
Sample records for dna-mediated charge transport

  1. A Molecular Dynamics-Quantum Mechanics Theoretical Study of DNA-Mediated Charge Transport in Hydrated Ionic Liquids. (United States)

    Meng, Zhenyu; Kubar, Tomas; Mu, Yuguang; Shao, Fangwei


    Charge transport (CT) through biomolecules is of high significance in the research fields of biology, nanotechnology, and molecular devices. Inspired by our previous work that showed the binding of ionic liquid (IL) facilitated charge transport in duplex DNA, in silico simulation is a useful means to understand the microscopic mechanism of the facilitation phenomenon. Here molecular dynamics simulations (MD) of duplex DNA in water and hydrated ionic liquids were employed to explore the helical parameters. Principal component analysis was further applied to capture the subtle conformational changes of helical DNA upon different environmental impacts. Sequentially, CT rates were calculated by a QM/MM simulation of the flickering resonance model based upon MD trajectories. Herein, MD simulation illustrated that the binding of ionic liquids can restrain dynamic conformation and lower the on-site energy of the DNA base. Confined movement among the adjacent base pairs was highly related to the increase of electronic coupling among base pairs, which may lead DNA to a CT facilitated state. Sequentially combining MD and QM/MM analysis, the rational correlations among the binding modes, the conformational changes, and CT rates illustrated the facilitation effects from hydrated IL on DNA CT and supported a conformational-gating mechanism.

  2. DNA-Mediated Electrochemistry (United States)

    Gorodetsky, Alon A.; Buzzeo, Marisa C.


    The base pair stack of DNA has been demonstrated as a medium for long range charge transport chemistry both in solution and at DNA-modified surfaces. This chemistry is exquisitely sensitive to structural perturbations in the base pair stack as occur with lesions, single base mismatches, and protein binding. We have exploited this sensitivity for the development of reliable electrochemical assays based on DNA charge transport at self-assembled DNA monolayers. Here we discuss the characteristic features, applications, and advantages of DNA-mediated electrochemistry. PMID:18980370

  3. Charge transport problem

    International Nuclear Information System (INIS)

    Lee, E.P.


    In a recent report (UCID 17346, ''Relativistic Particle Beam in a Semi-Infinite Axially Symmetric conducting channel extending from a perfectly conducting plane,'' Dec. 13, 1976) Cooper and Neil demonstrate that the net charge transported by a beam pulse injected into a channel of finite conductivity equals the charge of the beam itself. The channel is taken to be infinite in the positive z direction, has finite radius and is terminated by a conducting ground plane at z =0. This result is not an obvious one, and it is restricted in its applicability by the special model assumed for the channel. It is the purpose to explain the result of Cooper and Neil in more qualitative terms and to make similar calculations using several other channel models. It must be emphasized that these calculations are not concerned with the fate of the transported charge after the pulse has stopped, but rather with how much charge leaves the ground plane assuming the pulse does not stop

  4. Charge transport in organic semiconductors. (United States)

    Bässler, Heinz; Köhler, Anna


    Modern optoelectronic devices, such as light-emitting diodes, field-effect transistors and organic solar cells require well controlled motion of charges for their efficient operation. The understanding of the processes that determine charge transport is therefore of paramount importance for designing materials with improved structure-property relationships. Before discussing different regimes of charge transport in organic semiconductors, we present a brief introduction into the conceptual framework in which we interpret the relevant photophysical processes. That is, we compare a molecular picture of electronic excitations against the Su-Schrieffer-Heeger semiconductor band model. After a brief description of experimental techniques needed to measure charge mobilities, we then elaborate on the parameters controlling charge transport in technologically relevant materials. Thus, we consider the influences of electronic coupling between molecular units, disorder, polaronic effects and space charge. A particular focus is given to the recent progress made in understanding charge transport on short time scales and short length scales. The mechanism for charge injection is briefly addressed towards the end of this chapter.

  5. Charge transport in organic crystals

    Energy Technology Data Exchange (ETDEWEB)

    Ortmann, Frank


    The understanding of charge transport is one of the central goals in the research on semiconducting crystals. For organic crystals this is particularly complicated due to the strength of the electron-phonon interaction which requires the description of a seamless transition between the limiting cases of a coherent band-transport mechanism and incoherent hopping. In this thesis, charge transport phenomena in organic crystals are studied by theoretical means. A theory for charge transport in organic crystals is developed which covers the whole temperature range from low T, where it reproduces an expression from the Boltzmann equation for band transport, via elevated T, where it generalizes Holstein's small-polaron theory to finite bandwidths, up to high T, for which a temperature dependence equal to Marcus' electron-transfer theory is obtained. Thereby, coherent band transport and thermally induced hopping are treated on equal footing while simultaneously treating the electron-phonon interaction non-perturbatively. By avoiding the approximation of narrow polaron bands the theory allows for the description of large and small polarons and serves as a starting point for computational studies. The theoretical description is completed by using ab initio material parameters for the selected crystals under study. These material parameters are taken from density functional theory calculations for durene, naphthalene, and guanine crystals. Besides the analysis of the transport mechanism, special focus is put on the study of the relationship between mobility anisotropy and structure of the crystals. This study is supported by a 3D-visualization method for the transport channels in such crystals which has been derived in this thesis. (orig.)

  6. Diffusive charge transport in graphene (United States)

    Chen, Jianhao

    The physical mechanisms limiting the mobility of graphene on SiO 2 are studied and printed graphene devices on a flexible substrate are realized. Intentional addition of charged scattering impurities is used to study the effects of charged impurities. Atomic-scale defects are created by noble-gas ions irradiation to study the effect of unitary scatterers. The results show that charged impurities and atomic-scale defects both lead to conductivity linear in density in graphene, with a scattering magnitude that agrees quantitatively with theoretical estimates. While charged impurities cause intravalley scattering and induce a small change in the minimum conductivity, defects in graphene scatter electrons between the valleys and suppress the minimum conductivity below the metallic limit. Temperature-dependent measurements show that longitudinal acoustic phonons in graphene produce a small resistivity which is linear in temperature and independent of carrier density; at higher temperatures, polar optical phonons of the SiO2 substrate give rise to an activated, carrier density-dependent resistivity. Graphene is also made into high mobility transparent and flexible field effect device via the transfer-printing method. Together the results paint a complete picture of charge carrier transport in graphene on SiO2 in the diffusive regime, and show the promise of graphene as a novel electronic material that have potential applications not only on conventional inorganic substrates, but also on flexible substrates.

  7. Trap-controlled charge transport in corona-charged Teflon

    International Nuclear Information System (INIS)

    Gross, B.; Giacometti, J.A.; Ferreira, G.F.L.; Moreno A, R.A.


    The stability of negatively charged Teflon electrets is discussed. It is stated that it can only be explained by the assumption that the transport of excess charge is trap - controlled rather than mobility - controlled. (I.C.R.) [pt

  8. Charge transport through molecular switches

    International Nuclear Information System (INIS)

    Jan van der Molen, Sense; Liljeroth, Peter


    We review the fascinating research on charge transport through switchable molecules. In the past decade, detailed investigations have been performed on a great variety of molecular switches, including mechanically interlocked switches (rotaxanes and catenanes), redox-active molecules and photochromic switches (e.g. azobenzenes and diarylethenes). To probe these molecules, both individually and in self-assembled monolayers (SAMs), a broad set of methods have been developed. These range from low temperature scanning tunneling microscopy (STM) via two-terminal break junctions to larger scale SAM-based devices. It is generally found that the electronic coupling between molecules and electrodes has a profound influence on the properties of such molecular junctions. For example, an intrinsically switchable molecule may lose its functionality after it is contacted. Vice versa, switchable two-terminal devices may be created using passive molecules ('extrinsic switching'). Developing a detailed understanding of the relation between coupling and switchability will be of key importance for both future research and technology. (topical review)

  9. Charge transport through molecular switches

    Energy Technology Data Exchange (ETDEWEB)

    Jan van der Molen, Sense [Kamerlingh Onnes Laboratorium, Leiden University, Niels Bohrweg 2, 2333 CA Leiden (Netherlands); Liljeroth, Peter, E-mail: molen@physics.leidenuniv.n [Condensed Matter and Interfaces, Debye Institute for Nanomaterials Science, University of Utrecht, PO Box 80000, 3508 TA Utrecht (Netherlands)


    We review the fascinating research on charge transport through switchable molecules. In the past decade, detailed investigations have been performed on a great variety of molecular switches, including mechanically interlocked switches (rotaxanes and catenanes), redox-active molecules and photochromic switches (e.g. azobenzenes and diarylethenes). To probe these molecules, both individually and in self-assembled monolayers (SAMs), a broad set of methods have been developed. These range from low temperature scanning tunneling microscopy (STM) via two-terminal break junctions to larger scale SAM-based devices. It is generally found that the electronic coupling between molecules and electrodes has a profound influence on the properties of such molecular junctions. For example, an intrinsically switchable molecule may lose its functionality after it is contacted. Vice versa, switchable two-terminal devices may be created using passive molecules ('extrinsic switching'). Developing a detailed understanding of the relation between coupling and switchability will be of key importance for both future research and technology. (topical review)

  10. Role of molecular charge in nucleocytoplasmic transport.

    Directory of Open Access Journals (Sweden)

    Alexander Goryaynov

    Full Text Available Transport of genetic materials and proteins between the nucleus and cytoplasm of eukaryotic cells is mediated by nuclear pore complexes (NPCs. A selective barrier formed by phenylalanine-glycine (FG nucleoporins (Nups with net positive charges in the NPC allows for passive diffusion of signal-independent small molecules and transport-receptor facilitated translocation of signal-dependent cargo molecules. Recently, negative surface charge was postulated to be another essential criterion for selective passage through the NPC. However, the charge-driven mechanism in determining the transport kinetics and spatial transport route for either passive diffusion or facilitated translocation remains obscure. Here we employed high-speed single-molecule fluorescence microscopy with an unprecedented spatiotemporal resolution of 9 nm and 400 µs to uncover these mechanistic fundamentals for nuclear transport of charged substrates through native NPCs. We found that electrostatic interaction between negative surface charges on transiting molecules and the positively charged FG Nups, although enhancing their probability of binding to the NPC, never plays a dominant role in determining their nuclear transport mode or spatial transport route. A 3D reconstruction of transport routes revealed that small signal-dependent endogenous cargo protein constructs with high positive surface charges that are destined to the nucleus, rather than repelled from the NPC as suggested in previous models, passively diffused through an axial central channel of the NPC in the absence of transport receptors. Finally, we postulated a comprehensive map of interactions between transiting molecules and FG Nups during nucleocytoplasmic transport by combining the effects of molecular size, signal and surface charge.

  11. Charge and spin transport in mesoscopic superconductors

    Directory of Open Access Journals (Sweden)

    M. J. Wolf


    Full Text Available Background: Non-equilibrium charge transport in superconductors has been investigated intensely in the 1970s and 1980s, mostly in the vicinity of the critical temperature. Much less attention has been paid to low temperatures and the role of the quasiparticle spin.Results: We report here on nonlocal transport in superconductor hybrid structures at very low temperatures. By comparing the nonlocal conductance obtained by using ferromagnetic and normal-metal detectors, we discriminate charge and spin degrees of freedom. We observe spin injection and long-range transport of pure, chargeless spin currents in the regime of large Zeeman splitting. We elucidate charge and spin transport by comparison to theoretical models.Conclusion: The observed long-range chargeless spin transport opens a new path to manipulate and utilize the quasiparticle spin in superconductor nanostructures.

  12. Charge Transport Processes in Molecular Junctions (United States)

    Smith, Christopher Eugene

    Molecular electronics (ME) has evolved into a rich area of exploration that combines the fields of chemistry, materials, electronic engineering and computational modeling to explore the physics behind electronic conduction at the molecular level. Through studying charge transport properties of single molecules and nanoscale molecular materials the field has gained the potential to bring about new avenues for the miniaturization of electrical components where quantum phenomena are utilized to achieve solid state molecular device functionality. Molecular junctions are platforms that enable these studies and consist of a single molecule or a small group of molecules directly connected to electrodes. The work presented in this thesis has built upon the current understanding of the mechanisms of charge transport in ordered junctions using self-assembled monolayer (SAM) molecular thin films. Donor and acceptor compounds were synthesized and incorporated into SAMs grown on metal substrates then the transport properties were measured with conducting probe atomic force microscopy (CP-AFM). In addition to experimentally measured current-voltage (I-V) curves, the transport properties were addressed computationally and modeled theoretically. The key objectives of this project were to 1) investigate the impact of molecular structure on hole and electron charge transport, 2) understand the nature of the charge carriers and their structure-transport properties through long (chemically gated to modulate the transport. These results help advance our understanding of transport behavior in semiconducting molecular thin films, and open opportunities to engineer improved electronic functionality into molecular devices.

  13. Charge-transport simulations in organic semiconductors

    Energy Technology Data Exchange (ETDEWEB)

    May, Falk


    In this thesis we have extended the methods for microscopic charge-transport simulations for organic semiconductors, where weak intermolecular interactions lead to spatially localized charge carriers, and the charge transport occurs as an activated hopping process between diabatic states. In addition to weak electronic couplings between these states, different electrostatic environments in the organic material lead to a broadening of the density of states for the charge energies which limits carrier mobilities. The contributions to the method development include (i) the derivation of a bimolecular charge-transfer rate, (ii) the efficient evaluation of intermolecular (outer-sphere) reorganization energies, (iii) the investigation of effects of conformational disorder on intramolecular reorganization energies or internal site energies and (iv) the inclusion of self-consistent polarization interactions for calculation of charge energies. These methods were applied to study charge transport in amorphous phases of small molecules used in the emission layer of organic light emitting diodes (OLED). When bulky substituents are attached to an aromatic core in order to adjust energy levels or prevent crystallization, a small amount of delocalization of the frontier orbital to the substituents can increase electronic couplings between neighboring molecules. This leads to improved charge-transfer rates and, hence, larger charge-mobility. We therefore suggest using the mesomeric effect (as opposed to the inductive effect) when attaching substituents to aromatic cores, which is necessary for example in deep blue OLEDs, where the energy levels of a host molecule have to be adjusted to those of the emitter. Furthermore, the energy landscape for charges in an amorphous phase cannot be predicted by mesoscopic models because they approximate the realistic morphology by a lattice and represent molecular charge distributions in a multipole expansion. The microscopic approach shows that

  14. Charge splitters and charge transport junctions based on guanine quadruplexes (United States)

    Sha, Ruojie; Xiang, Limin; Liu, Chaoren; Balaeff, Alexander; Zhang, Yuqi; Zhang, Peng; Li, Yueqi; Beratan, David N.; Tao, Nongjian; Seeman, Nadrian C.


    Self-assembling circuit elements, such as current splitters or combiners at the molecular scale, require the design of building blocks with three or more terminals. A promising material for such building blocks is DNA, wherein multiple strands can self-assemble into multi-ended junctions, and nucleobase stacks can transport charge over long distances. However, nucleobase stacking is often disrupted at junction points, hindering electric charge transport between the two terminals of the junction. Here, we show that a guanine-quadruplex (G4) motif can be used as a connector element for a multi-ended DNA junction. By attaching specific terminal groups to the motif, we demonstrate that charges can enter the structure from one terminal at one end of a three-way G4 motif, and can exit from one of two terminals at the other end with minimal carrier transport attenuation. Moreover, we study four-way G4 junction structures by performing theoretical calculations to assist in the design and optimization of these connectors.

  15. Macroscopic acoustoelectric charge transport in graphene (United States)

    Bandhu, L.; Lawton, L. M.; Nash, G. R.


    We demonstrate macroscopic acoustoelectric transport in graphene, transferred onto piezoelectric lithium niobate substrates, between electrodes up to 500 μm apart. Using double finger interdigital transducers we have characterised the acoustoelectric current as a function of both surface acoustic wave intensity and frequency. The results are consistent with a relatively simple classical relaxation model, in which the acoustoelectric current is proportional to both the surface acoustic wave intensity and the attenuation of the wave caused by the charge transport.

  16. Simulations of charge transport in organic compounds

    Energy Technology Data Exchange (ETDEWEB)

    Vehoff, Thorsten


    We study the charge transport properties of organic liquid crystals, i.e. hexabenzocoronene and carbazole macrocycle, and single crystals, i.e. rubrene, indolocarbazole and benzothiophene derivatives (BTBT, BBBT). The aim is to find structure-property relationships linking the chemical structure as well as the morphology with the bulk charge carrier mobility of the compounds. To this end, molecular dynamics (MD) simulations are performed yielding realistic equilibrated morphologies. Partial charges and molecular orbitals are calculated based on single molecules in vacuum using quantum chemical methods. The molecular orbitals are then mapped onto the molecular positions and orientations, which allows calculation of the transfer integrals between nearest neighbors using the molecular orbital overlap method. Thus we obtain realistic transfer integral distributions and their autocorrelations. In case of organic crystals the differences between two descriptions of charge transport, namely semi-classical dynamics (SCD) in the small polaron limit and kinetic Monte Carlo (KMC) based on Marcus rates, are studied. The liquid crystals are investigated solely in the hopping limit. To simulate the charge dynamics using KMC, the centers of mass of the molecules are mapped onto lattice sites and the transfer integrals are used to compute the hopping rates. In the small polaron limit, where the electronic wave function is spread over a limited number of neighboring molecules, the Schroedinger equation is solved numerically using a semi-classical approach. The carbazole macrocycles form columnar structures arranged on a hexagonal lattice with side chains facing inwards, so columns can closely approach each other allowing inter-columnar and thus three-dimensional transport. We are able to show that, on the time-scales of charge transport, static disorder due to slow side chain motions is the main factor determining the mobility. The high mobility of rubrene is explained by two main

  17. Understanding charge transport in molecular electronics. (United States)

    Kushmerick, J J; Pollack, S K; Yang, J C; Naciri, J; Holt, D B; Ratner, M A; Shashidhar, R


    For molecular electronics to become a viable technology the factors that control charge transport across a metal-molecule-metal junction need to be elucidated. We use an experimentally simple crossed-wire tunnel junction to interrogate how factors such as metal-molecule coupling, molecular structure, and the choice of metal electrode influence the current-voltage characteristics of a molecular junction.

  18. Charge transport through DNA based electronic barriers (United States)

    Patil, Sunil R.; Chawda, Vivek; Qi, Jianqing; Anantram, M. P.; Sinha, Niraj


    We report charge transport in electronic 'barriers' constructed by sequence engineering in DNA. Considering the ionization potentials of Thymine-Adenine (AT) and Guanine-Cytosine (GC) base pairs, we treat AT as 'barriers'. The effect of DNA conformation (A and B form) on charge transport is also investigated. Particularly, the effect of width of 'barriers' on hole transport is investigated. Density functional theory (DFT) calculations are performed on energy minimized DNA structures to obtain the electronic Hamiltonian. The quantum transport calculations are performed using the Landauer-Buttiker framework. Our main findings are contrary to previous studies. We find that a longer A-DNA with more AT base pairs can conduct better than shorter A-DNA with a smaller number of AT base pairs. We also find that some sequences of A-DNA can conduct better than a corresponding B-DNA with the same sequence. The counterions mediated charge transport and long range interactions are speculated to be responsible for counter-intuitive length and AT content dependence of conductance of A-DNA.

  19. Theory and simulation of charge transport in disordered organic semiconductors

    NARCIS (Netherlands)

    Bobbert, P.A.; Kondov, I.; Sutman, G.


    Charge transport in polymeric or small-molecule organic semiconductors used in organic light-emitting diodes (OLEDs) occurs by hopping of charges between sites at which the charges are localized. The energetic disorder in these semiconductors has a profound influence on the charge transport: charges

  20. Variational multiscale models for charge transport. (United States)

    Wei, Guo-Wei; Zheng, Qiong; Chen, Zhan; Xia, Kelin


    This work presents a few variational multiscale models for charge transport in complex physical, chemical and biological systems and engineering devices, such as fuel cells, solar cells, battery cells, nanofluidics, transistors and ion channels. An essential ingredient of the present models, introduced in an earlier paper (Bulletin of Mathematical Biology, 72, 1562-1622, 2010), is the use of differential geometry theory of surfaces as a natural means to geometrically separate the macroscopic domain from the microscopic domain, meanwhile, dynamically couple discrete and continuum descriptions. Our main strategy is to construct the total energy functional of a charge transport system to encompass the polar and nonpolar free energies of solvation, and chemical potential related energy. By using the Euler-Lagrange variation, coupled Laplace-Beltrami and Poisson-Nernst-Planck (LB-PNP) equations are derived. The solution of the LB-PNP equations leads to the minimization of the total free energy, and explicit profiles of electrostatic potential and densities of charge species. To further reduce the computational complexity, the Boltzmann distribution obtained from the Poisson-Boltzmann (PB) equation is utilized to represent the densities of certain charge species so as to avoid the computationally expensive solution of some Nernst-Planck (NP) equations. Consequently, the coupled Laplace-Beltrami and Poisson-Boltzmann-Nernst-Planck (LB-PBNP) equations are proposed for charge transport in heterogeneous systems. A major emphasis of the present formulation is the consistency between equilibrium LB-PB theory and non-equilibrium LB-PNP theory at equilibrium. Another major emphasis is the capability of the reduced LB-PBNP model to fully recover the prediction of the LB-PNP model at non-equilibrium settings. To account for the fluid impact on the charge transport, we derive coupled Laplace-Beltrami, Poisson-Nernst-Planck and Navier-Stokes equations from the variational principle

  1. Variational multiscale models for charge transport (United States)

    Wei, Guo-Wei; Zheng, Qiong; Chen, Zhan; Xia, Kelin


    This work presents a few variational multiscale models for charge transport in complex physical, chemical and biological systems and engineering devices, such as fuel cells, solar cells, battery cells, nanofluidics, transistors and ion channels. An essential ingredient of the present models, introduced in an earlier paper (Bulletin of Mathematical Biology, 72, 1562-1622, 2010), is the use of differential geometry theory of surfaces as a natural means to geometrically separate the macroscopic domain from the microscopic domain, meanwhile, dynamically couple discrete and continuum descriptions. Our main strategy is to construct the total energy functional of a charge transport system to encompass the polar and nonpolar free energies of solvation, and chemical potential related energy. By using the Euler-Lagrange variation, coupled Laplace-Beltrami and Poisson-Nernst-Planck (LB-PNP) equations are derived. The solution of the LB-PNP equations leads to the minimization of the total free energy, and explicit profiles of electrostatic potential and densities of charge species. To further reduce the computational complexity, the Boltzmann distribution obtained from the Poisson-Boltzmann (PB) equation is utilized to represent the densities of certain charge species so as to avoid the computationally expensive solution of some Nernst-Planck (NP) equations. Consequently, the coupled Laplace-Beltrami and Poisson-Boltzmann-Nernst-Planck (LB-PBNP) equations are proposed for charge transport in heterogeneous systems. A major emphasis of the present formulation is the consistency between equilibrium LB-PB theory and non-equilibrium LB-PNP theory at equilibrium. Another major emphasis is the capability of the reduced LB-PBNP model to fully recover the prediction of the LB-PNP model at non-equilibrium settings. To account for the fluid impact on the charge transport, we derive coupled Laplace-Beltrami, Poisson-Nernst-Planck and Navier-Stokes equations from the variational principle

  2. Transportation charges in the gas industry

    International Nuclear Information System (INIS)

    Price, C.


    British Gas was privatized in 1986, a monopoly with no direct competition and only very light regulation of the tariff market. The regulator had an obligation to enable competition to develop in the unregulated, large-quantity, contract market. Competitors required access to the BG-owned transportation network. The government has recently rejected the recommendation of divestiture of the supply business, but has accelerated the advent of competition to the domestic market. This paper considers the role of BG's transport charges in these developments, using its past behaviour as a guide, and identifying the issues for future regulation and development of the gas market. (Author)

  3. Simulating charge transport in flexible systems

    Directory of Open Access Journals (Sweden)

    Timothy Clark


    Full Text Available Systems in which movements occur on two significantly different time domains, such as organic electronic components with flexible molecules, require different simulation techniques for the two time scales. In the case of molecular electronics, charge transport is complicated by the several different mechanisms (and theoretical models that apply in different cases. We cannot yet combine time scales of molecular and electronic movement in simulations of real systems. This review describes our progress towards this goal.

  4. Ultrafast Microscopy of Energy and Charge Transport (United States)

    Huang, Libai

    The frontier in solar energy research now lies in learning how to integrate functional entities across multiple length scales to create optimal devices. Advancing the field requires transformative experimental tools that probe energy transfer processes from the nano to the meso lengthscales. To address this challenge, we aim to understand multi-scale energy transport across both multiple length and time scales, coupling simultaneous high spatial, structural, and temporal resolution. In my talk, I will focus on our recent progress on visualization of exciton and charge transport in solar energy harvesting materials from the nano to mesoscale employing ultrafast optical nanoscopy. With approaches that combine spatial and temporal resolutions, we have recently revealed a new singlet-mediated triplet transport mechanism in certain singlet fission materials. This work demonstrates a new triplet exciton transport mechanism leading to favorable long-range triplet exciton diffusion on the picosecond and nanosecond timescales for solar cell applications. We have also performed a direct measurement of carrier transport in space and in time by mapping carrier density with simultaneous ultrafast time resolution and 50 nm spatial precision in perovskite thin films using transient absorption microscopy. These results directly visualize long-range carrier transport of 220nm in 2 ns for solution-processed polycrystalline CH3NH3PbI3 thin films. The spatially and temporally resolved measurements reported here underscore the importance of the local morphology and establish an important first step towards discerning the underlying transport properties of perovskite materials.

  5. Charge transport in amorphous organic semiconductors

    Energy Technology Data Exchange (ETDEWEB)

    Lukyanov, Alexander


    Organic semiconductors with the unique combination of electronic and mechanical properties may offer cost-effective ways of realizing many electronic applications, e. g. large-area flexible displays, printed integrated circuits and plastic solar cells. In order to facilitate the rational compound design of organic semiconductors, it is essential to understand relevant physical properties e. g. charge transport. This, however, is not straightforward, since physical models operating on different time and length scales need to be combined. First, the material morphology has to be known at an atomistic scale. For this atomistic molecular dynamics simulations can be employed, provided that an atomistic force field is available. Otherwise it has to be developed based on the existing force fields and first principle calculations. However, atomistic simulations are typically limited to the nanometer length- and nanosecond time-scales. To overcome these limitations, systematic coarse-graining techniques can be used. In the first part of this thesis, it is demonstrated how a force field can be parameterized for a typical organic molecule. Then different coarse-graining approaches are introduced together with the analysis of their advantages and problems. When atomistic morphology is available, charge transport can be studied by combining the high-temperature Marcus theory with kinetic Monte Carlo simulations. The approach is applied to the hole transport in amorphous films of tris(8- hydroxyquinoline)aluminium (Alq{sub 3}). First the influence of the force field parameters and the corresponding morphological changes on charge transport is studied. It is shown that the energetic disorder plays an important role for amorphous Alq{sub 3}, defining charge carrier dynamics. Its spatial correlations govern the Poole-Frenkel behavior of the charge carrier mobility. It is found that hole transport is dispersive for system sizes accessible to simulations, meaning that calculated

  6. Transport of electric charge in insulators

    International Nuclear Information System (INIS)

    Lopez C, E.


    In this work a review is made of important concepts in the study of the transport of electric charge in insulators. These concepts are: electrical contacts, transport regimes as viewed in the I-V characteristics, and photoinjection processes by internal photemission of holes or electrons from metals or semiconductors into insulators or by a virtual electrode using strongly absorbed light. Experimental results of photoinjection of holes and electrons into sulfur single crystals are analyzed using these concepts. The observation of the Mott-Gurney transition is reported for the first time. This is the transition between the region of space charge limited currents (SCLC) and the region of saturation of the current as a function of the applied voltage. A modified Mott-Gurney theoretical model is presented that is able to explain the whole I-V characteristic for uv and the internal photoemission of hopes and uv photoinjection of electrons. For the case of internal photoemission of electrons the conventional space charge limited current theory for an exponential distribution of traps is able to explain the experimental data. It is found that the crystals are of high purity since the total density of traps, as calculated from their exponential distribution, is Nsub(t) equals 1.8 X 10 14 cm -3 . (author)

  7. Conformation sensitive charge transport in conjugated polymers

    International Nuclear Information System (INIS)

    Mattias Andersson, L.; Hedström, Svante; Persson, Petter


    Temperature dependent charge carrier mobility measurements using field effect transistors and density functional theory calculations are combined to show how the conformation dependent frontier orbital delocalization influences the hole- and electron mobilities in a donor-acceptor based polymer. A conformationally sensitive lowest unoccupied molecular orbital results in an electron mobility that decreases with increasing temperature above room temperature, while a conformationally stable highest occupied molecular orbital is consistent with a conventional hole mobility behavior and also proposed to be one of the reasons for why the material works well as a hole transporter in amorphous bulk heterojunction solar cells

  8. Terahertz transport dynamics of graphene charge carriers

    DEFF Research Database (Denmark)

    Buron, Jonas Christian Due

    The electronic transport dynamics of graphene charge carriers at femtosecond (10-15 s) to picosecond (10-12 s) time scales are investigated using terahertz (1012 Hz) time-domain spectroscopy (THz-TDS). The technique uses sub-picosecond pulses of electromagnetic radiation to gauge the electrodynamic...... response of thin conducting films at up to multi-terahertz frequencies. In this thesis THz-TDS is applied towards two main goals; (1) investigation of the fundamental carrier transport dynamics in graphene at femtosecond to picosecond timescales and (2) application of terahertz time-domain spectroscopy...... to rapid and non-contact electrical characterization of large-area graphene, relevant for industrial integration. We show that THz-TDS is an accurate and reliable probe of graphene sheet conductance, and that the technique provides insight into fundamental aspects of the nanoscopic nature of conduction...

  9. Manipulation of charge transport in thermoelectrics (United States)

    Zhang, Xinyue; Pei, Yanzhong


    While numerous improvements have been achieved in thermoelectric materials by reducing the lattice thermal conductivity (κL), electronic approaches for enhancement can be as effective, or even more. A key challenge is decoupling Seebeck coefficient (S) from electrical conductivity (σ). The first order approximation - a single parabolic band assumption with acoustic scattering - leads the thermoelectric power factor (S2σ) to be maximized at a constant reduced Fermi level (η 0.67) and therefore at a given S of 167 μV/K. This simplifies the challenge of maximization of σ at a constant η, leading to a large number of degenerate transport channels (band degeneracy, Nv) and a fast transportation of charges (carrier mobility, μ). In this paper, existing efforts on this issue are summarized and future prospectives are given.

  10. Fractal like charge transport in polyaniline nanostructures

    International Nuclear Information System (INIS)

    Nath, Chandrani; Kumar, A.


    The structural and electrical properties of camphorsulfonic acid (CSA) doped nanotubes, and hydrochloric acid (HCl) doped nanofibers and nanoparticles of polyaniline have been studied as a function of doping level. The crystallinity increases with doping for all the nanostructures. Electrical transport measurements in the temperature range of 5–300 K show an increase in conductivity with doping for the nanostructures. All the nanostructures exhibit metal to insulator (MIT) transition below 40 K. The metallic behavior is ascribed to the electron–electron interaction effects. In the insulating regime of the nanotubes conduction follows the Mott quasi-1D variable range hopping model, whereas the conduction in the nanofibers and nanoparticles occur by variable range hopping of charge carriers among superlocalized states without and with Coulomb interaction, respectively. The smaller dopant size in case of HCl makes the polymer fractal resulting in superlocalization of electronic wave-functions. The confined morphology of the nanoparticles results in effective Coulomb interaction dominating the intersite hopping

  11. Charge Transport in LDPE Nanocomposites Part II—Computational Approach

    Directory of Open Access Journals (Sweden)

    Anh T. Hoang


    Full Text Available A bipolar charge transport model is employed to investigate the remarkable reduction in dc conductivity of low-density polyethylene (LDPE based material filled with uncoated nanofillers (reported in the first part of this work. The effect of temperature on charge transport is considered and the model outcomes are compared with measured conduction currents. The simulations reveal that the contribution of charge carrier recombination to the total transport process becomes more significant at elevated temperatures. Among the effects caused by the presence of nanoparticles, a reduced charge injection at electrodes has been found as the most essential one. Possible mechanisms for charge injection at different temperatures are therefore discussed.

  12. Methods for producing thin film charge selective transport layers (United States)

    Hammond, Scott Ryan; Olson, Dana C.; van Hest, Marinus Franciscus Antonius Maria


    Methods for producing thin film charge selective transport layers are provided. In one embodiment, a method for forming a thin film charge selective transport layer comprises: providing a precursor solution comprising a metal containing reactive precursor material dissolved into a complexing solvent; depositing the precursor solution onto a surface of a substrate to form a film; and forming a charge selective transport layer on the substrate by annealing the film.

  13. Charge Transport Along Phenylenevinylene Molecular Wires



    Abstract A model to calculate the mobility of charges along molecular wires is presented. The model is based on the tight-binding approximation and combines a quantum mechanical description of the charge with a classical description of the structural degrees of freedom. It is demonstrated that the average mobility of charge carriers along molecular wires can be obtained by time-propagation of states which are initially localised. The model is used to calculate the mobility of charg...

  14. Magnetic fields for transporting charged beams

    International Nuclear Information System (INIS)

    Parzen, G.


    The transport of charged particle beams requires magnetic fields that must be shaped correctly and very accurately. During the last 20 years or so, many studies have been made, both analytically and through the use of computer programs, of various magnetic shapes that have proved to be useful. Many of the results for magnetic field shapes can be applied equally well to electric field shapes. A report is given which gathers together the results that have more general significance and would be useful in designing a configuration to produce a desired magnetic field shape. The field shapes studied include the fields in dipoles, quadrupoles, sextupoles, octupoles, septum magnets, combined-function magnets, and electrostatic septums. Where possible, empirical formulas are proposed, based on computer and analytical studies and on magnetic field measurements. These empirical formulas are often easier to use than analytical formulas and often include effects that are difficult to compute analytically. In addition, results given in the form of tables and graphs serve as illustrative examples. The field shapes studied include uniform fields produced by window-frame magnets, C-magnets, H-magnets, and cosine magnets; linear fields produced by various types of quadrupoles; quadratic and cubic fields produced by sextupoles and octupoles; combinations of uniform and linear fields; and septum fields with sharp boundaries

  15. Charge transport in single photochromic molecular junctions (United States)

    Kim, Youngsang; Pietsch, T.; Scheer, Elke; Hellmuth, T.; Pauly, F.; Sysoiev, D.; Huhn, T.; Exner, T.; Groth, U.; Steiner, U.; Erbe, A.


    Recently, photoswitchable molecules, i.e. diarylethene, gained significant interest due to their applicability in data storage media, as optical switches, and in novel logic circuits [1]. Diarylethene-derivative molecules are the most promising candidates to design electronic functional elements, because of their excellent thermal stability, high fatigue resistance, and negligible change upon switching [1]. Here, we present the preferential conductance of specifically designed sulfur-free diarylethene molecules [2] bridging the mechanically controlled break-junctions at low temperatures [3]. The molecular energy levels and electrode couplings are obtained by evaluating the current-voltage characteristics using the single-level model [4]. The charge transport mechanism of different types of diarylethene molecules is investigated, and the results are discussed within the framework of novel theoretical predictions. [4pt] [1] M. Del Valle etal., Nat Nanotechnol 2, 176 (2007) S. J. van der Molen etal., Nano. Lett. 9, 76 (2009).[0pt] [2] D. Sysoiev etal., Chem. Eur. J. 17, 6663 (2011).[0pt] [3] Y. Kim etal., Phys. Rev. Lett. 106, 196804 (2011).[0pt] [4] Y. Kim etal., Nano Lett. 11, 3734 (2011). L. Zotti etal., Small 6, 1529 (2010).

  16. Quadrupole transport experiment with space charge dominated cesium ion beam

    International Nuclear Information System (INIS)

    Faltens, A.; Keefe, D.; Kim, C.; Rosenblum, S.; Tiefenback, M.; Warwick, A.


    The purpose of the experiment is to investigate the beam current transport limit in a long quadrupole-focussed transport channel in the space charge dominated region where the space charge defocussing force is almost as large as the average focussing force of the channel

  17. 31 CFR 337.2 - Transportation charges and risks. (United States)


    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Transportation charges and risks. 337... FEDERAL HOUSING ADMINISTRATION DEBENTURES Certificated Debentures § 337.2 Transportation charges and risks... to book-entry form, must be delivered at the expense and risk of the holder. Debentures bearing...

  18. The effect of ketone defects on the charge transport and charge recombination in polyfluorenes

    NARCIS (Netherlands)

    Kuik, M.; Wetzelaer, G.-J.A.H.; Laddé, J.G.; Nicolai, H.T.; Wildeman, J.; Sweelssen, J.; Blom, P.W.M.


    The effect of on-chain ketone defects on the charge transport of the polyfluorene derivative poly(9,9-dioctylfluorene) (PFO) is investigated. Using MoO3 as ohmic hole contact, the hole transport in a pristine PFO diode is observed to be limited by space-charge, whereas fluorenone contaminated PFO

  19. The Effect of Ketone Defects on the Charge Transport and Charge Recombination in Polyfluorenes

    NARCIS (Netherlands)

    Kuik, Martijn; Wetzelaer, Gert-Jan A. H.; Ladde, Jurre G.; Nicolai, Herman T.; Wildeman, Jurjen; Sweelssen, Jorgen; Blom, Paul W. M.; Sweelssen, Jörgen


    The effect of on-chain ketone defects on the charge transport of the polyfluorene derivative poly(9,9-dioctylfluorene) (PFO) is investigated. Using MoO3 as ohmic hole contact, the hole transport in a pristine PFO diode is observed to be limited by space-charge, whereas fluorenone contaminated PFO

  20. Molecular Level Manipulation of Interfacial Charge Transport (United States)

    Song, Charles Kiseok

    The bulk-heterojunction organic (BHJ) photovoltaics (OPVs) and lithium ion battery (LiB) have been extensively studied. Power conversion efficiency (PCE) of an OPV greater than 10% and utilizing group 4 elements as the anode to accommodate high capacity for LiBs are the goals of many studies. However, the currently ubiquitous hole-collecting layer of OPVs limit device performance and durability, and group 4 elements are unstable and brittle to be commercially produced. Thus, my thesis has focused on developing functional and durable interfacial layers (IFLs) for OPVs and characterizing flexible artificial solid-electrolyte interphase (SEI) for LiBs. In Chapter 2, a series of robust organosilane-based dipolar self-assembled monolayer (SAM) IFLs on the tin-doped indium oxide (ITO) anodes of OPVs are developed. These hydrophobic and amorphous IFLs modify anode work functions from 4.66 to 5.27 eV. Two series of Glass/ITO/SAM IFL/Active Layer/LiF/Al BHJ OPVs are fabricated, and a strong positive correlation between the electrochemically-derived heterogeneous electron transport rate constants (ks) and OPV PCEs are observed due to enhanced anode carrier extraction. In Chapter 3, a series of unusually denser organosilane-based SAM IFLs on ITO anodes of OPVs are developed. Precursor mixtures having short and long tail groups were simultaneously deposited to minimize sterical encumbrance and denser SAM IFLs are achieved. These heterogeneous supersaturated SAMs (SHSAMs), with PCE (7.62%) exceeding that of PEDOT:PSS IFL, are found to be 17% denser and enhances PCE by 54% versus comparable devices with homogeneous SAM IFLs due to enhanced charge selectivity and collection. In Chapter 4, libraries of electron affinities (EAs) of widely used conductive polymers are constructed by cyclic voltammetry (CV) in conventional and LiB media. The EAs of the conductive polymer films measured via CV in conventional (EAC) and Li+ battery (EAB) media could be linearly correlated by EAB = (1

  1. Density functional theory calculations of charge transport properties ...

    Indian Academy of Sciences (India)



    Aug 4, 2017 ... properties of 'plate-like' coronene topological structures ... Keywords. Organic semiconductors; density functional theory; charge carrier mobility; ambipolar transport; ..... nology Department of Sichuan Province (Grant Number.

  2. Symmetrization of mathematical model of charge transport in semiconductors

    Directory of Open Access Journals (Sweden)

    Alexander M. Blokhin


    Full Text Available A mathematical model of charge transport in semiconductors is considered. The model is a quasilinear system of differential equations. A problem of finding an additional entropy conservation law and system symmetrization are solved.

  3. Two-Dimensional Charge Transport in Disordered Organic Semiconductors

    NARCIS (Netherlands)

    Brondijk, J. J.; Roelofs, W. S. C.; Mathijssen, S. G. J.; Shehu, A.; Cramer, T.; Biscarini, F.; Blom, P. W. M.; de Leeuw, D. M.


    We analyze the effect of carrier confinement on the charge-transport properties of organic field-effect transistors. Confinement is achieved experimentally by the use of semiconductors of which the active layer is only one molecule thick. The two-dimensional confinement of charge carriers provides

  4. The charge transport in an electrostatic belt generator

    NARCIS (Netherlands)

    Vermeer, A.; Strasters, B.A.


    The fluctuations in the charge transport system of an EN Tandem Van de Graaff accelerator have been investigated by means of a frequency spectrum analyser. Frequency spectra of the terminal ripple, the short-circuit current and the voltage at the belt charge screen have been measured. Also the

  5. Charge injection and transport in quantum confined and disordered systems

    NARCIS (Netherlands)

    Houtepen, A.J.


    Quantum dots and conducting polymers are modern semiconductors with a high potential for applications such as lasers, LEDs, displays, solar cells etc. These applications require the controlled addition of charge carriers into the material and knowledge of the details of charge transport. This thesis

  6. Role of mesoscopic morphology in charge transport of doped ...

    Indian Academy of Sciences (India)

    In doped polyaniline (PANI), the charge transport properties are determined by mesoscopic morphology, which in turn is controlled by the molecular recognition interactions among polymer chain, dopant and solvent. Molecular recognition plays a significant role in chain conformation and charge delocalization.

  7. Percolative transport in the vicinity of charge-order ferromagnetic ...

    Indian Academy of Sciences (India)

    field driven charge transport in the system is modelled on the basis of an inhomogeneous medium consisting of ... The charge-ordered phase for incommensurate distribution of man- ganese ions (i.e. ... position x = 0.35 measured in a constant voltage mode. The electric ... a drop in resistance on decreasing the temperature.

  8. Charge transport in electrically doped amorphous organic semiconductors. (United States)

    Yoo, Seung-Jun; Kim, Jang-Joo


    This article reviews recent progress on charge generation by doping and its influence on the carrier mobility in organic semiconductors (OSs). The doping induced charge generation efficiency is generally low in OSs which was explained by the integer charge transfer model and the hybrid charge transfer model. The ionized dopants formed by charge transfer between hosts and dopants can act as Coulomb traps for mobile charges, and the presence of Coulomb traps in OSs broadens the density of states (DOS) in doped organic films. The Coulomb traps strongly reduce the carrier hopping rate and thereby change the carrier mobility, which was confirmed by experiments in recent years. In order to fully understand the doping mechanism in OSs, further quantitative and systematic analyses of charge transport characteristics must be accomplished. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Temperature dependent charge transport in poly(3-hexylthiophene) diodes (United States)

    Rahaman, Abdulla Bin; Sarkar, Atri; Banerjee, Debamalya


    In this work, we present charge transport properties of poly(3-hexylthiophene) (P3HT) diodes under dark conditions. Temperature dependent current-voltage (J-V) characteristics shows that charge transport represents a transition from ohomic to trap limited current. The forward current density obeys a power law J˜Vm, m>2 represents the space charge limited current region in presence of traps within the band gap. Frequency dependent conductivity has been studied in a temperature range 150K-473K. The dc conductivity values show Arrhenius like behavior and it gives conductivity activation energy 223 meV. Temperature dependent conductivity indicates a thermodynamic transition of our system.

  10. Charge transport parameters of HBC at different temperatures

    Energy Technology Data Exchange (ETDEWEB)

    Kirkpatrick, J. [Max Planck Institut fuer Polymerforschung, Ackermannweg 10, 55128 Mainz (Germany); Department of Physics, Imperial College London, Prince Consort Road, London SW7 2BW (United Kingdom); Marcon, V.; Kremer, K.; Andrienko, D. [Max Planck Institut fuer Polymerforschung, Ackermannweg 10, 55128 Mainz (Germany); Nelson, J. [Department of Physics, Imperial College London, Prince Consort Road, London SW7 2BW (United Kingdom)


    We study the dependence on temperature of the charge transport parameters for hexabenzocoronene (HBC). Following from Marcus theory, two charge transport parameters will be calculated: the transfer integral and the difference in site energies. These parameters are strongly dependent on the orientation and position of molecules. Position and orientation of molecules are determined using molecular dynamics. Transfer integrals are calculated from a simplified INDO method. A technique to compute energetic disorder, that is the spread in site energies for the charge carriers, is developed. In the herringbone phase transfer integrals are higher, but so is energetic disorder. We consider three derivatives of HBC with different side chains, which lead to different phase behaviour and distributions of charge transport parameters. (copyright 2008 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  11. Production, transport and charge capture measurements of highly charged recoil ions

    International Nuclear Information System (INIS)

    Trebus, U.E.


    An experiment is described to study highly charged recoil ions on-line to the heavy accelerator UNILAC at GSI. The highly charged recoil ions are produced by heavy-ion bombardment of a gas target. Subsequently the slow highly charged recoil ions are extracted from the ionization volume, and guided through a beam transport line to a Wien filter for charge state selection and to a collision region to study charge transfer processes. Several experiments were carried out to show the efficient charge state separation. Charge states up to q = 15 were observed. When using a retarding field analyzer cross sections for single electron capture were determined for different charge states of Xe q+ for q = 4 to 11 and He gas. The experiments demonstrated increasing charge transfer cross sections with increasing charge state q and indicated the effect of near resonant charge capture for q = 6. The flexible data acquisition system used, is described and other future experiments, such as for instance in flight ion-trapping are indicated in the appendix

  12. Effect of surface charge of immortalized mouse cerebral endothelial cell monolayer on transport of charged solutes. (United States)

    Yuan, Wei; Li, Guanglei; Gil, Eun Seok; Lowe, Tao Lu; Fu, Bingmei M


    Charge carried by the surface glycocalyx layer (SGL) of the cerebral endothelium has been shown to significantly modulate the permeability of the blood-brain barrier (BBB) to charged solutes in vivo. The cultured monolayer of bEnd3, an immortalized mouse cerebral endothelial cell line, is becoming a popular in vitro BBB model due to its easy growth and maintenance of many BBB characteristics over repeated passages. To test whether the SGL of bEnd3 monolayer carries similar charge as that in the intact BBB and quantify this charge, which can be characterized by the SGL thickness (L(f)) and charge density (C(mf)), we measured the solute permeability of bEnd3 monolayer to neutral solutes and to solutes with similar size but opposite charges: negatively charged alpha-lactalbumin (-11) and positively charged ribonuclease (+3). Combining the measured permeability data with a transport model across the cell monolayer, we predicted the L(f) and the C(mf) of bEnd3 monolayer, which is approximately 160 nm and approximately 25 mEq/L, respectively. We also investigated whether orosomucoid, a plasma glycoprotein modulating the charge of the intact BBB, alters the charge of bEnd3 monolayer. We found that 1 mg/mL orosomucoid would increase SGL charge density of bEnd3 monolayer to approximately 2-fold of its control value.

  13. Production, transport and charge capture measurements of highly charged recoil ions

    International Nuclear Information System (INIS)

    Trebus, U.E.


    An experiment is described to study highly charged recoil ions on-line to the heavy ion accelerator UNILAC at GSI. The highly charged recoil ions are produced by heavy ion bombardment of a gas target. Subsequently the slow highly charged recoil ions are extracted from the ionization volume, and guided through a beam transport line to a Wien filter for charge state selection and to a collision region to study charge transfer processes. Several experiments were carried out to show the efficient charge state separation. Charge states up to q=15 were observed. When using a retarding field analyzer cross sections for single electron capture were determined for different charge states of Xe q+ for q=4 to 11 and He gas. The experiments demonstrated increasing charge transfer cross sections with increasing charge state q and indicated the effect of near resonant charge capture for q=6. The flexible data acquisition system used, is described and other future experiments, such as for instance in flight ion-trapping are indicated in the appendix. (orig.)

  14. Charge Transport Phenomena in Peptide Molecular Junctions

    International Nuclear Information System (INIS)

    Luchini, A.; Petricoin, E.F.; Geho, D.H.; Liotta, L.A.; Long, D.P.; Vaisman, I.I.


    Inelastic electron tunneling spectroscopy (IETS) is a valuable in situ spectroscopic analysis technique that provides a direct portrait of the electron transport properties of a molecular species. In the past, IETS has been applied to small molecules. Using self-assembled nano electronic junctions, IETS was performed for the first time on a large polypeptide protein peptide in the phosphorylated and native form, yielding interpretable spectra. A reproducible 10-fold shift of the I/V characteristics of the peptide was observed upon phosphorylation. Phosphorylation can be utilized as a site-specific modification to alter peptide structure and thereby influence electron transport in peptide molecular junctions. It is envisioned that kinases and phosphatases may be used to create tunable systems for molecular electronics applications, such as biosensors and memory devices.

  15. Transportable charge in a periodic alternating gradient system

    International Nuclear Information System (INIS)

    Lee, E.P.; Fessenden, T.J.; Laslett, L.J.


    A simple set of formulas is derived which relate emittance, line charge density, matched maximum and average envelope radii, occupancy factors, and the (space charge) depressed and vacuum values of tune. This formulation is an improvement on the smooth limit approximation; deviations from exact (numerically determined) relations are on the order of +-2%, while the smooth limit values are in error by up to +-30%. This transport formalism is used to determine the limits of transportable line charge density in an electrostatic quadrupole array, with specific application to the low energy portion of the High Temperature Experiment of Heavy Ion Fusion Accelerator Research. The line charge density limit is found to be essentially proportional to the voltage on the pole faces and the fraction of occupied aperture area. A finite injection energy (greater than or equal to 2 MeV) is required to realize this limit, independent of particle mass

  16. Solitary Model of the Charge Particle Transport in Collisionless Plasma

    International Nuclear Information System (INIS)

    Simonchik, L.V.; Trukhachev, F.M.


    The one-dimensional MHD solitary model of charged particle transport in plasma is developed. It is shown that self-consistent electric field of ion-acoustic solitons can displace charged particles in space, which can be a reason of local electric current generation. The displacement amount is order of a few Debye lengths. It is shown that the current associated with soliton cascade has pulsating nature with DC component. Methods of built theory verification in dusty plasma are proposed

  17. Charged-particle calculations using Boltzmann transport methods

    International Nuclear Information System (INIS)

    Hoffman, T.J.; Dodds, H.L. Jr.; Robinson, M.T.; Holmes, D.K.


    Several aspects of radiation damage effects in fusion reactor neutron and ion irradiation environments are amenable to treatment by transport theory methods. In this paper, multigroup transport techniques are developed for the calculation of charged particle range distributions, reflection coefficients, and sputtering yields. The Boltzmann transport approach can be implemented, with minor changes, in standard neutral particle computer codes. With the multigroup discrete ordinates code, ANISN, determination of ion and target atom distributions as functions of position, energy, and direction can be obtained without the stochastic error associated with atomistic computer codes such as MARLOWE and TRIM. With the multigroup Monte Carlo code, MORSE, charged particle effects can be obtained for problems associated with very complex geometries. Results are presented for several charged particle problems. Good agreement is obtained between quantities calculated with the multigroup approach and those obtained experimentally or by atomistic computer codes

  18. Charge transport across bulk heterojunction organic thin film

    Energy Technology Data Exchange (ETDEWEB)

    Tessema, Genene [University of Kwazulu-Natal, School of Physics, Scottsville (South Africa); Addis Ababa University, Department of Physics, Addis Ababa (Ethiopia)


    The transport of charges in organic photo-active film has been the focus of tremendous research in the past few decades with the view to understand the physics of the polymers. Bulk heterojunction type devices are particularly more interesting because of their high power conversion efficiency. We have fabricated organic PV cell based on sandwich type ITO/PEDOT:PSS/APFO green-6:PCBM/LiF/Al device structure. The space charge limited currents were investigated to be able to derive important transport parameters of the devices. The measured current agrees very well with trap free space charge limited transport theory. The zero field mobility and field activation factor found from the data were {mu} {sub 0}=(3.39{+-}0.2) x 10{sup -6} m{sup 2}/V sec and {gamma}=(8.3{+-}0.3) x 10{sup -4} (m/V){sup 1/2}, respectively. (orig.)

  19. Modeling charge transport properties of cyano-substituted PPV

    International Nuclear Information System (INIS)

    Correia, Helena M.G.; Ramos, Marta M.D.


    In recent years, poly (p-phenylenevinylene) (PPV) and its derivatives have attracted much interest due to their applications in light-emitting diodes (LEDs). One of the issues that determine device performance is the transport of charge carriers along the polymer strands. For that reason, we investigate the influence of cyano substitution on geometry and electronic behaviour of PPV chains using self-consistent quantum molecular dynamics simulations. Our results suggest that substitution by cyano groups induce distortion in the PPV chains and a charge rearrangement among the polymer atoms. Specifically addressed is the issue concerning estimates of charge (electron and hole) mobility by computer experiments. Significant differences have been found both in the strength of the electric field needed to move positive and negative charge carriers along the polymer chain as well as in charge mobility

  20. Charge transport in a CoPt3 nanocrystal microwire

    International Nuclear Information System (INIS)

    Beecher, P.; De Marzi, G.; Quinn, A.J.; Redmond, G.; Shevchenko, E.V.; Weller, H.


    The electrical characteristics of single CoPt 3 nanocrystal microwires formed by magnetic field-directed growth from colloidal solutions are presented. The wires comprise disordered assemblies of discrete nanocrystals, separated from each other by protective organic ligand shells. Electrical data indicate that the activated charge transport properties of the wires are determined by the nanocrystal charging energy, governed by the size and capacitance of the individual nanocrystals. Focused ion beam-assisted deposition of Pt metal at the wire-electrode junctions is employed to optimize the wire-electrode contacts, whilst maintaining the nanocrystal-dominated transport characteristics of these one-dimensional nanocrystal structures

  1. Charge transport and structure in semimetallic polymers

    DEFF Research Database (Denmark)

    Rudd, Sam; Franco-Gonzalez, Juan F.; Kumar Singh, Sandeep


    Owing to changes in their chemistry and structure, polymers can be fabricated to demonstrate vastly different electrical conductivities over many orders of magnitude. At the high end of conductivity is the class of conducting polymers, which are ideal candidates for many applications in low......-cost electronics. Here, we report the influence of the nature of the doping anion at high doping levels within the semi-metallic conducting polymer poly(3,4-ethylenedioxythiophene) (PEDOT) on its electronic transport properties. Hall effect measurements on a variety of PEDOT samples show that the choice of doping...... that the chosen doping anion modifies the way PEDOT chains stack together. This link between structure and specific anion doping at high doping levels has ramifications for the fabrication of conducting polymer-based devices....

  2. Investigating anomalous transport of electrolytes in charged porous media (United States)

    Skjøde Bolet, Asger Johannes; Mathiesen, Joachim


    Surface charge is know to play an important role in microfluidics devices when dealing with electrolytes and their transport properties. Similarly, surface charge could play a role for transport in porous rock with submicron pore sizes. Estimates of the streaming potentials and electro osmotic are mostly considered in simple geometries both using analytic and numerical tools, however it is unclear at present how realistic complex geometries will modify the dynamics. Our work have focused on doing numerical studies of the full three-dimensional Stokes-Poisson-Nernst-Planck problem for electrolyte transport in porous rock. As the numerical implementation, we have used a finite element solver made using the FEniCS project code base, which can both solve for a steady state configuration and the full transient. In the presentation, we will show our results on anomalous transport due to electro kinetic effects such as the streaming potential or the electro osmotic effect.

  3. Microscopic origins of charge transport in triphenylene systems (United States)

    Thompson, Ian R.; Coe, Mary K.; Walker, Alison B.; Ricci, Matteo; Roscioni, Otello M.; Zannoni, Claudio


    We study the effects of molecular ordering on charge transport at the mesoscale level in a layer of ≈9000 hexa-octyl-thio-triphenylene discotic mesogens with dimensions of ≈20 ×20 ×60 nm3 . Ordered (columnar) and disordered isotropic morphologies are obtained from a combination of atomistic and coarse-grained molecular-dynamics simulations. Electronic structure codes are used to find charge hopping rates at the microscopic level. Energetic disorder is included through the Thole model. Kinetic Monte Carlo simulations then predict charge mobilities. We reproduce the large increase in mobility in going from an isotropic to a columnar morphology. To understand how these mobilities depend on the morphology and hopping rates, we employ graph theory to analyze charge trajectories by representing the film as a charge-transport network. This approach allows us to identify spatial correlations of molecule pairs with high transfer rates. These pairs must be linked to ensure good transport characteristics or may otherwise act as traps. Our analysis is straightforward to implement and will be a useful tool in linking materials to device performance, for example, to investigate the influence of local inhomogeneities in the current density. Our mobility-field curves show an increasing mobility with field, as would be expected for an organic semiconductor.

  4. Diffusive charge transport in graphene on SiO 2 (United States)

    Chen, J.-H.; Jang, C.; Ishigami, M.; Xiao, S.; Cullen, W. G.; Williams, E. D.; Fuhrer, M. S.


    We review our recent work on the physical mechanisms limiting the mobility of graphene on SiO 2. We have used intentional addition of charged scattering impurities and systematic variation of the dielectric environment to differentiate the effects of charged impurities and short-range scatterers. The results show that charged impurities indeed lead to a conductivity linear in density ( σ(n)∝n) in graphene, with a scattering magnitude that agrees quantitatively with theoretical estimates; increased dielectric screening reduces the scattering from charged impurities, but increases the scattering from short-range scatterers. We evaluate the effects of the corrugations (ripples) of graphene on SiO 2 on transport by measuring the height-height correlation function. The results show that the corrugations cannot mimic long-range (charged impurity) scattering effects, and have too small an amplitude-to-wavelength ratio to significantly affect the observed mobility via short-range scattering. Temperature-dependent measurements show that longitudinal acoustic phonons in graphene produce a resistivity that is linear in temperature and independent of carrier density; at higher temperatures, polar optical phonons of the SiO 2 substrate give rise to an activated, carrier density-dependent resistivity. Together the results paint a complete picture of charge carrier transport in graphene on SiO 2 in the diffusive regime.

  5. Charge transport in silicon nanocrystal superlattices in the terahertz regime

    Czech Academy of Sciences Publication Activity Database

    Němec, Hynek; Zajac, Vít; Kužel, Petr; Malý, P.; Gutsch, S.; Hiller, D.; Zacharias, M.


    Roč. 91, č. 19 (2015), "195443-1"-"195443-10" ISSN 1098-0121 R&D Projects: GA ČR GA13-12386S Institutional support: RVO:68378271 Keywords : silicon nanocrystals * charge transport * terahertz spectroscopy Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 3.736, year: 2014

  6. Magnetoresistance and charge transport in graphene governed by nitrogen dopants. (United States)

    Rein, Markus; Richter, Nils; Parvez, Khaled; Feng, Xinliang; Sachdev, Hermann; Kläui, Mathias; Müllen, Klaus


    We identify the influence of nitrogen-doping on charge- and magnetotransport of single layer graphene by comparing doped and undoped samples. Both sample types are grown by chemical vapor deposition (CVD) and transferred in an identical process onto Si/SiO2 wafers. We characterize the samples by Raman spectroscopy as well as by variable temperature magnetotransport measurements. Over the entire temperature range, the charge transport properties of all undoped samples are in line with literature values. The nitrogen doping instead leads to a 6-fold increase in the charge carrier concentration up to 4 × 10(13) cm(-2) at room temperature, indicating highly effective doping. Additionally it results in the opening of a charge transport gap as revealed by the temperature dependence of the resistance. The magnetotransport exhibits a conspicuous sign change from positive Lorentz magnetoresistance (MR) in undoped to large negative MR that we can attribute to the doping induced disorder. At low magnetic fields, we use quantum transport signals to quantify the transport properties. Analyses based on weak localization models allow us to determine an orders of magnitude decrease in the phase coherence and scattering times for doped samples, since the dopants act as effective scattering centers.

  7. On the Structure of the Fixed Charge Transportation Problem (United States)

    Kowalski, K.


    This work extends the theory of the fixed charge transportation problem (FCTP), currently based mostly on a forty-year-old publication by Hirsch and Danzig. This paper presents novel properties that need to be considered by those using existing, or those developing new methods for optimizing FCTP. It also defines the problem in an easier way,…

  8. Charge transport in nanoscale vertical organic semiconductor pillar devices

    NARCIS (Netherlands)

    Wilbers, J.G.E.; Xu, B.; Bobbert, P.A.; de Jong, M.P.; van der Wiel, W.G.


    We report charge transport measurements in nanoscale vertical pillar structures incorporating ultrathin layers of the organic semiconductor poly(3-hexylthiophene) (P3HT). P3HT layers with thickness down to 5 nm are gently top-contacted using wedging transfer, yielding highly reproducible, robust

  9. Charge transport in disordered organic field-effect transistors

    NARCIS (Netherlands)

    Tanase, Cristina; Blom, Paul W.M.; Meijer, Eduard J.; Leeuw, Dago M. de; Jabbour, GE; Carter, SA; Kido, J; Lee, ST; Sariciftci, NS


    The transport properties of poly(2,5-thienylene vinylene) (PTV) field-effect transistors (FET) have been investigated as a function of temperature under controlled atmosphere. In a disordered semiconductor as PTV the charge carrier mobility, dominated by hopping between localized states, is

  10. Ambipolar charge transport in organic field-effect transistors

    NARCIS (Netherlands)

    Smits, E.C.P.; Anthopoulos, T.D.; Setayesh, S.; Veenendaal, van E.; Coehoorn, R.; Blom, P.W.M.; Boer, de B.; Leeuw, de D.M.


    A model describing charge transport in disordered ambipolar organic field-effect transistors is presented. The basis of this model is the variable-range hopping in an exponential density of states developed for disordered unipolar organic transistors. We show that the model can be used to calculate

  11. Charge transport in conjugated polymers: a multiscale picture (United States)

    Ruehle, Victor; Kirkpatrick, James; Kremer, Kurt; Andrienko, Denis


    A framework to study charge transport in conjugated polymers using realistic morphologies is developed. First, the atomistic force field is refined using first-principles calculations. Systematic coarse graining is then performed to extend simulation times and system sizes accessible to molecular dynamics simulations. Material morphologies are generated using the coarse grained and atomistic models. Finally, the charge mobility is obtained using temperature activated hopping picture for charge transport [1]. The framework is tested on neutral and oxidized polypyrrole with different structural ordering [2]. [4pt] [1] J. Kirkpatrick, V. Marcon, J. Nelson, K. Kremer, D. Andrienko, Phys. Rev. Lett. 98, 227402 (2007)[0pt] [2] V. Ruehle, J. Kirkpatrick, K. Kremer, D. Andrienko, Phys. Stat. Solidi B, 245, 844 (2008)

  12. Disorder-tuned charge transport in organic semiconductors (United States)

    Xu, Feng; Qiu, Dong; Yan, Dadong


    We propose that the polaron transport in organic semiconductors is remarkably tuned by the fluctuation of polarization energy. The tuning effect of energetic fluctuation not only causes a continuous transition from non-Arrhenius to Arrhenius temperature activated charge transport with increasing moderate disorder strengths but also results in a band-like conduction in the low disorder regime which benefits from the enhanced mobilities in shallow trap states. As a result, a unified description of polaron transport is obtained for a set of typical organic semiconductors.

  13. Charge transport properties of CdMnTe radiation detectors

    Directory of Open Access Journals (Sweden)

    Prokopovich D. A.


    Full Text Available Growth, fabrication and characterization of indium-doped cadmium manganese telluride (CdMnTe radiation detectors have been described. Alpha-particle spectroscopy measurements and time resolved current transient measurements have yielded an average charge collection efficiency approaching 100 %. Spatially resolved charge collection efficiency maps have been produced for a range of detector bias voltages. Inhomogeneities in the charge transport of the CdMnTe crystals have been associated with chains of tellurium inclusions within the detector bulk. Further, it has been shown that the role of tellurium inclusions in degrading charge collection is reduced with increasing values of bias voltage. The electron drift velocity was calculated from the rise time distribution of the preamplifier output pulses at each measured bias. From the dependence of drift velocity on applied electric field the electron mobility was found to be μn = (718 ± 55 cm2/Vs at room temperature.

  14. Transport and matching of low energy space charge dominated beams

    International Nuclear Information System (INIS)

    Pandit, V.S.


