel manipulators. To a certain extent, the A3 head outperforms the common Sprint Z3 head, providing a new and satisfactory option for a machine tool head in industry.

  14. Characterization of a Chitin-Binding Protein from Bacillus thuringiensis HD-1.

    Directory of Open Access Journals (Sweden)

    Naresh Arora

    Full Text Available Strains of Bacillus thuringiensis produce insecticidal proteins. These strains have been isolated from diverse ecological niches, such as soil, phylloplane, insect cadavers and grain dust. To effectively propagate, these strains produce a range of molecules that facilitate its multiplication in a competing environment. In this report, we have examined synthesis of a chitin-binding protein and evaluated its effect on fungi encountered in environment and its interaction with insecticidal proteins synthesized by B. thuringiensis. The gene encoding chitin-binding protein has been cloned and expressed. The purified protein has been demonstrated to interact with Cry insecticidal protein, Cry1Ac by Circular Dichrosim spectroscopy (CD and in vitro pull down assays. The chitin-binding protein potentiates insecticidal activity of bacillar insecticidal protein, Cry1Ac. Further, chitin-binding protein was fungistatic against several soil fungi. The chitin binding protein is expressed in spore mother cell and deposited along with insecticidal protein, Cry1Ac. It interacts with Cry1Ac to potentiate its insecticidal activity and facilitate propagation of Bacillus strain in environment by inhibiting growth of certain fungi.

  15. SUMO Ligase Protein Inhibitor of Activated STAT1 (PIAS1) Is a Constituent Promyelocytic Leukemia Nuclear Body Protein That Contributes to the Intrinsic Antiviral Immune Response to Herpes Simplex Virus 1.

    Science.gov (United States)

    Brown, James R; Conn, Kristen L; Wasson, Peter; Charman, Matthew; Tong, Lily; Grant, Kyle; McFarlane, Steven; Boutell, Chris

    2016-07-01

    Aspects of intrinsic antiviral immunity are mediated by promyelocytic leukemia nuclear body (PML-NB) constituent proteins. During herpesvirus infection, these antiviral proteins are independently recruited to nuclear domains that contain infecting viral genomes to cooperatively promote viral genome silencing. Central to the execution of this particular antiviral response is the small ubiquitin-like modifier (SUMO) signaling pathway. However, the participating SUMOylation enzymes are not fully characterized. We identify the SUMO ligase protein inhibitor of activated STAT1 (PIAS1) as a constituent PML-NB protein. We show that PIAS1 localizes at PML-NBs in a SUMO interaction motif (SIM)-dependent manner that requires SUMOylated or SUMOylation-competent PML. Following infection with herpes simplex virus 1 (HSV-1), PIAS1 is recruited to nuclear sites associated with viral genome entry in a SIM-dependent manner, consistent with the SIM-dependent recruitment mechanisms of other well-characterized PML-NB proteins. In contrast to that of Daxx and Sp100, however, the recruitment of PIAS1 is enhanced by PML. PIAS1 promotes the stable accumulation of SUMO1 at nuclear sites associated with HSV-1 genome entry, whereas the accumulation of other evaluated PML-NB proteins occurs independently of PIAS1. We show that PIAS1 cooperatively contributes to HSV-1 restriction through mechanisms that are additive to those of PML and cooperative with those of PIAS4. The antiviral mechanisms of PIAS1 are counteracted by ICP0, the HSV-1 SUMO-targeted ubiquitin ligase, which disrupts the recruitment of PIAS1 to nuclear domains that contain infecting HSV-1 genomes through mechanisms that do not directly result in PIAS1 degradation. Adaptive, innate, and intrinsic immunity cooperatively and efficiently restrict the propagation of viral pathogens. Intrinsic immunity mediated by constitutively expressed cellular proteins represents the first line of intracellular defense against infection. PML

  16. Alpha-linolenic acid-enriched diacylglycerol oil does not promote tumor development in tongue and gastrointestinal tract tissues in a medium-term multi-organ carcinogenesis bioassay using male F344 rat.

    Science.gov (United States)

    Honda, Hiroshi; Kawamoto, Taisuke; Doi, Yuko; Matsumura, Shoji; Ito, Yuichi; Imai, Norio; Ikeda, Naohiro; Mera, Yukinori; Morita, Osamu

    2017-08-01

    Alpha-linolenic acid (ALA)-enriched diacylglycerol (DAG) oil is an edible oil enriched with DAG (>80%) and ALA (>50%). The present study investigated whether ALA-DAG oil promotes tumorigenesis in the tongue and gastrointestinal tract, using a rat medium-term multi-organ carcinogenesis bioassay model. Rats were treated with five genotoxic carcinogens to induce multi-organ tumorigenesis until week 4, and from 1 week after withdrawal, fed a semi-synthetic diet (AIN-93G) containing ALA-DAG oil at concentrations of 0, 13,750, 27,500, and 55,000 ppm. Rats fed AIN-93G containing 55,000 ppm ALA-triacylglycerol or a standard basal diet served as reference and negative control groups, respectively. Animals were euthanized at week 30. ALA-DAG oil was shown to have no effects on survival, general condition, body weight, food consumption, or organ weight. More discolored spots were observed in the stomachs of the 13,750- and 55,000-ppm ALA-DAG groups than in those of the control groups; however, there were no differences in the frequency of histopathological findings across groups. There were no meaningful increases in the incidence of pre-neoplastic and neoplastic lesions in the tongue and gastrointestinal tract among the groups. We therefore conclude that ALA-DAG oil does not promote tumor development in the digestive system. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Wasp venom proteins: phospholipase A1 and B.

    Science.gov (United States)

    King, T P; Kochoumian, L; Joslyn, A

    1984-04-01

    Three major venom proteins from different species of wasps have been isolated and characterized. They are hyaluronidase, phospholipase, and antigen 5 of as yet unknown biochemical function. These three proteins are allergens in wasp venom-sensitive persons. The species of wasps studied, of the genus Polistes, were annularis, carolina, exclamans, fuscatus, and instabilis. Antigen 5 and phospholipase from wasp venoms were shown to be antigenically distinct from homologous proteins of yellowjacket venoms. The venom phospholipase from wasp, as well as that from yellowjacket (Vespula germanica), appears to have dual enzymatic specificities of the A1 and B types. That is, hydrolysis takes place at the 1-acyl residue of phosphatidylcholine and at the 1- or 2-acyl residue of lysophosphatidylcholine.

  18. [Family of ribosomal proteins S1 contains unique conservative domain].

    Science.gov (United States)

    Deriusheva, E I; Machulin, A V; Selivanova, O M; Serdiuk, I N

    2010-01-01

    Different representatives of bacteria have different number of amino acid residues in the ribosomal proteins S1. This number varies from 111 (Spiroplasma kunkelii) to 863 a.a. (Treponema pallidum). Traditionally and for lack of this protein three-dimensional structure, its architecture is represented as repeating S1 domains. Number of these domains depends on the protein's length. Domain's quantity and its boundaries data are contained in the specialized databases, such as SMART, Pfam and PROSITE. However, for the same object these data may be very different. For search of domain's quantity and its boundaries, new approach, based on the analysis of dicted secondary structure (PsiPred), was used. This approach allowed us to reveal structural domains in amino acid sequences of S1 proteins and at that number varied from one to six. Alignment of S1 proteins, containing different domain's number, with the S1 RNAbinding domain of Escherichia coli PNPase elicited a fact that in family of ribosomal proteins SI one domain has maximal homology with S1 domain from PNPase. This conservative domain migrates along polypeptide chain and locates in proteins, containing different domain's number, according to specified pattern. In this domain as well in the S1 domain from PNPase, residues Phe-19, Phe-22, His-34, Asp-64 and Arg-68 are clustered on the surface and formed RNA binding site.

  19. Methodical investigation of the protein metabolism and of the bioenergetics of protein retention in growing animals. 1

    International Nuclear Information System (INIS)

    Schiemann, R.; Bock, H.D.; Keller, J.; Hoffmann, L.; Krawielitzki, K.; Klein, M.

    1983-01-01

    The influence of different protein levels in the feed (group R1 20%, R2 38% crude protein) and of different energy levels (group J1 low, J2 high energy level) on the composition of the carcass and the apparent half-life periods of the body proteins were determined in 4 groups of 15 male broiler chickens labelled with 15 NH 4 acetate. In all slaughtering phases the higher protein level resulted in a higher weight of the feathers, breast and leg muscles, higher amounts of N in all parts of the body and a higher percentage of feathers, breast and leg muscles of the total carcass than the lower protein level. Between 13 and 19% of the N in the carcass contributed to the feathers, 24-31% to the breast and leg muscles and 50-63% to the rest of the carcass. The relative quotas of the sum of breast and leg muscles in the carcass were higher for the low energy level than for the high energy level. There were no remarkable differences as to the protein content of the muscles in dependence on the energy level, the quota of sarcoplasmatic proteins, however, was higher on the high level in contrast to the low energy level, that of the myofibrillar proteins was lower. The apparent half-life period of the total body protein after normal protein supply was 22 days (group R1) and 14 after high protein supply. The energy levels in groups J1 and J2 had no significant influence on the half-life period of the total body protein. In the body fractions examined the apparent half-life periods were highest in the breast muscle and lowest in the rest of the carcass. The protein stored in the feathers did not undergo decomposition. The protein fractions 'sarcoplasmatic protein' and 'myofibrillar protein' of breast and leg muscle neither differed from one another nor from the respective total muscle fractions as regards their half-life period. (author)

  20. Quantitative analysis of differentially expressed saliva proteins in human immunodeficiency virus type 1 (HIV-1) infected individuals

    International Nuclear Information System (INIS)

    Zhang, Nawei; Zhang, Zhenyu; Feng, Shan; Wang, Qingtao; Malamud, Daniel; Deng, Haiteng

    2013-01-01

    Highlights: ► A high-throughput method for profiling and quantification of the differentially expressed proteins in saliva samples was developed. ► Identified that DMBT1, S100A7, S100A8, S100A9 and alpha defensin were up-regulated in saliva from HIV-1 seropositive patients. ► Established analytical strategies are translatable to the clinical setting. -- Abstract: In the present study, we have established a new methodology to analyze saliva proteins from HIV-1-seropositive patients before highly active antiretroviral therapy (HAART) and seronegative controls. A total of 593 and 601 proteins were identified in the pooled saliva samples from 5 HIV-1 subjects and 5 controls, respectively. Forty-one proteins were found to be differentially expressed. Bioinformatic analysis of differentially expressed salivary proteins showed an increase of antimicrobial proteins and decrease of protease inhibitors upon HIV-1 infection. To validate some of these differentially expressed proteins, a high-throughput quantitation method was established to determine concentrations of 10 salivary proteins in 40 individual saliva samples from 20 seropositive patients before HAART and 20 seronegative subjects. This method was based on limited protein separation within the zone of the stacking gel of the 1D SDS PAGE and using isotope-coded synthetic peptides as internal standards. The results demonstrated that a combination of protein profiling and targeted quantitation is an efficient method to identify and validate differentially expressed salivary proteins. Expression levels of members of the calcium-binding S100 protein family and deleted in malignant brain tumors 1 protein (DMBT1) were up-regulated while that of Mucin 5B was down-regulated in HIV-1 seropositive saliva samples, which may provide new perspectives for monitoring HIV-infection and understanding the mechanism of HIV-1 infectivity

  1. Quantitative analysis of differentially expressed saliva proteins in human immunodeficiency virus type 1 (HIV-1) infected individuals

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Nawei; Zhang, Zhenyu [Beijing Chaoyang Hospital Affiliated Capital Medical University, Beijing (China); Feng, Shan [MOE Key Laboratory of Bioinformatics, School of Life Sciences, Tsinghua University, Beijing (China); Wang, Qingtao [Beijing Chaoyang Hospital Affiliated Capital Medical University, Beijing (China); Malamud, Daniel [NYU College of Dentistry, 345 East 24th Street, New York, NY 10010 (United States); Deng, Haiteng, E-mail: dht@mail.tsinghua.edu.cn [MOE Key Laboratory of Bioinformatics, School of Life Sciences, Tsinghua University, Beijing (China)

    2013-04-24

    Highlights: ► A high-throughput method for profiling and quantification of the differentially expressed proteins in saliva samples was developed. ► Identified that DMBT1, S100A7, S100A8, S100A9 and alpha defensin were up-regulated in saliva from HIV-1 seropositive patients. ► Established analytical strategies are translatable to the clinical setting. -- Abstract: In the present study, we have established a new methodology to analyze saliva proteins from HIV-1-seropositive patients before highly active antiretroviral therapy (HAART) and seronegative controls. A total of 593 and 601 proteins were identified in the pooled saliva samples from 5 HIV-1 subjects and 5 controls, respectively. Forty-one proteins were found to be differentially expressed. Bioinformatic analysis of differentially expressed salivary proteins showed an increase of antimicrobial proteins and decrease of protease inhibitors upon HIV-1 infection. To validate some of these differentially expressed proteins, a high-throughput quantitation method was established to determine concentrations of 10 salivary proteins in 40 individual saliva samples from 20 seropositive patients before HAART and 20 seronegative subjects. This method was based on limited protein separation within the zone of the stacking gel of the 1D SDS PAGE and using isotope-coded synthetic peptides as internal standards. The results demonstrated that a combination of protein profiling and targeted quantitation is an efficient method to identify and validate differentially expressed salivary proteins. Expression levels of members of the calcium-binding S100 protein family and deleted in malignant brain tumors 1 protein (DMBT1) were up-regulated while that of Mucin 5B was down-regulated in HIV-1 seropositive saliva samples, which may provide new perspectives for monitoring HIV-infection and understanding the mechanism of HIV-1 infectivity.

  2. NS1-binding protein abrogates the elevation of cell viability by the influenza A virus NS1 protein in association with CRKL

    Energy Technology Data Exchange (ETDEWEB)

    Miyazaki, Masaya [Department of Cancer Pathology, Hokkaido University Graduate School of Medicine, N15W7, Kita-ku, Sapporo 060-8638 (Japan); Nishihara, Hiroshi, E-mail: hnishihara@med.hokudai.ac.jp [Department of Translational Pathology, Hokkaido University Graduate School of Medicine, N15W7, Kita-ku, Sapporo 060-8638 (Japan); Hasegawa, Hideki [Department of Pathology, National Institute of Infectious Diseases, Sinjuku-ku, Tokyo (Japan); Tashiro, Masato [Influenza Virus Research Center, National Institute of Infectious Diseases, Sinjuku-ku, Tokyo (Japan); Wang, Lei [Department of Translational Pathology, Hokkaido University Graduate School of Medicine, N15W7, Kita-ku, Sapporo 060-8638 (Japan); Kimura, Taichi; Tanino, Mishie; Tsuda, Masumi [Department of Cancer Pathology, Hokkaido University Graduate School of Medicine, N15W7, Kita-ku, Sapporo 060-8638 (Japan); Tanaka, Shinya [Department of Cancer Pathology, Hokkaido University Graduate School of Medicine, N15W7, Kita-ku, Sapporo 060-8638 (Japan); Department of Translational Pathology, Hokkaido University Graduate School of Medicine, N15W7, Kita-ku, Sapporo 060-8638 (Japan)

    2013-11-29

    Highlights: •NS1 induced excessive phosphorylation of ERK and elevated cell viability. •NS1-BP expression and CRKL knockdown abolished survival effect of NS1. •NS1-BP and NS1 formed the complex through the interaction with CRKL-SH3(N). -- Abstract: The influenza A virus non-structural protein 1 (NS1) is a multifunctional virulence factor consisting of an RNA binding domain and several Src-homology (SH) 2 and SH3 binding motifs, which promotes virus replication in the host cell and helps to evade antiviral immunity. NS1 modulates general host cell physiology in association with various cellular molecules including NS1-binding protein (NS1-BP) and signaling adapter protein CRK-like (CRKL), while the physiological role of NS1-BP during influenza A virus infection especially in association with NS1 remains unclear. In this study, we analyzed the intracellular association of NS1-BP, NS1 and CRKL to elucidate the physiological roles of these molecules in the host cell. In HEK293T cells, enforced expression of NS1 of A/Beijing (H1N1) and A/Indonesia (H5N1) significantly induced excessive phosphorylation of ERK and elevated cell viability, while the over-expression of NS1-BP and the abrogation of CRKL using siRNA abolished such survival effect of NS1. The pull-down assay using GST-fusion CRKL revealed the formation of intracellular complexes of NS1-BP, NS1 and CRKL. In addition, we identified that the N-terminus SH3 domain of CRKL was essential for binding to NS1-BP using GST-fusion CRKL-truncate mutants. This is the first report to elucidate the novel function of NS1-BP collaborating with viral protein NS1 in modulation of host cell physiology. In addition, an alternative role of adaptor protein CRKL in association with NS1 and NS1-BP during influenza A virus infection is demonstrated.

  3. Dendritic cell nuclear protein-1, a novel depression-related protein, upregulates corticotropin-releasing hormone expression

    NARCIS (Netherlands)

    Zhou, Tian; Wang, Shanshan; Ren, Haigang; Qi, Xin-Rui; Luchetti, Sabina; Kamphuis, Willem; Zhou, Jiang-Ning; Wang, Guanghui; Swaab, Dick F.

    2010-01-01

    The recently discovered dendritic cell nuclear protein-1 is the product of a novel candidate gene for major depression. The A allele encodes full-length dendritic cell nuclear protein-1, while the T allele encodes a premature termination of translation at codon number 117 on chromosome 5. In the

  4. Protein-protein interactions as a strategy towards protein-specific drug design: the example of ataxin-1.

    Directory of Open Access Journals (Sweden)

    Cesira de Chiara

    Full Text Available A main challenge for structural biologists is to understand the mechanisms that discriminate between molecular interactions and determine function. Here, we show how partner recognition of the AXH domain of the transcriptional co-regulator ataxin-1 is fine-tuned by a subtle balance between self- and hetero-associations. Ataxin-1 is the protein responsible for the hereditary spinocerebellar ataxia type 1, a disease linked to protein aggregation and transcriptional dysregulation. Expansion of a polyglutamine tract is essential for ataxin-1 aggregation, but the sequence-wise distant AXH domain plays an important aggravating role in the process. The AXH domain is also a key element for non-aberrant function as it intervenes in interactions with multiple protein partners. Previous data have shown that AXH is dimeric in solution and forms a dimer of dimers when crystallized. By solving the structure of a complex of AXH with a peptide from the interacting transcriptional repressor CIC, we show that the dimer interface of AXH is displaced by the new interaction and that, when blocked by the CIC peptide AXH aggregation and misfolding are impaired. This is a unique example in which palindromic self- and hetero-interactions within a sequence with chameleon properties discriminate the partner. We propose a drug design strategy for the treatment of SCA1 that is based on the information gained from the AXH/CIC complex.

  5. Uncoupling proteins (UCP) in unicellular eukaryotes: true UCPs or UCP1-like acting proteins?

    Science.gov (United States)

    Luévano-Martínez, Luis Alberto

    2012-04-05

    Uncoupling proteins belong to the superfamily of mitochondrial anion carriers. They are apparently present throughout the Eukarya domain in which only some members have an established physiological function, i.e. UCP1 from brown adipose tissue is involved in non-shivering thermogenesis. However, the proteins responsible for the phenotype observed in unicellular organisms have not been characterized. In this report we analyzed functional evidence concerning unicellular UCPs and found that true UCPs are restricted to some taxonomical groups while proteins conferring a UCP1-like phenotype to fungi and most protists are the result of a promiscuous activity exerted by other mitochondrial anion carriers. We describe a possible evolutionary route followed by these proteins by which they acquire this promiscuous mechanism. Copyright © 2012 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  6. Alpha-1-antitrypsin studies: canine serum and canine surfactant protein

    International Nuclear Information System (INIS)

    Tuttle, W.C.; Slauson, D.O.; Dahlstrom, M.; Gorman, C.

    1974-01-01

    Canine serum alpha-1-antitrypsin was isolated by gel filtration and affinity chromatography and characterized by polyacrylamide gel electrophoresis and immunoelectrophoresis. Measurement of the trypsin inhibitory capacity of the separated protein indicated a ninefold concentration of functional trypsin inhibitor during the isolation procedure. Electrophoresis demonstrated the presence of a single protein with alpha-globulin mobility and a molecular weight near that of human alpha-1-antitrypsin. The trypsin inhibitory capacity of pulmonary surfactant protein from five Beagle dogs was measured, related to total surfactant protein concentration, and compared with similar measurements on whole serum from the same animals. Results indicated a variable concentration of trypsin inhibitor in the canine pulmonary surfactant protein. However, the concentration in the surfactant protein was always significantly higher than that in the corresponding serum sample. Preliminary experiments designed to separate the trypsin inhibitory fraction(s) from the other surfactant proteins by gel filtration chromatography indicated that the trypsin inhibitor was probably a single protein with a molecular weight near that of alpha-1-antitrypsin. (U.S.)

  7. A Reconfigurable System Approach to the Direct Kinematics of a 5 D.o.f Robotic Manipulator

    Directory of Open Access Journals (Sweden)

    Diego F. Sánchez

    2010-01-01

    Full Text Available Hardware acceleration in high performance computer systems has a particular interest for many engineering and scientific applications in which a large number of arithmetic operations and transcendental functions must be computed. In this paper a hardware architecture for computing direct kinematics of robot manipulators with 5 degrees of freedom (5 D.o.f using floating-point arithmetic is presented for 32, 43, and 64 bit-width representations and it is implemented in Field Programmable Gate Arrays (FPGAs. The proposed architecture has been developed using several floating-point libraries for arithmetic and transcendental functions operators, allowing the designer to select (pre-synthesis a suitable bit-width representation according to the accuracy and dynamic range, as well as the area, elapsed time and power consumption requirements of the application. Synthesis results demonstrate the effectiveness and high performance of the implemented cores on commercial FPGAs. Simulation results have been addressed in order to compute the Mean Square Error (MSE, using the Matlab as statistical estimator, validating the correct behavior of the implemented cores. Additionally, the processing time of the hardware architecture was compared with the same formulation implemented in software, using the PowerPC (FPGA embedded processor, demonstrating that the hardware architecture speeds-up by factor of 1298 the software implementation.

