WorldWideScience

Sample records for dna-mediated charge transport

  1. Charge transport through DNA based electronic barriers

    Science.gov (United States)

    Patil, Sunil R.; Chawda, Vivek; Qi, Jianqing; Anantram, M. P.; Sinha, Niraj

    2018-05-01

    We report charge transport in electronic 'barriers' constructed by sequence engineering in DNA. Considering the ionization potentials of Thymine-Adenine (AT) and Guanine-Cytosine (GC) base pairs, we treat AT as 'barriers'. The effect of DNA conformation (A and B form) on charge transport is also investigated. Particularly, the effect of width of 'barriers' on hole transport is investigated. Density functional theory (DFT) calculations are performed on energy minimized DNA structures to obtain the electronic Hamiltonian. The quantum transport calculations are performed using the Landauer-Buttiker framework. Our main findings are contrary to previous studies. We find that a longer A-DNA with more AT base pairs can conduct better than shorter A-DNA with a smaller number of AT base pairs. We also find that some sequences of A-DNA can conduct better than a corresponding B-DNA with the same sequence. The counterions mediated charge transport and long range interactions are speculated to be responsible for counter-intuitive length and AT content dependence of conductance of A-DNA.

  2. Effect of base-pair inhomogeneities on charge transport along the DNA molecule, mediated by twist and radial polarons

    International Nuclear Information System (INIS)

    Palmero, F; Archilla, J F R; Hennig, D; Romero, F R

    2004-01-01

    Some recent results for a three-dimensional, semi-classical, tight-binding model for DNA show that there are two types of polarons, namely radial and twist polarons, which can transport charge along the DNA molecule. However, the existence of two types of base pairs in real DNA makes it crucial to find out if charge transport also exists in DNA chains with different base pairs. In this paper, we address this problem in its simple case, a homogeneous chain except for a single different base pair, which we call a base-pair inhomogeneity, and its effect on charge transport. Radial polarons experience either reflection or trapping. However, twist polarons are good candidates for charge transport along real DNA. This transport is also very robust with respect to weak parametric and diagonal disorder

  3. DNA-Mediated Electrochemistry

    Science.gov (United States)

    Gorodetsky, Alon A.; Buzzeo, Marisa C.

    2009-01-01

    The base pair stack of DNA has been demonstrated as a medium for long range charge transport chemistry both in solution and at DNA-modified surfaces. This chemistry is exquisitely sensitive to structural perturbations in the base pair stack as occur with lesions, single base mismatches, and protein binding. We have exploited this sensitivity for the development of reliable electrochemical assays based on DNA charge transport at self-assembled DNA monolayers. Here we discuss the characteristic features, applications, and advantages of DNA-mediated electrochemistry. PMID:18980370

  4. A Molecular Dynamics-Quantum Mechanics Theoretical Study of DNA-Mediated Charge Transport in Hydrated Ionic Liquids.

    Science.gov (United States)

    Meng, Zhenyu; Kubar, Tomas; Mu, Yuguang; Shao, Fangwei

    2018-05-08

    Charge transport (CT) through biomolecules is of high significance in the research fields of biology, nanotechnology, and molecular devices. Inspired by our previous work that showed the binding of ionic liquid (IL) facilitated charge transport in duplex DNA, in silico simulation is a useful means to understand the microscopic mechanism of the facilitation phenomenon. Here molecular dynamics simulations (MD) of duplex DNA in water and hydrated ionic liquids were employed to explore the helical parameters. Principal component analysis was further applied to capture the subtle conformational changes of helical DNA upon different environmental impacts. Sequentially, CT rates were calculated by a QM/MM simulation of the flickering resonance model based upon MD trajectories. Herein, MD simulation illustrated that the binding of ionic liquids can restrain dynamic conformation and lower the on-site energy of the DNA base. Confined movement among the adjacent base pairs was highly related to the increase of electronic coupling among base pairs, which may lead DNA to a CT facilitated state. Sequentially combining MD and QM/MM analysis, the rational correlations among the binding modes, the conformational changes, and CT rates illustrated the facilitation effects from hydrated IL on DNA CT and supported a conformational-gating mechanism.

  5. Long-range charge transport in single G-quadruplex DNA molecules

    DEFF Research Database (Denmark)

    Livshits, Gideon I.; Stern, Avigail; Rotem, Dvir

    2014-01-01

    DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set-ups, and transport......DNA and DNA-based polymers are of interest in molecular electronics because of their versatile and programmable structures. However, transport measurements have produced a range of seemingly contradictory results due to differences in the measured molecules and experimental set......-ups, and transporting significant current through individual DNA-based molecules remains a considerable challenge. Here, we report reproducible charge transport in guanine-quadruplex (G4) DNA molecules adsorbed on a mica substrate. Currents ranging from tens of picoamperes to more than 100 pA were measured in the G4......-DNA over distances ranging from tens of nanometres to more than 100 nm. Our experimental results, combined with theoretical modelling, suggest that transport occurs via a thermally activated long-range hopping between multi-tetrad segments of DNA. These results could re-ignite interest in DNA...

  6. DNA Charge Transport: From Chemical Principles to the Cell

    Science.gov (United States)

    Arnold, Anna R.; Grodick, Michael A.; Barton, Jacqueline K.

    2016-01-01

    The DNA double helix has captured the imagination of many, bringing it to the forefront of biological research. DNA has unique features that extend our interest into areas of chemistry, physics, material science and engineering. Our laboratory has focused on studies of DNA charge transport (CT), wherein charges can efficiently travel long molecular distances through the DNA helix while maintaining an exquisite sensitivity to base pair π-stacking. Because DNA CT chemistry reports on the integrity of the DNA duplex, this property may be exploited to develop electrochemical devices to detect DNA lesions and DNA-binding proteins. Furthermore, studies now indicate that DNA CT may also be used in the cell by, for example, DNA repair proteins, as a cellular diagnostic, in order to scan the genome to localize efficiently to damage sites. In this review, we describe this evolution of DNA CT chemistry from the discovery of fundamental chemical principles to applications in diagnostic strategies and possible roles in biology. PMID:26933744

  7. Charge transport properties of a twisted DNA molecule: A renormalization approach

    Energy Technology Data Exchange (ETDEWEB)

    Almeida, M.L. de; Ourique, G.S.; Fulco, U.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Albuquerque, E.L., E-mail: eudenilson@gmail.com [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Moura, F.A.B.F. de; Lyra, M.L. [Instituto de Física, Universidade Federal de Alagoas, 57072-900 Maceió-AL (Brazil)

    2016-10-20

    In this work we study the charge transport properties of a nanodevice consisting of a finite segment of the DNA molecule sandwiched between two metallic electrodes. Our model takes into account a nearest-neighbor tight-binding Hamiltonian considering the nucleobases twist motion, whose solutions make use of a two-steps renormalization process to simplify the algebra, which can be otherwise quite involved. The resulting variations of the charge transport efficiency are analyzed by numerically computing the main features of the electron transmittance spectra as well as their I × V characteristic curves.

  8. Charge transport through exciton shelves in cadmium chalcogenide quantum dot-DNA nano-bioelectronic thin films

    Science.gov (United States)

    Goodman, Samuel M.; Noh, Hyunwoo; Singh, Vivek; Cha, Jennifer N.; Nagpal, Prashant

    2015-02-01

    Quantum dot (QD), or semiconductor nanocrystal, thin films are being explored for making solution-processable devices due to their size- and shape-tunable bandgap and discrete higher energy electronic states. While DNA has been extensively used for the self-assembly of nanocrystals, it has not been investigated for the simultaneous conduction of multiple energy charges or excitons via exciton shelves (ES) formed in QD-DNA nano-bioelectronic thin films. Here, we present studies on charge conduction through exciton shelves, which are formed via chemically coupled QDs and DNA, between electronic states of the QDs and the HOMO-LUMO levels in the complementary DNA nucleobases. While several challenges need to be addressed in optimizing the formation of devices using QD-DNA thin films, a higher charge collection efficiency for hot-carriers and our detailed investigations of charge transport mechanism in these thin films highlight their potential for applications in nano-bioelectronic devices and biological transducers.

  9. Charge transport through exciton shelves in cadmium chalcogenide quantum dot-DNA nano-bioelectronic thin films

    Energy Technology Data Exchange (ETDEWEB)

    Goodman, Samuel M.; Singh, Vivek [Department of Chemical and Biological Engineering, University of Colorado Boulder, 3415 Colorado Avenue, Boulder, Colorado 80303 (United States); Noh, Hyunwoo [Department of Chemical and Biological Engineering, University of Colorado Boulder, 3415 Colorado Avenue, Boulder, Colorado 80303 (United States); Materials Science and Engineering Program and Department of Nanoengineering, University of California, 9500 Gilman Drive, La Jolla, San Diego, California 92093 (United States); Cha, Jennifer N. [Department of Chemical and Biological Engineering, University of Colorado Boulder, 3415 Colorado Avenue, Boulder, Colorado 80303 (United States); Materials Science and Engineering Program and Department of Nanoengineering, University of California, 9500 Gilman Drive, La Jolla, San Diego, California 92093 (United States); Materials Science and Engineering, University of Colorado Boulder, 3415 Colorado Avenue, Boulder, Colorado 80303 (United States); Nagpal, Prashant, E-mail: pnagpal@colorado.edu [Department of Chemical and Biological Engineering, University of Colorado Boulder, 3415 Colorado Avenue, Boulder, Colorado 80303 (United States); Materials Science and Engineering, University of Colorado Boulder, 3415 Colorado Avenue, Boulder, Colorado 80303 (United States); BioFrontiers Institute, University of Colorado Boulder, 3415 Colorado Avenue, Boulder, Colorado 80303 (United States); Renewable and Sustainable Energy Institute, University of Colorado Boulder, 2445 Kittredge Loop, Boulder, Colorado 80309 (United States)

    2015-02-23

    Quantum dot (QD), or semiconductor nanocrystal, thin films are being explored for making solution-processable devices due to their size- and shape-tunable bandgap and discrete higher energy electronic states. While DNA has been extensively used for the self-assembly of nanocrystals, it has not been investigated for the simultaneous conduction of multiple energy charges or excitons via exciton shelves (ES) formed in QD-DNA nano-bioelectronic thin films. Here, we present studies on charge conduction through exciton shelves, which are formed via chemically coupled QDs and DNA, between electronic states of the QDs and the HOMO-LUMO levels in the complementary DNA nucleobases. While several challenges need to be addressed in optimizing the formation of devices using QD-DNA thin films, a higher charge collection efficiency for hot-carriers and our detailed investigations of charge transport mechanism in these thin films highlight their potential for applications in nano-bioelectronic devices and biological transducers.

  10. Charge transport through exciton shelves in cadmium chalcogenide quantum dot-DNA nano-bioelectronic thin films

    International Nuclear Information System (INIS)

    Goodman, Samuel M.; Singh, Vivek; Noh, Hyunwoo; Cha, Jennifer N.; Nagpal, Prashant

    2015-01-01

    Quantum dot (QD), or semiconductor nanocrystal, thin films are being explored for making solution-processable devices due to their size- and shape-tunable bandgap and discrete higher energy electronic states. While DNA has been extensively used for the self-assembly of nanocrystals, it has not been investigated for the simultaneous conduction of multiple energy charges or excitons via exciton shelves (ES) formed in QD-DNA nano-bioelectronic thin films. Here, we present studies on charge conduction through exciton shelves, which are formed via chemically coupled QDs and DNA, between electronic states of the QDs and the HOMO-LUMO levels in the complementary DNA nucleobases. While several challenges need to be addressed in optimizing the formation of devices using QD-DNA thin films, a higher charge collection efficiency for hot-carriers and our detailed investigations of charge transport mechanism in these thin films highlight their potential for applications in nano-bioelectronic devices and biological transducers

  11. Charge splitters and charge transport junctions based on guanine quadruplexes

    Science.gov (United States)

    Sha, Ruojie; Xiang, Limin; Liu, Chaoren; Balaeff, Alexander; Zhang, Yuqi; Zhang, Peng; Li, Yueqi; Beratan, David N.; Tao, Nongjian; Seeman, Nadrian C.

    2018-04-01

    Self-assembling circuit elements, such as current splitters or combiners at the molecular scale, require the design of building blocks with three or more terminals. A promising material for such building blocks is DNA, wherein multiple strands can self-assemble into multi-ended junctions, and nucleobase stacks can transport charge over long distances. However, nucleobase stacking is often disrupted at junction points, hindering electric charge transport between the two terminals of the junction. Here, we show that a guanine-quadruplex (G4) motif can be used as a connector element for a multi-ended DNA junction. By attaching specific terminal groups to the motif, we demonstrate that charges can enter the structure from one terminal at one end of a three-way G4 motif, and can exit from one of two terminals at the other end with minimal carrier transport attenuation. Moreover, we study four-way G4 junction structures by performing theoretical calculations to assist in the design and optimization of these connectors.

  12. Charge transport in DNA oligonucleotides with various base-pairing patterns

    Czech Academy of Sciences Publication Activity Database

    Kratochvílová, Irena; Todorciuc, Tatiana; Král, Karel; Němec, Hynek; Bunček, M.; Šebera, Jakub; Záliš, Stanislav; Vokáčová, Zuzana; Sychrovský, Vladimír; Bednárová, Lucie; Mojzeš, P.; Schneider, Bohdan

    2010-01-01

    Roč. 114, č. 15 (2010), 5196–5205 ISSN 1520-6106 R&D Projects: GA ČR GA203/08/1594; GA AV ČR KAN401770651; GA MŠk OC 137; GA ČR GA202/07/0643; GA AV ČR IAA400550701; GA AV ČR KAN200100801; GA AV ČR KAN100400702; GA ČR GA202/09/0193 Institutional research plan: CEZ:AV0Z10100520; CEZ:AV0Z40500505; CEZ:AV0Z40400503; CEZ:AV0Z40550506; CEZ:AV0Z50520701 Keywords : DNA * charge transport * Scanning Tunneling Microscopy Subject RIV: CC - Organic Chemistry Impact factor: 3.603, year: 2010

  13. Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

    Science.gov (United States)

    Sinurat, E. N.; Yudiarsah, E.

    2017-07-01

    The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

  14. Charge Migration in DNA Perspectives from Physics, Chemistry, and Biology

    CERN Document Server

    Chakraborty, Tapash

    2007-01-01

    Charge migration through DNA has been the focus of considerable interest in recent years. A deeper understanding of the nature of charge transfer and transport along the double helix is important in fields as diverse as physics, chemistry and nanotechnology. It has also important implications in biology, in particular in DNA damage and repair. This book presents contributions from an international team of researchers active in this field. It contains a wide range of topics that includes the mathematical background of the quantum processes involved, the role of charge transfer in DNA radiation damage, a new approach to DNA sequencing, DNA photonics, and many others. This book should be of value to researchers in condensed matter physics, chemical physics, physical chemistry, and nanoscale sciences.

  15. Charge transport in polyguanine-polycytosine DNA molecules

    International Nuclear Information System (INIS)

    Wei, J H; Chan, K S

    2007-01-01

    A double chain tight-binding model is proposed to interpret the experimental I-V curves for polyguanine-polycytosine DNA molecules reported in Porath et al (2000 Nature 493 635). The proposed model includes the salient features of existing transport models of DNA molecules. The proposed double chain model fits excellently with the experimental I-V curves and provides a theoretical interpretation of features found in the I-V curves, which so far do not have a satisfactory explanation. Steps in the I-V curves are explained as the result of transmission gaps caused by hybridization with reservoirs and inter-chain coupling. Variations in I-V curves are due to the variation of inter-chain and intra-chain hopping parameters caused by structural changes in the DNA molecules

  16. Role of molecular charge in nucleocytoplasmic transport.

    Directory of Open Access Journals (Sweden)

    Alexander Goryaynov

    Full Text Available Transport of genetic materials and proteins between the nucleus and cytoplasm of eukaryotic cells is mediated by nuclear pore complexes (NPCs. A selective barrier formed by phenylalanine-glycine (FG nucleoporins (Nups with net positive charges in the NPC allows for passive diffusion of signal-independent small molecules and transport-receptor facilitated translocation of signal-dependent cargo molecules. Recently, negative surface charge was postulated to be another essential criterion for selective passage through the NPC. However, the charge-driven mechanism in determining the transport kinetics and spatial transport route for either passive diffusion or facilitated translocation remains obscure. Here we employed high-speed single-molecule fluorescence microscopy with an unprecedented spatiotemporal resolution of 9 nm and 400 µs to uncover these mechanistic fundamentals for nuclear transport of charged substrates through native NPCs. We found that electrostatic interaction between negative surface charges on transiting molecules and the positively charged FG Nups, although enhancing their probability of binding to the NPC, never plays a dominant role in determining their nuclear transport mode or spatial transport route. A 3D reconstruction of transport routes revealed that small signal-dependent endogenous cargo protein constructs with high positive surface charges that are destined to the nucleus, rather than repelled from the NPC as suggested in previous models, passively diffused through an axial central channel of the NPC in the absence of transport receptors. Finally, we postulated a comprehensive map of interactions between transiting molecules and FG Nups during nucleocytoplasmic transport by combining the effects of molecular size, signal and surface charge.

  17. Charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion

    Energy Technology Data Exchange (ETDEWEB)

    Rahmi, Kinanti Aldilla, E-mail: kinanti.aldilla@ui.ac.id; Yudiarsah, Efta [Physics Department, FMIPA, Universitas Indonesia, Kampus UI Depok (Indonesia)

    2016-04-19

    By using tight binding Hamiltonian model, charge transport properties of poly(dA)-poly(dT) DNA in variation of backbone disorder and amplitude of base-pair twisting motion is studied. The DNA chain used is 32 base pairs long poly(dA)-poly(dT) molecule. The molecule is contacted to electrode at both ends. The influence of environment on charge transport in DNA is modeled as variation of backbone disorder. The twisting motion amplitude is taking into account by assuming that the twisting angle distributes following Gaussian distribution function with zero average and standard deviation proportional to square root of temperature and inversely proportional to the twisting motion frequency. The base-pair twisting motion influences both the onsite energy of the bases and electron hopping constant between bases. The charge transport properties are studied by calculating current using Landauer-Buttiker formula from transmission probabilities which is calculated by transfer matrix methods. The result shows that as the backbone disorder increases, the maximum current decreases. By decreasing the twisting motion frequency, the current increases rapidly at low voltage, but the current increases slower at higher voltage. The threshold voltage can increase or decrease with increasing backbone disorder and increasing twisting frequency.

  18. Charge transport through DNA/DNA duplexes and DNA/RNA hybrids: complex mechanism study

    Czech Academy of Sciences Publication Activity Database

    Kratochvílová, Irena; Vala, M.; Weiter, M.; Špérová, M.; Schneider, Bohdan; Páv, Ondřej; Šebera, Jakub; Rosenberg, Ivan; Sychrovský, Vladimír

    2013-01-01

    Roč. 20, č. 1 (2013), s. 9-9 ISSN 1211-5894. [Discussions in Structural Molecular Biology. Annual Meeting of the Czech Society for Structural Biology /11./. 14.03.2013-16.03.2013, Nové Hrady] Institutional support: RVO:61388963 ; RVO:68378271 ; RVO:86652036 Keywords : charge transport * fluorescence spectroscopy * DFT Subject RIV: CF - Physical ; Theoretical Chemistry

  19. Charging a Li-O₂ battery using a redox mediator.

    Science.gov (United States)

    Chen, Yuhui; Freunberger, Stefan A; Peng, Zhangquan; Fontaine, Olivier; Bruce, Peter G

    2013-06-01

    The non-aqueous Li-air (O2) battery is receiving intense interest because its theoretical specific energy exceeds that of Li-ion batteries. Recharging the Li-O2 battery depends on oxidizing solid lithium peroxide (Li2O2), which is formed on discharge within the porous cathode. However, transporting charge between Li2O2 particles and the solid electrode surface is at best very difficult and leads to voltage polarization on charging, even at modest rates. This is a significant problem facing the non-aqueous Li-O2 battery. Here we show that incorporation of a redox mediator, tetrathiafulvalene (TTF), enables recharging at rates that are impossible for the cell in the absence of the mediator. On charging, TTF is oxidized to TTF(+) at the cathode surface; TTF(+) in turn oxidizes the solid Li2O2, which results in the regeneration of TTF. The mediator acts as an electron-hole transfer agent that permits efficient oxidation of solid Li2O2. The cell with the mediator demonstrated 100 charge/discharge cycles.

  20. Charge transport and magnetoresistance of G4-DNA molecular device modulated by counter ions and dephasing effect

    International Nuclear Information System (INIS)

    Kang, Da-wei; Sun, Meng-le; Zuo, Zheng-wei; Wang, Hui-xian; Lv, Shi-jie; Li, Xin-zhong; Li, Li-ben

    2016-01-01

    The charge transport properties of the G4-DNA molecular device in the presence of counter ions and dephasing effect are investigated based on the Green function method and Landauer–Büttiker theory. The currents through the G4-DNA molecular device depend on the interference patterns at different coupling configurations. There is an effective electrostatic interaction between the counter ions and the G4-DNA molecule which introduces disorder into the on-site energies of G bases. The current through the device can be enhanced by the small disorder which avoids the strong interference of electrons at the same energy in some coupling configurations, however the diagonal disorder can suppress the overall current due to the Anderson localization of charge carriers when the disorder is large. In the presence of dephasing effect the current through the device at all coupling configurations can be enhanced as a result of the phase coherence losing of electron. As for the magnetic field response, the magnetoresistance of the device is always suppressed by the counter ions and dephasing effect. - Highlights: • The counter ions can some times enhance the current through G4-DNA molecule. • The dephasing effect can enhance the current of the device at all four coupling configurations. • The magnetoresistance is always suppressed by the counter ions and dephasing effect.

  1. The role of cytosine methylation on charge transport through a DNA strand

    Energy Technology Data Exchange (ETDEWEB)

    Qi, Jianqing, E-mail: jqqi@uw.edu; Anantram, M. P., E-mail: anantmp@uw.edu [Department of Electrical Engineering, University of Washington, Seattle, Washington 98195-2500 (United States); Govind, Niranjan, E-mail: niri.govind@pnnl.gov [William R. Wiley Environmental Molecular Sciences Laboratory, Pacific Northwest National Laboratory, Richland, Washington 99352 (United States)

    2015-09-07

    Cytosine methylation has been found to play a crucial role in various biological processes, including a number of human diseases. The detection of this small modification remains challenging. In this work, we computationally explore the possibility of detecting methylated DNA strands through direct electrical conductance measurements. Using density functional theory and the Landauer-Büttiker method, we study the electronic properties and charge transport through an eight base-pair methylated DNA strand and its native counterpart. We first analyze the effect of cytosine methylation on the tight-binding parameters of two DNA strands and then model the transmission of the electrons and conductance through the strands both with and without decoherence. We find that the main difference of the tight-binding parameters between the native DNA and the methylated DNA lies in the on-site energies of (methylated) cytosine bases. The intra- and inter-strand hopping integrals between two nearest neighboring guanine base and (methylated) cytosine base also change with the addition of the methyl groups. Our calculations show that in the phase-coherent limit, the transmission of the methylated strand is close to the native strand when the energy is nearby the highest occupied molecular orbital level and larger than the native strand by 5 times in the bandgap. The trend in transmission also holds in the presence of the decoherence with the same rate. The lower conductance for the methylated strand in the experiment is suggested to be caused by the more stable structure due to the introduction of the methyl groups. We also study the role of the exchange-correlation functional and the effect of contact coupling by choosing coupling strengths ranging from weak to strong coupling limit.

  2. Charge transfer in DNA: role of base pairing

    Czech Academy of Sciences Publication Activity Database

    Kratochvílová, Irena; Bunček, M.; Schneider, Bohdan

    2009-01-01

    Roč. 38, Suppl. (2009), S123-S123 ISSN 0175-7571. [EBSA European Biophysics Congress /7./. Genoa, 11.07.2009-15.07.2009] Institutional research plan: CEZ:AV0Z10100520; CEZ:AV0Z50520701 Keywords : DNA * charge transport * base pairing Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 2.437, year: 2009

  3. Studies of charge transport in DNA films using the time-of-flight (TOF) technique

    Science.gov (United States)

    Yaney, Perry P.; Gorman, Timothy; Ouchen, Fahima; Grote, James G.

    2011-09-01

    Measurements were carried out on salmon DNA-based films, including as-received DNA (molecular weight, MW>2000 kDa) without and with hexacetyltrimethl-ammonium chloride (CTMA) surfactant, and sonicated DNA of MW~200 kDa with CTMA. The test specimens were spin-coated or drop-cast films on ITO-coated quartz slides with a gold charge-collecting electrode. To protect the films from atmospheric influences, the TOF devices were coated with a 200-400 nm polyurethane passivation layer. A quadrupled 20 ns, pulsed Nd:YAG laser with output at 266 nm was used for charge injection. The room temperature photoconductive transients were dispersive to varying degrees with hole mobilities in DNA materials films ranging between 2E-5 to 6E-3 cm2/Vs for fields ranging from 8 to 58 kV/cm. Only hole response was observed in DNA. The dispersive data were analyzed using a simple, quasi-empirical equation for the photocurrent transient data.

  4. Charge transfer through DNA/DNA duplexes and DNA/RNA hybrids: complex theoretical and experimental studies.

    Science.gov (United States)

    Kratochvílová, Irena; Vala, Martin; Weiter, Martin; Špérová, Miroslava; Schneider, Bohdan; Páv, Ondřej; Šebera, Jakub; Rosenberg, Ivan; Sychrovský, Vladimír

    2013-01-01

    Oligonucleotides conduct electric charge via various mechanisms and their characterization and understanding is a very important and complicated task. In this work, experimental (temperature dependent steady state fluorescence spectroscopy, time-resolved fluorescence spectroscopy) and theoretical (Density Functional Theory) approaches were combined to study charge transfer processes in short DNA/DNA and RNA/DNA duplexes with virtually equivalent sequences. The experimental results were consistent with the theoretical model - the delocalized nature of HOMO orbitals and holes, base stacking, electronic coupling and conformational flexibility formed the conditions for more effective short distance charge transfer processes in RNA/DNA hybrids. RNA/DNA and DNA/DNA charge transfer properties were strongly connected with temperature affected structural changes of molecular systems - charge transfer could be used as a probe of even tiny changes of molecular structures and settings. © 2013. Published by Elsevier B.V. All rights reserved.

  5. Like-charge attraction and opposite-charge decomplexation between polymers and DNA molecules

    OpenAIRE

    Buyukdagli, Sahin

    2016-01-01

    We scrutinize the effect of polyvalent ions on polymer-DNA interactions. We extend a recently developed test charge theory to the case of a stiff polymer interacting with a DNA molecule in an electrolyte mixture. The theory accounts for one-loop level electrostatic correlation effects such as the ionic cloud deformation around the strongly charged DNA molecule as well as image-charge forces induced by the low DNA permittivity. Our model can reproduce and explain various characteristics of the...

  6. Effect of a Dual Charge on the DNA-Conjugated Redox Probe on DNA Sensing by Short Hairpin Beacons Tethered to Gold Electrodes.

    Science.gov (United States)

    Kékedy-Nagy, László; Shipovskov, Stepan; Ferapontova, Elena E

    2016-08-16

    Charges of redox species can critically affect both the interfacial state of DNA and electrochemistry of DNA-conjugated redox labels and, as a result, the electroanalytical performance of those systems. Here, we show that the kinetics of electron transfer (ET) between the gold electrode and methylene blue (MB) label conjugated to a double-stranded (ds) DNA tethered to gold strongly depend on the charge of the MB molecule, and that affects the performance of genosensors exploiting MB-labeled hairpin DNA beacons. Positively charged MB binds to dsDNA via electrostatic and intercalative/groove binding, and this binding allows the DNA-mediated electrochemistry of MB intercalated into the duplex and, as a result, a complex mode of the electrochemical signal change upon hairpin hybridization to the target DNA, dominated by the "on-off" signal change mode at nanomolar levels of the analyzed DNA. When MB bears an additional carboxylic group, the negative charge provided by this group prevents intimate interactions between MB and DNA, and then the ET in duplexes is limited by the diffusion of the MB-conjugated dsDNA (the phenomenon first shown in Farjami , E. ; Clima , L. ; Gothelf , K. ; Ferapontova , E. E. Anal. Chem. 2011 , 83 , 1594 ) providing the robust "off-on" nanomolar DNA sensing. Those results can be extended to other intercalating redox probes and are of strategic importance for design and development of electrochemical hybridization sensors exploiting DNA nanoswitchable architectures.

  7. Directional rolling of positively charged nanoparticles along a flexibility gradient on long DNA molecules.

    Science.gov (United States)

    Park, Suehyun; Joo, Heesun; Kim, Jun Soo

    2018-01-31

    Directing the motion of molecules/colloids in any specific direction is of great interest in many applications of chemistry, physics, and biological sciences, where regulated positioning or transportation of materials is highly desired. Using Brownian dynamics simulations of coarse-grained models of a long, double-stranded DNA molecule and positively charged nanoparticles, we observed that the motion of a single nanoparticle bound to and wrapped by the DNA molecule can be directed along a gradient of DNA local flexibility. The flexibility gradient is constructed along a 0.8 kilobase-pair DNA molecule such that local persistence length decreases gradually from 50 nm to 40 nm, mimicking a gradual change in sequence-dependent flexibility. Nanoparticles roll over a long DNA molecule from less flexible regions towards more flexible ones as a result of the decreasing energetic cost of DNA bending and wrapping. In addition, the rolling becomes slightly accelerated as the positive charge of nanoparticles decreases due to a lower free energy barrier of DNA detachment from charged nanoparticle for processive rolling. This study suggests that the variation in DNA local flexibility can be utilized in constructing and manipulating supramolecular assemblies of DNA molecules and nanoparticles in structural DNA nanotechnology.

  8. Charge transfer in pi-stacked systems including DNA

    International Nuclear Information System (INIS)

    Siebbeles, L.D.A.

    2003-01-01

    Charge migration in DNA is a subject of intense current study motivated by long-range detection of DNA damage and the potential application of DNA as a molecular wire in nanoscale electronic devices. A key structural element, which makes DNA a medium for long-range charge transfer, is the array of stacked base pairs in the interior of the double helix. The overlapping pi-orbitals of the nucleobases provide a pathway for motion of charge carriers generated on the stack. This 'pi-pathway' resembles the columnarly stacked macrocyclic cores in discotic materials such as triphenylenes. The structure of these pi-stacked systems is highly disordered with dynamic fluctuations occurring on picosecond to nanosecond time scales. Theoretical calculations, concerning the effects of structural disorder and nucleobase sequence in DNA, on the dynamics of charge carriers are presented. Electronic couplings and localization energies of charge carriers were calculated using density functional theory (DFT). Results for columnarly stacked triphenylenes and DNA nucleobases are compared. The results are used to provide insight into the factors that control the mobility of charge carriers. Further, experimental results on the site-selective oxidation of guanine nucleobases in DNA (hot spots for DNA damage) are analyzed on basis of the theoretical results

  9. Charge transport in organic semiconductors.

    Science.gov (United States)

    Bässler, Heinz; Köhler, Anna

    2012-01-01

    Modern optoelectronic devices, such as light-emitting diodes, field-effect transistors and organic solar cells require well controlled motion of charges for their efficient operation. The understanding of the processes that determine charge transport is therefore of paramount importance for designing materials with improved structure-property relationships. Before discussing different regimes of charge transport in organic semiconductors, we present a brief introduction into the conceptual framework in which we interpret the relevant photophysical processes. That is, we compare a molecular picture of electronic excitations against the Su-Schrieffer-Heeger semiconductor band model. After a brief description of experimental techniques needed to measure charge mobilities, we then elaborate on the parameters controlling charge transport in technologically relevant materials. Thus, we consider the influences of electronic coupling between molecular units, disorder, polaronic effects and space charge. A particular focus is given to the recent progress made in understanding charge transport on short time scales and short length scales. The mechanism for charge injection is briefly addressed towards the end of this chapter.

  10. Dynamic structure mediates halophilic adaptation of a DNA polymerase from the deep-sea brines of the Red Sea.

    Science.gov (United States)

    Takahashi, Masateru; Takahashi, Etsuko; Joudeh, Luay I; Marini, Monica; Das, Gobind; Elshenawy, Mohamed M; Akal, Anastassja; Sakashita, Kosuke; Alam, Intikhab; Tehseen, Muhammad; Sobhy, Mohamed A; Stingl, Ulrich; Merzaban, Jasmeen S; Di Fabrizio, Enzo; Hamdan, Samir M

    2018-01-24

    The deep-sea brines of the Red Sea are remote and unexplored environments characterized by high temperatures, anoxic water, and elevated concentrations of salt and heavy metals. This environment provides a rare system to study the interplay between halophilic and thermophilic adaptation in biologic macromolecules. The present article reports the first DNA polymerase with halophilic and thermophilic features. Biochemical and structural analysis by Raman and circular dichroism spectroscopy showed that the charge distribution on the protein's surface mediates the structural balance between stability for thermal adaptation and flexibility for counteracting the salt-induced rigid and nonfunctional hydrophobic packing. Salt bridge interactions via increased negative and positive charges contribute to structural stability. Salt tolerance, conversely, is mediated by a dynamic structure that becomes more fixed and functional with increasing salt concentration. We propose that repulsive forces among excess negative charges, in addition to a high percentage of negatively charged random coils, mediate this structural dynamism. This knowledge enabled us to engineer a halophilic version of KOD DNA polymerase.-Takahashi, M., Takahashi, E., Joudeh, L. I., Marini, M., Das, G., Elshenawy, M. M., Akal, A., Sakashita, K., Alam, I., Tehseen, M., Sobhy, M. A., Stingl, U., Merzaban, J. S., Di Fabrizio, E., Hamdan, S. M. Dynamic structure mediates halophilic adaptation of a DNA polymerase from the deep-sea brines of the Red Sea.

  11. Dynamic structure mediates halophilic adaptation of a DNA polymerase from the deep-sea brines of the Red Sea

    KAUST Repository

    Takahashi, Masateru; Takahashi, Etsuko; Joudeh, Luay I.; Marini, Monica; Das, Gobind; Elshenawy, Mohamed; Akal, Anastassja; Sakashita, Kosuke; Alam, Intikhab; Tehseen, Muhammad; Sobhy, Mohamed Abdelmaboud; Stingl, Ulrich; Merzaban, Jasmeen; Di Fabrizio, Enzo M.; Hamdan, Samir

    2018-01-01

    The deep-sea brines of the Red Sea are remote and unexplored environments characterized by high temperatures, anoxic water, and elevated concentrations of salt and heavy metals. This environment provides a rare system to study the interplay between halophilic and thermophilic adaptation in biologic macromolecules. The present article reports the first DNA polymerase with halophilic and thermophilic features. Biochemical and structural analysis by Raman and circular dichroism spectroscopy showed that the charge distribution on the protein’s surface mediates the structural balance between stability for thermal adaptation and flexibility for counteracting the salt-induced rigid and nonfunctional hydrophobic packing. Salt bridge interactions via increased negative and positive charges contribute to structural stability. Salt tolerance, conversely, is mediated by a dynamic structure that becomes more fixed and functional with increasing salt concentration. We propose that repulsive forces among excess negative charges, in addition to a high percentage of negatively charged random coils, mediate this structural dynamism. This knowledge enabled us to engineer a halophilic version of KOD DNA polymerase.—Takahashi, M., Takahashi, E., Joudeh, L. I., Marini, M., Das, G., Elshenawy, M. M., Akal, A., Sakashita, K., Alam, I., Tehseen, M., Sobhy, M. A., Stingl, U., Merzaban, J. S., Di Fabrizio, E., Hamdan, S. M. Dynamic structure mediates halophilic adaptation of a DNA polymerase from the deep-sea brines of the Red Sea.

  12. Dynamic structure mediates halophilic adaptation of a DNA polymerase from the deep-sea brines of the Red Sea

    KAUST Repository

    Takahashi, Masateru

    2018-01-24

    The deep-sea brines of the Red Sea are remote and unexplored environments characterized by high temperatures, anoxic water, and elevated concentrations of salt and heavy metals. This environment provides a rare system to study the interplay between halophilic and thermophilic adaptation in biologic macromolecules. The present article reports the first DNA polymerase with halophilic and thermophilic features. Biochemical and structural analysis by Raman and circular dichroism spectroscopy showed that the charge distribution on the protein’s surface mediates the structural balance between stability for thermal adaptation and flexibility for counteracting the salt-induced rigid and nonfunctional hydrophobic packing. Salt bridge interactions via increased negative and positive charges contribute to structural stability. Salt tolerance, conversely, is mediated by a dynamic structure that becomes more fixed and functional with increasing salt concentration. We propose that repulsive forces among excess negative charges, in addition to a high percentage of negatively charged random coils, mediate this structural dynamism. This knowledge enabled us to engineer a halophilic version of KOD DNA polymerase.—Takahashi, M., Takahashi, E., Joudeh, L. I., Marini, M., Das, G., Elshenawy, M. M., Akal, A., Sakashita, K., Alam, I., Tehseen, M., Sobhy, M. A., Stingl, U., Merzaban, J. S., Di Fabrizio, E., Hamdan, S. M. Dynamic structure mediates halophilic adaptation of a DNA polymerase from the deep-sea brines of the Red Sea.

  13. Electric field-mediated transport of plasmid DNA in tumor interstitium in vivo.

    Science.gov (United States)

    Henshaw, Joshua W; Zaharoff, David A; Mossop, Brian J; Yuan, Fan

    2007-11-01

    Local pulsed electric field application is a method for improving non-viral gene delivery. Mechanisms of the improvement include electroporation and electrophoresis. To understand how electrophoresis affects pDNA delivery in vivo, we quantified the magnitude of electric field-induced interstitial transport of pDNA in 4T1 and B16.F10 tumors implanted in mouse dorsal skin-fold chambers. Four different electric pulse sequences were used in this study, each consisted of 10 identical pulses that were 100 or 400 V/cm in strength and 20 or 50 ms in duration. The interval between consecutive pulses was 1 s. The largest distance of transport was obtained with the 400 V/cm and 50 ms pulse, and was 0.23 and 0.22 microm/pulse in 4T1 and B16.F10 tumors, respectively. There were no significant differences in transport distances between 4T1 and B16.F10 tumors. Results from in vivo mapping and numerical simulations revealed an approximately uniform intratumoral electric field that was predominantly in the direction of the applied field. The data in the study suggested that interstitial transport of pDNA induced by a sequence of ten electric pulses was ineffective for macroscopic delivery of genes in tumors. However, the induced transport was more efficient than passive diffusion.

  14. Cloning and functional expression of a human pancreatic islet glucose-transporter cDNA

    International Nuclear Information System (INIS)

    Permutt, M.A.; Koranyi, L.; Keller, K.; Lacy, P.E.; Scharp, D.W.; Mueckler, M.

    1989-01-01

    Previous studies have suggested that pancreatic islet glucose transport is mediated by a high-K m , low-affinity facilitated transporter similar to that expressed in liver. To determine the relationship between islet and liver glucose transporters, liver-type glucose-transporter cDNA clones were isolated from a human liver cDNA library. The liver-type glucose-transporter cDNA clone hybridized to mRNA transcripts of the same size in human liver and pancreatic islet RNA. A cDNA library was prepared from purified human pancreatic islet tissue and screened with human liver-type glucose-transporter cDNA. The authors isolated two overlapping cDNA clones encompassing 2600 base pairs, which encode a pancreatic islet protein identical in sequence to that of the putative liver-type glucose-transporter protein. Xenopus oocytes injected with synthetic mRNA transcribed from a full-length cDNA construct exhibited increased uptake of 2-deoxyglucose, confirming the functional identity of the clone. These cDNA clones can now be used to study regulation of expression of the gene and to assess the role of inherited defects in this gene as a candidate for inherited susceptibility to non-insulin-dependent diabetes mellitus

  15. Fermi arc mediated entropy transport in topological semimetals

    Science.gov (United States)

    McCormick, Timothy M.; Watzman, Sarah J.; Heremans, Joseph P.; Trivedi, Nandini

    2018-05-01

    The low-energy excitations of topological Weyl semimetals are composed of linearly dispersing Weyl fermions that act as monopoles of Berry curvature in the bulk momentum space. Furthermore, on the surface there exist topologically protected Fermi arcs at the projections of these Weyl points. We propose a pathway for entropy transport involving Fermi arcs on one surface connecting to Fermi arcs on the other surface via the bulk Weyl monopoles. We present results for the temperature and magnetic field dependence of the magnetothermal conductance of this conveyor belt channel. The circulating currents result in a net entropy transport without any net charge transport. We provide results for the Fermi arc mediated magnetothermal conductivity in the low-field semiclassical limit as well as in the high-field ultraquantum limit, where only chiral Landau levels are involved. Our work provides a proposed signature of Fermi arc mediated magnetothermal transport and sets the stage for utilizing and manipulating the topological Fermi arcs in thermal applications.

  16. Charge transport problem

    International Nuclear Information System (INIS)

    Lee, E.P.

    1977-01-01

    In a recent report (UCID 17346, ''Relativistic Particle Beam in a Semi-Infinite Axially Symmetric conducting channel extending from a perfectly conducting plane,'' Dec. 13, 1976) Cooper and Neil demonstrate that the net charge transported by a beam pulse injected into a channel of finite conductivity equals the charge of the beam itself. The channel is taken to be infinite in the positive z direction, has finite radius and is terminated by a conducting ground plane at z =0. This result is not an obvious one, and it is restricted in its applicability by the special model assumed for the channel. It is the purpose to explain the result of Cooper and Neil in more qualitative terms and to make similar calculations using several other channel models. It must be emphasized that these calculations are not concerned with the fate of the transported charge after the pulse has stopped, but rather with how much charge leaves the ground plane assuming the pulse does not stop

  17. DNA-labeled micro- and nanoparticles: a new approach to study contaminant transport in the subsurface

    Science.gov (United States)

    McNew, C.; Wang, C.; Kocis, T. N.; Murphy, N. P.; Dahlke, H. E.

    2017-12-01

    Though our understanding of contaminant behavior in the subsurface has improved, our ability to measure and predict complex contaminant transport pathways at hillslope to watershed scales is still lacking. By utilizing bio-molecular nanotechnology developed for nano-medicines and drug delivery, we are able to produce DNA-labeled micro- and nanoparticles for use in a myriad of environmental systems. Control of the fabrication procedure allows us to produce particles of custom size, charge, and surface functionality to mimic the transport properties of the particulate contaminant or colloid of interest. The use of custom sequenced DNA allows for the fabrication of an enormous number of unique particle labels (approximately 1.61 x 1060 unique sequences) and the ability to discern between varied spatial and temporal applications, or the transport effect of varied particle size, charge, or surface properties. To date, this technology has been utilized to study contaminant transport from lab to field scales, including surface and open channel flow applications, transport in porous media, soil retention, and even subglacial flow pathways. Here, we present the technology for production and detection of the DNA-labeled particles along with the results from a current hillslope study at the Sierra Foothills Research and Extension Center (SFREC). This field study utilizes spatial and temporal variations in DNA-labeled particle applications to identify subsurface pollutant transport pathways through the four distinct soil horizons present at the SFREC site. Results from this and previous studies highlight the tremendous potential of the DNA-labeled particle technology for studying contaminant transport through the subsurface.

  18. Crystal structure of the gamma-2 herpesvirus LANA DNA binding domain identifies charged surface residues which impact viral latency.

    Directory of Open Access Journals (Sweden)

    Bruno Correia

    Full Text Available Latency-associated nuclear antigen (LANA mediates γ2-herpesvirus genome persistence and regulates transcription. We describe the crystal structure of the murine gammaherpesvirus-68 LANA C-terminal domain at 2.2 Å resolution. The structure reveals an alpha-beta fold that assembles as a dimer, reminiscent of Epstein-Barr virus EBNA1. A predicted DNA binding surface is present and opposite this interface is a positive electrostatic patch. Targeted DNA recognition substitutions eliminated DNA binding, while certain charged patch mutations reduced bromodomain protein, BRD4, binding. Virus containing LANA abolished for DNA binding was incapable of viable latent infection in mice. Virus with mutations at the charged patch periphery exhibited substantial deficiency in expansion of latent infection, while central region substitutions had little effect. This deficiency was independent of BRD4. These results elucidate the LANA DNA binding domain structure and reveal a unique charged region that exerts a critical role in viral latent infection, likely acting through a host cell protein(s.

  19. Overcoming the inhibitory effect of serum on lipofection by increasing the charge ratio of cationic liposome to DNA.

    Science.gov (United States)

    Yang, J P; Huang, L

    1997-09-01

    Since cationic liposome was first developed as a lipofection reagent, a drawback has been noted in that the efficiency of lipofection decreases dramatically after addition of serum to the lipofection medium. This drawback hampers the application of cationic liposome for systematic delivery of genes. In the present studies, we found that the effect of serum on DC-chol liposome-mediated lipofection is dependent on the charge ratio of liposome to DNA. Serum inhibited lipofection activity of the lipoplex at low charge ratios, whereas it enhanced the lipofection activity at high charge ratios. This phenomenon was observed using DOTAP/DOPE but not lipofectamine. Measurement of cellular association of DNA showed that serum could reduce the binding of lipoplex to cells at all tested charge ratios, i.e. 0-10.6. Removal of negatively charged proteins from serum by DEAE Sephacel column abolished the inhibitory effect of serum on lipofection. The fraction contained only negatively charged serum proteins which strongly inhibited lipofection at low charge ratios but not at higher charge ratios. Furthermore, preincubation of serum with positively charged polylysine, which neutralized negatively charged serum proteins, eliminated the inhibitory effect of serum on lipofection. In summary, inactivation of cationic liposome by serum is due to negatively charged serum proteins and it can be overcome by increasing charge ratio of cationic liposome-DNA lipoplexes or by neutralizing the serum with polylysine.

  20. Electronic transport in single-helical protein molecules: Effects of multiple charge conduction pathways and helical symmetry

    Energy Technology Data Exchange (ETDEWEB)

    Kundu, Sourav, E-mail: sourav.kunduphy@gmail.com; Karmakar, S.N.

    2016-07-15

    We propose a tight-binding model to investigate electronic transport properties of single helical protein molecules incorporating both the helical symmetry and the possibility of multiple charge transfer pathways. Our study reveals that due to existence of both the multiple charge transfer pathways and helical symmetry, the transport properties are quite rigid under influence of environmental fluctuations which indicates that these biomolecules can serve as better alternatives in nanoelectronic devices than its other biological counterparts e.g., single-stranded DNA.

  1. Trap-mediated electronic transport properties of gate-tunable pentacene/MoS2 p-n heterojunction diodes.

    Science.gov (United States)

    Kim, Jae-Keun; Cho, Kyungjune; Kim, Tae-Young; Pak, Jinsu; Jang, Jingon; Song, Younggul; Kim, Youngrok; Choi, Barbara Yuri; Chung, Seungjun; Hong, Woong-Ki; Lee, Takhee

    2016-11-10

    We investigated the trap-mediated electronic transport properties of pentacene/molybdenum disulphide (MoS 2 ) p-n heterojunction devices. We observed that the hybrid p-n heterojunctions were gate-tunable and were strongly affected by trap-assisted tunnelling through the van der Waals gap at the heterojunction interfaces between MoS 2 and pentacene. The pentacene/MoS 2 p-n heterojunction diodes had gate-tunable high ideality factor, which resulted from trap-mediated conduction nature of devices. From the temperature-variable current-voltage measurement, a space-charge-limited conduction and a variable range hopping conduction at a low temperature were suggested as the gate-tunable charge transport characteristics of these hybrid p-n heterojunctions. Our study provides a better understanding of the trap-mediated electronic transport properties in organic/2-dimensional material hybrid heterojunction devices.

  2. Trap-controlled charge transport in corona-charged Teflon

    International Nuclear Information System (INIS)

    Gross, B.; Giacometti, J.A.; Ferreira, G.F.L.; Moreno A, R.A.

    1980-01-01

    The stability of negatively charged Teflon electrets is discussed. It is stated that it can only be explained by the assumption that the transport of excess charge is trap - controlled rather than mobility - controlled. (I.C.R.) [pt

  3. Role of geometrical shape in like-charge attraction of DNA.

    Science.gov (United States)

    Kuron, Michael; Arnold, Axel

    2015-03-01

    While the phenomenon of like-charge attraction of DNA is clearly observed experimentally and in simulations, mean-field theories fail to predict it. Kornyshev et al. argued that like-charge attraction is due to DNA's helical geometry and hydration forces. Strong-coupling (SC) theory shows that attraction of like-charged rods is possible through ion correlations alone at large coupling parameters, usually by multivalent counterions. However for SC theory to be applicable, counterion-counterion correlations perpendicular to the DNA strands need to be sufficiently small, which is not a priori the case for DNA even with trivalent counterions. We study a system containing infinitely long DNA strands and trivalent counterions by computer simulations employing varying degrees of coarse-graining. Our results show that there is always attraction between the strands, but its magnitude is indeed highly dependent on the specific shape of the strand. While discreteness of the charge distribution has little influence on the attractive forces, the role of the helical charge distribution is considerable: charged rods maintain a finite distance in equilibrium, while helices collapse to close contact with a phase shift of π, in full agreement with SC predictions. The SC limit is applicable because counterions strongly bind to the charged sites of the helices, so that helix-counterion interactions dominate over counterion-counterion interactions. Thus DNA's helical geometry is not crucial for like-charge DNA attraction, but strongly enhances it, and electrostatic interactions in the strong-coupling limit are sufficient to explain this attraction.

  4. Long-range energy transfer in self-assembled quantum dot-DNA cascades

    Science.gov (United States)

    Goodman, Samuel M.; Siu, Albert; Singh, Vivek; Nagpal, Prashant

    2015-11-01

    The size-dependent energy bandgaps of semiconductor nanocrystals or quantum dots (QDs) can be utilized in converting broadband incident radiation efficiently into electric current by cascade energy transfer (ET) between layers of different sized quantum dots, followed by charge dissociation and transport in the bottom layer. Self-assembling such cascade structures with angstrom-scale spatial precision is important for building realistic devices, and DNA-based QD self-assembly can provide an important alternative. Here we show long-range Dexter energy transfer in QD-DNA self-assembled single constructs and ensemble devices. Using photoluminescence, scanning tunneling spectroscopy, current-sensing AFM measurements in single QD-DNA cascade constructs, and temperature-dependent ensemble devices using TiO2 nanotubes, we show that Dexter energy transfer, likely mediated by the exciton-shelves formed in these QD-DNA self-assembled structures, can be used for efficient transport of energy across QD-DNA thin films.The size-dependent energy bandgaps of semiconductor nanocrystals or quantum dots (QDs) can be utilized in converting broadband incident radiation efficiently into electric current by cascade energy transfer (ET) between layers of different sized quantum dots, followed by charge dissociation and transport in the bottom layer. Self-assembling such cascade structures with angstrom-scale spatial precision is important for building realistic devices, and DNA-based QD self-assembly can provide an important alternative. Here we show long-range Dexter energy transfer in QD-DNA self-assembled single constructs and ensemble devices. Using photoluminescence, scanning tunneling spectroscopy, current-sensing AFM measurements in single QD-DNA cascade constructs, and temperature-dependent ensemble devices using TiO2 nanotubes, we show that Dexter energy transfer, likely mediated by the exciton-shelves formed in these QD-DNA self-assembled structures, can be used for efficient

  5. DNA Electrochemistry with Tethered Methylene Blue

    Science.gov (United States)

    Pheeney, Catrina G.

    2012-01-01

    Methylene blue (MB′), covalently attached to DNA through a flexible C12 alkyl linker, provides a sensitive redox reporter in DNA electrochemistry measurements. Tethered, intercalated MB′ is reduced through DNA-mediated charge transport; the incorporation of a single base mismatch at position 3, 10, or 14 of a 17-mer causes an attenuation of the signal to 62 ± 3% of the well-matched DNA, irrespective of position in the duplex. The redox signal intensity for MB′–DNA is found to be least 3-fold larger than that of Nile blue (NB)–DNA, indicating that MB′ is even more strongly coupled to the π-stack. The signal attenuation due to an intervening mismatch does, however, depend on DNA film density and the backfilling agent used to passivate the surface. These results highlight two mechanisms for reduction of MB′ on the DNA-modified electrode: reduction mediated by the DNA base pair stack and direct surface reduction of MB′ at the electrode. These two mechanisms are distinguished by their rates of electron transfer that differ by 20-fold. The extent of direct reduction at the surface can be controlled by assembly and buffer conditions. PMID:22512327

  6. Lysosomal membrane protein SIDT2 mediates the direct uptake of DNA by lysosomes.

    Science.gov (United States)

    Aizawa, Shu; Contu, Viorica Raluca; Fujiwara, Yuuki; Hase, Katsunori; Kikuchi, Hisae; Kabuta, Chihana; Wada, Keiji; Kabuta, Tomohiro

    2017-01-02

    Lysosomes degrade macromolecules such as proteins and nucleic acids. We previously identified 2 novel types of autophagy, RNautophagy and DNautophagy, where lysosomes directly take up RNA and DNA, in an ATP-dependent manner, for degradation. We have also reported that SIDT2 (SID1 transmembrane family, member 2), an ortholog of the Caenorhabditis elegans putative RNA transporter SID-1 (systemic RNA interference defective-1), mediates RNA translocation during RNautophagy. In this addendum, we report that SIDT2 also mediates DNA translocation in the process of DNautophagy. These findings help elucidate the mechanisms underlying the direct uptake of nucleic acids by lysosomes and the physiological functions of DNautophagy.

  7. Charge Transport Processes in Molecular Junctions

    Science.gov (United States)

    Smith, Christopher Eugene

    Molecular electronics (ME) has evolved into a rich area of exploration that combines the fields of chemistry, materials, electronic engineering and computational modeling to explore the physics behind electronic conduction at the molecular level. Through studying charge transport properties of single molecules and nanoscale molecular materials the field has gained the potential to bring about new avenues for the miniaturization of electrical components where quantum phenomena are utilized to achieve solid state molecular device functionality. Molecular junctions are platforms that enable these studies and consist of a single molecule or a small group of molecules directly connected to electrodes. The work presented in this thesis has built upon the current understanding of the mechanisms of charge transport in ordered junctions using self-assembled monolayer (SAM) molecular thin films. Donor and acceptor compounds were synthesized and incorporated into SAMs grown on metal substrates then the transport properties were measured with conducting probe atomic force microscopy (CP-AFM). In addition to experimentally measured current-voltage (I-V) curves, the transport properties were addressed computationally and modeled theoretically. The key objectives of this project were to 1) investigate the impact of molecular structure on hole and electron charge transport, 2) understand the nature of the charge carriers and their structure-transport properties through long (chemically gated to modulate the transport. These results help advance our understanding of transport behavior in semiconducting molecular thin films, and open opportunities to engineer improved electronic functionality into molecular devices.

  8. Charge-transport simulations in organic semiconductors

    Energy Technology Data Exchange (ETDEWEB)

    May, Falk

    2012-07-06

    In this thesis we have extended the methods for microscopic charge-transport simulations for organic semiconductors, where weak intermolecular interactions lead to spatially localized charge carriers, and the charge transport occurs as an activated hopping process between diabatic states. In addition to weak electronic couplings between these states, different electrostatic environments in the organic material lead to a broadening of the density of states for the charge energies which limits carrier mobilities. The contributions to the method development include (i) the derivation of a bimolecular charge-transfer rate, (ii) the efficient evaluation of intermolecular (outer-sphere) reorganization energies, (iii) the investigation of effects of conformational disorder on intramolecular reorganization energies or internal site energies and (iv) the inclusion of self-consistent polarization interactions for calculation of charge energies. These methods were applied to study charge transport in amorphous phases of small molecules used in the emission layer of organic light emitting diodes (OLED). When bulky substituents are attached to an aromatic core in order to adjust energy levels or prevent crystallization, a small amount of delocalization of the frontier orbital to the substituents can increase electronic couplings between neighboring molecules. This leads to improved charge-transfer rates and, hence, larger charge-mobility. We therefore suggest using the mesomeric effect (as opposed to the inductive effect) when attaching substituents to aromatic cores, which is necessary for example in deep blue OLEDs, where the energy levels of a host molecule have to be adjusted to those of the emitter. Furthermore, the energy landscape for charges in an amorphous phase cannot be predicted by mesoscopic models because they approximate the realistic morphology by a lattice and represent molecular charge distributions in a multipole expansion. The microscopic approach shows that

  9. Efficient Long-Range Hole Transport Through G-Quadruplexes.

    Science.gov (United States)

    Wu, Jingyuan; Meng, Zhenyu; Lu, Yunpeng; Shao, Fangwei

    2017-10-09

    DNA offers a means of long-range charge transport for biology and electric nanodevices. Here, a series of tetra-stranded G-quadruplexes were assembled within a dendritic DNA architecture to explore oxidative charge transport (hole transport) through the G-quadruplex. Efficient charge transport was achieved over 28 Å upon UV irradiation. Over a longer G-quadruplex bridge, hole transport was escalated to a higher efficiency, which resulted in a higher yield than that of the optimal duplex DNA for charge transport, that is, the adenine tract. Efficient long-range hole transport suggests tetra-stranded G-quadruplexes, instead of an oxidation hotspot, hold better potential as an electron conduit than duplex DNA. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Charge Transport in Two-Photon Semiconducting Structures for Solar Fuels.

    Science.gov (United States)

    Liu, Guohua; Du, Kang; Haussener, Sophia; Wang, Kaiying

    2016-10-20

    Semiconducting heterostructures are emerging as promising light absorbers and offer effective electron-hole separation to drive solar chemistry. This technology relies on semiconductor composites or photoelectrodes that work in the presence of a redox mediator and that create cascade junctions to promote surface catalytic reactions. Rational tuning of their structures and compositions is crucial to fully exploit their functionality. In this review, we describe the possibilities of applying the two-photon concept to the field of solar fuels. A wide range of strategies including the indirect combination of two semiconductors by a redox couple, direct coupling of two semiconductors, multicomponent structures with a conductive mediator, related photoelectrodes, as well as two-photon cells are discussed for light energy harvesting and charge transport. Examples of charge extraction models from the literature are summarized to understand the mechanism of interfacial carrier dynamics and to rationalize experimental observations. We focus on a working principle of the constituent components and linking the photosynthetic activity with the proposed models. This work gives a new perspective on artificial photosynthesis by taking simultaneous advantages of photon absorption and charge transfer, outlining an encouraging roadmap towards solar fuels. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Ultrafast Microscopy of Energy and Charge Transport

    Science.gov (United States)

    Huang, Libai

    The frontier in solar energy research now lies in learning how to integrate functional entities across multiple length scales to create optimal devices. Advancing the field requires transformative experimental tools that probe energy transfer processes from the nano to the meso lengthscales. To address this challenge, we aim to understand multi-scale energy transport across both multiple length and time scales, coupling simultaneous high spatial, structural, and temporal resolution. In my talk, I will focus on our recent progress on visualization of exciton and charge transport in solar energy harvesting materials from the nano to mesoscale employing ultrafast optical nanoscopy. With approaches that combine spatial and temporal resolutions, we have recently revealed a new singlet-mediated triplet transport mechanism in certain singlet fission materials. This work demonstrates a new triplet exciton transport mechanism leading to favorable long-range triplet exciton diffusion on the picosecond and nanosecond timescales for solar cell applications. We have also performed a direct measurement of carrier transport in space and in time by mapping carrier density with simultaneous ultrafast time resolution and 50 nm spatial precision in perovskite thin films using transient absorption microscopy. These results directly visualize long-range carrier transport of 220nm in 2 ns for solution-processed polycrystalline CH3NH3PbI3 thin films. The spatially and temporally resolved measurements reported here underscore the importance of the local morphology and establish an important first step towards discerning the underlying transport properties of perovskite materials.

  12. Charge and spin transport in mesoscopic superconductors

    Directory of Open Access Journals (Sweden)

    M. J. Wolf

    2014-02-01

    Full Text Available Background: Non-equilibrium charge transport in superconductors has been investigated intensely in the 1970s and 1980s, mostly in the vicinity of the critical temperature. Much less attention has been paid to low temperatures and the role of the quasiparticle spin.Results: We report here on nonlocal transport in superconductor hybrid structures at very low temperatures. By comparing the nonlocal conductance obtained by using ferromagnetic and normal-metal detectors, we discriminate charge and spin degrees of freedom. We observe spin injection and long-range transport of pure, chargeless spin currents in the regime of large Zeeman splitting. We elucidate charge and spin transport by comparison to theoretical models.Conclusion: The observed long-range chargeless spin transport opens a new path to manipulate and utilize the quasiparticle spin in superconductor nanostructures.

  13. Charge transport in organic crystals

    Energy Technology Data Exchange (ETDEWEB)

    Ortmann, Frank

    2009-07-01

    The understanding of charge transport is one of the central goals in the research on semiconducting crystals. For organic crystals this is particularly complicated due to the strength of the electron-phonon interaction which requires the description of a seamless transition between the limiting cases of a coherent band-transport mechanism and incoherent hopping. In this thesis, charge transport phenomena in organic crystals are studied by theoretical means. A theory for charge transport in organic crystals is developed which covers the whole temperature range from low T, where it reproduces an expression from the Boltzmann equation for band transport, via elevated T, where it generalizes Holstein's small-polaron theory to finite bandwidths, up to high T, for which a temperature dependence equal to Marcus' electron-transfer theory is obtained. Thereby, coherent band transport and thermally induced hopping are treated on equal footing while simultaneously treating the electron-phonon interaction non-perturbatively. By avoiding the approximation of narrow polaron bands the theory allows for the description of large and small polarons and serves as a starting point for computational studies. The theoretical description is completed by using ab initio material parameters for the selected crystals under study. These material parameters are taken from density functional theory calculations for durene, naphthalene, and guanine crystals. Besides the analysis of the transport mechanism, special focus is put on the study of the relationship between mobility anisotropy and structure of the crystals. This study is supported by a 3D-visualization method for the transport channels in such crystals which has been derived in this thesis. (orig.)

  14. Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease

    Science.gov (United States)

    Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.

    2018-04-01

    We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.

  15. Twist–radial normal mode analysis in double-stranded DNA chains

    International Nuclear Information System (INIS)

    Torrellas, Germán; Maciá, Enrique

    2012-01-01

    We study the normal modes of a duplex DNA chain at low temperatures. We consider the coupling between the hydrogen-bond radial oscillations and the twisting motion of each base pair within the Peyrard–Bishop–Dauxois model. The coupling is mediated by the stacking interaction between adjacent base pairs along the helix. We explicitly consider different mass values for different nucleotides, extending previous works. We disclose several resonance conditions of interest, determined by the fine-tuning of certain model parameters. The role of these dynamical effects on the DNA chain charge transport properties is discussed.

  16. Mediated Electron Transfer at Vertically Aligned Single-Walled Carbon Nanotube Electrodes During Detection of DNA Hybridization

    Science.gov (United States)

    Wallen, Rachel; Gokarn, Nirmal; Bercea, Priscila; Grzincic, Elissa; Bandyopadhyay, Krisanu

    2015-06-01

    Vertically aligned single-walled carbon nanotube (VASWCNT) assemblies are generated on cysteamine and 2-mercaptoethanol (2-ME)-functionalized gold surfaces through amide bond formation between carboxylic groups generated at the end of acid-shortened single-walled carbon nanotubes (SWCNTs) and amine groups present on the gold surfaces. Atomic force microscopy (AFM) imaging confirms the vertical alignment mode of SWCNT attachment through significant changes in surface roughness compared to bare gold surfaces and the lack of any horizontally aligned SWCNTs present. These SWCNT assemblies are further modified with an amine-terminated single-stranded probe-DNA. Subsequent hybridization of the surface-bound probe-DNA in the presence of complementary strands in solution is followed using impedance measurements in the presence of Fe(CN)6 3-/4- as the redox probe in solution, which show changes in the interfacial electrochemical properties, specifically the charge-transfer resistance, due to hybridization. In addition, hybridization of the probe-DNA is also compared when it is attached directly to the gold surfaces without any intermediary SWCNTs. Contrary to our expectations, impedance measurements show a decrease in charge-transfer resistance with time due to hybridization with 300 nM complementary DNA in solution with the probe-DNA attached to SWCNTs. In contrast, an increase in charge-transfer resistance is observed with time during hybridization when the probe-DNA is attached directly to the gold surfaces. The decrease in charge-transfer resistance during hybridization in the presence of VASWCNTs indicates an enhancement in the electron transfer process of the redox probe at the VASWCNT-modified electrode. The results suggest that VASWCNTs are acting as mediators of electron transfer, which facilitate the charge transfer of the redox probe at the electrode-solution interface.

  17. Copper Complexes with Tetradentate Ligands for Enhanced Charge Transport in Dye-Sensitized Solar Cells

    Directory of Open Access Journals (Sweden)

    Hannes Michaels

    2018-05-01

    Full Text Available In dye-sensitized solar cells (DSCs, the redox mediator is responsible for the regeneration of the oxidized dye and for the hole transport towards the cathode. Here, we introduce new copper complexes with tetradentate 6,6′-bis(4-(S-isopropyl-2-oxazolinyl-2,2′-bipyridine ligands, Cu(oxabpy, as redox mediators. Copper coordination complexes with a square-planar geometry show low reorganization energies and thus introduce smaller losses in photovoltage. Slow recombination kinetics of excited electrons between the TiO2 and CuII(oxabpy species lead to an exceptionally long electron lifetime, a high Fermi level in the TiO2, and a high photovoltage of 920 mV with photocurrents of 10 mA∙cm−2 and 6.2% power conversion efficiency. Meanwhile, a large driving force remains for the dye regeneration of the Y123 dye with high efficiencies. The square-planar Cu(oxabpy complexes yield viscous gel-like solutions. The unique charge transport characteristics are attributed to a superposition of diffusion and electronic conduction. An enhancement in charge transport performance of 70% despite the higher viscosity is observed upon comparison of Cu(oxabpy to the previously reported Cu(tmby2 redox electrolyte.

  18. Polyoxometalate active charge-transfer material for mediated redox flow battery

    Energy Technology Data Exchange (ETDEWEB)

    Anderson, Travis Mark; Hudak, Nicholas; Staiger, Chad; Pratt, Harry

    2017-01-17

    Redox flow batteries including a half-cell electrode chamber coupled to a current collecting electrode are disclosed herein. In a general embodiment, a separator is coupled to the half-cell electrode chamber. The half-cell electrode chamber comprises a first redox-active mediator and a second redox-active mediator. The first redox-active mediator and the second redox-active mediator are circulated through the half-cell electrode chamber into an external container. The container includes an active charge-transfer material. The active charge-transfer material has a redox potential between a redox potential of the first redox-active mediator and a redox potential of the second redox-active mediator. The active charge-transfer material is a polyoxometalate or derivative thereof. The redox flow battery may be particularly useful in energy storage solutions for renewable energy sources and for providing sustained power to an electrical grid.

  19. Interactions Between Charged Macroions Mediated by Molecules with Rod-like Charged Structures

    Directory of Open Access Journals (Sweden)

    Bohinc, K.

    2014-03-01

    Full Text Available A short review of recent theoretical advances in studies of the interaction between highly charged systems embedded in a solution of rod-like molecules is presented. The system is theoretically described by the functional density theory, where the correlations within the rod-like molecules are accounted for. We show that for sufficiently long molecules and large surface charge densities, an attractive force between like-charged surfaces arises due to the spatially distributed charges within the molecules. The added salt has an influence on the condition for the attractive force between like-charged surfaces. The theoretical results are compared with Monte Carlo simulations. Many phenomena motivate the study of the interaction between like-charged surfaces (DNA condensation, virus aggregation, yeast flocculation, cohesion of cement paste.

  20. Theory and simulation of charge transport in disordered organic semiconductors

    NARCIS (Netherlands)

    Bobbert, P.A.; Kondov, I.; Sutman, G.

    2013-01-01

    Charge transport in polymeric or small-molecule organic semiconductors used in organic light-emitting diodes (OLEDs) occurs by hopping of charges between sites at which the charges are localized. The energetic disorder in these semiconductors has a profound influence on the charge transport: charges

  1. Charge Transport in 2D DNA Tunnel Junction Diodes

    KAUST Repository

    Yoon, Minho

    2017-11-06

    Recently, deoxyribonucleic acid (DNA) is studied for electronics due to its intrinsic benefits such as its natural plenitude, biodegradability, biofunctionality, and low-cost. However, its applications are limited to passive components because of inherent insulating properties. In this report, a metal-insulator-metal tunnel diode with Au/DNA/NiOx junctions is presented. Through the self-aligning process of DNA molecules, a 2D DNA nanosheet is synthesized and used as a tunneling barrier, and semitransparent conducting oxide (NiOx ) is applied as a top electrode for resolving metal penetration issues. This molecular device successfully operates as a nonresonant tunneling diode, and temperature-variable current-voltage analysis proves that Fowler-Nordheim tunneling is a dominant conduction mechanism at the junctions. DNA-based tunneling devices appear to be promising prototypes for nanoelectronics using biomolecules.

  2. Charge Transport in 2D DNA Tunnel Junction Diodes

    KAUST Repository

    Yoon, Minho; Min, Sung-Wook; Dugasani, Sreekantha Reddy; Lee, Yong Uk; Oh, Min Suk; Anthopoulos, Thomas D.; Park, Sung Ha; Im, Seongil

    2017-01-01

    Recently, deoxyribonucleic acid (DNA) is studied for electronics due to its intrinsic benefits such as its natural plenitude, biodegradability, biofunctionality, and low-cost. However, its applications are limited to passive components because of inherent insulating properties. In this report, a metal-insulator-metal tunnel diode with Au/DNA/NiOx junctions is presented. Through the self-aligning process of DNA molecules, a 2D DNA nanosheet is synthesized and used as a tunneling barrier, and semitransparent conducting oxide (NiOx ) is applied as a top electrode for resolving metal penetration issues. This molecular device successfully operates as a nonresonant tunneling diode, and temperature-variable current-voltage analysis proves that Fowler-Nordheim tunneling is a dominant conduction mechanism at the junctions. DNA-based tunneling devices appear to be promising prototypes for nanoelectronics using biomolecules.

  3. Charge Transport in LDPE Nanocomposites Part II—Computational Approach

    Directory of Open Access Journals (Sweden)

    Anh T. Hoang

    2016-03-01

    Full Text Available A bipolar charge transport model is employed to investigate the remarkable reduction in dc conductivity of low-density polyethylene (LDPE based material filled with uncoated nanofillers (reported in the first part of this work. The effect of temperature on charge transport is considered and the model outcomes are compared with measured conduction currents. The simulations reveal that the contribution of charge carrier recombination to the total transport process becomes more significant at elevated temperatures. Among the effects caused by the presence of nanoparticles, a reduced charge injection at electrodes has been found as the most essential one. Possible mechanisms for charge injection at different temperatures are therefore discussed.

  4. Methods for producing thin film charge selective transport layers

    Science.gov (United States)

    Hammond, Scott Ryan; Olson, Dana C.; van Hest, Marinus Franciscus Antonius Maria

    2018-01-02

    Methods for producing thin film charge selective transport layers are provided. In one embodiment, a method for forming a thin film charge selective transport layer comprises: providing a precursor solution comprising a metal containing reactive precursor material dissolved into a complexing solvent; depositing the precursor solution onto a surface of a substrate to form a film; and forming a charge selective transport layer on the substrate by annealing the film.