    The transport and matching of low energy high intensity beams from the ion source to the subsequent accelerating structure are of considerable interest in recent years for variety of applications such as Accelerator driven system (ADSS), transmutation of nuclear waste, spallation neutron sources etc. It is essential to perform detailed simulations with experimentation to predict the beam evolution in the presence of nonlinear self as well as external fields before the design of the next accelerating structure is finalized. In order to study and settle various physics and technical issues related with transport of space charge dominated beams we have developed a 2.45 GHz microwave ion source at VECC which is now delivering more than 10 mA proton beam current at 80 keV. We have successfully transported well collimated 8 mA proton beam through the solenoid based 3 meter long transport line and studied various beam properties. We have also studied the transport of beam through spiral inflector at low beam current ∼ 1mA. In this article we will discuss the beam transport issues and describe a technique for simulation of beam envelopes in presence of linear space charge effects. We use canonical description of the motion of a single particle and then obtain first order differential equations for evolution of the moments of beam ensemble by assuming uniform distribution of the beam. We will also discuss the methodology used in the simulations to understand the observed beam behaviour during transport. (author)

  15. Electronic structure and charge transport in nonstoichiometric tantalum oxide (United States)

    Perevalov, T. V.; Gritsenko, V. A.; Gismatulin, A. A.; Voronkovskii, V. A.; Gerasimova, A. K.; Aliev, V. Sh; Prosvirin, I. A.


    The atomic and electronic structure of nonstoichiometric oxygen-deficient tantalum oxide TaO x<2.5 grown by ion beam sputtering deposition was studied. The TaO x film content was analyzed by x-ray photoelectron spectroscopy and by quantum-chemistry simulation. TaO x is composed of Ta2O5, metallic tantalum clusters and tantalum suboxides. A method for evaluating the stoichiometry parameter of TaO x from the comparison of experimental and theoretical photoelectron valence band spectra is proposed. The charge transport properties of TaO x were experimentally studied and the transport mechanism was quantitatively analyzed with four theoretical dielectric conductivity models. It was found that the charge transport in almost stoichiometric and nonstoichiometric tantalum oxide can be consistently described by the phonon-assisted tunneling between traps.

  16. Electrolyte transport in neutral polymer gels embedded with charged inclusions (United States)

    Hill, Reghan


    Ion permeable membranes are the basis of a variety of molecular separation technologies, including ion exchange, gel electrophoresis and dialysis. This work presents a theoretical model of electrolyte transport in membranes comprised of a continuous polymer gel embedded with charged spherical inclusions, e.g., biological cells and synthetic colloids. The microstructure mimics immobilized cell cultures, where electric fields have been used to promote nutrient transport. Because several important characteristics can, in principle, be carefully controlled, the theory provides a quantitative framework to help tailor the bulk properties for enhanced molecular transport, microfluidic pumping, and physicochemical sensing applications. This talk focuses on the electroosmotic flow driven by weak electric fields and electrolyte concentration gradients. Also of importance is the influence of charge on the effective ion diffusion coefficients, bulk electrical conductivity, and membrane diffusion potential.

  17. Ion Transport through Diffusion Layer Controlled by Charge Mosaic Membrane

    Directory of Open Access Journals (Sweden)

    Akira Yamauchi


    Full Text Available The kinetic transport behaviors in near interface of the membranes were studied using commercial anion and cation exchange membrane and charge mosaic membrane. Current-voltage curve gave the limiting current density that indicates the ceiling of conventional flux. From chronopotentiometry above the limiting current density, the transition time was estimated. The thickness of boundary layer was derived with conjunction with the conventional limiting current density and the transition time from steady state flux. On the other hand, the charge mosaic membrane was introduced in order to examine the ion transport on the membrane surface in detail. The concentration profile was discussed by the kinetic transport number with regard to the water dissociation (splitting on the membrane surface.

  18. Organic n-type materials for charge transport and charge storage applications. (United States)

    Stolar, Monika; Baumgartner, Thomas


    Conjugated materials have attracted much attention toward applications in organic electronics in recent years. These organic species offer many advantages as potential replacement for conventional materials (i.e., silicon and metals) in terms of cheap fabrication and environmentally benign devices. While p-type (electron-donating or hole-conducting) materials have been extensively reviewed and researched, their counterpart n-type (electron-accepting or electron-conducting) materials have seen much less popularity despite the greater need for improvement. In addition to developing efficient charge transport materials, it is equally important to provide a means of charge storage, where energy can be used on an on-demand basis. This perspective is focused on discussing a selection of representative n-type materials and the efforts toward improving their charge-transport efficiencies. Additionally, this perspective will also highlight recent organic materials for battery components and the efforts that have been made to improve their environmental appeal.

  19. Bulk-Like Electrical Properties Induced by Contact-Limited Charge Transport in Organic Diodes: Revised Space Charge Limited Current

    KAUST Repository

    Xu, Guangwei; Gao, Nan; Lu, Congyan; Wang, Wei; Ji, Zhuoyu; Bi, Chong; Han, Zhiheng; Lu, Nianduan; Yang, Guanhua; Li, Yuan; Liu, Qi; Li, Ling; Liu, Ming


    , the charge transport properties of organic diodes are usually characterized by probing the current–voltage (I–V) curves of the devices. However, to unveil the landscape of the underlying potential/charge distribution, which essentially determines the I

  20. Charge transport in metal oxide nanocrystal-based materials (United States)

    Runnerstrom, Evan Lars

    There is probably no class of materials more varied, more widely used, or more ubiquitous than metal oxides. Depending on their composition, metal oxides can exhibit almost any number of properties. Of particular interest are the ways in which charge is transported in metal oxides: devices such as displays, touch screens, and smart windows rely on the ability of certain metal oxides to conduct electricity while maintaining visible transparency. Smart windows, fuel cells, and other electrochemical devices additionally rely on efficient transport of ionic charge in and around metal oxides. Colloidal synthesis has enabled metal oxide nanocrystals to emerge as a relatively new but highly tunable class of materials. Certain metal oxide nanocrystals, particularly highly doped metal oxides, have been enjoying rapid development in the last decade. As in myriad other materials systems, structure dictates the properties of metal oxide nanocrystals, but a full understanding of how nanocrystal synthesis, the processing of nanocrystal-based materials, and the structure of nanocrystals relate to the resulting properties of nanocrystal-based materials is still nascent. Gaining a fundamental understanding of and control over these structure-property relationships is crucial to developing a holistic understanding of metal oxide nanocrystals. The unique ability to tune metal oxide nanocrystals by changing composition through the introduction of dopants or by changing size and shape affords a way to study the interplay between structure, processing, and properties. This overall goal of this work is to chemically synthesize colloidal metal oxide nanocrystals, process them into useful materials, characterize charge transport in materials based on colloidal metal oxide nanocrystals, and develop ways to manipulate charge transport. In particular, this dissertation characterizes how the charge transport properties of metal oxide nanocrystal-based materials depend on their processing and

  1. Charge transport properties of CdMnTe radiation detectors

    Energy Technology Data Exchange (ETDEWEB)

    Kim K.; Rafiel, R.; Boardman, M.; Reinhard, I.; Sarbutt, A.; Watt, G.; Watt, C.; Uxa, S.; Prokopovich, D.A.; Belas, E.; Bolotnikov, A.E.; James, R.B.


    Growth, fabrication and characterization of indium-doped cadmium manganese telluride (CdMnTe)radiation detectors have been described. Alpha-particle spectroscopy measurements and time resolved current transient measurements have yielded an average charge collection efficiency approaching 100 %. Spatially resolved charge collection efficiency maps have been produced for a range of detector bias voltages. Inhomogeneities in the charge transport of the CdMnTe crystals have been associated with chains of tellurium inclusions within the detector bulk. Further, it has been shown that the role of tellurium inclusions in degrading chargecollection is reduced with increasing values of bias voltage. The electron transit time was determined from time of flight measurements. From the dependence of drift velocity on applied electric field the electron mobility was found to be n = (718 55) cm2/Vs at room temperature.

  2. Engineering charge transport by heterostructuring solution-processed semiconductors (United States)

    Voznyy, Oleksandr; Sutherland, Brandon R.; Ip, Alexander H.; Zhitomirsky, David; Sargent, Edward H.


    Solution-processed semiconductor devices are increasingly exploiting heterostructuring — an approach in which two or more materials with different energy landscapes are integrated into a composite system. Heterostructured materials offer an additional degree of freedom to control charge transport and recombination for more efficient optoelectronic devices. By exploiting energetic asymmetry, rationally engineered heterostructured materials can overcome weaknesses, augment strengths and introduce emergent physical phenomena that are otherwise inaccessible to single-material systems. These systems see benefit and application in two distinct branches of charge-carrier manipulation. First, they influence the balance between excitons and free charges to enhance electron extraction in solar cells and photodetectors. Second, they promote radiative recombination by spatially confining electrons and holes, which increases the quantum efficiency of light-emitting diodes. In this Review, we discuss advances in the design and composition of heterostructured materials, consider their implementation in semiconductor devices and examine unexplored paths for future advancement in the field.

  3. Charge transport in non-irradiated and irradiated silicon detectors

    International Nuclear Information System (INIS)

    Leroy, C.; Roy, P.; Casse, G.L.; Glaser, M.; Grigoriev, E.; Lemeilleur, F.


    A model describing the transport of the charge carriers generated in n-type silicon detectors by ionizing particles is presented. In order to reproduce the experimental current pulse responses induced by α and β particles in non-irradiated and irradiated detectors up to fluences (PHI) much beyond the n to p-type inversion, an n-type region 15 μm deep is introduced on the p + side of the diode. This model also gives mobilities which decrease linearly up to fluences of around 5x10 13 particles/cm 2 and beyond, converging to saturation values of about 1000 and 450 cm 2 /V s for electrons and holes, respectively. The charge carrier lifetime degradation with increased fluence, due to trapping, is responsible for a predicted charge collection deficit for β particles and for α particles which is found to agree with direct CCE measurements. (author)

  4. An alternative approach to charge transport in semiconducting electrodes (United States)

    Thomchick, J.; Buoncristiani, A. M.


    The excess-carrier charge transport through the space-charge region of a semiconducting electrode is analyzed by a technique known as the flux method. In this approach reflection and transmission coefficients appropriate for a sheet of uniform semiconducting material describe its transport properties. A review is presented of the flux method showing that the results for a semiconductor electrode reduce in a limiting case to those previously found by Gaertner if the depletion layer is treated as a perfectly transmitting medium in which scattering and recombination are ignored. Then, in the framework of the flux method the depletion layer is considered more realistically by explicitly taking into account scattering and recombination processes which occur in this region.

  5. Charge transport in highly efficient iridium cored electrophosphorescent dendrimers (United States)

    Markham, Jonathan P. J.; Samuel, Ifor D. W.; Lo, Shih-Chun; Burn, Paul L.; Weiter, Martin; Bässler, Heinz


    Electrophosphorescent dendrimers are promising materials for highly efficient light-emitting diodes. They consist of a phosphorescent core onto which dendritic groups are attached. Here, we present an investigation into the optical and electronic properties of highly efficient phosphorescent dendrimers. The effect of dendrimer structure on charge transport and optical properties is studied using temperature-dependent charge-generation-layer time-of-flight measurements and current voltage (I-V) analysis. A model is used to explain trends seen in the I-V characteristics. We demonstrate that fine tuning the mobility by chemical structure is possible in these dendrimers and show that this can lead to highly efficient bilayer dendrimer light-emitting diodes with neat emissive layers. Power efficiencies of 20 lm/W were measured for devices containing a second-generation (G2) Ir(ppy)3 dendrimer with a 1,3,5-tris(2-N-phenylbenzimidazolyl)benzene electron transport layer.

  6. On the mechanism of charge transport in low density polyethylene (United States)

    Upadhyay, Avnish K.; Reddy, C. C.


    Polyethylene based polymeric insulators, are being increasingly used in the power industry for their inherent advantages over conventional insulation materials. Specifically, modern power cables are almost made with these materials, replacing the mass-impregnated oil-paper cable technology. However, for ultra-high dc voltage applications, the use of these polymeric cables is hindered by ununderstood charge transport and accumulation. The conventional conduction mechanisms (Pool-Frenkel, Schottky, etc.) fail to track high-field charge transport in low density polyethylene, which is semi-crystalline in nature. Until now, attention was devoted mainly to the amorphous region of the material. In this paper, authors propose a novel mechanism for conduction in low density polyethylene, which could successfully track experimental results. As an implication, a novel, substantial relationship is established for electrical conductivity that could be effectively used for understanding conduction and breakdown in polyethylene, which is vital for successful development of ultra-high voltage dc cables.

  7. Charge-carrier transport in large-area epitaxial graphene

    Energy Technology Data Exchange (ETDEWEB)

    Kisslinger, Ferdinand; Popp, Matthias; Weber, Heiko B. [Lehrstuhl fuer Angewandte Physik, Friedrich-Alexander-Universitaet Erlangen-Nuernberg (FAU), Erlangen (Germany); Jobst, Johannes [Huygens-Kamerlingh Onnes Laboratorium, Leiden Institute of Physics, Leiden University (Netherlands); Shallcross, Sam [Lehrstuhl fuer theoretische Festkoerperphysik, Friedrich-Alexander-Universitaet Erlangen-Nuernberg (FAU), Erlangen (Germany)


    We present an overview of recent charge carrier transport experiments in both monolayer and bilayer graphene, with emphasis on the phenomena that appear in large-area samples. While many aspects of transport are based on quantum mechanical concepts, in the large-area limit classical corrections dominate and shape the magnetoresistance and the tunneling conductance. The discussed phenomena are very general and can, with little modification, be expected in any atomically thin 2D conductor. (copyright 2017 by WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  8. Adiabatic and Nonadiabatic Charge Transport in Li-S Batteries

    DEFF Research Database (Denmark)

    Park, Haesun; Kumar, Nitin; Melander, Marko


    The insulating nature of the redox end members in Li-S batteries, -S and Li2S, has the potential to limit the capacity and efficiency of this emerging energy storage system. Nevertheless, the mechanisms responsible for ionic and electronic transport in these materials remain a matter of debate...... studies, we conclude that low equilibrium carrier concentrations are responsible for sluggish charge transport in -S and Li2S. Thus, a potential strategy for improving the performance of Li-S batteries is to increase the concentrations of holes in these redox end members....

  9. Intrinsic Charge Transport in Organic Field-Effect Transistors (United States)

    Podzorov, Vitaly


    Organic field-effect transistors (OFETs) are essential components of modern electronics. Despite the rapid progress of organic electronics, understanding of fundamental aspects of the charge transport in organic devices is still lacking. Recently, the OFETs based on highly ordered organic crystals have been fabricated with innovative techniques that preserve the high quality of single-crystal organic surfaces. This technological progress facilitated the study of transport mechanisms in organic semiconductors [1-4]. It has been demonstrated that the intrinsic polaronic transport, not dominated by disorder, with a remarkably high mobility of ``holes'' μ = 20 cm^2/Vs can be achieved in these devices at room temperature [4]. The signatures of the intrinsic polaronic transport are the anisotropy of the carrier mobility and an increase of μ with cooling. These and other aspects of the charge transport in organic single-crystal FETs will be discussed. Co-authors are Etienne Menard, University of Illinois at Urbana Champaign; Valery Kiryukhin, Rutgers University; John Rogers, University of Illinois at Urbana Champaign; Michael Gershenson, Rutgers University. [1] V. Podzorov et al., Appl. Phys. Lett. 82, 1739 (2003); ibid. 83, 3504 (2003). [2] V. C. Sundar et al., Science 303, 1644 (2004). [3] R. W. I. de Boer et al., Phys. Stat. Sol. (a) 201, 1302 (2004). [4] V. Podzorov et al., Phys. Rev. Lett. 93, 086602 (2004).

  10. Charge Transport in LDPE Nanocomposites Part I—Experimental Approach

    Directory of Open Access Journals (Sweden)

    Anh T. Hoang


    Full Text Available This work presents results of bulk conductivity and surface potential decay measurements on low-density polyethylene and its nanocomposites filled with uncoated MgO and Al2O3, with the aim to highlight the effect of the nanofillers on charge transport processes. Material samples at various filler contents, up to 9 wt %, were prepared in the form of thin films. The performed measurements show a significant impact of the nanofillers on reduction of material’s direct current (dc conductivity. The investigations thus focused on the nanocomposites having the lowest dc conductivity. Various mechanisms of charge generation and transport in solids, including space charge limited current, Poole-Frenkel effect and Schottky injection, were utilized for examining the experimental results. The mobilities of charge carriers were deduced from the measured surface potential decay characteristics and were found to be at least two times lower for the nanocomposites. The temperature dependencies of the mobilities were compared for different materials.

  11. Observation of quantum interference in molecular charge transport

    DEFF Research Database (Denmark)

    Guedon, Constant M.; Valkenier, Hennie; Markussen, Troels


    for such behaviour has been indirect. Here, we report the observation of destructive quantum interference in charge transport through two-terminal molecular junctions at room temperature. We studied five different rigid p-conjugated molecular wires, all of which form self-assembled monolayers on a gold surface......, and find that the degree of interference can be controlled by simple chemical modifications of the molecular wire....

  12. Three-dimensional charge transport in organic semiconductor single crystals. (United States)

    He, Tao; Zhang, Xiying; Jia, Jiong; Li, Yexin; Tao, Xutang


    Three-dimensional charge transport anisotropy in organic semiconductor single crystals - both plates and rods (above and below, respectively, in the figure) - is measured in well-performing organic field-effect transistors for the first time. The results provide an excellent model for molecular design and device preparation that leads to good performance. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Charge transport through molecular rods with reduced pi-conjugation. (United States)

    Lörtscher, Emanuel; Elbing, Mark; Tschudy, Meinrad; von Hänisch, Carsten; Weber, Heiko B; Mayor, Marcel; Riel, Heike


    A series of oligophenylene rods of increasing lengths is synthesized to investigate the charge-transport mechanisms. Methyl groups are attached to the phenyl rings to weaken the electronic overlap of the pi-subsystems along the molecular backbones. Out-of-plane rotation of the phenyl rings is confirmed in the solid state by means of X-ray analysis and in solution by using UV/Vis spectroscopy. The influence of the reduced pi-conjugation on the resonant charge transport is studied at the single-molecule level by using the mechanically controllable break-junction technique. Experiments are performed under ultra-high-vacuum conditions at low temperature (50 K). A linear increase of the conductance gap with increasing number of phenyl rings (from 260 meV for one ring to 580 meV for four rings) is revealed. In addition, the absolute conductance of the first resonant peaks does not depend on the length of the molecular wire. Resonant transport through the first molecular orbital is found to be dominated by charge-carrier injection into the molecule, rather than by the intrinsic resistance of the molecular wire length.

  14. Charge carrier transport mechanisms in nanocrystalline indium oxide

    International Nuclear Information System (INIS)

    Forsh, E.A.; Marikutsa, A.V.; Martyshov, M.N.; Forsh, P.A.; Rumyantseva, M.N.; Gaskov, A.M.; Kashkarov, P.K.


    The charge transport properties of nanocrystalline indium oxide (In 2 O 3 ) are studied. A number of nanostructured In 2 O 3 samples with various nanocrystal sizes are prepared by sol–gel method and characterized using various techniques. The mean nanocrystals size varies from 7–8 nm to 18–20 nm depending on the conditions of their preparation. Structural characterizations of the In 2 O 3 samples are performed by means of transmission electron microscopy and X-ray diffraction. The analysis of dc and ac conductivity in a wide temperature range (T = 50–300 K) shows that at high temperatures charge carrier transport takes place over conduction band and at low temperatures a variable range hopping transport mechanism can be observed. We find out that the temperature of transition from one mechanism to another depends on nanocrystal size: the transition temperature rises when nanocrystals are bigger in size. The average hopping distance between two sites and the activation energy are calculated basing on the analysis of dc conductivity at low temperature. Using random barrier model we show a uniform hopping mechanism taking place in our samples and conclude that nanocrystalline In 2 O 3 can be regarded as a disordered system. - Highlights: • In 2 O 3 samples with various nanocrystal sizes are prepared by sol–gel method. • The mean nanocrystal size varies from 7–8 nm to 18–20 nm. • At high temperatures charge carrier transport takes place over conduction band. • At low temperatures a variable range hopping transport mechanism can be observed. • We show a uniform hopping mechanism taking place in our samples

  15. Electronic properties of mesoscopic graphene structures: Charge confinement and control of spin and charge transport

    Energy Technology Data Exchange (ETDEWEB)

    Rozhkov, A.V., E-mail: [Advanced Science Institute, RIKEN, Wako-shi, Saitama, 351-0198 (Japan); Institute for Theoretical and Applied Electrodynamics, Russian Academy of Sciences, 125412, Moscow (Russian Federation); Giavaras, G. [Advanced Science Institute, RIKEN, Wako-shi, Saitama, 351-0198 (Japan); Bliokh, Yury P. [Advanced Science Institute, RIKEN, Wako-shi, Saitama, 351-0198 (Japan); Department of Physics, Technion-Israel Institute of Technology, Haifa 32000 (Israel); Freilikher, Valentin [Advanced Science Institute, RIKEN, Wako-shi, Saitama, 351-0198 (Japan); Department of Physics, Bar-Ilan University, Ramat-Gan 52900 (Israel); Nori, Franco [Advanced Science Institute, RIKEN, Wako-shi, Saitama, 351-0198 (Japan); Department of Physics, University of Michigan, Ann Arbor, MI 48109-1040 (United States)


    This brief review discusses electronic properties of mesoscopic graphene-based structures. These allow controlling the confinement and transport of charge and spin; thus, they are of interest not only for fundamental research, but also for applications. The graphene-related topics covered here are: edges, nanoribbons, quantum dots, pn-junctions, pnp-structures, and quantum barriers and waveguides. This review is partly intended as a short introduction to graphene mesoscopics.

  16. Electric generation and ratcheted transport of contact-charged drops (United States)

    Cartier, Charles A.; Graybill, Jason R.; Bishop, Kyle J. M.


    We describe a simple microfluidic system that enables the steady generation and efficient transport of aqueous drops using only a constant voltage input. Drop generation is achieved through an electrohydrodynamic dripping mechanism by which conductive drops grow and detach from a grounded nozzle in response to an electric field. The now-charged drops are transported down a ratcheted channel by contact charge electrophoresis powered by the same voltage input used for drop generation. We investigate how the drop size, generation frequency, and transport velocity depend on system parameters such as the liquid viscosity, interfacial tension, applied voltage, and channel dimensions. The observed trends are well explained by a series of scaling analyses that provide insight into the dominant physical mechanisms underlying drop generation and ratcheted transport. We identify the conditions necessary for achieving reliable operation and discuss the various modes of failure that can arise when these conditions are violated. Our results demonstrate that simple electric inputs can power increasingly complex droplet operations with potential opportunities for inexpensive and portable microfluidic systems.

  17. Bulk-Like Electrical Properties Induced by Contact-Limited Charge Transport in Organic Diodes: Revised Space Charge Limited Current

    KAUST Repository

    Xu, Guangwei


    Charge transport governs the operation and performance of organic diodes. Illuminating the charge-transfer/transport processes across the interfaces and the bulk organic semiconductors is at the focus of intensive investigations. Traditionally, the charge transport properties of organic diodes are usually characterized by probing the current–voltage (I–V) curves of the devices. However, to unveil the landscape of the underlying potential/charge distribution, which essentially determines the I–V characteristics, still represents a major challenge. Here, the electrical potential distribution in planar organic diodes is investigated by using the scanning Kelvin probe force microscopy technique, a method that can clearly separate the contact and bulk regimes of charge transport. Interestingly, by applying to devices based on novel, high mobility organic materials, the space-charge-limited-current-like I–V curves, which are previously believed to be a result of the bulk transport, are surprisingly but unambiguously demonstrated to be caused by contact-limited conduction. A model accounting is developed for the transport properties of both the two metal/organic interfaces and the bulk. The results indicate that pure interface-dominated transport can indeed give rise to I–V curves similar to those caused by bulk transport. These findings provide a new insight into the charge injection and transport processes in organic diodes.

  18. Symposium GC: Nanoscale Charge Transport in Excitonic Solar Cells

    Energy Technology Data Exchange (ETDEWEB)

    Bommisetty, Venkat [Univ. of South Dakota, Vermillion, SD (United States)


    This paper provides a summary only and table of contents of the sessions. Excitonic solar cells, including all-organic, hybrid organic-inorganic and dye-sensitized solar cells (DSSCs), offer strong potential for inexpensive and large-area solar energy conversion. Unlike traditional inorganic semiconductor solar cells, where all the charge generation and collection processes are well understood, these excitonic solar cells contain extremely disordered structures with complex interfaces which results in large variations in nanoscale electronic properties and has a strong influence on carrier generation, transport, dissociation and collection. Detailed understanding of these processes is important for fabrication of highly efficient solar cells. Efforts to improve efficiency are underway at a large number of research groups throughout the world focused on inorganic and organic semiconductors, photonics, photophysics, charge transport, nanoscience, ultrafast spectroscopy, photonics, semiconductor processing, device physics, device structures, interface structure etc. Rapid progress in this multidisciplinary area requires strong synergetic efforts among researchers from diverse backgrounds. Such effort can lead to novel methods for development of new materials with improved photon harvesting and interfacial treatments for improved carrier transport, process optimization to yield ordered nanoscale morphologies with well defined electronic structures.

  19. Stochastic approach and fluctuation theorem for charge transport in diodes (United States)

    Gu, Jiayin; Gaspard, Pierre


    A stochastic approach for charge transport in diodes is developed in consistency with the laws of electricity, thermodynamics, and microreversibility. In this approach, the electron and hole densities are ruled by diffusion-reaction stochastic partial differential equations and the electric field generated by the charges is determined with the Poisson equation. These equations are discretized in space for the numerical simulations of the mean density profiles, the mean electric potential, and the current-voltage characteristics. Moreover, the full counting statistics of the carrier current and the measured total current including the contribution of the displacement current are investigated. On the basis of local detailed balance, the fluctuation theorem is shown to hold for both currents.

  20. SLC injector simulation and tuning for high charge transport

    International Nuclear Information System (INIS)

    Yeremian, A.D.; Miller, R.H.; Clendenin, J.E.; Early, R.A.; Ross, M.C.; Turner, J.L.; Wang, J.W.


    We have simulated the SLC injector from the thermionic gun through the first accelerating section and used the resulting parameters to tune the injector for optimum performance and high charge transport. Simulations are conducted using PARMELA, a three-dimensional ray-trace code with a two-dimensional space-charge model. The magnetic field profile due to the existing magnetic optics is calculated using POISSON, while SUPERFISH is used to calculate the space harmonics of the various bunchers and the accelerator cavities. The initial beam conditions in the PARMELA code are derived from the EGUN model of the gun. The resulting injector parameters from the PARMELA simulation are used to prescribe experimental settings of the injector components. The experimental results are in agreement with the results of the integrated injector model

  1. SLC injector simulation and tuning for high charge transport

    International Nuclear Information System (INIS)

    Yeremian, A.D.; Miller, R.H.; Clendenin, J.E.; Early, R.A.; Ross, M.C.; Turner, J.L.; Wang, J.W.


    We have simulated the SLC injector from the thermionic gun through the first accelerating section and used the resulting parameters to tune the injector for optimum performance and high charge transport. Simulations are conducted using PARMELA, a three-dimensional space-charge model. The magnetic field profile due to the existing magnetic optics is calculated using POISSON, while SUPERFISH is used to calculate the space harmonics of the various bunchers and the accelerator cavities. The initial beam conditions in the PARMELA code are derived from the EGUN model of the gun. The resulting injector parameters from the PARMELA simulation are used to prescribe experimental settings of the injector components. The experimental results are in agreement with the results of the integrated injector model. (Author) 5 figs., 7 refs

  2. Charge transportation in polyaniline/V2O5 composites

    International Nuclear Information System (INIS)

    Huguenin, Fritz; Torresi, Roberto M.


    In this work, composites formed from a mixture of V 2 O 5 and polyaniline (PANI) were investigated, for applications as cathode materials for secondary lithium batteries. Electrochemical quartz crystal microbalance (EQCM) data show that charge compensation in the [PANI] 0.3 V 2 O 5 nanocomposite is achieved predominantly by Li + migration. However, the charge compensation in the [PANI]V 2 O 5 microcomposite occurs by Li + and Cl O 4 - transport. Electrochemical Impedance Spectroscopy (EIS) measurements reveal several benefits of nanohybrid formation, including the achievement of shorter ionic diffusion pathways, the higher diffusion rate of the lithium ion and also the higher electronic conductivity, which are responsible for a synergetic effect of the energy storage properties. (author)

  3. Charge and Spin Transport in Dilute Magnetic Semiconductors. Final report

    International Nuclear Information System (INIS)

    Ullrich, Carsten A.


    This proposal to the DOE outlines a three-year plan of research in theoretical and computational condensed-matter physics, with the aim of developing a microscopic theory for charge and spin dynamics in disordered materials with magnetic impurities. Important representatives of this class of materials are the dilute magnetic semiconductors (DMS), which have attracted great attention as a promising basis for spintronics devices. There is an intense experimental effort underway to study the transport properties of ferromagnetic DMS such as (Ga,Mn)As, and a number of interesting features have emerged: negative magnetoresistance, anomalous Hall effect, non-Drude dynamical conductivity, and resistivity maxima at the Curie temperature. Available theories have been able to account for some of these features, but at present we are still far away from a systematic microscopic understanding of transport in DMS. We propose to address this challenge by developing a theory of charge and spin dynamics based on a combination of the memory-function formalism and time-dependent density functional theory. This approach will be capable of dealing with two important issues: (a) the strong degree of correlated disorder in DMS, close to the localization transition (which invalidates the usual relaxation-time approximation to the Boltzmann equation), (b) the essentially unknown role of dynamical many-body effects such as spin Coulomb drag. We will calculate static and dynamical conductivities in DMS as functions of magnetic order and carrier density, which will advance our understanding of recent transport and infrared absorption measurements. Furthermore, we will study collective plasmon excitations in DMS (3D, 2D and quantum wells), whose linewidths could constitute a new experimental probe of the correlation of disorder, many-body effects and charge and spin dynamics in these materials.

  4. Noise And Charge Transport In Carbon Nanotube Devices (United States)

    Reza, Shahed; Huynh, Quyen T.; Bosman, Gijs; Sippel, Jennifer; Rinzler, Andrew G.


    The charge transport and noise properties of three terminal, gated devices containing multiple, single wall, metallic and semiconductor carbon nanotubes have been measured as a function of gate and drain bias at 300K. Using pulsed bias the metallic tubes could be burned sequentially enabling the separation of measured conductance and low frequency excess noise into metallic and semiconductor contributions. The relative low frequency excess noise of the metallic tubes was about a factor 100 lower than that of the semiconductor tubes, whereas the conductance of the metallic tubes was significantly higher (10 to 50 times) than that of the semiconductor tubes.

  5. Chemical disorder and charge transport in ferromagnetic manganites

    International Nuclear Information System (INIS)

    Pickett, W.E.; Singh, D.J.


    Disorder broadening due to randomly distributed La 3+ and A 2+ (A=Ca,Sr,Ba) cations is combined with a virtual-crystal treatment of the average system to evaluate the effects on both majority and minority transport in the ferromagnetic La 2/3 A 1/3 MnO 3 system. The low-density minority carriers which lie in the band tail are localized by disorder, while the majority carriers retain long mean free paths reflected in the observed strongly metallic conductivity. In addition to obtaining transport parameters, we provide evidence that local distortions are due to nearby ionic charges rather than to ion size considerations. copyright 1997 The American Physical Society

  6. Mass and charge transport in micro and nanofluidic channels

    DEFF Research Database (Denmark)

    Mortensen, Niels Asger; Olesen, Laurits Højgaard; Okkels, Fridolin


    and charge transport coefficients that satisfy Onsager relations. In the limit of nonoverlapping Debye layers the transport coefficients are simply expressed in terms of parameters of the electrolyte as well as the hydraulic radiusR ¼ 2A=P with Aand P being the cross-sectional area and perimeter......, respectively. In particular, we consider the limits of thin nonoverlapping as well as strongly overlapping Debye layers, respectively, and calculate the corrections to the hydraulic resistance due to electrohydrodynamic interactions.......We consider laminar flow of incompressible electrolytes in long, straight channels driven by pressure and electroosmosis. We use aHilbert space eigenfunction expansion to address the general problem of an arbitrary cross section and obtain general results in linear-response theory for the mass...

  7. Simulating charge transport to understand the spectral response of Swept Charge Devices (United States)

    Athiray, P. S.; Sreekumar, P.; Narendranath, S.; Gow, J. P. D.


    Context. Swept Charge Devices (SCD) are novel X-ray detectors optimized for improved spectral performance without any demand for active cooling. The Chandrayaan-1 X-ray Spectrometer (C1XS) experiment onboard the Chandrayaan-1 spacecraft used an array of SCDs to map the global surface elemental abundances on the Moon using the X-ray fluorescence (XRF) technique. The successful demonstration of SCDs in C1XS spurred an enhanced version of the spectrometer on Chandrayaan-2 using the next-generation SCD sensors. Aims: The objective of this paper is to demonstrate validation of a physical model developed to simulate X-ray photon interaction and charge transportation in a SCD. The model helps to understand and identify the origin of individual components that collectively contribute to the energy-dependent spectral response of the SCD. Furthermore, the model provides completeness to various calibration tasks, such as generating spectral matrices (RMFs - redistribution matrix files), estimating efficiency, optimizing event selection logic, and maximizing event recovery to improve photon-collection efficiency in SCDs. Methods: Charge generation and transportation in the SCD at different layers related to channel stops, field zones, and field-free zones due to photon interaction were computed using standard drift and diffusion equations. Charge collected in the buried channel due to photon interaction in different volumes of the detector was computed by assuming a Gaussian radial profile of the charge cloud. The collected charge was processed further to simulate both diagonal clocking read-out, which is a novel design exclusive for SCDs, and event selection logic to construct the energy spectrum. Results: We compare simulation results of the SCD CCD54 with measurements obtained during the ground calibration of C1XS and clearly demonstrate that our model reproduces all the major spectral features seen in calibration data. We also describe our understanding of interactions at

  8. Charge transport properties in microcrystalline KDyFe(China)6

    International Nuclear Information System (INIS)

    Aubert, P.H.; Goubard, F.; Chevrot, C.; Tabuteau, A.


    Microcrystalline solid dysprosium(III) hexacyanoferrate(II) was synthesized by co-precipitation in aqueous solution. The resulting solid has been studied by Fourier transform infrared spectroscopy, X-ray analysis and solid state electrochemistry. The use of a cavity microelectrode was necessary to explore a wide range of time scale and minimize the (undesired) capacitive currents. Cyclic voltametric experiments were very helpful to understand the kinetic of charge transfer in such microstructure. A structure-properties relationship has been established from the crystallographic and the electrochemical properties. A square-scheme is presented to explain the unique electrochemical behavior of hexacyanoferrate containing dysprosium since this compound exhibits a second redox system. The solid presents an open channel-like morphology in which the motion of charged species occurs during the redox processes. Precisely, the electronic transfer is accompanied by a cation diffusion inside the microcrystalline structure. The size of these channels strongly suggests that the kinetic of charge transfer is limited by the cation transport into these structures. - Graphical abstract: Dy and Fe polyhedra packing in the cell of KDyFe(China) 6 .3.5H 2 O shows occluded water molecules and potassium ions forming a pseudohexagonal 2D sub-lattice connected to each other by diffusion channels

  9. Blue Light Emitting Polyphenylene Dendrimers with Bipolar Charge Transport Moieties

    Directory of Open Access Journals (Sweden)

    Guang Zhang


    Full Text Available Two light-emitting polyphenylene dendrimers with both hole and electron transporting moieties were synthesized and characterized. Both molecules exhibited pure blue emission solely from the pyrene core and efficient surface-to-core energy transfers when characterized in a nonpolar environment. In particular, the carbazole- and oxadiazole-functionalized dendrimer (D1 manifested a pure blue emission from the pyrene core without showing intramolecular charge transfer (ICT in environments with increasing polarity. On the other hand, the triphenylamine- and oxadiazole-functionalized one (D2 displayed notable ICT with dual emission from both the core and an ICT state in highly polar solvents. D1, in a three-layer organic light emitting diode (OLED by solution processing gave a pure blue emission with Commission Internationale de l’Éclairage 1931 CIE xy = (0.16, 0.12, a peak current efficiency of 0.21 cd/A and a peak luminance of 2700 cd/m2. This represents the first reported pure blue dendrimer emitter with bipolar charge transport and surface-to-core energy transfer in OLEDs.

  10. Blue Light Emitting Polyphenylene Dendrimers with Bipolar Charge Transport Moieties. (United States)

    Zhang, Guang; Auer-Berger, Manuel; Gehrig, Dominik W; Blom, Paul W M; Baumgarten, Martin; Schollmeyer, Dieter; List-Kratochvil, E J W; Müllen, Klaus


    Two light-emitting polyphenylene dendrimers with both hole and electron transporting moieties were synthesized and characterized. Both molecules exhibited pure blue emission solely from the pyrene core and efficient surface-to-core energy transfers when characterized in a nonpolar environment. In particular, the carbazole- and oxadiazole-functionalized dendrimer ( D1 ) manifested a pure blue emission from the pyrene core without showing intramolecular charge transfer (ICT) in environments with increasing polarity. On the other hand, the triphenylamine- and oxadiazole-functionalized one ( D2 ) displayed notable ICT with dual emission from both the core and an ICT state in highly polar solvents. D1 , in a three-layer organic light emitting diode (OLED) by solution processing gave a pure blue emission with Commission Internationale de l'Éclairage 1931 CIE xy = (0.16, 0.12), a peak current efficiency of 0.21 cd/A and a peak luminance of 2700 cd/m². This represents the first reported pure blue dendrimer emitter with bipolar charge transport and surface-to-core energy transfer in OLEDs.

  11. Simulations of charge transport in organic light emitting diodes

    International Nuclear Information System (INIS)

    Martin, Simon James


    In this thesis, two approaches to the modelling of charge transport in organic light emitting diodes (OLEDs) are presented. The first is a drift-diffusion model, normally used when considering conventional crystalline inorganic semiconductors (e.g. Si or lll-V's) which have well defined energy bands. In this model, electron and hole transport is described using the current continuity equations and the drift-diffusion current equations, and coupled to Poisson's equation. These equations are solved with the appropriate boundary conditions, which for OLEDs are Schottky contacts; carriers are injected by thermionic emission and tunnelling. The disordered nature of the organic semiconductors is accounted for by the inclusion of field-dependent carrier mobilities and Langevin optical recombination. The second approach treats the transport of carriers in disordered organic semi-conductors as a hopping process between spatially and energetically disordered sites. This method has been used previously to account for the observed temperature and electric field dependence of carrier mobilities in disordered organic semiconductors. A hopping transport model has been developed which accounts explicitly for the structure in highly ordered films of rigid rod liquid-crystalline conjugated polymers. Chapter 2 discusses the formation of metal-semiconductor contacts, and current injection processes in OLEDs. If the barrier to carrier injection at a metal-semiconductor contact is small, or the contact is Ohmic, then the current may be space charge limited; this second limiting regime of current flow for OLEDs is also described. The remainder of Chapter 2 describes the drift-diffusion model used in this work in some detail. Chapter 3 contains results obtained from modelling the J-V characteristics of single-layer OLEDs, which are compared to experimental data in order to validate the drift-diffusion model. Chapter 4 contains results of simulating bi-layer OLEDs; rather than examining J

  12. 19 CFR 351.515 - Internal transport and freight charges for export shipments. (United States)


    ... shipments. 351.515 Section 351.515 Customs Duties INTERNATIONAL TRADE ADMINISTRATION, DEPARTMENT OF COMMERCE... Internal transport and freight charges for export shipments. (a) Benefit—(1) In general. In the case of internal transport and freight charges on export shipments, a benefit exists to the extent that the charges...

  13. Charge transport through image charged stabilized states in a single molecule single electron transistor device

    International Nuclear Information System (INIS)

    Hedegard, Per; Bjornholm, Thomas


    The present paper gives an elaborate theoretical description of a new molecular charge transport mechanism applying to a single molecule trapped between two macroscopic electrodes in a solid state device. It is shown by a Hubbard type model of the electronic and electrostatic interactions, that the close proximity of metal electrodes may allow electrons to tunnel from the electrode directly into very localized image charge stabilized states on the molecule. Due to this mechanism, an exceptionally large number of redox states may be visited within an energy scale which would normally not allow the molecular HOMO-LUMO gap to be transversed. With a reasonable set of parameters, a good fit to recent experimental values may be obtained. The theoretical model is furthermore used to search for the physical boundaries of this effect, and it is found that a rather narrow geometrical space is available for the new mechanism to work: in the specific case of oligophenylenevinylene molecules recently explored in such devices several atoms in the terminal benzene rings need to be at van der Waal's distance to the electrode in order for the mechanism to work. The model predicts, that chemisorption of the terminal benzene rings too gold electrodes will impede the image charge effect very significantly because the molecule is pushed away from the electrode by the covalent thiol-gold bond

  14. Charge carrier transport properties in layer structured hexagonal boron nitride

    Directory of Open Access Journals (Sweden)

    T. C. Doan


    Full Text Available Due to its large in-plane thermal conductivity, high temperature and chemical stability, large energy band gap (˜ 6.4 eV, hexagonal boron nitride (hBN has emerged as an important material for applications in deep ultraviolet photonic devices. Among the members of the III-nitride material system, hBN is the least studied and understood. The study of the electrical transport properties of hBN is of utmost importance with a view to realizing practical device applications. Wafer-scale hBN epilayers have been successfully synthesized by metal organic chemical deposition and their electrical transport properties have been probed by variable temperature Hall effect measurements. The results demonstrate that undoped hBN is a semiconductor exhibiting weak p-type at high temperatures (> 700 °K. The measured acceptor energy level is about 0.68 eV above the valence band. In contrast to the electrical transport properties of traditional III-nitride wide bandgap semiconductors, the temperature dependence of the hole mobility in hBN can be described by the form of μ ∝ (T/T0−α with α = 3.02, satisfying the two-dimensional (2D carrier transport limit dominated by the polar optical phonon scattering. This behavior is a direct consequence of the fact that hBN is a layer structured material. The optical phonon energy deduced from the temperature dependence of the hole mobility is ħω = 192 meV (or 1546 cm-1, which is consistent with values previously obtained using other techniques. The present results extend our understanding of the charge carrier transport properties beyond the traditional III-nitride semiconductors.

  15. Vertical Charge Transport and Negative Transconductance in Multilayer Molybdenum Disulfides. (United States)

    Liu, Yuan; Guo, Jian; He, Qiyuan; Wu, Hao; Cheng, Hung-Chieh; Ding, Mengning; Shakir, Imran; Gambin, Vincent; Huang, Yu; Duan, Xiangfeng


    Negative transconductance (NTC) devices have been heavily investigated for their potential in low power logical circuit, memory, oscillating, and high-speed switching applications. Previous NTC devices are largely attributed to two working mechanisms: quantum mechanical tunneling, and mobility degradation at high electrical field. Herein we report a systematic investigation of charge transport in multilayer two-dimensional semiconductors (2DSCs) with optimized van der Waals contact and for the first time demonstrate NTC and antibipolar characteristics in multilayer 2DSCs (such as MoS 2 , WSe 2 ). By varying the measurement temperature, bias voltage, and body thickness, we found the NTC behavior can be attributed to a vertical potential barrier in the multilayer 2DSCs and the competing mechanisms between intralayer lateral transport and interlayer vertical transport, thus representing a new working mechanism for NTC operation. Importantly, this vertical potential barrier arises from inhomogeneous carrier distribution in 2DSC from the near-substrate region to the bulk region, which is in contrast to conventional semiconductors with homogeneous doping defined by bulk dopants. We further show that the unique NTC behavior can be explored for creating frequency doublers and phase shift keying circuits with only one transistor, greatly simplifying the circuit design compared to conventional technology.

  16. Ionic charge transport in strongly structured molten salts

    International Nuclear Information System (INIS)

    Tatlipinar, H.; Amoruso, M.; Tosi, M.P.


    Data on the d.c. ionic conductivity for strongly structured molten halides of divalent and trivalent metals near freezing are interpreted as mainly reflecting charge transport by the halogen ions. On this assumption the Nernst-Einstein relation allows an estimate of the translational diffusion coefficient D tr of the halogen. In at least one case (molten ZnCl 2 ) D tr is much smaller than the measured diffusion coefficient, pointing to substantial diffusion via neutral units. The values of D tr estimated from the Nernst-Einstein relation are analyzed on the basis of a model involving two parameters, i.e. a bond-stretching frequency ω and an average waiting time τ. With the help of Raman scattering data for ω, the values of τ are evaluated and found to mostly lie in the range 0.02 - 0.3 ps for a vast class of materials. (author)

  17. Fundamentals of charged particle transport in gases and condensed matter

    CERN Document Server

    Robson, Robert E; Hildebrandt, Malte


    This book offers a comprehensive and cohesive overview of transport processes associated with all kinds of charged particles, including electrons, ions, positrons, and muons, in both gases and condensed matter. The emphasis is on fundamental physics, linking experiment, theory and applications. In particular, the authors discuss: The kinetic theory of gases, from the traditional Boltzmann equation to modern generalizations A complementary approach: Maxwell’s equations of change and fluid modeling Calculation of ion-atom scattering cross sections Extension to soft condensed matter, amorphous materials Applications: drift tube experiments, including the Franck-Hertz experiment, modeling plasma processing devices, muon catalysed fusion, positron emission tomography, gaseous radiation detectors Straightforward, physically-based arguments are used wherever possible to complement mathematical rigor.

  18. Quantized charge transport in chiral Majorana edge modes (United States)

    Rachel, Stephan; Mascot, Eric; Cocklin, Sagen; Vojta, Matthias; Morr, Dirk K.


    Majorana fermions can be realized as quasiparticles in topological superconductors, with potential applications in topological quantum computing. Recently, lattices of magnetic adatoms deposited on the surface of s -wave superconductors—Shiba lattices—have been proposed as a new platform for topological superconductivity. These systems possess the great advantage that they are accessible via scanning-probe techniques and thus enable the local manipulation and detection of Majorana modes. Using a nonequilibrium Green's function technique we demonstrate that the topological Majorana edge modes of nanoscopic Shiba islands display universal electronic and transport properties. Most remarkably, these Majorana modes possess a quantized charge conductance that is proportional to the topological Chern number, C , and carry a supercurrent whose chirality reflects the sign of C . These results establish nanoscopic Shiba islands as promising components in future topology-based devices.

  19. Charge transport through superconductor/Anderson-insulator interfaces

    International Nuclear Information System (INIS)

    Frydman, A.; Ovadyahu, Z.


    We report on a study of charge transport through superconductor-insulator-superconductor and normal metal endash insulator endash superconductor structures (SIS and NIS junctions, respectively) where the insulator is of the Anderson type. Devices which are characterized by a junction resistance larger than 10 kΩ show behavior which is typical of Giaever tunnel junctions. In structures having smaller resistance, several peculiar features are observed. In the SIS junctions, Josephson coupling is detected over distances much larger then the typical insulator localization length. In addition, a series of resistance peaks appears at voltages of 2Δ/n, where Δ is the superconducting gap. The NIS Junctions exhibit a large resistance dip at subgap bias. We discuss possible interpretations of these findings and suggest that they may result from the presence of high transmission channels through the barrier region. copyright 1997 The American Physical Society

  20. DNA Charge Transport: From Chemical Principles to the Cell (United States)

    Arnold, Anna R.; Grodick, Michael A.; Barton, Jacqueline K.


    The DNA double helix has captured the imagination of many, bringing it to the forefront of biological research. DNA has unique features that extend our interest into areas of chemistry, physics, material science and engineering. Our laboratory has focused on studies of DNA charge transport (CT), wherein charges can efficiently travel long molecular distances through the DNA helix while maintaining an exquisite sensitivity to base pair π-stacking. Because DNA CT chemistry reports on the integrity of the DNA duplex, this property may be exploited to develop electrochemical devices to detect DNA lesions and DNA-binding proteins. Furthermore, studies now indicate that DNA CT may also be used in the cell by, for example, DNA repair proteins, as a cellular diagnostic, in order to scan the genome to localize efficiently to damage sites. In this review, we describe this evolution of DNA CT chemistry from the discovery of fundamental chemical principles to applications in diagnostic strategies and possible roles in biology. PMID:26933744

  1. The thermoballistic transport model a novel approach to charge carrier transport in semiconductors

    CERN Document Server

    Lipperheide, Reinhard


    The book presents a comprehensive survey of the thermoballistic approach to charge carrier transport in semiconductors. This semi-classical approach, which the authors have developed over the past decade, bridges the gap between the opposing drift-diffusion and ballistic  models of carrier transport. While incorporating basic features of the latter two models, the physical concept underlying the thermoballistic approach constitutes a novel, unifying scheme. It is based on the introduction of "ballistic configurations" arising from a random partitioning of the length of a semiconducting sample into ballistic transport intervals. Stochastic averaging of the ballistic carrier currents over the ballistic configurations results in a position-dependent thermoballistic current, which is the key element of the thermoballistic concept and forms  the point of departure for the calculation of all relevant transport properties. In the book, the thermoballistic concept and its implementation are developed in great detai...

  2. Charge injection and transport properties of an organic light-emitting diode

    Directory of Open Access Journals (Sweden)

    Peter Juhasz


    Full Text Available The charge behavior of organic light emitting diode (OLED is investigated by steady-state current–voltage technique and impedance spectroscopy at various temperatures to obtain activation energies of charge injection and transport processes. Good agreement of activation energies obtained by steady-state and frequency-domain was used to analyze their contributions to the charge injection and transport. We concluded that charge is injected into the OLED device mostly through the interfacial states at low voltage region, whereas the thermionic injection dominates in the high voltage region. This comparison of experimental techniques demonstrates their capabilities of identification of major bottleneck of charge injection and transport.

  3. Metal Oxides as Efficient Charge Transporters in Perovskite Solar Cells

    KAUST Repository

    Haque, Mohammed


    Over the past few years, hybrid halide perovskites have emerged as a highly promising class of materials for photovoltaic technology, and the power conversion efficiency of perovskite solar cells (PSCs) has accelerated at an unprecedented pace, reaching a record value of over 22%. In the context of PSC research, wide-bandgap semiconducting metal oxides have been extensively studied because of their exceptional performance for injection and extraction of photo-generated carriers. In this comprehensive review, we focus on the synthesis and applications of metal oxides as electron and hole transporters in efficient PSCs with both mesoporous and planar architectures. Metal oxides and their doped variants with proper energy band alignment with halide perovskites, in the form of nanostructured layers and compact thin films, can not only assist with charge transport but also improve the stability of PSCs under ambient conditions. Strategies for the implementation of metal oxides with tailored compositions and structures, and for the engineering of their interfaces with perovskites will be critical for the future development and commercialization of PSCs.

  4. New organic photorefractive material composed of a charge-transporting dendrimer and a stilbene chromophore (United States)

    Bai, Jaeil; Ducharme, Stephen; Leonov, Alexei G.; Lu, Liu; Takacs, James M.


    In this report, we introduce new organic photorefractive composites consisting of charge transporting den-drimers highly doped with a stilbene nonlinear optic chromophore, The purpose of making these composites is to improve charge transport, by reducing inhomogeneity when compared to ordinary polymer-based systems. Because the structure of this material gives us freedom to control the orientation of charge transport agents synthetically, we can study the charge transport mechanism more systematically than in polymers. We discuss this point and present the characterization results for this material.

  5. Charge transport models for reliability engineering of semiconductor devices

    International Nuclear Information System (INIS)

    Bina, M.


    The simulation of semiconductor devices is important for the assessment of device lifetimes before production. In this context, this work investigates the influence of the charge carrier transport model on the accuracy of bias temperature instability and hot-carrier degradation models in MOS devices. For this purpose, a four-state defect model based on a non-radiative multi phonon (NMP) theory is implemented to study the bias temperature instability. However, the doping concentrations typically used in nano-scale devices correspond to only a small number of dopants in the channel, leading to fluctuations of the electrostatic potential. Thus, the granularity of the doping cannot be ignored in these devices. To study the bias temperature instability in the presence of fluctuations of the electrostatic potential, the advanced drift diffusion device simulator Minimos-NT is employed. In a first effort to understand the bias temperature instability in p-channel MOSFETs at elevated temperatures, data from direct-current-current-voltage measurements is successfully reproduced using a four-state defect model. Differences between the four-state defect model and the commonly employed trapping model from Shockley, Read and Hall (SRH) have been investigated showing that the SRH model is incapable of reproducing the measurement data. This is in good agreement with the literature, where it has been extensively shown that a model based on SRH theory cannot reproduce the characteristic time constants found in BTI recovery traces. Upon inspection of recorded recovery traces after bias temperature stress in n-channel MOSFETs it is found that the gate current is strongly correlated with the drain current (recovery trace). Using a random discrete dopant model and non-equilibrium greens functions it is shown that direct tunnelling cannot explain the magnitude of the gate current reduction. Instead it is found that trap-assisted tunnelling, modelled using NMP theory, is the cause of this

  6. Longitudinal and transverse space charge limitations on transport of maximum power beams

    International Nuclear Information System (INIS)

    Khoe, T.K.; Martin, R.L.


    The maximum transportable beam power is a critical issue in selecting the most favorable approach to generating ignition pulses for inertial fusion with high energy accelerators. Maschke and Courant have put forward expressions for the limits on transport power for quadrupole and solenoidal channels. Included in a more general way is the self consistent effect of space charge defocusing on the power limit. The results show that no limits on transmitted power exist in principal. In general, quadrupole transport magnets appear superior to solenoids except for transport of very low energy and highly charged particles. Longitudinal space charge effects are very significant for transport of intense beams

  7. STM and transport measurements of highly charged ion modified materials

    International Nuclear Information System (INIS)

    Pomeroy, J.M.; Grube, H.; Perrella, A.C.; Gillaspy, J.D.


    Careful measurements of highly charged ions (HCIs) colliding with gases and surfaces have provided glimpses of intense electronic interactions, but a comprehensive model for the interaction mechanisms, time scales, and resultant nano-features that bridges materials systems is yet to be realized. At the National Institute of Standards and Technology (NIST) electron beam ion trap (EBIT) facility, new apparatus is now connected to the HCI beamline to allow preparation of clean, atomically flat surfaces of single crystals, e.g. gold, tungsten and silicon, and deposition and patterning of thin films, e.g. high resistivity oxides, ferromagnetic metals, normal metals and superconductors. Experiments reported here focus on the electronic and morphological structure of HCI induced nano-features. Current activities are focused on using in situ scanning tunneling microscope (STM) on Au(1 1 1) and (separately) ex situ transport measurements to study electronic properties within HCI modified magnetic multilayer systems. Specifically, we are fabricating magnetic multilayers similar to magnetic tunnel junctions (MTJs) (important in advanced magnetic field sensors and superconducting Josephson junction devices) and using HCIs to adjust critical electronic properties. The electrical response of the tunnel junction to HCIs provides a novel approach to performing HCI-induced nanostructure ensemble measurements

  8. Controllable spin-charge transport in strained graphene nanoribbon devices

    Energy Technology Data Exchange (ETDEWEB)

    Diniz, Ginetom S., E-mail:; Guassi, Marcos R. [Institute of Physics, University of Brasília, 70919-970, Brasília-DF (Brazil); Qu, Fanyao [Institute of Physics, University of Brasília, 70919-970, Brasília-DF (Brazil); Department of Physics, The University of Texas at Austin, Austin, Texas 78712 (United States)


    We theoretically investigate the spin-charge transport in two-terminal device of graphene nanoribbons in the presence of a uniform uniaxial strain, spin-orbit coupling, exchange field, and smooth staggered potential. We show that the direction of applied strain can efficiently tune strain-strength induced oscillation of band-gap of armchair graphene nanoribbon (AGNR). It is also found that electronic conductance in both AGNR and zigzag graphene nanoribbon (ZGNR) oscillates with Rashba spin-orbit coupling akin to the Datta-Das field effect transistor. Two distinct strain response regimes of electronic conductance as function of spin-orbit couplings magnitude are found. In the regime of small strain, conductance of ZGNR presents stronger strain dependence along the longitudinal direction of strain. Whereas for high values of strain shows larger effect for the transversal direction. Furthermore, the local density of states shows that depending on the smoothness of the staggered potential, the edge states of AGNR can either emerge or be suppressed. These emerging states can be determined experimentally by either spatially scanning tunneling microscope or by scanning tunneling spectroscopy. Our findings open up new paradigms of manipulation and control of strained graphene based nanostructure for application on novel topological quantum devices.

  9. Mass and charge transport in IPMC actuators with fractal interfaces (United States)

    Chang, Longfei; Wu, Yucheng; Zhu, Zicai; Li, Heng


    Ionic Polymer-Metal Composite (IPMC) actuators have been attracting a growing interest in extensive applications, which consequently raises the demands on the accuracy of its theoretical modeling. For the last few years, rough landscape of the interface between the electrode and the ionic membrane of IPMC has been well-documented as one of the key elements to ensure a satisfied performance. However, in most of the available work, the interface morphology of IPMC was simplified with structural idealization, which lead to perplexity in the physical interpretation on its interface mechanism. In this paper, the quasi-random rough interface of IPMC was described with fractal dimension and scaling parameters. And the electro-chemical field was modeled by Poisson equation and a properly simplified Nernst-Planck equation set. Then, by simulation with Finite Element Method, a comprehensive analysis on he inner mass and charge transportation in IPMC actuators with different fractal interfaces was provided, which may be further adopted to instruct the performance-oriented interface design for ionic electro-active actuators. The results also verified that rough interface can impact the electrical and mechanical response of IPMC, not only from the respect of the real surface increase, but also from mass distribution difference caused by the complexity of the micro profile.

  10. Short chain molecular junctions: Charge transport versus dipole moment

    International Nuclear Information System (INIS)

    Ikram, I. Mohamed; Rabinal, M.K.


    Graphical abstract: - Highlights: • The role of dipole moment of organic molecules on molecular junctions has been studied. • Molecular junctions constituted using propargyl molecules of different dipole moments. • The electronic properties of the molecules were calculated using Gaussian software. • Junctions show varying rectification due to their varying dipole moment and orientation. - Abstract: The investigation of the influence of dipole moment of short chain organic molecules having three carbon atoms varying in end group on silicon surface was carried on. Here, we use three different molecules of propargyl series varying in dipole moment and its orientation to constitute molecular junctions. The charge transport mechanism in metal–molecules–semiconductor (MMS) junction obtained from current–voltage (I–V) characteristics shows the rectification behavior for two junctions whereas the other junction shows a weak rectification. The electronic properties of the molecules were calculated using Gaussian software package. The observed rectification behavior of these junctions is examined and found to be accounted to the orientation of dipole moment and electron cloud density distribution inside the molecules

  11. Charge and energy transports via poly-phenylacetylene based dendrimers (United States)

    Shin, Yongwoo; Li, Minghai; Lin, Xi


    Poly-Phenylacetylene (PPA) is widely used in photoconductivity, photoluminescence, and light harvesting applications. In this work, we investigate the charge and exciton transport energetics and mechanisms in the PPA-based dendrimers using our recently developed adapted Su-Schrieffer-Heeger (SSH) model Hamiltonians and ab initio Hartree-Fock (HF) calculations. We found both doping and photo-excitation lead to the formation of optical phonon dressed pi electron states, namely the self-localized polarons, in the energy gap. Independent from their origins, these polarons can be self-trapped at multiple lattice locations along the PPA chain, and migrate from one to the next with an activation barrier of ˜0.006 eV, slightly higher than the corresponding barrier found in trans-polyacetylene. The PPA-based dendrimers can be constructed via the meta-positions of phenyl rings. In this case, we found the dendrimer junctions form attractive potential wells for both polarons and excitons, and the width and height of these junction potential wells can be controlled by the geometry of the dendrimers.

  12. Spokes and charged particle transport in HiPIMS magnetrons

    International Nuclear Information System (INIS)

    Brenning, N; Lundin, D; Minea, T; Vitelaru, C; Costin, C


    Two separate scientific communities are shown to have studied one common phenomenon, azimuthally rotating dense plasma structures, also called spokes, in pulsed-power E × B discharges, starting from quite different approaches. The first body of work is motivated by fundamental plasma science and concerns a phenomenon called the critical ionization velocity, CIV, while the other body of work is motivated by the applied plasma science of high power impulse magnetron sputtering (HiPIMS). Here we make use of this situation by applying experimental observations, and theoretical analysis, from the CIV literature to HiPIMS discharges. For a practical example, we take data from observed spokes in HiPIMS discharges and focus on their role in charged particle transport, and in electron energization. We also touch upon the closely related questions of how they channel the cross-B discharge current, how they maintain their internal potential structure and how they influence the energy spectrum of the ions? New particle-in-cell Monte Carlo collisional simulations that shed light on the azimuthal drift and expansion of the spokes are also presented. (paper)

  13. High-frequency acoustic charge transport in GaAs nanowires

    NARCIS (Netherlands)

    Büyükköse, S.; Hernandez-Minguez, A.; Vratzov, B.; Somaschini, C.; Geelhaar, L.; Riechert, H.; van der Wiel, Wilfred Gerard; Santos, P.V.


    The oscillating piezoelectric fields accompanying surface acoustic waves are able to transport charge carriers in semiconductor heterostructures. Here, we demonstrate high-frequency (above 1 GHz) acoustic charge transport in GaAs-based nanowires deposited on a piezoelectric substrate. The short

  14. Charge transport model in nanodielectric composites based on quantum tunneling mechanism and dual-level traps

    Energy Technology Data Exchange (ETDEWEB)

    Li, Guochang; Chen, George, E-mail:, E-mail: [State Key Laboratory of Electrical Insulation and Power Equipment, Xi' an Jiaotong University, Xi' an 710049 (China); School of Electronic and Computer Science, University of Southampton, Southampton SO17 1BJ (United Kingdom); Li, Shengtao, E-mail:, E-mail: [State Key Laboratory of Electrical Insulation and Power Equipment, Xi' an Jiaotong University, Xi' an 710049 (China)


    Charge transport properties in nanodielectrics present different tendencies for different loading concentrations. The exact mechanisms that are responsible for charge transport in nanodielectrics are not detailed, especially for high loading concentration. A charge transport model in nanodielectrics has been proposed based on quantum tunneling mechanism and dual-level traps. In the model, the thermally assisted hopping (TAH) process for the shallow traps and the tunnelling process for the deep traps are considered. For different loading concentrations, the dominant charge transport mechanisms are different. The quantum tunneling mechanism plays a major role in determining the charge conduction in nanodielectrics with high loading concentrations. While for low loading concentrations, the thermal hopping mechanism will dominate the charge conduction process. The model can explain the observed conductivity property in nanodielectrics with different loading concentrations.

  15. Role of transport band edge variation on delocalized charge transport in high-mobility crystalline organic semiconductors (United States)

    Kadashchuk, Andrey; Tong, Fei; Janneck, Robby; Fishchuk, Ivan I.; Mityashin, Alexander; Pavlica, Egon; Köhler, Anna; Heremans, Paul; Rolin, Cedric; Bratina, Gvido; Genoe, Jan


    We demonstrate that the degree of charge delocalization has a strong impact on polarization energy and thereby on the position of the transport band edge in organic semiconductors. This gives rise to long-range potential fluctuations, which govern the electronic transport through delocalized states in organic crystalline layers. This concept is employed to formulate an analytic model that explains a negative field dependence coupled with a positive temperature dependence of the charge mobility observed by a lateral time-of-flight technique in a high-mobility crystalline organic layer. This has important implications for the further understanding of the charge transport via delocalized states in organic semiconductors.

  16. DNA-mediated gene transfer into ataxia-telangiectasia cells

    International Nuclear Information System (INIS)

    Crescenzi, M.; Pulciani, S.; Carbonari, M.; Tedesco, L.; Russo, G.; Gaetano, C.; Fiorilli, M.


    The complete description of the genetic lesion(s) underlying the AT mutation might, therefore, highlight not only a DNA-repair pathwa, but also an important aspect of the physiology of lymphocytes. DNA-mediated gene transfer into eukaryotic cells has proved a powerful tool for the molecular cloning of certain mammalian genes. The possibility to clone a given gene using this technology depends, basically, on the availability of a selectable marker associated with the expression of the transfected gene in the recipient cell. Recently, a human DNA repair gene has been cloned in CHO mutant cells by taking advantage of the increased resistance to ultraviolet radiation of the transformants. As a preliminary step toward the molecular cloning of the AT gene(s), the authors have attempted to confer radioresistance to AT cells by transfection with normal human DNA

  17. Beamline for low-energy transport of highly charged ions at HITRAP

    International Nuclear Information System (INIS)

    Andelkovic, Z.; Herfurth, F.; Kotovskiy, N.; König, K.; Maaß, B.; Murböck, T.; Neidherr, D.; Schmidt, S.; Steinmann, J.; Vogel, M.; Vorobjev, G.