  8. Human kidney anion exchanger 1 interacts with adaptor-related protein complex 1 μ1A (AP-1 mu1A)

    International Nuclear Information System (INIS)

    Sawasdee, Nunghathai; Junking, Mutita; Ngaojanlar, Piengpaga; Sukomon, Nattakan; Ungsupravate, Duangporn; Limjindaporn, Thawornchai; Akkarapatumwong, Varaporn; Noisakran, Sansanee; Yenchitsomanus, Pa-thai

    2010-01-01

    Research highlights: → Trafficking defect of kAE1 is a cause of dRTA but trafficking pathway of kAE1 has not been clearly described. → Adaptor-related protein complex 1 μ1A (AP-1 mu1A) was firstly reported to interact with kAE1. → The interacting site for AP-1 mu1A on Ct-kAE1 was found to be Y904DEV907, a subset of YXXO motif. → AP-1 mu1A knockdown showed a marked reduction of kAE1 on the cell membrane and its accumulation in endoplasmic reticulum. → AP-1 mu1A has a critical role in kAE1 trafficking to the plasma membrane. -- Abstract: Kidney anion exchanger 1 (kAE1) mediates chloride (Cl - ) and bicarbonate (HCO 3 - ) exchange at the basolateral membrane of kidney α-intercalated cells. Impaired trafficking of kAE1 leads to defect of the Cl - /HCO 3 - exchange at the basolateral membrane and failure of proton (H + ) secretion at the apical membrane, causing a kidney disease - distal renal tubular acidosis (dRTA). To gain a better insight into kAE1 trafficking, we searched for proteins physically interacting with the C-terminal region of kAE1 (Ct-kAE1), which contains motifs crucial for intracellular trafficking, by a yeast two-hybrid (Y2H) system. An adaptor-related protein complex 1 μ1A (AP-1 mu1A) subunit was found to interact with Ct-kAE1. The interaction between either Ct-kAE1 or full-length kAE1 and AP-1 mu1A were confirmed in human embryonic kidney (HEK) 293T by co-immunoprecipitation, affinity co-purification, co-localization, yellow fluorescent protein (YFP)-based protein fragment complementation assay (PCA) and GST pull-down assay. The interacting site for AP-1 mu1A on Ct-kAE1 was found to be Y904DEV907, a subset of YXXO motif. Interestingly, suppression of endogenous AP-1 mu1A in HEK 293T by small interfering RNA (siRNA) decreased membrane localization of kAE1 and increased its intracellular accumulation, suggesting for the first time that AP-1 mu1A is involved in the kAE1 trafficking of kidney α-intercalated cells.

  9. Human kidney anion exchanger 1 interacts with adaptor-related protein complex 1 {mu}1A (AP-1 mu1A)

    Energy Technology Data Exchange (ETDEWEB)

    Sawasdee, Nunghathai; Junking, Mutita [Division of Medical Molecular Biology and BIOTEC-Medical Biotechnology Unit, Department of Research and Development, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700 (Thailand); Ngaojanlar, Piengpaga [Division of Medical Molecular Biology and BIOTEC-Medical Biotechnology Unit, Department of Research and Development, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700 (Thailand); Department of Immunology and Graduate Program in Immunology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700 (Thailand); Sukomon, Nattakan; Ungsupravate, Duangporn [Division of Medical Molecular Biology and BIOTEC-Medical Biotechnology Unit, Department of Research and Development, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700 (Thailand); Limjindaporn, Thawornchai [Division of Medical Molecular Biology and BIOTEC-Medical Biotechnology Unit, Department of Research and Development, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700 (Thailand); Department of Anatomy, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700 (Thailand); Akkarapatumwong, Varaporn [Institute of Molecular Biosciences, Mahidol University at Salaya Campus, Nakorn Pathom 73170 (Thailand); Noisakran, Sansanee [Division of Medical Molecular Biology and BIOTEC-Medical Biotechnology Unit, Department of Research and Development, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700 (Thailand); Yenchitsomanus, Pa-thai, E-mail: grpye@mahidol.ac.th [Division of Medical Molecular Biology and BIOTEC-Medical Biotechnology Unit, Department of Research and Development, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok 10700 (Thailand)

    2010-10-08

    Research highlights: {yields} Trafficking defect of kAE1 is a cause of dRTA but trafficking pathway of kAE1 has not been clearly described. {yields} Adaptor-related protein complex 1 {mu}1A (AP-1 mu1A) was firstly reported to interact with kAE1. {yields} The interacting site for AP-1 mu1A on Ct-kAE1 was found to be Y904DEV907, a subset of YXXO motif. {yields} AP-1 mu1A knockdown showed a marked reduction of kAE1 on the cell membrane and its accumulation in endoplasmic reticulum. {yields} AP-1 mu1A has a critical role in kAE1 trafficking to the plasma membrane. -- Abstract: Kidney anion exchanger 1 (kAE1) mediates chloride (Cl{sup -}) and bicarbonate (HCO{sub 3}{sup -}) exchange at the basolateral membrane of kidney {alpha}-intercalated cells. Impaired trafficking of kAE1 leads to defect of the Cl{sup -}/HCO{sub 3}{sup -} exchange at the basolateral membrane and failure of proton (H{sup +}) secretion at the apical membrane, causing a kidney disease - distal renal tubular acidosis (dRTA). To gain a better insight into kAE1 trafficking, we searched for proteins physically interacting with the C-terminal region of kAE1 (Ct-kAE1), which contains motifs crucial for intracellular trafficking, by a yeast two-hybrid (Y2H) system. An adaptor-related protein complex 1 {mu}1A (AP-1 mu1A) subunit was found to interact with Ct-kAE1. The interaction between either Ct-kAE1 or full-length kAE1 and AP-1 mu1A were confirmed in human embryonic kidney (HEK) 293T by co-immunoprecipitation, affinity co-purification, co-localization, yellow fluorescent protein (YFP)-based protein fragment complementation assay (PCA) and GST pull-down assay. The interacting site for AP-1 mu1A on Ct-kAE1 was found to be Y904DEV907, a subset of YXXO motif. Interestingly, suppression of endogenous AP-1 mu1A in HEK 293T by small interfering RNA (siRNA) decreased membrane localization of kAE1 and increased its intracellular accumulation, suggesting for the first time that AP-1 mu1A is involved in the kAE1

  10. Adhalin, the 50 kD dystrophin associated protein, is not the locus for severe childhood autosomal recessive dystrophy (SCARMD)

    Energy Technology Data Exchange (ETDEWEB)

    McNally, E.M.; Selig, S.; Kunkel, L.M. [Children`s Hospital, Boston, MA (United States)

    1994-09-01

    Mutations in the carboxyl-terminus in dystrophin are normally sufficient to produce severely dystrophic muscle. This portion of dystrophin binds a complex of dystrophin-associated glycoproteins (DAGs). The genes encoding these DAGs are candidate genes for causing neuromuscular disease. Immunoreactivity for adhalin, the 50 kD DAG, is absent in muscle biopsies from patients with SCARMD, a form of dystrophy clinically similar Duchenne muscular dystrophy. Prior linkage analysis in SCARMD families revealed that the disease gene segregates with markers on chromosome 13. To determine the molecular role that adhalin may play in SCARMD, human cDNA and genomic sequences were isolated. Primers were designed based on predicted areas of conservation in rabbit adhalin and used in RT-PCR with human skeletal and cardiac muscle. RT-PCR products were confirmed by sequence as human adhalin and then used as probes for screening human cDNA and genomic libraries. Human and rabbit adhalin are 90% identical, and among the cDNAs, a novel splice form of adhalin was seen which may encode part of the 35 kD component of the dystrophin-glycoprotein complex. To our surprise, only human/rodent hybrids containing human chromosome 17 amplified adhalin sequences in a PCR analysis. FISH analysis with three overlapping genomic sequences confirmed the chromosome 17 location and further delineated the map position to 17q21. Therefore, adhalin is excluded as the gene causing SCARMD.

  11. Time-dependent, glucose-regulated Arabidopsis Regulator of G-protein Signaling 1 network

    Directory of Open Access Journals (Sweden)

    Dinesh Kumar Jaiswal

    2016-04-01

    Full Text Available Plants lack 7-transmembrane, G-protein coupled receptors (GPCRs because the G alpha subunit of the heterotrimeric G protein complex is “self-activating”—meaning that it spontaneously exchanges bound GDP for GTP without the need of a GPCR. In lieu of GPCRs, most plants have a seven transmembrane receptor-like regulator of G-protein signaling (RGS protein, a component of the complex that keeps G-protein signaling in its non-activated state. The addition of glucose physically uncouples AtRGS1 from the complex through specific endocytosis leaving the activated G protein at the plasma membrane. The complement of proteins in the AtRGS1/G-protein complex over time from glucose-induced endocytosis was profiled by immunoprecipitation coupled to mass spectrometry (IP-MS. A total of 119 proteins in the AtRGS1 complex were identified. Several known interactors of the complex were identified, thus validating the approach, but the vast majority (93/119 were not known previously. AtRGS1 protein interactions were dynamically modulated by d-glucose. At low glucose levels, the AtRGS1 complex is comprised of proteins involved in transport, stress and metabolism. After glucose application, the AtRGS1 complex rapidly sheds many of these proteins and recruits other proteins involved in vesicular trafficking and signal transduction. The profile of the AtRGS1 components answers several questions about the type of coat protein and vesicular trafficking GTPases used in AtRGS1 endocytosis and the function of endocytic AtRGS1.

  12. Identification, characterization and antigenicity of the Plasmodium vivax rhoptry neck protein 1 (PvRON1

    Directory of Open Access Journals (Sweden)

    Patarroyo Manuel E

    2011-10-01

    Full Text Available Abstract Background Plasmodium vivax malaria remains a major health problem in tropical and sub-tropical regions worldwide. Several rhoptry proteins which are important for interaction with and/or invasion of red blood cells, such as PfRONs, Pf92, Pf38, Pf12 and Pf34, have been described during the last few years and are being considered as potential anti-malarial vaccine candidates. This study describes the identification and characterization of the P. vivax rhoptry neck protein 1 (PvRON1 and examine its antigenicity in natural P. vivax infections. Methods The PvRON1 encoding gene, which is homologous to that encoding the P. falciparum apical sushi protein (ASP according to the plasmoDB database, was selected as our study target. The pvron1 gene transcription was evaluated by RT-PCR using RNA obtained from the P. vivax VCG-1 strain. Two peptides derived from the deduced P. vivax Sal-I PvRON1 sequence were synthesized and inoculated in rabbits for obtaining anti-PvRON1 antibodies which were used to confirm the protein expression in VCG-1 strain schizonts along with its association with detergent-resistant microdomains (DRMs by Western blot, and its localization by immunofluorescence assays. The antigenicity of the PvRON1 protein was assessed using human sera from individuals previously exposed to P. vivax malaria by ELISA. Results In the P. vivax VCG-1 strain, RON1 is a 764 amino acid-long protein. In silico analysis has revealed that PvRON1 shares essential characteristics with different antigens involved in invasion, such as the presence of a secretory signal, a GPI-anchor sequence and a putative sushi domain. The PvRON1 protein is expressed in parasite's schizont stage, localized in rhoptry necks and it is associated with DRMs. Recombinant protein recognition by human sera indicates that this antigen can trigger an immune response during a natural infection with P. vivax. Conclusions This study shows the identification and characterization of

  13. Effects of ubiquilin 1 on the unfolded protein response.

    Science.gov (United States)

    Lu, Alice; Hiltunen, Mikko; Romano, Donna M; Soininen, Hilkka; Hyman, Bradley T; Bertram, Lars; Tanzi, Rudolph E

    2009-05-01

    Previous studies have implicated the unfolded protein response (UPR) in the pathogenesis of Alzheimer's disease (AD). We previously reported that DNA variants in the ubiquilin 1 (UBQLN1) gene increase the risk for AD. Since UBQLN1 has been shown to play a role in the UPR, we assessed the effects of overexpression and downregulation of UBQLN1 splice variants during tunicamycin-induced ER stress. In addition to previously described transcript variants, TV1 and TV2, we identified two novel transcript variants of UBQLN1 in brain: TV3 (lacking exons 2-4) and TV4 (lacking exon 4). Overexpression of TV1-3, but not TV4 significantly decreased the mRNA induction of UPR-inducible genes, C/EBP homologous protein (CHOP), BiP/GRP78, and protein disulfide isomerase (PDI) during the UPR. Stable overexpression of TV1-3, but not TV4, also significantly decreased the induction of CHOP protein and increased cell viability during the UPR. In contrast, downregulation of UBQLN1 did not affect CHOP mRNA induction, but instead increased PDI mRNA levels. These findings suggest that overexpression UBQLN1 transcript variants TV1-3, but not TV4, exert a protective effect during the UPR by attenuating CHOP induction and potentially increasing cell viability.

  14. Zac1, an Sp1-like protein, regulates human p21{sup WAF1/Cip1} gene expression in HeLa cells

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Pei-Yao [Graduate Institute of Life Sciences, National Defense Medical Center, Taipei 114, Taiwan, ROC (China); Hsieh, Tsai-Yuan [Division of Gastroenterology, Department of Internal Medicine, Tri-Service General Hospital, National Defense Medical Center, Taipei 114, Taiwan, ROC (China); Liu, Shu-Ting; Chang, Yung-Lung [Department of Biochemistry, National Defense Medical Center, Taipei 114, Taiwan, ROC (China); Lin, Wei-Shiang [Division of Cardiology, Department of Medicine, Tri-Service General Hospital, National Defense Medical Center, Taipei 114, Taiwan, ROC (China); Wang, Wei-Ming, E-mail: ades0431@ms38.hinet.net [Graduate Institute of Life Sciences, National Defense Medical Center, Taipei 114, Taiwan, ROC (China); Department of Dermatology, Tri-Service General Hospital, National Defense Medical Center, Taipei 114, Taiwan, ROC (China); Huang, Shih-Ming, E-mail: shihming@ndmctsgh.edu.tw [Graduate Institute of Life Sciences, National Defense Medical Center, Taipei 114, Taiwan, ROC (China); Department of Biochemistry, National Defense Medical Center, Taipei 114, Taiwan, ROC (China)

    2011-12-10

    Zac1 functions as both a transcription factor and a transcriptional cofactor for p53, nuclear receptors (NRs) and NR coactivators. Zac1 might also act as a transcriptional repressor via the recruitment of histone deacetylase 1 (HDAC1). The ability of Zac1 to interact directly with GC-specific elements indicates that Zac1 possibly binds to Sp1-responsive elements. In the present study, our data show that Zac1 is able to interact directly with the Sp1-responsive element in the p21{sup WAF1/Cip1} gene promoter and enhance the transactivation activity of Sp1 through direct physical interaction. Our data further demonstrate that Zac1 might enhance Sp1-specific promoter activity by interacting with the Sp1-responsive element, affecting the transactivation activity of Sp1 via a protein-protein interaction, or competing the HDAC1 protein away from the pre-existing Sp1/HDAC1 complex. Finally, the synergistic regulation of p21{sup WAF1/Cip1} gene expression by Zac1 and Sp1 is mediated by endogenous p53 protein and p53-responsive elements in HeLa cells. Our work suggests that Zac1 might serve as an Sp1-like protein that directly interacts with the Sp1-responsive element to oligomerize with and/or to coactivate Sp1.

  15. Cellular Cholesterol Regulates Ubiquitination and Degradation of the Cholesterol Export Proteins ABCA1 and ABCG1*

    Science.gov (United States)

    Hsieh, Victar; Kim, Mi-Jurng; Gelissen, Ingrid C.; Brown, Andrew J.; Sandoval, Cecilia; Hallab, Jeannette C.; Kockx, Maaike; Traini, Mathew; Jessup, Wendy; Kritharides, Leonard

    2014-01-01

    The objective of this study was to examine the influence of cholesterol in post-translational control of ABCA1 and ABCG1 protein expression. Using CHO cell lines stably expressing human ABCA1 or ABCG1, we observed that the abundance of these proteins is increased by cell cholesterol loading. The response to increased cholesterol is rapid, is independent of transcription, and appears to be specific for these membrane proteins. The effect is mediated through cholesterol-dependent inhibition of transporter protein degradation. Cell cholesterol loading similarly regulates degradation of endogenously expressed ABCA1 and ABCG1 in human THP-1 macrophages. Turnover of ABCA1 and ABCG1 is strongly inhibited by proteasomal inhibitors and is unresponsive to inhibitors of lysosomal proteolysis. Furthermore, cell cholesterol loading inhibits ubiquitination of ABCA1 and ABCG1. Our findings provide evidence for a rapid, cholesterol-dependent, post-translational control of ABCA1 and ABCG1 protein levels, mediated through a specific and sterol-sensitive mechanism for suppression of transporter protein ubiquitination, which in turn decreases proteasomal degradation. This provides a mechanism for acute fine-tuning of cholesterol transporter activity in response to fluctuations in cell cholesterol levels, in addition to the longer term cholesterol-dependent transcriptional regulation of these genes. PMID:24500716

  16. Higher accumulation of F1-V fusion recombinant protein in plants after induction of protein body formation.

    Science.gov (United States)

    Alvarez, M Lucrecia; Topal, Emel; Martin, Federico; Cardineau, Guy A

    2010-01-01

    Improving foreign protein accumulation is crucial for enhancing the commercial success of plant-based production systems since product yields have a major influence on process economics. Cereal grain evolved to store large amounts of proteins in tightly organized aggregates. In maize, gamma-Zein is the major storage protein synthesized by the rough endoplasmic reticulum (ER) and stored in specialized organelles called protein bodies (PB). Zera (gamma-Zein ER-accumulating domain) is the N-terminal proline-rich domain of gamma-zein that is sufficient to induce the assembly of PB formation. Fusion of the Zera domain to proteins of interest results in assembly of dense PB-like, ER-derived organelles, containing high concentration of recombinant protein. Our main goal was to increase recombinant protein accumulation in plants in order to enhance the efficiency of orally-delivered plant-made vaccines. It is well known that oral vaccination requires substantially higher doses than parental formulations. As a part of a project to develop a plant-made plague vaccine, we expressed our model antigen, the Yersinia pestis F1-V antigen fusion protein, with and without a fused Zera domain. We demonstrated that Zera-F1-V protein accumulation was at least 3x higher than F1-V alone when expressed in three different host plant systems: Ncotiana benthamiana, Medicago sativa (alfalfa) and Nicotiana tabacum NT1 cells. We confirmed the feasibility of using Zera technology to induce protein body formation in non-seed tissues. Zera expression and accumulation did not affect plant development and growth. These results confirmed the potential exploitation of Zera technology to substantially increase the accumulation of value-added proteins in plants.

  17. The F-box Protein FBXO44 Mediates BRCA1 Ubiquitination and Degradation*

    Science.gov (United States)

    Lu, Yunzhe; Li, Jiezhi; Cheng, Dongmei; Parameswaran, Balaji; Zhang, Shaohua; Jiang, Zefei; Yew, P. Renee; Peng, Junmin; Ye, Qinong; Hu, Yanfen

    2012-01-01

    BRCA1 mutations account for a significant proportion of familial breast and ovarian cancers. In addition, reduced BRCA1 protein is associated with sporadic cancer cases in these tissues. At the cellular level, BRCA1 plays a critical role in multiple cellular functions such as DNA repair and cell cycle checkpoint control. Its protein level is regulated in a cell cycle-dependent manner. However, regulation of BRCA1 protein stability is not fully understood. Our earlier study showed that the amino terminus of BRCA1 harbors a degron sequence that is sufficient and necessary for conferring BRCA1 degradation. In the current study, we used mass spectrometry to identify Skp1 that regulates BRCA1 protein stability. Small interfering RNA screening that targets all human F-box proteins uncovered FBXO44 as an important protein that influences BRCA1 protein level. The Skp1-Cul1-F-box-protein44 (SCFFBXO44) complex ubiquitinates full-length BRCA1 in vitro. Furthermore, the N terminus of BRCA1 mediates the interaction between BRCA1 and FBXO44. Overexpression of SCFFBXO44 reduces BRCA1 protein level. Taken together, our work strongly suggests that SCFFBXO44 is an E3 ubiquitin ligase responsible for BRCA1 degradation. In addition, FBXO44 expression pattern in breast carcinomas suggests that SCFFBXO44-mediated BRCA1 degradation might contribute to sporadic breast tumor development. PMID:23086937

  18. Cartilage acidic protein 1, a new member of the beta-propeller protein family with amyloid propensity.

    Science.gov (United States)

    Anjos, Liliana; Morgado, Isabel; Guerreiro, Marta; Cardoso, João C R; Melo, Eduardo P; Power, Deborah M

    2017-02-01

    Cartilage acidic protein1 (CRTAC1) is an extracellular matrix protein of chondrogenic tissue in humans and its presence in bacteria indicate it is of ancient origin. Structural modeling of piscine CRTAC1 reveals it belongs to the large family of beta-propeller proteins that in mammals have been associated with diseases, including amyloid diseases such as Alzheimer's. In order to characterize the structure/function evolution of this new member of the beta-propeller family we exploited the unique characteristics of piscine duplicate genes Crtac1a and Crtac1b and compared their structural and biochemical modifications with human recombinant CRTAC1. We demonstrate that CRTAC1 has a beta-propeller structure that has been conserved during evolution and easily forms high molecular weight thermo-stable aggregates. We reveal for the first time the propensity of CRTAC1 to form amyloid-like structures, and hypothesize that the aggregating property of CRTAC1 may be related to its disease-association. We further contribute to the general understating of CRTAC1's and beta-propeller family evolution and function. Proteins 2017; 85:242-255. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  19. Calcium Channels, Rho-Kinase, Protein Kinase-C, and Phospholipase-C Pathways Mediate Mercury Chloride-Induced Myometrial Contractions in Rats.