  5. Reconstitution of DNA strand exchange mediated by Rhp51 recombinase and two mediators.

    Directory of Open Access Journals (Sweden)

    Yumiko Kurokawa

    2008-04-01

    Full Text Available In the fission yeast Schizosaccharomyces pombe, genetic evidence suggests that two mediators, Rad22 (the S. pombe Rad52 homolog and the Swi5-Sfr1 complex, participate in a common pathway of Rhp51 (the S. pombe Rad51 homolog-mediated homologous recombination (HR and HR repair. Here, we have demonstrated an in vitro reconstitution of the central step of DNA strand exchange during HR. Our system consists entirely of homogeneously purified proteins, including Rhp51, the two mediators, and replication protein A (RPA, which reflects genetic requirements in vivo. Using this system, we present the first robust biochemical evidence that concerted action of the two mediators directs the loading of Rhp51 onto single-stranded DNA (ssDNA precoated with RPA. Dissection of the reaction reveals that Rad22 overcomes the inhibitory effect of RPA on Rhp51-Swi5-Sfr1-mediated strand exchange. In addition, Rad22 negates the requirement for a strict order of protein addition to the in vitro system. However, despite the presence of Rad22, Swi5-Sfr1 is still essential for strand exchange. Importantly, Rhp51, but neither Rad22 nor the Swi5-Sfr1 mediator, is the factor that displaces RPA from ssDNA. Swi5-Sfr1 stabilizes Rhp51-ssDNA filaments in an ATP-dependent manner, and this stabilization is correlated with activation of Rhp51 for the strand exchange reaction. Rad22 alone cannot activate the Rhp51 presynaptic filament. AMP-PNP, a nonhydrolyzable ATP analog, induces a similar stabilization of Rhp51, but this stabilization is independent of Swi5-Sfr1. However, hydrolysis of ATP is required for processive strand transfer, which results in the formation of a long heteroduplex. Our in vitro reconstitution system has revealed that the two mediators have indispensable, but distinct, roles for mediating Rhp51 loading onto RPA-precoated ssDNA.

  6. Linking loss of sodium-iodide symporter expression to DNA damage

    Energy Technology Data Exchange (ETDEWEB)

    Lyckesvärd, Madeleine Nordén [Sahlgrenska Cancer Center, University of Gothenburg, Göteborg (Sweden); Department of Medical Chemistry and Cell Biology, University of Gothenburg, Göteborg (Sweden); Kapoor, Nirmal [Department of Medical Chemistry and Cell Biology, University of Gothenburg, Göteborg (Sweden); Ingeson-Carlsson, Camilla; Carlsson, Therese [Sahlgrenska Cancer Center, University of Gothenburg, Göteborg (Sweden); Department of Medical Chemistry and Cell Biology, University of Gothenburg, Göteborg (Sweden); Karlsson, Jan-Olof [Department of Medical Chemistry and Cell Biology, University of Gothenburg, Göteborg (Sweden); Postgård, Per; Himmelman, Jakob; Forssell-Aronsson, Eva [Department of Radiation Physics, University of Gothenburg, Göteborg (Sweden); Hammarsten, Ola [Department of Clinical Chemistry, University of Gothenburg, Göteborg (Sweden); Nilsson, Mikael, E-mail: mikael.nilsson@gu.se [Sahlgrenska Cancer Center, University of Gothenburg, Göteborg (Sweden); Department of Medical Chemistry and Cell Biology, University of Gothenburg, Göteborg (Sweden)

    2016-05-15

    Radiotherapy of thyroid cancer with I-131 is abrogated by inherent loss of radioiodine uptake due to loss of sodium iodide symporter (NIS) expression in poorly differentiated tumor cells. It is also known that ionizing radiation per se down-regulates NIS (the stunning effect), but the mechanism is unknown. Here we investigated whether loss of NIS-mediated iodide transport may be elicited by DNA damage. Calicheamicin, a fungal toxin that specifically cleaves double-stranded DNA, induced a full scale DNA damage response mediated by the ataxia-telangiectasia mutated (ATM) kinase in quiescent normal thyrocytes. At sublethal concentrations (<1 nM) calicheamicin blocked NIS mRNA expression and transepithelial iodide transport as stimulated by thyrotropin; loss of function occurred at a much faster rate than after I-131 irradiation. KU-55933, a selective ATM kinase inhibitor, partly rescued NIS expression and iodide transport in DNA-damaged cells. Prolonged ATM inhibition in healthy cells also repressed NIS-mediated iodide transport. ATM-dependent loss of iodide transport was counteracted by IGF-1. Together, these findings indicate that NIS, the major iodide transporter of the thyroid gland, is susceptible to DNA damage involving ATM-mediated mechanisms. This uncovers novel means of poor radioiodine uptake in thyroid cells subjected to extrinsic or intrinsic genotoxic stress. - Highlights: • DNA damage inhibits polarized iodide transport in normal thyroid cells. • Down-regulation of NIS expression is mediated by activation of the ATM kinase. • Long-term ATM inhibition also represses NIS-mediated iodide transport. • IGF-1 rescues NIS expression and iodide transport in DNA-damaged cells.

  7. Linking loss of sodium-iodide symporter expression to DNA damage

    International Nuclear Information System (INIS)

    Lyckesvärd, Madeleine Nordén; Kapoor, Nirmal; Ingeson-Carlsson, Camilla; Carlsson, Therese; Karlsson, Jan-Olof; Postgård, Per; Himmelman, Jakob; Forssell-Aronsson, Eva; Hammarsten, Ola; Nilsson, Mikael

    2016-01-01

    Radiotherapy of thyroid cancer with I-131 is abrogated by inherent loss of radioiodine uptake due to loss of sodium iodide symporter (NIS) expression in poorly differentiated tumor cells. It is also known that ionizing radiation per se down-regulates NIS (the stunning effect), but the mechanism is unknown. Here we investigated whether loss of NIS-mediated iodide transport may be elicited by DNA damage. Calicheamicin, a fungal toxin that specifically cleaves double-stranded DNA, induced a full scale DNA damage response mediated by the ataxia-telangiectasia mutated (ATM) kinase in quiescent normal thyrocytes. At sublethal concentrations (<1 nM) calicheamicin blocked NIS mRNA expression and transepithelial iodide transport as stimulated by thyrotropin; loss of function occurred at a much faster rate than after I-131 irradiation. KU-55933, a selective ATM kinase inhibitor, partly rescued NIS expression and iodide transport in DNA-damaged cells. Prolonged ATM inhibition in healthy cells also repressed NIS-mediated iodide transport. ATM-dependent loss of iodide transport was counteracted by IGF-1. Together, these findings indicate that NIS, the major iodide transporter of the thyroid gland, is susceptible to DNA damage involving ATM-mediated mechanisms. This uncovers novel means of poor radioiodine uptake in thyroid cells subjected to extrinsic or intrinsic genotoxic stress. - Highlights: • DNA damage inhibits polarized iodide transport in normal thyroid cells. • Down-regulation of NIS expression is mediated by activation of the ATM kinase. • Long-term ATM inhibition also represses NIS-mediated iodide transport. • IGF-1 rescues NIS expression and iodide transport in DNA-damaged cells.

  8. 31 CFR 337.2 - Transportation charges and risks.

    Science.gov (United States)

    2010-07-01

    ... 31 Money and Finance: Treasury 2 2010-07-01 2010-07-01 false Transportation charges and risks. 337... FEDERAL HOUSING ADMINISTRATION DEBENTURES Certificated Debentures § 337.2 Transportation charges and risks... to book-entry form, must be delivered at the expense and risk of the holder. Debentures bearing...

  9. Charge transport parameters of HBC at different temperatures

    Energy Technology Data Exchange (ETDEWEB)

    Kirkpatrick, J. [Max Planck Institut fuer Polymerforschung, Ackermannweg 10, 55128 Mainz (Germany); Department of Physics, Imperial College London, Prince Consort Road, London SW7 2BW (United Kingdom); Marcon, V.; Kremer, K.; Andrienko, D. [Max Planck Institut fuer Polymerforschung, Ackermannweg 10, 55128 Mainz (Germany); Nelson, J. [Department of Physics, Imperial College London, Prince Consort Road, London SW7 2BW (United Kingdom)

    2008-05-15

    We study the dependence on temperature of the charge transport parameters for hexabenzocoronene (HBC). Following from Marcus theory, two charge transport parameters will be calculated: the transfer integral and the difference in site energies. These parameters are strongly dependent on the orientation and position of molecules. Position and orientation of molecules are determined using molecular dynamics. Transfer integrals are calculated from a simplified INDO method. A technique to compute energetic disorder, that is the spread in site energies for the charge carriers, is developed. In the herringbone phase transfer integrals are higher, but so is energetic disorder. We consider three derivatives of HBC with different side chains, which lead to different phase behaviour and distributions of charge transport parameters. (copyright 2008 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  10. Bulk-Like Electrical Properties Induced by Contact-Limited Charge Transport in Organic Diodes: Revised Space Charge Limited Current

    KAUST Repository

    Xu, Guangwei

    2018-02-22

    Charge transport governs the operation and performance of organic diodes. Illuminating the charge-transfer/transport processes across the interfaces and the bulk organic semiconductors is at the focus of intensive investigations. Traditionally, the charge transport properties of organic diodes are usually characterized by probing the current–voltage (I–V) curves of the devices. However, to unveil the landscape of the underlying potential/charge distribution, which essentially determines the I–V characteristics, still represents a major challenge. Here, the electrical potential distribution in planar organic diodes is investigated by using the scanning Kelvin probe force microscopy technique, a method that can clearly separate the contact and bulk regimes of charge transport. Interestingly, by applying to devices based on novel, high mobility organic materials, the space-charge-limited-current-like I–V curves, which are previously believed to be a result of the bulk transport, are surprisingly but unambiguously demonstrated to be caused by contact-limited conduction. A model accounting is developed for the transport properties of both the two metal/organic interfaces and the bulk. The results indicate that pure interface-dominated transport can indeed give rise to I–V curves similar to those caused by bulk transport. These findings provide a new insight into the charge injection and transport processes in organic diodes.

  11. Field distribution and DNA transport in solid tumors during electric field-mediated gene delivery.

    Science.gov (United States)

    Henshaw, Joshua W; Yuan, Fan

    2008-02-01

    Gene therapy has a great potential in cancer treatment. However, the efficacy of cancer gene therapy is currently limited by the lack of a safe and efficient means to deliver therapeutic genes into the nucleus of tumor cells. One method under investigation for improving local gene delivery is based on the use of pulsed electric field. Despite repeated demonstration of its effectiveness in vivo, the underlying mechanisms behind electric field-mediated gene delivery remain largely unknown. Without a thorough understanding of these mechanisms, it will be difficult to further advance the gene delivery. In this review, the electric field-mediated gene delivery in solid tumors will be examined by following individual transport processes that must occur in vivo for a successful gene transfer. The topics of examination include: (i) major barriers for gene delivery in the body, (ii) distribution of electric fields at both cell and tissue levels during the application of external fields, and (iii) electric field-induced transport of genes across each of the barriers. Through this approach, the review summarizes what is known about the mechanisms behind electric field-mediated gene delivery and what require further investigations in future studies.

  12. Electrochemical single-molecule conductivity of duplex and quadruplex DNA

    DEFF Research Database (Denmark)

    Zhang, Ling; Zhang, Jingdong; Ulstrup, Jens

    2017-01-01

    Photoinduced and electrochemical charge transport in DNA (oligonucleotides, OGNs) and the notions “hopping”, superexchange, polaron, and vibrationally gated charge transport have been in focus over more than two decades. In recent years mapping of electrochemical charge transport of pure and redo...

  13. The Effect of Ketone Defects on the Charge Transport and Charge Recombination in Polyfluorenes

    NARCIS (Netherlands)

    Kuik, Martijn; Wetzelaer, Gert-Jan A. H.; Ladde, Jurre G.; Nicolai, Herman T.; Wildeman, Jurjen; Sweelssen, Jorgen; Blom, Paul W. M.; Sweelssen, Jörgen

    2011-01-01

    The effect of on-chain ketone defects on the charge transport of the polyfluorene derivative poly(9,9-dioctylfluorene) (PFO) is investigated. Using MoO3 as ohmic hole contact, the hole transport in a pristine PFO diode is observed to be limited by space-charge, whereas fluorenone contaminated PFO

  14. The effect of ketone defects on the charge transport and charge recombination in polyfluorenes

    NARCIS (Netherlands)

    Kuik, M.; Wetzelaer, G.-J.A.H.; Laddé, J.G.; Nicolai, H.T.; Wildeman, J.; Sweelssen, J.; Blom, P.W.M.

    2011-01-01

    The effect of on-chain ketone defects on the charge transport of the polyfluorene derivative poly(9,9-dioctylfluorene) (PFO) is investigated. Using MoO3 as ohmic hole contact, the hole transport in a pristine PFO diode is observed to be limited by space-charge, whereas fluorenone contaminated PFO

  15. Charge and Spin Transport in Spin-orbit Coupled and Topological Systems

    KAUST Repository

    Ndiaye, Papa Birame

    2017-10-31

    In the search for low power operation of microelectronic devices, spin-based solutions have attracted undeniable increasing interest due to their intrinsic magnetic nonvolatility. The ability to electrically manipulate the magnetic order using spin-orbit interaction, associated with the recent emergence of topological spintronics with its promise of highly efficient charge-to-spin conversion in solid state, offer alluring opportunities in terms of system design. Although the related technology is still at its infancy, this thesis intends to contribute to this engaging field by investigating the nature of the charge and spin transport in spin-orbit coupled and topological systems using quantum transport methods. We identified three promising building blocks for next-generation technology, three classes of systems that possibly enhance the spin and charge transport efficiency: (i)- topological insulators, (ii)- spin-orbit coupled magnonic systems, (iii)- topological magnetic textures (skyrmions and 3Q magnetic state). Chapter 2 reviews the basics and essential concepts used throughout the thesis: the spin-orbit coupling, the mathematical notion of topology and its importance in condensed matter physics, then topological magnetism and a zest of magnonics. In Chapter 3, we study the spin-orbit torques at the magnetized interfaces of 3D topological insulators. We demonstrated that their peculiar form, compared to other spin-orbit torques, have important repercussions in terms of magnetization reversal, charge pumping and anisotropic damping. In Chapter 4, we showed that the interplay between magnon current jm and magnetization m in homogeneous ferromagnets with Dzyaloshinskii-Moriya (DM) interaction, produces a field-like torque as well as a damping-like torque. These DM torques mediated by spin wave can tilt the imeaveraged magnetization direction and are similar to Rashba torques for electronic systems. Moreover, the DM torque is more efficient when magnons are

  16. Simulations of charge transport in organic compounds

    Energy Technology Data Exchange (ETDEWEB)

    Vehoff, Thorsten

    2010-05-05

    We study the charge transport properties of organic liquid crystals, i.e. hexabenzocoronene and carbazole macrocycle, and single crystals, i.e. rubrene, indolocarbazole and benzothiophene derivatives (BTBT, BBBT). The aim is to find structure-property relationships linking the chemical structure as well as the morphology with the bulk charge carrier mobility of the compounds. To this end, molecular dynamics (MD) simulations are performed yielding realistic equilibrated morphologies. Partial charges and molecular orbitals are calculated based on single molecules in vacuum using quantum chemical methods. The molecular orbitals are then mapped onto the molecular positions and orientations, which allows calculation of the transfer integrals between nearest neighbors using the molecular orbital overlap method. Thus we obtain realistic transfer integral distributions and their autocorrelations. In case of organic crystals the differences between two descriptions of charge transport, namely semi-classical dynamics (SCD) in the small polaron limit and kinetic Monte Carlo (KMC) based on Marcus rates, are studied. The liquid crystals are investigated solely in the hopping limit. To simulate the charge dynamics using KMC, the centers of mass of the molecules are mapped onto lattice sites and the transfer integrals are used to compute the hopping rates. In the small polaron limit, where the electronic wave function is spread over a limited number of neighboring molecules, the Schroedinger equation is solved numerically using a semi-classical approach. The carbazole macrocycles form columnar structures arranged on a hexagonal lattice with side chains facing inwards, so columns can closely approach each other allowing inter-columnar and thus three-dimensional transport. We are able to show that, on the time-scales of charge transport, static disorder due to slow side chain motions is the main factor determining the mobility. The high mobility of rubrene is explained by two main

  17. Variational multiscale models for charge transport.

    Science.gov (United States)

    Wei, Guo-Wei; Zheng, Qiong; Chen, Zhan; Xia, Kelin

    2012-01-01

    This work presents a few variational multiscale models for charge transport in complex physical, chemical and biological systems and engineering devices, such as fuel cells, solar cells, battery cells, nanofluidics, transistors and ion channels. An essential ingredient of the present models, introduced in an earlier paper (Bulletin of Mathematical Biology, 72, 1562-1622, 2010), is the use of differential geometry theory of surfaces as a natural means to geometrically separate the macroscopic domain from the microscopic domain, meanwhile, dynamically couple discrete and continuum descriptions. Our main strategy is to construct the total energy functional of a charge transport system to encompass the polar and nonpolar free energies of solvation, and chemical potential related energy. By using the Euler-Lagrange variation, coupled Laplace-Beltrami and Poisson-Nernst-Planck (LB-PNP) equations are derived. The solution of the LB-PNP equations leads to the minimization of the total free energy, and explicit profiles of electrostatic potential and densities of charge species. To further reduce the computational complexity, the Boltzmann distribution obtained from the Poisson-Boltzmann (PB) equation is utilized to represent the densities of certain charge species so as to avoid the computationally expensive solution of some Nernst-Planck (NP) equations. Consequently, the coupled Laplace-Beltrami and Poisson-Boltzmann-Nernst-Planck (LB-PBNP) equations are proposed for charge transport in heterogeneous systems. A major emphasis of the present formulation is the consistency between equilibrium LB-PB theory and non-equilibrium LB-PNP theory at equilibrium. Another major emphasis is the capability of the reduced LB-PBNP model to fully recover the prediction of the LB-PNP model at non-equilibrium settings. To account for the fluid impact on the charge transport, we derive coupled Laplace-Beltrami, Poisson-Nernst-Planck and Navier-Stokes equations from the variational principle

  18. Variational multiscale models for charge transport

    Science.gov (United States)

    Wei, Guo-Wei; Zheng, Qiong; Chen, Zhan; Xia, Kelin

    2012-01-01

    This work presents a few variational multiscale models for charge transport in complex physical, chemical and biological systems and engineering devices, such as fuel cells, solar cells, battery cells, nanofluidics, transistors and ion channels. An essential ingredient of the present models, introduced in an earlier paper (Bulletin of Mathematical Biology, 72, 1562-1622, 2010), is the use of differential geometry theory of surfaces as a natural means to geometrically separate the macroscopic domain from the microscopic domain, meanwhile, dynamically couple discrete and continuum descriptions. Our main strategy is to construct the total energy functional of a charge transport system to encompass the polar and nonpolar free energies of solvation, and chemical potential related energy. By using the Euler-Lagrange variation, coupled Laplace-Beltrami and Poisson-Nernst-Planck (LB-PNP) equations are derived. The solution of the LB-PNP equations leads to the minimization of the total free energy, and explicit profiles of electrostatic potential and densities of charge species. To further reduce the computational complexity, the Boltzmann distribution obtained from the Poisson-Boltzmann (PB) equation is utilized to represent the densities of certain charge species so as to avoid the computationally expensive solution of some Nernst-Planck (NP) equations. Consequently, the coupled Laplace-Beltrami and Poisson-Boltzmann-Nernst-Planck (LB-PBNP) equations are proposed for charge transport in heterogeneous systems. A major emphasis of the present formulation is the consistency between equilibrium LB-PB theory and non-equilibrium LB-PNP theory at equilibrium. Another major emphasis is the capability of the reduced LB-PBNP model to fully recover the prediction of the LB-PNP model at non-equilibrium settings. To account for the fluid impact on the charge transport, we derive coupled Laplace-Beltrami, Poisson-Nernst-Planck and Navier-Stokes equations from the variational principle

  19. DNA Immobilization and Hybridization Detection by the Intrinsic Molecular Charge Using Capacitive Field-Effect Sensors Modified with a Charged Weak Polyelectrolyte Layer.

    Science.gov (United States)

    Bronder, Thomas S; Poghossian, Arshak; Scheja, Sabrina; Wu, Chunsheng; Keusgen, Michael; Mewes, Dieter; Schöning, Michael J

    2015-09-16

    Miniaturized setup, compatibility with advanced micro- and nanotechnologies, and ability to detect biomolecules by their intrinsic molecular charge favor the semiconductor field-effect platform as one of the most attractive approaches for the development of label-free DNA chips. In this work, a capacitive field-effect EIS (electrolyte-insulator-semiconductor) sensor covered with a layer-by-layer prepared, positively charged weak polyelectrolyte layer of PAH (poly(allylamine hydrochloride)) was used for the label-free electrical detection of DNA (deoxyribonucleic acid) immobilization and hybridization. The negatively charged probe single-stranded DNA (ssDNA) molecules were electrostatically adsorbed onto the positively charged PAH layer, resulting in a preferentially flat orientation of the ssDNA molecules within the Debye length, thus yielding a reduced charge-screening effect and a higher sensor signal. Each sensor-surface modification step (PAH adsorption, probe ssDNA immobilization, hybridization with complementary target DNA (cDNA), reducing an unspecific adsorption by a blocking agent, incubation with noncomplementary DNA (ncDNA) solution) was monitored by means of capacitance-voltage and constant-capacitance measurements. In addition, the surface morphology of the PAH layer was studied by atomic force microscopy and contact-angle measurements. High hybridization signals of 34 and 43 mV were recorded in low-ionic strength solutions of 10 and 1 mM, respectively. In contrast, a small signal of 4 mV was recorded in the case of unspecific adsorption of fully mismatched ncDNA. The density of probe ssDNA and dsDNA molecules as well as the hybridization efficiency was estimated using the experimentally measured DNA immobilization and hybridization signals and a simplified double-layer capacitor model. The results of field-effect experiments were supported by fluorescence measurements, verifying the DNA-immobilization and hybridization event.

  20. Protein phosphatase 5 is necessary for ATR-mediated DNA repair

    International Nuclear Information System (INIS)

    Kang, Yoonsung; Cheong, Hyang-Min; Lee, Jung-Hee; Song, Peter I.; Lee, Kwang-Ho; Kim, Sang-Yong; Jun, Jae Yeoul; You, Ho Jin

    2011-01-01

    Research highlights: → Serine/threonine protein phosphatase 5 (PP5) has been shown to participate in ataxia telangiectasia-mutated (ATM)- and ATR (ATM- and Rad3-related)-mediated checkpoint pathways, which plays an important role in the DNA damage response and maintenance of genomic stability. → However, it is not clear exactly how PP5 participates in this process. → Our results indicate that PP5 is more closely related with ATR-mediated pathway than ATM-mediated pathway in DNA damage repair. -- Abstract: Several recent studies have shown that protein phosphatase 5 (PP5) participates in cell cycle arrest after DNA damage, but its roles in DNA repair have not yet been fully characterized. We investigated the roles of PP5 in the repair of ultraviolet (UV)- and neocarzinostatin (NCS)-induced DNA damage. The results of comet assays revealed different repair patterns in UV- and NCS-exposed U2OS-PS cells. PP5 is only essential for Rad3-related (ATR)-mediated DNA repair. Furthermore, the phosphorylation of 53BP1 and BRCA1, important mediators of DNA damage repair, and substrates of ATR and ATM decreased in U2OS-PS cells exposed to UV radiation. In contrast, the cell cycle arrest proteins p53, CHK1, and CHK2 were normally phosphorylated in U2OS and U2OS-PS cells exposed to UV radiation or treated with NCS. In view of these results, we suggest that PP5 plays a crucial role in ATR-mediated repair of UV-induced DNA damage.

  1. Charged-particle calculations using Boltzmann transport methods

    International Nuclear Information System (INIS)

    Hoffman, T.J.; Dodds, H.L. Jr.; Robinson, M.T.; Holmes, D.K.

    1981-01-01

    Several aspects of radiation damage effects in fusion reactor neutron and ion irradiation environments are amenable to treatment by transport theory methods. In this paper, multigroup transport techniques are developed for the calculation of charged particle range distributions, reflection coefficients, and sputtering yields. The Boltzmann transport approach can be implemented, with minor changes, in standard neutral particle computer codes. With the multigroup discrete ordinates code, ANISN, determination of ion and target atom distributions as functions of position, energy, and direction can be obtained without the stochastic error associated with atomistic computer codes such as MARLOWE and TRIM. With the multigroup Monte Carlo code, MORSE, charged particle effects can be obtained for problems associated with very complex geometries. Results are presented for several charged particle problems. Good agreement is obtained between quantities calculated with the multigroup approach and those obtained experimentally or by atomistic computer codes

  2. High-frequency acoustic charge transport in GaAs nanowires

    NARCIS (Netherlands)

    Büyükköse, S.; Hernandez-Minguez, A.; Vratzov, B.; Somaschini, C.; Geelhaar, L.; Riechert, H.; van der Wiel, Wilfred Gerard; Santos, P.V.

    2014-01-01

    The oscillating piezoelectric fields accompanying surface acoustic waves are able to transport charge carriers in semiconductor heterostructures. Here, we demonstrate high-frequency (above 1 GHz) acoustic charge transport in GaAs-based nanowires deposited on a piezoelectric substrate. The short

  3. Charge transport in amorphous organic semiconductors

    Energy Technology Data Exchange (ETDEWEB)

    Lukyanov, Alexander

    2011-03-15

    Organic semiconductors with the unique combination of electronic and mechanical properties may offer cost-effective ways of realizing many electronic applications, e. g. large-area flexible displays, printed integrated circuits and plastic solar cells. In order to facilitate the rational compound design of organic semiconductors, it is essential to understand relevant physical properties e. g. charge transport. This, however, is not straightforward, since physical models operating on different time and length scales need to be combined. First, the material morphology has to be known at an atomistic scale. For this atomistic molecular dynamics simulations can be employed, provided that an atomistic force field is available. Otherwise it has to be developed based on the existing force fields and first principle calculations. However, atomistic simulations are typically limited to the nanometer length- and nanosecond time-scales. To overcome these limitations, systematic coarse-graining techniques can be used. In the first part of this thesis, it is demonstrated how a force field can be parameterized for a typical organic molecule. Then different coarse-graining approaches are introduced together with the analysis of their advantages and problems. When atomistic morphology is available, charge transport can be studied by combining the high-temperature Marcus theory with kinetic Monte Carlo simulations. The approach is applied to the hole transport in amorphous films of tris(8- hydroxyquinoline)aluminium (Alq{sub 3}). First the influence of the force field parameters and the corresponding morphological changes on charge transport is studied. It is shown that the energetic disorder plays an important role for amorphous Alq{sub 3}, defining charge carrier dynamics. Its spatial correlations govern the Poole-Frenkel behavior of the charge carrier mobility. It is found that hole transport is dispersive for system sizes accessible to simulations, meaning that calculated

  4. Charge transport in metal oxide nanocrystal-based materials

    Science.gov (United States)

    Runnerstrom, Evan Lars

    There is probably no class of materials more varied, more widely used, or more ubiquitous than metal oxides. Depending on their composition, metal oxides can exhibit almost any number of properties. Of particular interest are the ways in which charge is transported in metal oxides: devices such as displays, touch screens, and smart windows rely on the ability of certain metal oxides to conduct electricity while maintaining visible transparency. Smart windows, fuel cells, and other electrochemical devices additionally rely on efficient transport of ionic charge in and around metal oxides. Colloidal synthesis has enabled metal oxide nanocrystals to emerge as a relatively new but highly tunable class of materials. Certain metal oxide nanocrystals, particularly highly doped metal oxides, have been enjoying rapid development in the last decade. As in myriad other materials systems, structure dictates the properties of metal oxide nanocrystals, but a full understanding of how nanocrystal synthesis, the processing of nanocrystal-based materials, and the structure of nanocrystals relate to the resulting properties of nanocrystal-based materials is still nascent. Gaining a fundamental understanding of and control over these structure-property relationships is crucial to developing a holistic understanding of metal oxide nanocrystals. The unique ability to tune metal oxide nanocrystals by changing composition through the introduction of dopants or by changing size and shape affords a way to study the interplay between structure, processing, and properties. This overall goal of this work is to chemically synthesize colloidal metal oxide nanocrystals, process them into useful materials, characterize charge transport in materials based on colloidal metal oxide nanocrystals, and develop ways to manipulate charge transport. In particular, this dissertation characterizes how the charge transport properties of metal oxide nanocrystal-based materials depend on their processing and

  5. Using AFM to probe the complexation of DNA with anionic lipids mediated by Ca(2+): the role of surface pressure.

    Science.gov (United States)

    Luque-Caballero, Germán; Martín-Molina, Alberto; Sánchez-Treviño, Alda Yadira; Rodríguez-Valverde, Miguel A; Cabrerizo-Vílchez, Miguel A; Maldonado-Valderrama, Julia

    2014-04-28

    Complexation of DNA with lipids is currently being developed as an alternative to classical vectors based on viruses. Most of the research to date focuses on cationic lipids owing to their spontaneous complexation with DNA. Nonetheless, recent investigations have revealed that cationic lipids induce a large number of adverse effects on DNA delivery. Precisely, the lower cytotoxicity of anionic lipids accounts for their use as a promising alternative. However, the complexation of DNA with anionic lipids (mediated by cations) is still in early stages and is not yet well understood. In order to explore the molecular mechanisms underlying the complexation of anionic lipids and DNA we proposed a combined methodology based on the surface pressure-area isotherms, Gibbs elasticity and Atomic Force Microscopy (AFM). These techniques allow elucidation of the role of the surface pressure in the complexation and visualization of the interfacial aggregates for the first time. We demonstrate that the DNA complexes with negatively charged model monolayers (DPPC/DPPS 4 : 1) only in the presence of Ca(2+), but is expelled at very high surface pressures. Also, according to the Gibbs elasticity plot, the complexation of lipids and DNA implies a whole fluidisation of the monolayer and a completely different phase transition map in the presence of DNA and Ca(2+). AFM imaging allows identification for the first time of specific morphologies associated with different packing densities. At low surface coverage, a branched net like structure is observed whereas at high surface pressure fibers formed of interfacial aggregates appear. In summary, Ca(2+) mediates the interaction between DNA and negatively charged lipids and also the conformation of the ternary system depends on the surface pressure. Such observations are important new generic features of the interaction between DNA and anionic lipids.

  6. DNAzyme-Based Logic Gate-Mediated DNA Self-Assembly.

    Science.gov (United States)

    Zhang, Cheng; Yang, Jing; Jiang, Shuoxing; Liu, Yan; Yan, Hao

    2016-01-13

    Controlling DNA self-assembly processes using rationally designed logic gates is a major goal of DNA-based nanotechnology and programming. Such controls could facilitate the hierarchical engineering of complex nanopatterns responding to various molecular triggers or inputs. Here, we demonstrate the use of a series of DNAzyme-based logic gates to control DNA tile self-assembly onto a prescribed DNA origami frame. Logic systems such as "YES," "OR," "AND," and "logic switch" are implemented based on DNAzyme-mediated tile recognition with the DNA origami frame. DNAzyme is designed to play two roles: (1) as an intermediate messenger to motivate downstream reactions and (2) as a final trigger to report fluorescent signals, enabling information relay between the DNA origami-framed tile assembly and fluorescent signaling. The results of this study demonstrate the plausibility of DNAzyme-mediated hierarchical self-assembly and provide new tools for generating dynamic and responsive self-assembly systems.

  7. Organic n-type materials for charge transport and charge storage applications.

    Science.gov (United States)

    Stolar, Monika; Baumgartner, Thomas

    2013-06-21

    Conjugated materials have attracted much attention toward applications in organic electronics in recent years. These organic species offer many advantages as potential replacement for conventional materials (i.e., silicon and metals) in terms of cheap fabrication and environmentally benign devices. While p-type (electron-donating or hole-conducting) materials have been extensively reviewed and researched, their counterpart n-type (electron-accepting or electron-conducting) materials have seen much less popularity despite the greater need for improvement. In addition to developing efficient charge transport materials, it is equally important to provide a means of charge storage, where energy can be used on an on-demand basis. This perspective is focused on discussing a selection of representative n-type materials and the efforts toward improving their charge-transport efficiencies. Additionally, this perspective will also highlight recent organic materials for battery components and the efforts that have been made to improve their environmental appeal.

  8. Production, transport and charge capture measurements of highly charged recoil ions

    International Nuclear Information System (INIS)

    Trebus, U.E.

    1989-01-01

    An experiment is described to study highly charged recoil ions on-line to the heavy accelerator UNILAC at GSI. The highly charged recoil ions are produced by heavy-ion bombardment of a gas target. Subsequently the slow highly charged recoil ions are extracted from the ionization volume, and guided through a beam transport line to a Wien filter for charge state selection and to a collision region to study charge transfer processes. Several experiments were carried out to show the efficient charge state separation. Charge states up to q = 15 were observed. When using a retarding field analyzer cross sections for single electron capture were determined for different charge states of Xe q+ for q = 4 to 11 and He gas. The experiments demonstrated increasing charge transfer cross sections with increasing charge state q and indicated the effect of near resonant charge capture for q = 6. The flexible data acquisition system used, is described and other future experiments, such as for instance in flight ion-trapping are indicated in the appendix

  9. Production, transport and charge capture measurements of highly charged recoil ions

    International Nuclear Information System (INIS)

    Trebus, U.E.

    1989-05-01

    An experiment is described to study highly charged recoil ions on-line to the heavy ion accelerator UNILAC at GSI. The highly charged recoil ions are produced by heavy ion bombardment of a gas target. Subsequently the slow highly charged recoil ions are extracted from the ionization volume, and guided through a beam transport line to a Wien filter for charge state selection and to a collision region to study charge transfer processes. Several experiments were carried out to show the efficient charge state separation. Charge states up to q=15 were observed. When using a retarding field analyzer cross sections for single electron capture were determined for different charge states of Xe q+ for q=4 to 11 and He gas. The experiments demonstrated increasing charge transfer cross sections with increasing charge state q and indicated the effect of near resonant charge capture for q=6. The flexible data acquisition system used, is described and other future experiments, such as for instance in flight ion-trapping are indicated in the appendix. (orig.)

  10. Spatiotemporal kinetics of γ-H2AX protein on charged particles induced DNA damage

    Energy Technology Data Exchange (ETDEWEB)

    Niu, H., E-mail: hniu@mx.nthu.edu.tw [Nuclear Science and Technology Development Center, National Tsing Hua University, Hsinchu, Taiwan (China); Chang, H.C. [Department of Biomedical Engineering and Environmental Sciences, National Tsing Hua University, Hsinchu, Taiwan (China); Cho, I.C. [Institute for Radiological Research, Chang Gung University and Chang Gung Memorial Hospital, Taoyuan, Taiwan (China); Chen, C.H. [Nuclear Science and Technology Development Center, National Tsing Hua University, Hsinchu, Taiwan (China); Liu, C.S. [Cancer Center of Taipei Veterans General Hospital, Taipei, Taiwan (China); Chou, W.T. [Department of Biomedical Engineering and Environmental Sciences, National Tsing Hua University, Hsinchu, Taiwan (China)

    2014-08-15

    Highlights: • Charged particles can induce more complex DNA damages, and these complex damages have higher ability to cause the cell death or cell carcinogenesis. • In this study, we used γ-H2AX protein to investigate the spatiotemporal kinetics of DNA double strand breaks in particle irradiated HeLa cells. • The HeLa cells were irradiated by 400 keV alpha-particles in four different dosages. • The result shows that a good linear relationship can be observed between foci number and radiation dose. • The data shows that the dissolution rate of γ-H2AX foci agree with the two components DNA repairing model, and it was decreasing as the radiation dose increased. • These results suggest that charged particles can induce more complex DNA damages and causing the retardation of DNA repair. - Abstract: In several researches, it has been demonstrated that charged particles can induce more complex DNA damages. These complex damages have higher ability to cause the cell death or cell carcinogenesis. For this reason, clarifying the DNA repair mechanism after charged particle irradiation plays an important role in the development of charged particle therapy and space exploration. Unfortunately, the detail spatiotemporal kinetic of DNA damage repair is still unclear. In this study, we used γ-H2AX protein to investigate the spatiotemporal kinetics of DNA double strand breaks in alpha-particle irradiated HeLa cells. The result shows that the intensity of γ-H2AX foci increased gradually, and reached to its maximum at 30 min after irradiation. A good linear relationship can be observed between foci intensity and radiation dose. After 30 min, the γ-H2AX foci intensity was decreased with time passed, but remained a large portion (∼50%) at 48 h passed. The data show that the dissolution rate of γ-H2AX foci agreed with two components DNA repairing model. These results suggest that charged particles can induce more complex DNA damages and causing the retardation of DNA

  11. Transporter-mediated biofuel secretion.

    Science.gov (United States)

    Doshi, Rupak; Nguyen, Tuan; Chang, Geoffrey

    2013-05-07

    Engineering microorganisms to produce biofuels is currently among the most promising strategies in renewable energy. However, harvesting these organisms for extracting biofuels is energy- and cost-intensive, limiting the commercial feasibility of large-scale production. Here, we demonstrate the use of a class of transport proteins of pharmacological interest to circumvent the need to harvest biomass during biofuel production. We show that membrane-embedded transporters, better known to efflux lipids and drugs, can be used to mediate the secretion of intracellularly synthesized model isoprenoid biofuel compounds to the extracellular milieu. Transporter-mediated biofuel secretion sustainably maintained an approximate three- to fivefold boost in biofuel production in our Escherichia coli test system. Because the transporters used in this study belong to the ubiquitous ATP-binding cassette protein family, we propose their use as "plug-and-play" biofuel-secreting systems in a variety of bacteria, cyanobacteria, diatoms, yeast, and algae used for biofuel production. This investigation showcases the potential of expressing desired membrane transport proteins in cell factories to achieve the export or import of substances of economic, environmental, or therapeutic importance.

  12. Pyrovanadolysis: a Pyrophosphorolysis-like Reaction Mediated by Pyrovanadate MN2plus and DNA Polymerase of Bacteriophage T7

    Energy Technology Data Exchange (ETDEWEB)

    B Akabayov; A Kulczyk; S Akabayov; C Thiele; L McLaughlin; B Beauchamp; C Richardson

    2011-12-31

    DNA polymerases catalyze the 3'-5'-pyrophosphorolysis of a DNA primer annealed to a DNA template in the presence of pyrophosphate (PP{sub i}). In this reversal of the polymerization reaction, deoxynucleotides in DNA are converted to deoxynucleoside 5'-triphosphates. Based on the charge, size, and geometry of the oxygen connecting the two phosphorus atoms of PP{sub i}, a variety of compounds was examined for their ability to carry out a reaction similar to pyrophosphorolysis. We describe a manganese-mediated pyrophosphorolysis-like activity using pyrovanadate (VV) catalyzed by the DNA polymerase of bacteriophage T7. We designate this reaction pyrovanadolysis. X-ray absorption spectroscopy reveals a shorter Mn-V distance of the polymerase-VV complex than the Mn-P distance of the polymerase-PP{sub i} complex. This structural arrangement at the active site accounts for the enzymatic activation by Mn-VV. We propose that the Mn{sup 2+}, larger than Mg{sup 2+}, fits the polymerase active site to mediate binding of VV into the active site of the polymerase. Our results may be the first documentation that vanadium can substitute for phosphorus in biological processes.

  13. Controlling charge current through a DNA based molecular transistor

    Energy Technology Data Exchange (ETDEWEB)

    Behnia, S., E-mail: s.behnia@sci.uut.ac.ir; Fathizadeh, S.; Ziaei, J.

    2017-01-05

    Molecular electronics is complementary to silicon-based electronics and may induce electronic functions which are difficult to obtain with conventional technology. We have considered a DNA based molecular transistor and study its transport properties. The appropriate DNA sequence as a central chain in molecular transistor and the functional interval for applied voltages is obtained. I–V characteristic diagram shows the rectifier behavior as well as the negative differential resistance phenomenon of DNA transistor. We have observed the nearly periodic behavior in the current flowing through DNA. It is reported that there is a critical gate voltage for each applied bias which above it, the electrical current is always positive. - Highlights: • Modeling a DNA based molecular transistor and studying its transport properties. • Choosing the appropriate DNA sequence using the quantum chaos tools. • Choosing the functional interval for voltages via the inverse participation ratio tool. • Detecting the rectifier and negative differential resistance behavior of DNA.

  14. Theoretical and experimental study of charge transfer through DNA: impact of mercury mediated T-Hg-T base pair

    Czech Academy of Sciences Publication Activity Database

    Kratochvílová, Irena; Golan, Martin; Vala, M.; Špérová, M.; Weiter, M.; Páv, Ondřej; Šebera, Jakub; Rosenberg, Ivan; Sychrovský, Vladimír; Tanaka, Y.; Bickelhaupt, F.M.

    2014-01-01

    Roč. 118, č. 20 (2014), s. 5374-5381 ISSN 1520-6106 R&D Projects: GA TA ČR TA01011165; GA ČR(CZ) GA14-10279S; GA ČR GA13-26526S Institutional support: RVO:68378271 ; RVO:61388963 Keywords : charge transfer in DNA-Hg complexes * steady state fluorescence spectroscopy * density functional theory * electronic properties of biomolecules Subject RIV: BO - Biophysics Impact factor: 3.302, year: 2014

  15. Quantum mechanical calculations related to ionization and charge transfer in DNA

    International Nuclear Information System (INIS)

    Cauët, E; Liévin, J; Valiev, M; Weare, J H

    2012-01-01

    Ionization and charge migration in DNA play crucial roles in mechanisms of DNA damage caused by ionizing radiation, oxidizing agents and photo-irradiation. Therefore, an evaluation of the ionization properties of the DNA bases is central to the full interpretation and understanding of the elementary reactive processes that occur at the molecular level during the initial exposure and afterwards. Ab initio quantum mechanical (QM) methods have been successful in providing highly accurate evaluations of key parameters, such as ionization energies (IE) of DNA bases. Hence, in this study, we performed high-level QM calculations to characterize the molecular energy levels and potential energy surfaces, which shed light on ionization and charge migration between DNA bases. In particular, we examined the IEs of guanine, the most easily oxidized base, isolated and embedded in base clusters, and investigated the mechanism of charge migration over two and three stacked guanines. The IE of guanine in the human telomere sequence has also been evaluated. We report a simple molecular orbital analysis to explain how modifications in the base sequence are expected to change the efficiency of the sequence as a hole trap. Finally, the application of a hybrid approach combining quantum mechanics with molecular mechanics brings an interesting discussion as to how the native aqueous DNA environment affects the IE threshold of nucleobases.

  16. Inter-DNA Attraction Mediated by Divalent Counterions

    International Nuclear Information System (INIS)

    Qiu Xiangyun; Andresen, Kurt; Kwok, Lisa W.; Lamb, Jessica S.; Park, Hye Yoon; Pollack, Lois

    2007-01-01

    Can nonspecifically bound divalent counterions induce attraction between DNA strands? Here, we present experimental evidence demonstrating attraction between short DNA strands mediated by Mg 2+ ions. Solution small angle x-ray scattering data collected as a function of DNA concentration enable model independent extraction of the second virial coefficient. As the [Mg 2+ ] increases, this coefficient turns from positive to negative reflecting the transition from repulsive to attractive inter-DNA interaction. This surprising observation is corroborated by independent light scattering experiments. The dependence of the observed attraction on experimental parameters including DNA length provides valuable clues to its origin

  17. Microscopic origins of charge transport in triphenylene systems

    Science.gov (United States)

    Thompson, Ian R.; Coe, Mary K.; Walker, Alison B.; Ricci, Matteo; Roscioni, Otello M.; Zannoni, Claudio

    2018-06-01

    We study the effects of molecular ordering on charge transport at the mesoscale level in a layer of ≈9000 hexa-octyl-thio-triphenylene discotic mesogens with dimensions of ≈20 ×20 ×60 nm3 . Ordered (columnar) and disordered isotropic morphologies are obtained from a combination of atomistic and coarse-grained molecular-dynamics simulations. Electronic structure codes are used to find charge hopping rates at the microscopic level. Energetic disorder is included through the Thole model. Kinetic Monte Carlo simulations then predict charge mobilities. We reproduce the large increase in mobility in going from an isotropic to a columnar morphology. To understand how these mobilities depend on the morphology and hopping rates, we employ graph theory to analyze charge trajectories by representing the film as a charge-transport network. This approach allows us to identify spatial correlations of molecule pairs with high transfer rates. These pairs must be linked to ensure good transport characteristics or may otherwise act as traps. Our analysis is straightforward to implement and will be a useful tool in linking materials to device performance, for example, to investigate the influence of local inhomogeneities in the current density. Our mobility-field curves show an increasing mobility with field, as would be expected for an organic semiconductor.

  18. Charge injection and transport properties of an organic light-emitting diode

    Directory of Open Access Journals (Sweden)

    Peter Juhasz

    2016-01-01

    Full Text Available The charge behavior of organic light emitting diode (OLED is investigated by steady-state current–voltage technique and impedance spectroscopy at various temperatures to obtain activation energies of charge injection and transport processes. Good agreement of activation energies obtained by steady-state and frequency-domain was used to analyze their contributions to the charge injection and transport. We concluded that charge is injected into the OLED device mostly through the interfacial states at low voltage region, whereas the thermionic injection dominates in the high voltage region. This comparison of experimental techniques demonstrates their capabilities of identification of major bottleneck of charge injection and transport.

  19. Beamline for low-energy transport of highly charged ions at HITRAP

    International Nuclear Information System (INIS)

    Andelkovic, Z.; Herfurth, F.; Kotovskiy, N.; König, K.; Maaß, B.; Murböck, T.; Neidherr, D.; Schmidt, S.; Steinmann, J.; Vogel, M.; Vorobjev, G.

    2015-01-01

    A beamline for transport of highly charged ions with energies as low as a few keV/charge has been constructed and commissioned at GSI. Complementary to the existing infrastructure of the HITRAP facility for deceleration of highly charged ions from the GSI accelerator, the new beamline connects the HITRAP ion decelerator and an EBIT with the associated experimental setups. Therefore, the facility can now transport the decelerated heavy highly charged ions to the experiments or supply them offline with medium-heavy highly charged ions from the EBIT, both at energies as low as a few keV/charge. Here we present the design of the 20 m long beamline with the corresponding beam instrumentation, as well as its performance in terms of energy and transport efficiency

  20. Chromium reduces the in vitro activity and fidelity of DNA replication mediated by the human cell DNA synthesome

    International Nuclear Information System (INIS)

    Dai Heqiao; Liu Jianying; Malkas, Linda H.; Catalano, Jennifer; Alagharu, Srilakshmi; Hickey, Robert J.

    2009-01-01

    Hexavalent chromium Cr(VI) is known to be a carcinogenic metal ion, with a complicated mechanism of action. It can be found within our environment in soil and water contaminated by manufacturing processes. Cr(VI) ion is readily taken up by cells, and is recognized to be both genotoxic and cytotoxic; following its reduction to the stable trivalent form of the ion, chromium(Cr(III)), within cells. This form of the ion is known to impede the activity of cellular DNA polymerase and polymerase-mediated DNA replication. Here, we report the effects of chromium on the activity and fidelity of the DNA replication process mediated by the human cell DNA synthesome. The DNA synthesome is a functional multiprotein complex that is fully competent to carry-out each phase of the DNA replication process. The IC 50 of Cr(III) toward the activity of DNA synthesome-associated DNA polymerases α, δ and ε is 15, 45 and 125 μM, respectively. Cr(III) inhibits synthesome-mediated DNA synthesis (IC 50 = 88 μM), and significantly reduces the fidelity of synthesome-mediated DNA replication. The mutation frequency induced by the different concentrations of Cr(III) ion used in our assays ranges from 2-13 fold higher than that which occurs spontaneously, and the types of mutations include single nucleotide substitutions, insertions, and deletions. Single nucleotide substitutions are the predominant type of mutation, and they occur primarily at GC base-pairs. Cr(III) ion produces a lower number of transition and a higher number of transversion mutations than occur spontaneously. Unlike Cr(III), Cr(VI) ion has little effect on the in vitro DNA synthetic activity and fidelity of the DNA synthesome, but does significantly inhibit DNA synthesis in intact cells. Cell growth and proliferation is also arrested by increasing concentrations of Cr(VI) ion. Our studies provide evidence indicating that the chromium ion induced decrease in the fidelity and activity of synthesome mediated DNA replication

  1. Tolerance of DNA Mismatches in Dmc1 Recombinase-mediated DNA Strand Exchange*

    Science.gov (United States)

    Borgogno, María V.; Monti, Mariela R.; Zhao, Weixing; Sung, Patrick; Argaraña, Carlos E.; Pezza, Roberto J.

    2016-01-01

    Recombination between homologous chromosomes is required for the faithful meiotic segregation of chromosomes and leads to the generation of genetic diversity. The conserved meiosis-specific Dmc1 recombinase catalyzes homologous recombination triggered by DNA double strand breaks through the exchange of parental DNA sequences. Although providing an efficient rate of DNA strand exchange between polymorphic alleles, Dmc1 must also guard against recombination between divergent sequences. How DNA mismatches affect Dmc1-mediated DNA strand exchange is not understood. We have used fluorescence resonance energy transfer to study the mechanism of Dmc1-mediated strand exchange between DNA oligonucleotides with different degrees of heterology. The efficiency of strand exchange is highly sensitive to the location, type, and distribution of mismatches. Mismatches near the 3′ end of the initiating DNA strand have a small effect, whereas most mismatches near the 5′ end impede strand exchange dramatically. The Hop2-Mnd1 protein complex stimulates Dmc1-catalyzed strand exchange on homologous DNA or containing a single mismatch. We observed that Dmc1 can reject divergent DNA sequences while bypassing a few mismatches in the DNA sequence. Our findings have important implications in understanding meiotic recombination. First, Dmc1 acts as an initial barrier for heterologous recombination, with the mismatch repair system providing a second level of proofreading, to ensure that ectopic sequences are not recombined. Second, Dmc1 stepping over infrequent mismatches is likely critical for allowing recombination between the polymorphic sequences of homologous chromosomes, thus contributing to gene conversion and genetic diversity. PMID:26709229

  2. Charge transport across bulk heterojunction organic thin film

    Energy Technology Data Exchange (ETDEWEB)

    Tessema, Genene [University of Kwazulu-Natal, School of Physics, Scottsville (South Africa); Addis Ababa University, Department of Physics, Addis Ababa (Ethiopia)

    2012-01-15

    The transport of charges in organic photo-active film has been the focus of tremendous research in the past few decades with the view to understand the physics of the polymers. Bulk heterojunction type devices are particularly more interesting because of their high power conversion efficiency. We have fabricated organic PV cell based on sandwich type ITO/PEDOT:PSS/APFO green-6:PCBM/LiF/Al device structure. The space charge limited currents were investigated to be able to derive important transport parameters of the devices. The measured current agrees very well with trap free space charge limited transport theory. The zero field mobility and field activation factor found from the data were {mu} {sub 0}=(3.39{+-}0.2) x 10{sup -6} m{sup 2}/V sec and {gamma}=(8.3{+-}0.3) x 10{sup -4} (m/V){sup 1/2}, respectively. (orig.)

  3. Ultrafast dynamics of solvation and charge transfer in a DNA-based biomaterial.

    Science.gov (United States)

    Choudhury, Susobhan; Batabyal, Subrata; Mondol, Tanumoy; Sao, Dilip; Lemmens, Peter; Pal, Samir Kumar

    2014-05-01

    Charge migration along DNA molecules is a key factor for DNA-based devices in optoelectronics and biotechnology. The association of a significant amount of water molecules in DNA-based materials for the intactness of the DNA structure and their dynamic role in the charge-transfer (CT) dynamics is less documented in contemporary literature. In the present study, we have used a genomic DNA-cetyltrimethyl ammonium chloride (CTMA) complex, a technological important biomaterial, and Hoechest 33258 (H258), a well-known DNA minor groove binder, as fluorogenic probe for the dynamic solvation studies. The CT dynamics of CdSe/ZnS quantum dots (QDs; 5.2 nm) embedded in the as-prepared and swollen biomaterial have also been studied and correlated with that of the timescale of solvation. We have extended our studies on the temperature-dependent CT dynamics of QDs in a nanoenvironment of an anionic, sodium bis(2-ethylhexyl)sulfosuccinate reverse micelle (AOT RMs), whereby the number of water molecules and their dynamics can be tuned in a controlled manner. A direct correlation of the dynamics of solvation and that of the CT in the nanoenvironments clearly suggests that the hydration barrier within the Arrhenius framework essentially dictates the charge-transfer dynamics. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Quadrupole transport experiment with space charge dominated cesium ion beam

    International Nuclear Information System (INIS)

    Faltens, A.; Keefe, D.; Kim, C.; Rosenblum, S.; Tiefenback, M.; Warwick, A.

    1984-08-01

    The purpose of the experiment is to investigate the beam current transport limit in a long quadrupole-focussed transport channel in the space charge dominated region where the space charge defocussing force is almost as large as the average focussing force of the channel

  5. Tolerance of DNA Mismatches in Dmc1 Recombinase-mediated DNA Strand Exchange.

    Science.gov (United States)

    Borgogno, María V; Monti, Mariela R; Zhao, Weixing; Sung, Patrick; Argaraña, Carlos E; Pezza, Roberto J

    2016-03-04

    Recombination between homologous chromosomes is required for the faithful meiotic segregation of chromosomes and leads to the generation of genetic diversity. The conserved meiosis-specific Dmc1 recombinase catalyzes homologous recombination triggered by DNA double strand breaks through the exchange of parental DNA sequences. Although providing an efficient rate of DNA strand exchange between polymorphic alleles, Dmc1 must also guard against recombination between divergent sequences. How DNA mismatches affect Dmc1-mediated DNA strand exchange is not understood. We have used fluorescence resonance energy transfer to study the mechanism of Dmc1-mediated strand exchange between DNA oligonucleotides with different degrees of heterology. The efficiency of strand exchange is highly sensitive to the location, type, and distribution of mismatches. Mismatches near the 3' end of the initiating DNA strand have a small effect, whereas most mismatches near the 5' end impede strand exchange dramatically. The Hop2-Mnd1 protein complex stimulates Dmc1-catalyzed strand exchange on homologous DNA or containing a single mismatch. We observed that Dmc1 can reject divergent DNA sequences while bypassing a few mismatches in the DNA sequence. Our findings have important implications in understanding meiotic recombination. First, Dmc1 acts as an initial barrier for heterologous recombination, with the mismatch repair system providing a second level of proofreading, to ensure that ectopic sequences are not recombined. Second, Dmc1 stepping over infrequent mismatches is likely critical for allowing recombination between the polymorphic sequences of homologous chromosomes, thus contributing to gene conversion and genetic diversity. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Transportable charge in a periodic alternating gradient system

    International Nuclear Information System (INIS)

    Lee, E.P.; Fessenden, T.J.; Laslett, L.J.

    1985-05-01

    A simple set of formulas is derived which relate emittance, line charge density, matched maximum and average envelope radii, occupancy factors, and the (space charge) depressed and vacuum values of tune. This formulation is an improvement on the smooth limit approximation; deviations from exact (numerically determined) relations are on the order of +-2%, while the smooth limit values are in error by up to +-30%. This transport formalism is used to determine the limits of transportable line charge density in an electrostatic quadrupole array, with specific application to the low energy portion of the High Temperature Experiment of Heavy Ion Fusion Accelerator Research. The line charge density limit is found to be essentially proportional to the voltage on the pole faces and the fraction of occupied aperture area. A finite injection energy (greater than or equal to 2 MeV) is required to realize this limit, independent of particle mass

  7. Charge transport in conjugated polymers: a multiscale picture

    Science.gov (United States)

    Ruehle, Victor; Kirkpatrick, James; Kremer, Kurt; Andrienko, Denis

    2009-03-01

    A framework to study charge transport in conjugated polymers using realistic morphologies is developed. First, the atomistic force field is refined using first-principles calculations. Systematic coarse graining is then performed to extend simulation times and system sizes accessible to molecular dynamics simulations. Material morphologies are generated using the coarse grained and atomistic models. Finally, the charge mobility is obtained using temperature activated hopping picture for charge transport [1]. The framework is tested on neutral and oxidized polypyrrole with different structural ordering [2]. [4pt] [1] J. Kirkpatrick, V. Marcon, J. Nelson, K. Kremer, D. Andrienko, Phys. Rev. Lett. 98, 227402 (2007)[0pt] [2] V. Ruehle, J. Kirkpatrick, K. Kremer, D. Andrienko, Phys. Stat. Solidi B, 245, 844 (2008)

  8. Two-Dimensional Charge Transport in Disordered Organic Semiconductors

    NARCIS (Netherlands)

    Brondijk, J. J.; Roelofs, W. S. C.; Mathijssen, S. G. J.; Shehu, A.; Cramer, T.; Biscarini, F.; Blom, P. W. M.; de Leeuw, D. M.

    2012-01-01

    We analyze the effect of carrier confinement on the charge-transport properties of organic field-effect transistors. Confinement is achieved experimentally by the use of semiconductors of which the active layer is only one molecule thick. The two-dimensional confinement of charge carriers provides

  9. Lateral charge transport from heavy-ion tracks in integrated circuit chips

    Science.gov (United States)

    Zoutendyk, J. A.; Schwartz, H. R.; Nevill, L. R.

    1988-01-01

    A 256K DRAM has been used to study the lateral transport of charge (electron-hole pairs) induced by direct ionization from heavy-ion tracks in an IC. The qualitative charge transport has been simulated using a two-dimensional numerical code in cylindrical coordinates. The experimental bit-map data clearly show the manifestation of lateral charge transport in the creation of adjacent multiple-bit errors from a single heavy-ion track. The heavy-ion data further demonstrate the occurrence of multiple-bit errors from single ion tracks with sufficient stopping power. The qualitative numerical simulation results suggest that electric-field-funnel-aided (drift) collection accounts for single error generated by an ion passing through a charge-collecting junction, while multiple errors from a single ion track are due to lateral diffusion of ion-generated charge.

  10. Ultraviolet radiation-mediated damage to cellular DNA

    International Nuclear Information System (INIS)

    Cadet, Jean; Sage, Evelyne; Douki, Thierry

    2005-01-01

    Emphasis is placed in this review article on recent aspects of the photochemistry of cellular DNA in which both the UVB and UVA components of solar radiation are implicated individually or synergistically. Interestingly, further mechanistic insights into the UV-induced formation of DNA photoproducts were gained from the application of new accurate and sensitive chromatographic and enzymic assays aimed at measuring base damage. Thus, each of the twelve possible dimeric photoproducts that are produced at the four main bipyrimidine sites can now be singled out as dinucleoside monophosphates that are enzymatically released from UV-irradiated DNA. This was achieved using a recently developed high-performance liquid chromatography-tandem mass spectrometry assay (HPLC-MS/MS) assay after DNA extraction and appropriate enzymic digestion. Interestingly, a similar photoproduct distribution pattern is observed in both isolated and cellular DNA upon exposure to low doses of either UVC or UVB radiation. This applies more specifically to the DNA of rodent and human cells, the cis-syn cyclobutadithymine being predominant over the two other main photolesions, namely thymine-cytosine pyrimidine (6-4) pyrimidone adduct and the related cyclobutyl dimer. UVA-irradiation was found to generate cyclobutane dimers at TT and to a lower extent at TC sites as a likely result of energy transfer mechanism involving still unknown photoexcited chromophore(s). Oxidative damage to DNA is also induced although less efficiently by UVA-mediated photosensitization processes that mostly involved 1 O 2 together with a smaller contribution of hydroxyl radical-mediated reactions through initially generated superoxide radicals

  11. Charge Injection and Transport in Metal/Polymer Chains/Metal Sandwich Structure

    International Nuclear Information System (INIS)

    Hai-Hong, Li; Dong-Mei, Li; Yuan, Li; Kun, Gao; De-Sheng, Liu; Shi-Jie, Xie

    2008-01-01

    Using the tight-binding Su–Schrieffer–Heeger model and a nonadiabatic dynamic evolution method, we study the dynamic processes of the charge injection and transport in a metal/two coupled conjugated polymer chains/metal structure. It is found that the charge interchain transport is determined by the strength of the electric field and the magnitude of the voltage bias applied on the metal electrode. The stronger electric field and the larger voltage bias are both in favour of the charge interchain transport. (condensed matter: electronic structure, electrical, magnetic, and optical properties)

  12. The single-sink fixed-charge transportation problem: Applications and solution methods

    DEFF Research Database (Denmark)

    Goertz, Simon; Klose, Andreas

    2007-01-01

    The single-sink fixed-charge transportation problem (SSFCTP) consists in finding a minimum cost flow from a number of supplier nodes to a single demand node. Shipping costs comprise costs proportional to the amount shipped as well as a fixed-charge. Although the SSFCTP is an important special case...... of the well-known fixed-charge transportation problem, just a few methods for solving this problem have been proposed in the literature. After summarising some applications of this problem arising in manufacturing and transportation, we give an overview on approximation algorithms and worst-case results...

  13. The charge transport in an electrostatic belt generator

    NARCIS (Netherlands)

    Vermeer, A.; Strasters, B.A.

    1975-01-01

    The fluctuations in the charge transport system of an EN Tandem Van de Graaff accelerator have been investigated by means of a frequency spectrum analyser. Frequency spectra of the terminal ripple, the short-circuit current and the voltage at the belt charge screen have been measured. Also the

  14. A common pathway for charge transport through voltage-sensing domains.

    Science.gov (United States)

    Chanda, Baron; Bezanilla, Francisco

    2008-02-07

    Voltage-gated ion channels derive their voltage sensitivity from the movement of specific charged residues in response to a change in transmembrane potential. Several studies on mechanisms of voltage sensing in ion channels support the idea that these gating charges move through a well-defined permeation pathway. This gating pathway in a voltage-gated ion channel can also be mutated to transport free cations, including protons. The recent discovery of proton channels with sequence homology to the voltage-sensing domains suggests that evolution has perhaps exploited the same gating pathway to generate a bona fide voltage-dependent proton transporter. Here we will discuss implications of these findings on the mechanisms underlying charge (and ion) transport by voltage-sensing domains.

  15. DNA methylation of amino acid transporter genes in the human placenta.

    Science.gov (United States)

    Simner, C; Novakovic, B; Lillycrop, K A; Bell, C G; Harvey, N C; Cooper, C; Saffery, R; Lewis, R M; Cleal, J K

    2017-12-01

    Placental transfer of amino acids via amino acid transporters is essential for fetal growth. Little is known about the epigenetic regulation of amino acid transporters in placenta. This study investigates the DNA methylation status of amino acid transporters and their expression across gestation in human placenta. BeWo cells were treated with 5-aza-2'-deoxycytidine to inhibit methylation and assess the effects on amino acid transporter gene expression. The DNA methylation levels of amino acid transporter genes in human placenta were determined across gestation using DNA methylation array data. Placental amino acid transporter gene expression across gestation was also analysed using data from publically available Gene Expression Omnibus data sets. The expression levels of these transporters at term were established using RNA sequencing data. Inhibition of DNA methylation in BeWo cells demonstrated that expression of specific amino acid transporters can be inversely associated with DNA methylation. Amino acid transporters expressed in term placenta generally showed low levels of promoter DNA methylation. Transporters with little or no expression in term placenta tended to be more highly methylated at gene promoter regions. The transporter genes SLC1A2, SLC1A3, SLC1A4, SLC7A5, SLC7A11 and SLC7A10 had significant changes in enhancer DNA methylation across gestation, as well as gene expression changes across gestation. This study implicates DNA methylation in the regulation of amino acid transporter gene expression. However, in human placenta, DNA methylation of these genes remains low across gestation and does not always play an obvious role in regulating gene expression, despite clear evidence for differential expression as gestation proceeds. Copyright © 2017. Published by Elsevier Ltd.

  16. Macroscopic acoustoelectric charge transport in graphene

    Science.gov (United States)

    Bandhu, L.; Lawton, L. M.; Nash, G. R.

    2013-09-01

    We demonstrate macroscopic acoustoelectric transport in graphene, transferred onto piezoelectric lithium niobate substrates, between electrodes up to 500 μm apart. Using double finger interdigital transducers we have characterised the acoustoelectric current as a function of both surface acoustic wave intensity and frequency. The results are consistent with a relatively simple classical relaxation model, in which the acoustoelectric current is proportional to both the surface acoustic wave intensity and the attenuation of the wave caused by the charge transport.

  17. Nonequilibrium response of an electron-mediated charge density wave ordered material to a large dc electric field

    Science.gov (United States)

    Matveev, O. P.; Shvaika, A. M.; Devereaux, T. P.; Freericks, J. K.

    2016-01-01

    Using the Kadanoff-Baym-Keldysh formalism, we employ nonequilibrium dynamical mean-field theory to exactly solve for the nonlinear response of an electron-mediated charge-density-wave-ordered material. We examine both the dc current and the order parameter of the conduction electrons as the ordered system is driven by the electric field. Although the formalism we develop applies to all models, for concreteness, we examine the charge-density-wave phase of the Falicov-Kimball model, which displays a number of anomalous behaviors including the appearance of subgap density of states as the temperature increases. These subgap states should have a significant impact on transport properties, particularly the nonlinear response of the system to a large dc electric field.

  18. Temperature dependent charge transport in poly(3-hexylthiophene) diodes

    Science.gov (United States)

    Rahaman, Abdulla Bin; Sarkar, Atri; Banerjee, Debamalya

    2018-04-01

    In this work, we present charge transport properties of poly(3-hexylthiophene) (P3HT) diodes under dark conditions. Temperature dependent current-voltage (J-V) characteristics shows that charge transport represents a transition from ohomic to trap limited current. The forward current density obeys a power law J˜Vm, m>2 represents the space charge limited current region in presence of traps within the band gap. Frequency dependent conductivity has been studied in a temperature range 150K-473K. The dc conductivity values show Arrhenius like behavior and it gives conductivity activation energy 223 meV. Temperature dependent conductivity indicates a thermodynamic transition of our system.

  19. 19 CFR 351.515 - Internal transport and freight charges for export shipments.

    Science.gov (United States)

    2010-04-01

    ... shipments. 351.515 Section 351.515 Customs Duties INTERNATIONAL TRADE ADMINISTRATION, DEPARTMENT OF COMMERCE... Internal transport and freight charges for export shipments. (a) Benefit—(1) In general. In the case of internal transport and freight charges on export shipments, a benefit exists to the extent that the charges...

  20. Role of transport band edge variation on delocalized charge transport in high-mobility crystalline organic semiconductors

    Science.gov (United States)

    Kadashchuk, Andrey; Tong, Fei; Janneck, Robby; Fishchuk, Ivan I.; Mityashin, Alexander; Pavlica, Egon; Köhler, Anna; Heremans, Paul; Rolin, Cedric; Bratina, Gvido; Genoe, Jan

    2017-09-01

    We demonstrate that the degree of charge delocalization has a strong impact on polarization energy and thereby on the position of the transport band edge in organic semiconductors. This gives rise to long-range potential fluctuations, which govern the electronic transport through delocalized states in organic crystalline layers. This concept is employed to formulate an analytic model that explains a negative field dependence coupled with a positive temperature dependence of the charge mobility observed by a lateral time-of-flight technique in a high-mobility crystalline organic layer. This has important implications for the further understanding of the charge transport via delocalized states in organic semiconductors.

  1. Switchable DNA wire: deposition-stripping of copper nanoclusters as an "ON-OFF" nanoswitch.

    Science.gov (United States)

    Zhu, Xiaoli; Liu, Siyu; Cao, Jiepei; Mao, Xiaoxia; Li, Genxi

    2016-01-19

    Today, a consensus that DNA working as a molecular wire shows promise in nanoscale electronics is reached. Considering that the "ON-OFF" switch is the basis of a logic circuit, the switch of DNA-mediated charge transport (DNA CT) should be conquered. Here, on the basis of chemical or electrochemical deposition and stripping of DNA-templated copper nanoclusters (CuNCs), we develop an "ON-OFF" nanoswitch for DNA CT. While CuNCs are deposited, the DNA CT is blocked, which can be also recovered after stripping the CuNCs. A switch cycle can be completed in a few seconds and can be repeated for many times. Moreover, by regulating the amount of reagents, deposition/stripping time, applied potential, etc., the switch is adjustable to make the wire at either an "ON-OFF" state or an intermediate state. We believe that this concept and the successful implementation will promote the practical application of DNA wire one step further.

  2. Longitudinal and transverse space charge limitations on transport of maximum power beams

    International Nuclear Information System (INIS)

    Khoe, T.K.; Martin, R.L.

    1977-01-01

    The maximum transportable beam power is a critical issue in selecting the most favorable approach to generating ignition pulses for inertial fusion with high energy accelerators. Maschke and Courant have put forward expressions for the limits on transport power for quadrupole and solenoidal channels. Included in a more general way is the self consistent effect of space charge defocusing on the power limit. The results show that no limits on transmitted power exist in principal. In general, quadrupole transport magnets appear superior to solenoids except for transport of very low energy and highly charged particles. Longitudinal space charge effects are very significant for transport of intense beams

  3. Reversible assembly of protein-DNA nanostructures triggered by mediated electron transfer

    International Nuclear Information System (INIS)

    Vogt, Stephan; Wenderhold-Reeb, Sabine; Nöll, Gilbert

    2017-01-01

    Stable protein-DNA nanostructures have been assembled by reconstitution of the multi-ligand binding flavoprotein dodecin on top of flavin-terminated dsDNA monolayers on gold electrodes. These structures could be disassembled by electrochemical flavin reduction via mediated electron transfer. For this purpose a negative potential was applied at the Au working electrode in the presence of the redox mediator bis-(ammoniumethyl)-4,4′-bipyridinium tetrabromide. The stepwise formation of the flavin-terminated dsDNA monolayers as well as the binding and electrochemically triggered release of apododecin were monitored by surface plasmon resonance (SPR) and quartz crystal microbalance (QCM) measurements. The assembly and disassembly of the protein-DNA nanostructures were fully reversible processes, which could be carried out multiple times at the same flavin-dsDNA modified surface. When a negative potential was applied in the absence of a redox mediator apododecin could not be released, i.e. direct electron transfer was not possible. As alternative redox mediators also methylene blue and phenosafranine were studied, but in the presence of these molecules apododecin was released without applying a potential, probably because the tricyclic aromatic compounds are able to replace the flavins at the binding sites.

  4. On the electrostatics of DNA in chromatin

    Directory of Open Access Journals (Sweden)

    Klemen Bohinc

    2016-02-01

    Full Text Available We examine the interaction between DNA molecules immersed in an aqueous solution of oppositely charged, trivalent spermidine molecules. The DNA molecules are modeled as planar, likecharged surfaces immersed in an aqueous solution of multivalent, rod-like ions consisting of rigidly bonded point charges. An approximate field theory is used to determine the properties of this system from the weak to the intermediate through to the strong coupling regimes. In the weak coupling limit, the interaction between the charged surfaces is only repulsive, whereas in the intermediate coupling regime, the rod-like ions with spatial charge distribution can induce attractive force between the charged surfaces. In the strong coupling limit, the inter-ionic charge correlations induce attractive interaction at short separations between the surfaces. This theoretical study can give new insights in the problem of interaction between DNA molecules mediated by trivalent spermidine molecules.

