
Sample records for dof protein dag1

  1. DAG1, no gene for RNA regulation? (United States)

    Brancaccio, Andrea


    DAG1 encodes for a precursor protein that liberates the two subunits featured by the dystroglycan (DG) adhesion complex that are involved in an increasing number of cellular functions in a wide variety of cells and tissues. Aside from the proteolytic events producing the α and β subunits, especially the former undergoes extensive "post-production" modifications taking place within the ER/Golgi where its core protein is both N- and O-decorated with sugars. These post-translational events, that are mainly orchestrated by a plethora of certified, or putative, glycosyltransferases, prelude to the excocytosis-mediated trafficking and targeting of the DG complex to the plasma membrane. Extensive genetic and biochemical evidences have been accumulated so far on α-DG glycosylation, while little is know on possible regulatory events underlying the chromatine activation, transcription or post-transcription (splicing and escape from the nucleus) of DAG1 or of its mRNA. A scenario is envisaged in which cells would use a sort of preferential, and scarcely regulated, route for DAG1 activation, that would imply fast mRNA transcription, maturation and export to the cytosol, and would prelude to the multiple time-consuming enzymatic post-translational activities needed for its glycosylation. Such a provocative view might be helpful to trigger future work aiming at disclosing the complete molecular mechanisms underlying DAG1 activation and at improving our knowledge of any pre-translational step that is involved in dystroglycan regulation. Copyright © 2012 Elsevier B.V. All rights reserved.

  2. 3D Orthorhombic Elastic Wave Propagation Pre-Test Simulation of SPE DAG-1 Test (United States)

    Jensen, R. P.; Preston, L. A.


    A more realistic representation of many geologic media can be characterized as a dense system of vertically-aligned microfractures superimposed on a finely-layered horizontal geology found in shallow crustal rocks. This seismic anisotropy representation lends itself to being modeled as an orthorhombic elastic medium comprising three mutually orthogonal symmetry planes containing nine independent moduli. These moduli can be determined by observing (or prescribing) nine independent P-wave and S-wave phase speeds along different propagation directions. We have developed an explicit time-domain finite-difference (FD) algorithm for simulating 3D elastic wave propagation in a heterogeneous orthorhombic medium. The components of the particle velocity vector and the stress tensor are governed by a set of nine, coupled, first-order, linear, partial differential equations (PDEs) called the velocity-stress system. All time and space derivatives are discretized with centered and staggered FD operators possessing second- and fourth-order numerical accuracy, respectively. Additionally, we have implemented novel perfectly matched layer (PML) absorbing boundary conditions, specifically designed for orthorhombic media, to effectively suppress grid boundary reflections. In support of the Source Physics Experiment (SPE) Phase II, a series of underground chemical explosions at the Nevada National Security Site, the code has been used to perform pre-test estimates of the Dry Alluvium Geology - Experiment 1 (DAG-1). Based on literature searches, realistic geologic structure and values for orthorhombic P-wave and S-wave speeds have been estimated. Results and predictions from the simulations are presented.

  3. The DOF transcription factor Dof5.1 influences leaf axial patterning by promoting Revoluta transcription in Arabidopsis

    KAUST Repository

    Kim, Hyungsae


    Dof proteins are transcription factors that have a conserved single zinc finger DNA-binding domain. In this study, we isolated an activation tagging mutant Dof5.1-D exhibiting an upward-curling leaf phenotype due to enhanced expression of the REV gene that is required for establishing adaxialabaxial polarity. Dof5.1-D plants also had reduced transcript levels for IAA6 and IAA19 genes, indicating an altered auxin biosynthesis in Dof5.1-D. An electrophoretic mobility shift assay using the Dof5.1 DNA-binding motif and the REV promoter region indicated that the DNA-binding domain of Dof5.1 binds to a TAAAGT motif located in the 5′-distal promoter region of the REV promoter. Further, transient and chromatin immunoprecipitation assays verified binding activity of the Dof5.1 DNA-binding motif with the REV promoter. Consistent with binding assays, constitutive over-expression of the Dof5.1 DNA-binding domain in wild-type plants caused a downward-curling phenotype, whereas crossing Dof5.1-D to a rev mutant reverted the upward-curling phenotype of the Dof5.1-D mutant leaf to the wild-type. These results suggest that the Dof5.1 protein directly binds to the REV promoter and thereby regulates adaxialabaxial polarity. © 2010 Blackwell Publishing Ltd.

  4. The DOF transcription factor Dof5.1 influences leaf axial patterning by promoting Revoluta transcription in Arabidopsis

    KAUST Repository

    Kim, Hyungsae; Kim, Sungjin; Abbasi, Nazia; Bressan, Ray Anthony; Yun, Daejin; Yoo, Sangdong; Kwon, SukYun; Choi, Sangbong


    Dof proteins are transcription factors that have a conserved single zinc finger DNA-binding domain. In this study, we isolated an activation tagging mutant Dof5.1-D exhibiting an upward-curling leaf phenotype due to enhanced expression of the REV gene that is required for establishing adaxialabaxial polarity. Dof5.1-D plants also had reduced transcript levels for IAA6 and IAA19 genes, indicating an altered auxin biosynthesis in Dof5.1-D. An electrophoretic mobility shift assay using the Dof5.1 DNA-binding motif and the REV promoter region indicated that the DNA-binding domain of Dof5.1 binds to a TAAAGT motif located in the 5′-distal promoter region of the REV promoter. Further, transient and chromatin immunoprecipitation assays verified binding activity of the Dof5.1 DNA-binding motif with the REV promoter. Consistent with binding assays, constitutive over-expression of the Dof5.1 DNA-binding domain in wild-type plants caused a downward-curling phenotype, whereas crossing Dof5.1-D to a rev mutant reverted the upward-curling phenotype of the Dof5.1-D mutant leaf to the wild-type. These results suggest that the Dof5.1 protein directly binds to the REV promoter and thereby regulates adaxialabaxial polarity. © 2010 Blackwell Publishing Ltd.

  5. Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus. (United States)

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya


    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

  6. Kontrola kvalitete DOF 2


    Kozić, Ružica; Meštrić, Lucija


    Projekt studentske radionice bio je kontrola DOF-a u mjerilu 1:2000 na području općine Đurđevac. Proveden je terenski dio kontrole točnosti DMR-a, DOF-a, izvedene signalizacije te načina signalizacije. Mjerenja su obavljena 19.travnja 2013. godine. Obavljena je ponovna izmjera GPS točaka homogenog polja Đurđevac RTK metodom u sustavu CROPOS s ciljem kontrole tih točaka, čije su koordinate već određene u sklopu izrade DOF2. Uz trajno stabilizirane točke homogenog polja, RTK metodom snimane su ...

  7. The DAG1 transcription factor negatively regulates the seed-to-seedling transition in Arabidopsis acting on ABA and GA levels

    Czech Academy of Sciences Publication Activity Database

    Boccaccini, A.; Lorrai, R.; Ruta, V.; Frey, A.; Mercey-Boutet, S.; Marion-Poll, F.; Tarkowská, Danuše; Strnad, Miroslav; Costantino, P.; Vittorioso, P.


    Roč. 16, SEP 9 (2016), s. 198 ISSN 1471-2229 R&D Projects: GA MŠk LK21306; GA MŠk(CZ) LO1204; GA ČR GA14-34792S Institutional support: RVO:61389030 Keywords : DAG1 * Seed development * Chromatin remodelling Subject RIV: EF - Botanics Impact factor: 3.964, year: 2016

  8. Genome-wide characterization of the SiDof gene family in foxtail millet (Setaria italica). (United States)

    Zhang, Li; Liu, Baoling; Zheng, Gewen; Zhang, Aiying; Li, Runzhi


    Dof (DNA binding with one finger) proteins, which constitute a class of transcription factors found exclusively in plants, are involved in numerous physiological and biochemical reactions affecting growth and development. A genome-wide analysis of SiDof genes was performed in this study. Thirty five SiDof genes were identified and those genes were unevenly distributed across nine chromosomes in the Seteria italica genome. Protein lengths, molecular weights, and theoretical isoelectric points of SiDofs all vary greatly. Gene structure analysis demonstrated that most SiDof genes lack introns. Phylogenetic analysis of SiDof proteins and Dof proteins from Arabidopsis thaliana, rice, sorghum, and Setaria viridis revealed six major groups. Analysis of RNA-Seq data indicated that SiDof gene expression levels varied across roots, stems, leaves, and spike. In addition, expression profiling of SiDof genes in response to stress suggested that SiDof 7 and SiDof 15 are involved in drought stress signalling. Overall, this study could provide novel information on SiDofs for further investigation in foxtail millet. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  9. Fluctuation of Dof1/Dof2 expression ratio under the influence of varying nitrogen and light conditions: involvement in differential regulation of nitrogen metabolism in two genotypes of finger millet (Eleusine coracana L.). (United States)

    Gupta, Supriya; Gupta, Sanjay Mohan; Gupta, Alok Kumar; Gaur, Vikram Singh; Kumar, Anil


    In order to gain insights into the mechanism of high nitrogen use efficiency (NUE) of finger millet (FM) the role of Dof2 transcription factor (TF), which is a repressor of genes involved in C/N metabolism was investigated. The partial cDNA fragment of EcDof2 (912-bp; GenBank acc. no. KF261117) was isolated and characterized from finger millet (FM) that showed 63% and 58% homology with Dof2 of Zea mays at nucleotide and protein level, respectively. Its expression studies were carried out along with the activator EcDof1 in two genotypes (GE3885, high protein genotype (HPG); GE1437, low protein genotype (LPG)) of FM differing in grain protein contents (13.8% and 6.2%) showed that EcDof2 is expressed in both shoot and root tissues with significantly (p≤0.05) higher expression in the roots. The diurnal expression of both EcDof1 and EcDof2 in shoots was differential having different time of peak expression indicating a differential response to diurnal condition. Under continuous dark conditions, expression of EcDof1 and EcDof2 oscillated in both the genotypes whereas on illumination, the fold expression of EcDof1 was higher as compared to EcDof2. Under increasing nitrate concentration, EcDof2 expression increases in roots and shoots of LPG while it remains unchanged in HPG. However, the EcDof1 expression was found to increase in both genotypes. Further, time kinetics studies under single nitrate concentration revealed that EcDof2 was repressed in the roots of both genotypes whereas EcDof1 oscillated with time. The EcDof1/EcDof2 ratio measured showed differential response under different light and nitrogen conditions. It was higher in the roots of HPG indicating higher activation of genes involved in N uptake and assimilation resulting in high grain protein accumulation. The results indicate that both light and nitrogen concentration influence Dof1 and Dof2 expression and suggests a complex pattern of regulation of genes influenced by these plant specific TFs. In

  10. The family of DOF transcription factors in Brachypodium distachyon: phylogenetic comparison with rice and barley DOFs and expression profiling

    Directory of Open Access Journals (Sweden)

    Hernando-Amado Sara


    Full Text Available Abstract Background Transcription factors (TFs are proteins that have played a central role both in evolution and in domestication, and are major regulators of development in living organisms. Plant genome sequences reveal that approximately 7% of all genes encode putative TFs. The DOF (DNA binding with One Finger TF family has been associated with vital processes exclusive to higher plants and to their close ancestors (algae, mosses and ferns. These are seed maturation and germination, light-mediated regulation, phytohormone and plant responses to biotic and abiotic stresses, etc. In Hordeum vulgare and Oryza sativa, 26 and 30 different Dof genes, respectively, have been annotated. Brachypodium distachyon has been the first Pooideae grass to be sequenced and, due to its genomic, morphological and physiological characteristics, has emerged as the model system for temperate cereals, such as wheat and barley. Results Through searches in the B. distachyon genome, 27 Dof genes have been identified and a phylogenetic comparison with the Oryza sativa and the Hordeum vulgare DOFs has been performed. To explore the evolutionary relationship among these DOF proteins, a combined phylogenetic tree has been constructed with the Brachypodium DOFs and those from rice and barley. This phylogenetic analysis has classified the DOF proteins into four Major Cluster of Orthologous Groups (MCOGs. Using RT-qPCR analysis the expression profiles of the annotated BdDof genes across four organs (leaves, roots, spikes and seeds has been investigated. These results have led to a classification of the BdDof genes into two groups, according to their expression levels. The genes highly or preferentially expressed in seeds have been subjected to a more detailed expression analysis (maturation, dry stage and germination. Conclusions Comparison of the expression profiles of the Brachypodium Dof genes with the published functions of closely related DOF sequences from the cereal

  11. Genome-wide analysis of the Dof transcription factor gene family reveals soybean-specific duplicable and functional characteristics.

    Directory of Open Access Journals (Sweden)

    Yong Guo

    Full Text Available The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max. In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.

  12. Members of the Dof transcription factor family in Triticum aestivum are associated with light-mediated gene regulation. (United States)

    Shaw, Lindsay M; McIntyre, C Lynne; Gresshoff, Peter M; Xue, Gang-Ping


    DNA binding with One Finger (Dof) protein is a plant-specific transcription factor implicated in the regulation of many important plant-specific processes, including photosynthesis and carbohydrate metabolism. This study has identified 31 Dof genes (TaDof) in bread wheat through extensive analysis of current nucleotide databases. Phylogenetic analysis suggests that the TaDof family can be divided into four clades. Expression analysis of the TaDof family across all major organs using quantitative RT-PCR and searches of the wheat genome array database revealed that the majority of TaDof members were predominately expressed in vegetative organs. A large number of TaDof members were down-regulated by drought and/or were responsive to the light and dark cycle. Further expression analysis revealed that light up-regulated TaDof members were highly correlated in expression with a number of genes that are involved in photosynthesis or sucrose transport. These data suggest that the TaDof family may have an important role in light-mediated gene regulation, including involvement in the photosynthetic process.

  13. The LET Procedure for Prosthetic Myocontrol: Towards Multi-DOF Control Using Single-DOF Activations.

    Directory of Open Access Journals (Sweden)

    Markus Nowak

    Full Text Available Simultaneous and proportional myocontrol of dexterous hand prostheses is to a large extent still an open problem. With the advent of commercially and clinically available multi-fingered hand prostheses there are now more independent degrees of freedom (DOFs in prostheses than can be effectively controlled using surface electromyography (sEMG, the current standard human-machine interface for hand amputees. In particular, it is uncertain, whether several DOFs can be controlled simultaneously and proportionally by exclusively calibrating the intended activation of single DOFs. The problem is currently solved by training on all required combinations. However, as the number of available DOFs grows, this approach becomes overly long and poses a high cognitive burden on the subject. In this paper we present a novel approach to overcome this problem. Multi-DOF activations are artificially modelled from single-DOF ones using a simple linear combination of sEMG signals, which are then added to the training set. This procedure, which we named LET (Linearly Enhanced Training, provides an augmented data set to any machine-learning-based intent detection system. In two experiments involving intact subjects, one offline and one online, we trained a standard machine learning approach using the full data set containing single- and multi-DOF activations as well as using the LET-augmented data set in order to evaluate the performance of the LET procedure. The results indicate that the machine trained on the latter data set obtains worse results in the offline experiment compared to the full data set. However, the online implementation enables the user to perform multi-DOF tasks with almost the same precision as single-DOF tasks without the need of explicitly training multi-DOF activations. Moreover, the parameters involved in the system are statistically uniform across subjects.

  14. Transcriptome-Based Analysis of Dof Family Transcription Factors and Their Responses to Abiotic Stress in Tea Plant (Camellia sinensis

    Directory of Open Access Journals (Sweden)

    Hui Li


    Full Text Available Tea plant (Camellia sinensis (L. O. Kuntze is affected by abiotic stress during its growth and development. DNA-binding with one finger (Dof transcription factors (TFs play important roles in abiotic stress tolerance of plants. In this study, a total of 29 putative Dof TFs were identified based on transcriptome of tea plant, and the conserved domains and common motifs of these CsDof TFs were predicted and analyzed. The 29 CsDof proteins were divided into 7 groups (A, B1, B2, C1, C2.1, C2.2, and D2, and the interaction networks of Dof proteins in C. sinensis were established according to the data in Arabidopsis. Gene expression was analyzed in “Yingshuang” and “Huangjinya” under four experimental stresses by qRT-PCR. CsDof genes were expressed differentially and related to different abiotic stress conditions. In total, our results might suggest that there is a potential relationship between CsDof factors and tea plant stress resistance.

  15. Transcriptome analyses of the Dof-like gene family in grapevine reveal its involvement in berry, flower and seed development. (United States)

    da Silva, Danielle Costenaro; da Silveira Falavigna, Vítor; Fasoli, Marianna; Buffon, Vanessa; Porto, Diogo Denardi; Pappas, Georgios Joannis; Pezzotti, Mario; Pasquali, Giancarlo; Revers, Luís Fernando


    The Dof (DNA-binding with one finger) protein family spans a group of plant transcription factors involved in the regulation of several functions, such as plant responses to stress, hormones and light, phytochrome signaling and seed germination. Here we describe the Dof-like gene family in grapevine (Vitis vinifera L.), which consists of 25 genes coding for Dof. An extensive in silico characterization of the VviDofL gene family was performed. Additionally, the expression of the entire gene family was assessed in 54 grapevine tissues and organs using an integrated approach with microarray (cv Corvina) and real-time PCR (cv Pinot Noir) analyses. The phylogenetic analysis comparing grapevine sequences with those of Arabidopsis, tomato, poplar and already described Dof genes in other species allowed us to identify several duplicated genes. The diversification of grapevine DofL genes during evolution likely resulted in a broader range of biological roles. Furthermore, distinct expression patterns were identified between samples analyzed, corroborating such hypothesis. Our expression results indicate that several VviDofL genes perform their functional roles mainly during flower, berry and seed development, highlighting their importance for grapevine growth and production. The identification of similar expression profiles between both approaches strongly suggests that these genes have important regulatory roles that are evolutionally conserved between grapevine cvs Corvina and Pinot Noir.

  16. ThDof1.4 and ThZFP1 constitute a transcriptional regulatory cascade involved in salt or osmotic stress in Tamarix hispida. (United States)

    Zang, Dandan; Wang, Lina; Zhang, Yiming; Zhao, Huimin; Wang, Yucheng


    Identification of the upstream regulators of a gene is important to characterize the transcriptional pathway and the function of the gene. Previously, we found that a zinc finger protein (ThZFP1) is involved in abiotic stress tolerance of Tamarix hispida. In the present study, we further investigated the transcriptional pathway of ThZFP1. Dof motifs are abundant in the ThZFP1 promoter; therefore, we used them to screen for transcriptional regulators of ThZFP1. A Dof protein, ThDof1.4, binds to the Dof motif specifically, and was hypothesized as the upstream regulator of ThZFP1. Further study showed that overexpression of ThDof1.4 in T. hispida activated the expression of GUS controlled by the ThZFP1 promoter. In T. hispida, transient overexpression of ThDof1.4 increased the transcripts of ThZFP1; conversely, transient RNAi-silencing of ThDof1.4 reduced the expression of ThZFP1. Chromatin immunoprecipitation indicated that ThDof1.4 binds to the ThZFP1 promoter. Additionally, ThDof1.4 and ThZFP1 share similar expression patterns in response to salt or drought stress. Furthermore, like ThZFP1, ThDof1.4 could increase the proline level and enhance ROS scavenging capability to improve salt and osmotic stress tolerance. Together, these results suggested that ThDof1.4 and ThZFP1 form a transcriptional regulatory cascade involved in abiotic stress resistance in T. hispida.

  17. Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus


    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya


    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, a...

  18. Kinematics and Workspace of a 4-DOF Hybrid Palletizing Robot

    Directory of Open Access Journals (Sweden)

    Yong Tao


    Full Text Available We presented the kinematical analysis of a 4-DOF hybrid palletizing robot. The palletizing robot structure was proposed and the arm model of the robot was presented. The kinematical analysis of the end robotic manipulator was given. As a result, the position, velocity, and acceleration curves as well as the maximum workspace were demonstrated by simulation in Matlab. This study would be useful for the kinematical characteristics of the 4-DOF palletizing robot in space.

  19. Effect of suspension kinematic on 14 DOF vehicle model (United States)

    Wongpattananukul, T.; Chantharasenawong, C.


    Computer simulations play a major role in shaping modern science and engineering. They reduce time and resource consumption in new studies and designs. Vehicle simulations have been studied extensively to achieve a vehicle model used in minimum lap time solution. Simulation result accuracy depends on the abilities of these models to represent real phenomenon. Vehicles models with 7 degrees of freedom (DOF), 10 DOF and 14 DOF are normally used in optimal control to solve for minimum lap time. However, suspension kinematics are always neglected on these models. Suspension kinematics are defined as wheel movements with respect to the vehicle body. Tire forces are expressed as a function of wheel slip and wheel position. Therefore, the suspension kinematic relation is appended to the 14 DOF vehicle model to investigate its effects on the accuracy of simulate trajectory. Classical 14 DOF vehicle model is chosen as baseline model. Experiment data is collected from formula student style car test runs as baseline data for simulation and comparison between baseline model and model with suspension kinematic. Results show that in a single long turn there is an accumulated trajectory error in baseline model compared to model with suspension kinematic. While in short alternate turns, the trajectory error is much smaller. These results show that suspension kinematic had an effect on the trajectory simulation of vehicle. Which optimal control that use baseline model will result in inaccuracy control scheme.

  20. Simulated Energy Usage for a Novel 6 DOF Articulated Robot

    International Nuclear Information System (INIS)

    Shaik, A A; Tlale, N; Bright, G


    The serial robot architecture is widespread in modern day manufacturing, and over the last few decades the technology has matured and settled to its current state. One drawback from the architecture however is the location of motors and gearboxes which are either at the joint it controls or close by. A novel hybrid 6 DOF robot was designed to move all the actuators to the robot base, and to control the desired axis through a set of connected links and gears, while maintaining the same workspace and dexterity. This would reduce the inertia of the movable part of the robot and some of the moment arms on the 3 axes required for translation of the 3 DOF spherical wrist. Doing so would decrease the energy requirements when compared to a 6 DOF serial robot. This paper focuses on the mathematical modelling and simulation of the novel hybrid machine design and compares it to an equivalent serial robot

  1. Comparative study of 2-DOF micromirrors for precision light manipulation (United States)

    Young, Johanna I.; Shkel, Andrei M.


    Many industry experts predict that the future of fiber optic telecommunications depends on the development of all-optical components for switching of photonic signals from fiber to fiber throughout the networks. MEMS is a promising technology for providing all-optical switching at high speeds with significant cost reductions. This paper reports on the the analysis of two designs for 2-DOF electrostatically actuated MEMS micromirrors for precision controllable large optical switching arrays. The behavior of the micromirror designs is predicted by coupled-field electrostatic and modal analysis using a finite element analysis (FEA) multi-physics modeling software. The analysis indicates that the commonly used gimbal type mirror design experiences electrostatic interference and would therefore be difficult to precisely control for 2-DOF motion. We propose a new design approach which preserves 2-DOF actuation while minimizing electrostatic interference between the drive electrodes and the mirror. Instead of using two torsional axes, we use one actuator which combines torsional and flexural DOFs. A comparative analysis of the conventional gimbal design and the one proposed in this paper is performed.

  2. BALCO 6/7-DoF trajectory model

    NARCIS (Netherlands)

    Wey, P.; Corriveau, D.; Saitz, T.A.; Ruijter, W. de; Strömbäck, P.


    BALCO is a six- and seven-degree-of-freedom trajectory simulation program based on the mathematical model defined by the NATO Standardization Recommendation 4618. The primary goal of BALCO is to compute high-fidelity trajectories for both conventional and precision-guided projectiles. The 6-DoF

  3. Control of 4-DOF MR haptic master for medical application (United States)

    Oh, Jong-Seok; Choi, Seung-Hyun; Choi, Seung-Bok


    In this work, magnetorheological (MR) based haptic master for robot-assisted minimally invasive surgery (RMIS) is proposed and analyzed. Using a controllable MR fluid, the masters can generate a reflection force with the 4-DOF motion. The proposed master consists of two actuators: MR clutch featuring gimbal mechanism for 2-DOF rotational motion (X and Y axes) and MR clutch attached at gripper of gimbal structures for 1-DOF rotational motion (Z axis) and 1-DOF translational motion. After analyzing the dynamic motion by integrating mechanical and physical properties of the actuators, torque model of the proposed haptic master is derived. For realization of master-slave system, an encoder which can measure position information is integrated with the MR haptic master. In the RMIS system, the measured position is converted as a command signal and sent to the slave robot. In this work, slave and organ of patient are modeled in virtual space. In order to embody a human organ into virtual space, a volumetric deformable object is mathematically formulated by a shape retaining chain linked (S-chain) model. Accordingly, the haptic architecture is established by incorporating the virtual slave with the master device in which the reflection force and desired position originated from the object of the virtual slave and operator of the master, respectively, are transferred to each other. In order to achieve the desired force trajectories, a proportional-integral-derivative (PID) controller is designed and implemented. It has been demonstrated that the effective tracking control performance for the desired motion of reflection force is well presented in time domain.

  4. Development of 6-DOF painting robot control system (United States)

    Huang, Junbiao; Liu, Jianqun; Gao, Weiqiang


    With the development of society, the spraying technology of manufacturing industry in China has changed from the manual operation to the 6-DOF (Degree Of Freedom)robot automatic spraying. Spraying painting robot can not only complete the work which does harm to human being, but also improve the production efficiency and save labor costs. Control system is the most critical part of the 6-DOF robots, however, there is still a lack of relevant technology research in China. It is very necessary to study a kind of control system of 6-DOF spraying painting robots which is easy to operation, and has high efficiency and stable performance. With Googol controller platform, this paper develops programs based on Windows CE embedded systems to control the robot to finish the painting work. Software development is the core of the robot control system, including the direct teaching module, playback module, motion control module, setting module, man-machine interface, alarm module, log module, etc. All the development work of the entire software system has been completed, and it has been verified that the entire software works steady and efficient.

  5. Reference trajectory tracking for a multi-DOF robot arm

    Directory of Open Access Journals (Sweden)

    Krasňanský Róbert


    Full Text Available This paper presents the problem of tracking the generated reference trajectory by the simulation model of a multi-DOF robot arm. The kinematic transformation between task space and joint configuration coordinates is nonlinear and configuration dependent. To obtain the solution of the forward kinematics problem, the homogeneous transformation matrix is used. A solution to the inverse kinematics is a vector of joint configuration coordinates calculated using of pseudoinverse Jacobian technique. These coordinates correspond to a set of task space coordinates. The algorithm is presented which uses iterative solution and is simplified by considering stepper motors in robot arm joints. The reference trajectory in Cartesian coordinate system is generated on-line by the signal generator previously developed in MS Excel. Dynamic Data Exchange communication protocol allows sharing data with Matlab-Simulink. These data represent the reference tracking trajectory of the end effector. Matlab-Simulink software is used to calculate the representative joint rotations. The proposed algorithm is demonstrated experimentally on the model of 7-DOF robot arm system.

  6. A novel integrated 4-DOF radial hybrid magnetic bearing for MSCMG

    Energy Technology Data Exchange (ETDEWEB)

    Jinji, Sun; Ziyan, Ju [School of Instrumentation Science & Opto-electronics Engineering, Beijing University of Aeronautics and Astronautics, Science and Technology on Inertial Laboratory, Beijing 100191 (China); Weitao, Han, E-mail: [CRRC Qingdao Sifang CO., LTD, Qingdao 266111 (China); Gang, Liu [School of Instrumentation Science & Opto-electronics Engineering, Beijing University of Aeronautics and Astronautics, Science and Technology on Inertial Laboratory, Beijing 100191 (China)


    This paper proposes a novel integrated radial hybrid magnetic bearing (RHMB) for application with the small-sized magnetically suspended control moment gyroscope (MSCMG), which can control four degrees of freedom (4-DOFs), including two radial translational DOFs and two radial tilting DOFs, and provide the axial passive resilience. The configuration and working principle of the RHMB are introduced. Mathematical models of radial force, axial resilience and moment are established by using equivalent magnetic circuit method (EMCM), from which the radial force–radial displacement, radial force–current relationships are derived, as well as axial resilience–axial displacement, moment–tilting angle and moment–current. Finite element method (FEM) is also applied to analyze the performance and characteristics of the RHMB. The analysis results are in good agreement with that calculated by the EMCM, which is helpful in designing, optimizing and controlling the RHMB. The comparisons between the performances of the integrated 4-DOF RHMB and the traditional 4-DOF RHMB are made. The contrast results indicate that the proposed integrated 4-DOF RHMB possesses better performance compared to the traditional structure, such as copper loss, current stiffness, and tilting current stiffness. - Highlights: • An integrated 4-DOF RHMB is proposed for the small-sized MSCMG. • The 4-DOF RHMB has good linear force–displacement and force–current characteristics. • The RHMB has good linear moment–current and the moment–tilting angle characteristic.

  7. Designing, Fabrication and Controlling Of Multipurpose3-DOF Robotic Arm (United States)

    Nabeel, Hafiz Muhammad; Azher, Anum; Usman Ali, Syed M.; Wahab Mughal, Abdul


    In the present work, we have successfully designed and developed a 3-DOF articulated Robotic Arm capable of performing typical industrial tasks such as painting or spraying, assembling and handling automobiles parts and etc., in resemblance to a human arm. The mechanical assembly is designed on SOLIDWORKS and aluminum grade 6061 -T6 is used for its fabrication in order to reduce the structure weight. We have applied inverse kinematics to determine the joint angles, equations are fed into an efficient microcontroller ATMEGA16 which performs all the calculations to determine the joint angles on the basis of given coordinates to actuate the joints through motorized control. Good accuracy was obtained with quadrature optical encoders installed in each joint to achieve the desired position and a LabVIEW based GUI is designed to provide human machine interface.

  8. Design of a novel 6-DOF planar maglev system

    International Nuclear Information System (INIS)

    Lai, Y.-C.; Yen, J.-Y.


    This paper describes a novel single-deck and six degree-of-freedom (DOF) planar maglev positioning system design. The proposed design uses an array of solenoids to levitate and to hold a permanent magnet carrier in place. The solenoids are excited separately to generate restoring forces when the permanent magnet carrier is displaced from its equilibrium position. The research uses the ANSOFT finite element analysis simulation to analyze the solenoid restoring forces and to motivate a suitable permanent magnets arrangement. Active control on the solenoid currents is then used to maintain the carrier position. The system identification is carried out by perturbing the experimental set-up from its equilibrium position. The simulation results based on the identification models show that simple control is effective for maintaining the carrier position. Initial implementation has also showed that the concept is feasible

  9. A 3-DOF haptic master device for minimally invasive surgery (United States)

    Nguyen, Phuong-Bac; Oh, Jong-Seok; Choi, Seung-Bok


    This paper introduces a novel 3-DOF haptic master device for minimally invasive surgery featuring magneto-rheological (MR) fluid. It consists of three rotational motions. These motions are constituted by two bi-directional MR (BMR) plus one conventional MR brakes. The BMR brake used in the system possesses a salient advantage that its range of braking torque varies from negative to positive values. Therefore, the device is expected to be able sense in a wide environment from very soft tissues to bones. In this paper, overall of the design of the device is presented from idea, modeling, optimal design, manufacturing to control of the device. Moreover, experimental investigation is undertaken to validate the effectiveness of the device.

  10. Designing, Fabrication and Controlling Of Multipurpose3-DOF Robotic Arm

    International Nuclear Information System (INIS)

    Nabeel, Hafiz Muhammad; Azher, Anum; Ali, Syed M Usman; Mughal, Abdul Wahab


    In the present work, we have successfully designed and developed a 3-DOF articulated Robotic Arm capable of performing typical industrial tasks such as painting or spraying, assembling and handling automobiles parts and etc., in resemblance to a human arm. The mechanical assembly is designed on SOLIDWORKS and aluminum grade 6061 -T6 is used for its fabrication in order to reduce the structure weight. We have applied inverse kinematics to determine the joint angles, equations are fed into an efficient microcontroller ATMEGA16 which performs all the calculations to determine the joint angles on the basis of given coordinates to actuate the joints through motorized control. Good accuracy was obtained with quadrature optical encoders installed in each joint to achieve the desired position and a LabVIEW based GUI is designed to provide human machine interface

  11. Quantum wave packet study of D+OF reaction

    International Nuclear Information System (INIS)

    Kurban, M.; Karabulut, E.; Tutuk, R.; Goektas, F.


    The quantum dynamics of the D+OF reaction on the adiabatic potential energy surface of the ground 1 3 A ' state has been studied by using a time-dependent quantum real wave packet method. The state-to-state and state-to-all reaction probabilities for total angular momentum J = 0 have been calculated. The probabilities for J > 0 have been calculated by J-shifting the J = 0 results by means of capture model. Then, the integral cross sections and initial state selected rate constants have been calculated. The initial state-selected reaction probabilities and reaction cross section show threshold but not manifest any resonances and the initial state selected rate constants are sensitive to the temperature.

  12. A 6-DOF vibration isolation system for hydraulic hybrid vehicles (United States)

    Nguyen, The; Elahinia, Mohammad; Olson, Walter W.; Fontaine, Paul


    This paper presents the results of vibration isolation analysis for the pump/motor component of hydraulic hybrid vehicles (HHVs). The HHVs are designed to combine gasoline/diesel engine and hydraulic power in order to improve the fuel efficiency and reduce the pollution. Electric hybrid technology is being applied to passenger cars with small and medium engines to improve the fuel economy. However, for heavy duty vehicles such as large SUVs, trucks, and buses, which require more power, the hydraulic hybridization is a more efficient choice. In function, the hydraulic hybrid subsystem improves the fuel efficiency of the vehicle by recovering some of the energy that is otherwise wasted in friction brakes. Since the operation of the main component of HHVs involves with rotating parts and moving fluid, noise and vibration are an issue that affects both passengers (ride comfort) as well as surrounding people (drive-by noise). This study looks into the possibility of reducing the transmitted noise and vibration from the hydraulic subsystem to the vehicle's chassis by using magnetorheological (MR) fluid mounts. To this end, the hydraulic subsystem is modeled as a six degree of freedom (6-DOF) rigid body. A 6-DOF isolation system, consisting of five mounts connected to the pump/motor at five different locations, is modeled and simulated. The mounts are designed by combining regular elastomer components with MR fluids. In the simulation, the real loading and working conditions of the hydraulic subsystem are considered and the effects of both shock and vibration are analyzed. The transmissibility of the isolation system is monitored in a wide range of frequencies. The geometry of the isolation system is considered in order to sustain the weight of the hydraulic system without affecting the design of the chassis and the effectiveness of the vibration isolating ability. The simulation results shows reduction in the transmitted vibration force for different working cycles of

  13. DOF-binding sites additively contribute to guard cell-specificity of AtMYB60 promoter

    Directory of Open Access Journals (Sweden)

    Cominelli Eleonora


    Full Text Available Abstract Background We previously demonstrated that the Arabidopsis thaliana AtMYB60 protein is an R2R3MYB transcription factor required for stomatal opening. AtMYB60 is specifically expressed in guard cells and down-regulated at the transcriptional levels by the phytohormone ABA. Results To investigate the molecular mechanisms governing AtMYB60 expression, its promoter was dissected through deletion and mutagenesis analyses. By studying different versions of AtMYB60 promoter::GUS reporter fusions in transgenic plants we were able to demonstrate a modular organization for the AtMYB60 promoter. Particularly we defined: a minimal promoter sufficient to confer guard cell-specific activity to the reporter gene; the distinct roles of different DOF-binding sites organised in a cluster in the minimal promoter in determining guard cell-specific expression; the promoter regions responsible for the enhancement of activity in guard cells; a promoter region responsible for the negative transcriptional regulation by ABA. Moreover from the analysis of single and multiple mutants we could rule out the involvement of a group of DOF proteins, known as CDFs, already characterised for their involvement in flowering time, in the regulation of AtMYB60 expression. Conclusions These findings shed light on the regulation of gene expression in guard cells and provide new promoter modules as useful tools for manipulating gene expression in guard cells, both for physiological studies and future biotechnological applications.

  14. Kinematics and Dynamics Analysis of a 3-DOF Upper-Limb Exoskeleton with an Internally Rotated Elbow Joint


    Xin Wang; Qiuzhi Song; Xiaoguang Wang; Pengzhan Liu


    The contradiction between self-weight and load capacity of a power-assisted upper-limb exoskeleton for material hanging is unresolved. In this paper, a non-anthropomorphic 3-degree of freedom (DOF) upper-limb exoskeleton with an internally rotated elbow joint is proposed based on an anthropomorphic 5-DOF upper-limb exoskeleton for power-assisted activity. The proposed 3-DOF upper-limb exoskeleton contains a 2-DOF shoulder joint and a 1-DOF internally rotated elbow joint. The structural parame...

  15. Application of 2DOF controller for reactor power control. Verification by numerical simulation

    International Nuclear Information System (INIS)

    Ishikawa, Nobuyuki; Suzuki, Katsuo


    In this report the usefulness of the two degree of freedom (2DOF) control is discussed to improve the reference response characteristics and robustness for reactor power control system. The 2DOF controller consists of feedforward and feedback elements. The feedforward element was designed by model matching method and the feedback element by solving the mixed sensitivity problem of H ∞ control. The 2DOF control gives good performance in both reference response and robustness to disturbance and plant perturbation. The simulation of reactor power control was performed by digitizing the 2DOF controller with the digital control periods of 10[msec]. It is found that the control period of 10[msec] is enough not to make degradation of the control performance by digitizing. (author)

  16. Design and characterization of an ocean wave powered lifejacket using 2DOF floating boards (United States)

    Mi, Jia; Xu, Lin; Yang, Yaling; Zuo, Lei


    Lifejacket is an indispensable life-saving equipment for ships and airplanes. Traditional lifejacket is designed to prevent human from drowning. However, the water temperature is usually low, especially in winter, which significantly reduces the human body temperature and leads to death. Meanwhile, power is critical for drowning people to use emergency communication equipment. This paper proposed an ocean wave powered lifejacket using 2DOF floating boards to provide both buoyance and electricity for drowning people. Hence, they can use this continuous electric power to keep key body warm and send distress signal. This lifejacket is featured with two 2DOF floating boards and the mechanical motion rectifier (MMR) can convert the 2-DOF motions to the unidirectional rotation of generator. The design principle is illustrated and the dynamic modelling for the 2-DOF motions has been analyzed. Bench test and lake test have been conducted to validate the design concept.

  17. Design and implementation of a 2-DOF PID compensation for magnetic levitation systems. (United States)

    Ghosh, Arun; Rakesh Krishnan, T; Tejaswy, Pailla; Mandal, Abhisek; Pradhan, Jatin K; Ranasingh, Subhakant


    This paper employs a 2-DOF (degree of freedom) PID controller for compensating a physical magnetic levitation system. It is shown that because of having a feedforward gain in the proposed 2-DOF PID control, the transient performance of the compensated system can be changed in a desired manner unlike the conventional 1-DOF PID control. It is also shown that for a choice of PID parameters, although the theoretical loop robustness is the same for both the compensated systems, in real-time, 2-DOF PID control may provide superior robustness if a suitable choice of the feedforward parameter is made. The results are verified through simulations and experiments. Copyright © 2014 ISA. Published by Elsevier Ltd. All rights reserved.

  18. Design and Calibration of a New 6 DOF Haptic Device

    Directory of Open Access Journals (Sweden)

    Huanhuan Qin


    Full Text Available For many applications such as tele-operational robots and interactions with virtual environments, it is better to have performance with force feedback than without. Haptic devices are force reflecting interfaces. They can also track human hand positions simultaneously. A new 6 DOF (degree-of-freedom haptic device was designed and calibrated in this study. It mainly contains a double parallel linkage, a rhombus linkage, a rotating mechanical structure and a grasping interface. Benefited from the unique design, it is a hybrid structure device with a large workspace and high output capability. Therefore, it is capable of multi-finger interactions. Moreover, with an adjustable base, operators can change different postures without interrupting haptic tasks. To investigate the performance regarding position tracking accuracy and static output forces, we conducted experiments on a three-dimensional electric sliding platform and a digital force gauge, respectively. Displacement errors and force errors are calculated and analyzed. To identify the capability and potential of the device, four application examples were programmed.

  19. Design and Calibration of a New 6 DOF Haptic Device (United States)

    Qin, Huanhuan; Song, Aiguo; Liu, Yuqing; Jiang, Guohua; Zhou, Bohe


    For many applications such as tele-operational robots and interactions with virtual environments, it is better to have performance with force feedback than without. Haptic devices are force reflecting interfaces. They can also track human hand positions simultaneously. A new 6 DOF (degree-of-freedom) haptic device was designed and calibrated in this study. It mainly contains a double parallel linkage, a rhombus linkage, a rotating mechanical structure and a grasping interface. Benefited from the unique design, it is a hybrid structure device with a large workspace and high output capability. Therefore, it is capable of multi-finger interactions. Moreover, with an adjustable base, operators can change different postures without interrupting haptic tasks. To investigate the performance regarding position tracking accuracy and static output forces, we conducted experiments on a three-dimensional electric sliding platform and a digital force gauge, respectively. Displacement errors and force errors are calculated and analyzed. To identify the capability and potential of the device, four application examples were programmed. PMID:26690449

  20. Design of a planar 3-DOF parallel micromanipulator

    International Nuclear Information System (INIS)

    Lee, Jeong Jae; Dong, Yanlu; Jeon, Yong Ho; Lee, Moon Gu


    A planar three degree-of-freedom (DOF) parallel manipulator is proposed to be applied for alignment during assembly of microcomponents. It adopts a PRR (prismatic-revolute-revolute) mechanism to meet the requirements of high precision for assembly and robustness against disturbance. The mechanism was designed to have a large workspace and good dexterity because parallel mechanisms usually have a narrow range and singularity of motion compared to serial mechanisms. Inverse kinematics and a simple closed-loop algorithm of the parallel manipulator are presented to control it. Experimental tests have been carried out with high-resolution capacitance sensors to verify the performance of the mechanism. The results of experiments show that the manipulator has a large workspace of ±1.0 mm, ±1.0 mm, and ±10 mrad in the X-, Y-, and θ-directions, respectively. This is a large workspace when considering it adopts a parallel mechanism and has a small size, 100 ´ 100 ´ 100 mm3 . It also has a good precision of 2 μm, 3 μm, and 0.2 mrad, in the X-, Y-, and θ- axes, respectively. These are high resolutions considering the manipulator adopts conventional joints. The manipulator is expected to have good dexterity.

  1. A Contrast on Conductor Galloping Amplitude Calculated by Three Mathematical Models with Different DOFs

    Directory of Open Access Journals (Sweden)

    Bin Liu


    Full Text Available It is pivotal to find an effective mathematical model revealing the galloping mechanism. And it is important to compare the difference between the existing mathematical models on the conductor galloping. In this paper, the continuum cable model for transmission lines was proposed using the Hamilton principle. Discrete models of one DOF, two DOFs, and three DOFs were derived from the continuum model by using the Garlekin method. And the three models were compared by analyzing the galloping vertical amplitude and torsional angle with different influence factors. The influence factors include wind velocity, flow density, span length, damping ratio, and initial tension. The three-DOF model is more accurate at calculating the galloping characteristics than the other two models, but the one-DOF and two-DOF models can also present the trend of galloping amplitude change from the point view of qualitative analysis. And the change of the galloping amplitude relative to the main factors was also obtained, which is very essential to the antigalloping design applied in the actual engineering.

  2. TH-EF-BRB-08: Robotic Motion Compensation for Radiation Therapy: A 6DOF Phantom Study

    Energy Technology Data Exchange (ETDEWEB)

    Belcher, AH; Liu, X; Wiersma, R [The University of Chicago, Chicago, IL (United States)


    Purpose: The high accuracy of frame-based stereotactic radiosurgery (SRS), which uses a rigid frame fixed to the patient’s skull, is offset by potential drawbacks of poor patient compliance and clinical workflow restrictions. Recent research into frameless SRS has so far resulted in reduced accuracy. In this study, we investigate the use of a novel 6 degree-of-freedom (6DOF) robotic head motion cancellation system that continuously detects and compensates for patient head motions during a SRS delivery. This approach has the potential to reduce invasiveness while still achieving accuracies better or equal to traditional frame-based SRS. Methods: A 6DOF parallel kinematics robotics stage was constructed, and controlled using an inverse kinematics-based motion compensation algorithm. A 6DOF stereoscopic infrared (IR) marker tracking system was used to monitor real-time motions at sub-millimeter and sub-degree levels. A novel 6DOF calibration technique was first applied to properly orient the camera coordinate frame to match that of the LINAC and robotic control frames. Simulated head motions were measured by the system, and the robotic stage responded to these 6DOF motions automatically, returning the reflective marker coordinate frame to its original position. Results: After the motions were introduced to the system in the phantom-based study, the robotic stage automatically and rapidly returned the phantom to LINAC isocenter. When errors exceeded the compensation lower threshold of 0.25 mm or 0.25 degrees, the system registered the 6DOF error and generated a cancellation trajectory. The system responded in less than 0.5 seconds and returned all axes to less than 0.1 mm and 0.1 degree after the 6DOF compensation was performed. Conclusion: The 6DOF real-time motion cancellation system was found to be effective at compensating for translational and rotational motions to current SRS requirements. This system can improve frameless SRS by automatically returning

  3. TH-EF-BRB-08: Robotic Motion Compensation for Radiation Therapy: A 6DOF Phantom Study

    International Nuclear Information System (INIS)

    Belcher, AH; Liu, X; Wiersma, R


    Purpose: The high accuracy of frame-based stereotactic radiosurgery (SRS), which uses a rigid frame fixed to the patient’s skull, is offset by potential drawbacks of poor patient compliance and clinical workflow restrictions. Recent research into frameless SRS has so far resulted in reduced accuracy. In this study, we investigate the use of a novel 6 degree-of-freedom (6DOF) robotic head motion cancellation system that continuously detects and compensates for patient head motions during a SRS delivery. This approach has the potential to reduce invasiveness while still achieving accuracies better or equal to traditional frame-based SRS. Methods: A 6DOF parallel kinematics robotics stage was constructed, and controlled using an inverse kinematics-based motion compensation algorithm. A 6DOF stereoscopic infrared (IR) marker tracking system was used to monitor real-time motions at sub-millimeter and sub-degree levels. A novel 6DOF calibration technique was first applied to properly orient the camera coordinate frame to match that of the LINAC and robotic control frames. Simulated head motions were measured by the system, and the robotic stage responded to these 6DOF motions automatically, returning the reflective marker coordinate frame to its original position. Results: After the motions were introduced to the system in the phantom-based study, the robotic stage automatically and rapidly returned the phantom to LINAC isocenter. When errors exceeded the compensation lower threshold of 0.25 mm or 0.25 degrees, the system registered the 6DOF error and generated a cancellation trajectory. The system responded in less than 0.5 seconds and returned all axes to less than 0.1 mm and 0.1 degree after the 6DOF compensation was performed. Conclusion: The 6DOF real-time motion cancellation system was found to be effective at compensating for translational and rotational motions to current SRS requirements. This system can improve frameless SRS by automatically returning

  4. Research of a New 6-Dof Force Feedback Hand Controller System

    Directory of Open Access Journals (Sweden)

    Xin Gao


    Full Text Available The field of teleoperation with force telepresence has expanded its scope to include manipulation at different scales and in virtual worlds, and the key component of which is force feedback hand controller. This paper presents a novel force feedback hand controller system, including a 3-dof translational and 3-dof rotational hand controllers, respectively, to implement position and posture teleoperation of the robot end effector. The 3-dof translational hand controller adopts innovative three-axes decoupling structure based on the linear motor; the 3-dof rotational hand controller adopts serial mechanism based on three-axes intersecting at one point, improving its overall stiffness. Based on the kinematics, statics, and dynamics analyses for two platforms separately, the system applies big closed-loop force control method based on the zero force/torque, improving the feedback force/torque accuracy effectively. Experimental results show that self-developed 6-dof force feedback hand controller has good mechanical properties. The translational hand controller has the following advantages: simple kinematics solver, fast dynamic response, and better than 0.05 mm accuracy of three-axis end positioning, while the advantages of the rotational hand controller are wide turning space, larger than 1 Nm feedback, greater than 180 degrees of operating space of three axes, respectively, and high operation precision.

  5. On non-linear dynamics of coupled 1+1DOF versus 1+1/2DOF Electro-Mechanical System

    DEFF Research Database (Denmark)

    Darula, Radoslav; Sorokin, Sergey


    The electro-mechanical systems (EMS) are used from nano-/micro-scale (NEMS/MEMS) up to macro-scale applications. From mathematical view point, they are modelled with the second order differential equation (or a set of equations) for mechanical system, which is nonlinearly coupled with the second...... or the first order differential equation (or a set of equations) for electrical system, depending on properties of the electrical circuit. For the sake of brevity, we assume a 1DOF mechanical system, coupled to 1 or 1/2DOF electrical system (depending whether the capacitance is, or is not considered......). In the paper, authors perform a parametric study to identify operation regimes, where the capacitance term contributes to the non-linear behaviour of the coupled system. To accomplish this task, the classical method of multiple scales is used. The parametric study allows us to assess for which applications...

  6. Structural Design of a 6-DoF Hip Exoskeleton using Linear Series Elastic Actuators


    Li, Xiao


    A novel hip exoskeleton with six degrees of freedom (DoF) was developed, and multiple prototypes of this product were created in this thesis. The device was an upper level of the 12-DoF lower-body exoskeleton project, which was known as the Orthotic Lower-body Locomotion Exoskeleton (OLL-E). The hip exoskeleton had three motions per leg, which were roll, yaw, and pitch. Currently, the sufferers of hemiplegia and paraplegia can be addressed by using a wheelchair or operating an exoskeleton wi...

  7. Proposed Robot Scheme with 5 DoF and Dynamic Modelling Using Maple Software

    Directory of Open Access Journals (Sweden)

    Shala Ahmet


    Full Text Available In this paper is represented Dynamical Modelling of robots which is commonly first important step of Modelling, Analysis and Control of robotic systems. This paper is focused on using Denavit-Hartenberg (DH convention for kinematics and Newton-Euler Formulations for dynamic modelling of 5 DoF - Degree of Freedom of 3D robot. The process of deriving of dynamical model is done using Software Maple. Derived Dynamical Model of 5 DoF robot is converted for Matlab use for future analysis, control and simulations.

  8. Stair Climbing Control for 4-DOF Tracked Vehicle Based on Internal Sensors

    Directory of Open Access Journals (Sweden)

    Daisuke Endo


    Full Text Available In search-and-rescue missions, multi-degrees-of-freedom (DOF tracked robots that are equipped with subtracks are commonly used. These types of robots have superior locomotion performance on rough terrain. However, in teleoperated missions, the performance of tracked robots depends largely on the operators’ ability to control every subtrack appropriately. Therefore, an autonomous traversal function can significantly help in the teleoperation of such robots. In this paper, we propose a planning and control method for 4-DOF tracked robots climbing up/down known stairs automatically based on internal sensors. Experimental results obtained using mockup stairs verify the effectiveness of the proposed method.

  9. Kinematic Analysis of 3-DOF Planer Robot Using Artificial Neural Network

    Directory of Open Access Journals (Sweden)

    Jolly Atit Shah


    Full Text Available Automatic control of the robotic manipulator involves study of kinematics and dynamics as a major issue. This paper involves the forward and inverse kinematics of 3-DOF robotic manipulator with revolute joints. In this study the Denavit- Hartenberg (D-H model is used to model robot links and joints. Also forward and inverse kinematics solution has been achieved using Artificial Neural Networks for 3-DOF robotic manipulator. It shows that by using artificial neural network the solution we get is faster, acceptable and has zero error.

  10. Kinematics and Dynamics Analysis of a 3-DOF Upper-Limb Exoskeleton with an Internally Rotated Elbow Joint

    Directory of Open Access Journals (Sweden)

    Xin Wang


    Full Text Available The contradiction between self-weight and load capacity of a power-assisted upper-limb exoskeleton for material hanging is unresolved. In this paper, a non-anthropomorphic 3-degree of freedom (DOF upper-limb exoskeleton with an internally rotated elbow joint is proposed based on an anthropomorphic 5-DOF upper-limb exoskeleton for power-assisted activity. The proposed 3-DOF upper-limb exoskeleton contains a 2-DOF shoulder joint and a 1-DOF internally rotated elbow joint. The structural parameters of the 3-DOF upper-limb exoskeleton were determined, and the differences and singularities of the two exoskeletons were analyzed. The workspace, the joint torques and the power consumption of two exoskeletons were analyzed by kinematics and dynamics, and an exoskeleton prototype experiment was performed. The results showed that, compared with a typical anthropomorphic upper-limb exoskeleton, the non-anthropomorphic 3-DOF upper-limb exoskeleton had the same actual workspace; eliminated singularities within the workspace; improved the elbow joint force situation; and the maximum elbow joint torque, elbow external-flexion/internal-extension and shoulder flexion/extension power consumption were significantly reduced. The proposed non-anthropomorphic 3-DOF upper-limb exoskeleton can be applied to a power-assisted upper-limb exoskeleton in industrial settings.

  11. Scale-up for model verification; design, modeling and control of an elastic parallel kinematic 6-DOFs manipulator

    NARCIS (Netherlands)

    Huijts, Martijn; Brouwer, Dannis Michel; van Dijk, Johannes


    Manipulators with guidance constructions based on elastic mechanisms are of interest for the increasing number of precision vacuum applications. Previously, the design of an elastic MEMS-based 6-DOFs manipulator was presented. Characterization in six degrees of freedom (DOFs) of a manipulator the

  12. A statically balanced and bi-stable compliant end effector combined with a laparoscopic 2DoF robotic arm

    NARCIS (Netherlands)

    Lassooij, J.; Tolou, N.; Tortora, G.; Caccavaro, S.; Menciassi, A.; Herder, J.L.


    This article presents the design of a newly developed 2DoF robotic arm with a novel statically balanced and bi-stable compliant grasper as the end effector for laparoscopic surgery application. The arm is based on internal motors actuating 2 rotational DoFs: pitch and roll. The positive stiffness of

  13. Composite Material Testing Data Reduction to Adjust for the Systematic 6-DOF Testing Machine Aberrations (United States)

    Athanasios lliopoulos; John G. Michopoulos; John G. C. Hermanson


    This paper describes a data reduction methodology for eliminating the systematic aberrations introduced by the unwanted behavior of a multiaxial testing machine, into the massive amounts of experimental data collected from testing of composite material coupons. The machine in reference is a custom made 6-DoF system called NRL66.3 and developed at the NAval...

  14. MEMS 3-DoF gyroscope design, modeling and simulation through equivalent circuit lumped parameter model

    International Nuclear Information System (INIS)

    Mian, Muhammad Umer; Khir, M. H. Md.; Tang, T. B.; Dennis, John Ojur; Riaz, Kashif; Iqbal, Abid; Bazaz, Shafaat A.


    Pre-fabrication, behavioural and performance analysis with computer aided design (CAD) tools is a common and fabrication cost effective practice. In light of this we present a simulation methodology for a dual-mass oscillator based 3 Degree of Freedom (3-DoF) MEMS gyroscope. 3-DoF Gyroscope is modeled through lumped parameter models using equivalent circuit elements. These equivalent circuits consist of elementary components which are counterpart of their respective mechanical components, used to design and fabricate 3-DoF MEMS gyroscope. Complete designing of equivalent circuit model, mathematical modeling and simulation are being presented in this paper. Behaviors of the equivalent lumped models derived for the proposed device design are simulated in MEMSPRO T-SPICE software. Simulations are carried out with the design specifications following design rules of the MetalMUMPS fabrication process. Drive mass resonant frequencies simulated by this technique are 1.59 kHz and 2.05 kHz respectively, which are close to the resonant frequencies found by the analytical formulation of the gyroscope. The lumped equivalent circuit modeling technique proved to be a time efficient modeling technique for the analysis of complex MEMS devices like 3-DoF gyroscopes. The technique proves to be an alternative approach to the complex and time consuming couple field analysis Finite Element Analysis (FEA) previously used

  15. MEMS 3-DoF gyroscope design, modeling and simulation through equivalent circuit lumped parameter model

    Energy Technology Data Exchange (ETDEWEB)

    Mian, Muhammad Umer, E-mail:; Khir, M. H. Md.; Tang, T. B. [Department of Electrical and Electronic Engineering, Universiti Teknologi PETRONAS, Tronoh, Perak (Malaysia); Dennis, John Ojur [Department of Fundamental & Applied Sciences, Universiti Teknologi PETRONAS, Tronoh, Perak (Malaysia); Riaz, Kashif; Iqbal, Abid [Faculty of Electronics Engineering, GIK Institute of Engineering Sciences and Technology, Topi, Khyber Pakhtunkhaw (Pakistan); Bazaz, Shafaat A. [Department of Computer Science, Center for Advance Studies in Engineering, Islamabad (Pakistan)


    Pre-fabrication, behavioural and performance analysis with computer aided design (CAD) tools is a common and fabrication cost effective practice. In light of this we present a simulation methodology for a dual-mass oscillator based 3 Degree of Freedom (3-DoF) MEMS gyroscope. 3-DoF Gyroscope is modeled through lumped parameter models using equivalent circuit elements. These equivalent circuits consist of elementary components which are counterpart of their respective mechanical components, used to design and fabricate 3-DoF MEMS gyroscope. Complete designing of equivalent circuit model, mathematical modeling and simulation are being presented in this paper. Behaviors of the equivalent lumped models derived for the proposed device design are simulated in MEMSPRO T-SPICE software. Simulations are carried out with the design specifications following design rules of the MetalMUMPS fabrication process. Drive mass resonant frequencies simulated by this technique are 1.59 kHz and 2.05 kHz respectively, which are close to the resonant frequencies found by the analytical formulation of the gyroscope. The lumped equivalent circuit modeling technique proved to be a time efficient modeling technique for the analysis of complex MEMS devices like 3-DoF gyroscopes. The technique proves to be an alternative approach to the complex and time consuming couple field analysis Finite Element Analysis (FEA) previously used.