    Science.gov (United States)

    Koli, Swati; Prakash, Atul; Choudhury, Soumen; Mandil, Rajesh; Garg, Satish K

    2018-05-21

    Adverse effects of mercury on female reproduction are reported; however, its effect on myogenic activity of uterus and mechanism thereof is obscure. Present study was undertaken to unravel the mechanistic pathways of mercuric chloride (HgCl 2 )-induced myometrial contraction in rats. Isometric tension in myometrial strips of rats following in vitro exposure to HgCl 2 was recorded using data acquisition system-based physiograph. HgCl 2 produced concentration-dependent (10 nM-100 μM) uterotonic effect which was significantly (p Graphical Abstract Graphical abstract depicting the mechanism of mercury-induced myometrial contraction in rats. M receptor: Muscarinic receptor; PIP2: phospho-inositol bisphosphate; PLC: phospholipase-C; DAG: diacyl glycerol; IP3: inositol triphosphate; IP3R: inositol triphosphate receptor; PKC; protein kinase-C; MLCP: myosin light chain phosphatise; MYPT: myosin phosphatase; SR: sarco-endoplasmic reticulum.

  20. Nuclear localization of human DNA mismatch repair protein exonuclease 1 (hEXO1)

    DEFF Research Database (Denmark)

    Knudsen, Nina Østergaard; Nielsen, Finn Cilius; Vinther, Lena

    2007-01-01

    interaction with hMLH1 and we show that defective nuclear localization of hEXO1 mutant proteins could be rescued by hMLH1 or hMSH2. Both hEXO1 and hMLH1 form complexes with the nuclear import factors importin beta/alpha1,3,7 whereas hMSH2 specifically recognizes importin beta/alpha3. Taken together, we infer...... that hEXO1, hMLH1 and hMSH2 form complexes and are imported to the nucleus together, and that redundant NLS import signals in the proteins may safeguard nuclear import and thereby MMR activity....

  1. Proteomic analysis identifies insulin-like growth factor-binding protein-related protein-1 as a podocyte product.

    Science.gov (United States)

    Matsumoto, Takayuki; Hess, Sonja; Kajiyama, Hiroshi; Sakairi, Toru; Saleem, Moin A; Mathieson, Peter W; Nojima, Yoshihisa; Kopp, Jeffrey B

    2010-10-01

    The podocyte secretory proteome may influence the phenotype of adjacent podocytes, endothelial cells, parietal epithelial cells, and tubular epithelial cells but has not been systematically characterized. We have initiated studies to characterize this proteome, with the goal of further understanding the podocyte cell biology. We cultured differentiated conditionally immortalized human podocytes and subjected the proteins in conditioned medium to mass spectrometry. At a false discovery rate of factor-binding protein-related protein-1 (IGFBP-rP1), was expressed in mRNA and protein of cultured podocytes. In addition, transforming growth factor-β1 stimulation increased IGFBP-rP1 in conditioned medium. We analyzed IGFBP-rP1 glomerular expression in a mouse model of human immunodeficiency virus-associated nephropathy. IGFBP-rP1 was absent from podocytes of normal mice and was expressed in podocytes and pseudocrescents of transgenic mice, where it was coexpressed with desmin, a podocyte injury marker. We conclude that IGFBP-rP1 may be a product of injured podocytes. Further analysis of the podocyte secretory proteome may identify biomarkers of podocyte injury.

  2. Crystal Structure of Bacteriophage SPP1 Distal Tail Protein (gp19.1)

    Science.gov (United States)

    Veesler, David; Robin, Gautier; Lichière, Julie; Auzat, Isabelle; Tavares, Paulo; Bron, Patrick; Campanacci, Valérie; Cambillau, Christian

    2010-01-01

    Siphophage SPP1 infects the Gram-positive bacterium Bacillus subtilis using its long non-contractile tail and tail-tip. Electron microscopy (EM) previously allowed a low resolution assignment of most orf products belonging to these regions. We report here the structure of the SPP1 distal tail protein (Dit, gp19.1). The combination of x-ray crystallography, EM, and light scattering established that Dit is a back-to-back dimer of hexamers. However, Dit fitting in the virion EM maps was only possible with a hexamer located between the tail-tube and the tail-tip. Structure comparison revealed high similarity between Dit and a central component of lactophage baseplates. Sequence similarity search expanded its relatedness to several phage proteins, suggesting that Dit is a docking platform for the tail adsorption apparatus in Siphoviridae infecting Gram-positive bacteria and that its architecture is a paradigm for these hub proteins. Dit structural similarity extends also to non-contractile and contractile phage tail proteins (gpVN and XkdM) as well as to components of the bacterial type 6 secretion system, supporting an evolutionary connection between all these devices. PMID:20843802

  3. Deleted in breast cancer 1 (DBC1) protein regulates hepatic gluconeogenesis.

    Science.gov (United States)

    Nin, Veronica; Chini, Claudia C S; Escande, Carlos; Capellini, Verena; Chini, Eduardo N

    2014-02-28

    Liver gluconeogenesis is essential to provide energy to glycolytic tissues during fasting periods. However, aberrant up-regulation of this metabolic pathway contributes to the progression of glucose intolerance in individuals with diabetes. Phosphoenolpyruvate carboxykinase (PEPCK) expression plays a critical role in the modulation of gluconeogenesis. Several pathways contribute to the regulation of PEPCK, including the nuclear receptor Rev-erbα and the histone deacetylase SIRT1. Deleted in breast cancer 1 (DBC1) is a nuclear protein that binds to and regulates both Rev-erbα and SIRT1 and, therefore, is a candidate to participate in the regulation of PEPCK. In this work, we provide evidence that DBC1 regulates glucose metabolism and the expression of PEPCK. We show that DBC1 levels decrease early in the fasting state. Also, DBC1 KO mice display higher gluconeogenesis in a normal and a high-fat diet. DBC1 absence leads to an increase in PEPCK mRNA and protein expression. Conversely, overexpression of DBC1 results in a decrease in PEPCK mRNA and protein levels. DBC1 regulates the levels of Rev-erbα, and manipulation of Rev-erbα activity or levels prevents the effect of DBC1 on PEPCK. In addition, Rev-erbα levels decrease in the first hours of fasting. Finally, knockdown of the deacetylase SIRT1 eliminates the effect of DBC1 knockdown on Rev-erbα levels and PEPCK expression, suggesting that the mechanism of PEPCK regulation is, at least in part, dependent on the activity of this enzyme. Our results point to DBC1 as a novel regulator of gluconeogenesis.

  4. LDL receptor-related protein 1 regulates the abundance of diverse cell-signaling proteins in the plasma membrane proteome.

    Science.gov (United States)

    Gaultier, Alban; Simon, Gabriel; Niessen, Sherry; Dix, Melissa; Takimoto, Shinako; Cravatt, Benjamin F; Gonias, Steven L

    2010-12-03

    LDL receptor-related protein 1 (LRP1) is an endocytic receptor, reported to regulate the abundance of other receptors in the plasma membrane, including uPAR and tissue factor. The goal of this study was to identify novel plasma membrane proteins, involved in cell-signaling, that are regulated by LRP1. Membrane protein ectodomains were prepared from RAW 264.7 cells in which LRP1 was silenced and control cells using protease K. Peptides were identified by LC-MS/MS. By analysis of spectral counts, 31 transmembrane and secreted proteins were regulated in abundance at least 2-fold when LRP1 was silenced. Validation studies confirmed that semaphorin4D (Sema4D), plexin domain-containing protein-1 (Plxdc1), and neuropilin-1 were more abundant in the membranes of LRP1 gene-silenced cells. Regulation of Plxdc1 by LRP1 was confirmed in CHO cells, as a second model system. Plxdc1 coimmunoprecipitated with LRP1 from extracts of RAW 264.7 cells and mouse liver. Although Sema4D did not coimmunoprecipitate with LRP1, the cell-surface level of Sema4D was increased by RAP, which binds to LRP1 and inhibits binding of other ligands. These studies identify Plxdc1, Sema4D, and neuropilin-1 as novel LRP1-regulated cell-signaling proteins. Overall, LRP1 emerges as a generalized regulator of the plasma membrane proteome.

  5. MAS NMR of HIV-1 protein assemblies

    Science.gov (United States)

    Suiter, Christopher L.; Quinn, Caitlin M.; Lu, Manman; Hou, Guangjin; Zhang, Huilan; Polenova, Tatyana

    2015-04-01

    The negative global impact of the AIDS pandemic is well known. In this perspective article, the utility of magic angle spinning (MAS) NMR spectroscopy to answer pressing questions related to the structure and dynamics of HIV-1 protein assemblies is examined. In recent years, MAS NMR has undergone major technological developments enabling studies of large viral assemblies. We discuss some of these evolving methods and technologies and provide a perspective on the current state of MAS NMR as applied to the investigations into structure and dynamics of HIV-1 assemblies of CA capsid protein and of Gag maturation intermediates.

  6. Identification of new interacting partners of the shuttling protein ubinuclein (Ubn-1)

    Energy Technology Data Exchange (ETDEWEB)

    Lupo, Julien [Unit of Virus Host Cell Interactions (UVHCI), UMI 3265 UJF-EMBL-CNRS, 6 rue Jules Horowitz, BP 181, F-38042 Grenoble Cedex 9 (France); CHU de Grenoble, BP217, 38043 Grenoble Cedex 9 (France); Conti, Audrey [Unit of Virus Host Cell Interactions (UVHCI), UMI 3265 UJF-EMBL-CNRS, 6 rue Jules Horowitz, BP 181, F-38042 Grenoble Cedex 9 (France); Sueur, Charlotte [Unit of Virus Host Cell Interactions (UVHCI), UMI 3265 UJF-EMBL-CNRS, 6 rue Jules Horowitz, BP 181, F-38042 Grenoble Cedex 9 (France); CHU de Grenoble, BP217, 38043 Grenoble Cedex 9 (France); Coly, Pierre-Alain [Unit of Virus Host Cell Interactions (UVHCI), UMI 3265 UJF-EMBL-CNRS, 6 rue Jules Horowitz, BP 181, F-38042 Grenoble Cedex 9 (France); Coute, Yohann [CEA, IRTSV, Laboratoire Biologie a Grande Echelle, F-38054 Grenoble (France); INSERM, U1038, F-38054 Grenoble (France); Universite Joseph Fourier, Grenoble 1, F-38000 Grenoble Cedex 09 (France); Hunziker, Walter [Institute of Molecular and Cell Biology, Epithelial Cell Biology Laboratory, Singapore 1386473 (Singapore); Burmeister, Wim P. [Unit of Virus Host Cell Interactions (UVHCI), UMI 3265 UJF-EMBL-CNRS, 6 rue Jules Horowitz, BP 181, F-38042 Grenoble Cedex 9 (France); Germi, Raphaelle [Unit of Virus Host Cell Interactions (UVHCI), UMI 3265 UJF-EMBL-CNRS, 6 rue Jules Horowitz, BP 181, F-38042 Grenoble Cedex 9 (France); CHU de Grenoble, BP217, 38043 Grenoble Cedex 9 (France); Manet, Evelyne; Gruffat, Henri [INSERM U758, Unite de Virologie humaine, Lyon, 46 allee d' Italie F-69007 France (France); Ecole Normale Superieure de Lyon, F-69007 France (France); Universite Lyon1, F-69007, Lyon (France); and others

    2012-03-10

    We have previously characterized ubinuclein (Ubn-1) as a NACos (Nuclear and Adherent junction Complex components) protein which interacts with viral or cellular transcription factors and the tight junction (TJ) protein ZO-1. The purpose of the present study was to get more insights on the binding partners of Ubn-1, notably those present in the epithelial junctions. Using an in vivo assay of fluorescent protein-complementation assay (PCA), we demonstrated that the N-terminal domains of the Ubn-1 and ZO-1 proteins triggered a functional interaction inside the cell. Indeed, expression of both complementary fragments of venus fused to the N-terminal parts of Ubn-1 and ZO-1 was able to reconstitute a fluorescent venus protein. Furthermore, nuclear expression of the chimeric Ubn-1 triggered nuclear localization of the chimeric ZO-1. We could localize this interaction to the PDZ2 domain of ZO-1 using an in vitro pull-down assay. More precisely, a 184-amino acid region (from amino acids 39 to 223) at the N-terminal region of Ubn-1 was responsible for the interaction with the PDZ2 domain of ZO-1. Co-imunoprecipitation and confocal microscopy experiments also revealed the tight junction protein cingulin as a new interacting partner of Ubn-1. A proteomic approach based on mass spectrometry analysis (MS) was then undertaken to identify further binding partners of GST-Ubn-1 fusion protein in different subcellular fractions of human epithelial HT29 cells. LYRIC (Lysine-rich CEACAM1-associated protein) and RACK-1 (receptor for activated C-kinase) proteins were validated as bona fide interacting partners of Ubn-1. Altogether, these results suggest that Ubn-1 is a scaffold protein influencing protein subcellular localization and is involved in several processes such as cell-cell contact signalling or modulation of gene activity.

  7. The chaperone like function of the nonhistone protein HMGB1

    International Nuclear Information System (INIS)

    Osmanov, Taner; Ugrinova, Iva; Pasheva, Evdokia

    2013-01-01

    Highlights: ► The HMGB1 protein strongly enhanced the formation of nucleosome particles. ► The target of HMGB1 action as a chaperone is the DNA not the histone octamer. ► The acetylation of HMGB1 decreases the stimulating effect of the protein. -- Abstract: Almost all essential nuclear processes as replication, repair, transcription and recombination require the chromatin template to be correctly unwound and than repackaged. The major strategy that the cell uses to overcome the nucleosome barrier is the proper removal of the histone octamer and subsequent deposition onto DNA. Important factors in this multi step phenomenon are the histone chaperones that can assemble nucleosome arrays in vitro in the absence of ATP. The nonhistone protein HMGB1 is a good candidate for a chaperone as its molecule consists of two DNA binding motives, Box’s A and B, and a long nonstructured C tail highly negatively charged. HMGB1 protein is known as a nuclear “architectural” factor for its property to bind preferentially to distorted DNA structures and was reported to kink the double helix. Our experiments show that in the classical stepwise dialysis method for nucleosome assembly the addition of HMGB1 protein stimulates more than two times the formation of middle-positioned nucleosomes. The stimulation effect persists in dialysis free experiment when the reconstitution is possible only in the presence of a chaperone. The addition of HMGB1 protein strongly enhanced the formation of a nucleosome in a dose dependant manner. Our results show that the target of HMGB1 action as a chaperone is the DNA fragment not the histone octamer. One possible explanation for the stimulating effect of HMGB1 is the “architectural” property of the protein to associate with the middle of the DNA fragment and to kink it. The acquired V shaped DNA structure is probably conformationals more favorable to wrap around the prefolded histone octamer. We tested also the role of the post

  8. Proteomics in the investigation of HIV-1 interactions with host proteins.

    Science.gov (United States)

    Li, Ming

    2015-02-01

    Productive HIV-1 infection depends on host machinery, including a broad array of cellular proteins. Proteomics has played a significant role in the discovery of HIV-1 host proteins. In this review, after a brief survey of the HIV-1 host proteins that were discovered by proteomic analyses, I focus on analyzing the interactions between the virion and host proteins, as well as the technologies and strategies used in those proteomic studies. With the help of proteomics, the identification and characterization of HIV-1 host proteins can be translated into novel antiretroviral therapeutics. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Defining the extreme substrate specificity of Euonymus alatus diacylglycerol acetyltransferase, an unusual membrane-bound O-acyltransferase

    Science.gov (United States)

    Bansal, Sunil; Durrett, Timothy P.

    2016-01-01

    Euonymus alatus diacylglycerol acetyltransferase (EaDAcT) synthesizes the unusually structured 3-acetyl-1,2-diacylglycerols (acetyl-TAG) found in the seeds of a few plant species. A member of the membrane-bound O-acyltransferase (MBOAT) family, EaDAcT transfers the acetyl group from acetyl-CoA to sn-1,2-diacylglycerol (DAG) to produce acetyl-TAG. In vitro assays demonstrated that the enzyme is also able to utilize butyryl-CoA and hexanoyl-CoA as acyl donors, though with much less efficiency compared with acetyl-CoA. Acyl-CoAs longer than eight carbons were not used by EaDAcT. This extreme substrate specificity of EaDAcT distinguishes it from all other MBOATs which typically catalyze the transfer of much longer acyl groups. In vitro selectivity experiments revealed that EaDAcT preferentially acetylated DAG molecules containing more double bonds over those with less. However, the enzyme was also able to acetylate saturated DAG containing medium chain fatty acids, albeit with less efficiency. Interestingly, EaDAcT could only acetylate the free hydroxyl group of sn-1,2-DAG but not the available hydroxyl groups in sn-1,3-DAG or in monoacylglycerols (MAG). Consistent with its similarity to the jojoba wax synthase, EaDAcT could acetylate fatty alcohols in vitro to produce alkyl acetates. Likewise, when coexpressed in yeast with a fatty acyl-CoA reductase capable of producing fatty alcohols, EaDAcT synthesized alkyl acetates although the efficiency of production was low. This improved understanding of EaDAcT specificity confirms that the enzyme preferentially utilizes acetyl-CoA to acetylate sn-1,2-DAGs and will be helpful in engineering the production of acetyl-TAG with improved functionality in transgenic plants. PMID:27688773

  10. The F-box protein FBXO44 mediates BRCA1 ubiquitination and degradation.

    Science.gov (United States)

    Lu, Yunzhe; Li, Jiezhi; Cheng, Dongmei; Parameswaran, Balaji; Zhang, Shaohua; Jiang, Zefei; Yew, P Renee; Peng, Junmin; Ye, Qinong; Hu, Yanfen

    2012-11-30

    BRCA1 mutations account for a significant proportion of familial breast and ovarian cancers. In addition, reduced BRCA1 protein is associated with sporadic cancer cases in these tissues. At the cellular level, BRCA1 plays a critical role in multiple cellular functions such as DNA repair and cell cycle checkpoint control. Its protein level is regulated in a cell cycle-dependent manner. However, regulation of BRCA1 protein stability is not fully understood. Our earlier study showed that the amino terminus of BRCA1 harbors a degron sequence that is sufficient and necessary for conferring BRCA1 degradation. In the current study, we used mass spectrometry to identify Skp1 that regulates BRCA1 protein stability. Small interfering RNA screening that targets all human F-box proteins uncovered FBXO44 as an important protein that influences BRCA1 protein level. The Skp1-Cul1-F-box-protein44 (SCF(FBXO44)) complex ubiquitinates full-length BRCA1 in vitro. Furthermore, the N terminus of BRCA1 mediates the interaction between BRCA1 and FBXO44. Overexpression of SCF(FBXO44) reduces BRCA1 protein level. Taken together, our work strongly suggests that SCF(FBXO44) is an E3 ubiquitin ligase responsible for BRCA1 degradation. In addition, FBXO44 expression pattern in breast carcinomas suggests that SCF(FBXO44)-mediated BRCA1 degradation might contribute to sporadic breast tumor development.

  11. Diacylglycerol Kinases: Regulated Controllers of T Cell Activation, Function, and Development

    Directory of Open Access Journals (Sweden)

    Gary A. Koretzky

    2013-03-01

    Full Text Available Diacylglycerol kinases (DGKs are a diverse family of enzymes that catalyze the conversion of diacylglycerol (DAG, a crucial second messenger of receptor-mediated signaling, to phosphatidic acid (PA. Both DAG and PA are bioactive molecules that regulate a wide set of intracellular signaling proteins involved in innate and adaptive immunity. Clear evidence points to a critical role for DGKs in modulating T cell activation, function, and development. More recently, studies have elucidated factors that control DGK function, suggesting an added complexity to how DGKs act during signaling. This review summarizes the available knowledge of the function and regulation of DGK isoforms in signal transduction with a particular focus on T lymphocytes.

  12. Crystal Structure of PAV1-137: A Protein from the Virus PAV1 That Infects Pyrococcus abyssi

    Directory of Open Access Journals (Sweden)

    N. Leulliot

    2013-01-01

    Full Text Available Pyrococcus abyssi virus 1 (PAV1 was the first virus particle infecting a hyperthermophilic Euryarchaeota (Pyrococcus abyssi strain GE23 that has been isolated and characterized. It is lemon shaped and is decorated with a short fibered tail. PAV1 morphologically resembles the fusiform members of the family Fuselloviridae or the genus Salterprovirus. The 18 kb dsDNA genome of PAV1 contains 25 predicted genes, most of them of unknown function. To help assigning functions to these proteins, we have initiated structural studies of the PAV1 proteome. We determined the crystal structure of a putative protein of 137 residues (PAV1-137 at a resolution of 2.2 Å. The protein forms dimers both in solution and in the crystal. The fold of PAV1-137 is a four-α-helical bundle analogous to those found in some eukaryotic adhesion proteins such as focal adhesion kinase, suggesting that PAV1-137 is involved in protein-protein interactions.