  5. Transport of electric charge in insulators

    International Nuclear Information System (INIS)

    Lopez C, E.

    1979-01-01

    In this work a review is made of important concepts in the study of the transport of electric charge in insulators. These concepts are: electrical contacts, transport regimes as viewed in the I-V characteristics, and photoinjection processes by internal photemission of holes or electrons from metals or semiconductors into insulators or by a virtual electrode using strongly absorbed light. Experimental results of photoinjection of holes and electrons into sulfur single crystals are analyzed using these concepts. The observation of the Mott-Gurney transition is reported for the first time. This is the transition between the region of space charge limited currents (SCLC) and the region of saturation of the current as a function of the applied voltage. A modified Mott-Gurney theoretical model is presented that is able to explain the whole I-V characteristic for uv and the internal photoemission of hopes and uv photoinjection of electrons. For the case of internal photoemission of electrons the conventional space charge limited current theory for an exponential distribution of traps is able to explain the experimental data. It is found that the crystals are of high purity since the total density of traps, as calculated from their exponential distribution, is Nsub(t) equals 1.8 X 10 14 cm -3 . (author)

  6. DNA-mediated bacterial aggregation is dictated by acid-base interactions

    NARCIS (Netherlands)

    Das, Theerthankar; Krom, Bastiaan P.; van der Mei, Henny C.; Busscher, Henk J.; Sharma, Prashant K.

    2011-01-01

    Extracellular DNA (eDNA) plays a significant role in bacterial biofilm formation and aggregation. Here, for the first time, we present a physico-chemical analysis of the DNA-mediated aggregation for three bacterial strains (Streptococcus mutans LT11, Pseudomonas aeruginosa PAO1 and Staphylococcus

  7. Structural mediation on polycation nanoparticles by sulfadiazine to enhance DNA transfection efficiency and reduce toxicity.

    Science.gov (United States)

    Long, Xingwen; Zhang, Zhihui; Han, Shangcong; Tang, Minjie; Zhou, Junhui; Zhang, Jianhua; Xue, Zhenyi; Li, Yan; Zhang, Rongxin; Deng, Liandong; Dong, Anjie

    2015-04-15

    Reducing the toxicity while maintaining high transfection efficiency is an important issue for cationic polymers as gene carriers in clinical application. In this paper, a new zwitterionic copolymer, polycaprolactone-g-poly(dimethylaminoethyl methyacrylate-co-sulfadiazine methacrylate) (PC-SDZ) with unique pH-sensitivity, was designed and prepared. The incorporation of sulfadiazine into poly(dimethylaminoethyl methacrylate) (PDMAEMA) chains successfully mediates the surface properties including compacter shell structure, lower density of positive charges, stronger proton buffer capability, and enhanced hydrophobicity, which lead to reduction in toxicity and enhancements in stability, cellular uptake, endosome escape, and transfection efficiency for the PC-SDZ2 nanoparticles (NPs)/DNA complexes. Excellent transfection efficiency at the optimal N/P ratio of 10 was observed for PC-SDZ2 NPs/DNA complexes, which was higher than that of the commercial reagent-branched polyethylenimine (PEI). The cytotoxicity was evaluated by CCK8 measurement, and the results showed significant reduction in cytotoxicity even at high concentration of complexes after sulfadiazine modification. Therefore, this work may demonstrate a new way of structural mediation of cationic polymer carriers for gene delivery with high efficiency and low toxicity.

  8. Diffusive charge transport in graphene

    Science.gov (United States)

    Chen, Jianhao

    The physical mechanisms limiting the mobility of graphene on SiO 2 are studied and printed graphene devices on a flexible substrate are realized. Intentional addition of charged scattering impurities is used to study the effects of charged impurities. Atomic-scale defects are created by noble-gas ions irradiation to study the effect of unitary scatterers. The results show that charged impurities and atomic-scale defects both lead to conductivity linear in density in graphene, with a scattering magnitude that agrees quantitatively with theoretical estimates. While charged impurities cause intravalley scattering and induce a small change in the minimum conductivity, defects in graphene scatter electrons between the valleys and suppress the minimum conductivity below the metallic limit. Temperature-dependent measurements show that longitudinal acoustic phonons in graphene produce a small resistivity which is linear in temperature and independent of carrier density; at higher temperatures, polar optical phonons of the SiO2 substrate give rise to an activated, carrier density-dependent resistivity. Graphene is also made into high mobility transparent and flexible field effect device via the transfer-printing method. Together the results paint a complete picture of charge carrier transport in graphene on SiO2 in the diffusive regime, and show the promise of graphene as a novel electronic material that have potential applications not only on conventional inorganic substrates, but also on flexible substrates.

  9. Disorder-tuned charge transport in organic semiconductors

    Science.gov (United States)

    Xu, Feng; Qiu, Dong; Yan, Dadong

    2013-02-01

    We propose that the polaron transport in organic semiconductors is remarkably tuned by the fluctuation of polarization energy. The tuning effect of energetic fluctuation not only causes a continuous transition from non-Arrhenius to Arrhenius temperature activated charge transport with increasing moderate disorder strengths but also results in a band-like conduction in the low disorder regime which benefits from the enhanced mobilities in shallow trap states. As a result, a unified description of polaron transport is obtained for a set of typical organic semiconductors.

  10. Vibronic dephasing model for coherent-to-incoherent crossover in DNA

    Science.gov (United States)

    Karasch, Patrick; Ryndyk, Dmitry A.; Frauenheim, Thomas

    2018-05-01

    In this paper, we investigate the interplay between coherent and incoherent charge transport in cytosine-guanine (GC-) rich DNA molecules. Our objective is to introduce a physically grounded approach to dephasing in large molecules and to understand the length-dependent charge transport characteristics, and especially the crossover from the coherent tunneling to incoherent hopping regime at different temperatures. Therefore, we apply the vibronic dephasing model and compare the results to the Büttiker probe model which is commonly used to describe decoherence effects in charge transport. Using the full ladder model and simplified one-dimensional model of DNA, we consider molecular junctions with alternating and stacked GC sequences and compare our results to recent experimental measurements.

  11. Switchable DNA wire: deposition-stripping of copper nanoclusters as an “ON-OFF” nanoswitch

    Science.gov (United States)

    Zhu, Xiaoli; Liu, Siyu; Cao, Jiepei; Mao, Xiaoxia; Li, Genxi

    2016-01-01

    Today, a consensus that DNA working as a molecular wire shows promise in nanoscale electronics is reached. Considering that the “ON-OFF” switch is the basis of a logic circuit, the switch of DNA-mediated charge transport (DNA CT) should be conquered. Here, on the basis of chemical or electrochemical deposition and stripping of DNA-templated copper nanoclusters (CuNCs), we develop an “ON-OFF” nanoswitch for DNA CT. While CuNCs are deposited, the DNA CT is blocked, which can be also recovered after stripping the CuNCs. A switch cycle can be completed in a few seconds and can be repeated for many times. Moreover, by regulating the amount of reagents, deposition/stripping time, applied potential, etc., the switch is adjustable to make the wire at either an “ON-OFF” state or an intermediate state. We believe that this concept and the successful implementation will promote the practical application of DNA wire one step further. PMID:26781761

  12. An LP-based heuristic for the fixed charge transportation problem

    DEFF Research Database (Denmark)

    Klose, Andreas

    2007-01-01

    The fixed charge transportation problem consists in finding a minimum cost network flow from a set of suppliers to a set of customers. Beside costs proportional to quantities transported, transportation costs also include a fixed charge. The paper describes a linear programming based heuristic...... approach for computing lower and upper bounds on the minimal cost. To this end, the LP relaxation is iteratively strengthened by means of adding cuts; in each iteration the current LP solution is then used to guide a local search heuristic. In addition to standard polyhedral cuts as lifted cover...

  13. Role of mesoscopic morphology in charge transport of doped ...

    Indian Academy of Sciences (India)

    In doped polyaniline (PANI), the charge transport properties are determined by mesoscopic morphology, which in turn is controlled by the molecular recognition interactions among polymer chain, dopant and solvent. Molecular recognition plays a significant role in chain conformation and charge delocalization.

  14. Temperature-mediated polymorphism in molecular crystals: The impact on crystal packing and charge transport

    KAUST Repository

    Stevens, Loah A.; Goetz, Katelyn P.; Fonari, Alexandr; Shu, Ying; Williamson, Rachel M.; Bredas, Jean-Luc; Coropceanu, Veaceslav P.; Jurchescu, Oana D.; Collis, Gavin E.

    2015-01-01

    We report a novel synthesis to ultra high purity 7,14-bis((trimethylsilyl)ethynyl)dibenzo[b,def]-chrysene (TMS-DBC) and the use of this material in the growth of single crystals by solution and vapor deposition techniques. We observe that the substrate temperature has a dramatic impact on the crystal growth, producing two distinct polymorphs of TMS-DBC; low temperature (LT) fine red needles and high temperature (HT) large yellow platelets. Single crystal X-ray crystallography confirms packing structures where the LT crystals form a 1D slipped-stack structure, while the HT crystals adopt a 2D brickwork motif. These polymorphs also represent a rare example where both are extremely stable and do not interconvert to the other crystal structure upon solvent or thermal annealing. Single crystal organic field-effect transistors of the LT and HT crystals show that the HT 2D brickwork motif produces hole mobilities as high as 2.1 cm2 V-1 s-1, while the mobility of the 1D structure is significantly lower, at 0.028 cm2 V-1 s-1. Electronic-structure calculations indicate that the superior charge transport in the brickwork polymorph in comparison to the slipped-stack polymorph is due to the presence of an increased dimensionality of the charge migration pathways.

  15. Temperature-mediated polymorphism in molecular crystals: The impact on crystal packing and charge transport

    KAUST Repository

    Stevens, Loah A.

    2015-01-13

    We report a novel synthesis to ultra high purity 7,14-bis((trimethylsilyl)ethynyl)dibenzo[b,def]-chrysene (TMS-DBC) and the use of this material in the growth of single crystals by solution and vapor deposition techniques. We observe that the substrate temperature has a dramatic impact on the crystal growth, producing two distinct polymorphs of TMS-DBC; low temperature (LT) fine red needles and high temperature (HT) large yellow platelets. Single crystal X-ray crystallography confirms packing structures where the LT crystals form a 1D slipped-stack structure, while the HT crystals adopt a 2D brickwork motif. These polymorphs also represent a rare example where both are extremely stable and do not interconvert to the other crystal structure upon solvent or thermal annealing. Single crystal organic field-effect transistors of the LT and HT crystals show that the HT 2D brickwork motif produces hole mobilities as high as 2.1 cm2 V-1 s-1, while the mobility of the 1D structure is significantly lower, at 0.028 cm2 V-1 s-1. Electronic-structure calculations indicate that the superior charge transport in the brickwork polymorph in comparison to the slipped-stack polymorph is due to the presence of an increased dimensionality of the charge migration pathways.

  16. New organic photorefractive material composed of a charge-transporting dendrimer and a stilbene chromophore

    Science.gov (United States)

    Bai, Jaeil; Ducharme, Stephen; Leonov, Alexei G.; Lu, Liu; Takacs, James M.

    1999-10-01

    In this report, we introduce new organic photorefractive composites consisting of charge transporting den-drimers highly doped with a stilbene nonlinear optic chromophore, The purpose of making these composites is to improve charge transport, by reducing inhomogeneity when compared to ordinary polymer-based systems. Because the structure of this material gives us freedom to control the orientation of charge transport agents synthetically, we can study the charge transport mechanism more systematically than in polymers. We discuss this point and present the characterization results for this material.

  17. Charge transport in electrically doped amorphous organic semiconductors.

    Science.gov (United States)

    Yoo, Seung-Jun; Kim, Jang-Joo

    2015-06-01

    This article reviews recent progress on charge generation by doping and its influence on the carrier mobility in organic semiconductors (OSs). The doping induced charge generation efficiency is generally low in OSs which was explained by the integer charge transfer model and the hybrid charge transfer model. The ionized dopants formed by charge transfer between hosts and dopants can act as Coulomb traps for mobile charges, and the presence of Coulomb traps in OSs broadens the density of states (DOS) in doped organic films. The Coulomb traps strongly reduce the carrier hopping rate and thereby change the carrier mobility, which was confirmed by experiments in recent years. In order to fully understand the doping mechanism in OSs, further quantitative and systematic analyses of charge transport characteristics must be accomplished. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Numerical computation of discrete differential scattering cross sections for Monte Carlo charged particle transport

    International Nuclear Information System (INIS)

    Walsh, Jonathan A.; Palmer, Todd S.; Urbatsch, Todd J.

    2015-01-01

    Highlights: • Generation of discrete differential scattering angle and energy loss cross sections. • Gauss–Radau quadrature utilizing numerically computed cross section moments. • Development of a charged particle transport capability in the Milagro IMC code. • Integration of cross section generation and charged particle transport capabilities. - Abstract: We investigate a method for numerically generating discrete scattering cross sections for use in charged particle transport simulations. We describe the cross section generation procedure and compare it to existing methods used to obtain discrete cross sections. The numerical approach presented here is generalized to allow greater flexibility in choosing a cross section model from which to derive discrete values. Cross section data computed with this method compare favorably with discrete data generated with an existing method. Additionally, a charged particle transport capability is demonstrated in the time-dependent Implicit Monte Carlo radiative transfer code, Milagro. We verify the implementation of charged particle transport in Milagro with analytic test problems and we compare calculated electron depth–dose profiles with another particle transport code that has a validated electron transport capability. Finally, we investigate the integration of the new discrete cross section generation method with the charged particle transport capability in Milagro.

  19. Charge reversible gold nanoparticles for high efficient absorption and desorption of DNA

    Energy Technology Data Exchange (ETDEWEB)

    Wang Can; Zhuang Jiaqi; Jiang Shan; Li Jun; Yang Wensheng, E-mail: wsyang@jlu.edu.cn [Jilin University, State Key Laboratory of Supramolecular Structure and Materials, College of Chemistry (China)

    2012-10-15

    Mercaptoundecylamine and mercaptoundecanoic acid co-modified Au nanoparticles were prepared by two-step ligand exchange of 6-mercaptohexanoic acid modified gold nanoparticles. Such particles terminated by appropriate ratios of the amine and carboxyl groups (R{sub N/C}) were identified to show reversible charge on their surface, which were switchable by pH of the solution. The isoelectric point (IEP) of the particles is tunable by changing the ratios of the amine and carboxyl groups on the particle surfaces. The particles can absorb DNA effectively at pH lower than the IEP driven by the direct electrostatic interactions between DNA and the particle surface. When pH of the solutions was elevated to be higher than the IEP, the absorbed DNA can be released almost completely due to the electrostatic repulsion between the particle surface and DNA. With appropriate R{sub N/C} ratios of 0.8, the absorption and desorption efficiencies of DNA were 97 and 98%, respectively, corresponding an extraction efficiency of 95 %. Such particles with reversible surface charges allow the high efficient extraction of DNA by simply changing pH instead of by changing salt concentration in the conventional salt bridge method.Graphical Abstract.

  20. FOB-SH: Fragment orbital-based surface hopping for charge carrier transport in organic and biological molecules and materials

    Energy Technology Data Exchange (ETDEWEB)

    Spencer, J.; Gajdos, F.; Blumberger, J., E-mail: j.blumberger@ucl.ac.uk [Department of Physics and Astronomy, University College London, Gower Street, London WC1E 6BT (United Kingdom)

    2016-08-14

    We introduce a fragment orbital-based fewest switches surface hopping method, FOB-SH, designed to efficiently simulate charge carrier transport in strongly fluctuating condensed phase systems such as organic semiconductors and biomolecules. The charge carrier wavefunction is expanded and the electronic Hamiltonian constructed in a set of singly occupied molecular orbitals of the molecular sites that mediate the charge transfer. Diagonal elements of the electronic Hamiltonian (site energies) are obtained from a force field, whereas the off-diagonal or electronic coupling matrix elements are obtained using our recently developed analytic overlap method. We derive a general expression for the exact forces on the adiabatic ground and excited electronic state surfaces from the nuclear gradients of the charge localized electronic states. Applications to electron hole transfer in a model ethylene dimer and through a chain of ten model ethylenes validate our implementation and demonstrate its computational efficiency. On the larger system, we calculate the qualitative behaviour of charge mobility with change in temperature T for different regimes of the intermolecular electronic coupling. For small couplings, FOB-SH predicts a crossover from a thermally activated regime at low temperatures to a band-like transport regime at higher temperatures. For higher electronic couplings, the thermally activated regime disappears and the mobility decreases according to a power law. This is interpreted by a gradual loss in probability for resonance between the sites as the temperature increases. The polaron hopping model solved for the same system gives a qualitatively different result and underestimates the mobility decay at higher temperatures. Taken together, the FOB-SH methodology introduced here shows promise for a realistic investigation of charge carrier transport in complex organic, aqueous, and biological systems.

  1. FOB-SH: Fragment orbital-based surface hopping for charge carrier transport in organic and biological molecules and materials

    Science.gov (United States)

    Spencer, J.; Gajdos, F.; Blumberger, J.

    2016-08-01

    We introduce a fragment orbital-based fewest switches surface hopping method, FOB-SH, designed to efficiently simulate charge carrier transport in strongly fluctuating condensed phase systems such as organic semiconductors and biomolecules. The charge carrier wavefunction is expanded and the electronic Hamiltonian constructed in a set of singly occupied molecular orbitals of the molecular sites that mediate the charge transfer. Diagonal elements of the electronic Hamiltonian (site energies) are obtained from a force field, whereas the off-diagonal or electronic coupling matrix elements are obtained using our recently developed analytic overlap method. We derive a general expression for the exact forces on the adiabatic ground and excited electronic state surfaces from the nuclear gradients of the charge localized electronic states. Applications to electron hole transfer in a model ethylene dimer and through a chain of ten model ethylenes validate our implementation and demonstrate its computational efficiency. On the larger system, we calculate the qualitative behaviour of charge mobility with change in temperature T for different regimes of the intermolecular electronic coupling. For small couplings, FOB-SH predicts a crossover from a thermally activated regime at low temperatures to a band-like transport regime at higher temperatures. For higher electronic couplings, the thermally activated regime disappears and the mobility decreases according to a power law. This is interpreted by a gradual loss in probability for resonance between the sites as the temperature increases. The polaron hopping model solved for the same system gives a qualitatively different result and underestimates the mobility decay at higher temperatures. Taken together, the FOB-SH methodology introduced here shows promise for a realistic investigation of charge carrier transport in complex organic, aqueous, and biological systems.

  2. Semiconductor drift chamber: an application of a novel charge transport scheme

    International Nuclear Information System (INIS)

    Gatti, E.; Rehak, P.

    1983-08-01

    The purpose of this paper is to describe a novel charge tranport scheme in semiconductors in which the field responsible for the charge transport is independent of the depletion field. The application of the novel charge transport scheme leads to the following new semiconductor detectors: (1) Semiconductor Draft Chamber; (2) Ultra low capacitance - large semiconductor x-ray spectrometers and photodiodes; and (3) Fully depleted thick CCD. Special attention is paid to the concept of the Semiconductor Draft Chamber as a position sensing detector for high energy charged particles. Position resolution limiting factors are considered, and the values of the resolutions are given

  3. Akt Kinase-Mediated Checkpoint of cGAS DNA Sensing Pathway

    Directory of Open Access Journals (Sweden)

    Gil Ju Seo

    2015-10-01

    Full Text Available Upon DNA stimulation, cyclic GMP-AMP synthase (cGAS synthesizes the second messenger cyclic GMP-AMP (cGAMP that binds to the STING, triggering antiviral interferon-β (IFN-β production. However, it has remained undetermined how hosts regulate cGAS enzymatic activity after the resolution of DNA immunogen. Here, we show that Akt kinase plays a negative role in cGAS-mediated anti-viral immune response. Akt phosphorylated the S291 or S305 residue of the enzymatic domain of mouse or human cGAS, respectively, and this phosphorylation robustly suppressed its enzymatic activity. Consequently, expression of activated Akt led to the reduction of cGAMP and IFN-β production and the increase of herpes simplex virus 1 replication, whereas treatment with Akt inhibitor augmented cGAS-mediated IFN-β production. Furthermore, expression of the phosphorylation-resistant cGAS S291A mutant enhanced IFN-β production upon DNA stimulation, HSV-1 infection, and vaccinia virus infection. Our study identifies an Akt kinase-mediated checkpoint to fine-tune hosts’ immune responses to DNA stimulation.

  4. Cooperative DNA Recognition Modulated by an Interplay between Protein-Protein Interactions and DNA-Mediated Allostery.

    Directory of Open Access Journals (Sweden)

    Felipe Merino

    2015-06-01

    Full Text Available Highly specific transcriptional regulation depends on the cooperative association of transcription factors into enhanceosomes. Usually, their DNA-binding cooperativity originates from either direct interactions or DNA-mediated allostery. Here, we performed unbiased molecular simulations followed by simulations of protein-DNA unbinding and free energy profiling to study the cooperative DNA recognition by OCT4 and SOX2, key components of enhanceosomes in pluripotent cells. We found that SOX2 influences the orientation and dynamics of the DNA-bound configuration of OCT4. In addition SOX2 modifies the unbinding free energy profiles of both DNA-binding domains of OCT4, the POU specific and POU homeodomain, despite interacting directly only with the first. Thus, we demonstrate that the OCT4-SOX2 cooperativity is modulated by an interplay between protein-protein interactions and DNA-mediated allostery. Further, we estimated the change in OCT4-DNA binding free energy due to the cooperativity with SOX2, observed a good agreement with experimental measurements, and found that SOX2 affects the relative DNA-binding strength of the two OCT4 domains. Based on these findings, we propose that available interaction partners in different biological contexts modulate the DNA exploration routes of multi-domain transcription factors such as OCT4. We consider the OCT4-SOX2 cooperativity as a paradigm of how specificity of transcriptional regulation is achieved through concerted modulation of protein-DNA recognition by different types of interactions.

  5. Mediator links transcription and DNA repair by facilitating Rad2/XPG recruitment.

    Science.gov (United States)

    Eyboulet, Fanny; Cibot, Camille; Eychenne, Thomas; Neil, Helen; Alibert, Olivier; Werner, Michel; Soutourina, Julie

    2013-12-01

    Mediator is a large multiprotein complex conserved in all eukaryotes. The crucial function of Mediator in transcription is now largely established. However, we found that this complex also plays an important role by connecting transcription with DNA repair. We identified a functional contact between the Med17 Mediator subunit and Rad2/XPG, the 3' endonuclease involved in nucleotide excision DNA repair. Genome-wide location analyses revealed that Rad2 is associated with RNA polymerase II (Pol II)- and Pol III-transcribed genes and telomeric regions in the absence of exogenous genotoxic stress. Rad2 occupancy of Pol II-transcribed genes is transcription-dependent. Genome-wide Rad2 occupancy of class II gene promoters is well correlated with that of Mediator. Furthermore, UV sensitivity of med17 mutants is correlated with reduced Rad2 occupancy of class II genes and concomitant decrease of Mediator interaction with Rad2 protein. Our results suggest that Mediator is involved in DNA repair by facilitating Rad2 recruitment to transcribed genes.

  6. Charging and Transport Dynamics of a Flow-Through Electrode Capacitive Deionization System.

    Science.gov (United States)

    Qu, Yatian; Campbell, Patrick G; Hemmatifar, Ali; Knipe, Jennifer M; Loeb, Colin K; Reidy, John J; Hubert, Mckenzie A; Stadermann, Michael; Santiago, Juan G

    2018-01-11

    We present a study of the interplay among electric charging rate, capacitance, salt removal, and mass transport in "flow-through electrode" capacitive deionization (CDI) systems. We develop two models describing coupled transport and electro-adsorption/desorption which capture salt removal dynamics. The first model is a simplified, unsteady zero-dimensional volume-averaged model which identifies dimensionless parameters and figures of merits associated with cell performance. The second model is a higher fidelity area-averaged model which captures both spatial and temporal responses of charging. We further conducted an experimental study of these dynamics and considered two salt transport regimes: (1) advection-limited regime and (2) dispersion-limited regime. We use these data to validate models. The study shows that, in the advection-limited regime, differential charge efficiency determines the salt adsorption at the early stage of the deionization process. Subsequently, charging transitions to a quasi-steady state where salt removal rate is proportional to applied current scaled by the inlet flow rate. In the dispersion-dominated regime, differential charge efficiency, cell volume, and diffusion rates govern adsorption dynamics and flow rate has little effect. In both regimes, the interplay among mass transport rate, differential charge efficiency, cell capacitance, and (electric) charging current governs salt removal in flow-through electrode CDI.

  7. Nanoparticle-mediated rhodopsin cDNA but not intron-containing DNA delivery causes transgene silencing in a rhodopsin knockout model.

    Science.gov (United States)

    Zheng, Min; Mitra, Rajendra N; Filonov, Nazar A; Han, Zongchao

    2016-03-01

    Previously, we compared the efficacy of nanoparticle (NP)-mediated intron-containing rhodopsin (sgRho) vs. intronless cDNA in ameliorating retinal disease phenotypes in a rhodopsin knockout (RKO) mouse model of retinitis pigmentosa. We showed that NP-mediated sgRho delivery achieved long-term expression and phenotypic improvement in RKO mice, but not NP housing cDNA. However, the protein level of the NP-sgRho construct was only 5-10% of wild-type at 8 mo postinjection. To have a better understanding of the reduced levels of long-term expression of the vectors, in the present study, we evaluated the epigenetic changes of subretinal delivering NP-cDNA vs. NP-sgRho in the RKO mouse eyes. Following the administration, DNA methylation and histone status of specific regions (bacteria plasmid backbone, promoter, rhodopsin gene, and scaffold/matrix attachment region) of the vectors were evaluated at various time points. We documented that epigenetic transgene silencing occurred in vector-mediated gene transfer, which were caused by the plasmid backbone and the cDNA of the transgene, but not the intron-containing transgene. No toxicity or inflammation was found in the treated eyes. Our results suggest that cDNA of the rhodopsin transgene and bacteria backbone interfered with the host defense mechanism of DNA methylation-mediated transgene silencing through heterochromatin-associated modifications. © FASEB.

  8. Magnetoresistance and charge transport in graphene governed by nitrogen dopants.

    Science.gov (United States)

    Rein, Markus; Richter, Nils; Parvez, Khaled; Feng, Xinliang; Sachdev, Hermann; Kläui, Mathias; Müllen, Klaus

    2015-02-24

    We identify the influence of nitrogen-doping on charge- and magnetotransport of single layer graphene by comparing doped and undoped samples. Both sample types are grown by chemical vapor deposition (CVD) and transferred in an identical process onto Si/SiO2 wafers. We characterize the samples by Raman spectroscopy as well as by variable temperature magnetotransport measurements. Over the entire temperature range, the charge transport properties of all undoped samples are in line with literature values. The nitrogen doping instead leads to a 6-fold increase in the charge carrier concentration up to 4 × 10(13) cm(-2) at room temperature, indicating highly effective doping. Additionally it results in the opening of a charge transport gap as revealed by the temperature dependence of the resistance. The magnetotransport exhibits a conspicuous sign change from positive Lorentz magnetoresistance (MR) in undoped to large negative MR that we can attribute to the doping induced disorder. At low magnetic fields, we use quantum transport signals to quantify the transport properties. Analyses based on weak localization models allow us to determine an orders of magnitude decrease in the phase coherence and scattering times for doped samples, since the dopants act as effective scattering centers.

  9. The adsorption-desorption transition of double-stranded DNA interacting with an oppositely charged dendrimer induced by multivalent anions.

    Science.gov (United States)

    Jiang, Yangwei; Zhang, Dong; Zhang, Yaoyang; Deng, Zhenyu; Zhang, Linxi

    2014-05-28

    The adsorption-desorption transition of DNA in DNA-dendrimer solutions is observed when high-valence anions, such as hexavalent anions, are added to the DNA-dendrimer solutions. In the DNA-dendrimer solutions with low-valence anions, dendrimers bind tightly with the V-shaped double-stranded DNA. When high-valence anions, such as pentavalent or hexavalent anions, are added to the DNA-dendrimer solutions, the double-stranded DNA chains can be stretched straightly and the dendrimers are released from the double-stranded DNA chains. In fact, adding high-valence anions to the solutions can change the charge spatial distribution in the DNA-dendrimer solutions, and weaken the electrostatic interactions between the positively charged dendrimers and the oppositely charged DNA chains. Adsorption-desorption transition of DNA is induced by the overcharging of dendrimers. This investigation is capable of helping us understand how to control effectively the release of DNA in gene/drug delivery because an effective gene delivery for dendrimers includes non-covalent DNA-dendrimer binding and the effective release of DNA in gene therapy.

  10. Charge Transport in LDPE Nanocomposites Part I—Experimental Approach

    Directory of Open Access Journals (Sweden)

    Anh T. Hoang

    2016-03-01

    Full Text Available This work presents results of bulk conductivity and surface potential decay measurements on low-density polyethylene and its nanocomposites filled with uncoated MgO and Al2O3, with the aim to highlight the effect of the nanofillers on charge transport processes. Material samples at various filler contents, up to 9 wt %, were prepared in the form of thin films. The performed measurements show a significant impact of the nanofillers on reduction of material’s direct current (dc conductivity. The investigations thus focused on the nanocomposites having the lowest dc conductivity. Various mechanisms of charge generation and transport in solids, including space charge limited current, Poole-Frenkel effect and Schottky injection, were utilized for examining the experimental results. The mobilities of charge carriers were deduced from the measured surface potential decay characteristics and were found to be at least two times lower for the nanocomposites. The temperature dependencies of the mobilities were compared for different materials.

  11. Impact of Tortuosity on Charge-Carrier Transport in Organic Bulk Heterojunction Blends

    Science.gov (United States)

    Heiber, Michael C.; Kister, Klaus; Baumann, Andreas; Dyakonov, Vladimir; Deibel, Carsten; Nguyen, Thuc-Quyen

    2017-11-01

    The impact of the tortuosity of the charge-transport pathways through a bulk heterojunction film on the charge-carrier mobility is theoretically investigated using model morphologies and kinetic Monte Carlo simulations. The tortuosity descriptor provides a quantitative metric to characterize the quality of the charge-transport pathways, and model morphologies with controlled domain size and tortuosity are created using an anisotropic domain growth procedure. The tortuosity is found to be dependent on the anisotropy of the domain structure and is highly tunable. Time-of-flight charge-transport simulations on morphologies with a range of tortuosity values reveal that tortuosity can significantly reduce the magnitude of the mobility and the electric-field dependence relative to a neat material. These reductions are found to be further controlled by the energetic disorder and temperature. Most significantly, the sensitivity of the electric-field dependence to the tortuosity can explain the different experimental relationships previously reported, and exploiting this sensitivity could lead to simpler methods for characterizing and optimizing charge transport in organic solar cells.

  12. Single helically folded aromatic oligoamides that mimic the charge surface of double-stranded B-DNA

    Science.gov (United States)

    Ziach, Krzysztof; Chollet, Céline; Parissi, Vincent; Prabhakaran, Panchami; Marchivie, Mathieu; Corvaglia, Valentina; Bose, Partha Pratim; Laxmi-Reddy, Katta; Godde, Frédéric; Schmitter, Jean-Marie; Chaignepain, Stéphane; Pourquier, Philippe; Huc, Ivan

    2018-05-01

    Numerous essential biomolecular processes require the recognition of DNA surface features by proteins. Molecules mimicking these features could potentially act as decoys and interfere with pharmacologically or therapeutically relevant protein-DNA interactions. Although naturally occurring DNA-mimicking proteins have been described, synthetic tunable molecules that mimic the charge surface of double-stranded DNA are not known. Here, we report the design, synthesis and structural characterization of aromatic oligoamides that fold into single helical conformations and display a double helical array of negatively charged residues in positions that match the phosphate moieties in B-DNA. These molecules were able to inhibit several enzymes possessing non-sequence-selective DNA-binding properties, including topoisomerase 1 and HIV-1 integrase, presumably through specific foldamer-protein interactions, whereas sequence-selective enzymes were not inhibited. Such modular and synthetically accessible DNA mimics provide a versatile platform to design novel inhibitors of protein-DNA interactions.

  13. Influence of DNA Lesions on Polymerase-Mediated DNA Replication at Single-Molecule Resolution.

    Science.gov (United States)

    Gahlon, Hailey L; Romano, Louis J; Rueda, David

    2017-11-20

    Faithful replication of DNA is a critical aspect in maintaining genome integrity. DNA polymerases are responsible for replicating DNA, and high-fidelity polymerases do this rapidly and at low error rates. Upon exposure to exogenous or endogenous substances, DNA can become damaged and this can alter the speed and fidelity of a DNA polymerase. In this instance, DNA polymerases are confronted with an obstacle that can result in genomic instability during replication, for example, by nucleotide misinsertion or replication fork collapse. It is important to know how DNA polymerases respond to damaged DNA substrates to understand the mechanism of mutagenesis and chemical carcinogenesis. Single-molecule techniques have helped to improve our current understanding of DNA polymerase-mediated DNA replication, as they enable the dissection of mechanistic details that can otherwise be lost in ensemble-averaged experiments. These techniques have also been used to gain a deeper understanding of how single DNA polymerases behave at the site of the damage in a DNA substrate. In this review, we evaluate single-molecule studies that have examined the interaction between DNA polymerases and damaged sites on a DNA template.

  14. Charge carrier transport mechanisms in nanocrystalline indium oxide

    International Nuclear Information System (INIS)

    Forsh, E.A.; Marikutsa, A.V.; Martyshov, M.N.; Forsh, P.A.; Rumyantseva, M.N.; Gaskov, A.M.; Kashkarov, P.K.

    2014-01-01

    The charge transport properties of nanocrystalline indium oxide (In 2 O 3 ) are studied. A number of nanostructured In 2 O 3 samples with various nanocrystal sizes are prepared by sol–gel method and characterized using various techniques. The mean nanocrystals size varies from 7–8 nm to 18–20 nm depending on the conditions of their preparation. Structural characterizations of the In 2 O 3 samples are performed by means of transmission electron microscopy and X-ray diffraction. The analysis of dc and ac conductivity in a wide temperature range (T = 50–300 K) shows that at high temperatures charge carrier transport takes place over conduction band and at low temperatures a variable range hopping transport mechanism can be observed. We find out that the temperature of transition from one mechanism to another depends on nanocrystal size: the transition temperature rises when nanocrystals are bigger in size. The average hopping distance between two sites and the activation energy are calculated basing on the analysis of dc conductivity at low temperature. Using random barrier model we show a uniform hopping mechanism taking place in our samples and conclude that nanocrystalline In 2 O 3 can be regarded as a disordered system. - Highlights: • In 2 O 3 samples with various nanocrystal sizes are prepared by sol–gel method. • The mean nanocrystal size varies from 7–8 nm to 18–20 nm. • At high temperatures charge carrier transport takes place over conduction band. • At low temperatures a variable range hopping transport mechanism can be observed. • We show a uniform hopping mechanism taking place in our samples

  15. Diffusive charge transport in graphene on SiO 2

    Science.gov (United States)

    Chen, J.-H.; Jang, C.; Ishigami, M.; Xiao, S.; Cullen, W. G.; Williams, E. D.; Fuhrer, M. S.

    2009-07-01

    We review our recent work on the physical mechanisms limiting the mobility of graphene on SiO 2. We have used intentional addition of charged scattering impurities and systematic variation of the dielectric environment to differentiate the effects of charged impurities and short-range scatterers. The results show that charged impurities indeed lead to a conductivity linear in density ( σ(n)∝n) in graphene, with a scattering magnitude that agrees quantitatively with theoretical estimates; increased dielectric screening reduces the scattering from charged impurities, but increases the scattering from short-range scatterers. We evaluate the effects of the corrugations (ripples) of graphene on SiO 2 on transport by measuring the height-height correlation function. The results show that the corrugations cannot mimic long-range (charged impurity) scattering effects, and have too small an amplitude-to-wavelength ratio to significantly affect the observed mobility via short-range scattering. Temperature-dependent measurements show that longitudinal acoustic phonons in graphene produce a resistivity that is linear in temperature and independent of carrier density; at higher temperatures, polar optical phonons of the SiO 2 substrate give rise to an activated, carrier density-dependent resistivity. Together the results paint a complete picture of charge carrier transport in graphene on SiO 2 in the diffusive regime.

  16. Charge transport properties of metal/metal-phthalocyanine/n-Si structures

    Energy Technology Data Exchange (ETDEWEB)

    Hussain, Afzal

    2010-12-16

    In present work the charge transport properties of metal/metal-phthalocyanine/n-Si structures with low (N{sub D} = 4 x 10{sup 14} cm{sup -3}), medium (N{sub D}=1 x 10{sup 16} cm{sup -3}) and high (N{sub D}=2 x 10{sup 19} cm{sup -3}) doped n-Si as injecting electrode and the effect of air exposure of the vacuum evaporated metal-phthalocyanine film in these structures is investigated. The results obtained through temperature dependent electrical characterizations of the structures suggest that in terms of dominant conduction mechanism in the corresponding devices Schottky-type conduction mechanism dominates the charge transport in low-bias region of these devices up to 0.8 V, 0.302 V and 0.15 V in case of low, medium and high doped n-Silicon devices. For higher voltages, in each case of devices, the space-charge-limited conduction, controlled by exponential trap distribution, is found to dominate the charge transport properties of the devices. The interface density of states at the CuPc/n-Si interface of the devices are found to be lower in case of lower work function difference at the CuPc/n-Si interface of the devices. The results also suggest that the work function difference at the CuPc/n-Si interface of these devices causes charge transfer at the interface and these phenomena results in formation of interface dipole. The width of the Schottky depletion region at the CuPc/n-Si interface of these devices is found to be higher with higher work function difference at the interface. The investigation of charge transport properties of Al/ZnPc/medium n-Si and Au/ZnPc/ medium n-Si devices suggest that the Schottky depletion region formed at the ZnPc/n-Si interface of these devices determines the charge transport in the low-bias region of both the devices. Therefore, the Schottky-type (injection limited) and the space-charge-limited (bulk limited) conduction are observed in the low and the high bias regions of these devices, respectively. The determined width of the

  17. Density functional theory calculations of charge transport properties ...

    Indian Academy of Sciences (India)

    ZIRAN CHEN

    2017-08-04

    Aug 4, 2017 ... properties of 'plate-like' coronene topological structures ... Keywords. Organic semiconductors; density functional theory; charge carrier mobility; ambipolar transport; ..... nology Department of Sichuan Province (Grant Number.

  18. Carrier-mediated transport of peptides by the kidney

    International Nuclear Information System (INIS)

    Skopicki, H.A.

    1988-01-01

    Small peptide transport was characterized to determine if: (1) Multiple carriers are present in the luminal membrane of renal proximal tubular cells; (2) Carrier-mediated peptide transport is limited by size; and (3) Gentamicin inhibits carrier-mediated reabsorption of peptides. Uptake of glycyl-[ 3 H]proline (Gly-Pro) into renal brush border membrane vesicles demonstrated a dual affinity carrier system. Whether multiple carriers are present was further investigated by characterizing the uptake of [ 3 H]pyroglutamyl-histidine. To determine if carrier-mediated transport of peptides is limited by size of the molecule, uptake of the hydrolytically resistant tripeptide, [ 3 H]pryroglutamyl-histidyl-tryptophan (pGlu-His-Trp), and tetrapeptide, [ 3 H]pyroglutamyl-histidyl-tryptophyl-serine (pGlu-His-Trp-Ser) were assessed. These data indicate: multiple carriers exist on the luminal membrane of renal proximal tubular cells for the transport of dipeptides, and tripeptide pGlu-His-Trp and the tetrapeptide pGlu-His-Trp-Ser are not taken up by a carrier-mediated mechanism, suggesting that the carrier may be limited by the size of the substrate

  19. Percolative transport in the vicinity of charge-order ferromagnetic ...

    Indian Academy of Sciences (India)

    field driven charge transport in the system is modelled on the basis of an inhomogeneous medium consisting of ... The charge-ordered phase for incommensurate distribution of man- ganese ions (i.e. ... position x = 0.35 measured in a constant voltage mode. The electric ... a drop in resistance on decreasing the temperature.

  20. Modeling charge transport properties of cyano-substituted PPV

    International Nuclear Information System (INIS)

    Correia, Helena M.G.; Ramos, Marta M.D.

    2003-01-01

    In recent years, poly (p-phenylenevinylene) (PPV) and its derivatives have attracted much interest due to their applications in light-emitting diodes (LEDs). One of the issues that determine device performance is the transport of charge carriers along the polymer strands. For that reason, we investigate the influence of cyano substitution on geometry and electronic behaviour of PPV chains using self-consistent quantum molecular dynamics simulations. Our results suggest that substitution by cyano groups induce distortion in the PPV chains and a charge rearrangement among the polymer atoms. Specifically addressed is the issue concerning estimates of charge (electron and hole) mobility by computer experiments. Significant differences have been found both in the strength of the electric field needed to move positive and negative charge carriers along the polymer chain as well as in charge mobility

  1. Akt Kinase-Mediated Checkpoint of cGAS DNA Sensing Pathway.

    Science.gov (United States)

    Seo, Gil Ju; Yang, Aerin; Tan, Brandon; Kim, Sungyoon; Liang, Qiming; Choi, Younho; Yuan, Weiming; Feng, Pinghui; Park, Hee-Sung; Jung, Jae U

    2015-10-13

    Upon DNA stimulation, cyclic GMP-AMP synthase (cGAS) synthesizes the second messenger cyclic GMP-AMP (cGAMP) that binds to the STING, triggering antiviral interferon-β (IFN-β) production. However, it has remained undetermined how hosts regulate cGAS enzymatic activity after the resolution of DNA immunogen. Here, we show that Akt kinase plays a negative role in cGAS-mediated anti-viral immune response. Akt phosphorylated the S291 or S305 residue of the enzymatic domain of mouse or human cGAS, respectively, and this phosphorylation robustly suppressed its enzymatic activity. Consequently, expression of activated Akt led to the reduction of cGAMP and IFN-β production and the increase of herpes simplex virus 1 replication, whereas treatment with Akt inhibitor augmented cGAS-mediated IFN-β production. Furthermore, expression of the phosphorylation-resistant cGAS S291A mutant enhanced IFN-β production upon DNA stimulation, HSV-1 infection, and vaccinia virus infection. Our study identifies an Akt kinase-mediated checkpoint to fine-tune hosts' immune responses to DNA stimulation. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  2. Peroxidase-mediated binding of aromatic amine carcinogens to tissue DNA

    International Nuclear Information System (INIS)

    Wise, R.W.; Lakshmi, V.M.; Zenser, T.V.; Davis, B.B.

    1986-01-01

    Benzidine is a aromatic amine bladder carcinogen in man and dog which requires endogenous metabolic activation. Dog bladder microsomes activate benzidine to bind glutathione and DNA by a peroxidatic but not a mixed-function oxidase mediated pathway. Prostaglandin H synthase was responsible for peroxidatic metabolism. This study was designed to assess benzidine metabolism in a whole cell system. Rabbit renal medullary slices (100 mg/ml) were incubated for 60 min. in Krebs-Ringer bicarbonate buffer containing 100 μM 3 H-benzidine and 250 μM arachidonic acid. Arachidonic acid increased 3-(glutathione-S-yL)-benzidine, a product of peroxidatically activated benzidine, (6-fold) and 3 H-benzidine binding to endogenous DNA (4-fold). Indomethacin (100 μM) completely inhibited arachidonic acid-mediated increases in conjugate formation and DNA binding. HPLC analysis of the media demonstrated benzidine (95% of total 3 H), 3-(glutathion-S-yL)-benzidine (1%) and two unidentified peaks (4%). These results are consistent with the hydroperoxidase activity of prostaglandin H synthase mediating metabolic activation of benzidine to bind tissue nucleophiles in a whole cell system. Inhibition of peroxidatic activation of aromatic amines to bind DNA may prevent initiation of bladder cancer

  3. Transferrin-polycation-mediated introduction of DNA into human leukemic cells: Stimulation by agents that affect the survival of transfected DNA or modulate transferrin receptor levels

    International Nuclear Information System (INIS)

    Cotten, M.; Laengle-Rouault, F.; Kirlappos, H.; Wagner, E.; Mechtler, K.; Zenke, M.; Beug, H.; Birnstiel, M.L.

    1990-01-01

    The authors have subverted a receptor-mediated endocytosis event to transport genes into human leukemic cells. By coupling the natural iron-delivery protein transferrin to the DNA-binding polycations polylysine or protamine, they have created protein conjugates that bind nucleic acids and carry them into the cell during the normal transferrin cycle. They demonstrate here that this procedure is useful for a human leukemic cell line. They enhanced the rate of gene delivery by (i) increasing the transferrin receptor density through treatment of the cells with the cell permeable iron chelator desferrioxamine, (ii) interfering with the synthesis of heme with succinyl acetone treatment, or (iii) stimulating the degradation of heme with cobalt chloride treatment. Consistent with gene delivery as an endocytosis event, they show that the subsequent expression in K-562 cells of a gene included in the transported DNA depends upon the cellular presence of the lysosomotropic agent chloroquine. By contrast, monensin blocks transferrinfection, as does incubation of the cells at 18 degree C

  4. Understanding charge transport in molecular electronics.

    Science.gov (United States)

    Kushmerick, J J; Pollack, S K; Yang, J C; Naciri, J; Holt, D B; Ratner, M A; Shashidhar, R

    2003-12-01

    For molecular electronics to become a viable technology the factors that control charge transport across a metal-molecule-metal junction need to be elucidated. We use an experimentally simple crossed-wire tunnel junction to interrogate how factors such as metal-molecule coupling, molecular structure, and the choice of metal electrode influence the current-voltage characteristics of a molecular junction.

  5. A lower isoelectric point increases signal sequence-mediated secretion of recombinant proteins through a bacterial ABC transporter.

    Science.gov (United States)

    Byun, Hyunjong; Park, Jiyeon; Kim, Sun Chang; Ahn, Jung Hoon

    2017-12-01

    Efficient protein production for industrial and academic purposes often involves engineering microorganisms to produce and secrete target proteins into the culture. Pseudomonas fluorescens has a TliDEF ATP-binding cassette transporter, a type I secretion system, which recognizes C-terminal LARD3 signal sequence of thermostable lipase TliA. Many proteins are secreted by TliDEF in vivo when recombined with LARD3, but there are still others that cannot be secreted by TliDEF even when LARD3 is attached. However, the factors that determine whether or not a recombinant protein can be secreted through TliDEF are still unknown. Here, we recombined LARD3 with several proteins and examined their secretion through TliDEF. We found that the proteins secreted via LARD3 are highly negatively charged with highly-acidic isoelectric points (pI) lower than 5.5. Attaching oligo-aspartate to lower the pI of negatively-charged recombinant proteins improved their secretion, and attaching oligo-arginine to negatively-charged proteins blocked their secretion by LARD3. In addition, negatively supercharged green fluorescent protein (GFP) showed improved secretion, whereas positively supercharged GFP did not secrete. These results disclosed that proteins' acidic pI and net negative charge are major factors that determine their secretion through TliDEF. Homology modeling for TliDEF revealed that TliD dimer forms evolutionarily-conserved positively-charged clusters in its pore and substrate entrance site, which also partially explains the pI dependence of the TliDEF-dependent secretions. In conclusion, lowering the isoelectric point improved LARD3-mediated protein secretion, both widening the range of protein targets for efficient production via secretion and signifying an important aspect of ABC transporter-mediated secretions. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Charge transport in a CoPt3 nanocrystal microwire

    International Nuclear Information System (INIS)

    Beecher, P.; De Marzi, G.; Quinn, A.J.; Redmond, G.; Shevchenko, E.V.; Weller, H.

    2004-01-01

    The electrical characteristics of single CoPt 3 nanocrystal microwires formed by magnetic field-directed growth from colloidal solutions are presented. The wires comprise disordered assemblies of discrete nanocrystals, separated from each other by protective organic ligand shells. Electrical data indicate that the activated charge transport properties of the wires are determined by the nanocrystal charging energy, governed by the size and capacitance of the individual nanocrystals. Focused ion beam-assisted deposition of Pt metal at the wire-electrode junctions is employed to optimize the wire-electrode contacts, whilst maintaining the nanocrystal-dominated transport characteristics of these one-dimensional nanocrystal structures

  7. Charge-transfer interactions of Cr species with DNA.

    Science.gov (United States)

    Nowicka, Anna M; Matysiak-Brynda, Edyta; Hepel, Maria

    2017-10-01

    Interactions of Cr species with nucleic acids in living organisms depend strongly on Cr oxidation state and the environmental conditions. As the effects of these interactions range from benign to pre-mutagenic to carcinogenic, careful assessment of the hazard they pose to human health is necessary. We have investigated methods that would enable quantifying the DNA damage caused by Cr species under varying environmental conditions, including UV, O 2 , and redox potential, using simple instrumental techniques which could be in future combined into a field-deployable instrumentation. We have employed electrochemical quartz crystal nanogravimetry (EQCN), cyclic voltammetry (CV), and electrochemical impedance spectroscopy (EIS) to evaluate the extent of DNA damage expressed in terms of guanine oxidation yield (η) and changes in specific characteristics provided by these techniques. The effects of the interactions of Cr species with DNA were analyzed using a model calf thymus DNA (ctDNA) film on a gold electrode (Au@ctDNA) in different media, including: (i) Cr(VI), (ii) Cr(VI) reduced at -0.2V, (iii) Cr(III)+UV radiation+O 2 , and Cr(III), obtaining the η values: 7.4±1.4, 1.5±0.4, 1.1±0.31%, and 0%, respectively, thus quantifying the hazard posed. The EIS measurements have enabled utilizing the decrease in charge-transfer resistance (R ct ) for ferri/ferrocyanide redox probe at an Au@ctDNA electrode to assess the oxidative ctDNA damage by Cr(VI) species. In this case, circular dichroism indicates an extensive damage to the ctDNA hydrogen bonding. On the other hand, Cr(III) species have not induced any damage to ctDNA, although the EQCN measurements show an electrostatic binding to DNA. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. The Effect of Voltage Charging on the Transport Properties of Gold Nanotube Membranes.

    Science.gov (United States)

    Experton, Juliette; Martin, Charles R

    2018-05-01

    Porous membranes are used in chemical separations and in many electrochemical processes and devices. Research on the transport properties of a unique class of porous membranes that contain monodisperse gold nanotubes traversing the entire membrane thickness is reviewed here. These gold nanotubes can act as conduits for ionic and molecular transports through the membrane. Because the tubes are electronically conductive, they can be electrochemically charged by applying a voltage to the membrane. How this "voltage charging" affects the transport properties of gold nanotube membranes is the subject of this Review. Experiments showing that voltage charging can be used to reversibly switch the membrane between ideally cation- and anion-transporting states are reviewed. Voltage charging can also be used to enhance the ionic conductivity of gold nanotube membranes. Finally, voltage charging to accomplish electroporation of living bacteria as they pass through gold nanotube membranes is reviewed. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Charge-spin Transport in Surface-disordered Three-dimensional Topological Insulators

    Science.gov (United States)

    Peng, Xingyue

    As one of the most promising candidates for the building block of the novel spintronic circuit, the topological insulator (TI) has attracted world-wide interest of study. Robust topological order protected by time-reversal symmetry (TRS) makes charge transport and spin generation in TIs significantly different from traditional three-dimensional (3D) or two-dimensional (2D) electronic systems. However, to date, charge transport and spin generation in 3D TIs are still primarily modeled as single-surface phenomena, happening independently on top and bottom surfaces. In this dissertation, I will demonstrate via both experimental findings and theoretical modeling that this "single surface'' theory neither correctly describes a realistic 3D TI-based device nor reveals the amazingly distinct physical picture of spin transport dynamics in 3D TIs. Instead, I present a new viewpoint of the spin transport dynamics where the role of the insulating yet topologically non-trivial bulk of a 3D TI becomes explicit. Within this new theory, many mysterious transport and magneto-transport anomalies can be naturally explained. The 3D TI system turns out to be more similar to its low dimensional sibling--2D TI rather than some other systems sharing the Dirac dispersion, such as graphene. This work not only provides valuable fundamental physical insights on charge-spin transport in 3D TIs, but also offers important guidance to the design of 3D TI-based spintronic devices.

  10. Electronic structure and charge transport in nonstoichiometric tantalum oxide

    Science.gov (United States)

    Perevalov, T. V.; Gritsenko, V. A.; Gismatulin, A. A.; Voronkovskii, V. A.; Gerasimova, A. K.; Aliev, V. Sh; Prosvirin, I. A.

    2018-06-01

    The atomic and electronic structure of nonstoichiometric oxygen-deficient tantalum oxide TaO x<2.5 grown by ion beam sputtering deposition was studied. The TaO x film content was analyzed by x-ray photoelectron spectroscopy and by quantum-chemistry simulation. TaO x is composed of Ta2O5, metallic tantalum clusters and tantalum suboxides. A method for evaluating the stoichiometry parameter of TaO x from the comparison of experimental and theoretical photoelectron valence band spectra is proposed. The charge transport properties of TaO x were experimentally studied and the transport mechanism was quantitatively analyzed with four theoretical dielectric conductivity models. It was found that the charge transport in almost stoichiometric and nonstoichiometric tantalum oxide can be consistently described by the phonon-assisted tunneling between traps.

  11. Investigating anomalous transport of electrolytes in charged porous media

    Science.gov (United States)

    Skjøde Bolet, Asger Johannes; Mathiesen, Joachim

    2017-04-01

    Surface charge is know to play an important role in microfluidics devices when dealing with electrolytes and their transport properties. Similarly, surface charge could play a role for transport in porous rock with submicron pore sizes. Estimates of the streaming potentials and electro osmotic are mostly considered in simple geometries both using analytic and numerical tools, however it is unclear at present how realistic complex geometries will modify the dynamics. Our work have focused on doing numerical studies of the full three-dimensional Stokes-Poisson-Nernst-Planck problem for electrolyte transport in porous rock. As the numerical implementation, we have used a finite element solver made using the FEniCS project code base, which can both solve for a steady state configuration and the full transient. In the presentation, we will show our results on anomalous transport due to electro kinetic effects such as the streaming potential or the electro osmotic effect.

  12. DNA condensation by partially acetylated poly(amido amine) dendrimers: effects of dendrimer charge density on complex formation.

    Science.gov (United States)

    Yu, Shi; Li, Ming-Hsin; Choi, Seok Ki; Baker, James R; Larson, Ronald G

    2013-09-03

    The ability of poly(amido amine) (or PAMAM) dendrimers to condense semiflexible dsDNA and penetrate cell membranes gives them great potential in gene therapy and drug delivery but their high positive surface charge makes them cytotoxic. Here, we describe the effects of partial neutralization by acetylation on DNA condensation using light scattering, circular dichroism, and single molecule imaging of dendrimer-DNA complexes combed onto surfaces and tethered to those surfaces under flow. We find that DNA can be condensed by generation-five (G5) dendrimers even when the surface charges are more than 65% neutralized, but that such dendrimers bind negligibly when an end-tethered DNA is stretched in flow. We also find that when fully charged dendrimers are introduced by flow to end-tethered DNA, all DNA molecules become equally highly coated with dendrimers at a rate that becomes very fast at high dendrimer concentration, and that dendrimers remain bound during subsequent flow of dendrimer-free buffer. These results suggest that the presence of dendrimer-free DNA coexisting with dendrimer-bound DNA after bulk mixing of the two in solution may result from diffusion-limited irreversible dendrimer-DNA binding, rather than, or in addition to, the previously proposed cooperative binding mechanism of dendrimers to DNA.

  13. DNA Condensation by Partially Acetylated Poly(amido amine Dendrimers: Effects of Dendrimer Charge Density on Complex Formation

    Directory of Open Access Journals (Sweden)

    Ronald G. Larson

    2013-09-01

    Full Text Available The ability of poly(amido amine (or PAMAM dendrimers to condense semiflexible dsDNA and penetrate cell membranes gives them great potential in gene therapy and drug delivery but their high positive surface charge makes them cytotoxic. Here, we describe the effects of partial neutralization by acetylation on DNA condensation using light scattering, circular dichroism, and single molecule imaging of dendrimer-DNA complexes combed onto surfaces and tethered to those surfaces under flow. We find that DNA can be condensed by generation-five (G5 dendrimers even when the surface charges are more than 65% neutralized, but that such dendrimers bind negligibly when an end-tethered DNA is stretched in flow. We also find that when fully charged dendrimers are introduced by flow to end-tethered DNA, all DNA molecules become equally highly coated with dendrimers at a rate that becomes very fast at high dendrimer concentration, and that dendrimers remain bound during subsequent flow of dendrimer-free buffer. These results suggest that the presence of dendrimer-free DNA coexisting with dendrimer-bound DNA after bulk mixing of the two in solution may result from diffusion-limited irreversible dendrimer-DNA binding, rather than, or in addition to, the previously proposed cooperative binding mechanism of dendrimers to DNA.

  14. Simulating charge transport to understand the spectral response of Swept Charge Devices

    Science.gov (United States)

    Athiray, P. S.; Sreekumar, P.; Narendranath, S.; Gow, J. P. D.

    2015-11-01

    Context. Swept Charge Devices (SCD) are novel X-ray detectors optimized for improved spectral performance without any demand for active cooling. The Chandrayaan-1 X-ray Spectrometer (C1XS) experiment onboard the Chandrayaan-1 spacecraft used an array of SCDs to map the global surface elemental abundances on the Moon using the X-ray fluorescence (XRF) technique. The successful demonstration of SCDs in C1XS spurred an enhanced version of the spectrometer on Chandrayaan-2 using the next-generation SCD sensors. Aims: The objective of this paper is to demonstrate validation of a physical model developed to simulate X-ray photon interaction and charge transportation in a SCD. The model helps to understand and identify the origin of individual components that collectively contribute to the energy-dependent spectral response of the SCD. Furthermore, the model provides completeness to various calibration tasks, such as generating spectral matrices (RMFs - redistribution matrix files), estimating efficiency, optimizing event selection logic, and maximizing event recovery to improve photon-collection efficiency in SCDs. Methods: Charge generation and transportation in the SCD at different layers related to channel stops, field zones, and field-free zones due to photon interaction were computed using standard drift and diffusion equations. Charge collected in the buried channel due to photon interaction in different volumes of the detector was computed by assuming a Gaussian radial profile of the charge cloud. The collected charge was processed further to simulate both diagonal clocking read-out, which is a novel design exclusive for SCDs, and event selection logic to construct the energy spectrum. Results: We compare simulation results of the SCD CCD54 with measurements obtained during the ground calibration of C1XS and clearly demonstrate that our model reproduces all the major spectral features seen in calibration data. We also describe our understanding of interactions at

  15. Mediator MED23 Links Pigmentation and DNA Repair through the Transcription Factor MITF.

    Science.gov (United States)

    Xia, Min; Chen, Kun; Yao, Xiao; Xu, Yichi; Yao, Jiaying; Yan, Jun; Shao, Zhen; Wang, Gang

    2017-08-22

    DNA repair is related to many physiological and pathological processes, including pigmentation. Little is known about the role of the transcriptional cofactor Mediator complex in DNA repair and pigmentation. Here, we demonstrate that Mediator MED23 plays an important role in coupling UV-induced DNA repair to pigmentation. The loss of Med23 specifically impairs the pigmentation process in melanocyte-lineage cells and in zebrafish. Med23 deficiency leads to enhanced nucleotide excision repair (NER) and less DNA damage following UV radiation because of the enhanced expression and recruitment of NER factors to chromatin for genomic stability. Integrative analyses of melanoma cells reveal that MED23 controls the expression of a melanocyte master regulator, Mitf, by modulating its distal enhancer activity, leading to opposing effects on pigmentation and DNA repair. Collectively, the Mediator MED23/MITF axis connects DNA repair to pigmentation, thus providing molecular insights into the DNA damage response and skin-related diseases. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  16. Charge Transport in Metal-Molecule-Metal Junctions Probed by Conducting Atomic Force Microscopy

    International Nuclear Information System (INIS)

    Lee, Min Hyung; Song, Hyunwook

    2013-01-01

    We have demonstrated a proof of intrinsic charge transport properties in alkanedithiol molecular junctions using a multiprobe approach combining a variety of transport techniques. The temperature-independent I(V) behavior and the correct exponential decay of conductance with respect to molecular length shows that the dominant charge transport mechanism is off-resonant tunneling. Length-dependent TVS measurements for the saturated alkane-dithiol series indicate that we did indeed probe a molecular system with CAFM. These results can provide stringent criteria to establish a valid molecular transport junction via a probabilistic measurement technique. In this study, we report a study of charge transport in alkanedithiol SAMs formed in metal-molecule-metal junctions using CAFM in combination with a variety of molecular transport techniques including temperature-and length-variable transport measurements and transition voltage spectroscopy. The main goal of this study is to probe the intrinsic transport properties of component molecules using CAFM, but not parasitic or defect-related effects

  17. Simulation of charge generation and transport in semi-conductors under energetic-particle bombardment

    International Nuclear Information System (INIS)

    Martin, R.C.

    1990-01-01

    The passage of energetic ions through semiconductor devices generates excess charge which can produce logic upset, memory change, and device damage. This single event upset (SEU) phenomenon is increasingly important for satellite communications. Experimental and numerical simulation of SEUs is difficult because of the subnanosecond times and large charge densities within the ion track. The objective of this work is twofold: (1) the determination of the track structure and electron-hole pair generation profiles following the passage of an energetic ion; (2) the development and application of a new numerical method for transient charge transport in semiconductor devices. A secondary electron generation and transport model, based on the Monte Carlo method, is developed and coupled to an ion transport code to simulate ion track formation in silicon. A new numerical method is developed for the study of transient charge transport. The numerical method combines an axisymmetric quadratic finite-element formulation for the solution of the potential with particle simulation methods for electron and hole transport. Carrier transport, recombination, and thermal generation of both majority and minority carriers are included. To assess the method, transient one-dimensional solutions for silicon diodes are compared to a fully iterative finite-element method. Simulations of charge collection from ion tracks in three-dimensional axisymmetric devices are presented and compared to previous work. The results of this work for transient current pulses following charged ion passage are in agreement with recent experimental data

  18. Charge transport through molecular rods with reduced pi-conjugation.

    Science.gov (United States)

    Lörtscher, Emanuel; Elbing, Mark; Tschudy, Meinrad; von Hänisch, Carsten; Weber, Heiko B; Mayor, Marcel; Riel, Heike

    2008-10-24

    A series of oligophenylene rods of increasing lengths is synthesized to investigate the charge-transport mechanisms. Methyl groups are attached to the phenyl rings to weaken the electronic overlap of the pi-subsystems along the molecular backbones. Out-of-plane rotation of the phenyl rings is confirmed in the solid state by means of X-ray analysis and in solution by using UV/Vis spectroscopy. The influence of the reduced pi-conjugation on the resonant charge transport is studied at the single-molecule level by using the mechanically controllable break-junction technique. Experiments are performed under ultra-high-vacuum conditions at low temperature (50 K). A linear increase of the conductance gap with increasing number of phenyl rings (from 260 meV for one ring to 580 meV for four rings) is revealed. In addition, the absolute conductance of the first resonant peaks does not depend on the length of the molecular wire. Resonant transport through the first molecular orbital is found to be dominated by charge-carrier injection into the molecule, rather than by the intrinsic resistance of the molecular wire length.

  19. Electronic transport in methylated fragments of DNA

    Energy Technology Data Exchange (ETDEWEB)

    Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L., E-mail: umbertofulco@gmail.com; Albuquerque, E. L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970 Natal-RN (Brazil); Freire, V. N. [Departamento de Física, Universidade Federal do Ceará, 60455-760 Fortaleza, CE (Brazil); Caetano, E. W. S. [Instituto Federal de Educação, Ciência e Tecnologia do Ceará, 60040-531 Fortaleza, CE (Brazil); Moura, F. A. B. F. de; Lyra, M. L. [Instituto de Física, Universidade Federal de Alagoas, 57072-900 Maceió-AL (Brazil)

    2015-11-16

    We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics.

  20. Electronic transport in methylated fragments of DNA

    International Nuclear Information System (INIS)

    Almeida, M. L. de; Oliveira, J. I. N.; Lima Neto, J. X.; Gomes, C. E. M.; Fulco, U. L.; Albuquerque, E. L.; Freire, V. N.; Caetano, E. W. S.; Moura, F. A. B. F. de; Lyra, M. L.

    2015-01-01

    We investigate the electronic transport properties of methylated deoxyribonucleic-acid (DNA) strands, a biological system in which methyl groups are added to DNA (a major epigenetic modification in gene expression), sandwiched between two metallic platinum electrodes. Our theoretical simulations apply an effective Hamiltonian based on a tight-binding model to obtain current-voltage curves related to the non-methylated/methylated DNA strands. The results suggest potential applications in the development of novel biosensors for molecular diagnostics

  1. Study of the charge transport characteristics of dendrimer molecular thin films

    Energy Technology Data Exchange (ETDEWEB)

    Li, J.C., E-mail: jcli@mail.neu.edu.cn; Han, N.; Wang, S.S.; Ba, D.C.

    2011-05-31

    In this work, we systematically studied the electrical characteristics of two types of dendritic arylamine thin film devices. We observed that, for devices with different interfacial structures, their charge injection barriers and transport properties are obviously different. The smallest charge injection barrier is observed in dendrimer devices without charge-transfer interfacial layers. The Richardson-Schottky thermionic emission model can be well used to fit the experimental current-voltage characteristics at a lower voltage region. The charge injection barrier increases about 0.4 eV and 0.5 eV when a 1-decanethiol self-assembly layer and -CN terminated dendrimer thin films are inserted as the interfacial layer, respectively. It is shown that the molecule/electrode charge-transfer interfaces can largely affect the device charge injection/transport process and consequently change the device performance. In this case, the space charge limited conduction theory is more applicable to simulate the device conduction mechanism. Owing to its ultra-thin thickness, the self-assembly monolayer technique is proved to be an efficient approach in engineering the interfacial electronic structures of dendrimer thin film devices.

  2. Study of the charge transport characteristics of dendrimer molecular thin films

    International Nuclear Information System (INIS)

    Li, J.C.; Han, N.; Wang, S.S.; Ba, D.C.

    2011-01-01

    In this work, we systematically studied the electrical characteristics of two types of dendritic arylamine thin film devices. We observed that, for devices with different interfacial structures, their charge injection barriers and transport properties are obviously different. The smallest charge injection barrier is observed in dendrimer devices without charge-transfer interfacial layers. The Richardson-Schottky thermionic emission model can be well used to fit the experimental current-voltage characteristics at a lower voltage region. The charge injection barrier increases about 0.4 eV and 0.5 eV when a 1-decanethiol self-assembly layer and -CN terminated dendrimer thin films are inserted as the interfacial layer, respectively. It is shown that the molecule/electrode charge-transfer interfaces can largely affect the device charge injection/transport process and consequently change the device performance. In this case, the space charge limited conduction theory is more applicable to simulate the device conduction mechanism. Owing to its ultra-thin thickness, the self-assembly monolayer technique is proved to be an efficient approach in engineering the interfacial electronic structures of dendrimer thin film devices.

  3. Charge transport model in nanodielectric composites based on quantum tunneling mechanism and dual-level traps

    Energy Technology Data Exchange (ETDEWEB)

    Li, Guochang; Chen, George, E-mail: gc@ecs.soton.ac.uk, E-mail: sli@mail.xjtu.edu.cn [State Key Laboratory of Electrical Insulation and Power Equipment, Xi' an Jiaotong University, Xi' an 710049 (China); School of Electronic and Computer Science, University of Southampton, Southampton SO17 1BJ (United Kingdom); Li, Shengtao, E-mail: gc@ecs.soton.ac.uk, E-mail: sli@mail.xjtu.edu.cn [State Key Laboratory of Electrical Insulation and Power Equipment, Xi' an Jiaotong University, Xi' an 710049 (China)

    2016-08-08

    Charge transport properties in nanodielectrics present different tendencies for different loading concentrations. The exact mechanisms that are responsible for charge transport in nanodielectrics are not detailed, especially for high loading concentration. A charge transport model in nanodielectrics has been proposed based on quantum tunneling mechanism and dual-level traps. In the model, the thermally assisted hopping (TAH) process for the shallow traps and the tunnelling process for the deep traps are considered. For different loading concentrations, the dominant charge transport mechanisms are different. The quantum tunneling mechanism plays a major role in determining the charge conduction in nanodielectrics with high loading concentrations. While for low loading concentrations, the thermal hopping mechanism will dominate the charge conduction process. The model can explain the observed conductivity property in nanodielectrics with different loading concentrations.

  4. Transportation charges in the gas industry

    International Nuclear Information System (INIS)

    Price, C.

    1994-01-01

    British Gas was privatized in 1986, a monopoly with no direct competition and only very light regulation of the tariff market. The regulator had an obligation to enable competition to develop in the unregulated, large-quantity, contract market. Competitors required access to the BG-owned transportation network. The government has recently rejected the recommendation of divestiture of the supply business, but has accelerated the advent of competition to the domestic market. This paper considers the role of BG's transport charges in these developments, using its past behaviour as a guide, and identifying the issues for future regulation and development of the gas market. (Author)

  5. DNA conformational analysis in solution by uranyl mediated photocleavage

    DEFF Research Database (Denmark)

    Nielsen, Peter E.; Møllegaard, N E; Jeppesen, C

    1990-01-01

    Uranyl mediated photocleavage of double stranded DNA is proposed as a general probing for DNA helix conformation in terms of minor groove width/electronegative potential. Specifically, it is found that A/T-tracts known to constitute strong distamycin binding sites are preferentially photocleaved ......, uranyl photocleavage of the internal control region (ICR) of the 5S-RNA gene yields a cleavage modulation pattern fully compatible with that obtained by DNase I which also--in a more complex way--senses DNA minor groove width....

  6. Charge injection and transport in quantum confined and disordered systems

    NARCIS (Netherlands)

    Houtepen, A.J.

    2007-01-01

    Quantum dots and conducting polymers are modern semiconductors with a high potential for applications such as lasers, LEDs, displays, solar cells etc. These applications require the controlled addition of charge carriers into the material and knowledge of the details of charge transport. This thesis

  7. Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)

    Science.gov (United States)

    Risqi, A. M.; Yudiarsah, E.

    2017-07-01

    Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.

  8. Intrinsic Charge Transport in Organic Field-Effect Transistors

    Science.gov (United States)

    Podzorov, Vitaly

    2005-03-01

    Organic field-effect transistors (OFETs) are essential components of modern electronics. Despite the rapid progress of organic electronics, understanding of fundamental aspects of the charge transport in organic devices is still lacking. Recently, the OFETs based on highly ordered organic crystals have been fabricated with innovative techniques that preserve the high quality of single-crystal organic surfaces. This technological progress facilitated the study of transport mechanisms in organic semiconductors [1-4]. It has been demonstrated that the intrinsic polaronic transport, not dominated by disorder, with a remarkably high mobility of ``holes'' μ = 20 cm^2/Vs can be achieved in these devices at room temperature [4]. The signatures of the intrinsic polaronic transport are the anisotropy of the carrier mobility and an increase of μ with cooling. These and other aspects of the charge transport in organic single-crystal FETs will be discussed. Co-authors are Etienne Menard, University of Illinois at Urbana Champaign; Valery Kiryukhin, Rutgers University; John Rogers, University of Illinois at Urbana Champaign; Michael Gershenson, Rutgers University. [1] V. Podzorov et al., Appl. Phys. Lett. 82, 1739 (2003); ibid. 83, 3504 (2003). [2] V. C. Sundar et al., Science 303, 1644 (2004). [3] R. W. I. de Boer et al., Phys. Stat. Sol. (a) 201, 1302 (2004). [4] V. Podzorov et al., Phys. Rev. Lett. 93, 086602 (2004).