  16. Modeling the 3-DOF dynamics of an electrodynamic Maglev suspension system with a passive sled

    NARCIS (Netherlands)

    Boeij, de J.; Gutierrez, H.M.; Agarwal, R.; Steinbuch, M.


    A model that describes the 3-DOF dynamics of a passively levitated electro-dynamic maglevsystem is presented. The model is based on the flux-current-force interactions and the geometricrelationships between the levitation coils and the permanent magnets on the sled. The model ispresented in a


    DEFF Research Database (Denmark)

    Gjelstrup, Henrik; Larsen, Allan; Georgakis, Christos


    but can generally be applied for aerodynamic instability prediction for prismatic bluff bodies. The 3DOF, which make up the movement of the model, are the displacements in the XY-plane and the rotation around the bluff body’s rotational axis. The proposed model incorporates inertia coupling between...

  18. Experimental Investigation on the Positioning Accuracy of the Translation Module of a 6-DOF Industrial Robot

    Directory of Open Access Journals (Sweden)

    Zoltan-Iosif Korka


    Full Text Available The paper presents an experimental investigation regarding the positioning accuracy and kinematical parameters of the base translation module of a 6-DOF industrial robot. The positioning error of the translation module was computed for two cases: one way movement and reversed movement.

  19. Position calibration of a 3-DOF hand-controller with hybrid structure (United States)

    Zhu, Chengcheng; Song, Aiguo


    A hand-controller is a human-robot interactive device, which measures the 3-DOF (Degree of Freedom) position of the human hand and sends it as a command to control robot movement. The device also receives 3-DOF force feedback from the robot and applies it to the human hand. Thus, the precision of 3-DOF position measurements is a key performance factor for hand-controllers. However, when using a hybrid type 3-DOF hand controller, various errors occur and are considered originating from machining and assembly variations within the device. This paper presents a calibration method to improve the position tracking accuracy of hybrid type hand-controllers by determining the actual size of the hand-controller parts. By re-measuring and re-calibrating this kind of hand-controller, the actual size of the key parts that cause errors is determined. Modifying the formula parameters with the actual sizes, which are obtained in the calibrating process, improves the end position tracking accuracy of the device.

  20. Type synthesis for 4-DOF parallel press mechanism using GF set theory (United States)

    He, Jun; Gao, Feng; Meng, Xiangdun; Guo, Weizhong


    Parallel mechanisms is used in the large capacity servo press to avoid the over-constraint of the traditional redundant actuation. Currently, the researches mainly focus on the performance analysis for some specific parallel press mechanisms. However, the type synthesis and evaluation of parallel press mechanisms is seldom studied, especially for the four degrees of freedom(DOF) press mechanisms. The type synthesis of 4-DOF parallel press mechanisms is carried out based on the generalized function(GF) set theory. Five design criteria of 4-DOF parallel press mechanisms are firstly proposed. The general procedure of type synthesis of parallel press mechanisms is obtained, which includes number synthesis, symmetrical synthesis of constraint GF sets, decomposition of motion GF sets and design of limbs. Nine combinations of constraint GF sets of 4-DOF parallel press mechanisms, ten combinations of GF sets of active limbs, and eleven combinations of GF sets of passive limbs are synthesized. Thirty-eight kinds of press mechanisms are presented and then different structures of kinematic limbs are designed. Finally, the geometrical constraint complexity( GCC), kinematic pair complexity( KPC), and type complexity( TC) are proposed to evaluate the press types and the optimal press type is achieved. The general methodologies of type synthesis and evaluation for parallel press mechanism are suggested.

  1. A Novel Integral 5-DOFs Hybrid Magnetic Bearing with One Permanent Magnet Ring Used for Turboexpander

    Directory of Open Access Journals (Sweden)

    Bangcheng Han


    Full Text Available We propose a novel combined five-degrees-of-freedom (5-DOFs hybrid magnetic bearing (HMB with only one permanent magnet ring (PMR used for turboexpanders. It has two radial magnetic bearing (RMB units; each has four poles and one thrust magnetic bearing (TMB to control 5-DOFs. Based on one PMR, the bias flux of the two radial magnetic bearing units and the one thrust magnetic bearing unit is constructed. As a result, ultra-high-speed, lower power loss, small size, and low cost can be achieved. Furthermore, the equivalent magnetic circuit method and 3D finite element method (FEM are used to model and analyze the combined 5-DOFs HMB. The force-current, force-position, torque-coil currents, the torque-angle position, and the stiffness models of the combined 5-DOFs HMB are given. Moreover, its coupling problems between the RMB units and the AMB unit are also proposed in this paper. An example is given to clarify the mathematical models and the coupling problems, and the linearized models are proposed for the follow-up controller design.

  2. Adaptive PSO for optimal LQR tracking control of 2 DoF laboratory helicopter

    NARCIS (Netherlands)

    Vinodh Kumar, E.; Ganapathy Subramanian, R.; Jerome, J.


    This paper deals with the attitude tracking control problem for a 2 DoF laboratory helicopter using optimal linear quadratic regulator (LQR). As the performance of the LQR controller greatly depends on the weighting matrices (Q and R), it is important to select them optimally. However, normally the

  3. Rocking motion of structures under earthquakes. Overturning of 2-DOF system

    International Nuclear Information System (INIS)

    Kobayashi, Koichi; Watanabe, Tetsuya; Tanaka, Kihachiro; Tomoda, Akinori


    In recent years, huge earthquakes happen, for example, The South Hyogo prefecture Earthquake in 1995, The Mid Niigata Prefecture Earthquake in 2004, The Iwate-Miyagi Nairiku Earthquake in 2008. In The Niigataken Chuetsu-oki Earthquake in 2007, hundreds of drums fell down and water spilled out. A lot of studies about rocking behavior of rigid body had been performed from 1960's. However, these studies were only for a specific condition of the structure size or input vibration characteristics. Therefore, generalizes fall condition for earthquake is required. This paper deals with the analytical and the experimental study of the rocking vibration of 1-DOF rocking system, 2-DOF vibration-rocking system and 2-DOF rocking system under earthquakes. In this study, the equation of motion for each rocking systems are developed. The numerical model of 2-DOF rocking system is evaluated by free rocking experiment. In this paper, 'Overturning Map' which can distinguish whether structures falls or not is proposed. The overturning map of each rocking systems excited by the artificial earthquake wave calculated from the design spectrum is shown. As the result, overturning condition of structures is clarified. (author)

  4. Integrated 6-DOF Orbit-Attitude Dynamical Modeling and Control Using Geometric Mechanics

    Directory of Open Access Journals (Sweden)

    Ling Jiang


    Full Text Available The integrated 6-DOF orbit-attitude dynamical modeling and control have shown great importance in various missions, for example, formation flying and proximity operations. The integrated approach yields better performances than the separate one in terms of accuracy, efficiency, and agility. One challenge in the integrated approach is to find a unified representation for the 6-DOF motion with configuration space SE(3. Recently, exponential coordinates of SE(3 have been used in dynamics and control of the 6-DOF motion, however, only on the kinematical level. In this paper, we will improve the current method by adopting exponential coordinates on the dynamical level, by giving the relation between the second-order derivative of exponential coordinates and spacecraft’s accelerations. In this way, the 6-DOF motion in terms of exponential coordinates can be written as a second-order system with a quite compact form, to which a broader range of control theories, such as higher-order sliding modes, can be applied. For a demonstration purpose, a simple asymptotic tracking control law with almost global convergence is designed. Finally, the integrated modeling and control are applied to the body-fixed hovering over an asteroid and verified by a simulation, in which absolute motions of the spacecraft and asteroid are simulated separately.

  5. Modeling and controller design of a 6-DOF precision positioning system (United States)

    Cai, Kunhai; Tian, Yanling; Liu, Xianping; Fatikow, Sergej; Wang, Fujun; Cui, Liangyu; Zhang, Dawei; Shirinzadeh, Bijan


    A key hurdle to meet the needs of micro/nano manipulation in some complex cases is the inadequate workspace and flexibility of the operation ends. This paper presents a 6-degree of freedom (DOF) serial-parallel precision positioning system, which consists of two compact type 3-DOF parallel mechanisms. Each parallel mechanism is driven by three piezoelectric actuators (PEAs), guided by three symmetric T-shape hinges and three elliptical flexible hinges, respectively. It can extend workspace and improve flexibility of the operation ends. The proposed system can be assembled easily, which will greatly reduce the assembly errors and improve the positioning accuracy. In addition, the kinematic and dynamic model of the 6-DOF system are established, respectively. Furthermore, in order to reduce the tracking error and improve the positioning accuracy, the Discrete-time Model Predictive Controller (DMPC) is applied as an effective control method. Meanwhile, the effectiveness of the DMCP control method is verified. Finally, the tracking experiment is performed to verify the tracking performances of the 6-DOF stage.

  6. TH-AB-202-11: Spatial and Rotational Quality Assurance of 6DOF Patient Tracking Systems

    Energy Technology Data Exchange (ETDEWEB)

    Belcher, AH; Liu, X; Grelewicz, Z; Wiersma, R [The University of Chicago, Chicago, IL (United States)


    Purpose: External tracking systems used for patient positioning and motion monitoring during radiotherapy are now capable of detecting both translations and rotations (6DOF). In this work, we develop a novel technique to evaluate the 6DOF performance of external motion tracking systems. We apply this methodology to an infrared (IR) marker tracking system and two 3D optical surface mapping systems in a common tumor 6DOF workspace. Methods: An in-house designed and built 6DOF parallel kinematics robotic motion phantom was used to follow input trajectories with sub-millimeter and sub-degree accuracy. The 6DOF positions of the robotic system were then tracked and recorded independently by three optical camera systems. A calibration methodology which associates the motion phantom and camera coordinate frames was first employed, followed by a comprehensive 6DOF trajectory evaluation, which spanned a full range of positions and orientations in a 20×20×16 mm and 5×5×5 degree workspace. The intended input motions were compared to the calibrated 6DOF measured points. Results: The technique found the accuracy of the IR marker tracking system to have maximal root mean square error (RMSE) values of 0.25 mm translationally and 0.09 degrees rotationally, in any one axis, comparing intended 6DOF positions to positions measured by the IR camera. The 6DOF RSME discrepancy for the first 3D optical surface tracking unit yielded maximal values of 0.60 mm and 0.11 degrees over the same 6DOF volume. An earlier generation 3D optical surface tracker was observed to have worse tracking capabilities than both the IR camera unit and the newer 3D surface tracking system with maximal RMSE of 0.74 mm and 0.28 degrees within the same 6DOF evaluation space. Conclusion: The proposed technique was effective at evaluating the performance of 6DOF patient tracking systems. All systems examined exhibited tracking capabilities at the sub-millimeter and sub-degree level within a 6DOF workspace.

  7. Adaptive tuning of a 2DOF controller for robust cell manipulation using IPMC actuators

    International Nuclear Information System (INIS)

    McDaid, A J; Aw, K C; Haemmerle, E; Xie, S Q; Shahinpoor, M


    Rapid advancement in medicine and bioscience is causing demand for faster, more accurate and dexterous as well as safer and more reliable micro-manipulators capable of handling biological cells. Current micro-manipulation techniques commonly damage cell walls and membranes due to their stiffness and rigidity. Ionic polymer-metal composite (IPMC) actuators have inherent compliance and with their ability to operate well in fluid and cellular environments they present a unique solution for safe cell manipulation. The reason for the downfall of IPMCs is that their complex behaviour makes them hard to control precisely in unknown environments and in the presence of sizeable external disturbances. This paper presents a novel scheme for adaptively tuning IPMC actuators for precise and robust micro-manipulation of biological cells. A two-degree-of-freedom (2DOF) controller is developed to allow optimal performance for both disturbance rejection (DR) and set point (SP) tracking. These criteria are optimized using a proposed IFT algorithm which adaptively updates the controller parameters, with no model or prior knowledge of the operating conditions, to achieve a compliant manipulation system which can precisely track targets in the presence of large external disturbances, as will be encountered in real biological environments. Experiments are presented showing the performance optimization of an IPMC actuator in the presence of external mechanical disturbances as well as the optimization of the SP tracking. The IFT algorithm successfully tunes the DR and SP to an 85% and 69% improvement, respectively. Results are also presented for a one-degree-of-freedom (1DOF) controller tuned first for DR and then for SP, for a comparison with the 2DOF controller. Validation has been undertaken to verify that the 2DOF controller does indeed outperform both 1DOF controllers over a variety of operating conditions.

  8. Development of an Underactuated 2-DOF Wrist Joint using McKibben PAMs (United States)

    Rajagopal, S. P.; Jain, S.; Ramasubramanian, S. N.; Johnson, B. V.; Dwivedy, S. K.


    In this work, model of an underactuated 2-DOF wrist joint with pneumatically actuated muscles is proposed. For the joint, McKibben-type artificial muscles are used in parallel configuration for the actuation. For each Degree of Freedom (DOF) one agonist-antagonist pair arrangement is usually used with a pulley mechanism. A mathematical model of wrist joint is derived using conventional forward kinematic analysis. The static model relating pressure in the muscle with the orientation of the wrist joint is obtained by combining the experimental data and mathematical model. Regulation of pressure can be achieved by pulse width modulation control of on/off solenoid valves. A set of free vibration experiments are done for the dynamic identification of the muscle characteristics.

  9. Structural Synthesis of 3-DoF Spatial Fully Parallel Manipulators

    Directory of Open Access Journals (Sweden)

    Alfonso Hernandez


    Full Text Available In this paper, the architectures of three degrees of freedom (3-DoF spatial, fully parallel manipulators (PMs, whose limbs are structurally identical, are obtained systematically. To do this, the methodology followed makes use of the concepts of the displacement group theory of rigid body motion. This theory works with so-called ‘motion generators’. That is, every limb is a kinematic chain that produces a certain type of displacement in the mobile platform or end-effector. The laws of group algebra will determine the actual motion pattern of the end-effector. The structural synthesis is a combinatorial process of different kinematic chains’ topologies employed in order to get all of the 3-DoF motion pattern possibilities in the end-effector of the fully parallel manipulator.

  10. Operation analysis of a Chebyshev-Pantograph leg mechanism for a single DOF biped robot (United States)

    Liang, Conghui; Ceccarelli, Marco; Takeda, Yukio


    In this paper, operation analysis of a Chebyshev-Pantograph leg mechanism is presented for a single degree of freedom (DOF) biped robot. The proposed leg mechanism is composed of a Chebyshev four-bar linkage and a pantograph mechanism. In contrast to general fully actuated anthropomorphic leg mechanisms, the proposed leg mechanism has peculiar features like compactness, low-cost, and easy-operation. Kinematic equations of the proposed leg mechanism are formulated for a computer oriented simulation. Simulation results show the operation performance of the proposed leg mechanism with suitable characteristics. A parametric study has been carried out to evaluate the operation performance as function of design parameters. A prototype of a single DOF biped robot equipped with two proposed leg mechanisms has been built at LARM (Laboratory of Robotics and Mechatronics). Experimental test shows practical feasible walking ability of the prototype, as well as drawbacks are discussed for the mechanical design.

  11. On Virtual Integrated Model of a 6DoF Manipulator Arm for Emergency Cases Interventions

    Directory of Open Access Journals (Sweden)

    Gigi Naidin


    Full Text Available This research deals with a virtual integrated model for a 6DoF manipulator arm dedicated to use for emergency situations intervention. The virtual model can simulates both the entire structural and mechanical configuration of the manipulator, and the driving system with automated command unit. The basic idea supposes to develop a complex simulator for kinematical and dynamic behavior analysis of 6DoF robot manipulator, and for facilely cross correlation and comparative evaluation between essential parameters and extremely bearing cases defining the manipulator working state. The analysis was developed in Matlab© - SimScape© software. The conclusions dignify the main functional capability of the manipulator supposing the capacity of driving system and mechanical structure.

  12. Sliding mode control of a "Soft" 2-DOF Planar Pneumatic Manipulator (United States)

    Van Damme, M.; Vanderborght, B.; Beyl, P.; Versluys, R.; Vanderniepen, I.; Van Ham, R.; Cherelle, P.; Daerden, F.; Lefeber, D.


    This paper presents a sliding mode controller for a "Soft" 2-DOF Planar Pneumatic Manipulator actuated by pleated pneumatic artificial muscle actuators. Since actuator dynamics is not negligible, an approximate model for pressure dynamics was taken into account, which made it necessary to perform full input-output feedback linearization in order to design a sliding mode controller. The design of the controller is presented in detail, and experimental results obtained by implementing the controller are discussed

  13. Development of 3 DOF manipulator using ER fluid clutches for reduction of collision force

    International Nuclear Information System (INIS)

    Boku, Kazuhiko; Nakamura, Taro


    Abstract.With robots and users more commonly sharing space such as in the fields of medicine and home automation, the possibility of a physical collision has increased, even though many robots use actuators with high-ratio gear trains to minimize the effects of impact. We developed a 3-DOF manipulator having a smart flexible joint using an ER fluid and a sensor-equipped pneumatic cushion. Results of position control and collision experiments using the manipulator demonstrated its effectiveness.

  14. Development of 3 DOF manipulator using ER fluid clutches for reduction of collision force (United States)

    Boku, Kazuhiko; Nakamura, Taro


    .With robots and users more commonly sharing space such as in the fields of medicine and home automation, the possibility of a physical collision has increased, even though many robots use actuators with high-ratio gear trains to minimize the effects of impact. We developed a 3-DOF manipulator having a smart flexible joint using an ER fluid and a sensor-equipped pneumatic cushion. Results of position control and collision experiments using the manipulator demonstrated its effectiveness.

  15. Development of 3 DOF manipulator using ER fluid clutches for reduction of collision force

    Energy Technology Data Exchange (ETDEWEB)

    Boku, Kazuhiko; Nakamura, Taro [Chuo University, Faculty of Science and Engineering, Department of Precision Mechanics, 1-13-27 Kasuga, Bunkyo-ku, Tokyo 112-8551 (Japan)], E-mail:


    Abstract.With robots and users more commonly sharing space such as in the fields of medicine and home automation, the possibility of a physical collision has increased, even though many robots use actuators with high-ratio gear trains to minimize the effects of impact. We developed a 3-DOF manipulator having a smart flexible joint using an ER fluid and a sensor-equipped pneumatic cushion. Results of position control and collision experiments using the manipulator demonstrated its effectiveness.

  16. Automated optimal coordination of multiple-DOF neuromuscular actions in feedforward neuroprostheses. (United States)

    Lujan, J Luis; Crago, Patrick E


    This paper describes a new method for designing feedforward controllers for multiple-muscle, multiple-DOF, motor system neural prostheses. The design process is based on experimental measurement of the forward input/output properties of the neuromechanical system and numerical optimization of stimulation patterns to meet muscle coactivation criteria, thus resolving the muscle redundancy (i.e., overcontrol) and the coupled DOF problems inherent in neuromechanical systems. We designed feedforward controllers to control the isometric forces at the tip of the thumb in two directions during stimulation of three thumb muscles as a model system. We tested the method experimentally in ten able-bodied individuals and one patient with spinal cord injury. Good control of isometric force in both DOFs was observed, with rms errors less than 10% of the force range in seven experiments and statistically significant correlations between the actual and target forces in all ten experiments. Systematic bias and slope errors were observed in a few experiments, likely due to the neuromuscular fatigue. Overall, the tests demonstrated the ability of a general design approach to satisfy both control and coactivation criteria in multiple-muscle, multiple-axis neuromechanical systems, which is applicable to a wide range of neuromechanical systems and stimulation electrodes.

  17. IKO: A Five Actuated DoF Upper Limb Exoskeleton Oriented to Workplace Assistance

    Directory of Open Access Journals (Sweden)

    Felix Martinez


    Full Text Available IKerlan’s Orthosis (IKO is an upper limb exoskeleton oriented to increasing human force during routine activity at the workplace. Therefore, it can be considered as a force-amplification device conceived to work in collaboration with the human arm and implementing biomimetic principles. The aim of the proposed design is to find the best compromise between maximum reachable workspace and minimum moving mass, which are the key factors for obtaining an ergonomic, wearable exoskeleton. It consists of five actuated degree of freedom (DoF to move the human arm and three non-actuated DoF between the back and shoulder to allow relative displacement of the sterno-clavicular joint. Conventional electrical motors are used for most of the DoF and pneumatic muscles for one of them (forearm rotation. Power transmission is based on Bowden cables. This paper presents the IKO design, the mechanical structure of a first prototype and the redesign process from an aesthetic point of view. Controller set-up and control strategies are also shown, together with dynamic performance from experimental results.

  18. Bilateral, Misalignment-Compensating, Full-DOF Hip Exoskeleton: Design and Kinematic Validation

    Directory of Open Access Journals (Sweden)

    Karen Junius


    Full Text Available A shared design goal for most robotic lower limb exoskeletons is to reduce the metabolic cost of locomotion for the user. Despite this, only a limited amount of devices was able to actually reduce user metabolic consumption. Preservation of the natural motion kinematics was defined as an important requirement for a device to be metabolically beneficial. This requires the inclusion of all human degrees of freedom (DOF in a design, as well as perfect alignment of the rotation axes. As perfect alignment is impossible, compensation for misalignment effects should be provided. A misalignment compensation mechanism for a 3-DOF system is presented in this paper. It is validated by the implementation in a bilateral hip exoskeleton, resulting in a compact and lightweight device that can be donned fast and autonomously, with a minimum of required adaptations. Extensive testing of the prototype has shown that hip range of motion of the user is maintained while wearing the device and this for all three hip DOFs. This allowed the users to maintain their natural motion patterns when they are walking with the novel hip exoskeleton.

  19. Bilateral, Misalignment-Compensating, Full-DOF Hip Exoskeleton: Design and Kinematic Validation (United States)

    Degelaen, Marc; Lefeber, Nina; Swinnen, Eva; Vanderborght, Bram; Lefeber, Dirk


    A shared design goal for most robotic lower limb exoskeletons is to reduce the metabolic cost of locomotion for the user. Despite this, only a limited amount of devices was able to actually reduce user metabolic consumption. Preservation of the natural motion kinematics was defined as an important requirement for a device to be metabolically beneficial. This requires the inclusion of all human degrees of freedom (DOF) in a design, as well as perfect alignment of the rotation axes. As perfect alignment is impossible, compensation for misalignment effects should be provided. A misalignment compensation mechanism for a 3-DOF system is presented in this paper. It is validated by the implementation in a bilateral hip exoskeleton, resulting in a compact and lightweight device that can be donned fast and autonomously, with a minimum of required adaptations. Extensive testing of the prototype has shown that hip range of motion of the user is maintained while wearing the device and this for all three hip DOFs. This allowed the users to maintain their natural motion patterns when they are walking with the novel hip exoskeleton. PMID:28790799

  20. A Six-DOF Buoyancy Tank Microgravity Test Bed with Active Drag Compensation (United States)

    Sun, Chong; Chen, Shiyu; Yuan, Jianping; Zhu, Zhanxia


    Ground experiment under microgravity is very essential because it can verify the space enabling technologies before applied in space missions. In this paper, a novel ground experiment system that can provide long duration, large scale and high microgravity level for the six degree of freedom (DOF) spacecraft trajectory tracking is presented. In which, the most gravity of the test body is balanced by the buoyancy, and the small residual gravity is offset by the electromagnetic force. Because the electromagnetic force on the test body can be adjusted in the electromagnetic system, it can significantly simplify the balancing process using the proposed microgravity test bed compared to the neutral buoyance system. Besides, a novel compensation control system based on the active disturbance rejection control (ADRC) method is developed to estimate and compensate the water resistance online, in order to improve the fidelity of the ground experiment. A six-DOF trajectory tracking in the microgravity system is applied to testify the efficiency of the proposed compensation controller, and the experimental simulation results are compared to that obtained using the classic proportional-integral-derivative (PID) method. The simulation results demonstrated that, for the six-DOF motion ground experiment, the microgravity level can reach to 5 × 10-4 g. And, because the water resistance has been estimated and compensated, the performance of the presented controller is much better than the PID controller. The presented ground microgravity system can be applied in on-orbit service and other related technologies in future.

  1. Particularities of fully-parallel manipulators in 6-DOFs robots design: a review of critical aspects

    Directory of Open Access Journals (Sweden)

    Milica Lucian


    Full Text Available A whole range of industrial applications requires the presence of parallel mechanisms with six degrees of freedom (6-DOF which have been developed in the last fifteen years, and one of the reasons why they still are a current topic is that present-day computers are capable of performing real-time motion laws of great complexity associated with these types of parallel mechanisms. The present work underlines particularities of parallel manipulators and their importance in the design of 6-DOF robots. The paper reveals the progress made in the last twenty years in the development of 6-DOF parallel manipulators, which increasingly find a wide scope of applications in different industrial areas such as robotics, manufacture and assisted medicine. It also emphasizes the need to determine singular configurations and the effect of cinematic redundancy which can increase the working space of the manipulators by adding active joints in one or more branches of the manipulator. Throughout the work, there were outlined three types of singularities encountered in the modelling of different types of parallel manipulators, and three types of redundancy. Furthermore, an analysis was made of the dimension of the workspace for a series of parallel manipulators, highlighting a number of factors that influence its size.

  2. Design of a 7-DOF slave robot integrated with a magneto-rheological haptic master (United States)

    Hwang, Yong-Hoon; Cha, Seung-Woo; Kang, Seok-Rae; Choi, Seung-Bok


    In this study, a 7-DOF slave robot integrated with the haptic master is designed and its dynamic motion is controlled. The haptic master is made using a controllable magneto-rheological (MR) clutch and brake and it provides the surgeon with a sense of touch by using both kinetic and kinesthetic information. Due to the size constraint of the slave robot, a wire actuating is adopted to make the desired motion of the end-effector which has 3-DOF instead of a conventional direct-driven motor. Another motions of the link parts that have 4-DOF use direct-driven motor. In total system, for working as a haptic device, the haptic master need to receive the information of repulsive forces applied on the slave robot. Therefore, repulsive forces on the end-effector are sensed by using three uniaxial torque transducer inserted in the wire actuating system and another repulsive forces applied on link part are sensed by using 6-axis transducer that is able to sense forces and torques. Using another 6-axis transducer, verify the reliability of force information on final end of slave robot. Lastly, integrated with a MR haptic master, psycho-physical test is conducted by different operators who can feel the different repulsive force or torque generated from the haptic master which is equivalent to the force or torque occurred on the end-effector to demonstrate the effectiveness of the proposed system.

  3. Establishing an Improved Kane Dynamic Model for the 7-DOF Reconfigurable Modular Robot

    Directory of Open Access Journals (Sweden)

    Xiao Li


    Full Text Available We propose an improved Kane dynamic model theory for the 7-DOF modular robot in this paper, and the model precision is improved by the improved function T′it. We designed three types of progressive modular joints for reconfigurable modular robot that can be used in industrial robot, space robot, and special robot. The Kane dynamic model and the solid dynamic model are established, respectively, for the 7-DOF modular robot. After that, the experimental results are obtained from the simulation experiment of typical task in the established dynamic models. By the analysis model of error, the equation of the improved torque T′it is derived and proposed. And the improved Kane dynamic model is established for the modular robot that used T′it. Based on the experimental data, the undetermined coefficient matrix is five-order linear that was proved in 7-DOF modular robot. And the explicit formulation is solved of the Kane dynamic model and can be used in control system.

  4. Adaptive Controller for 6-DOF Parallel Robot Using T-S Fuzzy Inference

    Directory of Open Access Journals (Sweden)

    Xue Jian


    Full Text Available 6-DOF parallel robot always appears in the form of Stewart platform. It has been widely used in industry for the benefits such as strong structural stiffness, high movement accuracy and so on. Space docking technology makes higher requirements of motion accuracy and dynamic performance to the control method on 6-DOF parallel robot. In this paper, a hydraulic 6-DOF parallel robot was used to simulate the docking process. Based on this point, this paper gave a thorough study on the design of an adaptive controller to eliminate the asymmetric of controlled plant and uncertain load force interference. Takagi-Sugeno (T-S fuzzy inference model was used to build the fuzzy adaptive controller. With T-S model, the controller directly imposes adaptive control signal on the plant to make sure that the output of plant could track the reference model output. The controller has simple structure and is easy to implement. Experiment results show that the controller can eliminate asymmetric and achieve good dynamic performance, and has good robustness to load interference.

  5. The Impact of Environmental Design on Doffing Personal Protective Equipment in a Healthcare Environment: A Formative Human Factors Trial. (United States)

    Herlihey, Tracey A; Gelmi, Stefano; Cafazzo, Joseph A; Hall, Trevor N T


    OBJECTIVE To explore the impact of environmental design on doffing personal protective equipment in a simulated healthcare environment. METHODS A mixed-methods approach was used that included human-factors usability testing and qualitative questionnaire responses. A patient room and connecting anteroom were constructed for testing purposes. This experimental doffing area was designed to overcome the environmental failures identified in a previous study and was not constructed based on any generalizable hospital standard. RESULTS In total, 72 healthcare workers from Ontario, Canada, took part in the study and tested the simulated doffing area. The following environmental design changes were tested and were deemed effective: increasing prominence of color-coded zones; securing disinfectant wipes and hand sanitizer; outlining disposal bins locations; providing mirrors to detect possible contamination; providing hand rails to assist with doffing; and restricting the space to doff. Further experimentation and iterative design are required with regard to several important features: positioning the disposal bins for safety, decreasing the risk of contamination and user accessibility; optimal positioning of mirrors for safety; communication within the team; and positioning the secondary team member for optimal awareness. Additional design suggestions also emerged during this study, and they require future investigation. CONCLUSIONS This study highlights the importance of the environment on doffing personal protective equipment in a healthcare setting. Iterative testing and modification of the design of the environment (doffing area) are important to enhancing healthcare worker safety. Infect Control Hosp Epidemiol 2017;38:712-717.

  6. Thermal Actuation Based 3-DoF Non-Resonant Microgyroscope Using MetalMUMPs

    Directory of Open Access Journals (Sweden)

    Muhammad Masood ul Hassan


    Full Text Available High force, large displacement and low voltage consumption are a primary concern for microgyroscopes. The chevron-shaped thermal actuators are unique in terms of high force generation combined with the large displacements at a low operating voltage in comparison with traditional electrostatic actuators. A Nickel based 3-DoF micromachined gyroscope comprising 2-DoF drive mode and 1-DoF sense mode oscillator utilizing the chevron-shaped thermal actuators is presented here. Analytical derivations and finite element simulations are carried out to predict the performance of the proposed device using the thermo-physical properties of electroplated nickel. The device sensitivity is improved by utilizing the dynamical amplification of the oscillation in 2-DoF drive mode using an active-passive mass configuration. A comprehensive theoretical description, dynamics and mechanical design considerations of the proposed gyroscopes model are discussed in detail. Parametric optimization of gyroscope, its prototype modeling and fabrication using MetalMUMPs has also been investigated. Dynamic transient simulation results predicted that the sense mass of the proposed device achieved a drive displacement of 4.1µm when a sinusoidal voltage of 0.5V is applied at 1.77 kHz exhibiting a mechanical sensitivity of 1.7μm /o/s in vacuum. The wide bandwidth frequency response of the 2-DoF drive mode oscillator consists of two resonant peaks and a flat region of 2.11 kHz between the peaks defining the operational frequency region. The sense mode resonant frequency can lie anywhere within this region and therefore the amplitude of the response is insensitive to structural parameter variations, enhancing device robustness against such variations. The proposed device has a size of 2.2 x 2.6 mm2, almost one third in comparison with existing M-DoF vibratory gyroscope with an estimated power consumption of 0.26 Watts. These predicted results illustrate that the chevron

  7. Human Factors Risk Analyses of a Doffing Protocol for Ebola-Level Personal Protective Equipment: Mapping Errors to Contamination. (United States)

    Mumma, Joel M; Durso, Francis T; Ferguson, Ashley N; Gipson, Christina L; Casanova, Lisa; Erukunuakpor, Kimberly; Kraft, Colleen S; Walsh, Victoria L; Zimring, Craig; DuBose, Jennifer; Jacob, Jesse T


    Doffing protocols for personal protective equipment (PPE) are critical for keeping healthcare workers (HCWs) safe during care of patients with Ebola virus disease. We assessed the relationship between errors and self-contamination during doffing. Eleven HCWs experienced with doffing Ebola-level PPE participated in simulations in which HCWs donned PPE marked with surrogate viruses (ɸ6 and MS2), completed a clinical task, and were assessed for contamination after doffing. Simulations were video recorded, and a failure modes and effects analysis and fault tree analyses were performed to identify errors during doffing, quantify their risk (risk index), and predict contamination data. Fifty-one types of errors were identified, many having the potential to spread contamination. Hand hygiene and removing the powered air purifying respirator (PAPR) hood had the highest total risk indexes (111 and 70, respectively) and number of types of errors (9 and 13, respectively). ɸ6 was detected on 10% of scrubs and the fault tree predicted a 10.4% contamination rate, likely occurring when the PAPR hood inadvertently contacted scrubs during removal. MS2 was detected on 10% of hands, 20% of scrubs, and 70% of inner gloves and the predicted rates were 7.3%, 19.4%, 73.4%, respectively. Fault trees for MS2 and ɸ6 contamination suggested similar pathways. Ebola-level PPE can both protect and put HCWs at risk for self-contamination throughout the doffing process, even among experienced HCWs doffing with a trained observer. Human factors methodologies can identify error-prone steps, delineate the relationship between errors and self-contamination, and suggest remediation strategies.

  8. Experimental Analysis and Full Prediction Model of a 5-DOF Motorized Spindle

    Directory of Open Access Journals (Sweden)

    Weiyu Zhang


    Full Text Available The cost and power consumption of DC power amplifiers are much greater than that of AC power converters. Compared to a motorized spindle supported with DC magnetic bearings, a motorized spindle supported with AC magnetic bearings is inexpensive and more efficient. This paper studies a five-degrees-of-freedom (5-DOF motorized spindle supported with AC hybrid magnetic bearings (HMBs. Most models of suspension forces, except a “switching model”, are quite accurate, but only in a particular operating area and not in regional coverage. If a “switching model” is applied to a 5-DOF motorized spindle, the real-time performance of the control system can be significantly decreased due to the large amount of data processing for both displacement and current. In order to solve this defect, experiments based on the “switching model” are performed, and the resulting data are analyzed. Using the data analysis results, a “full prediction model” based on the operating state is proposed to improve real-time performance and precision. Finally, comparative, verification and stiffness tests are conducted to verify the improvement of the proposed model. Results of the tests indicate that the rotor has excellent characteristics, such as good real-time performance, superior anti-interference performance with load and the accuracy of the model in full zone. The satisfactory experimental results demonstrate the effectiveness of the “full prediction model” applied to the control system under different operating stages. Therefore, the results of the experimental analysis and the proposed full prediction model can provide a control system of a 5-DOF motorized spindle with the most suitable mathematical models of the suspension force.

  9. Comparison of FOLFOX and DOF regimens as first-line treatment in East Asian patients with advanced gastric cancer

    Directory of Open Access Journals (Sweden)

    Liu M


    Full Text Available Mengyao Liu,1,2 Guofang Hu,2 Yuan Wang,2 Jun Guo,2 Liyan Liu,2 Xiao Han,2 Zhehai Wang2 1School of Medicine and Life Sciences, University of Jinan-Shandong Academy of Medical Sciences, Jinan, Shandong, 2Department of Oncology, Shandong Cancer Hospital, affiliated to Shandong University, Shandong Academy of Medical Sciences, Jinan, Shandong, People’s Republic of China Background: Our study retrospectively assesses the safety and efficacy of the FOLFOX (oxaliplatin, fluorouracil, and leucovorin versus DOF (docetaxel, oxaliplatin, and fluorouracil regimens in untreated locally advanced gastric cancer (AGC.Patients and methods: A total of 108 patients underwent DOF (N=58 and FOLFOX (N=50 regimens. The end points were overall response rate (ORR, survival, and toxicity. Kaplan–Meier curve was used to estimate overall survival (OS and progression-free survival (PFS and Cox regression for multivariate analysis.Results: The ORRs were 50% for DOF and 30% for FOLFOX groups (P<0.05, and disease control rates were 91.4% and 72%, respectively. The median PFS and OS in DOF group were significantly better than FOLFOX group (8.2 versus 6.4 months, P<0.05; 16.3 versus 11.2 months, P<0.001. Both groups showed acceptable toxicity; all grades and grade 3–4 toxicity had no significant differences (P=0.071; P=0.247. However, the incidence of grade 3–4 peripheral neuropathy was significantly higher in DOF group (10.3% versus 2%, P<0.05. In the subgroup analysis for elderly AGC patients (≥65 years, administration of DOF also resulted in a superior PFS (8.5 versus 5.9 months; P=0.038 and OS (15.3 versus 9.8 months; P=0.004 compared with FOLFOX. However, DOF regimen was associated with more neutropenia (67% versus 30%; P<0.05, thrombocytopenia (61% versus 52%; P<0.05, and peripheral neuropathy (49% versus 22%; P<0.05.Conclusion: DOF regimen was more effective than FOLFOX for AGC, both in younger and older patients. The adverse effects of the two regimens were

  10. Towards frameless maskless SRS through real-time 6DoF robotic motion compensation (United States)

    Belcher, Andrew H.; Liu, Xinmin; Chmura, Steven; Yenice, Kamil; Wiersma, Rodney D.


    Stereotactic radiosurgery (SRS) uses precise dose placement to treat conditions of the CNS. Frame-based SRS uses a metal head ring fixed to the patient’s skull to provide high treatment accuracy, but patient comfort and clinical workflow may suffer. Frameless SRS, while potentially more convenient, may increase uncertainty of treatment accuracy and be physiologically confining to some patients. By incorporating highly precise robotics and advanced software algorithms into frameless treatments, we present a novel frameless and maskless SRS system where a robot provides real-time 6DoF head motion stabilization allowing positional accuracies to match or exceed those of traditional frame-based SRS. A 6DoF parallel kinematics robot was developed and integrated with a real-time infrared camera in a closed loop configuration. A novel compensation algorithm was developed based on an iterative closest-path correction approach. The robotic SRS system was tested on six volunteers, whose motion was monitored and compensated for in real-time over 15 min simulated treatments. The system’s effectiveness in maintaining the target’s 6DoF position within preset thresholds was determined by comparing volunteer head motion with and without compensation. Comparing corrected and uncorrected motion, the 6DoF robotic system showed an overall improvement factor of 21 in terms of maintaining target position within 0.5 mm and 0.5 degree thresholds. Although the system’s effectiveness varied among the volunteers examined, for all volunteers tested the target position remained within the preset tolerances 99.0% of the time when robotic stabilization was used, compared to 4.7% without robotic stabilization. The pre-clinical robotic SRS compensation system was found to be effective at responding to sub-millimeter and sub-degree cranial motions for all volunteers examined. The system’s success with volunteers has demonstrated its capability for implementation with frameless and

  11. Improved Inverse Kinematics Algorithm Using Screw Theory for a Six-DOF Robot Manipulator


    Chen, Qingcheng; Zhu, Shiqiang; Zhang, Xuequn


    Based on screw theory, a novel improved inverse-kinematics approach for a type of six-DOF serial robot, “Qianjiang I”, is proposed in this paper. The common kinematics model of the robot is based on the Denavit-Hartenberg (D-H) notation method while its inverse kinematics has inefficient calculation and complicated solution, which cannot meet the demands of online real-time application. To solve this problem, this paper presents a new method to improve the efficiency of the inverse kinematics...

  12. Geometric technique for the kinematic modeling of a 5 DOF redundant manipulator

    CSIR Research Space (South Africa)

    Makondo, N


    Full Text Available ,? Dipartimento di Elettronica, Informatica e Sistemistica (DEIS), Universit a di Bologna [Online]; Available at: http://www- Robotica/FIR 04 Kinem.pdf[31 October 2012] [18] Manocha, D.; Canny, J.F.; , ?Efficient... to the inverse kinematics of the Pioneer 2 robotic arm ?, Robotica, 2005, vol.23, pp.123, DOI: 10.1017/S0263574704000529 [20] De Xu, Carlos A. Acosta Calderon, John Q. Gan etc .An Analysis of the Inverse Kinematics for a 5-DOF Manipulator, International...

  13. A method of reactor power decrease by 2DOF control system during BWR power oscillation

    International Nuclear Information System (INIS)

    Ishikawa, Nobuyuki; Suzuki, Katsuo


    Occurrence of power oscillation events caused by void feedback effects in BWRs operated at low-flow and high-power condition has been reported. After thoroughly examining these events, BWRs have been equipped with the SRI (Selected Rod Insertion) system to avoid the power oscillation by decreasing the power under such reactor condition. This report presents a power control method for decreasing the reactor power stably by a two degree of freedom (2DOF) control. Performing a numerical simulation by utilizing a simple reactor dynamics model, it is found that the control system designed attains a satisfactory control performance of power decrease from a viewpoint of setting time and oscillation. (author)

  14. Kinematics and optimization of 2-DOF parallel manipulator with revolute actuators and a passive leg

    International Nuclear Information System (INIS)

    Nam, Yun Joo; Park, Myeong Kwan


    In this paper, a 2-DOF planar parallel manipulator with two revolute actuators and one passive constraining leg. The kinematic analysis of the mechanism is analytically performed : the inverse and forward kinematics problems are solved in closed forms, the workspace is derived systematically, and the three kinds of singular configurations are found. The optimal design to determine the geometric parameters and the operating limits of the actuated legs is performed considering the kinematic manipulability and workspace size. These results of the paper show the effectiveness of the presented manipulator

  15. End-Effector Position Analysis Using Forward Kinematics For 5 Dof Pravak Robot Arm


    Jolly Atit Shah; S.S. Rattan; B.C. Nakra


    Automatic control of the robotic manipulator involves study of kinematics and dynamics as a major issue. This paper involves the kinematic analysis of a Pravak Robot arm which is used for doing successful robotic manipulation task in its workspace. The Pravak Robot Arm is a 5-DOF robot having all the joints revolute. The kinematics problem is defined as the transformation from the Cartesian space to the joint space and vice versa. In this study the Denavit- Hartenberg (D-H) model is used to m...

  16. Towards frameless maskless SRS through real-time 6DoF robotic motion compensation. (United States)

    Belcher, Andrew H; Liu, Xinmin; Chmura, Steven; Yenice, Kamil; Wiersma, Rodney D


    Stereotactic radiosurgery (SRS) uses precise dose placement to treat conditions of the CNS. Frame-based SRS uses a metal head ring fixed to the patient's skull to provide high treatment accuracy, but patient comfort and clinical workflow may suffer. Frameless SRS, while potentially more convenient, may increase uncertainty of treatment accuracy and be physiologically confining to some patients. By incorporating highly precise robotics and advanced software algorithms into frameless treatments, we present a novel frameless and maskless SRS system where a robot provides real-time 6DoF head motion stabilization allowing positional accuracies to match or exceed those of traditional frame-based SRS. A 6DoF parallel kinematics robot was developed and integrated with a real-time infrared camera in a closed loop configuration. A novel compensation algorithm was developed based on an iterative closest-path correction approach. The robotic SRS system was tested on six volunteers, whose motion was monitored and compensated for in real-time over 15 min simulated treatments. The system's effectiveness in maintaining the target's 6DoF position within preset thresholds was determined by comparing volunteer head motion with and without compensation. Comparing corrected and uncorrected motion, the 6DoF robotic system showed an overall improvement factor of 21 in terms of maintaining target position within 0.5 mm and 0.5 degree thresholds. Although the system's effectiveness varied among the volunteers examined, for all volunteers tested the target position remained within the preset tolerances 99.0% of the time when robotic stabilization was used, compared to 4.7% without robotic stabilization. The pre-clinical robotic SRS compensation system was found to be effective at responding to sub-millimeter and sub-degree cranial motions for all volunteers examined. The system's success with volunteers has demonstrated its capability for implementation with frameless and maskless SRS

  17. Development of a simple system for simultaneously measuring 6DOF geometric motion errors of a linear guide. (United States)

    Qibo, Feng; Bin, Zhang; Cunxing, Cui; Cuifang, Kuang; Yusheng, Zhai; Fenglin, You


    A simple method for simultaneously measuring the 6DOF geometric motion errors of the linear guide was proposed. The mechanisms for measuring straightness and angular errors and for enhancing their resolution are described in detail. A common-path method for measuring the laser beam drift was proposed and it was used to compensate the errors produced by the laser beam drift in the 6DOF geometric error measurements. A compact 6DOF system was built. Calibration experiments with certain standard measurement meters showed that our system has a standard deviation of 0.5 µm in a range of ± 100 µm for the straightness measurements, and standard deviations of 0.5", 0.5", and 1.0" in the range of ± 100" for pitch, yaw, and roll measurements, respectively.

  18. Hybrid Taguchi DNA Swarm Intelligence for Optimal Inverse Kinematics Redundancy Resolution of Six-DOF Humanoid Robot Arms

    Directory of Open Access Journals (Sweden)

    Hsu-Chih Huang


    Full Text Available This paper presents a hybrid Taguchi deoxyribonucleic acid (DNA swarm intelligence for solving the inverse kinematics redundancy problem of six degree-of-freedom (DOF humanoid robot arms. The inverse kinematics problem of the multi-DOF humanoid robot arm is redundant and has no general closed-form solutions or analytical solutions. The optimal joint configurations are obtained by minimizing the predefined performance index in DNA algorithm for real-world humanoid robotics application. The Taguchi method is employed to determine the DNA parameters to search for the joint solutions of the six-DOF robot arms more efficiently. This approach circumvents the disadvantage of time-consuming tuning procedure in conventional DNA computing. Simulation results are conducted to illustrate the effectiveness and merit of the proposed methods. This Taguchi-based DNA (TDNA solver outperforms the conventional solvers, such as geometric solver, Jacobian-based solver, genetic algorithm (GA solver and ant, colony optimization (ACO solver.

  19. Kinematic modelling of a five-DOFs spatial manipulator used in robot-assisted surgery

    Directory of Open Access Journals (Sweden)

    Shakti Singh


    Full Text Available Since last three decades, research in the field of robot kinematics is boosted-up among different researchers worldwide. This is mainly due to their increased use in various challenging fields of engineering and science. One such challenging application is the use of master–slave concept in a robot-assisted surgery. The authors have already performed the kinematic study and gravity balancing of seven degrees-of-freedom (DOFs surgeon-side manipulator (Singh et al., 2015a, 2015b. To meet these challenging demands, the most important aspect of a robotic manipulator is to develop an accurate kinematic model. In this direction, different researchers in the literature have made significant contributions. Out of these, the most prominent one is D–H parameters method, which was proposed by Denavit and Hartenberg in 1955. In the present work, this method is applied to a five-DOFs spatial manipulator, named as patient-side manipulator, which tracks the motion of surgeon-side manipulator during a robot-assisted surgery. The prototype considered in this work is a spatial serial manipulator, being developed at CSIR-CSIO Chandigarh. Experimental validations are performed and results are found to be in close agreement.

  20. Improved Inverse Kinematics Algorithm Using Screw Theory for a Six-DOF Robot Manipulator

    Directory of Open Access Journals (Sweden)

    Qingcheng Chen


    Full Text Available Based on screw theory, a novel improved inverse-kinematics approach for a type of six-DOF serial robot, “Qianjiang I”, is proposed in this paper. The common kinematics model of the robot is based on the Denavit-Hartenberg (D-H notation method while its inverse kinematics has inefficient calculation and complicated solution, which cannot meet the demands of online real-time application. To solve this problem, this paper presents a new method to improve the efficiency of the inverse kinematics solution by introducing the screw theory. Unlike other methods, the proposed method only establishes two coordinates, namely the inertial coordinate and the tool coordinate; the screw motion of each link is carried out based on the inertial coordinate, ensuring definite geometric meaning. Furthermore, we adopt a new inverse kinematics algorithm, developing an improved sub-problem method along with Paden-Kahan sub-problems. This method has high efficiency and can be applied in real-time industrial operation. It is convenient to select the desired solutions directly from among multiple solutions by examining clear geometric meaning. Finally, the effectiveness and reliability performance of the new algorithm are analysed and verified in comparative experiments carried out on the six-DOF serial robot “Qianjiang I”.

  1. Radiometric compensation for cooperative distributed multi-projection system through 2-DOF distributed control. (United States)

    Tsukamoto, Jun; Iwai, Daisuke; Kashima, Kenji


    This paper proposes a novel radiometric compensation technique for cooperative projection system based-on distributed optimization. To achieve high scalability and robustness, we assume cooperative projection environments such that 1. each projector does not have information about other projectors as well as target images, 2. the camera does not have information about the projectors either, while having the target images, and 3. only a broadcast communication from the camera to the projectors is allowed to suppress the data transfer bandwidth. To this end, we first investigate a distributed optimization based feedback mechanism that is suitable for the required decentralized information processing environment. Next, we show that this mechanism works well for still image projection, however not necessary for moving images due to the lack of dynamic responsiveness. To overcome this issue, we propose to implement an additional feedforward mechanism. Such a 2 Degree Of Freedom (2-DOF) control structure is well-known in control engineering community as a typical method to enhance not only disturbance rejection but also reference tracking capability, simultaneously. We theoretically guarantee and experimentally demonstrate that this 2-DOF structure yields the moving image projection accuracy that is overwhelming the best achievable performance only by the distributed optimization mechanisms.

  2. Decoupled Sliding Mode Control for a Novel 3-DOF Parallel Manipulator with Actuation Redundancy

    Directory of Open Access Journals (Sweden)

    Niu Xuemei


    Full Text Available This paper presents a decoupled nonsingular terminal sliding mode controller (DNTSMC for a novel 3-DOF parallel manipulator with actuation redundancy. According to kinematic analysis, the inverse dynamic model for a novel 3-DOF redundantly actuated parallel manipulator is formulated in the task space using Lagrangian formalism and decoupled into three entirely independent subsystems under generalized coordinates to significantly reduce system complexity. Based on the dynamic model, a decoupled sliding mode control strategy is proposed for the parallel manipulator; the idea behind this strategy is to design a nonsingular terminal sliding mode controller for each subsystem, which can drive states of three subsystems to the original equilibrium points simultaneously by two intermediate variables. Additionally, a RBF neural network is used to compensate the cross-coupling force and gravity to enhance the control precision. Simulation and experimental results show that the proposed DNTSMC can achieve better control performances compared with the conventional sliding mode controller (SMC and the DNTSMC without compensator.

  3. Chattering-Free Neuro-Sliding Mode Control of 2-DOF Planar Parallel Manipulators

    Directory of Open Access Journals (Sweden)

    Tien Dung Le


    Full Text Available This paper proposes a novel chattering free neuro-sliding mode controller for the trajectory tracking control of two degrees of freedom (DOF parallel manipulators which have a complicated dynamic model, including modelling uncertainties, frictional uncertainties and external disturbances. A feedforward neural network (NN is combined with an error estimator to completely compensate the large nonlinear uncertainties and external disturbances of the parallel manipulators. The online weight tuning algorithms of the NN and the structure of the error estimator are derived with the strict theoretical stability proof of the Lyapunov theorem. The upper bound of uncertainties and the upper bound of the approximation errors are not required to be known in advance in order to guarantee the stability of the closed-loop system. The example simulation results show the effectiveness of the proposed control strategy for the tracking control of a 2-DOF parallel manipulator. It results in its being chattering-free, very small tracking errors and its robustness against uncertainties and external disturbances.

  4. Torque Measurement of 3-DOF Haptic Master Operated by Controllable Electrorheological Fluid

    Directory of Open Access Journals (Sweden)

    Oh Jong-Seok


    Full Text Available This work presents a torque measurement method of 3-degree-of-freedom (3-DOF haptic master featuring controllable electrorheological (ER fluid. In order to reflect the sense of an organ for a surgeon, the ER haptic master which can generate the repulsive torque of an organ is utilized as a remote controller for a surgery robot. Since accurate representation of organ feeling is essential for the success of the robot-assisted surgery, it is indispensable to develop a proper torque measurement method of 3-DOF ER haptic master. After describing the structural configuration of the haptic master, the torque models of ER spherical joint are mathematically derived based on the Bingham model of ER fluid. A new type of haptic device which has pitching, rolling, and yawing motions is then designed and manufactured using a spherical joint mechanism. Subsequently, the field-dependent parameters of the Bingham model are identified and generating repulsive torque according to applied electric field is measured. In addition, in order to verify the effectiveness of the proposed torque model, a comparative work between simulated and measured torques is undertaken.

  5. Evaluation of head-collision safety of a 7-DOF manipulator according to posture variation

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Ki Hong, E-mail:; Park, In Jun, E-mail:; Choi, Jin-Hwan, E-mail:; Rhim, Sungsoo, E-mail: [Kyung Hee University, Department of Mechanical Engineering (Korea, Republic of)


    As the need for the improvement of the productivity in the manufacturing process grows, industrial robots are brought out of the safety fences and used in the direct collaborative operation with human workers. Consequently, the intended and/or unintended contact between the human and the robot in the collaborative operation is no longer an extraordinary event and is a mundane possibility. The level of the risk of the collision depends on various quantities associated with the collision, for example, inertia, velocity, stiffness, and so on. MSI (manipulator safety index) which is based on HIC (head injury criteria) conventionally used in the automotive industry is one of the practically available measures to estimate the risk of the collision between the human and the manipulator. In this paper MSI is applied to evaluate the collision safety of a 7-DOF articulated human-arm-like manipulator. The risk of the collision could be reduced by choosing different postures without deviating from the given end-effector trajectory using the redundant degree of freedom in the 7-DOF manipulator. The paper shows how the redundant degree of the freedom is utilized to design safer trajectories and/or safer manipulator configurations among many available. A parametric analysis and simulation results for a given trajectory illustrate the usefulness of the concept of the trajectory design for alleviating the risk of the manipulator operation in the human–robot coexisting workspace.

  6. Design Optimization of a Cable-Driven Two-DOF Flexible Joint Module

    Directory of Open Access Journals (Sweden)

    Zhao Zhang


    Full Text Available This paper focuses on the kinematics, kinetostatics and design optimization of a 2-DOF cable-driven flexible joint module. Based on the motion characteristics of the 2-DOF joint module, the concept of instantaneous screw axis in conjunction with the Product-Of-Exponentials (POE formula is proposed to formulate its kinematic model. However, as the instantaneous screw axis is unfixed, the Lie group method is employed to derive the instantaneous kinematic model of the joint module. In order to generate the feasible workspace subject to positive tension constraint, the kinetostatics of the joint module is addressed, where the stiffness resulting from both the driving cables and the flexible backbone are considered. A numerical orientation workspace evaluation method is proposed based on an equi-volumetric partition in its parametric space and the volume-element associated integral factor. A global singular value (GSV index, which considers the minimum singular value of the stiffness matrix of joint module over the achievable workspace, is employed to optimize the geometric size of joint module. The simulation results demonstrate the effectiveness of the proposed GSV optimization algorithm.