  13. Proteomic analysis of protein phosphatase Z1 from Candida albicans.

    Directory of Open Access Journals (Sweden)

    Bernadett Márkus

    Full Text Available Protein phosphatase Z is a "novel type" fungus specific serine/threonine protein phosphatase. Previously our research group identified the CaPPZ1 gene in the opportunistic pathogen Candida albicans and reported that the gene deletion had several important physiological consequences. In order to reveal the protein targets and the associated mechanisms behind the functions of the phosphatase a proteomic method was adopted for the comparison of the cappz1 deletion mutant and the genetically matching QMY23 control strain. Proteins extracted from the control and deletion mutant strains were separated by two-dimensional gel electrophoresis and the protein spots were stained with RuBPS and Pro-Q Diamond in order to visualize the total proteome and the phosphoproteome, respectively. The alterations in spot intensities were determined by densitometry and were analysed with the Delta2D (Decodon software. Spots showing significantly different intensities between the mutant and control strains were excised from the gels and were digested with trypsin. The resulting peptides were identified by LC-MS/MS mass spectrometry. As many as 15 protein spots were found that exhibited significant changes in their intensity upon the deletion of the phosphatase and 20 phosphoproteins were identified in which the level of phosphorylation was modified significantly in the mutant. In agreement with previous findings we found that the affected proteins function in protein synthesis, oxidative stress response, regulation of morphology and metabolism. Among these proteins we identified two potential CaPpz1 substrates (Eft2 and Rpp0 that may regulate the elongation step of translation. RT-qPCR experiments revealed that the expression of the genes coding for the affected proteins was not altered significantly. Thus, the absence of CaPpz1 exerted its effects via protein synthesis/degradation and phosphorylation/dephosphorylation. In addition, our proteomics data strongly

  14. Proteomic analysis of protein phosphatase Z1 from Candida albicans

    Science.gov (United States)

    Pfliegler, Walter P.; Petrényi, Katalin; Boros, Enikő; Pócsi, István; Tőzsér, József; Dombrádi, Viktor

    2017-01-01

    Protein phosphatase Z is a “novel type” fungus specific serine/threonine protein phosphatase. Previously our research group identified the CaPPZ1 gene in the opportunistic pathogen Candida albicans and reported that the gene deletion had several important physiological consequences. In order to reveal the protein targets and the associated mechanisms behind the functions of the phosphatase a proteomic method was adopted for the comparison of the cappz1 deletion mutant and the genetically matching QMY23 control strain. Proteins extracted from the control and deletion mutant strains were separated by two-dimensional gel electrophoresis and the protein spots were stained with RuBPS and Pro-Q Diamond in order to visualize the total proteome and the phosphoproteome, respectively. The alterations in spot intensities were determined by densitometry and were analysed with the Delta2D (Decodon) software. Spots showing significantly different intensities between the mutant and control strains were excised from the gels and were digested with trypsin. The resulting peptides were identified by LC-MS/MS mass spectrometry. As many as 15 protein spots were found that exhibited significant changes in their intensity upon the deletion of the phosphatase and 20 phosphoproteins were identified in which the level of phosphorylation was modified significantly in the mutant. In agreement with previous findings we found that the affected proteins function in protein synthesis, oxidative stress response, regulation of morphology and metabolism. Among these proteins we identified two potential CaPpz1 substrates (Eft2 and Rpp0) that may regulate the elongation step of translation. RT-qPCR experiments revealed that the expression of the genes coding for the affected proteins was not altered significantly. Thus, the absence of CaPpz1 exerted its effects via protein synthesis/degradation and phosphorylation/dephosphorylation. In addition, our proteomics data strongly suggested a role for

  15. Regulation of protease-activated receptor 1 signaling by the adaptor protein complex 2 and R4 subfamily of regulator of G protein signaling proteins.

    Science.gov (United States)

    Chen, Buxin; Siderovski, David P; Neubig, Richard R; Lawson, Mark A; Trejo, Joann

    2014-01-17

    The G protein-coupled protease-activated receptor 1 (PAR1) is irreversibly proteolytically activated by thrombin. Hence, the precise regulation of PAR1 signaling is important for proper cellular responses. In addition to desensitization, internalization and lysosomal sorting of activated PAR1 are critical for the termination of signaling. Unlike most G protein-coupled receptors, PAR1 internalization is mediated by the clathrin adaptor protein complex 2 (AP-2) and epsin-1, rather than β-arrestins. However, the function of AP-2 and epsin-1 in the regulation of PAR1 signaling is not known. Here, we report that AP-2, and not epsin-1, regulates activated PAR1-stimulated phosphoinositide hydrolysis via two different mechanisms that involve, in part, a subset of R4 subfamily of "regulator of G protein signaling" (RGS) proteins. A significantly greater increase in activated PAR1 signaling was observed in cells depleted of AP-2 using siRNA or in cells expressing a PAR1 (420)AKKAA(424) mutant with defective AP-2 binding. This effect was attributed to AP-2 modulation of PAR1 surface expression and efficiency of G protein coupling. We further found that ectopic expression of R4 subfamily members RGS2, RGS3, RGS4, and RGS5 reduced activated PAR1 wild-type signaling, whereas signaling by the PAR1 AKKAA mutant was minimally affected. Intriguingly, siRNA-mediated depletion analysis revealed a function for RGS5 in the regulation of signaling by the PAR1 wild type but not the AKKAA mutant. Moreover, activation of the PAR1 wild type, and not the AKKAA mutant, induced Gαq association with RGS3 via an AP-2-dependent mechanism. Thus, AP-2 regulates activated PAR1 signaling by altering receptor surface expression and through recruitment of RGS proteins.

  16. Endoplasmic reticulum stress and N-glycosylation modulate expression of WFS1 protein

    International Nuclear Information System (INIS)

    Yamaguchi, Suguru; Ishihara, Hisamitsu; Tamura, Akira; Yamada, Takahiro; Takahashi, Rui; Takei, Daisuke; Katagiri, Hideki; Oka, Yoshitomo

    2004-01-01

    Mutations of the WFS1 gene are responsible for two hereditary diseases, Wolfram syndrome and low frequency sensorineural hearing loss. The WFS1 protein is a glycoprotein located in the endoplasmic reticulum (ER) membrane but its function is poorly understood. Herein we show WFS1 mRNA and protein levels in pancreatic islets to be increased with ER-stress inducers, thapsigargin and dithiothreitol. Another ER-stress inducer, the N-glycosylation inhibitor tunicamycin, also raised WFS1 mRNA but not protein levels. Site-directed mutagenesis showed both Asn-663 and Asn-748 to be N-glycosylated in mouse WFS1 protein. The glycosylation-defective WFS1 protein, in which Asn-663 and Asn-748 had been substituted with aspartate, exhibited an increased protein turnover rate. Consistent with this, the WFS1 protein was more rapidly degraded in the presence of tunicamycin. These data indicate that ER-stress and N-glycosylation play important roles in WFS1 expression and stability, and also suggest regulatory roles for this protein in ER-stress induced cell death

  17. Topology of transmembrane channel-like gene 1 protein.

    Science.gov (United States)

    Labay, Valentina; Weichert, Rachel M; Makishima, Tomoko; Griffith, Andrew J

    2010-10-05

    Mutations of transmembrane channel-like gene 1 (TMC1) cause hearing loss in humans and mice. TMC1 is the founding member of a family of genes encoding proteins of unknown function that are predicted to contain multiple transmembrane domains. The goal of our study was to define the topology of mouse TMC1 expressed heterologously in tissue culture cells. TMC1 was retained in the endoplasmic reticulum (ER) membrane of five tissue culture cell lines that we tested. We used anti-TMC1 and anti-HA antibodies to probe the topologic orientation of three native epitopes and seven HA epitope tags along full-length TMC1 after selective or complete permeabilization of transfected cells with digitonin or Triton X-100, respectively. TMC1 was present within the ER as an integral membrane protein containing six transmembrane domains and cytosolic N- and C-termini. There is a large cytoplasmic loop, between the fourth and fifth transmembrane domains, with two highly conserved hydrophobic regions that might associate with or penetrate, but do not span, the plasma membrane. Our study is the first to demonstrate that TMC1 is a transmembrane protein. The topologic organization revealed by this study shares some features with that of the shaker-TRP superfamily of ion channels.

  18. The 10 kDa domain of human erythrocyte protein 4.1 binds the Plasmodium falciparum EBA-181 protein

    Directory of Open Access Journals (Sweden)

    Coetzer Theresa L

    2006-11-01

    Full Text Available Abstract Background Erythrocyte invasion by Plasmodium falciparum parasites represents a key mechanism during malaria pathogenesis. Erythrocyte binding antigen-181 (EBA-181 is an important invasion protein, which mediates a unique host cell entry pathway. A novel interaction between EBA-181 and human erythrocyte membrane protein 4.1 (4.1R was recently demonstrated using phage display technology. In the current study, recombinant proteins were utilized to define and characterize the precise molecular interaction between the two proteins. Methods 4.1R structural domains (30, 16, 10 and 22 kDa domain and the 4.1R binding region in EBA-181 were synthesized in specific Escherichia coli strains as recombinant proteins and purified using magnetic bead technology. Recombinant proteins were subsequently used in blot-overlay and histidine pull-down assays to determine the binding domain in 4.1R. Results Blot overlay and histidine pull-down experiments revealed specific interaction between the 10 kDa domain of 4.1R and EBA-181. Binding was concentration dependent as well as saturable and was abolished by heat denaturation of 4.1R. Conclusion The interaction of EBA-181 with the highly conserved 10 kDa domain of 4.1R provides new insight into the molecular mechanisms utilized by P. falciparum during erythrocyte entry. The results highlight the potential multifunctional role of malaria invasion proteins, which may contribute to the success of the pathogenic stage of the parasite's life cycle.

  19. Zac1, an Sp1-like protein, regulates human p21WAF1/Cip1 gene expression in HeLa cells

    International Nuclear Information System (INIS)

    Liu, Pei-Yao; Hsieh, Tsai-Yuan; Liu, Shu-Ting; Chang, Yung-Lung; Lin, Wei-Shiang; Wang, Wei-Ming; Huang, Shih-Ming

    2011-01-01

    Zac1 functions as both a transcription factor and a transcriptional cofactor for p53, nuclear receptors (NRs) and NR coactivators. Zac1 might also act as a transcriptional repressor via the recruitment of histone deacetylase 1 (HDAC1). The ability of Zac1 to interact directly with GC-specific elements indicates that Zac1 possibly binds to Sp1-responsive elements. In the present study, our data show that Zac1 is able to interact directly with the Sp1-responsive element in the p21 WAF1/Cip1 gene promoter and enhance the transactivation activity of Sp1 through direct physical interaction. Our data further demonstrate that Zac1 might enhance Sp1-specific promoter activity by interacting with the Sp1-responsive element, affecting the transactivation activity of Sp1 via a protein–protein interaction, or competing the HDAC1 protein away from the pre-existing Sp1/HDAC1 complex. Finally, the synergistic regulation of p21 WAF1/Cip1 gene expression by Zac1 and Sp1 is mediated by endogenous p53 protein and p53-responsive elements in HeLa cells. Our work suggests that Zac1 might serve as an Sp1-like protein that directly interacts with the Sp1-responsive element to oligomerize with and/or to coactivate Sp1.

  20. Parameters affecting diacylglycerol formation during the production of specific-structured lipids by lipase-catalyzed interesterification

    DEFF Research Database (Denmark)

    Xu, Xuebing; Mu, Huiling; Skands, Anja

    1999-01-01

    Diacylglycerols (DAGs) are important intermediates in lipase-catalyzed interesterification, but a high DAG concentration in the reaction mixture results in a high DAG content in the final product. We have previously shown that a high DAG concentration in the reaction mixture increases the degree ...

  1. TORC1 regulates Pah1 phosphatidate phosphatase activity via the Nem1/Spo7 protein phosphatase complex.

    Directory of Open Access Journals (Sweden)

    Emmanuelle Dubots

    Full Text Available The evolutionarily conserved target of rapamycin complex 1 (TORC1 controls growth-related processes such as protein, nucleotide, and lipid metabolism in response to growth hormones, energy/ATP levels, and amino acids. Its deregulation is associated with cancer, type 2 diabetes, and obesity. Among other substrates, mammalian TORC1 directly phosphorylates and inhibits the phosphatidate phosphatase lipin-1, a central enzyme in lipid metabolism that provides diacylglycerol for the synthesis of membrane phospholipids and/or triacylglycerol as neutral lipid reserve. Here, we show that yeast TORC1 inhibits the function of the respective lipin, Pah1, to prevent the accumulation of triacylglycerol. Surprisingly, TORC1 regulates Pah1 in part indirectly by controlling the phosphorylation status of Nem1 within the Pah1-activating, heterodimeric Nem1-Spo7 protein phosphatase module. Our results delineate a hitherto unknown TORC1 effector branch that controls lipin function in yeast, which, given the recent discovery of Nem1-Spo7 orthologous proteins in humans, may be conserved.

  2. SH2/SH3 adaptor proteins can link tyrosine kinases to a Ste20-related protein kinase, HPK1.

    Science.gov (United States)

    Anafi, M; Kiefer, F; Gish, G D; Mbamalu, G; Iscove, N N; Pawson, T

    1997-10-31

    Ste20-related protein kinases have been implicated as regulating a range of cellular responses, including stress-activated protein kinase pathways and the control of cytoskeletal architecture. An important issue involves the identities of the upstream signals and regulators that might control the biological functions of mammalian Ste20-related protein kinases. HPK1 is a protein-serine/threonine kinase that possesses a Ste20-like kinase domain, and in transfected cells activates a protein kinase pathway leading to the stress-activated protein kinase SAPK/JNK. Here we have investigated candidate upstream regulators that might interact with HPK1. HPK1 possesses an N-terminal catalytic domain and an extended C-terminal tail with four proline-rich motifs. The SH3 domains of Grb2 bound in vitro to specific proline-rich motifs in the HPK1 tail and functioned synergistically to direct the stable binding of Grb2 to HPK1 in transfected Cos1 cells. Epidermal growth factor (EGF) stimulation did not affect the binding of Grb2 to HPK1 but induced recruitment of the Grb2.HPK1 complex to the autophosphorylated EGF receptor and to the Shc docking protein. Several activated receptor and cytoplasmic tyrosine kinases, including the EGF receptor, stimulated the tyrosine phosphorylation of the HPK1 serine/threonine kinase. These results suggest that HPK1, a mammalian Ste20-related protein-serine/threonine kinase, can potentially associate with protein-tyrosine kinases through interactions mediated by SH2/SH3 adaptors such as Grb2. Such interaction may provide a possible mechanism for cross-talk between distinct biochemical pathways following the activation of tyrosine kinases.

  3. Expression, purification, crystallization and preliminary diffraction studies of the mammalian DAG kinase homologue YegS from Escherichia coli

    International Nuclear Information System (INIS)

    Bakali H, M. Amin; Nordlund, Pär; Hallberg, B. Martin

    2006-01-01

    The overexpression, crystallization and preliminary diffraction analysis of E. coli YegS are reported. yegS is a gene encoding a 32 kDa cytosolic protein with unknown function but with strong sequence homology to a family of structurally uncharacterized eukaryotic non-protein kinases: diacylglycerol kinases, sphingosine kinases and ceramide kinases. Here, the overexpression, crystallization and preliminary diffraction analysis of Escherichia coli YegS are reported. The crystals belong to space group P2 1 , with unit-cell parameters a = 42.4, b = 166.1, c = 48.5 Å, β = 96.97°. The presence of a dimer in the asymmetric unit was estimated to give a Matthews coefficient (V M ) of 2.5 Å 3 Da −1 and a solvent content of 50.8%(v/v). Single-wavelength diffraction data were collected to a resolution of 1.9 Å using synchrotron radiation

  4. Engineering nutritious proteins: improvement of stability in the designer protein MB-1 via introduction of disulfide bridges.

    Science.gov (United States)

    Doucet, Alain; Williams, Martin; Gagnon, Mylene C; Sasseville, Maxime; Beauregard, Marc

    2002-01-02

    Protein design is currently used for the creation of new proteins with desirable traits. In this laboratory the focus has been on the synthesis of proteins with high essential amino acid content having potential applications in animal nutrition. One of the limitations faced in this endeavor is achieving stable proteins despite a highly biased amino acid content. Reported here are the synthesis and characterization of two disulfide-bridged mutants derived from the MB-1 designer protein. Both mutants outperformed their parent protein MB-1 with their bridge formed, as shown by circular dichroism, size exclusion chromatography, thermal denaturation, and proteolytic degradation experiments. When the disulfide bridges were cleaved, the mutants' behavior changed: the mutants significantly unfolded, suggesting that the introduction of Cys residues was deleterious to MB-1-folding. In an attempt to compensate for the mutations used, a Tyr62-Trp mutation was performed, leading to an increase in bulk and hydrophobicity in the core. The Trp-containing disulfide-bridged mutants did not behave as well as the original MB-1Trp, suggesting that position 62 might not be adequate for a compensatory mutation.

  5. Signal-dependent Hydrolysis of Phosphatidylinositol 4,5-Bisphosphate without Activation of Phospholipase C

    Science.gov (United States)

    Lev, Shaya; Katz, Ben; Tzarfaty, Vered; Minke, Baruch

    2012-01-01

    In Drosophila, a phospholipase C (PLC)-mediated signaling cascade, couples photo-excitation of rhodopsin to the opening of the transient receptor potential (TRP) and TRP-like (TRPL) channels. A lipid product of PLC, diacylglycerol (DAG), and its metabolites, polyunsaturated fatty acids (PUFAs) may function as second messengers of channel activation. However, how can one separate between the increase in putative second messengers, change in pH, and phosphatidylinositol 4,5-bisphosphate (PI(4,5)P2) depletion when exploring the TRPL gating mechanism? To answer this question we co-expressed the TRPL channels together with the muscarinic (M1) receptor, enabling the openings of TRPL channels via G-protein activation of PLC. To dissect PLC activation of TRPL into its molecular components, we used a powerful method that reduced plasma membrane-associated PI(4,5)P2 in HEK cells within seconds without activating PLC. Upon the addition of a dimerizing drug, PI(4,5)P2 was selectively hydrolyzed in the cell membrane without producing DAG, inositol trisphosphate, or calcium signals. We show that PI(4,5)P2 is not an inhibitor of TRPL channel activation. PI(4,5)P2 hydrolysis combined with either acidification or application of DAG analogs failed to activate the channels, whereas PUFA did activate the channels. Moreover, a reduction in PI(4,5)P2 levels or inhibition of DAG lipase during PLC activity suppressed the PLC-activated TRPL current. This suggests that PI(4,5)P2 is a crucial substrate for PLC-mediated activation of the channels, whereas PUFA may function as the channel activator. Together, this study defines a narrow range of possible mechanisms for TRPL gating. PMID:22065576

  6. Tax Protein-induced Expression of Antiapoptotic Bfl-1 Protein Contributes to Survival of Human T-cell Leukemia Virus Type 1 (HTLV-1)-infected T-cells*♦

    Science.gov (United States)

    Macaire, Héloïse; Riquet, Aurélien; Moncollin, Vincent; Biémont-Trescol, Marie-Claude; Duc Dodon, Madeleine; Hermine, Olivier; Debaud, Anne-Laure; Mahieux, Renaud; Mesnard, Jean-Michel; Pierre, Marlène; Gazzolo, Louis; Bonnefoy, Nathalie; Valentin, Hélène

    2012-01-01

    Human T lymphotropic virus type 1 (HTLV-1) is the etiologic agent of adult T-cell leukemia/lymphoma (ATLL). ATLL is a severe malignancy with no effective treatment. HTLV-1 regulatory proteins Tax and HTLV-1 basic leucine zipper factor (HBZ) play a major role in ATLL development, by interfering with cellular functions such as CD4+ T-cell survival. In this study, we observed that the expression of Bfl-1, an antiapoptotic protein of the Bcl-2 family, is restricted to HTLV-1-infected T-cell lines and to T-cells expressing both Tax and HBZ proteins. We showed that Tax-induced bfl-1 transcription through the canonical NF-κB pathway. Moreover, we demonstrated that Tax cooperated with c-Jun or JunD, but not JunB, transcription factors of the AP-1 family to stimulate bfl-1 gene activation. By contrast, HBZ inhibited c-Jun-induced bfl-1 gene activation, whereas it increased JunD-induced bfl-1 gene activation. We identified one NF-κB, targeted by RelA, c-Rel, RelB, p105/p50, and p100/p52, and two AP-1, targeted by both c-Jun and JunD, binding sites in the bfl-1 promoter of T-cells expressing both Tax and HBZ. Analyzing the potential role of antiapoptotic Bcl-2 proteins in HTLV-1-infected T-cell survival, we demonstrated that these cells are differentially sensitive to silencing of Bfl-1, Bcl-xL, and Bcl-2. Indeed, both Bfl-1 and Bcl-xL knockdowns decreased the survival of HTLV-1-infected T-cell lines, although no cell death was observed after Bcl-2 knockdown. Furthermore, we demonstrated that Bfl-1 knockdown sensitizes HTLV-1-infected T-cells to ABT-737 or etoposide treatment. Our results directly implicate Bfl-1 and Bcl-xL in HTLV-1-infected T-cell survival and suggest that both Bfl-1 and Bcl-xL represent potential therapeutic targets for ATLL treatment. PMID:22553204

  7. The L1TD1 Protein Interactome Reveals the Importance of Post-transcriptional Regulation in Human Pluripotency

    Directory of Open Access Journals (Sweden)

    Maheswara Reddy Emani

    2015-03-01

    Full Text Available The RNA-binding protein L1TD1 is one of the most specific and abundant proteins in pluripotent stem cells and is essential for the maintenance of pluripotency in human cells. Here, we identify the protein interaction network of L1TD1 in human embryonic stem cells (hESCs and provide insights into the interactome network constructed in human pluripotent cells. Our data reveal that L1TD1 has an important role in RNA splicing, translation, protein traffic, and degradation. L1TD1 interacts with multiple stem-cell-specific proteins, many of which are still uncharacterized in the context of development. Further, we show that L1TD1 is a part of the pluripotency interactome network of OCT4, SOX2, and NANOG, bridging nuclear and cytoplasmic regulation and highlighting the importance of RNA biology in pluripotency.