    A beamline for transport of highly charged ions with energies as low as a few keV/charge has been constructed and commissioned at GSI. Complementary to the existing infrastructure of the HITRAP facility for deceleration of highly charged ions from the GSI accelerator, the new beamline connects the HITRAP ion decelerator and an EBIT with the associated experimental setups. Therefore, the facility can now transport the decelerated heavy highly charged ions to the experiments or supply them offline with medium-heavy highly charged ions from the EBIT, both at energies as low as a few keV/charge. Here we present the design of the 20 m long beamline with the corresponding beam instrumentation, as well as its performance in terms of energy and transport efficiency

  18. The Effect of Voltage Charging on the Transport Properties of Gold Nanotube Membranes. (United States)

    Experton, Juliette; Martin, Charles R


    Porous membranes are used in chemical separations and in many electrochemical processes and devices. Research on the transport properties of a unique class of porous membranes that contain monodisperse gold nanotubes traversing the entire membrane thickness is reviewed here. These gold nanotubes can act as conduits for ionic and molecular transports through the membrane. Because the tubes are electronically conductive, they can be electrochemically charged by applying a voltage to the membrane. How this "voltage charging" affects the transport properties of gold nanotube membranes is the subject of this Review. Experiments showing that voltage charging can be used to reversibly switch the membrane between ideally cation- and anion-transporting states are reviewed. Voltage charging can also be used to enhance the ionic conductivity of gold nanotube membranes. Finally, voltage charging to accomplish electroporation of living bacteria as they pass through gold nanotube membranes is reviewed. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. EDITORIAL: Charge transport in non-metallic solids (United States)

    Youngs, Ian J.; Almond, Darryl P.


    Workers engaged in a wide range of investigations of charge transport in non-metallic solids came together at a meeting of the Institute of Physics Dielectric Group, held in London on 2 April 2008. Topics included both ionic and electronic conduction, investigations of the fundamental mechanisms of charge transport, percolation, modelling the conduction process in both natural and man-made composite electrical and electromagnetic materials, the design and development of solids with specified conduction properties and the ac characteristics of non-metallic solids. In the first session, the long-standing problem of the anomalous power law increase in ac conductivity with frequency was addressed by a set of four presentations. Jeppe Dyre, an invited speaker from Roskilde University, Denmark, introduced the problem and stressed the universality of the frequency dependence observed in the ac conductivities of disordered non-metallic materials. He showed that it could be obtained from a simple random barrier model, independent of the barrier distribution. Darryl Almond, University of Bath, showed that the electrical responses of large networks of randomly positioned resistors and capacitors, simulating the microstructures of disordered two-phase (conductor insulator) materials, exhibit the same frequency dependence. He demonstrated their robustness to component value and distribution and suggested that it was an emergent property of these networks and of two-phase materials. Klaus Funke, an invited speaker from the University of Munster, Germany, presented a detailed model of ion motion in disordered ionic materials. He stressed the need to account for the concerted many-particle processes that occur whilst ions hop from site to site in response to an applied electric field. The conductivity spectra obtained from this work reproduce the same frequency dispersion and have the additional feature of conductivity saturation at high frequencies. Tony West, University of

  20. Semiconductor drift chamber: an application of a novel charge transport scheme

    International Nuclear Information System (INIS)

    Gatti, E.; Rehak, P.


    The purpose of this paper is to describe a novel charge tranport scheme in semiconductors in which the field responsible for the charge transport is independent of the depletion field. The application of the novel charge transport scheme leads to the following new semiconductor detectors: (1) Semiconductor Draft Chamber; (2) Ultra low capacitance - large semiconductor x-ray spectrometers and photodiodes; and (3) Fully depleted thick CCD. Special attention is paid to the concept of the Semiconductor Draft Chamber as a position sensing detector for high energy charged particles. Position resolution limiting factors are considered, and the values of the resolutions are given

  1. Numerical computation of discrete differential scattering cross sections for Monte Carlo charged particle transport

    International Nuclear Information System (INIS)

    Walsh, Jonathan A.; Palmer, Todd S.; Urbatsch, Todd J.


    Highlights: • Generation of discrete differential scattering angle and energy loss cross sections. • Gauss–Radau quadrature utilizing numerically computed cross section moments. • Development of a charged particle transport capability in the Milagro IMC code. • Integration of cross section generation and charged particle transport capabilities. - Abstract: We investigate a method for numerically generating discrete scattering cross sections for use in charged particle transport simulations. We describe the cross section generation procedure and compare it to existing methods used to obtain discrete cross sections. The numerical approach presented here is generalized to allow greater flexibility in choosing a cross section model from which to derive discrete values. Cross section data computed with this method compare favorably with discrete data generated with an existing method. Additionally, a charged particle transport capability is demonstrated in the time-dependent Implicit Monte Carlo radiative transfer code, Milagro. We verify the implementation of charged particle transport in Milagro with analytic test problems and we compare calculated electron depth–dose profiles with another particle transport code that has a validated electron transport capability. Finally, we investigate the integration of the new discrete cross section generation method with the charged particle transport capability in Milagro.

  2. Charge Injection and Transport in Metal/Polymer Chains/Metal Sandwich Structure

    International Nuclear Information System (INIS)

    Hai-Hong, Li; Dong-Mei, Li; Yuan, Li; Kun, Gao; De-Sheng, Liu; Shi-Jie, Xie


    Using the tight-binding Su–Schrieffer–Heeger model and a nonadiabatic dynamic evolution method, we study the dynamic processes of the charge injection and transport in a metal/two coupled conjugated polymer chains/metal structure. It is found that the charge interchain transport is determined by the strength of the electric field and the magnitude of the voltage bias applied on the metal electrode. The stronger electric field and the larger voltage bias are both in favour of the charge interchain transport. (condensed matter: electronic structure, electrical, magnetic, and optical properties)

  3. The single-sink fixed-charge transportation problem: Applications and solution methods

    DEFF Research Database (Denmark)

    Goertz, Simon; Klose, Andreas


    The single-sink fixed-charge transportation problem (SSFCTP) consists in finding a minimum cost flow from a number of supplier nodes to a single demand node. Shipping costs comprise costs proportional to the amount shipped as well as a fixed-charge. Although the SSFCTP is an important special case...... of the well-known fixed-charge transportation problem, just a few methods for solving this problem have been proposed in the literature. After summarising some applications of this problem arising in manufacturing and transportation, we give an overview on approximation algorithms and worst-case results...

  4. Transport of Cryptosporidium parvum Oocysts in Charge Heterogeneous Porous Media: Microfluidics Experiment and Numerical Simulation (United States)

    Liu, Y.; Meng, X.; Guo, Z.; Zhang, C.; Nguyen, T. H.; Hu, D.; Ji, J.; Yang, X.


    Colloidal attachment on charge heterogeneous grains has significant environmental implications for transport of hazardous colloids, such as pathogens, in the aquifer, where iron, manganese, and aluminium oxide minerals are the major source of surface charge heterogeneity of the aquifer grains. A patchwise surface charge model is often used to describe the surface charge heterogeneity of the grains. In the patchwise model, the colloidal attachment efficiency is linearly correlated with the fraction of the favorable patches (θ=λ(θf - θu)+θu). However, our previous microfluidic study showed that the attachment efficiency of oocysts of Cryptosporidium parvum, a waterborne protozoan parasite, was not linear correlated with the fraction of the favorable patches (λ). In this study, we developed a pore scale model to simulate colloidal transport and attachment on charge heterogeneous grains. The flow field was simulated using the LBM method and colloidal transport and attachment were simulated using the Lagrange particle tracking method. The pore scale model was calibrated with experimental results of colloidal and oocyst transport in microfluidic devices and was then used to simulate oocyst transport in charge heterogeneous porous media under a variety of environmental relative conditions, i.e. the fraction of favorable patchwise, ionic strength, and pH. The results of the pore scale simulations were used to evaluate the effect of surface charge heterogeneity on upscaling of oocyst transport from pore to continuum scale and to develop an applicable correlation between colloidal attachment efficiency and the fraction of the favorable patches.

  5. The role of space charge compensation for ion beam extraction and ion beam transport (invited)

    International Nuclear Information System (INIS)

    Spädtke, Peter


    Depending on the specific type of ion source, the ion beam is extracted either from an electrode surface or from a plasma. There is always an interface between the (almost) space charge compensated ion source plasma, and the extraction region in which the full space charge is influencing the ion beam itself. After extraction, the ion beam is to be transported towards an accelerating structure in most cases. For lower intensities, this transport can be done without space charge compensation. However, if space charge is not negligible, the positive charge of the ion beam will attract electrons, which will compensate the space charge, at least partially. The final degree of Space Charge Compensation (SCC) will depend on different properties, like the ratio of generation rate of secondary particles and their loss rate, or the fact whether the ion beam is pulsed or continuous. In sections of the beam line, where the ion beam is drifting, a pure electrostatic plasma will develop, whereas in magnetic elements, these space charge compensating electrons become magnetized. The transport section will provide a series of different plasma conditions with different properties. Different measurement tools to investigate the degree of space charge compensation will be described, as well as computational methods for the simulation of ion beams with partial space charge compensation

  6. Poly(silylene)s: Charge carrier photogeneration and transport

    Czech Academy of Sciences Publication Activity Database

    Nešpůrek, Stanislav; Eckhardt, A.


    Roč. 12, č. 7 (2001), s. 427-440 ISSN 1042-7147 R&D Projects: GA AV ČR IAA4050603; GA AV ČR IAA1050901; GA AV ČR KSK4050111 Institutional research plan: CEZ:AV0Z4050913 Keywords : charge photogeneration * charge-transfer * ion-pair Subject RIV: CC - Organic Chemistry Impact factor: 0.701, year: 2001

  7. Lateral charge transport from heavy-ion tracks in integrated circuit chips (United States)

    Zoutendyk, J. A.; Schwartz, H. R.; Nevill, L. R.


    A 256K DRAM has been used to study the lateral transport of charge (electron-hole pairs) induced by direct ionization from heavy-ion tracks in an IC. The qualitative charge transport has been simulated using a two-dimensional numerical code in cylindrical coordinates. The experimental bit-map data clearly show the manifestation of lateral charge transport in the creation of adjacent multiple-bit errors from a single heavy-ion track. The heavy-ion data further demonstrate the occurrence of multiple-bit errors from single ion tracks with sufficient stopping power. The qualitative numerical simulation results suggest that electric-field-funnel-aided (drift) collection accounts for single error generated by an ion passing through a charge-collecting junction, while multiple errors from a single ion track are due to lateral diffusion of ion-generated charge.

  8. The Role of Shape on Electronic Structure and Charge Transport in Faceted PbSe Nanocrystals

    KAUST Repository

    Kaushik, Ananth P.; Lukose, Binit; Clancy, Paulette


    We have determined the effect of shape on the charge transport characteristics of nanocrystals. Our study looked at the explicit determination of the electronic properties of faceted nanocrystals that essentially probe the limit of current

  9. Bistetracene Thin Film Polymorphic Control to Unravel the Effect of Molecular Packing on Charge Transport

    KAUST Repository

    Burnett, Edmund K.


    Polymorphism, the ability for a given material to adopt multiple crystalline packing states, is a powerful approach for investigating how changes in molecular packing influence charge transport within organic semiconductors. In this study, a new

  10. Bistetracene Thin Film Polymorphic Control to Unravel the Effect of Molecular Packing on Charge Transport

    KAUST Repository

    Burnett, Edmund K.; Ly, Jack; Niazi, Muhammad Rizwan; Zhang, Lei; McCuskey, Samantha R.; Amassian, Aram; Smilgies, Detlef-M.; Mannsfeld, Stefan C. B.; Briseno, Alejandro L.


    Polymorphism, the ability for a given material to adopt multiple crystalline packing states, is a powerful approach for investigating how changes in molecular packing influence charge transport within organic semiconductors. In this study, a new

  11. Charge and Spin Transport in Spin-orbit Coupled and Topological Systems

    KAUST Repository

    Ndiaye, Papa Birame


    for next-generation technology, three classes of systems that possibly enhance the spin and charge transport efficiency: (i)- topological insulators, (ii)- spin-orbit coupled magnonic systems, (iii)- topological magnetic textures (skyrmions and 3Q magnetic

  12. Numerical design of electron guns and space charge limited transport systems

    International Nuclear Information System (INIS)

    Herrmannsfeldt, W.B.


    This paper describes the capabilities and limitations of computer programs used to design electron guns and similarly space-charge limited transport systems. Examples of computer generated plots from several different types of gun problems are included

  13. Electrification Opportunities in the Transportation Sector and Impact of Residential Charging

    Energy Technology Data Exchange (ETDEWEB)

    Muratori, Matteo [National Renewable Energy Laboratory (NREL), Golden, CO (United States)


    This presentation provides an overview of electrification opportunities in the transportation sector and present results of a study assessing the impact of residential charging on residential power demand and electric power distribution infrastructure.

  14. Multiple nucleon transfer in damped nuclear collisions. [Lectures, mass charge, and linear and angular momentum transport

    Energy Technology Data Exchange (ETDEWEB)

    Randrup, J.


    This lecture discusses a theory for the transport of mass, charge, linear, and angular momentum and energy in damped nuclear collisions, as induced by multiple transfer of individual nucleons. 11 references.

  15. Symmetry properties of the transport coefficients of charged particles in disordered materials

    International Nuclear Information System (INIS)

    Baird, J.K.


    The transport coefficients of a charged particle in an isotropic material are shown to be even functions of the applied electric field. We discuss the limitation which this result and its consequences place upon formulae used to represent these coefficients

  16. Optimal block-tridiagonalization of matrices for coherent charge transport

    International Nuclear Information System (INIS)

    Wimmer, Michael; Richter, Klaus


    Numerical quantum transport calculations are commonly based on a tight-binding formulation. A wide class of quantum transport algorithms require the tight-binding Hamiltonian to be in the form of a block-tridiagonal matrix. Here, we develop a matrix reordering algorithm based on graph partitioning techniques that yields the optimal block-tridiagonal form for quantum transport. The reordered Hamiltonian can lead to significant performance gains in transport calculations, and allows to apply conventional two-terminal algorithms to arbitrarily complex geometries, including multi-terminal structures. The block-tridiagonalization algorithm can thus be the foundation for a generic quantum transport code, applicable to arbitrary tight-binding systems. We demonstrate the power of this approach by applying the block-tridiagonalization algorithm together with the recursive Green's function algorithm to various examples of mesoscopic transport in two-dimensional electron gases in semiconductors and graphene.

  17. Battery-powered transport systems. Possible methods of automatically charging drive batteries

    Energy Technology Data Exchange (ETDEWEB)


    In modern driverless transport systems, not only easy maintenance of the drive battery is important but also automatic charging during times of standstill. Some systems are presented; one system is pointed out in particular in which 100 batteries can be charged at the same time.

  18. Charge transport in disordered organic host-guest systems: effects of carrier density and electric field

    NARCIS (Netherlands)

    Yimer, Y.Y.; Bobbert, P.A.; Coehoorn, R.


    We investigate charge transport in disordered organic host–guest systems with a bimodal Gaussian density of states (DOS). The energy difference between the two Gaussians defines the trap depth. By solving the Pauli master equation for the hopping of charge carriers on a regular lattice with site

  19. Charge transport in poly(p-phenylene vinylene) at low temperature and high electric field

    NARCIS (Netherlands)

    Katsouras, I.; Najafi, A.; Asadi, K.; Kronemeijer, A. J.; Oostra, A. J.; Koster, L. J. A.; de Leeuw, D. M.; Blom, P. W. M.

    Charge transport in poly(2-methoxy, 5-(2'-ethyl-hexyloxy)-p-phenylene vinylene) (MEH-PPV)-based hole-only diodes is investigated at high electric fields and low temperatures using a novel diode architecture. Charge carrier densities that are in the range of those in a field-effect transistor are

  20. Charge transport in disordered organic host-guest systems: effects of carrier density and electric field

    NARCIS (Netherlands)

    Yimer, Y.Y.; Bobbert, P.A.; Coehoorn, R.


    We investigate charge transport in disordered organic host–guest systems with a bimodal Gaussian density of states. The energy difference between the peaks of the two Gaussians defines the trap depth. By solving the Pauli master equation for the hopping of charge carriers on a regular lattice we

  1. Effect of electric charge on the transperitoneal transport of plasma proteins during CAPD

    NARCIS (Netherlands)

    Buis, B.; Koomen, G. C.; Imholz, A. L.; Struijk, D. G.; Reddingius, R. E.; Arisz, L.; Krediet, R. T.


    BACKGROUND: Controversy exists as to whether electric charges of plasma proteins influence their transport across the peritoneal membrane during CAPD. Fixed negative charges in the peritoneal membrane are diminished during peritonitis in rats. METHODS: Peritoneal clearances of 10 proteins and their

  2. Charge transport in amorphous InGaZnO thin-film transistors

    NARCIS (Netherlands)

    Germs, W.C.; Adriaans, W.H.; Tripathi, A.K.; Roelofs, W.S.C.; Cobb, B.; Janssen, R.A.J.; Gelinck, G.H.; Kemerink, M.


    We investigate the mechanism of charge transport in indium gallium zinc oxide (a-IGZO), an amorphous metal-oxide semiconductor. We measured the field-effect mobility and the Seebeck coefficient (S=ΔV/ΔT) of a-IGZO in thin-film transistors as a function of charge-carrier density for different

  3. Charge transport in amorphous InGaZnO thin film transistors

    NARCIS (Netherlands)

    Germs, W.C.; Adriaans, W.H.; Tripathi, A.K.; Roelofs, W.S.C.; Cobb, B.; Janssen, R.A.J.; Gelinck, G.H.; Kemerink, M.


    We investigate the mechanism of charge transport in indium gallium zinc oxide (a-IGZO), an amorphous metal-oxide semiconductor. We measured the field-effect mobility and the Seebeck coefficient (S=¿V/¿T) of a-IGZO in thin-film transistors as a function of charge-carrier density for different

  4. Simulation of charge generation and transport in semi-conductors under energetic-particle bombardment

    International Nuclear Information System (INIS)

    Martin, R.C.


    The passage of energetic ions through semiconductor devices generates excess charge which can produce logic upset, memory change, and device damage. This single event upset (SEU) phenomenon is increasingly important for satellite communications. Experimental and numerical simulation of SEUs is difficult because of the subnanosecond times and large charge densities within the ion track. The objective of this work is twofold: (1) the determination of the track structure and electron-hole pair generation profiles following the passage of an energetic ion; (2) the development and application of a new numerical method for transient charge transport in semiconductor devices. A secondary electron generation and transport model, based on the Monte Carlo method, is developed and coupled to an ion transport code to simulate ion track formation in silicon. A new numerical method is developed for the study of transient charge transport. The numerical method combines an axisymmetric quadratic finite-element formulation for the solution of the potential with particle simulation methods for electron and hole transport. Carrier transport, recombination, and thermal generation of both majority and minority carriers are included. To assess the method, transient one-dimensional solutions for silicon diodes are compared to a fully iterative finite-element method. Simulations of charge collection from ion tracks in three-dimensional axisymmetric devices are presented and compared to previous work. The results of this work for transient current pulses following charged ion passage are in agreement with recent experimental data

  5. Charge Transport in Spiro-OMeTAD Investigated through Space-Charge-Limited Current Measurements (United States)

    Röhr, Jason A.; Shi, Xingyuan; Haque, Saif A.; Kirchartz, Thomas; Nelson, Jenny


    Extracting charge-carrier mobilities for organic semiconductors from space-charge-limited conduction measurements is complicated in practice by nonideal factors such as trapping in defects and injection barriers. Here, we show that by allowing the bandlike charge-carrier mobility, trap characteristics, injection barrier heights, and the shunt resistance to vary in a multiple-trapping drift-diffusion model, a numerical fit can be obtained to the entire current density-voltage curve from experimental space-charge-limited current measurements on both symmetric and asymmetric 2 ,2',7 ,7' -tetrakis(N ,N -di-4-methoxyphenylamine)-9 ,9' -spirobifluorene (spiro-OMeTAD) single-carrier devices. This approach yields a bandlike mobility that is more than an order of magnitude higher than the effective mobility obtained using analytical approximations, such as the Mott-Gurney law and the moving-electrode equation. It is also shown that where these analytical approximations require a temperature-dependent effective mobility to achieve fits, the numerical model can yield a temperature-, electric-field-, and charge-carrier-density-independent mobility. Finally, we present an analytical model describing trap-limited current flow through a semiconductor in a symmetric single-carrier device. We compare the obtained charge-carrier mobility and trap characteristics from this analytical model to the results from the numerical model, showing excellent agreement. This work shows the importance of accounting for traps and injection barriers explicitly when analyzing current density-voltage curves from space-charge-limited current measurements.

  6. Methods for studying plasma charge transport across a magnetic field

    International Nuclear Information System (INIS)

    Popovich, A.S.


    A comparative analysis of experimental methods for the diffusion transfer of plasma charged particles accross the magnetic field at the study of its confinement effectiveness, instability effect is carried out. Considered are the methods based on the analysis of particle balance in the charge and possibilities of diffusion coefficient determination according to measuring parameters of density gradient and particle flow on the wall, rate of plasma decay after switching off ionization source radial profile of plasma density outside the active region of stationary charge. Much attension is payed to the research methods of diffusion transfer, connected with the study of propagation of periodic and aperiodic density perturbation in a plasma. Analysed is the Golubev and Granovsky method of diffusion waves and its different modifications, phase analysis method of ''test charges'' movement, as well as different modifications of correlation methods. Considered are physical preconditions of the latter and criticized is unilateral interpretation of correlation measurings, carried out in a number of works. The analysis of study possibilities of independent (non-ambipolar) diffusion of electrons and ions in a plasma in the magnetic field is executed

  7. Low-energy beam transport using space-charge lenses

    International Nuclear Information System (INIS)

    Meusel, O.; Bechtold, A.; Pozimski, J.; Ratzinger, U.; Schempp, A.; Klein, H.


    Space-charge lenses (SCL) of the Gabor type provide strong cylinder symmetric focusing for low-energy ion beams using a confined nonneutral plasma. They need modest magnetic and electrostatic field strength and provide a short installation length when compared to conventional LEBT-lenses like quadrupoles and magnetic solenoids. The density distribution of the enclosed space charge within the Gabor lens is given by the confinement in transverse and longitudinal directions. In the case of a positive ion beam, the space charge of the confined electron cloud may cause an overcompensation of the ion beam space-charge force and consequently focuses the beam. To investigate the capabilities of an SCL double-lens system for ion beam into an RFQ, a test injector was installed at IAP and put into operation successfully. Furthermore, to study the focusing capabilities of this lens at beam energies up to 500 keV, a high-field Gabor lens was built and installed downstream of the RFQ. Experimental results of the beam injection into the RFQ are presented as well as those of these first bunched beam-focusing tests with the 110 A keV He + beam

  8. Role of Molecular Weight Distribution on Charge Transport in Semiconducting Polymers

    KAUST Repository

    Himmelberger, Scott


    © 2014 American Chemical Society. Model semiconducting polymer blends of well-controlled molecular weight distributions are fabricated and demonstrated to be a simple method to control intermolecular disorder without affecting intramolecular order or degree of aggregation. Mobility measurements exhibit that even small amounts of low molecular weight material are detrimental to charge transport. Trends in charge carrier mobility can be reproduced by a simple analytical model which indicates that carriers have no preference for high or low molecular weight chains and that charge transport is limited by interchain hopping. These results quantify the role of long polymer tie-chains and demonstrate the need for controlled polydispersity for achieving high carrier mobilities.

  9. Metal Oxides as Efficient Charge Transporters in Perovskite Solar Cells

    KAUST Repository

    Haque, Mohammed; Sheikh, Arif D.; Guan, Xinwei; Wu, Tao


    . In this comprehensive review, we focus on the synthesis and applications of metal oxides as electron and hole transporters in efficient PSCs with both mesoporous and planar architectures. Metal oxides and their doped variants with proper energy band alignment

  10. Direct Imaging of Minority Charge Carrier Transport in Luminescent Semiconductors

    National Research Council Canada - National Science Library

    Luber, David R


    .... The measured values are in excellent agreement with theoretical calculations. The imaging transport technique is also employed to image the nature of the generation region as a function of beam energy probe current and sample atomic number...

  11. Charging and Transport Dynamics of a Flow-Through Electrode Capacitive Deionization System. (United States)

    Qu, Yatian; Campbell, Patrick G; Hemmatifar, Ali; Knipe, Jennifer M; Loeb, Colin K; Reidy, John J; Hubert, Mckenzie A; Stadermann, Michael; Santiago, Juan G


    We present a study of the interplay among electric charging rate, capacitance, salt removal, and mass transport in "flow-through electrode" capacitive deionization (CDI) systems. We develop two models describing coupled transport and electro-adsorption/desorption which capture salt removal dynamics. The first model is a simplified, unsteady zero-dimensional volume-averaged model which identifies dimensionless parameters and figures of merits associated with cell performance. The second model is a higher fidelity area-averaged model which captures both spatial and temporal responses of charging. We further conducted an experimental study of these dynamics and considered two salt transport regimes: (1) advection-limited regime and (2) dispersion-limited regime. We use these data to validate models. The study shows that, in the advection-limited regime, differential charge efficiency determines the salt adsorption at the early stage of the deionization process. Subsequently, charging transitions to a quasi-steady state where salt removal rate is proportional to applied current scaled by the inlet flow rate. In the dispersion-dominated regime, differential charge efficiency, cell volume, and diffusion rates govern adsorption dynamics and flow rate has little effect. In both regimes, the interplay among mass transport rate, differential charge efficiency, cell capacitance, and (electric) charging current governs salt removal in flow-through electrode CDI.

  12. Phenomena of charged particles transport in variable magnetic fields

    International Nuclear Information System (INIS)

    Savane, Sy Y.; Faza Barry, M.; Vladmir, L.; Diaby, I.


    This present work is dedicated to the study of the dynamical phenomena for the transport of ions in the presence of variable magnetic fields in front of the Jupiter wave shock. We obtain the spectrum of the accelerated ions and we study the conditions of acceleration by solving the transport equation in the planetocentric system. We discuss the theoretical results obtained and make a comparison with the experimental parameters in the region of acceleration behind the Jupiter wave shock. (author)

  13. A general relationship between disorder, aggregation and charge transport in conjugated polymers

    KAUST Repository

    Noriega, Rodrigo


    Conjugated polymer chains have many degrees of conformational freedom and interact weakly with each other, resulting in complex microstructures in the solid state. Understanding charge transport in such systems, which have amorphous and ordered phases exhibiting varying degrees of order, has proved difficult owing to the contribution of electronic processes at various length scales. The growing technological appeal of these semiconductors makes such fundamental knowledge extremely important for materials and process design. We propose a unified model of how charge carriers travel in conjugated polymer films. We show that in high-molecular-weight semiconducting polymers the limiting charge transport step is trapping caused by lattice disorder, and that short-range intermolecular aggregation is sufficient for efficient long-range charge transport. This generalization explains the seemingly contradicting high performance of recently reported, poorly ordered polymers and suggests molecular design strategies to further improve the performance of future generations of organic electronic materials. © 2013 Macmillan Publishers Limited. All rights reserved.

  14. A general relationship between disorder, aggregation and charge transport in conjugated polymers

    KAUST Repository

    Noriega, Rodrigo; Rivnay, Jonathan; Vandewal, Koen; Koch, Felix P. V.; Stingelin, Natalie; Smith, Paul; Toney, Michael F.; Salleo, Alberto


    Conjugated polymer chains have many degrees of conformational freedom and interact weakly with each other, resulting in complex microstructures in the solid state. Understanding charge transport in such systems, which have amorphous and ordered phases exhibiting varying degrees of order, has proved difficult owing to the contribution of electronic processes at various length scales. The growing technological appeal of these semiconductors makes such fundamental knowledge extremely important for materials and process design. We propose a unified model of how charge carriers travel in conjugated polymer films. We show that in high-molecular-weight semiconducting polymers the limiting charge transport step is trapping caused by lattice disorder, and that short-range intermolecular aggregation is sufficient for efficient long-range charge transport. This generalization explains the seemingly contradicting high performance of recently reported, poorly ordered polymers and suggests molecular design strategies to further improve the performance of future generations of organic electronic materials. © 2013 Macmillan Publishers Limited. All rights reserved.

  15. On the nature of high field charge transport in reinforced silicone dielectrics: Experiment and simulation

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Yanhui, E-mail:; Schadler, Linda S. [Department of Material Science and Engineering, Rensselaer Polytechnic Institute, 110 8th street, Troy, New York 12180 (United States)


    The high field charge injection and transport properties in reinforced silicone dielectrics were investigated by measuring the time-dependent space charge distribution and the current under dc conditions up to the breakdown field and were compared with the properties of other dielectric polymers. It is argued that the energy and spatial distribution of localized electronic states are crucial in determining these properties for polymer dielectrics. Tunneling to localized states likely dominates the charge injection process. A transient transport regime arises due to the relaxation of charge carriers into deep traps at the energy band tails and is successfully verified by a Monte Carlo simulation using the multiple-hopping model. The charge carrier mobility is found to be highly heterogeneous due to the non-uniform trapping. The slow moving electron packet exhibits a negative field dependent drift velocity possibly due to the spatial disorder of traps.

  16. A reduced-cost iterated local search heuristic for the fixed-charge transportation problem

    NARCIS (Netherlands)

    Buson, Erika; Roberti, Roberto; Toth, Paolo


    The fixed-charge transportation problem (FCTP) is a generalization of the transportation problem where an additional fixed cost is paid for sending a flow from an origin to a destination. We propose an iterated local search heuristic based on the utilization of reduced costs for guiding the restart

  17. Temperature-dependent charge transport mechanisms in carbon sphere/polyaniline composite (United States)

    Nieves, Cesar A.; Martinez, Luis M.; Meléndez, Anamaris; Ortiz, Margarita; Ramos, Idalia; Pinto, Nicholas J.; Zimbovskaya, Natalya


    Charge transport in the temperature range 80 K electrons between polymeric chains in PANi-filled gaps between CS is the predominant transport mechanism through CS/PANi composites. The high conductivity of the CS/PANi composite makes the material attractive for the fabrication of devices and sensors.

  18. Nonlinear charge transport in bipolar semiconductors due to electron heating

    International Nuclear Information System (INIS)

    Molina-Valdovinos, S.; Gurevich, Yu.G.


    It is known that when strong electric field is applied to a semiconductor sample, the current voltage characteristic deviates from the linear response. In this letter, we propose a new point of view of nonlinearity in semiconductors which is associated with the electron temperature dependence on the recombination rate. The heating of the charge carriers breaks the balance between generation and recombination, giving rise to nonequilibrium charge carriers concentration and nonlinearity. - Highlights: • A new mechanism of nonlinearity of current-voltage characteristic (CVC) is proposed. • The hot electron temperature violates the equilibrium between electrons and holes. • This violation gives rise to nonequilibrium concentration of electrons and holes. • This leads to nonlinear CVC (along with the heating nonlinearity).

  19. Nonlinear charge transport in bipolar semiconductors due to electron heating

    Energy Technology Data Exchange (ETDEWEB)

    Molina-Valdovinos, S., E-mail: [Universidad Autónoma de Zacatecas, Unidad Académica de Física, Calzada Solidaridad esq. Paseo, La Bufa s/n, CP 98060, Zacatecas, Zac, México (Mexico); Gurevich, Yu.G. [Centro de Investigación y de Estudios Avanzados del IPN, Departamento de Física, Av. IPN 2508, México D.F., CP 07360, México (Mexico)


    It is known that when strong electric field is applied to a semiconductor sample, the current voltage characteristic deviates from the linear response. In this letter, we propose a new point of view of nonlinearity in semiconductors which is associated with the electron temperature dependence on the recombination rate. The heating of the charge carriers breaks the balance between generation and recombination, giving rise to nonequilibrium charge carriers concentration and nonlinearity. - Highlights: • A new mechanism of nonlinearity of current-voltage characteristic (CVC) is proposed. • The hot electron temperature violates the equilibrium between electrons and holes. • This violation gives rise to nonequilibrium concentration of electrons and holes. • This leads to nonlinear CVC (along with the heating nonlinearity).

  20. Study of Charge Carrier Transport in GaN Sensors (United States)

    Gaubas, Eugenijus; Ceponis, Tomas; Kuokstis, Edmundas; Meskauskaite, Dovile; Pavlov, Jevgenij; Reklaitis, Ignas


    Capacitor and Schottky diode sensors were fabricated on GaN material grown by hydride vapor phase epitaxy and metal-organic chemical vapor deposition techniques using plasma etching and metal deposition. The operational characteristics of these devices have been investigated by profiling current transients and by comparing the experimental regimes of the perpendicular and parallel injection of excess carrier domains. Profiling of the carrier injection location allows for the separation of the bipolar and the monopolar charge drift components. Carrier mobility values attributed to the hydride vapor phase epitaxy (HVPE) GaN material have been estimated as μe = 1000 ± 200 cm2/Vs for electrons, and μh = 400 ± 80 cm2/Vs for holes, respectively. Current transients under injection of the localized and bulk packets of excess carriers have been examined in order to determine the surface charge formation and polarization effects. PMID:28773418

  1. Charge Carrier Transport Properties of Vacuum Evaporated Anthrylvinylbenzene Thin Films

    Directory of Open Access Journals (Sweden)

    Haikel HRICHI


    Full Text Available The charge carrier conduction processes and dielectric properties of two new materials based on anthracene core structure, 1-(9 anthrylvinyl-4-benzyloxybenzene (AVB and 1,4- bis(9-anthrylvinylbenzene (AV2B diodes have been investigated using dc current density–voltage (J–V and AC impedance spectroscopy (100 Hz–10 MHz. The DC electrical properties of ITO/anthracene derivative /Al device showing an ohmic behavior at low voltages and switches to space charge limited current (SCLC conduction with exponential trap distribution at higher voltages. The best performance device was achieved from ITO/AVB/Al structure showing the high charge carrier mobility which has also been evaluated from SCLC as 6.55´10-6 cm/Vs. According to the impedance spectroscopy results the structures were modeled by equivalent circuit designed as a parallel resistor Rp and capacitor Cp network in series with resistor Rs. The evolution of the electrical parameters with frequency and bias voltage of these anthracene-based systems has been discussed. The conductivity s(w evolution with frequency and bias voltage was studied for ITO/anthracene derivatives/Al devices. The dc conductivity sdc for these devices has been determined. The ac conductivity sac showed a variation in angular frequency as with a critical exponent s< 1 suggesting a hopping conduction mechanism at high frequency.

  2. An LP-based heuristic for the fixed charge transportation problem

    DEFF Research Database (Denmark)

    Klose, Andreas


    The fixed charge transportation problem consists in finding a minimum cost network flow from a set of suppliers to a set of customers. Beside costs proportional to quantities transported, transportation costs also include a fixed charge. The paper describes a linear programming based heuristic...... approach for computing lower and upper bounds on the minimal cost. To this end, the LP relaxation is iteratively strengthened by means of adding cuts; in each iteration the current LP solution is then used to guide a local search heuristic. In addition to standard polyhedral cuts as lifted cover...

  3. Iterated local search and record-to-record travel applied to the fixed charge transportation problem

    DEFF Research Database (Denmark)

    Andersen, Jeanne; Klose, Andreas

    The fixed charge transportation problem (FCTP) is a well-known and difficult optimization problem with lots of applications in logistics. It consists in finding a minimum cost network flow from a set of suppliers to a set of customers. Beside costs proportional to quantities transported......, transportation costs do, however, include a fixed charge. Iterated local search and record-to-record travel are both simple local search based meta-heuristics that, to our knowledge, not yet have been applied to the FCTP. In this paper, we apply both types of search strategies and combine them into a single...

  4. Electric Field Mediated Ion Transport Through Charged Mesoporous Membranes

    NARCIS (Netherlands)

    Schmuhl, R.; de Lint, W.B.S.; Keizer, Klaas; van den Berg, Albert; ten Elshof, Johan E.; Burganos, Vasilis N.; Noble, Richard D.; Asaeda, Masashi; Ayral, Andre; LeRoux, Johann D.


    The transport of ions from aqueous solutions through a stacked Au/alpha-alumina/gamma-alumina/Au membrane under the influence of a dc potential difference is reported. The membrane shows high cation permselectivity at ionic strengths of ~1 mM at pH 4.3-6.5, which is associated with a combination of

  5. Assessing the potential of different charging strategies for electric vehicle fleets in closed transport systems

    International Nuclear Information System (INIS)

    Schmidt, Johannes; Eisel, Matthias; Kolbe, Lutz M.


    A key reason for the low sales volumes of electric vehicles is their significantly higher purchasing price in comparison to conventional vehicles. However, various charging strategies can be applied to make these vehicles more profitable. In this paper, controlled charging concepts are transferred to commercial fleets operating in closed transport systems, as we found this field of application particularly well suited for the implementation of charging strategies. We analyzed data gathered in a field experiment conducted in a European port using electric vehicles in combination with a battery-swapping station to calculate the economic potentials of three charging scenarios: (1) optimizing energy procurement (2) trading load-shifting potential on control markets, and (3) a combination of the two. The findings indicate that all approaches are appropriate for reducing economic disadvantages of electric transport vehicles. Furthermore, we find that adjusting charging processes to avoid price peaks is more profitable than offering control reserve. Finally, focusing on the combination of both strategies seems to be most promising from an economic perspective. In this context, operational cost savings of more than 65% can be achieved compared to a similar dieselpowered vehicle when applying this strategy. - Highlights: • We model various charging strategies for electric transport vehicles. • The economic assessment is based on a field experiment with a port operator. • We consider the special market design of spot and ancillary service markets. • All charging strategies presented provide substantial cost-saving potentials. • Optimizing energy procurement is more profitable than offering control reserve

  6. Charge transport in transparent single-wall carbon nanotube networks

    International Nuclear Information System (INIS)

    Jaiswal, Manu; Wang, Wei; Fernando, K A Shiral; Sun Yaping; Menon, Reghu


    We report the electric-field effects and magnetotransport in transparent networks of single-wall carbon nanotubes (SWNT). The temperature dependence of conductance of the network indicates a 2D Mott variable-range hopping (VRH) transport mechanism. Electric field and temperature are shown to have similar effects on the carrier hops and identical exponents for the conductance of the network are obtained from the high electric field and temperature dependences. A power-law temperature dependence with an exponent 3/2 for the threshold field is obtained and explained as a result of the competing contributions from electric field and phonons to the carrier hop. A negative magnetoresistance (MR) is observed at low temperatures, which arises from a forward interference scattering mechanism in the weak scattering limit, consistent with the VRH transport

  7. Influence of functional groups on charge transport in molecular junctions

    DEFF Research Database (Denmark)

    Mowbray, Duncan; Jones, Glenn; Thygesen, Kristian Sommer


    Using density functional theory (DFT), we analyze the influence of five classes of functional groups, as exemplified by NO2, OCH3, CH3, CCl3, and I, on the transport properties of a 1,4-benzenedithiolate (BDT) and 1,4-benzenediamine (BDA) molecular junction with gold electrodes. Our analysis...... demonstrates how ideas from functional group chemistry may be used to engineer a molecule's transport properties, as was shown experimentally and using a semiempirical model for BDA [Nano Lett. 7, 502 (2007)]. In particular, we show that the qualitative change in conductance due to a given functional group can...... be predicted from its known electronic effect (whether it is sigma/pi donating/withdrawing). However, the influence of functional groups on a molecule's conductance is very weak, as was also found in the BDA experiments. The calculated DFT conductances for the BDA species are five times larger than...

  8. Muonium formation via charge transport in solids and liquids

    International Nuclear Information System (INIS)

    Storchak, Vyacheslav G.; Brewer, Jess H.; Cox, Stephen F.J.


    We review our recent experimental studies on delayed muonium formation in insulators and semiconductors. This involves the positive muon capturing one of the excess electrons liberated in its own ionization track and competes with recombination or escape of the electrons. The muon is generally found to thermalise well 'downstream' from the center of the electron distribution, so that the transport mechanism of the electrons is a crucial factor. This is discussed in terms of the different tendencies to localization (as polarons in solids or in bubbles in liquids) vs. band-like propagation. Studies of Van der Waals cryocrystals and cryoliquids are reviewed and some preliminary results reported for sapphire and silicon. Transport distances and times are determined from the variation of μSR signal amplitudes with applied electric and magnetic fields, respectively, enabling the development of a new technique for measuring electron mobilities on a microscopic scale

  9. Non-equilibrium spin and charge transport in superconducting heterojunctions

    Energy Technology Data Exchange (ETDEWEB)

    Thalmann, Marcel; Rudolf, Marcel; Braun, Julian; Pietsch, Torsten; Scheer, Elke [Department of Physics, University of Konstanz, Universitaetsstrasse 10, 78464 Konstanz (Germany)


    Ferromagnet Superconductance (F/S) junctions are rich in exciting quantum-physical-phenomena, which are still poorly understood but may provide bright prospects for new applications. In contrast to conventional normal-metal proximity systems, Andreev reflection is suppressed for singlet cooper pairs in F/S heterostructures. However, long-range triplet pairing may be observed in S/F systems with non-collinear magnetization or spin-active interfaces. Herein, we investigate non-equilibrium transport properties of lateral S/F heterojunctions, defined via electron beam lithography. In particular we focus microwave- and magneto-transport spectroscopy on conventional type-I (Al, Pb, Zn) and type-II (Nb) superconductors in combination with strong transition metal ferromagnets (Ni, Co, Fe). A cryogenic HF readout platform and advanced electronic filtering is developed and results on Al-based heterojunctions are shown.

  10. Adaptive tree multigrids and simplified spherical harmonics approximation in deterministic neutral and charged particle transport

    International Nuclear Information System (INIS)

    Kotiluoto, P.


    A new deterministic three-dimensional neutral and charged particle transport code, MultiTrans, has been developed. In the novel approach, the adaptive tree multigrid technique is used in conjunction with simplified spherical harmonics approximation of the Boltzmann transport equation. The development of the new radiation transport code started in the framework of the Finnish boron neutron capture therapy (BNCT) project. Since the application of the MultiTrans code to BNCT dose planning problems, the testing and development of the MultiTrans code has continued in conventional radiotherapy and reactor physics applications. In this thesis, an overview of different numerical radiation transport methods is first given. Special features of the simplified spherical harmonics method and the adaptive tree multigrid technique are then reviewed. The usefulness of the new MultiTrans code has been indicated by verifying and validating the code performance for different types of neutral and charged particle transport problems, reported in separate publications. (orig.)

  11. Effects of pressure and electrical charge on macromolecular transport across bovine lens basement membrane. (United States)

    Ferrell, Nicholas; Cameron, Kathleen O; Groszek, Joseph J; Hofmann, Christina L; Li, Lingyan; Smith, Ross A; Bian, Aihua; Shintani, Ayumi; Zydney, Andrew L; Fissell, William H


    Molecular transport through the basement membrane is important for a number of physiological functions, and dysregulation of basement membrane architecture can have serious pathological consequences. The structure-function relationships that govern molecular transport in basement membranes are not fully understood. The basement membrane from the lens capsule of the eye is a collagen IV-rich matrix that can easily be extracted and manipulated in vitro. As such, it provides a convenient model for studying the functional relationships that govern molecular transport in basement membranes. Here we investigate the effects of increased transmembrane pressure and solute electrical charge on the transport properties of the lens basement membrane (LBM) from the bovine eye. Pressure-permeability relationships in LBM transport were governed primarily by changes in diffusive and convective contributions to solute flux and not by pressure-dependent changes in intrinsic membrane properties. The solute electrical charge had a minimal but statistically significant effect on solute transport through the LBM that was opposite of the expected electrokinetic behavior. The observed transport characteristics of the LBM are discussed in the context of established membrane transport modeling and previous work on the effects of pressure and electrical charge in other basement membrane systems. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  12. Charge Transport in Metal-Molecule-Metal Junctions Probed by Conducting Atomic Force Microscopy

    International Nuclear Information System (INIS)

    Lee, Min Hyung; Song, Hyunwook


    We have demonstrated a proof of intrinsic charge transport properties in alkanedithiol molecular junctions using a multiprobe approach combining a variety of transport techniques. The temperature-independent I(V) behavior and the correct exponential decay of conductance with respect to molecular length shows that the dominant charge transport mechanism is off-resonant tunneling. Length-dependent TVS measurements for the saturated alkane-dithiol series indicate that we did indeed probe a molecular system with CAFM. These results can provide stringent criteria to establish a valid molecular transport junction via a probabilistic measurement technique. In this study, we report a study of charge transport in alkanedithiol SAMs formed in metal-molecule-metal junctions using CAFM in combination with a variety of molecular transport techniques including temperature-and length-variable transport measurements and transition voltage spectroscopy. The main goal of this study is to probe the intrinsic transport properties of component molecules using CAFM, but not parasitic or defect-related effects

  13. Charge Transport in Carbon Nanotubes-Polymer Composite Photovoltaic Cells (United States)

    Ltaief, Adnen; Bouazizi, Abdelaziz; Davenas, Joel


    We investigate the dark and illuminated current density-voltage (J/V) characteristics of poly(2-methoxy-5-(2’-ethylhexyloxy)1-4-phenylenevinylene) (MEH-PPV)/single-walled carbon nanotubes (SWNTs) composite photovoltaic cells. Using an exponential band tail model, the conduction mechanism has been analysed for polymer only devices and composite devices, in terms of space charge limited current (SCLC) conduction mechanism, where we determine the power parameters and the threshold voltages. Elaborated devices for MEH-PPV:SWNTs (1:1) composites showed a photoresponse with an open-circuit voltage Voc of 0.4 V, a short-circuit current density JSC of 1 µA/cm² and a fill factor FF of 43%. We have modelised the organic photovoltaic devices with an equivalent circuit, where we calculated the series and shunt resistances.

  14. Crossover from band-like to thermally activated charge transport in organic transistors due to strain-induced traps

    KAUST Repository

    Mei, Yaochuan; Diemer, Peter J.; Niazi, Muhammad Rizwan; Hallani, Rawad K.; Jarolimek, Karol; Day, Cynthia S.; Risko, Chad; Anthony, John E.; Amassian, Aram; Jurchescu, Oana D.


    The temperature dependence of the charge-carrier mobility provides essential insight into the charge transport mechanisms in organic semiconductors. Such knowledge imparts critical understanding of the electrical properties of these materials

  15. Absence of ballistic charge transport in the half-filled 1D Hubbard model (United States)

    Carmelo, J. M. P.; Nemati, S.; Prosen, T.


    Whether in the thermodynamic limit of lattice length L → ∞, hole concentration mηz = - 2 Sηz/L = 1 -ne → 0, nonzero temperature T > 0, and U / t > 0 the charge stiffness of the 1D Hubbard model with first neighbor transfer integral t and on-site repulsion U is finite or vanishes and thus whether there is or there is no ballistic charge transport, respectively, remains an unsolved and controversial issue, as different approaches yield contradictory results. (Here Sηz = - (L -Ne) / 2 is the η-spin projection and ne =Ne / L the electronic density.) In this paper we provide an upper bound on the charge stiffness and show that (similarly as at zero temperature), for T > 0 and U / t > 0 it vanishes for mηz → 0 within the canonical ensemble in the thermodynamic limit L → ∞. Moreover, we show that at high temperature T → ∞ the charge stiffness vanishes as well within the grand-canonical ensemble for L → ∞ and chemical potential μ →μu where (μ -μu) ≥ 0 and 2μu is the Mott-Hubbard gap. The lack of charge ballistic transport indicates that charge transport at finite temperatures is dominated by a diffusive contribution. Our scheme uses a suitable exact representation of the electrons in terms of rotated electrons for which the numbers of singly occupied and doubly occupied lattice sites are good quantum numbers for U / t > 0. In contrast to often less controllable numerical studies, the use of such a representation reveals the carriers that couple to the charge probes and provides useful physical information on the microscopic processes behind the exotic charge transport properties of the 1D electronic correlated system under study.

  16. Solving the Single-Sink, Fixed-Charge, Multiple-Choice Transportation Problem by Dynamic Programming

    DEFF Research Database (Denmark)

    Rauff Lind Christensen, Tue; Klose, Andreas; Andersen, Kim Allan

    important aspects of supplier selection, an important application of the SSFCTP, this does not reflect the real life situation. First, transportation costs faced by many companies are in fact piecewise linear. Secondly, when suppliers offer discounts, either incremental or all-unit discounts, such savings......The Single-Sink, Fixed-Charge, Multiple-Choice Transportation Problem (SSFCMCTP) is a problem with versatile applications. This problem is a generalization of the Single-Sink, Fixed-Charge Transportation Problem (SSFCTP), which has a fixed-charge, linear cost structure. However, in at least two...... are neglected in the SSFCTP. The SSFCMCTP overcome this problem by incorporating a staircase cost structure in the cost function instead of the usual one used in SSFCTP. We present a dynamic programming algorithm for the resulting problem. To enhance the performance of the generic algorithm a number...

  17. A common pathway for charge transport through voltage-sensing domains. (United States)

    Chanda, Baron; Bezanilla, Francisco


    Voltage-gated ion channels derive their voltage sensitivity from the movement of specific charged residues in response to a change in transmembrane potential. Several studies on mechanisms of voltage sensing in ion channels support the idea that these gating charges move through a well-defined permeation pathway. This gating pathway in a voltage-gated ion channel can also be mutated to transport free cations, including protons. The recent discovery of proton channels with sequence homology to the voltage-sensing domains suggests that evolution has perhaps exploited the same gating pathway to generate a bona fide voltage-dependent proton transporter. Here we will discuss implications of these findings on the mechanisms underlying charge (and ion) transport by voltage-sensing domains.

  18. Transition from direct to inverted charge transport Marcus regions in molecular junctions via molecular orbital gating (United States)

    Yuan, Li; Wang, Lejia; Garrigues, Alvar R.; Jiang, Li; Annadata, Harshini Venkata; Anguera Antonana, Marta; Barco, Enrique; Nijhuis, Christian A.


    Solid-state molecular tunnel junctions are often assumed to operate in the Landauer regime, which describes essentially activationless coherent tunnelling processes. In solution, on the other hand, charge transfer is described by Marcus theory, which accounts for thermally activated processes. In practice, however, thermally activated transport phenomena are frequently observed also in solid-state molecular junctions but remain poorly understood. Here, we show experimentally the transition from the Marcus to the inverted Marcus region in a solid-state molecular tunnel junction by means of intra-molecular orbital gating that can be tuned via the chemical structure of the molecule and applied bias. In the inverted Marcus region, charge transport is incoherent, yet virtually independent of temperature. Our experimental results fit well to a theoretical model that combines Landauer and Marcus theories and may have implications for the interpretation of temperature-dependent charge transport measurements in molecular junctions.

  19. Understanding the effects of electronic polarization and delocalization on charge-transport levels in oligoacene systems

    KAUST Repository

    Sutton, Christopher; Tummala, Naga Rajesh; Kemper, Travis; Aziz, Saadullah G.; Sears, John; Coropceanu, Veaceslav; Bredas, Jean-Luc


    Electronic polarization and charge delocalization are important aspects that affect the charge-transport levels in organic materials. Here, using a quantum mechanical/ embedded-charge (QM/EC) approach based on a combination of the long-range corrected omega B97X-D exchange-correlation functional (QM) and charge model 5 (CM5) point-charge model (EC), we evaluate the vertical detachment energies and polarization energies of various sizes of crystalline and amorphous anionic oligoacene clusters. Our results indicate that QM/EC calculations yield vertical detachment energies and polarization energies that compare well with the experimental values obtained from ultraviolet photoemission spectroscopy measurements. In order to understand the effect of charge delocalization on the transport levels, we considered crystalline naphthalene systems with QM regions including one or five-molecules. The results for these systems show that the delocalization and polarization effects are additive; therefore, allowing for electron delocalization by increasing the size of the QM region leads to the additional stabilization of the transport levels. Published by AIP Publishing.

  20. Understanding the effects of electronic polarization and delocalization on charge-transport levels in oligoacene systems

    KAUST Repository

    Sutton, Christopher


    Electronic polarization and charge delocalization are important aspects that affect the charge-transport levels in organic materials. Here, using a quantum mechanical/ embedded-charge (QM/EC) approach based on a combination of the long-range corrected omega B97X-D exchange-correlation functional (QM) and charge model 5 (CM5) point-charge model (EC), we evaluate the vertical detachment energies and polarization energies of various sizes of crystalline and amorphous anionic oligoacene clusters. Our results indicate that QM/EC calculations yield vertical detachment energies and polarization energies that compare well with the experimental values obtained from ultraviolet photoemission spectroscopy measurements. In order to understand the effect of charge delocalization on the transport levels, we considered crystalline naphthalene systems with QM regions including one or five-molecules. The results for these systems show that the delocalization and polarization effects are additive; therefore, allowing for electron delocalization by increasing the size of the QM region leads to the additional stabilization of the transport levels. Published by AIP Publishing.

  1. Impact of Tortuosity on Charge-Carrier Transport in Organic Bulk Heterojunction Blends (United States)

    Heiber, Michael C.; Kister, Klaus; Baumann, Andreas; Dyakonov, Vladimir; Deibel, Carsten; Nguyen, Thuc-Quyen


    The impact of the tortuosity of the charge-transport pathways through a bulk heterojunction film on the charge-carrier mobility is theoretically investigated using model morphologies and kinetic Monte Carlo simulations. The tortuosity descriptor provides a quantitative metric to characterize the quality of the charge-transport pathways, and model morphologies with controlled domain size and tortuosity are created using an anisotropic domain growth procedure. The tortuosity is found to be dependent on the anisotropy of the domain structure and is highly tunable. Time-of-flight charge-transport simulations on morphologies with a range of tortuosity values reveal that tortuosity can significantly reduce the magnitude of the mobility and the electric-field dependence relative to a neat material. These reductions are found to be further controlled by the energetic disorder and temperature. Most significantly, the sensitivity of the electric-field dependence to the tortuosity can explain the different experimental relationships previously reported, and exploiting this sensitivity could lead to simpler methods for characterizing and optimizing charge transport in organic solar cells.

  2. Space Charge Compensation in the Linac4 Low Energy Beam Transport Line with Negative Hydrogen Ions

    CERN Document Server

    Valerio-Lizarraga, C; Leon-Monzon, I; Lettry, J; Midttun, O; Scrivens, R


    The space charge effect of low energy, unbunched ion beams can be compensated by the trapping of ions or electrons into the beam potential. This has been studied for the 45 keV negative hydrogen ion beam in the CERN Linac4 Low Energy Beam Tranport (LEBT) using the package IBSimu1, which allows the space charge calculation of the particle trajectories. The results of the beam simulations will be compared to emittance measurements of an H- beam at the CERN Linac4 3 MeV test stand, where the injection of hydrogen gas directly into the beam transport region has been used to modify the space charge compensation degree.

  3. Third-order TRANSPORT: A computer program for designing charged particle beam transport systems

    International Nuclear Information System (INIS)

    Carey, D.C.; Brown, K.L.; Rothacker, F.


    TRANSPORT has been in existence in various evolutionary versions since 1963. The present version of TRANSPORT is a first-, second-, and third-order matrix multiplication computer program intended for the design of static-magnetic beam transport systems. This report discusses the following topics on TRANSPORT: Mathematical formulation of TRANSPORT; input format for TRANSPORT; summaries of TRANSPORT elements; preliminary specifications; description of the beam; physical elements; other transformations; assembling beam lines; operations; variation of parameters for fitting; and available constraints -- the FIT command

  4. Surface charge-specific interactions between polymer nanoparticles and ABC transporters in Caco-2 cells

    Energy Technology Data Exchange (ETDEWEB)

    Bhattacharjee, Sourav, E-mail: [Wageningen University, Laboratory of Organic Chemistry (Netherlands); Opstal, Edward J. van; Alink, Gerrit M. [Wageningen University, Division of Toxicology (Netherlands); Marcelis, Antonius T. M.; Zuilhof, Han [Wageningen University, Laboratory of Organic Chemistry (Netherlands); Rietjens, Ivonne M. C. M. [Wageningen University, Division of Toxicology (Netherlands)


    The surface charge-dependent transport of polymeric nanoparticles (PNPs) across Caco-2 monolayers grown on transwell culture systems as an in vitro model for intestinal transport was tested. The transport of well-characterized, monodisperse, and fluorescent tri-block copolymer nanoparticles (TCNPs/size {approx}45 nm) and polystyrene nanoparticles (PSNPs/size {approx}50 nm), with different surface charges (positive and negative), was quantified. The positive PNPs showed a higher intracellular uptake and flux across the Caco-2 monolayers than the negative PNPs. Multidrug resistance/P-glycoprotein (MDR1/P-gp), a specific ATP-binding cassette (ABC) transporter, was found to play a major role in the cellular efflux of positive PNPs, whereas the multidrug resistance protein 1 took part in the efflux of negative PNPs from Caco-2 cells. The positive PNPs also caused an increased cellular uptake and apical to basolateral transport of the carcinogen PhIP across the Caco-2 monolayer. The flavonoid quercetin, which is known to interact with ABC transporters, promoted the intracellular uptake of different PNPs and interfered with the normal distribution patterns of PNPs in the transwell system. These results indicate that PNPs display surface charge-specific interactions with ABC transporters and can even affect the bioavailability of toxic food-borne compounds (like pro-carcinogens).

  5. Surface charge-specific interactions between polymer nanoparticles and ABC transporters in Caco-2 cells (United States)

    Bhattacharjee, Sourav; van Opstal, Edward J.; Alink, Gerrit M.; Marcelis, Antonius T. M.; Zuilhof, Han; Rietjens, Ivonne M. C. M.


    The surface charge-dependent transport of polymeric nanoparticles (PNPs) across Caco-2 monolayers grown on transwell culture systems as an in vitro model for intestinal transport was tested. The transport of well-characterized, monodisperse, and fluorescent tri-block copolymer nanoparticles (TCNPs/size 45 nm) and polystyrene nanoparticles (PSNPs/size 50 nm), with different surface charges (positive and negative), was quantified. The positive PNPs showed a higher intracellular uptake and flux across the Caco-2 monolayers than the negative PNPs. Multidrug resistance/P-glycoprotein (MDR1/P-gp), a specific ATP-binding cassette (ABC) transporter, was found to play a major role in the cellular efflux of positive PNPs, whereas the multidrug resistance protein 1 took part in the efflux of negative PNPs from Caco-2 cells. The positive PNPs also caused an increased cellular uptake and apical to basolateral transport of the carcinogen PhIP across the Caco-2 monolayer. The flavonoid quercetin, which is known to interact with ABC transporters, promoted the intracellular uptake of different PNPs and interfered with the normal distribution patterns of PNPs in the transwell system. These results indicate that PNPs display surface charge-specific interactions with ABC transporters and can even affect the bioavailability of toxic food-borne compounds (like pro-carcinogens).

  6. Surface charge-specific interactions between polymer nanoparticles and ABC transporters in Caco-2 cells

    International Nuclear Information System (INIS)

    Bhattacharjee, Sourav; Opstal, Edward J. van; Alink, Gerrit M.; Marcelis, Antonius T. M.; Zuilhof, Han; Rietjens, Ivonne M. C. M.


    The surface charge-dependent transport of polymeric nanoparticles (PNPs) across Caco-2 monolayers grown on transwell culture systems as an in vitro model for intestinal transport was tested. The transport of well-characterized, monodisperse, and fluorescent tri-block copolymer nanoparticles (TCNPs/size ∼45 nm) and polystyrene nanoparticles (PSNPs/size ∼50 nm), with different surface charges (positive and negative), was quantified. The positive PNPs showed a higher intracellular uptake and flux across the Caco-2 monolayers than the negative PNPs. Multidrug resistance/P-glycoprotein (MDR1/P-gp), a specific ATP-binding cassette (ABC) transporter, was found to play a major role in the cellular efflux of positive PNPs, whereas the multidrug resistance protein 1 took part in the efflux of negative PNPs from Caco-2 cells. The positive PNPs also caused an increased cellular uptake and apical to basolateral transport of the carcinogen PhIP across the Caco-2 monolayer. The flavonoid quercetin, which is known to interact with ABC transporters, promoted the intracellular uptake of different PNPs and interfered with the normal distribution patterns of PNPs in the transwell system. These results indicate that PNPs display surface charge-specific interactions with ABC transporters and can even affect the bioavailability of toxic food-borne compounds (like pro-carcinogens).

  7. Charge-spin Transport in Surface-disordered Three-dimensional Topological Insulators (United States)

    Peng, Xingyue

    As one of the most promising candidates for the building block of the novel spintronic circuit, the topological insulator (TI) has attracted world-wide interest of study. Robust topological order protected by time-reversal symmetry (TRS) makes charge transport and spin generation in TIs significantly different from traditional three-dimensional (3D) or two-dimensional (2D) electronic systems. However, to date, charge transport and spin generation in 3D TIs are still primarily modeled as single-surface phenomena, happening independently on top and bottom surfaces. In this dissertation, I will demonstrate via both experimental findings and theoretical modeling that this "single surface'' theory neither correctly describes a realistic 3D TI-based device nor reveals the amazingly distinct physical picture of spin transport dynamics in 3D TIs. Instead, I present a new viewpoint of the spin transport dynamics where the role of the insulating yet topologically non-trivial bulk of a 3D TI becomes explicit. Within this new theory, many mysterious transport and magneto-transport anomalies can be naturally explained. The 3D TI system turns out to be more similar to its low dimensional sibling--2D TI rather than some other systems sharing the Dirac dispersion, such as graphene. This work not only provides valuable fundamental physical insights on charge-spin transport in 3D TIs, but also offers important guidance to the design of 3D TI-based spintronic devices.

  8. Charge transport properties of a twisted DNA molecule: A renormalization approach

    Energy Technology Data Exchange (ETDEWEB)

    Almeida, M.L. de; Ourique, G.S.; Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Albuquerque, E.L., E-mail: [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Moura, F.A.B.F. de; Lyra, M.L. [Instituto de Física, Universidade Federal de Alagoas, 57072-900 Maceió-AL (Brazil)


    In this work we study the charge transport properties of a nanodevice consisting of a finite segment of the DNA molecule sandwiched between two metallic electrodes. Our model takes into account a nearest-neighbor tight-binding Hamiltonian considering the nucleobases twist motion, whose solutions make use of a two-steps renormalization process to simplify the algebra, which can be otherwise quite involved. The resulting variations of the charge transport efficiency are analyzed by numerically computing the main features of the electron transmittance spectra as well as their I × V characteristic curves.

  9. Improving charge transport property and energy transfer with carbon quantum dots in inverted polymer solar cells

    International Nuclear Information System (INIS)

    Liu, Chunyu; Chang, Kaiwen; Guo, Wenbin; Li, Hao; Shen, Liang; Chen, Weiyou; Yan, Dawei


    Carbon quantum dots (Cdots) are synthesized by a simple method and introduced into active layer of polymer solar cells (PSCs). The performance of doped devices was apparently improved, and the highest power conversion efficiency of 7.05% was obtained, corresponding to a 28.2% enhancement compared with that of the contrast device. The charge transport properties, resistance, impedance, and transient absorption spectrum are systematically investigated to explore how the Cdots affect on PSCs performance. This study reveals the importance of Cdots in enhancing the efficiency of PSCs and gives insight into the mechanism of charge transport improvement.

  10. Algorithms for solving the single-sink fixed-charge transportation problem

    DEFF Research Database (Denmark)

    Klose, Andreas


    The single-sink fixed-charge transportation problem is an important subproblem of the fixed-charge transportation problem. Just a few methods have been proposed in the literature to solve this problem. In this paper, solution approaches based on dynamic programming and implicit enumeration...... are revisited. It is shown how the problem size as well as the search space of a recently published dynamic programming method can be reduced by exploiting reduced cost information. Additionally, a further implicit enumeration approach relying on solution concepts for the binary knapsack problem is introduced...

  11. Study of the charge transport characteristics of dendrimer molecular thin films

    Energy Technology Data Exchange (ETDEWEB)

    Li, J.C., E-mail:; Han, N.; Wang, S.S.; Ba, D.C.


    In this work, we systematically studied the electrical characteristics of two types of dendritic arylamine thin film devices. We observed that, for devices with different interfacial structures, their charge injection barriers and transport properties are obviously different. The smallest charge injection barrier is observed in dendrimer devices without charge-transfer interfacial layers. The Richardson-Schottky thermionic emission model can be well used to fit the experimental current-voltage characteristics at a lower voltage region. The charge injection barrier increases about 0.4 eV and 0.5 eV when a 1-decanethiol self-assembly layer and -CN terminated dendrimer thin films are inserted as the interfacial layer, respectively. It is shown that the molecule/electrode charge-transfer interfaces can largely affect the device charge injection/transport process and consequently change the device performance. In this case, the space charge limited conduction theory is more applicable to simulate the device conduction mechanism. Owing to its ultra-thin thickness, the self-assembly monolayer technique is proved to be an efficient approach in engineering the interfacial electronic structures of dendrimer thin film devices.

  12. Study of the charge transport characteristics of dendrimer molecular thin films

    International Nuclear Information System (INIS)

    Li, J.C.; Han, N.; Wang, S.S.; Ba, D.C.