  7. Simulation and training of lumbar punctures using haptic volume rendering and a 6DOF haptic device (United States)

    Färber, Matthias; Heller, Julika; Handels, Heinz


    The lumbar puncture is performed by inserting a needle into the spinal chord of the patient to inject medicaments or to extract liquor. The training of this procedure is usually done on the patient guided by experienced supervisors. A virtual reality lumbar puncture simulator has been developed in order to minimize the training costs and the patient's risk. We use a haptic device with six degrees of freedom (6DOF) to feedback forces that resist needle insertion and rotation. An improved haptic volume rendering approach is used to calculate the forces. This approach makes use of label data of relevant structures like skin, bone, muscles or fat and original CT data that contributes information about image structures that can not be segmented. A real-time 3D visualization with optional stereo view shows the punctured region. 2D visualizations of orthogonal slices enable a detailed impression of the anatomical context. The input data consisting of CT and label data and surface models of relevant structures is defined in an XML file together with haptic rendering and visualization parameters. In a first evaluation the visible human male data has been used to generate a virtual training body. Several users with different medical experience tested the lumbar puncture trainer. The simulator gives a good haptic and visual impression of the needle insertion and the haptic volume rendering technique enables the feeling of unsegmented structures. Especially, the restriction of transversal needle movement together with rotation constraints enabled by the 6DOF device facilitate a realistic puncture simulation.

  8. Real-time control of the 3-DOF sled dynamics of a null-flux Maglev System with a passive sled

    NARCIS (Netherlands)

    Boeij, de J.; Steinbuch, M.; Gutierrez, H.M.


    The real-time control of the three degrees of freedom (DOF) dynamics of an electrodynamic (EDS) Maglev vehicle is presented. The design is based on a 5-DOF state-space model of the sled dynamics that uses a simple algebraic model to describe the interaction between the -flux coils on the track and

  9. 6-DOF Pose Estimation of a Robotic Navigation Aid by Tracking Visual and Geometric Features. (United States)

    Ye, Cang; Hong, Soonhac; Tamjidi, Amirhossein


    This paper presents a 6-DOF Pose Estimation (PE) method for a Robotic Navigation Aid (RNA) for the visually impaired. The RNA uses a single 3D camera for PE and object detection. The proposed method processes the camera's intensity and range data to estimates the camera's egomotion that is then used by an Extended Kalman Filter (EKF) as the motion model to track a set of visual features for PE. A RANSAC process is employed in the EKF to identify inliers from the visual feature correspondences between two image frames. Only the inliers are used to update the EKF's state. The EKF integrates the egomotion into the camera's pose in the world coordinate system. To retain the EKF's consistency, the distance between the camera and the floor plane (extracted from the range data) is used by the EKF as the observation of the camera's z coordinate. Experimental results demonstrate that the proposed method results in accurate pose estimates for positioning the RNA in indoor environments. Based on the PE method, a wayfinding system is developed for localization of the RNA in a home environment. The system uses the estimated pose and the floorplan to locate the RNA user in the home environment and announces the points of interest and navigational commands to the user through a speech interface. This work was motivated by the limitations of the existing navigation technology for the visually impaired. Most of the existing methods use a point/line measurement sensor for indoor object detection. Therefore, they lack capability in detecting 3D objects and positioning a blind traveler. Stereovision has been used in recent research. However, it cannot provide reliable depth data for object detection. Also, it tends to produce a lower localization accuracy because its depth measurement error quadratically increases with the true distance. This paper suggests a new approach for navigating a blind traveler. The method uses a single 3D time-of-flight camera for both 6-DOF PE and 3D object

  10. Mathematical model of the 5-DOF sled dynamics of an electrodynamic Maglev system with a passive sled

    NARCIS (Netherlands)

    Boeij, de J.; Steinbuch, M.; Gutierrez, H.M.


    A model that describes the five-degrees-of-freedom (5-DOF) dynamics of a passively levitated electrodynamic maglev system is presented. The model is based on the flux-current-force interactions and the geometric relationships between the levitation coils and the permanent magnets on the sled. The

  11. Control Architecture of a 10 DOF Lower Limbs Exoskeleton for Gait Rehabilitation

    Directory of Open Access Journals (Sweden)

    Natasa Koceska


    Full Text Available This paper describes the control architecture of a 10 DOF (Degrees of Freedom lower limbs exoskeleton for the gait rehabilitation of patients with gait dysfunction. The system has 4 double-acting rod pneumatic actuators (two for each leg that control the hip and knee joints. The motion of each cylinder's piston is controlled by two proportional pressure valves, connected to both cylinder chambers. The control strategy has been specifically designed in order to ensure a proper trajectory control for guiding patient's legs along a fixed reference gait pattern. An adaptive fuzzy controller which is capable of compensating for the influence of the dry friction was successfully designed, implemented and tested on an embedded real-time PC/104. In order to verify the proposed control architecture, laboratory experiments without a patient were carried out and the results are reported here and discussed.

  12. Trajectory Planning of 7-DOF Space Manipulator for Minimizing Base Disturbance

    Directory of Open Access Journals (Sweden)

    Qiang Zhang


    Full Text Available In the free-floating mode, there is intense dynamic coupling existing between the space manipulator and the base, and the base attitude may change while performing a motion with its manipulator. Therefore, it is necessary to reduce the interference that resulted from the manipulator movement. For planning trajectories of the space manipulator with 7 degrees of freedom (7-DOF, simulated annealing particle swarm optimization (SAPSO algorithm is presented in the paper. Firstly, kinematics equations are setup. Secondly, the joint functions are parameterized by sinusoidal functions, and the objective function is defined according to the motion constraints of manipulator and accuracy requirements of the base attitude. Finally, SAPSO algorithm is used to search the optimal trajectory. The simulation results verify the proposed method.

  13. Sensor module design and forward and inverse kinematics analysis of 6-DOF sorting transferring robot (United States)

    Zhou, Huiying; Lin, Jiajian; Liu, Lei; Tao, Meng


    To meet the demand of high strength express sorting, it is significant to design a robot with multiple degrees of freedom that can sort and transfer. This paper uses infrared sensor, color sensor and pressure sensor to receive external information, combine the plan of motion path in advance and the feedback information from the sensors, then write relevant program. In accordance with these, we can design a 6-DOF robot that can realize multi-angle seizing. In order to obtain characteristics of forward and inverse kinematics, this paper describes the coordinate directions and pose estimation by the D-H parameter method and closed solution. On the basis of the solution of forward and inverse kinematics, geometric parameters of links and link parameters are optimized in terms of application requirements. In this way, this robot can identify route, sort and transfer.

  14. Optimal design of an alignment-free two-DOF rehabilitation robot for the shoulder complex. (United States)

    Galinski, Daniel; Sapin, Julien; Dehez, Bruno


    This paper presents the optimal design of an alignment-free exoskeleton for the rehabilitation of the shoulder complex. This robot structure is constituted of two actuated joints and is linked to the arm through passive degrees of freedom (DOFs) to drive the flexion-extension and abduction-adduction movements of the upper arm. The optimal design of this structure is performed through two steps. The first step is a multi-objective optimization process aiming to find the best parameters characterizing the robot and its position relative to the patient. The second step is a comparison process aiming to select the best solution from the optimization results on the basis of several criteria related to practical considerations. The optimal design process leads to a solution outperforming an existing solution on aspects as kinematics or ergonomics while being more simple.

  15. Development of a 6 DOF force-reflecting master input device

    Energy Technology Data Exchange (ETDEWEB)

    Yoon, Ji Sup; Yoon, Ho Sik


    The teleoperator is a very effective tool for various tasks of nuclear application in that it can reduce the operators' exposure to the radiation. For the utmost performances of the teleoperator, the force reflection capability is essential. This capability represents a function of transmitting the contact force of teleoperator with the object to the human operator. With this function the human operator in the remote area can effectively guide the motion of the teleoperator so that it can follow a safety guaranteed path. In this research a fully force reflectible input device 96 axis is developed. To develop the force reflecting device, the state of art is surveyed. Based on this survey, the 6 DOF manipulator which controls a power manipulator is fabricated and its performance is investigated. Also, various force reflection algorithms analyzed and the enhanced algorithm is proposed. (author). 18 refs., 4 tabs., 26 fi0008.

  16. Measurement system and model for simultaneously measuring 6DOF geometric errors. (United States)

    Zhao, Yuqiong; Zhang, Bin; Feng, Qibo


    A measurement system to simultaneously measure six degree-of-freedom (6DOF) geometric errors is proposed. The measurement method is based on a combination of mono-frequency laser interferometry and laser fiber collimation. A simpler and more integrated optical configuration is designed. To compensate for the measurement errors introduced by error crosstalk, element fabrication error, laser beam drift, and nonparallelism of two measurement beam, a unified measurement model, which can improve the measurement accuracy, is deduced and established using the ray-tracing method. A numerical simulation using the optical design software Zemax is conducted, and the results verify the correctness of the model. Several experiments are performed to demonstrate the feasibility and effectiveness of the proposed system and measurement model.

  17. Development of a 6 DOF force-reflecting master input device

    Energy Technology Data Exchange (ETDEWEB)

    Yoon, Ji Sup; Yoon, Ho Sik


    The teleoperator is a very effective tool for various tasks of nuclear application in that it can reduce the operators' exposure to the radiation. For the utmost performances of the teleoperator, the force reflection capability is essential. This capability represents a function of transmitting the contact force of teleoperator with the object to the human operator. With this function the human operator in the remote area can effectively guide the motion of the teleoperator so that it can follow a safety guaranteed path. In this research a fully force reflectible input device 96 axis is developed. To develop the force reflecting device, the state of art is surveyed. Based on this survey, the 6 DOF manipulator which controls a power manipulator is fabricated and its performance is investigated. Also, various force reflection algorithms analyzed and the enhanced algorithm is proposed. (author). 18 refs., 4 tabs., 26 fi0008.

  18. An Enhanced Intelligent Handheld Instrument with Visual Servo Control for 2-DOF Hand Motion Error Compensation

    Directory of Open Access Journals (Sweden)

    Yan Naing Aye


    Full Text Available The intelligent handheld instrument, ITrem2, enhances manual positioning accuracy by cancelling erroneous hand movements and, at the same time, provides automatic micromanipulation functions. Visual data is acquired from a high speed monovision camera attached to the optical surgical microscope and acceleration measurements are acquired from the inertial measurement unit (IMU on board ITrem2. Tremor estimation and canceling is implemented via Band-limited Multiple Fourier Linear Combiner (BMFLC filter. The piezoelectric actuated micromanipulator in ITrem2 generates the 3D motion to compensate erroneous hand motion. Preliminary bench-top 2-DOF experiments have been conducted. The error motions simulated by a motion stage is reduced by 67% for multiple frequency oscillatory motions and 56.16% for pre-conditioned recorded physiological tremor.

  19. Development of a 6 DOF force-reflecting master input device

    International Nuclear Information System (INIS)

    Yoon, Ji Sup; Yoon, Ho Sik


    The teleoperator is a very effective tool for various tasks of nuclear application in that it can reduce the operators' exposure to the radiation. For the utmost performances of the teleoperator, the force reflection capability is essential. This capability represents a function of transmitting the contact force of teleoperator with the object to the human operator. With this function the human operator in the remote area can effectively guide the motion of the teleoperator so that it can follow a safety guaranteed path. In this research a fully force reflectible input device 96 axis) is developed. To develop the force reflecting device, the state of art is surveyed. Based on this survey, the 6 DOF manipulator which controls a power manipulator is fabricated and its performance is investigated. Also, various force reflection algorithms analyzed and the enhanced algorithm is proposed. (author). 18 refs., 4 tabs., 26 figs

  20. Output Error Analysis of Planar 2-DOF Five-bar Mechanism (United States)

    Niu, Kejia; Wang, Jun; Ting, Kwun-Lon; Tao, Fen; Cheng, Qunchao; Wang, Quan; Zhang, Kaiyang


    Aiming at the mechanism error caused by clearance of planar 2-DOF Five-bar motion pair, the method of equivalent joint clearance of kinematic pair to virtual link is applied. The structural error model of revolute joint clearance is established based on the N-bar rotation laws and the concept of joint rotation space, The influence of the clearance of the moving pair is studied on the output error of the mechanis. and the calculation method and basis of the maximum error are given. The error rotation space of the mechanism under the influence of joint clearance is obtained. The results show that this method can accurately calculate the joint space error rotation space, which provides a new way to analyze the planar parallel mechanism error caused by joint space.

  1. Implementation of impedance trajectory control on a 6-DoF manipulator

    Directory of Open Access Journals (Sweden)

    Shardyko Igor


    Full Text Available Aiming at enhancing the performance of a robotic system, i.e. of a robot manipulator, it is extremely important to ensure the safety of its functioning and the convenience of operating it. Special attention is required if there is a possibility of a collision, especially with costly equipment or with a person. Among the different means and approaches to prevent or react to such situations, implementation of forcetorque control is considered in this paper. A trajectory task is analysed and an impedance control law is employed to achieve the desired robot behaviour. The effectiveness of the approach has been verified by using a 6-DoF elbow manipulator to perform two types of operations: a peg-in-hole task and path execution with obstacles on the way.

  2. Adaptive control of 5 DOF upper-limb exoskeleton robot with improved safety. (United States)

    Kang, Hao-Bo; Wang, Jian-Hui


    This paper studies an adaptive control strategy for a class of 5 DOF upper-limb exoskeleton robot with a special safety consideration. The safety requirement plays a critical role in the clinical treatment when assisting patients with shoulder, elbow and wrist joint movements. With the objective of assuring the tracking performance of the pre-specified operations, the proposed adaptive controller is firstly designed to be robust to the model uncertainties. To further improve the safety and fault-tolerance in the presence of unknown large parameter variances or even actuator faults, the adaptive controller is on-line updated according to the information provided by an adaptive observer without additional sensors. An output tracking performance is well achieved with a tunable error bound. The experimental example also verifies the effectiveness of the proposed control scheme. © 2013 ISA. Published by ISA. All rights reserved.

  3. End-Effector Position Analysis Using Forward Kinematics For 5 Dof Pravak Robot Arm

    Directory of Open Access Journals (Sweden)

    Jolly Atit Shah


    Full Text Available Automatic control of the robotic manipulator involves study of kinematics and dynamics as a major issue. This paper involves the kinematic analysis of a Pravak Robot arm which is used for doing successful robotic manipulation task in its workspace. The Pravak Robot Arm is a 5-DOF robot having all the joints revolute. The kinematics problem is defined as the transformation from the Cartesian space to the joint space and vice versa. In this study the Denavit- Hartenberg (D-H model is used to model robot links and joints. Pravak Robot Arm is a simple and safe robotic system designed for laboratory training and research applications. This robot allows to gain theoretical and practical experience in robotics, automation and control systems. The MATLAB R2007 is used to analyse end effectors position for a set of joint parameter.

  4. Investigation for Synchronization of a Rotor-Pendulum System considering the Multi-DOF Vibration

    Directory of Open Access Journals (Sweden)

    Yongjun Hou


    Full Text Available This work is a continuation for our published literature for vibration synchronization. A new mechanism, two rotors coupled with a pendulum rod in a multi-DOF vibration system, is proposed to implement coupling synchronization, and the dynamics equation of mechanism is derived by Lagrange equation. In addition, the coupling relationship between the vibrobody and the pendulum rod is ascertained with the Laplace transformation method, based on the dimensionless equation of the dynamics system. The Poincare method is employed to study the synchronization state between the two unbalanced rotors, which is converted into that of existence and the stability of solutions for synchronization-balance equations. The obtained results are supported by computer simulations. It is demonstrated that the values of the spring stiffness coefficient, the length of the pendulum, and the angular installation of the pendulum are important parameters with respect to the synchronous behavior in the rotor-pendulum system.

  5. Workspace optimization and kinematic performance evaluation of 2-DOF parallel mechanisms

    International Nuclear Information System (INIS)

    Nam, Yun Joo; Park, Myeong Kwan


    This paper presents the kinematics and workspace optimization of the two different 2-DOF (Degrees-of-Freedom) planar parallel mechanisms: one (called 2-RPR mechanism) with translational actuators and the other (called 2-RRR mechanism) with rotational ones. First of all, the inverse kinematics and Jacobian matrix for each mechanism are derived analytically. Then, the workspace including the output-space and the joint-space is systematically analyzed in order to determine the geometric parameters and the operating range of the actuators. Finally, the kinematic optimization of the mechanisms is performed in consideration of their dexterity and rigidity. It is expected that the optimization results can be effectively used as a basic material for the applications of the presented mechanisms to more industrial fields

  6. A redundant, 6-DOF parallel manipulator structure with improved workspace and dexterity

    International Nuclear Information System (INIS)

    Stoughton, R.S.; Salerno, R.; Canfield, S.; Reinholtz, C.


    This paper presents a novel manipulator structure which combines two known parallel manipulator structures--a Stewart Platform (SP), and a double octahedral Variable Geometry Truss (VGT). The combined VGT + SP structure is redundant, using nine actuators to realize six-DOF motion. Combining the two structures allows the translational and orientational workspaces of the two individual structures to sum together to a much larger workspace than is generally achievable with parallel manipulator structures. In addition, the VGT portion of the structure allows the configuration of the Stewart Platform to be changed ''on the fly'' from one with a large workspace to one with high dexterity. A useful application of this structure is at the distal end of a truss-based manipulator, where it can serve as a dexterous wrist while preserving an internal passageway for cabling and/or conveyance systems

  7. A simple 5-DoF MR-compatible motion signal measurement system. (United States)

    Chung, Soon-Cheol; Kim, Hyung-Sik; Yang, Jae-Woong; Lee, Su-Jeong; Choi, Mi-Hyun; Kim, Ji-Hye; Yeon, Hong-Won; Park, Jang-Yeon; Yi, Jeong-Han; Tack, Gye-Rae


    The purpose of this study was to develop a simple motion measurement system with magnetic resonance (MR) compatibility and safety. The motion measurement system proposed here can measure 5-DoF motion signals without deteriorating the MR images, and it has no effect on the intense and homogeneous main magnetic field, the temporal-gradient magnetic field (which varies rapidly with time), the transceiver radio frequency (RF) coil, and the RF pulse during MR data acquisition. A three-axis accelerometer and a two-axis gyroscope were used to measure 5-DoF motion signals, and Velcro was used to attach a sensor module to a finger or wrist. To minimize the interference between the MR imaging system and the motion measurement system, nonmagnetic materials were used for all electric circuit components in an MR shield room. To remove the effect of RF pulse, an amplifier, modulation circuit, and power supply were located in a shielded case, which was made of copper and aluminum. The motion signal was modulated to an optic signal using pulse width modulation, and the modulated optic signal was transmitted outside the MR shield room using a high-intensity light-emitting diode and an optic cable. The motion signal was recorded on a PC by demodulating the transmitted optic signal into an electric signal. Various kinematic variables, such as angle, acceleration, velocity, and jerk, can be measured or calculated by using the motion measurement system developed here. This system also enables motion tracking by extracting the position information from the motion signals. It was verified that MR images and motion signals could reliably be measured simultaneously.

  8. Principal components analysis based control of a multi-dof underactuated prosthetic hand

    Directory of Open Access Journals (Sweden)

    Magenes Giovanni


    Full Text Available Abstract Background Functionality, controllability and cosmetics are the key issues to be addressed in order to accomplish a successful functional substitution of the human hand by means of a prosthesis. Not only the prosthesis should duplicate the human hand in shape, functionality, sensorization, perception and sense of body-belonging, but it should also be controlled as the natural one, in the most intuitive and undemanding way. At present, prosthetic hands are controlled by means of non-invasive interfaces based on electromyography (EMG. Driving a multi degrees of freedom (DoF hand for achieving hand dexterity implies to selectively modulate many different EMG signals in order to make each joint move independently, and this could require significant cognitive effort to the user. Methods A Principal Components Analysis (PCA based algorithm is used to drive a 16 DoFs underactuated prosthetic hand prototype (called CyberHand with a two dimensional control input, in order to perform the three prehensile forms mostly used in Activities of Daily Living (ADLs. Such Principal Components set has been derived directly from the artificial hand by collecting its sensory data while performing 50 different grasps, and subsequently used for control. Results Trials have shown that two independent input signals can be successfully used to control the posture of a real robotic hand and that correct grasps (in terms of involved fingers, stability and posture may be achieved. Conclusions This work demonstrates the effectiveness of a bio-inspired system successfully conjugating the advantages of an underactuated, anthropomorphic hand with a PCA-based control strategy, and opens up promising possibilities for the development of an intuitively controllable hand prosthesis.

  9. Electrical coupling suppression and transient response improvement for a microgyroscope using ascending frequency drive with a 2-DOF PID controller

    International Nuclear Information System (INIS)

    Cui, J; Guo, Z Y; Yang, Z C; Hao, Y L; Yan, G Z


    In this paper, we demonstrate a novel control strategy for the drive mode of a microgyroscope using ascending frequency drive (AFD) with an AGC-2DOF PID controller, which drives a resonator with a modulation signal not at the resonant frequency and senses the vibration signal at the resonant frequency, thus realizing the isolation between the actual mechanical response and electrical coupling signal. This approach holds the following three advantages: (1) it employs the AFD signal instead of the resonant frequency drive signal to excite the gyroscope in the drive direction, suppressing the electrical coupling from the drive electrode to the sense electrode; (2) it can reduce the noise at low frequency and resonant frequency by shifting flicker noise to the high-frequency part; (3) it can effectively improve the performance of the transient response of the closed-loop control with a 2-DOF (degree of freedom) PID controller compared with the conventional 1-DOF PID. The stability condition of the whole loop is investigated by utilizing the averaging and linearization method. The control approach is applied to drive a lateral tuning fork microgyroscope. Test results show good agreement with the theoretical and simulation results. The non-ideal electrical antiresonance peak is removed and the resonant peak height increases by approximately 10 dB over a 400 Hz span with a flicker noise reduction of 30 dB within 100 Hz using AFD. The percent overshoot is reduced from 36.2% (1DOF PID) to 8.95% (2DOF PID, about 75.3% overshoot suppression) with 15.3% improvement in setting time

  10. Development of a 6DOF robotic motion phantom for radiation therapy

    International Nuclear Information System (INIS)

    Belcher, Andrew H.; Liu, Xinmin; Grelewicz, Zachary; Pearson, Erik; Wiersma, Rodney D.


    Purpose: The use of medical technology capable of tracking patient motion or positioning patients along 6 degree-of-freedom (6DOF) has steadily increased in the field of radiation therapy. However, due to the complex nature of tracking and performing 6DOF motion, it is critical that such technology is properly verified to be operating within specifications in order to ensure patient safety. In this study, a robotic motion phantom is presented that can be programmed to perform highly accurate motion along any X (left–right), Y (superior–inferior), Z (anterior–posterior), pitch (around X), roll (around Y), and yaw (around Z) axes. In addition, highly synchronized motion along all axes can be performed in order to simulate the dynamic motion of a tumor in 6D. The accuracy and reproducibility of this 6D motion were characterized. Methods: An in-house designed and built 6D robotic motion phantom was constructed following the Stewart–Gough parallel kinematics platform archetype. The device was controlled using an inverse kinematics formulation, and precise movements in all 6 degrees-of-freedom (X, Y, Z, pitch, roll, and yaw) were performed, both simultaneously and separately for each degree-of-freedom. Additionally, previously recorded 6D cranial and prostate motions were effectively executed. The robotic phantom movements were verified using a 15 fps 6D infrared marker tracking system and the measured trajectories were compared quantitatively to the intended input trajectories. The workspace, maximum 6D velocity, backlash, and weight load capabilities of the system were also established. Results: Evaluation of the 6D platform demonstrated translational root mean square error (RMSE) values of 0.14, 0.22, and 0.08 mm over 20 mm in X and Y and 10 mm in Z, respectively, and rotational RMSE values of 0.16°, 0.06°, and 0.08° over 10° of pitch, roll, and yaw, respectively. The robotic stage also effectively performed controlled 6D motions, as well as reproduced

  11. Novel Adaptive Forward Neural MIMO NARX Model for the Identification of Industrial 3-DOF Robot Arm Kinematics

    Directory of Open Access Journals (Sweden)

    Ho Pham Huy Anh


    Full Text Available In this paper, a novel forward adaptive neural MIMO NARX model is used for modelling and identifying the forward kinematics of an industrial 3-DOF robot arm system. The nonlinear features of the forward kinematics of the industrial robot arm drive are thoroughly modelled based on the forward adaptive neural NARX model-based identification process using experimental input-output training data. This paper proposes a novel use of a back propagation (BP algorithm to generate the forward neural MIMO NARX (FNMN model for the forward kinematics of the industrial 3-DOF robot arm. The results show that the proposed adaptive neural NARX model trained by a Back Propagation learning algorithm yields outstanding performance and perfect accuracy.

  12. Hand-held multi-DOF robotic forceps for neurosurgery designed for dexterous manipulation in deep and narrow space. (United States)

    Okubo, Takuro; Harada, Kanako; Fujii, Masahiro; Tanaka, Shinichi; Ishimaru, Tetsuya; Iwanaka, Tadashi; Nakatomi, Hirohumi; Sora, Sigeo; Morita, Akio; Sugita, Naohiko; Mitsuishi, Mamoru


    Neurosurgical procedures require precise and dexterous manipulation of a surgical suture in narrow and deep spaces in the brain. This is necessary for surgical tasks such as the anastomosis of microscopic blood vessels and dura mater suturing. A hand-held multi-degree of freedom (DOF) robotic forceps was developed to aid the performance of such difficult tasks. The diameter of the developed robotic forceps is 3.5 mm, and its tip has three DOFs, namely, bending, rotation, and grip. Experimental results showed that the robotic forceps had an average needle insertion force of 1.7 N. Therefore, an increase in the needle insertion force is necessary for practical application of the developed device.

  13. Robust design of a 2-DOF GMV controller: a direct self-tuning and fuzzy scheduling approach. (United States)

    Silveira, Antonio S; Rodríguez, Jaime E N; Coelho, Antonio A R


    This paper presents a study on self-tuning control strategies with generalized minimum variance control in a fixed two degree of freedom structure-or simply GMV2DOF-within two adaptive perspectives. One, from the process model point of view, using a recursive least squares estimator algorithm for direct self-tuning design, and another, using a Mamdani fuzzy GMV2DOF parameters scheduling technique based on analytical and physical interpretations from robustness analysis of the system. Both strategies are assessed by simulation and real plants experimentation environments composed of a damped pendulum and an under development wind tunnel from the Department of Automation and Systems of the Federal University of Santa Catarina. Copyright © 2011 ISA. Published by Elsevier Ltd. All rights reserved.

  14. New Jacobian Matrix and Equations of Motion for a 6 d.o.f Cable-Driven Robot

    Directory of Open Access Journals (Sweden)

    Ali Afshari


    Full Text Available In this paper, we introduce a new method and new motion variables to study kinematics and dynamics of a 6 d.o.f cable-driven robot. Using these new variables and Lagrange equations, we achieve new equations of motion which are different in appearance and several aspects from conventional equations usually used to study 6 d.o.f cable robots. Then, we introduce a new Jacobian matrix which expresses kinematical relations of the robot via a new approach and is basically different from the conventional Jacobian matrix. One of the important characteristics of the new method is computational efficiency in comparison with the conventional method. It is demonstrated that using the new method instead of the conventional one, significantly reduces the computation time required to determine workspace of the robot as well as the time required to solve the equations of motion.

  15. Novel Adaptive Forward Neural MIMO NARX Model for the Identification of Industrial 3-DOF Robot Arm Kinematics


    Ho Pham Huy Anh; Nguyen Thanh Nam


    In this paper, a novel forward adaptive neural MIMO NARX model is used for modelling and identifying the forward kinematics of an industrial 3‐DOF robot arm system. The nonlinear features of the forward kinematics of the industrial robot arm drive are thoroughly modelled based on the forward adaptive neural NARX model‐based identification process using experimental input‐output training data. This paper proposes a novel use of a back propagation (BP) algorithm to generate the forward neural M...

  16. The preliminary of software development for the kinematics analysis of 5 DOF Nuclear Malaysia robot arm v2

    International Nuclear Information System (INIS)

    Mohd Zaid Hassan; Anwar Abdul Rahman; Rosli Darmawan; Mohd Arif Hamzah


    This paper presents the preliminary software development for the kinematics analysis of 5 DOF rescue robot. The kinematics analysis is the study of relationship between the individual joints of the robot manipulator, the position and orientation of the end-effector. The Denavit-Hartenberg (DH) model is used to model the robot links and joints. Both forward and inverse kinematic are presented. The simulation software has been developed by using MATLAB to solve the robot arms kinematic behavior. (author)

  17. A Tabular Format for Computing Inverse Kinematic Equations for a 3DOF Robot Leg

    Directory of Open Access Journals (Sweden)

    F. Nickols


    Full Text Available A method is presented for accurately computing the three servomechanism angles that place the leg tip of a 3DOF robot leg in cylindrical coordinate space, R, θ, Z. The method is characterized by (i a multivariable integer power series for each degree of freedom that can be used to replace traditional trigonometrical functions, and, (ii only integer numbers are used. A technique is shown that derives the coefficients, Ci j k, of each of the terms in the series that represents a servomechanism angle, S. This power series method has the advantage of; (i satisfying accuracy requirements, (ii producing a unique solution, (iii high speed realtime computation, (iv low memory requirement and (v implementation into a generic algorithm or hardware such as a field programmable gate array. The series can represent many continuous kinematic systems just by changing the values of the coefficients. The coefficients are rapidly computed via a spreadsheet. The method can be extended to more than three degrees of freedom and also mapped into other coordinate frames such as a Cartesian or spherical.

  18. Dimensional synthesis of a 3-DOF parallel manipulator with full circle rotation (United States)

    Ni, Yanbing; Wu, Nan; Zhong, Xueyong; Zhang, Biao


    Parallel robots are widely used in the academic and industrial fields. In spite of the numerous achievements in the design and dimensional synthesis of the low-mobility parallel robots, few research efforts are directed towards the asymmetric 3-DOF parallel robots whose end-effector can realize 2 translational and 1 rotational(2T1R) motion. In order to develop a manipulator with the capability of full circle rotation to enlarge the workspace, a new 2T1R parallel mechanism is proposed. The modeling approach and kinematic analysis of this proposed mechanism are investigated. Using the method of vector analysis, the inverse kinematic equations are established. This is followed by a vigorous proof that this mechanism attains an annular workspace through its circular rotation and 2 dimensional translations. Taking the first order perturbation of the kinematic equations, the error Jacobian matrix which represents the mapping relationship between the error sources of geometric parameters and the end-effector position errors is derived. With consideration of the constraint conditions of pressure angles and feasible workspace, the dimensional synthesis is conducted with a goal to minimize the global comprehensive performance index. The dimension parameters making the mechanism to have optimal error mapping and kinematic performance are obtained through the optimization algorithm. All these research achievements lay the foundation for the prototype building of such kind of parallel robots.

  19. Optimal Design of a 3-DOF Cable-Driven Upper Arm Exoskeleton

    Directory of Open Access Journals (Sweden)

    Zhu-Feng Shao


    Full Text Available With outstanding advantages, such as large workspace, flexibility, and lightweight and low inertia, cable-driven parallel manipulator shows great potential for application as the exoskeleton rehabilitation robot. However, the optimal design is still a challenging problem to be solved. In this paper, the optimal design of a 3-DOF (3-degree-of-freedom cable-driven upper arm exoskeleton is accomplished considering the force exerted on the arm. After analysis of the working conditions, two promising configurations of the cable-driven upper arm exoskeleton are put forward and design parameters are simplified. Then, candidate ranges of two angle parameters are determined with the proposed main workspace requirement. Further, global force indices are defined to evaluate the force applied to the arm by the exoskeleton, in order to enhance the system safety and comfort. Finally, the optimal design of each configuration is obtained with proposed force indices. In addition, atlases and charts given in this paper well illustrate trends of workspace and force with different values of design parameters.

  20. A fuzzy PID-controlled SMA actuator for a two-DOF joint

    Directory of Open Access Journals (Sweden)

    Shi Zhenyun


    Full Text Available Shape memory alloy (SMA actuator is a potential advanced component for servo-systems of aerospace vehicles and aircraft. This paper presents a joint with two degrees of freedom (DOF and a mobility range close to ±60° when driven by SMA triple wires. The fuzzy proportional-integral-derivative (PID-controlled actuator drive was designed using antagonistic SMA triple wires, and the resistance feedback signal made a closed loop. Experiments showed that, with the driving responding frequency increasing, the overstress became harder to be avoided at the position under the maximum friction force. Furthermore, the hysteresis gap between the heating and cooling paths of the strain-to-resistance curve expanded under this condition. A fuzzy logic control was considered as a solution, and the curves of the wires were then modeled by fitting polynomials so that the measured resistance was used directly to determine the control signal. Accurate control was demonstrated through the step response, and the experimental results showed that under the fuzzy PID-control program, the mean absolute error (MAE of the rotation angle was about 3.147°. In addition, the investigation of the external interference to the system proved the controllable maximum output.

  1. Design of a 4-DOF MR haptic master for application to robot surgery: virtual environment work (United States)

    Oh, Jong-Seok; Choi, Seung-Hyun; Choi, Seung-Bok


    This paper presents the design and control performance of a novel type of 4-degrees-of-freedom (4-DOF) haptic master in cyberspace for a robot-assisted minimally invasive surgery (RMIS) application. By using a controllable magnetorheological (MR) fluid, the proposed haptic master can have a feedback function for a surgical robot. Due to the difficulty in utilizing real human organs in the experiment, the cyberspace that features the virtual object is constructed to evaluate the performance of the haptic master. In order to realize the cyberspace, a volumetric deformable object is represented by a shape-retaining chain-linked (S-chain) model, which is a fast volumetric model and is suitable for real-time applications. In the haptic architecture for an RMIS application, the desired torque and position induced from the virtual object of the cyberspace and the haptic master of real space are transferred to each other. In order to validate the superiority of the proposed master and volumetric model, a tracking control experiment is implemented with a nonhomogenous volumetric cubic object to demonstrate that the proposed model can be utilized in real-time haptic rendering architecture. A proportional-integral-derivative (PID) controller is then designed and empirically implemented to accomplish the desired torque trajectories. It has been verified from the experiment that tracking the control performance for torque trajectories from a virtual slave can be successfully achieved.

  2. Spacecraft attitude maneuver control using two parallel mounted 3-DOF spherical actuators

    Directory of Open Access Journals (Sweden)

    Guidan Li


    Full Text Available A parallel configuration using two 3-degree-of-freedom (3-DOF spherical electromagnetic momentum exchange actuators is investigated for large angle spacecraft attitude maneuvers. First, the full dynamic equations of motion for the spacecraft system are derived by the Newton-Euler method. To facilitate computation, virtual gimbal coordinate frames are established. Second, a nonlinear control law in terms of quaternions is developed via backstepping method. The proposed control law compensates the coupling torques arising from the spacecraft rotation, and is robust against the external disturbances. Then, the singularity problem is analyzed. To avoid singularities, a modified weighed Moore-Pseudo inverse velocity steering law based on null motion is proposed. The weighted matrices are carefully designed to switch the actuators and redistribute the control torques. The null motion is used to reorient the rotor away from the tilt angle saturation state. Finally, numerical simulations of rest-to-rest maneuvers are performed to validate the effectiveness of the proposed method.

  3. Design of human controlled 1 DOF right hand exoskeleton using electromyography signal (United States)

    Azzam, M.; Wijaya, S. K.; Prawito


    Exoskeleton in general is a structure that is anatomically designed to be able to accommodate the physical movement of its user and provide additional strength. The use of EMG signal to control a 1 DOF right arm exoskeleton is evaluated in this research. This research aims to achieve optimum control using EMG signal. EMG signal is a variation of voltage that occurs when muscle contracts hence its strong correlation with the user's intention of movement. The RMS values of each EMG signal that originates from bicep and tricep muscle are calculated and processed to determine the direction and speed of rotation of a DC motor that actuates the exoskeleton. The RMS calculation is conducted at various array length that will theoretically affect its accuracy. The difference between those two RMS values is then calculated and interpreted as the intention of flexion or extension movement that will control the DC motor rotational direction. The absolute value of the RMS difference multiplied with a gain factor is used to regulate the duty cycle of a PWM signal that is used to control the rotational speed of the DC motor. To achieve the smallest settling time, array length and gain factor were varied. The test was conducted in two stages, static and dynamic tests. The test result shows a trend where the settling time decreases when array length is shortened and gain is increased. It shows that optimum control can be achieved by selecting the right array length and gain.

  4. A 2-Dof LQR based PID controller for integrating processes considering robustness/performance tradeoff. (United States)

    Srivastava, Saurabh; Pandit, V S


    This paper focuses on the analytical design of a Proportional Integral and Derivative (PID) controller together with a unique set point filter that makes the overall Two-Degree of-Freedom (2-Dof) control system for integrating processes with time delay. The PID controller tuning is based on the Linear Quadratic Regulator (LQR) using dominant pole placement approach to obtain good regulatory response. The set point filter is designed with the calculated PID parameters and using a single filter time constant (λ) to precisely control the servo response. The effectiveness of the proposed methodology is demonstrated through a series of illustrative examples using real industrial integrated process models. The whole range of PID parameters is obtained for each case in a tradeoff between the robustness of the closed loop system measured in terms of Maximum Sensitivity (M s ) and the load disturbance measured in terms of Integral of Absolute Errors (IAE). Results show improved closed loop response in terms of regulatory and servo responses with less control efforts when compared with the latest PID tuning methods of integrating systems. Copyright © 2017 ISA. Published by Elsevier Ltd. All rights reserved.

  5. A combined vision-inertial fusion approach for 6-DoF object pose estimation (United States)

    Li, Juan; Bernardos, Ana M.; Tarrío, Paula; Casar, José R.


    The estimation of the 3D position and orientation of moving objects (`pose' estimation) is a critical process for many applications in robotics, computer vision or mobile services. Although major research efforts have been carried out to design accurate, fast and robust indoor pose estimation systems, it remains as an open challenge to provide a low-cost, easy to deploy and reliable solution. Addressing this issue, this paper describes a hybrid approach for 6 degrees of freedom (6-DoF) pose estimation that fuses acceleration data and stereo vision to overcome the respective weaknesses of single technology approaches. The system relies on COTS technologies (standard webcams, accelerometers) and printable colored markers. It uses a set of infrastructure cameras, located to have the object to be tracked visible most of the operation time; the target object has to include an embedded accelerometer and be tagged with a fiducial marker. This simple marker has been designed for easy detection and segmentation and it may be adapted to different service scenarios (in shape and colors). Experimental results show that the proposed system provides high accuracy, while satisfactorily dealing with the real-time constraints.

  6. Co-simulation of Six DOF Wire Driven Parallel Mechanism Based on ADAMS and Matlab

    Directory of Open Access Journals (Sweden)

    Tang Aofei


    Full Text Available The dynamic model of the 6 DOF Wire Driven Parallel Mechanism (WDPM system is introduced. Based on MATLAB system, the simulation of the inverse dynamic model is achieved. According to the simulation result, the mechanical model for the WDPM system is reasonable. Using ADAMS system, the dynamic model of the virtual prototype is verified by the simulation analysis. The combined control model based on ADAMS/Simulink is derived. The WDPM control system is designed with MATLAB/Simulink. The torque control method is selected for the outer ring and the PD control method for the inner ring. Combined with the ADAMS control model and control law design, the interactive simulation analysis of the WDPM system is completed. According to the simulation results of the spatial circle tracking and line tracking at the end of the moving platform, the tracking error can be reduced by the designed control algorithm. The minimum tracking error is 0.2 mm to 0.3 mm. Therefore, the theoretical foundation for designing hardware systems of the WDPM control system is established.

  7. A 6-DOF parallel bone-grinding robot for cervical disc replacement surgery. (United States)

    Tian, Heqiang; Wang, Chenchen; Dang, Xiaoqing; Sun, Lining


    Artificial cervical disc replacement surgery has become an effective and main treatment method for cervical disease, which has become a more common and serious problem for people with sedentary work. To improve cervical disc replacement surgery significantly, a 6-DOF parallel bone-grinding robot is developed for cervical bone-grinding by image navigation and surgical plan. The bone-grinding robot including mechanical design and low level control is designed. The bone-grinding robot navigation is realized by optical positioning with spatial registration coordinate system defined. And a parametric robot bone-grinding plan and high level control have been developed for plane grinding for cervical top endplate and tail endplate grinding by a cylindrical grinding drill and spherical grinding for two articular surfaces of bones by a ball grinding drill. Finally, the surgical flow for a robot-assisted cervical disc replacement surgery procedure is present. The final experiments results verified the key technologies and performance of the robot-assisted surgery system concept excellently, which points out a promising clinical application with higher operability. Finally, study innovations, study limitations, and future works of this present study are discussed, and conclusions of this paper are also summarized further. This bone-grinding robot is still in the initial stage, and there are many problems to be solved from a clinical point of view. Moreover, the technique is promising and can give a good support for surgeons in future clinical work.

  8. Synchronization of multiple 3-DOF helicopters under actuator faults and saturations with prescribed performance. (United States)

    Yang, Huiliao; Jiang, Bin; Yang, Hao; Liu, Hugh H T


    The distributed cooperative control strategy is proposed to make the networked nonlinear 3-DOF helicopters achieve the attitude synchronization in the presence of actuator faults and saturations. Based on robust adaptive control, the proposed control method can both compensate the uncertain partial loss of control effectiveness and deal with the system uncertainties. To address actuator saturation problem, the control scheme is designed to ensure that the saturation constraint on the actuation will not be violated during the operation in spite of the actuator faults. It is shown that with the proposed control strategy, both the tracking errors of the leading helicopter and the attitude synchronization errors of each following helicopter are bounded in the existence of faulty actuators and actuator saturations. Moreover, the state responses of the entire group would not exceed the predesigned performance functions which are totally independent from the underlaying interaction topology. Simulation results illustrate the effectiveness of the proposed control scheme. Copyright © 2018 ISA. Published by Elsevier Ltd. All rights reserved.

  9. Design of a New 4-DOF Haptic Master Featuring Magnetorheological Fluid

    Directory of Open Access Journals (Sweden)

    Byung-Keun Song


    Full Text Available This work presents a novel 4-degree-of-freedom (4-DOF haptic master using magnetorheological (MR fluid which is applicable to a robot-assisted minimally invasive surgery (RMIS system. By using MR fluid, the proposed haptic device can easily generate bidirectional repulsive torque along the directions of the required motions. The proposed master consists of two actuators: an MR bidirectional clutch associated with a planetary gear system and an MR clutch with a bevel gear system. After demonstrating the configuration, the torque models of MR actuators are mathematically derived based on the field-dependent Bingham model. An optimal design that accounts for spatial-limitation and the desired torque constraint is then undertaken. An optimization procedure based on finite element analysis is proposed to determine optimal geometric dimensions. Based on the design procedure, MR haptic master with the optimal parameters has been manufactured. In order to demonstrate the practical feasibility of the proposed haptic master, the field-dependent generating repulsive force is measured. In addition, a proportional-integral-derivative (PID controller is empirically implemented to accomplish the desired torque trajectories. It has been shown that the proposed haptic master can track the desired torque trajectory without a significant error.

  10. Two improvements on numerical simulation of 2-DOF vortex-induced vibration with low mass ratio (United States)

    Kang, Zhuang; Ni, Wen-chi; Zhang, Xu; Sun, Li-ping


    Till now, there have been lots of researches on numerical simulation of vortex-induced vibration. Acceptable results have been obtained for fixed cylinders with low Reynolds number. However, for responses of 2-DOF vortex-induced vibration with low mass ratio, the accuracy is not satisfactory, especially for the maximum amplitudes. In Jauvtis and Williamson's work, the maximum amplitude of the cylinder with low mass ratio m*=2.6 can reach as large as 1.5 D to be called as the "super-upper branch", but from current literatures, few simulation results can achieve such value, even fail to capture the upper branch. Besides, it is found that the amplitude decays too fast in the lower branch with the RANS-based turbulence model. The reason is likely to be the defects of the turbulence model itself in the prediction of unsteady separated flows as well as the unreasonable setting of the numerical simulation parameters. Aiming at above issues, a modified turbulence model is proposed in this paper, and the effect of the acceleration of flow field on the response of vortex-induced vibration is studied based on OpenFOAM. By analyzing the responses of amplitude, phase and trajectory, frequency and vortex mode, it is proved that the vortex-induced vibration can be predicted accurately with the modified turbulence model under appropriate flow field acceleration.

  11. Some aspects of floor spectra of 1DOF nonlinear primary structures

    International Nuclear Information System (INIS)

    Politopoulos, I.; Feau, C.


    In this paper the influence of the nonlinear behaviour of the primary structure on floor spectra is investigated by means of simple models. The general trends of floor spectra for different types of nonlinear behaviour of one degree of freedom (1DOF) primary structure are shown and we point out their common futures and their differences. A special attention is given to the cases of elastoplastic and nonlinear elastic behaviours and methods to determine an equivalent linear oscillator are proposed. The properties (frequency and damping) of this equivalent linear oscillator are quite different from the properties of equivalent linear oscillators commonly considered in practice. In particular, in the case of elastoplastic behaviour, there is no frequency shift and damping is smaller than assumed by other methods commonly used. In the case of nonlinear elastic behaviour, the concept of an equivalent frequency which is a random variable is used. Finally, a design floor spectrum of primary structures, exhibiting energy dissipating nonlinear behaviour is proposed. (authors)

  12. Analysis and experiments of a novel and compact 3-DOF precision positioning platform

    International Nuclear Information System (INIS)

    Huang, Hu; Zhao, Hongwei; Fan, Zunqiang; Zhang, Hui; Ma, Zhichao; Yang, Zhaojun


    A novel 3-DOF precision positioning platform with dimensions of 48 mm X 50 mm X 35 mm was designed by integrating piezo actuators and flexure hinges. The platform has a compact structure but it can do high precision positioning in three axes. The dynamic model of the platform in a single direction was established. Stiffness of the flexure hinges and modal characteristics of the flexure hinge mechanism were analyzed by the finite element method. Output displacements of the platform along three axes were forecasted via stiffness analysis. Output performance of the platform in x and y axes with open-loop control as well as the z-axis with closed-loop control was tested and discussed. The preliminary application of the platform in the field of nanoindentation indicates that the designed platform works well during nanoindentation tests, and the closed-loop control ensures the linear displacement output. With suitable control, the platform has the potential to realize different positioning functions under various working conditions.

  13. Design of a 4-DOF MR haptic master for application to robot surgery: virtual environment work

    International Nuclear Information System (INIS)

    Oh, Jong-Seok; Choi, Seung-Hyun; Choi, Seung-Bok


    This paper presents the design and control performance of a novel type of 4-degrees-of-freedom (4-DOF) haptic master in cyberspace for a robot-assisted minimally invasive surgery (RMIS) application. By using a controllable magnetorheological (MR) fluid, the proposed haptic master can have a feedback function for a surgical robot. Due to the difficulty in utilizing real human organs in the experiment, the cyberspace that features the virtual object is constructed to evaluate the performance of the haptic master. In order to realize the cyberspace, a volumetric deformable object is represented by a shape-retaining chain-linked (S-chain) model, which is a fast volumetric model and is suitable for real-time applications. In the haptic architecture for an RMIS application, the desired torque and position induced from the virtual object of the cyberspace and the haptic master of real space are transferred to each other. In order to validate the superiority of the proposed master and volumetric model, a tracking control experiment is implemented with a nonhomogenous volumetric cubic object to demonstrate that the proposed model can be utilized in real-time haptic rendering architecture. A proportional-integral-derivative (PID) controller is then designed and empirically implemented to accomplish the desired torque trajectories. It has been verified from the experiment that tracking the control performance for torque trajectories from a virtual slave can be successfully achieved. (paper)

  14. Design of a 7-DOF haptic master using a magneto-rheological devices for robot surgery (United States)

    Kang, Seok-Rae; Choi, Seung-Bok; Hwang, Yong-Hoon; Cha, Seung-Woo


    This paper presents a 7 degrees-of-freedom (7-DOF) haptic master which is applicable to the robot-assisted minimally invasive surgery (RMIS). By utilizing a controllable magneto-rheological (MR) fluid, the haptic master can provide force information to the surgeon during surgery. The proposed haptic master consists of three degrees motions of X, Y, Z and four degrees motions of the pitch, yaw, roll and grasping. All of them have force feedback capability. The proposed haptic master can generate the repulsive forces or torques by activating MR clutch and MR brake. Both MR clutch and MR brake are designed and manufactured with consideration of the size and output torque which is usable to the robotic surgery. A proportional-integral-derivative (PID) controller is then designed and implemented to achieve torque/force tracking trajectories. It is verified that the proposed haptic master can track well the desired torque and force occurred in the surgical place by controlling the input current applied to MR clutch and brake.

  15. Activation of a development-specific gene, dofA, by FruA, an essential transcription factor for development of Myxococcus xanthus. (United States)

    Ueki, Toshiyuki; Inouye, Sumiko


    FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development.

  16. Activation of a Development-Specific Gene, dofA, by FruA, an Essential Transcription Factor for Development of Myxococcus xanthus


    Ueki, Toshiyuki; Inouye, Sumiko


    FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development.

  17. A 3-DOF parallel robot with spherical motion for the rehabilitation and evaluation of balance performance. (United States)

    Patanè, Fabrizio; Cappa, Paolo


    In this paper a novel electrically actuated parallel robot with three degrees-of-freedom (3 DOF) for dynamic postural studies is presented. The design has been described, the solution to the inverse kinematics has been found, and a numerical solution for the direct kinematics has been proposed. The workspace of the implemented robot is characterized by an angular range of motion of about ±10° for roll and pitch when yaw is in the range ±15°. The robot was constructed and the orientation accuracy was tested by means of an optoelectronic system and by imposing a sinusoidal input, with a frequency of 1 Hz and amplitude of 10°, along the three axes, in sequence. The collected data indicated a phase delay of 1° and an amplitude error of 0.5%-1.5%; similar values were observed for cross-axis sensitivity errors. We also conducted a clinical application on a group of normal subjects, who were standing in equilibrium on the robot base with eyes open (EO) and eyes closed (EC), which was rotated with a tri-axial sinusoidal trajectory with a frequency of 0.5 Hz and amplitude 5° for roll and pitch and 10° for the yaw. The postural configuration of the subjects was recorded with an optoelectronic system. However, due to the mainly technical nature of this paper, only initial validation outcomes are reported here. The clinical application showed that only the tilt and displacement on the sagittal pane of head, trunk, and pelvis in the trials conducted with eyes closed were affected by drift and that the reduction of the yaw rotation and of the mediolateral translation was not a controlled parameter, as happened, instead, for the other anatomical directions.

  18. 6DoF object pose measurement by a monocular manifold-based pattern recognition technique

    International Nuclear Information System (INIS)

    Kouskouridas, Rigas; Charalampous, Konstantinos; Gasteratos, Antonios


    In this paper, a novel solution to the compound problem of object recognition and 3D pose estimation is presented. An accurate measurement of the geometrical configuration of a recognized target, relative to a known coordinate system, is of fundamental importance and constitutes a prerequisite for several applications such as robot grasping or obstacle avoidance. The proposed method lays its foundations on the following assumptions: (a) the same object captured under varying viewpoints and perspectives represents data that could be projected onto a well-established and highly distinguishable subspace; (b) totally different objects observed under the same viewpoints and perspectives share identical 3D pose that can be sufficiently modeled to produce a generalized model. Toward this end, we propose an advanced architecture that allows both recognizing patterns and providing efficient solution for 6DoF pose estimation. We employ a manifold modeling architecture that is grounded on a part-based representation of an object, which in turn, is accomplished via an unsupervised clustering of the extracted visual cues. The main contributions of the proposed framework are: (a) the proposed part-based architecture requires minimum supervision, compared to other contemporary solutions, whilst extracting new features encapsulating both appearance and geometrical attributes of the objects; (b) contrary to related projects that extract high-dimensional data, thus, increasing the complexity of the system, the proposed manifold modeling approach makes use of low dimensionality input vectors; (c) the formulation of a novel input–output space mapping that outperforms the existing dimensionality reduction schemes. Experimental results justify our theoretical claims and demonstrate the superiority of our method comparing to other related contemporary projects. (paper)

  19. System for simultaneously measuring 6DOF geometric motion errors using a polarization maintaining fiber-coupled dual-frequency laser. (United States)

    Cui, Cunxing; Feng, Qibo; Zhang, Bin; Zhao, Yuqiong


    A novel method for simultaneously measuring six degree-of-freedom (6DOF) geometric motion errors is proposed in this paper, and the corresponding measurement instrument is developed. Simultaneous measurement of 6DOF geometric motion errors using a polarization maintaining fiber-coupled dual-frequency laser is accomplished for the first time to the best of the authors' knowledge. Dual-frequency laser beams that are orthogonally linear polarized were adopted as the measuring datum. Positioning error measurement was achieved by heterodyne interferometry, and other 5DOF geometric motion errors were obtained by fiber collimation measurement. A series of experiments was performed to verify the effectiveness of the developed instrument. The experimental results showed that the stability and accuracy of the positioning error measurement are 31.1 nm and 0.5 μm, respectively. For the straightness error measurements, the stability and resolution are 60 and 40 nm, respectively, and the maximum deviation of repeatability is ± 0.15 μm in the x direction and ± 0.1 μm in the y direction. For pitch and yaw measurements, the stabilities are 0.03″ and 0.04″, the maximum deviations of repeatability are ± 0.18″ and ± 0.24″, and the accuracies are 0.4″ and 0.35″, respectively. The stability and resolution of roll measurement are 0.29″ and 0.2″, respectively, and the accuracy is 0.6″.

  20. The Microsoft Visual Studio Software Development For 5 DOF Nuclear Malaysia Robot Arm V2 Control System

    International Nuclear Information System (INIS)

    Mohd Zaid Hassan; Anwar Abdul Rahman; Azraf Azman; Mohd Rizal Mamat; Mohd Arif Hamzah


    This paper presents the Microsoft visual studio development for 5DOF Nuclear Malaysia Robot Arm V2 control system. The kinematics analysis is the study of the relationship between the individual joints of robot manipulator, the position and orientation of the end-effector. The Denavit-Hartenberg (DH) model is used to model the robot links and joints. Both forward and inverse kinematic are presented. The simulation software has been developed by using Microsoft visual studio to solve the robot arms kinematic behavior. (author)

  1. Estimation of continuous multi-DOF finger joint kinematics from surface EMG using a multi-output Gaussian Process. (United States)

    Ngeo, Jimson; Tamei, Tomoya; Shibata, Tomohiro


    Surface electromyographic (EMG) signals have often been used in estimating upper and lower limb dynamics and kinematics for the purpose of controlling robotic devices such as robot prosthesis and finger exoskeletons. However, in estimating multiple and a high number of degrees-of-freedom (DOF) kinematics from EMG, output DOFs are usually estimated independently. In this study, we estimate finger joint kinematics from EMG signals using a multi-output convolved Gaussian Process (Multi-output Full GP) that considers dependencies between outputs. We show that estimation of finger joints from muscle activation inputs can be improved by using a regression model that considers inherent coupling or correlation within the hand and finger joints. We also provide a comparison of estimation performance between different regression methods, such as Artificial Neural Networks (ANN) which is used by many of the related studies. We show that using a multi-output GP gives improved estimation compared to multi-output ANN and even dedicated or independent regression models.

  2. Towards Kilo-Hertz 6-DoF Visual Tracking Using an Egocentric Cluster of Rolling Shutter Cameras. (United States)

    Bapat, Akash; Dunn, Enrique; Frahm, Jan-Michael


    To maintain a reliable registration of the virtual world with the real world, augmented reality (AR) applications require highly accurate, low-latency tracking of the device. In this paper, we propose a novel method for performing this fast 6-DOF head pose tracking using a cluster of rolling shutter cameras. The key idea is that a rolling shutter camera works by capturing the rows of an image in rapid succession, essentially acting as a high-frequency 1D image sensor. By integrating multiple rolling shutter cameras on the AR device, our tracker is able to perform 6-DOF markerless tracking in a static indoor environment with minimal latency. Compared to state-of-the-art tracking systems, this tracking approach performs at significantly higher frequency, and it works in generalized environments. To demonstrate the feasibility of our system, we present thorough evaluations on synthetically generated data with tracking frequencies reaching 56.7 kHz. We further validate the method's accuracy on real-world images collected from a prototype of our tracking system against ground truth data using standard commodity GoPro cameras capturing at 120 Hz frame rate.