  8. p53 Protein interacts specifically with the meiosis-specific mammalian RecA-like protein DMC1 in meiosis.

    Science.gov (United States)

    Habu, Toshiyuki; Wakabayashi, Nobunao; Yoshida, Kayo; Yomogida, Kenntaro; Nishimune, Yoshitake; Morita, Takashi

    2004-06-01

    The tumor suppressor protein p53 is specifically expressed during meiosis in spermatocytes. Subsets of p53 knockout mice exhibit testicular giant cell degenerative syndrome, which suggests p53 may be associated with meiotic cell cycle and/or DNA metabolism. Here, we show that p53 binds to the mouse meiosis-specific RecA-like protein Mus musculus DMC1 (MmDMC1). The C-terminal domain (amino acid 234-340) of MmDMC1 binds to DNA-binding domain of p53 protein. p53 might be involved in homologous recombination and/or checkpoint function by directly binding to DMC1 protein to repress genomic instability in meiotic germ cells.

  9. The bone morphogenetic protein antagonist gremlin 1 is overexpressed in human cancers and interacts with YWHAH protein

    International Nuclear Information System (INIS)

    Namkoong, Hong; Shin, Seung Min; Kim, Hyun Kee; Ha, Seon-Ah; Cho, Goang Won; Hur, Soo Young; Kim, Tae Eung; Kim, Jin Woo

    2006-01-01

    Basic studies of oncogenesis have demonstrated that either the elevated production of particular oncogene proteins or the occurrence of qualitative abnormalities in oncogenes can contribute to neoplastic cellular transformation. The purpose of our study was to identify an unique gene that shows cancer-associated expression, and characterizes its function related to human carcinogenesis. We used the differential display (DD) RT-PCR method using normal cervical, cervical cancer, metastatic cervical tissues, and cervical cancer cell lines to identify genes overexpressed in cervical cancers and identified gremlin 1 which was overexpressed in cervical cancers. We determined expression levels of gremlin 1 using Northern blot analysis and immunohistochemical study in various types of human normal and cancer tissues. To understand the tumorigenesis pathway of identified gremlin 1 protein, we performed a yeast two-hybrid screen, GST pull down assay, and immunoprecipitation to identify gremlin 1 interacting proteins. DDRT-PCR analysis revealed that gremlin 1 was overexpressed in uterine cervical cancer. We also identified a human gremlin 1 that was overexpressed in various human tumors including carcinomas of the lung, ovary, kidney, breast, colon, pancreas, and sarcoma. PIG-2-transfected HEK 293 cells exhibited growth stimulation and increased telomerase activity. Gremlin 1 interacted with homo sapiens tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide (14-3-3 eta; YWHAH). YWHAH protein binding site for gremlin 1 was located between residues 61–80 and gremlin 1 binding site for YWHAH was found to be located between residues 1 to 67. Gremlin 1 may play an oncogenic role especially in carcinomas of the uterine cervix, lung, ovary, kidney, breast, colon, pancreas, and sarcoma. Over-expressed gremlin 1 functions by interaction with YWHAH. Therefore, Gremlin 1 and its binding protein YWHAH could be good targets for developing diagnostic and

  10. Functions of the CCCH type zinc finger protein OsGZF1 in regulation of the seed storage protein GluB-1 from rice

    NARCIS (Netherlands)

    Chen, Y.; Sun, A.; Wang, M.; Zhu, Z.; Ouwerkerk, P.B.F.

    2014-01-01

    Glutelins are the most abundant storage proteins in rice grain and can make up to 80 % of total protein content. The promoter region of GluB-1, one of the glutelin genes in rice, has been intensively used as a model to understand regulation of seed-storage protein accumulation. In this study, we

  11. Mechanism for the decrease in the FIP1L1-PDGFRalpha protein level in EoL-1 cells by histone deacetylase inhibitors.

    Science.gov (United States)

    Ishihara, Kenji; Kaneko, Motoko; Kitamura, Hajime; Takahashi, Aki; Hong, Jang Ja; Seyama, Toshio; Iida, Koji; Wada, Hiroshi; Hirasawa, Noriyasu; Ohuchi, Kazuo

    2008-01-01

    Acetylation and deacetylation of proteins occur in cells in response to various stimuli, and are reversibly catalyzed by histone acetyltransferase and histone deacetylase (HDAC), respectively. EoL-1 cells have an FIP1L1-PDGFRA fusion gene that causes transformation of eosinophilic precursor cells into leukemia cells. The HDAC inhibitors apicidin and n-butyrate suppress the proliferation of EoL-1 cells and induce differentiation into eosinophils by a decrease in the protein level of FIP1L1-PDGFRalpha without affecting the mRNA level for FIP1L1-PDGFRA. In this study, we analyzed the mechanism by which the protein level of FIP1L1-PDGFRalpha is decreased by apicidin and n-butyrate. EoL-1 cells were incubated in the presence of the HDAC inhibitors apicidin, trichostatin A or n-butyrate. The protein levels of FIP1L1-PDGFRalpha and phosphorylated eIF-2alpha were determined by Western blotting. Actinomycin D and cycloheximide were used to block RNA synthesis and protein synthesis, respectively, in the chasing experiment of the amount of FIP1L1-PDGFRalpha protein. When apicidin- and n-butyrate-treated EoL-1 cells were incubated in the presence of actinomycin D, the decrease in the protein level of FIP1L1-PDGFRalpha was significantly enhanced when compared with controls. In contrast, the protein levels were not changed by cycloheximide among these groups. Apicidin and n-butyrate induced the continuous phosphorylation of eIF-2alpha for up to 8 days. The decrease in the level of FIP1L1-PDGFRalpha protein by continuous inhibition of HDAC may be due to the decrease in the translation rate of FIP1L1-PDGFRA. Copyright 2008 S. Karger AG, Basel.

  12. Proteomic and functional analyses reveal MAPK1 regulates milk protein synthesis.

    Science.gov (United States)

    Lu, Li-Min; Li, Qing-Zhang; Huang, Jian-Guo; Gao, Xue-Jun

    2012-12-27

    L-Lysine (L-Lys) is an essential amino acid that plays fundamental roles in protein synthesis. Many nuclear phosphorylated proteins such as Stat5 and mTOR regulate milk protein synthesis. However, the details of milk protein synthesis control at the transcript and translational levels are not well known. In this current study, a two-dimensional gel electrophoresis (2-DE)/MS-based proteomic technology was used to identify phosphoproteins responsible for milk protein synthesis in dairy cow mammary epithelial cells (DCMECs). The effect of L-Lys on DCMECs was analyzed by CASY technology and reversed phase high performance liquid chromatography (RP-HPLC). The results showed that cell proliferation ability and β-casein expression were enhanced in DCMECs treated with L-Lys. By phosphoproteomics analysis, six proteins, including MAPK1, were identified up-expressed in DCMECs treated with 1.2 mM L-Lys for 24 h, and were verified by quantitative real-time PCR (qRT-PCR) and western blot. Overexpression and siRNA inhibition of MAPK1 experiments showed that MAPK1 upregulated milk protein synthesis through Stat5 and mTOR pathway. These findings that MAPK1 involves in regulation of milk synthesis shed new insights for understanding the mechanisms of milk protein synthesis.

  13. Overexpression of Grain Amaranth (Amaranthus hypochondriacus) AhERF or AhDOF Transcription Factors in Arabidopsis thaliana Increases Water Deficit- and Salt-Stress Tolerance, Respectively, via Contrasting Stress-Amelioration Mechanisms

    Science.gov (United States)

    Massange-Sánchez, Julio A.; Palmeros-Suárez, Paola A.; Espitia-Rangel, Eduardo; Rodríguez-Arévalo, Isaac; Sánchez-Segura, Lino; Martínez-Gallardo, Norma A.; Alatorre-Cobos, Fulgencio; Tiessen, Axel; Délano-Frier, John P.

    2016-01-01

    Two grain amaranth transcription factor (TF) genes were overexpressed in Arabidopsis plants. The first, coding for a group VII ethylene response factor TF (i.e., AhERF-VII) conferred tolerance to water-deficit stress (WS) in transgenic Arabidopsis without affecting vegetative or reproductive growth. A significantly lower water-loss rate in detached leaves coupled to a reduced stomatal opening in leaves of plants subjected to WS was associated with this trait. WS tolerance was also associated with an increased antioxidant enzyme activity and the accumulation of putative stress-related secondary metabolites. However, microarray and GO data did not indicate an obvious correlation between WS tolerance, stomatal closure, and abscisic acid (ABA)-related signaling. This scenario suggested that stomatal closure during WS in these plants involved ABA-independent mechanisms, possibly involving reactive oxygen species (ROS). WS tolerance may have also involved other protective processes, such as those employed for methyl glyoxal detoxification. The second, coding for a class A and cluster I DNA binding with one finger TF (i.e., AhDof-AI) provided salt-stress (SS) tolerance with no evident fitness penalties. The lack of an obvious development-related phenotype contrasted with microarray and GO data showing an enrichment of categories and genes related to developmental processes, particularly flowering. SS tolerance also correlated with increased superoxide dismutase activity but not with augmented stomatal closure. Additionally, microarray and GO data indicated that, contrary to AhERF-VII, SS tolerance conferred by AhDof-AI in Arabidopsis involved ABA-dependent and ABA-independent stress amelioration mechanisms. PMID:27749893

  14. Overexpression of Grain Amaranth (Amaranthus hypochondriacus AhERF or AhDOF Transcription Factors in Arabidopsis thaliana Increases Water Deficit- and Salt-Stress Tolerance, Respectively, via Contrasting Stress-Amelioration Mechanisms.

    Directory of Open Access Journals (Sweden)

    Julio A Massange-Sánchez

    Full Text Available Two grain amaranth transcription factor (TF genes were overexpressed in Arabidopsis plants. The first, coding for a group VII ethylene response factor TF (i.e., AhERF-VII conferred tolerance to water-deficit stress (WS in transgenic Arabidopsis without affecting vegetative or reproductive growth. A significantly lower water-loss rate in detached leaves coupled to a reduced stomatal opening in leaves of plants subjected to WS was associated with this trait. WS tolerance was also associated with an increased antioxidant enzyme activity and the accumulation of putative stress-related secondary metabolites. However, microarray and GO data did not indicate an obvious correlation between WS tolerance, stomatal closure, and abscisic acid (ABA-related signaling. This scenario suggested that stomatal closure during WS in these plants involved ABA-independent mechanisms, possibly involving reactive oxygen species (ROS. WS tolerance may have also involved other protective processes, such as those employed for methyl glyoxal detoxification. The second, coding for a class A and cluster I DNA binding with one finger TF (i.e., AhDof-AI provided salt-stress (SS tolerance with no evident fitness penalties. The lack of an obvious development-related phenotype contrasted with microarray and GO data showing an enrichment of categories and genes related to developmental processes, particularly flowering. SS tolerance also correlated with increased superoxide dismutase activity but not with augmented stomatal closure. Additionally, microarray and GO data indicated that, contrary to AhERF-VII, SS tolerance conferred by AhDof-AI in Arabidopsis involved ABA-dependent and ABA-independent stress amelioration mechanisms.

  15. Dietary protein-induced hepatic IGF-1 secretion mediated by PPARγ activation.

    Science.gov (United States)

    Wan, Xiaojuan; Wang, Songbo; Xu, Jingren; Zhuang, Lu; Xing, Kongping; Zhang, Mengyuan; Zhu, Xiaotong; Wang, Lina; Gao, Ping; Xi, Qianyun; Sun, Jiajie; Zhang, Yongliang; Li, Tiejun; Shu, Gang; Jiang, Qingyan

    2017-01-01

    Dietary protein or amino acid (AA) is a crucial nutritional factor to regulate hepatic insulin-like growth factor-1 (IGF-1) expression and secretion. However, the underlying intracellular mechanism by which dietary protein or AA induces IGF-1 expression remains unknown. We compared the IGF-1 gene expression and plasma IGF-1 level of pigs fed with normal crude protein (CP, 20%) and low-protein levels (LP, 14%). RNA sequencing (RNA-seq) was performed to detect transcript expression in the liver in response to dietary protein. The results showed that serum concentrations and mRNA levels of IGF-1 in the liver were higher in the CP group than in the LP group. RNA-seq analysis identified a total of 1319 differentially expressed transcripts (667 upregulated and 652 downregulated), among which the terms "oxidative phosphorylation", "ribosome", "gap junction", "PPAR signaling pathway", and "focal adhesion" were enriched. In addition, the porcine primary hepatocyte and HepG2 cell models also demonstrated that the mRNA and protein levels of IGF-1 and PPARγ increased with the increasing AA concentration in the culture. The PPARγ activator troglitazone increased IGF-1 gene expression and secretion in a dose dependent manner. Furthermore, inhibition of PPARγ effectively reversed the effects of the high AA concentration on the mRNA expression of IGF-1 and IGFBP-1 in HepG2 cells. Moreover, the protein levels of IGF-1 and PPARγ, as well as the phosphorylation of mTOR, significantly increased in HepG2 cells under high AA concentrations. mTOR phosphorylation can be decreased by the mTOR antagonist, rapamycin. The immunoprecipitation results also showed that high AA concentrations significantly increased the interaction of mTOR and PPARγ. In summary, PPARγ plays an important role in the regulation of IGF-1 secretion and gene expression in response to dietary protein.

  16. Cdk1-cyclin B1-mediated phosphorylation of tumor-associated microtubule-associated protein/cytoskeleton-associated protein 2 in mitosis.

    Science.gov (United States)

    Hong, Kyung Uk; Kim, Hyun-Jun; Kim, Hyo-Sil; Seong, Yeon-Sun; Hong, Kyeong-Man; Bae, Chang-Dae; Park, Joobae

    2009-06-12

    During mitosis, establishment of structurally and functionally sound bipolar spindles is necessary for maintaining the fidelity of chromosome segregation. Tumor-associated microtubule-associated protein (TMAP), also known as cytoskeleton-associated protein 2 (CKAP2), is a mitotic spindle-associated protein whose level is frequently up-regulated in various malignancies. Previous reports have suggested that TMAP is a potential regulator of mitotic spindle assembly and dynamics and that it is required for chromosome segregation to occur properly. So far, there have been no reports on how its mitosis-related functions are regulated. Here, we report that TMAP is hyper-phosphorylated at the C terminus specifically during mitosis. At least four different residues (Thr-578, Thr-596, Thr-622, and Ser-627) were responsible for the mitosis-specific phosphorylation of TMAP. Among these, Thr-622 was specifically phosphorylated by Cdk1-cyclin B1 both in vitro and in vivo. Interestingly, compared with the wild type, a phosphorylation-deficient mutant form of TMAP, in which Thr-622 had been replaced with an alanine (T622A), induced a significant increase in the frequency of metaphase cells with abnormal bipolar spindles, which often displayed disorganized, asymmetrical, or narrow and elongated morphologies. Formation of these abnormal bipolar spindles subsequently resulted in misalignment of metaphase chromosomes and ultimately caused a delay in the entry into anaphase. Moreover, such defects resulting from the T622A mutation were associated with a decrease in the rate of protein turnover at spindle microtubules. These findings suggest that Cdk1-cyclin B1-mediated phosphorylation of TMAP is important for and contributes to proper regulation of microtubule dynamics and establishment of functional bipolar spindles during mitosis.

  17. Cdk1-Cyclin B1-mediated Phosphorylation of Tumor-associated Microtubule-associated Protein/Cytoskeleton-associated Protein 2 in Mitosis*

    Science.gov (United States)

    Uk Hong, Kyung; Kim, Hyun-Jun; Kim, Hyo-Sil; Seong, Yeon-Sun; Hong, Kyeong-Man; Bae, Chang-Dae; Park, Joobae

    2009-01-01

    During mitosis, establishment of structurally and functionally sound bipolar spindles is necessary for maintaining the fidelity of chromosome segregation. Tumor-associated microtubule-associated protein (TMAP), also known as cytoskeleton-associated protein 2 (CKAP2), is a mitotic spindle-associated protein whose level is frequently up-regulated in various malignancies. Previous reports have suggested that TMAP is a potential regulator of mitotic spindle assembly and dynamics and that it is required for chromosome segregation to occur properly. So far, there have been no reports on how its mitosis-related functions are regulated. Here, we report that TMAP is hyper-phosphorylated at the C terminus specifically during mitosis. At least four different residues (Thr-578, Thr-596, Thr-622, and Ser-627) were responsible for the mitosis-specific phosphorylation of TMAP. Among these, Thr-622 was specifically phosphorylated by Cdk1-cyclin B1 both in vitro and in vivo. Interestingly, compared with the wild type, a phosphorylation-deficient mutant form of TMAP, in which Thr-622 had been replaced with an alanine (T622A), induced a significant increase in the frequency of metaphase cells with abnormal bipolar spindles, which often displayed disorganized, asymmetrical, or narrow and elongated morphologies. Formation of these abnormal bipolar spindles subsequently resulted in misalignment of metaphase chromosomes and ultimately caused a delay in the entry into anaphase. Moreover, such defects resulting from the T622A mutation were associated with a decrease in the rate of protein turnover at spindle microtubules. These findings suggest that Cdk1-cyclin B1-mediated phosphorylation of TMAP is important for and contributes to proper regulation of microtubule dynamics and establishment of functional bipolar spindles during mitosis. PMID:19369249

  18. Interplay between human high mobility group protein 1 and replication protein A on psoralen-cross-linked DNA

    DEFF Research Database (Denmark)

    Reddy, Madhava C; Christensen, Jesper; Vasquez, Karen M

    2005-01-01

    -DNA interstrand cross-link (ICL) to a specific site to determine the effect of HMGB proteins on recognition of these lesions. Our results reveal that human HMGB1 (but not HMGB2) binds with high affinity and specificity to psoralen ICLs, and interacts with the essential NER protein, replication protein A (RPA......), at these lesions. RPA, shown previously to bind tightly to these lesions, also binds in the presence of HMGB1, without displacing HMGB1. A discrete ternary complex is formed, containing HMGB1, RPA, and psoralen-damaged DNA. Thus, HMGB1 has the ability to recognize ICLs, can cooperate with RPA in doing so...

  19. A computational model of the LGI1 protein suggests a common binding site for ADAM proteins.

    Directory of Open Access Journals (Sweden)

    Emanuela Leonardi

    Full Text Available Mutations of human leucine-rich glioma inactivated (LGI1 gene encoding the epitempin protein cause autosomal dominant temporal lateral epilepsy (ADTLE, a rare familial partial epileptic syndrome. The LGI1 gene seems to have a role on the transmission of neuronal messages but the exact molecular mechanism remains unclear. In contrast to other genes involved in epileptic disorders, epitempin shows no homology with known ion channel genes but contains two domains, composed of repeated structural units, known to mediate protein-protein interactions.A three dimensional in silico model of the two epitempin domains was built to predict the structure-function relationship and propose a functional model integrating previous experimental findings. Conserved and electrostatic charged regions of the model surface suggest a possible arrangement between the two domains and identifies a possible ADAM protein binding site in the β-propeller domain and another protein binding site in the leucine-rich repeat domain. The functional model indicates that epitempin could mediate the interaction between proteins localized to different synaptic sides in a static way, by forming a dimer, or in a dynamic way, by binding proteins at different times.The model was also used to predict effects of known disease-causing missense mutations. Most of the variants are predicted to alter protein folding while several other map to functional surface regions. In agreement with experimental evidence, this suggests that non-secreted LGI1 mutants could be retained within the cell by quality control mechanisms or by altering interactions required for the secretion process.

  20. Purification, crystallization and X-ray diffraction analysis of human dynamin-related protein 1 GTPase-GED fusion protein

    International Nuclear Information System (INIS)

    Klinglmayr, Eva; Wenger, Julia; Mayr, Sandra; Bossy-Wetzel, Ella; Puehringer, Sandra

    2012-01-01

    The crystallization and initial diffraction analysis of human Drp1 GTPase-GED fusion protein are reported. The mechano-enzyme dynamin-related protein 1 plays an important role in mitochondrial fission and is implicated in cell physiology. Dysregulation of Drp1 is associated with abnormal mitochondrial dynamics and neuronal damage. Drp1 shares structural and functional similarities with dynamin 1 with respect to domain organization, ability to self-assemble into spiral-like oligomers and GTP-cycle-dependent membrane scission. Structural studies of human dynamin-1 have greatly improved the understanding of this prototypical member of the dynamin superfamily. However, high-resolution structural information for full-length human Drp1 covering the GTPase domain, the middle domain and the GTPase effector domain (GED) is still lacking. In order to obtain mechanistic insights into the catalytic activity, a nucleotide-free GTPase-GED fusion protein of human Drp1 was expressed, purified and crystallized. Initial X-ray diffraction experiments yielded data to 2.67 Å resolution. The hexagonal-shaped crystals belonged to space group P2 1 2 1 2, with unit-cell parameters a = 53.59, b = 151.65, c = 43.53 Å, one molecule per asymmetric unit and a solvent content of 42%. Expression of selenomethionine-labelled protein is currently in progress. Here, the expression, purification, crystallization and X-ray diffraction analysis of the Drp1 GTPase-GED fusion protein are presented, which form a basis for more detailed structural and biophysical analysis

  1. Evidence for the interaction of the regulatory protein Ki-1/57 with p53 and its interacting proteins

    International Nuclear Information System (INIS)

    Nery, Flavia C.; Rui, Edmilson; Kuniyoshi, Tais M.; Kobarg, Joerg

    2006-01-01

    Ki-1/57 is a cytoplasmic and nuclear phospho-protein of 57 kDa and interacts with the adaptor protein RACK1, the transcription factor MEF2C, and the chromatin remodeling factor CHD3, suggesting that it might be involved in the regulation of transcription. Here, we describe yeast two-hybrid studies that identified a total of 11 proteins interacting with Ki-1/57, all of which interact or are functionally associated with p53 or other members of the p53 family of proteins. We further found that Ki-1/57 is able to interact with p53 itself in the yeast two-hybrid system when the interaction was tested directly. This interaction could be confirmed by pull down assays with purified proteins in vitro and by reciprocal co-immunoprecipitation assays from the human Hodgkin analogous lymphoma cell line L540. Furthermore, we found that the phosphorylation of p53 by PKC abolishes its interaction with Ki-1/57 in vitro

  2. Proteomic analysis of membrane microdomain-associated proteins in the dorsolateral prefrontal cortex in schizophrenia and bipolar disorder reveals alterations in LAMP, STXBP1 and BASP1 protein expression.