    In this work, we systematically studied the electrical characteristics of two types of dendritic arylamine thin film devices. We observed that, for devices with different interfacial structures, their charge injection barriers and transport properties are obviously different. The smallest charge injection barrier is observed in dendrimer devices without charge-transfer interfacial layers. The Richardson-Schottky thermionic emission model can be well used to fit the experimental current-voltage characteristics at a lower voltage region. The charge injection barrier increases about 0.4 eV and 0.5 eV when a 1-decanethiol self-assembly layer and -CN terminated dendrimer thin films are inserted as the interfacial layer, respectively. It is shown that the molecule/electrode charge-transfer interfaces can largely affect the device charge injection/transport process and consequently change the device performance. In this case, the space charge limited conduction theory is more applicable to simulate the device conduction mechanism. Owing to its ultra-thin thickness, the self-assembly monolayer technique is proved to be an efficient approach in engineering the interfacial electronic structures of dendrimer thin film devices.

  13. Charge transport in polyguanine-polycytosine DNA molecules

    International Nuclear Information System (INIS)

    Wei, J H; Chan, K S


    A double chain tight-binding model is proposed to interpret the experimental I-V curves for polyguanine-polycytosine DNA molecules reported in Porath et al (2000 Nature 493 635). The proposed model includes the salient features of existing transport models of DNA molecules. The proposed double chain model fits excellently with the experimental I-V curves and provides a theoretical interpretation of features found in the I-V curves, which so far do not have a satisfactory explanation. Steps in the I-V curves are explained as the result of transmission gaps caused by hybridization with reservoirs and inter-chain coupling. Variations in I-V curves are due to the variation of inter-chain and intra-chain hopping parameters caused by structural changes in the DNA molecules

  14. Modeling of charge transport in ion bipolar junction transistors. (United States)

    Volkov, Anton V; Tybrandt, Klas; Berggren, Magnus; Zozoulenko, Igor V


    Spatiotemporal control of the complex chemical microenvironment is of great importance to many fields within life science. One way to facilitate such control is to construct delivery circuits, comprising arrays of dispensing outlets, for ions and charged biomolecules based on ionic transistors. This allows for addressability of ionic signals, which opens up for spatiotemporally controlled delivery in a highly complex manner. One class of ionic transistors, the ion bipolar junction transistors (IBJTs), is especially attractive for these applications because these transistors are functional at physiological conditions and have been employed to modulate the delivery of neurotransmitters to regulate signaling in neuronal cells. Further, the first integrated complementary ionic circuits were recently developed on the basis of these ionic transistors. However, a detailed understanding of the device physics of these transistors is still lacking and hampers further development of components and circuits. Here, we report on the modeling of IBJTs using Poisson's and Nernst-Planck equations and the finite element method. A two-dimensional model of the device is employed that successfully reproduces the main characteristics of the measurement data. On the basis of the detailed concentration and potential profiles provided by the model, the different modes of operation of the transistor are analyzed as well as the transitions between the different modes. The model correctly predicts the measured threshold voltage, which is explained in terms of membrane potentials. All in all, the results provide the basis for a detailed understanding of IBJT operation. This new knowledge is employed to discuss potential improvements of ion bipolar junction transistors in terms of miniaturization and device parameters.

  15. Frequency dependent magneto-transport in charge transfer Co(II) complex

    Energy Technology Data Exchange (ETDEWEB)

    Shaw, Bikash Kumar; Saha, Shyamal K., E-mail:


    A charge transfer chelated system containing ferromagnetic metal centers is the ideal system to investigate the magneto-transport and magneto-dielectric effects due to the presence of both electronic as well as magnetic properties and their coupling. Magneto-transport properties in materials are usually studied through dc charge transport under magnetic field. As frequency dependent conductivity is an essential tool to understand the nature of carrier wave, its spatial extension and their mutual interaction, in the present work, we have investigated frequency dependent magneto-transport along with magnetization behavior in [Co{sub 2}(II)-(5-(4-PhMe)-1,3,4-oxadiazole-H{sup +}-2-thiolate){sub 5}](OAc){sub 4} metal complex to elucidate the nature of above quantities and their response under magnetic field in the transport property. We have used the existing model for ac conduction incorporating the field dependence to explain the frequency dependent magneto-transport. It is seen that the frequency dependent magneto-transport could be well explained using the existing model for ac conduction. -Highlights: • Chelated Co(II) complex is synthesized for magneto-transport applications. • Frequency dependent magneto-transport and magnetization behavior are studied. • Nature of carrier wave, its spatial extension is investigated under magnetic field. • Existing model for ac conduction is used with magnetic field dependence.

  16. Plasma stream transport method (2) Use of charge exchange plasma source

    International Nuclear Information System (INIS)

    Tsuchimoto, T.


    The plasma stream transport method using a single plasma source has limitations for practical film deposition. Using a charge exchange phenomenon, a new plasma source is devised and tested by the plasma stream transport machine. Metals, silicon dioxide, and nitride films are deposited by this system. The mechanism of deposition under relatively high vacuum surrounding a silicon wafer is discussed as is the effect of radical atoms

  17. The Role of Dopant Ions on Charge Injection and Transport in Electrochemically Doped Quantum Dot Films. (United States)

    Gudjonsdottir, Solrun; van der Stam, Ward; Kirkwood, Nicholas; Evers, Wiel H; Houtepen, Arjan J


    Control over the charge density is very important for implementation of colloidal semiconductor nanocrystals into various optoelectronic applications. A promising approach to dope nanocrystal assemblies is charge injection by electrochemistry, in which the charge compensating electrolyte ions can be regarded as external dopant ions. To gain insight into the doping mechanism and the role of the external dopant ions, we investigate charge injection in ZnO nanocrystal assemblies for a large series of charge compensating electrolyte ions with spectroelectrochemical and electrochemical transistor measurements. We show that charge injection is limited by the diffusion of cations in the nanocrystal films as their diffusion coefficient are found to be ∼7 orders of magnitude lower than those of electrons. We further show that the rate of charge injection depends strongly on the cation size and cation concentration. Strikingly, the onset of electron injection varies up to 0.4 V, depending on the size of the electrolyte cation. For the small ions Li + and Na + the onset is at significantly less negative potentials. For larger ions (K + , quaternary ammonium ions) the onset is always at the same, more negative potential, suggesting that intercalation may take place for Li + and Na + . Finally, we show that the nature of the charge compensating cation does not affect the source-drain electronic conductivity and mobility, indicating that shallow donor levels from intercalating ions fully hybridize with the quantum confined energy levels and that the reorganization energy due to intercalating ions does not strongly affect electron transport in these nanocrystal assemblies.

  18. Computational investigation of the effects of perfluorination on the charge-transport properties of polyaromatic hydrocarbons

    International Nuclear Information System (INIS)

    Cardia, R.; Malloci, G.; Bosin, A.; Serra, G.; Cappellini, G.


    We present a systematic computational study of the effects of perfluorination on the charge-transport properties of three homologous classes of polyaromatic hydrocarbons of interest for molecular electronics: acenes, pyrenes, and circumacenes. By means of Density Functional Theory calculations we first obtained the key molecular properties for transport of both holes and electrons. We then used these parameters in the framework of Marcus theory to compare charge-transfer rates in the high temperatures regime for both unsubstituted and perfluorinated molecules. We additionally estimated the relative charge-mobility of each unsubstituted (perfluorinated) molecule with respect to unsubstituted (perfluorinated) pentacene. We found in all cases that perfluorination reduces the charge-transfer rate in absolute terms. This is largely due to the higher values of the molecular reorganization energies predicted for perfluorinated compounds. Interestingly, however, the charge-transfer rates for both holes and electrons of perfluorinated species are remarkably similar, especially for the larger species. In addition, in the case of the larger circumacenes the charge-mobility values relative to pentacene values are found to increase upon perfluorination.

  19. Computational investigation of the effects of perfluorination on the charge-transport properties of polyaromatic hydrocarbons

    Energy Technology Data Exchange (ETDEWEB)

    Cardia, R. [Università degli studi di Cagliari, Dipartimento di Fisica, Cittadella Universitaria, I-09042 Monserrato (Cagliari) (Italy); Istituto Officina dei Materiali (CNR – IOM), UOS di Cagliari, Cittadella Universitaria, I-09042 Monserrato, Cagliari (Italy); Malloci, G., E-mail: [Università degli studi di Cagliari, Dipartimento di Fisica, Cittadella Universitaria, I-09042 Monserrato (Cagliari) (Italy); Bosin, A.; Serra, G. [Università degli studi di Cagliari, Dipartimento di Fisica, Cittadella Universitaria, I-09042 Monserrato (Cagliari) (Italy); Cappellini, G., E-mail: [Università degli studi di Cagliari, Dipartimento di Fisica, Cittadella Universitaria, I-09042 Monserrato (Cagliari) (Italy); Istituto Officina dei Materiali (CNR – IOM), UOS di Cagliari, Cittadella Universitaria, I-09042 Monserrato, Cagliari (Italy)


    We present a systematic computational study of the effects of perfluorination on the charge-transport properties of three homologous classes of polyaromatic hydrocarbons of interest for molecular electronics: acenes, pyrenes, and circumacenes. By means of Density Functional Theory calculations we first obtained the key molecular properties for transport of both holes and electrons. We then used these parameters in the framework of Marcus theory to compare charge-transfer rates in the high temperatures regime for both unsubstituted and perfluorinated molecules. We additionally estimated the relative charge-mobility of each unsubstituted (perfluorinated) molecule with respect to unsubstituted (perfluorinated) pentacene. We found in all cases that perfluorination reduces the charge-transfer rate in absolute terms. This is largely due to the higher values of the molecular reorganization energies predicted for perfluorinated compounds. Interestingly, however, the charge-transfer rates for both holes and electrons of perfluorinated species are remarkably similar, especially for the larger species. In addition, in the case of the larger circumacenes the charge-mobility values relative to pentacene values are found to increase upon perfluorination.

  20. Charge transport in anodic TiO.sub.2./sub. nanotubes studied by terahertz spectroscopy

    Czech Academy of Sciences Publication Activity Database

    Krbal, M.; Kuchařík, Jiří; Sopha, H.; Němec, Hynek; Macák, J. M.


    Roč. 10, č. 9 (2016), s. 691-695 ISSN 1862-6254 R&D Projects: GA ČR GA13-12386S Institutional support: RVO:68378271 Keywords : terahertz spectroscopy * charge transport * TiO2 nanotubes Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 3.032, year: 2016

  1. Charge transport through DNA/DNA duplexes and DNA/RNA hybrids: complex mechanism study

    Czech Academy of Sciences Publication Activity Database

    Kratochvílová, Irena; Vala, M.; Weiter, M.; Špérová, M.; Schneider, Bohdan; Páv, Ondřej; Šebera, Jakub; Rosenberg, Ivan; Sychrovský, Vladimír


    Roč. 20, č. 1 (2013), s. 9-9 ISSN 1211-5894. [Discussions in Structural Molecular Biology. Annual Meeting of the Czech Society for Structural Biology /11./. 14.03.2013-16.03.2013, Nové Hrady] Institutional support: RVO:61388963 ; RVO:68378271 ; RVO:86652036 Keywords : charge transport * fluorescence spectroscopy * DFT Subject RIV: CF - Physical ; Theoretical Chemistry

  2. Influence of magnetic impurities on charge transport in diffusive-normal-metal/superconductor junctions

    NARCIS (Netherlands)

    Yokoyama, T.; Tanaka, Y.; Golubov, Alexandre Avraamovitch; Inoue, J.; Asano, Y.


    Charge transport in the diffusive normal metal (DN)/insulator/s- and d-wave superconductor junctions is studied in the presence of magnetic impurities in DN in the framework of the quasiclassical Usadel equations with the generalized boundary conditions. The cases of s- and d-wave superconducting

  3. Theory of thermal and charge transport in diffusive normal metal / superconductor junctions

    NARCIS (Netherlands)

    Yokoyama, T.; Tanaka, Y.; Golubov, Alexandre Avraamovitch; Asano, Y.


    Thermal and charge transport in diffusive normal metal (DN)/insulator/s-, d-, and p-wave superconductor junctions are studied based on the Usadel equation with the Nazarov's generalized boundary condition. We derive a general expression of the thermal conductance in unconventional superconducting

  4. Charge transport and contact resistance in coplanar devices based on colloidal polyaniline dispersion

    Czech Academy of Sciences Publication Activity Database

    Masillamani, A. M.; Peřinka, N.; Hajná, Milena; Stejskal, Jaroslav; Tondelier, D.; Bonnassieux, Y.; Vanel, J.-C.; Geffroy, B.; Mencaraglia, D.


    Roč. 54, č. 17 (2016), s. 1710-1716 ISSN 0887-6266 R&D Projects: GA ČR(CZ) GA13-00270S Institutional support: RVO:61389013 Keywords : charge transport * colloidal dispersion * colloids Subject RIV: JI - Composite Materials Impact factor: 2.838, year: 2016

  5. Picosecond charge transport in rutile at high carrier densities studiedby transient terahertz spectroscopy

    Czech Academy of Sciences Publication Activity Database

    Zajac, Vít; Němec, Hynek; Kužel, Petr


    Roč. 94, č. 11 (2016), 1-9, č. článku 115206. ISSN 1098-0121 R&D Projects: GA ČR GA13-12386S Institutional support: RVO:68378271 Keywords : terahertz spectroscopy * charge transport * TiO 2 * rutile * ultrafast spectroscopy Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 3.736, year: 2014

  6. Local charge transport properties of hydrazine reduced monolayer graphene oxide sheets prepared under pressure condition

    DEFF Research Database (Denmark)

    Ryuzaki, Sou; Meyer, Jakob Abild Stengaard; Petersen, Søren Vermehren


    Charge transport properties of chemically reduced graphene oxide (RGO) sheets prepared by treatment with hydrazine were examined using conductive atomic force microscopy. The current-voltage (I-V) characteristics of monolayer RGO sheets prepared under atmospheric pressure followed an exponentially...

  7. The electro-optical and charge transport study of imidazolidin derivative: Quantum chemical investigations

    Directory of Open Access Journals (Sweden)

    Ahmad Irfan


    Full Text Available Imidazolidin derivatives gained significant attention in our daily life from better biological activity to the semiconducting materials. The present investigation deals with the in depth study of (Z-2-sulfanylidene-5-(thiophen-2-ylmethylideneimidazolidin-4-one (STMI with respect to their structural, electronic, optical and charge transport properties as semiconducting material. The ground and first excited state geometries were optimized by applying density functional theory (DFT and time dependent DFT, respectively. The light has been shed on the frontier molecular orbitals (FMOs and observed comprehensible intramolecular charge transfer (ICT from the highest occupied molecular orbitals (HOMOs to the lowest unoccupied molecular orbitals (LUMOs. The absorption, emission, ionization potentials (IP, electron affinities (EA, total and partial densities of states and structure-property relationship have been discussed. Finally, hole as well as electron reorganization energies, transfer integrals and intrinsic mobilities have been calculated then charge transport behavior of STMI was discussed, intensively.

  8. Coulombic interactions and multicomponent ionic dispersion during transport of charged species in heterogeneous porous media

    DEFF Research Database (Denmark)

    Muniruzzaman, Muhammad; Rolle, Massimo

    Electrochemical cross-coupling plays a significant role for transport of charged species in porous media [1, 2]. In this study we performed flow-through experiments in a quasi two-dimensional setup using dilute solutions of strong electrolytes to study the influence of charge interactions on mass...... occurred. To quantitatively interpret the outcomes of our laboratory experiments in the spatially variable flow fields we developed a two dimensional numerical model based on a multicomponent formulation, on charge conservation and on the accurate description of transverse dispersion. The results...... of the multicomponent transport simulations were compared with the high-resolution (5 mm spacing) concentration measurements of the ionic species at the outlet of the flow-through domain. The excellent agreement between the measured concentrations and the results of purely forward numerical simulations demonstrates...

  9. A n-vector model for charge transport in molecular semiconductors. (United States)

    Jackson, Nicholas E; Kohlstedt, Kevin L; Chen, Lin X; Ratner, Mark A


    We develop a lattice model utilizing coarse-grained molecular sites to study charge transport in molecular semiconducting materials. The model bridges atomistic descriptions and structureless lattice models by mapping molecular structure onto sets of spatial vectors isomorphic with spin vectors in a classical n-vector Heisenberg model. Specifically, this model incorporates molecular topology-dependent orientational and intermolecular coupling preferences, including the direct inclusion of spatially correlated transfer integrals and site energy disorder. This model contains the essential physics required to explicitly simulate the interplay of molecular topology and correlated structural disorder, and their effect on charge transport. As a demonstration of its utility, we apply this model to analyze the effects of long-range orientational correlations, molecular topology, and intermolecular interaction strength on charge motion in bulk molecular semiconductors.

  10. An improved charge transport system for the pelletron accelerator in Lund

    International Nuclear Information System (INIS)

    Hellborg, R.; Hakansson, K.


    Several improvements have been implemented in the chain charge transport system of a pelletron. The main new components are a modified support at ground for the chain accessories, a new power supply for the chain motor, including the possibility of variable chain speed, and pickup rings to monitor the relative amount of charge on individual cylinders of the chain. These modifications, together with the installation of a second chain, have resulted in improved operational reliability, a much smoother startup of the chain, and a doubled maximum chain current. The latter will simplify running the accelerator with heavy ions at maximum terminal voltage. The pickup rings have been found to be useful in diagnosing malfunctions in the charge transport system. (orig.)

  11. Space charge compensation in the Linac4 low energy beam transport line with negative hydrogen ions

    Energy Technology Data Exchange (ETDEWEB)

    Valerio-Lizarraga, Cristhian A., E-mail: [CERN, Geneva (Switzerland); Departamento de Investigación en Física, Universidad de Sonora, Hermosillo (Mexico); Lallement, Jean-Baptiste; Lettry, Jacques; Scrivens, Richard [CERN, Geneva (Switzerland); Leon-Monzon, Ildefonso [Facultad de Ciencias Fisico-Matematicas, Universidad Autónoma de Sinaloa, Culiacan (Mexico); Midttun, Øystein [CERN, Geneva (Switzerland); University of Oslo, Oslo (Norway)


    The space charge effect of low energy, unbunched ion beams can be compensated by the trapping of ions or electrons into the beam potential. This has been studied for the 45 keV negative hydrogen ion beam in the CERN Linac4 Low Energy Beam Transport using the package IBSimu [T. Kalvas et al., Rev. Sci. Instrum. 81, 02B703 (2010)], which allows the space charge calculation of the particle trajectories. The results of the beam simulations will be compared to emittance measurements of an H{sup −} beam at the CERN Linac4 3 MeV test stand, where the injection of hydrogen gas directly into the beam transport region has been used to modify the space charge compensation degree.

  12. Two-Dimensional Spatial Imaging of Charge Transport in Germanium Crystals at Cryogenic Temperatures

    Energy Technology Data Exchange (ETDEWEB)

    Moffatt, Robert [Stanford Univ., CA (United States)


    In this dissertation, I describe a novel apparatus for studying the transport of charge in semiconductors at cryogenic temperatures. The motivation to conduct this experiment originated from an asymmetry observed between the behavior of electrons and holes in the germanium detector crystals used by the Cryogenic Dark Matter Search (CDMS). This asymmetry is a consequence of the anisotropic propagation of electrons in germanium at cryogenic temperatures. To better model our detectors, we incorporated this effect into our Monte Carlo simulations of charge transport. The purpose of the experiment described in this dissertation is to test those models in detail. Our measurements have allowed us to discover a shortcoming in our most recent Monte Carlo simulations of electrons in germanium. This discovery would not have been possible without the measurement of the full, two-dimensional charge distribution, which our experimental apparatus has allowed for the first time at cryogenic temperatures.

  13. Effect of backbone structure on charge transport along isolated conjugated polymer chains

    International Nuclear Information System (INIS)

    Siebbeles, Laurens D.A.; Grozema, Ferdinand C.; Haas, Matthijs P. de; Warman, John M.


    Fast charge transport in conjugated polymers is essential for their application in opto-electronic devices. In the present paper, measurements and theoretical modeling of the mobility of excess charges along isolated chains of conjugated polymers in dilute solution are presented. Charge carriers were produced by irradiation of the polymer solution with 3-MeV electrons from a Van de Graaff accelerator. The mobilities of the charges along the polymer chains were obtained from time-resolved microwave conductivity measurements. The mobilities are strongly dependent on the chemical nature of the polymer backbone. Comparison of the experimental data with results from ab initio quantum mechanical calculations shows that the measured mobilities are strongly limited by torsional disorder, chemical defects and chain ends. Improvement of the structure of polymer backbones is therefore expected to significantly enhance the performance of these materials in 'plastic electronics'

  14. Exciton shelves for charge and energy transport in third-generation quantum-dot devices (United States)

    Goodman, Samuel; Singh, Vivek; Noh, Hyunwoo; Casamada, Josep; Chatterjee, Anushree; Cha, Jennifer; Nagpal, Prashant


    Quantum dots are semiconductor nanocrystallites with size-dependent quantum-confined energy levels. While they have been intensively investigated to utilize hot-carriers for photovoltaic applications, to bridge the mismatch between incident solar photons and finite bandgap of semiconductor photocells, efficient charge or exciton transport in quantum-dot films has proven challenging. Here we show development of new coupled conjugated molecular wires with ``exciton shelves'', or different energy levels, matched with the multiple energy levels of quantum dots. Using single nanoparticle and ensemble device measurements we show successful extraction and transport of both bandedge and high-energy charge carriers, and energy transport of excitons. We demonstrate using measurements of electronic density of states, that careful matching of energy states of quantum-dot with molecular wires is important, and any mismatch can generate midgap states leading to charge recombination and reduced efficiency. Therefore, these exciton-shelves and quantum dots can lead to development of next-generation photovoltaic and photodetection devices using simultaneous transport of bandedge and hot-carriers or energy transport of excitons in these nanostructured solution-processed films.

  15. Analysis of charge transport in gels containing polyoxometallates using methods of different sensitivity to migration. (United States)

    Caban, Karolina; Lewera, Adam; Zukowska, Grazyna Z; Kulesza, Pawel J; Stojek, Zbigniew; Jeffrey, Kenneth R


    Two methods have been used for examination of transport of charge in gels soaked with DMF and containing dissolved polyoxometallates. The first method is based on the analysis of both Cottrellian and steady-state currents and therefore is capable of giving the concentration of the electroactive redox centres and their transport (diffusion-type) coefficient. The second method provides the real diffusion coefficients, i.e. transport coefficients free of migrational influence, for both the substrate and the product of the electrode reaction. Several gels based on poly(methyl methacrylate), with charged (addition of 1-acrylamido-2-methyl-2-propanesulphonic acid to the polymerization mixture) and uncharged chains, have been used in the investigation. The ratio obtained for the diffusion coefficient (second method) and transport coefficient (first method) was smaller for the gels containing charged polymer chains than for the gels with uncharged chains. In part these changes could be explained by the contribution of migration to the transport of polyoxomatallates in the gels. However, the impact of the changes in the polymer-channel capacity at the electrode surface while the electrode process proceeds was also considered. These structural changes should affect differently the methods based on different time domains.

  16. Carbon materials for enhancing charge transport in the advancements of perovskite solar cells (United States)

    Hu, Ruiyuan; Chu, Liang; Zhang, Jian; Li, Xing'ao; Huang, Wei


    Organic-inorganic halide perovskite solar cells (PSCs) have become a new favorite in the photovoltaic field, due to the boosted efficiency up to 22.1%. Despite a flow of achievements, there are certain challenges to simultaneously meet high efficiency, large scale, low cost and high stability. Due to the low cost, extensive sources, high electrical conductivity and chemical stability, carbon materials have made undeniable contributions to play positive roles in developing PSCs. Carbon materials not only have the favorable conductivity but also bipolar advantage, which can transfer both electrons and holes. In this review, we will discuss how the carbon materials transfer charge or accelerate charge transport by incorporation in PSCs. Carbon materials can replace transparent conductive oxide layers, and enhance electron transport in electron transport layers. Moreover, carbon materials with continuous structure, especially carbon nanotubes and graphene, can provide direct charge transport channel that make them suitable additives or even substitutes in hole transport layers. Especially, the successful application of carbon materials as counter electrodes makes the devices full-printable, low temperature and high stability. Finally, a brief outlook is provided on the future development of carbon materials for PSCs, which are expected to devote more contributions in the future photovoltaic market.

  17. Charge transport and recombination dynamics in organic bulk heterojunction solar cells

    Energy Technology Data Exchange (ETDEWEB)

    Baumann, Andreas


    The charge transport in disordered organic bulk heterojunction (BHJ) solar cells is a crucial process affecting the power conversion efficiency (PCE) of the solar cell. With the need of synthesizing new materials for improving the power conversion efficiency of those cells it is important to study not only the photophysical but also the electrical properties of the new material classes. Thereby, the experimental techniques need to be applicable to operating solar cells. In this work, the conventional methods of transient photoconductivity (also known as ''Time-of-Flight'' (TOF)), as well as the transient charge extraction technique of ''Charge Carrier Extraction by Linearly Increasing Voltage'' (CELIV) are performed on different organic blend compositions. Especially with the latter it is feasible to study the dynamics - i.e. charge transport and charge carrier recombination - in bulk heterojunction (BHJ) solar cells with active layer thicknesses of 100-200 nm. For a well performing organic BHJ solar cells the morphology is the most crucial parameter finding a trade-off between an efficient photogeneration of charge carriers and the transport of the latter to the electrodes. Besides the morphology, the nature of energetic disorder of the active material blend and its influence on the dynamics are discussed extensively in this work. Thereby, the material system of poly(3-hexylthiophene-2,5-diyl) (P3HT) and [6,6]-phenyl-C{sub 61}butyric acid methyl ester (PC{sub 61}BM) serves mainly as a reference material system. New promising donor or acceptor materials and their potential for application in organic photovoltaics are studied in view of charge dynamics and compared with the reference system. With the need for commercialization of organic solar cells the question of the impact of environmental conditions on the PCE of the solar cells raises. In this work, organic BHJ solar cells exposed to synthetic air for finite duration are

  18. Charge and current transport in open field lines turbulence: Influence of plasma-surface boundary conditions

    Energy Technology Data Exchange (ETDEWEB)

    Futtersack, R., E-mail: [CEA, IRFM, F-13108 Saint-Paul-lez-Durance (France); Universite Paul Sabatier Toulouse, LAPLACE, 118 Route de Narbonne, F-31062 Toulouse Cedex 9 (France); Tamain, P. [CEA, IRFM, F-13108 Saint-Paul-lez-Durance (France); Hagelaar, G. [Universite Paul Sabatier Toulouse, LAPLACE, 118 Route de Narbonne, F-31062 Toulouse Cedex 9 (France); Ghendrih, Ph.; Simonin, A. [CEA, IRFM, F-13108 Saint-Paul-lez-Durance (France)


    We investigate the impact of both parallel and transverse boundary conditions on the current and charge transport in open field line systems using the TOKAM2D code, which solves a minimal model for interchange turbulence. Various limit test cases are discussed and analyzed. In the parallel direction, the sheath conductivity is found to play an essential role in the stabilization of large-scale potential structures, leading to the formation of transport channel or transport barrier respectively for an insulating end wall or a wall with an enhanced sheath conductivity. On another hand, the addition of transverse boundary conditions intrinsically changes the transport characteristics, influencing both radial profiles and probability density functions. It underlines that in some cases a detailed description of the plasma-wall interaction process is required to get a proper description of the current loop pattern that determines electrostatic turbulent transport.

  19. Effects of Confinement on Microstructure and Charge Transport in High Performance Semicrystalline Polymer Semiconductors

    KAUST Repository

    Himmelberger, Scott; Dacuñ a, Javier; Rivnay, Jonathan; Jimison, Leslie H.; McCarthy-Ward, Thomas; Heeney, Martin; McCulloch, Iain; Toney, Michael F.; Salleo, Alberto


    The film thickness of one of the most crystalline and highest performing polymer semiconductors, poly(2,5-bis(3-tetradecylthiophen-2-yl)thieno[3,2-b] thiophene) (PBTTT), is varied in order to determine the effects of interfaces and confinement on the microstructure and performance in organic field effect transistors (OFETs). Crystalline texture and overall film crystallinity are found to depend strongly on film thickness and thermal processing. The angular distribution of crystallites narrows upon both a decrease in film thickness and thermal annealing. These changes in the film microstructure are paired with thin-film transistor characterization and shown to be directly correlated with variations in charge carrier mobility. Charge transport is shown to be governed by film crystallinity in films below 20 nm and by crystalline orientation for thicker films. An optimal thickness is found for PBTTT at which the mobility is maximized in unannealed films and where mobility reaches a plateau at its highest value for annealed films. The effects of confinement on the morphology and charge transport properties of poly(2,5-bis(3-tetradecylthiophen-2-yl) thieno[3,2-b]thiophene) (PBTTT) are studied using quantitative X-ray diffraction and field-effect transistor measurements. Polymer crystallinity is found to limit charge transport in the thinnest films while crystalline texture and intergrain connectivity modulate carrier mobility in thicker films. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Effects of Confinement on Microstructure and Charge Transport in High Performance Semicrystalline Polymer Semiconductors

    KAUST Repository

    Himmelberger, Scott


    The film thickness of one of the most crystalline and highest performing polymer semiconductors, poly(2,5-bis(3-tetradecylthiophen-2-yl)thieno[3,2-b] thiophene) (PBTTT), is varied in order to determine the effects of interfaces and confinement on the microstructure and performance in organic field effect transistors (OFETs). Crystalline texture and overall film crystallinity are found to depend strongly on film thickness and thermal processing. The angular distribution of crystallites narrows upon both a decrease in film thickness and thermal annealing. These changes in the film microstructure are paired with thin-film transistor characterization and shown to be directly correlated with variations in charge carrier mobility. Charge transport is shown to be governed by film crystallinity in films below 20 nm and by crystalline orientation for thicker films. An optimal thickness is found for PBTTT at which the mobility is maximized in unannealed films and where mobility reaches a plateau at its highest value for annealed films. The effects of confinement on the morphology and charge transport properties of poly(2,5-bis(3-tetradecylthiophen-2-yl) thieno[3,2-b]thiophene) (PBTTT) are studied using quantitative X-ray diffraction and field-effect transistor measurements. Polymer crystallinity is found to limit charge transport in the thinnest films while crystalline texture and intergrain connectivity modulate carrier mobility in thicker films. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Charge carrier transport and photogeneration in P3HT:PCBM photovoltaic blends. (United States)

    Laquai, Frédéric; Andrienko, Denis; Mauer, Ralf; Blom, Paul W M


    This article reviews the charge transport and photogeneration in bulk-heterojunction solar cells made from blend films of regioregular poly(3-hexylthiophene) (RR-P3HT) and methano-fullerene (PCBM). The charge transport, specifically the hole mobility in the RR-P3HT phase of the polymer:fullerene photovoltaic blend, is dramatically affected by thermal annealing. The hole mobility increases more than three orders of magnitude and reaches a value of up to 2 × 10(-4) cm(2) V(-1) s(-1) after the thermal annealing process as a result of an improved semi-crystallinity of the film. This significant increase of the hole mobility balances the electron and hole mobilities in a photovoltaic blend in turn reducing space-charge formation, and this is the most important factor for the strong enhancement of the photovoltaic efficiency compared to an as cast, that is, non-annealed device. In fact, the balanced charge carrier mobility in RR-P3HT:PCBM blends in combination with a field- and temperature-independent charge carrier generation and greatly reduced non-geminate recombination explains the large quantum efficiencies mea-sured in P3HT:PCBM photovoltaic devices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Charge Carrier Transport and Photogeneration in P3HT:PCBM Photovoltaic Blends

    KAUST Repository

    Laquai, Frederic


    This article reviews the charge transport and photogeneration in bulk-heterojunction solar cells made from blend films of regioregular poly(3-hexylthiophene) (RR-P3HT) and methano­fullerene (PCBM). The charge transport, specifically the hole mobility in the RR-P3HT phase of the polymer:fullerene photovoltaic blend, is dramatically affected by thermal annealing. The hole mobility increases more than three orders of magnitude and reaches a value of up to 2 × 10−4 cm2 V−1 s−1 after the thermal annealing process as a result of an improved semi-crystallinity of the film. This significant increase of the hole mobility balances the electron and hole mobilities in a photovoltaic blend in turn reducing space-charge formation, and this is the most important factor for the strong enhancement of the photovoltaic efficiency compared to an as cast, that is, non-annealed device. In fact, the balanced charge carrier mobility in RR-P3HT:PCBM blends in combination with a field- and temperature-independent charge carrier generation and greatly reduced non-geminate recombination explains the large quantum efficiencies mea­sured in P3HT:PCBM photovoltaic devices.

  3. Charge trapping and carrier transport mechanism in silicon-rich silicon oxynitride

    International Nuclear Information System (INIS)

    Yu Zhenrui; Aceves, Mariano; Carrillo, Jesus; Lopez-Estopier, Rosa


    The charge-trapping and carrier transport properties of silicon-rich silicon oxynitride (SRO:N) were studied. The SRO:N films were deposited by low pressure chemical vapor deposition. Infrared (IR) and transmission electron microscopic (TEM) measurements were performed to characterize their structural properties. Capacitance versus voltage and current versus voltage measurements (I-V) were used to study the charge-trapping and carrier transport mechanism. IR and TEM measurements revealed the existence of Si nanodots in SRO:N films. I-V measurements revealed that there are two conduction regimes divided by a threshold voltage V T . When the applied voltage is smaller than V T , the current is dominated by the charge transfer between the SRO:N and substrate; and in this regime only dynamic charging/discharging of the SRO:N layer is observed. When the voltage is larger than V T , the current increases rapidly and is dominated by the Poole-Frenkel mechanism; and in this regime, large permanent trapped charge density is obtained. Nitrogen incorporation significantly reduced the silicon nanodots or defects near the SRO:N/Si interface. However, a significant increase of the density of silicon nanodot in the bulk of the SRO:N layer is obtained

  4. Transport, charge exchange and loss of energetic heavy ions in the earth's radiation belts - Applicability and limitations of theory (United States)

    Spjeldvik, W. N.


    Computer simulations of processes which control the relative abundances of ions in the trapping regions of geospace are compared with observations from discriminating ion detectors. Energy losses due to Coulomb collisions between ions and exospheric neutrals are considered, along with charge exchange losses and internal charge exchanges. The time evolution of energetic ion fluxes of equatorially mirroring ions under radial diffusion is modelled to include geomagnetic and geoelectric fluctutations. Limits to the validity of diffusion transport theory are discussed, and the simulation is noted to contain provisions for six ionic charge states and the source effect on the radiation belt oxygen ion distributions. Comparisons are made with ion flux data gathered on Explorer 45 and ISEE-1 spacecraft and results indicate that internal charge exchanges cause the radiation belt ion charge state to be independent of source charge rate characteristics, and relative charge state distribution is independent of the radially diffusive transport rate below the charge state redistribution zone.

  5. Study of charge transport in composite blend of P3HT and PCBM (United States)

    Kumar, Manoj; Kumar, Sunil; Upadhyaya, Aditi; Yadav, Anjali; Gupta, Saral K.; Singh, Amarjeet


    Poly (3-hexylthiophene-2,5diyl) (P3HT) as donor and [6,6]-phenyl C61 butyric acid methyl ester (PCBM) as acceptor are mostly used as active medium in polymeric electronic device. In this paper we have prepare the P3HT - PCBM based bulk hetero junction thin films by spin coating technique. The charge transport properties of P3HT:PCBM blends are investigated by the current-voltage measurements using Ag as an electron injecting electrode and ITO as a hole injecting contact. The current density v/s voltage relationships are analyzed in the backdrop of Schottky and Space charge limited current model.

  6. Charge Transport in Conjugated Materials: From Theoretical Models to Experimental Systems

    International Nuclear Information System (INIS)

    Olivier, Yoann; Cornil, Jerome; Muccioli, Luca; Zannoni, Claudio


    Charge carrier mobility is the key quantity to characterize the charge transport properties in devices. Based on earlier work of Baessler and co-workers, we set up a Monte-Carlo approach that allows us to calculate mobility using transfer rates derived from Marcus theory. The parameters entering into the rate expression are evaluated by means of different quantum-chemical techniques. Our approach is applied here to a model one-dimensional system made of pentacene molecules as well as to real systems such as crystalline structures and columnar liquid crystal phases.

  7. The influence of morphology on charge transport/recombination dynamics in planar perovskite solar cells (United States)

    Yu, Man; Wang, Yi; Wang, Hao-Yi; Han, Jun; Qin, Yujun; Zhang, Jian-Ping; Ai, Xi-Cheng


    The photovoltaic performance of planar perovskite solar cell is significantly influenced by the morphology of perovskite film. In this work, five kinds of devices with different perovskite film morphologies were prepared by varying the concentration of CH3NH3Cl in precursor solutions. We found that best morphology of perovskite film results in the excellent photovoltaic performance with an average efficiency of 15.52% and a champion efficiency of 16.38%. Transient photovoltage and photocurrent measurements are performed to elucidate the mechanism of photoelectric conversion processes, which shows that the charge recombination is effectively suppressed and the charge transport is obviously promoted by optimized morphology.

  8. Electron-hole collision limited transport in charge-neutral bilayer graphene (United States)

    Nam, Youngwoo; Ki, Dong-Keun; Soler-Delgado, David; Morpurgo, Alberto F.


    Ballistic transport occurs whenever electrons propagate without collisions deflecting their trajectory. It is normally observed in conductors with a negligible concentration of impurities, at low temperature, to avoid electron-phonon scattering. Here, we use suspended bilayer graphene devices to reveal a new regime, in which ballistic transport is not limited by scattering with phonons or impurities, but by electron-hole collisions. The phenomenon manifests itself in a negative four-terminal resistance that becomes visible when the density of holes (electrons) is suppressed by gate-shifting the Fermi level in the conduction (valence) band, above the thermal energy. For smaller densities, transport is diffusive, and the measured conductivity is reproduced quantitatively, with no fitting parameters, by including electron-hole scattering as the only process causing velocity relaxation. Experiments on a trilayer device show that the phenomenon is robust and that transport at charge neutrality is governed by the same physics. Our results provide a textbook illustration of a transport regime that had not been observed previously and clarify the nature of conduction through charge-neutral graphene under conditions in which carrier density inhomogeneity is immaterial. They also demonstrate that transport can be limited by a fully electronic mechanism, originating from the same microscopic processes that govern the physics of Dirac-like plasmas.

  9. Charge transport properties of graphene: Effects of Cu-based gate electrode

    Energy Technology Data Exchange (ETDEWEB)

    Tang, Qide [School of Physics and Optoelectronics, Xiangtan University, Xiangtan 411105 (China); Zhang, C. X., E-mail:; Tang, Chao, E-mail:; Zhong, Jianxin [School of Physics and Optoelectronics, Xiangtan University, Xiangtan 411105 (China); Hunan Provincial Key Laboratory of Micro-Nano Energy Materials and Devices, Xiangtan University, Hunan 411105 (China); He, Chaoyu [Hunan Provincial Key Laboratory of Micro-Nano Energy Materials and Devices, Xiangtan University, Hunan 411105 (China)


    Using the first-principles nonequilibrium Green's function method, we study effects of Cu and Ni@Cu used as the Cu-based gate electrode on the charge transport of graphene in the field effect transistors (FET). We find that the transmission of graphene decreases with both Cu and Ni@Cu absorbed in the scatter region. Especially, noticeable transmission gaps are present around the Femi level. The transmission gaps are still effective, and considerable cut-off regions are found under the non-equilibrium environment. The Ni@Cu depresses the transmission of graphene more seriously than the Cu and enlarges the transmission gap in armchair direction. The effects on the charge transport are attributed to the redistribution of electronic states of graphene. Both Cu and Ni@Cu induce the localization of states, so as to block the electronic transport. The Ni@Cu transforms the interaction between graphene and gate electrode from the physisorption to the chemisorption, and then induces more localized states, so that the transmission decreases further. Our results suggest that besides being used to impose gate voltage, the Cu-based gate electrode itself will have a considerable effect on the charge transport of graphene and induces noticeable transmission gap in the FET.

  10. Modulation and Control of Charge Transport Through Single-Molecule Junctions. (United States)

    Wang, Kun; Xu, Bingqian


    The ability to modulate and control charge transport though single-molecule junction devices is crucial to achieving the ultimate goal of molecular electronics: constructing real-world-applicable electronic components from single molecules. This review aims to highlight the progress made in single-molecule electronics, emphasizing the development of molecular junction electronics in recent years. Among many techniques that attempt to wire a molecule to metallic electrodes, the single-molecule break junction (SMBJ) technique is one of the most reliable and tunable experimental platforms for achieving metal-molecule-metal configurations. It also provides great freedom to tune charge transport through the junction. Soon after the SMBJ technique was introduced, it was extensively used to measure the conductances of individual molecules; however, different conductances were obtained for the same molecule, and it proved difficult to interpret this wide distribution of experimental data. This phenomenon was later found to be mainly due to a lack of precise experimental control and advanced data analysis methods. In recent years, researchers have directed considerable effort into advancing the SMBJ technique by gaining a deeper physical understanding of charge transport through single molecules and thus enhancing its potential applicability in functional molecular-scale electronic devices, such as molecular diodes and molecular transistors. In parallel with that research, novel data analysis methods and approaches that enable the discovery of hidden yet important features in the data are being developed. This review discusses various aspects of molecular junction electronics, from the initial goal of molecular electronics, the development of experimental techniques for creating single-molecule junctions and determining single-molecule conductance, to the characterization of functional current-voltage features and the investigation of physical properties other than charge

  11. Thermal generation and mobility of charge carriers in collective proton transport in hydrogen-bonded chains

    International Nuclear Information System (INIS)

    Peyrard, M.; Boesch, R.; Kourakis, I.


    The transport of protons in hydrogen-bonded systems is a long standing problem which has not yet obtained a satisfactorily theoretical description. Although this problem was examined first for ice, it is relevant in many systems and in particular in biology for the transport along proteins or for proton conductance across membranes, an essential process in cell life. The broad relevance makes the study of proton conduction very appealing. Since the original work of Bernal and Fowler on ice, the idea that the transport occurs through chains of hydrogen bonds has been well accepted. Such ''proton wires'' were invoked by Nagle and Morowitz for proton transport across membranes proteins and more recently across lipid bilayers. In this report, we assume the existence of such an hydrogen-bonded chain and discuss its consequences on the dynamics of the charge carriers. We show that this assumption leads naturally to the idea of soliton transport and we put a special emphasis on the role of the coupling between the protons and heavy ions motions. The model is presented. We show how the coupling affects strongly the dynamics of the charge carriers and we discuss the role it plays in the thermal generation of carriers. The work presented has been performed in 1986 and 87 with St. Pnevmatikos and N. Flyzanis and was then completed in collaboration with D. Hochstrasser and H. Buettner. Therefore the results presented in this part are not new but we think that they are appropriate in the context of this multidisciplinary workshop because they provide a rather complete example of the soliton picture for proton conduction. This paper discusses the thermal generation of the charge carriers when the coupling between the protons and heavy ions dynamics is taken into account. The results presented in this part are very recent and will deserve further analysis but they already show that the coupling can assist for the formation of the charge carriers

  12. EBQ code: Transport of space-charge beams in axially symmetric devices (United States)

    Paul, A. C.


    Such general-purpose space charge codes as EGUN, BATES, WODF, and TRANSPORT do not gracefully accommodate the simulation of relativistic space-charged beams propagating a long distance in axially symmetric devices where a high degree of cancellation has occurred between the self-magnetic and self-electric forces of the beam. The EBQ code was written specifically to follow high current beam particles where space charge is important in long distance flight in axially symmetric machines possessing external electric and magnetic field. EBQ simultaneously tracks all trajectories so as to allow procedures for charge deposition based on inter-ray separations. The orbits are treated in Cartesian geometry (position and momentum) with z as the independent variable. Poisson's equation is solved in cylindrical geometry on an orthogonal rectangular mesh. EBQ can also handle problems involving multiple ion species where the space charge from each must be included. Such problems arise in the design of ion sources where different charge and mass states are present.

  13. EBQ code: transport of space-charge beams in axially symmetric devices

    International Nuclear Information System (INIS)

    Paul, A.C.


    Such general-purpose space charge codes as EGUN, BATES, WOLF, and TRANSPORT do not gracefully accommodate the simulation of relativistic space-charged beams propagating a long distance in axially symmetric devices where a high degree of cancellation has occurred between the self-magnetic and self-electric forces of the beam. The EBQ code was written specifically to follow high current beam particles where space charge is important in long distance flight in axially symmetric machines possessing external electric and magnetic field. EBQ simultaneously tracks all trajectories so as to allow procedures for charge deposition based on inter-ray separations. The orbits are treated in Cartesian geometry (position and momentum) with z as the independent variable. Poisson's equation is solved in cylindrical geometry on an orthogonal rectangular mesh. EBQ can also handle problems involving multiple ion species where the space charge from each must be included. Such problems arise in the design of ion sources where different charge and mass states are present

  14. Polarization of electron-beam irradiated LDPE films: contribution to charge generation and transport (United States)

    Banda, M. E.; Griseri, V.; Teyssèdre, G.; Le Roy, S.


    Electron-beam irradiation is an alternative way to generate charges in insulating materials, at controlled position and quantity, in order to monitor their behaviour in regard to transport phenomena under the space charge induced electric field or external field applied. In this study, low density polyethylene (LDPE) films were irradiated by a 80 keV electron-beam with a flux of 1 nA cm‑2 during 10 min in an irradiation chamber under vacuum conditions, and were then characterized outside the chamber using three experimental methods. The electrical behaviour of the irradiated material was assessed by space charge measurements using the pulsed electro-acoustic (PEA) method under dc stress. The influence of the applied electric field polarity and amplitude has been tested in order to better understand the charge behaviour after electron-beam irradiation. Fourier transform infra-red spectroscopy (FTIR) and photoluminescence (PL) measurements were performed to evaluate the impact of the electron beam irradiation, i.e. deposited charges and energy, on the chemical structure of the irradiated samples. The present results show that the electrical behaviour in LDPE after irradiation is mostly driven by charges, i.e. by physical process functions of the electric field, and that changes in the chemical structure seems to be mild.

  15. The Role of Dopant Ions on Charge Injection and Transport in Electrochemically Doped Quantum Dot Films (United States)


    Control over the charge density is very important for implementation of colloidal semiconductor nanocrystals into various optoelectronic applications. A promising approach to dope nanocrystal assemblies is charge injection by electrochemistry, in which the charge compensating electrolyte ions can be regarded as external dopant ions. To gain insight into the doping mechanism and the role of the external dopant ions, we investigate charge injection in ZnO nanocrystal assemblies for a large series of charge compensating electrolyte ions with spectroelectrochemical and electrochemical transistor measurements. We show that charge injection is limited by the diffusion of cations in the nanocrystal films as their diffusion coefficient are found to be ∼7 orders of magnitude lower than those of electrons. We further show that the rate of charge injection depends strongly on the cation size and cation concentration. Strikingly, the onset of electron injection varies up to 0.4 V, depending on the size of the electrolyte cation. For the small ions Li+ and Na+ the onset is at significantly less negative potentials. For larger ions (K+, quaternary ammonium ions) the onset is always at the same, more negative potential, suggesting that intercalation may take place for Li+ and Na+. Finally, we show that the nature of the charge compensating cation does not affect the source-drain electronic conductivity and mobility, indicating that shallow donor levels from intercalating ions fully hybridize with the quantum confined energy levels and that the reorganization energy due to intercalating ions does not strongly affect electron transport in these nanocrystal assemblies. PMID:29718666

  16. Solving the Single-Sink, Fixed-Charge, Multiple-Choice Transportation Problem by Dynamic Programming

    DEFF Research Database (Denmark)

    Christensen, Tue; Andersen, Kim Allan; Klose, Andreas


    This paper considers a minimum-cost network flow problem in a bipartite graph with a single sink. The transportation costs exhibit a staircase cost structure because such types of transportation cost functions are often found in practice. We present a dynamic programming algorithm for solving...... this so-called single-sink, fixed-charge, multiple-choice transportation problem exactly. The method exploits heuristics and lower bounds to peg binary variables, improve bounds on flow variables, and reduce the state-space variable. In this way, the dynamic programming method is able to solve large...... instances with up to 10,000 nodes and 10 different transportation modes in a few seconds, much less time than required by a widely used mixed-integer programming solver and other methods proposed in the literature for this problem....

  17. Thickness dependent charge transport in ferroelectric BaTiO3 heterojunctions (United States)

    Singh, Pooja; Rout, P. K.; Singh, Manju; Rakshit, R. K.; Dogra, Anjana


    We have investigated the effect of ferroelectric barium titanate (BaTiO3) film thickness on the charge transport mechanism in pulsed laser deposited epitaxial metal-ferroelectric semiconductor junctions. The current (I)-voltage (V) measurements across the junctions comprising of 20-500 nm thick BaTiO3 and conducting bottom electrode (Nb: SrTiO3 substrate or La2/3Ca1/3MnO3 buffer layer) demonstrate the space charge limited conduction. Further analysis indicates a reduction in the ratio of free to trapped carriers with increasing thickness in spite of decreasing trap density. Such behaviour arises the deepening of the shallow trap levels (I-V curves implies a bipolar resistive switching behaviour, which can be explained in terms of charge trapping and de-trapping process.

  18. PATH: a lumped-element beam-transport simulation program with space charge

    International Nuclear Information System (INIS)

    Farrell, J.A.


    PATH is a group of computer programs for simulating charged-particle beam-transport systems. It was developed for evaluating the effects of some aberrations without a time-consuming integration of trajectories through the system. The beam-transport portion of PATH is derived from the well-known program, DECAY TURTLE. PATH contains all features available in DECAY TURTLE (including the input format) plus additional features such as a more flexible random-ray generator, longitudinal phase space, some additional beamline elements, and space-charge routines. One of the programs also provides a simulation of an Alvarez linear accelerator. The programs, originally written for a CDC 7600 computer system, also are available on a VAX-VMS system. All of the programs are interactive with input prompting for ease of use

  19. Charge transport mechanisms of graphene/semiconductor Schottky barriers: A theoretical and experimental study

    International Nuclear Information System (INIS)

    Zhong, Haijian; Liu, Zhenghui; Xu, Gengzhao; Shi, Lin; Fan, Yingmin; Yang, Hui; Xu, Ke; Wang, Jianfeng; Ren, Guoqiang


    Graphene has been proposed as a material for semiconductor electronic and optoelectronic devices. Understanding the charge transport mechanisms of graphene/semiconductor Schottky barriers will be crucial for future applications. Here, we report a theoretical model to describe the transport mechanisms at the interface of graphene and semiconductors based on conventional semiconductor Schottky theory and a floating Fermi level of graphene. The contact barrier heights can be estimated through this model and be close to the values obtained from the experiments, which are lower than those of the metal/semiconductor contacts. A detailed analysis reveals that the barrier heights are as the function of the interface separations and dielectric constants, and are influenced by the interfacial states of semiconductors. Our calculations show how this behavior of lowering barrier heights arises from the Fermi level shift of graphene induced by the charge transfer owing to the unique linear electronic structure

  20. Synthesis, characterization and charge transport mechanism of CdZnO nanorods

    International Nuclear Information System (INIS)

    Mahmoud, Waleed E.; Al-Ghamdi, A.A.; El-Tantawy, F.; Al-Heniti, S.


    ZnO and Cd-doped ZnO nanostructures were prepared by new facile method at 80 deg. C. XRD measurement indicated that both samples had typical hexagonal wurtzite structures. Transmission electron microscopy (TEM) measurement shows that rod-like crystals have been formed. EDX measurement confirms the incorporation of the cadmium ion into the crystalline lattice of ZnO and indicated that cadmium ions uniformly distributed on the surface of the rods. The doping with cadmium ions has a great influence on the optical properties of the ZnO. The electrical measurements of Cd-doped ZnO nanorod were measured. The current-voltage (I-V) characteristic curve revealed that the charge transport above 4 V is mainly non-linear due to grain boundary contribution. The complex impedance spectroscopy was confirmed that the grain boundary effect controls the charge transport mechanism through CdZnO ceramic material.

  1. Quantitative description of charge-carrier transport in a white organic light-emitting diode (United States)

    Schober, M.; Anderson, M.; Thomschke, M.; Widmer, J.; Furno, M.; Scholz, R.; Lüssem, B.; Leo, K.


    We present a simulation model for the analysis of charge-carrier transport in organic thin-film devices, and apply it to a three-color white hybrid organic light-emitting diode (OLED) with fluorescent blue and phosphorescent red and green emission. We simulate a series of single-carrier devices, which reconstruct the OLED layer sequence step by step. Thereby, we determine the energy profiles for hole and electron transport, show how to discern bulk from interface limitation, and identify trap states.

  2. Charge transport in non-polar and semi-polar III-V nitride heterostructures

    International Nuclear Information System (INIS)

    Konar, Aniruddha; Verma, Amit; Fang, Tian; Zhao, Pei; Jana, Raj; Jena, Debdeep


    Compared to the intense research focus on the optical properties, the transport properties in non-polar and semi-polar III-nitride semiconductors remain relatively unexplored to date. The purpose of this paper is to discuss charge-transport properties in non-polar and semi-polar orientations of GaN in a comparative fashion to what is known for transport in polar orientations. A comprehensive approach is adopted, starting from an investigation of the differences in the electronic bandstructure along different polar orientations of GaN. The polarization fields along various orientations are then discussed, followed by the low-field electron and hole mobilities. A number of scattering mechanisms that are specific to non-polar and semi-polar GaN heterostructures are identified, and their effects are evaluated. Many of these scattering mechanisms originate due to the coupling of polarization with disorder and defects in various incarnations depending on the crystal orientation. The effect of polarization orientation on carrier injection into quantum-well light-emitting diodes is discussed. This paper ends with a discussion of orientation-dependent high-field charge-transport properties including velocity saturation, instabilities and tunneling transport. Possible open problems and opportunities are also discussed. (paper)

  3. Spiro-OMeTAD single crystals: Remarkably enhanced charge-carrier transport via mesoscale ordering

    KAUST Repository

    Shi, Dong


    We report the crystal structure and hole-transport mechanism in spiro-OMeTAD [2,2′,7,7′-tetrakis(N,N-di-p-methoxyphenyl-amine)9,9′-spirobifluorene], the dominant hole-transporting material in perovskite and solid-state dye-sensitized solar cells. Despite spiro-OMeTAD’s paramount role in such devices, its crystal structure was unknown because of highly disordered solution-processed films; the hole-transport pathways remained ill-defined and the charge carrier mobilities were low, posing a major bottleneck for advancing cell efficiencies. We devised an antisolvent crystallization strategy to grow single crystals of spiro-OMeTAD, which allowed us to experimentally elucidate its molecular packing and transport properties. Electronic structure calculations enabled us to map spiro-OMeTAD’s intermolecular charge-hopping pathways. Promisingly, single-crystal mobilities were found to exceed their thin-film counterparts by three orders of magnitude. Our findings underscore mesoscale ordering as a key strategy to achieving breakthroughs in hole-transport material engineering of solar cells.

  4. Design rules for charge-transport efficient host materials for phosphorescent organic light-emitting diodes. (United States)

    May, Falk; Al-Helwi, Mustapha; Baumeier, Björn; Kowalsky, Wolfgang; Fuchs, Evelyn; Lennartz, Christian; Andrienko, Denis


    The use of blue phosphorescent emitters in organic light-emitting diodes (OLEDs) imposes demanding requirements on a host material. Among these are large triplet energies, the alignment of levels with respect to the emitter, the ability to form and sustain amorphous order, material processability, and an adequate charge carrier mobility. A possible design strategy is to choose a π-conjugated core with a high triplet level and to fulfill the other requirements by using suitable substituents. Bulky substituents, however, induce large spatial separations between conjugated cores, can substantially reduce intermolecular electronic couplings, and decrease the charge mobility of the host. In this work we analyze charge transport in amorphous 2,8-bis(triphenylsilyl)dibenzofuran, an electron-transporting material synthesized to serve as a host in deep-blue OLEDs. We show that mesomeric effects delocalize the frontier orbitals over the substituents recovering strong electronic couplings and lowering reorganization energies, especially for electrons, while keeping energetic disorder small. Admittance spectroscopy measurements reveal that the material has indeed a high electron mobility and a small Poole-Frenkel slope, supporting our conclusions. By linking electronic structure, molecular packing, and mobility, we provide a pathway to the rational design of hosts with high charge mobilities.

  5. Analysis of some greedy algorithms for the single-sink fixed-charge transportation problem

    DEFF Research Database (Denmark)

    Görtz, Simon; Klose, Andreas


    -charge transportation problem. Nevertheless, just a few methods for solving this problem have been proposed in the literature. In this paper, some greedy heuristic solutions methods for the SSFCTP are investigated. It is shown that two greedy approaches for the SSFCTP known from the literature can be arbitrarily bad......, whereas an approximation algorithm proposed in the literature for the binary min-knapsack problem has a guaranteed worst case bound if adapted accordingly to the case of the SSFCTP....

  6. Finite Element in Angle Unit Sphere Meshing for Charged Particle Transport.

    Energy Technology Data Exchange (ETDEWEB)

    Ortega, Mario Ivan [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Drumm, Clifton R. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)


    Finite element in angle formulations of the charged particle transport equation require the discretization of the unit sphere. In Sceptre, a three-dimensional surface mesh of a sphere is transformed into a two-dimensional mesh. Projection of a sphere onto a two-dimensional surface is well studied with map makers spending the last few centuries attempting to create maps that preserve proportion and area. Using these techniques, various meshing schemes for the unit sphere were investigated.

  7. Charge transport mechanism in p-type copper ion containing triazine thiolate metallopolymer thin film devices (United States)

    K, Deepak; Roy, Amit; Anjaneyulu, P.; Kandaiah, Sakthivel; Pinjare, Sampatrao L.


    The charge transport mechanism in copper ions containing 1,3,5-Triazine-2,4,6-trithiolate (CuTCA) based polymer device in sandwich (Ag/CuTCA/Cu) geometry is studied. The current-voltage (I-V) characteristics of the metallopolymer CuTCA device have shown a transition in the charge transport mechanism from Ohmic to Space-charge limited conduction when temperature and voltage are varied. The carriers in CuTCA devices exhibit hopping transport, in which carriers hop from one site to the other. The hole mobility in this polymer device is found to be dependent on electric field E ( μpα√{E } ) and temperature, which suggests that the polymer has inherent disorder. The electric-field coefficient γ and zero-field mobility μ0 are temperature dependent. The values of mobility and activation energies are estimated from temperature (90-140 K) dependent charge transport studies and found to be in the range of 1 × 10-11-8 × 10-12 m2/(V s) and 16.5 meV, respectively. Temperature dependent electric-field coefficient γ is in the order of 17.8 × 10-4 (m/V)1/2, and the value of zero-field mobility μ0 is in the order of 1.2 × 10-11 m2/(V s) at 140 K. A constant phase element (Q) is used to model the device parameters, which are extracted using the Impedance spectroscopy technique. The bandgap of the polymer is estimated to be 2.6 eV from UV-Vis reflectance spectra.

  8. Enhancement of charge-transport characteristics in polymeric films using polymer brushes

    DEFF Research Database (Denmark)

    Whiting, G.L.; Snaith, H.J.; Khodabakhsh, S.


    We show that charge-transporting polymer chains in the brush conformation can be synthesized from a variety of substrates of interest, displaying a high degree of stretching and showing up to a 3 orders of magnitude increase in current density normal to the substrate as compared with a spin......-coated film. These nanostructured polymeric films may prove to be suitable for electronic devices based on molecular semiconductors as current fabrication techniques often provide little control over film structure....

  9. Adomian decomposition method for solving the telegraph equation in charged particle transport

    International Nuclear Information System (INIS)

    Abdou, M.A.


    In this paper, the analysis for the telegraph equation in case of isotropic small angle scattering from the Boltzmann transport equation for charged particle is presented. The Adomian decomposition is used to solve the telegraph equation. By means of MAPLE the Adomian polynomials of obtained series (ADM) solution have been calculated. The behaviour of the distribution function are shown graphically. The results reported in this article provide further evidence of the usefulness of Adomain decomposition for obtaining solution of linear and nonlinear problems

  10. DNA-mediated bacterial aggregation is dictated by acid-base interactions

    NARCIS (Netherlands)

    Das, Theerthankar; Krom, Bastiaan P.; van der Mei, Henny C.; Busscher, Henk J.; Sharma, Prashant K.


    Extracellular DNA (eDNA) plays a significant role in bacterial biofilm formation and aggregation. Here, for the first time, we present a physico-chemical analysis of the DNA-mediated aggregation for three bacterial strains (Streptococcus mutans LT11, Pseudomonas aeruginosa PAO1 and Staphylococcus

  11. TRANSPORT: a computer program for designing charged particle beam transport systems

    International Nuclear Information System (INIS)

    Brown, K.L.; Rothacker, F.; Carey, D.C.; Iselin, C.


    TRANSPORT is a first- and second-order matrix multiplication computer program intended for the design of static-magnetic beam transport systems. It has been in existence in various evolutionary versions since 1963. The present version, described in the manual given, includes both first- and second-order fitting capabilities. TRANSPORT will step through the beam line, element by element, calculating the properties of the beam or other quantities, described below, where requested. Therefore one of the first elements is a specification of the phase space region occupied by the beam entering the system. Magnets and intervening spaces and other elements then follow in the sequence in which they occur in the beam line. Specifications of calculations to be done or of configurations other than normal are placed in the same sequence, at the point where their effect is to be made

  12. Design study of low-energy beam transport for multi-charge beams at RAON (United States)

    Bahng, Jungbae; Qiang, Ji; Kim, Eun-San


    The Rare isotope Accelerator Of Newness (RAON) at the Rare Isotope Science Project (RISP) is being designed to simultaneously accelerate beams with multiple charge states. It includes a driver superconducting (SC) linac for producing 200 MeV/u and 400 kW continuous wave (CW) heavy ion beams from protons to uranium. The RAON consists of a few electron cyclotron resonance ion sources, a low-energy beam transport (LEBT) system, a CW 81.25 MHz, 500 keV/u radio frequency quadrupole (RFQ) accelerator, a medium-energy beam transport system, the SC linac, and a charge-stripper system. The LEBT system for the RISP accelerator facility consists of a high-voltage platform, two 90° dipoles, a multi-harmonic buncher (MHB), solenoids, electrostatic quadrupoles, a velocity equalizer, and a diagnostic system. The ECR ion sources are located on a high-voltage platform to reach an initial beam energy of 10 keV/u. After extraction, the ion beam is transported through the LEBT system to the RFQ accelerator. The generated charge states are selected by an achromatic bending system and then bunched by the MHB in the LEBT system. The MHB is used to achieve a small longitudinal emittance in the RFQ by generating a sawtooth wave with three harmonics. In this paper, we present the results and issues of the beam dynamics of the LEBT system.

  13. Design study of low-energy beam transport for multi-charge beams at RAON

    Energy Technology Data Exchange (ETDEWEB)

    Bahng, Jungbae [Department of Physics, Kyungpook National University, Daegu 41566 (Korea, Republic of); Qiang, Ji [Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Kim, Eun-San, E-mail: [Department of Accelerator Science, Graduate School, Korea University Sejong Campus, Sejong 30019 (Korea, Republic of)


    The Rare isotope Accelerator Of Newness (RAON) at the Rare Isotope Science Project (RISP) is being designed to simultaneously accelerate beams with multiple charge states. It includes a driver superconducting (SC) linac for producing 200 MeV/u and 400 kW continuous wave (CW) heavy ion beams from protons to uranium. The RAON consists of a few electron cyclotron resonance ion sources, a low-energy beam transport (LEBT) system, a CW 81.25 MHz, 500 keV/u radio frequency quadrupole (RFQ) accelerator, a medium-energy beam transport system, the SC linac, and a charge-stripper system. The LEBT system for the RISP accelerator facility consists of a high-voltage platform, two 90° dipoles, a multi-harmonic buncher (MHB), solenoids, electrostatic quadrupoles, a velocity equalizer, and a diagnostic system. The ECR ion sources are located on a high-voltage platform to reach an initial beam energy of 10 keV/u. After extraction, the ion beam is transported through the LEBT system to the RFQ accelerator. The generated charge states are selected by an achromatic bending system and then bunched by the MHB in the LEBT system. The MHB is used to achieve a small longitudinal emittance in the RFQ by generating a sawtooth wave with three harmonics. In this paper, we present the results and issues of the beam dynamics of the LEBT system.

  14. Role of collector alternating charged patches on transport of Cryptosporidium parvum oocyst in a patchwise charged heterogeneous micromodel

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Yuanyuan; Zhang, Changyong; Hu, Dehong; Kuhlenschmidt, Mark S.; Kuhlenschmidt, Theresa B.; Mylon, Steven E.; Kong, Rong; Bhargava, Rohit; Nguyen, Thanh H.