  3. Sistem Kontrol Robot Arm 5 DOF Berbasis Pengenalan Pola Suara Menggunakan Mel-Frequency Cepstrum Coefficients (MFCC dan Adaptive Neuro-Fuzzy Inference System (ANFIS

    Directory of Open Access Journals (Sweden)

    WS Mada Sanjaya


    Full Text Available Telah dilakukan penelitian yang menggambarkan implementasi pengenalan pola suara untuk mengontrol gerak robot arm 5 DoF dalam mengambil dan menyimpan benda. Dalam penelitian ini metode yang digunakan adalah Mel-Frequency Cepstrum Coefficients (MFCC dan Adaptive Neuro-Fuzzy Inferense System (ANFIS. Metode MFCC digunakan untuk ekstraksi ciri sinyal suara, sedangkan ANFIS digunakan sebagai metode pembelajaran untuk pengenalan pola suara. Pada proses pembelajaran ANFIS data latih yang digunakan sebanyak 6 ciri. Data suara terlatih dan data suara tak terlatih digunakan untuk pengujian sistem pengenalan pola suara. Hasil pengujian menunjukkan tingkat keberhasilan, untuk data suara terlatih sebesar 87,77% dan data tak terlatih sebesar 78,53%. Sistem pengenalan pola suara ini telah diaplikasikan dengan baik untuk mengerakan robot arm 5 DoF berbasis mikrokontroler Arduino. Have been implemented of sound pattern recognition to control 5 DoF of Arm Robot to pick and place an object. In this research used Mel-Frequency Cepstrum Coefficients (MFCC and Adaptive Neuro-Fuzzy Interferense System (ANFIS methods. MFCC method used for features extraction of sound signal, meanwhile ANFIS used to learn sound pattern recognition. On ANFIS method data learning use 6 features. Trained and not trained data used to examine the system of sound pattern identification. The result show the succesfull level, for trained data 87.77% and for not trained data 78.53%. Sound pattern identification system was appliedto controlled 5 DoF arm robot based Arduino microcontroller.

  4. Nonlinear Dynamics and Bifurcation Behavior of a 2-DOF Spring Resonator with End Stopper for Energy Harvesting

    Directory of Open Access Journals (Sweden)

    El Aroudi A.


    Full Text Available In this paper, the model of a two-degree-of-freedom (2-DOF spring resonator with end stopper for an energy harvesting application is presented. Then we characterize its nonlinear dynamical behavior by numerical simulations when some suitable parameters are varied. The system is formed by two resonators subject to external vibrational excitation and with an end stopper. We present the continuous time dynamical model of the system in the form of a switched fourth order differential equation. Harmonic vibrations are considered as the main ambient energy source for the system and its frequency response representing the RMS value of the displacement is first computed. The dynamical behavior is unveiled by computing state-space trajectories, timedomain series and FFT spectra and frequency response as the excitation amplitude is varied.

  5. Telerobotic control of a dextrous manipulator using master and six-DOF hand-controllers for space assembly and servicing tasks (United States)

    O'Hara, John M.


    Two studies were conducted evaluating methods of controlling a telerobot; bilateral force reflecting master controllers and proportional rate six degrees of freedom (DOF) hand controllers. The first study compared the controllers on performance of single manipulator arm tasks, a peg-in-the-hole task, and simulated satellite orbital replacement unit changeout. The second study, a Space Station truss assembly task, required simultaneous operation of both manipulator arms (all 12 DOFs) and complex multiaxis slave arm movements. Task times were significantly longer and fewer errors were committed with the hand controllers. The hand controllers were also rated significantly higher in cognitive and manual control workload on the two-arm task. The master controllers were rated significantly higher in physical workload. There were no significant differences in ratings of manipulator control quality.

  6. A Reconfigurable System Approach to the Direct Kinematics of a 5 D.o.f Robotic Manipulator

    Directory of Open Access Journals (Sweden)

    Diego F. Sánchez


    Full Text Available Hardware acceleration in high performance computer systems has a particular interest for many engineering and scientific applications in which a large number of arithmetic operations and transcendental functions must be computed. In this paper a hardware architecture for computing direct kinematics of robot manipulators with 5 degrees of freedom (5 D.o.f using floating-point arithmetic is presented for 32, 43, and 64 bit-width representations and it is implemented in Field Programmable Gate Arrays (FPGAs. The proposed architecture has been developed using several floating-point libraries for arithmetic and transcendental functions operators, allowing the designer to select (pre-synthesis a suitable bit-width representation according to the accuracy and dynamic range, as well as the area, elapsed time and power consumption requirements of the application. Synthesis results demonstrate the effectiveness and high performance of the implemented cores on commercial FPGAs. Simulation results have been addressed in order to compute the Mean Square Error (MSE, using the Matlab as statistical estimator, validating the correct behavior of the implemented cores. Additionally, the processing time of the hardware architecture was compared with the same formulation implemented in software, using the PowerPC (FPGA embedded processor, demonstrating that the hardware architecture speeds-up by factor of 1298 the software implementation.

  7. Design and analysis of a 3-DOF planar micromanipulation stage with large rotational displacement for micromanipulation system

    Directory of Open Access Journals (Sweden)

    B. Ding


    Full Text Available Flexure-based mechanisms have been widely used for scanning tunneling microscopy, nanoimprint lithography, fast servo tool system and micro/nano manipulation. In this paper, a novel planar micromanipulation stage with large rotational displacement is proposed. The designed monolithic manipulator has three degrees of freedom (DOF, i.e. two translations along the X and Y axes and one rotation around Z axis. In order to get a large workspace, the lever mechanism is adopted to magnify the stroke of the piezoelectric actuators and also the leaf beam flexure is utilized due to its large rotational scope. Different from conventional pre-tightening mechanism, a modified pre-tightening mechanism, which is less harmful to the stacked actuators, is proposed in this paper. Taking the circular flexure hinges and leaf beam flexures hinges as revolute joints, the forward kinematics and inverse kinematics models of this stage are derived. The workspace of the micromanipulator is finally obtained, which is based on the derived kinematic models.

  8. Systematic Design Method and Experimental Validation of a 2-DOF Compliant Parallel Mechanism with Excellent Input and Output Decoupling Performances

    Directory of Open Access Journals (Sweden)

    Yao Jiang


    Full Text Available The output and input coupling characteristics of the compliant parallel mechanism (CPM bring difficulty in the motion control and challenge its high performance and operational safety. This paper presents a systematic design method for a 2-degrees-of-freedom (DOFs CPM with excellent decoupling performance. A symmetric kinematic structure can guarantee a CPM with a complete output decoupling characteristic; input coupling is reduced by resorting to a flexure-based decoupler. This work discusses the stiffness design requirement of the decoupler and proposes a compound flexure hinge as its basic structure. Analytical methods have been derived to assess the mechanical performances of the CPM in terms of input and output stiffness, motion stroke, input coupling degree, and natural frequency. The CPM’s geometric parameters were optimized to minimize the input coupling while ensuring key performance indicators at the same time. The optimized CPM’s performances were then evaluated by using a finite element analysis. Finally, a prototype was constructed and experimental validations were carried out to test the performance of the CPM and verify the effectiveness of the design method. The design procedure proposed in this paper is systematic and can be extended to design the CPMs with other types of motion.

  9. Five-DOF innovative linear MagLev slider to account for pitch, tilt and load uncertainty (United States)

    Kao, Yi-Ming; Tsai, Nan-Chyuan; Chiu, Hsin-Lin


    This paper is focused at position deviation regulation upon a slider by Fuzzy Sliding Mode Control (FSMC). Five Degrees Of Freedom (DOF) of position deviation are required to be regulated except for the direction (i.e., X-axis) in which the slider moves forward and backward. Totally 8 sets of Magnetic Actuators (MAs) and an Electro-Pneumatic Transducer (EPT) are employed to drive the slider carrying loads under the commands of FSMC. EPT is applied to adjust the pressure of compressed air to counterbalance the weight of slider itself. At first, the system dynamic model of slider, including load uncertainty and load position uncertainty, is established. Intensive computer simulations are undertaken to verify the validity of proposed control strategy. Finally, a prototype of realistic slider position deviation regulation system is successfully built up. According to the experiments by cooperation of pneumatic and magnetic control, the actual linear position deviations of slider can be regulated within ±8 μm and angular position deviations within ±1 mini-degrees. From the viewpoint of energy consumption, the applied currents to 8 sets of MAs are all below 1.2 A. To sum up, the closed-loop levitation system by cooperation of pneumatic and magnetic control is capable to account for load uncertainty and uncertainty of the standing position of load to be carried.

  10. Aerodynamic Drag Analysis of 3-DOF Flex-Gimbal GyroWheel System in the Sense of Ground Test (United States)

    Huo, Xin; Feng, Sizhao; Liu, Kangzhi; Wang, Libin; Chen, Weishan


    GyroWheel is an innovative device that combines the actuating capabilities of a control moment gyro with the rate sensing capabilities of a tuned rotor gyro by using a spinning flex-gimbal system. However, in the process of the ground test, the existence of aerodynamic disturbance is inevitable, which hinders the improvement of the specification performance and control accuracy. A vacuum tank test is a possible candidate but is sometimes unrealistic due to the substantial increase in costs and complexity involved. In this paper, the aerodynamic drag problem with respect to the 3-DOF flex-gimbal GyroWheel system is investigated by simulation analysis and experimental verification. Concretely, the angular momentum envelope property of the spinning rotor system is studied and its integral dynamical model is deduced based on the physical configuration of the GyroWheel system with an appropriately defined coordinate system. In the sequel, the fluid numerical model is established and the model geometries are checked with FLUENT software. According to the diversity and time-varying properties of the rotor motions in three-dimensions, the airflow field around the GyroWheel rotor is analyzed by simulation with respect to its varying angular velocity and tilt angle. The IPC-based experimental platform is introduced, and the properties of aerodynamic drag in the ground test condition are obtained through comparing the simulation with experimental results. PMID:27941602

  11. Design of a Simple and Modular 2-DOF Ankle Physiotherapy Device Relying on a Hybrid Serial-Parallel Robotic Architecture

    Directory of Open Access Journals (Sweden)

    Christos E. Syrseloudis


    Full Text Available The aim of this work is to propose a new 2-DOF robotic platform with hybrid parallel-serial structure and to undertake its parametric design so that it can follow the whole range of ankle related foot movements. This robot can serve as a human ankle rehabilitation device. The existing ankle rehabilitation devices present typically one or more of the following shortcomings: redundancy, large size, or high cost, hence the need for a device that could offer simplicity, modularity, and low cost of construction and maintenance. In addition, our targeted device must be safe during operation, disallow undesirable movements of the foot, while adaptable to any human foot. Our detailed study of foot kinematics has led us to a new hybrid architecture, which strikes a balance among all aforementioned goals. It consists of a passive serial kinematics chain with two adjustable screws so that the axes of the chain match the two main ankle-axes of typical feet. An active parallel chain, which consists of two prismatic actuators, provides the movement of the platform. Thus, the platform can follow the foot movements, thanks to the passive chain, and also possesses the advantages of parallel robots, including rigidity, high stiffness and force capabilities. The lack of redundancy yields a simpler device with lower size and cost. The paper describes the kinematics modelling of the platform and analyses the force and velocity transmission. The parametric design of the platform is carried out; our simulations confirm the platform's suitability for ankle rehabilitation.

  12. Design and Simulation of 5-DOF Vision-Based Manipulator to Increase Radiation Safety for Industrial Cobalt-60 Irradiators

    International Nuclear Information System (INIS)

    Solyman, A.E.; Keshk, A.B.; Sharshar, K.A.; Roman, M.R.


    Robotics has proved its efficiency in nuclear and radiation fields. Computer vision is one of the advanced approaches used to enhance robotic efficiency. The current work investigates the possibility of using a vision-based controlled arm robot to collect the fallen hot Cobalt-60 capsules inside wet storage pool of industrial irradiator. A 5-DOF arm robot is designed and vision algorithms are established to pick the fallen capsules on the bottom surface of the storage pool, read the information printed on its edge (cap) and move it to a safe storage place. Two object detection approaches are studied; RGB-based filter and background subtraction technique. Vision algorithms and camera calibration are done using MATLAB/SIMULINK program. Robot arm forward and inverse kinematics are developed and programmed using an embedded micro controller system. Experiments show the validity of the proposed system and prove its success. The collecting process will be done without interference of operators, hence radiation safety will be increased.

  13. Multi-Mode Vibration Suppression in MIMO Systems by Extending the Zero Placement Input Shaping Technique: Applications to a 3-DOF Piezoelectric Tube Actuator

    Directory of Open Access Journals (Sweden)

    Yasser Al Hamidi


    Full Text Available Piezoelectric tube actuators are extensively used in scanning probe microscopes to provide dynamic scanning motions in open-loop operations. Furthermore, they are employed as micropositioners due to their high bandwidth, high resolution and ease of excitation. However, these piezoelectric micropositioners exhibit badly damped vibrations that occur when the input excites the dynamic response, which tends to degrade positioning accuracy and performance. This paper deals with vibrations’ feedforward control of a multi-degrees of freedom (DOF piezoelectric micropositioner in order to damp the vibrations in the direct axes and to reduce the cross-couplings. The novelty in this paper relative to the existing vibrations feedforward controls is the simplicity in design approach, the minimal number of shaper impulses for each input required to damp all modes of vibration at each output, and the account for the strong cross-couplings which only occur in multi-DOF cases. A generalization to a multiple degrees of freedom actuator is first proposed. Then simulation runs on a 3-DOF piezoelectric tube micropositioner have been effectuated to demonstrate the efficiency of the proposed method. Finally, experimental tests were carried out to validate and to confirm the predicted simulation.

  14. Synchronized motion control and precision positioning compensation of a 3-DOFs macro-micro parallel manipulator fully actuated by piezoelectric actuators (United States)

    Zhang, Quan; Li, Chaodong; Zhang, Jiantao; Zhang, Xu


    The macro-micro combined approach, as an effective way to realize trans-scale nano-precision positioning with multi-dimensions and high velocity, plays a significant role in integrated circuit manufacturing field. A 3-degree-of-freedoms (3-DOFs) macro-micro manipulator is designed and analyzed to compromise the conflictions among the large stroke, high precision and multi-DOFs. The macro manipulator is a 3-Prismatic-Revolute-Revolute (3-PRR) structure parallel manipulator which is driven by three linear ultrasonic motors. The dynamic model and the cross-coupling error based synchronized motion controller of the 3-PRR parallel manipulator are theoretical analyzed and experimental tested. To further improve the positioning accuracy, a 3-DOFs monolithic compliant manipulator actuated by three piezoelectric stack actuators is designed. Then a multilayer BP neural network based inverse kinematic model identifier is developed to perform the positioning control. Finally, by forming the macro-micro structure, the dual stage manipulator successfully achieved the positioning task from the point (2 mm, 2 mm, 0 rad) back to the original point (0 mm, 0 mm, 0 rad) with the translation errors in X and Y directions less than ±50 nm and the rotation error around Z axis less than ±1 μrad, respectively.

  15. Integration of computer-assisted fracture reduction system and a hybrid 3-DOF-RPS mechanism for assisting the orthopedic surgery (United States)

    Irwansyah; Sinh, N. P.; Lai, J. Y.; Essomba, T.; Asbar, R.; Lee, P. Y.


    In this paper, we present study to integrate virtual fracture bone reduction simulation tool with a novel hybrid 3-DOF-RPS external fixator to relocate back bone fragments into their anatomically original position. A 3D model of fractured bone was reconstructed and manipulated using 3D design and modeling software, PhysiGuide. The virtual reduction system was applied to reduce a bilateral femoral shaft fracture type 32-A3. Measurement data from fracture reduction and fixation stages were implemented to manipulate the manipulator pose in patient’s clinical case. The experimental result presents that by merging both of those techniques will give more possibilities to reduce virtual bone reduction time, improve facial and shortest healing treatment.

  16. A Comparison Study on Motion/Force Transmissibility of Two Typical 3-DOF Parallel Manipulators: The Sprint Z3 and A3 Tool Heads

    Directory of Open Access Journals (Sweden)

    Xiang Chen


    Full Text Available This paper presents a comparison study of two important three-degree-of-freedom (DOF parallel manipulators, the Sprint Z3 head and the A3 head, both commonly used in industry. As an initial step, the inverse kinematics are derived and an analysis of two classes of limbs is carried out via screw theory. For comparison, three transmission indices are then defined to describe their motion/force transmission performance. Based on the same main parameters, the compared results reveal some distinct characteristics in addition to the similarities between the two parallel manipulators. To a certain extent, the A3 head outperforms the common Sprint Z3 head, providing a new and satisfactory option for a machine tool head in industry.

  17. Effects of uniformities of deposition of respirable particles on filters on determining their quartz contents by using the direct on-filter X-ray diffraction (DOF XRD) method. (United States)

    Chen, Ching-Hwa; Tsaia, Perng-Jy; Lai, Chane-Yu; Peng, Ya-Lian; Soo, Jhy-Charm; Chen, Cheng-Yao; Shih, Tung-Sheng


    In this study, field samplings were conducted in three workplaces of a foundry plant, including the molding, demolding, and bead blasting, respectively. Three respirable aerosol samplers (including a 25-mm aluminum cyclone, nylon cyclone, and IOSH cyclone) were used side-by-side to collect samples from each selected workplace. For each collected sample, the uniformity of the deposition of respirable dusts on the filter was measured and its free silica content was determined by both the DOF XRD method and NIOSH 7500 XRD method (i.e., the reference method). A same trend in measured uniformities can be found in all selected workplaces: 25-mm aluminum cyclone>nylon cyclone>IOSH cyclone. Even for samples collected by the sampler with the highest uniformity (i.e., 25-mm aluminum cyclone), the use of the DOF XRD method would lead to the measured free silica concentrations 1.15-2.89 times in magnitude higher than that of the reference method. A new filter holder should be developed with the minimum uniformity comparable to that of NIOSH 7500 XRD method (=0.78) in the future. The use of conversion factors for correcting quartz concentrations obtained from the DOF XRD method based on the measured uniformities could be suitable for the foundry industry at this stage. 2009 Elsevier B.V. All rights reserved.

  18. Effects of uniformities of deposition of respirable particles on filters on determining their quartz contents by using the direct on-filter X-ray diffraction (DOF XRD) method

    International Nuclear Information System (INIS)

    Chen, Ching-Hwa; Tsaia, Perng-Jy; Lai, Chane-Yu; Peng, Ya-Lian; Soo, Jhy-Charm; Chen, Cheng-Yao; Shih, Tung-Sheng


    In this study, field samplings were conducted in three workplaces of a foundry plant, including the molding, demolding, and bead blasting, respectively. Three respirable aerosol samplers (including a 25-mm aluminum cyclone, nylon cyclone, and IOSH cyclone) were used side-by-side to collect samples from each selected workplace. For each collected sample, the uniformity of the deposition of respirable dusts on the filter was measured and its free silica content was determined by both the DOF XRD method and NIOSH 7500 XRD method (i.e., the reference method). A same trend in measured uniformities can be found in all selected workplaces: 25-mm aluminum cyclone > nylon cyclone > IOSH cyclone. Even for samples collected by the sampler with the highest uniformity (i.e., 25-mm aluminum cyclone), the use of the DOF XRD method would lead to the measured free silica concentrations 1.15-2.89 times in magnitude higher than that of the reference method. A new filter holder should be developed with the minimum uniformity comparable to that of NIOSH 7500 XRD method (=0.78) in the future. The use of conversion factors for correcting quartz concentrations obtained from the DOF XRD method based on the measured uniformities could be suitable for the foundry industry at this stage.

  19. An analytical study of non-linear behaviour of coupled 2+2x0.5 DOF electro-magneto-mechanical system by a method of multiple scales

    DEFF Research Database (Denmark)

    Darula, Radoslav; Sorokin, Sergey


    An electro-magneto-mechanical system combines three physical domains - a mechanical structure, a magnetic field and an electric circuit. The interaction between these domains is analysed for a structure with two degrees of freedom (translational and rotational) and two electrical circuits. Each...... electrical circuit is described by a differential equation of the 1st order, which is considered to contribute to the coupled system by 0.5 DOF. The electrical and mechanical systems are coupled via a magnetic circuit, which is inherently non-linear, due to a non-linear nature of the electro-magnetic force...

  20. Effects of water deficit on breadmaking quality and storage protein compositions in bread wheat (Triticum aestivum L.). (United States)

    Zhou, Jiaxing; Liu, Dongmiao; Deng, Xiong; Zhen, Shoumin; Wang, Zhimin; Yan, Yueming


    Water deficiency affects grain proteome dynamics and storage protein compositions, resulting in changes in gluten viscoelasticity. In this study, the effects of field water deficit on wheat breadmaking quality and grain storage proteins were investigated. Water deficiency produced a shorter grain-filling period, a decrease in grain number, grain weight and grain yield, a reduced starch granule size and increased protein content and glutenin macropolymer contents, resulting in superior dough properties and breadmaking quality. Reverse phase ultra-performance liquid chromatography analysis showed that the total gliadin and glutenin content and the accumulation of individual components were significantly increased by water deficiency. Two-dimensional gel electrophoresis detected 144 individual storage protein spots with significant accumulation changes in developing grains under water deficit. Comparative proteomic analysis revealed that water deficiency resulted in significant upregulation of 12 gliadins, 12 high-molecular-weight glutenin subunits and 46 low-molecular-weight glutenin subunits. Quantitative real-time polymerase chain reaction analysis revealed that the expression of storage protein biosynthesis-related transcription factors Dof and Spa was upregulated by water deficiency. The present results illustrated that water deficiency leads to increased accumulation of storage protein components and upregulated expression of Dof and Spa, resulting in an improvement in glutenin strength and breadmaking quality. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.

  1. Overexpression of Grain Amaranth (Amaranthus hypochondriacus) AhERF or AhDOF Transcription Factors in Arabidopsis thaliana Increases Water Deficit- and Salt-Stress Tolerance, Respectively, via Contrasting Stress-Amelioration Mechanisms (United States)

    Massange-Sánchez, Julio A.; Palmeros-Suárez, Paola A.; Espitia-Rangel, Eduardo; Rodríguez-Arévalo, Isaac; Sánchez-Segura, Lino; Martínez-Gallardo, Norma A.; Alatorre-Cobos, Fulgencio; Tiessen, Axel; Délano-Frier, John P.


    Two grain amaranth transcription factor (TF) genes were overexpressed in Arabidopsis plants. The first, coding for a group VII ethylene response factor TF (i.e., AhERF-VII) conferred tolerance to water-deficit stress (WS) in transgenic Arabidopsis without affecting vegetative or reproductive growth. A significantly lower water-loss rate in detached leaves coupled to a reduced stomatal opening in leaves of plants subjected to WS was associated with this trait. WS tolerance was also associated with an increased antioxidant enzyme activity and the accumulation of putative stress-related secondary metabolites. However, microarray and GO data did not indicate an obvious correlation between WS tolerance, stomatal closure, and abscisic acid (ABA)-related signaling. This scenario suggested that stomatal closure during WS in these plants involved ABA-independent mechanisms, possibly involving reactive oxygen species (ROS). WS tolerance may have also involved other protective processes, such as those employed for methyl glyoxal detoxification. The second, coding for a class A and cluster I DNA binding with one finger TF (i.e., AhDof-AI) provided salt-stress (SS) tolerance with no evident fitness penalties. The lack of an obvious development-related phenotype contrasted with microarray and GO data showing an enrichment of categories and genes related to developmental processes, particularly flowering. SS tolerance also correlated with increased superoxide dismutase activity but not with augmented stomatal closure. Additionally, microarray and GO data indicated that, contrary to AhERF-VII, SS tolerance conferred by AhDof-AI in Arabidopsis involved ABA-dependent and ABA-independent stress amelioration mechanisms. PMID:27749893

  2. Overexpression of Grain Amaranth (Amaranthus hypochondriacus AhERF or AhDOF Transcription Factors in Arabidopsis thaliana Increases Water Deficit- and Salt-Stress Tolerance, Respectively, via Contrasting Stress-Amelioration Mechanisms.

    Directory of Open Access Journals (Sweden)

    Julio A Massange-Sánchez

    Full Text Available Two grain amaranth transcription factor (TF genes were overexpressed in Arabidopsis plants. The first, coding for a group VII ethylene response factor TF (i.e., AhERF-VII conferred tolerance to water-deficit stress (WS in transgenic Arabidopsis without affecting vegetative or reproductive growth. A significantly lower water-loss rate in detached leaves coupled to a reduced stomatal opening in leaves of plants subjected to WS was associated with this trait. WS tolerance was also associated with an increased antioxidant enzyme activity and the accumulation of putative stress-related secondary metabolites. However, microarray and GO data did not indicate an obvious correlation between WS tolerance, stomatal closure, and abscisic acid (ABA-related signaling. This scenario suggested that stomatal closure during WS in these plants involved ABA-independent mechanisms, possibly involving reactive oxygen species (ROS. WS tolerance may have also involved other protective processes, such as those employed for methyl glyoxal detoxification. The second, coding for a class A and cluster I DNA binding with one finger TF (i.e., AhDof-AI provided salt-stress (SS tolerance with no evident fitness penalties. The lack of an obvious development-related phenotype contrasted with microarray and GO data showing an enrichment of categories and genes related to developmental processes, particularly flowering. SS tolerance also correlated with increased superoxide dismutase activity but not with augmented stomatal closure. Additionally, microarray and GO data indicated that, contrary to AhERF-VII, SS tolerance conferred by AhDof-AI in Arabidopsis involved ABA-dependent and ABA-independent stress amelioration mechanisms.

  3. Arabidopsis CDS blastp result: AK288349 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK288349 J090023P19 At2g46590.1 68415.m05811 Dof zinc finger protein DAG2 / Dof affecting germination... 2 (DAG2) identical to SP|Q9ZPY0 DOF zinc finger protein DAG2 (Dof affecting germination 2) {Arabidopsis thaliana} 1e-23 ...

  4. Arabidopsis CDS blastp result: AK241364 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK241364 J065152E11 At2g46590.1 68415.m05811 Dof zinc finger protein DAG2 / Dof affecting germination... 2 (DAG2) identical to SP|Q9ZPY0 DOF zinc finger protein DAG2 (Dof affecting germination 2) {Arabidopsis thaliana} 2e-20 ...

  5. Total protein (United States)

    ... page: // Total protein To use the sharing features on this page, please enable JavaScript. The total protein test measures the total amount of two classes ...

  6. Proteins engineering

    International Nuclear Information System (INIS)


    At the - Departement d'Ingenierie et d'etudes de proteines (Deip) of the CEA more than seventy researchers are working hard to understand the function of proteins. For that they use the molecular labelling technique (F.M.)

  7. Whey Protein (United States)

    ... reliable information about the safety of taking whey protein if you are pregnant or breast feeding. Stay on the safe side and avoid use. Milk allergy: If you are allergic to cow's milk, avoid using whey protein.

  8. 6 DOF Nonlinear AUV Simulation Toolbox (United States)


    advantage of monitor is you can change the shared memory variables at any time. So it can be used for “ hardware in loop ” simulation. An editable monitor...for tuning controller. “ Hardware in loop ” simulation will be tested in recently. In the coming year, we will improve this simulation software. We

  9. An experimental stationary quadrotor with variable DOF

    Indian Academy of Sciences (India)

    for which real time speed control of the motors is required for navigation. Continuous .... rotation which reduces the rotational friction extensively providing near-flight dynamics. While ... their charging time is pretty long. Thus ... memory. Controller inputs of the excitation system are the desired angles of roll, pitch, yaw and the.

  10. An experimental stationary quadrotor with variable DOF

    Indian Academy of Sciences (India)


    Aug 26, 2016 ... Keywords. UAV; Quadrotor; fuzzy control; matlab embedded function. Abstract. Unmanned air vehicles (UAV) and especially quadrotors have drawn great attention in recent years because of their maneuverability, ease of design and control. Most of the works concentrate mostly on control; yet, design and ...

  11. 2 DOF resolution adjustment laser position sensor

    CSIR Research Space (South Africa)

    Shaik, A


    Full Text Available means. [19, 20] Other - Displacement measuring instruments utilizing eddy currents, capacitive and inductive properties exist, but are not as widely spread as the technologies mentioned. Accelerometers and Gyroscopes are used to determine... resolution. The current accuracy of the IRB 340 Flex Picker, a rapid pick and place machine, is 0.1 mm. The lower limit on screen resolution for absolute 2D positioning would then be 400 phototransistors per square mm, a screen with twice the resolution...

  12. Protein politics

    NARCIS (Netherlands)

    Vijver, Marike


    This study is part of the program of the interdisciplinary research group Profetas (protein foods, environment, technology and society). Profetas consists of technological, environmental and socio-economic research projects on protein food systems which result in the development of scenarios and

  13. Protein adhesives (United States)

    Charles R. Frihart; Linda F. Lorenz


    Nature uses a wide variety of chemicals for providing adhesion internally (e.g., cell to cell) and externally (e.g., mussels to ships and piers). This adhesive bonding is chemically and mechanically complex, involving a variety of proteins, carbohydrates, and other compounds.Consequently,the effect of protein structures on adhesive properties is only partially...

  14. Tau protein

    DEFF Research Database (Denmark)

    Frederiksen, Jette Lautrup Battistini; Kristensen, Kim; Bahl, Jmc


    Background: Tau protein has been proposed as biomarker of axonal damage leading to irreversible neurological impairment in MS. CSF concentrations may be useful when determining risk of progression from ON to MS. Objective: To investigate the association between tau protein concentration and 14......-3-3 protein in the cerebrospinal fluid (CSF) of patients with monosymptomatic optic neuritis (ON) versus patients with monosymptomatic onset who progressed to multiple sclerosis (MS). To evaluate results against data found in a complete literature review. Methods: A total of 66 patients with MS and/or ON from...... the Department of Neurology of Glostrup Hospital, University of Copenhagen, Denmark, were included. CSF samples were analysed for tau protein and 14-3-3 protein, and clinical and paraclinical information was obtained from medical records. Results: The study shows a significantly increased concentration of tau...

  15. Protein nanoparticles for therapeutic protein delivery. (United States)

    Herrera Estrada, L P; Champion, J A


    Therapeutic proteins can face substantial challenges to their activity, requiring protein modification or use of a delivery vehicle. Nanoparticles can significantly enhance delivery of encapsulated cargo, but traditional small molecule carriers have some limitations in their use for protein delivery. Nanoparticles made from protein have been proposed as alternative carriers and have benefits specific to therapeutic protein delivery. This review describes protein nanoparticles made by self-assembly, including protein cages, protein polymers, and charged or amphipathic peptides, and by desolvation. It presents particle fabrication and delivery characterization for a variety of therapeutic and model proteins, as well as comparison of the features of different protein nanoparticles.

  16. Protein-Protein Interaction Databases

    DEFF Research Database (Denmark)

    Szklarczyk, Damian; Jensen, Lars Juhl


    Years of meticulous curation of scientific literature and increasingly reliable computational predictions have resulted in creation of vast databases of protein interaction data. Over the years, these repositories have become a basic framework in which experiments are analyzed and new directions...

  17. Aquaporin Protein-Protein Interactions

    Directory of Open Access Journals (Sweden)

    Jennifer Virginia Roche


    Full Text Available Aquaporins are tetrameric membrane-bound channels that facilitate transport of water and other small solutes across cell membranes. In eukaryotes, they are frequently regulated by gating or trafficking, allowing for the cell to control membrane permeability in a specific manner. Protein–protein interactions play crucial roles in both regulatory processes and also mediate alternative functions such as cell adhesion. In this review, we summarize recent knowledge about aquaporin protein–protein interactions; dividing the interactions into three types: (1 interactions between aquaporin tetramers; (2 interactions between aquaporin monomers within a tetramer (hetero-tetramerization; and (3 transient interactions with regulatory proteins. We particularly focus on the structural aspects of the interactions, discussing the small differences within a conserved overall fold that allow for aquaporins to be differentially regulated in an organism-, tissue- and trigger-specific manner. A deep knowledge about these differences is needed to fully understand aquaporin function and regulation in many physiological processes, and may enable design of compounds targeting specific aquaporins for treatment of human disease.

  18. Protein immobilization strategies for protein biochips

    NARCIS (Netherlands)

    Rusmini, F.; Rusmini, Federica; Zhong, Zhiyuan; Feijen, Jan


    In the past few years, protein biochips have emerged as promising proteomic and diagnostic tools for obtaining information about protein functions and interactions. Important technological innovations have been made. However, considerable development is still required, especially regarding protein

  19. The E5 Proteins


    DiMaio, Daniel; Petti, Lisa


    The E5 proteins are short transmembrane proteins encoded by many animal and human papillomaviruses. These proteins display transforming activity in cultured cells and animals, and they presumably also play a role in the productive virus life cycle. The E5 proteins are thought to act by modulating the activity of cellular proteins. Here, we describe the biological activities of the best-studied E5 proteins and discuss the evidence implicating specific protein targets and pathways in mediating ...

  20. EDITORIAL: Precision proteins Precision proteins (United States)

    Demming, Anna


    Since the birth of modern day medicine, during the times of Hippocrates in ancient Greece, the profession has developed from the rudimentary classification of disease into a rigorous science with an inspiring capability to treat and cure. Scientific methodology has distilled clinical diagnostic tools from the early arts of prognosis, which used to rely as much on revelation and prophecy, as intuition and judgement [1]. Over the past decade, research into the interactions between proteins and nanosystems has provided some ingenious and apt techniques for delving into the intricacies of anatomical systems. In vivo biosensing has emerged as a vibrant field of research, as much of medical diagnosis relies on the detection of substances or an imbalance in the chemicals in the body. The inherent properties of nanoscale structures, such as cantilevers, make them well suited to biosensing applications that demand the detection of molecules at very low concentrations. Measurable deflections in cantilevers functionalised with antibodies provide quantitative indicators of the presence of specific antigens when the two react. Such developments have roused mounting interest in the interactions of proteins with nanostructures, such as carbon nanotubes [3], which have demonstrated great potential as generic biomarkers. Plasmonic properties are also being exploited in sensing applications, such as the molecular sentinel recently devised by researchers in the US. The device uses the plasmonic properties of a silver nanoparticle linked to a Raman labelled hairpin DNA probe to signal changes in the probe geometry resulting from interactions with substances in the environment. Success stories so far include the detection of two specific genes associated with breast cancer [4]. A greater understanding of how RNA interference regulates gene expression has highlighted the potential of using this natural process as another agent for combating disease in personalized medicine. However, the

  1. Protein docking prediction using predicted protein-protein interface

    Directory of Open Access Journals (Sweden)

    Li Bin


    Full Text Available Abstract Background Many important cellular processes are carried out by protein complexes. To provide physical pictures of interacting proteins, many computational protein-protein prediction methods have been developed in the past. However, it is still difficult to identify the correct docking complex structure within top ranks among alternative conformations. Results We present a novel protein docking algorithm that utilizes imperfect protein-protein binding interface prediction for guiding protein docking. Since the accuracy of protein binding site prediction varies depending on cases, the challenge is to develop a method which does not deteriorate but improves docking results by using a binding site prediction which may not be 100% accurate. The algorithm, named PI-LZerD (using Predicted Interface with Local 3D Zernike descriptor-based Docking algorithm, is based on a pair wise protein docking prediction algorithm, LZerD, which we have developed earlier. PI-LZerD starts from performing docking prediction using the provided protein-protein binding interface prediction as constraints, which is followed by the second round of docking with updated docking interface information to further improve docking conformation. Benchmark results on bound and unbound cases show that PI-LZerD consistently improves the docking prediction accuracy as compared with docking without using binding site prediction or using the binding site prediction as post-filtering. Conclusion We have developed PI-LZerD, a pairwise docking algorithm, which uses imperfect protein-protein binding interface prediction to improve docking accuracy. PI-LZerD consistently showed better prediction accuracy over alternative methods in the series of benchmark experiments including docking using actual docking interface site predictions as well as unbound docking cases.

  2. Protein docking prediction using predicted protein-protein interface. (United States)

    Li, Bin; Kihara, Daisuke


    Many important cellular processes are carried out by protein complexes. To provide physical pictures of interacting proteins, many computational protein-protein prediction methods have been developed in the past. However, it is still difficult to identify the correct docking complex structure within top ranks among alternative conformations. We present a novel protein docking algorithm that utilizes imperfect protein-protein binding interface prediction for guiding protein docking. Since the accuracy of protein binding site prediction varies depending on cases, the challenge is to develop a method which does not deteriorate but improves docking results by using a binding site prediction which may not be 100% accurate. The algorithm, named PI-LZerD (using Predicted Interface with Local 3D Zernike descriptor-based Docking algorithm), is based on a pair wise protein docking prediction algorithm, LZerD, which we have developed earlier. PI-LZerD starts from performing docking prediction using the provided protein-protein binding interface prediction as constraints, which is followed by the second round of docking with updated docking interface information to further improve docking conformation. Benchmark results on bound and unbound cases show that PI-LZerD consistently improves the docking prediction accuracy as compared with docking without using binding site prediction or using the binding site prediction as post-filtering. We have developed PI-LZerD, a pairwise docking algorithm, which uses imperfect protein-protein binding interface prediction to improve docking accuracy. PI-LZerD consistently showed better prediction accuracy over alternative methods in the series of benchmark experiments including docking using actual docking interface site predictions as well as unbound docking cases.

  3. Shotgun protein sequencing.

    Energy Technology Data Exchange (ETDEWEB)

    Faulon, Jean-Loup Michel; Heffelfinger, Grant S.


    A novel experimental and computational technique based on multiple enzymatic digestion of a protein or protein mixture that reconstructs protein sequences from sequences of overlapping peptides is described in this SAND report. This approach, analogous to shotgun sequencing of DNA, is to be used to sequence alternative spliced proteins, to identify post-translational modifications, and to sequence genetically engineered proteins.

  4. Introduction to protein blotting. (United States)

    Kurien, Biji T; Scofield, R Hal


    Protein blotting is a powerful and important procedure for the immunodetection of proteins following electrophoresis, particularly proteins that are of low abundance. Since the inception of the protocol for protein transfer from an electrophoresed gel to a membrane in 1979, protein blotting has evolved greatly. The scientific community is now confronted with a variety of ways and means to carry out this transfer.

  5. Our interests in protein-protein interactions

    Indian Academy of Sciences (India)

    protein interactions. Evolution of P-P partnerships. Evolution of P-P structures. Evolutionary dynamics of P-P interactions. Dynamics of P-P interaction network. Host-pathogen interactions. CryoEM mapping of gigantic protein assemblies.

  6. Evolution of protein-protein interactions

    Indian Academy of Sciences (India)

    Evolution of protein-protein interactions · Our interests in protein-protein interactions · Slide 3 · Slide 4 · Slide 5 · Slide 6 · Slide 7 · Slide 8 · Slide 9 · Slide 10 · Slide 11 · Slide 12 · Slide 13 · Slide 14 · Slide 15 · Slide 16 · Slide 17 · Slide 18 · Slide 19 · Slide 20.

  7. Protein in diet (United States)

    Diet - protein ... Protein foods are broken down into parts called amino acids during digestion. The human body needs a ... to eat animal products to get all the protein you need in your diet. Amino acids are ...

  8. Protein-losing enteropathy (United States)

    ... this page: // Protein-losing enteropathy To use the sharing features on this page, please enable JavaScript. Protein-losing enteropathy is an abnormal loss of protein ...

  9. Oligomeric protein structure networks: insights into protein-protein interactions

    Directory of Open Access Journals (Sweden)

    Brinda KV


    Full Text Available Abstract Background Protein-protein association is essential for a variety of cellular processes and hence a large number of investigations are being carried out to understand the principles of protein-protein interactions. In this study, oligomeric protein structures are viewed from a network perspective to obtain new insights into protein association. Structure graphs of proteins have been constructed from a non-redundant set of protein oligomer crystal structures by considering amino acid residues as nodes and the edges are based on the strength of the non-covalent interactions between the residues. The analysis of such networks has been carried out in terms of amino acid clusters and hubs (highly connected residues with special emphasis to protein interfaces. Results A variety of interactions such as hydrogen bond, salt bridges, aromatic and hydrophobic interactions, which occur at the interfaces are identified in a consolidated manner as amino acid clusters at the interface, from this study. Moreover, the characterization of the highly connected hub-forming residues at the interfaces and their comparison with the hubs from the non-interface regions and the non-hubs in the interface regions show that there is a predominance of charged interactions at the interfaces. Further, strong and weak interfaces are identified on the basis of the interaction strength between amino acid residues and the sizes of the interface clusters, which also show that many protein interfaces are stronger than their monomeric protein cores. The interface strengths evaluated based on the interface clusters and hubs also correlate well with experimentally determined dissociation constants for known complexes. Finally, the interface hubs identified using the present method correlate very well with experimentally determined hotspots in the interfaces of protein complexes obtained from the Alanine Scanning Energetics database (ASEdb. A few predictions of interface hot

  10. Protein surface shielding agents in protein crystallization

    International Nuclear Information System (INIS)

    Hašek, J.


    The crystallization process can be controlled by protein surface shielding agents blocking undesirable competitive adhesion modes during non-equilibrium processes of deposition of protein molecules on the surface of growing crystalline blocks. The hypothesis is based on a number of experimental proofs from diffraction experiments and also retrieved from the Protein Data Bank. The molecules adhering temporarily on the surface of protein molecules change the propensity of protein molecules to deposit on the crystal surface in a definite position and orientation. The concepts of competitive adhesion modes and protein surface shielding agents acting on the surface of molecules in a non-equilibrium process of protein crystallization provide a useful platform for the control of crystallization. The desirable goal, i.e. a transient preference of a single dominating adhesion mode between protein molecules during crystallization, leads to uniform deposition of proteins in a crystal. This condition is the most important factor for diffraction quality and thus also for the accuracy of protein structure determination. The presented hypothesis is a generalization of the experimentally well proven behaviour of hydrophilic polymers on the surface of protein molecules of other compounds

  11. Protein sequence comparison and protein evolution

    Energy Technology Data Exchange (ETDEWEB)

    Pearson, W.R. [Univ. of Virginia, Charlottesville, VA (United States). Dept. of Biochemistry


    This tutorial was one of eight tutorials selected to be presented at the Third International Conference on Intelligent Systems for Molecular Biology which was held in the United Kingdom from July 16 to 19, 1995. This tutorial examines how the information conserved during the evolution of a protein molecule can be used to infer reliably homology, and thus a shared proteinfold and possibly a shared active site or function. The authors start by reviewing a geological/evolutionary time scale. Next they look at the evolution of several protein families. During the tutorial, these families will be used to demonstrate that homologous protein ancestry can be inferred with confidence. They also examine different modes of protein evolution and consider some hypotheses that have been presented to explain the very earliest events in protein evolution. The next part of the tutorial will examine the technical aspects of protein sequence comparison. Both optimal and heuristic algorithms and their associated parameters that are used to characterize protein sequence similarities are discussed. Perhaps more importantly, they survey the statistics of local similarity scores, and how these statistics can both be used to improve the selectivity of a search and to evaluate the significance of a match. They them examine distantly related members of three protein families, the serine proteases, the glutathione transferases, and the G-protein-coupled receptors (GCRs). Finally, the discuss how sequence similarity can be used to examine internal repeated or mosaic structures in proteins.

  12. Protein Structure Prediction by Protein Threading (United States)

    Xu, Ying; Liu, Zhijie; Cai, Liming; Xu, Dong

    The seminal work of Bowie, Lüthy, and Eisenberg (Bowie et al., 1991) on "the inverse protein folding problem" laid the foundation of protein structure prediction by protein threading. By using simple measures for fitness of different amino acid types to local structural environments defined in terms of solvent accessibility and protein secondary structure, the authors derived a simple and yet profoundly novel approach to assessing if a protein sequence fits well with a given protein structural fold. Their follow-up work (Elofsson et al., 1996; Fischer and Eisenberg, 1996; Fischer et al., 1996a,b) and the work by Jones, Taylor, and Thornton (Jones et al., 1992) on protein fold recognition led to the development of a new brand of powerful tools for protein structure prediction, which we now term "protein threading." These computational tools have played a key role in extending the utility of all the experimentally solved structures by X-ray crystallography and nuclear magnetic resonance (NMR), providing structural models and functional predictions for many of the proteins encoded in the hundreds of genomes that have been sequenced up to now.

  13. Polymer Directed Protein Assemblies

    NARCIS (Netherlands)

    van Rijn, Patrick


    Protein aggregation and protein self-assembly is an important occurrence in natural systems, and is in some form or other dictated by biopolymers. Very obvious influences of biopolymers on protein assemblies are, e. g., virus particles. Viruses are a multi-protein assembly of which the morphology is

  14. Amino acids and proteins (United States)

    A balanced, safe diet with proteins is important to meet nutritional requirements. Proteins occur in animal as well as vegetable products in important quantities. In some countries, many people obtain much of their protein from animal products. In other regions, the major portion of dietary protein ...

  15. The Protein Model Portal


    Arnold, Konstantin; Kiefer, Florian; Kopp, J?rgen; Battey, James N. D.; Podvinec, Michael; Westbrook, John D.; Berman, Helen M.; Bordoli, Lorenza; Schwede, Torsten


    Structural Genomics has been successful in determining the structures of many unique proteins in a high throughput manner. Still, the number of known protein sequences is much larger than the number of experimentally solved protein structures. Homology (or comparative) modeling methods make use of experimental protein structures to build models for evolutionary related proteins. Thereby, experimental structure determination efforts and homology modeling complement each other in the exploratio...

  16. Protein- protein interaction detection system using fluorescent protein microdomains (United States)

    Waldo, Geoffrey S.; Cabantous, Stephanie


    The invention provides a protein labeling and interaction detection system based on engineered fragments of fluorescent and chromophoric proteins that require fused interacting polypeptides to drive the association of the fragments, and further are soluble and stable, and do not change the solubility of polypeptides to which they are fused. In one embodiment, a test protein X is fused to a sixteen amino acid fragment of GFP (.beta.-strand 10, amino acids 198-214), engineered to not perturb fusion protein solubility. A second test protein Y is fused to a sixteen amino acid fragment of GFP (.beta.-strand 11, amino acids 215-230), engineered to not perturb fusion protein solubility. When X and Y interact, they bring the GFP strands into proximity, and are detected by complementation with a third GFP fragment consisting of GFP amino acids 1-198 (strands 1-9). When GFP strands 10 and 11 are held together by interaction of protein X and Y, they spontaneous association with GFP strands 1-9, resulting in structural complementation, folding, and concomitant GFP fluorescence.

  17. Comparing side chain packing in soluble proteins, protein-protein interfaces, and transmembrane proteins. (United States)

    Gaines, J C; Acebes, S; Virrueta, A; Butler, M; Regan, L; O'Hern, C S


    We compare side chain prediction and packing of core and non-core regions of soluble proteins, protein-protein interfaces, and transmembrane proteins. We first identified or created comparable databases of high-resolution crystal structures of these 3 protein classes. We show that the solvent-inaccessible cores of the 3 classes of proteins are equally densely packed. As a result, the side chains of core residues at protein-protein interfaces and in the membrane-exposed regions of transmembrane proteins can be predicted by the hard-sphere plus stereochemical constraint model with the same high prediction accuracies (>90%) as core residues in soluble proteins. We also find that for all 3 classes of proteins, as one moves away from the solvent-inaccessible core, the packing fraction decreases as the solvent accessibility increases. However, the side chain predictability remains high (80% within 30°) up to a relative solvent accessibility, rSASA≲0.3, for all 3 protein classes. Our results show that ≈40% of the interface regions in protein complexes are "core", that is, densely packed with side chain conformations that can be accurately predicted using the hard-sphere model. We propose packing fraction as a metric that can be used to distinguish real protein-protein interactions from designed, non-binding, decoys. Our results also show that cores of membrane proteins are the same as cores of soluble proteins. Thus, the computational methods we are developing for the analysis of the effect of hydrophobic core mutations in soluble proteins will be equally applicable to analyses of mutations in membrane proteins. © 2018 Wiley Periodicals, Inc.

  18. IGSF9 Family Proteins

    DEFF Research Database (Denmark)

    Hansen, Maria; Walmod, Peter Schledermann


    The Drosophila protein Turtle and the vertebrate proteins immunoglobulin superfamily (IgSF), member 9 (IGSF9/Dasm1) and IGSF9B are members of an evolutionarily ancient protein family. A bioinformatics analysis of the protein family revealed that invertebrates contain only a single IGSF9 family gene......, the longest isoforms of the proteins have the same general organization as the neural cell adhesion molecule family of cell adhesion molecule proteins, and like this family of proteins, IGSF9 family members are expressed in the nervous system. A review of the literature revealed that Drosophila Turtle...... facilitates homophilic cell adhesion. Moreover, IGSF9 family proteins have been implicated in the outgrowth and branching of neurites, axon guidance, synapse maturation, self-avoidance, and tiling. However, despite the few published studies on IGSF9 family proteins, reports on the functions of both Turtle...

  19. Personalizing Protein Nourishment (United States)



    Proteins are not equally digestible—their proteolytic susceptibility varies by their source and processing method. Incomplete digestion increases colonic microbial protein fermentation (putrefaction), which produces toxic metabolites that can induce inflammation in vitro and have been associated with inflammation in vivo. Individual humans differ in protein digestive capacity based on phenotypes, particularly disease states. To avoid putrefaction-induced intestinal inflammation, protein sources and processing methods must be tailored to the consumer’s digestive capacity. This review explores how food processing techniques alter protein digestibility and examines how physiological conditions alter digestive capacity. Possible solutions to improving digestive function or matching low digestive capacity with more digestible protein sources are explored. Beyond the ileal digestibility measurements of protein digestibility, less invasive, quicker and cheaper techniques for monitoring the extent of protein digestion and fermentation are needed to personalize protein nourishment. Biomarkers of protein digestive capacity and efficiency can be identified with the toolsets of peptidomics, metabolomics, microbial sequencing and multiplexed protein analysis of fecal and urine samples. By monitoring individual protein digestive function, the protein component of diets can be tailored via protein source and processing selection to match individual needs to minimize colonic putrefaction and, thus, optimize gut health. PMID:26713355

  20. Prediction of Protein-Protein Interactions Related to Protein Complexes Based on Protein Interaction Networks

    Directory of Open Access Journals (Sweden)

    Peng Liu


    Full Text Available A method for predicting protein-protein interactions based on detected protein complexes is proposed to repair deficient interactions derived from high-throughput biological experiments. Protein complexes are pruned and decomposed into small parts based on the adaptive k-cores method to predict protein-protein interactions associated with the complexes. The proposed method is adaptive to protein complexes with different structure, number, and size of nodes in a protein-protein interaction network. Based on different complex sets detected by various algorithms, we can obtain different prediction sets of protein-protein interactions. The reliability of the predicted interaction sets is proved by using estimations with statistical tests and direct confirmation of the biological data. In comparison with the approaches which predict the interactions based on the cliques, the overlap of the predictions is small. Similarly, the overlaps among the predicted sets of interactions derived from various complex sets are also small. Thus, every predicted set of interactions may complement and improve the quality of the original network data. Meanwhile, the predictions from the proposed method replenish protein-protein interactions associated with protein complexes using only the network topology.

  1. Athoropometric measurements and plasma proteins in protein ...

    African Journals Online (AJOL)

    Athoropometric measurements and plasma proteins in protein energy malnutrition. MH Etukudo, EO Agbedana, OO Akinyinka, BOA Osifo. Abstract. No Abstract. Global Journal of Medical Sciences Vol. 5(1) 2006: 7-11. Full Text: EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD ...

  2. Polymer Directed Protein Assemblies

    Directory of Open Access Journals (Sweden)

    Patrick van Rijn


    Full Text Available Protein aggregation and protein self-assembly is an important occurrence in natural systems, and is in some form or other dictated by biopolymers. Very obvious influences of biopolymers on protein assemblies are, e.g., virus particles. Viruses are a multi-protein assembly of which the morphology is dictated by poly-nucleotides namely RNA or DNA. This “biopolymer” directs the proteins and imposes limitations on the structure like the length or diameter of the particle. Not only do these bionanoparticles use polymer-directed self-assembly, also processes like amyloid formation are in a way a result of directed protein assembly by partial unfolded/misfolded biopolymers namely, polypeptides. The combination of proteins and synthetic polymers, inspired by the natural processes, are therefore regarded as a highly promising area of research. Directed protein assembly is versatile with respect to the possible interactions which brings together the protein and polymer, e.g., electrostatic, v.d. Waals forces or covalent conjugation, and possible combinations are numerous due to the large amounts of different polymers and proteins available. The protein-polymer interacting behavior and overall morphology is envisioned to aid in clarifying protein-protein interactions and are thought to entail some interesting new functions and properties which will ultimately lead to novel bio-hybrid materials.

  3. Protein and protein hydrolysates in sports nutrition. (United States)

    van Loon, Luc J C; Kies, Arie K; Saris, Wim H M


    With the increasing knowledge about the role of nutrition in increasing exercise performance, it has become clear over the last 2 decades that amino acids, protein, and protein hydrolysates can play an important role. Most of the attention has been focused on their effects at a muscular level. As these nutrients are ingested, however, it also means that gastrointestinal digestibility and absorption can modulate their efficacy significantly. Therefore, discussing the role of amino acids, protein, and protein hydrolysates in sports nutrition entails holding a discussion on all levels of the metabolic route. On May 28-29, 2007, a small group of researchers active in the field of exercise science and protein metabolism presented an overview of the different aspects of the application of protein and protein hydrolysates in sports nutrition. In addition, they were asked to share their opinions on the future progress in their fields of research. In this overview, an introduction to the workshop and a short summary of its outcome is provided.

  4. Protein Data Bank (PDB) (United States)

    U.S. Department of Health & Human Services — The Protein Data Bank (PDB) archive is the single worldwide repository of information about the 3D structures of large biological molecules, including proteins and...

  5. Learning about Proteins (United States)

    ... Fitness Diseases & Conditions Infections Drugs & Alcohol School & Jobs Sports Expert Answers (Q&A) Staying Safe Videos for Educators Search English Español Learning About Proteins KidsHealth / For Kids / Learning About Proteins What's in ...

  6. Protein electrophoresis - serum (United States)

    ... this page: // Protein electrophoresis - serum To use the sharing features on ... JavaScript. This lab test measures the types of protein in the fluid (serum) part of a blood ...

  7. Polarizable protein packing

    KAUST Repository

    Ng, Albert H.; Snow, Christopher D.


    To incorporate protein polarization effects within a protein combinatorial optimization framework, we decompose the polarizable force field AMOEBA into low order terms. Including terms up to the third-order provides a fair approximation to the full

  8. Urine protein electrophoresis test (United States)

    Urine protein electrophoresis; UPEP; Multiple myeloma - UPEP; Waldenström macroglobulinemia - UPEP; Amyloidosis - UPEP ... special paper and apply an electric current. The proteins move and form visible bands. These reveal the ...

  9. Allosteric Regulation of Proteins

    Indian Academy of Sciences (India)

    interactions with other proteins, or binding of small molecules. Covalent .... vealed through structural elucidation of the protein in free and oxygen-bound forms .... stance, molecular dynamic simulation of glutamine binding pro- tein shows that ...

  10. NMR of unfolded proteins

    Indian Academy of Sciences (India)



    Jan 3, 2005 ... covering all the systems, so far discovered.5,7,8,12. With the increasing ... Structural investigations on proteins by NMR are, currently ... rapid analysis of unfolded proteins. ...... and hence help in design of drugs against them.

  11. CSF total protein (United States)

    CSF total protein is a test to determine the amount of protein in your spinal fluid, also called cerebrospinal fluid (CSF). ... The normal protein range varies from lab to lab, but is typically about 15 to 60 milligrams per deciliter (mg/dL) ...

  12. Protein - Which is Best? (United States)

    Hoffman, Jay R; Falvo, Michael J


    Protein intake that exceeds the recommended daily allowance is widely accepted for both endurance and power athletes. However, considering the variety of proteins that are available much less is known concerning the benefits of consuming one protein versus another. The purpose of this paper is to identify and analyze key factors in order to make responsible recommendations to both the general and athletic populations. Evaluation of a protein is fundamental in determining its appropriateness in the human diet. Proteins that are of inferior content and digestibility are important to recognize and restrict or limit in the diet. Similarly, such knowledge will provide an ability to identify proteins that provide the greatest benefit and should be consumed. The various techniques utilized to rate protein will be discussed. Traditionally, sources of dietary protein are seen as either being of animal or vegetable origin. Animal sources provide a complete source of protein (i.e. containing all essential amino acids), whereas vegetable sources generally lack one or more of the essential amino acids. Animal sources of dietary protein, despite providing a complete protein and numerous vitamins and minerals, have some health professionals concerned about the amount of saturated fat common in these foods compared to vegetable sources. The advent of processing techniques has shifted some of this attention and ignited the sports supplement marketplace with derivative products such as whey, casein and soy. Individually, these products vary in quality and applicability to certain populations. The benefits that these particular proteins possess are discussed. In addition, the impact that elevated protein consumption has on health and safety issues (i.e. bone health, renal function) are also reviewed. Key PointsHigher protein needs are seen in athletic populations.Animal proteins is an important source of protein, however potential health concerns do exist from a diet of protein

  13. Peptide segments in protein-protein interfaces

    Indian Academy of Sciences (India)



    Sep 6, 2006 ... contact surface from the rest of the protein surface have been used to identify ..... interfaces the contribution of the charged residues, such as. Lys, Asp and ..... Lawrence M C and Colman P M 1993 Shape complementarity at.