    LENUS (Irish Health Repository)

    Behan, A T

    2009-06-01

    The dorsolateral prefrontal cortex (dlpfc) is strongly implicated in the pathogenesis of schizophrenia (SCZ) and bipolar disorder (BPD) and, within this region, abnormalities in glutamatergic neurotransmission and synaptic function have been described. Proteins associated with these functions are enriched in membrane microdomains (MM). In the current study, we used two complementary proteomic methods, two-dimensional difference gel electrophoresis and one-dimensional sodium dodecyl sulphate polyacrylamide gel electrophoresis followed by reverse phase-liquid chromatography-tandem mass spectrometry (RP-LC-MS\\/MS) (gel separation liquid chromatography-tandem mass spectrometry (GeLC-MS\\/MS)) to assess protein expression in MM in pooled samples of dlpfc from SCZ, BPD and control cases (n=10 per group) from the Stanley Foundation Brain series. We identified 16 proteins altered in one\\/both disorders using proteomic methods. We selected three proteins with roles in synaptic function (syntaxin-binding protein 1 (STXBP1), brain abundant membrane-attached signal protein 1 (BASP1) and limbic system-associated membrane protein (LAMP)) for validation by western blotting. This revealed significantly increased expression of these proteins in SCZ (STXBP1 (24% difference; P<0.001), BASP1 (40% difference; P<0.05) and LAMP (22% difference; P<0.01)) and BPD (STXBP1 (31% difference; P<0.001), BASP1 (23% difference; P<0.01) and LAMP (20% difference; P<0.01)) in the Stanley brain series (n=20 per group). Further validation in dlpfc from the Harvard brain subseries (n=10 per group) confirmed increased protein expression in SCZ of STXBP1 (18% difference; P<0.0001), BASP1 (14% difference; P<0.0001) but not LAMP (20% difference; P=0.14). No significant differences in STXBP1, BASP1 or LAMP protein expression in BPD dlpfc were observed. This study, through proteomic assessments of MM in dlpfc and validation in two brain series, strongly implicates LAMP, STXBP1 and BASP1 in SCZ and supports

  3. RACK1 downregulates levels of the pro-apoptotic protein Fem1b in apoptosis-resistant colon cancer cells.

    Science.gov (United States)

    Subauste, M Cecilia; Ventura-Holman, Tereza; Du, Liqin; Subauste, Jose S; Chan, Shing-Leng; Yu, Victor C; Maher, Joseph F

    2009-12-01

    Evasion of apoptosis plays an important role in colon cancer progression. Following loss of the Apc tumor suppressor gene in mice, the gene encoding Fem1b is upregulated early in neoplastic intestinal epithelium. Fem1b is a pro-apoptotic protein that interacts with Fas, TNFR1 and Apaf-1, and increased expression of Fem1b induces apoptosis of cancer cells. Fem1b is a homolog of FEM-1, a protein in Caenorhabditis elegans that is negatively regulated by ubiquitination and proteasomal degradation. To study Fem1b regulation in colon cancer progression, we used apoptotis-sensitive SW480 cells, derived from a primary colon cancer, and their isogenic, apoptosis-resistant counterparts SW620 cells, derived from a subsequent metastatic lesion in the same patient. Treatment with proteasome inhibitor increased Fem1b protein levels in SW620 cells, but not in SW480 cells. In SW620 cells we found that endogenous Fem1b co-immunoprecipitates in complexes with RACK1, a protein known to mediate ubiquitination and proteasomal degradation of other pro-apoptotic proteins and to be upregulated in colon cancer. Full-length Fem1b, or the N-terminal region of Fem1b, associated with RACK1 when co-expressed in HEK293T cells, and RACK1 stimulated ubiquitination of Fem1b. RACK1 overexpression in SW620 cells led to downregulation of Fem1b protein levels. Conversely, downregulation of RACK1 led to upregulation of Fem1b protein levels, associated with induction of apoptosis, and this apoptosis was inhibited by blocking Fem1b protein upregulation. In conclusion, RACK1 downregulates levels of the pro-apoptotic protein Fem1b in metastatic, apoptosis-resistant colon cancer cells, which may promote apoptosis-resistance during progression of colon cancer.

  4. LncRNA NEAT1 promotes autophagy in MPTP-induced Parkinson's disease through stabilizing PINK1 protein.

    Science.gov (United States)

    Yan, Wang; Chen, Zhao-Ying; Chen, Jia-Qi; Chen, Hui-Min

    2018-02-19

    Long non-coding RNA nuclear paraspeckle assembly transcript 1 (lncRNA NEAT1) was found to be closely related to the pathological changes in brain and nervous system. However, the role of NEAT1 and its potential mechanism in Parkinson's disease (PD) largely remain uncharacterized. In this study, PD mouse model was established by intraperitoneal injection of MPTP. The numbers of TH + neurons, NEAT1 expression and the level of PINK1, LC3-II, LC3-I protein were assessed in PD mice. SH-SY5Y cells were treated with MPP + as PD cell model. RNA pull-down assay was used to identify the interaction between NEAT1 and PINK1 in vitro. The endogenous expression of NEAT1 was modified by lentiviral vector carrying interference sequence for NEAT1 in vivo. The numbers of TH + neurons significantly decreased in PD mice compared with the control. The expressions of NEAT1, PINK1 protein and LC3-II/LC3-I level were increased by MPTP in vitro and in vivo. Moreover, NEAT1 positively regulated the protein level of PINK1 through inhibition of PINK1 protein degradation. And NEAT1 mediated the effects of MPP + on SH-SY5Y cells through stabilization of PINK1 protein. The results of in vivo experiments revealed that NEAT1 knockdown could effectively suppress MPTP-induced autophagy in vivo that alleviated dopaminergic neuronal injury. LncRNA NEAT1 promoted the MPTP-induced autophagy in PD through stabilization of PINK1 protein. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Mutations in POGLUT1, Encoding Protein O-Glucosyltransferase 1, Cause Autosomal-Dominant Dowling-Degos Disease

    Science.gov (United States)

    Basmanav, F. Buket; Oprisoreanu, Ana-Maria; Pasternack, Sandra M.; Thiele, Holger; Fritz, Günter; Wenzel, Jörg; Größer, Leopold; Wehner, Maria; Wolf, Sabrina; Fagerberg, Christina; Bygum, Anette; Altmüller, Janine; Rütten, Arno; Parmentier, Laurent; El Shabrawi-Caelen, Laila; Hafner, Christian; Nürnberg, Peter; Kruse, Roland; Schoch, Susanne; Hanneken, Sandra; Betz, Regina C.

    2014-01-01

    Dowling-Degos disease (DDD) is an autosomal-dominant genodermatosis characterized by progressive and disfiguring reticulate hyperpigmentation. We previously identified loss-of-function mutations in KRT5 but were only able to detect pathogenic mutations in fewer than half of our subjects. To identify additional causes of DDD, we performed exome sequencing in five unrelated affected individuals without mutations in KRT5. Data analysis identified three heterozygous mutations from these individuals, all within the same gene. These mutations, namely c.11G>A (p.Trp4∗), c.652C>T (p.Arg218∗), and c.798-2A>C, are within POGLUT1, which encodes protein O-glucosyltransferase 1. Further screening of unexplained cases for POGLUT1 identified six additional mutations, as well as two of the above described mutations. Immunohistochemistry of skin biopsies of affected individuals with POGLUT1 mutations showed significantly weaker POGLUT1 staining in comparison to healthy controls with strong localization of POGLUT1 in the upper parts of the epidermis. Immunoblot analysis revealed that translation of either wild-type (WT) POGLUT1 or of the protein carrying the p.Arg279Trp substitution led to the expected size of about 50 kDa, whereas the c.652C>T (p.Arg218∗) mutation led to translation of a truncated protein of about 30 kDa. Immunofluorescence analysis identified a colocalization of the WT protein with the endoplasmic reticulum and a notable aggregating pattern for the truncated protein. Recently, mutations in POFUT1, which encodes protein O-fucosyltransferase 1, were also reported to be responsible for DDD. Interestingly, both POGLUT1 and POFUT1 are essential regulators of Notch activity. Our results furthermore emphasize the important role of the Notch pathway in pigmentation and keratinocyte morphology. PMID:24387993

  6. Gardenia jasminoides Encodes an Inhibitor-2 Protein for Protein Phosphatase Type 1

    Science.gov (United States)

    Gao, Lan; Li, Hao-Ming

    2017-08-01

    Protein phosphatase-1 (PP1) regulates diverse, essential cellular processes such as cell cycle progression, protein synthesis, muscle contraction, carbohydrate metabolism, transcription and neuronal signaling. Inhibitor-2 (I-2) can inhibit the activity of PP1 and has been found in diverse organisms. In this work, a Gardenia jasminoides fruit cDNA library was constructed, and the GjI-2 cDNA was isolated from the cDNA library by sequencing method. The GjI-2 cDNA contains a predicted 543 bp open reading frame that encodes 180 amino acids. The bioinformatics analysis suggested that the GjI-2 has conserved PP1c binding motif, and contains a conserved phosphorylation site, which is important in regulation of its activity. The three-dimensional model structure of GjI-2 was buite, its similar with the structure of I-2 from mouse. The results suggest that GjI-2 has relatively conserved RVxF, FxxR/KxR/K and HYNE motif, and these motifs are involved in interaction with PP1.

  7. Diagnose nutricional de cafeeiros da região do Alto Jequitinhonha (MG: normas dris e faixas críticas de nutrientes Nutritional diagnosis of coffee plantations in the Upper Jequitinhonha Valley, Minas Gerais State, Brazil: dris norms and critical nutrient ranges

    Directory of Open Access Journals (Sweden)

    Múcio Mágno de Melo Farnezi

    2009-08-01

    Full Text Available As normas do Sistema Integrado de Diagnose e Recomendação (DRIS ainda não foram estabelecidas para a cultura do café do Alto Jequitinhonha, MG, o que impede que o DRIS seja aplicado nos cafeeiros da região. A diagnose foliar, mediante o uso do DRIS e de faixas críticas de referência, destaca-se entre as ferramentas potenciais que permitem usar eficientemente os fertilizantes. Desse modo, este trabalho objetiva estabelecer as normas DRIS, bem como estimar os valores das faixas críticas dos nutrientes de referência para a diagnose nutricional de cafeeiros da região do Alto Jequitinhonha, por meio do DRIS. Determinaram-se os teores foliares de N, P, K, Ca, Mg, S, B, Cu, Fe, Mn e Zn em 52 lavouras cafeeiras, em duas safras (2005 e 2006. Foram selecionadas, para estabelecer as normas DRIS, 23 lavouras em cada safra com produtividade maior e igual a 30 sacas de grãos de café por hectare. As faixas críticas obtidas do DRIS, determinando-se a frequência com que o teor de cada nutriente das lavouras nas duas safras foi deficiente, adequado ou excessivo em relação aos padrões mencionados e teores considerados adequados pela literatura. As normas DRIS foram estabelecidas para cafeeiros da região do Alto Jequitinhonha e utilizadas para propor faixas críticas adequadas. Para isso, foram estabelecidos os valores para N (2,25-2,79 dag kg-1, P (0,18-0,22 dag kg-1, K (1,72-2,10 dag kg-1, Ca (1,26-1,51 dag kg-1, Mg (0,29-0,35 dag kg-1, S (0,13-0,32 dag kg-1, B (83,8-96,3 mg kg-1, Cu (5,7-9,3 mg kg-1, Fe (67,5-116,2 mg kg-1, Mn (219-422 mg kg-1 e Zn (17,4-30,0 mg kg-1, e faixas críticas adequadas para diagnose nutricional de cafeeiros da região do Alto Jequitinhonha, no Estado de Minas Gerais. Os cafezais da região em desequilíbrio apresentaram deficiência em P, K, S, B, Cu, Mn e Zn e excesso de Ca, Mg e Fe.In the Diagnosis and Recommendation Integrated System (DRIS, norms for coffee in the Upper Jequitinhonha Valley, Minas Gerais, Brazil

  8. Regulator of G protein signaling 2 (RGS2 and RGS4 form distinct G protein-dependent complexes with protease activated-receptor 1 (PAR1 in live cells.

    Directory of Open Access Journals (Sweden)

    Sungho Ghil

    Full Text Available Protease-activated receptor 1 (PAR1 is a G-protein coupled receptor (GPCR that is activated by natural proteases to regulate many physiological actions. We previously reported that PAR1 couples to Gi, Gq and G12 to activate linked signaling pathways. Regulators of G protein signaling (RGS proteins serve as GTPase activating proteins to inhibit GPCR/G protein signaling. Some RGS proteins interact directly with certain GPCRs to modulate their signals, though cellular mechanisms dictating selective RGS/GPCR coupling are poorly understood. Here, using bioluminescence resonance energy transfer (BRET, we tested whether RGS2 and RGS4 bind to PAR1 in live COS-7 cells to regulate PAR1/Gα-mediated signaling. We report that PAR1 selectively interacts with either RGS2 or RGS4 in a G protein-dependent manner. Very little BRET activity is observed between PAR1-Venus (PAR1-Ven and either RGS2-Luciferase (RGS2-Luc or RGS4-Luc in the absence of Gα. However, in the presence of specific Gα subunits, BRET activity was markedly enhanced between PAR1-RGS2 by Gαq/11, and PAR1-RGS4 by Gαo, but not by other Gα subunits. Gαq/11-YFP/RGS2-Luc BRET activity is promoted by PAR1 and is markedly enhanced by agonist (TFLLR stimulation. However, PAR1-Ven/RGS-Luc BRET activity was blocked by a PAR1 mutant (R205A that eliminates PAR1-Gq/11 coupling. The purified intracellular third loop of PAR1 binds directly to purified His-RGS2 or His-RGS4. In cells, RGS2 and RGS4 inhibited PAR1/Gα-mediated calcium and MAPK/ERK signaling, respectively, but not RhoA signaling. Our findings indicate that RGS2 and RGS4 interact directly with PAR1 in Gα-dependent manner to modulate PAR1/Gα-mediated signaling, and highlight a cellular mechanism for selective GPCR/G protein/RGS coupling.

  9. The expression of selenium-binding protein 1 is decreased in uterine leiomyoma

    Directory of Open Access Journals (Sweden)

    Quddus M Ruhul

    2010-12-01

    Full Text Available Abstract Background Selenium has been shown to inhibit cancer development and growth through the mediation of selenium-binding proteins. Decreased expression of selenium-binding protein 1 has been reported in cancers of the prostate, stomach, colon, and lungs. No information, however, is available concerning the roles of selenium-binding protein 1 in uterine leiomyoma. Methods Using Western Blot analysis and immunohistochemistry, we examined the expression of selenium-binding protein 1 in uterine leiomyoma and normal myometrium in 20 patients who had undergone hysterectomy for uterine leiomyoma. Results and Discussion The patient age ranged from 34 to 58 years with a mean of 44.3 years. Proliferative endometrium was seen in 8 patients, secretory endometrium in 7 patients, and atrophic endometrium in 5 patients. Two patients showed solitary leiomyoma, and eighteen patients revealed 2 to 5 tumors. Tumor size ranged from 1 to 15.5 cm with a mean of 4.3 cm. Both Western Blot analysis and immunohistochemistry showed a significant lower level of selenium-binding protein 1 in leiomyoma than in normal myometrium. Larger tumors had a tendency to show a lower level of selenium-binding protein 1 than smaller ones, but the difference did not reach a statistical significance. The expression of selenium-binding protein 1 was the same among patients with proliferative, secretory, and atrophic endometrium in either leiomyoma or normal myometrium. Also, we did not find a difference of selenium-binding protein 1 level between patients younger than 45 years and older patients in either leiomyoma or normal myometrium. Conclusions Decreased expression of selenium-binding protein 1 in uterine leiomyoma may indicate a role of the protein in tumorigenesis. Our findings may provide a basis for future studies concerning the molecular mechanisms of selenium-binding protein 1 in tumorigenesis as well as the possible use of selenium in prevention and treatment of uterine

  10. Functional Evolution of Influenza Virus NS1 Protein in Currently Circulating Human 2009 Pandemic H1N1 Viruses.

    Science.gov (United States)

    Clark, Amelia M; Nogales, Aitor; Martinez-Sobrido, Luis; Topham, David J; DeDiego, Marta L

    2017-09-01

    In 2009, a novel H1N1 influenza virus emerged in humans, causing a global pandemic. It was previously shown that the NS1 protein from this human 2009 pandemic H1N1 (pH1N1) virus was an effective interferon (IFN) antagonist but could not inhibit general host gene expression, unlike other NS1 proteins from seasonal human H1N1 and H3N2 viruses. Here we show that the NS1 protein from currently circulating pH1N1 viruses has evolved to encode 6 amino acid changes (E55K, L90I, I123V, E125D, K131E, and N205S) with respect to the original protein. Notably, these 6 residue changes restore the ability of pH1N1 NS1 to inhibit general host gene expression, mainly by their ability to restore binding to the cellular factor CPSF30. This is the first report describing the ability of the pH1N1 NS1 protein to naturally acquire mutations that restore this function. Importantly, a recombinant pH1N1 virus containing these 6 amino acid changes in the NS1 protein (pH1N1/NSs-6mut) inhibited host IFN and proinflammatory responses to a greater extent than that with the parental virus (pH1N1/NS1-wt), yet virus titers were not significantly increased in cell cultures or in mouse lungs, and the disease was partially attenuated. The pH1N1/NSs-6mut virus grew similarly to pH1N1/NSs-wt in mouse lungs, but infection with pH1N1/NSs-6mut induced lower levels of proinflammatory cytokines, likely due to a general inhibition of gene expression mediated by the mutated NS1 protein. This lower level of inflammation induced by the pH1N1/NSs-6mut virus likely accounts for the attenuated disease phenotype and may represent a host-virus adaptation affecting influenza virus pathogenesis. IMPORTANCE Seasonal influenza A viruses (IAVs) are among the most common causes of respiratory infections in humans. In addition, occasional pandemics are caused when IAVs circulating in other species emerge in the human population. In 2009, a swine-origin H1N1 IAV (pH1N1) was transmitted to humans, infecting people then and up

  11. Design of a 4-DOF MR haptic master for application to robot surgery: virtual environment work

    Science.gov (United States)

    Oh, Jong-Seok; Choi, Seung-Hyun; Choi, Seung-Bok

    2014-09-01

    This paper presents the design and control performance of a novel type of 4-degrees-of-freedom (4-DOF) haptic master in cyberspace for a robot-assisted minimally invasive surgery (RMIS) application. By using a controllable magnetorheological (MR) fluid, the proposed haptic master can have a feedback function for a surgical robot. Due to the difficulty in utilizing real human organs in the experiment, the cyberspace that features the virtual object is constructed to evaluate the performance of the haptic master. In order to realize the cyberspace, a volumetric deformable object is represented by a shape-retaining chain-linked (S-chain) model, which is a fast volumetric model and is suitable for real-time applications. In the haptic architecture for an RMIS application, the desired torque and position induced from the virtual object of the cyberspace and the haptic master of real space are transferred to each other. In order to validate the superiority of the proposed master and volumetric model, a tracking control experiment is implemented with a nonhomogenous volumetric cubic object to demonstrate that the proposed model can be utilized in real-time haptic rendering architecture. A proportional-integral-derivative (PID) controller is then designed and empirically implemented to accomplish the desired torque trajectories. It has been verified from the experiment that tracking the control performance for torque trajectories from a virtual slave can be successfully achieved.