  9. On the ability of PAMAM dendrimers and dendrimer/DNA aggregates to penetrate POPC model biomembranes.

    Science.gov (United States)

    Ainalem, Marie-Louise; Campbell, Richard A; Khalid, Syma; Gillams, Richard J; Rennie, Adrian R; Nylander, Tommy

    2010-06-03

    Poly(amido amine) (PAMAM) dendrimers have previously been shown, as cationic condensing agents of DNA, to have high potential for nonviral gene delivery. This study addresses two key issues for gene delivery: the interaction of the biomembrane with (i) the condensing agent (the cationic PAMAM dendrimer) and (ii) the corresponding dendrimer/DNA aggregate. Using in situ null ellipsometry and neutron reflection, parallel experiments were carried out involving dendrimers of generations 2 (G2), 4 (G4), and 6 (G6). The study demonstrates that free dendrimers of all three generations were able to traverse supported palmitoyloleoylphosphatidylcholine (POPC) bilayers deposited on silica surfaces. The model biomembranes were elevated from the solid surfaces upon dendrimer penetration, which offers a promising new way to generate more realistic model biomembranes where the contact with the supporting surface is reduced and where aqueous cavities are present beneath the bilayer. The largest dendrimer (G6) induced partial bilayer destruction directly upon penetration, whereas the smaller dendrimers (G2 and G4) leave the bilayer intact, so we propose that lower generation dendrimers have greater potential as transfection mediators. In addition to the experimental observations, coarse-grained simulations on the interaction between generation 3 (G3) dendrimers and POPC bilayers were performed in the absence and presence of a bilayer-supporting negatively charged surface that emulates the support. The simulations demonstrate that G3 is transported across free-standing POPC bilayers by direct penetration and not by endocytosis. The penetrability was, however, reduced in the presence of a surface, indicating that the membrane transport observed experimentally was not driven solely by the surface. The experimental reflection techniques were also applied to dendrimer/DNA aggregates of charge ratio = 0.5, and while G2/DNA and G4/DNA aggregates interact with POPC bilayers, G6/DNA

  10. Probing the Relation Between Charge Transport and Supramolecular Organization Down to Ångström Resolution in a Benzothiadiazole‐Cyclopentadithiophene Copolymer

    DEFF Research Database (Denmark)

    Niedzialek, Dorota; Lemaur, Vincent; Dudenko, Dmytro

    2013-01-01

    Molecular modeling shows that longitudinal displacement of the backbones by a couple of ångströms has a profound impact on the electronic coupling mediating charge transport in a conjugated copolymer. These changes can be probed by monitoring the calculated X-ray scattering patterns and NMR chemi...... chemical shifts as a function of sliding of the polymer chains and comparing them to experiment....

  11. Algorithms for solving the single-sink fixed-charge transportation problem

    DEFF Research Database (Denmark)

    Klose, Andreas

    2006-01-01

    The single-sink fixed-charge transportation problem is an important subproblem of the fixed-charge transportation problem. Just a few methods have been proposed in the literature to solve this problem. In this paper, solution approaches based on dynamic programming and implicit enumeration...... are revisited. It is shown how the problem size as well as the search space of a recently published dynamic programming method can be reduced by exploiting reduced cost information. Additionally, a further implicit enumeration approach relying on solution concepts for the binary knapsack problem is introduced...

  12. Experimental transport studies of yttrium barium copper oxide and lambda-DNA

    Science.gov (United States)

    Zhang, Yuexing

    This dissertation consists of two parts. In Part I, we focus on the quasi-particle transport properties in the high temperature superconductor YBa2Cu3O7-delta (YBCO), probed by the thermal Hall conductivity (kappa xy). The thermal Hall conductivity selectively reflects the transport behaviors of the charge carriers. By measuring kappaxy in the normal state YBCO, we established a new method to determine the Wiedemann-Franz (WF) ratio in cuprates. We determined the Hall-channel WF ratio kappa xy/sigmaxyT in Cu and YBCO. In the latter, we uncovered a T-linear dependence and suppression of the Hallchannel WF ratio. The suppression of the Hall-channel WF ratio in systems with predominant electron-electron scattering will be discussed. Thermal transport behaviors of the quasi-particles in the mixed state were studied by measuring kappaxx and kappa xy in a high-purity YBCO crystal. From the field-dependence of the thermal conductivity kappaxx, we separated the quasi particle contribution (kappae) from the phonon background. In the Hall channel, we observed that the (weak-field) kappa xy increased 103-fold between T c (90 K) and 30 K, implying a 100-fold enhancement of the quasi-particle lifetime. We found that kappaxy exhibited a specific scaling behavior below ˜30 K. The implication of the scaling behavior will be discussed. In Part II, we describe an experiment on determining the electrical conductivity of the bacteriophage lambda-DNA, an issue currently under intense debate. We covalently bonded the DNA to Au electrodes by incorporating thiol modified dTTP into the 'sticky' ends of the lambda-DNA. Two-probe measurements on such molecules provided a lower bound for the resistivity rho > 10 6 mum at bias potentials up to 20 V, in conflict with recent claims of moderate to high conductivity. We stress the importance of eliminating salt residues in these measurements.

  13. Polymerase chain reaction-mediated DNA fingerprinting for epidemiological studies on Campylobacter spp

    NARCIS (Netherlands)

    Giesendorf, B A; Goossens, H; Niesters, H G; Van Belkum, A; Koeken, A; Endtz, H P; Stegeman, H; Quint, W G

    The applicability of polymerase chain reaction (PCR)-mediated DNA typing, with primers complementary to dispersed repetitive DNA sequences and arbitrarily chosen DNA motifs, to study the epidemiology of campylobacter infection was evaluated. With a single PCR reaction and simple gel electrophoresis,

  14. Role of Molecular Weight Distribution on Charge Transport in Semiconducting Polymers

    KAUST Repository

    Himmelberger, Scott

    2014-10-28

    © 2014 American Chemical Society. Model semiconducting polymer blends of well-controlled molecular weight distributions are fabricated and demonstrated to be a simple method to control intermolecular disorder without affecting intramolecular order or degree of aggregation. Mobility measurements exhibit that even small amounts of low molecular weight material are detrimental to charge transport. Trends in charge carrier mobility can be reproduced by a simple analytical model which indicates that carriers have no preference for high or low molecular weight chains and that charge transport is limited by interchain hopping. These results quantify the role of long polymer tie-chains and demonstrate the need for controlled polydispersity for achieving high carrier mobilities.

  15. Bulk-Like Electrical Properties Induced by Contact-Limited Charge Transport in Organic Diodes: Revised Space Charge Limited Current

    KAUST Repository

    Xu, Guangwei; Gao, Nan; Lu, Congyan; Wang, Wei; Ji, Zhuoyu; Bi, Chong; Han, Zhiheng; Lu, Nianduan; Yang, Guanhua; Li, Yuan; Liu, Qi; Li, Ling; Liu, Ming

    2018-01-01

    , the charge transport properties of organic diodes are usually characterized by probing the current–voltage (I–V) curves of the devices. However, to unveil the landscape of the underlying potential/charge distribution, which essentially determines the I

  16. Electric generation and ratcheted transport of contact-charged drops

    Science.gov (United States)

    Cartier, Charles A.; Graybill, Jason R.; Bishop, Kyle J. M.

    2017-10-01

    We describe a simple microfluidic system that enables the steady generation and efficient transport of aqueous drops using only a constant voltage input. Drop generation is achieved through an electrohydrodynamic dripping mechanism by which conductive drops grow and detach from a grounded nozzle in response to an electric field. The now-charged drops are transported down a ratcheted channel by contact charge electrophoresis powered by the same voltage input used for drop generation. We investigate how the drop size, generation frequency, and transport velocity depend on system parameters such as the liquid viscosity, interfacial tension, applied voltage, and channel dimensions. The observed trends are well explained by a series of scaling analyses that provide insight into the dominant physical mechanisms underlying drop generation and ratcheted transport. We identify the conditions necessary for achieving reliable operation and discuss the various modes of failure that can arise when these conditions are violated. Our results demonstrate that simple electric inputs can power increasingly complex droplet operations with potential opportunities for inexpensive and portable microfluidic systems.

  17. Ion Transport through Diffusion Layer Controlled by Charge Mosaic Membrane

    Directory of Open Access Journals (Sweden)

    Akira Yamauchi

    2012-01-01

    Full Text Available The kinetic transport behaviors in near interface of the membranes were studied using commercial anion and cation exchange membrane and charge mosaic membrane. Current-voltage curve gave the limiting current density that indicates the ceiling of conventional flux. From chronopotentiometry above the limiting current density, the transition time was estimated. The thickness of boundary layer was derived with conjunction with the conventional limiting current density and the transition time from steady state flux. On the other hand, the charge mosaic membrane was introduced in order to examine the ion transport on the membrane surface in detail. The concentration profile was discussed by the kinetic transport number with regard to the water dissociation (splitting on the membrane surface.

  18. Conductivity of natural and modified DNA measured by scanning tunneling microscopy. The effect of sequence, charge and stacking

    Czech Academy of Sciences Publication Activity Database

    Kratochvílová, Irena; Král, Karel; Bunček, M.; Víšková, A.; Nešpůrek, Stanislav; Kochalska, Anna; Todorciuc, Tatiana; Weiter, M.; Schneider, Bohdan

    2008-01-01

    Roč. 138, č. 1-2 (2008), s. 3-10 ISSN 0301-4622 R&D Projects: GA ČR GA203/08/1594; GA AV ČR KAN401770651; GA MŠk OC 137; GA AV ČR KAN200100801; GA ČR GA202/07/0643 Grant - others:Marie-Curie RTN BIMORE(XE) MRTN-CT-2006-035859 Institutional research plan: CEZ:AV0Z10100520; CEZ:AV0Z40500505; CEZ:AV0Z50520701 Keywords : DNA conductivity * charge transport in molecular systems * STM * electronic properties Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 2.362, year: 2008

  19. Control of electrical conduction in DNA using hole doping

    Science.gov (United States)

    Lee, Hea-Yeon; Taniguchi, Masateru; Yoo, K. H.; Otsuka, Youichi; Tanaka, Hidekazu; Kawai, Tomoji

    2002-03-01

    Control of electrical conduction in DNA using hole doping H.Y.Lee1, M.Taniguchi1, K.H.Yoo2, Y.Otsuka1 H.Tanaka1 and T.Kawai1 1The Institute of Scientific and Industrial Research(ISIR), Osaka University, Osaka, Japan. 2Department of Physics, Younsei University, Seoul, Korea Possible applications of DNA molecules in electronic devices and biosensors were suggested almost ten years ago A DNA structure containing a single type of base pair appears to be a good candidate for conduction along the \\x81E-electron clouds of the stacked bases. There have been lots of investigations on conduction mechanisms of the DNA molecules. However, it is not still clear whether the observed conductions of some DNA molecules come from motions of either ionic charges or other carriers. Although the basic mechanism for DNA-mediated charge transport should be understood for electronic applications, there have been divergent reports on its nature. And I will be present the research for the charge carrier conduction of DNA film under oxygen and iodine gas by using 10¡V100 nm gap. The doping studies using oxygen and iodine gas can provide a definite answer for the carrier conduction mechanism and also a possible method to control the carrier concentration in DNA molecules. Using oxygen and iodine adsorption experiments on the poly (dG)-poly (dC) DNA molecules, we will show that their conductance becomes increased easily by several orders of magnitudes due to the hole doping, which is a characteristic behavior of a p-type semiconductor. On the other hand, we will also show that the poly (dA) - poly (dT) DNA molecules behave as an n-type semiconductor. Our works indicate that the concentration and the type of carriers in the DNA molecules could be controlled using proper doping methods. We expect that this would be a major breakthrough in DNA-based nano-electronics, similar to the fact that the doped conductive has polyacetylene opened up a new field of electronics with exciting implications

  20. An alternative approach to charge transport in semiconducting electrodes

    Science.gov (United States)

    Thomchick, J.; Buoncristiani, A. M.

    1980-01-01

    The excess-carrier charge transport through the space-charge region of a semiconducting electrode is analyzed by a technique known as the flux method. In this approach reflection and transmission coefficients appropriate for a sheet of uniform semiconducting material describe its transport properties. A review is presented of the flux method showing that the results for a semiconductor electrode reduce in a limiting case to those previously found by Gaertner if the depletion layer is treated as a perfectly transmitting medium in which scattering and recombination are ignored. Then, in the framework of the flux method the depletion layer is considered more realistically by explicitly taking into account scattering and recombination processes which occur in this region.

  1. A n-vector model for charge transport in molecular semiconductors.

    Science.gov (United States)

    Jackson, Nicholas E; Kohlstedt, Kevin L; Chen, Lin X; Ratner, Mark A

    2016-11-28

    We develop a lattice model utilizing coarse-grained molecular sites to study charge transport in molecular semiconducting materials. The model bridges atomistic descriptions and structureless lattice models by mapping molecular structure onto sets of spatial vectors isomorphic with spin vectors in a classical n-vector Heisenberg model. Specifically, this model incorporates molecular topology-dependent orientational and intermolecular coupling preferences, including the direct inclusion of spatially correlated transfer integrals and site energy disorder. This model contains the essential physics required to explicitly simulate the interplay of molecular topology and correlated structural disorder, and their effect on charge transport. As a demonstration of its utility, we apply this model to analyze the effects of long-range orientational correlations, molecular topology, and intermolecular interaction strength on charge motion in bulk molecular semiconductors.

  2. Charge transport and recombination dynamics in organic bulk heterojunction solar cells

    Energy Technology Data Exchange (ETDEWEB)

    Baumann, Andreas

    2011-08-02

    The charge transport in disordered organic bulk heterojunction (BHJ) solar cells is a crucial process affecting the power conversion efficiency (PCE) of the solar cell. With the need of synthesizing new materials for improving the power conversion efficiency of those cells it is important to study not only the photophysical but also the electrical properties of the new material classes. Thereby, the experimental techniques need to be applicable to operating solar cells. In this work, the conventional methods of transient photoconductivity (also known as ''Time-of-Flight'' (TOF)), as well as the transient charge extraction technique of ''Charge Carrier Extraction by Linearly Increasing Voltage'' (CELIV) are performed on different organic blend compositions. Especially with the latter it is feasible to study the dynamics - i.e. charge transport and charge carrier recombination - in bulk heterojunction (BHJ) solar cells with active layer thicknesses of 100-200 nm. For a well performing organic BHJ solar cells the morphology is the most crucial parameter finding a trade-off between an efficient photogeneration of charge carriers and the transport of the latter to the electrodes. Besides the morphology, the nature of energetic disorder of the active material blend and its influence on the dynamics are discussed extensively in this work. Thereby, the material system of poly(3-hexylthiophene-2,5-diyl) (P3HT) and [6,6]-phenyl-C{sub 61}butyric acid methyl ester (PC{sub 61}BM) serves mainly as a reference material system. New promising donor or acceptor materials and their potential for application in organic photovoltaics are studied in view of charge dynamics and compared with the reference system. With the need for commercialization of organic solar cells the question of the impact of environmental conditions on the PCE of the solar cells raises. In this work, organic BHJ solar cells exposed to synthetic air for finite duration are

  3. The Ku80 carboxy terminus stimulates joining and artemis-mediated processing of DNA ends

    DEFF Research Database (Denmark)

    Weterings, Eric; Verkaik, Nicole S; Keijzers, Guido

    2008-01-01

    Repair of DNA double-strand breaks (DSBs) is predominantly mediated by nonhomologous end joining (NHEJ) in mammalian cells. NHEJ requires binding of the Ku70-Ku80 heterodimer (Ku70/80) to the DNA ends and subsequent recruitment of the DNA-dependent protein kinase catalytic subunit (DNA-PK(CS)) an......Repair of DNA double-strand breaks (DSBs) is predominantly mediated by nonhomologous end joining (NHEJ) in mammalian cells. NHEJ requires binding of the Ku70-Ku80 heterodimer (Ku70/80) to the DNA ends and subsequent recruitment of the DNA-dependent protein kinase catalytic subunit (DNA......-PK(CS)) and the XRCC4/ligase IV complex. Activation of the DNA-PK(CS) serine/threonine kinase requires an interaction with Ku70/80 and is essential for NHEJ-mediated DSB repair. In contrast to previous models, we found that the carboxy terminus of Ku80 is not absolutely required for the recruitment and activation...... was phosphorylated to normal levels. This resulted in severely reduced levels of Artemis nuclease activity in vivo and in vitro. We therefore conclude that the Ku80 carboxy terminus is important to support DNA-PK(CS) autophosphorylation at specific sites, which facilitates DNA end processing by the Artemis...

  4. Silver-mediated base pairings: towards dynamic DNA nanostructures with enhanced chemical and thermal stability

    International Nuclear Information System (INIS)

    Swasey, Steven M; Gwinn, Elisabeth G

    2016-01-01

    The thermal and chemical fragility of DNA nanomaterials assembled by Watson–Crick (WC) pairing constrain the settings in which these materials can be used and how they can be functionalized. Here we investigate use of the silver cation, Ag + , as an agent for more robust, metal-mediated self-assembly, focusing on the simplest duplex building blocks that would be required for more elaborate Ag + –DNA nanostructures. Our studies of Ag + -induced assembly of non-complementary DNA oligomers employ strands of 2–24 bases, with varied base compositions, and use electrospray ionization mass spectrometry to determine product compositions. High yields of duplex products containing narrowly distributed numbers of Ag + can be achieved by optimizing solution conditions. These Ag + -mediated duplexes are stable to at least 60 mM Mg 2+ , higher than is necessary for WC nanotechnology schemes such as tile assemblies and DNA origami, indicating that sequential stages of Ag + -mediated and WC-mediated assembly may be feasible. Circular dichroism spectroscopy suggests simple helical structures for Ag + -mediated duplexes with lengths to at least 20 base pairs, and further indicates that the structure of cytosine-rich duplexes is preserved at high urea concentrations. We therefore propose an approach towards dynamic DNA nanomaterials with enhanced thermal and chemical stability through designs that combine sturdy silver-mediated ‘frames’ with WC paired ‘pictures’. (paper)

  5. Transmission of HBV DNA Mediated by Ceramide-Triggered Extracellular Vesicles.

    Science.gov (United States)

    Sanada, Takahiro; Hirata, Yuichi; Naito, Yutaka; Yamamoto, Naoki; Kikkawa, Yoshiaki; Ishida, Yuji; Yamasaki, Chihiro; Tateno, Chise; Ochiya, Takahiro; Kohara, Michinori

    2017-03-01

    An extracellular vesicle (EV) is a nanovesicle that shuttles proteins, nucleic acids, and lipids, thereby influencing cell behavior. A recent crop of reports have shown that EVs are involved in infectious biology, influencing host immunity and playing a role in the viral life cycle. In the present work, we investigated the EV-mediated transmission of hepatitis B virus (HBV) infection. We investigated the EV-mediated transmission of HBV infection by using a HBV infectious culture system that uses primary human hepatocytes derived from humanized chimeric mice (PXB-cells). Purified EVs were isolated by ultracentrifugation. To analyze the EVs and virions, we used stimulated emission depletion microscopy. Purified EVs from HBV-infected PXB-cells were shown to contain HBV DNA and to be capable of transmitting HBV DNA to naive PXB-cells. These HBV-DNA-transmitting EVs were shown to be generated through a ceramide-triggered EV production pathway. Furthermore, we showed that these HBV-DNA-transmitting EVs were resistant to antibody neutralization; stimulated emission depletion microscopy showed that EVs lacked hepatitis B surface antigen, the target of neutralizing antibodies. These findings suggest that EVs harbor a DNA cargo capable of transmitting viral DNA into hepatocytes during HBV infection, representing an additional antibody-neutralization-resistant route of HBV infection.

  6. Modulation and Control of Charge Transport Through Single-Molecule Junctions.

    Science.gov (United States)

    Wang, Kun; Xu, Bingqian

    2017-02-01

    The ability to modulate and control charge transport though single-molecule junction devices is crucial to achieving the ultimate goal of molecular electronics: constructing real-world-applicable electronic components from single molecules. This review aims to highlight the progress made in single-molecule electronics, emphasizing the development of molecular junction electronics in recent years. Among many techniques that attempt to wire a molecule to metallic electrodes, the single-molecule break junction (SMBJ) technique is one of the most reliable and tunable experimental platforms for achieving metal-molecule-metal configurations. It also provides great freedom to tune charge transport through the junction. Soon after the SMBJ technique was introduced, it was extensively used to measure the conductances of individual molecules; however, different conductances were obtained for the same molecule, and it proved difficult to interpret this wide distribution of experimental data. This phenomenon was later found to be mainly due to a lack of precise experimental control and advanced data analysis methods. In recent years, researchers have directed considerable effort into advancing the SMBJ technique by gaining a deeper physical understanding of charge transport through single molecules and thus enhancing its potential applicability in functional molecular-scale electronic devices, such as molecular diodes and molecular transistors. In parallel with that research, novel data analysis methods and approaches that enable the discovery of hidden yet important features in the data are being developed. This review discusses various aspects of molecular junction electronics, from the initial goal of molecular electronics, the development of experimental techniques for creating single-molecule junctions and determining single-molecule conductance, to the characterization of functional current-voltage features and the investigation of physical properties other than charge

  7. A general relationship between disorder, aggregation and charge transport in conjugated polymers

    KAUST Repository

    Noriega, Rodrigo; Rivnay, Jonathan; Vandewal, Koen; Koch, Felix P. V.; Stingelin, Natalie; Smith, Paul; Toney, Michael F.; Salleo, Alberto

    2013-01-01

    Conjugated polymer chains have many degrees of conformational freedom and interact weakly with each other, resulting in complex microstructures in the solid state. Understanding charge transport in such systems, which have amorphous and ordered phases exhibiting varying degrees of order, has proved difficult owing to the contribution of electronic processes at various length scales. The growing technological appeal of these semiconductors makes such fundamental knowledge extremely important for materials and process design. We propose a unified model of how charge carriers travel in conjugated polymer films. We show that in high-molecular-weight semiconducting polymers the limiting charge transport step is trapping caused by lattice disorder, and that short-range intermolecular aggregation is sufficient for efficient long-range charge transport. This generalization explains the seemingly contradicting high performance of recently reported, poorly ordered polymers and suggests molecular design strategies to further improve the performance of future generations of organic electronic materials. © 2013 Macmillan Publishers Limited. All rights reserved.

  8. A general relationship between disorder, aggregation and charge transport in conjugated polymers

    KAUST Repository

    Noriega, Rodrigo

    2013-08-04

    Conjugated polymer chains have many degrees of conformational freedom and interact weakly with each other, resulting in complex microstructures in the solid state. Understanding charge transport in such systems, which have amorphous and ordered phases exhibiting varying degrees of order, has proved difficult owing to the contribution of electronic processes at various length scales. The growing technological appeal of these semiconductors makes such fundamental knowledge extremely important for materials and process design. We propose a unified model of how charge carriers travel in conjugated polymer films. We show that in high-molecular-weight semiconducting polymers the limiting charge transport step is trapping caused by lattice disorder, and that short-range intermolecular aggregation is sufficient for efficient long-range charge transport. This generalization explains the seemingly contradicting high performance of recently reported, poorly ordered polymers and suggests molecular design strategies to further improve the performance of future generations of organic electronic materials. © 2013 Macmillan Publishers Limited. All rights reserved.

  9. Detection of DNA damage based on metal-mediated molecular beacon and DNA strands displacement reaction

    Science.gov (United States)

    Xiong, Yanxiang; Wei, Min; Wei, Wei; Yin, Lihong; Pu, Yuepu; Liu, Songqin

    2014-01-01

    DNA hairpin structure probes are usually designed by forming intra-molecular duplex based on Watson-Crick hydrogen bonds. In this paper, a molecular beacon based on silver ions-mediated cytosine-Ag+-cytosine base pairs was used to detect DNA. The inherent characteristic of the metal ligation facilitated the design of functional probe and the adjustment of its binding strength compared to traditional DNA hairpin structure probes, which make it be used to detect DNA in a simple, rapid and easy way with the help of DNA strands displacement reaction. The method was sensitive and also possesses the good specificity to differentiate the single base mismatched DNA from the complementary DNA. It was also successfully applied to study the damage effect of classic genotoxicity chemicals such as styrene oxide and sodium arsenite on DNA, which was significant in food science, environmental science and pharmaceutical science.

  10. Nanoinjection: pronuclear DNA delivery using a charged lance.

    Science.gov (United States)

    Aten, Quentin T; Jensen, Brian D; Tamowski, Susan; Wilson, Aubrey M; Howell, Larry L; Burnett, Sandra H

    2012-12-01

    We present a non-fluidic pronuclear injection method using a silicon microchip "nanoinjector" composed of a microelectromechanical system with a solid, electrically conductive lance. Unlike microinjection which uses fluid delivery of DNA, nanoinjection electrically accumulates DNA on the lance, the DNA-coated lance is inserted into the pronucleus, and DNA is electrically released. We compared nanoinjection and microinjection side-by-side over the course of 4 days, injecting 1,013 eggs between the two groups. Nanoinjected zygotes had significantly higher rates of integration per injected embryo, with 6.2% integration for nanoinjected embryos compared to 1.6% integration for microinjected embryos. This advantage is explained by nanoinjected zygotes' significantly higher viability in two stages of development: zygote progress to two-cell stage, and progress from two-cell stage embryos to birth. We observed that 77.6% of nanoinjected zygotes proceeded to two-cell stage compared to 54.7% of microinjected zygotes. Of the healthy two-cell stage embryos, 52.4% from the nanoinjection group and 23.9% from the microinjected group developed into pups. Structural advantages of the nanoinjector are likely to contribute to the high viability observed. For instance, because charge is used to retain and release DNA, extracellular fluid is not injected into the pronucleus and the cross-sectional area of the nanoinjection lance (0.06 µm(2)) is smaller than that of a microinjection pipette tip (0.78 µm(2)). According to results from the comparative nanoinjection versus microinjection study, we conclude that nanoinjection is a viable method of pronuclear DNA transfer which presents viability advantages over microinjection.

  11. Electrolyte transport in neutral polymer gels embedded with charged inclusions

    Science.gov (United States)

    Hill, Reghan

    2005-11-01

    Ion permeable membranes are the basis of a variety of molecular separation technologies, including ion exchange, gel electrophoresis and dialysis. This work presents a theoretical model of electrolyte transport in membranes comprised of a continuous polymer gel embedded with charged spherical inclusions, e.g., biological cells and synthetic colloids. The microstructure mimics immobilized cell cultures, where electric fields have been used to promote nutrient transport. Because several important characteristics can, in principle, be carefully controlled, the theory provides a quantitative framework to help tailor the bulk properties for enhanced molecular transport, microfluidic pumping, and physicochemical sensing applications. This talk focuses on the electroosmotic flow driven by weak electric fields and electrolyte concentration gradients. Also of importance is the influence of charge on the effective ion diffusion coefficients, bulk electrical conductivity, and membrane diffusion potential.

  12. Frequency dependent magneto-transport in charge transfer Co(II) complex

    Energy Technology Data Exchange (ETDEWEB)

    Shaw, Bikash Kumar; Saha, Shyamal K., E-mail: cnssks@iacs.res.in

    2014-09-01

    A charge transfer chelated system containing ferromagnetic metal centers is the ideal system to investigate the magneto-transport and magneto-dielectric effects due to the presence of both electronic as well as magnetic properties and their coupling. Magneto-transport properties in materials are usually studied through dc charge transport under magnetic field. As frequency dependent conductivity is an essential tool to understand the nature of carrier wave, its spatial extension and their mutual interaction, in the present work, we have investigated frequency dependent magneto-transport along with magnetization behavior in [Co{sub 2}(II)-(5-(4-PhMe)-1,3,4-oxadiazole-H{sup +}-2-thiolate){sub 5}](OAc){sub 4} metal complex to elucidate the nature of above quantities and their response under magnetic field in the transport property. We have used the existing model for ac conduction incorporating the field dependence to explain the frequency dependent magneto-transport. It is seen that the frequency dependent magneto-transport could be well explained using the existing model for ac conduction. -Highlights: • Chelated Co(II) complex is synthesized for magneto-transport applications. • Frequency dependent magneto-transport and magnetization behavior are studied. • Nature of carrier wave, its spatial extension is investigated under magnetic field. • Existing model for ac conduction is used with magnetic field dependence.

  13. Temperature-dependent charge transport mechanisms in carbon sphere/polyaniline composite

    Science.gov (United States)

    Nieves, Cesar A.; Martinez, Luis M.; Meléndez, Anamaris; Ortiz, Margarita; Ramos, Idalia; Pinto, Nicholas J.; Zimbovskaya, Natalya

    2017-12-01

    Charge transport in the temperature range 80 K electrons between polymeric chains in PANi-filled gaps between CS is the predominant transport mechanism through CS/PANi composites. The high conductivity of the CS/PANi composite makes the material attractive for the fabrication of devices and sensors.

  14. Charge transport in disordered organic field-effect transistors

    NARCIS (Netherlands)

    Tanase, Cristina; Blom, Paul W.M.; Meijer, Eduard J.; Leeuw, Dago M. de; Jabbour, GE; Carter, SA; Kido, J; Lee, ST; Sariciftci, NS

    2002-01-01

    The transport properties of poly(2,5-thienylene vinylene) (PTV) field-effect transistors (FET) have been investigated as a function of temperature under controlled atmosphere. In a disordered semiconductor as PTV the charge carrier mobility, dominated by hopping between localized states, is

  15. Selective DNA-Mediated Assembly of Gold Nanoparticles on Electroded Substrates

    Science.gov (United States)

    2008-06-01

    might use the Watson - Crick base-pairing of DNA as a means for ultrahigh-precision engineering is well- known.5,6 The idea is to use the highly specific...Selective DNA -Mediated Assembly of Gold Nanoparticles on Electroded Substrates K. E. Sapsford,†,‡,∇ D. Park,§ E. R. Goldman,‡ E. E. Foos,| S. A...electrodes via DNA hybridization. Protocols are demonstrated for maximizing selectivity and coverage using 15mers as the active binding agents. Detailed

  16. DNA-mediated gene transfer into ataxia-telangiectasia cells

    International Nuclear Information System (INIS)

    Crescenzi, M.; Pulciani, S.; Carbonari, M.; Tedesco, L.; Russo, G.; Gaetano, C.; Fiorilli, M.

    1986-01-01

    The complete description of the genetic lesion(s) underlying the AT mutation might, therefore, highlight not only a DNA-repair pathwa, but also an important aspect of the physiology of lymphocytes. DNA-mediated gene transfer into eukaryotic cells has proved a powerful tool for the molecular cloning of certain mammalian genes. The possibility to clone a given gene using this technology depends, basically, on the availability of a selectable marker associated with the expression of the transfected gene in the recipient cell. Recently, a human DNA repair gene has been cloned in CHO mutant cells by taking advantage of the increased resistance to ultraviolet radiation of the transformants. As a preliminary step toward the molecular cloning of the AT gene(s), the authors have attempted to confer radioresistance to AT cells by transfection with normal human DNA

  17. Membrane Transporters as Mediators of Cisplatin Effects and Side Effects

    Directory of Open Access Journals (Sweden)

    Giuliano Ciarimboli

    2012-01-01

    Full Text Available Transporters are important mediators of specific cellular uptake and thus, not only for effects, but also for side effects, metabolism, and excretion of many drugs such as cisplatin. Cisplatin is a potent cytostatic drug, whose use is limited by its severe acute and chronic nephro-, oto-, and peripheral neurotoxicity. For this reason, other platinum derivatives, such as carboplatin and oxaliplatin, with less toxicity but still with antitumoral action have been developed. Several transporters, which are expressed on the cell membranes, have been associated with cisplatin transport across the plasma membrane and across the cell: the copper transporter 1 (Ctr1, the copper transporter 2 (Ctr2, the P-type copper-transporting ATPases ATP7A and ATP7B, the organic cation transporter 2 (OCT2, and the multidrug extrusion transporter 1 (MATE1. Some of these transporters are also able to accept other platinum derivatives as substrate. Since membrane transporters display a specific tissue distribution, they can be important molecules that mediate the entry of platinum derivatives in target and also nontarget cells possibly mediating specific effects and side effects of the chemotherapeutic drug. This paper summarizes the literature on toxicities of cisplatin compared to that of carboplatin and oxaliplatin and the interaction of these platinum derivatives with membrane transporters.

  18. TopBP1-mediated DNA processing during mitosis.

    Science.gov (United States)

    Gallina, Irene; Christiansen, Signe Korbo; Pedersen, Rune Troelsgaard; Lisby, Michael; Oestergaard, Vibe H

    2016-01-01

    Maintenance of genome integrity is crucial to avoid cancer and other genetic diseases. Thus faced with DNA damage, cells mount a DNA damage response to avoid genome instability. The DNA damage response is partially inhibited during mitosis presumably to avoid erroneous processing of the segregating chromosomes. Yet our recent study shows that TopBP1-mediated DNA processing during mitosis is highly important to reduce transmission of DNA damage to daughter cells. (1) Here we provide an overview of the DNA damage response and DNA repair during mitosis. One role of TopBP1 during mitosis is to stimulate unscheduled DNA synthesis at underreplicated regions. We speculated that such genomic regions are likely to hold stalled replication forks or post-replicative gaps, which become the substrate for DNA synthesis upon entry into mitosis. Thus, we addressed whether the translesion pathways for fork restart or post-replicative gap filling are required for unscheduled DNA synthesis in mitosis. Using genetics in the avian DT40 cell line, we provide evidence that unscheduled DNA synthesis in mitosis does not require the translesion synthesis scaffold factor Rev1 or PCNA ubiquitylation at K164, which serve to recruit translesion polymerases to stalled forks. In line with this finding, translesion polymerase η foci do not colocalize with TopBP1 or FANCD2 in mitosis. Taken together, we conclude that TopBP1 promotes unscheduled DNA synthesis in mitosis independently of the examined translesion polymerases.

  19. An improved charge transport system for the pelletron accelerator in Lund

    International Nuclear Information System (INIS)

    Hellborg, R.; Hakansson, K.

    1988-01-01

    Several improvements have been implemented in the chain charge transport system of a pelletron. The main new components are a modified support at ground for the chain accessories, a new power supply for the chain motor, including the possibility of variable chain speed, and pickup rings to monitor the relative amount of charge on individual cylinders of the chain. These modifications, together with the installation of a second chain, have resulted in improved operational reliability, a much smoother startup of the chain, and a doubled maximum chain current. The latter will simplify running the accelerator with heavy ions at maximum terminal voltage. The pickup rings have been found to be useful in diagnosing malfunctions in the charge transport system. (orig.)

  20. Battery-powered transport systems. Possible methods of automatically charging drive batteries

    Energy Technology Data Exchange (ETDEWEB)

    1981-03-01

    In modern driverless transport systems, not only easy maintenance of the drive battery is important but also automatic charging during times of standstill. Some systems are presented; one system is pointed out in particular in which 100 batteries can be charged at the same time.

  1. Simulating charge transport in flexible systems

    Directory of Open Access Journals (Sweden)

    Timothy Clark

    2015-12-01

    Full Text Available Systems in which movements occur on two significantly different time domains, such as organic electronic components with flexible molecules, require different simulation techniques for the two time scales. In the case of molecular electronics, charge transport is complicated by the several different mechanisms (and theoretical models that apply in different cases. We cannot yet combine time scales of molecular and electronic movement in simulations of real systems. This review describes our progress towards this goal.

  2. DNA-mediated gene transfer into human diploid fibroblasts derived from normal and ataxia-telangiectasia donors: parameters for DNA transfer and properties of DNA transformants

    International Nuclear Information System (INIS)

    Debenham, P.G.; Webb, M.B.T.; Masson, W.K.; Cox, R.

    1984-01-01

    An investigation was made of the feasibility of DNA-mediated gene transfer into human diploid fibroblasts derived from patients with the radiation sensitive syndrome ataxia-telangiectasia (A-T) and from a normal donor. Although they are markedly different in their growth characteristics, both normal and A-T strains give similar frequencies for DNA transfer in a model system using the recombinant plasmid pSV2-gpt. pSV2-gpt DNA transformants arise with a frequency between 10 -5 and 10 -4 per viable cell. Analysis of such transformants, although possible, is severely handicapped by the limited clonal life span of diploid human cells. Despite these problems it may be concluded that diploid human fibroblasts are competent recipients for DNA-mediated gene transfer and the putative repair deficiency of A-T does not markedly effect the efficiency of this process. (author)

  3. Ambipolar charge transport in organic field-effect transistors

    NARCIS (Netherlands)

    Smits, E.C.P.; Anthopoulos, T.D.; Setayesh, S.; Veenendaal, van E.; Coehoorn, R.; Blom, P.W.M.; Boer, de B.; Leeuw, de D.M.

    2006-01-01

    A model describing charge transport in disordered ambipolar organic field-effect transistors is presented. The basis of this model is the variable-range hopping in an exponential density of states developed for disordered unipolar organic transistors. We show that the model can be used to calculate

  4. Water Transport Mediated by Other Membrane Proteins.

    Science.gov (United States)

    Huang, Boyue; Wang, Hongkai; Yang, Baoxue

    2017-01-01

    Water transport through membrane is so intricate that there are still some debates. (Aquaporins) AQPs are entirely accepted to allow water transmembrane movement depending on osmotic gradient. Cotransporters and uniporters , however, are also concerned in water homeotatsis. Urea transporter B (UT-B) has a single-channel water permeability that is similar to AQP1. Cystic fibrosis transmembrane conductance regulator (CFTR ) was initially thought as a water channel but now not believed to transport water directly. By cotranporters, water is transported by water osmosis coupling with substrates, which explains how water is transported across the isolated small intestine. This chapter provides information about water transport mediated by other membrane proteins except AQPs .

  5. Charge-carrier transport in large-area epitaxial graphene

    Energy Technology Data Exchange (ETDEWEB)

    Kisslinger, Ferdinand; Popp, Matthias; Weber, Heiko B. [Lehrstuhl fuer Angewandte Physik, Friedrich-Alexander-Universitaet Erlangen-Nuernberg (FAU), Erlangen (Germany); Jobst, Johannes [Huygens-Kamerlingh Onnes Laboratorium, Leiden Institute of Physics, Leiden University (Netherlands); Shallcross, Sam [Lehrstuhl fuer theoretische Festkoerperphysik, Friedrich-Alexander-Universitaet Erlangen-Nuernberg (FAU), Erlangen (Germany)

    2017-11-15

    We present an overview of recent charge carrier transport experiments in both monolayer and bilayer graphene, with emphasis on the phenomena that appear in large-area samples. While many aspects of transport are based on quantum mechanical concepts, in the large-area limit classical corrections dominate and shape the magnetoresistance and the tunneling conductance. The discussed phenomena are very general and can, with little modification, be expected in any atomically thin 2D conductor. (copyright 2017 by WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  6. Electron-hole collision limited transport in charge-neutral bilayer graphene

    Science.gov (United States)

    Nam, Youngwoo; Ki, Dong-Keun; Soler-Delgado, David; Morpurgo, Alberto F.

    2017-12-01

    Ballistic transport occurs whenever electrons propagate without collisions deflecting their trajectory. It is normally observed in conductors with a negligible concentration of impurities, at low temperature, to avoid electron-phonon scattering. Here, we use suspended bilayer graphene devices to reveal a new regime, in which ballistic transport is not limited by scattering with phonons or impurities, but by electron-hole collisions. The phenomenon manifests itself in a negative four-terminal resistance that becomes visible when the density of holes (electrons) is suppressed by gate-shifting the Fermi level in the conduction (valence) band, above the thermal energy. For smaller densities, transport is diffusive, and the measured conductivity is reproduced quantitatively, with no fitting parameters, by including electron-hole scattering as the only process causing velocity relaxation. Experiments on a trilayer device show that the phenomenon is robust and that transport at charge neutrality is governed by the same physics. Our results provide a textbook illustration of a transport regime that had not been observed previously and clarify the nature of conduction through charge-neutral graphene under conditions in which carrier density inhomogeneity is immaterial. They also demonstrate that transport can be limited by a fully electronic mechanism, originating from the same microscopic processes that govern the physics of Dirac-like plasmas.

  7. Solvent Vapor Annealing-Mediated Crystallization Directs Charge Generation, Recombination and Extraction in BHJ Solar Cells

    KAUST Repository

    Babics, Maxime; Liang, Ru-Ze; Wang, Kai; Cruciani, Federico; Kan, Zhipeng; Wohlfahrt, Markus; Tang, Ming-Chun; Laquai, Fré dé ric; Beaujuge, Pierre

    2017-01-01

    Small-molecule (SM) donors that can be solution-processed with fullerene acceptors (e.g., PC61/71BM), or their “nonfullerene” counterparts, are proving particularly promising for the realization of high-efficiency bulk-heterojunction (BHJ) solar cells. In several recent studies, solvent vapor annealing (SVA) protocols have been found to yield significant BHJ device efficiency improvements via structural changes in the active layer morphologies. However, the mechanisms by which active layer morphologies evolve when subjected to SVA treatments, and the structural factors impacting charge generation, carrier transport, recombination and extraction in BHJ solar cells with SM donors and fullerene acceptors, remain important aspects to be elucidated. In this report, we show that – in BHJ solar cells with SM donors and fullerene acceptors – selective crystallization promoted by SVA mediates the development of optimized morphologies across the active layers, setting domain sizes and boundaries. Examining BHJ solar cells subjected to various SVA exposure times, with BDT[2F]QdC as the SM donor and PC71BM as the acceptor, we connect those morphological changes to specific carrier effects, showing that crystal growth effectively directs charge generation and recombination. We find that the SM donor-pure domains growing at the expense of a mixed donor-acceptor phase play a determining role, establishing optimum networks with 10-20nm-sized domains during the SVA treatment. Longer SVA times result in highly textured active layers with crystalline domains that can exceed the lengthscale of exciton diffusion, while inducing detrimental vertical morphologies and deep carrier traps. Last, we emphasize the field-dependence charge generation occurring upon SVA-mediated crystallization and link this carrier effect to the mixed phase depletion across the BHJ active layer.

  8. Solvent Vapor Annealing-Mediated Crystallization Directs Charge Generation, Recombination and Extraction in BHJ Solar Cells

    KAUST Repository

    Babics, Maxime

    2017-12-19

    Small-molecule (SM) donors that can be solution-processed with fullerene acceptors (e.g., PC61/71BM), or their “nonfullerene” counterparts, are proving particularly promising for the realization of high-efficiency bulk-heterojunction (BHJ) solar cells. In several recent studies, solvent vapor annealing (SVA) protocols have been found to yield significant BHJ device efficiency improvements via structural changes in the active layer morphologies. However, the mechanisms by which active layer morphologies evolve when subjected to SVA treatments, and the structural factors impacting charge generation, carrier transport, recombination and extraction in BHJ solar cells with SM donors and fullerene acceptors, remain important aspects to be elucidated. In this report, we show that – in BHJ solar cells with SM donors and fullerene acceptors – selective crystallization promoted by SVA mediates the development of optimized morphologies across the active layers, setting domain sizes and boundaries. Examining BHJ solar cells subjected to various SVA exposure times, with BDT[2F]QdC as the SM donor and PC71BM as the acceptor, we connect those morphological changes to specific carrier effects, showing that crystal growth effectively directs charge generation and recombination. We find that the SM donor-pure domains growing at the expense of a mixed donor-acceptor phase play a determining role, establishing optimum networks with 10-20nm-sized domains during the SVA treatment. Longer SVA times result in highly textured active layers with crystalline domains that can exceed the lengthscale of exciton diffusion, while inducing detrimental vertical morphologies and deep carrier traps. Last, we emphasize the field-dependence charge generation occurring upon SVA-mediated crystallization and link this carrier effect to the mixed phase depletion across the BHJ active layer.

  9. Release of DNA from polyelectrolyte multilayers fabricated using 'charge-shifting' cationic polymers: tunable temporal control and sequential, multi-agent release.

    Science.gov (United States)

    Sun, Bin; Lynn, David M

    2010-11-20

    We report an approach to the design of multilayered polyelectrolyte thin films (or 'polyelectrolyte multilayers', PEMs) that can be used to provide tunable control over the release of plasmid DNA (or multiple different DNA constructs) from film-coated surfaces. Our approach is based upon methods for the layer-by-layer assembly of DNA-containing thin films, and exploits the properties of a new class of cationic 'charge-shifting' polymers (amine functionalized polymers that undergo gradual changes in net charge upon side chain ester hydrolysis) to provide control over the rates at which these films erode and release DNA. We synthesized two 'charge-shifting' polymers (polymers 1 and 2) containing different side chain structures by ring-opening reactions of poly(2-alkenyl azlactone)s with two different tertiary amine functionalized alcohols (3-dimethylamino-1-propanol and 2-dimethylaminoethanol, respectively). Subsequent characterization revealed large changes in the rates of side chain ester hydrolysis for these two polymers; whereas the half-life for the hydrolysis of the esters in polymer 1 was ~200 days, the half-life for polymer 2 was ~6 days. We demonstrate that these large differences in side chain hydrolysis make possible the design of PEMs that erode and promote the surface-mediated release of DNA either rapidly (e.g., over ~3 days for films fabricated using polymer 2) or slowly (e.g., over ~1 month for films fabricated using polymer 1). We demonstrate further that it is possible to design films with release profiles that are intermediate to these two extremes by fabricating films using solutions containing different mixtures of these two polymers. This approach can thus expand the usefulness of these two polymers and achieve a broader range of DNA release profiles without the need to synthesize polymers with new structures or properties. Finally, we demonstrate that polymers 1 and 2 can be used to fabricate multilayered films with hierarchical structures that

  10. Transport of Cryptosporidium parvum Oocysts in Charge Heterogeneous Porous Media: Microfluidics Experiment and Numerical Simulation

    Science.gov (United States)

    Liu, Y.; Meng, X.; Guo, Z.; Zhang, C.; Nguyen, T. H.; Hu, D.; Ji, J.; Yang, X.

    2017-12-01

    Colloidal attachment on charge heterogeneous grains has significant environmental implications for transport of hazardous colloids, such as pathogens, in the aquifer, where iron, manganese, and aluminium oxide minerals are the major source of surface charge heterogeneity of the aquifer grains. A patchwise surface charge model is often used to describe the surface charge heterogeneity of the grains. In the patchwise model, the colloidal attachment efficiency is linearly correlated with the fraction of the favorable patches (θ=λ(θf - θu)+θu). However, our previous microfluidic study showed that the attachment efficiency of oocysts of Cryptosporidium parvum, a waterborne protozoan parasite, was not linear correlated with the fraction of the favorable patches (λ). In this study, we developed a pore scale model to simulate colloidal transport and attachment on charge heterogeneous grains. The flow field was simulated using the LBM method and colloidal transport and attachment were simulated using the Lagrange particle tracking method. The pore scale model was calibrated with experimental results of colloidal and oocyst transport in microfluidic devices and was then used to simulate oocyst transport in charge heterogeneous porous media under a variety of environmental relative conditions, i.e. the fraction of favorable patchwise, ionic strength, and pH. The results of the pore scale simulations were used to evaluate the effect of surface charge heterogeneity on upscaling of oocyst transport from pore to continuum scale and to develop an applicable correlation between colloidal attachment efficiency and the fraction of the favorable patches.

  11. Manipulation of charge transport in thermoelectrics

    Science.gov (United States)

    Zhang, Xinyue; Pei, Yanzhong

    2017-12-01

    While numerous improvements have been achieved in thermoelectric materials by reducing the lattice thermal conductivity (κL), electronic approaches for enhancement can be as effective, or even more. A key challenge is decoupling Seebeck coefficient (S) from electrical conductivity (σ). The first order approximation - a single parabolic band assumption with acoustic scattering - leads the thermoelectric power factor (S2σ) to be maximized at a constant reduced Fermi level (η 0.67) and therefore at a given S of 167 μV/K. This simplifies the challenge of maximization of σ at a constant η, leading to a large number of degenerate transport channels (band degeneracy, Nv) and a fast transportation of charges (carrier mobility, μ). In this paper, existing efforts on this issue are summarized and future prospectives are given.

  12. Proliferating cell nuclear antigen binds DNA polymerase-β and mediates 1-methyl-4-phenylpyridinium-induced neuronal death.

    Directory of Open Access Journals (Sweden)

    Zhentao Zhang

    Full Text Available The mechanisms leading to dopaminergic neuronal loss in the substantia nigra of patients with Parkinson disease (PD remain poorly understood. We recently reported that aberrant DNA replication mediated by DNA polymerase-β (DNA pol-β plays a causal role in the death of postmitotic neurons in an in vitro model of PD. In the present study, we show that both proliferating cell nuclear antigen (PCNA and DNA pol-β are required for MPP(+-induced neuronal death. PCNA binds to the catalytic domain of DNA pol-β in MPP(+-treated neurons and in post-mortem brain tissues of PD patients. The PCNA-DNA pol-β complex is loaded into DNA replication forks and mediates DNA replication in postmitotic neurons. The aberrant DNA replication mediated by the PCNA-DNA pol-β complex induces p53-dependent neuronal cell death. Our results indicate that the interaction of PCNA and DNA pol-β contributes to neuronal death in PD.

  13. Absence of ballistic charge transport in the half-filled 1D Hubbard model

    Science.gov (United States)

    Carmelo, J. M. P.; Nemati, S.; Prosen, T.

    2018-05-01

    Whether in the thermodynamic limit of lattice length L → ∞, hole concentration mηz = - 2 Sηz/L = 1 -ne → 0, nonzero temperature T > 0, and U / t > 0 the charge stiffness of the 1D Hubbard model with first neighbor transfer integral t and on-site repulsion U is finite or vanishes and thus whether there is or there is no ballistic charge transport, respectively, remains an unsolved and controversial issue, as different approaches yield contradictory results. (Here Sηz = - (L -Ne) / 2 is the η-spin projection and ne =Ne / L the electronic density.) In this paper we provide an upper bound on the charge stiffness and show that (similarly as at zero temperature), for T > 0 and U / t > 0 it vanishes for mηz → 0 within the canonical ensemble in the thermodynamic limit L → ∞. Moreover, we show that at high temperature T → ∞ the charge stiffness vanishes as well within the grand-canonical ensemble for L → ∞ and chemical potential μ →μu where (μ -μu) ≥ 0 and 2μu is the Mott-Hubbard gap. The lack of charge ballistic transport indicates that charge transport at finite temperatures is dominated by a diffusive contribution. Our scheme uses a suitable exact representation of the electrons in terms of rotated electrons for which the numbers of singly occupied and doubly occupied lattice sites are good quantum numbers for U / t > 0. In contrast to often less controllable numerical studies, the use of such a representation reveals the carriers that couple to the charge probes and provides useful physical information on the microscopic processes behind the exotic charge transport properties of the 1D electronic correlated system under study.

  14. Symmetrization of mathematical model of charge transport in semiconductors

    Directory of Open Access Journals (Sweden)

    Alexander M. Blokhin

    2002-11-01

    Full Text Available A mathematical model of charge transport in semiconductors is considered. The model is a quasilinear system of differential equations. A problem of finding an additional entropy conservation law and system symmetrization are solved.

  15. Breaks in the 45S rDNA Lead to Recombination-Mediated Loss of Repeats

    Directory of Open Access Journals (Sweden)

    Daniël O. Warmerdam

    2016-03-01

    Full Text Available rDNA repeats constitute the most heavily transcribed region in the human genome. Tumors frequently display elevated levels of recombination in rDNA, indicating that the repeats are a liability to the genomic integrity of a cell. However, little is known about how cells deal with DNA double-stranded breaks in rDNA. Using selective endonucleases, we show that human cells are highly sensitive to breaks in 45S but not the 5S rDNA repeats. We find that homologous recombination inhibits repair of breaks in 45S rDNA, and this results in repeat loss. We identify the structural maintenance of chromosomes protein 5 (SMC5 as contributing to recombination-mediated repair of rDNA breaks. Together, our data demonstrate that SMC5-mediated recombination can lead to error-prone repair of 45S rDNA repeats, resulting in their loss and thereby reducing cellular viability.

  16. Investigation on photoluminescence quenching of CdSe/ZnS quantum dots by organic charge transporting materials

    Directory of Open Access Journals (Sweden)

    Yuqiu Qu

    2015-12-01

    Full Text Available The effect of different organic charge transporting materials on the photoluminescence of CdSe/ZnS core/shell quantum dots has been studied by means of steady-state and time-resolved photoluminescence spectroscopy. With an increase in concentration of the organic charge transporting material in the quantum dots solutions, the photoluminescence intensity of CdSe/ZnS quantum dots was quenched greatly and the fluorescence lifetime was shortened gradually. The quenching efficiency of CdSe/ZnS core/shell quantum dots decreased with increasing the oxidation potential of organic charge transporting materials. Based on the analysis, two pathways in the photoluminescence quenching process have been defined: static quenching and dynamic quenching. The dynamic quenching is correlated with hole transporting from quantum dots to the charge transporting materials.

  17. Charge transport properties of graphene: Effects of Cu-based gate electrode

    Energy Technology Data Exchange (ETDEWEB)

    Tang, Qide [School of Physics and Optoelectronics, Xiangtan University, Xiangtan 411105 (China); Zhang, C. X., E-mail: zhangchunxiao@xtu.edu.cn; Tang, Chao, E-mail: tang-chao@xtu.edu.cn; Zhong, Jianxin [School of Physics and Optoelectronics, Xiangtan University, Xiangtan 411105 (China); Hunan Provincial Key Laboratory of Micro-Nano Energy Materials and Devices, Xiangtan University, Hunan 411105 (China); He, Chaoyu [Hunan Provincial Key Laboratory of Micro-Nano Energy Materials and Devices, Xiangtan University, Hunan 411105 (China)

    2016-07-21

    Using the first-principles nonequilibrium Green's function method, we study effects of Cu and Ni@Cu used as the Cu-based gate electrode on the charge transport of graphene in the field effect transistors (FET). We find that the transmission of graphene decreases with both Cu and Ni@Cu absorbed in the scatter region. Especially, noticeable transmission gaps are present around the Femi level. The transmission gaps are still effective, and considerable cut-off regions are found under the non-equilibrium environment. The Ni@Cu depresses the transmission of graphene more seriously than the Cu and enlarges the transmission gap in armchair direction. The effects on the charge transport are attributed to the redistribution of electronic states of graphene. Both Cu and Ni@Cu induce the localization of states, so as to block the electronic transport. The Ni@Cu transforms the interaction between graphene and gate electrode from the physisorption to the chemisorption, and then induces more localized states, so that the transmission decreases further. Our results suggest that besides being used to impose gate voltage, the Cu-based gate electrode itself will have a considerable effect on the charge transport of graphene and induces noticeable transmission gap in the FET.

  18. Exciton shelves for charge and energy transport in third-generation quantum-dot devices

    Science.gov (United States)

    Goodman, Samuel; Singh, Vivek; Noh, Hyunwoo; Casamada, Josep; Chatterjee, Anushree; Cha, Jennifer; Nagpal, Prashant

    2014-03-01

    Quantum dots are semiconductor nanocrystallites with size-dependent quantum-confined energy levels. While they have been intensively investigated to utilize hot-carriers for photovoltaic applications, to bridge the mismatch between incident solar photons and finite bandgap of semiconductor photocells, efficient charge or exciton transport in quantum-dot films has proven challenging. Here we show development of new coupled conjugated molecular wires with ``exciton shelves'', or different energy levels, matched with the multiple energy levels of quantum dots. Using single nanoparticle and ensemble device measurements we show successful extraction and transport of both bandedge and high-energy charge carriers, and energy transport of excitons. We demonstrate using measurements of electronic density of states, that careful matching of energy states of quantum-dot with molecular wires is important, and any mismatch can generate midgap states leading to charge recombination and reduced efficiency. Therefore, these exciton-shelves and quantum dots can lead to development of next-generation photovoltaic and photodetection devices using simultaneous transport of bandedge and hot-carriers or energy transport of excitons in these nanostructured solution-processed films.

  19. Charge transport in amorphous InGaZnO thin-film transistors

    NARCIS (Netherlands)

    Germs, W.C.; Adriaans, W.H.; Tripathi, A.K.; Roelofs, W.S.C.; Cobb, B.; Janssen, R.A.J.; Gelinck, G.H.; Kemerink, M.

    2012-01-01

    We investigate the mechanism of charge transport in indium gallium zinc oxide (a-IGZO), an amorphous metal-oxide semiconductor. We measured the field-effect mobility and the Seebeck coefficient (S=ΔV/ΔT) of a-IGZO in thin-film transistors as a function of charge-carrier density for different

  20. Charge transport in amorphous InGaZnO thin film transistors

    NARCIS (Netherlands)

    Germs, W.C.; Adriaans, W.H.; Tripathi, A.K.; Roelofs, W.S.C.; Cobb, B.; Janssen, R.A.J.; Gelinck, G.H.; Kemerink, M.

    2012-01-01

    We investigate the mechanism of charge transport in indium gallium zinc oxide (a-IGZO), an amorphous metal-oxide semiconductor. We measured the field-effect mobility and the Seebeck coefficient (S=¿V/¿T) of a-IGZO in thin-film transistors as a function of charge-carrier density for different

  1. Microneedle arrays coated with charge reversal pH-sensitive copolymers improve antigen presenting cells-homing DNA vaccine delivery and immune responses.

    Science.gov (United States)

    Duong, Huu Thuy Trang; Kim, Nak Won; Thambi, Thavasyappan; Giang Phan, V H; Lee, Min Sang; Yin, Yue; Jeong, Ji Hoon; Lee, Doo Sung

    2018-01-10

    Successful delivery of a DNA vaccine to antigen-presenting cells and their subsequent stimulation of CD4 + and CD8 + T cell immunity remains an inefficient process. In general, the delivery of prophylactic vaccines is mainly mired by low transfection efficacy, poor immunogenicity, and safety issues from the materials employed. Currently, several strategies have been exploited to improve immunogenicity, but an effective strategy for safe and pain-free delivery of DNA vaccines is complicated. Herein, we report the rapid delivery of polyplex-based DNA vaccines using microneedle arrays coated with a polyelectrolyte multilayer assembly of charge reversal pH-responsive copolymer and heparin. The charge reversal pH-responsive copolymer, composed of oligo(sulfamethazine)-b-poly(ethylene glycol)-b-poly(amino urethane) (OSM-b-PEG-b-PAEU), was used as a triggering layer in the polyelectrolyte multilayer assembly on microneedles. Charge reversal characteristics of this copolymer, that is, the OSM-b-PEG-b-PAEU copolymer exhibit, positive charge at low pH (pH4.03) and becoming negative charge when exposed to physiological pH conditions (pH7.4), allowing the facile assembly and disassembly of polyelectrolyte multilayers. The electrostatic repulsion between heparin and OSM-b-PEG-b-PAEU charge reversal copolymer triggered the release of DNA vaccines. DNA vaccines laden on microneedles are effectively transfected into RAW 264.7 macrophage cells in vitro. Vaccination of BALB/c mice by DNA vaccine-loaded microneedle arrays coated with a polyelectrolyte multilayer generated antigen-specific robust immune responses. These findings provide potential strategy of charge reversal pH-responsive copolymers coated microneedles for DNA vaccine delivery. Copyright © 2017. Published by Elsevier B.V.

  2. Charge trapping and carrier transport mechanism in silicon-rich silicon oxynitride

    International Nuclear Information System (INIS)

    Yu Zhenrui; Aceves, Mariano; Carrillo, Jesus; Lopez-Estopier, Rosa

    2006-01-01

    The charge-trapping and carrier transport properties of silicon-rich silicon oxynitride (SRO:N) were studied. The SRO:N films were deposited by low pressure chemical vapor deposition. Infrared (IR) and transmission electron microscopic (TEM) measurements were performed to characterize their structural properties. Capacitance versus voltage and current versus voltage measurements (I-V) were used to study the charge-trapping and carrier transport mechanism. IR and TEM measurements revealed the existence of Si nanodots in SRO:N films. I-V measurements revealed that there are two conduction regimes divided by a threshold voltage V T . When the applied voltage is smaller than V T , the current is dominated by the charge transfer between the SRO:N and substrate; and in this regime only dynamic charging/discharging of the SRO:N layer is observed. When the voltage is larger than V T , the current increases rapidly and is dominated by the Poole-Frenkel mechanism; and in this regime, large permanent trapped charge density is obtained. Nitrogen incorporation significantly reduced the silicon nanodots or defects near the SRO:N/Si interface. However, a significant increase of the density of silicon nanodot in the bulk of the SRO:N layer is obtained

  3. Theory and simulation of charge transfer through DNA - nanotube contacts

    International Nuclear Information System (INIS)

    Rink, Gunda; Kong Yong; Koslowski, Thorsten

    2006-01-01

    We address the problem of charge transfer between a single-stranded adenine oligomer and semiconducting boron nitride nanotubes from a theoretical and numerical perspective. The model structures have been motivated by computer simulations; sample geometries are used as the input of an electronic structure theory that is based upon an extended Su-Schrieffer-Heeger Hamiltonian. By analyzing the emerging potential energy surfaces, we obtain hole transfer rates via Marcus' theory of charge transfer. In the presence of nanotubes, these rates exceed those of isolated DNA single strands by a factor of up to 10 4 . This enhancement can be rationalized and quantified as a combination of a template effect and the participation of the tube within a superexchange mechanism

  4. Breaks in the 45S rDNA Lead to Recombination-Mediated Loss of Repeats.

    Science.gov (United States)

    Warmerdam, Daniël O; van den Berg, Jeroen; Medema, René H

    2016-03-22

    rDNA repeats constitute the most heavily transcribed region in the human genome. Tumors frequently display elevated levels of recombination in rDNA, indicating that the repeats are a liability to the genomic integrity of a cell. However, little is known about how cells deal with DNA double-stranded breaks in rDNA. Using selective endonucleases, we show that human cells are highly sensitive to breaks in 45S but not the 5S rDNA repeats. We find that homologous recombination inhibits repair of breaks in 45S rDNA, and this results in repeat loss. We identify the structural maintenance of chromosomes protein 5 (SMC5) as contributing to recombination-mediated repair of rDNA breaks. Together, our data demonstrate that SMC5-mediated recombination can lead to error-prone repair of 45S rDNA repeats, resulting in their loss and thereby reducing cellular viability. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  5. Seeking effective dyes for a mediated glucose-air alkaline battery/fuel cell

    Science.gov (United States)

    Eustis, Ross; Tsang, Tsz Ming; Yang, Brigham; Scott, Daniel; Liaw, Bor Yann

    2014-02-01

    A significant level of power generation from an abiotic, air breathing, mediated reducing sugar-air alkaline battery/fuel cell has been achieved in our laboratories at room temperature without complicated catalysis or membrane separation in the reaction chamber. Our prior studies suggested that mass transport limitation by the mediator is a limiting factor in power generation. New and effective mediators were sought here to improve charge transfer and power density. Forty-five redox dyes were studied to identify if any can facilitate mass transport in alkaline electrolyte solution; namely, by increasing the solubility and mobility of the dye, and the valence charge carried per molecule. Indigo dyes were studied more closely to understand the complexity involved in mass transport. The viability of water-miscible co-solvents was also explored to understand their effect on solubility and mass transport of the dyes. Using a 2.0 mL solution, 20% methanol by volume, with 100 mM indigo carmine, 1.0 M glucose and 2.5 M sodium hydroxide, the glucose-air alkaline battery/fuel cell attained 8 mA cm-2 at short-circuit and 800 μW cm-2 at the maximum power point. This work shall aid future optimization of mediated charge transfer mechanism in batteries or fuel cells.

  6. Solving the Single-Sink, Fixed-Charge, Multiple-Choice Transportation Problem by Dynamic Programming

    DEFF Research Database (Denmark)

    Rauff Lind Christensen, Tue; Klose, Andreas; Andersen, Kim Allan

    important aspects of supplier selection, an important application of the SSFCTP, this does not reflect the real life situation. First, transportation costs faced by many companies are in fact piecewise linear. Secondly, when suppliers offer discounts, either incremental or all-unit discounts, such savings......The Single-Sink, Fixed-Charge, Multiple-Choice Transportation Problem (SSFCMCTP) is a problem with versatile applications. This problem is a generalization of the Single-Sink, Fixed-Charge Transportation Problem (SSFCTP), which has a fixed-charge, linear cost structure. However, in at least two...... are neglected in the SSFCTP. The SSFCMCTP overcome this problem by incorporating a staircase cost structure in the cost function instead of the usual one used in SSFCTP. We present a dynamic programming algorithm for the resulting problem. To enhance the performance of the generic algorithm a number...

  7. Understanding the effects of electronic polarization and delocalization on charge-transport levels in oligoacene systems

    KAUST Repository

    Sutton, Christopher; Tummala, Naga Rajesh; Kemper, Travis; Aziz, Saadullah G.; Sears, John; Coropceanu, Veaceslav; Bredas, Jean-Luc

    2017-01-01

    Electronic polarization and charge delocalization are important aspects that affect the charge-transport levels in organic materials. Here, using a quantum mechanical/ embedded-charge (QM/EC) approach based on a combination of the long-range corrected omega B97X-D exchange-correlation functional (QM) and charge model 5 (CM5) point-charge model (EC), we evaluate the vertical detachment energies and polarization energies of various sizes of crystalline and amorphous anionic oligoacene clusters. Our results indicate that QM/EC calculations yield vertical detachment energies and polarization energies that compare well with the experimental values obtained from ultraviolet photoemission spectroscopy measurements. In order to understand the effect of charge delocalization on the transport levels, we considered crystalline naphthalene systems with QM regions including one or five-molecules. The results for these systems show that the delocalization and polarization effects are additive; therefore, allowing for electron delocalization by increasing the size of the QM region leads to the additional stabilization of the transport levels. Published by AIP Publishing.

  8. Understanding the effects of electronic polarization and delocalization on charge-transport levels in oligoacene systems

    KAUST Repository

    Sutton, Christopher

    2017-06-13

    Electronic polarization and charge delocalization are important aspects that affect the charge-transport levels in organic materials. Here, using a quantum mechanical/ embedded-charge (QM/EC) approach based on a combination of the long-range corrected omega B97X-D exchange-correlation functional (QM) and charge model 5 (CM5) point-charge model (EC), we evaluate the vertical detachment energies and polarization energies of various sizes of crystalline and amorphous anionic oligoacene clusters. Our results indicate that QM/EC calculations yield vertical detachment energies and polarization energies that compare well with the experimental values obtained from ultraviolet photoemission spectroscopy measurements. In order to understand the effect of charge delocalization on the transport levels, we considered crystalline naphthalene systems with QM regions including one or five-molecules. The results for these systems show that the delocalization and polarization effects are additive; therefore, allowing for electron delocalization by increasing the size of the QM region leads to the additional stabilization of the transport levels. Published by AIP Publishing.

  9. Neutralized ion beam modification of cellulose membranes for study of ion charge effect on ion-beam-induced DNA transfer

    Science.gov (United States)

    Prakrajang, K.; Sangwijit, K.; Anuntalabhochai, S.; Wanichapichart, P.; Yu, L. D.

    2012-02-01

    Low-energy ion beam biotechnology (IBBT) has recently been rapidly developed worldwide. Ion-beam-induced DNA transfer is one of the important applications of IBBT. However, mechanisms involved in this application are not yet well understood. In this study plasma-neutralized ion beam was applied to investigate ion charge effect on induction of DNA transfer. Argon ion beam at 7.5 keV was neutralized by RF-driven plasma in the beam path and then bombarded cellulose membranes which were used as the mimetic plant cell envelope. Electrical properties such as impedance and capacitance of the membranes were measured after the bombardment. An in vitro experiment on plasmid DNA transfer through the cellulose membrane was followed up. The results showed that the ion charge input played an important role in the impedance and capacitance changes which would affect DNA transfer. Generally speaking, neutral particle beam bombardment of biologic cells was more effective in inducing DNA transfer than charged ion beam bombardment.

  10. Transcription-factor-mediated DNA looping probed by high-resolution, single-molecule imaging in live E. coli cells.

    Directory of Open Access Journals (Sweden)

    Zach Hensel

    Full Text Available DNA looping mediated by transcription factors plays critical roles in prokaryotic gene regulation. The "genetic switch" of bacteriophage λ determines whether a prophage stays incorporated in the E. coli chromosome or enters the lytic cycle of phage propagation and cell lysis. Past studies have shown that long-range DNA interactions between the operator sequences O(R and O(L (separated by 2.3 kb, mediated by the λ repressor CI (accession number P03034, play key roles in regulating the λ switch. In vitro, it was demonstrated that DNA segments harboring the operator sequences formed loops in the presence of CI, but CI-mediated DNA looping has not been directly visualized in vivo, hindering a deep understanding of the corresponding dynamics in realistic cellular environments. We report a high-resolution, single-molecule imaging method to probe CI-mediated DNA looping in live E. coli cells. We labeled two DNA loci with differently colored fluorescent fusion proteins and tracked their separations in real time with ∼40 nm accuracy, enabling the first direct analysis of transcription-factor-mediated DNA looping in live cells. Combining looping measurements with measurements of CI expression levels in different operator mutants, we show quantitatively that DNA looping activates transcription and enhances repression. Further, we estimated the upper bound of the rate of conformational change from the unlooped to the looped state, and discuss how chromosome compaction may impact looping kinetics. Our results provide insights into transcription-factor-mediated DNA looping in a variety of operator and CI mutant backgrounds in vivo, and our methodology can be applied to a broad range of questions regarding chromosome conformations in prokaryotes and higher organisms.

  11. HMGB1-mediated DNA bending: Distinct roles in increasing p53 binding to DNA and the transactivation of p53-responsive gene promoters.

    Science.gov (United States)

    Štros, Michal; Kučírek, Martin; Sani, Soodabeh Abbasi; Polanská, Eva

    2018-03-01

    HMGB1 is a chromatin-associated protein that has been implicated in many important biological processes such as transcription, recombination, DNA repair, and genome stability. These functions include the enhancement of binding of a number of transcription factors, including the tumor suppressor protein p53, to their specific DNA-binding sites. HMGB1 is composed of two highly conserved HMG boxes, linked to an intrinsically disordered acidic C-terminal tail. Previous reports have suggested that the ability of HMGB1 to bend DNA may explain the in vitro HMGB1-mediated increase in sequence-specific DNA binding by p53. The aim of this study was to reinvestigate the importance of HMGB1-induced DNA bending in relationship to the ability of the protein to promote the specific binding of p53 to short DNA duplexes in vitro, and to transactivate two major p53-regulated human genes: Mdm2 and p21/WAF1. Using a number of HMGB1 mutants, we report that the HMGB1-mediated increase in sequence-specific p53 binding to DNA duplexes in vitro depends very little on HMGB1-mediated DNA bending. The presence of the acidic C-terminal tail of HMGB1 and/or the oxidation of the protein can reduce the HMGB1-mediated p53 binding. Interestingly, the induction of transactivation of p53-responsive gene promoters by HMGB1 requires both the ability of the protein to bend DNA and the acidic C-terminal tail, and is promoter-specific. We propose that the efficient transactivation of p53-responsive gene promoters by HMGB1 depends on complex events, rather than solely on the promotion of p53 binding to its DNA cognate sites. Copyright © 2018 Elsevier B.V. All rights reserved.