  14. Highly thermostable fluorescent proteins (United States)

    Bradbury, Andrew M [Santa Fe, NM; Waldo, Geoffrey S [Santa Fe, NM; Kiss, Csaba [Los Alamos, NM


    Thermostable fluorescent proteins (TSFPs), methods for generating these and other stability-enhanced proteins, polynucleotides encoding such proteins, and assays and method for using the TSFPs and TSFP-encoding nucleic acid molecules are provided. The TSFPs of the invention show extremely enhanced levels of stability and thermotolerance. In one case, for example, a TSFP of the invention is so stable it can be heated to C. for short periods of time without denaturing, and retains 85% of its fluorescence when heated to C. for several minutes. The invention also provides a method for generating stability-enhanced variants of a protein, including but not limited to fluorescent proteins.

  15. Intracellular protein breakdown. 8

    International Nuclear Information System (INIS)

    Bohley, P.; Kirschke, H.; Langner, J.; Wiederanders, B.; Ansorge, S.


    Double-labelled proteins from rat liver cytosol ( 14 C in long-lived, 3 H in short-lived proteins after in-vivo-labelling) are used as substrates for unlabelled proteinases in vitro. Differences in the degradation rates of short-lived and long-lived proteins in vitro by different proteinases and after addition of different effectors allow conclusions concerning their importance for the in-vivo-turnover of substrate proteins. The main activity (>90%) of soluble lysosomal proteinases at pH 6.1 and pH 6.9 is caused by thiolproteinases, which degrade preferentially short-lived cytosol proteins. These proteinases are inhibited by leupeptin. Autolysis of double-labelled cell fractions shows a remarkably faster breakdown of short-lived substrate proteins only in the soluble part of lysosomes. Microsomal fractions degrade in vitro preferentially long-lived substrate proteins. (author)

  16. Protein carbonylation in plants

    DEFF Research Database (Denmark)

    Møller, Ian Max; Havelund, Jesper; Rogowska-Wrzesinska, Adelina


    This chapter provides an overview of the current knowledge on protein carbonylation in plants and its role in plant physiology. It starts with a brief outline of the turnover and production sites of reactive oxygen species (ROS) in plants and the causes of protein carbonylation. This is followed...... by a description of the methods used to study protein carbonylation in plants, which is also very brief as the methods are similar to those used in studies on animals. The chapter also focuses on protein carbonylation in plants in general and in mitochondria and in seeds in particular, as case stories where...... specific carbonylated proteins have been identified. Protein carbonylation appears to accumulate at all stages of seed development and germination investigated to date. In some cases, such as seed aging, it is probably simply an accumulation of oxidative damage. However, in other cases protein...

  17. Racemic protein crystallography. (United States)

    Yeates, Todd O; Kent, Stephen B H


    Although natural proteins are chiral and are all of one "handedness," their mirror image forms can be prepared by chemical synthesis. This opens up new opportunities for protein crystallography. A racemic mixture of the enantiomeric forms of a protein molecule can crystallize in ways that natural proteins cannot. Recent experimental data support a theoretical prediction that this should make racemic protein mixtures highly amenable to crystallization. Crystals obtained from racemic mixtures also offer advantages in structure determination strategies. The relevance of these potential advantages is heightened by advances in synthetic methods, which are extending the size limit for proteins that can be prepared by chemical synthesis. Recent ideas and results in the area of racemic protein crystallography are reviewed.

  18. Texturized dairy proteins. (United States)

    Onwulata, Charles I; Phillips, John G; Tunick, Michael H; Qi, Phoebi X; Cooke, Peter H


    Dairy proteins are amenable to structural modifications induced by high temperature, shear, and moisture; in particular, whey proteins can change conformation to new unfolded states. The change in protein state is a basis for creating new foods. The dairy products, nonfat dried milk (NDM), whey protein concentrate (WPC), and whey protein isolate (WPI) were modified using a twin-screw extruder at melt temperatures of 50, 75, and 100 degrees C, and moistures ranging from 20 to 70 wt%. Viscoelasticity and solubility measurements showed that extrusion temperature was a more significant (P extruded dairy protein ranged from rigid (2500 N) to soft (2.7 N). Extruding at or above 75 degrees C resulted in increased peak force for WPC (138 to 2500 N) and WPI (2.7 to 147.1 N). NDM was marginally texturized; the presence of lactose interfered with its texturization. WPI products extruded at 50 degrees C were not texturized; their solubility values ranged from 71.8% to 92.6%. A wide possibility exists for creating new foods with texturized dairy proteins due to the extensive range of states achievable. Dairy proteins can be used to boost the protein content in puffed snacks made from corn meal, but unmodified, they bind water and form doughy pastes with starch. To minimize the water binding property of dairy proteins, WPI, or WPC, or NDM were modified by extrusion processing. Extrusion temperature conditions were adjusted to 50, 75, or 100 degrees C, sufficient to change the structure of the dairy proteins, but not destroy them. Extrusion modified the structures of these dairy proteins for ease of use in starchy foods to boost nutrient levels. Dairy proteins can be used to boost the protein content in puffed snacks made from corn meal, but unmodified, they bind water and form doughy pastes with starch. To minimize the water binding property of dairy proteins, whey protein isolate, whey protein concentrate, or nonfat dried milk were modified by extrusion processing. Extrusion

  19. Design of a 3-DOF Parallel Hand-Controller

    Directory of Open Access Journals (Sweden)

    Chengcheng Zhu


    Full Text Available Hand-controllers, as human-machine-interface (HMI devices, can transfer the position information of the operator’s hands into the virtual environment to control the target objects or a real robot directly. At the same time, the haptic information from the virtual environment or the sensors on the real robot can be displayed to the operator. It helps human perceive haptic information more truly with feedback force. A parallel hand-controller is designed in this paper. It is simplified from the traditional delta haptic device. The swing arms in conventional delta devices are replaced with the slider rail modules. The base consists of two hexagons and several links. For the use of the linear sliding modules instead of swing arms, the arc movement is replaced by linear movement. So that, the calculating amount of the position positive solution and the force inverse solution is reduced for the simplification of the motion. The kinematics, static mechanics, and dynamic mechanics are analyzed in this paper. What is more, two demonstration applications are developed to verify the performance of the designed hand-controller.

  20. Parameterized Analysis of 2-DOF Motion Platform Based on ADAMS

    Directory of Open Access Journals (Sweden)

    Hu Hanyuan


    Full Text Available According to the functions of parametric modeling and analysis from ADAMS, this thesis was established a parametric simulation model in order to optimize the rated output power of electric cylinders according to the real field environment. First, the variable which could affect sensitivity of the output variables was chosen by the electric cylinder’s elongation which was obtained through loop vector method. Then this thesis tried to get the optimum optimization design parameters through the simulation, and the change of rated output power affected by the change of parameters, meanwhile, made a filter and calibration of parameters which have greater influence on sensibilities. The goal of design could meet the qualification with less work load and faster speed. It is concluded that the change of the location parameters affects the rated output power.

  1. A Bioinspired 10 DOF Wearable Powered Arm Exoskeleton for Rehabilitation

    Directory of Open Access Journals (Sweden)

    Soumya Kanti Manna


    Full Text Available The developed exoskeleton device (Exorn has ten degrees of freedom to control joints starting from shoulder griddle to wrist to provide better redundancy, portability, and flexibility to the human arm motion. A 3D conceptual model is being designed to make the system wearable by human arm. All the joints are simple revolute joints with desired motion limit. A Simulink model of the human arm is being developed with proper mass and length to determine proper torque required for actuating those joints. Forward kinematics of the whole system has been formulated for getting desired dexterous workspace. A proper and simple Graphical User Interface (GUI and the required embedded system have been designed for providing physiotherapy lessons to the patients. In the literature review it has been found that researchers have generally ignored the motion of shoulder griddle. Here we have implemented those motions in our design. It has also been found that people have taken elbow pronation and supination motion as a part of shoulder internal and external rotation though both motions are quite different. A predefined resolved motion rate control structure with independent joint control is used so that all movements can be controlled in a predefined way.

  2. Bilateral teleoperation for force sensorless 1-dof robots

    NARCIS (Netherlands)

    Lichiardopol, S.; Wouw, van de N.; Nijmeijer, H.; Filipe, J.; Cetto, J.A.; Ferrier, J.-L.


    It is well known that for bilateral teleoperation, force feedback information is needed. In this paper, we propose a control approach for bilateral teleoperation with uncertainties in the model of the slave robot and which does not use force sensors for haptic feedback. The controller design is

  3. Modeling, Simulation and Position Control of 3DOF Articulated Manipulator

    Directory of Open Access Journals (Sweden)

    Hossein Sadegh Lafmejani


    Full Text Available In this paper, the modeling, simulation and control of 3 degrees of freedom articulated robotic manipulator have been studied. First, we extracted kinematics and dynamics equations of the mentioned manipulator by using the Lagrange method. In order to validate the analytical model of the manipulator we compared the model simulated in the simulation environment of Matlab with the model was simulated with the SimMechanics toolbox. A sample path has been designed for analyzing the tracking subject. The system has been linearized with feedback linearization and then a PID controller was applied to track a reference trajectory. Finally, the control results have been compared with a nonlinear PID controller.

  4. Dealing with Flexible Modes in 6 DOFs Robust Servo Control

    NARCIS (Netherlands)

    Oomen, T.A.E.; Bosgra, O.H.; Angelis, G.Z.


    Control of high performance multi-input multi-output electromechanical systems with flexible dynamics is investigated. Present feedforward and feedback control design approaches mainly focus on rigid-body plant behaviour. To achieve higher performance, flexible dynamics should be explicitly


    Directory of Open Access Journals (Sweden)

    NAIDIN Gigi


    Full Text Available Modelling and simulation is an important aspect in robotic field. Knowing of the workspace is very important to the operation of manipulators arm. This paper investigates operational performance of space manipulator arm destined for industrial manufacturing, by defining and analyzing their workspace and manipulability measure. The authors show that manipulator arm developing requires the consideration of more efficient dynamic models and use of dedicated processing techniques such as Autodesk-Inventor 9, MATLAB, WorkSpace software.

  6. Protein kinesis: The dynamics of protein trafficking and stability

    Energy Technology Data Exchange (ETDEWEB)



    The purpose of this conference is to provide a multidisciplinary forum for exchange of state-of-the-art information on protein kinesis. This volume contains abstracts of papers in the following areas: protein folding and modification in the endoplasmic reticulum; protein trafficking; protein translocation and folding; protein degradation; polarity; nuclear trafficking; membrane dynamics; and protein import into organelles.


    Directory of Open Access Journals (Sweden)

    Michael J. Falvo


    Full Text Available Protein intake that exceeds the recommended daily allowance is widely accepted for both endurance and power athletes. However, considering the variety of proteins that are available much less is known concerning the benefits of consuming one protein versus another. The purpose of this paper is to identify and analyze key factors in order to make responsible recommendations to both the general and athletic populations. Evaluation of a protein is fundamental in determining its appropriateness in the human diet. Proteins that are of inferior content and digestibility are important to recognize and restrict or limit in the diet. Similarly, such knowledge will provide an ability to identify proteins that provide the greatest benefit and should be consumed. The various techniques utilized to rate protein will be discussed. Traditionally, sources of dietary protein are seen as either being of animal or vegetable origin. Animal sources provide a complete source of protein (i.e. containing all essential amino acids, whereas vegetable sources generally lack one or more of the essential amino acids. Animal sources of dietary protein, despite providing a complete protein and numerous vitamins and minerals, have some health professionals concerned about the amount of saturated fat common in these foods compared to vegetable sources. The advent of processing techniques has shifted some of this attention and ignited the sports supplement marketplace with derivative products such as whey, casein and soy. Individually, these products vary in quality and applicability to certain populations. The benefits that these particular proteins possess are discussed. In addition, the impact that elevated protein consumption has on health and safety issues (i.e. bone health, renal function are also reviewed

  8. Specificity and affinity quantification of protein-protein interactions. (United States)

    Yan, Zhiqiang; Guo, Liyong; Hu, Liang; Wang, Jin


    Most biological processes are mediated by the protein-protein interactions. Determination of the protein-protein structures and insight into their interactions are vital to understand the mechanisms of protein functions. Currently, compared with the isolated protein structures, only a small fraction of protein-protein structures are experimentally solved. Therefore, the computational docking methods play an increasing role in predicting the structures and interactions of protein-protein complexes. The scoring function of protein-protein interactions is the key responsible for the accuracy of the computational docking. Previous scoring functions were mostly developed by optimizing the binding affinity which determines the stability of the protein-protein complex, but they are often lack of the consideration of specificity which determines the discrimination of native protein-protein complex against competitive ones. We developed a scoring function (named as SPA-PP, specificity and affinity of the protein-protein interactions) by incorporating both the specificity and affinity into the optimization strategy. The testing results and comparisons with other scoring functions show that SPA-PP performs remarkably on both predictions of binding pose and binding affinity. Thus, SPA-PP is a promising quantification of protein-protein interactions, which can be implemented into the protein docking tools and applied for the predictions of protein-protein structure and affinity. The algorithm is implemented in C language, and the code can be downloaded from

  9. General protein-protein cross-linking. (United States)

    Alegria-Schaffer, Alice


    This protocol describes a general protein-to-protein cross-linking procedure using the water-soluble amine-reactive homobifunctional BS(3) (bis[sulfosuccinimidyl] suberate); however, the protocol can be easily adapted using other cross-linkers of similar properties. BS(3) is composed of two sulfo-NHS ester groups and an 11.4 Å linker. Sulfo-NHS ester groups react with primary amines in slightly alkaline conditions (pH 7.2-8.5) and yield stable amide bonds. The reaction releases N-hydroxysuccinimide (see an application of NHS esters on Labeling a protein with fluorophores using NHS ester derivitization). © 2014 Elsevier Inc. All rights reserved.

  10. Scoring functions for protein-protein interactions. (United States)

    Moal, Iain H; Moretti, Rocco; Baker, David; Fernández-Recio, Juan


    The computational evaluation of protein-protein interactions will play an important role in organising the wealth of data being generated by high-throughput initiatives. Here we discuss future applications, report recent developments and identify areas requiring further investigation. Many functions have been developed to quantify the structural and energetic properties of interacting proteins, finding use in interrelated challenges revolving around the relationship between sequence, structure and binding free energy. These include loop modelling, side-chain refinement, docking, multimer assembly, affinity prediction, affinity change upon mutation, hotspots location and interface design. Information derived from models optimised for one of these challenges can be used to benefit the others, and can be unified within the theoretical frameworks of multi-task learning and Pareto-optimal multi-objective learning. Copyright © 2013 Elsevier Ltd. All rights reserved.

  11. Computational Protein Design

    DEFF Research Database (Denmark)

    Johansson, Kristoffer Enøe

    Proteins are the major functional group of molecules in biology. The impact of protein science on medicine and chemical productions is rapidly increasing. However, the greatest potential remains to be realized. The fi eld of protein design has advanced computational modeling from a tool of support...... to a central method that enables new developments. For example, novel enzymes with functions not found in natural proteins have been de novo designed to give enough activity for experimental optimization. This thesis presents the current state-of-the-art within computational design methods together...... with a novel method based on probability theory. With the aim of assembling a complete pipeline for protein design, this work touches upon several aspects of protein design. The presented work is the computational half of a design project where the other half is dedicated to the experimental part...

  12. Blue Emission in Proteins


    Sarkar, Sohini; Sengupta, Abhigyan; Hazra, Partha; Mandal, Pankaj


    Recent literatures reported blue-green emission from amyloid fibril as exclusive signature of fibril formation. This unusual visible luminescence is regularly used to monitor fibril growth. Blue-green emission has also been observed in crystalline protein and in solution. However, the origin of this emission is not known exactly. Our spectroscopic study of serum proteins reveals that the blue-green emission is a property of protein monomer. Evidences suggest that semiconductor-like band struc...

  13. Pressure cryocooling protein crystals (United States)

    Kim, Chae Un [Ithaca, NY; Gruner, Sol M [Ithaca, NY


    Preparation of cryocooled protein crystal is provided by use of helium pressurizing and cryocooling to obtain cryocooled protein crystal allowing collection of high resolution data and by heavier noble gas (krypton or xenon) binding followed by helium pressurizing and cryocooling to obtain cryocooled protein crystal for collection of high resolution data and SAD phasing simultaneously. The helium pressurizing is carried out on crystal coated to prevent dehydration or on crystal grown in aqueous solution in a capillary.

  14. Yeast ribosomal proteins

    International Nuclear Information System (INIS)

    Otaka, E.; Kobata, K.


    The cytoplasmic 80s ribosomal proteins from the cells of yeast Saccharomyces cerevisiae were analyzed by SDS two-dimensional polyacrylamide gel electrophoresis. Seventyfour proteins were identified and consecutively numbered from 1 to 74. Upon oxidation of the 80s proteins with performic acid, ten proteins (no. 15, 20, 35, 40, 44, 46, 49, 51, 54 and 55) were dislocated on the gel without change of the total number of protein spots. Five proteins (no. 8, 14, 16, 36 and 74) were phosphorylated in vivo as seen in 32 P-labelling experiments. The large and small subunits separated in low magnesium medium were analyzed by the above gel electrophoresis. At least forty-five and twenty-eight proteins were assumed to be in the large and small subunits, respectively. All proteins found in the 80s ribosomes, except for no. 3, were detected in either subunit without appearance of new spots. The acidic protein no. 3 seems to be lost during subunit dissociation. (orig.) [de

  15. Physics of protein folding (United States)

    Finkelstein, A. V.; Galzitskaya, O. V.


    Protein physics is grounded on three fundamental experimental facts: protein, this long heteropolymer, has a well defined compact three-dimensional structure; this structure can spontaneously arise from the unfolded protein chain in appropriate environment; and this structure is separated from the unfolded state of the chain by the “all-or-none” phase transition, which ensures robustness of protein structure and therefore of its action. The aim of this review is to consider modern understanding of physical principles of self-organization of protein structures and to overview such important features of this process, as finding out the unique protein structure among zillions alternatives, nucleation of the folding process and metastable folding intermediates. Towards this end we will consider the main experimental facts and simple, mostly phenomenological theoretical models. We will concentrate on relatively small (single-domain) water-soluble globular proteins (whose structure and especially folding are much better studied and understood than those of large or membrane and fibrous proteins) and consider kinetic and structural aspects of transition of initially unfolded protein chains into their final solid (“native”) 3D structures.

  16. Ultrafiltration of pegylated proteins (United States)

    Molek, Jessica R.

    There is considerable clinical interest in the use of "second-generation" therapeutics produced by conjugation of a native protein with various polymers including polyethylene glycol (PEG). PEG--protein conjugates, so-called PEGylated proteins, can exhibit enhanced stability, half-life, and bioavailability. One of the challenges in the commercial production of PEGylated proteins is the purification required to remove unreacted polymer, native protein, and in many cases PEGylated proteins with nonoptimal degrees of conjugation. The overall objective of this thesis was to examine the use of ultrafiltration for the purification of PEGylated proteins. This included: (1) analysis of size-based separation of PEGylated proteins using conventional ultrafiltration membranes, (2) use of electrically-charged membranes to exploit differences in electrostatic interactions, and (3) examination of the effects of PEGylation on protein fouling. The experimental results were analyzed using appropriate theoretical models, with the underlying physical properties of the PEGylated proteins evaluated using size exclusion chromatography, capillary electrophoresis, dynamic light scattering, and reverse phase chromatography. PEGylated proteins were produced by covalent attachment of activated PEG to a protein via primary amines on the lysine residues. A simple model was developed for the reaction kinetics, which was used to explore the effect of reaction conditions and mode of operation on the distribution of PEGylated products. The effective size of the PEGylated proteins was evaluated using size exclusion chromatography, with appropriate correlations developed for the size in terms of the molecular weight of the native protein and attached PEG. The electrophoretic mobility of the PEGylated proteins were evaluated by capillary electrophoresis with the data in good agreement with a simple model accounting for the increase in protein size and the reduction in the number of protonated amine

  17. Advances in Protein Precipitation

    NARCIS (Netherlands)

    Golubovic, M.


    Proteins are biological macromolecules, which are among the key components of all living organisms. Proteins are nowadays present in all fields of biotech industry, such as food and feed, synthetic and pharmaceutical industry. They are isolated from their natural sources or produced in different

  18. Synthesis of Lipidated Proteins. (United States)

    Mejuch, Tom; Waldmann, Herbert


    Protein lipidation is one of the major post-translational modifications (PTM) of proteins. The attachment of the lipid moiety frequently determines the localization and the function of the lipoproteins. Lipidated proteins participate in many essential biological processes in eukaryotic cells, including vesicular trafficking, signal transduction, and regulation of the immune response. Malfunction of these cellular processes usually leads to various diseases such as cancer. Understanding the mechanism of cellular signaling and identifying the protein-protein and protein-lipid interactions in which the lipoproteins are involved is a crucial task. To achieve these goals, fully functional lipidated proteins are required. However, access to lipoproteins by means of standard expression is often rather limited. Therefore, semisynthetic methods, involving the synthesis of lipidated peptides and their subsequent chemoselective ligation to yield full-length lipoproteins, were developed. In this Review we summarize the commonly used methods for lipoprotein synthesis and the development of the corresponding chemoselective ligation techniques. Several key studies involving full-length semisynthetic lipidated Ras, Rheb, and LC3 proteins are presented.

  19. Amino acids and proteins

    NARCIS (Netherlands)

    van Goudoever, Johannes B.; Vlaardingerbroek, Hester; van den Akker, Chris H.; de Groof, Femke; van der Schoor, Sophie R. D.


    Amino acids and protein are key factors for growth. The neonatal period requires the highest intake in life to meet the demands. Those demands include amino acids for growth, but proteins and amino acids also function as signalling molecules and function as neurotransmitters. Often the nutritional

  20. Protein Attachment on Nanodiamonds. (United States)

    Lin, Chung-Lun; Lin, Cheng-Huang; Chang, Huan-Cheng; Su, Meng-Chih


    A recent advance in nanotechnology is the scale-up production of small and nonaggregated diamond nanoparticles suitable for biological applications. Using detonation nanodiamonds (NDs) with an average diameter of ∼4 nm as the adsorbents, we have studied the static attachment of three proteins (myoglobin, bovine serum albumin, and insulin) onto the nanoparticles by optical spectroscopy, mass spectrometry, and dynamic light scattering, and electrophoretic zeta potential measurements. Results show that the protein surface coverage is predominantly determined by the competition between protein-protein and protein-ND interactions, giving each protein a unique and characteristic structural configuration in its own complex. Specifically, both myoglobin and bovine serum albumin show a Langmuir-type adsorption behavior, forming 1:1 complexes at saturation, whereas insulin folds into a tightly bound multimer before adsorption. The markedly different adsorption patterns appear to be independent of the protein concentration and are closely related to the affinity of the individual proteins for the NDs. The present study provides a fundamental understanding for the use of NDs as a platform for nanomedical drug delivery.

  1. Poxviral Ankyrin Proteins

    Directory of Open Access Journals (Sweden)

    Michael H. Herbert


    Full Text Available Multiple repeats of the ankyrin motif (ANK are ubiquitous throughout the kingdoms of life but are absent from most viruses. The main exception to this is the poxvirus family, and specifically the chordopoxviruses, with ANK repeat proteins present in all but three species from separate genera. The poxviral ANK repeat proteins belong to distinct orthologue groups spread over different species, and align well with the phylogeny of their genera. This distribution throughout the chordopoxviruses indicates these proteins were present in an ancestral vertebrate poxvirus, and have since undergone numerous duplication events. Most poxviral ANK repeat proteins contain an unusual topology of multiple ANK motifs starting at the N-terminus with a C-terminal poxviral homologue of the cellular F-box enabling interaction with the cellular SCF ubiquitin ligase complex. The subtle variations between ANK repeat proteins of individual poxviruses suggest an array of different substrates may be bound by these protein-protein interaction domains and, via the F-box, potentially directed to cellular ubiquitination pathways and possible degradation. Known interaction partners of several of these proteins indicate that the NF-κB coordinated anti-viral response is a key target, whilst some poxviral ANK repeat domains also have an F-box independent affect on viral host-range.

  2. Protein oxidation and peroxidation

    DEFF Research Database (Denmark)

    Davies, Michael Jonathan


    Proteins are major targets for radicals and two-electron oxidants in biological systems due to their abundance and high rate constants for reaction. With highly reactive radicals damage occurs at multiple side-chain and backbone sites. Less reactive species show greater selectivity with regard...... to the residues targeted and their spatial location. Modification can result in increased side-chain hydrophilicity, side-chain and backbone fragmentation, aggregation via covalent cross-linking or hydrophobic interactions, protein unfolding and altered conformation, altered interactions with biological partners...... and modified turnover. In the presence of O2, high yields of peroxyl radicals and peroxides (protein peroxidation) are formed; the latter account for up to 70% of the initial oxidant flux. Protein peroxides can oxidize both proteins and other targets. One-electron reduction results in additional radicals...

  3. Protein restriction and cancer. (United States)

    Yin, Jie; Ren, Wenkai; Huang, Xingguo; Li, Tiejun; Yin, Yulong


    Protein restriction without malnutrition is currently an effective nutritional intervention known to prevent diseases and promote health span from yeast to human. Recently, low protein diets are reported to be associated with lowered cancer incidence and mortality risk of cancers in human. In murine models, protein restriction inhibits tumor growth via mTOR signaling pathway. IGF-1, amino acid metabolic programing, FGF21, and autophagy may also serve as potential mechanisms of protein restriction mediated cancer prevention. Together, dietary intervention aimed at reducing protein intake can be beneficial and has the potential to be widely adopted and effective in preventing and treating cancers. Copyright © 2018 Elsevier B.V. All rights reserved.

  4. Sensitizing properties of proteins

    DEFF Research Database (Denmark)

    Poulsen, Lars K.; Ladics, Gregory S; McClain, Scott


    The scope of allergy risk is diverse considering the myriad ways in which protein allergenicity is affected by physiochemical characteristics of proteins. The complexity created by the matrices of foods and the variability of the human immune system add additional challenges to understanding...... the relationship between sensitization potential and allergy disease. To address these and other issues, an April 2012 international symposium was held in Prague, Czech Republic, to review and discuss the state-of-the-science of sensitizing properties of protein allergens. The symposium, organized by the Protein...... Allergenicity Technical Committee of the International Life Sciences Institute's Health and Environmental Sciences Institute, featured presentations on current methods, test systems, research trends, and unanswered questions in the field of protein sensitization. A diverse group of over 70 interdisciplinary...

  5. Artificially Engineered Protein Polymers. (United States)

    Yang, Yun Jung; Holmberg, Angela L; Olsen, Bradley D


    Modern polymer science increasingly requires precise control over macromolecular structure and properties for engineering advanced materials and biomedical systems. The application of biological processes to design and synthesize artificial protein polymers offers a means for furthering macromolecular tunability, enabling polymers with dispersities of ∼1.0 and monomer-level sequence control. Taking inspiration from materials evolved in nature, scientists have created modular building blocks with simplified monomer sequences that replicate the function of natural systems. The corresponding protein engineering toolbox has enabled the systematic development of complex functional polymeric materials across areas as diverse as adhesives, responsive polymers, and medical materials. This review discusses the natural proteins that have inspired the development of key building blocks for protein polymer engineering and the function of these elements in material design. The prospects and progress for scalable commercialization of protein polymers are reviewed, discussing both technology needs and opportunities.

  6. The Protein Model Portal. (United States)

    Arnold, Konstantin; Kiefer, Florian; Kopp, Jürgen; Battey, James N D; Podvinec, Michael; Westbrook, John D; Berman, Helen M; Bordoli, Lorenza; Schwede, Torsten


    Structural Genomics has been successful in determining the structures of many unique proteins in a high throughput manner. Still, the number of known protein sequences is much larger than the number of experimentally solved protein structures. Homology (or comparative) modeling methods make use of experimental protein structures to build models for evolutionary related proteins. Thereby, experimental structure determination efforts and homology modeling complement each other in the exploration of the protein structure space. One of the challenges in using model information effectively has been to access all models available for a specific protein in heterogeneous formats at different sites using various incompatible accession code systems. Often, structure models for hundreds of proteins can be derived from a given experimentally determined structure, using a variety of established methods. This has been done by all of the PSI centers, and by various independent modeling groups. The goal of the Protein Model Portal (PMP) is to provide a single portal which gives access to the various models that can be leveraged from PSI targets and other experimental protein structures. A single interface allows all existing pre-computed models across these various sites to be queried simultaneously, and provides links to interactive services for template selection, target-template alignment, model building, and quality assessment. The current release of the portal consists of 7.6 million model structures provided by different partner resources (CSMP, JCSG, MCSG, NESG, NYSGXRC, JCMM, ModBase, SWISS-MODEL Repository). The PMP is available at and from the PSI Structural Genomics Knowledgebase.

  7. Coarse-grain modelling of protein-protein interactions

    NARCIS (Netherlands)

    Baaden, Marc; Marrink, Siewert J.


    Here, we review recent advances towards the modelling of protein-protein interactions (PPI) at the coarse-grained (CG) level, a technique that is now widely used to understand protein affinity, aggregation and self-assembly behaviour. PPI models of soluble proteins and membrane proteins are

  8. Protein-Protein Docking in Drug Design and Discovery. (United States)

    Kaczor, Agnieszka A; Bartuzi, Damian; Stępniewski, Tomasz Maciej; Matosiuk, Dariusz; Selent, Jana


    Protein-protein interactions (PPIs) are responsible for a number of key physiological processes in the living cells and underlie the pathomechanism of many diseases. Nowadays, along with the concept of so-called "hot spots" in protein-protein interactions, which are well-defined interface regions responsible for most of the binding energy, these interfaces can be targeted with modulators. In order to apply structure-based design techniques to design PPIs modulators, a three-dimensional structure of protein complex has to be available. In this context in silico approaches, in particular protein-protein docking, are a valuable complement to experimental methods for elucidating 3D structure of protein complexes. Protein-protein docking is easy to use and does not require significant computer resources and time (in contrast to molecular dynamics) and it results in 3D structure of a protein complex (in contrast to sequence-based methods of predicting binding interfaces). However, protein-protein docking cannot address all the aspects of protein dynamics, in particular the global conformational changes during protein complex formation. In spite of this fact, protein-protein docking is widely used to model complexes of water-soluble proteins and less commonly to predict structures of transmembrane protein assemblies, including dimers and oligomers of G protein-coupled receptors (GPCRs). In this chapter we review the principles of protein-protein docking, available algorithms and software and discuss the recent examples, benefits, and drawbacks of protein-protein docking application to water-soluble proteins, membrane anchoring and transmembrane proteins, including GPCRs.

  9. Bacterial Ice Crystal Controlling Proteins (United States)

    Lorv, Janet S. H.; Rose, David R.; Glick, Bernard R.


    Across the world, many ice active bacteria utilize ice crystal controlling proteins for aid in freezing tolerance at subzero temperatures. Ice crystal controlling proteins include both antifreeze and ice nucleation proteins. Antifreeze proteins minimize freezing damage by inhibiting growth of large ice crystals, while ice nucleation proteins induce formation of embryonic ice crystals. Although both protein classes have differing functions, these proteins use the same ice binding mechanisms. Rather than direct binding, it is probable that these protein classes create an ice surface prior to ice crystal surface adsorption. Function is differentiated by molecular size of the protein. This paper reviews the similar and different aspects of bacterial antifreeze and ice nucleation proteins, the role of these proteins in freezing tolerance, prevalence of these proteins in psychrophiles, and current mechanisms of protein-ice interactions. PMID:24579057

  10. Protein oxidation in aquatic foods

    DEFF Research Database (Denmark)

    Baron, Caroline P.


    The chapter discusses general considerations about protein oxidation and reviews the mechanisms involved in protein oxidation and consequences of protein oxidation on fish proteins. It presents two case studies, the first deals with protein and lipid oxidation in frozen rainbow trout......, and the second with oxidation in salted herring. The mechanisms responsible for initiation of protein oxidation are unclear, but it is generally accepted that free radical species initiating lipid oxidation can also initiate protein oxidation. The chapter focuses on interaction between protein and lipid...... oxidation. The protein carbonyl group measurement is the widely used method for estimating protein oxidation in foods and has been used in fish muscle. The chapter also talks about the impact of protein oxidation on protein functionality, fish muscle texture, and food nutritional value. Protein oxidation...

  11. Endometrial proteins: a reappraisal. (United States)

    Seppälä, M; Julkunen, M; Riittinen, L; Koistinen, R


    Uterine factors influence reproduction at the macro-anatomy level, and the effects of hormonal steroids on endometrial morphology are well recognized in the histopathological diagnosis of dysfunctional bleeding and infertility. During the past decade, attention has been paid to endometrial protein synthesis and secretion with respect to endocrine stimuli and implantation, and to the paracrine/autocrine effects of endometrial peptide growth factors, their binding proteins and other factors. The emphasis of this presentation is on protein secretion of the secretory endometrium, in which progesterone plays a pivotal role. Insulin-like growth factors have receptors on the endometrium, and IGF-binding proteins, stimulated by progesterone, modulate the effects of IGFs locally. Also other protein products of the secretory endometrium have been reviewed in this communication, with special emphasis on studies of a progesterone-associated endometrial protein which has many names in the literature, such as PEP, PP14, alpha 2-PEG and AUP. Extensive studies are ongoing in many laboratories to elucidate the regulation, function, interplay at tissue and cellular levels, and clinical significance of these proteins.

  12. Protein trapping of nanoparticles

    International Nuclear Information System (INIS)

    Ang, Joo C.; Lin, Jack M.; Yaron, Peter N.; White, John W.


    Full text: We have observed the formation of protein-nanoparticle complexes at the air-water interfaces from three different methods of presenting the nanoparticles to proteins. The structures formed resemble the 'protein-nanoparticle corona' proposed by Lynch et al. [1-3) in relation to a possible route for nanoparticle entry into living cells. To do this, the methods of x-ray and neutron reflectivity (with isotopic contrast variation between the protein and nanoparticles) have been used to study the structures formed at the air-water interface of l 3 - casein presented to silica nanoparticle dispersions. Whilst the silica dispersions showed no observable reflectivity, strong signals appear in the reflectivity when protein is present. Drop-wise spreading of a small amount of protein at the air-silica sol interface and presentation of the silica sol to an isolated monomolecular protein film (made by the 'flow-trough' method [4]) gave an immediate signal. Mixing the components in solution only produces a slow response but in all cases a similar structure is formed. The different responses are interpreted in structural and stoichiometric ways.

  13. Intercellular protein-protein interactions at synapses. (United States)

    Yang, Xiaofei; Hou, Dongmei; Jiang, Wei; Zhang, Chen


    Chemical synapses are asymmetric intercellular junctions through which neurons send nerve impulses to communicate with other neurons or excitable cells. The appropriate formation of synapses, both spatially and temporally, is essential for brain function and depends on the intercellular protein-protein interactions of cell adhesion molecules (CAMs) at synaptic clefts. The CAM proteins link pre- and post-synaptic sites, and play essential roles in promoting synapse formation and maturation, maintaining synapse number and type, accumulating neurotransmitter receptors and ion channels, controlling neuronal differentiation, and even regulating synaptic plasticity directly. Alteration of the interactions of CAMs leads to structural and functional impairments, which results in many neurological disorders, such as autism, Alzheimer's disease and schizophrenia. Therefore, it is crucial to understand the functions of CAMs during development and in the mature neural system, as well as in the pathogenesis of some neurological disorders. Here, we review the function of the major classes of CAMs, and how dysfunction of CAMs relates to several neurological disorders.

  14. Functional aspects of protein flexibility

    DEFF Research Database (Denmark)

    Teilum, Kaare; Olsen, Johan G; Kragelund, Birthe B


    this into an intuitive perception of protein function is challenging. Flexibility is of overwhelming importance for protein function, and the changes in protein structure during interactions with binding partners can be dramatic. The present review addresses protein flexibility, focusing on protein-ligand interactions...

  15. Alpha Shapes and Proteins

    DEFF Research Database (Denmark)

    Winter, Pawel; Sterner, Henrik; Sterner, Peter


    We provide a unified description of (weighted) alpha shapes, beta shapes and the corresponding simplicialcomplexes. We discuss their applicability to various protein-related problems. We also discuss filtrations of alpha shapes and touch upon related persistence issues.We claim that the full...... potential of alpha-shapes and related geometrical constructs in protein-related problems yet remains to be realized and verified. We suggest parallel algorithms for (weighted) alpha shapes, and we argue that future use of filtrations and kinetic variants for larger proteins will need such implementation....

  16. The Pentapeptide Repeat Proteins


    Vetting, Matthew W.; Hegde, Subray S.; Fajardo, J. Eduardo; Fiser, Andras; Roderick, Steven L.; Takiff, Howard E.; Blanchard, John S.


    The Pentapeptide Repeat Protein (PRP) family has over 500 members in the prokaryotic and eukaryotic kingdoms. These proteins are composed of, or contain domains composed of, tandemly repeated amino acid sequences with a consensus sequence of [S,T,A,V][D,N][L,F]-[S,T,R][G]. The biochemical function of the vast majority of PRP family members is unknown. The three-dimensional structure of the first member of the PRP family was determined for the fluoroquinolone resistance protein (MfpA) from Myc...

  17. Pierced Lasso Proteins (United States)

    Jennings, Patricia

    Entanglement and knots are naturally occurring, where, in the microscopic world, knots in DNA and homopolymers are well characterized. The most complex knots are observed in proteins which are harder to investigate, as proteins are heteropolymers composed of a combination of 20 different amino acids with different individual biophysical properties. As new-knotted topologies and new proteins containing knots continue to be discovered and characterized, the investigation of knots in proteins has gained intense interest. Thus far, the principle focus has been on the evolutionary origin of tying a knot, with questions of how a protein chain `self-ties' into a knot, what the mechanism(s) are that contribute to threading, and the biological relevance and functional implication of a knotted topology in vivo gaining the most insight. Efforts to study the fully untied and unfolded chain indicate that the knot is highly stable, remaining intact in the unfolded state orders of magnitude longer than first anticipated. The persistence of ``stable'' knots in the unfolded state, together with the challenge of defining an unfolded and untied chain from an unfolded and knotted chain, complicates the study of fully untied protein in vitro. Our discovery of a new class of knotted proteins, the Pierced Lassos (PL) loop topology, simplifies the knotting approach. While PLs are not easily recognizable by the naked eye, they have now been identified in many proteins in the PDB through the use of computation tools. PL topologies are diverse proteins found in all kingdoms of life, performing a large variety of biological responses such as cell signaling, immune responses, transporters and inhibitors ( Many of these PL topologies are secreted proteins, extracellular proteins, as well as, redox sensors, enzymes and metal and co-factor binding proteins; all of which provide a favorable environment for the formation of the disulphide bridge. In the PL

  18. Protein digestion in ruminants

    African Journals Online (AJOL)

    a balance between synthesis and hydrolysis. Aside from .... be used to follow the synthesis of this protein fraction. (Clarke, 1977a) .... form of digestive enzymes, urea and ammonia (Egan, ..... decreasing urine-nitrogen excretion (Thornton, Bird,.

  19. Dietary Proteins and Angiogenesis

    Directory of Open Access Journals (Sweden)

    Miguel Ángel Medina


    Full Text Available Both defective and persistent angiogenesis are linked to pathological situations in the adult. Compounds able to modulate angiogenesis have a potential value for the treatment of such pathologies. Several small molecules present in the diet have been shown to have modulatory effects on angiogenesis. This review presents the current state of knowledge on the potential modulatory roles of dietary proteins on angiogenesis. There is currently limited available information on the topic. Milk contains at least three proteins for which modulatory effects on angiogenesis have been previously demonstrated. On the other hand, there is some scarce information on the potential of dietary lectins, edible plant proteins and high protein diets to modulate angiogenesis.

  20. Electron transfer in proteins

    DEFF Research Database (Denmark)

    Farver, O; Pecht, I


    Electron migration between and within proteins is one of the most prevalent forms of biological energy conversion processes. Electron transfer reactions take place between active centers such as transition metal ions or organic cofactors over considerable distances at fast rates and with remarkable...... specificity. The electron transfer is attained through weak electronic interaction between the active sites, so that considerable research efforts are centered on resolving the factors that control the rates of long-distance electron transfer reactions in proteins. These factors include (in addition......-containing proteins. These proteins serve almost exclusively in electron transfer reactions, and as it turns out, their metal coordination sites are endowed with properties uniquely optimized for their function....

  1. Markers of protein oxidation

    DEFF Research Database (Denmark)

    Headlam, Henrietta A; Davies, Michael Jonathan


    Exposure of proteins to radicals in the presence of O2 gives both side-chain oxidation and backbone fragmentation. These processes can be interrelated, with initial side-chain oxidation giving rise to backbone damage via transfer reactions. We have shown previously that alkoxyl radicals formed...... of this process depends on the extent of oxidation at C-3 compared with other sites. HO*, generated by gamma radiolysis, gave the highest total carbonyl yield, with protein-bound carbonyls predominating over released. In contrast, metal ion/H2O2 systems, gave more released than bound carbonyls, with this ratio...... modulated by EDTA. This is ascribed to metal ion-protein interactions affecting the sites of initial oxidation. Hypochlorous acid gave low concentrations of released carbonyls, but high yields of protein-bound material. The peroxyl radical generator 2,2'-azobis(2-amidinopropane) hydrochloride...

  2. Protein Colloidal Aggregation Project (United States)

    Oliva-Buisson, Yvette J. (Compiler)


    To investigate the pathways and kinetics of protein aggregation to allow accurate predictive modeling of the process and evaluation of potential inhibitors to prevalent diseases including cataract formation, chronic traumatic encephalopathy, Alzheimer's Disease, Parkinson's Disease and others.

  3. Protein Polymers and Amyloids

    DEFF Research Database (Denmark)

    Risør, Michael Wulff


    Several human disorders are caused by a common general disease mechanism arising from abnormal folding and aggregation of the underlying protein. These include the prevalent dementias like Alzheimer’s and Parkinson’s, where accumulation of protein fibrillar structures, known as amyloid fibrils......, is a general hallmark. They also include the α1-antitrypsin deficiency, where disease-causing mutations in the serine protease inhibitor, α1-antitrypsin (α1AT), leads to accumulation of the aberrant protein in the liver of these patients. The native metastable structure of α1AT constitutes a molecular trap...... that inhibits its target protease through a large conformational change but mutations compromise this function and cause premature structural collapse into hyperstable polymers. Understanding the conformational disorders at a molecular level is not only important for our general knowledge on protein folding...

  4. Protein turnover in sheep

    International Nuclear Information System (INIS)

    Buttery, P.J.


    Considerable advances have been made in the knowledge of the mechanisms and control of synthesis and degradation of proteins in animal tissues during the last decade. Most of the work on the measurement of synthetic and degradative rates of the mixed protein fraction from tissues has been conducted in the rat. There have, unfortunately, been few publications describing results of protein turnover studies with ruminants. Consideration is given here to the techniques used to measure protein turnover, and some of the results obtained, particularly with sheep, are summarized. No attempt has been made to discuss directly the situation in parasitized animals; rather the aim is to provide background information which complements other work dealing with the effects of parasites on the nitrogen metabolism of ruminants. (author)

  5. MicroProteins

    DEFF Research Database (Denmark)

    Eguen, Teinai Ebimienere; Straub, Daniel; Graeff, Moritz


    MicroProteins (miPs) are short, usually single-domain proteins that, in analogy to miRNAs, heterodimerize with their targets and exert a dominant-negative effect. Recent bioinformatic attempts to identify miPs have resulted in a list of potential miPs, many of which lack the defining...... characteristics of a miP. In this opinion article, we clearly state the characteristics of a miP as evidenced by known proteins that fit the definition; we explain why modulatory proteins misrepresented as miPs do not qualify as true miPs. We also discuss the evolutionary history of miPs, and how the miP concept...

  6. Interactive protein manipulation

    Energy Technology Data Exchange (ETDEWEB)


    We describe an interactive visualization and modeling program for the creation of protein structures ''from scratch''. The input to our program is an amino acid sequence -decoded from a gene- and a sequence of predicted secondary structure types for each amino acid-provided by external structure prediction programs. Our program can be used in the set-up phase of a protein structure prediction process; the structures created with it serve as input for a subsequent global internal energy minimization, or another method of protein structure prediction. Our program supports basic visualization methods for protein structures, interactive manipulation based on inverse kinematics, and visualization guides to aid a user in creating ''good'' initial structures.

  7. Interactive protein manipulation

    International Nuclear Information System (INIS)


    We describe an interactive visualization and modeling program for the creation of protein structures ''from scratch''. The input to our program is an amino acid sequence -decoded from a gene- and a sequence of predicted secondary structure types for each amino acid-provided by external structure prediction programs. Our program can be used in the set-up phase of a protein structure prediction process; the structures created with it serve as input for a subsequent global internal energy minimization, or another method of protein structure prediction. Our program supports basic visualization methods for protein structures, interactive manipulation based on inverse kinematics, and visualization guides to aid a user in creating ''good'' initial structures

  8. The protein protocols handbook

    National Research Council Canada - National Science Library

    Walker, John M


    .... The new chapters cover with many rapidly developing areas, particularly the application of mass spectrometry in protein characterization, as well as the now well-established 2-D PAGE technique in proteomics...

  9. Polymers for Protein Conjugation

    Directory of Open Access Journals (Sweden)

    Gianfranco Pasut


    Full Text Available Polyethylene glycol (PEG at the moment is considered the leading polymer for protein conjugation in view of its unique properties, as well as to its low toxicity in humans, qualities which have been confirmed by its extensive use in clinical practice. Other polymers that are safe, biodegradable and custom-designed have, nevertheless, also been investigated as potential candidates for protein conjugation. This review will focus on natural polymers and synthetic linear polymers that have been used for protein delivery and the results associated with their use. Genetic fusion approaches for the preparation of protein-polypeptide conjugates will be also reviewed and compared with the best known chemical conjugation ones.

  10. The effect of protein-protein and protein-membrane interactions on membrane fouling in ultrafiltration

    NARCIS (Netherlands)

    Huisman, I.H.; Prádanos, P.; Hernández, A.


    It was studied how protein-protein and protein-membrane interactions influence the filtration performance during the ultrafiltration of protein solutions over polymeric membranes. This was done by measuring flux, streaming potential, and protein transmission during filtration of bovine serum albumin

  11. Recombinant Collagenlike Proteins (United States)

    Fertala, Andzej


    A group of collagenlike recombinant proteins containing high densities of biologically active sites has been invented. The method used to express these proteins is similar to a method of expressing recombinant procollagens and collagens described in U. S. Patent 5,593,859, "Synthesis of human procollagens and collagens in recombinant DNA systems." Customized collagenous proteins are needed for biomedical applications. In particular, fibrillar collagens are attractive for production of matrices needed for tissue engineering and drug delivery. Prior to this invention, there was no way of producing customized collagenous proteins for these and other applications. Heretofore, collagenous proteins have been produced by use of such biological systems as yeasts, bacteria, and transgenic animals and plants. These products are normal collagens that can also be extracted from such sources as tendons, bones, and hides. These products cannot be made to consist only of biologically active, specific amino acid sequences that may be needed for specific applications. Prior to this invention, it had been established that fibrillar collagens consist of domains that are responsible for such processes as interaction with cells, binding of growth factors, and interaction with a number of structural proteins present in the extracellular matrix. A normal collagen consists of a sequence of domains that can be represented by a corresponding sequence of labels, e.g., D1D2D3D4. A collagenlike protein of the present invention contains regions of collagen II that contain multiples of a single domain (e.g., D1D1D1D1 or D4D4D4D4) chosen for its specific biological activity. By virtue of the multiplicity of the chosen domain, the density of sites having that specific biological activity is greater than it is in a normal collagen. A collagenlike protein according to this invention can thus be made to have properties that are necessary for tissue engineering.

  12. Occupational protein contact dermatitis. (United States)

    Barbaud, Annick; Poreaux, Claire; Penven, Emmanuelle; Waton, Julie


    Occupational contact dermatitis is generally caused by haptens but can also be induced by proteins causing mainly immunological contact urticaria (ICU); chronic hand eczema in the context of protein contact dermatitis (PCD). In a monocentric retrospective study, from our database, only 31 (0.41%) of patients with contact dermatitis had positive skin tests with proteins: 22 had occupational PCD, 3 had non-occupational PCD, 5 occupational ICU and 1 cook had a neutrophilic fixed food eruption (NFFE) due to fish. From these results and analysis of literature, the characteristics of PCD can be summarized as follows. It is a chronic eczematous dermatitis, possibly exacerbated by work, suggestive if associated with inflammatory perionyxix and immediate erythema with pruritis, to be investigated when the patient resumes work after a period of interruption. Prick tests with the suspected protein-containing material are essential, as patch tests have negative results. In case of multisensitisation revealed by prick tests, it is advisable to analyse IgE against recombinant allergens. A history of atopy, found in 56 to 68% of the patients, has to be checked for. Most of the cases are observed among food-handlers but PCD can also be due to non-edible plants, latex, hydrolysed proteins or animal proteins. Occupational exposure to proteins can thus lead to the development of ICU. Reflecting hypersensitivity to very low concentrations of allergens, investigating ICU therefore requires caution and prick tests should be performed with a diluted form of the causative protein-containing product. Causes are food, especially fruit peel, non-edible plants, cosmetic products, latex, animals.

  13. Proteins and their crystals

    Czech Academy of Sciences Publication Activity Database

    Kutá-Smatanová, Ivana; Hogg, T.; Hilgenfeld, R.; Grandori, R.; Carey, J.; Vácha, František; Štys, Dalibor


    Roč. 10, č. 1 (2003), s. 31-32 ISSN 1211-5894 R&D Projects: GA MŠk LN00A141; GA ČR GA206/00/D007 Institutional research plan: CEZ:AV0Z5051902; CEZ:MSM 123100001 Keywords : pokeweed antiviral protein * flavodoxin-like protein * PSII Subject RIV: EB - Genetics ; Molecular Biology

  14. The tubby family proteins


    Mukhopadhyay, Saikat; Jackson, Peter K


    The tubby mouse shows a tripartite syndrome characterized by maturity-onset obesity, blindness and deafness. The causative gene Tub is the founding member of a family of related proteins present throughout the animal and plant kingdoms, each characterized by a signature carboxy-terminal tubby domain. This domain consists of a β barrel enclosing a central α helix and binds selectively to specific membrane phosphoinositides. The vertebrate family of tubby-like proteins (TULPs) includes the foun...

  15. The caveolin proteins


    Williams, Terence M; Lisanti, Michael P


    The caveolin gene family has three members in vertebrates: caveolin-1, caveolin-2, and caveolin-3. So far, most caveolin-related research has been conducted in mammals, but the proteins have also been found in other animals, including Xenopus laevis, Fugu rubripes, and Caenorhabditis elegans. Caveolins can serve as protein markers of caveolae ('little caves'), invaginations in the plasma membrane 50-100 nanometers in diameter. Caveolins are found predominantly at the plasma membrane but also ...

  16. More protein in cereals?

    International Nuclear Information System (INIS)


    Ways in which the protein content of plant crops may be raised by the use of nuclear radiation are to be discussed at a symposium in Vienna in June next year, organized by the joint Food and Agriculture Organization/Agency Division of Atomic Energy in Food and Agriculture. Plant crops - especially cereal grains - are the basic food and protein source of most of the world's population, particularly in less-developed countries. But their natural protein content is low; increasing the quantity and nutritional quality of plant protein is potentially the most feasible way to combat widespread protein malnutrition. This improvement in seed stock can be achieved by plant breeding methods in which nuclear irradiation techniques are used to induce mutations in grain, and other isotopic techniques can be used to select only those mutants which have the desired properties. The scientists who attend the symposium will have an opportunity to review what mutation plant breeders have achieved, the application of nuclear techniques to screening for protein and amino-acid content and nutritional value, and isotopic methods which contribute to research in plant nutrition and physiology. (author)

  17. Electrophoretic transfer protein zymography. (United States)

    Pan, Daniel; Hill, Adam P; Kashou, Anthony; Wilson, Karl A; Tan-Wilson, Anna


    Zymography detects and characterizes proteolytic enzymes by electrophoresis of protease-containing samples into a nonreducing sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel containing a copolymerized protein substrate. The usefulness of zymography for molecular weight determination and proteomic analysis is hampered by the fact that some proteases exhibit slower migration through a gel that contains substrate protein. This article introduces electrophoretic transfer protein zymography as one solution to this problem. In this technique, samples containing proteolytic enzymes are first resolved in nonreducing SDS-PAGE on a gel without protein substrate. The proteins in the resolving gel are then electrophoretically transferred to a receiving gel previously prepared with a copolymerized protein substrate. The receiving gel is then developed as a zymogram to visualize clear or lightly stained bands in a dark background. Band intensities are linearly related to the amount of protease, extending the usefulness of the technique so long as conditions for transfer and development of the zymogram are kept constant. Conditions of transfer, such as the pore sizes of resolving and receiving gels and the transfer time relative to the molecular weight of the protease, are explored. Copyright © 2011 Elsevier Inc. All rights reserved.

  18. More protein in cereals?

    Energy Technology Data Exchange (ETDEWEB)



    Ways in which the protein content of plant crops may be raised by the use of nuclear radiation are to be discussed at a symposium in Vienna in June next year, organized by the joint Food and Agriculture Organization/Agency Division of Atomic Energy in Food and Agriculture. Plant crops - especially cereal grains - are the basic food and protein source of most of the world's population, particularly in less-developed countries. But their natural protein content is low; increasing the quantity and nutritional quality of plant protein is potentially the most feasible way to combat widespread protein malnutrition. This improvement in seed stock can be achieved by plant breeding methods in which nuclear irradiation techniques are used to induce mutations in grain, and other isotopic techniques can be used to select only those mutants which have the desired properties. The scientists who attend the symposium will have an opportunity to review what mutation plant breeders have achieved, the application of nuclear techniques to screening for protein and amino-acid content and nutritional value, and isotopic methods which contribute to research in plant nutrition and physiology. (author)

  19. Disease specific protein corona (United States)

    Rahman, M.; Mahmoudi, M.


    It is now well accepted that upon their entrance into the biological environments, the surface of nanomaterials would be covered by various biomacromolecules (e.g., proteins and lipids). The absorption of these biomolecules, so called `protein corona', onto the surface of (nano)biomaterials confers them a new `biological identity'. Although the formation of protein coronas on the surface of nanoparticles has been widely investigated, there are few reports on the effect of various diseases on the biological identity of nanoparticles. As the type of diseases may tremendously changes the composition of the protein source (e.g., human plasma/serum), one can expect that amount and composition of associated proteins in the corona composition may be varied, in disease type manner. Here, we show that corona coated silica and polystyrene nanoparticles (after interaction with in the plasma of the healthy individuals) could induce unfolding of fibrinogen, which promotes release of the inflammatory cytokines. However, no considerable releases of inflammatory cytokines were observed for corona coated graphene sheets. In contrast, the obtained corona coated silica and polystyrene nanoparticles from the hypofibrinogenemia patients could not induce inflammatory cytokine release where graphene sheets do. Therefore, one can expect that disease-specific protein coronas can provide a novel approach for applying nanomedicine to personalized medicine, improving diagnosis and treatment of different diseases tailored to the specific conditions and circumstances.

  20. Competitive protein binding assay

    International Nuclear Information System (INIS)

    Kaneko, Toshio; Oka, Hiroshi


    The measurement of cyclic GMP (cGMP) by competitive protein binding assay was described and discussed. The principle of binding assay was represented briefly. Procedures of our method by binding protein consisted of preparation of cGMP binding protein, selection of 3 H-cyclic GMP on market, and measurement procedures. In our method, binding protein was isolated from the chrysalis of silk worm. This method was discussed from the points of incubation medium, specificity of binding protein, the separation of bound cGMP from free cGMP, and treatment of tissue from which cGMP was extracted. cGMP existing in the tissue was only one tenth or one scores of cGMP, and in addition, cGMP competed with cGMP in binding with binding protein. Therefore, Murad's technique was applied to the isolation of cGMP. This method provided the measurement with sufficient accuracy; the contamination by cAMP was within several per cent. (Kanao, N.)