    The role of collector surface charge heterogeneity on transport of Cryptosporidium parvum oocyst and carboxylate microsphere in 2-dimensional micromodels was studied. The cylindrical silica collectors within the micromodels were coated with 0, 10, 20, 50 and 100% Fe2O3 patches. The experimental values of average single collector removal efficiencies (η) of the Fe2O3 patches and on the entire collectors were determined. In the presence of significant (>3500 kT) Derjaguin–Landau–Verwey–Overbeek (DLVO) energy barrier between the microspheres and the silica collectors at pH 5.8 and 8.1, the values of η determined for Fe2O3 patches were significantly less (p < 0.05, t-test) than that obtained for collectors coated entirely with Fe2O3. However, η on Fe2O3 patches for microspheres at pH 4.4 and for oocysts at pH 5.8 and 8.1, where the DLVO energy barrier was relatively small (ca. 200-360 kT), were significantly greater (p < 0.05, t-test) than that on the collectors coated entirely with Fe2O3. The dependence of η determined for Fe2O3 patches on the DLVO energy barrier indicated the importance of periodic favorable and unfavorable electrostatic interactions between colloids and collectors with alternating Fe2O3 and silica patches. Differences between experimentally determined η and that predicted by a patchwise geochemical heterogeneous model was observed, but can be explained by the model’s lack of consideration for the spatial distribution of charge heterogeneity on the collector surface and colloid migration on patchwise heterogeneous collectors.

  15. Design of the low energy beam transport line between CARIBU and the EBIS charge breeder

    Energy Technology Data Exchange (ETDEWEB)

    Perry, A., E-mail: [Argonne National Laboratory, Argonne, IL 60439, USA and Illinois Institute of Technology, Chicago, IL 60616 (United States); Ostroumov, P. N.; Barcikowski, A.; Dickerson, C.; Kondrashev, S. A.; Mustapha, B.; Savard, G. [Argonne National Laboratory, Argonne, IL 60439 (United States)


    An Electron Beam Ion Source Charge Breeder (EBIS-CB) has been developed to breed radioactive beams from the CAlifornium Rare Isotope Breeder Upgrade (CARIBU) facility at ATLAS. The EBIS-CB will replace the existing ECR charge breeder to increase the intensity and improve the purity of reaccelerated radioactive ion beams. The EBIS-CB is in the final stage of off-line commissioning. Currently, we are developing a low energy beam transport (LEBT) system to transfer CARIBU beams to the EBIS-CB. As was originally planned, an RFQ cooler-buncher will precede the EBIS-CB. Recently, it was decided to include a multi-reflection time-of-flight (MR-TOF) mass-spectrometer following the RFQ. MR-TOF is a relatively new technology used to purify beams with a mass-resolving power up to 3×10{sup 5} as was demonstrated in experiments at CERN/ISOLDE. Very high purity singly-charged radioactive ion beams will be injected into the EBIS for charge breeding and due to its inherent properties, the EBIS-CB will maintain the purity of the charge bred beams. Possible contamination of residual gas ions will be greatly suppressed by achieving ultra-high vacuum in the EBIS trap. This paper will present and discuss the design of the LEBT and the overall integration of the EBIS-CB into ATLAS.

  16. Investigation on photoluminescence quenching of CdSe/ZnS quantum dots by organic charge transporting materials

    Directory of Open Access Journals (Sweden)

    Yuqiu Qu


    Full Text Available The effect of different organic charge transporting materials on the photoluminescence of CdSe/ZnS core/shell quantum dots has been studied by means of steady-state and time-resolved photoluminescence spectroscopy. With an increase in concentration of the organic charge transporting material in the quantum dots solutions, the photoluminescence intensity of CdSe/ZnS quantum dots was quenched greatly and the fluorescence lifetime was shortened gradually. The quenching efficiency of CdSe/ZnS core/shell quantum dots decreased with increasing the oxidation potential of organic charge transporting materials. Based on the analysis, two pathways in the photoluminescence quenching process have been defined: static quenching and dynamic quenching. The dynamic quenching is correlated with hole transporting from quantum dots to the charge transporting materials.

  17. Effect of base-pair inhomogeneities on charge transport along the DNA molecule, mediated by twist and radial polarons

    International Nuclear Information System (INIS)

    Palmero, F; Archilla, J F R; Hennig, D; Romero, F R


    Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder

  18. Opto-electro-modulated transient photovoltage and photocurrent system for investigation of charge transport and recombination in solar cells. (United States)

    Shi, Jiangjian; Li, Dongmei; Luo, Yanhong; Wu, Huijue; Meng, Qingbo


    An opto-electro-modulated transient photovoltage/photocurrent system has been developed to probe microscopic charge processes of a solar cell in its adjustable operating conditions. The reliability of this system is carefully determined by electric circuit simulations and experimental measurements. Using this system, the charge transport, recombination and storage properties of a conventional multicrystalline silicon solar cell under different steady-state bias voltages, and light illumination intensities are investigated. This system has also been applied to study the influence of the hole transport material layer on charge extraction and the microscopic charge processes behind the widely considered photoelectric hysteresis in perovskite solar cells.

  19. Charge transport in organic light-emitting diodes. Experiments and simulations

    Energy Technology Data Exchange (ETDEWEB)

    Schober, Matthias


    This thesis is about the development and validation of a numerical model for the simulation of the current-voltage characteristics of organic thin-film devices. The focus is on the analysis of a white organic light-emitting diode (OLED) with fluorescent blue and phosphorescent red and green emitters. The simulation model describes the charge transport as a one-dimensional drift-diffusion current and is developed on the basis of the Scharfetter-Gummel method. It incorporates modern theories for the charge transport in disordered organic materials, which are considered by means of special functions for the diffusion coefficient and the charge-carrier mobility. The algorithm is designed such that it can switch between different models for mobility and calculates both transient and steady-state solutions. In the analysis of the OLED, electron and hole transport are investigated separately in series of single-carrier devices. These test devices incorporate parts of the layers in the OLED between symmetrically arranged injection layers that are electrically doped. Thereby, the OLED layer sequence is reconstructed step by step. The analysis of the test devices allows to obtain the numerous parameters which are required for the simulation of the complete OLED and reveals many interesting features of the OLED. For instance, it is shown how the accumulation of charge carriers in front of an interface barrier increases the mobility and the transfer rate across the interface. Furthermore, it is demonstrated how to identify charge-trapping states. This leads to the detection of deep trap states in the emission zone of the OLED -- an interesting aspect, since these states can function as recombination centers and may cause non-radiative losses. Moreover, various other effects such as interface dipoles and a slight freeze-out of active electric dopants in the injection layers are observed. In the simulations of the numerous test devices, the parameters are consistently applied

  20. BEAMR: An interactive graphic computer program for design of charged particle beam transport systems (United States)

    Leonard, R. F.; Giamati, C. C.


    A computer program for a PDP-15 is presented which calculates, to first order, the characteristics of charged-particle beam as it is transported through a sequence of focusing and bending magnets. The maximum dimensions of the beam envelope normal to the transport system axis are continuously plotted on an oscilloscope as a function of distance along the axis. Provision is made to iterate the calculation by changing the types of magnets, their positions, and their field strengths. The program is especially useful for transport system design studies because of the ease and rapidity of altering parameters from panel switches. A typical calculation for a system with eight elements is completed in less than 10 seconds. An IBM 7094 version containing more-detailed printed output but no oscilloscope display is also presented.

  1. Charge-transport anisotropy in black phosphorus: critical dependence on the number of layers. (United States)

    Banerjee, Swastika; Pati, Swapan K


    Phosphorene is a promising candidate for modern electronics because of the anisotropy associated with high electron-hole mobility. Additionally, superior mechanical flexibility allows the strain-engineering of various properties including the transport of charge carriers in phosphorene. In this work, we have shown the criticality of the number of layers to dictate the transport properties of black phosphorus. Trilayer black phosphorus (TBP) has been proposed as an excellent anisotropic material, based on the transport parameters using Boltzmann transport formalisms coupled with density functional theory. The mobilities of both the electron and the hole are found to be higher along the zigzag direction (∼10(4) cm(2) V(-1) s(-1) at 300 K) compared to the armchair direction (∼10(2) cm(2) V(-1) s(-1)), resulting in the intrinsic directional anisotropy. Application of strain leads to additional electron-hole anisotropy with 10(3) fold higher mobility for the electron compared to the hole. Critical strain for maximum anisotropic response has also been determined. Whether the transport anisotropy is due to the spatial or charge-carrier has been determined through analyses of the scattering process of electrons and holes, and their recombination as well as relaxation dynamics. In this context, we have derived two descriptors (S and F(k)), which are general enough for any 2D or quasi-2D systems. Information on the scattering involving purely the carrier states also helps to understand the layer-dependent photoluminescence and electron (hole) relaxation in black phosphorus. Finally, we justify trilayer black phosphorus (TBP) as the material of interest with excellent transport properties.

  2. Long-range charge transport in single G-quadruplex DNA molecules

    DEFF Research Database (Denmark)

    Livshits, Gideon I.; Stern, Avigail; Rotem, Dvir


    DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set-ups, and transport......DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set......-ups, and transporting significant current through individual DNA-based molecules remains a considerable challenge. Here, we report reproducible charge transport in guanine-quadruplex (G4) DNA molecules adsorbed on a mica substrate. Currents ranging from tens of picoamperes to more than 100 pA were measured in the G4......-DNA over distances ranging from tens of nanometres to more than 100 nm. Our experimental results, combined with theoretical modelling, suggest that transport occurs via a thermally activated long-range hopping between multi-tetrad segments of DNA. These results could re-ignite interest in DNA...

  3. Effects of Te inclusions on charge-carrier transport properties in CdZnTe radiation detectors

    International Nuclear Information System (INIS)

    Gu, Yaxu; Rong, Caicai; Xu, Yadong; Shen, Hao; Zha, Gangqiang; Wang, Ning; Lv, Haoyan; Li, Xinyi; Wei, Dengke; Jie, Wanqi


    Highlights: • This work reveals the behaviors of Te inclusion in affecting charge-carrier transport properties in CdZnTe detectors for the first time and analysis the mechanism therein. • The results show that charge collection efficiencies in Te inclusion degraded regions experience fast ascent under low biases and slow descent at high applied biases, which deviates from the Hecht rule. • This phenomenon is attributed to the competitive influence of two mechanisms under different biases, namely charge carrier trapping due to uniformly distributed point defects and Te inclusion induced transient charge loss. • A modified Hecht equation is further proposed to explain the effects of high-density localized defects, say Te inclusions, on the charge collection efficiency. • We believe that this research has wide appeal to analyze the macroscopic defects and their influence on charge transport properties in semiconductor radiation detectors. - Abstract: The influence of tellurium (Te) inclusions on the charge collection efficiency in cadmium zinc telluride (CdZnTe or CZT) detectors has been investigated using ion beam induced charge (IBIC) technique. Combining the analysis of infrared transmittance image, most of the low charge collection areas in the IBIC images prove the existence of Te inclusions. To further clarify the role of Te inclusions on charge transport properties, bias dependent local IBIC scan was performed on Te inclusion related regions from 20 V to 500 V. The result shows that charge collection efficiencies in Te inclusion degraded regions experience fast ascent under low biases and slow descent at high applied biases, which deviates from Hecht rule. This behavior is attributed to the competitive influence of two mechanisms under different biases, namely charge carrier trapping due to uniformly distributed point defects and Te inclusion induced transient charge loss. A modified Hecht equation is further proposed to explain the effects of high

  4. Charge and Spin Transport in Spin-orbit Coupled and Topological Systems

    KAUST Repository

    Ndiaye, Papa Birame


    In the search for low power operation of microelectronic devices, spin-based solutions have attracted undeniable increasing interest due to their intrinsic magnetic nonvolatility. The ability to electrically manipulate the magnetic order using spin-orbit interaction, associated with the recent emergence of topological spintronics with its promise of highly efficient charge-to-spin conversion in solid state, offer alluring opportunities in terms of system design. Although the related technology is still at its infancy, this thesis intends to contribute to this engaging field by investigating the nature of the charge and spin transport in spin-orbit coupled and topological systems using quantum transport methods. We identified three promising building blocks for next-generation technology, three classes of systems that possibly enhance the spin and charge transport efficiency: (i)- topological insulators, (ii)- spin-orbit coupled magnonic systems, (iii)- topological magnetic textures (skyrmions and 3Q magnetic state). Chapter 2 reviews the basics and essential concepts used throughout the thesis: the spin-orbit coupling, the mathematical notion of topology and its importance in condensed matter physics, then topological magnetism and a zest of magnonics. In Chapter 3, we study the spin-orbit torques at the magnetized interfaces of 3D topological insulators. We demonstrated that their peculiar form, compared to other spin-orbit torques, have important repercussions in terms of magnetization reversal, charge pumping and anisotropic damping. In Chapter 4, we showed that the interplay between magnon current jm and magnetization m in homogeneous ferromagnets with Dzyaloshinskii-Moriya (DM) interaction, produces a field-like torque as well as a damping-like torque. These DM torques mediated by spin wave can tilt the imeaveraged magnetization direction and are similar to Rashba torques for electronic systems. Moreover, the DM torque is more efficient when magnons are

  5. The Role of Shape on Electronic Structure and Charge Transport in Faceted PbSe Nanocrystals

    KAUST Repository

    Kaushik, Ananth P.


    We have determined the effect of shape on the charge transport characteristics of nanocrystals. Our study looked at the explicit determination of the electronic properties of faceted nanocrystals that essentially probe the limit of current computational reach, i.e., nanocrystals from 1.53 to 2.1 nm in diameter. These nanocrystals, which resemble PbSe systems, are either bare or covered in short ligands. They also differ in shape, octahedral vs cube-octahedral, and in superlattice symmetry (fcc vs bcc). We have provided insights on electron and hole coupling along different facets and overall charge mobility in bcc and fcc superlattices. We have determined that the relative areas of (100) to (111) facets, and facet atom types are important factors governing the optimization of charge transport. The calculated electronic density of states shows no role of -SCH3 - ligands on states near the band gap. Electron coupling between nanocrystals is significantly higher than that of hole coupling; thiol ligands lower the ratio between electron and hole couplings. Stronger coupling exists between smaller nanocrystals. © 2014 American Chemical Society.

  6. Space charge compensation on the low energy beam transport of Linac4

    CERN Document Server

    AUTHOR|(SzGeCERN)733270; Scrivens, Richard; Jesus Castillo, Santos

    Part of the upgrade program in the injector chains of the CERN accelerator complex is the replacement of the the proton accelerator Linac2 for the brand new Linac4 which will accelerate H$^-$ and its main goal is to increase the beam intensity in the next sections of the LHC accelerator chain. The Linac4 is now under commissioning and will use several ion sources to produce high intensity unbunched H$^-$ beams with different properties, and the low energy beam transport (LEBT) is the system in charge of match all these different beams to the Radio frequency quadrupole (RFQ). The space charge forces that spread the beam ions apart of each other and cause emittance growth limits the maximum intensity that can be transported in the LEBT, but the space charge of intense unbunched ion beams can be compensated by the generated ions by the impact ionization of the residual gas, which creates a source of secondary particles inside the beam pipe. For negative ion beams, the effect of the beam electric field is to ex...

  7. Charge transport kinetics in a robust radical-substituted polymer/nanocarbon composite electrode (United States)

    Sato, Kan; Oyaizu, Kenichi; Nishide, Hiroyuki

    We have reported a series of organic radical-substituted polymers as new-type charge storage and transport materials which could be used for energy related devices such as batteries and solar cells. Redox-active radical moieties introduced to the non-conjugated polymer backbones enable the rapid electron transfer among the adjacent radical sites, and thus large diffusive flux of electrical charge at a bulk scale. Here we present the elucidated charge transport kinetics in a radical polymer/single-walled carbon nanotube (SWNT) composite electrode. The synergetic effect of electrical conduction by a three-dimensional SWNT network and electron self-exchange reaction by radical polymers contributed to the 105-fold (per 1 g of added SWNT) boosting of electrochemical reactions and exceptionally large current density (greater than 1 A/cm2) as a rechargeable electrode. A totally organic-based secondary battery with a submicron thickness was fabricated to demonstrate the splendid electrochemical performances. Grants-in-Aid for Scientific Research (No. 24225003, 15J00888) and the Leading Graduate Program in Science and Engineering, from the Japanese Ministry of Education, Culture, Sports, Science and Technology (MEXT).

  8. Models of charge transport and transfer in molecular switch tunnel junctions of bistable catenanes and rotaxanes

    International Nuclear Information System (INIS)

    Flood, Amar H.; Wong, Eric W.; Stoddart, J. Fraser


    The processes by which charge transfer can occur play a foundational role in molecular electronics. Here we consider simplified models of the transfer processes that could be present in bistable molecular switch tunnel junction (MSTJ) devices during one complete cycle of the device from its low- to high- and back to low-conductance state. The bistable molecular switches, which are composed of a monolayer of either switchable catenanes or rotaxanes, exist in either a ground-state co-conformation or a metastable one in which the conduction properties of the two co-conformations, when measured at small biases (+0.1 V), are significantly different irrespective of whether transport is dominated by tunneling or hopping. The voltage-driven generation (±2 V) of molecule-based redox states, which are sufficiently long-lived to allow the relative mechanical movements necessary to switch between the two co-conformations, rely upon unequal charge transfer rates on to and/or off of the molecules. Surface-enhanced Raman spectroscopy has been used to image the ground state of the bistable rotaxane in MSTJ-like devices. Consideration of these models provide new ways of looking at molecular electronic devices that rely, not only on nanoscale charge-transport, but also upon the bustling world of molecular motion in mechanically interlocked bistable molecules

  9. Charge transport properties of metal/metal-phthalocyanine/n-Si structures

    Energy Technology Data Exchange (ETDEWEB)

    Hussain, Afzal


    In present work the charge transport properties of metal/metal-phthalocyanine/n-Si structures with low (N{sub D} = 4 x 10{sup 14} cm{sup -3}), medium (N{sub D}=1 x 10{sup 16} cm{sup -3}) and high (N{sub D}=2 x 10{sup 19} cm{sup -3}) doped n-Si as injecting electrode and the effect of air exposure of the vacuum evaporated metal-phthalocyanine film in these structures is investigated. The results obtained through temperature dependent electrical characterizations of the structures suggest that in terms of dominant conduction mechanism in the corresponding devices Schottky-type conduction mechanism dominates the charge transport in low-bias region of these devices up to 0.8 V, 0.302 V and 0.15 V in case of low, medium and high doped n-Silicon devices. For higher voltages, in each case of devices, the space-charge-limited conduction, controlled by exponential trap distribution, is found to dominate the charge transport properties of the devices. The interface density of states at the CuPc/n-Si interface of the devices are found to be lower in case of lower work function difference at the CuPc/n-Si interface of the devices. The results also suggest that the work function difference at the CuPc/n-Si interface of these devices causes charge transfer at the interface and these phenomena results in formation of interface dipole. The width of the Schottky depletion region at the CuPc/n-Si interface of these devices is found to be higher with higher work function difference at the interface. The investigation of charge transport properties of Al/ZnPc/medium n-Si and Au/ZnPc/ medium n-Si devices suggest that the Schottky depletion region formed at the ZnPc/n-Si interface of these devices determines the charge transport in the low-bias region of both the devices. Therefore, the Schottky-type (injection limited) and the space-charge-limited (bulk limited) conduction are observed in the low and the high bias regions of these devices, respectively. The determined width of the

  10. Correlation of Disorder and Charge Transport in a Range of Indacenodithiophene-Based Semiconducting Polymers

    KAUST Repository

    Nikolka, Mark


    Over the past 25 years, various design motifs have emerged for the development of organic semiconductors for demanding applications in flexible organic light emitting diode display backplanes or even printed organic logic. Due to their large area uniformity paired with high charge carrier mobilities, conjugated polymers have attracted increasing attention in this respect. However, the performances delivered by current generation conjugated polymers still fall short of many industrial requirements demanding devices with ideal transistor characteristics and higher mobilities. The discovery of conjugated polymers with low energetic disorder, such as the indacenodithiophene-based polymer indacenodithiophene-co-benzothiadiazole, represent an exciting opportunity to breach this chasm if these materials can be further optimized while maintaining their low disorder. Here, it is shown how both the charge transport properties as well as the energetic disorder are affected by tuning the molecular structure of a large range of indacenodithiophene-based semiconducting polymer derivatives. This study allows to understand better the interplay between molecular design and structure of the polymer backbone and the degree of energetic disorder that governs the charge transport properties in thin polymer films.

  11. Charge Carrier Transport Mechanism Based on Stable Low Voltage Organic Bistable Memory Device. (United States)

    Ramana, V V; Moodley, M K; Kumar, A B V Kiran; Kannan, V


    A solution processed two terminal organic bistable memory device was fabricated utilizing films of polymethyl methacrylate PMMA/ZnO/PMMA on top of ITO coated glass. Electrical characterization of the device structure showed that the two terminal device exhibited favorable switching characteristics with an ON/OFF ratio greater than 1 x 10(4) when the voltage was swept between - 2 V and +3 V. The device maintained its state after removal of the bias voltage. The device did not show degradation after a 1-h retention test at 120 degrees C. The memory functionality was consistent even after fifty cycles of operation. The charge transport switching mechanism is discussed on the basis of carrier transport mechanism and our analysis of the data shows that the charge carrier trans- port mechanism of the device during the writing process can be explained by thermionic emission (TE) and space-charge-limited-current (SCLC) mechanism models while erasing process could be explained by the FN tunneling mechanism. This demonstration provides a class of memory devices with the potential for low-cost, low-power consumption applications, such as a digital memory cell.

  12. Correction: The effect of recombination under short-circuit conditions on the determination of charge transport properties in nanostructured photoelectrodes. (United States)

    Villanueva-Cab, J; Anta, J A; Oskam, G


    Correction for 'The effect of recombination under short-circuit conditions on the determination of charge transport properties in nanostructured photoelectrodes' by J. Villanueva-Cab et al., Phys. Chem. Chem. Phys., 2016, 18, 2303-2308.

  13. Visualizing electron dynamics in organic materials: Charge transport through molecules and angular resolved photoemission (United States)

    Kümmel, Stephan

    Being able to visualize the dynamics of electrons in organic materials is a fascinating perspective. Simulations based on time-dependent density functional theory allow to realize this hope, as they visualize the flow of charge through molecular structures in real-space and real-time. We here present results on two fundamental processes: Photoemission from organic semiconductor molecules and charge transport through molecular structures. In the first part we demonstrate that angular resolved photoemission intensities - from both theory and experiment - can often be interpreted as a visualization of molecular orbitals. However, counter-intuitive quantum-mechanical electron dynamics such as emission perpendicular to the direction of the electrical field can substantially alter the picture, adding surprising features to the molecular orbital interpretation. In a second study we calculate the flow of charge through conjugated molecules. The calculations show in real time how breaks in the conjugation can lead to a local buildup of charge and the formation of local electrical dipoles. These can interact with neighboring molecular chains. As a consequence, collections of ''molecular electrical wires'' can show distinctly different characteristics than ''classical electrical wires''. German Science Foundation GRK 1640.

  14. Secondary electron emission and self-consistent charge transport in semi-insulating samples

    Energy Technology Data Exchange (ETDEWEB)

    Fitting, H.-J. [Institute of Physics, University of Rostock, Universitaetsplatz 3, D-18051 Rostock (Germany); Touzin, M. [Unite Materiaux et Transformations, UMR CNRS 8207, Universite de Lille 1, F-59655 Villeneuve d' Ascq (France)


    Electron beam induced self-consistent charge transport and secondary electron emission (SEE) in insulators are described by means of an electron-hole flight-drift model (FDM) now extended by a certain intrinsic conductivity (c) and are implemented by an iterative computer simulation. Ballistic secondary electrons (SE) and holes, their attenuation to drifting charge carriers, and their recombination, trapping, and field- and temperature-dependent detrapping are included. As a main result the time dependent ''true'' secondary electron emission rate {delta}(t) released from the target material and based on ballistic electrons and the spatial distributions of currents j(x,t), charges {rho}(x,t), field F(x,t), and potential V(x,t) are obtained where V{sub 0} = V(0,t) presents the surface potential. The intrinsic electronic conductivity limits the charging process and leads to a conduction sample current to the support. In that case the steady-state total SE yield will be fixed below the unit: i.e., {sigma} {eta} + {delta} < 1.

  15. Electronic transport in single-helical protein molecules: Effects of multiple charge conduction pathways and helical symmetry

    Energy Technology Data Exchange (ETDEWEB)

    Kundu, Sourav, E-mail:; Karmakar, S.N.


    We propose a tight-binding model to investigate electronic transport properties of single helical protein molecules incorporating both the helical symmetry and the possibility of multiple charge transfer pathways. Our study reveals that due to existence of both the multiple charge transfer pathways and helical symmetry, the transport properties are quite rigid under influence of environmental fluctuations which indicates that these biomolecules can serve as better alternatives in nanoelectronic devices than its other biological counterparts e.g., single-stranded DNA.

  16. Modeling the Charge Transport in Graphene Nano Ribbon Interfaces for Nano Scale Electronic Devices (United States)

    Kumar, Ravinder; Engles, Derick


    In this research work we have modeled, simulated and compared the electronic charge transport for Metal-Semiconductor-Metal interfaces of Graphene Nano Ribbons (GNR) with different geometries using First-Principle calculations and Non-Equilibrium Green's Function (NEGF) method. We modeled junctions of Armchair GNR strip sandwiched between two Zigzag strips with (Z-A-Z) and Zigzag GNR strip sandwiched between two Armchair strips with (A-Z-A) using semi-empirical Extended Huckle Theory (EHT) within the framework of Non-Equilibrium Green Function (NEGF). I-V characteristics of the interfaces were visualized for various transport parameters. The distinct changes in conductance and I-V curves reported as the Width across layers, Channel length (Central part) was varied at different bias voltages from -1V to 1 V with steps of 0.25 V. From the simulated results we observed that the conductance through A-Z-A graphene junction is in the range of 10-13 Siemens whereas the conductance through Z-A-Z graphene junction is in the range of 10-5 Siemens. These suggested conductance controlled mechanisms for the charge transport in the graphene interfaces with different geometries is important for the design of graphene based nano scale electronic devices like Graphene FETs, Sensors.

  17. Copper Complexes with Tetradentate Ligands for Enhanced Charge Transport in Dye-Sensitized Solar Cells

    Directory of Open Access Journals (Sweden)

    Hannes Michaels


    Full Text Available In dye-sensitized solar cells (DSCs, the redox mediator is responsible for the regeneration of the oxidized dye and for the hole transport towards the cathode. Here, we introduce new copper complexes with tetradentate 6,6′-bis(4-(S-isopropyl-2-oxazolinyl-2,2′-bipyridine ligands, Cu(oxabpy, as redox mediators. Copper coordination complexes with a square-planar geometry show low reorganization energies and thus introduce smaller losses in photovoltage. Slow recombination kinetics of excited electrons between the TiO2 and CuII(oxabpy species lead to an exceptionally long electron lifetime, a high Fermi level in the TiO2, and a high photovoltage of 920 mV with photocurrents of 10 mA∙cm−2 and 6.2% power conversion efficiency. Meanwhile, a large driving force remains for the dye regeneration of the Y123 dye with high efficiencies. The square-planar Cu(oxabpy complexes yield viscous gel-like solutions. The unique charge transport characteristics are attributed to a superposition of diffusion and electronic conduction. An enhancement in charge transport performance of 70% despite the higher viscosity is observed upon comparison of Cu(oxabpy to the previously reported Cu(tmby2 redox electrolyte.

  18. Charge transport in films of Geobacter sulfurreducens on graphite electrodes as a function of film thickness

    KAUST Repository

    Jana, Partha Sarathi; Katuri, Krishna; Kavanagh, Paul; Kumar, Amit Ravi Pradeep; Leech, Dó nal


    Harnessing, and understanding the mechanisms of growth and activity of, biofilms of electroactive bacteria (EAB) on solid electrodes is of increasing interest, for application to microbial fuel and electrolysis cells. Microbial electrochemical cell technology can be used to generate electricity, or higher value chemicals, from organic waste. The capability of biofilms of electroactive bacteria to transfer electrons to solid anodes is a key feature of this emerging technology, yet the electron transfer mechanism is not fully characterized as yet. Acetate oxidation current generated from biofilms of an EAB, Geobacter sulfurreducens, on graphite electrodes as a function of time does not correlate with film thickness. Values of film thickness, and the number and local concentration of electrically connected redox sites within Geobacter sulfurreducens biofilms as well as a charge transport diffusion co-efficient for the biofilm can be estimated from non-turnover voltammetry. The thicker biofilms, of 50 ± 9 μm, display higher charge transport diffusion co-efficient than that in thinner films, as increased film porosity of these films improves ion transport, required to maintain electro-neutrality upon electrolysis. This journal is © the Partner Organisations 2014.

  19. Charge transport along luminescent oxide layers containing Si and SiC nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Jambois, O. [EME, Departament d' Electronica, Universitat de Barcelona, Marti i Franques 1, 08028 Barcelona (Spain)]. E-mail:; Vila, A. [EME, Departament d' Electronica, Universitat de Barcelona, Marti i Franques 1, 08028 Barcelona (Spain); Pellegrino, P. [EME, Departament d' Electronica, Universitat de Barcelona, Marti i Franques 1, 08028 Barcelona (Spain); Carreras, J. [EME, Departament d' Electronica, Universitat de Barcelona, Marti i Franques 1, 08028 Barcelona (Spain); Perez-Rodriguez, A. [EME, Departament d' Electronica, Universitat de Barcelona, Marti i Franques 1, 08028 Barcelona (Spain); Garrido, B. [EME, Departament d' Electronica, Universitat de Barcelona, Marti i Franques 1, 08028 Barcelona (Spain); Bonafos, C. [Nanomaterials Group, CEMES-CNRS, 29 rue J. Marvig 31055, Toulouse (France); BenAssayag, G. [Nanomaterials Group, CEMES-CNRS, 29 rue J. Marvig 31055, Toulouse (France)


    The electrical conductivity of silicon oxides containing silicon and silicon-carbon nanoparticles has been investigated. By use of sequential Si{sup +} and C{sup +} ion implantations in silicon oxide followed by an annealing at 1100 deg. C, luminescent Si nanocrystals and SiC nanoparticles were precipitated. The characterization of the electrical transport has been carried out on two kinds of structures, allowing parallel or perpendicular transport, with respect to the substrate. The first type of samples were elaborated by means of a focus-ion-beam technique: electrical contacts to embedded nanoparticles were made by milling two nanotrenches on the sample surface until reaching the buried layer, then filling them with tungsten. The distance between the electrodes is about 100 nm. The second type of samples correspond to 40 nm thick typical MOS capacitors. The electron transport along the buried layer has shown a dramatic lowering of the electrical current, up to five orders of magnitude, when applying a sequence of voltages. It has been related to a progressive charge retention inside the nanoparticles, which, on its turn, suppresses the electrical conduction along the layer. On the other hand, the MOS capacitors show a reversible carrier charge and discharge effect that limits the current at low voltage, mostly due to the presence of C in the layers. A typical Fowler-Nordheim injection takes place at higher applied voltages, with a threshold voltage equal to 23 V.

  20. Space-charge limits on the transport of ion beams in a long alternating gradient system

    International Nuclear Information System (INIS)

    Tiefenback, M.G.


    We have experimentally studied the space-charge-dominated transport of ion beams in an alternating-gradient channel, without acceleration. We parameterize the focusing strength in terms of the zero-current ''betatron'' oscillation phase advance rate, σ 0 (degrees per focusing period). We have investigated the conditions for ''stability'', defined as the constancy of the total current and phase space area of the beam during transport. We find that the beam may be transported with neither loss of current nor growth in phase area if σ 0 0 . In this regime, the space-charge repulsive force can counter 98-99% of the externally applied focusing field, and the oscillation frequency of the beam particles can be depressed by self-forces to almost a factor of 10 below the zero-current value, limited only by the optical quality of our ion source. For σ 0 > 90 0 , we find that collective interactions bound the maintainable density of the beam, and we present a simple, semi-empirical characterization for stability, within our ability to distinguish the growth rate from zero in our apparatus. Our channel comprises 87 quadrupole lenses, 5 of which are used to prepare the beam for injection into the non-azimuthally-symmetric focusing channel

  1. Universal transport characteristics of multiple topological superconducting wires with large charging energy

    Energy Technology Data Exchange (ETDEWEB)

    Kashuba, Oleksiy; Trauzettel, Bjoern [Institut fuer Theoretische Physik und Astrophysik, Universitaet Wuerzburg, 97074 Wuerzburg (Germany); Timm, Carsten [Institut fuer Theoretische Physik, TU Dresden, 01062 Dresden (Germany)


    The system with multiple Majorana states coupled to the normal lead can potentially support the interaction between Majorana fermions and electrons. Such system can be implemented by several floating topological superconducting wires with large charging energy asymmetrically coupled to two normal leads. The analysis of the renormalization flow shows that there is a single fixed point - the strong coupling limit of isotropic antiferromagnetic Kondo model. The topological Kondo-like interaction leads also to the selective renormalization of the tunneling coefficients, strongly enhancing one component and suppressing others. Thus, charging energy crucially changes the transport properties of the system leading to the universal single-channel conductance independently from the values of the initial leads-wires coupling.

  2. Integral transport theory for charged particles in electric and magnetic fields

    International Nuclear Information System (INIS)

    Boffi, V.C.; Molinari, V.G.


    An integral transport theory for charged particles which, in the presence of electric and magnetic fields, diffuse by collisions against the atoms (or molecules) of a host medium is proposed. The combined effects of both the external fields and the mechanisms of scattering, removal and creation in building up the distribution function of the charged particles considered are investigated. The eigenvalue problem associated with the sourceless case of the given physical situation is also commented. Applications of the theory to a purely velocity-dependent problem and to a space-dependent problem, respectively, are illustrated for the case of a separable isotropic scattering kernel of synthetic type. Calculations of the distribution function, of the total current density and of relevant electrical conductivity are then carried out for different specializations of the external fields. (author)

  3. Evaluation and comparison of SN and Monte-Carlo charged particle transport calculations

    International Nuclear Information System (INIS)

    Hadad, K.


    A study was done to evaluate a 3-D S N charged particle transport code called SMARTEPANTS 1 and another 3-D Monte Carlo code called Integrated Tiger Series, ITS 2 . The evaluation study of SMARTEPANTS code was based on angular discretization and reflected boundary sensitivity whilst the evaluation of ITS was based on CPU time and variance reduction. The comparison of the two code was based on energy and charge deposition calculation in block of Gallium Arsenide with embedded gold cylinders. The result of evaluation tests shows that an S 8 calculation maintains both accuracy and speed and calculations with reflected boundaries geometry produces full symmetrical results. As expected for ITS evaluation, the CPU time and variance reduction are opposite to a point beyond which the history augmentation while increasing the CPU time do not result in variance reduction. The comparison test problem showed excellent agreement in total energy deposition calculations

  4. A new computational method for simulation of charge transport in semiconductor radiation detectors

    International Nuclear Information System (INIS)

    Holban, I.


    An effective computational method for simulation of charge transport in semiconductor radiation detectors is the purpose of the present work. Basic equations for analysis include (1) Poisson's equations, (2) continuity equation for electrons and holes, (3) rate equations for deep levels, (4) current equation for electrons and holes and (5) boundary conditions. The system of equations is discretized and equidistant space and time grids is brought. The nonlinearity of the problem is overcome by using Newton-Raphson iteration scheme. Instead of solving a nonlinear boundary problem we resolve a linear matrix equation. Our computation procedure becomes very efficient using a sparse matrix. The computed program allows to calculate the charge collection efficiency and transient response for arbitrary electric fields when trapping and detrapping effects are present. The earlier literature results are reproduced. (Author)

  5. Quadrupole beam-transport experiment for heavy ions under extreme space charge conditions

    International Nuclear Information System (INIS)

    Chupp, W.; Faltens, A.; Hartwig, E.C.


    A Cs ion-beam-transport experiment is in progress to study beam behavior under extreme space-charge conditions. A five-lens section matches the beam into a periodic electrostatic quadrupole FODO channel and its behavior is found to agree with predictions. With the available parameters (less than or equal to 200 keV, less than or equal to 20 mA, πepsilon/sub n/ greater than or equal to 10 - 7 π rad-m, up to 41 periods) the transverse (betatron) occillation frequency (nu) can be depressed down to one-tenth of its zero current value (nu/sub 0/), where nu/sup 2/ = nu/sub 0//sup 2/ -#betta#/sub p/ 2 /2, and #betta#/sub p/ is the beam plasma frequency. The current can be controlled by adjustment of the gun and the emittance can be controlled independently by means of a set of charged grids

  6. Transport properties of triarylamine based dendrimers studied by space charge limited current transients (United States)

    Szymanski, Marek Z.; Kulszewicz-Bajer, Irena; Faure-Vincent, Jérôme; Djurado, David


    We have studied hole transport in triarylamine based dendrimer using space-charge-limited current transient technique. A mobility of 8 × 10-6 cm2/(V s) and a characteristic detrapping time of about 100 ms have been obtained. We found that quasi-ohmic contact is formed with gold. The obtained mobility differs from the apparent one given by the analysis of stationary current-voltage characteristics because of a limited contact efficiency. The comparison between transients obtained from fresh and aged samples reveals no change in mobility with aging. The deterioration of electrical properties is exclusively caused by trap formation and accumulation of ionic conducting impurities. Finally, repeated transient measurements have been applied to analyze the dynamics of charge trapping process.

  7. Momentum and charge transport in non-relativistic holographic fluids from Hořava gravity

    Energy Technology Data Exchange (ETDEWEB)

    Davison, Richard A. [Department of Physics, Harvard University, Cambridge, MA 02138 (United States); Grozdanov, Sašo [Instituut-Lorentz for Theoretical Physics, Leiden University, Niels Bohrweg 2, Leiden 2333 CA (Netherlands); Janiszewski, Stefan [Department of Physics and Astronomy, University of Victoria, Victoria, BC, V8W 3P6 (Canada); Kaminski, Matthias [Department of Physics and Astronomy, University of Alabama, Tuscaloosa, AL 35487 (United States)


    We study the linearized transport of transverse momentum and charge in a conjectured field theory dual to a black brane solution of Hořava gravity with Lifshitz exponent z=1. As expected from general hydrodynamic reasoning, we find that both of these quantities are diffusive over distance and time scales larger than the inverse temperature. We compute the diffusion constants and conductivities of transverse momentum and charge, as well the ratio of shear viscosity to entropy density, and find that they differ from their relativistic counterparts. To derive these results, we propose how the holographic dictionary should be modified to deal with the multiple horizons and differing propagation speeds of bulk excitations in Hořava gravity. When possible, as a check on our methods and results, we use the covariant Einstein-Aether formulation of Hořava gravity, along with field redefinitions, to re-derive our results from a relativistic bulk theory.

  8. The role of polymer dots on efficiency enhancement of organic solar cells: Improving charge transport property (United States)

    Li, Jinfeng; Zhang, Xinyuan; Liu, Chunyu; Li, Zhiqi; He, Yeyuan; Zhang, Zhihui; Shen, Liang; Guo, Wenbin; Ruan, Shengping


    In this work, poly(9,9-dioctylfluorene)-co-(4,7-di-2-thienyl-2,1,3-benzothiadiazole) (PF-5DTBT) and copolymer poly(styrene-co-maleic anhydride) (PSMA) dots were prepared as additive for active layer doping to enhance the power conversion efficiency (PCE) of organic solar cells (OSCs), which based on poly[N-9″-hepta-decanyl-2,7-carbazole-alt-5,5-(4‧,7‧-di-2-thienyl-2‧,1‧,3‧-benzothiadiazole) (PCDTBT) and [6,6]-phenyl C71 butyric acid methyl-ester (PC71BM). A high efficiency of 7.40% was achieved due to increase of short-circuit current (Jsc) and fill factor (FF). The operation mechanism of OSCs doping with polymer dots was investigated, which demonstrated that the efficiency enhancement ascribes to improvement of electrical properties, such as exciton generation, exction dissociation, charge transport, and charge collection.

  9. Peculiarities of charge transport in a semiconductor gas discharge electronic devices

    International Nuclear Information System (INIS)

    Koch, E.; Chivi, M.; Salamov, B.G.; Salamov, B.G.


    The memory effect in planar semiconductor gas discharge system at different pressures (15-760) and interelectrode distance (60-445 μm) were experimentally studied. The study was performed on the bases of current-voltage characteristic (CVC) measurements with the time lag of several hours of afterglow periods. The influence of the active space-charge remaining from previous discharge on the breakdown voltage has been analyzed using the CVC method for different conductivity of semiconductor GaAs photocathode. On the other hand, the CVC data for subsequent dates present a correlation of memory effect and hysteresis behaviour. The explanation of such relation is based on the influence of long-lived active charges on the electronic transport mechanism of semiconductor material

  10. Charge-carrier transport in epitactical strontium titanate layers for the application in superconducting components

    International Nuclear Information System (INIS)

    Grosse, Veit


    In this thesis thin STO layers were epitactically deposited on YBCO for a subsequent electrical characterization. YBCO layers with a roughness of less than 2 nm (RMS), good out-of-plane orientation with a half-width in the rocking curve in the range (0.2..0.3) at only slightly diminished critical temperature could be reached. The STO layers exhibited also very good crystallographic properties. The charge-carrier transport in STO is mainly dominated by interface-limited processes. By means of an in thesis newly developed barrier model thereby the measured dependencies j(U,T) respectively σ(U,T) could be described very far-reachingly. At larger layer thicknesses and low temperatures the charge-carrier transport succeeds by hopping processes. So in the YBCO/STO/YBCO system the variable-range hopping could be identified as dominating transport process. Just above U>10 V a new behaviour is observed, which concerning its temperature dependence however is also tunnel-like. The STO layers exhibit here very large resistances, so that fields up to 10 7 ..10 8 V/m can be reached without flowing of significant leakage currents through the barrier. In the system YBCO/STO/Au the current transport can be principally in the same way as in the YBCO/STO/YBCO system. The special shape and above all the asymmetry of the barrier however work out very distinctly. It could be shown that at high temperatures according to the current direction a second barrier on the opposite electrode must be passed. So often observed breakdown effects can be well described. For STO layer-thicknesses in the range around 25 nm in the whole temperature range studied inelastic tunneling over chains of localized states was identified as dominating transport process. It could however for the first time be shown that at very low temperatures in the STO layers Coulomb blockades can be formed.

  11. TTF/TCNQ-based thin films and microcrystals. Growth and charge transport phenomena

    Energy Technology Data Exchange (ETDEWEB)

    Solovyeva, Vita


    The thesis adresses several problems related to growth and charge transport phenomena in thin films of TTF-TCNQ and (BEDT-TTF)TCNQ. The following main new problems are addressed: - The influence of thin-film specific factors, such as the substrate material and growth-induced defects, on the Peierls transition temperature in TTF-TCNQ thin films was studied; - finite-size effects in TTF-TCNQ were investigated by considering transport properties in TTF-TCNQ microcrystals. The influence of the size of the crystal on the Peierls transition temperature was studied. In this context a new method of microcontact fabrication was employed to favor the measurements; - an analysis of radiation-induced defects in TTF-TCNQ thin films and microcrystals was performed. It was demonstrated than an electron beam can induce appreciable damage to the sample such that its electronic properties are strongly modified; - a bilayer growth method was established to fabricate (BEDT-TTF)TCNQ from the gas phase. This newly developed bilayer growth method was showed to be suitable for testing (BEDT-TTF)TCNQ charge-transfer phase formation; - the structure of the formed (BEDT-TTF)TCNQ charge-transfer compounds was analyzed by using a wide range of experimental techniques. An overview and the description of the basic physical principles underlying charge-transfer compounds is given in chapter 2. Experimental techniques used for the growth and characterization of thin films and microcrystals are presented in chapter 3. Chapter 4 gives an overview of the physical properties of the studied organic materials. Chapter 5 discussed the experimental study of TTF-TCNQ thin films. he Peierls transition in TTF-TCNQ is a consequence of the quasi-one-dimensional structure of the material and depends on different factors, studied in chapters 5 and 6. In contradistinction to TTF-TTCNQ, the (BEDT-TTF)TCNQ charge-transfer compound crystallizes in several different modifications with different physical properties

  12. Two-dimensional charge transport in self-organized, high-mobility conjugated polymers

    DEFF Research Database (Denmark)

    Sirringhaus, H.; Brown, P.J.; Friend, R.H.


    Self-organization in many solution-processed, semiconducting conjugated polymers results in complex microstructures, in which ordered microcrystalline domains are embedded in an amorphous matrix(I). This has important consequences for electrical properties of these materials: charge transport...... of the ordered microcrystalline domains in the conjugated polymer poly(3-hexylthiophene), P3HT, Self-organization in P3HT results in a lamella structure with two-dimensional conjugated sheets formed by interchain stacking. We find that, depending on processing conditions, the lamellae can adopt two different...... of polymer transistors in logic circuits(5) and active-matrix displays(4,6)....

  13. Simulation of neutron transport process, photons and charged particles within the Monte Carlo method

    International Nuclear Information System (INIS)

    Androsenko, A.A.; Androsenko, P.A.; Artamonov, S.N.; Bolonkina, G.V.; Lomtev, V.L.; Pupko, S.V.


    Description is given to the program system BRAND designed for the accurate solution of non-stationary transport equation of neutrons, photons and charged particles in the conditions of real three-dimensional geometry. An extensive set of local and non-local estimates provides an opportunity of calculating a great set of linear functionals normally being of interest in the calculation of reactors, radiation protection and experiment simulation. The process of particle interaction with substance is simulated on the basis of individual non-group data on each isotope of the composition. 24 refs

  14. Solution-grown organic single-crystalline p-n junctions with ambipolar charge transport. (United States)

    Fan, Congcheng; Zoombelt, Arjan P; Jiang, Hao; Fu, Weifei; Wu, Jiake; Yuan, Wentao; Wang, Yong; Li, Hanying; Chen, Hongzheng; Bao, Zhenan


    Organic single-crystalline p-n junctions are grown from mixed solutions. First, C60 crystals (n-type) form and, subsequently, C8-BTBT crystals (p-type) nucleate heterogeneously on the C60 crystals. Both crystals continue to grow simultaneously into single-crystalline p-n junctions that exhibit ambipolar charge transport characteristics. This work provides a platform to study organic single-crystalline p-n junctions. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  15. Competition between deformability and charge transport in semiconducting polymers for flexible and stretchable electronics

    Energy Technology Data Exchange (ETDEWEB)

    Printz, Adam D.; Lipomi, Darren J., E-mail: [Department of NanoEngineering, University of California, San Diego, 9500 Gilman Drive, Mail Code 0448, La Jolla, California 92093-0448 (United States)


    The primary goal of the field concerned with organic semiconductors is to produce devices with performance approaching that of silicon electronics, but with the deformability—flexibility and stretchability—of conventional plastics. However, an inherent competition between deformability and charge transport has long been observed in these materials, and achieving the extreme (or even moderate) deformability implied by the word “plastic” concurrently with high charge transport may be elusive. This competition arises because the properties needed for high carrier mobilities—e.g., rigid chains in π-conjugated polymers and high degrees of crystallinity in the solid state—are antithetical to deformability. On the device scale, this competition can lead to low-performance yet mechanically robust devices, or high-performance devices that fail catastrophically (e.g., cracking, cohesive failure, and delamination) under strain. There are, however, some observations that contradict the notion of the mutual exclusivity of electronic and mechanical performances. These observations suggest that this problem may not be a fundamental trade-off, but rather an inconvenience that may be negotiated by a logical selection of materials and processing conditions. For example, the selection of the poly(3-alkylthiophene) with a critical side-chain length—poly(3-heptylthiophene) (n = 7)—marries the high deformability of poly(3-octylthiophene) (n = 8) with the high electronic performance (as manifested in photovoltaic efficiency) of poly(3-hexylthiophene) (n = 6). This review explores the relationship between deformability and charge transport in organic semiconductors. The principal conclusions are that reducing the competition between these two parameters is in fact possible, with two demonstrated routes being: (1) incorporation of softer, insulating material into a stiffer, semiconducting material and (2) increasing disorder in a highly ordered film, but not

  16. Modelling of charge carrier transport in conjugated polymers doped by polar additives

    Czech Academy of Sciences Publication Activity Database

    Toman, Petr; Nešpůrek, Stanislav; Bartkowiak, W.


    Roč. 27, č. 3 (2009), s. 797-812 ISSN 0137-1339. [International Conference on Electrical and Related Properties of Organic Solids /11./. Piechowice, 13.07.2008-17.07.2008] R&D Projects: GA ČR GA203/06/0285; GA AV ČR KAN400720701; GA MŠk MEB050815 Institutional research plan: CEZ:AV0Z40500505 Keywords : conjugated polymers * charge carrier transport * molecular electronics Subject RIV: CD - Macromolecular Chemistry Impact factor: 0.384, year: 2009

  17. A Boltzmann-weighted hopping model of charge transport in organic semicrystalline films

    KAUST Repository

    Kwiatkowski, Joe J.; Jimison, Leslie H.; Salleo, Alberto; Spakowitz, Andrew J.


    We present a model of charge transport in polycrystalline electronic films, which considers details of the microscopic scale while simultaneously allowing realistically sized films to be simulated. We discuss the approximations and assumptions made by the model, and rationalize its application to thin films of directionally crystallized poly(3-hexylthiophene). In conjunction with experimental data, we use the model to characterize the effects of defects in these films. Our findings support the hypothesis that it is the directional crystallization of these films, rather than their defects, which causes anisotropic mobilities. © 2011 American Institute of Physics.

  18. Electronic Transport Behaviors due to Charge Density Waves in Ni-Nb-Zr-H Glassy Alloys (United States)

    Fukuhara, Mikio; Umemori, Yoshimasa


    The amorphous Ni-Nb-Zr-H glassy alloy containing subnanometer-sized icosahedral Zr5 Nb5Ni3 clusters exhibited four types of electronic phenomena: a metal/insulator transition, an electric current-induced voltage oscillation (Coulomb oscillation), giant capacitor behavior and an electron avalanche with superior resistivity. These findings could be excluded by charge density waves that the low-dimensional component of clusters, in which the atoms are lined up in chains along the [130] direction, plays important roles in various electron transport phenomena.

  19. Competition between deformability and charge transport in semiconducting polymers for flexible and stretchable electronics

    International Nuclear Information System (INIS)

    Printz, Adam D.; Lipomi, Darren J.


    The primary goal of the field concerned with organic semiconductors is to produce devices with performance approaching that of silicon electronics, but with the deformability—flexibility and stretchability—of conventional plastics. However, an inherent competition between deformability and charge transport has long been observed in these materials, and achieving the extreme (or even moderate) deformability implied by the word “plastic” concurrently with high charge transport may be elusive. This competition arises because the properties needed for high carrier mobilities—e.g., rigid chains in π-conjugated polymers and high degrees of crystallinity in the solid state—are antithetical to deformability. On the device scale, this competition can lead to low-performance yet mechanically robust devices, or high-performance devices that fail catastrophically (e.g., cracking, cohesive failure, and delamination) under strain. There are, however, some observations that contradict the notion of the mutual exclusivity of electronic and mechanical performances. These observations suggest that this problem may not be a fundamental trade-off, but rather an inconvenience that may be negotiated by a logical selection of materials and processing conditions. For example, the selection of the poly(3-alkylthiophene) with a critical side-chain length—poly(3-heptylthiophene) (n = 7)—marries the high deformability of poly(3-octylthiophene) (n = 8) with the high electronic performance (as manifested in photovoltaic efficiency) of poly(3-hexylthiophene) (n = 6). This review explores the relationship between deformability and charge transport in organic semiconductors. The principal conclusions are that reducing the competition between these two parameters is in fact possible, with two demonstrated routes being: (1) incorporation of softer, insulating material into a stiffer, semiconducting material and (2) increasing disorder in a highly ordered film, but not

  20. The effect of interfacial layers on charge transport in organic solar cell

    Energy Technology Data Exchange (ETDEWEB)

    Mbuyise, Xolani G.; Tonui, Patrick; Mola, Genene Tessema, E-mail:


    The effect of interfacial buffer layers in organic photovoltaic cell (OPV) whose active layer is composed of poly(3 hexylthiophene) (P3HT) and [6,6]-phenyl-C61-butyric acid methyl ester (PCBM) blend was studied. The electrical properties of OPV devices produced with and without interfacial layers are compared and discussed in terms of measured parameters of the cells. The charge transport properties showed significant difference on the mobility and activation factor between the two types of device structures. The life time measurements in the unprotected conditions are also presented and discussed.

  1. Solution of charged particle transport equation by Monte-Carlo method in the BRANDZ code system

    International Nuclear Information System (INIS)

    Artamonov, S.N.; Androsenko, P.A.; Androsenko, A.A.


    Consideration is given to the issues of Monte-Carlo employment for the solution of charged particle transport equation and its implementation in the BRANDZ code system under the conditions of real 3D geometry and all the data available on radiation-to-matter interaction in multicomponent and multilayer targets. For the solution of implantation problem the results of BRANDZ data comparison with the experiments and calculations by other codes in complexes systems are presented. The results of direct nuclear pumping process simulation for laser-active media by a proton beam are also included. 4 refs.; 7 figs

  2. Vivitron - A 35 MV Van de Graaff tandem. Design, performance, charge transport system

    International Nuclear Information System (INIS)

    Letournel, M.; Helleboid, J.M.; Bertein, H.


    This paper describes a new configuration for an electrostatic tandem accelerator. The project of the Strasbourg Nuclear Center is a 35 MV Van de Graaff tandem, in fact a new design in that field. The general features of the machine and its associated electrostatic field are described. The machine is designed to minimise energy dissipation within the accelerator column in the event of electrical breakdown. This is discussed as also insulator and conductor designs. Charge transport system is a particular field. The choice of a belt system and its design result from specific studies carried out at the C.R.N. with reference to the electrostatics of solid and gaseous insulations [fr

  3. Correlation of nanostructure and charge transport properties of oxidized a -SiC:H films

    Energy Technology Data Exchange (ETDEWEB)

    Gordienko, S.O.; Nazarov, A.N.; Vasin, A.V.; Rusavsky, A.V.; Lysenko, V.S. [Lashkaryov Institute of Semiconductor Physics, National Academy of Sciences of Ukraine, Prospekt Nauki 41, 03028 Kyiv (Ukraine)


    This paper considers the influence of low temperature oxidation on structural and electrical properties of amorphous carbon-rich a -Si{sub 1-x}C{sub x}:H thin films fabricated by reactive RF magnetron sputtering. It is shown that oxidation leads to formation of SiO{sub x} matrix with graphite-like carbon inclusions. Such conductive precipitates has a strong effect on charge transport in oxidized a -Si{sub 1-x}C{sub x}:H films (copyright 2012 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  4. Determination of charge carrier mobility of hole transporting polytriarylamine-based diodes

    International Nuclear Information System (INIS)

    Barea, Eva M.; Garcia-Belmonte, Germa; Sommer, Michael; Huettner, Sven; Bolink, Henk J.; Thelakkat, Mukundan


    Hole transport properties of three different side chain poly(triarylamines) have been determined by means of the analysis of steady-state current-voltage characteristics using co-planar diode structures. The interpretation is based on space-charge limited models with field-dependent mobility. Mobilities between ∼ 10 -8 and 10 -6 cm 2 V -1 s -1 are obtained. The highest mobility is achieved for poly(tetraphenylbenzidine) devices and the lowest for poly(triphenylamine) devices. Electron-rich methoxy substituents increase the mobility of poly(triphenylamine)s. A comparison of the mobility values with those obtained using organic field-effect transistors is also given.

  5. Ionic charge transport between blockages: Sodium cation conduction in freshly excised bulk brain tissue

    Energy Technology Data Exchange (ETDEWEB)

    Emin, David, E-mail: [Department of Physics and Astronomy, University of New Mexico, Albuquerque, NM 87131 (United States); Akhtari, Massoud [Semple Institutes for Neuroscience and Human Behavior, David Geffen School of Medicine, University of California at Los Angeles, Los Angeles, CA 90095 (United States); Ellingson, B. M. [Department of Radiology, David Geffen School of Medicine, University of California at Los Angeles, Los Angeles, CA 90095 (United States); Mathern, G. W. [Department of Neurosurgery, David Geffen School of Medicine, University of California at Los Angeles, Los Angeles, CA 90095 (United States)


    We analyze the transient-dc and frequency-dependent electrical conductivities between blocking electrodes. We extend this analysis to measurements of ions’ transport in freshly excised bulk samples of human brain tissue whose complex cellular structure produces blockages. The associated ionic charge-carrier density and diffusivity are consistent with local values for sodium cations determined non-invasively in brain tissue by MRI (NMR) and diffusion-MRI (spin-echo NMR). The characteristic separation between blockages, about 450 microns, is very much shorter than that found for sodium-doped gel proxies for brain tissue, >1 cm.

  6. Modelling charge transport of discotic liquid-crystalline triindoles: the role of peripheral substitution. (United States)

    Volpi, Riccardo; Camilo, Ana Claudia Santos; Filho, Demetrio A da Silva; Navarrete, Juan T López; Gómez-Lor, Berta; Delgado, M Carmen Ruiz; Linares, Mathieu


    We have performed a multiscale approach to study the influence of peripheral substitution in the semiconducting properties of discotic liquid-crystalline triindoles. Charge carrier mobility as high as 1.4 cm 2 V -1 s -1 was experimentally reported for triindoles substituted with alkynyl chains on the periphery (Gómez-Lor et al. Angew. Chem., Int. Ed., 2011, 50, 7399-7402). In this work, our goal is to get a deeper understanding of both the molecular electronic structure and microscopic factors affecting the charge transport properties in triindoles as a function of the spacer group connecting the central cores with the external alkyl chains (i.e., alkyne or phenyl spacers groups). To this end, we first perform Quantum Mechanical (QM) calculations to assess how the peripheral substitution affects the electronic structure and the internal reorganization energy. Secondly, boxes of stacked molecules were built and relaxed through molecular dynamics to obtain realistic structures. Conformational analysis and calculations of transfer integrals for closed neighbours were performed. Our results show that the insertion of ethynyl spacers between the central aromatic core and the flexible peripheral chains results in lower reorganization energies and enhanced intermolecular order within the stacks with a preferred cofacial 60° staggered conformation, which would result in high charge-carrier mobilities in good agreement with the experimental data. This work allows a deeper understanding of charge carrier mobility in columnar phases, linking the structural order at the molecular level to the property of interest, i.e. the charge carrier mobility. We hope that this understanding will improve the design of systems at the supramolecular level aiming at obtaining a more defined conducting channel, higher mobility and smaller fluctuations within the column.

  7. The effects of two counterpropagating surface acoustic wave beams on single electron acoustic charge transport

    International Nuclear Information System (INIS)

    He Jianhong; Guo Huazhong; Song Li; Zhang Wei; Gao Jie; Lu Chuan


    We present a comprehensive study of the effects of two counterpropagating surface acoustic waves on the acoustoelectric current of single electron transport devices. A significant improvement in the accuracy of current quantization is achieved as a result of an additional surface acoustic wave beam. The experiments reveal the sinusoidally periodical modulation in the acoustoelectric current characteristic as a function of the relative phase of the two surface acoustic wave beams. Besides, by using standing surface acoustic waves, the acoustoelectric current is detected which we consider as the so-called anomalous acoustoelectric current produced by acoustic wave mechanical deformations. This kind current is contributed to one component of the acoustoelectric current in surface acoustic wave device, which could enable us to establish a more adequate description of acoustoelectric effects on single-electron acoustic charge transport.

  8. OoTran, an object-oriented program for charged-particle beam transport design

    International Nuclear Information System (INIS)

    Ninane, A.; Ferte, J.M.; Mareschal, P.; Sibomana, M.; Somers, F.


    The OoTran program is a new object-oriented program for charged-particle beam transport computation. Using a simple menu interface, the user builds his beam line with magnetic and electric elements taken from a standard library. The program computes the beam transport using a well-known first-order matrix formalism and displays 'in real time' the computed beam envelope. The menu editor provides functions to interactively modify the beam line. Ootran is written in C++ and uses two object libraries: OOPS, the Object-Oriented Program Support Class Library, which is a collection of classes similar to those of Smalltalk-80; and InterViews, a C++ graphical-interface toolkit based on the X-Window system. OoTran is running on DECstation 3100, VAXstation 2000 and SUN 3, with the ULTRIX and SUN OS operating systems. (orig.)

  9. Self-consistent study of space-charge-dominated beams in a misaligned transport system

    International Nuclear Information System (INIS)

    Sing Babu, P.; Goswami, A.; Pandit, V.S.


    A self-consistent particle-in-cell (PIC) simulation method is developed to investigate the dynamics of space-charge-dominated beams through a misaligned solenoid based transport system. Evolution of beam centroid, beam envelope and emittance is studied as a function of misalignment parameters for various types of beam distributions. Simulation results performed up to 40 mA of proton beam indicate that centroid oscillations induced by the displacement and rotational misalignments of solenoids do not depend of the beam distribution. It is shown that the beam envelope around the centroid is independent of the centroid motion for small centroid oscillation. In addition, we have estimated the loss of beam during the transport caused by the misalignment for various beam distributions

  10. Description of bipolar charge transport in polyethylene using a fluid model with a constant mobility: model prediction

    International Nuclear Information System (INIS)

    Le Roy, S; Segur, P; Teyssedre, G; Laurent, C


    We present a conduction model aimed at describing bipolar transport and space charge phenomena in low density polyethylene under dc stress. In the first part we recall the basic requirements for the description of charge transport and charge storage in disordered media with emphasis on the case of polyethylene. A quick review of available conduction models is presented and our approach is compared with these models. Then, the bases of the model are described and related assumptions are discussed. Finally, results on external current, trapped and free space charge distributions, field distribution and recombination rate are presented and discussed, considering a constant dc voltage, a step-increase of the voltage, and a polarization-depolarization protocol for the applied voltage. It is shown that the model is able to describe the general features reported for external current, electroluminescence and charge distribution in polyethylene

  11. Simulation of charge transport in organic semiconductors: A time-dependent multiscale method based on nonequilibrium Green's functions

    DEFF Research Database (Denmark)

    Leitherer, Susanne; Jager, C. M.; Krause, A.


    In weakly interacting organic semiconductors, static disorder and dynamic disorder often have an important impact on transport properties. Describing charge transport in these systems requires an approach that correctly takes structural and electronic fluctuations into account. Here, we present...... are used in organic field-effect transistors....

  12. Charge transport and recombination in bulk heterojunction solar cells studied by the photoinduced charge extraction in linearly increasing voltage technique (United States)

    Mozer, A. J.; Sariciftci, N. S.; Lutsen, L.; Vanderzande, D.; Österbacka, R.; Westerling, M.; Juška, G.


    Charge carrier mobility and recombination in a bulk heterojunction solar cell based on the mixture of poly[2-methoxy-5-(3,7-dimethyloctyloxy)-phenylene vinylene] (MDMO-PPV) and 1-(3-methoxycarbonyl)propyl-1-phenyl-(6,6)-C61 (PCBM) has been studied using the novel technique of photoinduced charge carrier extraction in a linearly increasing voltage (Photo-CELIV). In this technique, charge carriers are photogenerated by a short laser flash, and extracted under a reverse bias voltage ramp after an adjustable delay time (tdel). The Photo-CELIV mobility at room temperature is found to be μ =2×10-4cm2V-1s-1, which is almost independent on charge carrier density, but slightly dependent on tdel. Furthermore, determination of charge carrier lifetime and demonstration of an electric field dependent mobility is presented.

  13. Heterojunction PbS nanocrystal solar cells with oxide charge-transport layers. (United States)

    Hyun, Byung-Ryool; Choi, Joshua J; Seyler, Kyle L; Hanrath, Tobias; Wise, Frank W


    Oxides are commonly employed as electron-transport layers in optoelectronic devices based on semiconductor nanocrystals, but are relatively rare as hole-transport layers. We report studies of NiO hole-transport layers in PbS nanocrystal photovoltaic structures. Transient fluorescence experiments are used to verify the relevant energy levels for hole transfer. On the basis of these results, planar heterojunction devices with ZnO as the photoanode and NiO as the photocathode were fabricated and characterized. Solution-processed devices were used to systematically study the dependence on nanocrystal size and achieve conversion efficiency as high as 2.5%. Optical modeling indicates that optimum performance should be obtained with thinner oxide layers than can be produced reliably by solution casting. Room-temperature sputtering allows deposition of oxide layers as thin as 10 nm, which enables optimization of device performance with respect to the thickness of the charge-transport layers. The best devices achieve an open-circuit voltage of 0.72 V and efficiency of 5.3% while eliminating most organic material from the structure and being compatible with tandem structures.

  14. Coherent Charge Transport in Ballistic InSb Nanowire Josephson Junctions (United States)

    Li, S.; Kang, N.; Fan, D. X.; Wang, L. B.; Huang, Y. Q.; Caroff, P.; Xu, H. Q.