  12. Electric Field Mediated Ion Transport Through Charged Mesoporous Membranes

    NARCIS (Netherlands)

    Schmuhl, R.; de Lint, W.B.S.; Keizer, Klaas; van den Berg, Albert; ten Elshof, Johan E.; Burganos, Vasilis N.; Noble, Richard D.; Asaeda, Masashi; Ayral, Andre; LeRoux, Johann D.

    2003-01-01

    The transport of ions from aqueous solutions through a stacked Au/alpha-alumina/gamma-alumina/Au membrane under the influence of a dc potential difference is reported. The membrane shows high cation permselectivity at ionic strengths of ~1 mM at pH 4.3-6.5, which is associated with a combination of

  13. DNA Damage by Ionizing Radiation: Tandem Double Lesions by Charged Particles

    Science.gov (United States)

    Huo, Winifred M.; Chaban, Galina M.; Wang, Dunyou; Dateo, Christopher E.

    2005-01-01

    Oxidative damages by ionizing radiation are the source of radiation-induced carcinogenesis, damage to the central nervous system, lowering of the immune response, as well as other radiation-induced damages to human health. Monte Carlo track simulations and kinetic modeling of radiation damages to the DNA employ available molecular and cellular data to simulate the biological effect of high and low LET radiation io the DNA. While the simulations predict single and double strand breaks and base damages, so far all complex lesions are the result of stochastic coincidence from independent processes. Tandem double lesions have not yet been taken into account. Unlike the standard double lesions that are produced by two separate attacks by charged particles or radicals, tandem double lesions are produced by one single attack. The standard double lesions dominate at the high dosage regime. On the other hand, tandem double lesions do not depend on stochastic coincidences and become important at the low dosage regime of particular interest to NASA. Tandem double lesions by hydroxyl radical attack of guanine in isolated DNA have been reported at a dosage of radiation as low as 10 Gy. The formation of two tandem base lesions was found to be linear with the applied doses, a characteristic of tandem lesions. However, tandem double lesions from attack by a charged particle have not been reported.

  14. Effect of surface charge of immortalized mouse cerebral endothelial cell monolayer on transport of charged solutes.

    Science.gov (United States)

    Yuan, Wei; Li, Guanglei; Gil, Eun Seok; Lowe, Tao Lu; Fu, Bingmei M

    2010-04-01

    Charge carried by the surface glycocalyx layer (SGL) of the cerebral endothelium has been shown to significantly modulate the permeability of the blood-brain barrier (BBB) to charged solutes in vivo. The cultured monolayer of bEnd3, an immortalized mouse cerebral endothelial cell line, is becoming a popular in vitro BBB model due to its easy growth and maintenance of many BBB characteristics over repeated passages. To test whether the SGL of bEnd3 monolayer carries similar charge as that in the intact BBB and quantify this charge, which can be characterized by the SGL thickness (L(f)) and charge density (C(mf)), we measured the solute permeability of bEnd3 monolayer to neutral solutes and to solutes with similar size but opposite charges: negatively charged alpha-lactalbumin (-11) and positively charged ribonuclease (+3). Combining the measured permeability data with a transport model across the cell monolayer, we predicted the L(f) and the C(mf) of bEnd3 monolayer, which is approximately 160 nm and approximately 25 mEq/L, respectively. We also investigated whether orosomucoid, a plasma glycoprotein modulating the charge of the intact BBB, alters the charge of bEnd3 monolayer. We found that 1 mg/mL orosomucoid would increase SGL charge density of bEnd3 monolayer to approximately 2-fold of its control value.

  15. The radioprotector O-phospho-tyrosine stimulates DNA-repair via epidermal growth factor receptor- and DNA-dependent kinase phosphorylation

    International Nuclear Information System (INIS)

    Dittmann, Klaus; Mayer, Claus; Wanner, Gabriele; Kehlbach, Rainer; Rodemann, H. Peter

    2007-01-01

    Background and purpose: Purpose of the study was to elucidate the underlying molecular mechanism of the radioprotector O-phospho-tyrosine (P-Tyr). Methods: Molecular effects of P-Tyr at the level of EGFR responses were investigated in vitro with bronchial carcinoma cell line A549. Nuclear EGFR transport and DNA-PK activation were quantified after Western blotting. Residual DNA-damages were quantified by help of γH 2 AX focus assay. Results: As determined by dose-response curves, treatment of cells with P-Tyr for 16 h before irradiation results in radioprotection. Simultaneous treatment with EGFR blocking antibody Cetuximab abolished P-Tyr associated radioprotection. At the molecular level P-Tyr mediated a general phosphorylation of EGFR and a pronounced phosphorylation of nuclear EGFR at residue Thr No. 654, also observed after treatment with ionizing radiation. This phosphorylation was associated with nuclear EGFR accumulation. Moreover, P-Tyr-triggered EGFR nuclear accumulation was associated with phosphorylation of DNA-PK at Thr 2609. This activated form of DNA-PK was not DNA associated, but after radiation, DNA binding increased, particularly after P-Tyr pre-treatment. These molecular effects of P-Tyr resulted in a reduction of residual DNA-damage after irradiation. Conclusions: Radioprotection by P-Tyr is mediated through its stimulation of nuclear EGFR transport and concurrent, but DNA-damage independent, activation of DNA-PK. Thus, subsequent irradiation results in increased binding of DNA-PK to DNA, improved DNA-repair and increased cell survival

  16. Effects of charged particles on DNA

    International Nuclear Information System (INIS)

    Eguchi-Kasai, Kiyomi; Itsukaichi, Hiromi; Murakami, Masahiro

    1995-01-01

    It can be noted that it is not simple double strand breaks (dsb) but the non-reparable breaks that are associated with high biological effectiveness in the cell killing effect for high LET radiation. Here, we have examined the effectiveness of fast neutrons and low (initial energy = 12 MeV/u) or high (135 MeV/u) energy charged particles on cell death in 19 mammalian cell lines including radiosensitive mutants. Some of the radiosensitive lines were deficient in DNA dsb repair such as LX830, M10, V3, and L5178Y-S cells and showed lower values of relative biological effectiveness (RBE) for fast neutrons if compared with their parent cell lines. The other lines of human ataxia-telangiectasia fibroblasts, irs 1, irs 2, irs 3 and irs 1SF cells, which were also radiosensitive but known as proficient in dsb repair, showed moderate RBEs. Dsb repair deficient mutants showed low RBE values for heavy ions. These experimental findings suggest that the DNA repair system does not play a major role against the attack of high linear energy transfer (LET) radiations. Therefore, we hypothesize that a main cause of cell death induced by high LET radiations is due to non-reparable dsb, which are produced at a higher rate compared to low LET radiations. (author)

  17. Extended HSR/CARD domain mediates AIRE binding to DNA

    Energy Technology Data Exchange (ETDEWEB)

    Maslovskaja, Julia, E-mail: julia.maslovskaja@ut.ee; Saare, Mario; Liiv, Ingrid; Rebane, Ana; Peterson, Pärt

    2015-12-25

    Autoimmune regulator (AIRE) activates the transcription of many genes in an unusual promiscuous and stochastic manner. The mechanism by which AIRE binds to the chromatin and DNA is not fully understood, and the regulatory elements that AIRE target genes possess are not delineated. In the current study, we demonstrate that AIRE activates the expression of transiently transfected luciferase reporters that lack defined promoter regions, as well as intron and poly(A) signal sequences. Our protein-DNA interaction experiments with mutated AIRE reveal that the intact homogeneously staining region/caspase recruitment domain (HSR/CARD) and amino acids R113 and K114 are key elements involved in AIRE binding to DNA. - Highlights: • Promoter and mRNA processing elements are not important for AIRE to activate gene expression from reporter plasmids. • AIRE protein fragment aa 1–138 mediates direct binding to DNA. • Integrity of the HSR/CARD domain is needed for AIRE binding to DNA.

  18. Extended HSR/CARD domain mediates AIRE binding to DNA

    International Nuclear Information System (INIS)

    Maslovskaja, Julia; Saare, Mario; Liiv, Ingrid; Rebane, Ana; Peterson, Pärt

    2015-01-01

    Autoimmune regulator (AIRE) activates the transcription of many genes in an unusual promiscuous and stochastic manner. The mechanism by which AIRE binds to the chromatin and DNA is not fully understood, and the regulatory elements that AIRE target genes possess are not delineated. In the current study, we demonstrate that AIRE activates the expression of transiently transfected luciferase reporters that lack defined promoter regions, as well as intron and poly(A) signal sequences. Our protein-DNA interaction experiments with mutated AIRE reveal that the intact homogeneously staining region/caspase recruitment domain (HSR/CARD) and amino acids R113 and K114 are key elements involved in AIRE binding to DNA. - Highlights: • Promoter and mRNA processing elements are not important for AIRE to activate gene expression from reporter plasmids. • AIRE protein fragment aa 1–138 mediates direct binding to DNA. • Integrity of the HSR/CARD domain is needed for AIRE binding to DNA.

  19. Charge transport in highly efficient iridium cored electrophosphorescent dendrimers

    Science.gov (United States)

    Markham, Jonathan P. J.; Samuel, Ifor D. W.; Lo, Shih-Chun; Burn, Paul L.; Weiter, Martin; Bässler, Heinz

    2004-01-01

    Electrophosphorescent dendrimers are promising materials for highly efficient light-emitting diodes. They consist of a phosphorescent core onto which dendritic groups are attached. Here, we present an investigation into the optical and electronic properties of highly efficient phosphorescent dendrimers. The effect of dendrimer structure on charge transport and optical properties is studied using temperature-dependent charge-generation-layer time-of-flight measurements and current voltage (I-V) analysis. A model is used to explain trends seen in the I-V characteristics. We demonstrate that fine tuning the mobility by chemical structure is possible in these dendrimers and show that this can lead to highly efficient bilayer dendrimer light-emitting diodes with neat emissive layers. Power efficiencies of 20 lm/W were measured for devices containing a second-generation (G2) Ir(ppy)3 dendrimer with a 1,3,5-tris(2-N-phenylbenzimidazolyl)benzene electron transport layer.

  20. Symposium GC: Nanoscale Charge Transport in Excitonic Solar Cells

    Energy Technology Data Exchange (ETDEWEB)

    Bommisetty, Venkat [Univ. of South Dakota, Vermillion, SD (United States)

    2011-06-23

    This paper provides a summary only and table of contents of the sessions. Excitonic solar cells, including all-organic, hybrid organic-inorganic and dye-sensitized solar cells (DSSCs), offer strong potential for inexpensive and large-area solar energy conversion. Unlike traditional inorganic semiconductor solar cells, where all the charge generation and collection processes are well understood, these excitonic solar cells contain extremely disordered structures with complex interfaces which results in large variations in nanoscale electronic properties and has a strong influence on carrier generation, transport, dissociation and collection. Detailed understanding of these processes is important for fabrication of highly efficient solar cells. Efforts to improve efficiency are underway at a large number of research groups throughout the world focused on inorganic and organic semiconductors, photonics, photophysics, charge transport, nanoscience, ultrafast spectroscopy, photonics, semiconductor processing, device physics, device structures, interface structure etc. Rapid progress in this multidisciplinary area requires strong synergetic efforts among researchers from diverse backgrounds. Such effort can lead to novel methods for development of new materials with improved photon harvesting and interfacial treatments for improved carrier transport, process optimization to yield ordered nanoscale morphologies with well defined electronic structures.

  1. Effects of Olive Metabolites on DNA Cleavage Mediated by Human Type II Topoisomerases

    Science.gov (United States)

    2016-01-01

    Several naturally occurring dietary polyphenols with chemopreventive or anticancer properties are topoisomerase II poisons. To identify additional phytochemicals that enhance topoisomerase II-mediated DNA cleavage, a library of 341 Mediterranean plant extracts was screened for activity against human topoisomerase IIα. An extract from Phillyrea latifolia L., a member of the olive tree family, displayed high activity against the human enzyme. On the basis of previous metabolomics studies, we identified several polyphenols (hydroxytyrosol, oleuropein, verbascoside, tyrosol, and caffeic acid) as potential candidates for topoisomerase II poisons. Of these, hydroxytyrosol, oleuropein, and verbascoside enhanced topoisomerase II-mediated DNA cleavage. The potency of these olive metabolites increased 10–100-fold in the presence of an oxidant. Hydroxytyrosol, oleuropein, and verbascoside displayed hallmark characteristics of covalent topoisomerase II poisons. (1) The activity of the metabolites was abrogated by a reducing agent. (2) Compounds inhibited topoisomerase II activity when they were incubated with the enzyme prior to the addition of DNA. (3) Compounds were unable to poison a topoisomerase IIα construct that lacked the N-terminal domain. Because hydroxytyrosol, oleuropein, and verbascoside are broadly distributed across the olive family, extracts from the leaves, bark, and fruit of 11 olive tree species were tested for activity against human topoisomerase IIα. Several of the extracts enhanced enzyme-mediated DNA cleavage. Finally, a commercial olive leaf supplement and extra virgin olive oils pressed from a variety of Olea europea subspecies enhanced DNA cleavage mediated by topoisomerase IIα. Thus, olive metabolites appear to act as topoisomerase II poisons in complex formulations intended for human dietary consumption. PMID:26132160

  2. The role of space charge compensation for ion beam extraction and ion beam transport (invited)

    International Nuclear Information System (INIS)

    Spädtke, Peter

    2014-01-01

    Depending on the specific type of ion source, the ion beam is extracted either from an electrode surface or from a plasma. There is always an interface between the (almost) space charge compensated ion source plasma, and the extraction region in which the full space charge is influencing the ion beam itself. After extraction, the ion beam is to be transported towards an accelerating structure in most cases. For lower intensities, this transport can be done without space charge compensation. However, if space charge is not negligible, the positive charge of the ion beam will attract electrons, which will compensate the space charge, at least partially. The final degree of Space Charge Compensation (SCC) will depend on different properties, like the ratio of generation rate of secondary particles and their loss rate, or the fact whether the ion beam is pulsed or continuous. In sections of the beam line, where the ion beam is drifting, a pure electrostatic plasma will develop, whereas in magnetic elements, these space charge compensating electrons become magnetized. The transport section will provide a series of different plasma conditions with different properties. Different measurement tools to investigate the degree of space charge compensation will be described, as well as computational methods for the simulation of ion beams with partial space charge compensation

  3. Influence of DNA-methylation on zinc homeostasis in myeloid cells: Regulation of zinc transporters and zinc binding proteins.

    Science.gov (United States)

    Kessels, Jana Elena; Wessels, Inga; Haase, Hajo; Rink, Lothar; Uciechowski, Peter

    2016-09-01

    The distribution of intracellular zinc, predominantly regulated through zinc transporters and zinc binding proteins, is required to support an efficient immune response. Epigenetic mechanisms such as DNA methylation are involved in the expression of these genes. In demethylation experiments using 5-Aza-2'-deoxycytidine (AZA) increased intracellular (after 24 and 48h) and total cellular zinc levels (after 48h) were observed in the myeloid cell line HL-60. To uncover the mechanisms that cause the disturbed zinc homeostasis after DNA demethylation, the expression of human zinc transporters and zinc binding proteins were investigated. Real time PCR analyses of 14 ZIP (solute-linked carrier (SLC) SLC39A; Zrt/IRT-like protein), and 9 ZnT (SLC30A) zinc transporters revealed significantly enhanced mRNA expression of the zinc importer ZIP1 after AZA treatment. Because ZIP1 protein was also enhanced after AZA treatment, ZIP1 up-regulation might be the mediator of enhanced intracellular zinc levels. The mRNA expression of ZIP14 was decreased, whereas zinc exporter ZnT3 mRNA was also significantly increased; which might be a cellular reaction to compensate elevated zinc levels. An enhanced but not significant chromatin accessibility of ZIP1 promoter region I was detected by chromatin accessibility by real-time PCR (CHART) assays after demethylation. Additionally, DNA demethylation resulted in increased mRNA accumulation of zinc binding proteins metallothionein (MT) and S100A8/S100A9 after 48h. MT mRNA was significantly enhanced after 24h of AZA treatment also suggesting a reaction of the cell to restore zinc homeostasis. These data indicate that DNA methylation is an important epigenetic mechanism affecting zinc binding proteins and transporters, and, therefore, regulating zinc homeostasis in myeloid cells. Copyright © 2016 Elsevier GmbH. All rights reserved.

  4. Charge transport properties of CdMnTe radiation detectors

    Directory of Open Access Journals (Sweden)

    Prokopovich D. A.

    2012-10-01

    Full Text Available Growth, fabrication and characterization of indium-doped cadmium manganese telluride (CdMnTe radiation detectors have been described. Alpha-particle spectroscopy measurements and time resolved current transient measurements have yielded an average charge collection efficiency approaching 100 %. Spatially resolved charge collection efficiency maps have been produced for a range of detector bias voltages. Inhomogeneities in the charge transport of the CdMnTe crystals have been associated with chains of tellurium inclusions within the detector bulk. Further, it has been shown that the role of tellurium inclusions in degrading charge collection is reduced with increasing values of bias voltage. The electron drift velocity was calculated from the rise time distribution of the preamplifier output pulses at each measured bias. From the dependence of drift velocity on applied electric field the electron mobility was found to be μn = (718 ± 55 cm2/Vs at room temperature.

  5. Disorder Effects in Charge Transport and Spin Response of Topological Insulators

    Science.gov (United States)

    Zhao, Lukas Zhonghua

    ), and describe our detection of paramagnetic singularity in the magnetic susceptibility at low magnetic fields that persists up to room temperature, and which we have demonstrated to arise from the surfaces of the samples. The singularity is universal to the entire family, largely independent of the bulk carrier density, and consistent with the existence of electronic states near the spin-degenerate Dirac point of the 2D helical metal. The exceptional thermal stability of the signal points to an intrinsic surface cooling process, probably of thermoelectric organ, and establishes a sustainable platform for the singular field-tunable Dirac spin response. In Chapter 4 we describe our discovery of surface superconductivity in a hole-conducting topological insulator Sb2Te3 with transition to zero resistance induced through a minor tuning of growth chemistry that depletes bulk conduction channels. The depletion shifts Fermi energy towards the Dirac point as witnessed by over two orders of magnitude reduced bulk hole density and by the largest carrier mobility (~ 25,000 cm 2 V-1 s-1) found in any topological material. Direct evidence from transport, the unprecedentedly large diamagnetic screening, and the presence of up to ~ 25 meV gaps in differential conductance detected by scanning tunneling spectroscopy (STM) reveal the superconducting condensate to emerge first in surface puddles at unexpectedly high temperature, near 50 K. Percolative Josephson paths mediated by diffusing quasiparticles establish global phase coherence around 9 K. Rich structure of this state lends itself to manipulation and tuning via growth conditions and the topological material's parameters such as Fermi velocity and mean free path. In Chapter 5 we describe a new approach we have developed to reaching stable charge neutrality in 3D topological materials. The technique uses swift (~ 2.5 MeV energy) electron beams to compensate charged bulk defects and bring the Fermi level back into the bulk gap. By

  6. Effects of pressure and electrical charge on macromolecular transport across bovine lens basement membrane.

    Science.gov (United States)

    Ferrell, Nicholas; Cameron, Kathleen O; Groszek, Joseph J; Hofmann, Christina L; Li, Lingyan; Smith, Ross A; Bian, Aihua; Shintani, Ayumi; Zydney, Andrew L; Fissell, William H

    2013-04-02

    Molecular transport through the basement membrane is important for a number of physiological functions, and dysregulation of basement membrane architecture can have serious pathological consequences. The structure-function relationships that govern molecular transport in basement membranes are not fully understood. The basement membrane from the lens capsule of the eye is a collagen IV-rich matrix that can easily be extracted and manipulated in vitro. As such, it provides a convenient model for studying the functional relationships that govern molecular transport in basement membranes. Here we investigate the effects of increased transmembrane pressure and solute electrical charge on the transport properties of the lens basement membrane (LBM) from the bovine eye. Pressure-permeability relationships in LBM transport were governed primarily by changes in diffusive and convective contributions to solute flux and not by pressure-dependent changes in intrinsic membrane properties. The solute electrical charge had a minimal but statistically significant effect on solute transport through the LBM that was opposite of the expected electrokinetic behavior. The observed transport characteristics of the LBM are discussed in the context of established membrane transport modeling and previous work on the effects of pressure and electrical charge in other basement membrane systems. Copyright © 2013 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  7. Charge transport in nanoscale vertical organic semiconductor pillar devices

    NARCIS (Netherlands)

    Wilbers, J.G.E.; Xu, B.; Bobbert, P.A.; de Jong, M.P.; van der Wiel, W.G.

    2017-01-01

    We report charge transport measurements in nanoscale vertical pillar structures incorporating ultrathin layers of the organic semiconductor poly(3-hexylthiophene) (P3HT). P3HT layers with thickness down to 5 nm are gently top-contacted using wedging transfer, yielding highly reproducible, robust

  8. Gold-nanoparticle-mediated jigsaw-puzzle-like assembly of supersized plasmonic DNA origami.

    Science.gov (United States)

    Yao, Guangbao; Li, Jiang; Chao, Jie; Pei, Hao; Liu, Huajie; Zhao, Yun; Shi, Jiye; Huang, Qing; Wang, Lianhui; Huang, Wei; Fan, Chunhai

    2015-03-02

    DNA origami has rapidly emerged as a powerful and programmable method to construct functional nanostructures. However, the size limitation of approximately 100 nm in classic DNA origami hampers its plasmonic applications. Herein, we report a jigsaw-puzzle-like assembly strategy mediated by gold nanoparticles (AuNPs) to break the size limitation of DNA origami. We demonstrated that oligonucleotide-functionalized AuNPs function as universal joint units for the one-pot assembly of parent DNA origami of triangular shape to form sub-microscale super-origami nanostructures. AuNPs anchored at predefined positions of the super-origami exhibited strong interparticle plasmonic coupling. This AuNP-mediated strategy offers new opportunities to drive macroscopic self-assembly and to fabricate well-defined nanophotonic materials and devices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Immune- and Pollution-mediated DNA Damage in Two Wild Mya arenaria Clam Populations

    Directory of Open Access Journals (Sweden)

    François Gagné

    2009-01-01

    Full Text Available In aquatic environments, genotoxicity results from the effects of pollution combined with the inflammatory response triggered by the immune system. Indeed, the production of nitrosylated DNA and proteins are though to arise from the production of peroxinitrite during phagocytosis and inflammation. The purpose of this study was to examine new DNA biomarkers that differentiate between immune- and pollution-mediated genotoxicity in wild clam populations. Intertidal clam populations were sampled and analyzed for gonadal DNA strand breaks, DNA nitrosylation and xanthine oxidoreductase (XOR activity (purine salvage pathway. The clam weight-to-shell-length ratio, the gonado-somatic index (GSI, age status, lipid peroxidation, xenobiotic conjugation activity (glutathione S-transferase (GST and phagocytic activity were examined to shed light on their relationships with the observed genotoxic endpoints. XOR activity and DNA strand breaks were generally elevated at polluted sites and correlated significantly with clam weight-to-shell-length ratios and DNA nitrosylation. DNA nitrosylation was also higher at some sites and correlated significantly with phagocytic activity and with DNA strand breaks. This study showed that DNA strand breaks were associated with both immune- and pollution-mediated effects. This suggests that there is a loss of DNA repair capacity due to the combined effects of aging, pollution and immune response in wild clam populations that are impacted by anthropogenic activity.

  10. Transport and matching of low energy space charge dominated beams

    International Nuclear Information System (INIS)

    Pandit, V.S.

    2013-01-01

    The transport and matching of low energy high intensity beams from the ion source to the subsequent accelerating structure are of considerable interest in recent years for variety of applications such as Accelerator driven system (ADSS), transmutation of nuclear waste, spallation neutron sources etc. It is essential to perform detailed simulations with experimentation to predict the beam evolution in the presence of nonlinear self as well as external fields before the design of the next accelerating structure is finalized. In order to study and settle various physics and technical issues related with transport of space charge dominated beams we have developed a 2.45 GHz microwave ion source at VECC which is now delivering more than 10 mA proton beam current at 80 keV. We have successfully transported well collimated 8 mA proton beam through the solenoid based 3 meter long transport line and studied various beam properties. We have also studied the transport of beam through spiral inflector at low beam current ∼ 1mA. In this article we will discuss the beam transport issues and describe a technique for simulation of beam envelopes in presence of linear space charge effects. We use canonical description of the motion of a single particle and then obtain first order differential equations for evolution of the moments of beam ensemble by assuming uniform distribution of the beam. We will also discuss the methodology used in the simulations to understand the observed beam behaviour during transport. (author)

  11. Charge transport in organic light-emitting diodes. Experiments and simulations

    Energy Technology Data Exchange (ETDEWEB)

    Schober, Matthias

    2012-11-01

    This thesis is about the development and validation of a numerical model for the simulation of the current-voltage characteristics of organic thin-film devices. The focus is on the analysis of a white organic light-emitting diode (OLED) with fluorescent blue and phosphorescent red and green emitters. The simulation model describes the charge transport as a one-dimensional drift-diffusion current and is developed on the basis of the Scharfetter-Gummel method. It incorporates modern theories for the charge transport in disordered organic materials, which are considered by means of special functions for the diffusion coefficient and the charge-carrier mobility. The algorithm is designed such that it can switch between different models for mobility and calculates both transient and steady-state solutions. In the analysis of the OLED, electron and hole transport are investigated separately in series of single-carrier devices. These test devices incorporate parts of the layers in the OLED between symmetrically arranged injection layers that are electrically doped. Thereby, the OLED layer sequence is reconstructed step by step. The analysis of the test devices allows to obtain the numerous parameters which are required for the simulation of the complete OLED and reveals many interesting features of the OLED. For instance, it is shown how the accumulation of charge carriers in front of an interface barrier increases the mobility and the transfer rate across the interface. Furthermore, it is demonstrated how to identify charge-trapping states. This leads to the detection of deep trap states in the emission zone of the OLED -- an interesting aspect, since these states can function as recombination centers and may cause non-radiative losses. Moreover, various other effects such as interface dipoles and a slight freeze-out of active electric dopants in the injection layers are observed. In the simulations of the numerous test devices, the parameters are consistently applied

  12. Solitary Model of the Charge Particle Transport in Collisionless Plasma

    International Nuclear Information System (INIS)

    Simonchik, L.V.; Trukhachev, F.M.

    2006-01-01

    The one-dimensional MHD solitary model of charged particle transport in plasma is developed. It is shown that self-consistent electric field of ion-acoustic solitons can displace charged particles in space, which can be a reason of local electric current generation. The displacement amount is order of a few Debye lengths. It is shown that the current associated with soliton cascade has pulsating nature with DC component. Methods of built theory verification in dusty plasma are proposed

  13. Selenium-Mediated Dehalogenation of Halogenated Nucleosides and its Relevance to the DNA Repair Pathway.

    Science.gov (United States)

    Mondal, Santanu; Manna, Debasish; Mugesh, Govindasamy

    2015-08-03

    Halogenated nucleosides can be incorporated into the newly synthesized DNA of replicating cells and therefore are commonly used in the detection of proliferating cells in living tissues. Dehalogenation of these modified nucleosides is one of the key pathways involved in DNA repair mediated by the uracil-DNA glycosylase. Herein, we report the first example of a selenium-mediated dehalogenation of halogenated nucleosides. We also show that the mechanism for the debromination is remarkably different from that of deiodination and that the presence of a ribose or deoxyribose moiety in the nucleosides facilitates the deiodination. The results described herein should help in understanding the metabolism of halogenated nucleosides in DNA and RNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Regulation of DNA Methylation Patterns by CK2-Mediated Phosphorylation of Dnmt3a

    Directory of Open Access Journals (Sweden)

    Rachel Deplus

    2014-08-01

    Full Text Available DNA methylation is a central epigenetic modification that is established by de novo DNA methyltransferases. The mechanisms underlying the generation of genomic methylation patterns are still poorly understood. Using mass spectrometry and a phosphospecific Dnmt3a antibody, we demonstrate that CK2 phosphorylates endogenous Dnmt3a at two key residues located near its PWWP domain, thereby downregulating the ability of Dnmt3a to methylate DNA. Genome-wide DNA methylation analysis shows that CK2 primarily modulates CpG methylation of several repeats, most notably of Alu SINEs. This modulation can be directly attributed to CK2-mediated phosphorylation of Dnmt3a. We also find that CK2-mediated phosphorylation is required for localization of Dnmt3a to heterochromatin. By revealing phosphorylation as a mode of regulation of de novo DNA methyltransferase function and by uncovering a mechanism for the regulation of methylation at repetitive elements, our results shed light on the origin of DNA methylation patterns.

  15. Surface charge-specific interactions between polymer nanoparticles and ABC transporters in Caco-2 cells

    Energy Technology Data Exchange (ETDEWEB)

    Bhattacharjee, Sourav, E-mail: sourav.bhattacharjee@wur.nl [Wageningen University, Laboratory of Organic Chemistry (Netherlands); Opstal, Edward J. van; Alink, Gerrit M. [Wageningen University, Division of Toxicology (Netherlands); Marcelis, Antonius T. M.; Zuilhof, Han [Wageningen University, Laboratory of Organic Chemistry (Netherlands); Rietjens, Ivonne M. C. M. [Wageningen University, Division of Toxicology (Netherlands)

    2013-06-15

    The surface charge-dependent transport of polymeric nanoparticles (PNPs) across Caco-2 monolayers grown on transwell culture systems as an in vitro model for intestinal transport was tested. The transport of well-characterized, monodisperse, and fluorescent tri-block copolymer nanoparticles (TCNPs/size {approx}45 nm) and polystyrene nanoparticles (PSNPs/size {approx}50 nm), with different surface charges (positive and negative), was quantified. The positive PNPs showed a higher intracellular uptake and flux across the Caco-2 monolayers than the negative PNPs. Multidrug resistance/P-glycoprotein (MDR1/P-gp), a specific ATP-binding cassette (ABC) transporter, was found to play a major role in the cellular efflux of positive PNPs, whereas the multidrug resistance protein 1 took part in the efflux of negative PNPs from Caco-2 cells. The positive PNPs also caused an increased cellular uptake and apical to basolateral transport of the carcinogen PhIP across the Caco-2 monolayer. The flavonoid quercetin, which is known to interact with ABC transporters, promoted the intracellular uptake of different PNPs and interfered with the normal distribution patterns of PNPs in the transwell system. These results indicate that PNPs display surface charge-specific interactions with ABC transporters and can even affect the bioavailability of toxic food-borne compounds (like pro-carcinogens).

  16. Surface charge-specific interactions between polymer nanoparticles and ABC transporters in Caco-2 cells

    Science.gov (United States)

    Bhattacharjee, Sourav; van Opstal, Edward J.; Alink, Gerrit M.; Marcelis, Antonius T. M.; Zuilhof, Han; Rietjens, Ivonne M. C. M.

    2013-06-01

    The surface charge-dependent transport of polymeric nanoparticles (PNPs) across Caco-2 monolayers grown on transwell culture systems as an in vitro model for intestinal transport was tested. The transport of well-characterized, monodisperse, and fluorescent tri-block copolymer nanoparticles (TCNPs/size 45 nm) and polystyrene nanoparticles (PSNPs/size 50 nm), with different surface charges (positive and negative), was quantified. The positive PNPs showed a higher intracellular uptake and flux across the Caco-2 monolayers than the negative PNPs. Multidrug resistance/P-glycoprotein (MDR1/P-gp), a specific ATP-binding cassette (ABC) transporter, was found to play a major role in the cellular efflux of positive PNPs, whereas the multidrug resistance protein 1 took part in the efflux of negative PNPs from Caco-2 cells. The positive PNPs also caused an increased cellular uptake and apical to basolateral transport of the carcinogen PhIP across the Caco-2 monolayer. The flavonoid quercetin, which is known to interact with ABC transporters, promoted the intracellular uptake of different PNPs and interfered with the normal distribution patterns of PNPs in the transwell system. These results indicate that PNPs display surface charge-specific interactions with ABC transporters and can even affect the bioavailability of toxic food-borne compounds (like pro-carcinogens).

  17. Surface charge-specific interactions between polymer nanoparticles and ABC transporters in Caco-2 cells

    International Nuclear Information System (INIS)

    Bhattacharjee, Sourav; Opstal, Edward J. van; Alink, Gerrit M.; Marcelis, Antonius T. M.; Zuilhof, Han; Rietjens, Ivonne M. C. M.

    2013-01-01

    The surface charge-dependent transport of polymeric nanoparticles (PNPs) across Caco-2 monolayers grown on transwell culture systems as an in vitro model for intestinal transport was tested. The transport of well-characterized, monodisperse, and fluorescent tri-block copolymer nanoparticles (TCNPs/size ∼45 nm) and polystyrene nanoparticles (PSNPs/size ∼50 nm), with different surface charges (positive and negative), was quantified. The positive PNPs showed a higher intracellular uptake and flux across the Caco-2 monolayers than the negative PNPs. Multidrug resistance/P-glycoprotein (MDR1/P-gp), a specific ATP-binding cassette (ABC) transporter, was found to play a major role in the cellular efflux of positive PNPs, whereas the multidrug resistance protein 1 took part in the efflux of negative PNPs from Caco-2 cells. The positive PNPs also caused an increased cellular uptake and apical to basolateral transport of the carcinogen PhIP across the Caco-2 monolayer. The flavonoid quercetin, which is known to interact with ABC transporters, promoted the intracellular uptake of different PNPs and interfered with the normal distribution patterns of PNPs in the transwell system. These results indicate that PNPs display surface charge-specific interactions with ABC transporters and can even affect the bioavailability of toxic food-borne compounds (like pro-carcinogens).

  18. Engineering charge transport by heterostructuring solution-processed semiconductors

    Science.gov (United States)

    Voznyy, Oleksandr; Sutherland, Brandon R.; Ip, Alexander H.; Zhitomirsky, David; Sargent, Edward H.

    2017-06-01

    Solution-processed semiconductor devices are increasingly exploiting heterostructuring — an approach in which two or more materials with different energy landscapes are integrated into a composite system. Heterostructured materials offer an additional degree of freedom to control charge transport and recombination for more efficient optoelectronic devices. By exploiting energetic asymmetry, rationally engineered heterostructured materials can overcome weaknesses, augment strengths and introduce emergent physical phenomena that are otherwise inaccessible to single-material systems. These systems see benefit and application in two distinct branches of charge-carrier manipulation. First, they influence the balance between excitons and free charges to enhance electron extraction in solar cells and photodetectors. Second, they promote radiative recombination by spatially confining electrons and holes, which increases the quantum efficiency of light-emitting diodes. In this Review, we discuss advances in the design and composition of heterostructured materials, consider their implementation in semiconductor devices and examine unexplored paths for future advancement in the field.

  19. The thermoballistic transport model a novel approach to charge carrier transport in semiconductors

    CERN Document Server

    Lipperheide, Reinhard

    2014-01-01

    The book presents a comprehensive survey of the thermoballistic approach to charge carrier transport in semiconductors. This semi-classical approach, which the authors have developed over the past decade, bridges the gap between the opposing drift-diffusion and ballistic  models of carrier transport. While incorporating basic features of the latter two models, the physical concept underlying the thermoballistic approach constitutes a novel, unifying scheme. It is based on the introduction of "ballistic configurations" arising from a random partitioning of the length of a semiconducting sample into ballistic transport intervals. Stochastic averaging of the ballistic carrier currents over the ballistic configurations results in a position-dependent thermoballistic current, which is the key element of the thermoballistic concept and forms  the point of departure for the calculation of all relevant transport properties. In the book, the thermoballistic concept and its implementation are developed in great detai...

  20. Charge transport properties of CdMnTe radiation detectors

    Energy Technology Data Exchange (ETDEWEB)

    Kim K.; Rafiel, R.; Boardman, M.; Reinhard, I.; Sarbutt, A.; Watt, G.; Watt, C.; Uxa, S.; Prokopovich, D.A.; Belas, E.; Bolotnikov, A.E.; James, R.B.

    2012-04-11

    Growth, fabrication and characterization of indium-doped cadmium manganese telluride (CdMnTe)radiation detectors have been described. Alpha-particle spectroscopy measurements and time resolved current transient measurements have yielded an average charge collection efficiency approaching 100 %. Spatially resolved charge collection efficiency maps have been produced for a range of detector bias voltages. Inhomogeneities in the charge transport of the CdMnTe crystals have been associated with chains of tellurium inclusions within the detector bulk. Further, it has been shown that the role of tellurium inclusions in degrading chargecollection is reduced with increasing values of bias voltage. The electron transit time was determined from time of flight measurements. From the dependence of drift velocity on applied electric field the electron mobility was found to be n = (718 55) cm2/Vs at room temperature.

  1. Loop-mediated isothermal amplification (LAMP) shield for Arduino DNA detection.

    Science.gov (United States)

    Velders, Aldrik H; Schoen, Cor; Saggiomo, Vittorio

    2018-02-01

    Loop-mediated isothermal amplification (LAMP) of DNA is gaining relevance as a method to detect nucleic acids, as it is easier, faster, and more powerful than conventional Polymerase Chain Reaction. However, LAMP is still mostly used in laboratory settings, because of the lack of a cheap and easy, one-button device that can perform LAMP experiments. Here we show how to build and program an Arduino shield for a LAMP and detection of DNA. The here described Arduino Shield is cheap, easy to assemble, to program and use, it is battery operated and the detection of DNA is done by naked-eye so that it can be used in field.

  2. Ionizing and ultraviolet radiation enhances the efficiency of DNA mediated gene transfer in vitro

    International Nuclear Information System (INIS)

    Perez, C.F.

    1984-08-01

    The enhancement effects of ionizing and non-ionizing radiation on the efficiency of DNA mediated gene transfer were studied. Confluent Rat-2 cells were transfected with purified SV40 viral DNA, irradiated with either X-rays or ultraviolet, trypsinized, plated, and assayed for the formation of foci on Rat-2 monolayers. Both ionizing and ultraviolet radiation enhanced the frequency of A-gene transformants/survivor compared to unirradiated transfected cells. These enhancements were non-linear and dose dependent. A recombinant plasmid, pOT-TK5, was constructed that contained the SV40 virus A-gene and the Herpes Simplex virus (HSV) thymidine kinase (TK) gene. Confluent Rat-2 cells transfected with pOT-TK5 DNA and then immediately irradiated with either X-rays or 330 MeV/amu argon particles at the Berkeley Bevalac showed a higher frequency of HAT + colonies/survivor than unirradiated transfected cells. Rat-2 cells transfected with the plasmid, pTK2, containing only the HSV TK-gene were enhanced for TK-transformation by both X-rays and ultraviolet radiation. The results demonstrate that radiation enhancement of the efficiency of DNA mediated gene transfer is not explained by increased nuclear uptake of the transfected DNA. Radiation increases the competence of the transfected cell population for genetic transformation. Three models for this increased competence are presented. The targeted integration model, the inducible recombination model, the partition model, and the utilization of DNA mediated gene transfer for DNA repair studies are discussed. 465 references

  3. Ionizing and ultraviolet radiation enhances the efficiency of DNA mediated gene transfer in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Perez, C.F.

    1984-08-01

    The enhancement effects of ionizing and non-ionizing radiation on the efficiency of DNA mediated gene transfer were studied. Confluent Rat-2 cells were transfected with purified SV40 viral DNA, irradiated with either X-rays or ultraviolet, trypsinized, plated, and assayed for the formation of foci on Rat-2 monolayers. Both ionizing and ultraviolet radiation enhanced the frequency of A-gene transformants/survivor compared to unirradiated transfected cells. These enhancements were non-linear and dose dependent. A recombinant plasmid, pOT-TK5, was constructed that contained the SV40 virus A-gene and the Herpes Simplex virus (HSV) thymidine kinase (TK) gene. Confluent Rat-2 cells transfected with pOT-TK5 DNA and then immediately irradiated with either X-rays or 330 MeV/amu argon particles at the Berkeley Bevalac showed a higher frequency of HAT/sup +/ colonies/survivor than unirradiated transfected cells. Rat-2 cells transfected with the plasmid, pTK2, containing only the HSV TK-gene were enhanced for TK-transformation by both X-rays and ultraviolet radiation. The results demonstrate that radiation enhancement of the efficiency of DNA mediated gene transfer is not explained by increased nuclear uptake of the transfected DNA. Radiation increases the competence of the transfected cell population for genetic transformation. Three models for this increased competence are presented. The targeted integration model, the inducible recombination model, the partition model, and the utilization of DNA mediated gene transfer for DNA repair studies are discussed. 465 references.

  4. Charge Carrier Transport and Photogeneration in P3HT:PCBM Photovoltaic Blends

    KAUST Repository

    Laquai, Frederic

    2015-05-03

    This article reviews the charge transport and photogeneration in bulk-heterojunction solar cells made from blend films of regioregular poly(3-hexylthiophene) (RR-P3HT) and methano­fullerene (PCBM). The charge transport, specifically the hole mobility in the RR-P3HT phase of the polymer:fullerene photovoltaic blend, is dramatically affected by thermal annealing. The hole mobility increases more than three orders of magnitude and reaches a value of up to 2 × 10−4 cm2 V−1 s−1 after the thermal annealing process as a result of an improved semi-crystallinity of the film. This significant increase of the hole mobility balances the electron and hole mobilities in a photovoltaic blend in turn reducing space-charge formation, and this is the most important factor for the strong enhancement of the photovoltaic efficiency compared to an as cast, that is, non-annealed device. In fact, the balanced charge carrier mobility in RR-P3HT:PCBM blends in combination with a field- and temperature-independent charge carrier generation and greatly reduced non-geminate recombination explains the large quantum efficiencies mea­sured in P3HT:PCBM photovoltaic devices.

  5. Chemical disorder and charge transport in ferromagnetic manganites

    International Nuclear Information System (INIS)

    Pickett, W.E.; Singh, D.J.

    1997-01-01

    Disorder broadening due to randomly distributed La 3+ and A 2+ (A=Ca,Sr,Ba) cations is combined with a virtual-crystal treatment of the average system to evaluate the effects on both majority and minority transport in the ferromagnetic La 2/3 A 1/3 MnO 3 system. The low-density minority carriers which lie in the band tail are localized by disorder, while the majority carriers retain long mean free paths reflected in the observed strongly metallic conductivity. In addition to obtaining transport parameters, we provide evidence that local distortions are due to nearby ionic charges rather than to ion size considerations. copyright 1997 The American Physical Society

  6. Pyrovanadolysis, a Pyrophosphorolysis-like Reaction Mediated by Pyrovanadate, Mn2+, and DNA Polymerase of Bacteriophage T7

    NARCIS (Netherlands)

    Akabayov, Barak; Kulczyk, Arkadiusz W.; Akabayov, Sabine R.; Theile, Christopher; McLaughlin, Larry W.; Beauchamp, Benjamin; van Oijen, Antoine M.; Richardson, Charles C.

    2011-01-01

    DNA polymerases catalyze the 3'-5'-pyrophosphorolysis of a DNA primer annealed to a DNA template in the presence of pyrophosphate (PPi). In this reversal of the polymerization reaction, deoxynucleotides in DNA are converted to deoxynucleoside 5'-triphosphates. Based on the charge, size, and geometry

  7. The regiochemical distribution of positive charges along cholesterol polyamine carbamates plays significant roles in modulating DNA binding affinity and lipofection.

    Science.gov (United States)

    Geall, A J; Eaton, M A; Baker, T; Catterall, C; Blagbrough, I S

    1999-10-15

    We have quantified the effects of the regiochemical distribution of positive charges along the polyamine moiety in lipopolyamines for DNA molecular recognition. High affinity binding leads to charge neutralisation, DNA condensation and ultimately to lipofection. Binding affinities for calf thymus DNA were determined using an ethidium bromide displacement assay and condensation was detected by changes in turbidity using light scattering. The in vitro transfection competence of cholesterol polyamine carbamates was measured in CHO cells. In the design of DNA condensing and transfecting agents for non-viral gene therapy, the interrelationship of ammonium ions, not just their number, must be considered.

  8. Carbon materials for enhancing charge transport in the advancements of perovskite solar cells

    Science.gov (United States)

    Hu, Ruiyuan; Chu, Liang; Zhang, Jian; Li, Xing'ao; Huang, Wei

    2017-09-01

    Organic-inorganic halide perovskite solar cells (PSCs) have become a new favorite in the photovoltaic field, due to the boosted efficiency up to 22.1%. Despite a flow of achievements, there are certain challenges to simultaneously meet high efficiency, large scale, low cost and high stability. Due to the low cost, extensive sources, high electrical conductivity and chemical stability, carbon materials have made undeniable contributions to play positive roles in developing PSCs. Carbon materials not only have the favorable conductivity but also bipolar advantage, which can transfer both electrons and holes. In this review, we will discuss how the carbon materials transfer charge or accelerate charge transport by incorporation in PSCs. Carbon materials can replace transparent conductive oxide layers, and enhance electron transport in electron transport layers. Moreover, carbon materials with continuous structure, especially carbon nanotubes and graphene, can provide direct charge transport channel that make them suitable additives or even substitutes in hole transport layers. Especially, the successful application of carbon materials as counter electrodes makes the devices full-printable, low temperature and high stability. Finally, a brief outlook is provided on the future development of carbon materials for PSCs, which are expected to devote more contributions in the future photovoltaic market.

  9. Effect of electric charge on the transperitoneal transport of plasma proteins during CAPD

    NARCIS (Netherlands)

    Buis, B.; Koomen, G. C.; Imholz, A. L.; Struijk, D. G.; Reddingius, R. E.; Arisz, L.; Krediet, R. T.

    1996-01-01

    BACKGROUND: Controversy exists as to whether electric charges of plasma proteins influence their transport across the peritoneal membrane during CAPD. Fixed negative charges in the peritoneal membrane are diminished during peritonitis in rats. METHODS: Peritoneal clearances of 10 proteins and their

  10. Disruption of mitochondrial DNA replication in Drosophila increases mitochondrial fast axonal transport in vivo.

    Directory of Open Access Journals (Sweden)

    Rehan M Baqri

    Full Text Available Mutations in mitochondrial DNA polymerase (pol gamma cause several progressive human diseases including Parkinson's disease, Alper's syndrome, and progressive external ophthalmoplegia. At the cellular level, disruption of pol gamma leads to depletion of mtDNA, disrupts the mitochondrial respiratory chain, and increases susceptibility to oxidative stress. Although recent studies have intensified focus on the role of mtDNA in neuronal diseases, the changes that take place in mitochondrial biogenesis and mitochondrial axonal transport when mtDNA replication is disrupted are unknown. Using high-speed confocal microscopy, electron microscopy and biochemical approaches, we report that mutations in pol gamma deplete mtDNA levels and lead to an increase in mitochondrial density in Drosophila proximal nerves and muscles, without a noticeable increase in mitochondrial fragmentation. Furthermore, there is a rise in flux of bidirectional mitochondrial axonal transport, albeit with slower kinesin-based anterograde transport. In contrast, flux of synaptic vesicle precursors was modestly decreased in pol gamma-alpha mutants. Our data indicate that disruption of mtDNA replication does not hinder mitochondrial biogenesis, increases mitochondrial axonal transport, and raises the question of whether high levels of circulating mtDNA-deficient mitochondria are beneficial or deleterious in mtDNA diseases.

  11. Repair of DNA double-strand breaks and cell killing by charged particles

    Science.gov (United States)

    Eguchi-Kasai, K.; Murakami, M.; Itsukaichi, H.; Fukutsu, K.; Yatagai, F.; Kanai, T.; Ohara, H.; Sato, K.

    It has been suggested that it is not simple double-strand breaks (dsb) but the non-reparable breaks which correlate well with the high biological effectiveness of high LET radiations for cell killing. We have compared the effects of charged particles on cell death in 3 pairs of cell lines which are normal or defective in the repair of DNA dsbs. For the cell lines SL3-147, M10, and SX10 which are deficient in DNA dsb repair, RBE values were close to unity for cell killing induced by charged particles with linear energy transfer (LET) up to 200 keV/mum and were even smaller than unity for the LET region greater than 300 keV/mum. The inactivation cross section (ICS) increased with LET for all 3 pairs. The ICS of dsb repair deficient mutants was always larger than that of their parents for all the LET ranges, but with increasing LET the difference in ICS between the mutant and its parent became smaller. Since a small difference in ICS remained at LET of about 300 keV/mum, dsb repair may still take place at this high LET, even if its role is apparently small. These results suggest that the DNA repair system does not play a major role in protection against the attack of high LET radiations and that a main cause of cell death is non-reparable dsb which are produced at a higher yield compared with low LET radiations. No correlation was observed between DNA content or nuclear area and ICS.

  12. Terahertz transport dynamics of graphene charge carriers

    DEFF Research Database (Denmark)

    Buron, Jonas Christian Due

    The electronic transport dynamics of graphene charge carriers at femtosecond (10-15 s) to picosecond (10-12 s) time scales are investigated using terahertz (1012 Hz) time-domain spectroscopy (THz-TDS). The technique uses sub-picosecond pulses of electromagnetic radiation to gauge the electrodynamic...... response of thin conducting films at up to multi-terahertz frequencies. In this thesis THz-TDS is applied towards two main goals; (1) investigation of the fundamental carrier transport dynamics in graphene at femtosecond to picosecond timescales and (2) application of terahertz time-domain spectroscopy...... to rapid and non-contact electrical characterization of large-area graphene, relevant for industrial integration. We show that THz-TDS is an accurate and reliable probe of graphene sheet conductance, and that the technique provides insight into fundamental aspects of the nanoscopic nature of conduction...

  13. Mediation analysis of alcohol consumption, DNA methylation, and epithelial ovarian cancer.

    Science.gov (United States)

    Wu, Dongyan; Yang, Haitao; Winham, Stacey J; Natanzon, Yanina; Koestler, Devin C; Luo, Tiane; Fridley, Brooke L; Goode, Ellen L; Zhang, Yanbo; Cui, Yuehua

    2018-03-01

    Epigenetic factors and consumption of alcohol, which suppresses DNA methylation, may influence the development and progression of epithelial ovarian cancer (EOC). However, there is a lack of understanding whether these factors interact to affect the EOC risk. In this study, we aimed to gain insight into this relationship by identifying leukocyte-derived DNA methylation markers acting as potential mediators of alcohol-associated EOC. We implemented a causal inference test (CIT) and the VanderWeele and Vansteelandt multiple mediator model to examine CpG sites that mediate the association between alcohol consumption and EOC risk. We modified one step of the CIT by adopting a high-dimensional inference procedure. The data were based on 196 cases and 202 age-matched controls from the Mayo Clinic Ovarian Cancer Case-Control Study. Implementation of the CIT test revealed two CpG sites (cg09358725, cg11016563), which represent potential mediators of the relationship between alcohol consumption and EOC case-control status. Implementation of the VanderWeele and Vansteelandt multiple mediator model further revealed that these two CpGs were the key mediators. Decreased methylation at both CpGs was more common in cases who drank alcohol at the time of enrollment vs. those who did not. cg11016563 resides in TRPC6 which has been previously shown to be overexpressed in EOC. These findings suggest two CpGs may serve as novel biomarkers for EOC susceptibility.

  14. Adiabatic and Nonadiabatic Charge Transport in Li-S Batteries

    DEFF Research Database (Denmark)

    Park, Haesun; Kumar, Nitin; Melander, Marko

    2018-01-01

    The insulating nature of the redox end members in Li-S batteries, -S and Li2S, has the potential to limit the capacity and efficiency of this emerging energy storage system. Nevertheless, the mechanisms responsible for ionic and electronic transport in these materials remain a matter of debate...... studies, we conclude that low equilibrium carrier concentrations are responsible for sluggish charge transport in -S and Li2S. Thus, a potential strategy for improving the performance of Li-S batteries is to increase the concentrations of holes in these redox end members....

  15. Observation of quantum interference in molecular charge transport

    DEFF Research Database (Denmark)

    Guedon, Constant M.; Valkenier, Hennie; Markussen, Troels

    2012-01-01

    for such behaviour has been indirect. Here, we report the observation of destructive quantum interference in charge transport through two-terminal molecular junctions at room temperature. We studied five different rigid p-conjugated molecular wires, all of which form self-assembled monolayers on a gold surface......, and find that the degree of interference can be controlled by simple chemical modifications of the molecular wire....

  16. Hda Monomerization by ADP Binding Promotes Replicase Clamp-mediated DnaA-ATP Hydrolysis*S⃞

    OpenAIRE

    Su'etsugu, Masayuki; Nakamura, Kenta; Keyamura, Kenji; Kudo, Yuka; Katayama, Tsutomu

    2008-01-01

    ATP-DnaA is the initiator of chromosomal replication in Escherichia coli, and the activity of DnaA is regulated by the regulatory inactivation of the DnaA (RIDA) system. In this system, the Hda protein promotes DnaA-ATP hydrolysis to produce inactive ADP-DnaA in a mechanism that is mediated by the DNA-loaded form of the replicase sliding clamp. In this study, we first revealed that hda translation uses an unusual initiation codon, CUG, located downstream of the annotat...

  17. The Ku80 carboxy terminus stimulates joining and artemis-mediated processing of DNA ends.

    Science.gov (United States)

    Weterings, Eric; Verkaik, Nicole S; Keijzers, Guido; Florea, Bogdan I; Wang, Shih-Ya; Ortega, Laura G; Uematsu, Naoya; Chen, David J; van Gent, Dik C

    2009-03-01

    Repair of DNA double-strand breaks (DSBs) is predominantly mediated by nonhomologous end joining (NHEJ) in mammalian cells. NHEJ requires binding of the Ku70-Ku80 heterodimer (Ku70/80) to the DNA ends and subsequent recruitment of the DNA-dependent protein kinase catalytic subunit (DNA-PK(CS)) and the XRCC4/ligase IV complex. Activation of the DNA-PK(CS) serine/threonine kinase requires an interaction with Ku70/80 and is essential for NHEJ-mediated DSB repair. In contrast to previous models, we found that the carboxy terminus of Ku80 is not absolutely required for the recruitment and activation of DNA-PK(CS) at DSBs, although cells that harbored a carboxy-terminal deletion in the Ku80 gene were sensitive to ionizing radiation and showed reduced end-joining capacity. More detailed analysis of this repair defect showed that DNA-PK(CS) autophosphorylation at Thr2647 was diminished, while Ser2056 was phosphorylated to normal levels. This resulted in severely reduced levels of Artemis nuclease activity in vivo and in vitro. We therefore conclude that the Ku80 carboxy terminus is important to support DNA-PK(CS) autophosphorylation at specific sites, which facilitates DNA end processing by the Artemis endonuclease and the subsequent joining reaction.

  18. The Ku80 Carboxy Terminus Stimulates Joining and Artemis-Mediated Processing of DNA Ends▿

    Science.gov (United States)

    Weterings, Eric; Verkaik, Nicole S.; Keijzers, Guido; Florea, Bogdan I.; Wang, Shih-Ya; Ortega, Laura G.; Uematsu, Naoya; Chen, David J.; van Gent, Dik C.

    2009-01-01

    Repair of DNA double-strand breaks (DSBs) is predominantly mediated by nonhomologous end joining (NHEJ) in mammalian cells. NHEJ requires binding of the Ku70-Ku80 heterodimer (Ku70/80) to the DNA ends and subsequent recruitment of the DNA-dependent protein kinase catalytic subunit (DNA-PKCS) and the XRCC4/ligase IV complex. Activation of the DNA-PKCS serine/threonine kinase requires an interaction with Ku70/80 and is essential for NHEJ-mediated DSB repair. In contrast to previous models, we found that the carboxy terminus of Ku80 is not absolutely required for the recruitment and activation of DNA-PKCS at DSBs, although cells that harbored a carboxy-terminal deletion in the Ku80 gene were sensitive to ionizing radiation and showed reduced end-joining capacity. More detailed analysis of this repair defect showed that DNA-PKCS autophosphorylation at Thr2647 was diminished, while Ser2056 was phosphorylated to normal levels. This resulted in severely reduced levels of Artemis nuclease activity in vivo and in vitro. We therefore conclude that the Ku80 carboxy terminus is important to support DNA-PKCS autophosphorylation at specific sites, which facilitates DNA end processing by the Artemis endonuclease and the subsequent joining reaction. PMID:19103741

  19. PATH: a lumped-element beam-transport simulation program with space charge

    International Nuclear Information System (INIS)

    Farrell, J.A.

    1983-01-01

    PATH is a group of computer programs for simulating charged-particle beam-transport systems. It was developed for evaluating the effects of some aberrations without a time-consuming integration of trajectories through the system. The beam-transport portion of PATH is derived from the well-known program, DECAY TURTLE. PATH contains all features available in DECAY TURTLE (including the input format) plus additional features such as a more flexible random-ray generator, longitudinal phase space, some additional beamline elements, and space-charge routines. One of the programs also provides a simulation of an Alvarez linear accelerator. The programs, originally written for a CDC 7600 computer system, also are available on a VAX-VMS system. All of the programs are interactive with input prompting for ease of use

  20. Genomics and radical mediated DNA damage: major differences between ionizing radiation and DNA-cleaving enediynes

    International Nuclear Information System (INIS)

    Cosgrove, J.P.; Begley, T.J.; Samson, L.D.; Dedon, P.C.

    2003-01-01

    While the evidence is strong for radical-mediated oxidative processes in the pathophysiology of cancer and aging, the mechanisms by which cells respond to oxidative stress have eluded definition. To this end, we have undertaken genomic studies comparing the response of S. cerevisiae to DNA-specific oxidizing agents, the enediynes calicheamicin (CAL), esperamicin (ESP), and neocarzinostatin (NCS), and the non-specific gamma-radiation (RAD). While RAD results in relatively indiscriminate oxidation of cellular molecules, the enediynes are highly specific to DNA and produce damage by a common mechanism involving radical-mediated oxidation of deoxyribose. Transcriptional profiling in response to these agents (80% survival; 15 min exposure; Affymetrix) revealed unexpected differences between RAD and the enediynes and among the three enediynes. Only 2 genes responded in common to all agents, while 9 genes were regulated in common for the 3 enediynes (no DNA repair genes altered in common). The limited common gene expression changes for the 3 enediynes may result from differences in deoxyribose oxidation chemistry, DNA and chromatin targets or the proportions of single- and double-strand DNA lesions. RAD produced a more robust response than the enediynes, altering expression of 195 and 52 genes by more than 2- and 5-fold, respectively, compared to 16-44 and *2 genes, respectively, for the enediynes. This suggests that the transcriptional response varies in intensity according to the number of cellular features affected by the toxin. Genes showing the strongest up-regulation with RAD: ribonucleotide reductase, multidrug resistance, DS break repair/RAD51, GSH transferase; strongly reduced gene expression: TEL1 (damage signaling), NAT2 (acetyltransferase). Genomic phenotyping studies, using a subset of the Research Genetics deletion library, revealed that loss of apn1, the major AP endonuclease, caused resistance to NCS, possibly due to reduced formation of protein-DNA cross

  1. Crowding and hopping in a protein’s diffusive transport on DNA

    International Nuclear Information System (INIS)

    Koslover, Elena F; Spakowitz, Andrew J; Díaz de la Rosa, Mario

    2017-01-01

    Diffusion is a ubiquitous phenomenon that impacts virtually all processes that involve random fluctuations, and as such, the foundational work of Smoluchowski has proven to be instrumental in addressing innumerable problems. Here, we focus on a critical biological problem that relies on diffusive transport and is analyzed using a probabilistic treatment originally developed by Smoluchowski. The search of a DNA binding protein for its specific target site is believed to rely on non-specific binding to DNA with transient hops along the chain. In this work, we address the impact of protein crowding along the DNA on the transport of a DNA-binding protein. The crowders dramatically alter the dynamics of the protein while bound to the DNA, resulting in single-file transport that is subdiffusive in nature. However, transient unbinding and hopping results in a long-time behavior (shown to be superdiffusive) that is qualitatively unaffected by the crowding on the DNA. Thus, hopping along the chain mitigates the role that protein crowding has in restricting the translocation dynamics along the chain. The superdiffusion coefficient is influenced by the quantitative values of the effective binding rate, which is influenced by protein crowding. We show that vacancy fraction and superdiffusion coefficient exhibits a non-monotonic relationship under many circumstances. We leverage analytical theory and dynamic Monte Carlo simulations to address this problem. With several additional contributions, the core of our modeling work adopts a reaction-diffusion framework that is based on Smoluchowski’s original work. (paper)

  2. Preparation of a differentially expressed, full-length cDNA expression library by RecA-mediated triple-strand formation with subtractively enriched cDNA fragments

    NARCIS (Netherlands)

    Hakvoort, T. B.; Spijkers, J. A.; Vermeulen, J. L.; Lamers, W. H.

    1996-01-01

    We have developed a fast and general method to obtain an enriched, full-length cDNA expression library with subtractively enriched cDNA fragments. The procedure relies on RecA-mediated triple-helix formation of single-stranded cDNA fragments with a double-stranded cDNA plasmid library. The complexes

  3. Spiro-OMeTAD single crystals: Remarkably enhanced charge-carrier transport via mesoscale ordering

    KAUST Repository

    Shi, Dong

    2016-04-15

    We report the crystal structure and hole-transport mechanism in spiro-OMeTAD [2,2′,7,7′-tetrakis(N,N-di-p-methoxyphenyl-amine)9,9′-spirobifluorene], the dominant hole-transporting material in perovskite and solid-state dye-sensitized solar cells. Despite spiro-OMeTAD’s paramount role in such devices, its crystal structure was unknown because of highly disordered solution-processed films; the hole-transport pathways remained ill-defined and the charge carrier mobilities were low, posing a major bottleneck for advancing cell efficiencies. We devised an antisolvent crystallization strategy to grow single crystals of spiro-OMeTAD, which allowed us to experimentally elucidate its molecular packing and transport properties. Electronic structure calculations enabled us to map spiro-OMeTAD’s intermolecular charge-hopping pathways. Promisingly, single-crystal mobilities were found to exceed their thin-film counterparts by three orders of magnitude. Our findings underscore mesoscale ordering as a key strategy to achieving breakthroughs in hole-transport material engineering of solar cells.

  4. Mediator-assisted photocurrent extraction from the thylakoids

    International Nuclear Information System (INIS)

    Yu, Yue; Zuo, Fulin; Li, Chen-Zhong

    2014-01-01

    Photocurrent extracted from the thylakoids has been studied as a function of electron mediator concentration. Phenazine methosulfate is used to facilitate the charge transfer from the thylakoid's charge transport chain to the outside medium. The photocurrent has been shown to originate from the photosynthesis on the thylakoid membranes. Comparing with a previous study using para-Benzoquinone as the mediator, a similar peak effect in the photocurrent as a function of concentration is observed, but the magnitude of the current is nearly a thousand times greater. A semi-quantitative analysis is presented to explain the data found in those systems

  5. Histone dosage regulates DNA damage sensitivity in a checkpoint-independent manner by the homologous recombination pathway

    Science.gov (United States)

    Liang, Dun; Burkhart, Sarah Lyn; Singh, Rakesh Kumar; Kabbaj, Marie-Helene Miquel; Gunjan, Akash

    2012-01-01

    In eukaryotes, multiple genes encode histone proteins that package genomic deoxyribonucleic acid (DNA) and regulate its accessibility. Because of their positive charge, ‘free’ (non-chromatin associated) histones can bind non-specifically to the negatively charged DNA and affect its metabolism, including DNA repair. We have investigated the effect of altering histone dosage on DNA repair in budding yeast. An increase in histone gene dosage resulted in enhanced DNA damage sensitivity, whereas deletion of a H3–H4 gene pair resulted in reduced levels of free H3 and H4 concomitant with resistance to DNA damaging agents, even in mutants defective in the DNA damage checkpoint. Studies involving the repair of a HO endonuclease-mediated DNA double-strand break (DSB) at the MAT locus show enhanced repair efficiency by the homologous recombination (HR) pathway on a reduction in histone dosage. Cells with reduced histone dosage experience greater histone loss around a DSB, whereas the recruitment of HR factors is concomitantly enhanced. Further, free histones compete with the HR machinery for binding to DNA and associate with certain HR factors, potentially interfering with HR-mediated repair. Our findings may have important implications for DNA repair, genomic stability, carcinogenesis and aging in human cells that have dozens of histone genes. PMID:22850743

  6. Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.

    Science.gov (United States)

    Takezawa, Yusuke; Shionoya, Mitsuhiko

    2012-12-18

    With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional

  7. Charge carrier transport and photogeneration in P3HT:PCBM photovoltaic blends.

    Science.gov (United States)

    Laquai, Frédéric; Andrienko, Denis; Mauer, Ralf; Blom, Paul W M

    2015-06-01

    This article reviews the charge transport and photogeneration in bulk-heterojunction solar cells made from blend films of regioregular poly(3-hexylthiophene) (RR-P3HT) and methano-fullerene (PCBM). The charge transport, specifically the hole mobility in the RR-P3HT phase of the polymer:fullerene photovoltaic blend, is dramatically affected by thermal annealing. The hole mobility increases more than three orders of magnitude and reaches a value of up to 2 × 10(-4) cm(2) V(-1) s(-1) after the thermal annealing process as a result of an improved semi-crystallinity of the film. This significant increase of the hole mobility balances the electron and hole mobilities in a photovoltaic blend in turn reducing space-charge formation, and this is the most important factor for the strong enhancement of the photovoltaic efficiency compared to an as cast, that is, non-annealed device. In fact, the balanced charge carrier mobility in RR-P3HT:PCBM blends in combination with a field- and temperature-independent charge carrier generation and greatly reduced non-geminate recombination explains the large quantum efficiencies mea-sured in P3HT:PCBM photovoltaic devices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. EBQ code: Transport of space-charge beams in axially symmetric devices

    Science.gov (United States)

    Paul, A. C.

    1982-11-01

    Such general-purpose space charge codes as EGUN, BATES, WODF, and TRANSPORT do not gracefully accommodate the simulation of relativistic space-charged beams propagating a long distance in axially symmetric devices where a high degree of cancellation has occurred between the self-magnetic and self-electric forces of the beam. The EBQ code was written specifically to follow high current beam particles where space charge is important in long distance flight in axially symmetric machines possessing external electric and magnetic field. EBQ simultaneously tracks all trajectories so as to allow procedures for charge deposition based on inter-ray separations. The orbits are treated in Cartesian geometry (position and momentum) with z as the independent variable. Poisson's equation is solved in cylindrical geometry on an orthogonal rectangular mesh. EBQ can also handle problems involving multiple ion species where the space charge from each must be included. Such problems arise in the design of ion sources where different charge and mass states are present.

  9. EBQ code: transport of space-charge beams in axially symmetric devices

    International Nuclear Information System (INIS)

    Paul, A.C.

    1982-11-01

    Such general-purpose space charge codes as EGUN, BATES, WOLF, and TRANSPORT do not gracefully accommodate the simulation of relativistic space-charged beams propagating a long distance in axially symmetric devices where a high degree of cancellation has occurred between the self-magnetic and self-electric forces of the beam. The EBQ code was written specifically to follow high current beam particles where space charge is important in long distance flight in axially symmetric machines possessing external electric and magnetic field. EBQ simultaneously tracks all trajectories so as to allow procedures for charge deposition based on inter-ray separations. The orbits are treated in Cartesian geometry (position and momentum) with z as the independent variable. Poisson's equation is solved in cylindrical geometry on an orthogonal rectangular mesh. EBQ can also handle problems involving multiple ion species where the space charge from each must be included. Such problems arise in the design of ion sources where different charge and mass states are present

  10. Plasma stream transport method (2) Use of charge exchange plasma source

    International Nuclear Information System (INIS)

    Tsuchimoto, T.

    1978-01-01

    The plasma stream transport method using a single plasma source has limitations for practical film deposition. Using a charge exchange phenomenon, a new plasma source is devised and tested by the plasma stream transport machine. Metals, silicon dioxide, and nitride films are deposited by this system. The mechanism of deposition under relatively high vacuum surrounding a silicon wafer is discussed as is the effect of radical atoms

  11. Plasma DNA Mediate Autonomic Dysfunctions and White Matter Injuries in Patients with Parkinson’s Disease

    Directory of Open Access Journals (Sweden)

    Meng-Hsiang Chen

    2017-01-01

    Full Text Available Background. Cardiovascular autonomic dysfunction is well known in Parkinson’s disease (PD presentation and it produces hypoperfusion of vital organs. The association between cardiovascular autonomic dysfunction and oxidative stress was examined in previous animal models. Oxidative stress and neuroinflammation were thought to have roles in PD pathogenesis. Owing to the relative low intrinsic antioxidative properties, brain white matter (WM is vulnerable to the oxidative stress. This study is conducted to examine possible relationships by using a hypothesis-driven mediation model. Methods. Twenty-nine patients with PD and 26 healthy controls participated in this study, with complete examinations of cardiac autonomic parameters, plasma DNA level, and WM integrity. A single-level three-variable mediation model was used to investigate the possible relationships. Results. The elevated serum oxidative stress biomarkers include plasma nuclear DNA and mitochondrial DNA, and poorer cardiac autonomic parameters and multiple regional microstructural WM changes are demonstrated. Further mediation analysis shows that plasma nuclear DNA served as the mediators between poorer baroreflex sensitivity and mean diffusivity changes in cingulum. Conclusions. These results provide a possible pathophysiology for how the poor baroreflex sensitivity and higher oxidative stress adversely impacted the WM integrity. This model could provide us with a piece of the puzzle of the entire PD pathogenesis.

  12. Electrification Opportunities in the Transportation Sector and Impact of Residential Charging

    Energy Technology Data Exchange (ETDEWEB)

    Muratori, Matteo [National Renewable Energy Laboratory (NREL), Golden, CO (United States)

    2018-04-04

    This presentation provides an overview of electrification opportunities in the transportation sector and present results of a study assessing the impact of residential charging on residential power demand and electric power distribution infrastructure.

  13. X-ray-mediated cross linking of protein and DNA

    International Nuclear Information System (INIS)

    Minsky, B.D.; Braun, A.

    1977-01-01

    Using a simple filter assay for the binding of BSA or lysozyme to DNA, two mechanisms of x-ray-mediated cross linking are shown to occur. One, a fast reaction, appears to involve a radical intermediate, is inhibited by high pH and salt, and seems to be enhanced by deoxygenation. The second mechanism, a slow time-dependent component, differs from the fast reaction in its stimulation by histidine, its inhibition by catalase, and the lack of an oxygen effect. Separate irradiation of DNA or water does not lead to cross linking. However, separate irradiation of protein leads to cross linking which proceeds with slow-component kinetics

  14. Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

    Science.gov (United States)

    Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

    2015-01-01

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science. PMID:25973536

  15. Silver (I) as DNA glue: Ag(+)-mediated guanine pairing revealed by removing Watson-Crick constraints.

    Science.gov (United States)

    Swasey, Steven M; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G

    2015-05-14

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag(+) is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg(2+). In contrast to prior studies of Ag(+) incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag(+)-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag(+) bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag(+)-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

  16. Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

    Science.gov (United States)

    Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.