  12. Design of a 4-DOF MR haptic master for application to robot surgery: virtual environment work

    International Nuclear Information System (INIS)

    Oh, Jong-Seok; Choi, Seung-Hyun; Choi, Seung-Bok

    2014-01-01

    This paper presents the design and control performance of a novel type of 4-degrees-of-freedom (4-DOF) haptic master in cyberspace for a robot-assisted minimally invasive surgery (RMIS) application. By using a controllable magnetorheological (MR) fluid, the proposed haptic master can have a feedback function for a surgical robot. Due to the difficulty in utilizing real human organs in the experiment, the cyberspace that features the virtual object is constructed to evaluate the performance of the haptic master. In order to realize the cyberspace, a volumetric deformable object is represented by a shape-retaining chain-linked (S-chain) model, which is a fast volumetric model and is suitable for real-time applications. In the haptic architecture for an RMIS application, the desired torque and position induced from the virtual object of the cyberspace and the haptic master of real space are transferred to each other. In order to validate the superiority of the proposed master and volumetric model, a tracking control experiment is implemented with a nonhomogenous volumetric cubic object to demonstrate that the proposed model can be utilized in real-time haptic rendering architecture. A proportional-integral-derivative (PID) controller is then designed and empirically implemented to accomplish the desired torque trajectories. It has been verified from the experiment that tracking the control performance for torque trajectories from a virtual slave can be successfully achieved. (paper)

  13. L1 retrotransposition is activated by Ten-eleven-translocation protein 1 and repressed by methyl-CpG binding proteins.

    Science.gov (United States)

    Zhang, Peng; Ludwig, Anne K; Hastert, Florian D; Rausch, Cathia; Lehmkuhl, Anne; Hellmann, Ines; Smets, Martha; Leonhardt, Heinrich; Cardoso, M Cristina

    2017-09-03

    One of the major functions of DNA methylation is the repression of transposable elements, such as the long-interspersed nuclear element 1 (L1). The underlying mechanism(s), however, are unclear. Here, we addressed how retrotransposon activation and mobilization are regulated by methyl-cytosine modifying ten-eleven-translocation (Tet) proteins and how this is modulated by methyl-CpG binding domain (MBD) proteins. We show that Tet1 activates both, endogenous and engineered L1 retrotransposons. Furthermore, we found that Mecp2 and Mbd2 repress Tet1-mediated activation of L1 by preventing 5hmC formation at the L1 promoter. Finally, we demonstrate that the methyl-CpG binding domain, as well as the adjacent non-sequence specific DNA binding domain of Mecp2 are each sufficient to mediate repression of Tet1-induced L1 mobilization. Our study reveals a mechanism how L1 elements get activated in the absence of Mecp2 and suggests that Tet1 may contribute to Mecp2/Mbd2-deficiency phenotypes, such as the Rett syndrome. We propose that the balance between methylation "reader" and "eraser/writer" controls L1 retrotransposition.

  14. Arabidopsis protein phosphatase DBP1 nucleates a protein network with a role in regulating plant defense.

    Directory of Open Access Journals (Sweden)

    José Luis Carrasco

    Full Text Available Arabidopsis thaliana DBP1 belongs to the plant-specific family of DNA-binding protein phosphatases. Although recently identified as a novel host factor mediating susceptibility to potyvirus, little is known about DBP1 targets and partners and the molecular mechanisms underlying its function. Analyzing changes in the phosphoproteome of a loss-of-function dbp1 mutant enabled the identification of 14-3-3λ isoform (GRF6, a previously reported DBP1 interactor, and MAP kinase (MAPK MPK11 as components of a small protein network nucleated by DBP1, in which GRF6 stability is modulated by MPK11 through phosphorylation, while DBP1 in turn negatively regulates MPK11 activity. Interestingly, grf6 and mpk11 loss-of-function mutants showed altered response to infection by the potyvirus Plum pox virus (PPV, and the described molecular mechanism controlling GRF6 stability was recapitulated upon PPV infection. These results not only contribute to a better knowledge of the biology of DBP factors, but also of MAPK signalling in plants, with the identification of GRF6 as a likely MPK11 substrate and of DBP1 as a protein phosphatase regulating MPK11 activity, and unveils the implication of this protein module in the response to PPV infection in Arabidopsis.

  15. Et episk sus for læsere i alle aldre

    DEFF Research Database (Denmark)

    Davidsen-Nielsen, Niels

    2014-01-01

    Eftertanken. Ligesom Charles Dickens udgav Alexandre Dumas sine værker som avisføljetoner, og deres værker holder den dag i dag.......Eftertanken. Ligesom Charles Dickens udgav Alexandre Dumas sine værker som avisføljetoner, og deres værker holder den dag i dag....

  16. Direct protein-protein interaction between PLCγ1 and the bradykinin B2 receptor-Importance of growth conditions

    International Nuclear Information System (INIS)

    Duchene, Johan; Chauhan, Sharmila D.; Lopez, Frederic; Pecher, Christiane; Esteve, Jean-Pierre; Girolami, Jean-Pierre; Bascands, Jean-Loup; Schanstra, Joost P.

    2005-01-01

    Recently, we have described a novel protein-protein interaction between the G-protein coupled bradykinin B2 receptor and tyrosine phosphatase SHP-2 via an immunoreceptor tyrosine-based inhibition motif (ITIM) sequence located in the C-terminal part of the B2 receptor and the Src homology (SH2) domains of SHP-2. Here we show that phospholipase C (PLC)γ1, another SH2 domain containing protein, can also interact with this ITIM sequence. Using surface plasmon resonance analysis, we observed that PLCγ1 interacted with a peptide containing the phosphorylated form of the bradykinin B2 receptor ITIM sequence. In CHO cells expressing the wild-type B2 receptor, bradykinin-induced transient recruitment and activation of PLCγ1. Interestingly, this interaction was only observed in quiescent and not in proliferating cells. Mutation of the key ITIM residue abolished this interaction with and activation of PLCγ1. Finally we also identified bradykinin-induced PLCγ1 recruitment and activation in primary culture renal mesangial cells

  17. Disease-Causing Mutations in BEST1 Gene Are Associated with Altered Sorting of Bestrophin-1 Protein

    Science.gov (United States)

    Doumanov, Jordan A.; Zeitz, Christina; Gimenez, Paloma Dominguez; Audo, Isabelle; Krishna, Abhay; Alfano, Giovanna; Diaz, Maria Luz Bellido; Moskova-Doumanova, Veselina; Lancelot, Marie-Elise; Sahel, José-Alain; Nandrot, Emeline F.; Bhattacharya, Shomi S.

    2013-01-01

    Mutations in BEST1 gene, encoding the bestrophin-1 (Best1) protein are associated with macular dystrophies. Best1 is predominantly expressed in the retinal pigment epithelium (RPE), and is inserted in its basolateral membrane. We investigated the cellular localization in polarized MDCKII cells of disease-associated Best1 mutant proteins to study specific sorting motifs of Best1. Real-time PCR and western blots for endogenous expression of BEST1 in MDCK cells were performed. Best1 mutant constructs were generated using site-directed mutagenesis and transfected in MDCK cells. For protein sorting, confocal microscopy studies, biotinylation assays and statistical methods for quantification of mislocalization were used. Analysis of endogenous expression of BEST1 in MDCK cells revealed the presence of BEST1 transcript but no protein. Confocal microscopy and quantitative analyses indicate that transfected normal human Best1 displays a basolateral localization in MDCK cells, while cell sorting of several Best1 mutants (Y85H, Q96R, L100R, Y227N, Y227E) was altered. In contrast to constitutively active Y227E, constitutively inactive Y227F Best1 mutant localized basolaterally similar to the normal Best1 protein. Our data suggest that at least three basolateral sorting motifs might be implicated in proper Best1 basolateral localization. In addition, non-phosphorylated tyrosine 227 could play a role for basolateral delivery. PMID:23880862

  18. The Reg1-interacting proteins, Bmh1, Bmh2, Ssb1, and Ssb2, have roles in maintaining glucose repression in Saccharomyces cerevisiae.

    Science.gov (United States)

    Dombek, Kenneth M; Kacherovsky, Nataly; Young, Elton T

    2004-09-10

    In Saccharomyces cerevisiae, a type 1 protein phosphatase complex composed of the Glc7 catalytic subunit and the Reg1 regulatory subunit represses expression of many glucose-regulated genes. Here we show that the Reg1-interacting proteins Bmh1, Bmh2, Ssb1, and Ssb2 have roles in glucose repression. Deleting both BMH genes causes partially constitutive ADH2 expression without significantly increasing the level of Adr1 protein, the major activator of ADH2 expression. Adr1 and Bcy1, the regulatory subunit of cAMP-dependent protein kinase, are both required for this effect indicating that constitutive expression in Deltabmh1Deltabmh2 cells uses the same activation pathway that operates in Deltareg1 cells. Deletion of both BMH genes and REG1 causes a synergistic relief from repression, suggesting that Bmh proteins also act independently of Reg1 during glucose repression. A two-hybrid interaction with the Bmh proteins was mapped to amino acids 187-232, a region of Reg1 that is conserved in different classes of fungi. Deleting this region partially releases SUC2 from glucose repression. This indicates a role for the Reg1-Bmh interaction in glucose repression and also suggests a broad role for Bmh proteins in this process. An in vivo Reg1-Bmh interaction was confirmed by copurification of Bmh proteins with HA(3)-TAP-tagged Reg1. The nonconventional heat shock proteins Ssb1 and Ssb2 are also copurified with HA(3)-TAP-tagged Reg1. Deletion of both SSB genes modestly decreases repression of ADH2 expression in the presence of glucose, suggesting that Ssb proteins, perhaps through their interaction with Reg1, play a minor role in glucose repression.

  19. Poly (ADP-ribose polymerase 1 is required for protein localization to Cajal body.

    Directory of Open Access Journals (Sweden)

    Elena Kotova

    2009-02-01

    Full Text Available Recently, the nuclear protein known as Poly (ADP-ribose Polymerase1 (PARP1 was shown to play a key role in regulating transcription of a number of genes and controlling the nuclear sub-organelle nucleolus. PARP1 enzyme is known to catalyze the transfer of ADP-ribose to a variety of nuclear proteins. At present, however, while we do know that the main acceptor for pADPr in vivo is PARP1 protein itself, by PARP1 automodification, the significance of PARP1 automodification for in vivo processes is not clear. Therefore, we investigated the roles of PARP1 auto ADP-ribosylation in dynamic nuclear processes during development. Specifically, we discovered that PARP1 automodification is required for shuttling key proteins into Cajal body (CB by protein non-covalent interaction with pADPr in vivo. We hypothesize that PARP1 protein shuttling follows a chain of events whereby, first, most unmodified PARP1 protein molecules bind to chromatin and accumulate in nucleoli, but then, second, upon automodification with poly(ADP-ribose, PARP1 interacts non-covalently with a number of nuclear proteins such that the resulting protein-pADPr complex dissociates from chromatin into CB.

  20. Modulation of intracellular protein degradation by SSB1-SIS1 chaperon system in yeast S. cerevisiae.

    Science.gov (United States)

    Ohba, M

    1997-06-09

    In prokaryotes, DnaK-DnaJ chaperon is involved in the protein degradation catalyzed by proteases La and ClpA/B complex as shown in E. coli. To extend this into eukaryotic cells, we examined the effects of hsp70 genes, SSA1 and SSB1, and DnaJ genes, SIS1 and YDJ1, on the growth of proteasome subunit mutants of the yeast S. cerevisiae. The results identified SSB1 and SIS1 as a pair of chaperon genes specifically involved in efficient protein turnover in the yeast, whose overexpression suppressed the growth defects caused by the proteasome mutations. Moreover, a single amino acid substitution in the putative peptide-binding site of SSB1 protein profoundly enhanced the suppression activity, indicating that the activity is mediated by the peptide-binding activity of this chaperon. Thus SSB1, with its partner DnaJ, SIS1, modulates the efficiency of protein turnover through its chaperon activity.

  1. Stage-Specific Fatty Acid Fluxes Play a Regulatory Role in Glycerolipid Metabolism during Seed Development in Jatropha curcas L.

    Science.gov (United States)

    Chaitanya, Bharatula Sri Krishna; Kumar, Sumit; Kaki, Shiva Shanker; Balakrishna, Marrapu; Karuna, Mallampalli Sri Lakshmi; Prasad, Rachapudi Badari Narayana; Sastry, Pidaparty Seshadri; Reddy, Attipalli Ramachandra

    2015-12-23

    The present study describes the changes in lipid profile as well as fatty acid fluxes during seed development in Jatropha curcas L. Endosperm from 34, 37, and 40 days after anthesis (DAA), incubated with [(14)C]acetate, showed significant synthesis of phosphatidylcholine (PC) at seed maturation. The fatty acid methyl ester profile showed PC from 34 DAA was rich in palmitic acid (16:0), whereas PC from 37 and 40 DAA was rich in oleic acid (18:1n-9). Molecular species analysis of diacylglycerol (DAG) indicated DAG (16:0/18:2n-6) was in abundance at 34 DAA, whereas DAG (18:1n-9/18:2n-6) was significantly high at 40 DAA. Triacylglycerol (TAG) analysis revealed TAG (16:0/18:2n-6/16:0) was abundant at 34 DAA, whereas TAG (18:1n-9/18:2n-6/18:1n-9) formed the majority at 40 DAA. Expression of two types of diacylglycerol acyltransferases varied with seed maturation. These data demonstrate stage-specific distinct pools of PC and DAG synthesis during storage TAG accumulation in Jatropha seed.

  2. Hepatitis C virus nonstructural protein-5A activates sterol regulatory element-binding protein-1c through transcription factor Sp1

    Energy Technology Data Exchange (ETDEWEB)

    Xiang, Zhonghua; Qiao, Ling; Zhou, Yan [Vaccine and Infectious Disease Organization, University of Saskatchewan, Saskatoon, Saskatchewan, Canada S7N 5E3 (Canada); Babiuk, Lorne A. [University of Alberta, Edmonton, Alberta (Canada); Liu, Qiang, E-mail: qiang.liu@usask.ca [Vaccine and Infectious Disease Organization, University of Saskatchewan, Saskatoon, Saskatchewan, Canada S7N 5E3 (Canada)

    2010-11-19

    Research highlights: {yields} A chimeric subgenomic HCV replicon expresses HCV-3a NS5A in an HCV-1b backbone. {yields} HCV-3a NS5A increases mature SREBP-1c protein level. {yields} HCV-3a NS5A activates SREBP-1c transcription. {yields} Domain II of HCV-3a NS5A is more effective in SREBP-1c promoter activation. {yields} Transcription factor Sp1 is required for SREBP-1c activation by HCV-3a NS5A. -- Abstract: Steatosis is an important clinical manifestation of hepatitis C virus (HCV) infection. The molecular mechanisms of HCV-associated steatosis are not well understood. Sterol regulatory element-binding protein-1c (SREBP-1c) is a key transcription factor which activates the transcription of lipogenic genes. Here we showed that the nuclear, mature SREBP-1c level increases in the nucleus of replicon cells expressing HCV-3a nonstructural protein-5A (NS5A). We further showed that HCV-3a NS5A up-regulates SREBP-1c transcription. Additional analysis showed that transcriptional factor Sp1 is involved in SREBP-1c activation by HCV-3a NS5A because inhibition of Sp1 activity by mithramycin A or a dominant-negative Sp1 construct abrogated SREBP-1c promoter activation by HCV-3a NS5A. In addition, chromatin immunoprecipitation (ChIP) assay demonstrated enhanced binding of Sp1 on the SREBP-1c promoter in HCV-3a NS5A replicon cells. These results showed that HCV-3a NS5A activates SREBP-1c transcription through Sp1. Taken together, our results suggest that HCV-3a NS5A is a contributing factor for steatosis caused by HCV-3a infection.

  3. Hepatitis C virus nonstructural protein-5A activates sterol regulatory element-binding protein-1c through transcription factor Sp1

    International Nuclear Information System (INIS)

    Xiang, Zhonghua; Qiao, Ling; Zhou, Yan; Babiuk, Lorne A.; Liu, Qiang

    2010-01-01

    Research highlights: → A chimeric subgenomic HCV replicon expresses HCV-3a NS5A in an HCV-1b backbone. → HCV-3a NS5A increases mature SREBP-1c protein level. → HCV-3a NS5A activates SREBP-1c transcription. → Domain II of HCV-3a NS5A is more effective in SREBP-1c promoter activation. → Transcription factor Sp1 is required for SREBP-1c activation by HCV-3a NS5A. -- Abstract: Steatosis is an important clinical manifestation of hepatitis C virus (HCV) infection. The molecular mechanisms of HCV-associated steatosis are not well understood. Sterol regulatory element-binding protein-1c (SREBP-1c) is a key transcription factor which activates the transcription of lipogenic genes. Here we showed that the nuclear, mature SREBP-1c level increases in the nucleus of replicon cells expressing HCV-3a nonstructural protein-5A (NS5A). We further showed that HCV-3a NS5A up-regulates SREBP-1c transcription. Additional analysis showed that transcriptional factor Sp1 is involved in SREBP-1c activation by HCV-3a NS5A because inhibition of Sp1 activity by mithramycin A or a dominant-negative Sp1 construct abrogated SREBP-1c promoter activation by HCV-3a NS5A. In addition, chromatin immunoprecipitation (ChIP) assay demonstrated enhanced binding of Sp1 on the SREBP-1c promoter in HCV-3a NS5A replicon cells. These results showed that HCV-3a NS5A activates SREBP-1c transcription through Sp1. Taken together, our results suggest that HCV-3a NS5A is a contributing factor for steatosis caused by HCV-3a infection.

  4. Antifungal Effect of Arabidopsis SGT1 Proteins via Mitochondrial Reactive Oxygen Species.

    Science.gov (United States)

    Park, Seong-Cheol; Cheong, Mi Sun; Kim, Eun-Ji; Kim, Jin Hyo; Chi, Yong Hun; Jang, Mi-Kyeong

    2017-09-27

    The highly conserved SGT1 (suppressor of the G2 alleles of skp1) proteins from Arabidopsis are known to contribute to plant resistance to pathogens. While SGT1 proteins respond to fungal pathogens, their antifungal activity is not reported and the mechanism for this inhibition is not well understood. Therefore, recombinant Arabidopsis SGT1 proteins were cloned, expressed, and purified to evaluate their antifungal activity, resulting in their potent inhibition of pathogen growth. Dye-labeled proteins are localized to the cytosol of Candida albicans cells without the disruption of the cell membrane. Moreover, we showed that entry of the proteins into C. albicans cells resulted in the accumulation of reactive oxygen species (ROS) and cell death via altered mitochondrial potential. Morphological changes of C. albicans cells in the presence of proteins were visualized by scanning electron microscopy. Our data suggest that AtSGT1 proteins play a critical role in plant resistance to pathogenic fungal infection and they can be classified to a new plant antifungal protein.

  5. 14-3-3 checkpoint regulatory proteins interact specifically with DNA repair protein human exonuclease 1 (hEXO1) via a semi-conserved motif

    DEFF Research Database (Denmark)

    Andersen, Sofie Dabros; Keijzers, Guido; Rampakakis, Emmanouil

    2012-01-01

    Human exonuclease 1 (hEXO1) acts directly in diverse DNA processing events, including replication, mismatch repair (MMR), and double strand break repair (DSBR), and it was also recently described to function as damage sensor and apoptosis inducer following DNA damage. In contrast, 14-3-3 proteins...... are specifically induced by replication inhibition leading to protein ubiquitination and degradation. We demonstrate direct and robust interaction between hEXO1 and six of the seven 14-3-3 isoforms in vitro, suggestive of a novel protein interaction network between DNA repair and cell cycle control. Binding...... and most likely a second unidentified binding motif. 14-3-3 associations do not appear to directly influence hEXO1 in vitro nuclease activity or in vitro DNA replication initiation. Moreover, specific phosphorylation variants, including hEXO1 S746A, are efficiently imported to the nucleus; to associate...

  6. Organ accumulation and subcellular location of Cicer arietinum ST1 protein.

    Science.gov (United States)

    Albornos, Lucía; Cabrera, Javier; Hernández-Nistal, Josefina; Martín, Ignacio; Labrador, Emilia; Dopico, Berta

    2014-07-01

    The ST (ShooT Specific) proteins are a new family of proteins characterized by a signal peptide, tandem repeats of 25/26 amino acids, and a domain of unknown function (DUF2775), whose presence is limited to a few families of dicotyledonous plants, mainly Fabaceae and Asteraceae. Their function remains unknown, although involvement in plant growth, fruit morphogenesis or in biotic and abiotic interactions have been suggested. This work is focused on ST1, a Cicer arietinum ST protein. We established the protein accumulation in different tissues and organs of chickpea seedlings and plants and its subcellular localization, which could indicate the possible function of ST1. The raising of specific antibodies against ST1 protein revealed that its accumulation in epicotyls and radicles was related to their elongation rate. Its pattern of tissue location in cotyledons during seed formation and early seed germination, as well as its localization in the perivascular fibres of epicotyls and radicles, indicated a possible involvement in seed germination and seedling growth. ST1 protein appears both inside the cell and in the cell wall. This double subcellular localization was found in every organ in which the ST1 protein was detected: seeds, cotyledons and seedling epicotyls and radicles. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  7. The spliceosome-associated protein Mfap1 binds to VCP in Drosophila.

    Directory of Open Access Journals (Sweden)

    Sandra Rode

    Full Text Available Posttranscriptional regulation of gene expression contributes to many developmental transitions. Previously, we found that the AAA chaperone Valosin-Containing Protein (VCP regulates ecdysone-dependent dendrite pruning of Drosophila class IV dendritic arborization (c4da neurons via an effect on RNA metabolism. In a search for RNA binding proteins associated with VCP, we identified the spliceosome-associated protein Mfap1, a component of the tri-snRNP complex. Mfap1 is a nucleolar protein in neurons and its levels are regulated by VCP. Mfap1 binds to VCP and TDP-43, a disease-associated RNA-binding protein. via distinct regions in its N- and C-terminal halfs. Similar to vcp mutations, Mfap1 overexpression causes c4da neuron dendrite pruning defects and mislocalization of TDP-43 in these cells, but genetic analyses show that Mfap1 is not a crucial VCP target during dendrite pruning. Finally, rescue experiments with a lethal mfap1 mutant show that the VCP binding region is not essential for Mfap1 function, but may act to increase its stability or activity.