    Hybrid InSb nanowire-superconductor devices are promising for investigating Majorana modes and topological quantum computation in solid-state devices. An experimental realisation of ballistic, phase-coherent superconductor-nanowire hybrid devices is a necessary step towards engineering topological superconducting electronics. Here, we report on a low-temperature transport study of Josephson junction devices fabricated from InSb nanowires grown by molecular-beam epitaxy and provide a clear evidence for phase-coherent, ballistic charge transport through the nanowires in the junctions. We demonstrate that our devices show gate-tunable proximity-induced supercurrent and clear signatures of multiple Andreev reflections in the differential conductance, indicating phase-coherent transport within the junctions. We also observe periodic modulations of the critical current that can be associated with the Fabry-Pérot interference in the nanowires in the ballistic transport regime. Our work shows that the InSb nanowires grown by molecular-beam epitaxy are of excellent material quality and hybrid superconducting devices made from these nanowires are highly desirable for investigation of the novel physics in topological states of matter and for applications in topological quantum electronics. PMID:27102689

  15. Heterojunction PbS Nanocrystal Solar Cells with Oxide Charge-Transport Layers

    KAUST Repository

    Hyun, Byung-Ryool


    Oxides are commonly employed as electron-transport layers in optoelectronic devices based on semiconductor nanocrystals, but are relatively rare as hole-transport layers. We report studies of NiO hole-transport layers in PbS nanocrystal photovoltaic structures. Transient fluorescence experiments are used to verify the relevant energy levels for hole transfer. On the basis of these results, planar heterojunction devices with ZnO as the photoanode and NiO as the photocathode were fabricated and characterized. Solution-processed devices were used to systematically study the dependence on nanocrystal size and achieve conversion efficiency as high as 2.5%. Optical modeling indicates that optimum performance should be obtained with thinner oxide layers than can be produced reliably by solution casting. Roomerature sputtering allows deposition of oxide layers as thin as 10 nm, which enables optimization of device performance with respect to the thickness of the charge-transport layers. The best devices achieve an open-circuit voltage of 0.72 V and efficiency of 5.3% while eliminating most organic material from the structure and being compatible with tandem structures. © 2013 American Chemical Society.

  16. A Generalized Boltzmann Fokker-Planck Method for Coupled Charged Particle Transport

    Energy Technology Data Exchange (ETDEWEB)

    Prinja, Anil K


    The goal of this project was to develop and investigate the performance of reduced-physics formulations of high energy charged particle (electrons, protons and heavier ions) transport that are computationally more efficient than not only analog Monte Carlo methods but also the established condensed history Monte Carlo technique. Charged particles interact with matter by Coulomb collisions with target nuclei and electrons, by bremsstrahlung radiation loss and by nuclear reactions such as spallation and fission. Of these, inelastic electronic collisions and elastic nuclear collisions are the dominant cause of energy-loss straggling and angular deflection or range straggling of a primary particle. These collisions are characterized by extremely short mean free paths (sub-microns) and highly peaked, near-singular differential cross sections about forward directions and zero energy loss, with the situation for protons and heavier ions more extreme than for electrons. For this reason, analog or truephysics single-event Monte Carlo simulation, while possible in principle, is computationally prohibitive for routine calculation of charged particle interaction phenomena.

  17. The programme library for numerical simulation of charged particle dynamics in transportation lines

    International Nuclear Information System (INIS)

    Aleksandrov, V.S.; Shevtsov, V.F.; Shirkov, G.D.; Batygin, Yu.K.


    The description of a PC codes library to simulate the beam transportation of charged particles is presented. The codes are realized on IBM PC in Visual Basic common interface. It is destined for the simulation and optimization of beam dynamics and based on the successive and consistent use of two methods: the momentum method of distribution functions (RMS technique) and the particle-particle method (PP-Method). The library allows to calculate the RMS parameters of electron and ion beams, passing through a set of quadrupoles, solenoids, bends, accelerating sections. The RMS code is a fast code very suitable for the first test, design and optimization of the beam line parameters. The PP code requires more time for execution but provides a high accuracy of simulation taking into account the space charge effects, aberrations and beam losses. One of the main advantages of PP code presented here is an ability to simulate a real multicomponent beam of different masses and charged states of ions from ion sources

  18. Charge Transport in Two-Photon Semiconducting Structures for Solar Fuels. (United States)

    Liu, Guohua; Du, Kang; Haussener, Sophia; Wang, Kaiying


    Semiconducting heterostructures are emerging as promising light absorbers and offer effective electron-hole separation to drive solar chemistry. This technology relies on semiconductor composites or photoelectrodes that work in the presence of a redox mediator and that create cascade junctions to promote surface catalytic reactions. Rational tuning of their structures and compositions is crucial to fully exploit their functionality. In this review, we describe the possibilities of applying the two-photon concept to the field of solar fuels. A wide range of strategies including the indirect combination of two semiconductors by a redox couple, direct coupling of two semiconductors, multicomponent structures with a conductive mediator, related photoelectrodes, as well as two-photon cells are discussed for light energy harvesting and charge transport. Examples of charge extraction models from the literature are summarized to understand the mechanism of interfacial carrier dynamics and to rationalize experimental observations. We focus on a working principle of the constituent components and linking the photosynthetic activity with the proposed models. This work gives a new perspective on artificial photosynthesis by taking simultaneous advantages of photon absorption and charge transfer, outlining an encouraging roadmap towards solar fuels. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. An Electronic Structure Approach to Charge Transfer and Transport in Molecular Building Blocks for Organic Optoelectronics (United States)

    Hendrickson, Heidi Phillips

    A fundamental understanding of charge separation in organic materials is necessary for the rational design of optoelectronic devices suited for renewable energy applications and requires a combination of theoretical, computational, and experimental methods. Density functional theory (DFT) and time-dependent (TD)DFT are cost effective ab-initio approaches for calculating fundamental properties of large molecular systems, however conventional DFT methods have been known to fail in accurately characterizing frontier orbital gaps and charge transfer states in molecular systems. In this dissertation, these shortcomings are addressed by implementing an optimally-tuned range-separated hybrid (OT-RSH) functional approach within DFT and TDDFT. The first part of this thesis presents the way in which RSH-DFT addresses the shortcomings in conventional DFT. Environmentally-corrected RSH-DFT frontier orbital energies are shown to correspond to thin film measurements for a set of organic semiconducting molecules. Likewise, the improved RSH-TDDFT description of charge transfer excitations is benchmarked using a model ethene dimer and silsesquioxane molecules. In the second part of this thesis, RSH-DFT is applied to chromophore-functionalized silsesquioxanes, which are currently investigated as candidates for building blocks in optoelectronic applications. RSH-DFT provides insight into the nature of absorptive and emissive states in silsesquioxanes. While absorption primarily involves transitions localized on one chromophore, charge transfer between chromophores and between chromophore and silsesquioxane cage have been identified. The RSH-DFT approach, including a protocol accounting for complex environmental effects on charge transfer energies, was tested and validated against experimental measurements. The third part of this thesis addresses quantum transport through nano-scale junctions. The ability to quantify a molecular junction via spectroscopic methods is crucial to their

  20. Alternate mutation based artificial immune algorithm for step fixed charge transportation problem

    Directory of Open Access Journals (Sweden)

    Mahmoud Moustafa El-Sherbiny


    Full Text Available Step fixed charge transportation problem (SFCTP is considered as a special version of the fixed-charge transportation problem (FCTP. In SFCTP, the fixed cost is incurred for every route that is used in the solution and is proportional to the amount shipped. This cost structure causes the value of the objective function to behave like a step function. Both FCTP and SFCTP are considered to be NP-hard problems. While a lot of research has been carried out concerning FCTP, not much has been done concerning SFCTP. This paper introduces an alternate Mutation based Artificial Immune (MAI algorithm for solving SFCTPs. The proposed MAI algorithm solves both balanced and unbalanced SFCTP without introducing a dummy supplier or a dummy customer. In MAI algorithm a coding schema is designed and procedures are developed for decoding such schema and shipping units. MAI algorithm guarantees the feasibility of all the generated solutions. Due to the significant role of mutation function on the MAI algorithm’s quality, 16 mutation functions are presented and their performances are compared to select the best one. For this purpose, forty problems with different sizes have been generated at random and then a robust calibration is applied using the relative percentage deviation (RPD method. Through two illustrative problems of different sizes the performance of the MAI algorithm has been compared with most recent methods.

  1. Theoretical proposal for a magnetic resonance study of charge transport in organic semiconductors (United States)

    Mkhitaryan, Vagharsh

    Charge transport in disordered organic semiconductors occurs via carrier incoherent hops in a band of localized states. In the framework of continuous-time random walk the carrier on-site waiting time distribution (WTD) is one of the basic characteristics of diffusion. Besides, WTD is fundamentally related to the density of states (DOS) of localized states, which is a key feature of a material determining the optoelectric properties. However, reliable first-principle calculations of DOS in organic materials are not yet available and experimental characterization of DOS and WTD is desirable. We theoretically study the spin dynamics of hopping carriers and propose measurement schemes directly probing WTD, based on the zero-field spin relaxation and the primary (Hahn) spin echo. The proposed schemes are possible because, as we demonstrate, the long-time behavior of the zero-field relaxation and the primary echo is determined by WTD, both for the hyperfine coupling dominated and the spin-orbit coupling dominated spin dynamics. We also examine the dispersive charge transport, which is a non-Markovian sub-diffusive process characterized by non-stationarity. We show that the proposed schemes unambiguously capture the effects of non-stationarity, e.g., the aging behavior of random walks. This work was supported by the Department of Energy-Basic Energy Sciences under Contract No. DE-AC02-07CH11358.

  2. Influence of Magnetic Field on Electric Charge Transport in Holomiun Thin Films at Low Temperatures

    Directory of Open Access Journals (Sweden)

    Jan Dudas


    Full Text Available Holmium thin films were prepared by evaporation in ultrahigh vacuum (UHV and high precision electrical resistance measurements were performed on them as well as on holomium bulk sample in the wide temperature range from 4,2 K up to the room temperature. Electric charge transport is profoundly influenced by the magnetic structure at low temperatures and a "knee-like" resistance anomaly was observed near the transportation from paramagnetic state to basal-plane spiral structure in bulk with the Neel temperature TN=128,9 K and below ~ 122 K in thin Ho films in a thickness range from 98 nm to 215 nm. Unexpected resistance minimum at ~ 9 K and a slope´s charge of the R vs. T curve near ~ 170 K was observed in 215 nm thin film. Application of magnetic field parallel to the substrate and thin film plane for temperatures below ~ 150 K caused the decrease of resistence value with increasing magnetic flux density. Increasing suppression of the TN value up to ~ 5 K with increasing flux density value up to 5 T was observed in Ho films. 

  3. Signatures of dynamics in charge transport through organic molecules; Dynamisches Verhalten beim Ladungstransport durch organische Molekuele

    Energy Technology Data Exchange (ETDEWEB)

    Secker, Daniel


    The aim of the thesis at hand was to investigate dynamical behaviour in charge transport through organic molecules experimentally with the help of the mechanically controlled break junction (MCBJ) technique. the thesis concentrates on the complex interaction between the molecular contact configuration and the electronic structure. it is shown that by variation of the electrode distance and so by a manipulation of the molecule and contact configuration the electronic structure as well as the coupling between the molecule and the electrodes is affected. The latter statement is an additional hint how closely I-V-characteristics depend on the molecular contact configuration. Depending on the applied voltage and so the electric field there are two different configurations preferred by the molecular contact. A potential barrier between these two states is the origin of the hysteresis. A central part of the thesis is dealing with measurements of the current noise. Finally it can be concluded that the detailed discussion reveals the strong effect of dynamical interactions between the atomic configuration of the molecular contact and the electronic structure on the charge transport in single molecule junctions. (orig.)

  4. Kinetic phenomena in charged particle transport in gases, swarm parameters and cross section data

    International Nuclear Information System (INIS)

    Petrovic, Z Lj; Suvakov, M; Nikitovic, Z; Dujko, S; Sasic, O; Jovanovic, J; Malovic, G; Stojanovic, V


    In this review we discuss the current status of the physics of charged particle swarms, mainly electrons. The whole field is analysed mainly through its relationship to plasma modelling and illustrated by some recent examples developed mainly by our group. The measurements of the swarm coefficients and the availability of the data are briefly discussed. More time is devoted to the development of complete electron-molecule cross section sets along with recent examples such as NO, CF 4 and HBr. We extend the discussion to the availability of ion and fast neutral data and how swarm experiments may serve to provide new data. As a point where new insight into the kinetics of charge particle transport is provided, the role of kinetic phenomena is discussed and recent examples are listed. We focus here on giving two examples on how non-conservative processes make dramatic effects in transport, the negative absolute mobility and the negative differential conductivity for positrons in argon. Finally we discuss the applicability of swarm data in plasma modelling and the relationship to other fields where swarm experiments and analysis make significant contributions. (topical review)

  5. Quantifying TEMPO Redox Polymer Charge Transport toward the Organic Radical Battery. (United States)

    Karlsson, Christoffer; Suga, Takeo; Nishide, Hiroyuki


    To design new and better organic active battery materials in a rational fashion, fundamental parameters of the charge transport must be studied. Herein we report on the electronic conductivity by electron diffusion in a TEMPO-containing redox polymer, and the reorganization energy of the TEMPO self-exchange in an organic solvent is determined for the first time. The electronic conductivity was 8.5 μS/cm at E 0 and corresponded to a redox hopping mechanism. The apparent electron diffusion coefficient was 1.9 × 10 -9 cm 2 /s at room temperature, and at short times the ion diffusion was limiting with a diffusion coefficient of 6.5 × 10 -10 cm 2 /s. The reorganization energy was determined to be 1.01 eV, indicating a rather polar chemical environment for the TEMPO groups. The implications for the usage of this type of materials in organic energy storage are discussed. As conductivity through 10 μm was demonstrated, we show that, if sufficient swellability can be ensured, charge can be transported through several micrometer thick layers in a battery electrode without any conducting additive.

  6. Simulation of photon and charge transport in X-ray imaging semiconductor sensors

    CERN Document Server

    Nilsson, H E; Hjelm, M; Bertilsson, K


    A fully stochastic model for the imaging properties of X-ray silicon pixel detectors is presented. Both integrating and photon counting configurations have been considered, as well as scintillator-coated structures. The model is based on three levels of Monte Carlo simulations; photon transport and absorption using MCNP, full band Monte Carlo simulation of charge transport and system level Monte Carlo simulation of the imaging performance of the detector system. In the case of scintillator-coated detectors, the light scattering in the detector layers has been simulated using a Monte Carlo method. The image resolution was found to be much lower in scintillator-coated systems due to large light spread in thick scintillator layers. A comparison between integrating and photon counting readout methods shows that the image resolution can be slightly enhanced using a photon-counting readout. In addition, the proposed model has been used to study charge-sharing effects on the energy resolution in photon counting dete...

  7. Temperature-dependent charge injection and transport in pentacene thin-film transistors

    International Nuclear Information System (INIS)

    Kim, Dong Wook; Shin, Hyunji; Choi, Jong Sun; Park, Ji-Ho; Park, Jaehoon


    The electrical characteristics of p-channel pentacene thin-film transistors (TFTs) were analyzed at different operating temperatures ranging from 253 to 353 K. An improvement in the drain current and field-effect mobility of the pentacene TFTs is observed with increasing temperature. From the Arrhenius plots of field-effect mobility extracted at various temperatures, a lower activation energy of 99.34 meV was obtained when the device is operating in the saturation region. Such observation is ascribed to the thermally activated hole transport through the pentacene grain boundaries. On the other hand, it was found that the Au/pentacene contact significantly affects the TFTs electrical characteristics in the linear region, which resulted in a higher activation energy. The activation energy based on the linear field-effect mobility, which increased from 344.61 to 444.70 meV with decreasing temperature, implies the charge-injection-limited electrical behavior of pentacene TFTs at low temperatures. The thermally induced electrical characteristic variations in pentacene TFTs can thus be studied through the temperature dependence of the charge injection and transport processes. (paper)

  8. Scientific Computation Application Partnerships in Materials and Chemical Sciences, Charge Transfer and Charge Transport in Photoactivated Systems, Developing Electron-Correlated Methods for Excited State Structure and Dynamics in the NWChem Software Suite

    Energy Technology Data Exchange (ETDEWEB)

    Cramer, Christopher J. [Univ. of Minnesota, Minneapolis, MN (United States)


    Charge transfer and charge transport in photoactivated systems are fundamental processes that underlie solar energy capture, solar energy conversion, and photoactivated catalysis, both organometallic and enzymatic. We developed methods, algorithms, and software tools needed for reliable treatment of the underlying physics for charge transfer and charge transport, an undertaking with broad applicability to the goals of the fundamental-interaction component of the Department of Energy Office of Basic Energy Sciences and the exascale initiative of the Office of Advanced Scientific Computing Research.

  9. Mechanism of Crystallization and Implications for Charge Transport in Poly(3-ethylhexylthiophene) Thin Films

    KAUST Repository

    Duong, Duc T.


    In this work, crystallization kinetics and aggregate growth of poly(3-ethylhexylthiophene) (P3EHT) thin films are studied as a function of film thickness. X-ray diffraction and optical absorption show that individual aggregates and crystallites grow anisotropically and mostly along only two packing directions: the alkyl stacking and the polymer chain backbone direction. Further, it is also determined that crystallization kinetics is limited by the reorganization of polymer chains and depends strongly on the film thickness and average molecular weight. Time-dependent, field-effect hole mobilities in thin films reveal a percolation threshold for both low and high molecular weight P3EHT. Structural analysis reveals that charge percolation requires bridged aggregates separated by a distance of ≈2-3 nm, which is on the order of the polymer persistence length. These results thus highlight the importance of tie molecules and inter-aggregate distance in supporting charge percolation in semiconducting polymer thin films. The study as a whole also demonstrates that P3EHT is an ideal model system for polythiophenes and should prove to be useful for future investigations into crystallization kinetics. Recrystallization kinetics and its relationship to charge transport in poly(3-ethylhexylthiophene) (P3EHT) thin films are investigated using a combination of grazing incidence X-ray diffraction, optical absorption, and field-effect transistor measurements. These results show that thin film crystallization kinetics is limited by polymer chain reorganization and that charge percolation depends strongly on the edge-to-edge distance between aggregates. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Particle-based simulation of charge transport in discrete-charge nano-scale systems: the electrostatic problem. (United States)

    Berti, Claudio; Gillespie, Dirk; Eisenberg, Robert S; Fiegna, Claudio


    The fast and accurate computation of the electric forces that drive the motion of charged particles at the nanometer scale represents a computational challenge. For this kind of system, where the discrete nature of the charges cannot be neglected, boundary element methods (BEM) represent a better approach than finite differences/finite elements methods. In this article, we compare two different BEM approaches to a canonical electrostatic problem in a three-dimensional space with inhomogeneous dielectrics, emphasizing their suitability for particle-based simulations: the iterative method proposed by Hoyles et al. and the Induced Charge Computation introduced by Boda et al.

  11. Charge transport and recombination in bulk heterojunction solar cells studied by the photoinduced charge extraction in linearly increasing voltage technique


    Mozer, AJ; Sariciftci, NS; Osterbacka, R; Westerling, M; Juska, G; LUTSEN, Laurence; VANDERZANDE, Dirk


    Charge carrier mobility and recombination in a bulk heterojunction solar cell based on the mixture of poly[2-methoxy-5-(3,7-dimethyloctyloxy)-phenylene vinylene] (MDMO-PPV) and 1-(3-methoxycarbonyl)propyl-1-phenyl-(6,6)-C-61 (PCBM) has been studied using the novel technique of photoinduced charge carrier extraction in a linearly increasing voltage (Photo-CELIV). In this technique, charge carriers are photogenerated by a short laser flash, and extracted under a reverse bias voltage ramp after ...

  12. Invariance of molecular charge transport upon changes of extended molecule size and several related issues

    Directory of Open Access Journals (Sweden)

    Ioan Bâldea


    Full Text Available As a sanity test for the theoretical method employed, studies on (steady-state charge transport through molecular devices usually confine themselves to check whether the method in question satisfies the charge conservation. Another important test of the theory’s correctness is to check that the computed current does not depend on the choice of the central region (also referred to as the “extended molecule”. This work addresses this issue and demonstrates that the relevant transport and transport-related properties are indeed invariant upon changing the size of the extended molecule, when the embedded molecule can be described within a general single-particle picture (namely, a second-quantized Hamiltonian bilinear in the creation and annihilation operators. It is also demonstrates that the invariance of nonequilibrium properties is exhibited by the exact results but not by those computed approximately within ubiquitous wide- and flat-band limits (WBL and FBL, respectively. To exemplify the limitations of the latter, the phenomenon of negative differential resistance (NDR is considered. It is shown that the exactly computed current may exhibit a substantial NDR, while the NDR effect is absent or drastically suppressed within the WBL and FBL approximations. The analysis done in conjunction with the WBLs and FBLs reveals why general studies on nonequilibrium properties require a more elaborate theoretical than studies on linear response properties (e.g., ohmic conductance and thermopower at zero temperature. Furthermore, examples are presented that demonstrate that treating parts of electrodes adjacent to the embedded molecule and the remaining semi-infinite electrodes at different levels of theory (which is exactly what most NEGF-DFT approaches do is a procedure that yields spurious structures in nonlinear ranges of current–voltage curves.

  13. Particle-based simulation of charge transport in discrete-charge nano-scale systems: the electrostatic problem


    Berti, Claudio; Gillespie, Dirk; Eisenberg, Robert S; Fiegna, Claudio


    The fast and accurate computation of the electric forces that drive the motion of charged particles at the nanometer scale represents a computational challenge. For this kind of system, where the discrete nature of the charges cannot be neglected, boundary element methods (BEM) represent a better approach than finite differences/finite elements methods. In this article, we compare two different BEM approaches to a canonical electrostatic problem in a three-dimensional space with inhomogeneous...

  14. Carrier mobility in mesoscale heterogeneous organic materials: Effects of crystallinity and anisotropy on efficient charge transport (United States)

    Kobayashi, Hajime; Shirasawa, Raku; Nakamoto, Mitsunori; Hattori, Shinnosuke; Tomiya, Shigetaka


    Charge transport in the mesoscale bulk heterojunctions (BHJs) of organic photovoltaic devices (OPVs) is studied using multiscale simulations in combination with molecular dynamics, the density functional theory, the molecular-level kinetic Monte Carlo (kMC) method, and the coarse-grained kMC method, which was developed to estimate mesoscale carrier mobility. The effects of the degree of crystallinity and the anisotropy of the conductivity of donors on hole mobility are studied for BHJ structures that consist of crystalline and amorphous pentacene grains that act as donors and amorphous C60 grains that act as acceptors. We find that the hole mobility varies dramatically with the degree of crystallinity of pentacene because it is largely restricted by a low-mobility amorphous region that occurs in the hole transport network. It was also found that the percolation threshold of crystalline pentacene is relatively high at approximately 0.6. This high percolation threshold is attributed to the 2D-like conductivity of crystalline pentacene, and the threshold is greatly improved to a value of approximately 0.3 using 3D-like conductive donors. We propose essential guidelines to show that it is critical to increase the degree of crystallinity and develop 3D conductive donors for efficient hole transport through percolative networks in the BHJs of OPVs.

  15. Disorder Effects in Charge Transport and Spin Response of Topological Insulators (United States)

    Zhao, Lukas Zhonghua

    Topological insulators are a class of solids in which the non-trivial inverted bulk band structure gives rise to metallic surface states that are robust against impurity backscattering. First principle calculations predicted Bi2Te3, Sb2Te3 and Bi2Se3 to be three-dimensional (3D) topological insulators with a single Dirac cone on the surface. The topological surface states were subsequently observed by angle-resolved photoemission (ARPES) and scanning tunneling microscopy (STM). The investigations of charge transport through topological surfaces of 3D topological insulators, however, have faced a major challenge due to large charge carrier densities in the bulk donated by randomly distributed defects such as vacancies and antisites. This bulk disorder intermixes surface and bulk conduction channels, thereby complicating access to the low-energy (Dirac point) charge transport or magnetic response and resulting in the relatively low measured carrier mobilities. Moreover, charge inhomogeneity arising from bulk disorder can result in pronounced nanoscale spatial fluctuations of energy on the surface, leading to the formation of surface `puddles' of different carrier types. Great efforts have been made to combat the undesirable effects of disorder in 3D topological insulators and to reduce bulk carriers through chemical doping, nanostructure fabrication, and electric gating. In this work we have developed a new way to reduce bulk carrier densities using high-energy electron irradiation, thereby allowing us access to the topological surface quantum channels. We also found that disorder in 3D topological insulators can be beneficial. It can play an important part in enabling detection of unusual magnetic response from Dirac fermions and in uncovering new excitations, namely surface superconductivity in Dirac `puddles'. In Chapter 3 we show how by using differential magnetometry we could probe spin rotation in the 3D topological material family (Bi2Se 3, Bi2Te3 and Sb2Te3

  16. A numerical study on the charge transport in TPD/Alq3-based organic light emitting diodes. (United States)

    Kim, K S; Hwang, Y W; Lee, H G; Won, T Y


    We report our simulation study on the charge transport characteristic of the multi-layer structure for organic light emitting diodes (OLEDs). We performed a numerical simulation on a multilayer structure comprising a hole transport layer (HTL), an emission layer (EML), and an electron transport layer (ETL) between both electrodes. The material of the HTL is TPD (N,N'-Bis (3-methylphenyl)-N,N'-bis(phenyl) benzidine), and the ETL includes Alq3 (Tris (8-hyroxyquinolinato) aluminium). Here, we investigated the parameters such as recombination rates which influence the efficiency of the charge transport between layers in bilayer OLEDs. We also analyzed a transient response during the turn on/off period and the carrier transport in accordance with the variation of the injection barrier and applied voltage. In addition, our numerical simulation revealed that the insertion of the EML affects the photonic characteristics in bilayer structure and also the efficiency due to the difference in the internal barrier height.

  17. Microscopic studies of the fate of charges in organic semiconductors: Scanning Kelvin probe measurements of charge trapping, transport, and electric fields in p- and n-type devices (United States)

    Smieska, Louisa Marion

    Organic semiconductors could have wide-ranging applications in lightweight, efficient electronic circuits. However, several fundamental questions regarding organic electronic device behavior have not yet been fully addressed, including the nature of chemical charge traps, and robust models for injection and transport. Many studies focus on engineering devices through bulk transport measurements, but it is not always possible to infer the microscopic behavior leading to the observed measurements. In this thesis, we present scanning-probe microscope studies of organic semiconductor devices in an effort to connect local properties with local device behavior. First, we study the chemistry of charge trapping in pentacene transistors. Working devices are doped with known pentacene impurities and the extent of charge trap formation is mapped across the transistor channel. Trap-clearing spectroscopy is employed to measure an excitation of the pentacene charge trap species, enabling identification of the degradationrelated chemical trap in pentacene. Second, we examine transport and trapping in peryelene diimide (PDI) transistors. Local mobilities are extracted from surface potential profiles across a transistor channel, and charge injection kinetics are found to be highly sensitive to electrode cleanliness. Trap-clearing spectra generally resemble PDI absorption spectra, but one derivative yields evidence indicating variation in trap-clearing mechanisms for different surface chemistries. Trap formation rates are measured and found to be independent of surface chemistry, contradicting a proposed silanol trapping mechanism. Finally, we develop a variation of scanning Kelvin probe microscopy that enables measurement of electric fields through a position modulation. This method avoids taking a numeric derivative of potential, which can introduce high-frequency noise into the electric field signal. Preliminary data is presented, and the theoretical basis for electric field

  18. Charge transport in DNA oligonucleotides with various base-pairing patterns

    Czech Academy of Sciences Publication Activity Database

    Kratochvílová, Irena; Todorciuc, Tatiana; Král, Karel; Němec, Hynek; Bunček, M.; Šebera, Jakub; Záliš, Stanislav; Vokáčová, Zuzana; Sychrovský, Vladimír; Bednárová, Lucie; Mojzeš, P.; Schneider, Bohdan


    Roč. 114, č. 15 (2010), 5196–5205 ISSN 1520-6106 R&D Projects: GA ČR GA203/08/1594; GA AV ČR KAN401770651; GA MŠk OC 137; GA ČR GA202/07/0643; GA AV ČR IAA400550701; GA AV ČR KAN200100801; GA AV ČR KAN100400702; GA ČR GA202/09/0193 Institutional research plan: CEZ:AV0Z10100520; CEZ:AV0Z40500505; CEZ:AV0Z40400503; CEZ:AV0Z40550506; CEZ:AV0Z50520701 Keywords : DNA * charge transport * Scanning Tunneling Microscopy Subject RIV: CC - Organic Chemistry Impact factor: 3.603, year: 2010

  19. Determination of charge carrier mobility of hole transporting polytriarylamine-based diodes

    Energy Technology Data Exchange (ETDEWEB)

    Barea, Eva M. [Photovoltaic and Optoelectronic Devices Group, Departament de Fisica, Universitat Jaume I, 12071 Castello (Spain); Garcia-Belmonte, Germa, E-mail: garciag@uji.e [Photovoltaic and Optoelectronic Devices Group, Departament de Fisica, Universitat Jaume I, 12071 Castello (Spain); Sommer, Michael; Huettner, Sven [Applied Functional Polymers, Universitaet Bayreuth, 95440 Bayreuth (Germany); Bolink, Henk J. [Molecular Science Institute-Universitat de Valencia, Poligon La Coma s/n, 46980 Paterna, Valencia (Spain); Thelakkat, Mukundan, E-mail: mukundan.thelakkat@uni-bayreuth.d [Applied Functional Polymers, Universitaet Bayreuth, 95440 Bayreuth (Germany)


    Hole transport properties of three different side chain poly(triarylamines) have been determined by means of the analysis of steady-state current-voltage characteristics using co-planar diode structures. The interpretation is based on space-charge limited models with field-dependent mobility. Mobilities between {approx} 10{sup -8} and 10{sup -6} cm{sup 2} V{sup -1} s{sup -1} are obtained. The highest mobility is achieved for poly(tetraphenylbenzidine) devices and the lowest for poly(triphenylamine) devices. Electron-rich methoxy substituents increase the mobility of poly(triphenylamine)s. A comparison of the mobility values with those obtained using organic field-effect transistors is also given.

  20. i-CELIV technique for investigation of charge carriers transport properties

    Energy Technology Data Exchange (ETDEWEB)

    Važgėla, J., E-mail:; Genevičius, K.; Juška, G.


    The extraction of the injected charge carriers by linearly increasing voltage (i-CELIV) is a promising method for separate analysis of the holes and electrons transport properties in the bulk heterojunction layers. We are demonstrating how to establish the mobility dependence on the electric field and obtain more precise results by performing corrections in transit time by this technique. [6,6]-Phenyl C61 butyric acid methyl ester (PCBM) and poly[2,6-(4,4-bis-(2-ethylhexyl)-4H-cyclopenta [2,1-b;3,4-b′]dithiophene)-alt-4,7(2,1,3-benzothiadiazole)] (PCPDTBT) bulk heterojunctions with different blend ratios were experimentally tested with i-CELIV method. The hole and electron mobilities were found to be heavily imbalanced in the optimised 3:1 PCBM:PCPDTBT bulk heterojunction.

  1. Relationship between defect density and charge carrier transport in amorphous and microcrystalline silicon

    International Nuclear Information System (INIS)

    Astakhov, Oleksandr; Carius, Reinhard; Finger, Friedhelm; Petrusenko, Yuri; Borysenko, Valery; Barankov, Dmytro


    The influence of dangling-bond defects and the position of the Fermi level on the charge carrier transport properties in undoped and phosphorous doped thin-film silicon with structure compositions all the way from highly crystalline to amorphous is investigated. The dangling-bond density is varied reproducibly over several orders of magnitude by electron bombardment and subsequent annealing. The defects are investigated by electron-spin-resonance and photoconductivity spectroscopies. Comparing intrinsic amorphous and microcrystalline silicon, it is found that the relationship between defect density and photoconductivity is different in both undoped materials, while a similar strong influence of the position of the Fermi level on photoconductivity via the charge carrier lifetime is found in the doped materials. The latter allows a quantitative determination of the value of the transport gap energy in microcrystalline silicon. The photoconductivity in intrinsic microcrystalline silicon is, on one hand, considerably less affected by the bombardment but, on the other hand, does not generally recover with annealing of the defects and is independent from the spin density which itself can be annealed back to the as-deposited level. For amorphous silicon and material prepared close to the crystalline growth regime, the results for nonequilibrium transport fit perfectly to a recombination model based on direct capture into neutral dangling bonds over a wide range of defect densities. For the heterogeneous microcrystalline silicon, this model fails completely. The application of photoconductivity spectroscopy in the constant photocurrent mode (CPM) is explored for the entire structure composition range over a wide variation in defect densities. For amorphous silicon previously reported linear correlation between the spin density and the subgap absorption is confirmed for defect densities below 10 18 cm -3 . Beyond this defect level, a sublinear relation is found i.e., not


    International Nuclear Information System (INIS)

    Cranmer, Steven R.


    There have been several ideas proposed to explain how the Sun's corona is heated and how the solar wind is accelerated. Some models assume that open magnetic field lines are heated by Alfvén waves driven by photospheric motions and dissipated after undergoing a turbulent cascade. Other models posit that much of the solar wind's mass and energy is injected via magnetic reconnection from closed coronal loops. The latter idea is motivated by observations of reconnecting jets and also by similarities of ion composition between closed loops and the slow wind. Wave/turbulence models have also succeeded in reproducing observed trends in ion composition signatures versus wind speed. However, the absolute values of the charge-state ratios predicted by those models tended to be too low in comparison with observations. This Letter refines these predictions by taking better account of weak Coulomb collisions for coronal electrons, whose thermodynamic properties determine the ion charge states in the low corona. A perturbative description of nonlocal electron transport is applied to an existing set of wave/turbulence models. The resulting electron velocity distributions in the low corona exhibit mild suprathermal tails characterized by ''kappa'' exponents between 10 and 25. These suprathermal electrons are found to be sufficiently energetic to enhance the charge states of oxygen ions, while maintaining the same relative trend with wind speed that was found when the distribution was assumed to be Maxwellian. The updated wave/turbulence models are in excellent agreement with solar wind ion composition measurements

  3. Experimental study on the supercritical startup and heat transport capability of a neon-charged cryogenic loop heat pipe

    International Nuclear Information System (INIS)

    Guo, Yuandong; Lin, Guiping; He, Jiang; Bai, Lizhan; Zhang, Hongxing; Miao, Jianyin


    Highlights: • A neon-charged CLHP integrated with a G-M cryocooler was designed and investigated. • The CLHP can realize the supercritical startup with an auxiliary heat load of 1.5 W. • Maximum heat transport capability of the CLHP was 4.5 W over a distance of 0.6 m. • There existed an optimum auxiliary heat load to expedite the supercritical startup. • There existed an optimum charged pressure to reach the largest heat transfer limit. - Abstract: Neon-charged cryogenic loop heat pipe (CLHP) can realize efficient cryogenic heat transport in the temperature range of 30–40 K, and promises great application potential in the thermal control of future space infrared exploration system. In this work, extensive experimental studies on the supercritical startup and heat transport capability of a neon-charged CLHP integrated with a G-M cryocooler were carried out, where the effects of the auxiliary heat load applied to the secondary evaporator and charged pressure of the working fluid were investigated. Experimental results showed that the CLHP could successfully realize the supercritical startup with an auxiliary heat load of 1.5 W, and there existed an optimum auxiliary heat load and charged pressure of the working fluid respectively, to achieve the maximum temperature drop rate of the primary evaporator during the supercritical startup. The CLHP could reach a maximum heat transport capability of 4.5 W over a distance of 0.6 m corresponding to the optimum charged pressure of the working fluid; however, the heat transport capability decreased with the increase of the auxiliary heat load. Furthermore, the inherent mechanisms responsible for the phenomena observed in the experiments were analyzed and discussed, to provide a better understanding from the theoretical view.

  4. Mode-selective vibrational modulation of charge transport in organic electronic devices

    KAUST Repository

    Bakulin, Artem A.; Lovrincic, Robert; Yu, Xi; Selig, Oleg; Bakker, Huib J.; Rezus, Yves L. A.; Nayak, Pabitra K.; Fonari, Alexandr; Coropceanu, Veaceslav; Bredas, Jean-Luc; Cahen, David


    The soft character of organic materials leads to strong coupling between molecular, nuclear and electronic dynamics. This coupling opens the way to influence charge transport in organic electronic devices by exciting molecular vibrational motions. However, despite encouraging theoretical predictions, experimental realization of such approach has remained elusive. Here we demonstrate experimentally that photoconductivity in a model organic optoelectronic device can be modulated by the selective excitation of molecular vibrations. Using an ultrafast infrared laser source to create a coherent superposition of vibrational motions in a pentacene/C60 photoresistor, we observe that excitation of certain modes in the 1,500–1,700 cm−1 region leads to photocurrent enhancement. Excited vibrations affect predominantly trapped carriers. The effect depends on the nature of the vibration and its mode-specific character can be well described by the vibrational modulation of intermolecular electronic couplings. This presents a new tool for studying electron–phonon coupling and charge dynamics in (bio)molecular materials.

  5. Momentum transfer theory of non-conservative charged particle transport in crossed electric and magnetic fields

    International Nuclear Information System (INIS)

    Vrhovac, S.B.; Petrovic, Z.Lj.


    Momentum - transfer approximation is applied to momentum and energy balance equations describing reacting particle swarms in gases in crossed electric and magnetic fields. Transport coefficients of charged particles undergoing both inelastic and reactive, non-particle-conserving collisions with a gas of neutral molecules are calculated. Momentum - transfer theory (MTT) has been developed mainly by Robson and collaborators. It has been applied to a single reactive gas and mixtures of reactive gases in electric field only. MTT has also been applied in crossed electric and magnetic fields recently and independently of our work but the reactive collisions were not considered. Consider a swarm of electrons of charge e and mass m moving with velocity rvec v through a neutral gas under the influence of an applied electric rvec E and magnetic rvec B field. The collision processes which we shall investigate are limited to elastic, inelastic and reactive collisions of electrons with gas molecules. Here we interpret reactive collisions as collisions which produce change in number of the swarm particles. Reactive collisions involve creation (ionization by electron impact) or loss (electron attachment) of swarm particles. We consider only single ionization in approximation of the mass ratio m/m 0 0 are masses of electrons and neutral particles, respectively. We assume that the stage of evolution of the swarm is the hydrodynamic limit (HDL). In HDL, the space - time dependence of all properties is carried by the number density n of swarm particles

  6. Mode-selective vibrational modulation of charge transport in organic electronic devices

    KAUST Repository

    Bakulin, Artem A.


    The soft character of organic materials leads to strong coupling between molecular, nuclear and electronic dynamics. This coupling opens the way to influence charge transport in organic electronic devices by exciting molecular vibrational motions. However, despite encouraging theoretical predictions, experimental realization of such approach has remained elusive. Here we demonstrate experimentally that photoconductivity in a model organic optoelectronic device can be modulated by the selective excitation of molecular vibrations. Using an ultrafast infrared laser source to create a coherent superposition of vibrational motions in a pentacene/C60 photoresistor, we observe that excitation of certain modes in the 1,500–1,700 cm−1 region leads to photocurrent enhancement. Excited vibrations affect predominantly trapped carriers. The effect depends on the nature of the vibration and its mode-specific character can be well described by the vibrational modulation of intermolecular electronic couplings. This presents a new tool for studying electron–phonon coupling and charge dynamics in (bio)molecular materials.

  7. Temperature-mediated polymorphism in molecular crystals: The impact on crystal packing and charge transport

    KAUST Repository

    Stevens, Loah A.; Goetz, Katelyn P.; Fonari, Alexandr; Shu, Ying; Williamson, Rachel M.; Bredas, Jean-Luc; Coropceanu, Veaceslav P.; Jurchescu, Oana D.; Collis, Gavin E.


    We report a novel synthesis to ultra high purity 7,14-bis((trimethylsilyl)ethynyl)dibenzo[b,def]-chrysene (TMS-DBC) and the use of this material in the growth of single crystals by solution and vapor deposition techniques. We observe that the substrate temperature has a dramatic impact on the crystal growth, producing two distinct polymorphs of TMS-DBC; low temperature (LT) fine red needles and high temperature (HT) large yellow platelets. Single crystal X-ray crystallography confirms packing structures where the LT crystals form a 1D slipped-stack structure, while the HT crystals adopt a 2D brickwork motif. These polymorphs also represent a rare example where both are extremely stable and do not interconvert to the other crystal structure upon solvent or thermal annealing. Single crystal organic field-effect transistors of the LT and HT crystals show that the HT 2D brickwork motif produces hole mobilities as high as 2.1 cm2 V-1 s-1, while the mobility of the 1D structure is significantly lower, at 0.028 cm2 V-1 s-1. Electronic-structure calculations indicate that the superior charge transport in the brickwork polymorph in comparison to the slipped-stack polymorph is due to the presence of an increased dimensionality of the charge migration pathways.

  8. Temperature-mediated polymorphism in molecular crystals: The impact on crystal packing and charge transport

    KAUST Repository

    Stevens, Loah A.


    We report a novel synthesis to ultra high purity 7,14-bis((trimethylsilyl)ethynyl)dibenzo[b,def]-chrysene (TMS-DBC) and the use of this material in the growth of single crystals by solution and vapor deposition techniques. We observe that the substrate temperature has a dramatic impact on the crystal growth, producing two distinct polymorphs of TMS-DBC; low temperature (LT) fine red needles and high temperature (HT) large yellow platelets. Single crystal X-ray crystallography confirms packing structures where the LT crystals form a 1D slipped-stack structure, while the HT crystals adopt a 2D brickwork motif. These polymorphs also represent a rare example where both are extremely stable and do not interconvert to the other crystal structure upon solvent or thermal annealing. Single crystal organic field-effect transistors of the LT and HT crystals show that the HT 2D brickwork motif produces hole mobilities as high as 2.1 cm2 V-1 s-1, while the mobility of the 1D structure is significantly lower, at 0.028 cm2 V-1 s-1. Electronic-structure calculations indicate that the superior charge transport in the brickwork polymorph in comparison to the slipped-stack polymorph is due to the presence of an increased dimensionality of the charge migration pathways.

  9. Charged particle transport in gaseous nitrogen at intermediate E/N using the voltage transient method

    International Nuclear Information System (INIS)

    Purdie, P.H.; Fletcher, J.


    A pulsed swarm of charged particles crossing an inter-electrode gap under the influence of an applied electric field E will produce a pulsed current in the external circuit which, when integrated over time, will result in a transient voltage pulse, the shape and magnitude of which is characteristic of the number of type of charged particles. This voltage transient technique has been used to investigate a gas discharge in nitrogen gas at values of E/N (the ratio of applied electric field to gas number density), such that ionization is non-negligible. The voltage transients have been subjected to a theoretical analysis, which has previously been reported, which includes not only cathode and anode image terms but also both electron and ion diffusion terms. Electron transport parameters are reported for E/N ≤ 350 Td (1 Td = 10 -17 V cm 2 ). Data are also obtained for the drift velocities and diffusion coefficients of the ions operative within the nitrogen discharge. An estimate is obtained for the collisional decay rate of N 2 + . 21 refs., 7 figs

  10. Photoinduced Charge Transport Spectra for Porphyrin and Naphthalene Derivative-based Dendrimers (United States)

    Park, J. H.; Wu, Y.; Parquette, J. R.; Epstein, A. J.


    Dendrimers are important chemical structures for harvesting charge. We prepared model dendrimers using two porphyrin derivatives and a naphthalene derivative. Films of these porphyrin derivatives have a strong Soret band (˜430nm) and four significant Q-bands; the naphthalene derivative has strong absorption at 365 and 383nm. Two kinds of photovoltaic cell structures [ITO/BaytronP/(thick or thin) dendrimer/Al] are constructed to investigate the optical response spectra of dendrimers under electric potential(V) on the cell (range from -1V to 2V). To obtain pure optical responses, incident light is modulated with an optical chopper and a lock-in amplifier is used to measure current (IAC) and phase (θ). For the excitation of the Soret band, IAC and θ do not change substantially with change of sign and amplitude of V. For Q-bands and naphthalene absorption bands, θ nearly follows the polarity of V on the cells and IAC is linear with V. Hence, IAC is nearly ohmic for Q- band although there are shifts due to built-in-potential. IAC for Soret band is almost same for thick and thin active layer cells. In contrast, IAC increases with thickness increase for Q bands. Mechanisms of photogeneration and charge transport will be discussed.

  11. Study of charge transport in silicon detectors: Non-irradiated and irradiated

    International Nuclear Information System (INIS)

    Leroy, C.; Roy, P.; Casse, G.; Glaser, M.; Grigoriev, E.; Lemeilleur, F.


    The electrical characteristics of silicon detectors (standard planar float zone and MESA detectors) as a function of the particle fluence can be extracted by the application of a model describing the transport of charge carriers generated in the detectors by ionizing particles. The current pulse response induced by α and β particles in non-irradiated detectors and detectors irradiated up to fluences PHI ∼ 3 · 10 14 particles/cm 2 is reproduced via this model: i) by adding a small n-type region 15 μm deep on the p + side for the detectors at fluences beyond the n to p-type inversion and ii) for the MESA detectors, by considering one additional dead layer of 14 μm (observed experimentally) on each side of the detector, and introducing a second (delayed) component to the current pulse response. For both types of detectors, the model gives mobilities decreasing linearily up to fluences of about 5·10 13 particles/cm 2 and converging, beyond, to saturation values of about 1050 cm 2 /Vs and 450 cm 2 /Vs for electrons and holes, respectively. At a fluence PHI ∼ 10 14 particles/cm 2 (corresponding to about ten years of operation at the CERN-LHC), charge collection deficits of about 14% for β particles, 25% for α particles incident on the front and 35% for α particles incident on the back of the detector are found for both type of detectors

  12. Charge transport in nanoscale "all-inorganic" networks of semiconductor nanorods linked by metal domains. (United States)

    Lavieville, Romain; Zhang, Yang; Casu, Alberto; Genovese, Alessandro; Manna, Liberato; Di Fabrizio, Enzo; Krahne, Roman


    Charge transport across metal-semiconductor interfaces at the nanoscale is a crucial issue in nanoelectronics. Chains of semiconductor nanorods linked by Au particles represent an ideal model system in this respect, because the metal-semiconductor interface is an intrinsic feature of the nanosystem and does not manifest solely as the contact to the macroscopic external electrodes. Here we investigate charge transport mechanisms in all-inorganic hybrid metal-semiconductor networks fabricated via self-assembly in solution, in which CdSe nanorods were linked to each other by Au nanoparticles. Thermal annealing of our devices changed the morphology of the networks and resulted in the removal of small Au domains that were present on the lateral nanorod facets, and in ripening of the Au nanoparticles in the nanorod junctions with more homogeneous metal-semiconductor interfaces. In such thermally annealed devices the voltage dependence of the current at room temperature can be well described by a Schottky barrier lowering at a metal semiconductor contact under reverse bias, if the spherical shape of the gold nanoparticles is considered. In this case the natural logarithm of the current does not follow the square-root dependence of the voltage as in the bulk, but that of V(2/3). From our fitting with this model we extract the effective permittivity that agrees well with theoretical predictions for the permittivity near the surface of CdSe nanorods. Furthermore, the annealing improved the network conductance at cryogenic temperatures, which could be related to the reduction of the number of trap states.

  13. Focused transport of intense charged particle beams. Final technical report FY/93

    International Nuclear Information System (INIS)


    Many recent developments in accelerator technology have increased the need for a better understanding of the physics of intense-beam transport. Of particular interest to the work described here is the appearance, as beam intensities are increased, of a class of nonlinear phenomena which involve the collective interaction of the beam particles. Beam intensity, used as a measure of the importance of space-charge collective behavior, depends on the ratio of current to emittance. The nonlinear beam dynamics, and any resulting emittance growth, which are characteristic of the intense-beam regime, can therefore occur even at low currents in any accelerator system with sufficiently high intensity, especially in the low beta section. Furthermore, since emittance of a beam is difficult to reduce, the ultimate achievement of necessary beam luminosities requires the consideration of possible causes of longitudinal and transverse emittance growth at every stage of the beam lifetime. The research program described here has addressed the fundamental physics which comes into play during the transport, acceleration and focusing of intense beams. Because of the long term and ongoing nature of the research program discussed here, this report is divided into two sections. The first section constitutes a long term revue of the accomplishments which have resulted from the research effort reported, especially in pioneering the use of particle-in-cell (PIC) computer simulation techniques for simulation of the dynamics of space-charge-dominated beams in particle accelerators. The following section emphasizes, in more detail, the accomplishments of the FY 92/93 period immediately prior to the termination of this particular avenue of support. 41 refs

  14. Ionizing and ultraviolet radiation enhances the efficiency of DNA mediated gene transfer in vitro

    International Nuclear Information System (INIS)

    Perez, C.F.


    The enhancement effects of ionizing and non-ionizing radiation on the efficiency of DNA mediated gene transfer were studied. Confluent Rat-2 cells were transfected with purified SV40 viral DNA, irradiated with either X-rays or ultraviolet, trypsinized, plated, and assayed for the formation of foci on Rat-2 monolayers. Both ionizing and ultraviolet radiation enhanced the frequency of A-gene transformants/survivor compared to unirradiated transfected cells. These enhancements were non-linear and dose dependent. A recombinant plasmid, pOT-TK5, was constructed that contained the SV40 virus A-gene and the Herpes Simplex virus (HSV) thymidine kinase (TK) gene. Confluent Rat-2 cells transfected with pOT-TK5 DNA and then immediately irradiated with either X-rays or 330 MeV/amu argon particles at the Berkeley Bevalac showed a higher frequency of HAT + colonies/survivor than unirradiated transfected cells. Rat-2 cells transfected with the plasmid, pTK2, containing only the HSV TK-gene were enhanced for TK-transformation by both X-rays and ultraviolet radiation. The results demonstrate that radiation enhancement of the efficiency of DNA mediated gene transfer is not explained by increased nuclear uptake of the transfected DNA. Radiation increases the competence of the transfected cell population for genetic transformation. Three models for this increased competence are presented. The targeted integration model, the inducible recombination model, the partition model, and the utilization of DNA mediated gene transfer for DNA repair studies are discussed. 465 references

  15. Ionizing and ultraviolet radiation enhances the efficiency of DNA mediated gene transfer in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Perez, C.F.


    The enhancement effects of ionizing and non-ionizing radiation on the efficiency of DNA mediated gene transfer were studied. Confluent Rat-2 cells were transfected with purified SV40 viral DNA, irradiated with either X-rays or ultraviolet, trypsinized, plated, and assayed for the formation of foci on Rat-2 monolayers. Both ionizing and ultraviolet radiation enhanced the frequency of A-gene transformants/survivor compared to unirradiated transfected cells. These enhancements were non-linear and dose dependent. A recombinant plasmid, pOT-TK5, was constructed that contained the SV40 virus A-gene and the Herpes Simplex virus (HSV) thymidine kinase (TK) gene. Confluent Rat-2 cells transfected with pOT-TK5 DNA and then immediately irradiated with either X-rays or 330 MeV/amu argon particles at the Berkeley Bevalac showed a higher frequency of HAT/sup +/ colonies/survivor than unirradiated transfected cells. Rat-2 cells transfected with the plasmid, pTK2, containing only the HSV TK-gene were enhanced for TK-transformation by both X-rays and ultraviolet radiation. The results demonstrate that radiation enhancement of the efficiency of DNA mediated gene transfer is not explained by increased nuclear uptake of the transfected DNA. Radiation increases the competence of the transfected cell population for genetic transformation. Three models for this increased competence are presented. The targeted integration model, the inducible recombination model, the partition model, and the utilization of DNA mediated gene transfer for DNA repair studies are discussed. 465 references.

  16. Selective DNA-Mediated Assembly of Gold Nanoparticles on Electroded Substrates (United States)


    might use the Watson - Crick base-pairing of DNA as a means for ultrahigh-precision engineering is well- known.5,6 The idea is to use the highly specific...Selective DNA -Mediated Assembly of Gold Nanoparticles on Electroded Substrates K. E. Sapsford,†,‡,∇ D. Park,§ E. R. Goldman,‡ E. E. Foos,| S. A...electrodes via DNA hybridization. Protocols are demonstrated for maximizing selectivity and coverage using 15mers as the active binding agents. Detailed

  17. Dihedral angle control to improve the charge transport properties of conjugated polymers in organic field effect transistors (United States)

    Dharmapurikar, Satej S.; Chithiravel, Sundaresan; Mane, Manoj V.; Deshmukh, Gunvant; Krishnamoorthy, Kothandam


    Diketopyrrolopyrrole (DPP) and i-Indigo (i-Ind) are two monomers that are widely explored as active materials in organic field effect transistor and solar cells. These two molecules showed impressive charge carrier mobility due to better packing that are facilitated by quadrupoles. We hypothesized that the copolymers of these monomers would also exhibit high charge carrier mobility. However, we envisioned that the dihedral angle at the connecting point between the monomers will play a crucial role in packing as well as charge transport. To understand the impact of dihedral angle on charge transport, we synthesized three copolymers, wherein the DPP was sandwiched between benzenes, thiophenes and furans. The copolymer of i-Indigo and furan comprising DPP showed a band gap of 1.4 eV with a very high dihedral angle of 179°. The polymer was found to pack better and the coherence length was found to be 112 Å. The hole carrier mobility of these polymer was found to be highest among the synthesized polymer i.e. 0.01 cm2/vs. The copolymer comprising benzene did not transport hole and electrons. The dihedral angle at the connecting point between i and Indigo and benzene DPP was 143 Å, which the packing and consequently charge transport properties.

  18. A new approach to calculate charge carrier transport mobility in organic molecular crystals from imaginary time path integral simulations

    International Nuclear Information System (INIS)

    Song, Linze; Shi, Qiang


    We present a new non-perturbative method to calculate the charge carrier mobility using the imaginary time path integral approach, which is based on the Kubo formula for the conductivity, and a saddle point approximation to perform the analytic continuation. The new method is first tested using a benchmark calculation from the numerical exact hierarchical equations of motion method. Imaginary time path integral Monte Carlo simulations are then performed to explore the temperature dependence of charge carrier delocalization and mobility in organic molecular crystals (OMCs) within the Holstein and Holstein-Peierls models. The effects of nonlocal electron-phonon interaction on mobility in different charge transport regimes are also investigated

  19. In situ characterization of the film coverage and the charge transport in the alkylated-organic thin film transistor (United States)

    Watanabe, Takeshi; Koganezawa, Tomoyuki; Kikuchi, Mamoru; Muraoka, Hiroki; Ogawa, Satoshi; Yoshimoto, Noriyuki; Hirosawa, Ichiro


    We propose an in situ experimental method of investigating the correlations of the film coverage of the organic semiconductor layers and charge transport properties of organic thin film transistors during vacuum deposition. The coverage of each monolayer was estimated using the intensity of off-specular diffuse scattering and diffraction. Experimental data were obtained from the in situ measurements of two-dimensional grazing incidence X-ray scattering and charge transport. The source-drain current increased over the film coverage of the first monolayer (= 0.48). This is in agreement with the critical percolation coverage, indicating that the conductivities of the first and second monolayers are different.

  20. Charge transport in dye-sensibilized porous zinc oxide films; Ladungstransport in farbstoffsensibilisierten poroesen Zinkoxidfilmen

    Energy Technology Data Exchange (ETDEWEB)

    Reemts, J.


    During the last decades, zinc oxide has attracted a lot of attention as an important material in various electrical, chemical, and optical applications. In the present work results are discussed gained from investigations of highly porous electrochemically deposited zinc oxide, which is a promising electrode material both in the area of solar energy conversion and sensor technology. The films were prepared by adding detergents during the electrodeposition process. The detergents have a structure-directing influence during the film deposition and, therefore, on the morphology of the films. The obtained electrodes can easily be sensitized for light or different chemicals by a simple adsorption of different molecules. In the present work I discuss the fundamental charge transport properties of electrochemically deposited zinc oxide films. Temperature-dependent measurements of the current-voltage characteristics are carried out and the spectral response of the photoconductivity is investigated. In order to understand the charge transport properties of this highly porous material, it is necessary to get a deeper insight in the electrode morphology. Therefore, different optical and scanning probe microscopy methods are used to characterize the inner structure of the electrodes. The electrical conductivity of the zinc oxide films can be seen as a thermally activated process, which can be explained by electronic transitions from the valence band of the zinc oxide to two shallow impurity levels. The current-voltage characteristic unveils a nonlinear behavior which can be explained by a space-charge-limited current model with traps distributed in energy. Upon excitation with different wavelengths, the conductivity of the zinc oxide increases already under sub-band gap illumination due to widely distributed trap states within the band gap. The transients of the photoconductivity follow a stretched exponential law with time scales in the range of several hours, either if the

  1. Crossover from band-like to thermally activated charge transport in organic transistors due to strain-induced traps

    KAUST Repository

    Mei, Yaochuan


    The temperature dependence of the charge-carrier mobility provides essential insight into the charge transport mechanisms in organic semiconductors. Such knowledge imparts critical understanding of the electrical properties of these materials, leading to better design of high-performance materials for consumer applications. Here, we present experimental results that suggest that the inhomogeneous strain induced in organic semiconductor layers by the mismatch between the coefficients of thermal expansion (CTE) of the consecutive device layers of field-effect transistors generates trapping states that localize charge carriers. We observe a universal scaling between the activation energy of the transistors and the interfacial thermal expansion mismatch, in which band-like transport is observed for similar CTEs, and activated transport otherwise. Our results provide evidence that a high-quality semiconductor layer is necessary, but not sufficient, to obtain efficient charge-carrier transport in devices, and underline the importance of holistic device design to achieve the intrinsic performance limits of a given organic semiconductor. We go on to show that insertion of an ultrathin CTE buffer layer mitigates this problem and can help achieve band-like transport on a wide range of substrate platforms.

  2. Crossover from band-like to thermally activated charge transport in organic transistors due to strain-induced traps. (United States)

    Mei, Yaochuan; Diemer, Peter J; Niazi, Muhammad R; Hallani, Rawad K; Jarolimek, Karol; Day, Cynthia S; Risko, Chad; Anthony, John E; Amassian, Aram; Jurchescu, Oana D


    The temperature dependence of the charge-carrier mobility provides essential insight into the charge transport mechanisms in organic semiconductors. Such knowledge imparts critical understanding of the electrical properties of these materials, leading to better design of high-performance materials for consumer applications. Here, we present experimental results that suggest that the inhomogeneous strain induced in organic semiconductor layers by the mismatch between the coefficients of thermal expansion (CTE) of the consecutive device layers of field-effect transistors generates trapping states that localize charge carriers. We observe a universal scaling between the activation energy of the transistors and the interfacial thermal expansion mismatch, in which band-like transport is observed for similar CTEs, and activated transport otherwise. Our results provide evidence that a high-quality semiconductor layer is necessary, but not sufficient, to obtain efficient charge-carrier transport in devices, and underline the importance of holistic device design to achieve the intrinsic performance limits of a given organic semiconductor. We go on to show that insertion of an ultrathin CTE buffer layer mitigates this problem and can help achieve band-like transport on a wide range of substrate platforms.

  3. Role of reduced pi-pi stacking in the charge transport in polyfluorene

    International Nuclear Information System (INIS)

    Bajpai, Manisha; Srivastava, Ritu; Dhar, Ravindra; Tiwari, R.S.


    Highlights: • Role of bulky copolymer on the hole transport properties of polyfluorene thin films has been studied. • Photophysical measurement shows that the introduction of a SY in PFO effectively suppresses pi-stacking/aggregation of conjugated polymers in the solid state. • Current density decreases on blending for a given applied bias. - Abstract: We investigated the effect of blending of a bulky copolymer on the hole transport properties of poly (9,9-dihexyl fluorenyl-2,7-diyl)(PFO) thin films (∼120 nm) at different temperatures by obtaining the current density-voltage measurement. The poly (phenylenevinylene) based copolymer ‘‘Super Yellow” (SY) has been used as a blending component. Such polymer blending matrix is useful as it combines the host polymer (PFO) with the guest polymer of bulky side groups where pi-pi stacking is hindered by bulky side groups. This makes polyflorene much interesting and versatile material for lighting application. It has been found that the current density decreases on blending for a given applied bias. We demonstrated that the current conduction mechanism is bulk limited. It has been analyzed by trapped charge limited currents (TCLC) with electric field. We conclude that the relatively low hole mobility in blends as compared to pristine PFO would result due to increase in the pi-pi stacking distance and disorder.

  4. Dopant effects on charge transport to enhance performance of phosphorescent white organic light emitting diodes

    Energy Technology Data Exchange (ETDEWEB)

    Zhu, Liping; Chen, Jiangshan; Ma, Dongge, E-mail: [State Key Laboratory of Polymer Physics and Chemistry, Changchun Institute of Applied Chemistry, Chinese Academy of Sciences, University of Chinese Academy of Sciences, Changchun 130022 (China)


    We compared the performance of phosphorescent white organic light emitting diodes (WOLEDs) with red-blue-green and green-blue-red sequent emissive layers. It was found that the influence of red and green dopants on electron and hole transport in emissive layers leads to the large difference in the efficiency of fabricated WOLEDs. This improvement mechanism is well investigated by the current density-voltage characteristics of single-carrier devices based on dopant doped emissive layers and the comparison of electroluminescent and photoluminescence spectra, and attributed to the different change of charge carrier transport by the dopants. The optimized device achieves a maximum power efficiency, current efficiency, and external quantum efficiency of 37.0 lm/W, 38.7 cd/A, and 17.7%, respectively, which are only reduced to 32.8 lm/W, 38.5 cd/A, and 17.3% at 1000 cd/m{sup 2} luminance. The critical current density is as high as 210 mA/cm{sup 2}. It can be seen that the efficiency roll-off in phosphorescent WOLEDs can be well improved by effectively designing the structure of emissive layers.

  5. Understanding Non-Equilibrium Charge Transport and Rectification at Chromophore/Metal Interfaces (United States)

    Darancet, Pierre

    Understanding non-equilibrium charge and energy transport across nanoscale interfaces is central to developing an intuitive picture of fundamental processes in solar energy conversion applications. In this talk, I will discuss our theoretical studies of finite-bias transport at organic/metal interfaces. First, I will show how the finite-bias electronic structure of such systems can be quantitatively described using density functional theory in conjunction with simple models of non-local correlations and bias-induced Stark effects.. Using these methods, I will discuss the conditions of emergence of highly non-linear current-voltage characteristics in bilayers made of prototypical organic materials, and their implications in the context of hole- and electron-blocking layers in organic photovoltaic. In particular, I will show how the use of strongly-hybridized, fullerene-coated metallic surfaces as electrodes is a viable route to maximizing the diodic behavior and electrical functionality of molecular components. The submitted manuscript has been created by UChicago Argonne, LLC, Operator of Argonne National Laboratory (Argonne). Argonne, a U.S. Department of Energy Office of Science laboratory, is operated under Contract No. DE-AC02-06CH11357.


    Energy Technology Data Exchange (ETDEWEB)

    Strauss, R. D.; Engelbrecht, N. E.; Dunzlaff, P. [Center for Space Research, North-West University, Potchefstroom, 2522 (South Africa); Roux, J. A. le [Center for Space Plasma and Aeronomic Research, University of Alabama in Huntsville, Huntsville, AL 3585 (United States); Ruffolo, D., E-mail: [Department of Physics, Faculty of Science, Mahidol University, Bangkok 10400 (Thailand)


    We investigate the transport of charged particles across magnetic discontinuities, focusing specifically on stream interfaces associated with co-rotating interaction regions in the solar wind. We argue that the magnetic field fluctuations perpendicular to the magnetic discontinuity, and usually also perpendicular to the mean magnetic field, are strongly damped in the vicinity of such a magnetic structure, leading to anisotropic perpendicular diffusion. Assuming that perpendicular diffusion arises from drifts in a turbulent magnetic field, we adopt a simplified approach to derive the relevant perpendicular diffusion coefficient. This approach, which we believe gives the correct principal dependences as expected from more elaborate calculations, allows us to investigate transport in different turbulent geometries, such as longitudinal compressional turbulence that may be present near the heliopause. Although highly dependent on the (possibly anisotropic) perpendicular length scales and turbulence levels, we generally find perpendicular diffusion to be strongly damped at magnetic discontinuities, which may in turn provide an explanation for the large particle gradients associated with these structures.

  7. Role of reduced pi-pi stacking in the charge transport in polyfluorene

    Energy Technology Data Exchange (ETDEWEB)

    Bajpai, Manisha, E-mail: [Soft Materials Research Laboratory, Centre of Material Sciences, Institute of Interdisciplinary Studies, University of Allahabad, Allahabad 211002 (India); Department of Physics, Banaras Hindu University, Varanasi 221005 (India); Srivastava, Ritu [Centre for Organic Electronics, National Physical Laboratory (Council of Scientific and Industrial Research), Dr. K. S. Krishnan Road, New Delhi 110012 (India); Dhar, Ravindra [Soft Materials Research Laboratory, Centre of Material Sciences, Institute of Interdisciplinary Studies, University of Allahabad, Allahabad 211002 (India); Tiwari, R.S. [Department of Physics, Banaras Hindu University, Varanasi 221005 (India)


    Highlights: • Role of bulky copolymer on the hole transport properties of polyfluorene thin films has been studied. • Photophysical measurement shows that the introduction of a SY in PFO effectively suppresses pi-stacking/aggregation of conjugated polymers in the solid state. • Current density decreases on blending for a given applied bias. - Abstract: We investigated the effect of blending of a bulky copolymer on the hole transport properties of poly (9,9-dihexyl fluorenyl-2,7-diyl)(PFO) thin films (∼120 nm) at different temperatures by obtaining the current density-voltage measurement. The poly (phenylenevinylene) based copolymer ‘‘Super Yellow” (SY) has been used as a blending component. Such polymer blending matrix is useful as it combines the host polymer (PFO) with the guest polymer of bulky side groups where pi-pi stacking is hindered by bulky side groups. This makes polyflorene much interesting and versatile material for lighting application. It has been found that the current density decreases on blending for a given applied bias. We demonstrated that the current conduction mechanism is bulk limited. It has been analyzed by trapped charge limited currents (TCLC) with electric field. We conclude that the relatively low hole mobility in blends as compared to pristine PFO would result due to increase in the pi-pi stacking distance and disorder.