    2015-05-01

    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

  17. On the Structure of the Fixed Charge Transportation Problem

    Science.gov (United States)

    Kowalski, K.

    2005-01-01

    This work extends the theory of the fixed charge transportation problem (FCTP), currently based mostly on a forty-year-old publication by Hirsch and Danzig. This paper presents novel properties that need to be considered by those using existing, or those developing new methods for optimizing FCTP. It also defines the problem in an easier way,…

  18. Loop-mediated isothermal amplification (LAMP) shield for Arduino DNA detection

    NARCIS (Netherlands)

    Velders, Aldrik H.; Schoen, Cor; Saggiomo, Vittorio

    2018-01-01

    Objective: Loop-mediated isothermal amplification (LAMP) of DNA is gaining relevance as a method to detect nucleic acids, as it is easier, faster, and more powerful than conventional Polymerase Chain Reaction. However, LAMP is still mostly used in laboratory settings, because of the lack of a cheap

  19. Charge transport in non-irradiated and irradiated silicon detectors

    International Nuclear Information System (INIS)

    Leroy, C.; Roy, P.; Casse, G.L.; Glaser, M.; Grigoriev, E.; Lemeilleur, F.

    1999-01-01

    A model describing the transport of the charge carriers generated in n-type silicon detectors by ionizing particles is presented. In order to reproduce the experimental current pulse responses induced by α and β particles in non-irradiated and irradiated detectors up to fluences (PHI) much beyond the n to p-type inversion, an n-type region 15 μm deep is introduced on the p + side of the diode. This model also gives mobilities which decrease linearly up to fluences of around 5x10 13 particles/cm 2 and beyond, converging to saturation values of about 1000 and 450 cm 2 /V s for electrons and holes, respectively. The charge carrier lifetime degradation with increased fluence, due to trapping, is responsible for a predicted charge collection deficit for β particles and for α particles which is found to agree with direct CCE measurements. (author)

  20. Charge transport in non-polar and semi-polar III-V nitride heterostructures

    International Nuclear Information System (INIS)

    Konar, Aniruddha; Verma, Amit; Fang, Tian; Zhao, Pei; Jana, Raj; Jena, Debdeep

    2012-01-01

    Compared to the intense research focus on the optical properties, the transport properties in non-polar and semi-polar III-nitride semiconductors remain relatively unexplored to date. The purpose of this paper is to discuss charge-transport properties in non-polar and semi-polar orientations of GaN in a comparative fashion to what is known for transport in polar orientations. A comprehensive approach is adopted, starting from an investigation of the differences in the electronic bandstructure along different polar orientations of GaN. The polarization fields along various orientations are then discussed, followed by the low-field electron and hole mobilities. A number of scattering mechanisms that are specific to non-polar and semi-polar GaN heterostructures are identified, and their effects are evaluated. Many of these scattering mechanisms originate due to the coupling of polarization with disorder and defects in various incarnations depending on the crystal orientation. The effect of polarization orientation on carrier injection into quantum-well light-emitting diodes is discussed. This paper ends with a discussion of orientation-dependent high-field charge-transport properties including velocity saturation, instabilities and tunneling transport. Possible open problems and opportunities are also discussed. (paper)

  1. Effects of Te inclusions on charge-carrier transport properties in CdZnTe radiation detectors

    International Nuclear Information System (INIS)

    Gu, Yaxu; Rong, Caicai; Xu, Yadong; Shen, Hao; Zha, Gangqiang; Wang, Ning; Lv, Haoyan; Li, Xinyi; Wei, Dengke; Jie, Wanqi

    2015-01-01

    Highlights: • This work reveals the behaviors of Te inclusion in affecting charge-carrier transport properties in CdZnTe detectors for the first time and analysis the mechanism therein. • The results show that charge collection efficiencies in Te inclusion degraded regions experience fast ascent under low biases and slow descent at high applied biases, which deviates from the Hecht rule. • This phenomenon is attributed to the competitive influence of two mechanisms under different biases, namely charge carrier trapping due to uniformly distributed point defects and Te inclusion induced transient charge loss. • A modified Hecht equation is further proposed to explain the effects of high-density localized defects, say Te inclusions, on the charge collection efficiency. • We believe that this research has wide appeal to analyze the macroscopic defects and their influence on charge transport properties in semiconductor radiation detectors. - Abstract: The influence of tellurium (Te) inclusions on the charge collection efficiency in cadmium zinc telluride (CdZnTe or CZT) detectors has been investigated using ion beam induced charge (IBIC) technique. Combining the analysis of infrared transmittance image, most of the low charge collection areas in the IBIC images prove the existence of Te inclusions. To further clarify the role of Te inclusions on charge transport properties, bias dependent local IBIC scan was performed on Te inclusion related regions from 20 V to 500 V. The result shows that charge collection efficiencies in Te inclusion degraded regions experience fast ascent under low biases and slow descent at high applied biases, which deviates from Hecht rule. This behavior is attributed to the competitive influence of two mechanisms under different biases, namely charge carrier trapping due to uniformly distributed point defects and Te inclusion induced transient charge loss. A modified Hecht equation is further proposed to explain the effects of high

  2. DNA and protein co-administration induces tolerogenic dendritic cells through DC-SIGN mediated negative signals.

    Science.gov (United States)

    Li, Jinyao; Geng, Shuang; Liu, Xiuping; Liu, Hu; Jin, Huali; Liu, Chang-Gong; Wang, Bin

    2013-10-01

    We previously demonstrated that DNA and protein co-administration induced differentiation of immature dendritic cells (iDCs) into CD11c(+)CD40(low)IL-10(+) regulatory DCs (DCregs) via the caveolin-1 (Cav-1) -mediated signal pathway. Here, we demonstrate that production of IL-10 and the low expression of CD40 play a critical role in the subsequent induction of regulatory T cells (Tregs) by the DCregs. We observed that DNA and protein were co-localized with DC-SIGN in caveolae and early lysosomes in the treated DCs, as indicated by co-localization with Cav-1 and EEA-1 compartment markers. DNA and protein also co-localized with LAMP-2. Gene-array analysis of gene expression showed that more than a thousand genes were significantly changed by the DC co-treatment with DNA + protein compared with controls. Notably, the level of DC-SIGN expression was dramatically upregulated in pOVA + OVA co-treated DCs. The expression levels of Rho and Rho GNEF, the down-stream molecules of DC-SIGN mediated signal pathway, were also greatly upregulated. Further, the level of TLR9, the traditional DNA receptor, was significantly downregulated. These results suggest that DC-SIGN as the potential receptor for DNA and protein might trigger the negative pathway to contribute the induction of DCreg combining with Cav-1 mediated negative signal pathway.

  3. Charge and Spin Transport in Spin-orbit Coupled and Topological Systems

    KAUST Repository

    Ndiaye, Papa Birame

    2017-01-01

    for next-generation technology, three classes of systems that possibly enhance the spin and charge transport efficiency: (i)- topological insulators, (ii)- spin-orbit coupled magnonic systems, (iii)- topological magnetic textures (skyrmions and 3Q magnetic

  4. Charge transport in silicon nanocrystal superlattices in the terahertz regime

    Czech Academy of Sciences Publication Activity Database

    Němec, Hynek; Zajac, Vít; Kužel, Petr; Malý, P.; Gutsch, S.; Hiller, D.; Zacharias, M.

    2015-01-01

    Roč. 91, č. 19 (2015), "195443-1"-"195443-10" ISSN 1098-0121 R&D Projects: GA ČR GA13-12386S Institutional support: RVO:68378271 Keywords : silicon nanocrystals * charge transport * terahertz spectroscopy Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 3.736, year: 2014

  5. On the mechanism of charge transport in low density polyethylene

    Science.gov (United States)

    Upadhyay, Avnish K.; Reddy, C. C.

    2017-08-01

    Polyethylene based polymeric insulators, are being increasingly used in the power industry for their inherent advantages over conventional insulation materials. Specifically, modern power cables are almost made with these materials, replacing the mass-impregnated oil-paper cable technology. However, for ultra-high dc voltage applications, the use of these polymeric cables is hindered by ununderstood charge transport and accumulation. The conventional conduction mechanisms (Pool-Frenkel, Schottky, etc.) fail to track high-field charge transport in low density polyethylene, which is semi-crystalline in nature. Until now, attention was devoted mainly to the amorphous region of the material. In this paper, authors propose a novel mechanism for conduction in low density polyethylene, which could successfully track experimental results. As an implication, a novel, substantial relationship is established for electrical conductivity that could be effectively used for understanding conduction and breakdown in polyethylene, which is vital for successful development of ultra-high voltage dc cables.

  6. Numerical design of electron guns and space charge limited transport systems

    International Nuclear Information System (INIS)

    Herrmannsfeldt, W.B.

    1980-10-01

    This paper describes the capabilities and limitations of computer programs used to design electron guns and similarly space-charge limited transport systems. Examples of computer generated plots from several different types of gun problems are included

  7. Adenovirus DNA binding protein inhibits SrCap-activated CBP and CREB-mediated transcription

    International Nuclear Information System (INIS)

    Xu Xiequn; Tarakanova, Vera; Chrivia, John; Yaciuk, Peter

    2003-01-01

    The SNF2-related CBP activator protein (SrCap) is a potent activator of transcription mediated by CBP and CREB. We have previously demonstrated that the Adenovirus 2 DNA Binding Protein (DBP) binds to SrCap and inhibits the transcription mediated by the carboxyl-terminal region of SrCap (amino acids 1275-2971). We report here that DBP inhibits the ability of full-length SrCap (1-2971) to activate transcription mediated by Gal-CREB and Gal-CBP. In addition, DBP also inhibits the ability of SrCap to enhance Protein Kinase A (PKA) activated transcription of the enkaphalin promoter. DBP was found to dramatically inhibit transcription of a mammalian two-hybrid system that was dependent on the interaction of SrCap and CBP binding domains. We also found that DBP has no effect on transcription mediated by a transcriptional activator that is not related to SrCap, indicating that our reported transcriptional inhibition is specific for SrCap and not due to nonspecific effects of DBP's DNA binding activity on the CAT reporter plasmid. Taken together, these results suggest a model in which DBP inhibits cellular transcription mediated by the interaction between SrCap and CBP

  8. Charge transportation in polyaniline/V2O5 composites

    International Nuclear Information System (INIS)

    Huguenin, Fritz; Torresi, Roberto M.

    2004-01-01

    In this work, composites formed from a mixture of V 2 O 5 and polyaniline (PANI) were investigated, for applications as cathode materials for secondary lithium batteries. Electrochemical quartz crystal microbalance (EQCM) data show that charge compensation in the [PANI] 0.3 V 2 O 5 nanocomposite is achieved predominantly by Li + migration. However, the charge compensation in the [PANI]V 2 O 5 microcomposite occurs by Li + and Cl O 4 - transport. Electrochemical Impedance Spectroscopy (EIS) measurements reveal several benefits of nanohybrid formation, including the achievement of shorter ionic diffusion pathways, the higher diffusion rate of the lithium ion and also the higher electronic conductivity, which are responsible for a synergetic effect of the energy storage properties. (author)

  9. Three-dimensional charge transport in organic semiconductor single crystals.

    Science.gov (United States)

    He, Tao; Zhang, Xiying; Jia, Jiong; Li, Yexin; Tao, Xutang

    2012-04-24

    Three-dimensional charge transport anisotropy in organic semiconductor single crystals - both plates and rods (above and below, respectively, in the figure) - is measured in well-performing organic field-effect transistors for the first time. The results provide an excellent model for molecular design and device preparation that leads to good performance. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Membrane-traversing mechanism of thyroid hormone transport by monocarboxylate transporter 8.

    Science.gov (United States)

    Protze, Jonas; Braun, Doreen; Hinz, Katrin Manuela; Bayer-Kusch, Dorothea; Schweizer, Ulrich; Krause, Gerd

    2017-06-01

    Monocarboxylate transporter 8 (MCT8) mediates thyroid hormone (TH) transport across the plasma membrane in many cell types. In order to better understand its mechanism, we have generated three new MCT8 homology models based on sugar transporters XylE in the intracellular opened (PDB ID: 4aj4) and the extracellular partly occluded (PDB ID: 4gby) conformations as well as FucP (PDB ID: 3o7q) and GLUT3 (PDB ID: 4zwc) in the fully extracellular opened conformation. T 3 -docking studies from both sides revealed interactions with His192, His415, Arg445 and Asp498 as previously identified. Selected mutations revealed further transport-sensitive positions mainly at the discontinuous transmembrane helices TMH7 and 10. Lys418 is potentially involved in neutralising the charge of the TH substrate because it can be replaced by charged, but not by uncharged, amino acids. The side chain of Thr503 was hypothesised to stabilise a helix break at TMH10 that undergoes a prominent local shift during the transport cycle. A T503V mutation accordingly affected transport. The aromatic Tyr419, the polar Ser313 and Ser314 as well as the charged Glu422 and Glu423 lining the transport channel have been studied. Based on related sugar transporters, we suggest an alternating access mechanism for MCT8 involving a series of amino acid positions previously and newly identified as critical for transport.

  11. On the nature of high field charge transport in reinforced silicone dielectrics: Experiment and simulation

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Yanhui, E-mail: huangy12@rpi.edu; Schadler, Linda S. [Department of Material Science and Engineering, Rensselaer Polytechnic Institute, 110 8th street, Troy, New York 12180 (United States)

    2016-08-07

    The high field charge injection and transport properties in reinforced silicone dielectrics were investigated by measuring the time-dependent space charge distribution and the current under dc conditions up to the breakdown field and were compared with the properties of other dielectric polymers. It is argued that the energy and spatial distribution of localized electronic states are crucial in determining these properties for polymer dielectrics. Tunneling to localized states likely dominates the charge injection process. A transient transport regime arises due to the relaxation of charge carriers into deep traps at the energy band tails and is successfully verified by a Monte Carlo simulation using the multiple-hopping model. The charge carrier mobility is found to be highly heterogeneous due to the non-uniform trapping. The slow moving electron packet exhibits a negative field dependent drift velocity possibly due to the spatial disorder of traps.

  12. Iterated local search and record-to-record travel applied to the fixed charge transportation problem

    DEFF Research Database (Denmark)

    Andersen, Jeanne; Klose, Andreas

    The fixed charge transportation problem (FCTP) is a well-known and difficult optimization problem with lots of applications in logistics. It consists in finding a minimum cost network flow from a set of suppliers to a set of customers. Beside costs proportional to quantities transported......, transportation costs do, however, include a fixed charge. Iterated local search and record-to-record travel are both simple local search based meta-heuristics that, to our knowledge, not yet have been applied to the FCTP. In this paper, we apply both types of search strategies and combine them into a single...

  13. Analysis of charge transport in gels containing polyoxometallates using methods of different sensitivity to migration.

    Science.gov (United States)

    Caban, Karolina; Lewera, Adam; Zukowska, Grazyna Z; Kulesza, Pawel J; Stojek, Zbigniew; Jeffrey, Kenneth R

    2006-08-04

    Two methods have been used for examination of transport of charge in gels soaked with DMF and containing dissolved polyoxometallates. The first method is based on the analysis of both Cottrellian and steady-state currents and therefore is capable of giving the concentration of the electroactive redox centres and their transport (diffusion-type) coefficient. The second method provides the real diffusion coefficients, i.e. transport coefficients free of migrational influence, for both the substrate and the product of the electrode reaction. Several gels based on poly(methyl methacrylate), with charged (addition of 1-acrylamido-2-methyl-2-propanesulphonic acid to the polymerization mixture) and uncharged chains, have been used in the investigation. The ratio obtained for the diffusion coefficient (second method) and transport coefficient (first method) was smaller for the gels containing charged polymer chains than for the gels with uncharged chains. In part these changes could be explained by the contribution of migration to the transport of polyoxomatallates in the gels. However, the impact of the changes in the polymer-channel capacity at the electrode surface while the electrode process proceeds was also considered. These structural changes should affect differently the methods based on different time domains.

  14. Impact of charged particle exposure on homologous DNA double-strand break repair in human blood-derived cells

    Directory of Open Access Journals (Sweden)

    Melanie eRall

    2015-11-01

    Full Text Available Ionizing radiation generates DNA double-strand breaks (DSB which, unless faithfully repaired, can generate chromosomal rearrangements in hematopoietic stem and/or progenitor cells (HSPC, potentially priming the cells towards a leukemic phenotype. Using an enhanced green fluorescent protein (EGFP-based reporter system, we recently identified differences in the removal of enzyme-mediated DSB in human HSPC versus mature peripheral blood lymphocytes (PBL, particularly regarding homologous DSB repair (HR. Assessment of chromosomal breaks via premature chromosome condensation or γH2AX foci indicated similar efficiency and kinetics of radiation-induced DSB formation and rejoining in PBL and HSPC. Prolonged persistence of chromosomal breaks was observed for higher LET charged particles which are known to induce more complex DNA damage compared to X rays. Consistent with HR deficiency in HSPC observed in our previous study, we noticed here pronounced focal accumulation of 53BP1 after X-ray and carbon ion exposure (intermediate LET in HSPC versus PBL. For higher LET, 53BP1 foci kinetics were similarly delayed in PBL and HSPC suggesting similar failure to repair complex DNA damage. Data obtained with plasmid reporter systems revealed a dose- and LET-dependent HR increase after X-ray, carbon ion and higher LET exposure, particularly in HR-proficient immortalized and primary lymphocytes, confirming preferential use of conservative HR in PBL for intermediate LET damage repair. HR measured adjacent to the leukemia-associated MLL breakpoint cluster sequence in reporter lines revealed dose-dependency of potentially leukemogenic rearrangements underscoring the risk of leukemia-induction by radiation treatment.

  15. (Poly)cation-induced protection of conventional and wireframe DNA origami nanostructures.

    Science.gov (United States)

    Ahmadi, Yasaman; De Llano, Elisa; Barišić, Ivan

    2018-04-26

    DNA nanostructures hold immense potential to be used for biological and medical applications. However, they are extremely vulnerable towards salt depletion and nucleases, which are common under physiological conditions. In this contribution, we used chitosan and linear polyethyleneimine for coating and long-term stabilization of several three-dimensional DNA origami nanostructures. The impact of the degree of polymerization and the charge density of the polymer together with the N/P charge ratio (ratio of the amines in polycations to the phosphates in DNA) on the stability of encapsulated DNA origami nanostructures in the presence of nucleases and in low-salt media was examined. The polycation shells were compatible with enzyme- and aptamer-based functionalization of the DNA nanostructures. Additionally, we showed that despite being highly vulnerable to salt depletion and nucleolytic digestion, self-assembled DNA nanostructures are stable in cell culture media up to a week. This was contrary to unassembled DNA scaffolds that degraded in one hour, showing that placing DNA strands into a spatially designed configuration crucially affect the structural integrity. The stability of naked DNA nanostructures in cell culture was shown to be mediated by growth media. DNA origami nanostructures kept in growth media were significantly more resistant towards low-salt denaturation, DNase I and serum-mediated digestion than when in a conventional buffer. Moreover, we confirmed that DNA origami nanostructures remain not only structurally intact but also fully functional after exposure to cell media. Agarose gel electrophoresis and negative stain transmission electron microscopy analysis revealed the hybridization of DNA origami nanostructures to their targets in the presence of serum proteins and nucleases. The structural integrity and functionality of DNA nanostructures in physiological fluids validate their use particularly for short-time biological applications in which the

  16. A reduced-cost iterated local search heuristic for the fixed-charge transportation problem

    NARCIS (Netherlands)

    Buson, Erika; Roberti, Roberto; Toth, Paolo

    2014-01-01

    The fixed-charge transportation problem (FCTP) is a generalization of the transportation problem where an additional fixed cost is paid for sending a flow from an origin to a destination. We propose an iterated local search heuristic based on the utilization of reduced costs for guiding the restart

  17. A novel technique with enhanced detection and quantitation of HPV-16 E1- and E2-mediated DNA replication

    International Nuclear Information System (INIS)

    Taylor, Ewan R.; Morgan, Iain M.

    2003-01-01

    Transient DNA replication assays to detect papillomavirus E1/E2-mediated DNA replication have depended upon Southern blotting. This technique is hazardous (radioactive), labour intensive, semiquantitative, and physically limited in the number of samples that can be processed at any one time. We have overcome these problems by developing a real-time PCR protocol for the detection of E1/E2-mediated transient DNA replication. The results demonstrate detection of replication at levels not seen using Southern blotting demonstrating enhanced sensitivity. This technique is also, by definition, highly quantitative. Therefore, the real-time PCR technique is the optimal method for the detection of E1/E2-mediated DNA replication

  18. Crossover from band-like to thermally activated charge transport in organic transistors due to strain-induced traps

    KAUST Repository

    Mei, Yaochuan

    2017-08-02

    The temperature dependence of the charge-carrier mobility provides essential insight into the charge transport mechanisms in organic semiconductors. Such knowledge imparts critical understanding of the electrical properties of these materials, leading to better design of high-performance materials for consumer applications. Here, we present experimental results that suggest that the inhomogeneous strain induced in organic semiconductor layers by the mismatch between the coefficients of thermal expansion (CTE) of the consecutive device layers of field-effect transistors generates trapping states that localize charge carriers. We observe a universal scaling between the activation energy of the transistors and the interfacial thermal expansion mismatch, in which band-like transport is observed for similar CTEs, and activated transport otherwise. Our results provide evidence that a high-quality semiconductor layer is necessary, but not sufficient, to obtain efficient charge-carrier transport in devices, and underline the importance of holistic device design to achieve the intrinsic performance limits of a given organic semiconductor. We go on to show that insertion of an ultrathin CTE buffer layer mitigates this problem and can help achieve band-like transport on a wide range of substrate platforms.

  19. Crossover from band-like to thermally activated charge transport in organic transistors due to strain-induced traps.

    Science.gov (United States)

    Mei, Yaochuan; Diemer, Peter J; Niazi, Muhammad R; Hallani, Rawad K; Jarolimek, Karol; Day, Cynthia S; Risko, Chad; Anthony, John E; Amassian, Aram; Jurchescu, Oana D

    2017-08-15

    The temperature dependence of the charge-carrier mobility provides essential insight into the charge transport mechanisms in organic semiconductors. Such knowledge imparts critical understanding of the electrical properties of these materials, leading to better design of high-performance materials for consumer applications. Here, we present experimental results that suggest that the inhomogeneous strain induced in organic semiconductor layers by the mismatch between the coefficients of thermal expansion (CTE) of the consecutive device layers of field-effect transistors generates trapping states that localize charge carriers. We observe a universal scaling between the activation energy of the transistors and the interfacial thermal expansion mismatch, in which band-like transport is observed for similar CTEs, and activated transport otherwise. Our results provide evidence that a high-quality semiconductor layer is necessary, but not sufficient, to obtain efficient charge-carrier transport in devices, and underline the importance of holistic device design to achieve the intrinsic performance limits of a given organic semiconductor. We go on to show that insertion of an ultrathin CTE buffer layer mitigates this problem and can help achieve band-like transport on a wide range of substrate platforms.

  20. Conformation sensitive charge transport in conjugated polymers

    International Nuclear Information System (INIS)

    Mattias Andersson, L.; Hedström, Svante; Persson, Petter

    2013-01-01

    Temperature dependent charge carrier mobility measurements using field effect transistors and density functional theory calculations are combined to show how the conformation dependent frontier orbital delocalization influences the hole- and electron mobilities in a donor-acceptor based polymer. A conformationally sensitive lowest unoccupied molecular orbital results in an electron mobility that decreases with increasing temperature above room temperature, while a conformationally stable highest occupied molecular orbital is consistent with a conventional hole mobility behavior and also proposed to be one of the reasons for why the material works well as a hole transporter in amorphous bulk heterojunction solar cells

  1. Computational investigation of the effects of perfluorination on the charge-transport properties of polyaromatic hydrocarbons

    International Nuclear Information System (INIS)

    Cardia, R.; Malloci, G.; Bosin, A.; Serra, G.; Cappellini, G.

    2016-01-01

    We present a systematic computational study of the effects of perfluorination on the charge-transport properties of three homologous classes of polyaromatic hydrocarbons of interest for molecular electronics: acenes, pyrenes, and circumacenes. By means of Density Functional Theory calculations we first obtained the key molecular properties for transport of both holes and electrons. We then used these parameters in the framework of Marcus theory to compare charge-transfer rates in the high temperatures regime for both unsubstituted and perfluorinated molecules. We additionally estimated the relative charge-mobility of each unsubstituted (perfluorinated) molecule with respect to unsubstituted (perfluorinated) pentacene. We found in all cases that perfluorination reduces the charge-transfer rate in absolute terms. This is largely due to the higher values of the molecular reorganization energies predicted for perfluorinated compounds. Interestingly, however, the charge-transfer rates for both holes and electrons of perfluorinated species are remarkably similar, especially for the larger species. In addition, in the case of the larger circumacenes the charge-mobility values relative to pentacene values are found to increase upon perfluorination.

  2. Computational investigation of the effects of perfluorination on the charge-transport properties of polyaromatic hydrocarbons

    Energy Technology Data Exchange (ETDEWEB)

    Cardia, R. [Università degli studi di Cagliari, Dipartimento di Fisica, Cittadella Universitaria, I-09042 Monserrato (Cagliari) (Italy); Istituto Officina dei Materiali (CNR – IOM), UOS di Cagliari, Cittadella Universitaria, I-09042 Monserrato, Cagliari (Italy); Malloci, G., E-mail: giuliano.malloci@dsf.unica.it [Università degli studi di Cagliari, Dipartimento di Fisica, Cittadella Universitaria, I-09042 Monserrato (Cagliari) (Italy); Bosin, A.; Serra, G. [Università degli studi di Cagliari, Dipartimento di Fisica, Cittadella Universitaria, I-09042 Monserrato (Cagliari) (Italy); Cappellini, G., E-mail: giancarlo.cappellini@dsf.unica.it [Università degli studi di Cagliari, Dipartimento di Fisica, Cittadella Universitaria, I-09042 Monserrato (Cagliari) (Italy); Istituto Officina dei Materiali (CNR – IOM), UOS di Cagliari, Cittadella Universitaria, I-09042 Monserrato, Cagliari (Italy)

    2016-10-20

    We present a systematic computational study of the effects of perfluorination on the charge-transport properties of three homologous classes of polyaromatic hydrocarbons of interest for molecular electronics: acenes, pyrenes, and circumacenes. By means of Density Functional Theory calculations we first obtained the key molecular properties for transport of both holes and electrons. We then used these parameters in the framework of Marcus theory to compare charge-transfer rates in the high temperatures regime for both unsubstituted and perfluorinated molecules. We additionally estimated the relative charge-mobility of each unsubstituted (perfluorinated) molecule with respect to unsubstituted (perfluorinated) pentacene. We found in all cases that perfluorination reduces the charge-transfer rate in absolute terms. This is largely due to the higher values of the molecular reorganization energies predicted for perfluorinated compounds. Interestingly, however, the charge-transfer rates for both holes and electrons of perfluorinated species are remarkably similar, especially for the larger species. In addition, in the case of the larger circumacenes the charge-mobility values relative to pentacene values are found to increase upon perfluorination.

  3. Assessing the potential of different charging strategies for electric vehicle fleets in closed transport systems

    International Nuclear Information System (INIS)

    Schmidt, Johannes; Eisel, Matthias; Kolbe, Lutz M.

    2014-01-01

    A key reason for the low sales volumes of electric vehicles is their significantly higher purchasing price in comparison to conventional vehicles. However, various charging strategies can be applied to make these vehicles more profitable. In this paper, controlled charging concepts are transferred to commercial fleets operating in closed transport systems, as we found this field of application particularly well suited for the implementation of charging strategies. We analyzed data gathered in a field experiment conducted in a European port using electric vehicles in combination with a battery-swapping station to calculate the economic potentials of three charging scenarios: (1) optimizing energy procurement (2) trading load-shifting potential on control markets, and (3) a combination of the two. The findings indicate that all approaches are appropriate for reducing economic disadvantages of electric transport vehicles. Furthermore, we find that adjusting charging processes to avoid price peaks is more profitable than offering control reserve. Finally, focusing on the combination of both strategies seems to be most promising from an economic perspective. In this context, operational cost savings of more than 65% can be achieved compared to a similar dieselpowered vehicle when applying this strategy. - Highlights: • We model various charging strategies for electric transport vehicles. • The economic assessment is based on a field experiment with a port operator. • We consider the special market design of spot and ancillary service markets. • All charging strategies presented provide substantial cost-saving potentials. • Optimizing energy procurement is more profitable than offering control reserve

  4. Two-Dimensional Spatial Imaging of Charge Transport in Germanium Crystals at Cryogenic Temperatures

    Energy Technology Data Exchange (ETDEWEB)

    Moffatt, Robert [Stanford Univ., CA (United States)

    2016-03-01

    In this dissertation, I describe a novel apparatus for studying the transport of charge in semiconductors at cryogenic temperatures. The motivation to conduct this experiment originated from an asymmetry observed between the behavior of electrons and holes in the germanium detector crystals used by the Cryogenic Dark Matter Search (CDMS). This asymmetry is a consequence of the anisotropic propagation of electrons in germanium at cryogenic temperatures. To better model our detectors, we incorporated this effect into our Monte Carlo simulations of charge transport. The purpose of the experiment described in this dissertation is to test those models in detail. Our measurements have allowed us to discover a shortcoming in our most recent Monte Carlo simulations of electrons in germanium. This discovery would not have been possible without the measurement of the full, two-dimensional charge distribution, which our experimental apparatus has allowed for the first time at cryogenic temperatures.

  5. SLC injector simulation and tuning for high charge transport

    International Nuclear Information System (INIS)

    Yeremian, A.D.; Miller, R.H.; Clendenin, J.E.; Early, R.A.; Ross, M.C.; Turner, J.L.; Wang, J.W.

    1992-01-01

    We have simulated the SLC injector from the thermionic gun through the first accelerating section and used the resulting parameters to tune the injector for optimum performance and high charge transport. Simulations are conducted using PARMELA, a three-dimensional space-charge model. The magnetic field profile due to the existing magnetic optics is calculated using POISSON, while SUPERFISH is used to calculate the space harmonics of the various bunchers and the accelerator cavities. The initial beam conditions in the PARMELA code are derived from the EGUN model of the gun. The resulting injector parameters from the PARMELA simulation are used to prescribe experimental settings of the injector components. The experimental results are in agreement with the results of the integrated injector model. (Author) 5 figs., 7 refs

  6. Transporter-mediated natural product–drug interactions for the treatment of cardiovascular diseases

    Directory of Open Access Journals (Sweden)

    Weibin Zha

    2018-04-01

    Full Text Available The growing use of natural products in cardiovascular (CV patients has been greatly raising the concerns about potential natural product–CV drug interactions. Some of these may lead to unexpected cardiovascular adverse effects and it is, therefore, essential to identify or predict potential natural product–CV drug interactions, and to understand the underlying mechanisms. Drug transporters are important determinants for the pharmacokinetics of drugs and alterations of drug transport has been recognized as one of the major causes of natural product–drug interactions. In last two decades, many CV drugs (e.g., angiotensin II receptor blockers, beta-blockers and statins have been identified to be substrates and inhibitors of the solute carrier (SLC transporters and the ATP-binding cassette (ABC transporters, which are two major transporter superfamilies. Meanwhile, in vitro and in vivo studies indicate that a growing number of natural products showed cardioprotective effects (e.g., gingko biloba, danshen and their active ingredients are also substrates and inhibitors of drug transporters. Thus, to understand transporter-mediated natural product–CV drug interactions is important and some transporter-mediated interactions have already shown to have clinical relevance. In this review, we review the current knowledge on the role of ABC and SLC transporters in CV therapy, as well as transporter modulation by natural products used in CV diseases and their induced natural product–CV drug interactions through alterations of drug transport. We hope our review will aid in a comprehensive summary of transporter-mediated natural product–CV drug interactions and help public and physicians understand these type of interactions. Keywords: Cardiovascular drugs, Natural products, Drug transporters, Natural product–drug interaction, Pharmacokinetics

  7. Electronic properties of mesoscopic graphene structures: Charge confinement and control of spin and charge transport

    Energy Technology Data Exchange (ETDEWEB)

    Rozhkov, A.V., E-mail: arozhkov@gmail.co [Advanced Science Institute, RIKEN, Wako-shi, Saitama, 351-0198 (Japan); Institute for Theoretical and Applied Electrodynamics, Russian Academy of Sciences, 125412, Moscow (Russian Federation); Giavaras, G. [Advanced Science Institute, RIKEN, Wako-shi, Saitama, 351-0198 (Japan); Bliokh, Yury P. [Advanced Science Institute, RIKEN, Wako-shi, Saitama, 351-0198 (Japan); Department of Physics, Technion-Israel Institute of Technology, Haifa 32000 (Israel); Freilikher, Valentin [Advanced Science Institute, RIKEN, Wako-shi, Saitama, 351-0198 (Japan); Department of Physics, Bar-Ilan University, Ramat-Gan 52900 (Israel); Nori, Franco [Advanced Science Institute, RIKEN, Wako-shi, Saitama, 351-0198 (Japan); Department of Physics, University of Michigan, Ann Arbor, MI 48109-1040 (United States)

    2011-06-15

    This brief review discusses electronic properties of mesoscopic graphene-based structures. These allow controlling the confinement and transport of charge and spin; thus, they are of interest not only for fundamental research, but also for applications. The graphene-related topics covered here are: edges, nanoribbons, quantum dots, pn-junctions, pnp-structures, and quantum barriers and waveguides. This review is partly intended as a short introduction to graphene mesoscopics.

  8. SMC1-Mediated Intra-S-Phase Arrest Facilitates Bocavirus DNA Replication

    Science.gov (United States)

    Luo, Yong; Deng, Xuefeng; Cheng, Fang; Li, Yi

    2013-01-01

    Activation of a host DNA damage response (DDR) is essential for DNA replication of minute virus of canines (MVC), a member of the genus Bocavirus of the Parvoviridae family; however, the mechanism by which DDR contributes to viral DNA replication is unknown. In the current study, we demonstrate that MVC infection triggers the intra-S-phase arrest to slow down host cellular DNA replication and to recruit cellular DNA replication factors for viral DNA replication. The intra-S-phase arrest is regulated by ATM (ataxia telangiectasia-mutated kinase) signaling in a p53-independent manner. Moreover, we demonstrate that SMC1 (structural maintenance of chromosomes 1) is the key regulator of the intra-S-phase arrest induced during infection. Either knockdown of SMC1 or complementation with a dominant negative SMC1 mutant blocks both the intra-S-phase arrest and viral DNA replication. Finally, we show that the intra-S-phase arrest induced during MVC infection was caused neither by damaged host cellular DNA nor by viral proteins but by replicating viral genomes physically associated with the DNA damage sensor, the Mre11-Rad50-Nbs1 (MRN) complex. In conclusion, the feedback loop between MVC DNA replication and the intra-S-phase arrest is mediated by ATM-SMC1 signaling and plays a critical role in MVC DNA replication. Thus, our findings unravel the mechanism underlying DDR signaling-facilitated MVC DNA replication and demonstrate a novel strategy of DNA virus-host interaction. PMID:23365434

  9. Turgor-mediated transport of sugars

    International Nuclear Information System (INIS)

    Daie, J.

    1986-01-01

    Membrane associated processes have been suggested to be modulated by cellular turgor. The nature of this regulation is not, however, clearly understood. Evidence is presented that active but not passive transport of sugars is turgor regulated. Isolated phloem tissue, vascular bundles or storage parenchyma of celery were incubated in buffered solutions adjusted to 100, 200 or 400 m osmolal that contained various concentrations of 14 C-sugars. Cellular turgor was manipulated by using the non-permeating PEG (3350). Saturating carrier-mediated sucrose transport which is present only in phloem-containing tissue was enhanced under low turgor conditions. Sucrose diffusion, the predominant mode of uptake in non-phloem parenchyma tissue was not affected by cellular turgor. Furthermore, GA and IAA seem to interact with cellular turgor to bring about modified rates of sucrose uptake. The data are consistent with observations that sucrose loading is enhanced under mild water deficit conditions

  10. TRIM56-mediated monoubiquitination of cGAS for cytosolic DNA sensing.

    Science.gov (United States)

    Seo, Gil Ju; Kim, Charlotte; Shin, Woo-Jin; Sklan, Ella H; Eoh, Hyungjin; Jung, Jae U

    2018-02-09

    Intracellular nucleic acid sensors often undergo sophisticated modifications that are critical for the regulation of antimicrobial responses. Upon recognition of DNA, the cytosolic sensor cyclic GMP-AMP (cGAMP) synthase (cGAS) produces the second messenger cGAMP, which subsequently initiates downstream signaling to induce interferon-αβ (IFNαβ) production. Here we report that TRIM56 E3 ligase-induced monoubiquitination of cGAS is important for cytosolic DNA sensing and IFNαβ production to induce anti-DNA viral immunity. TRIM56 induces the Lys335 monoubiquitination of cGAS, resulting in a marked increase of its dimerization, DNA-binding activity, and cGAMP production. Consequently, TRIM56-deficient cells are defective in cGAS-mediated IFNαβ production upon herpes simplex virus-1 (HSV-1) infection. Furthermore, TRIM56-deficient mice show impaired IFNαβ production and high susceptibility to lethal HSV-1 infection but not to influenza A virus infection. This adds TRIM56 as a crucial component of the cytosolic DNA sensing pathway that induces anti-DNA viral innate immunity.

  11. Charge transport in poly(p-phenylene vinylene) at low temperature and high electric field

    NARCIS (Netherlands)

    Katsouras, I.; Najafi, A.; Asadi, K.; Kronemeijer, A. J.; Oostra, A. J.; Koster, L. J. A.; de Leeuw, D. M.; Blom, P. W. M.

    Charge transport in poly(2-methoxy, 5-(2'-ethyl-hexyloxy)-p-phenylene vinylene) (MEH-PPV)-based hole-only diodes is investigated at high electric fields and low temperatures using a novel diode architecture. Charge carrier densities that are in the range of those in a field-effect transistor are

  12. Space charge compensation on the low energy beam transport of Linac4

    CERN Document Server

    AUTHOR|(SzGeCERN)733270; Scrivens, Richard; Jesus Castillo, Santos

    Part of the upgrade program in the injector chains of the CERN accelerator complex is the replacement of the the proton accelerator Linac2 for the brand new Linac4 which will accelerate H$^-$ and its main goal is to increase the beam intensity in the next sections of the LHC accelerator chain. The Linac4 is now under commissioning and will use several ion sources to produce high intensity unbunched H$^-$ beams with different properties, and the low energy beam transport (LEBT) is the system in charge of match all these different beams to the Radio frequency quadrupole (RFQ). The space charge forces that spread the beam ions apart of each other and cause emittance growth limits the maximum intensity that can be transported in the LEBT, but the space charge of intense unbunched ion beams can be compensated by the generated ions by the impact ionization of the residual gas, which creates a source of secondary particles inside the beam pipe. For negative ion beams, the effect of the beam electric field is to ex...

  13. Synthesis, characterization and charge transport mechanism of CdZnO nanorods

    International Nuclear Information System (INIS)

    Mahmoud, Waleed E.; Al-Ghamdi, A.A.; El-Tantawy, F.; Al-Heniti, S.

    2009-01-01

    ZnO and Cd-doped ZnO nanostructures were prepared by new facile method at 80 deg. C. XRD measurement indicated that both samples had typical hexagonal wurtzite structures. Transmission electron microscopy (TEM) measurement shows that rod-like crystals have been formed. EDX measurement confirms the incorporation of the cadmium ion into the crystalline lattice of ZnO and indicated that cadmium ions uniformly distributed on the surface of the rods. The doping with cadmium ions has a great influence on the optical properties of the ZnO. The electrical measurements of Cd-doped ZnO nanorod were measured. The current-voltage (I-V) characteristic curve revealed that the charge transport above 4 V is mainly non-linear due to grain boundary contribution. The complex impedance spectroscopy was confirmed that the grain boundary effect controls the charge transport mechanism through CdZnO ceramic material.

  14. Transmission of HBV DNA Mediated by Ceramide-Triggered Extracellular VesiclesSummary

    Directory of Open Access Journals (Sweden)

    Takahiro Sanada

    2017-03-01

    Full Text Available Background & Aims: An extracellular vesicle (EV is a nanovesicle that shuttles proteins, nucleic acids, and lipids, thereby influencing cell behavior. A recent crop of reports have shown that EVs are involved in infectious biology, influencing host immunity and playing a role in the viral life cycle. In the present work, we investigated the EV-mediated transmission of hepatitis B virus (HBV infection. Methods: We investigated the EV-mediated transmission of HBV infection by using a HBV infectious culture system that uses primary human hepatocytes derived from humanized chimeric mice (PXB-cells. Purified EVs were isolated by ultracentrifugation. To analyze the EVs and virions, we used stimulated emission depletion microscopy. Results: Purified EVs from HBV-infected PXB-cells were shown to contain HBV DNA and to be capable of transmitting HBV DNA to naive PXB-cells. These HBV-DNA–transmitting EVs were shown to be generated through a ceramide-triggered EV production pathway. Furthermore, we showed that these HBV-DNA–transmitting EVs were resistant to antibody neutralization; stimulated emission depletion microscopy showed that EVs lacked hepatitis B surface antigen, the target of neutralizing antibodies. Conclusions: These findings suggest that EVs harbor a DNA cargo capable of transmitting viral DNA into hepatocytes during HBV infection, representing an additional antibody-neutralization–resistant route of HBV infection. Keywords: HBV, Extracellular Vesicles, Transmission Pathway

  15. Charge and Spin Transport in Dilute Magnetic Semiconductors. Final report

    International Nuclear Information System (INIS)

    Ullrich, Carsten A.

    2009-01-01

    This proposal to the DOE outlines a three-year plan of research in theoretical and computational condensed-matter physics, with the aim of developing a microscopic theory for charge and spin dynamics in disordered materials with magnetic impurities. Important representatives of this class of materials are the dilute magnetic semiconductors (DMS), which have attracted great attention as a promising basis for spintronics devices. There is an intense experimental effort underway to study the transport properties of ferromagnetic DMS such as (Ga,Mn)As, and a number of interesting features have emerged: negative magnetoresistance, anomalous Hall effect, non-Drude dynamical conductivity, and resistivity maxima at the Curie temperature. Available theories have been able to account for some of these features, but at present we are still far away from a systematic microscopic understanding of transport in DMS. We propose to address this challenge by developing a theory of charge and spin dynamics based on a combination of the memory-function formalism and time-dependent density functional theory. This approach will be capable of dealing with two important issues: (a) the strong degree of correlated disorder in DMS, close to the localization transition (which invalidates the usual relaxation-time approximation to the Boltzmann equation), (b) the essentially unknown role of dynamical many-body effects such as spin Coulomb drag. We will calculate static and dynamical conductivities in DMS as functions of magnetic order and carrier density, which will advance our understanding of recent transport and infrared absorption measurements. Furthermore, we will study collective plasmon excitations in DMS (3D, 2D and quantum wells), whose linewidths could constitute a new experimental probe of the correlation of disorder, many-body effects and charge and spin dynamics in these materials.

  16. Celecoxib Induced Tumor Cell Radiosensitization by Inhibiting Radiation Induced Nuclear EGFR Transport and DNA-Repair: A COX-2 Independent Mechanism

    International Nuclear Information System (INIS)

    Dittmann, Klaus H.; Mayer, Claus; Ohneseit, Petra A.; Raju, Uma; Andratschke, Nickolaus H.; Milas, Luka; Rodemann, H. Peter

    2008-01-01

    Purpose: The purpose of the study was to elucidate the molecular mechanisms mediating radiosensitization of human tumor cells by the selective cyclooxygenase (COX)-2 inhibitor celecoxib. Methods and Materials: Experiments were performed using bronchial carcinoma cells A549, transformed fibroblasts HH4dd, the FaDu head-and-neck tumor cells, the colon carcinoma cells HCT116, and normal fibroblasts HSF7. Effects of celecoxib treatment were assessed by clonogenic cell survival, Western analysis, and quantification of residual DNA damage by γH 2 AX foci assay. Results: Celecoxib treatment resulted in a pronounced radiosensitization of A549, HCT116, and HSF7 cells, whereas FaDu and HH4dd cells were not radiosensitized. The observed radiosensitization could neither be correlated with basal COX-2 expression pattern nor with basal production of prostaglandin E2, but was depended on the ability of celecoxib to inhibit basal and radiation-induced nuclear transport of epidermal growth factor receptor (EGFR). The nuclear EGFR transport was strongly inhibited in A549-, HSF7-, and COX-2-deficient HCT116 cells, which were radiosensitized, but not in FaDu and HH4dd cells, which resisted celecoxib-induced radiosensitization. Celecoxib inhibited radiation-induced DNA-PK activation in A549, HSF7, and HCT116 cells, but not in FaDu and HH4dd cells. Consequentially, celecoxib increased residual γH2AX foci after irradiation, demonstrating that inhibition of DNA repair has occurred in responsive A549, HCT116, and HSF7 cells only. Conclusions: Celecoxib enhanced radiosensitivity by inhibition of EGFR-mediated mechanisms of radioresistance, a signaling that was independent of COX-2 activity. This novel observation may have therapeutic implications such that COX-2 inhibitors may improve therapeutic efficacy of radiation even in patients whose tumor radioresistance is not dependent on COX-2

  17. Transporter-mediated natural product-drug interactions for the treatment of cardiovascular diseases.

    Science.gov (United States)

    Zha, Weibin

    2018-04-01

    The growing use of natural products in cardiovascular (CV) patients has been greatly raising the concerns about potential natural product-CV drug interactions. Some of these may lead to unexpected cardiovascular adverse effects and it is, therefore, essential to identify or predict potential natural product-CV drug interactions, and to understand the underlying mechanisms. Drug transporters are important determinants for the pharmacokinetics of drugs and alterations of drug transport has been recognized as one of the major causes of natural product-drug interactions. In last two decades, many CV drugs (e.g., angiotensin II receptor blockers, beta-blockers and statins) have been identified to be substrates and inhibitors of the solute carrier (SLC) transporters and the ATP-binding cassette (ABC) transporters, which are two major transporter superfamilies. Meanwhile, in vitro and in vivo studies indicate that a growing number of natural products showed cardioprotective effects (e.g., gingko biloba, danshen and their active ingredients) are also substrates and inhibitors of drug transporters. Thus, to understand transporter-mediated natural product-CV drug interactions is important and some transporter-mediated interactions have already shown to have clinical relevance. In this review, we review the current knowledge on the role of ABC and SLC transporters in CV therapy, as well as transporter modulation by natural products used in CV diseases and their induced natural product-CV drug interactions through alterations of drug transport. We hope our review will aid in a comprehensive summary of transporter-mediated natural product-CV drug interactions and help public and physicians understand these type of interactions. Copyright © 2017. Published by Elsevier B.V.

  18. Blue Light Emitting Polyphenylene Dendrimers with Bipolar Charge Transport Moieties

    Directory of Open Access Journals (Sweden)

    Guang Zhang

    2016-10-01

    Full Text Available Two light-emitting polyphenylene dendrimers with both hole and electron transporting moieties were synthesized and characterized. Both molecules exhibited pure blue emission solely from the pyrene core and efficient surface-to-core energy transfers when characterized in a nonpolar environment. In particular, the carbazole- and oxadiazole-functionalized dendrimer (D1 manifested a pure blue emission from the pyrene core without showing intramolecular charge transfer (ICT in environments with increasing polarity. On the other hand, the triphenylamine- and oxadiazole-functionalized one (D2 displayed notable ICT with dual emission from both the core and an ICT state in highly polar solvents. D1, in a three-layer organic light emitting diode (OLED by solution processing gave a pure blue emission with Commission Internationale de l’Éclairage 1931 CIE xy = (0.16, 0.12, a peak current efficiency of 0.21 cd/A and a peak luminance of 2700 cd/m2. This represents the first reported pure blue dendrimer emitter with bipolar charge transport and surface-to-core energy transfer in OLEDs.

  19. Blue Light Emitting Polyphenylene Dendrimers with Bipolar Charge Transport Moieties.

    Science.gov (United States)

    Zhang, Guang; Auer-Berger, Manuel; Gehrig, Dominik W; Blom, Paul W M; Baumgarten, Martin; Schollmeyer, Dieter; List-Kratochvil, E J W; Müllen, Klaus

    2016-10-20

    Two light-emitting polyphenylene dendrimers with both hole and electron transporting moieties were synthesized and characterized. Both molecules exhibited pure blue emission solely from the pyrene core and efficient surface-to-core energy transfers when characterized in a nonpolar environment. In particular, the carbazole- and oxadiazole-functionalized dendrimer ( D1 ) manifested a pure blue emission from the pyrene core without showing intramolecular charge transfer (ICT) in environments with increasing polarity. On the other hand, the triphenylamine- and oxadiazole-functionalized one ( D2 ) displayed notable ICT with dual emission from both the core and an ICT state in highly polar solvents. D1 , in a three-layer organic light emitting diode (OLED) by solution processing gave a pure blue emission with Commission Internationale de l'Éclairage 1931 CIE xy = (0.16, 0.12), a peak current efficiency of 0.21 cd/A and a peak luminance of 2700 cd/m². This represents the first reported pure blue dendrimer emitter with bipolar charge transport and surface-to-core energy transfer in OLEDs.

  20. Dihedral angle control to improve the charge transport properties of conjugated polymers in organic field effect transistors

    Science.gov (United States)

    Dharmapurikar, Satej S.; Chithiravel, Sundaresan; Mane, Manoj V.; Deshmukh, Gunvant; Krishnamoorthy, Kothandam

    2018-03-01

    Diketopyrrolopyrrole (DPP) and i-Indigo (i-Ind) are two monomers that are widely explored as active materials in organic field effect transistor and solar cells. These two molecules showed impressive charge carrier mobility due to better packing that are facilitated by quadrupoles. We hypothesized that the copolymers of these monomers would also exhibit high charge carrier mobility. However, we envisioned that the dihedral angle at the connecting point between the monomers will play a crucial role in packing as well as charge transport. To understand the impact of dihedral angle on charge transport, we synthesized three copolymers, wherein the DPP was sandwiched between benzenes, thiophenes and furans. The copolymer of i-Indigo and furan comprising DPP showed a band gap of 1.4 eV with a very high dihedral angle of 179°. The polymer was found to pack better and the coherence length was found to be 112 Å. The hole carrier mobility of these polymer was found to be highest among the synthesized polymer i.e. 0.01 cm2/vs. The copolymer comprising benzene did not transport hole and electrons. The dihedral angle at the connecting point between i and Indigo and benzene DPP was 143 Å, which the packing and consequently charge transport properties.

  1. Charge Transport in Conjugated Materials: From Theoretical Models to Experimental Systems

    International Nuclear Information System (INIS)

    Olivier, Yoann; Cornil, Jerome; Muccioli, Luca; Zannoni, Claudio

    2008-01-01

    Charge carrier mobility is the key quantity to characterize the charge transport properties in devices. Based on earlier work of Baessler and co-workers, we set up a Monte-Carlo approach that allows us to calculate mobility using transfer rates derived from Marcus theory. The parameters entering into the rate expression are evaluated by means of different quantum-chemical techniques. Our approach is applied here to a model one-dimensional system made of pentacene molecules as well as to real systems such as crystalline structures and columnar liquid crystal phases.

  2. Proteins mediating intra- and intercellular transport of lipids and lipid-modified proteins

    NARCIS (Netherlands)

    Neumann, S.

    2008-01-01

    Proteins mediating intra- and intercellular transport of lipids and lipid-modified proteins In this thesis, I studied the intra- and intercellular transport of lipidic molecules, in particular glycosphingolipids and lipid-modified proteins. The first part focuses on the intracellular transport of

  3. The ATPases of cohesin interface with regulators to modulate cohesin-mediated DNA tethering

    Science.gov (United States)

    Çamdere, Gamze; Guacci, Vincent; Stricklin, Jeremiah; Koshland, Douglas

    2015-01-01

    Cohesin tethers together regions of DNA, thereby mediating higher order chromatin organization that is critical for sister chromatid cohesion, DNA repair and transcriptional regulation. Cohesin contains a heterodimeric ATP-binding Cassette (ABC) ATPase comprised of Smc1 and Smc3 ATPase active sites. These ATPases are required for cohesin to bind DNA. Cohesin’s DNA binding activity is also promoted by the Eco1 acetyltransferase and inhibited by Wpl1. Recently we showed that after cohesin stably binds DNA, a second step is required for DNA tethering. This second step is also controlled by Eco1 acetylation. Here, we use genetic and biochemical analyses to show that this second DNA tethering step is regulated by cohesin ATPase. Furthermore, our results also suggest that Eco1 promotes cohesion by modulating the ATPase cycle of DNA-bound cohesin in a state that is permissive for DNA tethering and refractory to Wpl1 inhibition. DOI: http://dx.doi.org/10.7554/eLife.11315.001 PMID:26583750

  4. The electro-optical and charge transport study of imidazolidin derivative: Quantum chemical investigations

    Directory of Open Access Journals (Sweden)

    Ahmad Irfan

    2016-11-01

    Full Text Available Imidazolidin derivatives gained significant attention in our daily life from better biological activity to the semiconducting materials. The present investigation deals with the in depth study of (Z-2-sulfanylidene-5-(thiophen-2-ylmethylideneimidazolidin-4-one (STMI with respect to their structural, electronic, optical and charge transport properties as semiconducting material. The ground and first excited state geometries were optimized by applying density functional theory (DFT and time dependent DFT, respectively. The light has been shed on the frontier molecular orbitals (FMOs and observed comprehensible intramolecular charge transfer (ICT from the highest occupied molecular orbitals (HOMOs to the lowest unoccupied molecular orbitals (LUMOs. The absorption, emission, ionization potentials (IP, electron affinities (EA, total and partial densities of states and structure-property relationship have been discussed. Finally, hole as well as electron reorganization energies, transfer integrals and intrinsic mobilities have been calculated then charge transport behavior of STMI was discussed, intensively.

  5. Charge transport through molecular switches

    International Nuclear Information System (INIS)

    Jan van der Molen, Sense; Liljeroth, Peter

    2010-01-01

    We review the fascinating research on charge transport through switchable molecules. In the past decade, detailed investigations have been performed on a great variety of molecular switches, including mechanically interlocked switches (rotaxanes and catenanes), redox-active molecules and photochromic switches (e.g. azobenzenes and diarylethenes). To probe these molecules, both individually and in self-assembled monolayers (SAMs), a broad set of methods have been developed. These range from low temperature scanning tunneling microscopy (STM) via two-terminal break junctions to larger scale SAM-based devices. It is generally found that the electronic coupling between molecules and electrodes has a profound influence on the properties of such molecular junctions. For example, an intrinsically switchable molecule may lose its functionality after it is contacted. Vice versa, switchable two-terminal devices may be created using passive molecules ('extrinsic switching'). Developing a detailed understanding of the relation between coupling and switchability will be of key importance for both future research and technology. (topical review)

  6. Charge transport through molecular switches

    Energy Technology Data Exchange (ETDEWEB)

    Jan van der Molen, Sense [Kamerlingh Onnes Laboratorium, Leiden University, Niels Bohrweg 2, 2333 CA Leiden (Netherlands); Liljeroth, Peter, E-mail: molen@physics.leidenuniv.n [Condensed Matter and Interfaces, Debye Institute for Nanomaterials Science, University of Utrecht, PO Box 80000, 3508 TA Utrecht (Netherlands)

    2010-04-07

    We review the fascinating research on charge transport through switchable molecules. In the past decade, detailed investigations have been performed on a great variety of molecular switches, including mechanically interlocked switches (rotaxanes and catenanes), redox-active molecules and photochromic switches (e.g. azobenzenes and diarylethenes). To probe these molecules, both individually and in self-assembled monolayers (SAMs), a broad set of methods have been developed. These range from low temperature scanning tunneling microscopy (STM) via two-terminal break junctions to larger scale SAM-based devices. It is generally found that the electronic coupling between molecules and electrodes has a profound influence on the properties of such molecular junctions. For example, an intrinsically switchable molecule may lose its functionality after it is contacted. Vice versa, switchable two-terminal devices may be created using passive molecules ('extrinsic switching'). Developing a detailed understanding of the relation between coupling and switchability will be of key importance for both future research and technology. (topical review)

  7. SLC injector simulation and tuning for high charge transport

    International Nuclear Information System (INIS)

    Yeremian, A.D.; Miller, R.H.; Clendenin, J.E.; Early, R.A.; Ross, M.C.; Turner, J.L.; Wang, J.W.

    1992-08-01

    We have simulated the SLC injector from the thermionic gun through the first accelerating section and used the resulting parameters to tune the injector for optimum performance and high charge transport. Simulations are conducted using PARMELA, a three-dimensional ray-trace code with a two-dimensional space-charge model. The magnetic field profile due to the existing magnetic optics is calculated using POISSON, while SUPERFISH is used to calculate the space harmonics of the various bunchers and the accelerator cavities. The initial beam conditions in the PARMELA code are derived from the EGUN model of the gun. The resulting injector parameters from the PARMELA simulation are used to prescribe experimental settings of the injector components. The experimental results are in agreement with the results of the integrated injector model

  8. Proteins mediating DNA loops effectively block transcription.

    Science.gov (United States)

    Vörös, Zsuzsanna; Yan, Yan; Kovari, Daniel T; Finzi, Laura; Dunlap, David

    2017-07-01

    Loops are ubiquitous topological elements formed when proteins simultaneously bind to two noncontiguous DNA sites. While a loop-mediating protein may regulate initiation at a promoter, the presence of the protein at the other site may be an obstacle for RNA polymerases (RNAP) transcribing a different gene. To test whether a DNA loop alters the extent to which a protein blocks transcription, the lac repressor (LacI) was used. The outcome of in vitro transcription along templates containing two LacI operators separated by 400 bp in the presence of LacI concentrations that produced both looped and unlooped molecules was visualized with scanning force microscopy (SFM). An analysis of transcription elongation complexes, moving for 60 s at an average of 10 nt/s on unlooped DNA templates, revealed that they more often surpassed LacI bound to the lower affinity O2 operator than to the highest affinity Os operator. However, this difference was abrogated in looped DNA molecules where LacI became a strong roadblock independently of the affinity of the operator. Recordings of transcription elongation complexes, using magnetic tweezers, confirmed that they halted for several minutes upon encountering a LacI bound to a single operator. The average pause lifetime is compatible with RNAP waiting for LacI dissociation, however, the LacI open conformation visualized in the SFM images also suggests that LacI could straddle RNAP to let it pass. Independently of the mechanism by which RNAP bypasses the LacI roadblock, the data indicate that an obstacle with looped topology more effectively interferes with transcription. © 2017 The Authors Protein Science published by Wiley Periodicals, Inc. on behalf of The Protein Society.

  9. Opto-electro-modulated transient photovoltage and photocurrent system for investigation of charge transport and recombination in solar cells.

    Science.gov (United States)

    Shi, Jiangjian; Li, Dongmei; Luo, Yanhong; Wu, Huijue; Meng, Qingbo

    2016-12-01

    An opto-electro-modulated transient photovoltage/photocurrent system has been developed to probe microscopic charge processes of a solar cell in its adjustable operating conditions. The reliability of this system is carefully determined by electric circuit simulations and experimental measurements. Using this system, the charge transport, recombination and storage properties of a conventional multicrystalline silicon solar cell under different steady-state bias voltages, and light illumination intensities are investigated. This system has also been applied to study the influence of the hole transport material layer on charge extraction and the microscopic charge processes behind the widely considered photoelectric hysteresis in perovskite solar cells.

  10. DNA polymerase I-mediated ultraviolet repair synthesis in toluene-treated Escherichia coli

    International Nuclear Information System (INIS)

    Dorson, J.W.; Moses, R.E.

    1978-01-01

    DNA synthesis after ultraviolet irradiation is low in wild type toluene-treated cells. The level of repair incorporation is greater in strains deficient in DNA polymerase I. The low level of repair synthesis is attributable to the concerted action of DNA polymerase I and polynucleotide ligase. Repair synthesis is stimulated by blocking ligase activity with the addition of nicotinamide mononucleotide (NMN) or the use of a ligase temperature-sensitive mutant. NMN stimulation is specific for DNA polymerase I-mediated repair synthesis, as it is absent in isogenic strains deficient in the polymerase function or the 5' yields 3' exonuclease function associated with DNA polymerase I. DNA synthesis that is stimulated by NMN is proportional to the ultraviolet exposure at low doses, nonconservative in nature, and is dependent on the uvrA gene product but is independent of the recA gene product. These criteria place this synthesis in the excision repair pathway. The NMN-stimulated repair synthesis requires ATP and is N-ethylmaleimide-resistant. The use of NMN provides a direct means for evaluating the involvement of DNA polymerase I in excision repair

  11. Stopped-flow kinetic studies of poly(amidoamine) dendrimer-calf thymus DNA to form dendriplexes.

    Science.gov (United States)

    Dey, Debabrata; Kumar, Santosh; Maiti, Souvik; Dhara, Dibakar

    2013-11-07

    Poly(amidoamine) (PAMAM) dendrimers are known to be highly efficient nonviral carriers in gene delivery. Dendrimer-mediated transfection is known to be a function of the dendrimer to DNA charge ratio as well as the size of the dendrimer. In the present study, the binding kinetics of four PAMAM dendrimers (G1, G2, G3, and G4) with calf thymus DNA (CT-DNA) has been studied using stopped-flow fluorescence spectroscopy. The effect of dendrimer-to-DNA charge ratio and dendrimer generation on the binding kinetics was investigated. In most cases, the results of dendrimer-CT-DNA binding can be explained by a two-step reaction mechanism: a rapid electrostatic binding between the dendrimer and DNA, followed by a conformational change of the dendrimer-DNA complex that ultimately leads to DNA condensation. It was observed that the charge ratio on the dendrimer and the DNA phosphate groups, as well as the dendrimer generation (size), has a marked effect on the kinetics of binding between the DNA and the dendrimers. The rate constant (k'1) of the first step was much higher compared to that of the second step (k'2), and both were found to increase with an increase in dendrimer concentration. Among the four generations of dendrimers, G4 exhibited significantly faster binding kinetics compared to the three smaller generation dendrimers.

  12. Charged Semiconductor Defects Structure, Thermodynamics and Diffusion

    CERN Document Server

    Seebauer, Edmund G

    2009-01-01

    The technologically useful properties of a solid often depend upon the types and concentrations of the defects it contains. Not surprisingly, defects in semiconductors have been studied for many years, in many cases with a view towards controlling their behavior through various forms of "defect engineering." For example, in the bulk, charging significantly affects the total concentration of defects that are available to mediate phenomena such as solid-state diffusion. Surface defects play an important role in mediating surface mass transport during high temperature processing steps such as epitaxial film deposition, diffusional smoothing in reflow, and nanostructure formation in memory device fabrication. Charged Semiconductor Defects details the current state of knowledge regarding the properties of the ionized defects that can affect the behavior of advanced transistors, photo-active devices, catalysts, and sensors. Features: Group IV, III-V, and oxide semiconductors; Intrinsic and extrinsic defects; and, P...

  13. Thickness dependent charge transport in ferroelectric BaTiO3 heterojunctions

    Science.gov (United States)

    Singh, Pooja; Rout, P. K.; Singh, Manju; Rakshit, R. K.; Dogra, Anjana

    2015-09-01

    We have investigated the effect of ferroelectric barium titanate (BaTiO3) film thickness on the charge transport mechanism in pulsed laser deposited epitaxial metal-ferroelectric semiconductor junctions. The current (I)-voltage (V) measurements across the junctions comprising of 20-500 nm thick BaTiO3 and conducting bottom electrode (Nb: SrTiO3 substrate or La2/3Ca1/3MnO3 buffer layer) demonstrate the space charge limited conduction. Further analysis indicates a reduction in the ratio of free to trapped carriers with increasing thickness in spite of decreasing trap density. Such behaviour arises the deepening of the shallow trap levels (I-V curves implies a bipolar resistive switching behaviour, which can be explained in terms of charge trapping and de-trapping process.

  14. Stochastic approach and fluctuation theorem for charge transport in diodes

    Science.gov (United States)

    Gu, Jiayin; Gaspard, Pierre

    2018-05-01

    A stochastic approach for charge transport in diodes is developed in consistency with the laws of electricity, thermodynamics, and microreversibility. In this approach, the electron and hole densities are ruled by diffusion-reaction stochastic partial differential equations and the electric field generated by the charges is determined with the Poisson equation. These equations are discretized in space for the numerical simulations of the mean density profiles, the mean electric potential, and the current-voltage characteristics. Moreover, the full counting statistics of the carrier current and the measured total current including the contribution of the displacement current are investigated. On the basis of local detailed balance, the fluctuation theorem is shown to hold for both currents.

  15. Adaptive tree multigrids and simplified spherical harmonics approximation in deterministic neutral and charged particle transport

    International Nuclear Information System (INIS)

    Kotiluoto, P.

    2007-05-01

    A new deterministic three-dimensional neutral and charged particle transport code, MultiTrans, has been developed. In the novel approach, the adaptive tree multigrid technique is used in conjunction with simplified spherical harmonics approximation of the Boltzmann transport equation. The development of the new radiation transport code started in the framework of the Finnish boron neutron capture therapy (BNCT) project. Since the application of the MultiTrans code to BNCT dose planning problems, the testing and development of the MultiTrans code has continued in conventional radiotherapy and reactor physics applications. In this thesis, an overview of different numerical radiation transport methods is first given. Special features of the simplified spherical harmonics method and the adaptive tree multigrid technique are then reviewed. The usefulness of the new MultiTrans code has been indicated by verifying and validating the code performance for different types of neutral and charged particle transport problems, reported in separate publications. (orig.)

  16. Germline stem cell gene PIWIL2 mediates DNA repair through relaxation of chromatin.

    Directory of Open Access Journals (Sweden)

    De-Tao Yin

    Full Text Available DNA damage response (DDR is an intrinsic barrier of cell to tumorigenesis initiated by genotoxic agents. However, the mechanisms underlying the DDR are not completely understood despite of extensive investigation. Recently, we have reported that ectopic expression of germline stem cell gene PIWIL2 is associated with tumor stem cell development, although the underlying mechanisms are largely unknown. Here we show that PIWIL2 is required for the repair of DNA-damage induced by various types of genotoxic agents. Upon ultraviolet (UV irradiation, silenced PIWIL2 gene in normal human fibroblasts was transiently activated after treatment with UV light. This activation was associated with DNA repair, because Piwil2-deficienct mouse embryonic fibroblasts (mili(-/- MEFs were defective in cyclobutane pyrimidine dimers (CPD repair after UV treatment. As a result, the UV-treated mili(-/- MEFs were more susceptible to apoptosis, as characterized by increased levels of DNA damage-associated apoptotic proteins, such as active caspase-3, cleaved Poly (ADP-ribose polymerase (PARP and Bik. The impaired DNA repair in the mili(-/- MEFs was associated with the reductions of histone H3 acetylation and chromatin relaxation, although the DDR pathway downstream chromatin relaxation appeared not to be directly affected by Piwil2. Moreover, guanine-guanine (Pt-[GG] and double strand break (DSB repair were also defective in the mili(-/- MEFs treated by genotoxic chemicals Cisplatin and ionizing radiation (IR, respectively. The results indicate that Piwil2 can mediate DNA repair through an axis of Piwil2 → histone acetylation → chromatin relaxation upstream DDR pathways. The findings reveal a new role for Piwil2 in DNA repair and suggest that Piwil2 may act as a gatekeeper against DNA damage-mediated tumorigenesis.

  17. Mass and charge transport in micro and nanofluidic channels

    DEFF Research Database (Denmark)

    Mortensen, Niels Asger; Olesen, Laurits Højgaard; Okkels, Fridolin

    2007-01-01

    and charge transport coefficients that satisfy Onsager relations. In the limit of nonoverlapping Debye layers the transport coefficients are simply expressed in terms of parameters of the electrolyte as well as the hydraulic radiusR ¼ 2A=P with Aand P being the cross-sectional area and perimeter......, respectively. In particular, we consider the limits of thin nonoverlapping as well as strongly overlapping Debye layers, respectively, and calculate the corrections to the hydraulic resistance due to electrohydrodynamic interactions.......We consider laminar flow of incompressible electrolytes in long, straight channels driven by pressure and electroosmosis. We use aHilbert space eigenfunction expansion to address the general problem of an arbitrary cross section and obtain general results in linear-response theory for the mass...

  18. Efficient Transformation of Oil Palm Protoplasts by PEG-Mediated Transfection and DNA Microinjection

    Science.gov (United States)

    Masani, Mat Yunus Abdul; Noll, Gundula A.; Parveez, Ghulam Kadir Ahmad; Sambanthamurthi, Ravigadevi; Prüfer, Dirk

    2014-01-01

    Background Genetic engineering remains a major challenge in oil palm (Elaeis guineensis) because particle bombardment and Agrobacterium-mediated transformation are laborious and/or inefficient in this species, often producing chimeric plants and escapes. Protoplasts are beneficial as a starting material for genetic engineering because they are totipotent, and chimeras are avoided by regenerating transgenic plants from single cells. Novel approaches for the transformation of oil palm protoplasts could therefore offer a new and efficient strategy for the development of transgenic oil palm plants. Methodology/Principal Findings We recently achieved the regeneration of healthy and fertile oil palms from protoplasts. Therefore, we focused on the development of a reliable PEG-mediated transformation protocol for oil palm protoplasts by establishing and validating optimal heat shock conditions, concentrations of DNA, PEG and magnesium chloride, and the transfection procedure. We also investigated the transformation of oil palm protoplasts by DNA microinjection and successfully regenerated transgenic microcalli expressing green fluorescent protein as a visible marker to determine the efficiency of transformation. Conclusions/Significance We have established the first successful protocols for the transformation of oil palm protoplasts by PEG-mediated transfection and DNA microinjection. These novel protocols allow the rapid and efficient generation of non-chimeric transgenic callus and represent a significant milestone in the use of protoplasts as a starting material for the development of genetically-engineered oil palm plants. PMID:24821306

  19. Charge transport kinetics in a robust radical-substituted polymer/nanocarbon composite electrode

    Science.gov (United States)

    Sato, Kan; Oyaizu, Kenichi; Nishide, Hiroyuki

    We have reported a series of organic radical-substituted polymers as new-type charge storage and transport materials which could be used for energy related devices such as batteries and solar cells. Redox-active radical moieties introduced to the non-conjugated polymer backbones enable the rapid electron transfer among the adjacent radical sites, and thus large diffusive flux of electrical charge at a bulk scale. Here we present the elucidated charge transport kinetics in a radical polymer/single-walled carbon nanotube (SWNT) composite electrode. The synergetic effect of electrical conduction by a three-dimensional SWNT network and electron self-exchange reaction by radical polymers contributed to the 105-fold (per 1 g of added SWNT) boosting of electrochemical reactions and exceptionally large current density (greater than 1 A/cm2) as a rechargeable electrode. A totally organic-based secondary battery with a submicron thickness was fabricated to demonstrate the splendid electrochemical performances. Grants-in-Aid for Scientific Research (No. 24225003, 15J00888) and the Leading Graduate Program in Science and Engineering, from the Japanese Ministry of Education, Culture, Sports, Science and Technology (MEXT).