  1. Protein hydrolysates in sports nutrition

    Directory of Open Access Journals (Sweden)

    Manninen Anssi H


    Full Text Available Abstract It has been suggested that protein hydrolysates providing mainly di- and tripeptides are superior to intact (whole proteins and free amino acids in terms of skeletal muscle protein anabolism. This review provides a critical examination of protein hydrolysate studies conducted in healthy humans with special reference to sports nutrition. The effects of protein hydrolysate ingestion on blood amino acid levels, muscle protein anabolism, body composition, exercise performance and muscle glycogen resynthesis are discussed.

  2. Unique Features of Halophilic Proteins. (United States)

    Arakawa, Tsutomu; Yamaguchi, Rui; Tokunaga, Hiroko; Tokunaga, Masao


    Proteins from moderate and extreme halophiles have unique characteristics. They are highly acidic and hydrophilic, similar to intrinsically disordered proteins. These characteristics make the halophilic proteins soluble in water and fold reversibly. In addition to reversible folding, the rate of refolding of halophilic proteins from denatured structure is generally slow, often taking several days, for example, for extremely halophilic proteins. This slow folding rate makes the halophilic proteins a novel model system for folding mechanism analysis. High solubility and reversible folding also make the halophilic proteins excellent fusion partners for soluble expression of recombinant proteins.

  3. Tumor cell surface proteins

    International Nuclear Information System (INIS)

    Kennel, S.J.; Braslawsky, G.R.; Flynn, K.; Foote, L.J.; Friedman, E.; Hotchkiss, J.A.; Huang, A.H.L.; Lankford, P.K.


    Cell surface proteins mediate interaction between cells and their environment. Unique tumor cell surface proteins are being identified and quantified in several tumor systems to address the following questions: (i) how do tumor-specific proteins arise during cell transformation; (ii) can these proteins be used as markers of tumor cell distribution in vivo; (iii) can cytotoxic drugs be targeted specifically to tumor cells using antibody; and (iv) can solid state radioimmunoassay of these proteins provide a means to quantify transformation frequencies. A tumor surface protein of 180,000 M/sub r/ (TSP-180) has been identified on cells of several lung carcinomas of BALB/c mice. TSP-180 was not detected on normal lung tissue, embryonic tissue, or other epithelial or sarcoma tumors, but it was found on lung carcinomas of other strains of mice. Considerable amino acid sequence homology exists among TSP-180's from several cell sources, indicating that TSP-180 synthesis is directed by normal cellular genes although it is not expressed in normal cells. The regulation of synthesis of TSP-180 and its relationship to normal cell surface proteins are being studied. Monoclonal antibodies (MoAb) to TSP-180 have been developed. The antibodies have been used in immunoaffinity chromatography to isolate TSP-180 from tumor cell sources. This purified tumor antigen was used to immunize rats. Antibody produced by these animals reacted at different sites (epitopes) on the TSP-180 molecule than did the original MoAb. These sera and MoAb from these animals are being used to identify normal cell components related to the TSP-180 molecule

  4. Bioinformatics and moonlighting proteins

    Directory of Open Access Journals (Sweden)

    Sergio eHernández


    Full Text Available Multitasking or moonlighting is the capability of some proteins to execute two or more biochemical functions. Usually, moonlighting proteins are experimentally revealed by serendipity. For this reason, it would be helpful that Bioinformatics could predict this multifunctionality, especially because of the large amounts of sequences from genome projects. In the present work, we analyse and describe several approaches that use sequences, structures, interactomics and current bioinformatics algorithms and programs to try to overcome this problem. Among these approaches are: a remote homology searches using Psi-Blast, b detection of functional motifs and domains, c analysis of data from protein-protein interaction databases (PPIs, d match the query protein sequence to 3D databases (i.e., algorithms as PISITE, e mutation correlation analysis between amino acids by algorithms as MISTIC. Programs designed to identify functional motif/domains detect mainly the canonical function but usually fail in the detection of the moonlighting one, Pfam and ProDom being the best methods. Remote homology search by Psi-Blast combined with data from interactomics databases (PPIs have the best performance. Structural information and mutation correlation analysis can help us to map the functional sites. Mutation correlation analysis can only be used in very specific situations –it requires the existence of multialigned family protein sequences - but can suggest how the evolutionary process of second function acquisition took place. The multitasking protein database MultitaskProtDB (, previously published by our group, has been used as a benchmark for the all of the analyses.

  5. Modeling Mercury in Proteins

    Energy Technology Data Exchange (ETDEWEB)

    Smith, Jeremy C [ORNL; Parks, Jerry M [ORNL


    Mercury (Hg) is a naturally occurring element that is released into the biosphere both by natural processes and anthropogenic activities. Although its reduced, elemental form Hg(0) is relatively non-toxic, other forms such as Hg2+ and, in particular, its methylated form, methylmercury, are toxic, with deleterious effects on both ecosystems and humans. Microorganisms play important roles in the transformation of mercury in the environment. Inorganic Hg2+ can be methylated by certain bacteria and archaea to form methylmercury. Conversely, bacteria also demethylate methylmercury and reduce Hg2+ to relatively inert Hg(0). Transformations and toxicity occur as a result of mercury interacting with various proteins. Clearly, then, understanding the toxic effects of mercury and its cycling in the environment requires characterization of these interactions. Computational approaches are ideally suited to studies of mercury in proteins because they can provide a detailed picture and circumvent issues associated with toxicity. Here we describe computational methods for investigating and characterizing how mercury binds to proteins, how inter- and intra-protein transfer of mercury is orchestrated in biological systems, and how chemical reactions in proteins transform the metal. We describe quantum chemical analyses of aqueous Hg(II), which reveal critical factors that determine ligand binding propensities. We then provide a perspective on how we used chemical reasoning to discover how microorganisms methylate mercury. We also highlight our combined computational and experimental studies of the proteins and enzymes of the mer operon, a suite of genes that confers mercury resistance in many bacteria. Lastly, we place work on mercury in proteins in the context of what is needed for a comprehensive multi-scale model of environmental mercury cycling.

  6. Protein (Cyanobacteria): 654346314 [PGDBj - Ortholog DB

    Lifescience Database Archive (English)


  7. Protein Correlation Profiles Identify Lipid Droplet Proteins with High Confidence* (United States)

    Krahmer, Natalie; Hilger, Maximiliane; Kory, Nora; Wilfling, Florian; Stoehr, Gabriele; Mann, Matthias; Farese, Robert V.; Walther, Tobias C.


    Lipid droplets (LDs) are important organelles in energy metabolism and lipid storage. Their cores are composed of neutral lipids that form a hydrophobic phase and are surrounded by a phospholipid monolayer that harbors specific proteins. Most well-established LD proteins perform important functions, particularly in cellular lipid metabolism. Morphological studies show LDs in close proximity to and interacting with membrane-bound cellular organelles, including the endoplasmic reticulum, mitochondria, peroxisomes, and endosomes. Because of these close associations, it is difficult to purify LDs to homogeneity. Consequently, the confident identification of bona fide LD proteins via proteomics has been challenging. Here, we report a methodology for LD protein identification based on mass spectrometry and protein correlation profiles. Using LD purification and quantitative, high-resolution mass spectrometry, we identified LD proteins by correlating their purification profiles to those of known LD proteins. Application of the protein correlation profile strategy to LDs isolated from Drosophila S2 cells led to the identification of 111 LD proteins in a cellular LD fraction in which 1481 proteins were detected. LD localization was confirmed in a subset of identified proteins via microscopy of the expressed proteins, thereby validating the approach. Among the identified LD proteins were both well-characterized LD proteins and proteins not previously known to be localized to LDs. Our method provides a high-confidence LD proteome of Drosophila cells and a novel approach that can be applied to identify LD proteins of other cell types and tissues. PMID:23319140

  8. Integral UBL domain proteins: a family of proteasome interacting proteins

    DEFF Research Database (Denmark)

    Hartmann-Petersen, Rasmus; Gordon, Colin


    The family of ubiquitin-like (UBL) domain proteins (UDPs) comprises a conserved group of proteins involved in a multitude of different cellular activities. However, recent studies on UBL-domain proteins indicate that these proteins appear to share a common property in their ability to interact...

  9. Measuring protein breakdown rate in individual proteins in vivo

    DEFF Research Database (Denmark)

    Holm, Lars; Kjaer, Michael


    To outline different approaches of how protein breakdown can be quantified and to present a new approach to determine the fractional breakdown rate of individual slow turnover proteins in vivo.......To outline different approaches of how protein breakdown can be quantified and to present a new approach to determine the fractional breakdown rate of individual slow turnover proteins in vivo....

  10. Changes in protein composition and protein phosphorylation during ...

    African Journals Online (AJOL)

    Changes in protein profiles and protein phosphorylation were studied in various stages of germinating somatic and zygotic embryos. Many proteins, which were expressed in cotyledonary stage somatic embryos, were also present in the zygotic embryos obtained from mature dry seed. The intensity of 22 kDa protein was ...

  11. A Stevedore's protein knot.

    Directory of Open Access Journals (Sweden)

    Daniel Bölinger


    Full Text Available Protein knots, mostly regarded as intriguing oddities, are gradually being recognized as significant structural motifs. Seven distinctly knotted folds have already been identified. It is by and large unclear how these exceptional structures actually fold, and only recently, experiments and simulations have begun to shed some light on this issue. In checking the new protein structures submitted to the Protein Data Bank, we encountered the most complex and the smallest knots to date: A recently uncovered alpha-haloacid dehalogenase structure contains a knot with six crossings, a so-called Stevedore knot, in a projection onto a plane. The smallest protein knot is present in an as yet unclassified protein fragment that consists of only 92 amino acids. The topological complexity of the Stevedore knot presents a puzzle as to how it could possibly fold. To unravel this enigma, we performed folding simulations with a structure-based coarse-grained model and uncovered a possible mechanism by which the knot forms in a single loop flip.

  12. Protein Annotation from Protein Interaction Networks and Gene Ontology


    Nguyen, Cao D.; Gardiner, Katheleen J.; Cios, Krzysztof J.


    We introduce a novel method for annotating protein function that combines Naïve Bayes and association rules, and takes advantage of the underlying topology in protein interaction networks and the structure of graphs in the Gene Ontology. We apply our method to proteins from the Human Protein Reference Database (HPRD) and show that, in comparison with other approaches, it predicts protein functions with significantly higher recall with no loss of precision. Specifically, it achieves 51% precis...

  13. Polarizable protein packing

    KAUST Repository

    Ng, Albert H.


    To incorporate protein polarization effects within a protein combinatorial optimization framework, we decompose the polarizable force field AMOEBA into low order terms. Including terms up to the third-order provides a fair approximation to the full energy while maintaining tractability. We represent the polarizable packing problem for protein G as a hypergraph and solve for optimal rotamers with the FASTER combinatorial optimization algorithm. These approximate energy models can be improved to high accuracy [root mean square deviation (rmsd) < 1 kJ mol -1] via ridge regression. The resulting trained approximations are used to efficiently identify new, low-energy solutions. The approach is general and should allow combinatorial optimization of other many-body problems. © 2011 Wiley Periodicals, Inc. J Comput Chem, 2011 Copyright © 2011 Wiley Periodicals, Inc.

  14. Sound of proteins

    DEFF Research Database (Denmark)


    In my group we work with Molecular Dynamics to model several different proteins and protein systems. We submit our modelled molecules to changes in temperature, changes in solvent composition and even external pulling forces. To analyze our simulation results we have so far used visual inspection...... and statistical analysis of the resulting molecular trajectories (as everybody else!). However, recently I started assigning a particular sound frequency to each amino acid in the protein, and by setting the amplitude of each frequency according to the movement amplitude we can "hear" whenever two aminoacids...... example of soundfile was obtained from using Steered Molecular Dynamics for stretching the neck region of the scallop myosin molecule (in rigor, PDB-id: 1SR6), in such a way as to cause a rotation of the myosin head. Myosin is the molecule responsible for producing the force during muscle contraction...

  15. Can infrared spectroscopy provide information on protein-protein interactions? (United States)

    Haris, Parvez I


    For most biophysical techniques, characterization of protein-protein interactions is challenging; this is especially true with methods that rely on a physical phenomenon that is common to both of the interacting proteins. Thus, for example, in IR spectroscopy, the carbonyl vibration (1600-1700 cm(-1)) associated with the amide bonds from both of the interacting proteins will overlap extensively, making the interpretation of spectral changes very complicated. Isotope-edited infrared spectroscopy, where one of the interacting proteins is uniformly labelled with (13)C or (13)C,(15)N has been introduced as a solution to this problem, enabling the study of protein-protein interactions using IR spectroscopy. The large shift of the amide I band (approx. 45 cm(-1) towards lower frequency) upon (13)C labelling of one of the proteins reveals the amide I band of the unlabelled protein, enabling it to be used as a probe for monitoring conformational changes. With site-specific isotopic labelling, structural resolution at the level of individual amino acid residues can be achieved. Furthermore, the ability to record IR spectra of proteins in diverse environments means that isotope-edited IR spectroscopy can be used to structurally characterize difficult systems such as protein-protein complexes bound to membranes or large insoluble peptide/protein aggregates. In the present article, examples of application of isotope-edited IR spectroscopy for studying protein-protein interactions are provided.

  16. Ubiquitin domain proteins in disease

    DEFF Research Database (Denmark)

    Klausen, Louise Kjær; Schulze, Andrea; Seeger, Michael


    The human genome encodes several ubiquitin-like (UBL) domain proteins (UDPs). Members of this protein family are involved in a variety of cellular functions and many are connected to the ubiquitin proteasome system, an essential pathway for protein degradation in eukaryotic cells. Despite...... and cancer. Publication history: Republished from Current BioData's Targeted Proteins database (TPdb;

  17. Protein: FBA7 [TP Atlas

    Lifescience Database Archive (English)

    Full Text Available FBA7 claudin-zona occluden Tjp1 Zo1 Tight junction protein ZO-1 Tight junction protein 1, Zona occludens pr...otein 1, Zonula occludens protein 1 10090 Mus musculus 21872 P39447 2RRM P39447 21431884 ...

  18. Protein: FEA3 [TP Atlas

    Lifescience Database Archive (English)

    Full Text Available FEA3 AREB pathway: Signaling proteins At4g11890/T26M18_100 At4g11890, Protein kinase family pr...otein, Putative uncharacterized protein At4g11890/T26M18_100 3702 Arabidopsis thaliana 826796 Q8GY82 22225700 ...

  19. Cold gelation of globular proteins

    NARCIS (Netherlands)

    Alting, A.C.


    Keywords : globular proteins, whey protein, ovalbumin, cold gelation, disulfide bonds, texture, gel hardnessProtein gelation in food products is important to obtain desirable sensory and textural properties. Cold gelation is a novel method to produce protein-based gels. It is a two step process in

  20. Vibrational spectroscopy of proteins

    International Nuclear Information System (INIS)

    Schwaighofer, A.


    Two important steps for the development of a biosensor are the immobilization of the biological component (e.g. protein) on a surface and the enhancement of the signal to improve the sensitivity of detection. To address these subjects, the present work describes Fourier transform infrared (FTIR) investigations of several proteins bound to the surface of an attenuated total reflection (ATR) crystal. Furthermore, new nanostructured surfaces for signal enhancement were developed for use in FTIR microscopy. The mitochondrial redox-protein cytochrome c oxidase (CcO) was incorporated into a protein-tethered bilayer lipid membrane (ptBLM) on an ATR crystal featuring a roughened two-layer gold surface for signal enhancement. Electrochemical excitation by periodic potential pulses at different modulation frequencies was followed by time-resolved FTIR spectroscopy. Phase sensitive detection was used for deconvolution of the IR spectra into vibrational components. A model based on protonation-dependent chemical reaction kinetics could be fitted to the time evolution of IR bands attributed to several different redox centers of the CcO. Further investigations involved the odorant binding protein 14 (OBP14) of the honey bee (Apis mellifera), which was studied using ATR-FTIR spectroscopy and circular dichroism. OBP14 was found to be thermally stable up to 45 °C, thus permitting the potential application of this protein for the fabrication of biosensors. Thermal denaturation measurements showed that odorant binding increases the thermal stability of the OBP-odorant complex. In another project, plasmonic nanostructures were fabricated that enhance the absorbance in FTIR microscopy measurements. The nanostructures are composed of an array of round-shaped insulator and gold discs on top of a continuous gold layer. Enhancement factors of up to ⁓125 could be observed with self-assembled monolayers of dodecanethiol molecules immobilized on the gold surface (author) [de

  1. Urinary Protein Biomarker Analysis (United States)


    silica emitter via a Valco stainless steel union. Four μL of individual peptide fractions (total volume 20 μL) following PRISM were injected for LC...secreted cement gland protein XAG-2 homolog, AGR2 belongs to the protein disulfide 5 isomerase (PDI) family. The strongest AGR2 expression has...µm C18 column (75 µm i.d. × 10 cm), which was connected to a chemically etched 20 µm i.d. fused-silica emitter via a Valco stainless steel union

  2. Protein energy malnutrition. (United States)

    Grover, Zubin; Ee, Looi C


    Protein energy malnutrition (PEM) is a common problem worldwide and occurs in both developing and industrialized nations. In the developing world, it is frequently a result of socioeconomic, political, or environmental factors. In contrast, protein energy malnutrition in the developed world usually occurs in the context of chronic disease. There remains much variation in the criteria used to define malnutrition, with each method having its own limitations. Early recognition, prompt management, and robust follow up are critical for best outcomes in preventing and treating PEM.

  3. Heme Sensor Proteins* (United States)

    Girvan, Hazel M.; Munro, Andrew W.


    Heme is a prosthetic group best known for roles in oxygen transport, oxidative catalysis, and respiratory electron transport. Recent years have seen the roles of heme extended to sensors of gases such as O2 and NO and cell redox state, and as mediators of cellular responses to changes in intracellular levels of these gases. The importance of heme is further evident from identification of proteins that bind heme reversibly, using it as a signal, e.g. to regulate gene expression in circadian rhythm pathways and control heme synthesis itself. In this minireview, we explore the current knowledge of the diverse roles of heme sensor proteins. PMID:23539616

  4. Protein-protein interactions: an application of Tus-Ter mediated protein microarray system. (United States)

    Sitaraman, Kalavathy; Chatterjee, Deb K


    In this chapter, we present a novel, cost-effective microarray strategy that utilizes expression-ready plasmid DNAs to generate protein arrays on-demand and its use to validate protein-protein interactions. These expression plasmids were constructed in such a way so as to serve a dual purpose of synthesizing the protein of interest as well as capturing the synthesized protein. The microarray system is based on the high affinity binding of Escherichia coli "Tus" protein to "Ter," a 20 bp DNA sequence involved in the regulation of DNA replication. The protein expression is carried out in a cell-free protein synthesis system, with rabbit reticulocyte lysates, and the target proteins are detected either by labeled incorporated tag specific or by gene-specific antibodies. This microarray system has been successfully used for the detection of protein-protein interaction because both the target protein and the query protein can be transcribed and translated simultaneously in the microarray slides. The utility of this system for detecting protein-protein interaction is demonstrated by a few well-known examples: Jun/Fos, FRB/FKBP12, p53/MDM2, and CDK4/p16. In all these cases, the presence of protein complexes resulted in the localization of fluorophores at the specific sites of the immobilized target plasmids. Interestingly, during our interactions studies we also detected a previously unknown interaction between CDK2 and p16. Thus, this Tus-Ter based system of protein microarray can be used for the validation of known protein interactions as well as for identifying new protein-protein interactions. In addition, it can be used to examine and identify targets of nucleic acid-protein, ligand-receptor, enzyme-substrate, and drug-protein interactions.

  5. Truly Absorbed Microbial Protein Synthesis, Rumen Bypass Protein, Endogenous Protein, and Total Metabolizable Protein from Starchy and Protein-Rich Raw Materials

    NARCIS (Netherlands)

    Parand, Ehsan; Vakili, Alireza; Mesgaran, Mohsen Danesh; Duinkerken, Van Gert; Yu, Peiqiang


    This study was carried out to measure truly absorbed microbial protein synthesis, rumen bypass protein, and endogenous protein loss, as well as total metabolizable protein, from starchy and protein-rich raw feed materials with model comparisons. Predictions by the DVE2010 system as a more

  6. Interaction between plate make and protein in protein crystallisation screening.

    Directory of Open Access Journals (Sweden)

    Gordon J King

    Full Text Available BACKGROUND: Protein crystallisation screening involves the parallel testing of large numbers of candidate conditions with the aim of identifying conditions suitable as a starting point for the production of diffraction quality crystals. Generally, condition screening is performed in 96-well plates. While previous studies have examined the effects of protein construct, protein purity, or crystallisation condition ingredients on protein crystallisation, few have examined the effect of the crystallisation plate. METHODOLOGY/PRINCIPAL FINDINGS: We performed a statistically rigorous examination of protein crystallisation, and evaluated interactions between crystallisation success and plate row/column, different plates of same make, different plate makes and different proteins. From our analysis of protein crystallisation, we found a significant interaction between plate make and the specific protein being crystallised. CONCLUSIONS/SIGNIFICANCE: Protein crystal structure determination is the principal method for determining protein structure but is limited by the need to produce crystals of the protein under study. Many important proteins are difficult to crystallize, so that identification of factors that assist crystallisation could open up the structure determination of these more challenging targets. Our findings suggest that protein crystallisation success may be improved by matching a protein with its optimal plate make.

  7. HIV protein sequence hotspots for crosstalk with host hub proteins.

    Directory of Open Access Journals (Sweden)

    Mahdi Sarmady

    Full Text Available HIV proteins target host hub proteins for transient binding interactions. The presence of viral proteins in the infected cell results in out-competition of host proteins in their interaction with hub proteins, drastically affecting cell physiology. Functional genomics and interactome datasets can be used to quantify the sequence hotspots on the HIV proteome mediating interactions with host hub proteins. In this study, we used the HIV and human interactome databases to identify HIV targeted host hub proteins and their host binding partners (H2. We developed a high throughput computational procedure utilizing motif discovery algorithms on sets of protein sequences, including sequences of HIV and H2 proteins. We identified as HIV sequence hotspots those linear motifs that are highly conserved on HIV sequences and at the same time have a statistically enriched presence on the sequences of H2 proteins. The HIV protein motifs discovered in this study are expressed by subsets of H2 host proteins potentially outcompeted by HIV proteins. A large subset of these motifs is involved in cleavage, nuclear localization, phosphorylation, and transcription factor binding events. Many such motifs are clustered on an HIV sequence in the form of hotspots. The sequential positions of these hotspots are consistent with the curated literature on phenotype altering residue mutations, as well as with existing binding site data. The hotspot map produced in this study is the first global portrayal of HIV motifs involved in altering the host protein network at highly connected hub nodes.

  8. Protein Molecular Structures, Protein SubFractions, and Protein Availability Affected by Heat Processing: A Review

    International Nuclear Information System (INIS)

    Yu, P.


    The utilization and availability of protein depended on the types of protein and their specific susceptibility to enzymatic hydrolysis (inhibitory activities) in the gastrointestine and was highly associated with protein molecular structures. Studying internal protein structure and protein subfraction profiles leaded to an understanding of the components that make up a whole protein. An understanding of the molecular structure of the whole protein was often vital to understanding its digestive behavior and nutritive value in animals. In this review, recently obtained information on protein molecular structural effects of heat processing was reviewed, in relation to protein characteristics affecting digestive behavior and nutrient utilization and availability. The emphasis of this review was on (1) using the newly advanced synchrotron technology (S-FTIR) as a novel approach to reveal protein molecular chemistry affected by heat processing within intact plant tissues; (2) revealing the effects of heat processing on the profile changes of protein subfractions associated with digestive behaviors and kinetics manipulated by heat processing; (3) prediction of the changes of protein availability and supply after heat processing, using the advanced DVE/OEB and NRC-2001 models, and (4) obtaining information on optimal processing conditions of protein as intestinal protein source to achieve target values for potential high net absorbable protein in the small intestine. The information described in this article may give better insight in the mechanisms involved and the intrinsic protein molecular structural changes occurring upon processing.

  9. 24-hour urine protein (United States)

    ... your provider may be able to order a test that is done on just one urine sample (protein-to-creatinine ratio). Normal Results The normal ... Some labs use different measurements or test different samples. Talk to your provider about the meaning of your specific test ... Abnormal results may be due to: A group ...

  10. Disorder in Protein Crystals. (United States)

    Clarage, James Braun, II


    Methods have been developed for analyzing the diffuse x-ray scattering in the halos about a crystal's Bragg reflections as a means of determining correlations in atomic displacements in protein crystals. The diffuse intensity distribution for rhombohedral insulin, tetragonal lysozyme, and triclinic lysozyme crystals was best simulated in terms of exponential displacement correlation functions. About 90% of the disorder can be accounted for by internal movements correlated with a decay distance of about 6A; the remaining 10% corresponds to intermolecular movements that decay in a distance the order of size of the protein molecule. The results demonstrate that protein crystals fit into neither the Einstein nor the Debye paradigms for thermally fluctuating crystalline solids. Unlike the Einstein model, there are correlations in the atomic displacements, but these correlations decay more steeply with distance than predicted by the Debye-Waller model for an elastic solid. The observed displacement correlations are liquid -like in the sense that they decay exponentially with the distance between atoms, just as positional correlations in a liquid. This liquid-like disorder is similar to the disorder observed in 2-D crystals of polystyrene latex spheres, and similar systems where repulsive interactions dominate; hence, these colloidal crystals appear to provide a better analogy for the dynamics of protein crystals than perfectly elastic lattices.

  11. Optimization of fluorescent proteins

    NARCIS (Netherlands)

    Bindels, D.S.; Goedhart, J.; Hink, M.A.; van Weeren, L.; Joosen, L.; Gadella (jr.), T.W.J.; Engelborghs, Y.; Visser, A.J.W.G.


    Nowadays, fluorescent protein (FP) variants have been engineered to fluoresce in all different colors; to display photoswitchable, or photochromic, behavior; or to show yet other beneficial properties that enable or enhance a still growing set of new fluorescence spectroscopy and microcopy

  12. Cellulose binding domain proteins (United States)

    Shoseyov, Oded; Shpiegl, Itai; Goldstein, Marc; Doi, Roy


    A cellulose binding domain (CBD) having a high affinity for crystalline cellulose and chitin is disclosed, along with methods for the molecular cloning and recombinant production thereof. Fusion products comprising the CBD and a second protein are likewise described. A wide range of applications are contemplated for both the CBD and the fusion products, including drug delivery, affinity separations, and diagnostic techniques.

  13. Tuber storage proteins. (United States)

    Shewry, Peter R


    A wide range of plants are grown for their edible tubers, but five species together account for almost 90 % of the total world production. These are potato (Solanum tuberosum), cassava (Manihot esculenta), sweet potato (Ipomoea batatus), yams (Dioscorea spp.) and taro (Colocasia, Cyrtosperma and Xanthosoma spp.). All of these, except cassava, contain groups of storage proteins, but these differ in the biological properties and evolutionary relationships. Thus, patatin from potato exhibits activity as an acylhydrolase and esterase, sporamin from sweet potato is an inhibitor of trypsin, and dioscorin from yam is a carbonic anhydrase. Both sporamin and dioscorin also exhibit antioxidant and radical scavenging activity. Taro differs from the other three crops in that it contains two major types of storage protein: a trypsin inhibitor related to sporamin and a mannose-binding lectin. These characteristics indicate that tuber storage proteins have evolved independently in different species, which contrasts with the highly conserved families of storage proteins present in seeds. Furthermore, all exhibit biological activities which could contribute to resistance to pests, pathogens or abiotic stresses, indicating that they may have dual roles in the tubers.

  14. Mobility of photosynthetic proteins

    Czech Academy of Sciences Publication Activity Database

    Kaňa, Radek


    Roč. 116, 2-3 (2013), s. 465-479 ISSN 0166-8595 R&D Projects: GA ČR GAP501/12/0304; GA MŠk(CZ) ED2.1.00/03.0110 Institutional support: RVO:61388971 Keywords : Photosynthesis * Protein mobility * FRAP Subject RIV: EE - Microbiology, Virology Impact factor : 3.185, year: 2013

  15. Proteins and their crystals

    Czech Academy of Sciences Publication Activity Database

    Kutá-Smatanová, Ivana; Hogg, T.; Hilgenfeld, R.; Grandori, R.; Carey, J.; Vácha, František; Štys, D.


    Roč. 10, - (2003), s. 30-31 ISSN 1211-5894 R&D Projects: GA MŠk LN00A141; GA ČR GA206/00/D007 Institutional research plan: CEZ:MSM 123100001 Keywords : antiviral proteins Subject RIV: CD - Macromolecular Chemistry

  16. Antifreeze Proteins of Bacteria

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 12; Issue 12. Antifreeze Proteins of Bacteria. M K Chattopadhyay. General Article Volume 12 Issue 12 December 2007 pp 25-30. Fulltext. Click here to view fulltext PDF. Permanent link: ...

  17. Radioimmunoassay of protein hormones

    International Nuclear Information System (INIS)

    Talas, M.; Fingerova, H.


    A survey is presented of the history of RIA methods for FSH, LH, HCG, HPL and prolactin determinations with special regard to the double antibody method in a kinetic system. Problems are shown in 125 I-labelling protein hormones in preparing own antisera. (L.O.)

  18. Allosteric Regulation of Proteins

    Indian Academy of Sciences (India)

    ... Lecture Workshops · Refresher Courses · Symposia · Live Streaming. Home; Journals; Resonance – Journal of Science Education; Volume 22; Issue 1. Allosteric Regulation of Proteins: A Historical Perspective on the Development of Concepts and Techniques. General Article Volume 22 Issue 1 January 2017 pp 37-50 ...

  19. High quality protein microarray using in situ protein purification

    Directory of Open Access Journals (Sweden)

    Fleischmann Robert D


    Full Text Available Abstract Background In the postgenomic era, high throughput protein expression and protein microarray technologies have progressed markedly permitting screening of therapeutic reagents and discovery of novel protein functions. Hexa-histidine is one of the most commonly used fusion tags for protein expression due to its small size and convenient purification via immobilized metal ion affinity chromatography (IMAC. This purification process has been adapted to the protein microarray format, but the quality of in situ His-tagged protein purification on slides has not been systematically evaluated. We established methods to determine the level of purification of such proteins on metal chelate-modified slide surfaces. Optimized in situ purification of His-tagged recombinant proteins has the potential to become the new gold standard for cost-effective generation of high-quality and high-density protein microarrays. Results Two slide surfaces were examined, chelated Cu2+ slides suspended on a polyethylene glycol (PEG coating and chelated Ni2+ slides immobilized on a support without PEG coating. Using PEG-coated chelated Cu2+ slides, consistently higher purities of recombinant proteins were measured. An optimized wash buffer (PBST composed of 10 mM phosphate buffer, 2.7 mM KCl, 140 mM NaCl and 0.05% Tween 20, pH 7.4, further improved protein purity levels. Using Escherichia coli cell lysates expressing 90 recombinant Streptococcus pneumoniae proteins, 73 proteins were successfully immobilized, and 66 proteins were in situ purified with greater than 90% purity. We identified several antigens among the in situ-purified proteins via assays with anti-S. pneumoniae rabbit antibodies and a human patient antiserum, as a demonstration project of large scale microarray-based immunoproteomics profiling. The methodology is compatible with higher throughput formats of in vivo protein expression, eliminates the need for resin-based purification and circumvents

  20. Dairy Proteins and Energy Balance

    DEFF Research Database (Denmark)

    Bendtsen, Line Quist

    High protein diets affect energy balance beneficially through decreased hunger, enhanced satiety and increased energy expenditure. Dairy products are a major source of protein. Dairy proteins are comprised of two classes, casein (80%) and whey proteins (20%), which are both of high quality......, but casein is absorbed slowly and whey is absorbed rapidly. The present PhD study investigated the effects of total dairy proteins, whey, and casein, on energy balance and the mechanisms behind any differences in the effects of the specific proteins. The results do not support the hypothesis that dairy...... proteins, whey or casein are more beneficial than other protein sources in the regulation of energy balance, and suggest that dairy proteins, whey or casein seem to play only a minor role, if any, in the prevention and treatment of obesity....

  1. Phosphorylation of human link proteins

    International Nuclear Information System (INIS)

    Oester, D.A.; Caterson, B.; Schwartz, E.R.


    Three link proteins of 48, 44 and 40 kDa were purified from human articular cartilage and identified with monoclonal anti-link protein antibody 8-A-4. Two sets of lower molecular weight proteins of 30-31 kDa and 24-26 kDa also contained link protein epitopes recognized by the monoclonal antibody and were most likely degradative products of the intact link proteins. The link proteins of 48 and 40 kDa were identified as phosphoproteins while the 44 kDa link protein did not contain 32 P. The phosphorylated 48 and 40 kDa link proteins contained approximately 2 moles PO 4 /mole link protein

  2. Coevolution study of mitochondria respiratory chain proteins: toward the understanding of protein--protein interaction. (United States)

    Yang, Ming; Ge, Yan; Wu, Jiayan; Xiao, Jingfa; Yu, Jun


    Coevolution can be seen as the interdependency between evolutionary histories. In the context of protein evolution, functional correlation proteins are ever-present coordinated evolutionary characters without disruption of organismal integrity. As to complex system, there are two forms of protein--protein interactions in vivo, which refer to inter-complex interaction and intra-complex interaction. In this paper, we studied the difference of coevolution characters between inter-complex interaction and intra-complex interaction using "Mirror tree" method on the respiratory chain (RC) proteins. We divided the correlation coefficients of every pairwise RC proteins into two groups corresponding to the binary protein--protein interaction in intra-complex and the binary protein--protein interaction in inter-complex, respectively. A dramatical discrepancy is detected between the coevolution characters of the two sets of protein interactions (Wilcoxon test, p-value = 4.4 × 10(-6)). Our finding reveals some critical information on coevolutionary study and assists the mechanical investigation of protein--protein interaction. Furthermore, the results also provide some unique clue for supramolecular organization of protein complexes in the mitochondrial inner membrane. More detailed binding sites map and genome information of nuclear encoded RC proteins will be extraordinary valuable for the further mitochondria dynamics study. Copyright © 2011. Published by Elsevier Ltd.

  3. Fluorogen-activating proteins: beyond classical fluorescent proteins

    Directory of Open Access Journals (Sweden)

    Shengnan Xu


    Full Text Available Fluorescence imaging is a powerful technique for the real-time noninvasive monitoring of protein dynamics. Recently, fluorogen activating proteins (FAPs/fluorogen probes for protein imaging were developed. Unlike the traditional fluorescent proteins (FPs, FAPs do not fluoresce unless bound to their specific small-molecule fluorogens. When using FAPs/fluorogen probes, a washing step is not required for the removal of free probes from the cells, thus allowing rapid and specific detection of proteins in living cells with high signal-to-noise ratio. Furthermore, with different fluorogens, living cell multi-color proteins labeling system was developed. In this review, we describe about the discovery of FAPs, the design strategy of FAP fluorogens, the application of the FAP technology and the advances of FAP technology in protein labeling systems. KEY WORDS: Fluorogen activating proteins, Fluorogens, Genetically encoded sensors, Fluorescence imaging, Molecular imaging

  4. Utilization of soya protein as an alternative protein source in ...

    African Journals Online (AJOL)



    Jan 5, 2009 ... For carcass trait, ash, crude fat, and energy varied significantly with soya protein ... high-protein content, relatively well-balanced amino acid profile ..... and organoleptic quality of flesh of brook char (Salvelinus fontinalis).

  5. Analysis of protein folds using protein contact networks

    Indian Academy of Sciences (India)

    is a well-recognized classification system of proteins, which is based on manual in- ... can easily correspond to the information in the 2D matrix. ..... [7] U K Muppirala and Zhijun Li, Protein Engineering, Design & Selection 19, 265 (2006).

  6. Competitive Protein Adsorption - Multilayer Adsorption and Surface Induced Protein Aggregation

    DEFF Research Database (Denmark)

    Holmberg, Maria; Hou, Xiaolin


    In this study, competitive adsorption of albumin and IgG (immunoglobulin G) from human serum solutions and protein mixtures onto polymer surfaces is studied by means of radioactive labeling. By using two different radiolabels (125I and 131I), albumin and IgG adsorption to polymer surfaces...... is monitored simultaneously and the influence from the presence of other human serum proteins on albumin and IgG adsorption, as well as their mutual influence during adsorption processes, is investigated. Exploring protein adsorption by combining analysis of competitive adsorption from complex solutions...... of high concentration with investigation of single protein adsorption and interdependent adsorption between two specific proteins enables us to map protein adsorption sequences during competitive protein adsorption. Our study shows that proteins can adsorb in a multilayer fashion onto the polymer surfaces...

  7. A Mesoscopic Model for Protein-Protein Interactions in Solution


    Lund, Mikael; Jönsson, Bo


    Protein self-association may be detrimental in biological systems, but can be utilized in a controlled fashion for protein crystallization. It is hence of considerable interest to understand how factors like solution conditions prevent or promote aggregation. Here we present a computational model describing interactions between protein molecules in solution. The calculations are based on a molecular description capturing the detailed structure of the protein molecule using x-ray or nuclear ma...

  8. Protein Functionalized Nanodiamond Arrays

    Directory of Open Access Journals (Sweden)

    Liu YL


    Full Text Available Abstract Various nanoscale elements are currently being explored for bio-applications, such as in bio-images, bio-detection, and bio-sensors. Among them, nanodiamonds possess remarkable features such as low bio-cytotoxicity, good optical property in fluorescent and Raman spectra, and good photostability for bio-applications. In this work, we devise techniques to position functionalized nanodiamonds on self-assembled monolayer (SAMs arrays adsorbed on silicon and ITO substrates surface using electron beam lithography techniques. The nanodiamond arrays were functionalized with lysozyme to target a certain biomolecule or protein specifically. The optical properties of the nanodiamond-protein complex arrays were characterized by a high throughput confocal microscope. The synthesized nanodiamond-lysozyme complex arrays were found to still retain their functionality in interacting with E. coli.

  9. Immunostimulatory mouse granuloma protein. (United States)

    Fontan, E; Fauve, R M; Hevin, B; Jusforgues, H


    Earlier studies have shown that from subcutaneous talc-induced granuloma in mice, a fraction could be extracted that fully protected mice against Listeria monocytogenes. Using standard biochemical procedures--i.e., ammonium sulfate fractionation, preparative electrophoresis, gel filtration chromatography, isoelectric focusing, and preparative polyacrylamide gel electrophoresis--we have now purified an active factor to homogeneity. A single band was obtained in NaDodSO4/polyacrylamide gel with an apparent Mr of 55,000. It migrated with alpha 1-globulins and the isoelectric point was 5 +/- 0.1. The biological activity was destroyed with Pronase but not with trypsin and a monospecific polyclonal rabbit antiserum was obtained. The intravenous injection of 5 micrograms of this "mouse granuloma protein" fully protects mice against a lethal inoculum of L. monocytogenes. Moreover, after their incubation with 10 nM mouse granuloma protein, mouse peritoneal cells became cytostatic against Lewis carcinoma cells.

  10. Stability of Hyperthermophilic Proteins

    DEFF Research Database (Denmark)

    Stiefler-Jensen, Daniel

    stability by randomly generate mutants and lengthy screening processes to identify the best new mutants. However, with the increase in available genomic sequences of thermophilic or hyperthermophilic organisms a world of enzymes with intrinsic high stability are now available. As these organisms are adapted...... to life at high temperatures so are their enzymes, as a result the high stability is accompanied by low activity at moderate temperatures. Thus, much effort had been put into decoding the mechanisms behind the high stability of the thermophilic enzymes. The hope is to enable scientist to design enzymes...... in the high stability of hyperthermophilic enzymes. The thesis starts with an introduction to the field of protein and enzyme stability with special focus on the thermophilic and hyperthermophilic enzymes and proteins. After the introduction three original research manuscripts present the experimental data...

  11. Structures composing protein domains. (United States)

    Kubrycht, Jaroslav; Sigler, Karel; Souček, Pavel; Hudeček, Jiří


    This review summarizes available data concerning intradomain structures (IS) such as functionally important amino acid residues, short linear motifs, conserved or disordered regions, peptide repeats, broadly occurring secondary structures or folds, etc. IS form structural features (units or elements) necessary for interactions with proteins or non-peptidic ligands, enzyme reactions and some structural properties of proteins. These features have often been related to a single structural level (e.g. primary structure) mostly requiring certain structural context of other levels (e.g. secondary structures or supersecondary folds) as follows also from some examples reported or demonstrated here. In addition, we deal with some functionally important dynamic properties of IS (e.g. flexibility and different forms of accessibility), and more special dynamic changes of IS during enzyme reactions and allosteric regulation. Selected notes concern also some experimental methods, still more necessary tools of bioinformatic processing and clinically interesting relationships. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  12. Detection of protein-protein interactions by ribosome display and protein in situ immobilisation. (United States)

    He, Mingyue; Liu, Hong; Turner, Martin; Taussig, Michael J


    We describe a method for identification of protein-protein interactions by combining two cell-free protein technologies, namely ribosome display and protein in situ immobilisation. The method requires only PCR fragments as the starting material, the target proteins being made through cell-free protein synthesis, either associated with their encoding mRNA as ribosome complexes or immobilised on a solid surface. The use of ribosome complexes allows identification of interacting protein partners from their attached coding mRNA. To demonstrate the procedures, we have employed the lymphocyte signalling proteins Vav1 and Grb2 and confirmed the interaction between Grb2 and the N-terminal SH3 domain of Vav1. The method has promise for library screening of pairwise protein interactions, down to the analytical level of individual domain or motif mapping.

  13. Identification of Protein-Protein Interactions with Glutathione-S-Transferase (GST) Fusion Proteins. (United States)

    Einarson, Margret B; Pugacheva, Elena N; Orlinick, Jason R


    INTRODUCTIONGlutathione-S-transferase (GST) fusion proteins have had a wide range of applications since their introduction as tools for synthesis of recombinant proteins in bacteria. GST was originally selected as a fusion moiety because of several desirable properties. First and foremost, when expressed in bacteria alone, or as a fusion, GST is not sequestered in inclusion bodies (in contrast to previous fusion protein systems). Second, GST can be affinity-purified without denaturation because it binds to immobilized glutathione, which provides the basis for simple purification. Consequently, GST fusion proteins are routinely used for antibody generation and purification, protein-protein interaction studies, and biochemical analysis. This article describes the use of GST fusion proteins as probes for the identification of protein-protein interactions.

  14. Why fibrous proteins are romantic. (United States)

    Cohen, C


    Here I give a personal account of the great history of fibrous protein structure. I describe how Astbury first recognized the essential simplicity of fibrous proteins and their paradigmatic role in protein structure. The poor diffraction patterns yielded by these proteins were then deciphered by Pauling, Crick, Ramachandran and others (in part by model building) to reveal alpha-helical coiled coils, beta-sheets, and the collagen triple helical coiled coil-all characterized by different local sequence periodicities. Longer-range sequence periodicities (or "magic numbers") present in diverse fibrous proteins, such as collagen, tropomyosin, paramyosin, myosin, and were then shown to account for the characteristic axial repeats observed in filaments of these proteins. More recently, analysis of fibrous protein structure has been extended in many cases to atomic resolution, and some systems, such as "leucine zippers," are providing a deeper understanding of protein design than similar studies of globular proteins. In the last sections, I provide some dramatic examples of fibrous protein dynamics. One example is the so-called "spring-loaded" mechanism for viral fusion by the hemagglutinin protein of influenza. Another is the possible conformational changes in prion proteins, implicated in "mad cow disease," which may be related to similar transitions in a variety of globular and fibrous proteins. Copyright 1998 Academic Press.

  15. Tuber Storage Proteins




    A wide range of plants are grown for their edible tubers, but five species together account for almost 90 % of the total world production. These are potato (Solanum tuberosum), cassava (Manihot esculenta), sweet potato (Ipomoea batatus), yams (Dioscorea spp.) and taro (Colocasia, Cyrtosperma and Xanthosoma spp.). All of these, except cassava, contain groups of storage proteins, but these differ in the biological properties and evolutionary relationships. Thus, patatin from potato exhibits act...

  16. Prion Protein and Aging

    Directory of Open Access Journals (Sweden)

    Lisa eGasperini


    Full Text Available The cellular prion protein (PrPC has been widely investigated ever since its conformational isoform, the prion (or PrPSc, was identified as the etiological agent of prion disorders. The high homology shared by the PrPC-encoding gene among mammals, its high turnover rate and expression in every tissue strongly suggest that PrPC may possess key physiological functions. Therefore, defining PrPC roles, properties and fate in the physiology of mammalian cells would be fundamental to understand its pathological involvement in prion diseases. Since the incidence of these neurodegenerative disorders is enhanced in aging, understanding PrPC functions in this life phase may be of crucial importance. Indeed, a large body of evidence suggests that PrPC plays a neuroprotective and antioxidant role. Moreover, it has been suggested that PrPC is involved in Alzheimer disease, another neurodegenerative pathology that develops predominantly in the aging population. In prion diseases, PrPC function is likely lost upon protein aggregation occurring in the course of the disease. Additionally, the aging process may alter PrPC biochemical properties, thus influencing its propensity to convert into PrPSc. Both phenomena may contribute to the disease development and progression. In Alzheimer disease, PrPC has a controversial role because its presence seems to mediate β-amyloid toxicity, while its down-regulation correlates with neuronal death. The role of PrPC in aging has been investigated from different perspectives, often leading to contrasting results. The putative protein functions in aging have been studied in relation to memory, behavior and myelin maintenance. In aging mice, PrPC changes in subcellular localization and post-translational modifications have been explored in an attempt to relate them to different protein roles and propensity to convert into PrPSc. Here we provide an overview of the most relevant studies attempting to delineate PrPC functions and

  17. The mitochondrial uncoupling proteins


    Ledesma, Amalia; de Lacoba, Mario García; Rial, Eduardo


    The uncoupling proteins (UCPs) are transporters, present in the mitochondrial inner membrane, that mediate a regulated discharge of the proton gradient that is generated by the respiratory chain. This energy-dissipatory mechanism can serve functions such as thermogenesis, maintenance of the redox balance, or reduction in the production of reactive oxygen species. Some UCP homologs may not act as true uncouplers, however, and their activity has yet to be defined. The UCPs are integral membrane...

  18. Protein engineering techniques gateways to synthetic protein universe

    CERN Document Server

    Poluri, Krishna Mohan


    This brief provides a broad overview of protein-engineering research, offering a glimpse of the most common experimental methods. It also presents various computational programs with applications that are widely used in directed evolution, computational and de novo protein design. Further, it sheds light on the advantages and pitfalls of existing methodologies and future perspectives of protein engineering techniques.

  19. The interface of protein structure, protein biophysics, and molecular evolution (United States)

    Liberles, David A; Teichmann, Sarah A; Bahar, Ivet; Bastolla, Ugo; Bloom, Jesse; Bornberg-Bauer, Erich; Colwell, Lucy J; de Koning, A P Jason; Dokholyan, Nikolay V; Echave, Julian; Elofsson, Arne; Gerloff, Dietlind L; Goldstein, Richard A; Grahnen, Johan A; Holder, Mark T; Lakner, Clemens; Lartillot, Nicholas; Lovell, Simon C; Naylor, Gavin; Perica, Tina; Pollock, David D; Pupko, Tal; Regan, Lynne; Roger, Andrew; Rubinstein, Nimrod; Shakhnovich, Eugene; Sjölander, Kimmen; Sunyaev, Shamil; Teufel, Ashley I; Thorne, Jeffrey L; Thornton, Joseph W; Weinreich, Daniel M; Whelan, Simon


    Abstract The interface of protein structural biology, protein biophysics, molecular evolution, and molecular population genetics forms the foundations for a mechanistic understanding of many aspects of protein biochemistry. Current efforts in interdisciplinary protein modeling are in their infancy and the state-of-the art of such models is described. Beyond the relationship between amino acid substitution and static protein structure, protein function, and corresponding organismal fitness, other considerations are also discussed. More complex mutational processes such as insertion and deletion and domain rearrangements and even circular permutations should be evaluated. The role of intrinsically disordered proteins is still controversial, but may be increasingly important to consider. Protein geometry and protein dynamics as a deviation from static considerations of protein structure are also important. Protein expression level is known to be a major determinant of evolutionary rate and several considerations including selection at the mRNA level and the role of interaction specificity are discussed. Lastly, the relationship between modeling and needed high-throughput experimental data as well as experimental examination of protein evolution using ancestral sequence resurrection and in vitro biochemistry are presented, towards an aim of ultimately generating better models for biological inference and prediction. PMID:22528593

  20. Molecular simulations of lipid-mediated protein-protein interactions

    NARCIS (Netherlands)

    de Meyer, F.J.M.; Venturoli, M.; Smit, B.


    Recent experimental results revealed that lipid-mediated interactions due to hydrophobic forces may be important in determining the protein topology after insertion in the membrane, in regulating the protein activity, in protein aggregation and in signal transduction. To gain insight into the

  1. Accessory Proteins at ERES

    DEFF Research Database (Denmark)

    Klinkenberg, Rafael David

    membrane targeting and association with ERES. We determine the localization of Sec16B by transient expression in HeLa cells, and find that the protein is evenly distributed throughout the cell except the nucleus at 37°C, as is also observed with mSec16A. When the temperature is lowered to 15°C, mSec16B...... proteins. Together these components co‐operate in cargo‐selection as well as forming, loading and releasing budding vesicles from specific regions on the membrane surface of the ER. Coat components furthermore convey vesicle targeting towards the Golgi. However, not much is known about the mechanisms...... that regulate the COPII assembly at the vesicle bud site. This thesis provides the first regulatory mechanism of COPII assembly in relation to ER‐membrane lipid‐signal recognition by the accessory protein p125A (Sec23IP). The aim of the project was to characterize p125A function by dissecting two main domains...

  2. Papillomavirus E6 proteins

    International Nuclear Information System (INIS)

    Howie, Heather L.; Katzenellenbogen, Rachel A.; Galloway, Denise A.


    The papillomaviruses are small DNA viruses that encode approximately eight genes, and require the host cell DNA replication machinery for their viral DNA replication. Thus papillomaviruses have evolved strategies to induce host cell DNA synthesis balanced with strategies to protect the cell from unscheduled replication. While the papillomavirus E1 and E2 genes are directly involved in viral replication by binding to and unwinding the origin of replication, the E6 and E7 proteins have auxillary functions that promote proliferation. As a consequence of disrupting the normal checkpoints that regulate cell cycle entry and progression, the E6 and E7 proteins play a key role in the oncogenic properties of human papillomaviruses with a high risk of causing anogenital cancers (HR HPVs). As a consequence, E6 and E7 of HR HPVs are invariably expressed in cervical cancers. This article will focus on the E6 protein and its numerous activities including inactivating p53, blocking apoptosis, activating telomerase, disrupting cell adhesion, polarity and epithelial differentiation, altering transcription and reducing immune recognition

  3. Neutron protein crystallography

    Energy Technology Data Exchange (ETDEWEB)

    Niimura, Nobuo [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment


    X-ray diffraction of single crystal has enriched the knowledge of various biological molecules such as proteins, DNA, t-RNA, viruses, etc. It is difficult to make structural analysis of hydrogen atoms in a protein using X-ray crystallography, whereas neutron diffraction seems usable to directly determine the location of those hydrogen atoms. Here, neutron diffraction method was applied to structural analysis of hen egg-white lysozyme. Since the crystal size of a protein to analyze is generally small (5 mm{sup 3} at most), the neutron beam at the sample position in monochromator system was set to less than 5 x 5 mm{sup 2} and beam divergence to 0.4 degree or less. Neutron imaging plate with {sup 6}Li or Gd mixed with photostimulated luminescence material was used and about 2500 Bragg reflections were recorded in one crystal setting. A total of 38278 reflections for 2.0 A resolution were collected in less than 10 days. Thus, stereo views of Trp-111 omit map around the indol ring of Trp-111 was presented and the three-dimensional arrangement of 696H and 264D atoms in the lysozyme molecules was determined using the omit map. (M.N.)

  4. Noncovalent synthesis of protein dendrimers

    NARCIS (Netherlands)

    Lempens, E.H.M.; Baal, van I.; Dongen, van J.L.J.; Hackeng, T.M.; Merkx, M.; Meijer, E.W.


    The covalent synthesis of complex biomolecular systems such as multivalent protein dendrimers often proceeds with low efficiency, thereby making alternative strategies based on noncovalent chemistry of high interest. Here, the synthesis of protein dendrimers using a strong but noncovalent

  5. Protein folding and wring resonances

    DEFF Research Database (Denmark)

    Bohr, Jakob; Bohr, Henrik; Brunak, Søren


    The polypeptide chain of a protein is shown to obey topological contraints which enable long range excitations in the form of wring modes of the protein backbone. Wring modes of proteins of specific lengths can therefore resonate with molecular modes present in the cell. It is suggested that prot......The polypeptide chain of a protein is shown to obey topological contraints which enable long range excitations in the form of wring modes of the protein backbone. Wring modes of proteins of specific lengths can therefore resonate with molecular modes present in the cell. It is suggested...... that protein folding takes place when the amplitude of a wring excitation becomes so large that it is energetically favorable to bend the protein backbone. The condition under which such structural transformations can occur is found, and it is shown that both cold and hot denaturation (the unfolding...

  6. Protein Linked to Atopic Dermatitis (United States)

    ... Research Matters NIH Research Matters January 14, 2013 Protein Linked to Atopic Dermatitis Normal skin from a ... in mice suggests that lack of a certain protein may trigger atopic dermatitis, the most common type ...

  7. Pathways of Unconventional Protein Secretion

    NARCIS (Netherlands)

    Rabouille, Catherine


    Secretory proteins are conventionally transported through the endoplasmic reticulum to the Golgi and then to the plasma membrane where they are released into the extracellular space. However, numerous substrates also reach these destinations using unconventional pathways. Unconventional protein

  8. Pathways of Unconventional Protein Secretion

    NARCIS (Netherlands)

    Rabouille, Catherine


    Secretory proteins are conventionally transported through the endoplasmic reticulum to the Golgi and then to the plasma membrane where they are released into the extracellular space. However, numerous substrates also reach these destinations using unconventional pathways. Unconventional protein

  9. Designing proteins for therapeutic applications. (United States)

    Lazar, Greg A; Marshall, Shannon A; Plecs, Joseph J; Mayo, Stephen L; Desjarlais, John R


    Protein design is becoming an increasingly useful tool for optimizing protein drugs and creating novel biotherapeutics. Recent progress includes the engineering of monoclonal antibodies, cytokines, enzymes and viral fusion inhibitors.

  10. Protein kinase substrate identification on functional protein arrays

    Directory of Open Access Journals (Sweden)

    Zhou Fang


    Full Text Available Abstract Background Over the last decade, kinases have emerged as attractive therapeutic targets for a number of different diseases, and numerous high throughput screening efforts in the pharmaceutical community are directed towards discovery of compounds that regulate kinase function. The emerging utility of systems biology approaches has necessitated the development of multiplex tools suitable for proteomic-scale experiments to replace lower throughput technologies such as mass spectroscopy for the study of protein phosphorylation. Recently, a new approach for identifying substrates of protein kinases has applied the miniaturized format of functional protein arrays to characterize phosphorylation for thousands of candidate protein substrates in a single experiment. This method involves the addition of protein kinases in solution to arrays of immobilized proteins to identify substrates using highly sensitive radioactive detection and hit identification algorithms. Results To date, the factors required for optimal performance of protein array-based kinase substrate identification have not been described. In the current study, we have carried out a detailed characterization of the protein array-based method for kinase substrate identification, including an examination of the effects of time, buffer compositions, and protein concentration on the results. The protein array approach was compared to standard solution-based assays for assessing substrate phosphorylation, and a correlation of greater than 80% was observed. The results presented here demonstrate how novel substrates for protein kinases can be quickly identified from arrays containing thousands of human proteins to provide new clues to protein kinase function. In addition, a pooling-deconvolution strategy was developed and applied that enhances characterization of specific kinase-substrate relationships and decreases reagent consumption. Conclusion Functional protein microarrays are an

  11. Tyrosine phosphorylation of WW proteins (United States)

    Reuven, Nina; Shanzer, Matan


    A number of key regulatory proteins contain one or two copies of the WW domain known to mediate protein–protein interaction via proline-rich motifs, such as PPxY. The Hippo pathway components take advantage of this module to transduce tumor suppressor signaling. It is becoming evident that tyrosine phosphorylation is a critical regulator of the WW proteins. Here, we review the current knowledge on the involved tyrosine kinases and their roles in regulating the WW proteins. PMID:25627656

  12. Protein annotation from protein interaction networks and Gene Ontology. (United States)

    Nguyen, Cao D; Gardiner, Katheleen J; Cios, Krzysztof J


    We introduce a novel method for annotating protein function that combines Naïve Bayes and association rules, and takes advantage of the underlying topology in protein interaction networks and the structure of graphs in the Gene Ontology. We apply our method to proteins from the Human Protein Reference Database (HPRD) and show that, in comparison with other approaches, it predicts protein functions with significantly higher recall with no loss of precision. Specifically, it achieves 51% precision and 60% recall versus 45% and 26% for Majority and 24% and 61% for χ²-statistics, respectively. Copyright © 2011 Elsevier Inc. All rights reserved.