  8. Characterization of nitride hole lateral transport in a charge trap flash memory by using a random telegraph signal method (United States)

    Liu, Yu-Heng; Jiang, Cheng-Min; Lin, Hsiao-Yi; Wang, Tahui; Tsai, Wen-Jer; Lu, Tao-Cheng; Chen, Kuang-Chao; Lu, Chih-Yuan


    We use a random telegraph signal method to investigate nitride trapped hole lateral transport in a charge trap flash memory. The concept of this method is to utilize an interface oxide trap and its associated random telegraph signal as an internal probe to detect a local channel potential change resulting from nitride charge lateral movement. We apply different voltages to the drain of a memory cell and vary a bake temperature in retention to study the electric field and temperature dependence of hole lateral movement in a nitride. Thermal energy absorption by trapped holes in lateral transport is characterized. Mechanisms of hole lateral transport in retention are investigated. From the measured and modeled results, we find that thermally assisted trap-to-band tunneling is a major trapped hole emission mechanism in nitride hole lateral transport.

  9. Isolated effects of external bath osmolality, solute concentration, and electrical charge on solute transport across articular cartilage. (United States)

    Pouran, Behdad; Arbabi, Vahid; Zadpoor, Amir A; Weinans, Harrie


    The metabolic function of cartilage primarily depends on transport of solutes through diffusion mechanism. In the current study, we use contrast enhanced micro-computed tomography to determine equilibrium concentration of solutes through different cartilage zones and solute flux in the cartilage, using osteochondral plugs from equine femoral condyles. Diffusion experiments were performed with two solutes of different charge and approximately equal molecular weight, namely iodixanol (neutral) and ioxaglate (charge=-1) in order to isolate the effects of solute's charge on diffusion. Furthermore, solute concentrations as well as bath osmolality were changed to isolate the effects of steric hindrance on diffusion. Bath concentration and bath osmolality only had minor effects on the diffusion of the neutral solute through cartilage at the surface, middle and deep zones, indicating that the diffusion of the neutral solute was mainly Fickian. The negatively charged solute diffused considerably slower through cartilage than the neutral solute, indicating a large non-Fickian contribution in the diffusion of charged molecules. The numerical models determined maximum solute flux in the superficial zone up to a factor of 2.5 lower for the negatively charged solutes (charge=-1) as compared to the neutral solutes confirming the importance of charge-matrix interaction in diffusion of molecules across cartilage. Copyright © 2016 IPEM. Published by Elsevier Ltd. All rights reserved.

  10. Third-Order Transport with MAD Input: A Computer Program for Designing Charged Particle Beam Transport Systems

    Energy Technology Data Exchange (ETDEWEB)

    Brown, Karl


    TRANSPORT has been in existence in various evolutionary versions since 1963. The present version of TRANSPORT is a first-, second-, and third-order matrix multiplication computer program intended for the design of static-magnetic beam transport systems.

  11. Characterization of Charge-Carrier Transport in Semicrystalline Polymers: Electronic Couplings, Site Energies, and Charge-Carrier Dynamics in Poly(bithiophene- alt -thienothiophene) [PBTTT

    KAUST Repository

    Poelking, Carl


    We establish a link between the microscopic ordering and the charge-transport parameters for a highly crystalline polymeric organic semiconductor, poly(2,5-bis(3-tetradecylthiophen-2-yl)thieno[3,2-b]thiophene) (PBTTT). We find that the nematic and dynamic order parameters of the conjugated backbones, as well as their separation, evolve linearly with temperature, while the side-chain dynamic order parameter and backbone paracrystallinity change abruptly upon the (also experimentally observed) melting of the side chains around 400 K. The distribution of site energies follows the behavior of the backbone paracrystallinity and can be treated as static on the time scale of a single-charge transfer reaction. On the contrary, the electronic couplings between adjacent backbones are insensitive to side-chain melting and vary on a much faster time scale. The hole mobility, calculated after time-averaging of the electronic couplings, reproduces well the value measured in a short-channel thin-film transistor. The results underline that to secure efficient charge transport in lamellar arrangements of conjugated polymers: (i) the electronic couplings should present high average values and fast dynamics, and (ii) the energetic disorder (paracrystallinity) should be small. © 2013 American Chemical Society.

  12. Characterization of Charge-Carrier Transport in Semicrystalline Polymers: Electronic Couplings, Site Energies, and Charge-Carrier Dynamics in Poly(bithiophene- alt -thienothiophene) [PBTTT

    KAUST Repository

    Poelking, Carl; Cho, Eunkyung; Malafeev, Alexander; Ivanov, Viktor; Kremer, Kurt; Risko, Chad; Bré das, Jean-Luc; Andrienko, Denis


    We establish a link between the microscopic ordering and the charge-transport parameters for a highly crystalline polymeric organic semiconductor, poly(2,5-bis(3-tetradecylthiophen-2-yl)thieno[3,2-b]thiophene) (PBTTT). We find that the nematic and dynamic order parameters of the conjugated backbones, as well as their separation, evolve linearly with temperature, while the side-chain dynamic order parameter and backbone paracrystallinity change abruptly upon the (also experimentally observed) melting of the side chains around 400 K. The distribution of site energies follows the behavior of the backbone paracrystallinity and can be treated as static on the time scale of a single-charge transfer reaction. On the contrary, the electronic couplings between adjacent backbones are insensitive to side-chain melting and vary on a much faster time scale. The hole mobility, calculated after time-averaging of the electronic couplings, reproduces well the value measured in a short-channel thin-film transistor. The results underline that to secure efficient charge transport in lamellar arrangements of conjugated polymers: (i) the electronic couplings should present high average values and fast dynamics, and (ii) the energetic disorder (paracrystallinity) should be small. © 2013 American Chemical Society.

  13. Routine average effective charge calculation using visible Bremsstrahlung emission and comparison with the impurity transport code of Tore Supra

    International Nuclear Information System (INIS)

    Guirlet, R.; Mattioli, M.; DeMichelis, C.; Hess, W.; Pecquet, A.L.


    Effective charge measurements and calculations are presented for the Tore Supra, using visible Bremsstrahlung diagnostics. The measurements, are presented together with a reliability test of the results are discussed, by means of an impurity transport code simulating all available experimental data (XUV line spectroscopy, soft X-ray emission and Bremsstrahlung). (author) 5 refs.; 10 figs

  14. Understanding charge transport and recombination losses in high performance polymer solar cells with non-fullerene acceptors

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Xuning [HEEGER Beijing Research & Development Center; School of Chemistry; Beihang University; Beijing 100191; China; Zuo, Xiaobing [X-ray Science Division; Argonne National Laboratory; Argonne; USA; Xie, Shenkun [HEEGER Beijing Research & Development Center; School of Chemistry; Beihang University; Beijing 100191; China; Yuan, Jianyu [Jiangsu Key Laboratory for Carbon-Based Functional Materials & Devices; Institute of Functional Nano & Soft Materials (FUNSOM); Soochow University; Suzhou; P. R. China; Zhou, Huiqiong [CAS Key Laboratory of Nanosystem and Hierarchical Fabrication; CAS Center for Excellence in Nanoscience; National Center for Nanoscience and Technology; Beijing 100190; China; Zhang, Yuan [HEEGER Beijing Research & Development Center; School of Chemistry; Beihang University; Beijing 100191; China


    Photovoltaic characteristics, recombination and charge transport properties are investigated. The determined recombination reduction factor can reconcile the supreme device performance in organic solar cells using non-fullerene ITIC acceptor and severe carrier losses in all-polymer devices with P(NDI2OD-T2).

  15. Orientation-Dependent Electronic Structures and Charge Transport Mechanisms in Ultrathin Polymeric n-Channel Field-Effect Transistors

    NARCIS (Netherlands)

    Fabiano, Simone; Yoshida, Hiroyuki; Chen, Zhihua; Facchetti, Antonio; Loi, Maria Antonietta


    We investigated the role of metal/organic semiconductor interface morphology on the charge transport mechanisms and energy level alignment of the n-channel semiconductor poly{[N,N'-bis(2-octyldodecyl)-naphthalene-1,4,5,8-bis(dicarboximide)-2,6-diyl]-alt-5,5'-(2,2'-bithiophene)} (P-(NDI2ODT2)).

  16. Charge transport across metal/molecular (alkyl) monolayer-Si junctions is dominated by the LUMO level

    NARCIS (Netherlands)

    Yaffe, O.; Qi, Y.; Scheres, L.M.W.; Puniredd, S.R.; Segev, L.; Ely, T.; Haick, H.; Zuilhof, H.; Vilan, A.; Kronik, L.; Kahn, A.; Cahen, D.


    We compare the charge transport characteristics of heavy-doped p(++)- and n(++)-Si-alkyl chain/Hg junctions. Based on negative differential resistance in an analogous semiconductor-inorganic insulator/metal junction we suggest that for both p(++)- and n(++)-type junctions, the energy difference

  17. Improved performance of porous bio-anodes in microbial electrolysis cells by enhancing mass and charge transport

    NARCIS (Netherlands)

    Sleutels, T.H.J.A.; Lodder, R.; Hamelers, H.V.M.; Buisman, C.J.N.


    To create an efficient MEC high current densities and high coulombic efficiencies are required. The aim of this study was to increase cur-rent densities and coulombic efficiencies by influencing mass and charge transport in porous electrodes by: (i) introduction of a forced flow through the anode to

  18. Theoretical studies on the effect of benzene and thiophene groups on the charge transport properties of Isoindigo and its derivatives (United States)

    Jia, Xu-Bo; Wei, Hui-Ling; Shi, Ya-Ting; Shi, Ya-Rui; Liu, Yu-Fang


    In this work, the charge transport properties of Isoindigo (II) and its derivatives which have the same hexyl chain were theoretically investigated by the Marcus-Hush theory combined with density functional theory (DFT). Here we demonstrate that the changes of benzene and thiophene groups in molecular structure have an important influence on the charge transport properties of organic semiconductor. The benzene rings of II are replaced by thiophenes to form the thienoisoindigo (TII), and the addition of benzene rings to the TII form the benzothienoisoindigo (BTII). The results show that benzene rings and thiophenes change the chemical structure of crystal molecules, which lead to different molecule stacking, thus, the length of hydrogen bond was changed. A shorter intermolecular hydrogen bond lead to tighter molecular stacking, which reduces the center-to-center distance and enhances the ability of charge transfer. At the same time, we theoretically demonstrated that II and BTII are the ambipolar organic semiconductor. BTII has better carrier mobility. The hole mobility far greater than electron mobility in TII, which is p-type organic semiconductor. Among all hopping path, we find that the distance of face-to-face stacking in II is the shortest and the electron-transport electronic coupling Ve is the largest, but II has not a largest anisotropic mobility, because the reorganization energy has a greater influence on the mobility than the electronic coupling. This work is helpful for designing ambipolar organic semiconductor materials with higher charge transport properties by introducing benzene ring and thiophene.

  19. Theory of charge transport in diffusive normal metal/conventional superconductor point contacts in the presence of magnetic impurity

    NARCIS (Netherlands)

    Yokoyama, T.; Tanaka, Y.; Golubov, Alexandre Avraamovitch; Inoue, J.; Asano, Y.


    Charge transport in the diffusive normal metal/insulator/s-wave superconductor junctions is studied in the presence of the magnetic impurity for various situations, where we have used the Usadel equation with Nazarov's generalized boundary condition. It is revealed that the magnetic impurity

  20. Charge Recombination, Transport Dynamics, and Interfacial Effects in Organic Solar Cells

    Energy Technology Data Exchange (ETDEWEB)

    Heeger, Alan [Univ. of California, Santa Barbara, CA (United States); Bazan, Guillermo [Univ. of California, Santa Barbara, CA (United States); Nguyen, Thuc-Quyen [Univ. of California, Santa Barbara, CA (United States); Wudl, Fred [Univ. of California, Santa Barbara, CA (United States)


    The need for renewable sources of energy is well known. Conversion of sunlight to electricity using solar cells is one of the most important opportunities for creating renewable energy sources. The research carried out under DE-FG02-08ER46535 focused on the science and technology of “Plastic” solar cells comprised of organic (i.e. carbon based) semiconductors. The Bulk Heterojunction concept involves a phase separated blend of two organic semiconductors each with dimensions in the nano-meter length scale --- one a material that functions as a donor for electrons and the other a material that functions as an acceptor for electrons. The nano-scale inter-penetrating network concept for “Plastic” solar cells was created at UC Santa Barbara. A simple measure of the impact of this concept can be obtained from a Google search which gives 244,000 “hits” for the Bulk Heterojunction solar cell. Research funded through this program focused on four major areas: 1. Interfacial effects in organic photovoltaics, 2. Charge transfer and photogeneration of mobile charge carriers in organic photovoltaics, 3. Transport and recombination of the photogenerated charge carriers in organic photovoltaics, 4. Synthesis of novel organic semiconducting polymers and semiconducting small molecules, including conjugated polyelectrolytes. Following the discovery of ultrafast charge transfer at UC Santa Barbara in 1992, the nano-organic (Bulk Heterojunction) concept was formulated. The need for a morphology comprising two interpenetrating bicontinuous networks was clear: one network to carry the photogenerated electrons (negative charge) to the cathode and one network to carry the photo-generated holes (positive charge) to the anode. This remarkable self-assembled network morphology has now been established using Transmission electron Microscopy (TEM) either in the Phase Contrast mode or via TEM-Tomography. The steps involved in delivering power from a solar cell to an external circuit

  1. Bipolar charge transport in PCPDTBT-PCBM bulk-heterojunctions for photovoltaic applications

    Energy Technology Data Exchange (ETDEWEB)

    Morana, Mauro [Konarka Austria GmbH, 4040 Linz (Austria); Dipartimento di Ingegeria Elettrica ed Elettronica, Universita di Cagliari (Italy); Wegscheider, Matthias; Bonanni, Alberta [Johannes Kepler University, Institute of Solid State Physics, Linz (Austria); Kopidakis, Nikos; Shaheen, Sean [National Renewable Energy Laboratory, Golden, CO (United States); Scharber, Markus; Brabec, Christoph [Konarka Austria GmbH, 4040 Linz (Austria); Zhu, Zhengguo; Waller, David; Gaudiana, Russell [Konarka Technologies Inc., Lowell, MA (United States)


    An experimental study of the transport properties of a low-bandgap conjugated polymer giving high photovoltaic quantum efficiencies in the near infrared spectral region (E{sub g-opt}{proportional_to} 1.35 eV) is presented. Using a organic thin film transistor geometry, we demonstrate a relatively high in-plane hole mobility, up to 1.5. x 10{sup -2} cm{sup 2} V{sup -1} s{sup -1} and quantify the electron mobility at 3 x . 10{sup -5} cm{sup 2} V{sup -1} s{sup -1} on a SiO{sub 2} dielectric. In addition, singular contact behavior results in bipolar quasi-Ohmic injection both from low and high workfunction metals like LiF/Al and Au. X-ray investigations revealed a degree of interchain {pi}-stacking that is probably embedded in a disordered matrix. Disorder also manifests itself in a strong positive field dependence of the hole mobility from the electric field. In blends made with the electron acceptor methanofullerene [6,6]-phenyl C{sub 61} butyric acid methyl ester (PCBM), the transistor characteristics suggest a relatively unfavorable intermixing of the two components for the application to photovoltaic devices. We attribute this to a too fine dispersion of [C60]-PCBM in the polymer matrix, that is also confirmed by the quenching of the photoluminescence signal measured in PCPDTBT [C60]-PCBM films with various composition. We show that a higher degree of phase separation can be induced during the film formation by using 1,8-octanedithiol (ODT), which leads to a more efficient electron percolation in the [C60]-PCBM. In addition, the experimental results, in combination with those of solar cells seem to support the correlation between the blend morphology and charge recombination. We tentatively propose that the drift length, and similarly the electrical fill factor, can be limited by the recombination of holes with electrons trapped on isolated [C60]-PCBM clusters. Ionized and isolated [C60]-PCBM molecules can modify the local electric field in the solar cell by build

  2. Charge transport through exciton shelves in cadmium chalcogenide quantum dot-DNA nano-bioelectronic thin films (United States)

    Goodman, Samuel M.; Noh, Hyunwoo; Singh, Vivek; Cha, Jennifer N.; Nagpal, Prashant


    Quantum dot (QD), or semiconductor nanocrystal, thin films are being explored for making solution-processable devices due to their size- and shape-tunable bandgap and discrete higher energy electronic states. While DNA has been extensively used for the self-assembly of nanocrystals, it has not been investigated for the simultaneous conduction of multiple energy charges or excitons via exciton shelves (ES) formed in QD-DNA nano-bioelectronic thin films. Here, we present studies on charge conduction through exciton shelves, which are formed via chemically coupled QDs and DNA, between electronic states of the QDs and the HOMO-LUMO levels in the complementary DNA nucleobases. While several challenges need to be addressed in optimizing the formation of devices using QD-DNA thin films, a higher charge collection efficiency for hot-carriers and our detailed investigations of charge transport mechanism in these thin films highlight their potential for applications in nano-bioelectronic devices and biological transducers.

  3. Charge transport through exciton shelves in cadmium chalcogenide quantum dot-DNA nano-bioelectronic thin films

    Energy Technology Data Exchange (ETDEWEB)

    Goodman, Samuel M.; Singh, Vivek [Department of Chemical and Biological Engineering, University of Colorado Boulder, 3415 Colorado Avenue, Boulder, Colorado 80303 (United States); Noh, Hyunwoo [Department of Chemical and Biological Engineering, University of Colorado Boulder, 3415 Colorado Avenue, Boulder, Colorado 80303 (United States); Materials Science and Engineering Program and Department of Nanoengineering, University of California, 9500 Gilman Drive, La Jolla, San Diego, California 92093 (United States); Cha, Jennifer N. [Department of Chemical and Biological Engineering, University of Colorado Boulder, 3415 Colorado Avenue, Boulder, Colorado 80303 (United States); Materials Science and Engineering Program and Department of Nanoengineering, University of California, 9500 Gilman Drive, La Jolla, San Diego, California 92093 (United States); Materials Science and Engineering, University of Colorado Boulder, 3415 Colorado Avenue, Boulder, Colorado 80303 (United States); Nagpal, Prashant, E-mail: [Department of Chemical and Biological Engineering, University of Colorado Boulder, 3415 Colorado Avenue, Boulder, Colorado 80303 (United States); Materials Science and Engineering, University of Colorado Boulder, 3415 Colorado Avenue, Boulder, Colorado 80303 (United States); BioFrontiers Institute, University of Colorado Boulder, 3415 Colorado Avenue, Boulder, Colorado 80303 (United States); Renewable and Sustainable Energy Institute, University of Colorado Boulder, 2445 Kittredge Loop, Boulder, Colorado 80309 (United States)


    Quantum dot (QD), or semiconductor nanocrystal, thin films are being explored for making solution-processable devices due to their size- and shape-tunable bandgap and discrete higher energy electronic states. While DNA has been extensively used for the self-assembly of nanocrystals, it has not been investigated for the simultaneous conduction of multiple energy charges or excitons via exciton shelves (ES) formed in QD-DNA nano-bioelectronic thin films. Here, we present studies on charge conduction through exciton shelves, which are formed via chemically coupled QDs and DNA, between electronic states of the QDs and the HOMO-LUMO levels in the complementary DNA nucleobases. While several challenges need to be addressed in optimizing the formation of devices using QD-DNA thin films, a higher charge collection efficiency for hot-carriers and our detailed investigations of charge transport mechanism in these thin films highlight their potential for applications in nano-bioelectronic devices and biological transducers.

  4. Charge transport through exciton shelves in cadmium chalcogenide quantum dot-DNA nano-bioelectronic thin films

    International Nuclear Information System (INIS)

    Goodman, Samuel M.; Singh, Vivek; Noh, Hyunwoo; Cha, Jennifer N.; Nagpal, Prashant


    Quantum dot (QD), or semiconductor nanocrystal, thin films are being explored for making solution-processable devices due to their size- and shape-tunable bandgap and discrete higher energy electronic states. While DNA has been extensively used for the self-assembly of nanocrystals, it has not been investigated for the simultaneous conduction of multiple energy charges or excitons via exciton shelves (ES) formed in QD-DNA nano-bioelectronic thin films. Here, we present studies on charge conduction through exciton shelves, which are formed via chemically coupled QDs and DNA, between electronic states of the QDs and the HOMO-LUMO levels in the complementary DNA nucleobases. While several challenges need to be addressed in optimizing the formation of devices using QD-DNA thin films, a higher charge collection efficiency for hot-carriers and our detailed investigations of charge transport mechanism in these thin films highlight their potential for applications in nano-bioelectronic devices and biological transducers

  5. Characterization of dextran-grafted hydrophobic charge-induction resins: Structural properties, protein adsorption and transport. (United States)

    Liu, Tao; Angelo, James M; Lin, Dong-Qiang; Lenhoff, Abraham M; Yao, Shan-Jing


    The structural and functional properties of a series of dextran-grafted and non-grafted hydrophobic charge-induction chromatographic (HCIC) agarose resins were characterized by macroscopic and microscopic techniques. The effects of dextran grafting and mobile phase conditions on the pore dimensions of the resins were investigated with inverse size exclusion chromatography (ISEC). A significantly lower pore radius (17.6nm) was found for dextran-grafted than non-grafted resins (29.5nm), but increased salt concentration would narrow the gap between the respective pore radii. Two proteins, human immunoglobulin G (hIgG) and bovine serum albumin (BSA), were used to examine the effect of protein characteristics. The results of adsorption isotherms showed that the dextran-grafted resin with high ligand density had substantially higher adsorption capacity and enhanced the salt-tolerance property for hIgG, but displayed a significantly smaller benefit for BSA adsorption. Confocal laser scanning microscopy (CLSM) showed that hIgG presented more diffuse and slower moving adsorption front compared to BSA during uptake into the resins because of the selective binding of multiple species from polyclonal IgG; polymer-grafting with high ligand density could enhance the rate of hIgG transport in the dextran-grafted resins without salt addition, but not for the case with high salt and BSA. The results indicate that microscopic analysis using ISEC and CLSM is useful to improve the mechanistic understanding of resin structure and of critical functional parameters involving protein adsorption and transport, which would guide the rational design of new resins and processes. Copyright © 2017. Published by Elsevier B.V.

  6. Charge carrier transport mechanisms in perovskite CdTiO3 fibers

    Directory of Open Access Journals (Sweden)

    Z. Imran


    Full Text Available Electrical transport properties of electrospun cadmium titanate (CdTiO3 fibers have been investigated using ac and dc measurements. Air annealing of as spun fibers at 1000 °C yielded the single phase perovskite fibers having diameter ∼600 nm - 800 nm. Both the ac and dc electrical measurements were carried out at temperatures from 200 K – 420 K. The complex impedance plane plots revealed a single semicircular arc which indicates the interfacial effect due to grain boundaries of fibers. The dielectric properties obey the Maxwell-Wagner theory of interfacial polarization. In dc transport study at low voltages, data show Ohmic like behavior followed by space charge limited current (SCLC with traps at higher voltages at all temperatures (200 K – 420 K. Trap density in our fibers system is Nt = 6.27 × 1017 /cm3. Conduction mechanism in the sample is governed by 3-D variable range hopping (VRH from 200 K – 300 K. The localized density of states were found to be N(EF = 5.51 × 1021 eV−1 cm−3 at 2 V. Other VRH parameters such as hopping distance (Rhop and hopping energy (Whop were also calculated. In the high temperature range of 320 K – 420 K, conductivity follows the Arrhenius law. The activation energy found at 2 V is 0.10 eV. Temperature dependent and higher values of dielectric constant make the perovskite CdTiO3 fibers efficient material for capacitive energy storage devices.

  7. Influence of surface charge on the transport characteristics of nanowire-field effect transistors in liquid environments

    Energy Technology Data Exchange (ETDEWEB)

    Nozaki, Daijiro, E-mail:, E-mail: [Institute for Materials Science and Max Bergmann Center of Biomaterials, TU Dresden, 01062 Dresden (Germany); Kunstmann, Jens [Institute for Materials Science and Max Bergmann Center of Biomaterials, TU Dresden, 01062 Dresden (Germany); Theoretical Chemistry, Department of Chemistry and Food Chemistry, TU Dresden, 01062 Dresden (Germany); Zörgiebel, Felix [Institute for Materials Science and Max Bergmann Center of Biomaterials, TU Dresden, 01062 Dresden (Germany); Center for Advancing Electronics Dresden (cfAED), TU Dresden, 01062 Dresden (Germany); Cuniberti, Gianaurelio [Institute for Materials Science and Max Bergmann Center of Biomaterials, TU Dresden, 01062 Dresden (Germany); Center for Advancing Electronics Dresden (cfAED), TU Dresden, 01062 Dresden (Germany); Dresden Center for Computational Materials Science (DCCMS), TU Dresden, 01062 Dresden (Germany)


    One dimensional nanowire field effect transistors (NW-FETs) are a promising platform for sensor applications. The transport characteristics of NW-FETs are strongly modified in liquid environment due to the charging of surface functional groups accompanied with protonation or deprotonation. In order to investigate the influence of surface charges and ionic concentrations on the transport characteristics of Schottky-barrier NW-FETs, we have combined the modified Poisson-Boltzmann theory with the Landauer-Büttiker transport formalism. For a typical device, the model is able to capture the reduction of the sensitivity of NW-FETs in ionic solutions due to the screening from counter ions as well as a local gating from surface functional groups. Our approach allows to model, to investigate, and to optimize realistic Schottky-barrier NW-FET devices in liquid environment.

  8. A New Approach for Evaluating Charge Transport Properties of Semiconductor Detectors

    International Nuclear Information System (INIS)

    Kim, Kyung O; Kim, Jong Kyung; Kim, Soon Young; Ha, Jang Ho


    The semiconductor detectors (e.g., CdTe, CdZnTe, and HgI 2 ) have been widely used for radiation detection and medical imaging because of its various outstanding features such as excellent energy resolution, wide bandgap energy, room temperature operation, and so on. Unfortunately, the performance of these detectors is mainly limited by the charge transport properties of semiconductor, especially the mobility-lifetime products (i.e., (μτ) e and ((μτ) h ). Hence, the analysis on the mobility-lifetime products is very important for evaluating correct characteristics of semiconductor detectors. A commonly used method to analyze the mobilitylifetime products is based on their responses to α particle. However, the α particle method cannot evaluate the ((μτ)h product in many cases, because a semiconductor detector operating at positive bias voltages often yields the energy spectrum without the peaks. This method is also known to be very sensitive to the experimental conditions as well as surface conditions of the detector. In this study, a new approach with gamma-ray instead of α particle was carried out to solve the determination difficulty of the ((μτ) h product with common method. The special relation between the two mobility-lifetime products, which we call the 'Nural equation', was also developed to simply obtain each parameter based on Hecht equation

  9. The effects of free volumes on charge carrier transport in polysilanes probed by positron annihilation

    International Nuclear Information System (INIS)

    Seki, Shu; Terashima, Y.; Kunimi, Y.; Kawamori, T.; Tashiro, M.; Honda, Y.; Tagawa, S.


    Free volume characteristics were investigated by positron annihilation technique in poly(n-alkylphenylsilane)s with a variety length of n-alkyl chains from methyl (C1) to n-dodecyl (C12). The average radius of free volume: R changes in two steps. An increase in R is observed with an elongation of n-alkyl side-groups from C1 to n-pentyl (C5), followed by an abrupt decrease in R between C5 and n-hexyl (C6), and a gradual increase by further elongation from C6 to C12. The sudden decrease in R at C5 and C6 gives a good interpretation to the reduction of inter-site hopping distances and their fluctuation for the charge carrier (hole) transport estimated by time-of-flight measurements. The values of free volume fraction in the polymers mainly reflect the density of the polymers; however, differences in the microscopic inter-molecular structure are also observed for poly(n-hexylphenylsilane) in the present study

  10. Charge Energy Transport in Hopping Systems with Rapidly Decreasing Density of States (United States)

    Mendels, Dan; Organic Electronics Group Technion Team


    An accurate description of the carrier hopping topology in the energy domain of hopping systems incorporating a rapidly decreasing density of states and the subsequent energetic position of these systems' so called effective conduction band is crucial for rationalizing and quantifying these systems' thermo-electric properties, doping related phenomena and carrier gradient effects such as the emergence of the General Einstein Relation under degenerate conditions. Additionally, as will be shown, the 'mobile' carriers propagating through the system can have excess energies reaching 0.3eV above the system quasi-Fermi energy. Hence, since these mobile carriers are most prone to reach systems interfaces and interact with oppositely charged carriers, their excess energy should be considered in determining the efficiencies of energy dependent processes such as carrier recombination and exciton dissociation. In light of the stated motivations, a comprehensive numerical and analytical study of the topology of hopping in the energetic density of such systems (i.e. the statistics regarding which energy values carriers visit most and in what manner) was implemented and the main statistical features of the hopping process that determine the position in energy of the system's effective conduction band were distilled. The obtained results also help shed light on yet to be elucidated discrepancies between predictions given by the widely employed transport energy concept and Monte Carlo simulations.

  11. Ionomer design for augmented charge transport in novel ionic polymer transducers

    International Nuclear Information System (INIS)

    Duncan, Andrew J; Akle, Barbar J; Long, Timothy E; Leo, Donald J


    Ionic polymer transducers are devices that display electromechanical transduction and are projected to have extensive applications as actuators and sensors. This study employs novel, highly branched sulfonated polysulfones (sBPS) as part of an investigation into the contribution of polymer topology to electromechanical transduction. Specifically, the ionomers are combined with an ionic liquid to determine the optimal ratio and method for maximizing ionic conductivity, where charge transport is essential to device performance. Two uptake methods are assessed for introduction of ionic liquid into the central ionomeric membrane. The effects of casting membranes in the presence of ionic liquid and swelling preformed membranes in ionic liquid on film stability and ionic conductivity are examined. Membranes cast from a solution of the ionomer and ionic liquid allow for direct targeting of the component ratio and a single-step process for membrane formation. Swelling conditions for preformed neat membranes combine time, temperature, and the presence of organic co-diluents to achieve the maximum stable uptake of ionic liquid. Comparison of optimal conditions for the various methods reveals that swelling with co-diluents achieves ionic conductivity of the imbibed membrane per uptake higher than the levels achieved with the casting process for highly sulfonated sBPS. However, for less sulfonated sBPS the casting process successfully produced membranes with ionic conductivities unreachable with the co-diluent process. Both methods will enable the production of high performance ionic polymer transducers constructed from novel sBPS ionomers and ionic liquids

  12. Anomalous transport of charged dust grains in a magnetized collisional plasma: A molecular dynamics study (United States)

    Bezbaruah, Pratikshya; Das, Nilakshi


    Anomalous diffusion of charged dust grains immersed in a plasma in the presence of strong ion-neutral collision, flowing ions, and a magnetic field has been observed. Molecular Dynamics simulation confirms the deviation from normal diffusion in an ensemble of dust grains probed in laboratory plasma chambers. Collisional effects are significant in governing the nature of diffusion. In order to have a clear idea on the transport of particles in a real experimental situation, the contribution of streaming ions and the magnetic field along with collision is considered through the relevant interaction potential. The nonlinear evolution of Mean Square Displacement is an indication of the modification in particle trajectories due to several effects as mentioned above. It is found that strong collision and ion flow significantly affect the interparticle interaction potential in the presence of the magnetic field and lead to the appearance of the asymmetric type of Debye Hückel (D H) potential. Due to the combined effect of the magnetic field, ion flow, and collision, dusty plasma exhibits a completely novel behavior. The coupling parameter Γ enhances the asymmetric D H type potential arising due to ion flow, and this may drive the system to a disordered state.

  13. Low-Energy Electron Potentiometry: Contactless Imaging of Charge Transport on the Nanoscale. (United States)

    Kautz, J; Jobst, J; Sorger, C; Tromp, R M; Weber, H B; van der Molen, S J


    Charge transport measurements form an essential tool in condensed matter physics. The usual approach is to contact a sample by two or four probes, measure the resistance and derive the resistivity, assuming homogeneity within the sample. A more thorough understanding, however, requires knowledge of local resistivity variations. Spatially resolved information is particularly important when studying novel materials like topological insulators, where the current is localized at the edges, or quasi-two-dimensional (2D) systems, where small-scale variations can determine global properties. Here, we demonstrate a new method to determine spatially-resolved voltage maps of current-carrying samples. This technique is based on low-energy electron microscopy (LEEM) and is therefore quick and non-invasive. It makes use of resonance-induced contrast, which strongly depends on the local potential. We demonstrate our method using single to triple layer graphene. However, it is straightforwardly extendable to other quasi-2D systems, most prominently to the upcoming class of layered van der Waals materials.

  14. Photoconductivity enhancement and charge transport properties in ruthenium-containing block copolymer/carbon nanotube hybrids. (United States)

    Lo, Kin Cheung; Hau, King In; Chan, Wai Kin


    Functional polymer/carbon nanotube (CNT) hybrid materials can serve as a good model for light harvesting systems based on CNTs. This paper presents the synthesis of block copolymer/CNT hybrids and the characterization of their photocurrent responses by both experimental and computational approaches. A series of functional diblock copolymers was synthesized by reversible addition-fragmentation chain transfer polymerizations for the dispersion and functionalization of CNTs. The block copolymers contain photosensitizing ruthenium complexes and modified pyrene-based anchoring units. The photocurrent responses of the polymer/CNT hybrids were measured by photoconductive atomic force microscopy (PCAFM), from which the experimental data were analyzed by vigorous statistical models. The difference in photocurrent response among different hybrids was correlated to the conformations of the hybrids, which were elucidated by molecular dynamics simulations, and the electronic properties of polymers. The photoresponse of the block copolymer/CNT hybrids can be enhanced by introducing an electron-accepting block between the photosensitizing block and the CNT. We have demonstrated that the application of a rigorous statistical methodology can unravel the charge transport properties of these hybrid materials and provide general guidelines for the design of molecular light harvesting systems.

  15. Pure crystal orientation and anisotropic charge transport in large-area hybrid perovskite films

    KAUST Repository

    Cho, Nam Chul


    Controlling crystal orientations and macroscopic morphology is vital to develop the electronic properties of hybrid perovskites. Here we show that a large-area, orientationally pure crystalline (OPC) methylammonium lead iodide (MAPbI3) hybrid perovskite film can be fabricated using a thermal-gradient-assisted directional crystallization method that relies on the sharp liquid-to-solid transition of MAPbI3 from ionic liquid solution. We find that the OPC films spontaneously form periodic microarrays that are distinguishable from general polycrystalline perovskite materials in terms of their crystal orientation, film morphology and electronic properties. X-ray diffraction patterns reveal that the film is strongly oriented in the (112) and (200) planes parallel to the substrate. This film is structurally confined by directional crystal growth, inducing intense anisotropy in charge transport. In addition, the low trap-state density (7.9 × 1013 cm−3) leads to strong amplified stimulated emission. This ability to control crystal orientation and morphology could be widely adopted in optoelectronic devices.

  16. Charge Transport Phenomena in Detectors of the Cryogenic Dark Matter Search (United States)

    Sundqvist, Kyle


    The Cryogenic Dark Matter Search (CDMS) seeks to detect putative weakly-interacting massive particles (WIMPS), which could explain the dark matter problem in cosmology and particle physics. By simultaneously measuring the number of charge carriers and the energy in athermal phonons created by particle interactions in intrinsic Ge and Si crystals at a temperature of 40 mK, a signature response for each event is produced. This response, combined with phonon pulse-shape information, allows CDMS to actively discriminate candidate WIMP interactions with nuclei apart from electromagnetic radioactive background which interacts with electrons. The challenges associated with these techniques are unique. Carrier drift-fields are maintained at only a few V/cm, else drift-emitted Luke-Neganov phonons would dominate the phonons of the original interaction. Under such conditions, carrier scattering is dominated by zero-point fluctuations of the lattice ions. It has been an open question how well the 8 Kelvin data prominent in the literature depicts this case. We compare the simulated transport properties of electrons and holes in Ge at 40 mK and at 8 K, and apply this understanding to our detectors.

  17. Effect of PANI rate percentage on morphology, structure and charge transport mechanism in PANI–PVDF composites above percolation threshold

    International Nuclear Information System (INIS)

    Saïdi, Sami; Bouzitoun, Mouna; Mannaî, Aymen; Gmati, Fethi; Derouiche, Hassen; Mohamed, Abdellatif Belhadj


    Polyaniline–Poly(vinylidene) fluoride (PANI–PVDF) composites were prepared by adding PANI to the PVDF by different weight percentages p % (p = 0, 5, 10, 20, … until 100%). The dc and ac electrical conductivity were studied as a function of PANI percentage in the temperature range 303–453 K. The percolation threshold was found to be equal to 2.95%. When the amount of PANI varies from 5 to 30%, the charge transport mechanism was found to be governed by Mott's three-dimensional variable range hopping model and the dc conductivity decreases within this range. For p > 30%, the conductivity increases and the charge transport mechanism are better fitted by a fluctuation induced tunnelling model (FIT). By calculating the distance ‘s’ between two successive clusters (the distance between two active imines centres (=N + H–) of PANI) from the FIT model, we deduce that electron charge transfer is done by inter-chain hopping for the range [p = 40 to 60%] and by intra-chain hopping for p = 70 to 90%. Some insights about the contribution of the ionic charge transport for PANI concentrations in the interval 5% < p < 30% were obtained using impedance measurements at different frequencies. X-ray diffraction measurements, Fourier transform infrared spectroscopy and scanning electron microscopy were used to investigate the effect of PANI on the structure and morphology of composites. (paper)

  18. A multi-agent quantum Monte Carlo model for charge transport: Application to organic field-effect transistors

    International Nuclear Information System (INIS)

    Bauer, Thilo; Jäger, Christof M.; Jordan, Meredith J. T.; Clark, Timothy


    We have developed a multi-agent quantum Monte Carlo model to describe the spatial dynamics of multiple majority charge carriers during conduction of electric current in the channel of organic field-effect transistors. The charge carriers are treated by a neglect of diatomic differential overlap Hamiltonian using a lattice of hydrogen-like basis functions. The local ionization energy and local electron affinity defined previously map the bulk structure of the transistor channel to external potentials for the simulations of electron- and hole-conduction, respectively. The model is designed without a specific charge-transport mechanism like hopping- or band-transport in mind and does not arbitrarily localize charge. An electrode model allows dynamic injection and depletion of charge carriers according to source-drain voltage. The field-effect is modeled by using the source-gate voltage in a Metropolis-like acceptance criterion. Although the current cannot be calculated because the simulations have no time axis, using the number of Monte Carlo moves as pseudo-time gives results that resemble experimental I/V curves

  19. A multi-agent quantum Monte Carlo model for charge transport: Application to organic field-effect transistors

    Energy Technology Data Exchange (ETDEWEB)

    Bauer, Thilo; Jäger, Christof M. [Department of Chemistry and Pharmacy, Computer-Chemistry-Center and Interdisciplinary Center for Molecular Materials, Friedrich-Alexander-Universität Erlangen-Nürnberg, Nägelsbachstrasse 25, 91052 Erlangen (Germany); Jordan, Meredith J. T. [School of Chemistry, University of Sydney, Sydney, NSW 2006 (Australia); Clark, Timothy, E-mail: [Department of Chemistry and Pharmacy, Computer-Chemistry-Center and Interdisciplinary Center for Molecular Materials, Friedrich-Alexander-Universität Erlangen-Nürnberg, Nägelsbachstrasse 25, 91052 Erlangen (Germany); Centre for Molecular Design, University of Portsmouth, Portsmouth PO1 2DY (United Kingdom)


    We have developed a multi-agent quantum Monte Carlo model to describe the spatial dynamics of multiple majority charge carriers during conduction of electric current in the channel of organic field-effect transistors. The charge carriers are treated by a neglect of diatomic differential overlap Hamiltonian using a lattice of hydrogen-like basis functions. The local ionization energy and local electron affinity defined previously map the bulk structure of the transistor channel to external potentials for the simulations of electron- and hole-conduction, respectively. The model is designed without a specific charge-transport mechanism like hopping- or band-transport in mind and does not arbitrarily localize charge. An electrode model allows dynamic injection and depletion of charge carriers according to source-drain voltage. The field-effect is modeled by using the source-gate voltage in a Metropolis-like acceptance criterion. Although the current cannot be calculated because the simulations have no time axis, using the number of Monte Carlo moves as pseudo-time gives results that resemble experimental I/V curves.

  20. FOB-SH: Fragment orbital-based surface hopping for charge carrier transport in organic and biological molecules and materials (United States)

    Spencer, J.; Gajdos, F.; Blumberger, J.


    We introduce a fragment orbital-based fewest switches surface hopping method, FOB-SH, designed to efficiently simulate charge carrier transport in strongly fluctuating condensed phase systems such as organic semiconductors and biomolecules. The charge carrier wavefunction is expanded and the electronic Hamiltonian constructed in a set of singly occupied molecular orbitals of the molecular sites that mediate the charge transfer. Diagonal elements of the electronic Hamiltonian (site energies) are obtained from a force field, whereas the off-diagonal or electronic coupling matrix elements are obtained using our recently developed analytic overlap method. We derive a general expression for the exact forces on the adiabatic ground and excited electronic state surfaces from the nuclear gradients of the charge localized electronic states. Applications to electron hole transfer in a model ethylene dimer and through a chain of ten model ethylenes validate our implementation and demonstrate its computational efficiency. On the larger system, we calculate the qualitative behaviour of charge mobility with change in temperature T for different regimes of the intermolecular electronic coupling. For small couplings, FOB-SH predicts a crossover from a thermally activated regime at low temperatures to a band-like transport regime at higher temperatures. For higher electronic couplings, the thermally activated regime disappears and the mobility decreases according to a power law. This is interpreted by a gradual loss in probability for resonance between the sites as the temperature increases. The polaron hopping model solved for the same system gives a qualitatively different result and underestimates the mobility decay at higher temperatures. Taken together, the FOB-SH methodology introduced here shows promise for a realistic investigation of charge carrier transport in complex organic, aqueous, and biological systems.

  1. FOB-SH: Fragment orbital-based surface hopping for charge carrier transport in organic and biological molecules and materials

    Energy Technology Data Exchange (ETDEWEB)

    Spencer, J.; Gajdos, F.; Blumberger, J., E-mail: [Department of Physics and Astronomy, University College London, Gower Street, London WC1E 6BT (United Kingdom)


    We introduce a fragment orbital-based fewest switches surface hopping method, FOB-SH, designed to efficiently simulate charge carrier transport in strongly fluctuating condensed phase systems such as organic semiconductors and biomolecules. The charge carrier wavefunction is expanded and the electronic Hamiltonian constructed in a set of singly occupied molecular orbitals of the molecular sites that mediate the charge transfer. Diagonal elements of the electronic Hamiltonian (site energies) are obtained from a force field, whereas the off-diagonal or electronic coupling matrix elements are obtained using our recently developed analytic overlap method. We derive a general expression for the exact forces on the adiabatic ground and excited electronic state surfaces from the nuclear gradients of the charge localized electronic states. Applications to electron hole transfer in a model ethylene dimer and through a chain of ten model ethylenes validate our implementation and demonstrate its computational efficiency. On the larger system, we calculate the qualitative behaviour of charge mobility with change in temperature T for different regimes of the intermolecular electronic coupling. For small couplings, FOB-SH predicts a crossover from a thermally activated regime at low temperatures to a band-like transport regime at higher temperatures. For higher electronic couplings, the thermally activated regime disappears and the mobility decreases according to a power law. This is interpreted by a gradual loss in probability for resonance between the sites as the temperature increases. The polaron hopping model solved for the same system gives a qualitatively different result and underestimates the mobility decay at higher temperatures. Taken together, the FOB-SH methodology introduced here shows promise for a realistic investigation of charge carrier transport in complex organic, aqueous, and biological systems.

  2. Solution processable semiconductor thin films: Correlation between morphological, structural, optical and charge transport properties (United States)

    Isik, Dilek

    This Ph.D. thesis is a result of multidisciplinary research bringing together fundamental concepts in thin film engineering, materials science, materials processing and characterization, electrochemistry, microfabrication, and device physics. Experiments were conducted by tackling scientific problems in the field of thin films and interfaces, with the aim to correlate the morphology, crystalline structure, electronic structure of thin films with the functional properties of the films and the performances of electronic devices based thereon. Furthermore, novel strategies based on interfacial phenomena at electrolyte/thin film interfaces were explored and exploited to control the electrical conductivity of the thin films. Three main chemical systems were the object of the studies performed during this Ph.D., two types of organic semiconductors (azomethine-based oligomers and polymers and soluble pentacene derivatives) and one metal oxide semiconductor (tungsten trioxide, WO3). To explore the morphological properties of the thin films, atomic force microscopy was employed. The morphological properties were further investigated by hyperspectral fluorescence microscopy and tentatively correlated to the charge transport properties of the films. X-ray diffraction (Grazing incidence XRD, GIXRD) was used to investigate the crystallinity of the film and the effect of the heat treatment on such crystallinity, as well as to understand the molecular arrangement of the organic molecules in the thin film. The charge transport properties of the films were evaluated in thin film transistor configuration. For electrolyte gated thin film transistors, time dependent transient measurements were conducted, in parallel to more conventional transistor characterizations, to explore the specific effects played on the gating by the anion and cation constituting the electrolyte. The capacitances of the electrical double layers at the electrolyte/WO3 interface were obtained from

  3. Elucidating the Performance Limitations of Lithium-ion Batteries due to Species and Charge Transport through Five Characteristic Parameters (United States)

    Jiang, Fangming; Peng, Peng


    Underutilization due to performance limitations imposed by species and charge transports is one of the key issues that persist with various lithium-ion batteries. To elucidate the relevant mechanisms, two groups of characteristic parameters were proposed. The first group contains three characteristic time parameters, namely: (1) te, which characterizes the Li-ion transport rate in the electrolyte phase, (2) ts, characterizing the lithium diffusion rate in the solid active materials, and (3) tc, describing the local Li-ion depletion rate in electrolyte phase at the electrolyte/electrode interface due to electrochemical reactions. The second group contains two electric resistance parameters: Re and Rs, which represent respectively, the equivalent ionic transport resistance and the effective electronic transport resistance in the electrode. Electrochemical modeling and simulations to the discharge process of LiCoO2 cells reveal that: (1) if te, ts and tc are on the same order of magnitude, the species transports may not cause any performance limitations to the battery; (2) the underlying mechanisms of performance limitations due to thick electrode, high-rate operation, and large-sized active material particles as well as effects of charge transports are revealed. The findings may be used as quantitative guidelines in the development and design of more advanced Li-ion batteries. PMID:27599870

  4. The role of cytosine methylation on charge transport through a DNA strand

    Energy Technology Data Exchange (ETDEWEB)

    Qi, Jianqing, E-mail:; Anantram, M. P., E-mail: [Department of Electrical Engineering, University of Washington, Seattle, Washington 98195-2500 (United States); Govind, Niranjan, E-mail: [William R. Wiley Environmental Molecular Sciences Laboratory, Pacific Northwest National Laboratory, Richland, Washington 99352 (United States)


    Cytosine methylation has been found to play a crucial role in various biological processes, including a number of human diseases. The detection of this small modification remains challenging. In this work, we computationally explore the possibility of detecting methylated DNA strands through direct electrical conductance measurements. Using density functional theory and the Landauer-Büttiker method, we study the electronic properties and charge transport through an eight base-pair methylated DNA strand and its native counterpart. We first analyze the effect of cytosine methylation on the tight-binding parameters of two DNA strands and then model the transmission of the electrons and conductance through the strands both with and without decoherence. We find that the main difference of the tight-binding parameters between the native DNA and the methylated DNA lies in the on-site energies of (methylated) cytosine bases. The intra- and inter-strand hopping integrals between two nearest neighboring guanine base and (methylated) cytosine base also change with the addition of the methyl groups. Our calculations show that in the phase-coherent limit, the transmission of the methylated strand is close to the native strand when the energy is nearby the highest occupied molecular orbital level and larger than the native strand by 5 times in the bandgap. The trend in transmission also holds in the presence of the decoherence with the same rate. The lower conductance for the methylated strand in the experiment is suggested to be caused by the more stable structure due to the introduction of the methyl groups. We also study the role of the exchange-correlation functional and the effect of contact coupling by choosing coupling strengths ranging from weak to strong coupling limit.

  5. Optically induced charge transport in mesoscopic semiconductor systems; Optisch induzierter Ladungstransport in mesoskopischen Halbleitersystemen

    Energy Technology Data Exchange (ETDEWEB)

    Hof, Klaus-Dieter


    In the framework of this thesis optoelectronic processes in a to a quantum-dot contact nanostructured heterostructure were studied. In the experiment thereby by means of a laser in a 2DES heterostructure charge carriers were optically induced in the neighbourhood of a quantum-dot contact. Thereafter their effect on the electronic transport through the quantum-dot contact in the sample is studied. In the planely etched samples the purely electronic conductivity measurements indicate with the conductivity stages a one-dimensional subband quantization. The energetic distance of the subband bottoms amounts up to 5 meV. Furthermore the measurement in the magnetic field shows a transition of the subband structure over magnetoelectric bands to the pure Landau quantization. First photoresponse measurement s show under illumination the effect of an unwanted parallel conductivity. This effect can be suppressed by changed sample design and optimized wafer material. By this photoresponse measurements on the free-sttanding bridge samples and planely etched qunatum-dot contact samples. In low-frequency photoresponse measurements in both sample types the effect of an optically induced conductivity change can be identified. A simple model of the optically induced photoconductivity is introduced, which shows in the framework of a numerical simulation a very good agreement with the measurement data and allows the identification of the experimentally determined time constant. By application of for radiofrequencies suited components the experiment can be performed also at higher-frequent modulation of the optical excitation. Thereby it was proved that the effect of the photoinduced conductivity change because of its relatively high time constant generates for excitations in the MHz range a quasi-static conductivity state and the sample conductivity experiences therefore on a fast time scale no change.

  6. Multiphasic modeling of charged solute transport across articular cartilage: Application of multi-zone finite-bath model. (United States)

    Arbabi, Vahid; Pouran, Behdad; Weinans, Harrie; Zadpoor, Amir A


    Charged and uncharged solutes penetrate through cartilage to maintain the metabolic function of chondrocytes and to possibly restore or further breakdown the cartilage tissue in different stages of osteoarthritis. In this study the transport of charged solutes across the various zones of cartilage was quantified, taken into account the physicochemical interactions between the solute and the cartilage constituents. A multiphasic finite-bath finite element (FE) model was developed to simulate equine cartilage diffusion experiments that used a negatively charged contrast agent (ioxaglate) in combination with serial micro-computed tomography (micro-CT) to measure the diffusion. By comparing the FE model with the experimental data both the diffusion coefficient of ioxaglate and the fixed charge density (FCD) were obtained. In the multiphasic model, cartilage was divided into multiple (three) zones to help understand how diffusion coefficient and FCD vary across cartilage thickness. The direct effects of charged solute-FCD interaction on diffusion were investigated by comparing the diffusion coefficients derived from the multiphasic and biphasic-solute models. We found a relationship between the FCD obtained by the multiphasic model and ioxaglate partitioning obtained from micro-CT experiments. Using our multi-zone multiphasic model, diffusion coefficient of the superficial zone was up to ten-fold higher than that of the middle zone, while the FCD of the middle zone was up to almost two-fold higher than that of the superficial zone. In conclusion, the developed finite-bath multiphasic model provides us with a non-destructive method by which we could obtain both diffusion coefficient and FCD of different cartilage zones. The outcomes of the current work will also help understand how charge of the bath affects the diffusion of a charged molecule and also predict the diffusion behavior of a charged solute across articular cartilage. Copyright © 2016 Elsevier Ltd. All

  7. Understanding and removing surface states limiting charge transport in TiO2 nanowire arrays for enhanced optoelectronic device performance. (United States)

    Sheng, Xia; Chen, Liping; Xu, Tao; Zhu, Kai; Feng, Xinjian


    Charge transport within electrode materials plays a key role in determining the optoelectronic device performance. Aligned single-crystal TiO 2 nanowire arrays offer an ideal electron transport path and are expected to have higher electron mobility. Unfortunately, their transport is found not to be superior to that in nanoparticle films. Here we show that the low electron transport in rutile TiO 2 nanowires is mainly caused by surface traps in relatively deep energy levels, which cannot be removed by conventional approaches, such as oxygen annealing treatment. Moreover, we demonstrate an effective wet-chemistry approach to minimize these trap states, leading to over 20-fold enhancement in electron diffusion coefficient and 62% improvement in solar cell performance. On the basis of our results, the potential of TiO 2 NWs can be developed and well-utilized, which is significantly important for their practical applications.

  8. Organic Light-Emitting Diodes Using Multifunctional Phosphorescent Dendrimers with Iridium-Complex Core and Charge-Transporting Dendrons (United States)

    Tsuzuki, Toshimitsu; Shirasawa, Nobuhiko; Suzuki, Toshiyasu; Tokito, Shizuo


    We report a novel class of light-emitting materials for use in organic light-emitting diodes (OLEDs): multifunctional phosphorescent dendrimers that have a phosphorescent core and dendrons based on charge-transporting building blocks. We synthesized first-generation and second-generation dendrimers consisting of a fac-tris(2-phenylpyridine)iridium [Ir(ppy)3] core and hole-transporting phenylcarbazole-based dendrons. Smooth amorphous films of these dendrimers were formed by spin-coating them from solutions. The OLEDs using the dendrimer exhibited bright green or yellowish-green emission from the Ir(ppy)3 core. The OLEDs using the film containing a mixture of the dendrimer and an electron-transporting material exhibited higher efficiency than those using the neat dendrimer film. The external quantum efficiency of OLEDs using the film containing a mixture of the first-generation dendrimer and an electron-transporting material was as high as 7.6%.

  9. Mechanism of charge transport in ligand-capped crystalline CdTe nanoparticles according to surface photovoltaic and photoacoustic results

    Energy Technology Data Exchange (ETDEWEB)

    Li Kuiying, E-mail: [National Laboratory of Metastable Materials Manufacture Technology and Science, Yanshan University, Hebei Str. 438, Qinhuangdao, Hebei Province 066004 (China); Zhang Hao [Key Laboratory for Supramolecular Structure and Materials, College of Chemistry, Jilin University, Changchun 130012 (China); Yang Weiyong; Wei Sailing [National Laboratory of Metastable Materials Manufacture Technology and Science, Yanshan University, Hebei Str. 438, Qinhuangdao, Hebei Province 066004 (China); Wang Dayang, E-mail: [Max Planck Institute of Colloids and Interfaces, Potsdam 14424 (Germany)


    By combining surface photovoltaic and photoacoustic techniques, we probed the photogenerated charge transport channels of 3-mercaptopropionic acid (MPA)- and 2-mercaptoethylamine (MA)-capped crystalline CdTe nanoparticles on illumination with UV-near IR light. The results experimentally confirmed the presence of a CdS shell outside the CdTe core that formed through the self-assembly and decomposition of mercapto ligands during CdTe preparation. The data revealed that the CdS layer was partly responsible for the deexcitation behavior of the photogenerated carriers, which is related to the quantum tunnel effect. Experiments demonstrated that two quantum wells were located at wavelengths of 440 and 500 nm in buried interfacial space-charge regions, whereas the formation of a ligand layer obstructed charge transfer transitions of the core CdTe nanoparticles to a certain extent.

  10. Charge transport in organic molecular semiconductors from first principles: The bandlike hole mobility in a naphthalene crystal (United States)

    Lee, Nien-En; Zhou, Jin-Jian; Agapito, Luis A.; Bernardi, Marco


    Predicting charge transport in organic molecular crystals is notoriously challenging. Carrier mobility calculations in organic semiconductors are dominated by quantum chemistry methods based on charge hopping, which are laborious and only moderately accurate. We compute from first principles the electron-phonon scattering and the phonon-limited hole mobility of naphthalene crystal in the framework of ab initio band theory. Our calculations combine GW electronic bandstructures, ab initio electron-phonon scattering, and the Boltzmann transport equation. The calculated hole mobility is in very good agreement with experiment between 100 -300 K , and we can predict its temperature dependence with high accuracy. We show that scattering between intermolecular phonons and holes regulates the mobility, though intramolecular phonons possess the strongest coupling with holes. We revisit the common belief that only rigid molecular motions affect carrier dynamics in organic molecular crystals. Our paper provides a quantitative and rigorous framework to compute charge transport in organic crystals and is a first step toward reconciling band theory and carrier hopping computational methods.

  11. Effect of Structure and Disorder on the Charge Transport in Defined Self-Assembled Monolayers of Organic Semiconductors. (United States)

    Schmaltz, Thomas; Gothe, Bastian; Krause, Andreas; Leitherer, Susanne; Steinrück, Hans-Georg; Thoss, Michael; Clark, Timothy; Halik, Marcus


    Self-assembled monolayer field-effect transistors (SAMFETs) are not only a promising type of organic electronic device but also allow detailed analyses of structure-property correlations. The influence of the morphology on the charge transport is particularly pronounced, due to the confined monolayer of 2D-π-stacked organic semiconductor molecules. The morphology, in turn, is governed by relatively weak van-der-Waals interactions and is thus prone to dynamic structural fluctuations. Accordingly, combining electronic and physical characterization and time-averaged X-ray analyses with the dynamic information available at atomic resolution from simulations allows us to characterize self-assembled monolayer (SAM) based devices in great detail. For this purpose, we have constructed transistors based on SAMs of two molecules that consist of the organic p-type semiconductor benzothieno[3,2-b][1]benzothiophene (BTBT), linked to a C 11 or C 12 alkylphosphonic acid. Both molecules form ordered SAMs; however, our experiments show that the size of the crystalline domains and the charge-transport properties vary considerably in the two systems. These findings were confirmed by molecular dynamics (MD) simulations and semiempirical molecular-orbital electronic-structure calculations, performed on snapshots from the MD simulations at different times, revealing, in atomistic detail, how the charge transport in organic semiconductors is influenced and limited by dynamic disorder.

  12. Influence of orientation mismatch on charge transport across grain boundaries in tri-isopropylsilylethynyl (TIPS) pentacene thin films. (United States)

    Steiner, Florian; Poelking, Carl; Niedzialek, Dorota; Andrienko, Denis; Nelson, Jenny


    We present a multi-scale model for charge transport across grain boundaries in molecular electronic materials that incorporates packing disorder, electrostatic and polarisation effects. We choose quasi two-dimensional films of tri-isopropylsilylethynyl pentacene (TIPS-P) as a model system representative of technologically relevant crystalline organic semiconductors. We use atomistic molecular dynamics, with a force-field specific for TIPS-P, to generate and equilibrate polycrystalline two-dimensional thin films. The energy landscape is obtained by calculating contributions from electrostatic interactions and polarization. The variation in these contributions leads to energetic barriers between grains. Subsequently, charge transport is simulated using a kinetic Monte-Carlo algorithm. Two-grain systems with varied mutual orientation are studied. We find relatively little effect of long grain boundaries due to the presence of low impedance pathways. However, effects could be more pronounced for systems with limited inter-grain contact areas. Furthermore, we present a lattice model to generalize the model for small molecular systems. In the general case, depending on molecular architecture and packing, grain boundaries can result in interfacial energy barriers, traps or a combination of both with qualitatively different effects on charge transport.

  13. Transport and Deposition of Variably Charged Soil Colloids in Saturated Porous Media

    DEFF Research Database (Denmark)

    Sharma, Anu; Kawamoto, Ken; Møldrup, Per


    Okinawa (RYS colloids) in Japan. The VAS colloids exhibited a negative surface charge with a high pH dependency, whereas the RYS colloids exhibited a negative surface charge with less pH dependency. The soil colloids were applied as colloidal suspensions to 10-cm-long saturated sand columns packed...

  14. Environmental Effects of a Kilometre Charge in Road Transport: an Investigation for the Netherlands

    NARCIS (Netherlands)

    Ubbels, B.J.; Rietveld, P.; Peeters, P.


    This study discusses the potential environmental effects of a kilometre charge for car traffic in the Netherlands. This kilometre charge would replace the existing taxes on new cars and on car ownership. It would lead to a substantial increase in the variable costs of car use. It may lead to a

  15. Charge transport in polycrystalline alumina materials: application to the optimization of dielectric breakdown strength; Transport de charges dans les alumines polycristallines: application a l'optimisation de la rigidite dielectrique

    Energy Technology Data Exchange (ETDEWEB)

    Touzin, M.


    Dielectric breakdown constitutes an important limitation in the use of insulating materials under high-tension since it leads to the local fusion and the sublimation of material. The microstructure (average grain size, intergranular phase) has a great influence on the ability of material to resist this catastrophic phenomenon. Indeed, the interfaces between the various phases constitute potential sites of trapping for the charges. The optimization of the dielectric breakdown strength of a polycrystalline alumina sintered with a liquid phase passes necessarily through the control of the microstructural parameters. Thus, it is shown that by controlling the conditions of the process (rate of sintering aids, powder grain size and thermal cycle), it is possible to control the density (by the average grain size) but also the nature (by the crystallization or not of anorthite) of the grain boundaries. The study of the influence of these two parameters as well temperature on the properties of charge transport and storage was carried out by methods ICM and SEMME. The results, interpreted in light of the numerical simulation of the charge transport in bulk alumina sample during electron beam irradiation, allowed to highlight behaviors, and the corresponding microstructures, favourable to the dielectric breakdown resistance according to the considered temperature. Thus, at room temperature a high density of interfaces (low grain size and crystallized intergranular phase) makes it possible material to durably trap a great amount of charges, which leads to a high dielectric strength. On the other hand, at higher temperature, the presence of shallow traps (vitreous intergranular phase) supports the charge diffusion and makes it possible to delay breakdown. (author)

  16. The effect of hole transporting layer in charge accumulation properties of p-i-n perovskite solar cells

    Directory of Open Access Journals (Sweden)

    Fedros Galatopoulos


    Full Text Available The charge accumulation properties of p-i-n perovskite solar cells were investigated using three representative organic and inorganic hole transporting layer (HTL: (a Poly(3,4-ethylenedioxythiophene-poly(styrenesulfonate (PEDOT:PSS, Al 4083, (b copper-doped nickel oxide (Cu:NiOx, and (c Copper oxide (CuO. Through impedance spectroscopy analysis and modelling, it is shown that charge accumulation is decreased in the HTL/perovskite interface, between PEDOT:PSS to Cu:NiOx and CuO. This was indicative from the decrease in double layer capacitance (Cdl and interfacial charge accumulation capacitance (Cel, resulting in an increase to recombination resistance (Rrec, thus decreased charge recombination events between the three HTLs. Through AFM measurements, it is also shown that the reduced recombination events (followed by the increase in Rrec are also a result of increased grain size between the three HTLs, thus reduction in the grain boundary area. These charge accumulation properties of the three HTLs have resulted in an increase to the power conversion efficiency between the PEDOT:PSS (8.44%, Cu:NiOx (11.45%, and CuO (15.3%-based devices.