  20. Charge transport in disordered organic host-guest systems: effects of carrier density and electric field

    NARCIS (Netherlands)

    Yimer, Y.Y.; Bobbert, P.A.; Coehoorn, R.

    2008-01-01

    We investigate charge transport in disordered organic host–guest systems with a bimodal Gaussian density of states (DOS). The energy difference between the two Gaussians defines the trap depth. By solving the Pauli master equation for the hopping of charge carriers on a regular lattice with site

  1. Transition from direct to inverted charge transport Marcus regions in molecular junctions via molecular orbital gating

    Science.gov (United States)

    Yuan, Li; Wang, Lejia; Garrigues, Alvar R.; Jiang, Li; Annadata, Harshini Venkata; Anguera Antonana, Marta; Barco, Enrique; Nijhuis, Christian A.

    2018-04-01

    Solid-state molecular tunnel junctions are often assumed to operate in the Landauer regime, which describes essentially activationless coherent tunnelling processes. In solution, on the other hand, charge transfer is described by Marcus theory, which accounts for thermally activated processes. In practice, however, thermally activated transport phenomena are frequently observed also in solid-state molecular junctions but remain poorly understood. Here, we show experimentally the transition from the Marcus to the inverted Marcus region in a solid-state molecular tunnel junction by means of intra-molecular orbital gating that can be tuned via the chemical structure of the molecule and applied bias. In the inverted Marcus region, charge transport is incoherent, yet virtually independent of temperature. Our experimental results fit well to a theoretical model that combines Landauer and Marcus theories and may have implications for the interpretation of temperature-dependent charge transport measurements in molecular junctions.

  2. Experimental study on the supercritical startup and heat transport capability of a neon-charged cryogenic loop heat pipe

    International Nuclear Information System (INIS)

    Guo, Yuandong; Lin, Guiping; He, Jiang; Bai, Lizhan; Zhang, Hongxing; Miao, Jianyin

    2017-01-01

    Highlights: • A neon-charged CLHP integrated with a G-M cryocooler was designed and investigated. • The CLHP can realize the supercritical startup with an auxiliary heat load of 1.5 W. • Maximum heat transport capability of the CLHP was 4.5 W over a distance of 0.6 m. • There existed an optimum auxiliary heat load to expedite the supercritical startup. • There existed an optimum charged pressure to reach the largest heat transfer limit. - Abstract: Neon-charged cryogenic loop heat pipe (CLHP) can realize efficient cryogenic heat transport in the temperature range of 30–40 K, and promises great application potential in the thermal control of future space infrared exploration system. In this work, extensive experimental studies on the supercritical startup and heat transport capability of a neon-charged CLHP integrated with a G-M cryocooler were carried out, where the effects of the auxiliary heat load applied to the secondary evaporator and charged pressure of the working fluid were investigated. Experimental results showed that the CLHP could successfully realize the supercritical startup with an auxiliary heat load of 1.5 W, and there existed an optimum auxiliary heat load and charged pressure of the working fluid respectively, to achieve the maximum temperature drop rate of the primary evaporator during the supercritical startup. The CLHP could reach a maximum heat transport capability of 4.5 W over a distance of 0.6 m corresponding to the optimum charged pressure of the working fluid; however, the heat transport capability decreased with the increase of the auxiliary heat load. Furthermore, the inherent mechanisms responsible for the phenomena observed in the experiments were analyzed and discussed, to provide a better understanding from the theoretical view.

  3. Effect of backbone structure on charge transport along isolated conjugated polymer chains

    International Nuclear Information System (INIS)

    Siebbeles, Laurens D.A.; Grozema, Ferdinand C.; Haas, Matthijs P. de; Warman, John M.

    2005-01-01

    Fast charge transport in conjugated polymers is essential for their application in opto-electronic devices. In the present paper, measurements and theoretical modeling of the mobility of excess charges along isolated chains of conjugated polymers in dilute solution are presented. Charge carriers were produced by irradiation of the polymer solution with 3-MeV electrons from a Van de Graaff accelerator. The mobilities of the charges along the polymer chains were obtained from time-resolved microwave conductivity measurements. The mobilities are strongly dependent on the chemical nature of the polymer backbone. Comparison of the experimental data with results from ab initio quantum mechanical calculations shows that the measured mobilities are strongly limited by torsional disorder, chemical defects and chain ends. Improvement of the structure of polymer backbones is therefore expected to significantly enhance the performance of these materials in 'plastic electronics'

  4. Description of bipolar charge transport in polyethylene using a fluid model with a constant mobility: model prediction

    International Nuclear Information System (INIS)

    Le Roy, S; Segur, P; Teyssedre, G; Laurent, C

    2004-01-01

    We present a conduction model aimed at describing bipolar transport and space charge phenomena in low density polyethylene under dc stress. In the first part we recall the basic requirements for the description of charge transport and charge storage in disordered media with emphasis on the case of polyethylene. A quick review of available conduction models is presented and our approach is compared with these models. Then, the bases of the model are described and related assumptions are discussed. Finally, results on external current, trapped and free space charge distributions, field distribution and recombination rate are presented and discussed, considering a constant dc voltage, a step-increase of the voltage, and a polarization-depolarization protocol for the applied voltage. It is shown that the model is able to describe the general features reported for external current, electroluminescence and charge distribution in polyethylene

  5. Symmetry properties of the transport coefficients of charged particles in disordered materials

    International Nuclear Information System (INIS)

    Baird, J.K.

    1979-01-01

    The transport coefficients of a charged particle in an isotropic material are shown to be even functions of the applied electric field. We discuss the limitation which this result and its consequences place upon formulae used to represent these coefficients

  6. Mitochondrial DNA as an inflammatory mediator in cardiovascular diseases.

    Science.gov (United States)

    Nakayama, Hiroyuki; Otsu, Kinya

    2018-03-06

    Mitochondria play a central role in multiple cellular functions, including energy production, calcium homeostasis, and cell death. Currently, growing evidence indicates the vital roles of mitochondria in triggering and maintaining inflammation. Chronic inflammation without microbial infection - termed sterile inflammation - is strongly involved in the development of heart failure. Sterile inflammation is triggered by the activation of pattern recognition receptors (PRRs) that sense endogenous ligands called damage-associated molecular patterns (DAMPs). Mitochondria release multiple DAMPs including mitochondrial DNA, peptides, and lipids, which induce inflammation via the stimulation of multiple PRRs. Among the mitochondrial DAMPs, mitochondrial DNA (mtDNA) is currently highlighted as the DAMP that mediates the activation of multiple PRRs, including Toll-like receptor 9, Nod-like receptors, and cyclic GMP-AMP synthetase/stimulator of interferon gene pathways. These PRR signalling pathways, in turn, lead to the activation of nuclear factor-κB and interferon regulatory factor, which enhances the transcriptional activity of inflammatory cytokines and interferons, and induces the recruitment of inflammatory cells. As the heart is an organ comprising abundant mitochondria for its ATP consumption (needed to maintain constant cyclic contraction and relaxation), the generation of massive amounts of mitochondrial radical oxygen species and mitochondrial DAMPs are predicted to occur and promote cardiac inflammation. Here, we will focus on the role of mtDNA in cardiac inflammation and review the mechanism and pathological significance of mtDNA-induced inflammatory responses in cardiac diseases. © 2018 The Author(s).

  7. Virus-sized self-assembling lamellar complexes between plasmid DNA and cationic micelles promote gene transfer

    Science.gov (United States)

    Pitard, Bruno; Aguerre, Olivier; Airiau, Marc; Lachagès, Anne-Marie; Boukhnikachvili, Tsiala; Byk, Gérardo; Dubertret, Catherine; Herviou, Christian; Scherman, Daniel; Mayaux, Jean-François; Crouzet, Joël

    1997-01-01

    Gene therapy is based on the vectorization of genes to target cells and their subsequent expression. Cationic amphiphile-mediated delivery of plasmid DNA is the nonviral gene transfer method most often used. We examined the supramolecular structure of lipopolyamine/plasmid DNA complexes under various condensing conditions. Plasmid DNA complexation with lipopolyamine micelles whose mean diameter was 5 nm revealed three domains, depending on the lipopolyamine/plasmid DNA ratio. These domains respectively corresponded to negatively, neutrally, and positively charged complexes. Transmission electron microscopy and x-ray scattering experiments on complexes originating from these three domains showed that although their morphology depends on the lipopolyamine/plasmid DNA ratio, their particle structure consists of ordered domains characterized by even spacing of 80 Å, irrespective of the lipid/DNA ratio. The most active lipopolyamine/DNA complexes for gene transfer were positively charged. They were characterized by fully condensed DNA inside spherical particles (diameter: 50 nm) sandwiched between lipid bilayers. These results show that supercoiled plasmid DNA is able to transform lipopolyamine micelles into a supramolecular organization characterized by ordered lamellar domains. PMID:9405626

  8. Charge transport in disordered organic host-guest systems: effects of carrier density and electric field

    NARCIS (Netherlands)

    Yimer, Y.Y.; Bobbert, P.A.; Coehoorn, R.

    2009-01-01

    We investigate charge transport in disordered organic host–guest systems with a bimodal Gaussian density of states. The energy difference between the peaks of the two Gaussians defines the trap depth. By solving the Pauli master equation for the hopping of charge carriers on a regular lattice we

  9. Photothermal Transport of DNA in Entropy-Landscape Plasmonic Waveguides

    DEFF Research Database (Denmark)

    Smith, Cameron; Thilsted, Anil Haraksingh; Pedersen, Jonas Nyvold

    2017-01-01

    landscapes. Separately, a range of plasmonic configurations have demonstrated active manipulation of nano-objects by harnessing concentrated electric fields. The integration of these two independent techniques promises a range of sophisticated and complementary functions to handle, for example, DNA...... photothermal transport of DNA through the losses of plasmonic modes. The propulsive forces, assisted by in-coupling to propagating channel plasmon polaritons, extend along the V-grooves with a directed motion up to ≈0.5 μm·mW-1 away from the input beam and λ-DNA velocities reaching ≈0.2 μm·s-1·mW-1....... The entropic trapping enables the V-grooves to be flexibly loaded and unloaded with DNA by variation of transverse fluid flow, a process that is selective to biopolymers versus fixed-shape objects and also allows the technique to address the challenges of nanoscale interaction volumes. Our self-aligning, light...

  10. Coulombic interactions and multicomponent ionic dispersion during transport of charged species in heterogeneous porous media

    DEFF Research Database (Denmark)

    Muniruzzaman, Muhammad; Rolle, Massimo

    Electrochemical cross-coupling plays a significant role for transport of charged species in porous media [1, 2]. In this study we performed flow-through experiments in a quasi two-dimensional setup using dilute solutions of strong electrolytes to study the influence of charge interactions on mass...... occurred. To quantitatively interpret the outcomes of our laboratory experiments in the spatially variable flow fields we developed a two dimensional numerical model based on a multicomponent formulation, on charge conservation and on the accurate description of transverse dispersion. The results...... of the multicomponent transport simulations were compared with the high-resolution (5 mm spacing) concentration measurements of the ionic species at the outlet of the flow-through domain. The excellent agreement between the measured concentrations and the results of purely forward numerical simulations demonstrates...

  11. Effects of Confinement on Microstructure and Charge Transport in High Performance Semicrystalline Polymer Semiconductors

    KAUST Repository

    Himmelberger, Scott

    2012-11-23

    The film thickness of one of the most crystalline and highest performing polymer semiconductors, poly(2,5-bis(3-tetradecylthiophen-2-yl)thieno[3,2-b] thiophene) (PBTTT), is varied in order to determine the effects of interfaces and confinement on the microstructure and performance in organic field effect transistors (OFETs). Crystalline texture and overall film crystallinity are found to depend strongly on film thickness and thermal processing. The angular distribution of crystallites narrows upon both a decrease in film thickness and thermal annealing. These changes in the film microstructure are paired with thin-film transistor characterization and shown to be directly correlated with variations in charge carrier mobility. Charge transport is shown to be governed by film crystallinity in films below 20 nm and by crystalline orientation for thicker films. An optimal thickness is found for PBTTT at which the mobility is maximized in unannealed films and where mobility reaches a plateau at its highest value for annealed films. The effects of confinement on the morphology and charge transport properties of poly(2,5-bis(3-tetradecylthiophen-2-yl) thieno[3,2-b]thiophene) (PBTTT) are studied using quantitative X-ray diffraction and field-effect transistor measurements. Polymer crystallinity is found to limit charge transport in the thinnest films while crystalline texture and intergrain connectivity modulate carrier mobility in thicker films. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Effects of Confinement on Microstructure and Charge Transport in High Performance Semicrystalline Polymer Semiconductors

    KAUST Repository

    Himmelberger, Scott; Dacuñ a, Javier; Rivnay, Jonathan; Jimison, Leslie H.; McCarthy-Ward, Thomas; Heeney, Martin; McCulloch, Iain; Toney, Michael F.; Salleo, Alberto

    2012-01-01

    The film thickness of one of the most crystalline and highest performing polymer semiconductors, poly(2,5-bis(3-tetradecylthiophen-2-yl)thieno[3,2-b] thiophene) (PBTTT), is varied in order to determine the effects of interfaces and confinement on the microstructure and performance in organic field effect transistors (OFETs). Crystalline texture and overall film crystallinity are found to depend strongly on film thickness and thermal processing. The angular distribution of crystallites narrows upon both a decrease in film thickness and thermal annealing. These changes in the film microstructure are paired with thin-film transistor characterization and shown to be directly correlated with variations in charge carrier mobility. Charge transport is shown to be governed by film crystallinity in films below 20 nm and by crystalline orientation for thicker films. An optimal thickness is found for PBTTT at which the mobility is maximized in unannealed films and where mobility reaches a plateau at its highest value for annealed films. The effects of confinement on the morphology and charge transport properties of poly(2,5-bis(3-tetradecylthiophen-2-yl) thieno[3,2-b]thiophene) (PBTTT) are studied using quantitative X-ray diffraction and field-effect transistor measurements. Polymer crystallinity is found to limit charge transport in the thinnest films while crystalline texture and intergrain connectivity modulate carrier mobility in thicker films. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Crossover from band-like to thermally activated charge transport in organic transistors due to strain-induced traps

    KAUST Repository

    Mei, Yaochuan; Diemer, Peter J.; Niazi, Muhammad Rizwan; Hallani, Rawad K.; Jarolimek, Karol; Day, Cynthia S.; Risko, Chad; Anthony, John E.; Amassian, Aram; Jurchescu, Oana D.

    2017-01-01

    The temperature dependence of the charge-carrier mobility provides essential insight into the charge transport mechanisms in organic semiconductors. Such knowledge imparts critical understanding of the electrical properties of these materials

  14. Design study of low-energy beam transport for multi-charge beams at RAON

    Science.gov (United States)

    Bahng, Jungbae; Qiang, Ji; Kim, Eun-San

    2015-12-01

    The Rare isotope Accelerator Of Newness (RAON) at the Rare Isotope Science Project (RISP) is being designed to simultaneously accelerate beams with multiple charge states. It includes a driver superconducting (SC) linac for producing 200 MeV/u and 400 kW continuous wave (CW) heavy ion beams from protons to uranium. The RAON consists of a few electron cyclotron resonance ion sources, a low-energy beam transport (LEBT) system, a CW 81.25 MHz, 500 keV/u radio frequency quadrupole (RFQ) accelerator, a medium-energy beam transport system, the SC linac, and a charge-stripper system. The LEBT system for the RISP accelerator facility consists of a high-voltage platform, two 90° dipoles, a multi-harmonic buncher (MHB), solenoids, electrostatic quadrupoles, a velocity equalizer, and a diagnostic system. The ECR ion sources are located on a high-voltage platform to reach an initial beam energy of 10 keV/u. After extraction, the ion beam is transported through the LEBT system to the RFQ accelerator. The generated charge states are selected by an achromatic bending system and then bunched by the MHB in the LEBT system. The MHB is used to achieve a small longitudinal emittance in the RFQ by generating a sawtooth wave with three harmonics. In this paper, we present the results and issues of the beam dynamics of the LEBT system.

  15. Design study of low-energy beam transport for multi-charge beams at RAON

    Energy Technology Data Exchange (ETDEWEB)

    Bahng, Jungbae [Department of Physics, Kyungpook National University, Daegu 41566 (Korea, Republic of); Qiang, Ji [Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Kim, Eun-San, E-mail: eskim1@korea.ac.kr [Department of Accelerator Science, Graduate School, Korea University Sejong Campus, Sejong 30019 (Korea, Republic of)

    2015-12-21

    The Rare isotope Accelerator Of Newness (RAON) at the Rare Isotope Science Project (RISP) is being designed to simultaneously accelerate beams with multiple charge states. It includes a driver superconducting (SC) linac for producing 200 MeV/u and 400 kW continuous wave (CW) heavy ion beams from protons to uranium. The RAON consists of a few electron cyclotron resonance ion sources, a low-energy beam transport (LEBT) system, a CW 81.25 MHz, 500 keV/u radio frequency quadrupole (RFQ) accelerator, a medium-energy beam transport system, the SC linac, and a charge-stripper system. The LEBT system for the RISP accelerator facility consists of a high-voltage platform, two 90° dipoles, a multi-harmonic buncher (MHB), solenoids, electrostatic quadrupoles, a velocity equalizer, and a diagnostic system. The ECR ion sources are located on a high-voltage platform to reach an initial beam energy of 10 keV/u. After extraction, the ion beam is transported through the LEBT system to the RFQ accelerator. The generated charge states are selected by an achromatic bending system and then bunched by the MHB in the LEBT system. The MHB is used to achieve a small longitudinal emittance in the RFQ by generating a sawtooth wave with three harmonics. In this paper, we present the results and issues of the beam dynamics of the LEBT system.

  16. Yields of clustered DNA damage induced by charged-particle radiations of similar kinetic energy per nucleon: LET dependence in different DNA microenvironments

    International Nuclear Information System (INIS)

    Keszenman, D.J.; Sutherland, B.M.

    2010-01-01

    To determine the linear energy transfer (LET) dependence of the biological effects of densely ionizing radiation in relation to changes in the ionization density along the track, we measured the yields and spectrum of clustered DNA damages induced by charged particles of different atomic number but similar kinetic energy per nucleon in different DNA microenvironments. Yeast DNA embedded in agarose in solutions of different free radical scavenging capacity was irradiated with 1 GeV protons, 1 GeV/nucleon oxygen ions, 980 MeV/nucleon titanium ions or 968 MeV/nucleon iron ions. The frequencies of double-strand breaks (DSBs), abasic sites and oxypurine clusters were quantified. The total DNA damage yields per absorbed dose induced in non-radioquenching solution decreased with LET, with minor variations in radioquenching conditions being detected. However, the total damage yields per particle fluence increased with LET in both conditions, indicating a higher efficiency per particle to induce clustered DNA damages. The yields of DSBs and non-DSB clusters as well as the damage spectra varied with LET and DNA milieu, suggesting the involvement of more than one mechanism in the formation of the different types of clustered damages.

  17. Theory of thermal and charge transport in diffusive normal metal / superconductor junctions

    NARCIS (Netherlands)

    Yokoyama, T.; Tanaka, Y.; Golubov, Alexandre Avraamovitch; Asano, Y.

    2005-01-01

    Thermal and charge transport in diffusive normal metal (DN)/insulator/s-, d-, and p-wave superconductor junctions are studied based on the Usadel equation with the Nazarov's generalized boundary condition. We derive a general expression of the thermal conductance in unconventional superconducting

  18. Electrochemical DNA biosensor based on grafting-to mode of terminal deoxynucleoside transferase-mediated extension.

    Science.gov (United States)

    Chen, Jinyuan; Liu, Zhoujie; Peng, Huaping; Zheng, Yanjie; Lin, Zhen; Liu, Ailin; Chen, Wei; Lin, Xinhua

    2017-12-15

    Previously reported electrochemical DNA biosensors based on in-situ polymerization approach reveal that terminal deoxynucleoside transferase (TdTase) has good amplifying performance and promising application in the design of electrochemical DNA biosensor. However, this method, in which the background is significantly affected by the amount of TdTase, suffers from being easy to produce false positive result and poor stability. Herein, we firstly present a novel electrochemical DNA biosensor based on grafting-to mode of TdTase-mediated extension, in which DNA targets are polymerized in homogeneous solution and then hybridized with DNA probes on BSA-based DNA carrier platform. It is surprising to find that the background in the grafting-to mode of TdTase-based electrochemical DNA biosensor have little interference from the employed TdTase. Most importantly, the proposed electrochemical DNA biosensor shows greatly improved detection performance over the in-situ polymerization approach-based electrochemical DNA biosensor. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Charge transport mechanism in p-type copper ion containing triazine thiolate metallopolymer thin film devices

    Science.gov (United States)

    K, Deepak; Roy, Amit; Anjaneyulu, P.; Kandaiah, Sakthivel; Pinjare, Sampatrao L.

    2017-10-01

    The charge transport mechanism in copper ions containing 1,3,5-Triazine-2,4,6-trithiolate (CuTCA) based polymer device in sandwich (Ag/CuTCA/Cu) geometry is studied. The current-voltage (I-V) characteristics of the metallopolymer CuTCA device have shown a transition in the charge transport mechanism from Ohmic to Space-charge limited conduction when temperature and voltage are varied. The carriers in CuTCA devices exhibit hopping transport, in which carriers hop from one site to the other. The hole mobility in this polymer device is found to be dependent on electric field E ( μpα√{E } ) and temperature, which suggests that the polymer has inherent disorder. The electric-field coefficient γ and zero-field mobility μ0 are temperature dependent. The values of mobility and activation energies are estimated from temperature (90-140 K) dependent charge transport studies and found to be in the range of 1 × 10-11-8 × 10-12 m2/(V s) and 16.5 meV, respectively. Temperature dependent electric-field coefficient γ is in the order of 17.8 × 10-4 (m/V)1/2, and the value of zero-field mobility μ0 is in the order of 1.2 × 10-11 m2/(V s) at 140 K. A constant phase element (Q) is used to model the device parameters, which are extracted using the Impedance spectroscopy technique. The bandgap of the polymer is estimated to be 2.6 eV from UV-Vis reflectance spectra.

  20. Scientific Computation Application Partnerships in Materials and Chemical Sciences, Charge Transfer and Charge Transport in Photoactivated Systems, Developing Electron-Correlated Methods for Excited State Structure and Dynamics in the NWChem Software Suite

    Energy Technology Data Exchange (ETDEWEB)

    Cramer, Christopher J. [Univ. of Minnesota, Minneapolis, MN (United States)

    2017-11-12

    Charge transfer and charge transport in photoactivated systems are fundamental processes that underlie solar energy capture, solar energy conversion, and photoactivated catalysis, both organometallic and enzymatic. We developed methods, algorithms, and software tools needed for reliable treatment of the underlying physics for charge transfer and charge transport, an undertaking with broad applicability to the goals of the fundamental-interaction component of the Department of Energy Office of Basic Energy Sciences and the exascale initiative of the Office of Advanced Scientific Computing Research.

  1. Noise And Charge Transport In Carbon Nanotube Devices

    Science.gov (United States)

    Reza, Shahed; Huynh, Quyen T.; Bosman, Gijs; Sippel, Jennifer; Rinzler, Andrew G.

    2005-11-01

    The charge transport and noise properties of three terminal, gated devices containing multiple, single wall, metallic and semiconductor carbon nanotubes have been measured as a function of gate and drain bias at 300K. Using pulsed bias the metallic tubes could be burned sequentially enabling the separation of measured conductance and low frequency excess noise into metallic and semiconductor contributions. The relative low frequency excess noise of the metallic tubes was about a factor 100 lower than that of the semiconductor tubes, whereas the conductance of the metallic tubes was significantly higher (10 to 50 times) than that of the semiconductor tubes.

  2. Temperature-dependent charge injection and transport in pentacene thin-film transistors

    International Nuclear Information System (INIS)

    Kim, Dong Wook; Shin, Hyunji; Choi, Jong Sun; Park, Ji-Ho; Park, Jaehoon

    2015-01-01

    The electrical characteristics of p-channel pentacene thin-film transistors (TFTs) were analyzed at different operating temperatures ranging from 253 to 353 K. An improvement in the drain current and field-effect mobility of the pentacene TFTs is observed with increasing temperature. From the Arrhenius plots of field-effect mobility extracted at various temperatures, a lower activation energy of 99.34 meV was obtained when the device is operating in the saturation region. Such observation is ascribed to the thermally activated hole transport through the pentacene grain boundaries. On the other hand, it was found that the Au/pentacene contact significantly affects the TFTs electrical characteristics in the linear region, which resulted in a higher activation energy. The activation energy based on the linear field-effect mobility, which increased from 344.61 to 444.70 meV with decreasing temperature, implies the charge-injection-limited electrical behavior of pentacene TFTs at low temperatures. The thermally induced electrical characteristic variations in pentacene TFTs can thus be studied through the temperature dependence of the charge injection and transport processes. (paper)

  3. Mycobacterial nonhomologous end joining mediates mutagenic repair of chromosomal double-strand DNA breaks.

    Science.gov (United States)

    Stephanou, Nicolas C; Gao, Feng; Bongiorno, Paola; Ehrt, Sabine; Schnappinger, Dirk; Shuman, Stewart; Glickman, Michael S

    2007-07-01

    Bacterial nonhomologous end joining (NHEJ) is a recently described DNA repair pathway best characterized in mycobacteria. Bacterial NHEJ proteins LigD and Ku have been analyzed biochemically, and their roles in linear plasmid repair in vivo have been verified genetically; yet the contributions of NHEJ to repair of chromosomal DNA damage are unknown. Here we use an extensive set of NHEJ- and homologous recombination (HR)-deficient Mycobacterium smegmatis strains to probe the importance of HR and NHEJ in repairing diverse types of chromosomal DNA damage. An M. smegmatis Delta recA Delta ku double mutant has no apparent growth defect in vitro. Loss of the NHEJ components Ku and LigD had no effect on sensitivity to UV radiation, methyl methanesulfonate, or quinolone antibiotics. NHEJ deficiency had no effect on sensitivity to ionizing radiation in logarithmic- or early-stationary-phase cells but was required for ionizing radiation resistance in late stationary phase in 7H9 but not LB medium. In addition, NHEJ components were required for repair of I-SceI mediated chromosomal double-strand breaks (DSBs), and in the absence of HR, the NHEJ pathway rapidly mutates the chromosomal break site. The molecular outcomes of NHEJ-mediated chromosomal DSB repair involve predominantly single-nucleotide insertions at the break site, similar to previous findings using plasmid substrates. These findings demonstrate that prokaryotic NHEJ is specifically required for DSB repair in late stationary phase and can mediate mutagenic repair of homing endonuclease-generated chromosomal DSBs.

  4. Caulimoviridae Tubule-Guided Transport Is Dictated by Movement Protein Properties ▿

    Science.gov (United States)

    Sánchez-Navarro, Jesús; Fajardo, Thor; Zicca, Stefania; Pallás, Vicente; Stavolone, Livia

    2010-01-01

    Plant viruses move through plasmodesmata (PD) either as nucleoprotein complexes (NPCs) or as tubule-guided encapsidated particles with the help of movement proteins (MPs). To explore how and why MPs specialize in one mechanism or the other, we tested the exchangeability of MPs encoded by DNA and RNA virus genomes by means of an engineered alfalfa mosaic virus (AMV) system. We show that Caulimoviridae (DNA genome virus) MPs are competent for RNA virus particle transport but are unable to mediate NPC movement, and we discuss this restriction in terms of the evolution of DNA virus MPs as a means of mediating DNA viral genome entry into the RNA-trafficking PD pathway. PMID:20130061

  5. A multi-agent quantum Monte Carlo model for charge transport: Application to organic field-effect transistors

    International Nuclear Information System (INIS)

    Bauer, Thilo; Jäger, Christof M.; Jordan, Meredith J. T.; Clark, Timothy

    2015-01-01

    We have developed a multi-agent quantum Monte Carlo model to describe the spatial dynamics of multiple majority charge carriers during conduction of electric current in the channel of organic field-effect transistors. The charge carriers are treated by a neglect of diatomic differential overlap Hamiltonian using a lattice of hydrogen-like basis functions. The local ionization energy and local electron affinity defined previously map the bulk structure of the transistor channel to external potentials for the simulations of electron- and hole-conduction, respectively. The model is designed without a specific charge-transport mechanism like hopping- or band-transport in mind and does not arbitrarily localize charge. An electrode model allows dynamic injection and depletion of charge carriers according to source-drain voltage. The field-effect is modeled by using the source-gate voltage in a Metropolis-like acceptance criterion. Although the current cannot be calculated because the simulations have no time axis, using the number of Monte Carlo moves as pseudo-time gives results that resemble experimental I/V curves

  6. A multi-agent quantum Monte Carlo model for charge transport: Application to organic field-effect transistors

    Energy Technology Data Exchange (ETDEWEB)

    Bauer, Thilo; Jäger, Christof M. [Department of Chemistry and Pharmacy, Computer-Chemistry-Center and Interdisciplinary Center for Molecular Materials, Friedrich-Alexander-Universität Erlangen-Nürnberg, Nägelsbachstrasse 25, 91052 Erlangen (Germany); Jordan, Meredith J. T. [School of Chemistry, University of Sydney, Sydney, NSW 2006 (Australia); Clark, Timothy, E-mail: tim.clark@fau.de [Department of Chemistry and Pharmacy, Computer-Chemistry-Center and Interdisciplinary Center for Molecular Materials, Friedrich-Alexander-Universität Erlangen-Nürnberg, Nägelsbachstrasse 25, 91052 Erlangen (Germany); Centre for Molecular Design, University of Portsmouth, Portsmouth PO1 2DY (United Kingdom)

    2015-07-28

    We have developed a multi-agent quantum Monte Carlo model to describe the spatial dynamics of multiple majority charge carriers during conduction of electric current in the channel of organic field-effect transistors. The charge carriers are treated by a neglect of diatomic differential overlap Hamiltonian using a lattice of hydrogen-like basis functions. The local ionization energy and local electron affinity defined previously map the bulk structure of the transistor channel to external potentials for the simulations of electron- and hole-conduction, respectively. The model is designed without a specific charge-transport mechanism like hopping- or band-transport in mind and does not arbitrarily localize charge. An electrode model allows dynamic injection and depletion of charge carriers according to source-drain voltage. The field-effect is modeled by using the source-gate voltage in a Metropolis-like acceptance criterion. Although the current cannot be calculated because the simulations have no time axis, using the number of Monte Carlo moves as pseudo-time gives results that resemble experimental I/V curves.

  7. Space charge compensation in the Linac4 low energy beam transport line with negative hydrogen ions

    Energy Technology Data Exchange (ETDEWEB)

    Valerio-Lizarraga, Cristhian A., E-mail: cristhian.alfonso.valerio.lizarraga@cern.ch [CERN, Geneva (Switzerland); Departamento de Investigación en Física, Universidad de Sonora, Hermosillo (Mexico); Lallement, Jean-Baptiste; Lettry, Jacques; Scrivens, Richard [CERN, Geneva (Switzerland); Leon-Monzon, Ildefonso [Facultad de Ciencias Fisico-Matematicas, Universidad Autónoma de Sinaloa, Culiacan (Mexico); Midttun, Øystein [CERN, Geneva (Switzerland); University of Oslo, Oslo (Norway)

    2014-02-15

    The space charge effect of low energy, unbunched ion beams can be compensated by the trapping of ions or electrons into the beam potential. This has been studied for the 45 keV negative hydrogen ion beam in the CERN Linac4 Low Energy Beam Transport using the package IBSimu [T. Kalvas et al., Rev. Sci. Instrum. 81, 02B703 (2010)], which allows the space charge calculation of the particle trajectories. The results of the beam simulations will be compared to emittance measurements of an H{sup −} beam at the CERN Linac4 3 MeV test stand, where the injection of hydrogen gas directly into the beam transport region has been used to modify the space charge compensation degree.

  8. Rat organic solute carrier protein 1 (rOscp1) mediated the transport of organic solutes in Xenopus laevis oocytes: isolation and pharmacological characterization of rOscp1.

    Science.gov (United States)

    Izuno, Hisanori; Kobayashi, Yasuna; Sanada, Yutaka; Nihei, Daisuke; Suzuki, Masako; Kohyama, Noriko; Ohbayashi, Masayuki; Yamamoto, Toshinori

    2007-09-22

    Rat organic solute carrier protein 1 (rOscp1) was isolated from a rat testis cDNA library. Isolated rOscp1 cDNA consisted of 1089 base pairs that encoded a 363-amino acid protein, and the amino acid sequence was 88% and 93% identical to that of human OSCP1 (hOSCP1) and mouse Oscp1 (mOscp1), respectively. The message for rOscp1 is highly detected in rat testis. When expressed in X. oocytes, rOscp1 mediated the high affinity transport of p-aminohippurate (PAH) with a Km value of 15.7+/-1.9 microM, and rOscp1-mediated organic solutes were exhibited in time- and Na+-independent manners. rOscp1 also transported various structurally heterogenous compounds such as testosterone, dehydroepiandrosterone sulfate (DHEA-S), and taurocholate with some differences in substrate specificity compared with hOSCP1. Immunohistochemical analysis revealed that the rOscp1 protein is localized in the basal membrane side of Sertoli cells as observed in mouse testis [Kobayashi et al., 2007; Kobayashi, Y., Tsuchiya, A., Hayashi, T., Kohyama, N., Ohbayashi, M., Yamamoto, T., 2007. Isolation and characterization of polyspecific mouse organic solute carrier protein 1 (mOscp1). Drug Metabolism and Disposition 35 (7), 1239-1245]. Thus, the present results indicate that a newly isolated cDNA clone, rOscp1, is a polyspecific organic solute carrier protein with some differences in substrate specificity compared with human and mouse OSCP1.

  9. Carrier-mediated system for transport of biotin in rat intestine in vitro

    International Nuclear Information System (INIS)

    Said, H.M.; Redha, R.

    1987-01-01

    Transport of biotin was examined in rat intestine using the everted sac technique. Transport of 0.1 μM biotin was linear with time for at least 30 min of incubation and occurred at a rate 3.7 pmol g initial tissue wet wt -1 min -1 . Transport of biotin was higher in the jejunum than the ileum and was minimum in the colon (85 +/- 6, 36 +/- 6, and 2.8 +/- 0.6 pmol x g initial tissue wet wt -1 x 25 min -1 , respectively). In the jejunum, transport of biotin was saturable at low concentrations but linear at higher concentrations. The transport of low concentrations of biotin was 1) inhibited by structural analogues (desthiobiotin, biotin methyl ester, diaminobiotin, and biocytin), 2) Na + dependent, 3) energy dependent, 4) temperature dependent, and 5) proceeded against a concentration gradient in the serosal compartment. No metabolic alteration occurs to the biotin molecule during transport. This study demonstrates that biotin transport in rat intestine occurs by a carrier-mediated process at low concentrations and by simple diffusion at high concentrations. Furthermore, the carrier-mediated process is Na + , energy, and temperature dependent

  10. Transport, charge exchange and loss of energetic heavy ions in the earth's radiation belts - Applicability and limitations of theory

    Science.gov (United States)

    Spjeldvik, W. N.

    1981-01-01

    Computer simulations of processes which control the relative abundances of ions in the trapping regions of geospace are compared with observations from discriminating ion detectors. Energy losses due to Coulomb collisions between ions and exospheric neutrals are considered, along with charge exchange losses and internal charge exchanges. The time evolution of energetic ion fluxes of equatorially mirroring ions under radial diffusion is modelled to include geomagnetic and geoelectric fluctutations. Limits to the validity of diffusion transport theory are discussed, and the simulation is noted to contain provisions for six ionic charge states and the source effect on the radiation belt oxygen ion distributions. Comparisons are made with ion flux data gathered on Explorer 45 and ISEE-1 spacecraft and results indicate that internal charge exchanges cause the radiation belt ion charge state to be independent of source charge rate characteristics, and relative charge state distribution is independent of the radially diffusive transport rate below the charge state redistribution zone.

  11. A numerical study on the charge transport in TPD/Alq3-based organic light emitting diodes.

    Science.gov (United States)

    Kim, K S; Hwang, Y W; Lee, H G; Won, T Y

    2014-08-01

    We report our simulation study on the charge transport characteristic of the multi-layer structure for organic light emitting diodes (OLEDs). We performed a numerical simulation on a multilayer structure comprising a hole transport layer (HTL), an emission layer (EML), and an electron transport layer (ETL) between both electrodes. The material of the HTL is TPD (N,N'-Bis (3-methylphenyl)-N,N'-bis(phenyl) benzidine), and the ETL includes Alq3 (Tris (8-hyroxyquinolinato) aluminium). Here, we investigated the parameters such as recombination rates which influence the efficiency of the charge transport between layers in bilayer OLEDs. We also analyzed a transient response during the turn on/off period and the carrier transport in accordance with the variation of the injection barrier and applied voltage. In addition, our numerical simulation revealed that the insertion of the EML affects the photonic characteristics in bilayer structure and also the efficiency due to the difference in the internal barrier height.

  12. SGLT1-mediated transport in Caco-2 cells is highly dependent on cell bank origin

    DEFF Research Database (Denmark)

    Steffansen, B; Pedersen, Maria; Laghmoch, A M

    2017-01-01

    The Caco-2 cell line is a well-established in vitro model for studying transport phenomena for prediction of intestinal nutrient and drug absorption. However, for substances depending on transporters such predictions are complicated due to variable transporter expression and limited knowledge about...... transporter function during multiple cell passaging and cell thawings. In the case of SGLT1, a key transporter of oral absorption of D-glucose, one reason for compromised prediction could be inadequate expression of SGLT1 in Caco-2 cells and thereby limited sensitivity in the determination of SGLT1-mediated...... permeability (PSGLT1). Here, the objective was to characterize and compare SGLT1-mediated uptake in Caco-2 cells obtained from different cell banks. SGLT1-mediated uptake of the standard SGLT1 substrate, α-MDG, in Caco-2 cells was shown to be highly dependent on cell bank origin. The most robust and reliable...

  13. Simulation of photon and charge transport in X-ray imaging semiconductor sensors

    CERN Document Server

    Nilsson, H E; Hjelm, M; Bertilsson, K

    2002-01-01

    A fully stochastic model for the imaging properties of X-ray silicon pixel detectors is presented. Both integrating and photon counting configurations have been considered, as well as scintillator-coated structures. The model is based on three levels of Monte Carlo simulations; photon transport and absorption using MCNP, full band Monte Carlo simulation of charge transport and system level Monte Carlo simulation of the imaging performance of the detector system. In the case of scintillator-coated detectors, the light scattering in the detector layers has been simulated using a Monte Carlo method. The image resolution was found to be much lower in scintillator-coated systems due to large light spread in thick scintillator layers. A comparison between integrating and photon counting readout methods shows that the image resolution can be slightly enhanced using a photon-counting readout. In addition, the proposed model has been used to study charge-sharing effects on the energy resolution in photon counting dete...

  14. ISOLASI cDNA SUCROSE TRANSPORTER (SUT DARI BATANG TANAMAN TEBU (Saccharum officinarum L.

    Directory of Open Access Journals (Sweden)

    - Slameto

    2010-09-01

    Full Text Available Sucrose Transporter (SUT is kind of protein transporter that control in sucrose translocation. Sucrose Transporter is intermediate in translocation of sucrose from apoplasmic to simplasmic. SUT facilitates sucrose transportation from vascular tissues to parenchyma cells toward in node sugarcane stem. This research was purposed to isolate cDNA SUT from sugarcane stem, and cloned in Escherichia coli strain DH5α. Total RNA of sugarcane stem was isolated by single step method, then add with oligo dT in order to obtain the first strand of SUT cDNA then used as template for PCR. The primer used for PCR is 5’ –ggg ctg att gtg gcc atg tc- ‘3 (SUT-F and 5’ –tgc cct ttg tct ccg gaa cc- ‘3 (SUT-R. PCR was programmed as follow denaturation at 94°C for 2 minutes and 30 second, annealing at 54°C for 30 s, extension at 72°C 2 min and 7 min, and storage at 4°C for unlimited, It was for 30 cycles. Complementary DNA SUT from PCR ligalized to pTOPO bunt-end, then it cloned in to E. coli strain DH5α. The cloning resulted then be sequenced in order to observe the homologues with other nucleotides sequences of some plant using BLASTn program in GENE BANK NCBI and the level of homology determined by Genetyx program. The concentrated of total RNA isolated was 5,024 μg/μl, with purity of 1,85. Complementary DNA SUT fragment from PCR with size 2037 bp appropriated to the both of primer was used. Complementary DNA SUT fragment showed by analyzed some of restriction enzyme e.g. EcoRI, PstI and BamHI. Homologues of this cDNA SUT fragment was 100% to SoSUT 2A of sugarcane stem and 84% to OsSUT of rice plant (Casu et al ., 2003.

  15. Interface-Engineered Charge-Transport Properties in Benzenedithiol Molecular Electronic Junctions via Chemically p-Doped Graphene Electrodes.

    Science.gov (United States)

    Jang, Yeonsik; Kwon, Sung-Joo; Shin, Jaeho; Jeong, Hyunhak; Hwang, Wang-Taek; Kim, Junwoo; Koo, Jeongmin; Ko, Taeg Yeoung; Ryu, Sunmin; Wang, Gunuk; Lee, Tae-Woo; Lee, Takhee

    2017-12-06

    In this study, we fabricated and characterized vertical molecular junctions consisting of self-assembled monolayers of benzenedithiol (BDT) with a p-doped multilayer graphene electrode. The p-type doping of a graphene film was performed by treating pristine graphene (work function of ∼4.40 eV) with trifluoromethanesulfonic (TFMS) acid, producing a significantly increased work function (∼5.23 eV). The p-doped graphene-electrode molecular junctions statistically showed an order of magnitude higher current density and a lower charge injection barrier height than those of the pristine graphene-electrode molecular junctions, as a result of interface engineering. This enhancement is due to the increased work function of the TFMS-treated p-doped graphene electrode in the highest occupied molecular orbital-mediated tunneling molecular junctions. The validity of these results was proven by a theoretical analysis based on a coherent transport model that considers asymmetric couplings at the electrode-molecule interfaces.

  16. TTF/TCNQ-based thin films and microcrystals. Growth and charge transport phenomena

    Energy Technology Data Exchange (ETDEWEB)

    Solovyeva, Vita

    2011-05-26

    The thesis adresses several problems related to growth and charge transport phenomena in thin films of TTF-TCNQ and (BEDT-TTF)TCNQ. The following main new problems are addressed: - The influence of thin-film specific factors, such as the substrate material and growth-induced defects, on the Peierls transition temperature in TTF-TCNQ thin films was studied; - finite-size effects in TTF-TCNQ were investigated by considering transport properties in TTF-TCNQ microcrystals. The influence of the size of the crystal on the Peierls transition temperature was studied. In this context a new method of microcontact fabrication was employed to favor the measurements; - an analysis of radiation-induced defects in TTF-TCNQ thin films and microcrystals was performed. It was demonstrated than an electron beam can induce appreciable damage to the sample such that its electronic properties are strongly modified; - a bilayer growth method was established to fabricate (BEDT-TTF)TCNQ from the gas phase. This newly developed bilayer growth method was showed to be suitable for testing (BEDT-TTF)TCNQ charge-transfer phase formation; - the structure of the formed (BEDT-TTF)TCNQ charge-transfer compounds was analyzed by using a wide range of experimental techniques. An overview and the description of the basic physical principles underlying charge-transfer compounds is given in chapter 2. Experimental techniques used for the growth and characterization of thin films and microcrystals are presented in chapter 3. Chapter 4 gives an overview of the physical properties of the studied organic materials. Chapter 5 discussed the experimental study of TTF-TCNQ thin films. he Peierls transition in TTF-TCNQ is a consequence of the quasi-one-dimensional structure of the material and depends on different factors, studied in chapters 5 and 6. In contradistinction to TTF-TTCNQ, the (BEDT-TTF)TCNQ charge-transfer compound crystallizes in several different modifications with different physical properties

  17. Multiplex and high-throughput DNA detection using surface plasmon mediated fluorescence

    Science.gov (United States)

    Mei, Zhong

    The overall objective of this research project was to develop a user-friendly and sensitive biosensor for nucleic acid aptamers with multiplexing and high-throughput capability. The sensing was based on the fluorescence signals emitted by the fluorophores coupling with plamonic nanoparticle (gold nanorod) deposited on a patterned substrate. Gold nanorods (GNRs) were synthesized using a binary mixture of hexadecyltrimethylammonium bromide (CTAB) and sodium oleate (NaOL) in seed mediated growth method. Polytetrafluoroethylene (PTFE) printed glass slides were selectively coated with a gold thin-film to define hydrophilic areas for GNR deposition. Due to the wettablity contrast, GNR solution dropped on the slide was induced to assemble exclusively in the hydrophilic spots. By controlling temperature and humidity of the evaporation process, vertically-standing GNR arrays were achieved on the pattered slide. Fluorescence was conjugated to GNR surface via DNA double strand with tunable length. Theoretical simulation predicted a flat layer ( 30 nm thick) of uniform "hot spots" presented on the GNR tips, which could modify the nearby fluorescence. Experimentally, the vertical GNR arrays yielded metallic enhanced fluorescence (MEF) effect, which was dependent on the spectrum overlap and GNR-fluorophore distance. Specifically, the maximum enhancement of Quasar 670 and Alexa 750 was observed when it was coupled with GNR664 (plasmonic wavelength 664 nm) and GNR778 respectively at a distance of 16 nm, while the carboxyfluorescein (FAM) was at maximal intensity when attached to gold nanosphere520. This offers an opportunity for multiplexed DNA sensing. Based on this, we developed a novel GNR mediated fluorescence biosensor for DNA detection. Fluorescence labeled haipin-DNA probes were introduced to designated spots of GNR array with the matching LSPR wavelengths on the substrate. The fluorescence was quenched originally because of Forster resonance energy transfer (FRET) effect

  18. A hybrid charged-particle guide for studying (n, charged particle) reactions

    International Nuclear Information System (INIS)

    Haight, R.C.; White, R.M.; Zinkle, S.J.

    1983-01-01

    Charged-particle transport systems consisting of magnetic quadrupole lenses have been employed in recent years in the study of (n, charged particle) reactions. A new transport system was completed at the laboratory that is based both on magnetic lenses as well as electrostatic fields. The magnetic focusing of the charged-particle guide is provided by six magnetic quadrupole lenses arranged in a CDCCDC sequence (in the vertical plane). The electrostatic field is produced by a wire at high voltage which stretches the length of the guide and is physically at the centre of the magnetic axis. The magnetic lenses are used for charged particles above 5 MeV; the electrostatic guide is used for lower energies. This hybrid system possesses the excellent focusing and background rejection properties of other magnetic systems. For low energy charged-particles, the electrostatic transport avoids the narrow band-passes in charged-particle energy which are a problem with purely magnetic transport systems. This system is installed at the LLNL Cyclograaff facility for the study of (n, charged particle) reactions at neutron energies up to 35 MeV. (Auth.)

  19. Charge transport properties in microcrystalline KDyFe(China)6

    International Nuclear Information System (INIS)

    Aubert, P.H.; Goubard, F.; Chevrot, C.; Tabuteau, A.

    2007-01-01

    Microcrystalline solid dysprosium(III) hexacyanoferrate(II) was synthesized by co-precipitation in aqueous solution. The resulting solid has been studied by Fourier transform infrared spectroscopy, X-ray analysis and solid state electrochemistry. The use of a cavity microelectrode was necessary to explore a wide range of time scale and minimize the (undesired) capacitive currents. Cyclic voltametric experiments were very helpful to understand the kinetic of charge transfer in such microstructure. A structure-properties relationship has been established from the crystallographic and the electrochemical properties. A square-scheme is presented to explain the unique electrochemical behavior of hexacyanoferrate containing dysprosium since this compound exhibits a second redox system. The solid presents an open channel-like morphology in which the motion of charged species occurs during the redox processes. Precisely, the electronic transfer is accompanied by a cation diffusion inside the microcrystalline structure. The size of these channels strongly suggests that the kinetic of charge transfer is limited by the cation transport into these structures. - Graphical abstract: Dy and Fe polyhedra packing in the cell of KDyFe(China) 6 .3.5H 2 O shows occluded water molecules and potassium ions forming a pseudohexagonal 2D sub-lattice connected to each other by diffusion channels

  20. Charge transport in polycrystalline alumina materials: application to the optimization of dielectric breakdown strength; Transport de charges dans les alumines polycristallines: application a l'optimisation de la rigidite dielectrique

    Energy Technology Data Exchange (ETDEWEB)

    Touzin, M.

    2005-12-15

    Dielectric breakdown constitutes an important limitation in the use of insulating materials under high-tension since it leads to the local fusion and the sublimation of material. The microstructure (average grain size, intergranular phase) has a great influence on the ability of material to resist this catastrophic phenomenon. Indeed, the interfaces between the various phases constitute potential sites of trapping for the charges. The optimization of the dielectric breakdown strength of a polycrystalline alumina sintered with a liquid phase passes necessarily through the control of the microstructural parameters. Thus, it is shown that by controlling the conditions of the process (rate of sintering aids, powder grain size and thermal cycle), it is possible to control the density (by the average grain size) but also the nature (by the crystallization or not of anorthite) of the grain boundaries. The study of the influence of these two parameters as well temperature on the properties of charge transport and storage was carried out by methods ICM and SEMME. The results, interpreted in light of the numerical simulation of the charge transport in bulk alumina sample during electron beam irradiation, allowed to highlight behaviors, and the corresponding microstructures, favourable to the dielectric breakdown resistance according to the considered temperature. Thus, at room temperature a high density of interfaces (low grain size and crystallized intergranular phase) makes it possible material to durably trap a great amount of charges, which leads to a high dielectric strength. On the other hand, at higher temperature, the presence of shallow traps (vitreous intergranular phase) supports the charge diffusion and makes it possible to delay breakdown. (author)

  1. Effect of seven Indian plant extracts on Fenton reaction-mediated damage to DNA constituents.

    Science.gov (United States)

    Kar, Indrani; Chattopadhyaya, Rajagopal

    2017-11-01

    The influences of substoichiometric amounts of seven plant extracts in the Fenton reaction-mediated damage to deoxynucleosides, deoxynucleoside monophosphates, deoxynucleoside triphosphates, and supercoiled plasmid DNA were studied to rationalize anticancer properties reported in some of these extracts. Extracts from Acacia catechu, Emblica officinalis, Spondias dulcis, Terminalia belerica, Terminalia chebula, as well as gallic acid, epicatechin, chebulagic acid and chebulinic acid enhance the extent of damage in Fenton reactions with all monomeric substrates but protect supercoiled plasmid DNA, compared to standard Fenton reactions. The damage to pyrimidine nucleosides/nucleotides is enhanced by these extracts and compounds to a greater extent than for purine ones in a concentration dependent manner. Dolichos biflorus and Hemidesmus indicus extracts generally do not show this enhancement for the monomeric substrates though they protect plasmid DNA. Compared to standard Fenton reactions for deoxynucleosides with ethanol, the presence of these five plant extracts render ethanol scavenging less effective as the radical is generated in the vicinity of the target. Since substoichiometric amounts of these extracts and the four compounds produce this effect, a catalytic mechanism involving the presence of a ternary complex of the nucleoside/nucleotide substrate, a plant compound and the hydroxyl radical is proposed. Such a mechanism cannot operate for plasmid DNA as the planar rings in the extract compounds cannot stack with the duplex DNA bases. These plant extracts, by enhancing Fenton reaction-mediated damage to deoxynucleoside triphosphates, slow down DNA replication in rapidly dividing cancer cells, thus contributing to their anticancer properties.

  2. The Nuclear Cap-Binding Complex Mediates Meiotic Silencing by Unpaired DNA

    Directory of Open Access Journals (Sweden)

    Logan M. Decker

    2017-04-01

    Full Text Available In the filamentous fungus Neurospora crassa, cross walls between individual cells are normally incomplete, making the entire fungal network vulnerable to attack by viruses and selfish DNAs. Accordingly, several genome surveillance mechanisms are maintained to help the fungus combat these repetitive elements. One of these defense mechanisms is called meiotic silencing by unpaired DNA (MSUD, which identifies and silences unpaired genes during meiosis. Utilizing common RNA interference (RNAi proteins, such as Dicer and Argonaute, MSUD targets mRNAs homologous to the unpaired sequence to achieve silencing. In this study, we have identified an additional silencing component, namely the cap-binding complex (CBC. Made up of cap-binding proteins CBP20 and CBP80, CBC associates with the 5′ cap of mRNA transcripts in eukaryotes. The loss of CBC leads to a deficiency in MSUD activity, suggesting its role in mediating silencing. As confirmed in this study, CBC is predominantly nuclear, although it is known to travel in and out of the nucleus to facilitate RNA transport. As seen in animals but not in plants, CBP20’s robust nuclear import depends on CBP80 in Neurospora. CBC interacts with a component (Argonaute of the perinuclear meiotic silencing complex (MSC, directly linking the two cellular factors.

  3. DNaseI Protects against Paraquat-Induced Acute Lung Injury and Pulmonary Fibrosis Mediated by Mitochondrial DNA

    Directory of Open Access Journals (Sweden)

    Guo Li

    2015-01-01

    Full Text Available Background. Paraquat (PQ poisoning is a lethal toxicological challenge that served as a disease model of acute lung injury and pulmonary fibrosis, but the mechanism is undetermined and no effective treatment has been discovered. Methods and Findings. We demonstrated that PQ injures mitochondria and leads to mtDNA release. The mtDNA mediated PBMC recruitment and stimulated the alveolar epithelial cell production of TGF-β1 in vitro. The levels of mtDNA in circulation and bronchial alveolar lavage fluid (BALF were elevated in a mouse of PQ-induced lung injury. DNaseI could protect PQ-induced lung injury and significantly improved survival. Acute lung injury markers, such as TNFα, IL-1β, and IL-6, and marker of fibrosis, collagen I, were downregulated in parallel with the elimination of mtDNA by DNaseI. These data indicate a possible mechanism for PQ-induced, mtDNA-mediated lung injury, which may be shared by other causes of lung injury, as suggested by the same protective effect of DNaseI in bleomycin-induced lung injury model. Interestingly, increased mtDNA in the BALF of patients with amyopathic dermatomyositis-interstitial lung disease can be appreciated. Conclusions. DNaseI targeting mtDNA may be a promising approach for the treatment of PQ-induced acute lung injury and pulmonary fibrosis that merits fast tracking through clinical trials.

  4. Charge Carrier Transport Mechanism Based on Stable Low Voltage Organic Bistable Memory Device.

    Science.gov (United States)

    Ramana, V V; Moodley, M K; Kumar, A B V Kiran; Kannan, V

    2015-05-01

    A solution processed two terminal organic bistable memory device was fabricated utilizing films of polymethyl methacrylate PMMA/ZnO/PMMA on top of ITO coated glass. Electrical characterization of the device structure showed that the two terminal device exhibited favorable switching characteristics with an ON/OFF ratio greater than 1 x 10(4) when the voltage was swept between - 2 V and +3 V. The device maintained its state after removal of the bias voltage. The device did not show degradation after a 1-h retention test at 120 degrees C. The memory functionality was consistent even after fifty cycles of operation. The charge transport switching mechanism is discussed on the basis of carrier transport mechanism and our analysis of the data shows that the charge carrier trans- port mechanism of the device during the writing process can be explained by thermionic emission (TE) and space-charge-limited-current (SCLC) mechanism models while erasing process could be explained by the FN tunneling mechanism. This demonstration provides a class of memory devices with the potential for low-cost, low-power consumption applications, such as a digital memory cell.

  5. Simulations of charge transport in organic light emitting diodes

    International Nuclear Information System (INIS)

    Martin, Simon James

    2002-01-01

    In this thesis, two approaches to the modelling of charge transport in organic light emitting diodes (OLEDs) are presented. The first is a drift-diffusion model, normally used when considering conventional crystalline inorganic semiconductors (e.g. Si or lll-V's) which have well defined energy bands. In this model, electron and hole transport is described using the current continuity equations and the drift-diffusion current equations, and coupled to Poisson's equation. These equations are solved with the appropriate boundary conditions, which for OLEDs are Schottky contacts; carriers are injected by thermionic emission and tunnelling. The disordered nature of the organic semiconductors is accounted for by the inclusion of field-dependent carrier mobilities and Langevin optical recombination. The second approach treats the transport of carriers in disordered organic semi-conductors as a hopping process between spatially and energetically disordered sites. This method has been used previously to account for the observed temperature and electric field dependence of carrier mobilities in disordered organic semiconductors. A hopping transport model has been developed which accounts explicitly for the structure in highly ordered films of rigid rod liquid-crystalline conjugated polymers. Chapter 2 discusses the formation of metal-semiconductor contacts, and current injection processes in OLEDs. If the barrier to carrier injection at a metal-semiconductor contact is small, or the contact is Ohmic, then the current may be space charge limited; this second limiting regime of current flow for OLEDs is also described. The remainder of Chapter 2 describes the drift-diffusion model used in this work in some detail. Chapter 3 contains results obtained from modelling the J-V characteristics of single-layer OLEDs, which are compared to experimental data in order to validate the drift-diffusion model. Chapter 4 contains results of simulating bi-layer OLEDs; rather than examining J

  6. Peculiarities of charge transport in a semiconductor gas discharge electronic devices

    International Nuclear Information System (INIS)

    Koch, E.; Chivi, M.; Salamov, B.G.; Salamov, B.G.

    2009-01-01

    The memory effect in planar semiconductor gas discharge system at different pressures (15-760) and interelectrode distance (60-445 μm) were experimentally studied. The study was performed on the bases of current-voltage characteristic (CVC) measurements with the time lag of several hours of afterglow periods. The influence of the active space-charge remaining from previous discharge on the breakdown voltage has been analyzed using the CVC method for different conductivity of semiconductor GaAs photocathode. On the other hand, the CVC data for subsequent dates present a correlation of memory effect and hysteresis behaviour. The explanation of such relation is based on the influence of long-lived active charges on the electronic transport mechanism of semiconductor material

  7. Quasi-equilibrium analysis of the ion-pair mediated membrane transport of low-permeability drugs.

    Science.gov (United States)

    Miller, Jonathan M; Dahan, Arik; Gupta, Deepak; Varghese, Sheeba; Amidon, Gordon L

    2009-07-01

    The aim of this research was to gain a mechanistic understanding of ion-pair mediated membrane transport of low-permeability drugs. Quasi-equilibrium mass transport analyses were developed to describe the ion-pair mediated octanol-buffer partitioning and hydrophobic membrane permeation of the model basic drug phenformin. Three lipophilic counterions were employed: p-toluenesulfonic acid, 2-naphthalenesulfonic acid, and 1-hydroxy-2-naphthoic acid (HNAP). Association constants and intrinsic octanol-buffer partition coefficients (Log P(AB)) of the ion-pairs were obtained by fitting a transport model to double reciprocal plots of apparent octanol-buffer distribution coefficients versus counterion concentration. All three counterions enhanced the lipophilicity of phenformin, with HNAP providing the greatest increase in Log P(AB), 3.7 units over phenformin alone. HNAP also enhanced the apparent membrane permeability of phenformin, 27-fold in the PAMPA model, and 4.9-fold across Caco-2 cell monolayers. As predicted from a quasi-equilibrium analysis of ion-pair mediated membrane transport, an order of magnitude increase in phenformin flux was observed per log increase in counterion concentration, such that log-log plots of phenformin flux versus HNAP concentration gave linear relationships. These results provide increased understanding of the underlying mechanisms of ion-pair mediated membrane transport, emphasizing the potential of this approach to enable oral delivery of low-permeability drugs.

  8. Electrochemiluminescent DNA sensor based on controlled Zn-mediated grafting of diazonium precursors.

    Science.gov (United States)

    Torréns, Mabel; Ortiz, Mayreli; Bejarano-Nosas, Diego; O'Sullivan, Ciara K

    2015-07-01

    Controlled Zn-mediated grafting of a thin layer of a diazonium salt was used to functionalise a carbon electrode with ruthenium(II)-tris-bipyridine (Ru)-labelled DNA for use as a capture probe in an electrochemiluminescent genosensor. A secondary reporter probe was labelled with a ferrocene (Fc) molecule, and in the presence of the single-stranded DNA target a genocomplex formed, where the Fc-label effectively quenched the electrochemiluminescence of the signal emitted from the Ru-label. The spacing of the labels for maximum sensitivity and minimum detection limit was optimised, and the signal reproducibility and stability of the method was established.

  9. Simplified dark matter models with charged mediators: prospects for direct detection

    Energy Technology Data Exchange (ETDEWEB)

    Sandick, Pearl; Sinha, Kuver; Teng, Fei [Department of Physics and Astronomy, University of Utah,Salt Lake City, UT 84112 (United States)

    2016-10-05

    We consider direct detection prospects for a class of simplified models of fermionic dark matter (DM) coupled to left and right-handed Standard Model fermions via two charged scalar mediators with arbitrary mixing angle α. DM interactions with the nucleus are mediated by higher electromagnetic moments, which, for Majorana DM, is the anapole moment. After giving a full analytic calculation of the anapole moment, including its α dependence, and matching with limits in the literature, we compute the DM-nucleon scattering cross-section and show the LUX and future LZ constraints on the parameter space of these models. We then compare these results with constraints coming from Fermi-LAT continuum and line searches. Results in the supersymmetric limit of these simplified models are provided in all cases. We find that future direct detection experiments will be able to probe most of the parameter space of these models for O(100−200) GeV DM and lightest mediator mass ≲O(5%) larger than the DM mass. The direct detection prospects dwindle for larger DM mass and larger mass gap between the DM and the lightest mediator mass, although appreciable regions are still probed for O(200) GeV DM and lightest mediator mass ≲O(20%) larger than the DM mass. The direct detection bounds are also attenuated near certain “blind spots' in the parameter space, where the anapole moment is severely suppressed due to cancellation of different terms. We carefully study these blind spots and the associated Fermi-LAT signals in these regions.

  10. GLTP mediated non-vesicular GM1 transport between native membranes.

    Directory of Open Access Journals (Sweden)

    Ines Lauria

    Full Text Available Lipid transfer proteins (LTPs are emerging as key players in lipid homeostasis by mediating non-vesicular transport steps between two membrane surfaces. Little is known about the driving force that governs the direction of transport in cells. Using the soluble LTP glycolipid transfer protein (GLTP, we examined GM1 (monosialotetrahexosyl-ganglioside transfer to native membrane surfaces. With artificial GM1 donor liposomes, GLTP can be used to increase glycolipid levels over natural levels in either side of the membrane leaflet, i.e., external or cytosolic. In a system with native donor- and acceptor-membranes, we find that GLTP balances highly variable GM1 concentrations in a population of membranes from one cell type, and in addition, transfers lipids between membranes from different cell types. Glycolipid transport is highly efficient, independent of cofactors, solely driven by the chemical potential of GM1 and not discriminating between the extra- and intracellular membrane leaflet. We conclude that GLTP mediated non-vesicular lipid trafficking between native membranes is driven by simple thermodynamic principles and that for intracellular transport less than 1 µM GLTP would be required in the cytosol. Furthermore, the data demonstrates the suitability of GLTP as a tool for artificially increasing glycolipid levels in cellular membranes.

  11. Design rules for charge-transport efficient host materials for phosphorescent organic light-emitting diodes.

    Science.gov (United States)

    May, Falk; Al-Helwi, Mustapha; Baumeier, Björn; Kowalsky, Wolfgang; Fuchs, Evelyn; Lennartz, Christian; Andrienko, Denis

    2012-08-22

    The use of blue phosphorescent emitters in organic light-emitting diodes (OLEDs) imposes demanding requirements on a host material. Among these are large triplet energies, the alignment of levels with respect to the emitter, the ability to form and sustain amorphous order, material processability, and an adequate charge carrier mobility. A possible design strategy is to choose a π-conjugated core with a high triplet level and to fulfill the other requirements by using suitable substituents. Bulky substituents, however, induce large spatial separations between conjugated cores, can substantially reduce intermolecular electronic couplings, and decrease the charge mobility of the host. In this work we analyze charge transport in amorphous 2,8-bis(triphenylsilyl)dibenzofuran, an electron-transporting material synthesized to serve as a host in deep-blue OLEDs. We show that mesomeric effects delocalize the frontier orbitals over the substituents recovering strong electronic couplings and lowering reorganization energies, especially for electrons, while keeping energetic disorder small. Admittance spectroscopy measurements reveal that the material has indeed a high electron mobility and a small Poole-Frenkel slope, supporting our conclusions. By linking electronic structure, molecular packing, and mobility, we provide a pathway to the rational design of hosts with high charge mobilities.

  12. A Generalized Boltzmann Fokker-Planck Method for Coupled Charged Particle Transport

    Energy Technology Data Exchange (ETDEWEB)

    Prinja, Anil K

    2012-01-09

    The goal of this project was to develop and investigate the performance of reduced-physics formulations of high energy charged particle (electrons, protons and heavier ions) transport that are computationally more efficient than not only analog Monte Carlo methods but also the established condensed history Monte Carlo technique. Charged particles interact with matter by Coulomb collisions with target nuclei and electrons, by bremsstrahlung radiation loss and by nuclear reactions such as spallation and fission. Of these, inelastic electronic collisions and elastic nuclear collisions are the dominant cause of energy-loss straggling and angular deflection or range straggling of a primary particle. These collisions are characterized by extremely short mean free paths (sub-microns) and highly peaked, near-singular differential cross sections about forward directions and zero energy loss, with the situation for protons and heavier ions more extreme than for electrons. For this reason, analog or truephysics single-event Monte Carlo simulation, while possible in principle, is computationally prohibitive for routine calculation of charged particle interaction phenomena.

  13. Some Effective Tight-Binding Models for Electrons in DNA Conduction: A Review

    International Nuclear Information System (INIS)

    Yamada, H.; Iguchi, K.

    2010-01-01

    Quantum transport for DNA conduction has been widely studied with interest in application as a candidate in making nanowires as well as interest in the scientific mechanism. In this paper, we review recent works concerning the electronic states and the conduction/transfer in DNA polymers. We have mainly investigated the energy-band structure and the correlation effects of localization property in the two- and three-chain systems (ladder model) with long-range correlation as a simple model for electronic property in a double strand of DNA by using the tight-bindingmodel. In addition, we investigated the localization properties of electronic states in several actual DNA sequences such as bacteriophages of Escherichia coli, human-chromosome 22, compared with those of the artificial disordered sequences with correlation. The charge-transfer properties for poly(dA)-poly(dT) and poly(dG)-poly(dC) DNA polymers are also presented in terms of localization lengths within the frameworks of the polaron models due to the coupling between the charge carriers and the lattice vibrations of the double strand of DNA

  14. Non-homologous end joining mediated DNA repair is impaired in the NUP98-HOXD13 mouse model for myelodysplastic syndrome.

    Science.gov (United States)

    Puthiyaveetil, Abdul Gafoor; Reilly, Christopher M; Pardee, Timothy S; Caudell, David L

    2013-01-01

    Chromosomal translocations typically impair cell differentiation and often require secondary mutations for malignant transformation. However, the role of a primary translocation in the development of collaborating mutations is debatable. To delineate the role of leukemic translocation NUP98-HOXD13 (NHD13) in secondary mutagenesis, DNA break and repair mechanisms in stimulated mouse B lymphocytes expressing NHD13 were analyzed. Our results showed significantly reduced expression of non-homologous end joining (NHEJ)-mediated DNA repair genes, DNA Pkcs, DNA ligase4, and Xrcc4 leading to cell cycle arrest at G2/M phase. Our results showed that expression of NHD13 fusion gene resulted in impaired NHEJ-mediated DNA break repair. Copyright © 2012 Elsevier Ltd. All rights reserved.

  15. Charge transport in organic molecular semiconductors from first principles: The bandlike hole mobility in a naphthalene crystal

    Science.gov (United States)

    Lee, Nien-En; Zhou, Jin-Jian; Agapito, Luis A.; Bernardi, Marco

    2018-03-01

    Predicting charge transport in organic molecular crystals is notoriously challenging. Carrier mobility calculations in organic semiconductors are dominated by quantum chemistry methods based on charge hopping, which are laborious and only moderately accurate. We compute from first principles the electron-phonon scattering and the phonon-limited hole mobility of naphthalene crystal in the framework of ab initio band theory. Our calculations combine GW electronic bandstructures, ab initio electron-phonon scattering, and the Boltzmann transport equation. The calculated hole mobility is in very good agreement with experiment between 100 -300 K , and we can predict its temperature dependence with high accuracy. We show that scattering between intermolecular phonons and holes regulates the mobility, though intramolecular phonons possess the strongest coupling with holes. We revisit the common belief that only rigid molecular motions affect carrier dynamics in organic molecular crystals. Our paper provides a quantitative and rigorous framework to compute charge transport in organic crystals and is a first step toward reconciling band theory and carrier hopping computational methods.

  16. Mimicking Retention and Transport of Rotavirus and Adenovirus in Sand Media Using DNA-labeled, Protein-coated Silica Nanoparticles

    Science.gov (United States)

    Pang, Liping; Farkas, Kata; Bennett, Grant; Varsani, Arvind; Easingwood, Richard; Tilley, Richard; Nowostawska, Urszula; Lin, Susan

    2014-05-01

    Rotavirus (RoV) and adenovirus (AdV) are important viral pathogens for the risk analysis of drinking water. Despite this, little is known about their retention and transport behaviors in porous media (e.g. sand filtered used for water treatment and groundwater aquifers due to a lack of representative surrogates. In this study, we developed RoV and AdV surrogates by covalently coating 70-nm sized silica nanoparticles with specific proteins and a DNA marker for sensitive detection. Filtration experiments using beach sand columns demonstrated the similarity of the surrogates' concentrations, attachment, and filtration efficiencies to the target viruses. The surrogates showed the same magnitude of concentration reduction as the viruses. Conversely, MS2 phage (a traditional virus model) over predicted concentrations of AdV and RoV by 1- and 2-orders of magnitude, respectively. The surrogates remained stable in size, surface charge and DNA concentration for at least one year. They can be easily and rapidly detected at concentrations down to one particle per PCR reaction and are readily detectable in natural waters and even in effluent. With up-scaling validation in pilot trials, the surrogates can be a useful cost-effective new tool for studying virus retention and transport in porous media, e.g. for assessing filter efficiency in water and wastewater treatment, tracking virus migration in groundwater after effluent land disposal, and establishing safe setback distances for groundwater protection.

  17. Correlation of Disorder and Charge Transport in a Range of Indacenodithiophene-Based Semiconducting Polymers

    KAUST Repository

    Nikolka, Mark

    2017-12-13

    Over the past 25 years, various design motifs have emerged for the development of organic semiconductors for demanding applications in flexible organic light emitting diode display backplanes or even printed organic logic. Due to their large area uniformity paired with high charge carrier mobilities, conjugated polymers have attracted increasing attention in this respect. However, the performances delivered by current generation conjugated polymers still fall short of many industrial requirements demanding devices with ideal transistor characteristics and higher mobilities. The discovery of conjugated polymers with low energetic disorder, such as the indacenodithiophene-based polymer indacenodithiophene-co-benzothiadiazole, represent an exciting opportunity to breach this chasm if these materials can be further optimized while maintaining their low disorder. Here, it is shown how both the charge transport properties as well as the energetic disorder are affected by tuning the molecular structure of a large range of indacenodithiophene-based semiconducting polymer derivatives. This study allows to understand better the interplay between molecular design and structure of the polymer backbone and the degree of energetic disorder that governs the charge transport properties in thin polymer films.