  13. Protein Adsorption in Three Dimensions (United States)

    Vogler, Erwin A.


    Recent experimental and theoretical work clarifying the physical chemistry of blood-protein adsorption from aqueous-buffer solution to various kinds of surfaces is reviewed and interpreted within the context of biomaterial applications, especially toward development of cardiovascular biomaterials. The importance of this subject in biomaterials surface science is emphasized by reducing the “protein-adsorption problem” to three core questions that require quantitative answer. An overview of the protein-adsorption literature identifies some of the sources of inconsistency among many investigators participating in more than five decades of focused research. A tutorial on the fundamental biophysical chemistry of protein adsorption sets the stage for a detailed discussion of the kinetics and thermodynamics of protein adsorption, including adsorption competition between two proteins for the same adsorbent immersed in a binary-protein mixture. Both kinetics and steady-state adsorption can be rationalized using a single interpretive paradigm asserting that protein molecules partition from solution into a three-dimensional (3D) interphase separating bulk solution from the physical-adsorbent surface. Adsorbed protein collects in one-or-more adsorbed layers, depending on protein size, solution concentration, and adsorbent surface energy (water wettability). The adsorption process begins with the hydration of an adsorbent surface brought into contact with an aqueous-protein solution. Surface hydration reactions instantaneously form a thin, pseudo-2D interface between the adsorbent and protein solution. Protein molecules rapidly diffuse into this newly-formed interface, creating a truly 3D interphase that inflates with arriving proteins and fills to capacity within milliseconds at mg/mL bulk-solution concentrations CB. This inflated interphase subsequently undergoes time-dependent (minutes-to-hours) decrease in volume VI by expulsion of either-or-both interphase water and

  14. A Novel Approach for Protein-Named Entity Recognition and Protein-Protein Interaction Extraction

    Directory of Open Access Journals (Sweden)

    Meijing Li


    Full Text Available Many researchers focus on developing protein-named entity recognition (Protein-NER or PPI extraction systems. However, the studies about these two topics cannot be merged well; then existing PPI extraction systems’ Protein-NER still needs to improve. In this paper, we developed the protein-protein interaction extraction system named PPIMiner based on Support Vector Machine (SVM and parsing tree. PPIMiner consists of three main models: natural language processing (NLP model, Protein-NER model, and PPI discovery model. The Protein-NER model, which is named ProNER, identifies the protein names based on two methods: dictionary-based method and machine learning-based method. ProNER is capable of identifying more proteins than dictionary-based Protein-NER model in other existing systems. The final discovered PPIs extracted via PPI discovery model are represented in detail because we showed the protein interaction types and the occurrence frequency through two different methods. In the experiments, the result shows that the performances achieved by our ProNER and PPI discovery model are better than other existing tools. PPIMiner applied this protein-named entity recognition approach and parsing tree based PPI extraction method to improve the performance of PPI extraction. We also provide an easy-to-use interface to access PPIs database and an online system for PPIs extraction and Protein-NER.

  15. Proteins: Chemistry, Characterization, and Quality

    NARCIS (Netherlands)

    Sforza, S.; Tedeschi, T.; Wierenga, P.A.


    Proteins are one of the major macronutrients in food, and several traditional food commodities are good sources of proteins (meat, egg, milk and dairy products, fish, and soya). Proteins are polymers made by 20 different amino acids. They might undergo desired or undesired chemical or enzymatic

  16. Protein: FBA8 [TP Atlas

    Lifescience Database Archive (English)

    Full Text Available FBA8 LUBAC (linear ubiquitin chain-assembly complex) RNF31 ZIBRA RNF31 RING finger pr...otein 31 HOIL-1-interacting protein, Zinc in-between-RING-finger ubiquitin-associated domain protein 9606 Homo sapiens Q96EP0 55072 2CT7 55072 Q96EP0 ...

  17. Protein: MPA1 [TP Atlas

    Lifescience Database Archive (English)

    Full Text Available MPA1 TLR signaling molecules MAVS IPS1, KIAA1271, VISA VISA_(gene) Mitochondrial antiviral-signaling pr...otein CARD adapter inducing interferon beta, Interferon beta promoter stimulator protein... 1, Putative NF-kappa-B-activating protein 031N, Virus-induced-signaling adapter 9606 Homo sapiens Q7Z434 57506 2VGQ 57506 ...

  18. Protein: FBA3 [TP Atlas

    Lifescience Database Archive (English)

    Full Text Available FBA3 Ubiquitination CBLB RNF56 CBLB E3 ubiquitin-protein ligase CBL-B Casitas B-lineage lymphoma pr...oto-oncogene b, RING finger protein 56, SH3-binding protein CBL-B, Signal transduction prote

  19. Protein: MPB2 [TP Atlas

    Lifescience Database Archive (English)

    Full Text Available MPB2 Ubiquitin ligases WWP1 WWP1 NEDD4-like E3 ubiquitin-protein ligase WWP1 Atrophin-1-interacting pr...otein 5, WW domain-containing protein 1 9606 Homo sapiens Q9H0M0 11059 2OP7, 1ND7 11059 ...

  20. Hydrophobic patches on protein surfaces

    NARCIS (Netherlands)

    Lijnzaad, P.


    Hydrophobicity is a prime determinant of the structure and function of proteins. It is the driving force behind the folding of soluble proteins, and when exposed on the surface, it is frequently involved in recognition and binding of ligands and other proteins. The energetic cost of

  1. Modeling complexes of modeled proteins. (United States)

    Anishchenko, Ivan; Kundrotas, Petras J; Vakser, Ilya A


    Structural characterization of proteins is essential for understanding life processes at the molecular level. However, only a fraction of known proteins have experimentally determined structures. This fraction is even smaller for protein-protein complexes. Thus, structural modeling of protein-protein interactions (docking) primarily has to rely on modeled structures of the individual proteins, which typically are less accurate than the experimentally determined ones. Such "double" modeling is the Grand Challenge of structural reconstruction of the interactome. Yet it remains so far largely untested in a systematic way. We present a comprehensive validation of template-based and free docking on a set of 165 complexes, where each protein model has six levels of structural accuracy, from 1 to 6 Å C α RMSD. Many template-based docking predictions fall into acceptable quality category, according to the CAPRI criteria, even for highly inaccurate proteins (5-6 Å RMSD), although the number of such models (and, consequently, the docking success rate) drops significantly for models with RMSD > 4 Å. The results show that the existing docking methodologies can be successfully applied to protein models with a broad range of structural accuracy, and the template-based docking is much less sensitive to inaccuracies of protein models than the free docking. Proteins 2017; 85:470-478. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  2. Protein-protein interactions and cancer: targeting the central dogma. (United States)

    Garner, Amanda L; Janda, Kim D


    Between 40,000 and 200,000 protein-protein interactions have been predicted to exist within the human interactome. As these interactions are of a critical nature in many important cellular functions and their dysregulation is causal of disease, the modulation of these binding events has emerged as a leading, yet difficult therapeutic arena. In particular, the targeting of protein-protein interactions relevant to cancer is of fundamental importance as the tumor-promoting function of several aberrantly expressed proteins in the cancerous state is directly resultant of its ability to interact with a protein-binding partner. Of significance, these protein complexes play a crucial role in each of the steps of the central dogma of molecular biology, the fundamental processes of genetic transmission. With the many important discoveries being made regarding the mechanisms of these genetic process, the identification of new chemical probes are needed to better understand and validate the druggability of protein-protein interactions related to the central dogma. In this review, we provide an overview of current small molecule-based protein-protein interaction inhibitors for each stage of the central dogma: transcription, mRNA splicing and translation. Importantly, through our analysis we have uncovered a lack of necessary probes targeting mRNA splicing and translation, thus, opening up the possibility for expansion of these fields.

  3. Biophysics of protein evolution and evolutionary protein biophysics (United States)

    Sikosek, Tobias; Chan, Hue Sun


    The study of molecular evolution at the level of protein-coding genes often entails comparing large datasets of sequences to infer their evolutionary relationships. Despite the importance of a protein's structure and conformational dynamics to its function and thus its fitness, common phylogenetic methods embody minimal biophysical knowledge of proteins. To underscore the biophysical constraints on natural selection, we survey effects of protein mutations, highlighting the physical basis for marginal stability of natural globular proteins and how requirement for kinetic stability and avoidance of misfolding and misinteractions might have affected protein evolution. The biophysical underpinnings of these effects have been addressed by models with an explicit coarse-grained spatial representation of the polypeptide chain. Sequence–structure mappings based on such models are powerful conceptual tools that rationalize mutational robustness, evolvability, epistasis, promiscuous function performed by ‘hidden’ conformational states, resolution of adaptive conflicts and conformational switches in the evolution from one protein fold to another. Recently, protein biophysics has been applied to derive more accurate evolutionary accounts of sequence data. Methods have also been developed to exploit sequence-based evolutionary information to predict biophysical behaviours of proteins. The success of these approaches demonstrates a deep synergy between the fields of protein biophysics and protein evolution. PMID:25165599

  4. The Proteins API: accessing key integrated protein and genome information. (United States)

    Nightingale, Andrew; Antunes, Ricardo; Alpi, Emanuele; Bursteinas, Borisas; Gonzales, Leonardo; Liu, Wudong; Luo, Jie; Qi, Guoying; Turner, Edd; Martin, Maria


    The Proteins API provides searching and programmatic access to protein and associated genomics data such as curated protein sequence positional annotations from UniProtKB, as well as mapped variation and proteomics data from large scale data sources (LSS). Using the coordinates service, researchers are able to retrieve the genomic sequence coordinates for proteins in UniProtKB. This, the LSS genomics and proteomics data for UniProt proteins is programmatically only available through this service. A Swagger UI has been implemented to provide documentation, an interface for users, with little or no programming experience, to 'talk' to the services to quickly and easily formulate queries with the services and obtain dynamically generated source code for popular programming languages, such as Java, Perl, Python and Ruby. Search results are returned as standard JSON, XML or GFF data objects. The Proteins API is a scalable, reliable, fast, easy to use RESTful services that provides a broad protein information resource for users to ask questions based upon their field of expertise and allowing them to gain an integrated overview of protein annotations available to aid their knowledge gain on proteins in biological processes. The Proteins API is available at ( © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  5. Protein subcellular localization assays using split fluorescent proteins (United States)

    Waldo, Geoffrey S [Santa Fe, NM; Cabantous, Stephanie [Los Alamos, NM


    The invention provides protein subcellular localization assays using split fluorescent protein systems. The assays are conducted in living cells, do not require fixation and washing steps inherent in existing immunostaining and related techniques, and permit rapid, non-invasive, direct visualization of protein localization in living cells. The split fluorescent protein systems used in the practice of the invention generally comprise two or more self-complementing fragments of a fluorescent protein, such as GFP, wherein one or more of the fragments correspond to one or more beta-strand microdomains and are used to "tag" proteins of interest, and a complementary "assay" fragment of the fluorescent protein. Either or both of the fragments may be functionalized with a subcellular targeting sequence enabling it to be expressed in or directed to a particular subcellular compartment (i.e., the nucleus).

  6. Diffusion of Integral Membrane Proteins in Protein-Rich Membranes

    DEFF Research Database (Denmark)

    Javanainen, Matti; Martinez-Seara, Hector; Metzler, Ralf


    of being protein-poor, native cell membranes are extremely crowded with proteins. On the basis of extensive molecular simulations, we here demonstrate that protein crowding of the membrane at physiological levels leads to deviations from the SD relation and to the emergence of a stronger Stokes......-like dependence D ∝ 1/R. We propose that this 1/R law mainly arises due to geometrical factors: smaller proteins are able to avoid confinement effects much better than their larger counterparts. The results highlight that the lateral dynamics in the crowded setting found in native membranes is radically different......The lateral diffusion of embedded proteins along lipid membranes in protein-poor conditions has been successfully described in terms of the Saffman-Delbrück (SD) model, which predicts that the protein diffusion coefficient D is weakly dependent on its radius R as D ∝ ln(1/R). However, instead...

  7. Protein enriched pasta: structure and digestibility of its protein network. (United States)

    Laleg, Karima; Barron, Cécile; Santé-Lhoutellier, Véronique; Walrand, Stéphane; Micard, Valérie


    Wheat (W) pasta was enriched in 6% gluten (G), 35% faba (F) or 5% egg (E) to increase its protein content (13% to 17%). The impact of the enrichment on the multiscale structure of the pasta and on in vitro protein digestibility was studied. Increasing the protein content (W- vs. G-pasta) strengthened pasta structure at molecular and macroscopic scales but reduced its protein digestibility by 3% by forming a higher covalently linked protein network. Greater changes in the macroscopic and molecular structure of the pasta were obtained by varying the nature of protein used for enrichment. Proteins in G- and E-pasta were highly covalently linked (28-32%) resulting in a strong pasta structure. Conversely, F-protein (98% SDS-soluble) altered the pasta structure by diluting gluten and formed a weak protein network (18% covalent link). As a result, protein digestibility in F-pasta was significantly higher (46%) than in E- (44%) and G-pasta (39%). The effect of low (55 °C, LT) vs. very high temperature (90 °C, VHT) drying on the protein network structure and digestibility was shown to cause greater molecular changes than pasta formulation. Whatever the pasta, a general strengthening of its structure, a 33% to 47% increase in covalently linked proteins and a higher β-sheet structure were observed. However, these structural differences were evened out after the pasta was cooked, resulting in identical protein digestibility in LT and VHT pasta. Even after VHT drying, F-pasta had the best amino acid profile with the highest protein digestibility, proof of its nutritional interest.

  8. NMR Studies of Protein Hydration and Protein-Ligand Interactions (United States)

    Chong, Yuan

    Water on the surface of a protein is called hydration water. Hydration water is known to play a crucial role in a variety of biological processes including protein folding, enzymatic activation, and drug binding. Although the significance of hydration water has been recognized, the underlying mechanism remains far from being understood. This dissertation employs a unique in-situ nuclear magnetic resonance (NMR) technique to study the mechanism of protein hydration and the role of hydration in alcohol-protein interactions. Water isotherms in proteins are measured at different temperatures via the in-situ NMR technique. Water is found to interact differently with hydrophilic and hydrophobic groups on the protein. Water adsorption on hydrophilic groups is hardly affected by the temperature, while water adsorption on hydrophobic groups strongly depends on the temperature around 10 C, below which the adsorption is substantially reduced. This effect is induced by the dramatic decrease in the protein flexibility below 10 C. Furthermore, nanosecond to microsecond protein dynamics and the free energy, enthalpy, and entropy of protein hydration are studied as a function of hydration level and temperature. A crossover at 10 C in protein dynamics and thermodynamics is revealed. The effect of water at hydrophilic groups on protein dynamics and thermodynamics shows little temperature dependence, whereas water at hydrophobic groups has stronger effect above 10 C. In addition, I investigate the role of water in alcohol binding to the protein using the in-situ NMR detection. The isotherms of alcohols are first measured on dry proteins, then on proteins with a series of controlled hydration levels. The free energy, enthalpy, and entropy of alcohol binding are also determined. Two distinct types of alcohol binding are identified. On the one hand, alcohols can directly bind to a few specific sites on the protein. This type of binding is independent of temperature and can be

  9. Protein Sorting Prediction

    DEFF Research Database (Denmark)

    Nielsen, Henrik


    and drawbacks of each of these approaches is described through many examples of methods that predict secretion, integration into membranes, or subcellular locations in general. The aim of this chapter is to provide a user-level introduction to the field with a minimum of computational theory.......Many computational methods are available for predicting protein sorting in bacteria. When comparing them, it is important to know that they can be grouped into three fundamentally different approaches: signal-based, global-property-based and homology-based prediction. In this chapter, the strengths...

  10. Proteins in the experiment

    International Nuclear Information System (INIS)

    Yang, Y.S.


    The backbone of ferredoxin and hemoproteins are described by SAWs in two and three dimensions. But the spin-lattice relaxation process of Fsub(e) 3+ ions cannot be described by pure fractal model. The spectral dimensions observed in experiment is defined through dsub(s)=dsub(f)/a, a is given by the scaling form of the low frequency mode ω(bL)=bsup(a)ω(L) of the whole system consisting of proteins and the solvent upon a change of the length scale. (author)

  11. Protein-protein interaction network-based detection of functionally similar proteins within species. (United States)

    Song, Baoxing; Wang, Fen; Guo, Yang; Sang, Qing; Liu, Min; Li, Dengyun; Fang, Wei; Zhang, Deli


    Although functionally similar proteins across species have been widely studied, functionally similar proteins within species showing low sequence similarity have not been examined in detail. Identification of these proteins is of significant importance for understanding biological functions, evolution of protein families, progression of co-evolution, and convergent evolution and others which cannot be obtained by detection of functionally similar proteins across species. Here, we explored a method of detecting functionally similar proteins within species based on graph theory. After denoting protein-protein interaction networks using graphs, we split the graphs into subgraphs using the 1-hop method. Proteins with functional similarities in a species were detected using a method of modified shortest path to compare these subgraphs and to find the eligible optimal results. Using seven protein-protein interaction networks and this method, some functionally similar proteins with low sequence similarity that cannot detected by sequence alignment were identified. By analyzing the results, we found that, sometimes, it is difficult to separate homologous from convergent evolution. Evaluation of the performance of our method by gene ontology term overlap showed that the precision of our method was excellent. Copyright © 2012 Wiley Periodicals, Inc.

  12. Detection of protein complex from protein-protein interaction network using Markov clustering

    International Nuclear Information System (INIS)

    Ochieng, P J; Kusuma, W A; Haryanto, T


    Detection of complexes, or groups of functionally related proteins, is an important challenge while analysing biological networks. However, existing algorithms to identify protein complexes are insufficient when applied to dense networks of experimentally derived interaction data. Therefore, we introduced a graph clustering method based on Markov clustering algorithm to identify protein complex within highly interconnected protein-protein interaction networks. Protein-protein interaction network was first constructed to develop geometrical network, the network was then partitioned using Markov clustering to detect protein complexes. The interest of the proposed method was illustrated by its application to Human Proteins associated to type II diabetes mellitus. Flow simulation of MCL algorithm was initially performed and topological properties of the resultant network were analysed for detection of the protein complex. The results indicated the proposed method successfully detect an overall of 34 complexes with 11 complexes consisting of overlapping modules and 20 non-overlapping modules. The major complex consisted of 102 proteins and 521 interactions with cluster modularity and density of 0.745 and 0.101 respectively. The comparison analysis revealed MCL out perform AP, MCODE and SCPS algorithms with high clustering coefficient (0.751) network density and modularity index (0.630). This demonstrated MCL was the most reliable and efficient graph clustering algorithm for detection of protein complexes from PPI networks. (paper)

  13. Human cancer protein-protein interaction network: a structural perspective.

    Directory of Open Access Journals (Sweden)

    Gozde Kar


    Full Text Available Protein-protein interaction networks provide a global picture of cellular function and biological processes. Some proteins act as hub proteins, highly connected to others, whereas some others have few interactions. The dysfunction of some interactions causes many diseases, including cancer. Proteins interact through their interfaces. Therefore, studying the interface properties of cancer-related proteins will help explain their role in the interaction networks. Similar or overlapping binding sites should be used repeatedly in single interface hub proteins, making them promiscuous. Alternatively, multi-interface hub proteins make use of several distinct binding sites to bind to different partners. We propose a methodology to integrate protein interfaces into cancer interaction networks (ciSPIN, cancer structural protein interface network. The interactions in the human protein interaction network are replaced by interfaces, coming from either known or predicted complexes. We provide a detailed analysis of cancer related human protein-protein interfaces and the topological properties of the cancer network. The results reveal that cancer-related proteins have smaller, more planar, more charged and less hydrophobic binding sites than non-cancer proteins, which may indicate low affinity and high specificity of the cancer-related interactions. We also classified the genes in ciSPIN according to phenotypes. Within phenotypes, for breast cancer, colorectal cancer and leukemia, interface properties were found to be discriminating from non-cancer interfaces with an accuracy of 71%, 67%, 61%, respectively. In addition, cancer-related proteins tend to interact with their partners through distinct interfaces, corresponding mostly to multi-interface hubs, which comprise 56% of cancer-related proteins, and constituting the nodes with higher essentiality in the network (76%. We illustrate the interface related affinity properties of two cancer-related hub

  14. Metagenomics and the protein universe (United States)

    Godzik, Adam


    Metagenomics sequencing projects have dramatically increased our knowledge of the protein universe and provided over one-half of currently known protein sequences; they have also introduced a much broader phylogenetic diversity into the protein databases. The full analysis of metagenomic datasets is only beginning, but it has already led to the discovery of thousands of new protein families, likely representing novel functions specific to given environments. At the same time, a deeper analysis of such novel families, including experimental structure determination of some representatives, suggests that most of them represent distant homologs of already characterized protein families, and thus most of the protein diversity present in the new environments are due to functional divergence of the known protein families rather than the emergence of new ones. PMID:21497084

  15. Bioinformatic Prediction of WSSV-Host Protein-Protein Interaction

    Directory of Open Access Journals (Sweden)

    Zheng Sun


    Full Text Available WSSV is one of the most dangerous pathogens in shrimp aquaculture. However, the molecular mechanism of how WSSV interacts with shrimp is still not very clear. In the present study, bioinformatic approaches were used to predict interactions between proteins from WSSV and shrimp. The genome data of WSSV (NC_003225.1 and the constructed transcriptome data of F. chinensis were used to screen potentially interacting proteins by searching in protein interaction databases, including STRING, Reactome, and DIP. Forty-four pairs of proteins were suggested to have interactions between WSSV and the shrimp. Gene ontology analysis revealed that 6 pairs of these interacting proteins were classified into “extracellular region” or “receptor complex” GO-terms. KEGG pathway analysis showed that they were involved in the “ECM-receptor interaction pathway.” In the 6 pairs of interacting proteins, an envelope protein called “collagen-like protein” (WSSV-CLP encoded by an early virus gene “wsv001” in WSSV interacted with 6 deduced proteins from the shrimp, including three integrin alpha (ITGA, two integrin beta (ITGB, and one syndecan (SDC. Sequence analysis on WSSV-CLP, ITGA, ITGB, and SDC revealed that they possessed the sequence features for protein-protein interactions. This study might provide new insights into the interaction mechanisms between WSSV and shrimp.

  16. Prion protein in milk.

    Directory of Open Access Journals (Sweden)

    Nicola Franscini

    Full Text Available BACKGROUND: Prions are known to cause transmissible spongiform encephalopathies (TSE after accumulation in the central nervous system. There is increasing evidence that prions are also present in body fluids and that prion infection by blood transmission is possible. The low concentration of the proteinaceous agent in body fluids and its long incubation time complicate epidemiologic analysis and estimation of spreading and thus the risk of human infection. This situation is particularly unsatisfactory for food and pharmaceutical industries, given the lack of sensitive tools for monitoring the infectious agent. METHODOLOGY/PRINCIPAL FINDINGS: We have developed an adsorption matrix, Alicon PrioTrap, which binds with high affinity and specificity to prion proteins. Thus we were able to identify prion protein (PrP(C--the precursor of prions (PrP(Sc--in milk from humans, cows, sheep, and goats. The absolute amount of PrP(C differs between the species (from microg/l range in sheep to ng/l range in human milk. PrP(C is also found in homogenised and pasteurised off-the-shelf milk, and even ultrahigh temperature treatment only partially diminishes endogenous PrP(C concentration. CONCLUSIONS/SIGNIFICANCE: In view of a recent study showing evidence of prion replication occurring in the mammary gland of scrapie infected sheep suffering from mastitis, the appearance of PrP(C in milk implies the possibility that milk of TSE-infected animals serves as source for PrP(Sc.

  17. Ethylene and protein synthesis

    Energy Technology Data Exchange (ETDEWEB)

    Osborne, D J


    Ethylene reduces the rate of expansion growth of cells and it is suggestive that the rate of expansion is controlled at least in part by the synthesis of hydroxyproline rich glycopeptides that are secreted with other polysaccharide material through the plasmalemma into the cell wall, thereby enhancing the thickness of the cell wall and also rendering it poorly extensible. In combination, auxin would appear to counteract the effect of ethylene in this respect, for although auxin enhances the synthesis of protein and the content in the cell walls, as well as causing some increase in wall thickness, it reduces the amount of hydroxyproline reaching the wall. Such effects may be instrumental in enhancing wall plasticity, the rate of expansion and the final cell size. These results indicate that ethylene and auxin together afford a dual regulatory system exerted through a control of a specific part of the protein synthetic pathway, the products of which regulate the rate of expansion, and the potential for expansion, of the plant cell wall. 38 references, 3 figures, 8 tables.

  18. The netrin protein family. (United States)

    Rajasekharan, Sathyanath; Kennedy, Timothy E


    The name netrin is derived from the Sanskrit Netr, meaning 'guide'. Netrins are a family of extracellular proteins that direct cell and axon migration during embryogenesis. Three secreted netrins (netrins 1, 3 and 4), and two glycosylphosphatidylinositol (GPI)-anchored membrane proteins, netrins G1 and G2, have been identified in mammals. The secreted netrins are bifunctional, acting as attractants for some cell types and repellents for others. Receptors for the secreted netrins include the Deleted in Colorectal Cancer (DCC) family, the Down's syndrome cell adhesion molecule (DSCAM), and the UNC-5 homolog family: Unc5A, B, C and D in mammals. Netrin Gs do not appear to interact with these receptors, but regulate synaptic interactions between neurons by binding to the transmembrane netrin G ligands NGL1 and 2. The chemotropic function of secreted netrins has been best characterized with regard to axon guidance during the development of the nervous system. Extending axons are tipped by a flattened, membranous structure called the growth cone. Multiple extracellular guidance cues direct axonal growth cones to their ultimate targets where synapses form. Such cues can be locally derived (short-range), or can be secreted diffusible cues that allow target cells to signal axons from a distance (long-range). The secreted netrins function as short-range and long-range guidance cues in different circumstances. In addition to directing cell migration, functional roles for netrins have been identified in the regulation of cell adhesion, the maturation of cell morphology, cell survival and tumorigenesis.

  19. Protein detection using biobarcodes. (United States)

    Müller, Uwe R


    Over the past 50 years the development of assays for the detection of protein analytes has been driven by continuing demands for higher levels of sensitivity and multiplexing. The result has been a progression of sandwich-type immunoassays, starting with simple radioisotopic, colorimetric, or fluorescent labeling systems to include various enzymatic or nanostructure-based signal amplification schemes, with a concomitant sensitivity increase of over 1 million fold. Multiplexing of samples and tests has been enabled by microplate and microarray platforms, respectively, or lately by various molecular barcoding systems. Two different platforms have emerged as the current front-runners by combining a nucleic acid amplification step with the standard two-sided immunoassay. In both, the captured protein analyte is replaced by a multiplicity of oligonucleotides that serve as surrogate targets. One of these platforms employs DNA or RNA polymerases for the amplification step, while detection is by fluorescence. The other is based on gold nanoparticles for both amplification as well as detection. The latter technology, now termed Biobarcode, is completely enzyme-free and offers potentially much higher multiplexing power.

  20. IGF binding proteins. (United States)

    Bach, Leon A


    Insulin-like growth factor binding proteins (IGFBPs) 1-6 bind IGFs but not insulin with high affinity. They were initially identified as serum carriers and passive inhibitors of IGF actions. However, subsequent studies showed that, although IGFBPs inhibit IGF actions in many circumstances, they may also potentiate these actions. IGFBPs are widely expressed in most tissues, and they are flexible endocrine and autocrine/paracrine regulators of IGF activity, which is essential for this important physiological system. More recently, individual IGFBPs have been shown to have IGF-independent actions. Mechanisms underlying these actions include (i) interaction with non-IGF proteins in compartments including the extracellular space and matrix, the cell surface and intracellularly; (ii) interaction with and modulation of other growth factor pathways including EGF, TGF- and VEGF; and (iii) direct or indirect transcriptional effects following nuclear entry of IGFBPs. Through these IGF-dependent and IGF-independent actions, IGFBPs modulate essential cellular processes including proliferation, survival, migration, senescence, autophagy and angiogenesis. They have been implicated in a range of disorders including malignant, metabolic, neurological and immune diseases. A more complete understanding of their cellular roles may lead to the development of novel IGFBP-based therapeutic opportunities.

  1. Peptides and proteins

    Energy Technology Data Exchange (ETDEWEB)

    Bachovchin, W.W.; Unkefer, C.J.


    Advances in magnetic resonance and vibrational spectroscopy make it possible to derive detailed structural information about biomolecular structures in solution. These techniques are critically dependent on the availability of labeled compounds. For example, NMR techniques used today to derive peptide and protein structures require uniformity {sup 13}C-and {sup 15}N-labeled samples that are derived biosynthetically from (U-6-{sup 13}C) glucose. These experiments are possible now because, during the 1970s, the National Stable Isotope Resource developed algal methods for producing (U-6-{sup 13}C) glucose. If NMR techniques are to be used to study larger proteins, we will need sophisticated labelling patterns in amino acids that employ a combination of {sup 2}H, {sup 13}C, and {sup 15}N labeling. The availability of these specifically labeled amino acids requires a renewed investment in new methods for chemical synthesis of labeled amino acids. The development of new magnetic resonance or vibrational techniques to elucidate biomolecular structure will be seriously impeded if we do not see rapid progress in labeling technology. Investment in labeling chemistry is as important as investment in the development of advanced spectroscopic tools.

  2. Botanical and Protein Sweeteners

    Directory of Open Access Journals (Sweden)

    D.A. Agboola


    Full Text Available Plant species with unusual taste properties such as bitterness, sourness or sweetness and others with a taste- modifying components; have long been known to man, although their exploitation has been limited. Exponential growth in the number of patients suffering from diseases caused by the consumption of sugar has become a threat to mankind's health. Artificial low calorie sweeteners available in the market may have severe side effects. It takes time to figure out the long term side effects and by the time these are established, they are replaced by a new low calorie sweetener. Saccharine has been used for centuries to sweeten foods and beverages without calories or carbohydrate. It was also used on a large scale during the sugar shortage of the two world wars but was abandoned as soon as it was linked with the development of bladder cancer. Naturally occurring sweet and taste modifying proteins (Thaumatin, Curculin, Miraculin, Brazzein, Pentadin, Monellin, Mabinlin present in  plants such as Thaumatococcus daniellii (Marantaceae, Curculigo latifolia (Hypoxidaceae, Synsepalum dulcificum (Sapotaceae, Pentadiplandra brazzeana (Pentadiplandraceae, Dioscoreophyllum cumminsii (Menispermaceae, Capparis masaikai (Capparaceae are being seen as potential replacements for the currently available artificial low calorie sweeteners. Most protein sweetener plants such as S. dulcificum, P. brazzeana, C. masaikai, are shrubs; C. latifolia, T. danielli, are perennial herbs while D. Cumminsii is an annual liana.

  3. Bioactive proteins from pipefishes

    Directory of Open Access Journals (Sweden)

    E. Rethna Priya


    Full Text Available Objective: To screen antimicrobial potence of some pipefish species collected from Tuticorin coastal environment. Methods: Antimicrobial activity of pipefishes in methanol extract was investigated against 10 bacterial and 10 fungal human pathogenic strains. Results: Among the tested strains, in Centriscus scutatus, pipefish showed maximum zone of inhibition against Vibrio cholerae (8 mm and minimum in the sample of Hippichthys cyanospilos against Klebseilla pneumoniae (2 mm. In positive control, maximum zone of inhibition was recorded in Vibrio cholerae (9 mm and minimum in Klebseilla pneumoniae, and Salmonella paratyphi (5 mm. Chemical investigation indicated the presence of peptides as evidenced by ninhydrin positive spots on thin layer chromatography and presence of peptide. In SDS PAGE, in Centriscus scutatus, four bands were detected in the gel that represented the presence of proteins in the range nearly 25.8-75 kDa. In Hippichthys cyanospilos, five bands were detected in the gel that represented the presence of proteins in the range nearly 20.5-78 kDa. The result of FT-IR spectrum revealed that the pipe fishes extracts compriseed to have peptide derivatives as their predominant chemical groups. Conclusions: It can be conclude that this present investigation suggests the tested pipe fishes will be a potential source of natural bioactive compounds.

  4. Bioactive proteins from pipefishes

    Directory of Open Access Journals (Sweden)

    E. Rethna Priya


    Full Text Available Objective: To screen antimicrobial potence of some pipefish species collected from Tuticorin coastal environment. Methods: Antimicrobial activity of pipefishes in methanol extract was investigated against 10 bacterial and 10 fungal human pathogenic strains. Results: Among the tested strains, in Centriscus scutatus, pipefish showed maximum zone of inhibition against Vibrio cholerae (8 mm and minimum in the sample of Hippichthys cyanospilos against Klebseilla pneumoniae (2 mm. In positive control, maximum zone of inhibition was recorded in Vibrio cholerae (9 mm and minimum in Klebseilla pneumoniae, and Salmonella paratyphi (5 mm. Chemical investigation indicated the presence of peptides as evidenced by ninhydrin positive spots on thin layer chromatography and presence of peptide. In SDS PAGE, in Centriscus scutatus, four bands were detected in the gel that represented the presence of proteins in the range nearly 25.8-75 kDa. In Hippichthys cyanospilos, five bands were detected in the gel that represented the presence of proteins in the range nearly 20.5-78 kDa. The result of FT-IR spectrum revealed that the pipe fishes extracts compriseed to have peptide derivatives as their predominant chemical groups. Conclusions: It can be conclude that this present investigation suggests the tested pipe fishes will be a potential source of natural bioactive compounds.

  5. Mitochondrial nucleoid interacting proteins support mitochondrial protein synthesis. (United States)

    He, J; Cooper, H M; Reyes, A; Di Re, M; Sembongi, H; Litwin, T R; Gao, J; Neuman, K C; Fearnley, I M; Spinazzola, A; Walker, J E; Holt, I J


    Mitochondrial ribosomes and translation factors co-purify with mitochondrial nucleoids of human cells, based on affinity protein purification of tagged mitochondrial DNA binding proteins. Among the most frequently identified proteins were ATAD3 and prohibitin, which have been identified previously as nucleoid components, using a variety of methods. Both proteins are demonstrated to be required for mitochondrial protein synthesis in human cultured cells, and the major binding partner of ATAD3 is the mitochondrial ribosome. Altered ATAD3 expression also perturbs mtDNA maintenance and replication. These findings suggest an intimate association between nucleoids and the machinery of protein synthesis in mitochondria. ATAD3 and prohibitin are tightly associated with the mitochondrial membranes and so we propose that they support nucleic acid complexes at the inner membrane of the mitochondrion.

  6. Mapping Protein-Protein Interactions by Quantitative Proteomics

    DEFF Research Database (Denmark)

    Dengjel, Joern; Kratchmarova, Irina; Blagoev, Blagoy


    spectrometry (MS)-based proteomics in combination with affinity purification protocols has become the method of choice to map and track the dynamic changes in protein-protein interactions, including the ones occurring during cellular signaling events. Different quantitative MS strategies have been used...... to characterize protein interaction networks. In this chapter we describe in detail the use of stable isotope labeling by amino acids in cell culture (SILAC) for the quantitative analysis of stimulus-dependent dynamic protein interactions.......Proteins exert their function inside a cell generally in multiprotein complexes. These complexes are highly dynamic structures changing their composition over time and cell state. The same protein may thereby fulfill different functions depending on its binding partners. Quantitative mass...

  7. On the role of electrostatics on protein-protein interactions (United States)

    Zhang, Zhe; Witham, Shawn; Alexov, Emil


    The role of electrostatics on protein-protein interactions and binding is reviewed in this article. A brief outline of the computational modeling, in the framework of continuum electrostatics, is presented and basic electrostatic effects occurring upon the formation of the complex are discussed. The role of the salt concentration and pH of the water phase on protein-protein binding free energy is demonstrated and indicates that the increase of the salt concentration tends to weaken the binding, an observation that is attributed to the optimization of the charge-charge interactions across the interface. It is pointed out that the pH-optimum (pH of optimal binding affinity) varies among the protein-protein complexes, and perhaps is a result of their adaptation to particular subcellular compartment. At the end, the similarities and differences between hetero- and homo-complexes are outlined and discussed with respect to the binding mode and charge complementarity. PMID:21572182

  8. Proteins interacting with cloning scars: a source of false positive protein-protein interactions. (United States)

    Banks, Charles A S; Boanca, Gina; Lee, Zachary T; Florens, Laurence; Washburn, Michael P


    A common approach for exploring the interactome, the network of protein-protein interactions in cells, uses a commercially available ORF library to express affinity tagged bait proteins; these can be expressed in cells and endogenous cellular proteins that copurify with the bait can be identified as putative interacting proteins using mass spectrometry. Control experiments can be used to limit false-positive results, but in many cases, there are still a surprising number of prey proteins that appear to copurify specifically with the bait. Here, we have identified one source of false-positive interactions in such studies. We have found that a combination of: 1) the variable sequence of the C-terminus of the bait with 2) a C-terminal valine "cloning scar" present in a commercially available ORF library, can in some cases create a peptide motif that results in the aberrant co-purification of endogenous cellular proteins. Control experiments may not identify false positives resulting from such artificial motifs, as aberrant binding depends on sequences that vary from one bait to another. It is possible that such cryptic protein binding might occur in other systems using affinity tagged proteins; this study highlights the importance of conducting careful follow-up studies where novel protein-protein interactions are suspected.

  9. Protein complex prediction in large ontology attributed protein-protein interaction networks. (United States)

    Zhang, Yijia; Lin, Hongfei; Yang, Zhihao; Wang, Jian; Li, Yanpeng; Xu, Bo


    Protein complexes are important for unraveling the secrets of cellular organization and function. Many computational approaches have been developed to predict protein complexes in protein-protein interaction (PPI) networks. However, most existing approaches focus mainly on the topological structure of PPI networks, and largely ignore the gene ontology (GO) annotation information. In this paper, we constructed ontology attributed PPI networks with PPI data and GO resource. After constructing ontology attributed networks, we proposed a novel approach called CSO (clustering based on network structure and ontology attribute similarity). Structural information and GO attribute information are complementary in ontology attributed networks. CSO can effectively take advantage of the correlation between frequent GO annotation sets and the dense subgraph for protein complex prediction. Our proposed CSO approach was applied to four different yeast PPI data sets and predicted many well-known protein complexes. The experimental results showed that CSO was valuable in predicting protein complexes and achieved state-of-the-art performance.

  10. Evolutionary reprograming of protein-protein interaction specificity. (United States)

    Akiva, Eyal; Babbitt, Patricia C


    Using mutation libraries and deep sequencing, Aakre et al. study the evolution of protein-protein interactions using a toxin-antitoxin model. The results indicate probable trajectories via "intermediate" proteins that are promiscuous, thus avoiding transitions via non-interactions. These results extend observations about other biological interactions and enzyme evolution, suggesting broadly general principles. Copyright © 2015 Elsevier Inc. All rights reserved.

  11. Information assessment on predicting protein-protein interactions

    Directory of Open Access Journals (Sweden)

    Gerstein Mark


    Full Text Available Abstract Background Identifying protein-protein interactions is fundamental for understanding the molecular machinery of the cell. Proteome-wide studies of protein-protein interactions are of significant value, but the high-throughput experimental technologies suffer from high rates of both false positive and false negative predictions. In addition to high-throughput experimental data, many diverse types of genomic data can help predict protein-protein interactions, such as mRNA expression, localization, essentiality, and functional annotation. Evaluations of the information contributions from different evidences help to establish more parsimonious models with comparable or better prediction accuracy, and to obtain biological insights of the relationships between protein-protein interactions and other genomic information. Results Our assessment is based on the genomic features used in a Bayesian network approach to predict protein-protein interactions genome-wide in yeast. In the special case, when one does not have any missing information about any of the features, our analysis shows that there is a larger information contribution from the functional-classification than from expression correlations or essentiality. We also show that in this case alternative models, such as logistic regression and random forest, may be more effective than Bayesian networks for predicting interactions. Conclusions In the restricted problem posed by the complete-information subset, we identified that the MIPS and Gene Ontology (GO functional similarity datasets as the dominating information contributors for predicting the protein-protein interactions under the framework proposed by Jansen et al. Random forests based on the MIPS and GO information alone can give highly accurate classifications. In this particular subset of complete information, adding other genomic data does little for improving predictions. We also found that the data discretizations used in the

  12. Protein Adaptations in Archaeal Extremophiles (United States)

    Reed, Christopher J.; Lewis, Hunter; Trejo, Eric; Winston, Vern; Evilia, Caryn


    Extremophiles, especially those in Archaea, have a myriad of adaptations that keep their cellular proteins stable and active under the extreme conditions in which they live. Rather than having one basic set of adaptations that works for all environments, Archaea have evolved separate protein features that are customized for each environment. We categorized the Archaea into three general groups to describe what is known about their protein adaptations: thermophilic, psychrophilic, and halophilic. Thermophilic proteins tend to have a prominent hydrophobic core and increased electrostatic interactions to maintain activity at high temperatures. Psychrophilic proteins have a reduced hydrophobic core and a less charged protein surface to maintain flexibility and activity under cold temperatures. Halophilic proteins are characterized by increased negative surface charge due to increased acidic amino acid content and peptide insertions, which compensates for the extreme ionic conditions. While acidophiles, alkaliphiles, and piezophiles are their own class of Archaea, their protein adaptations toward pH and pressure are less discernible. By understanding the protein adaptations used by archaeal extremophiles, we hope to be able to engineer and utilize proteins for industrial, environmental, and biotechnological applications where function in extreme conditions is required for activity. PMID:24151449

  13. Protein Adaptations in Archaeal Extremophiles

    Directory of Open Access Journals (Sweden)

    Christopher J. Reed


    Full Text Available Extremophiles, especially those in Archaea, have a myriad of adaptations that keep their cellular proteins stable and active under the extreme conditions in which they live. Rather than having one basic set of adaptations that works for all environments, Archaea have evolved separate protein features that are customized for each environment. We categorized the Archaea into three general groups to describe what is known about their protein adaptations: thermophilic, psychrophilic, and halophilic. Thermophilic proteins tend to have a prominent hydrophobic core and increased electrostatic interactions to maintain activity at high temperatures. Psychrophilic proteins have a reduced hydrophobic core and a less charged protein surface to maintain flexibility and activity under cold temperatures. Halophilic proteins are characterized by increased negative surface charge due to increased acidic amino acid content and peptide insertions, which compensates for the extreme ionic conditions. While acidophiles, alkaliphiles, and piezophiles are their own class of Archaea, their protein adaptations toward pH and pressure are less discernible. By understanding the protein adaptations used by archaeal extremophiles, we hope to be able to engineer and utilize proteins for industrial, environmental, and biotechnological applications where function in extreme conditions is required for activity.

  14. Viral Organization of Human Proteins (United States)

    Wuchty, Stefan; Siwo, Geoffrey; Ferdig, Michael T.


    Although maps of intracellular interactions are increasingly well characterized, little is known about large-scale maps of host-pathogen protein interactions. The investigation of host-pathogen interactions can reveal features of pathogenesis and provide a foundation for the development of drugs and disease prevention strategies. A compilation of experimentally verified interactions between HIV-1 and human proteins and a set of HIV-dependency factors (HDF) allowed insights into the topology and intricate interplay between viral and host proteins on a large scale. We found that targeted and HDF proteins appear predominantly in rich-clubs, groups of human proteins that are strongly intertwined among each other. These assemblies of proteins may serve as an infection gateway, allowing the virus to take control of the human host by reaching protein pathways and diversified cellular functions in a pronounced and focused way. Particular transcription factors and protein kinases facilitate indirect interactions between HDFs and viral proteins. Discerning the entanglement of directly targeted and indirectly interacting proteins may uncover molecular and functional sites that can provide novel perspectives on the progression of HIV infection and highlight new avenues to fight this virus. PMID:20827298

  15. Proteins aggregation and human diseases (United States)

    Hu, Chin-Kun


    Many human diseases and the death of most supercentenarians are related to protein aggregation. Neurodegenerative diseases include Alzheimer's disease (AD), Huntington's disease (HD), Parkinson's disease (PD), frontotemporallobar degeneration, etc. Such diseases are due to progressive loss of structure or function of neurons caused by protein aggregation. For example, AD is considered to be related to aggregation of Aβ40 (peptide with 40 amino acids) and Aβ42 (peptide with 42 amino acids) and HD is considered to be related to aggregation of polyQ (polyglutamine) peptides. In this paper, we briefly review our recent discovery of key factors for protein aggregation. We used a lattice model to study the aggregation rates of proteins and found that the probability for a protein sequence to appear in the conformation of the aggregated state can be used to determine the temperature at which proteins can aggregate most quickly. We used molecular dynamics and simple models of polymer chains to study relaxation and aggregation of proteins under various conditions and found that when the bending-angle dependent and torsion-angle dependent interactions are zero or very small, then protein chains tend to aggregate at lower temperatures. All atom models were used to identify a key peptide chain for the aggregation of insulin chains and to find that two polyQ chains prefer anti-parallel conformation. It is pointed out that in many cases, protein aggregation does not result from protein mis-folding. A potential drug from Chinese medicine was found for Alzheimer's disease.

  16. Proteins of bacteriophage phi6

    International Nuclear Information System (INIS)

    Sinclair, J.F.; Tzagoloff, A.; Levine, D.; Mindich, L.


    We investigated the protein composition of the lipid-containing bacteriophage phi 6. We also studied the synthesis of phage-specific proteins in the host bacterium Pseudomonas phaseolicola HB10Y. The virion was found to contain 10 proteins of the following molecular weights: P1, 93,000; P2, 88,000; P3, 84,000; P4, 36,800; P5, 24,000; P6, 21,000; P7, 19,900; P8, 10,500; P9, 8,700; and P10, less than 6,000. Proteins P3, P9, and P10 were completely extracted from the virion with 1 percent Triton X-100. Protein P6 was partially extracted. Proteins P8 and P9 were purified by column chromatography. The amino acid composition of P9 was determined and was found to lack methionine. Labeling of viral proteins with [ 35 S]methionine in infected cells indicated that proteins P5, P9, P10, and P11 lacked methionine. Treatment of host cells with uv light before infection allowed the synthesis of P1, P2, P4, and P7; however, the extent of viral protein synthesis fell off exponentially with increasing delay time between irradiation and infection. Treatment of host cells with rifampin during infection allowed preferential synthesis of viral proteins, but the extent of synthesis also fell off exponentially with increasing delay time between the addition of rifampin and the addition of radioactive amino acids. All of the virion proteins were seen in gels prepared from rifampin-treated infected cells. In addition, two proteins, P11 and P12, were observed; their molecular weights were 25,200 and 20,100, respectively. Proteins P1, P2, P4, and P7 were synthesized early, whereas the rest began to increase at 45 min post-infection

  17. Protein (Cyanobacteria): 500464022 [PGDBj - Ortholog DB

    Lifescience Database Archive (English)


  18. Protein (Cyanobacteria): 504930526 [PGDBj - Ortholog DB

    Lifescience Database Archive (English)


  19. Protein (Viridiplantae): 159470305 [PGDBj - Ortholog DB

    Lifescience Database Archive (English)


  20. Protein (Cyanobacteria): 516317055 [PGDBj - Ortholog DB

    Lifescience Database Archive (English)


  1. Protein (Cyanobacteria): 497073171 [PGDBj - Ortholog DB

    Lifescience Database Archive (English)


  2. Protein (Cyanobacteria): 518320325 [PGDBj - Ortholog DB

    Lifescience Database Archive (English)


  3. Protein (Cyanobacteria): 447729 [PGDBj - Ortholog DB

    Lifescience Database Archive (English)


  4. Protein (Cyanobacteria): 515516403 [PGDBj - Ortholog DB

    Lifescience Database Archive (English)


  5. Protein (Viridiplantae): 308803454 [PGDBj - Ortholog DB

    Lifescience Database Archive (English)


  6. Protein (Cyanobacteria): 493685768 [PGDBj - Ortholog DB

    Lifescience Database Archive (English)


  7. Protein supplementation with sports protein bars in renal patients. (United States)

    Meade, Anthony


    Malnutrition prevalence in patients on dialysis is well established. The protein requirements for both hemodialysis and peritoneal dialysis have been documented elsewhere, including the Kidney Disease Outcomes Quality Initiative Clinical Practice Guidelines for Nutrition in Chronic Renal Failure. The clinical challenge is to assist patients in meeting these targets, especially in those with anorexia. Traditional supplements have included fluid, which is an issue for patients who are fluid restricted. The study objectives were to (1) investigate the range of sports protein supplements that may be suitable for patients on hemodialysis to use and (2) trial nonfluid protein supplements in patients on hemodialysis. Known manufacturers of sports protein bars and other sports supplements available in Australia were contacted for the nutrient breakdown of high-protein products, specifically potassium, protein, and phosphorus contents. As a result, selected high-protein sports bars (Protein FX, Aussie Bodies, Port Melbourne, Victoria, Australia) were used as an alternative to the more commonly used renal-specific fluid supplements (Nepro, Abbott Laboratories, Abbott Park, IL; Novasource Renal, Novartis Nutrition Corporation, Fremont, MI; and Renilon, Nutricia, Wiltshire, UK) in patients with poor nutritional status requiring supplementation. Patient satisfaction and clinical nutrition markers were investigated. The study took place at inpatient, in-center, and satellite hemodialysis settings in Adelaide, South Australia. A total of 32 patients (16 females and 16 males) with an average age of 62.9 years (range 32-86 years) undergoing hemodialysis (acute and maintenance) were included. Subjects were selected by the author as part of routine clinical nutrition care. Patients trialed sports protein bars as a protein supplement alone or in conjunction with other supplementary products. All patients were in favor of the trial, with 22 of 32 patients continuing with the protein

  8. Modular protein switches derived from antibody mimetic proteins. (United States)

    Nicholes, N; Date, A; Beaujean, P; Hauk, P; Kanwar, M; Ostermeier, M


    Protein switches have potential applications as biosensors and selective protein therapeutics. Protein switches built by fusion of proteins with the prerequisite input and output functions are currently developed using an ad hoc process. A modular switch platform in which existing switches could be readily adapted to respond to any ligand would be advantageous. We investigated the feasibility of a modular protein switch platform based on fusions of the enzyme TEM-1 β-lactamase (BLA) with two different antibody mimetic proteins: designed ankyrin repeat proteins (DARPins) and monobodies. We created libraries of random insertions of the gene encoding BLA into genes encoding a DARPin or a monobody designed to bind maltose-binding protein (MBP). From these libraries, we used a genetic selection system for β-lactamase activity to identify genes that conferred MBP-dependent ampicillin resistance to Escherichia coli. Some of these selected genes encoded switch proteins whose enzymatic activity increased up to 14-fold in the presence of MBP. We next introduced mutations into the antibody mimetic domain of these switches that were known to cause binding to different ligands. To different degrees, introduction of the mutations resulted in switches with the desired specificity, illustrating the potential modularity of these platforms. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail:

  9. Protein degradation and protection against misfolded or damaged proteins (United States)

    Goldberg, Alfred L.


    The ultimate mechanism that cells use to ensure the quality of intracellular proteins is the selective destruction of misfolded or damaged polypeptides. In eukaryotic cells, the large ATP-dependent proteolytic machine, the 26S proteasome, prevents the accumulation of non-functional, potentially toxic proteins. This process is of particular importance in protecting cells against harsh conditions (for example, heat shock or oxidative stress) and in a variety of diseases (for example, cystic fibrosis and the major neurodegenerative diseases). A full understanding of the pathogenesis of the protein-folding diseases will require greater knowledge of how misfolded proteins are recognized and selectively degraded.

  10. Water-Protein Interactions: The Secret of Protein Dynamics

    Directory of Open Access Journals (Sweden)

    Silvia Martini


    Full Text Available Water-protein interactions help to maintain flexible conformation conditions which are required for multifunctional protein recognition processes. The intimate relationship between the protein surface and hydration water can be analyzed by studying experimental water properties measured in protein systems in solution. In particular, proteins in solution modify the structure and the dynamics of the bulk water at the solute-solvent interface. The ordering effects of proteins on hydration water are extended for several angstroms. In this paper we propose a method for analyzing the dynamical properties of the water molecules present in the hydration shells of proteins. The approach is based on the analysis of the effects of protein-solvent interactions on water protons NMR relaxation parameters. NMR relaxation parameters, especially the nonselective (R1NS and selective (R1SE spin-lattice relaxation rates of water protons, are useful for investigating the solvent dynamics at the macromolecule-solvent interfaces as well as the perturbation effects caused by the water-macromolecule interactions on the solvent dynamical properties. In this paper we demonstrate that Nuclear Magnetic Resonance Spectroscopy can be used to determine the dynamical contributions of proteins to the water molecules belonging to their hydration shells.

  11. Mapping monomeric threading to protein-protein structure prediction. (United States)

    Guerler, Aysam; Govindarajoo, Brandon; Zhang, Yang


    The key step of template-based protein-protein structure prediction is the recognition of complexes from experimental structure libraries that have similar quaternary fold. Maintaining two monomer and dimer structure libraries is however laborious, and inappropriate library construction can degrade template recognition coverage. We propose a novel strategy SPRING to identify complexes by mapping monomeric threading alignments to protein-protein interactions based on the original oligomer entries in the PDB, which does not rely on library construction and increases the efficiency and quality of complex template recognitions. SPRING is tested on 1838 nonhomologous protein complexes which can recognize correct quaternary template structures with a TM score >0.5 in 1115 cases after excluding homologous proteins. The average TM score of the first model is 60% and 17% higher than that by HHsearch and COTH, respectively, while the number of targets with an interface RMSD benchmark proteins. Although the relative performance of SPRING and ZDOCK depends on the level of homology filters, a combination of the two methods can result in a significantly higher model quality than ZDOCK at all homology thresholds. These data demonstrate a new efficient approach to quaternary structure recognition that is ready to use for genome-scale modeling of protein-protein interactions due to the high speed and accuracy.

  12. Protein Crystal Growth (United States)


    In order to rapidly and efficiently grow crystals, tools were needed to automatically identify and analyze the growing process of protein crystals. To meet this need, Diversified Scientific, Inc. (DSI), with the support of a Small Business Innovation Research (SBIR) contract from NASA s Marshall Space Flight Center, developed CrystalScore(trademark), the first automated image acquisition, analysis, and archiving system designed specifically for the macromolecular crystal growing community. It offers automated hardware control, image and data archiving, image processing, a searchable database, and surface plotting of experimental data. CrystalScore is currently being used by numerous pharmaceutical companies and academic and nonprofit research centers. DSI, located in Birmingham, Alabama, was awarded the patent Method for acquiring, storing, and analyzing crystal images on March 4, 2003. Another DSI product made possible by Marshall SBIR funding is VaporPro(trademark), a unique, comprehensive system that allows for the automated control of vapor diffusion for crystallization experiments.