  17. Surface potential, charging and local current transport of individual Ge quantum dots grown by molecular beam epitaxy

    Energy Technology Data Exchange (ETDEWEB)

    Singha, R.K. [Department of Physics, Visva-Bharati, Santiniketan 731235 (India); Manna, S.; Bar, R.; Das, S. [Department of Physics, Indian Institute of Technology-Kharagpur, Kharagpur 721302 (India); Ray, S.K., E-mail: [Department of Physics, Indian Institute of Technology-Kharagpur, Kharagpur 721302 (India)


    Highlights: We have elaborately explained the individual Ge QD charging phenomena and current transport, which is very important to understand the Ge/Si nano devices. This paper will give a flavor to properly understand these phenomena linked together along with the photocurrent mechanism which is related to the Ge/Si valence band offset. • Both the CAFM and KPFM techniques point out the functionality of doping nature of the underneath Si substrate on the aforementioned characteristics of Ge QDs. • Analysis of the surface potential mapping using KPFM technique yields an approximate valence band offset measurement which is required to understand the intra-valence transition of holes for the realization of long wavelength infrared photodetector. • KPFM and CAFM can be utilized to explore the charging/discharging phenomena of dots and their composition variations. • Current-voltage (I–V) characteristics of the individual Ge QD strongly depends on the individual QD size. • Energy band diagrams for diamond tip and Ge QD shows the higher barrier for electrons and lower barrier for holes allowing the easy tunneling for holes to dominate the transport. - Abstract: It is fundamentally important to understand the nanoscale electronic properties of a single quantum dot (QD) contrary to an ensemble of QDs. Kelvin probe force microscopy (KPFM) and conductive atomic force microscopy (CAFM) are two important tools, which could be employed to probe surface potential, charging phenomena, and current transport mechanism of individual QD. We demonstrate the aforementioned characteristics of self-assembled Ge QDs, which was grown on Si substrates by solid source molecular beam epitaxy driven by the Stranski-Krastanov method. Study reveals that each Ge QD acts as charge storage node even at zero applied bias. The shape, size and density of QDs could be well probed by CAFM and KPFM, whereas QD facets could be better resolved by the conductive tip. The CAFM investigation

  18. A molecular dynamics study on the transport of a charged biomolecule in a polymeric adsorbent medium and its adsorption onto a charged ligand. (United States)

    Riccardi, E; Wang, J-C; Liapis, A I


    The transport of a charged adsorbate biomolecule in a porous polymeric adsorbent medium and its adsorption onto the covalently immobilized ligands have been modeled and investigated using molecular dynamics modeling and simulations as the third part of a novel fundamental methodology developed for studying ion-exchange chromatography based bioseparations. To overcome computational challenges, a novel simulation approach is devised where appropriate atomistic and coarse grain models are employed simultaneously and the transport of the adsorbate is characterized through a number of locations representative of the progress of the transport process. The adsorbate biomolecule for the system studied in this work changes shape, orientation, and lateral position in order to proceed toward the site where adsorption occurs and exhibits decreased mass transport coefficients as it approaches closer to the immobilized ligand. Furthermore, because the ligands are surrounded by counterions carrying the same type of charge as the adsorbate biomolecule, it takes the biomolecule repeated attempts to approach toward a ligand in order to displace the counterions in the proximity of the ligand and to finally become adsorbed. The formed adsorbate-ligand complex interacts with the counterions and polymeric molecules and is found to evolve slowly and continuously from one-site (monovalent) interaction to multisite (multivalent) interactions. Such a transition of the nature of adsorption reduces the overall adsorption capacity of the ligands in the adsorbent medium and results in a type of surface exclusion effect. Also, the adsorption of the biomolecule also presents certain volume exclusion effects by not only directly reducing the pore volume and the availability of the ligands in the adjacent regions, but also causing the polymeric molecules to change to more compact structures that could further shield certain ligands from being accessible to subsequent adsorbate molecules. These

  19. Charge and spin transport in edge channels of a ν=0 quantum Hall system on the surface of topological insulators. (United States)

    Morimoto, Takahiro; Furusaki, Akira; Nagaosa, Naoto


    Three-dimensional topological insulators of finite thickness can show the quantum Hall effect (QHE) at the filling factor ν=0 under an external magnetic field if there is a finite potential difference between the top and bottom surfaces. We calculate energy spectra of surface Weyl fermions in the ν=0 QHE and find that gapped edge states with helical spin structure are formed from Weyl fermions on the side surfaces under certain conditions. These edge channels account for the nonlocal charge transport in the ν=0 QHE which is observed in a recent experiment on (Bi_{1-x}Sb_{x})_{2}Te_{3} films. The edge channels also support spin transport due to the spin-momentum locking. We propose an experimental setup to observe various spintronics functions such as spin transport and spin conversion.

  20. Integrated planning of electric vehicles routing and charging stations location considering transportation networks and power distribution systems

    Directory of Open Access Journals (Sweden)

    Andrés Arias


    Full Text Available Electric Vehicles (EVs represent a significant option that contributes to improve the mobility and reduce the pollution, leaving a future expectation in the merchandise transportation sector, which has been demonstrated with pilot projects of companies operating EVs for products delivering. In this work a new approach of EVs for merchandise transportation considering the location of Electric Vehicle Charging Stations (EVCSs and the impact on the Power Distribution System (PDS is addressed. This integrated planning is formulated through a mixed integer non-linear mathematical model. Test systems of different sizes are designed to evaluate the model performance, considering the transportation network and PDS. The results show a trade-off between EVs routing, PDS energy losses and EVCSs location.

  1. Correlation of Disorder and Charge Transport in a Range of Indacenodithiophene-Based Semiconducting Polymers

    KAUST Repository

    Nikolka, Mark; Hurhangee, Michael; Sadhanala, Aditya; Chen, Hu; McCulloch, Iain; Sirringhaus, Henning


    uniformity paired with high charge carrier mobilities, conjugated polymers have attracted increasing attention in this respect. However, the performances delivered by current generation conjugated polymers still fall short of many industrial requirements

  2. Moment-Preserving Computational Approach for High Energy Charged Particle Transport (United States)


    posed, but with modified cross sections such that the resulting single-event Monte Carlo simulation is computationally efficient (minutes vs . days...configurations, which are all characteristics of real world applications. In other words , it is possible to simulate real, physical phenomena using charged...0 < 0.95) ~ 1 2() ≫ 1, (3) Demonstrating that scattering is highly forward peaked. Thus, the picture of charged particle interactions

  3. Varying the charge of small cations in liquid water: Structural, transport, and thermodynamical properties (United States)

    Martelli, Fausto; Vuilleumier, Rodolphe; Simonin, Jean-Pierre; Spezia, Riccardo


    In this work, we show how increasing the charge of small cations affects the structural, thermodynamical, and dynamical properties of these ions in liquid water. We have studied the case of lanthanoid and actinoid ions, for which we have recently developed accurate polarizable force fields, and the ionic radius is in the 0.995-1.250 Å range, and explored the valency range from 0 to 4+. We found that the ion charge strongly structures the neighboring water molecules and that, in this range of charges, the hydration enthalpies exhibit a quadratic dependence with respect to the charge, in line with the Born model. The diffusion process follows two main regimes: a hydrodynamical regime for neutral or low charges, and a dielectric friction regime for high charges in which the contraction of the ionic radius along the series of elements causes a decrease of the diffusion coefficient. This latter behavior can be qualitatively described by theoretical models, such as the Zwanzig and the solvated ion models. However, these models need be modified in order to obtain agreement with the observed behavior in the full charge range. We have thus modified the solvated ion model by introducing a dependence of the bare ion radius as a function of the ionic charge. Besides agreement between theory and simulation this modification allows one to obtain an empirical unified model. Thus, by analyzing the contributions to the drag coefficient from the viscous and the dielectric terms, we are able to explain the transition from a regime in which the effect of viscosity dominates to one in which dielectric friction governs the motion of ions with radii of ca. 1 Å.

  4. Charge carrier transport and collection enhancement of copper indium diselenide photoactive nanoparticle-ink by laser crystallization

    Energy Technology Data Exchange (ETDEWEB)

    Nian, Qiong; Cheng, Gary J., E-mail: [Birck Nanotechnology Center, Purdue University, West Lafayette, Indiana 47906 (United States); School of Industrial Engineering, Purdue University, West Lafayette, Indiana 47906 (United States); Zhang, Martin Y. [School of Industrial Engineering, Purdue University, West Lafayette, Indiana 47906 (United States); Wang, Yuefeng [Birck Nanotechnology Center, Purdue University, West Lafayette, Indiana 47906 (United States); School of Materials Engineering, Purdue University, West Lafayette, Indiana 47906 (United States); Das, Suprem R.; Bhat, Venkataprasad S. [Birck Nanotechnology Center, Purdue University, West Lafayette, Indiana 47906 (United States); Huang, Fuqiang [Shanghai Institute of Ceramics, Chinese Academy of Science, Shanghai 200050 (China)


    There has been increasing needs for cost-effective and high performance thin film deposition techniques for photovoltaics. Among all deposition techniques, roll-to-roll printing of nanomaterials has been a promising method. However, the printed thin film contains many internal imperfections, which reduce the charge-collection performance. Here, direct pulse laser crystallization (DPLC) of photoactive nanoparticles-inks is studied to meet this challenge. In this study, copper indium selenite (CIS) nanoparticle-inks is applied as an example. Enhanced crystallinity, densified structure in the thin film is resulted after DLPC under optimal conditions. It is found that the decreased film internal imperfections after DPLC results in reducing scattering and multi-trapping effects. Both of them contribute to better charge-collection performance of CIS absorber material by increasing extended state mobility and carrier lifetime, when carrier transport and kinetics are coupled. Charge carrier transport was characterized after DPLC, showing mobility increased by 2 orders of magnitude. Photocurrent under AM1.5 illumination was measured and shown 10 times enhancement of integrated power density after DPLC, which may lead to higher efficiency in photo-electric energy conversion.

  5. 3-D pore-scale resolved model for coupled species/charge/fluid transport in a vanadium redox flow battery

    International Nuclear Information System (INIS)

    Qiu Gang; Joshi, Abhijit S.; Dennison, C.R.; Knehr, K.W.; Kumbur, E.C.; Sun Ying


    The vanadium redox flow battery (VRFB) has emerged as a viable grid-scale energy storage technology that offers cost-effective energy storage solutions for renewable energy applications. In this paper, a novel methodology is introduced for modeling of the transport mechanisms of electrolyte flow, species and charge in the VRFB at the pore scale of the electrodes; that is, at the level where individual carbon fiber geometry and electrolyte flow are directly resolved. The detailed geometry of the electrode is obtained using X-ray computed tomography (XCT) and calibrated against experimentally determined pore-scale characteristics (e.g., pore and fiber diameter, porosity, and surface area). The processed XCT data is then used as geometry input for modeling of the electrochemical processes in the VRFB. The flow of electrolyte through the pore space is modeled using the lattice Boltzmann method (LBM) while the finite volume method (FVM) is used to solve the coupled species and charge transport and predict the performance of the VRFB under various conditions. An electrochemical model using the Butler–Volmer equations is used to provide species and charge coupling at the surfaces of the carbon fibers. Results are obtained for the cell potential distribution, as well as local concentration, overpotential and current density profiles under galvanostatic discharge conditions. The cell performance is investigated as a function of the electrolyte flow rate and external drawing current. The model developed here provides a useful tool for building the structure–property–performance relationship of VRFB electrodes.

  6. Transporte de carga em compósitos de polianilina/V2O5 Charge transportation in polyaniline/V2O5 composites

    Directory of Open Access Journals (Sweden)

    Fritz Huguenin


    Full Text Available In this work, composites formed from a mixture of V2O5 and polyaniline (PANI were investigated, for applications as cathode materials for secondary lithium batteries. Electrochemical quartz crystal microbalance (EQCM data show that charge compensation in the [PANI]0.3V2O5 nanocomposite is achieved predominantly by Li+ migration. However, the charge compensation in the [PANI]V2O5 microcomposite occurs by Li+ and ClO4- transport. Electrochemical Impedance Spectroscopy (EIS measurements reveal several benefits of nanohybrid formation, including the achievement of shorter ionic diffusion pathways, the higher diffusion rate of the lithium ion and also the higher electronic conductivity, which are responsible for a synergetic effect of the energy storage properties.

  7. Charge transport of graphene ferromagnetic-insulator-superconductor junction with pairing state of broken time reversal symmetry

    Directory of Open Access Journals (Sweden)

    Yaser Hajati


    Full Text Available We investigate the charge transport through a graphene-based ferromagnetic-insulator-superconductor junction with a broken time reversal symmetry (BTRS of dx2−y2 + is and dx2−y2 + idxy superconductor using the extended Blonder-Tinkham-Klapwijk formalism. Our analysis have shown several charateristics in this junction, providing a useful probe to understand the role of the order parameter symmetry in the superconductivity. We find that the presence of the BTRS (X state in the superconductor region has a strong effect on the tunneling conductance curves which leads to a decrease in the height of the zero-bias conductance peak (ZBCP. In particular, we show that the magnitude of the superconducting proximity effect depends to a great extent on X and by increasing X, the zero-bias charge conductance oscillations with respect to the rotation angle β are suppressed. In addition, we find that at the maximum rotation angle β = π/4, introducing BTRS in the FIS junction causes oscillatory behavior of the zero-bias charge conductance with the barrier strength (χG by a period of π and by approaching the X to 1, the amplitude of charge conductance oscillations increases. This behavior is drastically different from none BTRS similar graphene junctions. At last, we suggest an experimental setup for verifying our predicted effects.

  8. Experimental evidence of high pressure decoupling between charge transport and structural dynamics in a protic ionic glass-former. (United States)

    Wojnarowska, Z; Rams-Baron, M; Knapik-Kowalczuk, J; Połatyńska, A; Pochylski, M; Gapinski, J; Patkowski, A; Wlodarczyk, P; Paluch, M


    In this paper the relaxation dynamics of ionic glass-former acebutolol hydrochloride (ACB-HCl) is studied as a function of temperature and pressure by using dynamic light scattering and broadband dielectric spectroscopy. These unique experimental data provide the first direct evidence that the decoupling between the charge transport and structural relaxation exists in proton conductors over a wide T-P thermodynamic space, with the time scale of structural relaxation being constant at the liquid-glass transition (τ α  = 1000 s). We demonstrate that the enhanced proton transport, being a combination of intermolecular H + hopping between cation and anion as well as tautomerization process within amide moiety of ACB molecule, results in a breakdown of the Stokes-Einstein relation at ambient and elevated pressure with the fractional exponent k being pressure dependent. The dT g /dP coefficient, stretching exponent β KWW and dynamic modulus E a /ΔV # were found to be the same regardless of the relaxation processes studied. This is in contrast to the apparent activation volume parameter that is different when charge transport and structural dynamics are considered. These experimental results together with theoretical considerations create new ideas to design efficient proton conductors for potential electrochemical applications.

  9. Entanglements in Marginal Solutions: A Means of Tuning Pre-Aggregation of Conjugated Polymers with Positive Implications for Charge Transport

    KAUST Repository

    Hu, Hanlin


    The solution-processing of conjugated polymers, just like commodity polymers, is subject to solvent and molecular weight-dependent solubility, interactions and chain entanglements within the polymer, all of which can influence the crystallization and microstructure development in semi-crystalline polymers and consequently affect charge transport and optoelectronic properties. Disentanglement of polymer chains in marginal solvents was reported to work via ultrasonication, facilitating the formation of photophysically ordered polymer aggregates. In this contribution, we explore how a wide range of technologically relevant solvents and formulations commonly used in organic electronics influence chain entanglement and the aggregation behaviour of P3HT using a combination of rheological and spectrophotometric measurements. The specific viscosity of the solution offers an excellent indication of the degree of entanglements in the solution, which is found to be related to the solubility of P3HT in a given solvent. Moreover, deliberately disentangling the solution in the presence of solvophobic driving forces, leads consistently to formation of photophysically visible aggregates which is indicative of local and perhaps long range order in the solute. We show for a broad range of solvents and molecular weights that disentanglement ultimately leads to significant ordering of the polymer in the solid state and a commensurate increase in charge transport properties. In doing so we demonstrate a remarkable ability to tune the microstructure which has important implications for transport properties. We discuss its potential implications in the context of organic photovoltaics.

  10. Entanglements in Marginal Solutions: A Means of Tuning Pre-Aggregation of Conjugated Polymers with Positive Implications for Charge Transport

    KAUST Repository

    Hu, Hanlin; Zhao, Kui; Fernandes, Nikhil J.; Boufflet, Pierre; Bannock, James Henry; Yu, Liyang; de Mello, John C; Stingelin, Natalie; Heeney, Martin; Giannelis, Emmanuel P.; Amassian, Aram


    The solution-processing of conjugated polymers, just like commodity polymers, is subject to solvent and molecular weight-dependent solubility, interactions and chain entanglements within the polymer, all of which can influence the crystallization and microstructure development in semi-crystalline polymers and consequently affect charge transport and optoelectronic properties. Disentanglement of polymer chains in marginal solvents was reported to work via ultrasonication, facilitating the formation of photophysically ordered polymer aggregates. In this contribution, we explore how a wide range of technologically relevant solvents and formulations commonly used in organic electronics influence chain entanglement and the aggregation behaviour of P3HT using a combination of rheological and spectrophotometric measurements. The specific viscosity of the solution offers an excellent indication of the degree of entanglements in the solution, which is found to be related to the solubility of P3HT in a given solvent. Moreover, deliberately disentangling the solution in the presence of solvophobic driving forces, leads consistently to formation of photophysically visible aggregates which is indicative of local and perhaps long range order in the solute. We show for a broad range of solvents and molecular weights that disentanglement ultimately leads to significant ordering of the polymer in the solid state and a commensurate increase in charge transport properties. In doing so we demonstrate a remarkable ability to tune the microstructure which has important implications for transport properties. We discuss its potential implications in the context of organic photovoltaics.

  11. General view of Lie algebrical methods in applied mathematics optics and transport systems for charged beam accelerators

    Energy Technology Data Exchange (ETDEWEB)

    Dattoli, G.; Torre, A.


    The theory of partial and ordinary differential equations is reformulated within the context of a unifying formalism, which combines the algebric ordering procedure with the matrix image technique. The problems of the invariant forms, associated with ordinary differential equations, is approached within the framework of the same formalism, thus dispalying interesting relations with the Courant-Snyder invariant, introduced in the analysis of the motion of a charged particle along a transport channel, and with the Lewis-Riesenfeld invariant, introduced in the analysis of the evolution of a quantum harmonic oscillator with time-dependent frequency. Particular attention is devoted to the paraxial propagation of an electromagnetic wave through a non homogeneous medium and to the paraxial motion of a charged particle beam in a circular accelerator.

  12. Electrical bistability and charge-transport mechanisms in cuprous sulfide nanosphere-poly(N-vinylcarbazole) composite films

    International Nuclear Information System (INIS)

    Tang Aiwei; Teng Feng; Liu Jie; Wang Yichao; Peng Hongshang; Hou Yanbing; Wang Yongsheng


    In this study, electrically bistable devices were fabricated by incorporating cuprous sulfide (Cu 2 S) nanospheres with mean size less than 10 nm into a poly(N-vinylcarbazole) (PVK) matrix. A remarkable electrical bistability was clearly observed in the current–voltage curves of the devices due to an electric-field-induced charge transfer between the dodecanethiol-capped Cu 2 S nanospheres and PVK. The maximum ON/OFF current ratio reached up to value as large as 10 4 , which was dependent on the mass ratios of Cu 2 S nanospheres to PVK, the amplitude of the scanning voltages, and the film thickness. The charge-transport mechanisms of the electrically bistable devices were described on the basis of the experimental results using different theoretical models of organic electronics.

  13. Charge and Spin Transport in Graphene Heterostructures and Cr2Ge2Te6 (United States)

    Lin, Zhisheng

    This dissertation summarizes my past work on hydrogenation of graphene, development of Al2O3 tunnel barrier, pressure effects on Cr2Ge 2Te6 (CGT), and proximity effects in graphene/WSe2 heterostructures. There are three main parts. The first part is the study of hydrogenation of graphene and the development of atomically smooth Al2O3 tunnel barrier. Graphene device is coated with hydrogen silsesquioxane (HSQ) resist and exposed with electron beam. Graphene is hydrogenated by forming the covalently bonds to the hydrogen atoms and transforms from sp2 to sp3 bonds. By breaking the inversion symmetry perpendicular to the graphene plane, Rashba spin orbit coupling (SOC) is enhanced. We characterized the hydrogenation effects by performing Raman spectroscopy measurements. A clear D and D' peak grow abruptly with small hydrogenation dosage and keep growing with higher dosage, indicating the increased defects density in graphene. Electrical transport properties are characterized by measuring the gate voltage dependence at different hydrogenation percentages: mobility decreases and graphene becomes more electron-doped upon hydrogenation. The hydrogenation process is reversible, which means the hydrogenation effects are almost gone after annealing. Nonlocal resistivity is 1 to 3 orders of magnitude larger than that of the pristine graphene, which cannot be accounted for by the ohmic contribution assuming uniform graphene channel. The problems of nonlocal measurement method are discussed. The rest of first part is focused on developing the atomically smooth Al2O3 tunnel barrier by sputtering a thin layer of aluminum first and oxidizing it in O 2 atmosphere. The second part is about the pressure effects on the magnetic anisotropy of CGT. Magnetoresistance of CGT bulk crystal is measured under applied hydrostatic pressures up to 2 GPa. Upon the application of hydrostatic pressure, we observe an induced transition of easy axis from c axis to the ab plane of the crystal

  14. Effect of five-membered ring and heteroatom substitution on charge transport properties of perylene discotic derivatives: A theoretical approach

    Energy Technology Data Exchange (ETDEWEB)

    Navarro, Amparo, E-mail:; Fernández-Liencres, M. Paz; Peña-Ruiz, Tomás; Granadino-Roldán, José M.; Fernández-Gómez, Manuel [Departamento de Química Física y Analítica, Universidad de Jaén, Campus Las Lagunillas, E23071 Jaén (Spain); García, Gregorio [Instituto de Energía Solar and Departamento TFB, E.T.S.I. Telecomunicación, Universidad Politécnica de Madrid, Ciudad Universitaria, Madrid 28040 (Spain)


    Density functional theory calculations were carried out to investigate the evolvement of charge transport properties of a set of new discotic systems as a function of ring and heteroatom (B, Si, S, and Se) substitution on the basic structure of perylene. The replacement of six-membered rings by five-membered rings in the reference compound has shown a prominent effect on the electron reorganization energy that decreases ∼0.2 eV from perylene to the new carbon five-membered ring derivative. Heteroatom substitution with boron also revealed to lower the LUMO energy level and increase the electron affinity, therefore lowering the electron injection barrier compared to perylene. Since the rate of the charge transfer between two molecules in columnar discotic systems is strongly dependent on the orientation of the stacked cores, the total energy and transfer integral of a dimer as a disc is rotated with respect to the other along the stacking axis have been predicted. Aimed at obtaining a more realistic approach to the bulk structure, the molecular geometry of clusters made up of five discs was fully optimized, and charge transfer rate and mobilities were estimated for charge transport along a one dimensional pathway. Heteroatom substitution with selenium yields electron transfer integral values ∼0.3 eV with a relative disc orientation of 25°, which is the preferred angle according to the dimer energy profile. All the results indicate that the tetraselenium-substituted derivative, not synthetized so far, could be a promising candidate among those studied in this work for the fabrication of n-type semiconductors based on columnar discotic liquid crystals materials.

  15. Transport charge of gallium arsenide films synthesized on polycrystalline silicon by ion ablation

    International Nuclear Information System (INIS)

    Kabyshev, A V; Konusov, F V; Remnev, G E; Pavlov, S K


    Electrophysical and photoelectric properties of thin GaAs films deposited on polysilicon by pulse ion ablation using high-power ion beams have been investigated. The predominant charge carriers transfer mechanism in films and the type of dark and photoconductivity have been established. A vacuum annealing effect (10 −2 Pa, 300-1000 K) on energetic and kinetic characteristics of dark and photoconductivity, the transfer mechanism and the type of charge carriers have been determined. The most probable causes of changes in the film electric and photoelectric characteristics have been discussed

  16. A stochastic model of multiple scattering of charged particles: process, transport equation and solutions

    International Nuclear Information System (INIS)

    Papiez, L.; Moskvin, V.; Tulovsky, V.


    The process of angular-spatial evolution of multiple scattering of charged particles can be described by a special case of Boltzmann integro-differential equation called Lewis equation. The underlying stochastic process for this evolution is the compound Poisson process on the surface of the unit sphere. The significant portion of events that constitute compound Poisson process that describes multiple scattering have diffusional character. This property allows to analyze the process of angular-spatial evolution of multiple scattering of charged particles as combination of soft and hard collision processes and compute appropriately its transition densities. These computations provide a method of the approximate solution to the Lewis equation. (orig.)

  17. Charge transport in 2DEG/s-wave superconductor junction with Dresselhaus-type spin-orbit coupling

    International Nuclear Information System (INIS)

    Sawa, Y.; Yokoyama, T.; Tanaka, Y.


    We study spin-dependent charge transport in superconducting junctions. We consider ballistic two-dimensional electron gas (2DEG)/s-wave superconductor junctions with Dresselhaus-type spin-orbit coupling (DSOC). We calculate the conductance normalized by that in the normal state of superconductor in order to study the effect of DSOC in 2DEG on conductance, changing the height of insulating barrier. We find the DSOC suppresses the conductance for low insulating barrier, while it can slightly enhance the conductance for high insulating barrier. It has a reentrant dependence on DSOC for middle strength insulating barrier. The effect of DSOC is weaken as the insulating barrier becomes high

  18. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair (United States)

    Sinurat, E. N.; Yudiarsah, E.


    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  19. Electric field confinement effect on charge transport in organic field-effect transistors

    NARCIS (Netherlands)

    Li, X.; Kadashchuk, A.; Fishchuk, I.I.; Smaal, W.T.T.; Gelinck, G.H.; Broer, D.J.; Genoe, J.; Heremans, P.; Bässler, H.


    While it is known that the charge-carrier mobility in organic semiconductors is only weakly dependent on the electric field at low fields, the experimental mobility in organic field-effect transistors using silylethynyl-substituted pentacene is found to be surprisingly field dependent at low

  20. Anisotropic charge transport in large single crystals of π-conjugated organic molecules. (United States)

    Hourani, Wael; Rahimi, Khosrow; Botiz, Ioan; Koch, Felix Peter Vinzenz; Reiter, Günter; Lienerth, Peter; Heiser, Thomas; Bubendorff, Jean-Luc; Simon, Laurent


    The electronic properties of organic semiconductors depend strongly on the nature of the molecules, their conjugation and conformation, their mutual distance and the orientation between adjacent molecules. Variations of intramolecular distances and conformation disturb the conjugation and perturb the delocalization of charges. As a result, the mobility considerably decreases compared to that of a covalently well-organized crystal. Here, we present electrical characterization of large single crystals made of the regioregular octamer of 3-hexyl-thiophene (3HT)8 using a conductive-atomic force microscope (C-AFM) in air. We find a large anisotropy in the conduction with charge mobility values depending on the crystallographic orientation of the single crystal. The smaller conduction is in the direction of π-π stacking (along the long axis of the single crystal) with a mobility value in the order of 10(-3) cm(2) V(-1) s(-1), and the larger one is along the molecular axis (in the direction normal to the single crystal surface) with a mobility value in the order of 0.5 cm(2) V(-1) s(-1). The measured current-voltage (I-V) curves showed that along the molecular axis, the current followed an exponential dependence corresponding to an injection mode. In the π-π stacking direction, the current exhibits a space charge limited current (SCLC) behavior, which allows us to estimate the charge carrier mobility.

  1. Modelling the effect of nonplanarity on charge transport along conjugated polymer chains

    International Nuclear Information System (INIS)

    Correia, Helena M.G.; Ramos, Marta M.D.


    Conjugated polymers show interesting properties that make them appropriated for nanoelectronics. Several studies of poly(p-phenylene vinylene) (PPV) have suggested that each polymer chain consists of several planar segments, with conjugation length of nanoscale dimension, linked by twists or kinks. A pronounced twist between two planar segments in a PPV chain not only causes loss of main-chain conjugation but it may also alter electron and hole mobility along the chain, which has further implications for the percolation of charge through the polymer film. We used self-consistent quantum molecular dynamics calculations to provide information on the electric field needed to move the injected charges (either electrons or holes) along the planar segments of PPV and to cross the twist between two planar segments perpendicular to each other. Field-dependent charge mobility was also estimated for conjugated segments of various lengths. Our results suggest that electrons can cross the twist between adjacent planar segments for lower applied electric fields than holes if there is no more than one electronic charge (electron or hole) on the PPV chain, otherwise similar fields are needed

  2. Mechanism of Crystallization and Implications for Charge Transport in Poly(3-ethylhexylthiophene) Thin Films

    KAUST Repository

    Duong, Duc T.; Ho, Victor; Shang, Zhengrong; Mollinger, Sonya; Mannsfeld, Stefan C.B.; Dacuñ a, Javier; Toney, Michael F.; Segalman, Rachel; Salleo, Alberto


    on the film thickness and average molecular weight. Time-dependent, field-effect hole mobilities in thin films reveal a percolation threshold for both low and high molecular weight P3EHT. Structural analysis reveals that charge percolation requires bridged

  3. Optical conductivity and optical effective mass in a high-mobility organic semiconductor: Implications for the nature of charge transport

    KAUST Repository

    Li, Yuan


    We present a multiscale modeling of the infrared optical properties of the rubrene crystal. The results are in very good agreement with the experimental data that point to nonmonotonic features in the optical conductivity spectrum and small optical effective masses. We find that, in the static-disorder approximation, the nonlocal electron-phonon interactions stemming from low-frequency lattice vibrations can decrease the optical effective masses and lead to lighter quasiparticles. On the other hand, the charge-transport and infrared optical properties of the rubrene crystal at room temperature are demonstrated to be governed by localized carriers driven by inherent thermal disorders. Our findings underline that the presence of apparently light carriers in high-mobility organic semiconductors does not necessarily imply bandlike transport.

  4. Measurements of stability limits for a space-charge-dominated ion beam in a long A.G. transport channel

    International Nuclear Information System (INIS)

    Tiefenback, M.G.; Keefe, D.


    The Single Beam Transport Experiment at LBL consists of 82 electrostatic quadrupole lenses arranged in a FODO lattice. Five further lenses provide a matched beam from a high-current high-brightness cesium source for injection into the FODO channel. We call the transport conditions stable if both the emittance and current remain unchanged between the beginning and end of the channel, and unstable if either the emittance grows or the current decreases because of collective effects. We have explored the range of single-particle betatron phase advance per period from sigma 0 = 45 0 to 150 0 to determine the stability limits for the space-charge depressed phase advance, sigma. No lower limit for sigma (down to 7 0 ) has been found at sigma 0 = 60 0 , whereas limits have clearly been identified and mapped in the region of sigma 0 above 90 0

  5. Double path integral method for obtaining the mobility of the one-dimensional charge transport in molecular chain. (United States)

    Yoo-Kong, Sikarin; Liewrian, Watchara


    We report on a theoretical investigation concerning the polaronic effect on the transport properties of a charge carrier in a one-dimensional molecular chain. Our technique is based on the Feynman's path integral approach. Analytical expressions for the frequency-dependent mobility and effective mass of the carrier are obtained as functions of electron-phonon coupling. The result exhibits the crossover from a nearly free particle to a heavily trapped particle. We find that the mobility depends on temperature and decreases exponentially with increasing temperature at low temperature. It exhibits large polaronic-like behaviour in the case of weak electron-phonon coupling. These results agree with the phase transition (A.S. Mishchenko et al., Phys. Rev. Lett. 114, 146401 (2015)) of transport phenomena related to polaron motion in the molecular chain.

  6. Optical conductivity and optical effective mass in a high-mobility organic semiconductor: Implications for the nature of charge transport

    KAUST Repository

    Li, Yuan; Yi, Yuanping; Coropceanu, Veaceslav; Bredas, Jean-Luc


    We present a multiscale modeling of the infrared optical properties of the rubrene crystal. The results are in very good agreement with the experimental data that point to nonmonotonic features in the optical conductivity spectrum and small optical effective masses. We find that, in the static-disorder approximation, the nonlocal electron-phonon interactions stemming from low-frequency lattice vibrations can decrease the optical effective masses and lead to lighter quasiparticles. On the other hand, the charge-transport and infrared optical properties of the rubrene crystal at room temperature are demonstrated to be governed by localized carriers driven by inherent thermal disorders. Our findings underline that the presence of apparently light carriers in high-mobility organic semiconductors does not necessarily imply bandlike transport.

  7. Role of Li2O2@Li2CO3 Interfaces on Charge Transport in Nonaqueous Li−Air Batteries

    DEFF Research Database (Denmark)

    Mekonnen, Yedilfana Setarge; García Lastra, Juan Maria; Hummelshøj, Jens S.


    The formation and oxidation of the main discharge product in nonaqueous secondary Li−O2 batteries, that is, Li2O2, has been studied intensively, but less attention has been given to the formation of cathode−electrolyte interfaces, which can significantly influence the performance of the Li−O2...... battery. Here we apply density functional theory with the Hubbard U correction (DFT+U) and nonequilibrium Green’s function (NEGF) methods to investigate the role of Li2O2@Li2CO3 interface layers on the ionic and electronic transport properties at the oxygen electrode. We show that, for example, lithium...... vacancies accumulate at the peroxide part of the interface during charge, reducing the coherent electron transport by two to three orders of magnitude compared with pristine Li2O2. During discharge, Li2O2@Li2CO3 interfaces may, however, provide an alternative in-plane channel for fast electron polaron...

  8. Transport of charged particles in the plasma of an ECRIS; Transport des particules chargees dans le plasma d'ECRIS

    Energy Technology Data Exchange (ETDEWEB)

    Girard, A.; Perrer, Douysset; Melin, G. [Dept. de Recherche Fondamentale sur la Matiere Condensee CEA Centre d' Etudes de Grenoble, 38 (France)


    The paper has the following contents: 1. Introduction; 2. Electron transport. 2.1. Experiments - Lifetime measurements - Contradiction. 2.2. Modelling; 3. Ion transport. 3.1. Experiments - Measurement of argon K{sub {alpha}}. 3.2. Lifetime. 3.3. Proposed model, controversy; 4. Conclusion. A setup of the experiment and the results concerning the electron density, energy content, mean energy, current density, electron lifetime and lifetime of electron energy as a function of rf power are presented. The results are interpreted and modelled. Also, the experimental setup for the study of ion transport is presented. The density of argon ions is determined by means of the high resolution X ray spectra which, by making use of a simple collisional radiative model, is able to single out the argon K{sub {alpha}} rays corresponding to different ions. These results are also interpreted and modelled. In conclusion, with an electron dynamics controlled by rf, due to a high mirror ratio, the losses are limited. According to the scale law the higher the frequency the higher is the energy content of the electrons and consequently the higher are the performances. The ions are cool and colliding. Their lifetime increases with the charge. If it increases linearly their transport is controlled by the spatial diffusion in the ambipolar electric field. A correct lifetime requires plasma of high dimensions and low ionic temperature.

  9. Spiro-OMeTAD single crystals: Remarkably enhanced charge-carrier transport via mesoscale ordering

    KAUST Repository

    Shi, Dong; Qin, X.; Li, Yuan; He, Yao; Zhong, Cheng; Pan, Jun; Dong, H.; Xu, Wei; Li, T.; Hu, W.; Bredas, Jean-Luc; Bakr, Osman


    bottleneck for advancing cell efficiencies. We devised an antisolvent crystallization strategy to grow single crystals of spiro-OMeTAD, which allowed us to experimentally elucidate its molecular packing and transport properties. Electronic structure

  10. Optimal charging scheduling for large-scale EV (electric vehicle) deployment based on the interaction of the smart-grid and intelligent-transport systems

    International Nuclear Information System (INIS)

    Luo, Yugong; Zhu, Tao; Wan, Shuang; Zhang, Shuwei; Li, Keqiang


    The widespread use of electric vehicles (EVs) is becoming an imminent trend. Research has been done on the scheduling of EVs from the perspective of the charging characteristic, improvement in the safety and economy of the power grid, or the traffic jams in the transport system caused by a large number of EVs driven to charging stations. There is a lack of systematic studies considering EVs, the power grid, and the transport system all together. In this paper, a novel optimal charging scheduling strategy for different types of EVs is proposed based on not only transport system information, such as road length, vehicle velocity and waiting time, but also grid system information, such as load deviation and node voltage. In addition, a charging scheduling simulation platform suitable for large-scale EV deployment is developed based on actual charging scenarios. The simulation results show that the improvements in both the transport system efficiency and the grid system operation can be obtained by using the optimal strategy, such as the node voltage drop is decreased, the power loss is reduced, and the load curve is optimized. - Highlights: • A novel optimal charging scheduling strategy is proposed for different electric vehicles (EVs). • A simulation platform suitable for large-scale EV deployment is established. • The traffic congestion near the charging and battery-switch stations is relieved. • The safety and economy problems of the distribution network are solved. • The peak-to-valley load of the distribution system is reduced.

  11. Exploring the energy landscape of the charge transport levels in organic semiconductors at the molecular scale. (United States)

    Cornil, J; Verlaak, S; Martinelli, N; Mityashin, A; Olivier, Y; Van Regemorter, T; D'Avino, G; Muccioli, L; Zannoni, C; Castet, F; Beljonne, D; Heremans, P


    The extraordinary semiconducting properties of conjugated organic materials continue to attract attention across disciplines including materials science, engineering, chemistry, and physics, particularly with application to organic electronics. Such materials are used as active components in light-emitting diodes, field-effect transistors, or photovoltaic cells, as a substitute for (mostly Si-based) inorganic semiconducting materials. Many strategies developed for inorganic semiconductor device building (doping, p-n junctions, etc.) have been attempted, often successfully, with organics, even though the key electronic and photophysical properties of organic thin films are fundamentally different from those of their bulk inorganic counterparts. In particular, organic materials consist of individual units (molecules or conjugated segments) that are coupled by weak intermolecular forces. The flexibility of organic synthesis has allowed the development of more efficient opto-electronic devices including impressive improvements in quantum yields for charge generation in organic solar cells and in light emission in electroluminescent displays. Nonetheless, a number of fundamental questions regarding the working principles of these devices remain that preclude their full optimization. For example, the role of intermolecular interactions in driving the geometric and electronic structures of solid-state conjugated materials, though ubiquitous in organic electronic devices, has long been overlooked, especially when it comes to these interfaces with other (in)organic materials or metals. Because they are soft and in most cases disordered, conjugated organic materials support localized electrons or holes associated with local geometric distortions, also known as polarons, as primary charge carriers. The spatial localization of excess charges in organics together with low dielectric constant (ε) entails very large electrostatic effects. It is therefore not obvious how these

  12. Explosive underground: vehicles and concepts for transport and charging; Sprengstoff Untertage: Fahrzeuge und Konzepte fuer den Transport und das Laden

    Energy Technology Data Exchange (ETDEWEB)

    Plagemann, D.; Schroeder, W. [Hermann Paus Maschinenfabrik GmbH, Emsbueren (Germany)


    For about 30 years Hermann Paus Maschinenfabrik GmbH has been in continuous and direct contact with mines throughout the world and during this period has developed a number of specific solutions, which offer mines a potential for performance of the respective tasks. The essential feature of each development is high individualisation of the equipment or high universality of the machine platforms used for this purpose to ensure that the costs are clear also in the case of special equipment. In particular for transport and the handling of Anfo concepts were already developed and tested jointly with the users at an early stage. (orig.)

  13. A numerical model for charge transport and energy conversion of perovskite solar cells. (United States)

    Zhou, Yecheng; Gray-Weale, Angus


    Based on the continuity equations and Poisson's equation, we developed a numerical model for perovskite solar cells. Due to different working mechanisms, the model for perovskite solar cells differs from that of silicon solar cells and Dye Sensitized Solar Cells. The output voltage and current are calculated differently, and in a manner suited in particular to perovskite organohalides. We report a test of our equations against experiment with good agreement. Using this numerical model, it was found that performances of solar cells increase with charge carrier's lifetimes, mobilities and diffusion lengths. The open circuit voltage (Voc) of a solar cell is dependent on light intensities, and charge carrier lifetimes. Diffusion length and light intensity determine the saturated current (Jsc). Additionally, three possible guidelines for the design and fabrication of perovskite solar cells are suggested by our calculations. Lastly, we argue that concentrator perovskite solar cells are promising.

  14. Transport properties of monolayer and bilayer graphene p-n junctions with charge puddles in the quantum Hall regime

    International Nuclear Information System (INIS)

    Cheng Shuguang


    Recent experiments have confirmed that the electron-hole inhomogeneity in graphene is a new type of charge disorder. Motivated by such confirmation, we theoretically study the transport properties of a monolayer graphene (MLG) based p-n junction and a bilayer graphene (BLG) p-n junction in the quantum Hall regime where electron-hole puddles are considered. By using the non-equilibrium Green function method, both the current and conductance are obtained. We find that, in the presence of the electron-hole inhomogeneity, the lowest quantized conductance plateau at e 2 /h emerges in the MLG p-n junction under very small charge puddle disorder strength. For a BLG p-n junction, however, the conductance in the p-n region is enhanced with charge puddles, and the lowest quantized conductance plateau emerges at 2e 2 /h. Besides, when an ideal quantized conductance plateau is formed for a MLG p-n junction, the universal conductance fluctuation is found to be 2e 2 /3h. Furthermore, we also investigate the influence of Anderson disorder on such p-n junctions and the comparison and discussion are given accordingly. To compare the two models with different types of disorder, we investigate the conductance distribution specially. Finally the influence of disorder strength on the conductance of a MLG p-n junction is investigated.

  15. Molecular structure of the discotic liquid crystalline phase of hexa-peri-hexabenzocoronene/oligothiophene hybrid and their charge transport properties

    International Nuclear Information System (INIS)

    Bag, Saientan; Maingi, Vishal; Maiti, Prabal K.; Yelk, Joe; Glaser, Matthew A.; Clark, Noel A.; Walba, David M.


    Using atomistic molecular dynamics simulation, we study the discotic columnar liquid crystalline (LC) phases formed by a new organic compound having hexa-peri-Hexabenzocoronene (HBC) core with six pendant oligothiophene units recently synthesized by Nan Hu et al. [Adv. Mater. 26, 2066 (2014)]. This HBC core based LC phase was shown to have electric field responsive behavior and has important applications in organic electronics. Our simulation results confirm the hexagonal arrangement of columnar LC phase with a lattice spacing consistent with that obtained from small angle X-ray diffraction data. We have also calculated various positional and orientational correlation functions to characterize the ordering of the molecules in the columnar arrangement. The molecules in a column are arranged with an average twist of 25° having an average inter-molecular separation of ∼5 Å. Interestingly, we find an overall tilt angle of 43° between the columnar axis and HBC core. We also simulate the charge transport through this columnar phase and report the numerical value of charge carrier mobility for this liquid crystal phase. The charge carrier mobility is strongly influenced by the twist angle and average spacing of the molecules in the column

  16. Investigation of magnetic and magneto-transport properties of ferromagnetic-charge ordered core-shell nanostructures (United States)

    Das, Kalipada


    In our present study, we address in detail the magnetic and magneto-transport properties of ferromagnetic-charge ordered core-shell nanostructures. In these core-shell nanostructures, well-known half metallic La0.67Sr0.33MnO3 nanoparticles (average particle size, ˜20 nm) are wrapped by the charge ordered antiferromagnetic Pr0.67Ca0.33MnO3 (PCMO) matrix. The intrinsic properties of PCMO markedly modify it into such a core-shell form. The robustness of the PCMO matrix becomes fragile and melts at an external magnetic field (H) of ˜20 kOe. The analysis of magneto-transport data indicates the systematic reduction of the electron-electron and electron-magnon interactions in the presence of an external magnetic field in these nanostructures. The pronounced training effect appears in this phase separated compound, which was analyzed by considering the second order tunneling through the grain boundaries of the nanostructures. Additionally, the analysis of low field magnetoconductance data supports the second order tunneling and shows the close value of the universal limit (˜1.33).

  17. Charge transport in micas: The kinetics of FeII/III electron transfer in the octahedral sheet

    International Nuclear Information System (INIS)

    Rosso, Kevin M.; Ilton, Eugene S.


    The two principal FeII/III electron exchange reactions underlying charge transport in the octahedral sheet of ideal end-member annite were modeled using a combination of ab initio calculations and Marcus electron transfer theory. A small polaron model was applied which yielded electron hopping activation energies that agree well with the limited available experimental data. A small ab initio cluster model successfully reproduced several important structural, energetic, and magnetic characteristics of the M1 and M2 Fe sites in the annite octahedral sheet. The cluster enabled calculation of the internal reorganization energy and electronic coupling matrix elements for the M2-M2 and M1-M2 electron transfer reactions. The M2-M2 electron transfer is symmetric with a predicted forward/reverse electron hopping rate of 106 s-1. The M1-M2 electron transfers are asymmetric due to the higher ionization potential by 0.46 eV of FeII in the M1 site. The electronic coupling matrix elements for these reactions are predicted to be small and of similar magnitude, suggesting the possibility that the coupling is essentially direction independent amongst hopping directions in the octahedral sheet. M1 Fe sites are predicted to be efficient electron traps and charge transport should occur by nearest-neighbor electron hops along the M2 Fe sublattice

  18. High-efficiency red-light emission from polyfluorenes grafted with cyclometalated iridium complexes and charge transport moiety. (United States)

    Chen, Xiwen; Liao, Jin-Long; Liang, Yongmin; Ahmed, M O; Tseng, Hao-En; Chen, Show-An


    We report a new route for the design of electroluminescent polymers by grafting high-efficiency phosphorescent organometallic complexes as dopants and charge transport moieties onto alky side chains of fully conjugated polymers for polymer light-emitting diodes (PLED) with single layer/single polymers. The polymer system studied involves polyfluorene (PF) as the base conjugated polymer, carbazole (Cz) as the charge transport moiety and a source for green emission by forming an electroplex with the PF main chain, and cyclometalated iridium (Ir) complexes as the phosphorescent dopant. Energy transfer from the green Ir complex or an electroplex formed between the fluorene main chain and side-chain carbazole moieties, in addition to that from the PF main chain, to the red Ir complex can significantly enhance the device performance, and a red light-emitting device with the high efficiency 2.8 cd/A at 7 V and 65 cd/m2, comparable to that of the same Ir complex-based OLED, and a broad-band light-emitting device containing blue, green, and red peaks (2.16 cd/A at 9 V) are obtained.

  19. Charge transport in quantum dot organic solar cells with Si quantum dots sandwiched between poly(3-hexylthiophene) (P3HT) absorber and bathocuproine (BCP) transport layers (United States)

    Verma, Upendra Kumar; Kumar, Brijesh


    We have modeled a multilayer quantum dot organic solar cell that explores the current-voltage characteristic of the solar cell whose characteristics can be tuned by varying the fabrication parameters of the quantum dots (QDs). The modeled device consists of a hole transport layer (HTL) which doubles up as photon absorbing layer, several quantum dot layers, and an electron transport layer (ETL). The conduction of charge carriers in HTL and ETL has been modeled by the drift-diffusion transport mechanism. The conduction and recombination in the quantum dot layers are described by a system of coupled rate equations incorporating tunneling and bimolecular recombination. Analysis of QD-solar cells shows improved device performance compared to the similar bilayer and trilayer device structures without QDs. Keeping other design parameters constant, solar cell characteristics can be controlled by the quantum dot layers. Bimolecular recombination coefficient of quantum dots is a prime factor which controls the open circuit voltage (VOC) without any significant reduction in short circuit current (JSC).

  20. Modelling of charge carrier mobility for transport between elastic polyacetylene-like polymer nanorods

    Czech Academy of Sciences Publication Activity Database

    Menšík, Miroslav; Sun, S. J.; Toman, Petr; Král, Karel


    Roč. 61, č. 2 (2017), s. 127-135 ISSN 0862-5468 R&D Projects: GA MŠk(CZ) LD14011; GA ČR(CZ) GA15-05095S Grant - others:European Commission(XE) COST Action MP1202 HINT; AV ČR(CZ) KONNECT-007 Program:Bilaterální spolupráce Institutional support: RVO:61389013 ; RVO:68378271 Keywords : charge carrier mobility * polymers * electron-phonon coupling Subject RIV: CF - Physical ; Theoretical Chemistry; CF - Physical ; Theoretical Chemistry (FZU-D) OBOR OECD: Physical chemistry; Physical chemistry (FZU-D) Impact factor: 0.439, year: 2016

  1. Artificial immune system and sheep flock algorithms for two-stage fixed-charge transportation problem

    DEFF Research Database (Denmark)

    Kannan, Devika; Govindan, Kannan; Soleimani, Hamed


    In this paper, we cope with a two-stage distribution planning problem of supply chain regarding fixed charges. The focus of the paper is on developing efficient solution methodologies of the selected NP-hard problem. Based on computational limitations, common exact and approximation solution...... approaches are unable to solve real-world instances of such NP-hard problems in a reasonable time. These approaches involve cumbersome computational steps in real-size cases. In order to solve the mixed integer linear programming model, we develop an artificial immune system and a sheep flock algorithm...

  2. Charge transport in organic transistors accounting for a wide distribution of carrier energies, Part I : Theory

    NARCIS (Netherlands)

    Torricelli, F.


    An extended theory of carrier hopping transport in organic transistors is proposed. According to many experimental studies, the density of localized states in organic thin-film transistors can be described by a double-exponential function. In this work, using a percolation model of hopping, the

  3. Studies of charge transport in DNA films using the time-of-flight (TOF) technique (United States)

    Yaney, Perry P.; Gorman, Timothy; Ouchen, Fahima; Grote, James G.


    Measurements were carried out on salmon DNA-based films, including as-received DNA (molecular weight, MW>2000 kDa) without and with hexacetyltrimethl-ammonium chloride (CTMA) surfactant, and sonicated DNA of MW~200 kDa with CTMA. The test specimens were spin-coated or drop-cast films on ITO-coated quartz slides with a gold charge-collecting electrode. To protect the films from atmospheric influences, the TOF devices were coated with a 200-400 nm polyurethane passivation layer. A quadrupled 20 ns, pulsed Nd:YAG laser with output at 266 nm was used for charge injection. The room temperature photoconductive transients were dispersive to varying degrees with hole mobilities in DNA materials films ranging between 2E-5 to 6E-3 cm2/Vs for fields ranging from 8 to 58 kV/cm. Only hole response was observed in DNA. The dispersive data were analyzed using a simple, quasi-empirical equation for the photocurrent transient data.

  4. Laser-driven strong magnetostatic fields with applications to charged beam transport and magnetized high energy-density physics (United States)

    Santos, Joao


    Powerful laser-plasma processes are explored to generate discharge currents of a few 100 kA in coil targets, yielding magnetostatic fields (B-fields) in the kTesla range. The B-fields are measured by proton-deflectometry and high-frequency bandwidth B-dot probes. According to our modeling, the quasi-static currents are provided from hot electron ejection from the laser-irradiated surface, accounting for the space charge neutralization and the plasma magnetization. The major control parameter is the laser irradiance Iλ2 . The B-fields ns-scale is long enough to magnetize secondary targets through resistive diffusion. We applied it in experiments of laser-generated relativistic electron transport into solid dielectric targets, yielding an unprecedented enhancement of a factor 5 on the energy-density flux at 60 µm depth, compared to unmagnetized transport conditions. These studies pave the ground for magnetized high-energy density physics investigations, related to laser-generated secondary sources of radiation and/or high-energy particles and their transport, to high-gain fusion energy schemes and to laboratory astrophysics. We acknowledge funding from French National Agency for Research (ANR), Grant TERRE ANR-2011-BS04-014, and from EUROfusion Consortium, European Union's Horizon 2020 research and innovation programme, Grant 633053.

  5. Highly efficient single-layer dendrimer light-emitting diodes with balanced charge transport (United States)

    Anthopoulos, Thomas D.; Markham, Jonathan P. J.; Namdas, Ebinazar B.; Samuel, Ifor D. W.; Lo, Shih-Chun; Burn, Paul L.


    High-efficiency single-layer-solution-processed green light-emitting diodes based on a phosphorescent dendrimer are demonstrated. A peak external quantum efficiency of 10.4% (35 cd/A) was measured for a first generation fac-tris(2-phenylpyridine) iridium cored dendrimer when blended with 4,4'-bis(N-carbazolyl)biphenyl and electron transporting 1,3,5-tris(2-N-phenylbenzimidazolyl)benzene at 8.1 V. A maximum power efficiency of 12.8 lm/W was measured also at 8.1 V and 550 cd/m2. These results indicate that, by simple blending of bipolar and electron-transporting molecules, highly efficient light-emitting diodes can be made employing a very simple device structure.

  6. Charge transport in nanostructured materials for solar energy conversion studied by time-resolved terahertz spectroscopy

    Czech Academy of Sciences Publication Activity Database

    Němec, Hynek; Kužel, Petr; Sundström, V.


    Roč. 215, 2-3 (2010), s. 123-139 ISSN 1010-6030 R&D Projects: GA ČR(CZ) GP202/09/P099; GA AV ČR(CZ) IAA100100902; GA MŠk LC512 Institutional research plan: CEZ:AV0Z10100520 Keywords : time-resolved terahertz spectroscopy * ultrafast dynamics * bulk heterojunction * semiconductor nanostructures * transport * mobility Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 2.243, year: 2010

  7. Polymers Containing Diphenylvinyl-Substituted Indole Rings as Charge-Transporting Materials for OLEDs (United States)

    Grigalevicius, S.; Zostautiene, R.; Sipaviciute, D.; Stulpinaite, B.; Volyniuk, D.; Grazulevicius, J. V.; Liu, L.; Xie, Z.; Zhang, B.


    Monomers and polymers containing electronically isolated diphenylvinyl-substituted indole rings were synthesized and characterized by nuclear magnetic resonance (NMR) and mass spectroscopies as well as by gel permeation chromatography. The polymers represent amorphous materials with glass transition temperatures of 91-109°C and thermal decomposition starting above 307°C. Electron photoemission spectra of thin films of the synthesized polymers revealed ionization potentials of 5.54-5.58 eV. The synthesized polymers were tested as hole-transporting materials in simple electroluminescent organic light-emitting diode (OLED) devices with tris(quinolin-8-olato)aluminium (Alq3) as an emitter as well as an electron-transporting layer. A green OLED device containing a hole-transporting layer of poly[1-(2,3-epithiopropyl)-2-methyl-3-(2,2-diphenylvinyl)índole] exhibited the best overall performance with a driving voltage of 4.0 V, maximum photometric efficiency of 2.8 cd/A and maximum brightness of about 4200 cd/m2.

  8. Manipulation of charge transfer and transport in plasmonic-ferroelectric hybrids for photoelectrochemical applications (United States)

    Wang, Zhijie; Cao, Dawei; Wen, Liaoyong; Xu, Rui; Obergfell, Manuel; Mi, Yan; Zhan, Zhibing; Nasori, Nasori; Demsar, Jure; Lei, Yong


    Utilizing plasmonic nanostructures for efficient and flexible conversion of solar energy into electricity or fuel presents a new paradigm in photovoltaics and photoelectrochemistry research. In a conventional photoelectrochemical cell, consisting of a plasmonic structure in contact with a semiconductor, the type of photoelectrochemical reaction is determined by the band bending at the semiconductor/electrolyte interface. The nature of the reaction is thus hard to tune. Here instead of using a semiconductor, we employed a ferroelectric material, Pb(Zr,Ti)O3 (PZT). By depositing gold nanoparticle arrays and PZT films on ITO substrates, and studying the photocurrent as well as the femtosecond transient absorbance in different configurations, we demonstrate an effective charge transfer between the nanoparticle array and PZT. Most importantly, we show that the photocurrent can be tuned by nearly an order of magnitude when changing the ferroelectric polarization in PZT, demonstrating a versatile and tunable system for energy harvesting. PMID:26753764

  9. Tunable quantum criticality and super-ballistic transport in a "charge" Kondo circuit. (United States)

    Iftikhar, Z; Anthore, A; Mitchell, A K; Parmentier, F D; Gennser, U; Ouerghi, A; Cavanna, A; Mora, C; Simon, P; Pierre, F


    Quantum phase transitions (QPTs) are ubiquitous in strongly-correlated materials. However the microscopic complexity of these systems impedes the quantitative understanding of QPTs. Here, we observe and thoroughly analyze the rich strongly-correlated physics in two profoundly dissimilar regimes of quantum criticality. With a circuit implementing a quantum simulator for the three-channel Kondo model, we reveal the universal scalings toward different low-temperature fixed points and along the multiple crossovers from quantum criticality. Notably, an unanticipated violation of the maximum conductance for ballistic free electrons is uncovered. The present charge pseudospin implementation of a Kondo impurity opens access to a broad variety of strongly-correlated phenomena. Copyright © 2018, American Association for the Advancement of Science.

  10. Charge photogeneration and transport in side-chain carbazole polymers and co-polymers

    KAUST Repository

    Li, Huawei; Termine, Roberto; Godbert, Nicolas; Angiolini, Luigi; Giorgini, Loris; Golemme, Attilio


    The photoconductivity, hole mobility and charge photogeneration efficiency of a series of side-chain carbazole homopolymers and copolymers (with azo side-chains) have been investigated. Cyclic voltammetry measurement of frontier orbitals energies show that the HOMO energy is determined by the nature and the position of attachment of the linker between the main chain and the carbazole, the azo-moiety being not relevant in this respect. Hole mobility is not influenced by the HOMO energy but seems to depend on the degree of conformational mobility of the side-chains, reaching values of the order of 10-3cm2V-1s-1 in the best cases. The HOMO energy is instead extremely important when considering photogeneration efficiency, that can change by 10 orders of magnitude depending on the density of the carbazole side-chains in co-polymers and on the linker nature and attachment position. © 2011 Elsevier B.V. All rights reserved.

  11. Charge photogeneration and transport in side-chain carbazole polymers and co-polymers

    KAUST Repository

    Li, Huawei


    The photoconductivity, hole mobility and charge photogeneration efficiency of a series of side-chain carbazole homopolymers and copolymers (with azo side-chains) have been investigated. Cyclic voltammetry measurement of frontier orbitals energies show that the HOMO energy is determined by the nature and the position of attachment of the linker between the main chain and the carbazole, the azo-moiety being not relevant in this respect. Hole mobility is not influenced by the HOMO energy but seems to depend on the degree of conformational mobility of the side-chains, reaching values of the order of 10-3cm2V-1s-1 in the best cases. The HOMO energy is instead extremely important when considering photogeneration efficiency, that can change by 10 orders of magnitude depending on the density of the carbazole side-chains in co-polymers and on the linker nature and attachment position. © 2011 Elsevier B.V. All rights reserved.


    Directory of Open Access Journals (Sweden)

    M. Mensik


    Full Text Available A quantum model solving the charge carrier mobility between polyacetylene-like polymer nanorods is presented. The model assumes: a Quantum mechanical calculation of hole on-chain delocalization involving electron-phonon coupling leading to the Peierls instability, b Hybridization coupling between the polymer backbone and side-groups (or environmental states, which act as hole traps, and c Semiclassical description of the inter-chain hole transfer in an applied voltage based on Marcus theory. We have found that mobility resonantly depends on the hybridization coupling between polymer and linked groups. We observed also non-trivial mobility dependences on the difference of energies of the highest occupied molecular orbitals localized on the polymer backbone and side-groups, respectively, and hole concentration. Those findings are important for optimization of hybrid opto-electronic devices.

  13. Redox Probing Study of the Potential Dependence of Charge Transport Through Li2O2

    DEFF Research Database (Denmark)

    Knudsen, Kristian Bastholm; Luntz, Alan C.; Jensen, Søren Højgaard


    -of-the-art Liion technologies and the demand placed on batteries by technologies such as electrical vehicles. Here we present a redox probing study of the charge transfer across the main deposition product lithium peroxide, Li2O2, in the Li−O2 battery using outer-sphere redox shuttles. The change in heterogeneous......In the field of energy storage devices the pursuit for cheap, high energy density, reliable secondary batteries is at the top of the agenda. The Li−O2 battery is one of the possible technologies that, in theory, should be able to close the gap, which exists between the present state...... electron transfer exchange rate as a function of the potential and the Li2O2 layer thickness (∼depth-of-discharge) was determined using electrochemical impedance spectroscopy. The attenuation of the electron transfer exchange rate with film thickness is dependent on the probing potential, providing...

  14. Mechanical and charge transport properties of alkanethiol self-assembled monolayers on Au (111) surface: The Role of Molecular Tilt

    Energy Technology Data Exchange (ETDEWEB)

    Mulleregan, Alice; Qi, Yabing; Ratera, Imma; Park, Jeong Y.; Ashby, Paul D.; Quek, Su Ying; Neaton, J. B.; Salmeron, Miquel


    The relationship between charge transport and mechanical properties of alkanethiol self-assembled monolayers (SAM) on Au(111) films has been investigated using an atomic force microscope with a conductive tip. Molecular tilts induced by the pressure applied by the tip cause stepwise increases in film conductivity. A decay constant {beta} = 0.57 {+-} 0.03 {angstrom}{sup -1} was found for the current passing through the film as a function of tip-substrate separation due to this molecular tilt. This is significantly smaller than the value of {approx} 1 {angstrom}{sup -1} found when the separation is changed by changing the length of the alkanethiol molecules. Calculations indicate that for isolated dithiol molecules S-bonded to hollow sites, the junction conductance does not vary significantly as a function of molecular tilt. The impact of S-Au bonding on SAM conductance is discussed.

  15. Synthesis of Dimethyl-Substituted Polyviologen and Control of Charge Transport in Electrodes for High-Resolution Electrochromic Displays

    Directory of Open Access Journals (Sweden)

    Kan Sato


    Full Text Available Electrochromic (EC polymers such as polyviologens have been attracting considerable attention as wet-processable electrodes for EC displays, thanks to their brilliant color change accompanied with reversible redox reactions. To establish wider usage, achieving multicolor and high-resolution characteristics is indispensable. In this paper, we demonstrated that the introduction of substituents such as methyl groups into bipyridine units changed the stereostructure of the cation radicals, and thus shifted the color (e.g., ordinary purple to blue. Also, by relaxing excessive π-stacking between the viologen moieties, the response rate was improved by a factor of more than 10. The controlled charge transport throughout the polyviologen layer gave rise to the fabrication of EC displays which are potentially suitable for the thin film transistor (TFT substrate as the counter electrodes with submillimeter pixels. The findings can be versatilely used for the new design of polyviologens with enhanced electrochemical properties and high-resolution, multicolor EC displays.

  16. Spin-polarized charge transport in HgTe/CdTe quantum well topological insulator under a ferromagnetic metal strip (United States)

    Wu, Zhenhua; Luo, Kun; Yu, Jiahan; Wu, Xiaobo; Lin, Liangzhong


    Electron tunneling through a single magnetic barrier in a HgTe topological insulator has been theoretically investigated. We find that the perpendicular magnetic field would not lead to spin-flip of the edge states due to the conservation of the angular moment. By tuning the magnetic field and the Fermi energy, the edge channels can be transited from switch-on states to switch-off states and the current from unpolarized states can be filtered to fully spin polarized states. These features offer us an efficient way to control charge/spin transport in a HgTe/CdTe quantum well, and pave a way to construct the nanoelectronic devices utilizing the topological edge states.


    Directory of Open Access Journals (Sweden)

    Ecobici Nicolae


    Full Text Available New tax rules with effect from 1 May 2009 with a series of changes on the tax deductibility of the value added acquisitions related to transport and fuel use. The measure is very obvious nature of politics in order to bring the state budget amounts as required under the current government crisis in the financial world. The book focuses on not commenting policy modifications as required on the implications that they bring in on the accounting chargeback. Therefore, in the paper we will address the resolution of these legal provisions in the economic accounts.

  18. An alternative treatment of heat flow for charge transport in semiconductor devices

    International Nuclear Information System (INIS)

    Grupen, Matt


    A unique thermodynamic model of Fermi gases suitable for semiconductor device simulation is presented. Like other models, such as drift diffusion and hydrodynamics, it employs moments of the Boltzmann transport equation derived using the Fermi-Dirac distribution function. However, unlike other approaches, it replaces the concept of an electron thermal conductivity with the heat capacity of an ideal Fermi gas to determine heat flow. The model is used to simulate a field-effect transistor and show that the external current-voltage characteristics are strong functions of the state space available to the heated Fermi distribution.

  19. Diffusion, Coulombic interactions and multicomponent ionic transport of charged species in saturated porous media

    DEFF Research Database (Denmark)

    Rolle, Massimo; Muniruzzaman, Muhammad

    water are cross-coupled due to the effects of Coulombic interactions. Such effects are illustrated in flow-through experiments in saturated porous media. Simple strong electrolytes (i.e., salts and strong acid solutions) were selected as tracers and their transport was studied under different advection......-dominated conditions in homogeneous and heterogeneous porous media [2-3]. The model-based interpretation of the experimental results is challenging since it requires a multicomponent ionic formulation with an accurate description of local hydrodynamic dispersion and explicitly accounting for the cross-coupling...

  20. Charge transport and magnetoresistance of G4-DNA molecular device modulated by counter ions and dephasing effect

    International Nuclear Information System (INIS)

    Kang, Da-wei; Sun, Meng-le; Zuo, Zheng-wei; Wang, Hui-xian; Lv, Shi-jie; Li, Xin-zhong; Li, Li-ben


    The charge transport properties of the G4-DNA molecular device in the presence of counter ions and dephasing effect are investigated based on the Green function method and Landauer–Büttiker theory. The currents through the G4-DNA molecular device depend on the interference patterns at different coupling configurations. There is an effective electrostatic interaction between the counter ions and the G4-DNA molecule which introduces disorder into the on-site energies of G bases. The current through the device can be enhanced by the small disorder which avoids the strong interference of electrons at the same energy in some coupling configurations, however the diagonal disorder can suppress the overall current due to the Anderson localization of charge carriers when the disorder is large. In the presence of dephasing effect the current through the device at all coupling configurations can be enhanced as a result of the phase coherence losing of electron. As for the magnetic field response, the magnetoresistance of the device is always suppressed by the counter ions and dephasing effect. - Highlights: • The counter ions can some times enhance the current through G4-DNA molecule. • The dephasing effect can enhance the current of the device at all four coupling configurations. • The magnetoresistance is always suppressed by the counter ions and dephasing effect.