  8. The protein network surrounding the human telomere repeat binding factors TRF1, TRF2, and POT1.

    Directory of Open Access Journals (Sweden)

    Richard J Giannone

    2010-08-01

    Full Text Available Telomere integrity (including telomere length and capping is critical in overall genomic stability. Telomere repeat binding factors and their associated proteins play vital roles in telomere length regulation and end protection. In this study, we explore the protein network surrounding telomere repeat binding factors, TRF1, TRF2, and POT1 using dual-tag affinity purification in combination with multidimensional protein identification technology liquid chromatography--tandem mass spectrometry (MudPIT LC-MS/MS. After control subtraction and data filtering, we found that TRF2 and POT1 co-purified all six members of the telomere protein complex, while TRF1 identified five of six components at frequencies that lend evidence towards the currently accepted telomere architecture. Many of the known TRF1 or TRF2 interacting proteins were also identified. Moreover, putative associating partners identified for each of the three core components fell into functional categories such as DNA damage repair, ubiquitination, chromosome cohesion, chromatin modification/remodeling, DNA replication, cell cycle and transcription regulation, nucleotide metabolism, RNA processing, and nuclear transport. These putative protein-protein associations may participate in different biological processes at telomeres or, intriguingly, outside telomeres.

  9. ALDH16A1 is a novel non-catalytic enzyme that may be involved in the etiology of gout via protein-protein interactions with HPRT1.

    Science.gov (United States)

    Vasiliou, Vasilis; Sandoval, Monica; Backos, Donald S; Jackson, Brian C; Chen, Ying; Reigan, Philip; Lanaspa, Miguel A; Johnson, Richard J; Koppaka, Vindhya; Thompson, David C

    2013-02-25

    Gout, a common form of inflammatory arthritis, is strongly associated with elevated uric acid concentrations in the blood (hyperuricemia). A recent study in Icelanders identified a rare missense single nucleotide polymorphism (SNP) in the ALDH16A1 gene, ALDH16A1*2, to be associated with gout and serum uric acid levels. ALDH16A1 is a novel and rather unique member of the ALDH superfamily in relation to its gene and protein structures. ALDH16 genes are present in fish, amphibians, protista, bacteria but absent from archaea, fungi and plants. In most mammalian species, two ALDH16A1 spliced variants (ALDH16A1, long form and ALDH16A1_v2, short form) have been identified and both are expressed in HepG-2, HK-2 and HK-293 human cell lines. The ALDH16 proteins contain two ALDH domains (as opposed to one in the other members of the superfamily), four transmembrane and one coiled-coil domains. The active site of ALDH16 proteins from bacterial, frog and lower animals contain the catalytically important cysteine residue (Cys-302); this residue is absent from the mammalian and fish orthologs. Molecular modeling predicts that both the short and long forms of human ALDH16A1 protein would lack catalytic activity but may interact with the hypoxanthine-guanine phosphoribosyltransferase (HPRT1) protein, a key enzyme involved in uric acid metabolism and gout. Interestingly, such protein-protein interactions with HPRT1 are predicted to be impaired for the long or short forms of ALDH16A1*2. These results lead to the intriguing possibility that association between ALDH16A1 and HPRT1 may be required for optimal HPRT activity with disruption of this interaction possibly contributing to the hyperuricemia seen in ALDH16A1*2 carriers. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  10. Spliced X-box binding protein 1 couples the unfolded protein response to hexosamine biosynthetic pathway.

    Science.gov (United States)

    Wang, Zhao V; Deng, Yingfeng; Gao, Ningguo; Pedrozo, Zully; Li, Dan L; Morales, Cyndi R; Criollo, Alfredo; Luo, Xiang; Tan, Wei; Jiang, Nan; Lehrman, Mark A; Rothermel, Beverly A; Lee, Ann-Hwee; Lavandero, Sergio; Mammen, Pradeep P A; Ferdous, Anwarul; Gillette, Thomas G; Scherer, Philipp E; Hill, Joseph A

    2014-03-13

    The hexosamine biosynthetic pathway (HBP) generates uridine diphosphate N-acetylglucosamine (UDP-GlcNAc) for glycan synthesis and O-linked GlcNAc (O-GlcNAc) protein modifications. Despite the established role of the HBP in metabolism and multiple diseases, regulation of the HBP remains largely undefined. Here, we show that spliced X-box binding protein 1 (Xbp1s), the most conserved signal transducer of the unfolded protein response (UPR), is a direct transcriptional activator of the HBP. We demonstrate that the UPR triggers HBP activation via Xbp1s-dependent transcription of genes coding for key, rate-limiting enzymes. We further establish that this previously unrecognized UPR-HBP axis is triggered in a variety of stress conditions. Finally, we demonstrate a physiologic role for the UPR-HBP axis by showing that acute stimulation of Xbp1s in heart by ischemia/reperfusion confers robust cardioprotection in part through induction of the HBP. Collectively, these studies reveal that Xbp1s couples the UPR to the HBP to protect cells under stress. Copyright © 2014 Elsevier Inc. All rights reserved.

  11. "Al mijn werk is het resultaat van wat ik heb meegemaakt"

    NARCIS (Netherlands)

    Verhoogt, G.W.; Dijkhuis, A.; Engels, J.G.A.; Verhoogt, G.W.

    2009-01-01

    7 december is een belangrijke dag in het leven van Shinkichi Tajiri. In 1923 wordt hij op die dag geboren in Los Angeles; in 1941 op die dag valt het Japanse leger Pearl Harbor aan en op die dag wordt hij, in 2008, officieel Nederlands staatsburger. In de tussenliggende 85 jaar maakt Tajiri veel

  12. Identification of human hnRNP C1/C2 as a dengue virus NS1-interacting protein

    International Nuclear Information System (INIS)

    Noisakran, Sansanee; Sengsai, Suchada; Thongboonkerd, Visith; Kanlaya, Rattiyaporn; Sinchaikul, Supachok; Chen, Shui-Tein; Puttikhunt, Chunya

    2008-01-01

    Dengue virus nonstructural protein 1 (NS1) is a key glycoprotein involved in the production of infectious virus and the pathogenesis of dengue diseases. Very little is known how NS1 interacts with host cellular proteins and functions in dengue virus-infected cells. This study aimed at identifying NS1-interacting host cellular proteins in dengue virus-infected cells by employing co-immunoprecipitation, two-dimensional gel electrophoresis, and mass spectrometry. Using lysates of dengue virus-infected human embryonic kidney cells (HEK 293T), immunoprecipitation with an anti-NS1 monoclonal antibody revealed eight isoforms of dengue virus NS1 and a 40-kDa protein, which was subsequently identified by quadrupole time-of-flight tandem mass spectrometry (Q-TOF MS/MS) as human heterogeneous nuclear ribonucleoprotein (hnRNP) C1/C2. Further investigation by co-immunoprecipitation and co-localization confirmed the association of hnRNP C1/C2 and dengue virus NS1 proteins in dengue virus-infected cells. Their interaction may have implications in virus replication and/or cellular responses favorable to survival of the virus in host cells

  13. Airborne Conflict Management within Confined Airspace in a Piloted Simulation of DAG-TM Autonomous Aircraft Operations

    Science.gov (United States)

    Barmore, Bryan; Johnson, Edward; Wing, David J.; Barhydt, Richard

    2003-01-01

    A human-in-the-loop experiment was performed at the NASA Langley Research Center to study the feasibility of Distributed Air/Ground Traffic Management (DAG-TM) autonomous aircraft operations in highly constrained airspace. The airspace was constrained by a pair of special use airspace (SUA) regions on either side of the pilot s planned route. The available airspace was further varied by changing the separation standard for lateral separation between 3 nm and 5 nm. The pilot had to maneuver through the corridor between the SUA s, avoid other traffic and meet flow management constraints. Traffic flow management (TFM) constraints were imposed as a required time of arrival and crossing altitude at an en route fix. This is a follow-up study to work presented at the 4th USA/Europe Air Traffic Management R&D Seminar in December 2001. Nearly all of the pilots were able to meet their TFM constraints while maintaining adequate separation from other traffic. In only 3 out of 59 runs were the pilots unable to meet their required time of arrival. Two loss of separation cases are studied and it is found that the pilots need conflict prevention information presented in a clearer manner. No degradation of performance or safety was seen between the wide and narrow corridors. Although this was not a thorough study of the consequences of reducing the en route lateral separation, nothing was found that would refute the feasibility of reducing the separation requirement from 5 nm to 3 nm. The creation of additional, second-generation conflicts is also investigated. Two resolution methods were offered to the pilots: strategic and tactical. The strategic method is a closed-loop alteration to the Flight Management System (FMS) active route that considers other traffic as well as TFM constraints. The tactical resolutions are short-term resolutions that leave avoiding other traffic conflicts and meeting the TFM constraints to the pilot. Those that made use of the strategic tools avoided

  14. [Depth of focus in spherical and aspheric intraocular lenses].

    Science.gov (United States)

    Nan, Li; Tang, Xin; Liu, Yong-ji

    2012-02-01

    To investigate depth of focus (DOF) in spherical and aspheric IOL eye models. Computer numerical simulation experiment was used. IOL eye model based on Liou-Brennan eye model was constructed by using ZEMAX optical design software. Different IOL were implanted in this eye model. Monochromatic through focus modulation transfer function (MTF) curves were computed. Pupil and aspheric designs' effect on DOF were analyzed. DOF of eye model increased with pupil shrinkage in 550 nm monochromatic light (FY60AD 1.20 D at 6 mm pupil, 1.35 D at 5 mm pupil, 1.70 D at 4 mm pupil, 2.46 D at 3 mm pupil; YA60BBR 1.24 D at 6 mm pupil, 1.48 D at 5 mm pupil, 1.80 D at 4 mm pupil, 2.50 D at 3 mm pupil). MTF in spherical IOL eye model was higher with minus defocus, this trend was obvious at larger pupil. MTF of aspheric IOL eyes were higher than spherical IOL eyes when well focused at 5 mm pupil, while the DOF was lower in aspheric IOL with negative spherical aberration (Tecnis Z9000 1.31 D, FY60AD 1.35 D, CeeOn911 1.55 D, YA60BBR 1.48 D). DOF decreased less in aspheric IOL with zero spherical aberration (LI61AO 1.42 D). DOF in IOL eye model was higher at smaller pupil. When the pupil was large, well focused aspheric IOL improved optical quality compared with spherical IOL, while DOF and the tolerance to defocus in aspheric IOL were partially lost; this phenomenon was obvious with minus defocus.

  15. A banana NAC transcription factor (MusaSNAC1) impart drought tolerance by modulating stomatal closure and H2O2 content.

    Science.gov (United States)

    Negi, Sanjana; Tak, Himanshu; Ganapathi, T R

    2018-03-01

    MusaSNAC1 function in H 2 O 2 mediated stomatal closure and promote drought tolerance by directly binding to CGT[A/G] motif in regulatory region of multiple stress-related genes. Drought is a abiotic stress-condition, causing reduced plant growth and diminished crop yield. Guard cells of the stomata control photosynthesis and transpiration by regulating CO 2 exchange and water loss, thus affecting growth and crop yield. Roles of NAC (NAM, ATAF1/2 and CUC2) protein in regulation of stress-conditions has been well documented however, their control over stomatal aperture is largely unknown. In this study we report a banana NAC protein, MusaSNAC1 which induced stomatal closure by elevating H 2 O 2 content in guard cells during drought stress. Overexpression of MusaSNAC1 in banana resulted in higher number of stomata closure causing reduced water loss and thus elevated drought-tolerance. During drought, expression of GUS (β-glucuronidase) under P MusaSNAC1 was remarkably elevated in guard cells of stomata which correlated with its function as a transcription factor regulating stomatal aperture closing. MusaSNAC1 is a transcriptional activator belonging to SNAC subgroup and its 5'-upstream region contain multiple Dof1 elements as well as stress-associated cis-elements. Moreover, MusaSNAC1 also regulate multiple stress-related genes by binding to core site of NAC-proteins CGT[A/G] in their 5'-upstream region. Results indicated an interesting mechanism of drought tolerance through stomatal closure by H 2 O 2 generation in guard cells, regulated by a NAC-protein in banana.

  16. Bcl-2 protein expression is associated with p27 and p53 protein expressions and MIB-1 counts in breast cancer

    International Nuclear Information System (INIS)

    Tsutsui, Shinichi; Yasuda, Kazuhiro; Suzuki, Kosuke; Takeuchi, Hideya; Nishizaki, Takashi; Higashi, Hidefumi; Era, Shoichi

    2006-01-01

    Recent experimental studies have shown that Bcl-2, which has been established as a key player in the control of apoptosis, plays a role in regulating the cell cycle and proliferation. The aim of this study was to investigate the relationship between Bcl-2 and p27 protein expression, p53 protein expression and the proliferation activity as defined by the MIB-1 counts. The prognostic implication of Bcl-2 protein expression in relation to p27 and p53 protein expressions and MIB-1 counts for breast cancer was also evaluated. The immunohistochemical expression of Bcl-2 protein was evaluated in a series of 249 invasive ductal carcinomas of the breast, in which p27 and p53 protein expressions and MIB-1 counts had been determined previously. The Bcl-2 protein expression was found to be decreased in 105 (42%) cases. A decreased Bcl-2 protein expression was significantly correlated with a nuclear grade of III, a negative estrogen receptor, a decreased p27 protein expression, a positive p53 protein expression, positive MIB-1 counts and a positive HER2 protein expression. The incidence of a nuclear grade of III and positive MIB-1 counts increased as the number of abnormal findings of Bcl-2, p27 and p53 protein expressions increased. A univariate analysis indicated a decreased Bcl-2 protein expression to be significantly (p = 0.0089) associated with a worse disease free survival (DFS), while a multivariate analysis indicated the lymph node status and MIB-1 counts to be independently significant prognostic factors for the DFS. The Bcl-2 protein expression has a close correlation with p27 and p53 protein expressions and the proliferation activity determined by MIB-1 counts in invasive ductal carcinoma of the breast. The prognostic value of Bcl-2 as well as p27 and p53 protein expressions was dependent on the proliferation activity in breast cancer

  17. Bcl-2 protein expression is associated with p27 and p53 protein expressions and MIB-1 counts in breast cancer

    Directory of Open Access Journals (Sweden)

    Nishizaki Takashi

    2006-07-01

    Full Text Available Abstract Background Recent experimental studies have shown that Bcl-2, which has been established as a key player in the control of apoptosis, plays a role in regulating the cell cycle and proliferation. The aim of this study was to investigate the relationship between Bcl-2 and p27 protein expression, p53 protein expression and the proliferation activity as defined by the MIB-1 counts. The prognostic implication of Bcl-2 protein expression in relation to p27 and p53 protein expressions and MIB-1 counts for breast cancer was also evaluated. Methods The immunohistochemical expression of Bcl-2 protein was evaluated in a series of 249 invasive ductal carcinomas of the breast, in which p27 and p53 protein expressions and MIB-1 counts had been determined previously. Results The Bcl-2 protein expression was found to be decreased in 105 (42% cases. A decreased Bcl-2 protein expression was significantly correlated with a nuclear grade of III, a negative estrogen receptor, a decreased p27 protein expression, a positive p53 protein expression, positive MIB-1 counts and a positive HER2 protein expression. The incidence of a nuclear grade of III and positive MIB-1 counts increased as the number of abnormal findings of Bcl-2, p27 and p53 protein expressions increased. A univariate analysis indicated a decreased Bcl-2 protein expression to be significantly (p = 0.0089 associated with a worse disease free survival (DFS, while a multivariate analysis indicated the lymph node status and MIB-1 counts to be independently significant prognostic factors for the DFS. Conclusion The Bcl-2 protein expression has a close correlation with p27 and p53 protein expressions and the proliferation activity determined by MIB-1 counts in invasive ductal carcinoma of the breast. The prognostic value of Bcl-2 as well as p27 and p53 protein expressions was dependent on the proliferation activity in breast cancer.

  18. FOXO1 is a direct target of EWS-Fli1 oncogenic fusion protein in Ewing's sarcoma cells

    International Nuclear Information System (INIS)

    Yang, Liu; Hu, Hsien-Ming; Zielinska-Kwiatkowska, Anna; Chansky, Howard A.

    2010-01-01

    Research highlights: → Inducible and reversible siRNA knockdown of an oncogenic fusion protein such as EWS-Fli1 is feasible and more advantageous than other siRNA methods. → The tumor suppressor gene FOXO1 is a new EWS-Fli1 target. → While trans-activators are known for the FOXO1 gene, there has been no report on negative regulators of FOXO1 transcription. → This study provides first evidence that the EWS-Fli1 oncogenic fusion protein can function as a transcriptional repressor of the FOXO1 gene. -- Abstract: Ewing's family tumors are characterized by a specific t(11;22) chromosomal translocation that results in the formation of EWS-Fli1 oncogenic fusion protein. To investigate the effects of EWS-Fli1 on gene expression, we carried out DNA microarray analysis after specific knockdown of EWS-Fli1 through transfection of synthetic siRNAs. EWS-Fli1 knockdown increased expression of genes such as DKK1 and p57 that are known to be repressed by EWS-Fli1 fusion protein. Among other potential EWS-Fli1 targets identified by our microarray analysis, we have focused on the FOXO1 gene since it encodes a potential tumor suppressor and has not been previously reported in Ewing's cells. To better understand how EWS-Fli1 affects FOXO1 expression, we have established a doxycycline-inducible siRNA system to achieve stable and reversible knockdown of EWS-Fli1 in Ewing's sarcoma cells. Here we show that FOXO1 expression in Ewing's cells has an inverse relationship with EWS-Fli1 protein level, and FOXO1 promoter activity is increased after doxycycline-induced EWS-Fli1 knockdown. In addition, we have found that direct binding of EWS-Fli1 to FOXO1 promoter is attenuated after doxycycline-induced siRNA knockdown of the fusion protein. Together, these results suggest that suppression of FOXO1 function by EWS-Fli1 fusion protein may contribute to cellular transformation in Ewing's family tumors.

  19. 6DoF object pose measurement by a monocular manifold-based pattern recognition technique

    International Nuclear Information System (INIS)

    Kouskouridas, Rigas; Charalampous, Konstantinos; Gasteratos, Antonios

    2012-01-01

    In this paper, a novel solution to the compound problem of object recognition and 3D pose estimation is presented. An accurate measurement of the geometrical configuration of a recognized target, relative to a known coordinate system, is of fundamental importance and constitutes a prerequisite for several applications such as robot grasping or obstacle avoidance. The proposed method lays its foundations on the following assumptions: (a) the same object captured under varying viewpoints and perspectives represents data that could be projected onto a well-established and highly distinguishable subspace; (b) totally different objects observed under the same viewpoints and perspectives share identical 3D pose that can be sufficiently modeled to produce a generalized model. Toward this end, we propose an advanced architecture that allows both recognizing patterns and providing efficient solution for 6DoF pose estimation. We employ a manifold modeling architecture that is grounded on a part-based representation of an object, which in turn, is accomplished via an unsupervised clustering of the extracted visual cues. The main contributions of the proposed framework are: (a) the proposed part-based architecture requires minimum supervision, compared to other contemporary solutions, whilst extracting new features encapsulating both appearance and geometrical attributes of the objects; (b) contrary to related projects that extract high-dimensional data, thus, increasing the complexity of the system, the proposed manifold modeling approach makes use of low dimensionality input vectors; (c) the formulation of a novel input–output space mapping that outperforms the existing dimensionality reduction schemes. Experimental results justify our theoretical claims and demonstrate the superiority of our method comparing to other related contemporary projects. (paper)

  20. The calcium-binding protein ALG-2 regulates protein secretion and trafficking via interactions with MISSL and MAP1B proteins.

    Science.gov (United States)

    Takahara, Terunao; Inoue, Kuniko; Arai, Yumika; Kuwata, Keiko; Shibata, Hideki; Maki, Masatoshi

    2017-10-13

    Mobilization of intracellular calcium is essential for a wide range of cellular processes, including signal transduction, apoptosis, and vesicular trafficking. Several lines of evidence have suggested that apoptosis-linked gene 2 (ALG-2, also known as PDCD6 ), a calcium-binding protein, acts as a calcium sensor linking calcium levels with efficient vesicular trafficking, especially at the endoplasmic reticulum (ER)-to-Golgi transport step. However, how ALG-2 regulates these processes remains largely unclear. Here, we report that M APK1- i nteracting and s pindle- s tabilizing (MISS)- l ike (MISSL), a previously uncharacterized protein, interacts with ALG-2 in a calcium-dependent manner. Live-cell imaging revealed that upon a rise in intracellular calcium levels, GFP-tagged MISSL (GFP-MISSL) dynamically relocalizes in a punctate pattern and colocalizes with ALG-2. MISSL knockdown caused disorganization of the components of the ER exit site, the ER-Golgi intermediate compartment, and Golgi. Importantly, knockdown of either MISSL or ALG-2 attenuated the secretion of se creted a lkaline p hosphatase (SEAP), a model secreted cargo protein, with similar reductions in secretion by single- and double-protein knockdowns, suggesting that MISSL and ALG-2 act in the same pathway to regulate the secretion process. Furthermore, ALG-2 or MISSL knockdown delayed ER-to-Golgi transport of procollagen type I. We also found that ALG-2 and MISSL interact with microtubule-associated protein 1B (MAP1B) and that MAP1B knockdown reverts the reduced secretion of SEAP caused by MISSL or ALG-2 depletion. These results suggest that a change in the intracellular calcium level plays a role in regulation of the secretory pathway via interaction of ALG-2 with MISSL and MAP1B. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.