  13. Protein- mediated enamel mineralization (United States)

    Moradian-Oldak, Janet


    Enamel is a hard nanocomposite bioceramic with significant resilience that protects the mammalian tooth from external physical and chemical damages. The remarkable mechanical properties of enamel are associated with its hierarchical structural organization and its thorough connection with underlying dentin. This dynamic mineralizing system offers scientists a wealth of information that allows the study of basic principals of organic matrix-mediated biomineralization and can potentially be utilized in the fields of material science and engineering for development and design of biomimetic materials. This chapter will provide a brief overview of enamel hierarchical structure and properties as well as the process and stages of amelogenesis. Particular emphasis is given to current knowledge of extracellular matrix protein and proteinases, and the structural chemistry of the matrix components and their putative functions. The chapter will conclude by discussing the potential of enamel for regrowth. PMID:22652761

  14. Drosophila Protein interaction Map (DPiM)


    Guruharsha, K.G.; Obar, Robert A.; Mintseris, Julian; Aishwarya, K.; Krishnan, R.T.; VijayRaghavan, K.; Artavanis-Tsakonas, Spyros


    Proteins perform essential cellular functions as part of protein complexes, often in conjunction with RNA, DNA, metabolites and other small molecules. The genome encodes thousands of proteins but not all of them are expressed in every cell type; and expressed proteins are not active at all times. Such diversity of protein expression and function accounts for the level of biological intricacy seen in nature. Defining protein-protein interactions in protein complexes, and establishing the when,...

  15. Nanofibers made of globular proteins. (United States)

    Dror, Yael; Ziv, Tamar; Makarov, Vadim; Wolf, Hila; Admon, Arie; Zussman, Eyal


    Strong nanofibers composed entirely of a model globular protein, namely, bovine serum albumin (BSA), were produced by electrospinning directly from a BSA solution without the use of chemical cross-linkers. Control of the spinnability and the mechanical properties of the produced nanofibers was achieved by manipulating the protein conformation, protein aggregation, and intra/intermolecular disulfide bonds exchange. In this manner, a low-viscosity globular protein solution could be modified into a polymer-like spinnable solution and easily spun into fibers whose mechanical properties were as good as those of natural fibers made of fibrous protein. We demonstrate here that newly formed disulfide bonds (intra/intermolecular) have a dominant role in both the formation of the nanofibers and in providing them with superior mechanical properties. Our approach to engineer proteins into biocompatible fibrous structures may be used in a wide range of biomedical applications such as suturing, wound dressing, and wound closure.

  16. Validation of protein carbonyl measurement

    DEFF Research Database (Denmark)

    Augustyniak, Edyta; Adam, Aisha; Wojdyla, Katarzyna


    Protein carbonyls are widely analysed as a measure of protein oxidation. Several different methods exist for their determination. A previous study had described orders of magnitude variance that existed when protein carbonyls were analysed in a single laboratory by ELISA using different commercial...... protein carbonyl analysis across Europe. ELISA and Western blotting techniques detected an increase in protein carbonyl formation between 0 and 5min of UV irradiation irrespective of method used. After irradiation for 15min, less oxidation was detected by half of the laboratories than after 5min...... irradiation. Three of the four ELISA carbonyl results fell within 95% confidence intervals. Likely errors in calculating absolute carbonyl values may be attributed to differences in standardisation. Out of up to 88 proteins identified as containing carbonyl groups after tryptic cleavage of irradiated...

  17. Maintaining protein composition in cilia. (United States)

    Stephen, Louise A; Elmaghloob, Yasmin; Ismail, Shehab


    The primary cilium is a sensory organelle that is vital in regulating several signalling pathways. Unlike most organelles cilia are open to the rest of the cell, not enclosed by membranes. The distinct protein composition is crucial to the function of cilia and many signalling proteins and receptors are specifically concentrated within distinct compartments. To maintain this composition, a mechanism is required to deliver proteins to the cilium whilst another must counter the entropic tendency of proteins to distribute throughout the cell. The combination of the two mechanisms should result in the concentration of ciliary proteins to the cilium. In this review we will look at different cellular mechanisms that play a role in maintaining the distinct composition of cilia, including regulation of ciliary access and trafficking of ciliary proteins to, from and within the cilium.

  18. Preparation of GST Fusion Proteins. (United States)

    Einarson, Margret B; Pugacheva, Elena N; Orlinick, Jason R


    INTRODUCTIONThis protocol describes the preparation of glutathione-S-transferase (GST) fusion proteins, which have had a wide range of applications since their introduction as tools for synthesis of recombinant proteins in bacteria. GST was originally selected as a fusion moiety because of several desirable properties. First and foremost, when expressed in bacteria alone, or as a fusion, GST is not sequestered in inclusion bodies (in contrast to previous fusion protein systems). Second, GST can be affinity-purified without denaturation because it binds to immobilized glutathione, which provides the basis for simple purification. Consequently, GST fusion proteins are routinely used for antibody generation and purification, protein-protein interaction studies, and biochemical analysis.

  19. The clinical expression of hereditary protein C and protein S deficiency: : a relation to clinical thrombotic risk-factors and to levels of protein C and protein S

    NARCIS (Netherlands)

    Henkens, C. M. A.; van der Meer, J.; Hillege, J. L.; Bom, V. J. J.; Halie, M. R.; van der Schaaf, W.

    We investigated 103 first-degree relatives of 13 unrelated protein C or protein S deficient patients to assess the role of additional thrombotic risk factors and of protein C and protein S levels in the clinical expression of hereditary protein C and protein S deficiency. Fifty-seven relatives were

  20. Multiple protonation equilibria in electrostatics of protein-protein binding. (United States)

    Piłat, Zofia; Antosiewicz, Jan M


    All proteins contain groups capable of exchanging protons with their environment. We present here an approach, based on a rigorous thermodynamic cycle and the partition functions for energy levels characterizing protonation states of the associating proteins and their complex, to compute the electrostatic pH-dependent contribution to the free energy of protein-protein binding. The computed electrostatic binding free energies include the pH of the solution as the variable of state, mutual "polarization" of associating proteins reflected as changes in the distribution of their protonation states upon binding and fluctuations between available protonation states. The only fixed property of both proteins is the conformation; the structure of the monomers is kept in the same conformation as they have in the complex structure. As a reference, we use the electrostatic binding free energies obtained from the traditional Poisson-Boltzmann model, computed for a single macromolecular conformation fixed in a given protonation state, appropriate for given solution conditions. The new approach was tested for 12 protein-protein complexes. It is shown that explicit inclusion of protonation degrees of freedom might lead to a substantially different estimation of the electrostatic contribution to the binding free energy than that based on the traditional Poisson-Boltzmann model. This has important implications for the balancing of different contributions to the energetics of protein-protein binding and other related problems, for example, the choice of protein models for Brownian dynamics simulations of their association. Our procedure can be generalized to include conformational degrees of freedom by combining it with molecular dynamics simulations at constant pH. Unfortunately, in practice, a prohibitive factor is an enormous requirement for computer time and power. However, there may be some hope for solving this problem by combining existing constant pH molecular dynamics

  1. Protein function prediction using neighbor relativity in protein-protein interaction network. (United States)

    Moosavi, Sobhan; Rahgozar, Masoud; Rahimi, Amir


    There is a large gap between the number of discovered proteins and the number of functionally annotated ones. Due to the high cost of determining protein function by wet-lab research, function prediction has become a major task for computational biology and bioinformatics. Some researches utilize the proteins interaction information to predict function for un-annotated proteins. In this paper, we propose a novel approach called "Neighbor Relativity Coefficient" (NRC) based on interaction network topology which estimates the functional similarity between two proteins. NRC is calculated for each pair of proteins based on their graph-based features including distance, common neighbors and the number of paths between them. In order to ascribe function to an un-annotated protein, NRC estimates a weight for each neighbor to transfer its annotation to the unknown protein. Finally, the unknown protein will be annotated by the top score transferred functions. We also investigate the effect of using different coefficients for various types of functions. The proposed method has been evaluated on Saccharomyces cerevisiae and Homo sapiens interaction networks. The performance analysis demonstrates that NRC yields better results in comparison with previous protein function prediction approaches that utilize interaction network. Copyright © 2012 Elsevier Ltd. All rights reserved.

  2. Myristoylated proteins and peptidyl myristoyltransferase

    International Nuclear Information System (INIS)

    Marchildon, G.A.


    The distribution and intracellular locations of myristoylated proteins have been examined in cultured cells. Incubating a variety of cells in minimal medium containing / 3 H/ myristate led to the incorporation of labeled myristate into as many as twenty-five different intracellular proteins. The incorporation increased linearly with time for up to six hours and then increased more slowly for an additional ten hours. The chemical stability indicated that the attachment was covalent and excluded nucleophile-labile bonds such as thioesters. Fluorographs of proteins modified by / 3 H/ myristate and resolved on gradient SDS-PAGE showed patterns that differed from cell type to cell type. To examine the intracellular locations of the myristate-labeled proteins, cells were isotonically subfractionated. Most of the myristate-labeled proteins remained in the high speed supernatant devoid of microsomal membranes. This indicated that the myristate modification in itself is not sufficient to serve as an anchor for membrane association. Myristate labeled catalytic subunit of the cyclic AMP dependent protein kinase was specifically immunoprecipitated from an aliquot of the high speed supernatant proteins. However, the prominent tyrosine protein kinase of the murine lymphoma cell line LSTRA, pp56/sup lstra/, also incorporated myristate and was specifically immunoprecipitated from the high speed pellet (particulate) fraction of labeled LSTRA cells. To begin to understand the biochemical mechanism of myristate attachment to protein. The authors partially purified and characterized the peptidyl myristoyltransferase from monkey liver. Recovery of enzymatic activity was 69%

  3. Computational protein design: a review

    International Nuclear Information System (INIS)

    Coluzza, Ivan


    Proteins are one of the most versatile modular assembling systems in nature. Experimentally, more than 110 000 protein structures have been identified and more are deposited every day in the Protein Data Bank. Such an enormous structural variety is to a first approximation controlled by the sequence of amino acids along the peptide chain of each protein. Understanding how the structural and functional properties of the target can be encoded in this sequence is the main objective of protein design. Unfortunately, rational protein design remains one of the major challenges across the disciplines of biology, physics and chemistry. The implications of solving this problem are enormous and branch into materials science, drug design, evolution and even cryptography. For instance, in the field of drug design an effective computational method to design protein-based ligands for biological targets such as viruses, bacteria or tumour cells, could give a significant boost to the development of new therapies with reduced side effects. In materials science, self-assembly is a highly desired property and soon artificial proteins could represent a new class of designable self-assembling materials. The scope of this review is to describe the state of the art in computational protein design methods and give the reader an outline of what developments could be expected in the near future. (topical review)

  4. Protein intrinsic disorder in plants. (United States)

    Pazos, Florencio; Pietrosemoli, Natalia; García-Martín, Juan A; Solano, Roberto


    To some extent contradicting the classical paradigm of the relationship between protein 3D structure and function, now it is clear that large portions of the proteomes, especially in higher organisms, lack a fixed structure and still perform very important functions. Proteins completely or partially unstructured in their native (functional) form are involved in key cellular processes underlain by complex networks of protein interactions. The intrinsic conformational flexibility of these disordered proteins allows them to bind multiple partners in transient interactions of high specificity and low affinity. In concordance, in plants this type of proteins has been found in processes requiring these complex and versatile interaction networks. These include transcription factor networks, where disordered proteins act as integrators of different signals or link different transcription factor subnetworks due to their ability to interact (in many cases simultaneously) with different partners. Similarly, they also serve as signal integrators in signaling cascades, such as those related to response to external stimuli. Disordered proteins have also been found in plants in many stress-response processes, acting as protein chaperones or protecting other cellular components and structures. In plants, it is especially important to have complex and versatile networks able to quickly and efficiently respond to changing environmental conditions since these organisms cannot escape and have no other choice than adapting to them. Consequently, protein disorder can play an especially important role in plants, providing them with a fast mechanism to obtain complex, interconnected and versatile molecular networks.

  5. Fluorine-18 labeling of proteins

    International Nuclear Information System (INIS)

    Kilbourn, M.R.; Dence, C.S.; Welch, M.J.; Mathias, C.J.


    Two fluorine-18-labeled reagents, methyl 3-[ 18 F]fluoro-5-nitrobenzimidate and 4-[ 18 F]fluorophenacyl bromide, have been prepared for covalent attachment of fluorine-18 to proteins. Both reagents can be prepared in moderate yields (30-50%, EOB) in synthesis times of 50-70 min. Reaction of these reagents with proteins (human serum albumin, human fibrinogen, and human immunoglobulin A) is pH independent, protein concentration dependent, and takes 5-60 min at mild pH (8.0) and temperature (25-37 degrees C), in yields up to 95% (corrected). The 18 F-labeled proteins are purified by size exclusion chromatography

  6. Protein intrinsic disorder in plants

    Directory of Open Access Journals (Sweden)

    Florencio ePazos


    Full Text Available To some extent contradicting the classical paradigm of the relationship between protein 3D structure and function, now it is clear that large portions of the proteomes, especially in higher organisms, lack a fixed structure and still perform very important functions. Proteins completely or partially unstructured in their native (functional form are involved in key cellular processes underlain by complex networks of protein interactions. The intrinsic conformational flexibility of these disordered proteins allows them to bind multiple partners in transient interactions of high specificity and low affinity. In concordance, in plants this type of proteins has been found in processes requiring these complex and versatile interaction networks. These include transcription factor networks, where disordered proteins act as integrators of different signals or link different transcription factor subnetworks due to their ability to interact (in many cases simultaneously with different partners. Similarly, they also serve as signal integrators in signalling cascades, such as those related to response to external stimuli. Disordered proteins have also been found in plants in many stress-response processes, acting as protein chaperones or protecting other cellular components and structures. In plants, it is especially important to have complex and versatile networks able to quickly and efficiently respond to changing environmental conditions since these organisms can not escape and have no other choice than adapting to them. Consequently, protein disorder can play an especially important role in plants, providing them with a fast mechanism to obtain complex, interconnected and versatile molecular networks.

  7. High throughput protein production screening (United States)

    Beernink, Peter T [Walnut Creek, CA; Coleman, Matthew A [Oakland, CA; Segelke, Brent W [San Ramon, CA


    Methods, compositions, and kits for the cell-free production and analysis of proteins are provided. The invention allows for the production of proteins from prokaryotic sequences or eukaryotic sequences, including human cDNAs using PCR and IVT methods and detecting the proteins through fluorescence or immunoblot techniques. This invention can be used to identify optimized PCR and WT conditions, codon usages and mutations. The methods are readily automated and can be used for high throughput analysis of protein expression levels, interactions, and functional states.

  8. Protein stability: a crystallographer’s perspective

    International Nuclear Information System (INIS)

    Deller, Marc C.; Kong, Leopold; Rupp, Bernhard


    An understanding of protein stability is essential for optimizing the expression, purification and crystallization of proteins. In this review, discussion will focus on factors affecting protein stability on a somewhat practical level, particularly from the view of a protein crystallographer. Protein stability is a topic of major interest for the biotechnology, pharmaceutical and food industries, in addition to being a daily consideration for academic researchers studying proteins. An understanding of protein stability is essential for optimizing the expression, purification, formulation, storage and structural studies of proteins. In this review, discussion will focus on factors affecting protein stability, on a somewhat practical level, particularly from the view of a protein crystallographer. The differences between protein conformational stability and protein compositional stability will be discussed, along with a brief introduction to key methods useful for analyzing protein stability. Finally, tactics for addressing protein-stability issues during protein expression, purification and crystallization will be discussed

  9. Protein stability: a crystallographer’s perspective

    Energy Technology Data Exchange (ETDEWEB)

    Deller, Marc C., E-mail: [Stanford University, Shriram Center, 443 Via Ortega, Room 097, MC5082, Stanford, CA 94305-4125 (United States); Kong, Leopold [National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK), National Institutes of Health (NIH), Building 8, Room 1A03, 8 Center Drive, Bethesda, MD 20814 (United States); Rupp, Bernhard [k.-k. Hofkristallamt, 91 Audrey Place, Vista, CA 92084 (United States); Medical University of Innsbruck, Schöpfstrasse 41, A-6020 Innsbruck (Austria)


    An understanding of protein stability is essential for optimizing the expression, purification and crystallization of proteins. In this review, discussion will focus on factors affecting protein stability on a somewhat practical level, particularly from the view of a protein crystallographer. Protein stability is a topic of major interest for the biotechnology, pharmaceutical and food industries, in addition to being a daily consideration for academic researchers studying proteins. An understanding of protein stability is essential for optimizing the expression, purification, formulation, storage and structural studies of proteins. In this review, discussion will focus on factors affecting protein stability, on a somewhat practical level, particularly from the view of a protein crystallographer. The differences between protein conformational stability and protein compositional stability will be discussed, along with a brief introduction to key methods useful for analyzing protein stability. Finally, tactics for addressing protein-stability issues during protein expression, purification and crystallization will be discussed.

  10. Protein linguistics - a grammar for modular protein assembly? (United States)

    Gimona, Mario


    The correspondence between biology and linguistics at the level of sequence and lexical inventories, and of structure and syntax, has fuelled attempts to describe genome structure by the rules of formal linguistics. But how can we define protein linguistic rules? And how could compositional semantics improve our understanding of protein organization and functional plasticity?

  11. Protein-Protein Interactions (PPI) reagents: | Office of Cancer Genomics (United States)

    The CTD2 Center at Emory University has a library of genes used to study protein-protein interactions in mammalian cells. These genes are cloned in different mammalian expression vectors. A list of available cancer-associated genes can be accessed below.

  12. Protein-Protein Interaction Reagents | Office of Cancer Genomics (United States)

    The CTD2 Center at Emory University has a library of genes used to study protein-protein interactions in mammalian cells. These genes are cloned in different mammalian expression vectors. A list of available cancer-associated genes can be accessed below. Emory_CTD^2_PPI_Reagents.xlsx Contact: Haian Fu

  13. Human Serum Protein-Bound iodine and Protein Fractions at ...

    African Journals Online (AJOL)

    Iodine profile of Nigerians at different ages in both sexes and in pregnant women, and under narcotic influence, such as alcoholism, cigarette smoking and marijuana addiction were studied. Their serum total protein, albumin and globulin concentrations were also determined. Results of the study showed that serum protein ...

  14. Implications of protein polymorphism on protein phase behaviour

    NARCIS (Netherlands)

    Stegen, J.; Schoot, van der P.P.A.M.


    The phase behaviour of small globular proteins is often modeled by approximating them as spherical particles with fixed internal structure. However, changes in the local environment of a protein can lead to changes in its conformation rendering this approximation invalid. We present a simple

  15. Protein scissors: Photocleavage of proteins at specific locations

    Indian Academy of Sciences (India)


    Binding of ligands to globular proteins at hydrophobic cavities while making specific ... ched to a PTI model A1010 monochromator. UV cut-off filter ..... >1:1 stoichiometry (protein to ligand), the binding equilibrium favors the thermo- dynamically ...

  16. Dark proteins disturb multichromophore coupling in tetrameric fluorescent proteins

    NARCIS (Netherlands)

    Blum, Christian; Meixner, Alfred J.; Subramaniam, Vinod


    DsRed is representative of the tetrameric reef coral fluorescent proteins that constitute particularly interesting coupled multichromophoric systems. Either a green emitting or a red emitting chromophore can form within each of the monomers of the protein tetramer. Within the tetramers the

  17. Inactivation of Tor proteins affects the dynamics of endocytic proteins ...

    Indian Academy of Sciences (India)

    Tor2 is an activator of the Rom2/Rho1 pathway that regulates -factor internalization. Since the recruitment of endocytic proteins such as actin-binding proteins and the amphiphysins precedes the internalization of -factor, we hypothesized that loss of Tor function leads to an alteration in the dynamics of the endocytic ...

  18. Modularity in protein structures: study on all-alpha proteins. (United States)

    Khan, Taushif; Ghosh, Indira


    Modularity is known as one of the most important features of protein's robust and efficient design. The architecture and topology of proteins play a vital role by providing necessary robust scaffolds to support organism's growth and survival in constant evolutionary pressure. These complex biomolecules can be represented by several layers of modular architecture, but it is pivotal to understand and explore the smallest biologically relevant structural component. In the present study, we have developed a component-based method, using protein's secondary structures and their arrangements (i.e. patterns) in order to investigate its structural space. Our result on all-alpha protein shows that the known structural space is highly populated with limited set of structural patterns. We have also noticed that these frequently observed structural patterns are present as modules or "building blocks" in large proteins (i.e. higher secondary structure content). From structural descriptor analysis, observed patterns are found to be within similar deviation; however, frequent patterns are found to be distinctly occurring in diverse functions e.g. in enzymatic classes and reactions. In this study, we are introducing a simple approach to explore protein structural space using combinatorial- and graph-based geometry methods, which can be used to describe modularity in protein structures. Moreover, analysis indicates that protein function seems to be the driving force that shapes the known structure space.

  19. Allergenicity assessment strategy for novel food proteins and protein sources

    NARCIS (Netherlands)

    Verhoeckx, Kitty; Broekman, Henrike; Knulst, André; Houben, Geert

    To solve the future food insecurity problem, alternative and sustainable protein sources (e.g. insects, rapeseed, fava bean and algae) are now being explored for the production of food and feed. To approve these novel protein sources for future food a comprehensive risk assessment is needed

  20. Imaging protein-protein interactions in living cells

    NARCIS (Netherlands)

    Hink, M.A.; Bisseling, T.; Visser, A.J.W.G.


    The complex organization of plant cells makes it likely that the molecular behaviour of proteins in the test tube and the cell is different. For this reason, it is essential though a challenge to study proteins in their natural environment. Several innovative microspectroscopic approaches provide

  1. Composition of Overlapping Protein-Protein and Protein-Ligand Interfaces.

    Directory of Open Access Journals (Sweden)

    Ruzianisra Mohamed

    Full Text Available Protein-protein interactions (PPIs play a major role in many biological processes and they represent an important class of targets for therapeutic intervention. However, targeting PPIs is challenging because often no convenient natural substrates are available as starting point for small-molecule design. Here, we explored the characteristics of protein interfaces in five non-redundant datasets of 174 protein-protein (PP complexes, and 161 protein-ligand (PL complexes from the ABC database, 436 PP complexes, and 196 PL complexes from the PIBASE database and a dataset of 89 PL complexes from the Timbal database. In all cases, the small molecule ligands must bind at the respective PP interface. We observed similar amino acid frequencies in all three datasets. Remarkably, also the characteristics of PP contacts and overlapping PL contacts are highly similar.

  2. Detecting protein-protein interactions in living cells

    DEFF Research Database (Denmark)

    Gottschalk, Marie; Bach, Anders; Hansen, Jakob Lerche


    to the endogenous C-terminal peptide of the NMDA receptor, as evaluated by a cell-free protein-protein interaction assay. However, it is important to address both membrane permeability and effect in living cells. Therefore a bioluminescence resonance energy transfer (BRET) assay was established, where the C......-terminal of the NMDA receptor and PDZ2 of PSD-95 were fused to green fluorescent protein (GFP) and Renilla luciferase (Rluc) and expressed in COS7 cells. A robust and specific BRET signal was obtained by expression of the appropriate partner proteins and subsequently, the assay was used to evaluate a Tat......The PDZ domain mediated interaction between the NMDA receptor and its intracellular scaffolding protein, PSD-95, is a potential target for treatment of ischemic brain diseases. We have recently developed a number of peptide analogues with improved affinity for the PDZ domains of PSD-95 compared...

  3. Understanding Protein-Protein Interactions Using Local Structural Features

    DEFF Research Database (Denmark)

    Planas-Iglesias, Joan; Bonet, Jaume; García-García, Javier


    Protein-protein interactions (PPIs) play a relevant role among the different functions of a cell. Identifying the PPI network of a given organism (interactome) is useful to shed light on the key molecular mechanisms within a biological system. In this work, we show the role of structural features...... interacting and non-interacting protein pairs to classify the structural features that sustain the binding (or non-binding) behavior. Our study indicates that not only the interacting region but also the rest of the protein surface are important for the interaction fate. The interpretation...... to score the likelihood of the interaction between two proteins and to develop a method for the prediction of PPIs. We have tested our method on several sets with unbalanced ratios of interactions and non-interactions to simulate real conditions, obtaining accuracies higher than 25% in the most unfavorable...

  4. Text Mining for Protein Docking.

    Directory of Open Access Journals (Sweden)

    Varsha D Badal


    Full Text Available The rapidly growing amount of publicly available information from biomedical research is readily accessible on the Internet, providing a powerful resource for predictive biomolecular modeling. The accumulated data on experimentally determined structures transformed structure prediction of proteins and protein complexes. Instead of exploring the enormous search space, predictive tools can simply proceed to the solution based on similarity to the existing, previously determined structures. A similar major paradigm shift is emerging due to the rapidly expanding amount of information, other than experimentally determined structures, which still can be used as constraints in biomolecular structure prediction. Automated text mining has been widely used in recreating protein interaction networks, as well as in detecting small ligand binding sites on protein structures. Combining and expanding these two well-developed areas of research, we applied the text mining to structural modeling of protein-protein complexes (protein docking. Protein docking can be significantly improved when constraints on the docking mode are available. We developed a procedure that retrieves published abstracts on a specific protein-protein interaction and extracts information relevant to docking. The procedure was assessed on protein complexes from Dockground ( The results show that correct information on binding residues can be extracted for about half of the complexes. The amount of irrelevant information was reduced by conceptual analysis of a subset of the retrieved abstracts, based on the bag-of-words (features approach. Support Vector Machine models were trained and validated on the subset. The remaining abstracts were filtered by the best-performing models, which decreased the irrelevant information for ~ 25% complexes in the dataset. The extracted constraints were incorporated in the docking protocol and tested on the Dockground unbound

  5. Protein-protein interactions within late pre-40S ribosomes.

    Directory of Open Access Journals (Sweden)

    Melody G Campbell


    Full Text Available Ribosome assembly in eukaryotic organisms requires more than 200 assembly factors to facilitate and coordinate rRNA transcription, processing, and folding with the binding of the ribosomal proteins. Many of these assembly factors bind and dissociate at defined times giving rise to discrete assembly intermediates, some of which have been partially characterized with regards to their protein and RNA composition. Here, we have analyzed the protein-protein interactions between the seven assembly factors bound to late cytoplasmic pre-40S ribosomes using recombinant proteins in binding assays. Our data show that these factors form two modules: one comprising Enp1 and the export adaptor Ltv1 near the beak structure, and the second comprising the kinase Rio2, the nuclease Nob1, and a regulatory RNA binding protein Dim2/Pno1 on the front of the head. The GTPase-like Tsr1 and the universally conserved methylase Dim1 are also peripherally connected to this second module. Additionally, in an effort to further define the locations for these essential proteins, we have analyzed the interactions between these assembly factors and six ribosomal proteins: Rps0, Rps3, Rps5, Rps14, Rps15 and Rps29. Together, these results and previous RNA-protein crosslinking data allow us to propose a model for the binding sites of these seven assembly factors. Furthermore, our data show that the essential kinase Rio2 is located at the center of the pre-ribosomal particle and interacts, directly or indirectly, with every other assembly factor, as well as three ribosomal proteins required for cytoplasmic 40S maturation. These data suggest that Rio2 could play a central role in regulating cytoplasmic maturation steps.

  6. Annotating the protein-RNA interaction sites in proteins using evolutionary information and protein backbone structure. (United States)

    Li, Tao; Li, Qian-Zhong


    RNA-protein interactions play important roles in various biological processes. The precise detection of RNA-protein interaction sites is very important for understanding essential biological processes and annotating the function of the proteins. In this study, based on various features from amino acid sequence and structure, including evolutionary information, solvent accessible surface area and torsion angles (φ, ψ) in the backbone structure of the polypeptide chain, a computational method for predicting RNA-binding sites in proteins is proposed. When the method is applied to predict RNA-binding sites in three datasets: RBP86 containing 86 protein chains, RBP107 containing 107 proteins chains and RBP109 containing 109 proteins chains, better sensitivities and specificities are obtained compared to previously published methods in five-fold cross-validation tests. In order to make further examination for the efficiency of our method, the RBP107 dataset is used as training set, RBP86 and RBP109 datasets are used as the independent test sets. In addition, as examples of our prediction, RNA-binding sites in a few proteins are presented. The annotated results are consistent with the PDB annotation. These results show that our method is useful for annotating RNA binding sites of novel proteins.

  7. Porcine prion protein amyloid. (United States)

    Hammarström, Per; Nyström, Sofie


    Mammalian prions are composed of misfolded aggregated prion protein (PrP) with amyloid-like features. Prions are zoonotic disease agents that infect a wide variety of mammalian species including humans. Mammals and by-products thereof which are frequently encountered in daily life are most important for human health. It is established that bovine prions (BSE) can infect humans while there is no such evidence for any other prion susceptible species in the human food chain (sheep, goat, elk, deer) and largely prion resistant species (pig) or susceptible and resistant pets (cat and dogs, respectively). PrPs from these species have been characterized using biochemistry, biophysics and neurobiology. Recently we studied PrPs from several mammals in vitro and found evidence for generic amyloidogenicity as well as cross-seeding fibril formation activity of all PrPs on the human PrP sequence regardless if the original species was resistant or susceptible to prion disease. Porcine PrP amyloidogenicity was among the studied. Experimentally inoculated pigs as well as transgenic mouse lines overexpressing porcine PrP have, in the past, been used to investigate the possibility of prion transmission in pigs. The pig is a species with extraordinarily wide use within human daily life with over a billion pigs harvested for human consumption each year. Here we discuss the possibility that the largely prion disease resistant pig can be a clinically silent carrier of replicating prions.

  8. Radioimmunoassay of platelet proteins

    International Nuclear Information System (INIS)

    Pepper, D.S.


    The radioimmunoassay of platelet-specific proteins has proven to be an excellent way of monitoring platelet activation in vivo. In contrast to earlier methods such as aggregometry, which has been the major tool used in the evaluation of antiplatelet drugs, the RIAs are capable of working with samples which have been subjected to physiological conditions such as haematocrit, oxygen tension, shear rate and ionized calcium concentration. Also, in contrast to aggregometry, no choice of agonist is necessary. Thus, for the first time it has been possible to monitor the effects of therapeutic intervention with drugs upon the platelet release reaction in vivo. It seems reasonable to equate the release reaction in vivo with activation in vivo, though the stimuli necessarily remain unknown. Nevertheless, the fact that a significant number of the compounds mentioned in Table 3 are indeed capable of reducing platelet activation in vivo and that this effect can be measured objectively is a major step forward in our understanding of platelet pharmacology. Two important goals remain to be achieved, however, the establishment of nonhuman animal models for the evaluation of newer compounds in vivo and longer-term goal of proving in the clinical setting the relevance or otherwise of platelet activation per se to the clinical outcome of a particular disease. In this respect, the availability of accurate, reliable and specific radioimmunoassays has a central role

  9. Modelling of proteins in membranes

    DEFF Research Database (Denmark)

    Sperotto, Maria Maddalena; May, S.; Baumgaertner, A.


    This review describes some recent theories and simulations of mesoscopic and microscopic models of lipid membranes with embedded or attached proteins. We summarize results supporting our understanding of phenomena for which the activities of proteins in membranes are expected to be significantly ...

  10. Protein folding on a chip

    CERN Multimedia


    "Scientists at the U.S. Department of Energy's Brookhaven National Laboratory are proposing to use a super- computer originally developed to simulate elementary particles in high- energy physics to help determine the structures and functions of proteins, including, for example, the 30,000 or so proteins encoded by the human genome" (1 page)

  11. Extraction of Proteins with ABS

    NARCIS (Netherlands)

    Desai, R.K.; Streefland, M.; Wijffels, R.H.; Eppink, M.H.M.


    Over the past years, there has been an increasing trend in research on the extraction and purification of proteins using aqueous biphasic systems (ABS) formed by polymers, e.g., polyethylene glycol (PEG). In general, when dealing with protein purification processes, it is essential to maintain their

  12. Protein: MPA1 [TP Atlas

    Lifescience Database Archive (English)

    Full Text Available MPA1 TLR signaling molecules Rsad2 Vig1 Radical S-adenosyl methionine domain-containing pr...otein 2 Viperin, Virus inhibitory protein, endoplasmic reticulum-associated, interferon-inducible 10090 Mus musculus 58185 Q8CBB9 21435586 ...

  13. Protein: FBA6 [TP Atlas

    Lifescience Database Archive (English)

    Full Text Available FBA6 vesicular transport RAB11FIP3 ARFO1, KIAA0665 RAB11FIP3 Rab11 family-interacting pr...otein 3 Arfophilin-1, EF hands-containing Rab-interacting protein, MU-MB-17.148 9606 Homo sapiens O75154 9727 2HV8 2D7C 9727 21790911 ...

  14. Protein: MPB2 [TP Atlas

    Lifescience Database Archive (English)

    Full Text Available MPB2 Ubiquitin ligases SMURF1 KIAA1625 SMURF1 E3 ubiquitin-protein ligase SMURF1 SM...AD ubiquitination regulatory factor 1, SMAD-specific E3 ubiquitin-protein ligase 1 9606 Homo sapiens Q9HCE7 57154 2LB1, 2LAZ, 2LB0, 3PYC 57154 Q9HCE7 ...

  15. Protein: MPB4 [TP Atlas

    Lifescience Database Archive (English)

    Full Text Available MPB4 Sema3A signaling molecules DPYSL2 CRMP2, ULIP2 DPYSL2 Dihydropyrimidinase-related pr...otein 2 Collapsin response mediator protein 2, N2A3, Unc-33-like phosphoprotein 2 9606 Homo sapiens Q16555 1808 2VM8, 2GSE 1808 Q16555 ...

  16. Protein: MPB2 [TP Atlas

    Lifescience Database Archive (English)

    Full Text Available MPB2 Ubiquitin ligases STUB1 CHIP STUB1 E3 ubiquitin-protein ligase CHIP Antigen NY...-CO-7, CLL-associated antigen KW-8, Carboxy terminus of Hsp70-interacting protein, STIP1 homology and U box-containing pr

  17. Protein Networks in Alzheimer's Disease

    DEFF Research Database (Denmark)

    Carlsen, Eva Meier; Rasmussen, Rune


    Overlap of RNA and protein networks reveals glia cells as key players for the development of symptomatic Alzheimer’s disease in humans......Overlap of RNA and protein networks reveals glia cells as key players for the development of symptomatic Alzheimer’s disease in humans...

  18. Mesostructure of fibrillar protein gels

    NARCIS (Netherlands)

    Veerman, C.; Sagis, L.M.C.; Linden, van der E.


    We investigated the mesostructure of three different food proteins (ß-lactoglobulin (ß-lg), bovine serum albumin (BSA), and ovalbumin), after protein assembly at pH 2, using rheology and transmission electron microscopy (TEM). TEM micrographs showed fibrils with a contour length of about 2-7 µm for

  19. Statistical mechanics of protein solutions

    NARCIS (Netherlands)

    Prinsen, P.


    We study theoretically thermodynamic properties of spherical globular proteins in aqueous solution with added monovalent salt. We show how one can determine an effective interaction potential between the proteins from experimental data as a function of salt concentration and we apply this to the

  20. Water holding of protein gels

    NARCIS (Netherlands)

    Urbonaite, V.



    Food products are typically multicomponent systems, where often the spatial volume is set by a protein continuous network. The ability of protein-based food products to entrap water and to prevent its exudation upon mechanical deformation is important for the

  1. Teaching computers to fold proteins

    DEFF Research Database (Denmark)

    Winther, Ole; Krogh, Anders Stærmose


    A new general algorithm for optimization of potential functions for protein folding is introduced. It is based upon gradient optimization of the thermodynamic stability of native folds of a training set of proteins with known structure. The iterative update rule contains two thermodynamic averages...

  2. Cohesion and Adhesion with Proteins (United States)

    Charles R. Frihart


    With increasing interest in bio-based adhesives, research on proteins has expanded because historically they have been used by both nature and humans as adhesives. A wide variety of proteins have been used as wood adhesives. Ancient Egyptians most likely used collagens tobond veneer to wood furniture, then came casein (milk), blood, fish scales, and soy adhesives, with...

  3. Protein Electrochemistry: Questions and Answers. (United States)

    Fourmond, V; Léger, C

    This chapter presents the fundamentals of electrochemistry in the context of protein electrochemistry. We discuss redox proteins and enzymes that are not photoactive. Of course, the principles described herein also apply to photobioelectrochemistry, as discussed in later chapters of this book. Depending on which experiment is considered, electron transfer between proteins and electrodes can be either direct or mediated, and achieved in a variety of configurations: with the protein and/or the mediator free to diffuse in solution, immobilized in a thick, hydrated film, or adsorbed as a sub-monolayer on the electrode. The experiments can be performed with the goal to study the protein or to use it. Here emphasis is on mechanistic studies, which are easier in the configuration where the protein is adsorbed and electron transfer is direct, but we also explain the interpretation of signals obtained when diffusion processes affect the response.This chapter is organized as a series of responses to questions. Questions 1-5 are related to the basics of electrochemistry: what does "potential" or "current" mean, what does an electrochemical set-up look like? Questions 6-9 are related to the distinction between adsorbed and diffusive redox species. The answers to questions 10-13 explain the interpretation of slow and fast scan voltammetry with redox proteins. Questions 14-19 deal with catalytic electrochemistry, when the protein studied is actually an enzyme. Questions 20, 21 and 22 are general.

  4. Non-Protein Coding RNAs

    CERN Document Server

    Walter, Nils G; Batey, Robert T


    This book assembles chapters from experts in the Biophysics of RNA to provide a broadly accessible snapshot of the current status of this rapidly expanding field. The 2006 Nobel Prize in Physiology or Medicine was awarded to the discoverers of RNA interference, highlighting just one example of a large number of non-protein coding RNAs. Because non-protein coding RNAs outnumber protein coding genes in mammals and other higher eukaryotes, it is now thought that the complexity of organisms is correlated with the fraction of their genome that encodes non-protein coding RNAs. Essential biological processes as diverse as cell differentiation, suppression of infecting viruses and parasitic transposons, higher-level organization of eukaryotic chromosomes, and gene expression itself are found to largely be directed by non-protein coding RNAs. The biophysical study of these RNAs employs X-ray crystallography, NMR, ensemble and single molecule fluorescence spectroscopy, optical tweezers, cryo-electron microscopy, and ot...

  5. FERM proteins in animal morphogenesis. (United States)

    Tepass, Ulrich


    Proteins containing a FERM domain are ubiquitous components of the cytocortex of animal cells where they are engaged in structural, transport, and signaling functions. Recent years have seen a wealth of genetic studies in model organisms that explore FERM protein function in development and tissue organization. In addition, mutations in several FERM protein-encoding genes have been associated with human diseases. This review will provide a brief overview of the FERM domain structure and the FERM protein superfamily and then discuss recent advances in our understanding of the mechanism of function and developmental requirement of several FERM proteins including Moesin, Myosin-VIIA, Myosin-XV, Coracle/Band4.1 as well as Yurt and its vertebrate homologs Mosaic Eyes and EPB41L5/YMO1/Limulus.

  6. The PMDB Protein Model Database (United States)

    Castrignanò, Tiziana; De Meo, Paolo D'Onorio; Cozzetto, Domenico; Talamo, Ivano Giuseppe; Tramontano, Anna


    The Protein Model Database (PMDB) is a public resource aimed at storing manually built 3D models of proteins. The database is designed to provide access to models published in the scientific literature, together with validating experimental data. It is a relational database and it currently contains >74 000 models for ∼240 proteins. The system is accessible at and allows predictors to submit models along with related supporting evidence and users to download them through a simple and intuitive interface. Users can navigate in the database and retrieve models referring to the same target protein or to different regions of the same protein. Each model is assigned a unique identifier that allows interested users to directly access the data. PMID:16381873

  7. Chemical shift homology in proteins

    International Nuclear Information System (INIS)

    Potts, Barbara C.M.; Chazin, Walter J.


    The degree of chemical shift similarity for homologous proteins has been determined from a chemical shift database of over 50 proteins representing a variety of families and folds, and spanning a wide range of sequence homologies. After sequence alignment, the similarity of the secondary chemical shifts of C α protons was examined as a function of amino acid sequence identity for 37 pairs of structurally homologous proteins. A correlation between sequence identity and secondary chemical shift rmsd was observed. Important insights are provided by examining the sequence identity of homologous proteins versus percentage of secondary chemical shifts that fall within 0.1 and 0.3 ppm thresholds. These results begin to establish practical guidelines for the extent of chemical shift similarity to expect among structurally homologous proteins

  8. Microdomain forming proteins in oncogenesis

    Directory of Open Access Journals (Sweden)

    I. B. Zborovskaya


    Full Text Available Lipid rafts are lateral assembles of cholesterol, sphingomyelin, glicosphingolipids and specific proteins within cell plasma membrane. These microdomains are involved into a number of important cellular processes including membrane rearrangement, protein internalization, signal transduction, entry of viruses into the cell. Some of lipid rafts are stabilized by special microdomain-forming proteins such as caveolins, SPFH domain containing superfamily, tetraspanins, galectins, which maintain integrity of rafts and regulate signal transduction via forming of “signalosomes”. Involvement of the different lipid rafts is necessary in many situations such as binding of growth factors with their receptors, integrin regulation, cytoskeleton and extracellular matrix rearrangements, vesicular transport, etc. However, such classes of microdomain-forming proteins are still considered separately from each other. In this review we tried to perform complex analysis of microdomain-forming proteins in regulation of cancer assotiated processes.

  9. Nanostructures for protein drug delivery. (United States)

    Pachioni-Vasconcelos, Juliana de Almeida; Lopes, André Moreni; Apolinário, Alexsandra Conceição; Valenzuela-Oses, Johanna Karina; Costa, Juliana Souza Ribeiro; Nascimento, Laura de Oliveira; Pessoa, Adalberto; Barbosa, Leandro Ramos Souza; Rangel-Yagui, Carlota de Oliveira


    Use of nanoscale devices as carriers for drugs and imaging agents has been extensively investigated and successful examples can already be found in therapy. In parallel, recombinant DNA technology together with molecular biology has opened up numerous possibilities for the large-scale production of many proteins of pharmaceutical interest, reflecting in the exponentially growing number of drugs of biotechnological origin. When we consider protein drugs, however, there are specific criteria to take into account to select adequate nanostructured systems as drug carriers. In this review, we highlight the main features, advantages, drawbacks and recent developments of nanostructures for protein encapsulation, such as nanoemulsions, liposomes, polymersomes, single-protein nanocapsules and hydrogel nanoparticles. We also discuss the importance of nanoparticle stabilization, as well as future opportunities and challenges in nanostructures for protein drug delivery.

  10. Soy protein modification: A review

    Directory of Open Access Journals (Sweden)

    Barać Miroljub B.


    Full Text Available Soy protein products such as flour, concentrates and isolates are used in food formulation because of their functionality, nutritional value and low cost. To obtain their optimal nutritive and functional properties as well as desirable flavor different treatments are used. Soybean proteins can be modified by physical, chemical and enzymatic treatments. Different thermal treatments are most commonly used, while the most appropriate way of modifying soy proteins from the standpoint of safety is their limited proteolysis. These treatments cause physical and chemical changes that affect their functional properties. This review discusses three principal methods used for modification of soy protein products, their effects on dominant soy protein properties and some biologically active compounds.

  11. Random copolymers that protect proteins (United States)

    Alexander-Katz, Alfredo; Van Lehn, Reid C.


    Scientists have tried and in some limited cases succeeded to harness proteins to do chemistry (1) or use them in functional materials. However, most proteins only function correctly if they fold into specific conformations, which typically occurs with the assistance of other proteins (such as chaperones, translocons, or transporters) that mediate structure formation, membrane insertion, and intracellular trafficking (2, 3). Several methods have been used to improve protein stability in nonbiological environments—including micelle encapsulation, polymer conjugation, and sol-gel trapping (4)—but for most intended applications, they suffer from low levels of functionality, difficult chemical postfunctionalization, or the requirement of very specific solvent environments. On page 1239 of this issue, Panganiban et al. (5) introduce an approach for stabilizing proteins in disparate solvent environments that does not suffer from these drawbacks.

  12. Transduction proteins of olfactory receptor cells: identification of guanine nucleotide binding proteins and protein kinase C

    International Nuclear Information System (INIS)

    Anholt, R.R.H.; Mumby, S.M.; Stoffers, D.A.; Girard, P.R.; Kuo, J.F.; Snyder, S.H.


    The authors have analyzed guanine nucleotide binding proteins (G-proteins) in the olfactory epithelium of Rana catesbeiana using subunit-specific antisera. The olfactory epithelium contained the α subunits of three G-proteins, migrating on polyacrylamide gels in SDS with apparent molecular weights of 45,000, 42,000, and 40,000, corresponding to G/sub s/, G/sub i/, and G/sub o/, respectively. A single β subunit with an apparent molecular weight of 36,000 was detected. An antiserum against the α subunit of retinal transducin failed to detect immunoreactive proteins in olfactory cilia detached from the epithelium. The olfactory cilia appeared to be enriched in immunoreactive G/sub sα/ relative to G/sub ichemical bond/ and G/sub ochemical bond/ when compared to membranes prepared from the olfactory epithelium after detachment of the cilia. Bound antibody was detected by autoradiography after incubation with [ 125 I]protein. Immunohistochemical studies using an antiserum against the β subunit of G-proteins revealed intense staining of the ciliary surface of the olfactory epithelium and of the axon bundles in the lamina propria. In contrast, an antiserum against a common sequence of the α subunits preferentially stained the cell membranes of the olfactory receptor cells and the acinar cells of Bowman's glands and the deep submucosal glands. In addition to G-proteins, they have identified protein kinase C in olfactory cilia via a protein kinase C specific antiserum and via phorbol ester binding. However, in contrast to the G-proteins, protein kinase C occurred also in cilia isolated from respiratory epithelium

  13. Proteins aggregation and human diseases

    International Nuclear Information System (INIS)

    Hu, Chin-Kun


    Many human diseases and the death of most supercentenarians are related to protein aggregation. Neurodegenerative diseases include Alzheimer's disease (AD), Huntington's disease (HD), Parkinson's disease (PD), frontotemporallobar degeneration, etc. Such diseases are due to progressive loss of structure or function of neurons caused by protein aggregation. For example, AD is considered to be related to aggregation of Aβ40 (peptide with 40 amino acids) and Aβ42 (peptide with 42 amino acids) and HD is considered to be related to aggregation of polyQ (polyglutamine) peptides. In this paper, we briefly review our recent discovery of key factors for protein aggregation. We used a lattice model to study the aggregation rates of proteins and found that the probability for a protein sequence to appear in the conformation of the aggregated state can be used to determine the temperature at which proteins can aggregate most quickly. We used molecular dynamics and simple models of polymer chains to study relaxation and aggregation of proteins under various conditions and found that when the bending-angle dependent and torsion-angle dependent interactions are zero or very small, then protein chains tend to aggregate at lower temperatures. All atom models were used to identify a key peptide chain for the aggregation of insulin chains and to find that two polyQ chains prefer anti-parallel conformation. It is pointed out that in many cases, protein aggregation does not result from protein mis-folding. A potential drug from Chinese medicine was found for Alzheimer's disease. (paper)

  14. Protein improvement in crop plants

    Energy Technology Data Exchange (ETDEWEB)

    Rabson, R


    There are compelling reasons for attempting to increase the quality and quantity of protein available in crop plants through plant breeding, despite the fact that some critics have argued that no worldwide protein shortage exists. What used to be thought of as a 'protein gap' has now come to be considered in terms of protein-calorie malnutrition. This is only right since protein and calorie nutrition are inextricable. t the moment there are still unanswered questions as to the precise protein requirements of humans as a function of age, health and ambient conditions. There are, in addition, some indications that the incidence of Kwashiorkor (protein deficiency disease) is increasing in different parts of the world. At a recent meeting of the Protein Advisory Group of the United Nations System, Dr. Jean Mayer, an eminent human nutritionist of Harvard University, U.S.A., indicated the reasons for concern for the current food situation generally, and the protein food supply in particular. These factors include: - Immoderate continuing human population increases, most pronounced in some poor developing countries. - The highly accelerated consumption of animal foods associated with increasing affluence in the richer countries of the world. The production of such foods as meat demands great expenditures of grain, which is an inefficient mode of obtaining the required calories and protein for human consumption. - The over-exploitation of many of the world's fishery resources resulting in reduced yields, perhaps irreversibly, of some fishes. - Recent price increases in petroleum and fertilizer products which have imposed a major obstacle to increasing crop production. - The apparent alteration of climates in places like Africa, Asia and other parts of the Northern hemisphere which may put significant restrictions on crop production. hey are cogent reasons to be seriously concerned about these matters. (author)

  15. Protein improvement in crop plants

    International Nuclear Information System (INIS)

    Rabson, R.


    There are compelling reasons for attempting to increase the quality and quantity of protein available in crop plants through plant breeding, despite the fact that some critics have argued that no worldwide protein shortage exists. What used to be thought of as a 'protein gap' has now come to be considered in terms of protein-calorie malnutrition. This is only right since protein and calorie nutrition are inextricable. t the moment there are still unanswered questions as to the precise protein requirements of humans as a function of age, health and ambient conditions. There are, in addition, some indications that the incidence of Kwashiorkor (protein deficiency disease) is increasing in different parts of the world. At a recent meeting of the Protein Advisory Group of the United Nations System, Dr. Jean Mayer, an eminent human nutritionist of Harvard University, U.S.A., indicated the reasons for concern for the current food situation generally, and the protein food supply in particular. These factors include: - Immoderate continuing human population increases, most pronounced in some poor developing countries. - The highly accelerated consumption of animal foods associated with increasing affluence in the richer countries of the world. The production of such foods as meat demands great expenditures of grain, which is an inefficient mode of obtaining the required calories and protein for human consumption. - The over-exploitation of many of the world's fishery resources resulting in reduced yields, perhaps irreversibly, of some fishes. - Recent price increases in petroleum and fertilizer products which have imposed a major obstacle to increasing crop production. - The apparent alteration of climates in places like Africa, Asia and other parts of the Northern hemisphere which may put significant restrictions on crop production. hey are cogent reasons to be seriously concerned about these matters. (author)

  16. Hematological alterations in protein malnutrition. (United States)

    Santos, Ed W; Oliveira, Dalila C; Silva, Graziela B; Tsujita, Maristela; Beltran, Jackeline O; Hastreiter, Araceli; Fock, Ricardo A; Borelli, Primavera


    Protein malnutrition is one of the most serious nutritional problems worldwide, affecting 794 million people and costing up to $3.5 trillion annually in the global economy. Protein malnutrition primarily affects children, the elderly, and hospitalized patients. Different degrees of protein deficiency lead to a broad spectrum of signs and symptoms of protein malnutrition, especially in organs in which the hematopoietic system is characterized by a high rate of protein turnover and, consequently, a high rate of protein renewal and cellular proliferation. Here, the current scientific information about protein malnutrition and its effects on the hematopoietic process is reviewed. The production of hematopoietic cells is described, with special attention given to the hematopoietic microenvironment and the development of stem cells. Advances in the study of hematopoiesis in protein malnutrition are also summarized. Studies of protein malnutrition in vitro, in animal models, and in humans demonstrate several alterations that impair hematopoiesis, such as structural changes in the extracellular matrix, the hematopoietic stem cell niche, the spleen, the thymus, and bone marrow stromal cells; changes in mesenchymal and hematopoietic stem cells; increased autophagy; G0/G1 cell-cycle arrest of progenitor hematopoietic cells; and functional alterations in leukocytes. Structural and cellular changes of the hematopoietic microenvironment in protein malnutrition contribute to bone marrow atrophy and nonestablishment of hematopoietic stem cells, resulting in impaired homeostasis and an impaired immune response. © The Author(s) 2017. Published by Oxford University Press on behalf of the International Life Sciences Institute. All rights reserved. For Permissions, please e-mail:

  17. Targeting protein-protein interactions for parasite control.

    Directory of Open Access Journals (Sweden)

    Christina M Taylor


    Full Text Available Finding new drug targets for pathogenic infections would be of great utility for humanity, as there is a large need to develop new drugs to fight infections due to the developing resistance and side effects of current treatments. Current drug targets for pathogen infections involve only a single protein. However, proteins rarely act in isolation, and the majority of biological processes occur via interactions with other proteins, so protein-protein interactions (PPIs offer a realm of unexplored potential drug targets and are thought to be the next-generation of drug targets. Parasitic worms were chosen for this study because they have deleterious effects on human health, livestock, and plants, costing society billions of dollars annually and many sequenced genomes are available. In this study, we present a computational approach that utilizes whole genomes of 6 parasitic and 1 free-living worm species and 2 hosts. The species were placed in orthologous groups, then binned in species-specific orthologous groups. Proteins that are essential and conserved among species that span a phyla are of greatest value, as they provide foundations for developing broad-control strategies. Two PPI databases were used to find PPIs within the species specific bins. PPIs with unique helminth proteins and helminth proteins with unique features relative to the host, such as indels, were prioritized as drug targets. The PPIs were scored based on RNAi phenotype and homology to the PDB (Protein DataBank. EST data for the various life stages, GO annotation, and druggability were also taken into consideration. Several PPIs emerged from this study as potential drug targets. A few interactions were supported by co-localization of expression in M. incognita (plant parasite and B. malayi (H. sapiens parasite, which have extremely different modes of parasitism. As more genomes of pathogens are sequenced and PPI databases expanded, this methodology will become increasingly

  18. Protein folding and the organization of the protein topology universe

    DEFF Research Database (Denmark)

    Lindorff-Larsen,, Kresten; Røgen, Peter; Paci, Emanuele


    residues and, in addition, that the topology of the transition state is closer to that of the native state than to that of any other fold in the protein universe. Here, we review the evidence for these conclusions and suggest a molecular mechanism that rationalizes these findings by presenting a view...... of protein folds that is based on the topological features of the polypeptide backbone, rather than the conventional view that depends on the arrangement of different types of secondary-structure elements. By linking the folding process to the organization of the protein structure universe, we propose...

  19. Spectral affinity in protein networks. (United States)

    Voevodski, Konstantin; Teng, Shang-Hua; Xia, Yu


    Protein-protein interaction (PPI) networks enable us to better understand the functional organization of the proteome. We can learn a lot about a particular protein by querying its neighborhood in a PPI network to find proteins with similar function. A spectral approach that considers random walks between nodes of interest is particularly useful in evaluating closeness in PPI networks. Spectral measures of closeness are more robust to noise in the data and are more precise than simpler methods based on edge density and shortest path length. We develop a novel affinity measure for pairs of proteins in PPI networks, which uses personalized PageRank, a random walk based method used in context-sensitive search on the Web. Our measure of closeness, which we call PageRank Affinity, is proportional to the number of times the smaller-degree protein is visited in a random walk that restarts at the larger-degree protein. PageRank considers paths of all lengths in a network, therefore PageRank Affinity is a precise measure that is robust to noise in the data. PageRank Affinity is also provably related to cluster co-membership, making it a meaningful measure. In our experiments on protein networks we find that our measure is better at predicting co-complex membership and finding functionally related proteins than other commonly used measures of closeness. Moreover, our experiments indicate that PageRank Affinity is very resilient to noise in the network. In addition, based on our method we build a tool that quickly finds nodes closest to a queried protein in any protein network, and easily scales to much larger biological networks. We define a meaningful way to assess the closeness of two proteins in a PPI network, and show that our closeness measure is more biologically significant than other commonly used methods. We also develop a tool, accessible at, that allows the user to quickly find nodes closest to a queried vertex in any protein

  20. Spectral affinity in protein networks

    Directory of Open Access Journals (Sweden)

    Teng Shang-Hua


    Full Text Available Abstract Background Protein-protein interaction (PPI networks enable us to better understand the functional organization of the proteome. We can learn a lot about a particular protein by querying its neighborhood in a PPI network to find proteins with similar function. A spectral approach that considers random walks between nodes of interest is particularly useful in evaluating closeness in PPI networks. Spectral measures of closeness are more robust to noise in the data and are more precise than simpler methods based on edge density and shortest path length. Results We develop a novel affinity measure for pairs of proteins in PPI networks, which uses personalized PageRank, a random walk based method used in context-sensitive search on the Web. Our measure of closeness, which we call PageRank Affinity, is proportional to the number of times the smaller-degree protein is visited in a random walk that restarts at the larger-degree protein. PageRank considers paths of all lengths in a network, therefore PageRank Affinity is a precise measure that is robust to noise in the data. PageRank Affinity is also provably related to cluster co-membership, making it a meaningful measure. In our experiments on protein networks we find that our measure is better at predicting co-complex membership and finding functionally related proteins than other commonly used measures of closeness. Moreover, our experiments indicate that PageRank Affinity is very resilient to noise in the network. In addition, based on our method we build a tool that quickly finds nodes closest to a queried protein in any protein network, and easily scales to much larger biological networks. Conclusion We define a meaningful way to assess the closeness of two proteins in a PPI network, and show that our closeness measure is more biologically significant than other commonly used methods. We also develop a tool, accessible at, that allows the user to