  18. Effects of Environmental Factors and Metallic Electrodes on AC Electrical Conduction Through DNA Molecule.

    Science.gov (United States)

    Abdalla, S; Obaid, A; Al-Marzouki, F M

    2017-12-01

    Deoxyribonucleic acid (DNA) is one of the best candidate materials for various device applications such as in electrodes for rechargeable batteries, biosensors, molecular electronics, medical- and biomedical-applications etc. Hence, it is worthwhile to examine the mechanism of charge transport in the DNA molecule, however, still a question without a clear answer is DNA a molecular conducting material (wire), semiconductor, or insulator? The answer, after the published data, is still ambiguous without any confirmed and clear scientific answer. DNA is found to be always surrounded with different electric charges, ions, and dipoles. These surrounding charges and electric barrier(s) due to metallic electrodes (as environmental factors (EFs)) play a substantial role when measuring the electrical conductivity through λ-double helix (DNA) molecule suspended between metallic electrodes. We found that strong frequency dependence of AC-complex conductivity comes from the electrical conduction of EFs. This leads to superimposing serious incorrect experimental data to measured ones. At 1 MHz, we carried out a first control experiment on electrical conductivity with and without the presence of DNA molecule. If there are possible electrical conduction due to stray ions and contribution of substrate, we will detected them. This control experiment revealed that there is an important role played by the environmental-charges around DNA molecule and any experiment should consider this role. We have succeeded to measure both electrical conductivity due to EFs (σ ENV ) and electrical conductivity due to DNA molecule (σ DNA ) independently by carrying the measurements at different DNA-lengths and subtracting the data. We carried out measurements as a function of frequency (f) and temperature (T) in the ranges 0.1 Hz molecule from all EFs effects that surround the molecule, but also to present accurate values of σ DNA and the dielectric constant of the molecule ε' DNA as a

  19. Thermal generation and mobility of charge carriers in collective proton transport in hydrogen-bonded chains

    International Nuclear Information System (INIS)

    Peyrard, M.; Boesch, R.; Kourakis, I.

    1991-01-01

    The transport of protons in hydrogen-bonded systems is a long standing problem which has not yet obtained a satisfactorily theoretical description. Although this problem was examined first for ice, it is relevant in many systems and in particular in biology for the transport along proteins or for proton conductance across membranes, an essential process in cell life. The broad relevance makes the study of proton conduction very appealing. Since the original work of Bernal and Fowler on ice, the idea that the transport occurs through chains of hydrogen bonds has been well accepted. Such ''proton wires'' were invoked by Nagle and Morowitz for proton transport across membranes proteins and more recently across lipid bilayers. In this report, we assume the existence of such an hydrogen-bonded chain and discuss its consequences on the dynamics of the charge carriers. We show that this assumption leads naturally to the idea of soliton transport and we put a special emphasis on the role of the coupling between the protons and heavy ions motions. The model is presented. We show how the coupling affects strongly the dynamics of the charge carriers and we discuss the role it plays in the thermal generation of carriers. The work presented has been performed in 1986 and 87 with St. Pnevmatikos and N. Flyzanis and was then completed in collaboration with D. Hochstrasser and H. Buettner. Therefore the results presented in this part are not new but we think that they are appropriate in the context of this multidisciplinary workshop because they provide a rather complete example of the soliton picture for proton conduction. This paper discusses the thermal generation of the charge carriers when the coupling between the protons and heavy ions dynamics is taken into account. The results presented in this part are very recent and will deserve further analysis but they already show that the coupling can assist for the formation of the charge carriers

  20. Quantifying TEMPO Redox Polymer Charge Transport toward the Organic Radical Battery.

    Science.gov (United States)

    Karlsson, Christoffer; Suga, Takeo; Nishide, Hiroyuki

    2017-03-29

    To design new and better organic active battery materials in a rational fashion, fundamental parameters of the charge transport must be studied. Herein we report on the electronic conductivity by electron diffusion in a TEMPO-containing redox polymer, and the reorganization energy of the TEMPO self-exchange in an organic solvent is determined for the first time. The electronic conductivity was 8.5 μS/cm at E 0 and corresponded to a redox hopping mechanism. The apparent electron diffusion coefficient was 1.9 × 10 -9 cm 2 /s at room temperature, and at short times the ion diffusion was limiting with a diffusion coefficient of 6.5 × 10 -10 cm 2 /s. The reorganization energy was determined to be 1.01 eV, indicating a rather polar chemical environment for the TEMPO groups. The implications for the usage of this type of materials in organic energy storage are discussed. As conductivity through 10 μm was demonstrated, we show that, if sufficient swellability can be ensured, charge can be transported through several micrometer thick layers in a battery electrode without any conducting additive.

  1. Carrier-mediated γ-aminobutyric acid transport across the basolateral membrane of human intestinal Caco-2 cell monolayers.

    Science.gov (United States)

    Nielsen, Carsten Uhd; Carstensen, Mette; Brodin, Birger

    2012-06-01

    The aim of the present study was to investigate the transport of γ-aminobutyric acid (GABA) across the basolateral membrane of intestinal cells. The proton-coupled amino acid transporter, hPAT1, mediates the influx of GABA and GABA mimetic drug substances such as vigabatrin and gaboxadol and the anticancer prodrug δ-aminolevulinic acid across the apical membrane of small intestinal enterocytes. Little is however known about the basolateral transport of these substances. We investigated basolateral transport of GABA in mature Caco-2 cell monolayers using isotope studies. Here we report that, at least two transporters seem to be involved in the basolateral transport of GABA. The basolateral uptake consisted of a high-affinity system with a K(m) of 290 μM and V(max) of 75 pmol cm(-2) min(-1) and a low affinity system with a K(m) of approximately 64 mM and V(max) of 1.6 nmol cm(-2) min(-1). The high-affinity transporter is Na(+) and Cl(-) dependent. The substrate specificity of the high-affinity transporter was further studied and Gly-Sar, Leucine, gaboxadol, sarcosine, lysine, betaine, 5-hydroxythryptophan, proline and glycine reduced the GABA uptake to approximately 44-70% of the GABA uptake in the absence of inhibitor. Other substances such as β-alanine, GABA, 5-aminovaleric acid, taurine and δ-aminolevulinic acid reduced the basolateral GABA uptake to 6-25% of the uptake in the absence of inhibitor. Our results indicate that the distance between the charged amino- and acid-groups is particular important for inhibition of basolateral GABA uptake. Thus, there seems to be a partial substrate overlap between the basolateral GABA transporter and hPAT1, which may prove important for understanding drug interactions at the level of intestinal transport. Copyright © 2012 Elsevier B.V. All rights reserved.

  2. Improving charge transport property and energy transfer with carbon quantum dots in inverted polymer solar cells

    International Nuclear Information System (INIS)

    Liu, Chunyu; Chang, Kaiwen; Guo, Wenbin; Li, Hao; Shen, Liang; Chen, Weiyou; Yan, Dawei

    2014-01-01

    Carbon quantum dots (Cdots) are synthesized by a simple method and introduced into active layer of polymer solar cells (PSCs). The performance of doped devices was apparently improved, and the highest power conversion efficiency of 7.05% was obtained, corresponding to a 28.2% enhancement compared with that of the contrast device. The charge transport properties, resistance, impedance, and transient absorption spectrum are systematically investigated to explore how the Cdots affect on PSCs performance. This study reveals the importance of Cdots in enhancing the efficiency of PSCs and gives insight into the mechanism of charge transport improvement.

  3. DNA methylation mediated control of gene expression is critical for development of crown gall tumors.

    Directory of Open Access Journals (Sweden)

    Jochen Gohlke

    Full Text Available Crown gall tumors develop after integration of the T-DNA of virulent Agrobacterium tumefaciens strains into the plant genome. Expression of the T-DNA-encoded oncogenes triggers proliferation and differentiation of transformed plant cells. Crown gall development is known to be accompanied by global changes in transcription, metabolite levels, and physiological processes. High levels of abscisic acid (ABA in crown galls regulate expression of drought stress responsive genes and mediate drought stress acclimation, which is essential for wild-type-like tumor growth. An impact of epigenetic processes such as DNA methylation on crown gall development has been suggested; however, it has not yet been investigated comprehensively. In this study, the methylation pattern of Arabidopsis thaliana crown galls was analyzed on a genome-wide scale as well as at the single gene level. Bisulfite sequencing analysis revealed that the oncogenes Ipt, IaaH, and IaaM were unmethylated in crown galls. Nevertheless, the oncogenes were susceptible to siRNA-mediated methylation, which inhibited their expression and subsequently crown gall growth. Genome arrays, hybridized with methylated DNA obtained by immunoprecipitation, revealed a globally hypermethylated crown gall genome, while promoters were rather hypomethylated. Mutants with reduced non-CG methylation developed larger tumors than the wild-type controls, indicating that hypermethylation inhibits plant tumor growth. The differential methylation pattern of crown galls and the stem tissue from which they originate correlated with transcriptional changes. Genes known to be transcriptionally inhibited by ABA and methylated in crown galls became promoter methylated upon treatment of A. thaliana with ABA. This suggests that the high ABA levels in crown galls may mediate DNA methylation and regulate expression of genes involved in drought stress protection. In summary, our studies provide evidence that epigenetic processes

  4. Glucose Elevates NITRATE TRANSPORTER2.1 Protein Levels and Nitrate Transport Activity Independently of Its HEXOKINASE1-Mediated Stimulation of NITRATE TRANSPORTER2.1 Expression1[W][OPEN

    Science.gov (United States)

    de Jong, Femke; Thodey, Kate; Lejay, Laurence V.; Bevan, Michael W.

    2014-01-01

    Mineral nutrient uptake and assimilation is closely coordinated with the production of photosynthate to supply nutrients for growth. In Arabidopsis (Arabidopsis thaliana), nitrate uptake from the soil is mediated by genes encoding high- and low-affinity transporters that are transcriptionally regulated by both nitrate and photosynthate availability. In this study, we have studied the interactions of nitrate and glucose (Glc) on gene expression, nitrate transport, and growth using glucose-insensitive2-1 (gin2-1), which is defective in sugar responses. We confirm and extend previous work by showing that HEXOKINASE1-mediated oxidative pentose phosphate pathway (OPPP) metabolism is required for Glc-mediated NITRATE TRANSPORTER2.1 (NRT2.1) expression. Treatment with pyruvate and shikimate, two products derived from intermediates of the OPPP that are destined for amino acid production, restores wild-type levels of NRT2.1 expression, suggesting that metabolites derived from OPPP metabolism can, together with Glc, directly stimulate high levels of NRT2.1 expression. Nitrate-mediated NRT2.1 expression is not influenced by gin2-1, showing that Glc does not influence NRT2.1 expression through nitrate-mediated mechanisms. We also show that Glc stimulates NRT2.1 protein levels and transport activity independently of its HEXOKINASE1-mediated stimulation of NRT2.1 expression, demonstrating another possible posttranscriptional mechanism influencing nitrate uptake. In gin2-1 plants, nitrate-responsive biomass growth was strongly reduced, showing that the supply of OPPP metabolites is essential for assimilating nitrate for growth. PMID:24272701

  5. Charge transport mechanisms of graphene/semiconductor Schottky barriers: A theoretical and experimental study

    International Nuclear Information System (INIS)

    Zhong, Haijian; Liu, Zhenghui; Xu, Gengzhao; Shi, Lin; Fan, Yingmin; Yang, Hui; Xu, Ke; Wang, Jianfeng; Ren, Guoqiang

    2014-01-01

    Graphene has been proposed as a material for semiconductor electronic and optoelectronic devices. Understanding the charge transport mechanisms of graphene/semiconductor Schottky barriers will be crucial for future applications. Here, we report a theoretical model to describe the transport mechanisms at the interface of graphene and semiconductors based on conventional semiconductor Schottky theory and a floating Fermi level of graphene. The contact barrier heights can be estimated through this model and be close to the values obtained from the experiments, which are lower than those of the metal/semiconductor contacts. A detailed analysis reveals that the barrier heights are as the function of the interface separations and dielectric constants, and are influenced by the interfacial states of semiconductors. Our calculations show how this behavior of lowering barrier heights arises from the Fermi level shift of graphene induced by the charge transfer owing to the unique linear electronic structure

  6. Charge transport through image charged stabilized states in a single molecule single electron transistor device

    International Nuclear Information System (INIS)

    Hedegard, Per; Bjornholm, Thomas

    2005-01-01

    The present paper gives an elaborate theoretical description of a new molecular charge transport mechanism applying to a single molecule trapped between two macroscopic electrodes in a solid state device. It is shown by a Hubbard type model of the electronic and electrostatic interactions, that the close proximity of metal electrodes may allow electrons to tunnel from the electrode directly into very localized image charge stabilized states on the molecule. Due to this mechanism, an exceptionally large number of redox states may be visited within an energy scale which would normally not allow the molecular HOMO-LUMO gap to be transversed. With a reasonable set of parameters, a good fit to recent experimental values may be obtained. The theoretical model is furthermore used to search for the physical boundaries of this effect, and it is found that a rather narrow geometrical space is available for the new mechanism to work: in the specific case of oligophenylenevinylene molecules recently explored in such devices several atoms in the terminal benzene rings need to be at van der Waal's distance to the electrode in order for the mechanism to work. The model predicts, that chemisorption of the terminal benzene rings too gold electrodes will impede the image charge effect very significantly because the molecule is pushed away from the electrode by the covalent thiol-gold bond

  7. Influence of surface charge on the transport characteristics of nanowire-field effect transistors in liquid environments

    Energy Technology Data Exchange (ETDEWEB)

    Nozaki, Daijiro, E-mail: daijiro.nozaki@gmail.com, E-mail: research@nano.tu-dresden.de [Institute for Materials Science and Max Bergmann Center of Biomaterials, TU Dresden, 01062 Dresden (Germany); Kunstmann, Jens [Institute for Materials Science and Max Bergmann Center of Biomaterials, TU Dresden, 01062 Dresden (Germany); Theoretical Chemistry, Department of Chemistry and Food Chemistry, TU Dresden, 01062 Dresden (Germany); Zörgiebel, Felix [Institute for Materials Science and Max Bergmann Center of Biomaterials, TU Dresden, 01062 Dresden (Germany); Center for Advancing Electronics Dresden (cfAED), TU Dresden, 01062 Dresden (Germany); Cuniberti, Gianaurelio [Institute for Materials Science and Max Bergmann Center of Biomaterials, TU Dresden, 01062 Dresden (Germany); Center for Advancing Electronics Dresden (cfAED), TU Dresden, 01062 Dresden (Germany); Dresden Center for Computational Materials Science (DCCMS), TU Dresden, 01062 Dresden (Germany)

    2015-05-18

    One dimensional nanowire field effect transistors (NW-FETs) are a promising platform for sensor applications. The transport characteristics of NW-FETs are strongly modified in liquid environment due to the charging of surface functional groups accompanied with protonation or deprotonation. In order to investigate the influence of surface charges and ionic concentrations on the transport characteristics of Schottky-barrier NW-FETs, we have combined the modified Poisson-Boltzmann theory with the Landauer-Büttiker transport formalism. For a typical device, the model is able to capture the reduction of the sensitivity of NW-FETs in ionic solutions due to the screening from counter ions as well as a local gating from surface functional groups. Our approach allows to model, to investigate, and to optimize realistic Schottky-barrier NW-FET devices in liquid environment.

  8. Particle integrity, sampling, and application of a DNA-tagged tracer for aerosol transport studies

    Energy Technology Data Exchange (ETDEWEB)

    Kaeser, Cynthia Jeanne [Michigan State Univ., East Lansing, MI (United States)

    2017-07-21

    Aerosols are an ever-present part of our daily environment and have extensive effects on both human and environmental health. Particles in the inhalable range (1-10 μm diameter) are of particular concern because their deposition in the lung can lead to a variety of illnesses including allergic reactions, viral or bacterial infections, and cancer. Understanding the transport of inhalable aerosols across both short and long distances is necessary to predict human exposures to aerosols. To assess the transport of hazardous aerosols, surrogate tracer particles are required to measure their transport through occupied spaces. These tracer particles must not only possess similar transport characteristics to those of interest but also be easily distinguished from the background at low levels and survive the environmental conditions of the testing environment. A previously-developed DNA-tagged particle (DNATrax), composed of food-grade sugar and a DNA oligonucleotide as a “barcode” label, shows promise as a new aerosol tracer. Herein, the use of DNATrax material is validated for use in both indoor and outdoor environments. Utilizing passive samplers made of materials commonly found in indoor environments followed by quantitative polymerase chain reaction (qPCR) assay for endpoint particle detection, particles detection was achieved up to 90 m from the aerosolization location and across shorter distances with high spatial resolution. The unique DNA label and PCR assay specificity were leveraged to perform multiple simultaneous experiments. This allowed the assessment of experimental reproducibility, a rare occurrence among aerosol field tests. To transition to outdoor testing, the solid material provides some protection of the DNA label when exposed to ultraviolet (UV) radiation, with 60% of the DNA remaining intact after 60 minutes under a germicidal lamp and the rate of degradation declining with irradiation time. Additionally, exposure of the DNATrax material using

  9. Characterization of Charge-Carrier Transport in Semicrystalline Polymers: Electronic Couplings, Site Energies, and Charge-Carrier Dynamics in Poly(bithiophene- alt -thienothiophene) [PBTTT

    KAUST Repository

    Poelking, Carl; Cho, Eunkyung; Malafeev, Alexander; Ivanov, Viktor; Kremer, Kurt; Risko, Chad; Bré das, Jean-Luc; Andrienko, Denis

    2013-01-01

    We establish a link between the microscopic ordering and the charge-transport parameters for a highly crystalline polymeric organic semiconductor, poly(2,5-bis(3-tetradecylthiophen-2-yl)thieno[3,2-b]thiophene) (PBTTT). We find that the nematic and dynamic order parameters of the conjugated backbones, as well as their separation, evolve linearly with temperature, while the side-chain dynamic order parameter and backbone paracrystallinity change abruptly upon the (also experimentally observed) melting of the side chains around 400 K. The distribution of site energies follows the behavior of the backbone paracrystallinity and can be treated as static on the time scale of a single-charge transfer reaction. On the contrary, the electronic couplings between adjacent backbones are insensitive to side-chain melting and vary on a much faster time scale. The hole mobility, calculated after time-averaging of the electronic couplings, reproduces well the value measured in a short-channel thin-film transistor. The results underline that to secure efficient charge transport in lamellar arrangements of conjugated polymers: (i) the electronic couplings should present high average values and fast dynamics, and (ii) the energetic disorder (paracrystallinity) should be small. © 2013 American Chemical Society.

  10. Characterization of Charge-Carrier Transport in Semicrystalline Polymers: Electronic Couplings, Site Energies, and Charge-Carrier Dynamics in Poly(bithiophene- alt -thienothiophene) [PBTTT

    KAUST Repository

    Poelking, Carl

    2013-01-31

    We establish a link between the microscopic ordering and the charge-transport parameters for a highly crystalline polymeric organic semiconductor, poly(2,5-bis(3-tetradecylthiophen-2-yl)thieno[3,2-b]thiophene) (PBTTT). We find that the nematic and dynamic order parameters of the conjugated backbones, as well as their separation, evolve linearly with temperature, while the side-chain dynamic order parameter and backbone paracrystallinity change abruptly upon the (also experimentally observed) melting of the side chains around 400 K. The distribution of site energies follows the behavior of the backbone paracrystallinity and can be treated as static on the time scale of a single-charge transfer reaction. On the contrary, the electronic couplings between adjacent backbones are insensitive to side-chain melting and vary on a much faster time scale. The hole mobility, calculated after time-averaging of the electronic couplings, reproduces well the value measured in a short-channel thin-film transistor. The results underline that to secure efficient charge transport in lamellar arrangements of conjugated polymers: (i) the electronic couplings should present high average values and fast dynamics, and (ii) the energetic disorder (paracrystallinity) should be small. © 2013 American Chemical Society.

  11. Coherent Charge Transport in Ballistic InSb Nanowire Josephson Junctions

    Science.gov (United States)

    Li, S.; Kang, N.; Fan, D. X.; Wang, L. B.; Huang, Y. Q.; Caroff, P.; Xu, H. Q.

    2016-01-01

    Hybrid InSb nanowire-superconductor devices are promising for investigating Majorana modes and topological quantum computation in solid-state devices. An experimental realisation of ballistic, phase-coherent superconductor-nanowire hybrid devices is a necessary step towards engineering topological superconducting electronics. Here, we report on a low-temperature transport study of Josephson junction devices fabricated from InSb nanowires grown by molecular-beam epitaxy and provide a clear evidence for phase-coherent, ballistic charge transport through the nanowires in the junctions. We demonstrate that our devices show gate-tunable proximity-induced supercurrent and clear signatures of multiple Andreev reflections in the differential conductance, indicating phase-coherent transport within the junctions. We also observe periodic modulations of the critical current that can be associated with the Fabry-Pérot interference in the nanowires in the ballistic transport regime. Our work shows that the InSb nanowires grown by molecular-beam epitaxy are of excellent material quality and hybrid superconducting devices made from these nanowires are highly desirable for investigation of the novel physics in topological states of matter and for applications in topological quantum electronics. PMID:27102689

  12. DNA@Mn3(PO4)2 Nanoparticles Supported with Graphene Oxide as Photoelectrodes for Photoeletrocatalysis

    Science.gov (United States)

    Gao, Lixia; Xie, Jiale; Ma, Xiaoqing; Li, Man; Yu, Ling

    2017-01-01

    A novel deoxyribose nucleic acid (DNA)-based photoelectrode consisting of DNA@Mn3(PO4)2 nanoparticles on graphene oxide (GO) sheets was successfully fabricated for photoelectrocatalysis. DNA served as a soft template to guide the nucleation and growth of Mn3(PO4)2 nanoparticles in the synthesis of Mn3(PO4)2 nanoparticles. More importantly, the DNA also serves as semiconductor materials to adjust charge transport. Under UV light irradiation (180-420 nm, 15 mW/cm2), the photocurrent density of DNA@ Mn3(PO4)2/GO electrodes reached 9 μA/cm2 at 0.7 V bias (vs. SCE). An applied bias photon-to-current efficiency (ABPE) of 0.18% can be achieved, which was much higher than that of other control electrodes (<0.04%). In this DNA-based photoelectrode, well-matched energy levels can efficiently improve charge transfer and reduce the recombination of photogenerated electron-hole pairs.

  13. Synthesis of furan-based DNA binders and their interaction with DNA

    International Nuclear Information System (INIS)

    Voege, Andrea; Hoffmann, Sascha; Gabel, Detlef

    2006-01-01

    In recent years, many substances, based on naturally occurring DNA-binding molecules have been developed for the use in cancer therapy and as virostatica. Most of these substances are binding specifically to A-T rich sequences in the DNA minor groove. Neutral and positively charged DNA-binders are known. BNCT is most effective, which the boron is directly located in the cellular nucleus, so that the intercation with thermal neutrons can directly damage the DNA. To reach this aim, we have connected ammonioundecahydrododecaborate(1-) to DNA-binding structures such as 2,5-bis(4-formylphenyl)furan via a Schiff-Base reaction followed by a reduction of the imine to a secondary amine. In a following step the amine can be alkylated to insert positive charges to prevent repulsion between the compounds and the negatively charged sugar-phosphate-backbone of the DNA. (author)

  14. pH-induced fabrication of DNA/chitosan/α-ZrP nanocomposite and DNA release

    International Nuclear Information System (INIS)

    Liu Limin; Zhang Haitang; Shen Bo; He Weijiang; Lu Guoyuan; Liu Yuge; Zhu Junjie

    2010-01-01

    With positively charged chitosan as an intermediary, herring sperm DNA was intercalated into the interlayer galleries of negatively charged α-ZrP to form DNA/chitosan/α-ZrP ternary hybrids at pH 5.5. Fourier-transform IR, x-ray diffraction and scanning electron microscopy confirmed not only the coexistence of DNA, chitosan and α-ZrP in the composite but also the layered composite structure with an interlayer distance of 4.25 nm. Circular dichroism (CD) and UV spectroscopic studies disclosed that the restraint of DNA by the layered α-ZrP favors stabilization of the double-helical conformation of DNA and enhances the denaturation temperature. The intercalated DNA can be effectively released from the ternary nanocomposites at pHs higher than 6.5, and the released DNA displayed a similar CD spectrum to that of free DNA. The current research displays the promising potential to obtain a non-viral gene vector by intercalating DNA into negatively charged inorganic layered materials in the presence of a positively charged intermediary.

  15. Inhibition of Ku70 acetylation by INHAT subunit SET/TAF-Iβ regulates Ku70-mediated DNA damage response.

    Science.gov (United States)

    Kim, Kee-Beom; Kim, Dong-Wook; Park, Jin Woo; Jeon, Young-Joo; Kim, Daehwan; Rhee, Sangmyung; Chae, Jung-Il; Seo, Sang-Beom

    2014-07-01

    DNA double-strand breaks (DSBs) can cause either cell death or genomic instability. The Ku heterodimer Ku70/80 is required for the NHEJ (non-homologous end-joining) DNA DSB repair pathway. The INHAT (inhibitor of histone acetyltransferases) complex subunit, SET/TAF-Iβ, can inhibit p300- and PCAF-mediated acetylation of both histone and p53, thereby repressing general transcription and that of p53 target genes. Here, we show that SET/TAF-Iβ interacts with Ku70/80, and that this interaction inhibits CBP- and PCAF-mediated Ku70 acetylation in an INHAT domain-dependent manner. Notably, DNA damage by UV disrupted the interaction between SET/TAF-Iβ and Ku70. Furthermore, we demonstrate that overexpressed SET/TAF-Iβ inhibits recruitment of Ku70/80 to DNA damage sites. We propose that dysregulation of SET/TAF-Iβ expression prevents repair of damaged DNA and also contributes to cellular proliferation. All together, our findings indicate that SET/TAF-Iβ interacts with Ku70/80 in the nucleus and inhibits Ku70 acetylation. Upon DNA damage, SET/TAF-Iβ dissociates from the Ku complex and releases Ku70/Ku80, which are then recruited to DNA DSB sites via the NHEJ DNA repair pathway.

  16. Charge transport and contact resistance in coplanar devices based on colloidal polyaniline dispersion

    Czech Academy of Sciences Publication Activity Database

    Masillamani, A. M.; Peřinka, N.; Hajná, Milena; Stejskal, Jaroslav; Tondelier, D.; Bonnassieux, Y.; Vanel, J.-C.; Geffroy, B.; Mencaraglia, D.

    2016-01-01

    Roč. 54, č. 17 (2016), s. 1710-1716 ISSN 0887-6266 R&D Projects: GA ČR(CZ) GA13-00270S Institutional support: RVO:61389013 Keywords : charge transport * colloidal dispersion * colloids Subject RIV: JI - Composite Materials Impact factor: 2.838, year: 2016

  17. Charge-transport anisotropy in black phosphorus: critical dependence on the number of layers.

    Science.gov (United States)

    Banerjee, Swastika; Pati, Swapan K

    2016-06-28

    Phosphorene is a promising candidate for modern electronics because of the anisotropy associated with high electron-hole mobility. Additionally, superior mechanical flexibility allows the strain-engineering of various properties including the transport of charge carriers in phosphorene. In this work, we have shown the criticality of the number of layers to dictate the transport properties of black phosphorus. Trilayer black phosphorus (TBP) has been proposed as an excellent anisotropic material, based on the transport parameters using Boltzmann transport formalisms coupled with density functional theory. The mobilities of both the electron and the hole are found to be higher along the zigzag direction (∼10(4) cm(2) V(-1) s(-1) at 300 K) compared to the armchair direction (∼10(2) cm(2) V(-1) s(-1)), resulting in the intrinsic directional anisotropy. Application of strain leads to additional electron-hole anisotropy with 10(3) fold higher mobility for the electron compared to the hole. Critical strain for maximum anisotropic response has also been determined. Whether the transport anisotropy is due to the spatial or charge-carrier has been determined through analyses of the scattering process of electrons and holes, and their recombination as well as relaxation dynamics. In this context, we have derived two descriptors (S and F(k)), which are general enough for any 2D or quasi-2D systems. Information on the scattering involving purely the carrier states also helps to understand the layer-dependent photoluminescence and electron (hole) relaxation in black phosphorus. Finally, we justify trilayer black phosphorus (TBP) as the material of interest with excellent transport properties.

  18. Secondary electron emission and self-consistent charge transport in semi-insulating samples

    Energy Technology Data Exchange (ETDEWEB)

    Fitting, H.-J. [Institute of Physics, University of Rostock, Universitaetsplatz 3, D-18051 Rostock (Germany); Touzin, M. [Unite Materiaux et Transformations, UMR CNRS 8207, Universite de Lille 1, F-59655 Villeneuve d' Ascq (France)

    2011-08-15

    Electron beam induced self-consistent charge transport and secondary electron emission (SEE) in insulators are described by means of an electron-hole flight-drift model (FDM) now extended by a certain intrinsic conductivity (c) and are implemented by an iterative computer simulation. Ballistic secondary electrons (SE) and holes, their attenuation to drifting charge carriers, and their recombination, trapping, and field- and temperature-dependent detrapping are included. As a main result the time dependent ''true'' secondary electron emission rate {delta}(t) released from the target material and based on ballistic electrons and the spatial distributions of currents j(x,t), charges {rho}(x,t), field F(x,t), and potential V(x,t) are obtained where V{sub 0} = V(0,t) presents the surface potential. The intrinsic electronic conductivity limits the charging process and leads to a conduction sample current to the support. In that case the steady-state total SE yield will be fixed below the unit: i.e., {sigma} {eta} + {delta} < 1.

  19. Quantitative description of charge-carrier transport in a white organic light-emitting diode

    Science.gov (United States)

    Schober, M.; Anderson, M.; Thomschke, M.; Widmer, J.; Furno, M.; Scholz, R.; Lüssem, B.; Leo, K.

    2011-10-01

    We present a simulation model for the analysis of charge-carrier transport in organic thin-film devices, and apply it to a three-color white hybrid organic light-emitting diode (OLED) with fluorescent blue and phosphorescent red and green emission. We simulate a series of single-carrier devices, which reconstruct the OLED layer sequence step by step. Thereby, we determine the energy profiles for hole and electron transport, show how to discern bulk from interface limitation, and identify trap states.

  20. Neocarzinostatin-mediated DNA damage and repair in wild-type and repair-deficient Chinese hamster ovary cells

    International Nuclear Information System (INIS)

    Kuo, W.L.; Meyn, R.E.; Haidle, C.W.

    1984-01-01

    The formation and repair of neocarzinostatin (NCS)-mediated DNA damage were examined in two strains of Chinese hamster ovary cells. The response in strain EM9, a mutant line selected for its sensitivity to ethyl methanesulfonate and shown to have a defect in the repair of X-ray-induced DNA breaks, was compared with that observed in the parental strain (AA8). The DNA strand breaks and their subsequent rejoining were measured using the method of elution of DNA from filters under either alkaline (for single-strand breaks), or nondenaturing conditions (for double-strand breaks). Colony survival assays showed that the mutant was more sensitive to the action of NCS than was the parental strain by a factor of approximately 1.5. Elution analyses showed that the DNA from both strains was damaged by NCS; the mutant displayed more damage than the parent under the same treatment conditions. Single-strand breaks were produced with a frequency of about 10 to 15 times the frequency of double-strand breaks. Both strains were able to rejoin both single-strand breaks and double-strand breaks induced by NCS treatment. The strand break data suggest that the difference in NCS-mediated cytotoxicity between EM9 and AA8 cells may be directly related to the enhanced production of DNA strand breaks in EM9. However, the fact that much higher doses of NCS were required in the DNA studies compared to the colony survival assays implies that either a small number of DNA breaks occur in a critical region of the genome, or that lesions other than DNA strand breaks are partly responsible for the observed cytotoxicity

  1. Insulin modulates hippocampally-mediated spatial working memory via glucose transporter-4.

    Science.gov (United States)

    Pearson-Leary, J; Jahagirdar, V; Sage, J; McNay, E C

    2018-02-15

    The insulin-regulated glucose transporter, GluT4, is a key molecule in peripheral insulin signaling. Although GluT4 is abundantly expressed in neurons of specific brain regions such as the hippocampus, the functional role of neuronal GluT4 is unclear. Here, we used pharmacological inhibition of GluT4-mediated glucose uptake to determine whether GluT4 mediates insulin-mediated glucose uptake in the hippocampus. Consistent with previous reports, we found that glucose utilization increased in the dorsal hippocampus of male rats during spontaneous alternation (SA), a hippocampally-mediated spatial working memory task. We previously showed that insulin signaling within the hippocampus is required for processing this task, and that administration of exogenous insulin enhances performance. At baseline levels of hippocampal insulin, inhibition of GluT4-mediated glucose uptake did not affect SA performance. However, inhibition of an upstream regulator of GluT4, Akt, did impair SA performance. Conversely, when a memory-enhancing dose of insulin was delivered to the hippocampus prior to SA-testing, inhibition of GluT4-mediated glucose transport prevented cognitive enhancement. These data suggest that baseline hippocampal cognitive processing does not require functional hippocampal GluT4, but that cognitive enhancement by supra-baseline insulin does. Consistent with these findings, we found that in neuronal cell culture, insulin increases glucose utilization in a GluT4-dependent manner. Collectively, these data demonstrate a key role for GluT4 in transducing the procognitive effects of elevated hippocampal insulin. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. DMPD: Signal transduction pathways mediated by the interaction of CpG DNA withToll-like receptor 9. [Dynamic Macrophage Pathway CSML Database

    Lifescience Database Archive (English)

    Full Text Available 14751759 Signal transduction pathways mediated by the interaction of CpG DNA withTo...;16(1):17-22. (.png) (.svg) (.html) (.csml) Show Signal transduction pathways mediated by the interaction of... CpG DNA withToll-like receptor 9. PubmedID 14751759 Title Signal transduction pathways media

  3. Influence of magnetic impurities on charge transport in diffusive-normal-metal/superconductor junctions

    NARCIS (Netherlands)

    Yokoyama, T.; Tanaka, Y.; Golubov, Alexandre Avraamovitch; Inoue, J.; Asano, Y.

    2005-01-01

    Charge transport in the diffusive normal metal (DN)/insulator/s- and d-wave superconductor junctions is studied in the presence of magnetic impurities in DN in the framework of the quasiclassical Usadel equations with the generalized boundary conditions. The cases of s- and d-wave superconducting

  4. Evidence for a role of transporter-mediated currents in the depletion of brain serotonin induced by serotonin transporter substrates.

    Science.gov (United States)

    Baumann, Michael H; Bulling, Simon; Benaderet, Tova S; Saha, Kusumika; Ayestas, Mario A; Partilla, John S; Ali, Syed F; Stockner, Thomas; Rothman, Richard B; Sandtner, Walter; Sitte, Harald H

    2014-05-01

    Serotonin (5-HT) transporter (SERT) substrates like fenfluramine and 3,4-methylenedioxymethamphetamine cause long-term depletion of brain 5-HT, while certain other substrates do not. The 5-HT deficits produced by SERT substrates are dependent upon transporter proteins, but the exact mechanisms responsible are unclear. Here, we compared the pharmacology of several SERT substrates: fenfluramine, d-fenfluramine, 1-(m-chlorophenyl)piperazine (mCPP) and 1-(m-trifluoromethylphenyl)piperainze (TFMPP), to establish relationships between acute drug mechanisms and the propensity for long-term 5-HT depletions. In vivo microdialysis was carried out in rat nucleus accumbens to examine acute 5-HT release and long-term depletion in the same subjects. In vitro assays were performed to measure efflux of [(3)H]5-HT in rat brain synaptosomes and transporter-mediated ionic currents in SERT-expressing Xenopus oocytes. When administered repeatedly to rats (6 mg/kg, i.p., four doses), all drugs produce large sustained elevations in extracellular 5-HT (>5-fold) with minimal effects on dopamine. Importantly, 2 weeks after dosing, only rats exposed to fenfluramine and d-fenfluramine display depletion of brain 5-HT. All test drugs evoke fluoxetine-sensitive efflux of [(3)H]5-HT from synaptosomes, but d-fenfluramine and its bioactive metabolite d-norfenfluramine induce significantly greater SERT-mediated currents than phenylpiperazines. Our data confirm that drug-induced 5-HT release probably does not mediate 5-HT depletion. However, the magnitude of transporter-mediated inward current may be a critical factor in the cascade of events leading to 5-HT deficits. This hypothesis warrants further study, especially given the growing popularity of designer drugs that target SERT.

  5. Optimization of nanowire DNA sensor sensitivity using self-consistent simulation

    KAUST Repository

    Baumgartner, S; Vasicek, M; Bulyha, A; Heitzinger, C

    2011-01-01

    In order to facilitate the rational design and the characterization of nanowire field-effect sensors, we have developed a model based on self-consistent charge-transport equations combined with interface conditions for the description of the biofunctionalized surface layer at the semiconductor/electrolyte interface. Crucial processes at the interface, such as the screening of the partial charges of the DNA strands and the influence of the angle of the DNA strands with respect to the nanowire, are computed by a Metropolis Monte Carlo algorithm for charged molecules at interfaces. In order to investigate the sensing mechanism of the device, we have computed the current-voltage characteristics, the electrostatic potential and the concentrations of electrons and holes. Very good agreement with measurements has been found and optimal device parameters have been identified. Our approach provides the capability to study the device sensitivity, which is of fundamental importance for reliable sensing. © IOP Publishing Ltd.

  6. Optimization of nanowire DNA sensor sensitivity using self-consistent simulation

    KAUST Repository

    Baumgartner, S

    2011-09-26

    In order to facilitate the rational design and the characterization of nanowire field-effect sensors, we have developed a model based on self-consistent charge-transport equations combined with interface conditions for the description of the biofunctionalized surface layer at the semiconductor/electrolyte interface. Crucial processes at the interface, such as the screening of the partial charges of the DNA strands and the influence of the angle of the DNA strands with respect to the nanowire, are computed by a Metropolis Monte Carlo algorithm for charged molecules at interfaces. In order to investigate the sensing mechanism of the device, we have computed the current-voltage characteristics, the electrostatic potential and the concentrations of electrons and holes. Very good agreement with measurements has been found and optimal device parameters have been identified. Our approach provides the capability to study the device sensitivity, which is of fundamental importance for reliable sensing. © IOP Publishing Ltd.

  7. Electrochemical and Electronic Charge Transport Properties of Ni-Doped LiMn2O4 Spinel Obtained from Polyol-Mediated Synthesis

    Directory of Open Access Journals (Sweden)

    Shuo Yang

    2018-05-01

    Full Text Available LiNi0.5Mn1.5O4 (LNMO spinel has been extensively investigated as one of the most promising high-voltage cathode candidates for lithium-ion batteries. The electrochemical performance of LNMO, especially its rate performance, seems to be governed by its crystallographic structure, which is strongly influenced by the preparation methods. Conventionally, LNMO materials are prepared via solid-state reactions, which typically lead to microscaled particles with only limited control over the particle size and morphology. In this work, we prepared Ni-doped LiMn2O4 (LMO spinel via the polyol method. The cycling stability and rate capability of the synthesized material are found to be comparable to the ones reported in literature. Furthermore, its electronic charge transport properties were investigated by local electrical transport measurements on individual particles by means of a nanorobotics setup in a scanning electron microscope, as well as by performing DFT calculations. We found that the scarcity of Mn3+ in the LNMO leads to a significant decrease in electronic conductivity as compared to undoped LMO, which had no obvious effect on the rate capability of the two materials. Our results suggest that the rate capability of LNMO and LMO materials is not limited by the electronic conductivity of the fully lithiated materials.

  8. Heterojunction PbS nanocrystal solar cells with oxide charge-transport layers.

    Science.gov (United States)

    Hyun, Byung-Ryool; Choi, Joshua J; Seyler, Kyle L; Hanrath, Tobias; Wise, Frank W

    2013-12-23

    Oxides are commonly employed as electron-transport layers in optoelectronic devices based on semiconductor nanocrystals, but are relatively rare as hole-transport layers. We report studies of NiO hole-transport layers in PbS nanocrystal photovoltaic structures. Transient fluorescence experiments are used to verify the relevant energy levels for hole transfer. On the basis of these results, planar heterojunction devices with ZnO as the photoanode and NiO as the photocathode were fabricated and characterized. Solution-processed devices were used to systematically study the dependence on nanocrystal size and achieve conversion efficiency as high as 2.5%. Optical modeling indicates that optimum performance should be obtained with thinner oxide layers than can be produced reliably by solution casting. Room-temperature sputtering allows deposition of oxide layers as thin as 10 nm, which enables optimization of device performance with respect to the thickness of the charge-transport layers. The best devices achieve an open-circuit voltage of 0.72 V and efficiency of 5.3% while eliminating most organic material from the structure and being compatible with tandem structures.

  9. Influence of electron-phonon interaction on soliton mediated spin-charge conversion effects in two-component polymer model

    International Nuclear Information System (INIS)

    Sergeenkov, S.; Moraes, F.; Furtado, C.; Araujo-Moreira, F.M.

    2010-01-01

    By mapping a Hubbard-like model describing a two-component polymer in the presence of strong enough electron-phonon interactions (κ) onto the system of two coupled nonlinear Schroedinger equations with U(2) symmetry group, some nontrivial correlations between topological solitons mediated charge Q and spin S degrees of freedom are obtained. Namely, in addition to a charge fractionalization and reentrant like behavior of both Q(κ) and S(κ), the model also predicts a decrease of soliton velocity with κ as well as spin-charge conversion effects which manifest themselves through an explicit S(Q,Ω) dependence (with Ω being a mixing angle between spin-up and spin-down electron amplitudes). A possibility to observe the predicted effects in low-dimensional systems with charge and spin soliton carriers is discussed.

  10. Charge transport models for reliability engineering of semiconductor devices

    International Nuclear Information System (INIS)

    Bina, M.

    2014-01-01

    The simulation of semiconductor devices is important for the assessment of device lifetimes before production. In this context, this work investigates the influence of the charge carrier transport model on the accuracy of bias temperature instability and hot-carrier degradation models in MOS devices. For this purpose, a four-state defect model based on a non-radiative multi phonon (NMP) theory is implemented to study the bias temperature instability. However, the doping concentrations typically used in nano-scale devices correspond to only a small number of dopants in the channel, leading to fluctuations of the electrostatic potential. Thus, the granularity of the doping cannot be ignored in these devices. To study the bias temperature instability in the presence of fluctuations of the electrostatic potential, the advanced drift diffusion device simulator Minimos-NT is employed. In a first effort to understand the bias temperature instability in p-channel MOSFETs at elevated temperatures, data from direct-current-current-voltage measurements is successfully reproduced using a four-state defect model. Differences between the four-state defect model and the commonly employed trapping model from Shockley, Read and Hall (SRH) have been investigated showing that the SRH model is incapable of reproducing the measurement data. This is in good agreement with the literature, where it has been extensively shown that a model based on SRH theory cannot reproduce the characteristic time constants found in BTI recovery traces. Upon inspection of recorded recovery traces after bias temperature stress in n-channel MOSFETs it is found that the gate current is strongly correlated with the drain current (recovery trace). Using a random discrete dopant model and non-equilibrium greens functions it is shown that direct tunnelling cannot explain the magnitude of the gate current reduction. Instead it is found that trap-assisted tunnelling, modelled using NMP theory, is the cause of this

  11. The inhibitory effects of five alkaloids on the substrate transport mediated through human organic anion and cation transporters.

    Science.gov (United States)

    Shams, Tahiatul; Lu, Xiaoxi; Zhu, Ling; Zhou, Fanfan

    2018-02-01

    1. Human solute carrier transporters (SLCs) are important membrane proteins mediate the cellular transport of many endogenous and exogenous substances. Organic anion/cation transporters (OATs/OCTs) and organic anion transporting polypeptides (OATPs) are essential SLCs involved in drug influx. Drug-drug/herb interactions through competing for specific SLCs often lead to unsatisfied therapeutic outcomes and/or unwanted side effects. In this study, we comprehensively investigated the inhibitory effects of five clinically relevant alkaloids (dendrobine, matrine, oxymatrine, tryptanthrin and chelerythrine) on the substrate transport through several OATs/OCTs and OATPs. 2. We performed transport functional assay and kinetic analysis on the HEK-293 cells over-expressing each SLC gene. 3. Our data showed tryptanthrin significantly inhibited the transport activity of OAT3 (IC 50  = 0.93 ± 0.22 μM, K i  = 0.43 μM); chelerythrine acted as a potent inhibitor to the substrate transport mediated through OATP1A2 (IC 50  = 0.63 ± 0.43 μM, K i  = 0.60 μM), OCT1 (IC 50  = 13.60 ± 2.81 μM) and OCT2 (IC 50  =10.80 ± 1.16 μM). 4. Our study suggested tryptanthrin and chelerythrine could potently impact on the drug transport via specific OATs/OCTs. Therefore, the co-administration of these alkaloids with drugs could have clinical consequences due to drug-drug/herb interactions. Precautions should be warranted in the multi-drug therapies involving these alkaloids.

  12. Charge Transport Along Phenylenevinylene Molecular Wires

    OpenAIRE

    2006-01-01

    Abstract A model to calculate the mobility of charges along molecular wires is presented. The model is based on the tight-binding approximation and combines a quantum mechanical description of the charge with a classical description of the structural degrees of freedom. It is demonstrated that the average mobility of charge carriers along molecular wires can be obtained by time-propagation of states which are initially localised. The model is used to calculate the mobility of charg...

  13. Ebullition, Plant-Mediated Transport, and Subsurface Horizontal Water Flow Dominate Methane Transport in an Arctic Sphagnum Bog

    Science.gov (United States)

    Wehr, R. A.; McCalley, C. K.; Logan, T. A.; Chanton, J.; Crill, P. M.; Rich, V. I.; Saleska, S. R.

    2017-12-01

    Emission of the greenhouse gas methane from wetlands is of prime concern in the prediction of climate change - especially emission associated with thawing permafrost, which may drive a positive feedback loop of emission and warming. In addition to the biochemistry of methane production and consumption, wetland methane emission depends critically on the transport mechanisms by which methane moves through and out of the ecosystem. We therefore developed a model of methane biochemistry and transport for a sphagnum bog representing an intermediate permafrost thaw stage in Stordalen Mire, Sweden. In order to simultaneously reproduce measured profiles of both the concentrations and isotopic compositions of both methane and carbon dioxide in the peat pore water (Fig. 1) - as well as the surface methane emission - it was necessary for the model to include ebullition, plant-mediated transport via aerenchyma, and subsurface horizontal water flow. Diffusion of gas through the pore water was relatively unimportant. As a result, 90% of the produced methane escaped the wetland rather than being consumed by methanotrophic organisms in the near-surface pore water. Our model provides a comprehensive picture of methane emission from this bog site by quantifying the vertical profiles of: acetoclastic methanogenesis, hydrogenotrophic methanogenesis, methane oxidation, aerobic respiration, ebullition, plant-mediated transport, subsurface horizontal water flow, and diffusion.

  14. Solving the Single-Sink, Fixed-Charge, Multiple-Choice Transportation Problem by Dynamic Programming

    DEFF Research Database (Denmark)

    Christensen, Tue; Andersen, Kim Allan; Klose, Andreas

    2013-01-01

    This paper considers a minimum-cost network flow problem in a bipartite graph with a single sink. The transportation costs exhibit a staircase cost structure because such types of transportation cost functions are often found in practice. We present a dynamic programming algorithm for solving...... this so-called single-sink, fixed-charge, multiple-choice transportation problem exactly. The method exploits heuristics and lower bounds to peg binary variables, improve bounds on flow variables, and reduce the state-space variable. In this way, the dynamic programming method is able to solve large...... instances with up to 10,000 nodes and 10 different transportation modes in a few seconds, much less time than required by a widely used mixed-integer programming solver and other methods proposed in the literature for this problem....

  15. Exogenous DNA internalisation by sperm cells is improved by combining lipofection and restriction enzyme mediated integration.

    Science.gov (United States)

    Churchil, R R; Gupta, J; Singh, A; Sharma, D

    2011-06-01

    1. Three types of exogenous DNA inserts, i.e. complete linearised pVIVO2-GFP/LacZ vector (9620 bp), the LacZ gene (5317 bp) and the GFP gene (2152 bp) were used to transfect chicken spermatozoa through simple incubation of sperm cells with insert. 2. PCR assay, Dot Blot hybridisation and Southern hybridisation showed the successful internalisation of exogenous DNA by chicken sperm cells. 3. Lipofection and Restriction Enzyme Mediated Integration (REMI) were used to improve the rate of internalisation of exogenous DNA by sperm cells. 4. Results from dot blot as well as Southern hybridisation were semi-quantified and improved exogenous DNA uptake by sperm cells through lipofection and REMI. Stronger signals were observed from hybridisation of LacZ as well as GFP specific probe with the DNA from lipofected exogenous DNA transfected sperm DNA in comparison with those transfected with nude exogenous DNA.

  16. Integral transport theory for charged particles in electric and magnetic fields

    International Nuclear Information System (INIS)

    Boffi, V.C.; Molinari, V.G.

    1979-01-01

    An integral transport theory for charged particles which, in the presence of electric and magnetic fields, diffuse by collisions against the atoms (or molecules) of a host medium is proposed. The combined effects of both the external fields and the mechanisms of scattering, removal and creation in building up the distribution function of the charged particles considered are investigated. The eigenvalue problem associated with the sourceless case of the given physical situation is also commented. Applications of the theory to a purely velocity-dependent problem and to a space-dependent problem, respectively, are illustrated for the case of a separable isotropic scattering kernel of synthetic type. Calculations of the distribution function, of the total current density and of relevant electrical conductivity are then carried out for different specializations of the external fields. (author)

  17. TALE nickase mediates high efficient targeted transgene integration at the human multi-copy ribosomal DNA locus.

    Science.gov (United States)

    Wu, Yong; Gao, Tieli; Wang, Xiaolin; Hu, Youjin; Hu, Xuyun; Hu, Zhiqing; Pang, Jialun; Li, Zhuo; Xue, Jinfeng; Feng, Mai; Wu, Lingqian; Liang, Desheng

    2014-03-28

    Although targeted gene addition could be stimulated strikingly by a DNA double strand break (DSB) created by either zinc finger nucleases (ZFNs) or TALE nucleases (TALENs), the DSBs are really mutagenic and toxic to human cells. As a compromised solution, DNA single-strand break (SSB) or nick has been reported to mediate high efficient gene addition but with marked reduction of random mutagenesis. We previously demonstrated effective targeted gene addition at the human multicopy ribosomal DNA (rDNA) locus, a genomic safe harbor for the transgene with therapeutic potential. To improve the transgene integration efficiency by using TALENs while lowering the cytotoxicity of DSBs, we created both TALENs and TALE nickases (TALENickases) targeting this multicopy locus. A targeting vector which could integrate a GFP cassette at the rDNA locus was constructed and co-transfected with TALENs or TALENickases. Although the fraction of GFP positive cells using TALENs was greater than that using TALENickases during the first few days after transfection, it reduced to a level less than that using TALENickases after continuous culture. Our findings showed that the TALENickases were more effective than their TALEN counterparts at the multi-copy rDNA locus, though earlier studies using ZFNs and ZFNickases targeting the single-copy loci showed the reverse. Besides, TALENickases mediated the targeted integration of a 5.4 kb fragment at a frequency of up to 0.62% in HT1080 cells after drug selection, suggesting their potential application in targeted gene modification not being limited at the rDNA locus. Copyright © 2014 Elsevier Inc. All rights reserved.

  18. FGF2 mediates DNA repair in epidermoid carcinoma cells exposed to ionizing radiation

    International Nuclear Information System (INIS)

    Marie, Melanie; Hafner, Sophie; Moratille, Sandra; Vaigot, Pierre; Rigaud, Odile; Martin, Michele T.; Mine, Solene

    2012-01-01

    Fibroblast growth factor 2 (FGF2) is a well-known survival factor. However, its role in DNA repair is poorly documented. The present study was designed to investigate in epidermoid carcinoma cells the potential role of FGF2 in DNA repair. The side population (SP) with cancer stem cell-like properties and the main population (MP) were isolated from human A431 squamous carcinoma cells. Radiation-induced DNA damage and repair were assessed using the alkaline comet assay. FGF2 expression was quantified by enzyme linked immunosorbent assay (ELISA). SP cells exhibited rapid repair of radiation induced DNA damage and a high constitutive level of nuclear FGF2. Blocking FGF2 signaling abrogated the rapid DNA repair. In contrast, in MP cells, a slower repair of damage was associated with low basal expression of FGF2. Moreover, the addition of exogenous FGF2 accelerated DNA repair in MP cells. When irradiated, SP cells secreted FGF2, whereas MP cells did not. FGF2 was found to mediate DNA repair in epidermoid carcinoma cells. We postulate that carcinoma stem cells would be intrinsically primed to rapidly repair DNA damage by a high constitutive level of nuclear FGF2. In contrast, the main population with a low FGF2 content exhibits a lower repair rate which can be increased by exogenous FGF2. (authors)

  19. Solid lipid nanoparticles mediate non-viral delivery of plasmid DNA to dendritic cells

    Science.gov (United States)

    Penumarthi, Alekhya; Parashar, Deepti; Abraham, Amanda N.; Dekiwadia, Chaitali; Macreadie, Ian; Shukla, Ravi; Smooker, Peter M.

    2017-06-01

    There is an increasing demand for novel DNA vaccine delivery systems, mainly for the non-viral type as they are considered relatively safe. Therefore, solid lipid nanoparticles (SLNs) were investigated for their suitability as a non-viral DNA vaccine delivery system. SLNs were synthesised by a modified solvent-emulsification method in order to study their potential to conjugate with plasmid DNA and deliver them in vitro to dendritic cells using eGFP as the reporter plasmid. The DNA-SLN complexes were characterised by electron microscopy, gel retardation assays and dynamic light scattering. The cytotoxicity assay data supported their biocompatibility and was used to estimate safe threshold concentration resulting in high transfection rate. The transfection efficiency of these complexes in a dendritic cell line was shown to increase significantly compared to plasmid alone, and was comparable to that mediated by lipofectamine. Transmission electron microscopy studies delineated the pathway of cellular uptake. Endosomal escape was observed supporting the mechanism of transfection.

  20. Universal transport characteristics of multiple topological superconducting wires with large charging energy

    Energy Technology Data Exchange (ETDEWEB)

    Kashuba, Oleksiy; Trauzettel, Bjoern [Institut fuer Theoretische Physik und Astrophysik, Universitaet Wuerzburg, 97074 Wuerzburg (Germany); Timm, Carsten [Institut fuer Theoretische Physik, TU Dresden, 01062 Dresden (Germany)

    2016-07-01

    The system with multiple Majorana states coupled to the normal lead can potentially support the interaction between Majorana fermions and electrons. Such system can be implemented by several floating topological superconducting wires with large charging energy asymmetrically coupled to two normal leads. The analysis of the renormalization flow shows that there is a single fixed point - the strong coupling limit of isotropic antiferromagnetic Kondo model. The topological Kondo-like interaction leads also to the selective renormalization of the tunneling coefficients, strongly enhancing one component and suppressing others. Thus, charging energy crucially changes the transport properties of the system leading to the universal single-channel conductance independently from the values of the initial leads-wires coupling.

  1. Polarization of electron-beam irradiated LDPE films: contribution to charge generation and transport

    Science.gov (United States)

    Banda, M. E.; Griseri, V.; Teyssèdre, G.; Le Roy, S.

    2018-04-01

    Electron-beam irradiation is an alternative way to generate charges in insulating materials, at controlled position and quantity, in order to monitor their behaviour in regard to transport phenomena under the space charge induced electric field or external field applied. In this study, low density polyethylene (LDPE) films were irradiated by a 80 keV electron-beam with a flux of 1 nA cm‑2 during 10 min in an irradiation chamber under vacuum conditions, and were then characterized outside the chamber using three experimental methods. The electrical behaviour of the irradiated material was assessed by space charge measurements using the pulsed electro-acoustic (PEA) method under dc stress. The influence of the applied electric field polarity and amplitude has been tested in order to better understand the charge behaviour after electron-beam irradiation. Fourier transform infra-red spectroscopy (FTIR) and photoluminescence (PL) measurements were performed to evaluate the impact of the electron beam irradiation, i.e. deposited charges and energy, on the chemical structure of the irradiated samples. The present results show that the electrical behaviour in LDPE after irradiation is mostly driven by charges, i.e. by physical process functions of the electric field, and that changes in the chemical structure seems to be mild.

  2. The Role of Shape on Electronic Structure and Charge Transport in Faceted PbSe Nanocrystals

    KAUST Repository

    Kaushik, Ananth P.

    2014-03-25

    We have determined the effect of shape on the charge transport characteristics of nanocrystals. Our study looked at the explicit determination of the electronic properties of faceted nanocrystals that essentially probe the limit of current computational reach, i.e., nanocrystals from 1.53 to 2.1 nm in diameter. These nanocrystals, which resemble PbSe systems, are either bare or covered in short ligands. They also differ in shape, octahedral vs cube-octahedral, and in superlattice symmetry (fcc vs bcc). We have provided insights on electron and hole coupling along different facets and overall charge mobility in bcc and fcc superlattices. We have determined that the relative areas of (100) to (111) facets, and facet atom types are important factors governing the optimization of charge transport. The calculated electronic density of states shows no role of -SCH3 - ligands on states near the band gap. Electron coupling between nanocrystals is significantly higher than that of hole coupling; thiol ligands lower the ratio between electron and hole couplings. Stronger coupling exists between smaller nanocrystals. © 2014 American Chemical Society.

  3. Aag DNA glycosylase promotes alkylation-induced tissue damage mediated by Parp1.

    Science.gov (United States)

    Calvo, Jennifer A; Moroski-Erkul, Catherine A; Lake, Annabelle; Eichinger, Lindsey W; Shah, Dharini; Jhun, Iny; Limsirichai, Prajit; Bronson, Roderick T; Christiani, David C; Meira, Lisiane B; Samson, Leona D

    2013-04-01

    Alkylating agents comprise a major class of front-line cancer chemotherapeutic compounds, and while these agents effectively kill tumor cells, they also damage healthy tissues. Although base excision repair (BER) is essential in repairing DNA alkylation damage, under certain conditions, initiation of BER can be detrimental. Here we illustrate that the alkyladenine DNA glycosylase (AAG) mediates alkylation-induced tissue damage and whole-animal lethality following exposure to alkylating agents. Aag-dependent tissue damage, as observed in cerebellar granule cells, splenocytes, thymocytes, bone marrow cells, pancreatic β-cells, and retinal photoreceptor cells, was detected in wild-type mice, exacerbated in Aag transgenic mice, and completely suppressed in Aag⁻/⁻ mice. Additional genetic experiments dissected the effects of modulating both BER and Parp1 on alkylation sensitivity in mice and determined that Aag acts upstream of Parp1 in alkylation-induced tissue damage; in fact, cytotoxicity in WT and Aag transgenic mice was abrogated in the absence of Parp1. These results provide in vivo evidence that Aag-initiated BER may play a critical role in determining the side-effects of alkylating agent chemotherapies and that Parp1 plays a crucial role in Aag-mediated tissue damage.

  4. Aag DNA glycosylase promotes alkylation-induced tissue damage mediated by Parp1.

    Directory of Open Access Journals (Sweden)

    Jennifer A Calvo

    2013-04-01

    Full Text Available Alkylating agents comprise a major class of front-line cancer chemotherapeutic compounds, and while these agents effectively kill tumor cells, they also damage healthy tissues. Although base excision repair (BER is essential in repairing DNA alkylation damage, under certain conditions, initiation of BER can be detrimental. Here we illustrate that the alkyladenine DNA glycosylase (AAG mediates alkylation-induced tissue damage and whole-animal lethality following exposure to alkylating agents. Aag-dependent tissue damage, as observed in cerebellar granule cells, splenocytes, thymocytes, bone marrow cells, pancreatic β-cells, and retinal photoreceptor cells, was detected in wild-type mice, exacerbated in Aag transgenic mice, and completely suppressed in Aag⁻/⁻ mice. Additional genetic experiments dissected the effects of modulating both BER and Parp1 on alkylation sensitivity in mice and determined that Aag acts upstream of Parp1 in alkylation-induced tissue damage; in fact, cytotoxicity in WT and Aag transgenic mice was abrogated in the absence of Parp1. These results provide in vivo evidence that Aag-initiated BER may play a critical role in determining the side-effects of alkylating agent chemotherapies and that Parp1 plays a crucial role in Aag-mediated tissue damage.

  5. Simulation of charge transport in organic semiconductors: A time-dependent multiscale method based on nonequilibrium Green's functions

    DEFF Research Database (Denmark)

    Leitherer, Susanne; Jager, C. M.; Krause, A.

    2017-01-01

    In weakly interacting organic semiconductors, static disorder and dynamic disorder often have an important impact on transport properties. Describing charge transport in these systems requires an approach that correctly takes structural and electronic fluctuations into account. Here, we present...... are used in organic field-effect transistors....

  6. Charge transport through superconductor/Anderson-insulator interfaces

    International Nuclear Information System (INIS)

    Frydman, A.; Ovadyahu, Z.

    1997-01-01

    We report on a study of charge transport through superconductor-insulator-superconductor and normal metal endash insulator endash superconductor structures (SIS and NIS junctions, respectively) where the insulator is of the Anderson type. Devices which are characterized by a junction resistance larger than 10 kΩ show behavior which is typical of Giaever tunnel junctions. In structures having smaller resistance, several peculiar features are observed. In the SIS junctions, Josephson coupling is detected over distances much larger then the typical insulator localization length. In addition, a series of resistance peaks appears at voltages of 2Δ/n, where Δ is the superconducting gap. The NIS Junctions exhibit a large resistance dip at subgap bias. We discuss possible interpretations of these findings and suggest that they may result from the presence of high transmission channels through the barrier region. copyright 1997 The American Physical Society

  7. Highly Stable Double-Stranded DNA Containing Sequential Silver(I)-Mediated 7-Deazaadenine/Thymine Watson-Crick Base Pairs.

    Science.gov (United States)

    Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A

    2016-05-17

    The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Enhanced charge transport and photovoltaic performance of PBDTTT-C-T/PC70BM solar cells via UV-ozone treatment.

    Science.gov (United States)

    Adhikary, Prajwal; Venkatesan, Swaminathan; Adhikari, Nirmal; Maharjan, Purna P; Adebanjo, Olusegun; Chen, Jihua; Qiao, Qiquan

    2013-10-21

    In this work, the electron transport layer of PBDTTT-C-T/PC70BM polymer solar cells were subjected to UV-ozone treatment, leading to improved cell performances from 6.46% to 8.34%. The solar cell efficiency reached a maximum of 8.34% after an optimal 5 minute UV-ozone treatment, and then decreased if treated for a longer time. To the best of our knowledge, the mechanism behind the effects of UV-ozone treatment on the improvement of charge transport and cell performance is not fully understood. We have developed a fundamental understanding of the UV-ozone treatment mechanism, which explains both the enhancements in charge transport and photovoltaic performance at an optimal treatment time, and also the phenomenon whereby further treatment time leads to a drop in cell efficiency. Transient photocurrent measurements indicated that the cell charge transport times were 1370 ns, 770 ns, 832 ns, 867 ns, and 1150 ns for the 0 min, 5 min, 10 min, 15 min, and 20 min UV-ozone treatment times, respectively. Therefore the 5 min UV-ozone treatment time led to the shortest transport time and the most efficient charge transport in the cells. The 5 min UV-ozone treated sample exhibited the highest peak intensity (E2) in the Raman spectra of the treated films, at about 437 cm(-1), indicating that it possessed the best wurtzite phase crystallinity of the ZnO films. Further increasing the UV-ozone treatment time from 5 to 20 min induced the formation of p-type defects (e.g. interstitial oxygen atoms), pushing the ZnO Fermi-level further away from the vacuum level, and decreasing the wurtzite crystallinity.

  9. Charge transport along luminescent oxide layers containing Si and SiC nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Jambois, O. [EME, Departament d' Electronica, Universitat de Barcelona, Marti i Franques 1, 08028 Barcelona (Spain)]. E-mail: ojambois@el.ub.es; Vila, A. [EME, Departament d' Electronica, Universitat de Barcelona, Marti i Franques 1, 08028 Barcelona (Spain); Pellegrino, P. [EME, Departament d' Electronica, Universitat de Barcelona, Marti i Franques 1, 08028 Barcelona (Spain); Carreras, J. [EME, Departament d' Electronica, Universitat de Barcelona, Marti i Franques 1, 08028 Barcelona (Spain); Perez-Rodriguez, A. [EME, Departament d' Electronica, Universitat de Barcelona, Marti i Franques 1, 08028 Barcelona (Spain); Garrido, B. [EME, Departament d' Electronica, Universitat de Barcelona, Marti i Franques 1, 08028 Barcelona (Spain); Bonafos, C. [Nanomaterials Group, CEMES-CNRS, 29 rue J. Marvig 31055, Toulouse (France); BenAssayag, G. [Nanomaterials Group, CEMES-CNRS, 29 rue J. Marvig 31055, Toulouse (France)

    2006-12-15

    The electrical conductivity of silicon oxides containing silicon and silicon-carbon nanoparticles has been investigated. By use of sequential Si{sup +} and C{sup +} ion implantations in silicon oxide followed by an annealing at 1100 deg. C, luminescent Si nanocrystals and SiC nanoparticles were precipitated. The characterization of the electrical transport has been carried out on two kinds of structures, allowing parallel or perpendicular transport, with respect to the substrate. The first type of samples were elaborated by means of a focus-ion-beam technique: electrical contacts to embedded nanoparticles were made by milling two nanotrenches on the sample surface until reaching the buried layer, then filling them with tungsten. The distance between the electrodes is about 100 nm. The second type of samples correspond to 40 nm thick typical MOS capacitors. The electron transport along the buried layer has shown a dramatic lowering of the electrical current, up to five orders of magnitude, when applying a sequence of voltages. It has been related to a progressive charge retention inside the nanoparticles, which, on its turn, suppresses the electrical conduction along the layer. On the other hand, the MOS capacitors show a reversible carrier charge and discharge effect that limits the current at low voltage, mostly due to the presence of C in the layers. A typical Fowler-Nordheim injection takes place at higher applied voltages, with a threshold voltage equal to 23 V.

  10. A DNAzyme-mediated logic gate for programming molecular capture and release on DNA origami.

    Science.gov (United States)

    Li, Feiran; Chen, Haorong; Pan, Jing; Cha, Tae-Gon; Medintz, Igor L; Choi, Jong Hyun

    2016-06-28

    Here we design a DNA origami-based site-specific molecular capture and release platform operated by a DNAzyme-mediated logic gate process. We show the programmability and versatility of this platform with small molecules, proteins, and nanoparticles, which may also be controlled by external light signals.

  11. The Role of Shape on Electronic Structure and Charge Transport in Faceted PbSe Nanocrystals

    KAUST Repository

    Kaushik, Ananth P.; Lukose, Binit; Clancy, Paulette

    2014-01-01

    We have determined the effect of shape on the charge transport characteristics of nanocrystals. Our study looked at the explicit determination of the electronic properties of faceted nanocrystals that essentially probe the limit of current

  12. Bistetracene Thin Film Polymorphic Control to Unravel the Effect of Molecular Packing on Charge Transport

    KAUST Repository

    Burnett, Edmund K.

    2018-02-26

    Polymorphism, the ability for a given material to adopt multiple crystalline packing states, is a powerful approach for investigating how changes in molecular packing influence charge transport within organic semiconductors. In this study, a new

  13. Bistetracene Thin Film Polymorphic Control to Unravel the Effect of Molecular Packing on Charge Transport

    KAUST Repository

    Burnett, Edmund K.; Ly, Jack; Niazi, Muhammad Rizwan; Zhang, Lei; McCuskey, Samantha R.; Amassian, Aram; Smilgies, Detlef-M.; Mannsfeld, Stefan C. B.; Briseno, Alejandro L.

    2018-01-01

    Polymorphism, the ability for a given material to adopt multiple crystalline packing states, is a powerful approach for investigating how changes in molecular packing influence charge transport within organic semiconductors. In this study, a new

  14. Charge and energy transfer interplay in hybrid sensitized solar cells mediated by graphene quantum dots

    International Nuclear Information System (INIS)

    Mihalache, Iuliana; Radoi, Antonio; Mihaila, Mihai; Munteanu, Cornel; Marin, Alexandru; Danila, Mihai; Kusko, Mihaela; Kusko, Cristian

    2015-01-01

    Highlights: • We report a one pot synthesis metod of GQD with controlled size and optoelectronic properties. • An improvement of common N3-DSSC characteristics is achieved when GQDs are used as co-sensitiser. • The role of GQD as cosensitisers in hybrid DSSC was investigated and the interplay between charge and energy transfer phenomena mediated by GQDs was demonstrated. • The GQDs presence determines an inhibition of the recombination processes at the TiO 2 /electrolyte interface. - Abstract: We explored the role of graphene quantum dots (GQDs) as co-sensitizers in hybrid dye sensitized solar cell (DSSC) architectures, focusing on various concurring mechanisms, such as: charge transfer, energy transfer and recombination rate, towards light harvesting improvement. GQDs were prepared by the hydrothermal method that allows the tuning of electronic levels and optical properties by employing appropriate precursors and synthesis conditions. The aim was to realize a type II alignment for TiO 2 /GQD/dye hybrid configuration, using standard N3 Ru-dye in order to improve charge transfer. When GQDs were used as co-sensitizers together with N3 Ru-dye, an improvement in power conversion efficiency was achieved, as shown by electrical measurements. The experimental analysis indicates that this improvement arises from the interplay of various mechanisms mediated by GQDs: (i) enhancement of charge separation and collection due to the cascaded alignment of the energy levels; (ii) energy transfer from GQDs to N3 Ru-dye due to the overlap between GQD photoluminescence and N3 Ru-dye absorption spectra; and (iii) reduction of the electron recombination to the redox couple due to the inhibition of the back electron transfer to the electrolyte by the GQDs

  15. Enhancement of charge-transport characteristics in polymeric films using polymer brushes

    DEFF Research Database (Denmark)

    Whiting, G.L.; Snaith, H.J.; Khodabakhsh, S.

    2006-01-01

    We show that charge-transporting polymer chains in the brush conformation can be synthesized from a variety of substrates of interest, displaying a high degree of stretching and showing up to a 3 orders of magnitude increase in current density normal to the substrate as compared with a spin......-coated film. These nanostructured polymeric films may prove to be suitable for electronic devices based on molecular semiconductors as current fabrication techniques often provide little control over film structure....

  16. Finite Element in Angle Unit Sphere Meshing for Charged Particle Transport.

    Energy Technology Data Exchange (ETDEWEB)

    Ortega, Mario Ivan [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Drumm, Clifton R. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)

    2017-10-01

    Finite element in angle formulations of the charged particle transport equation require the discretization of the unit sphere. In Sceptre, a three-dimensional surface mesh of a sphere is transformed into a two-dimensional mesh. Projection of a sphere onto a two-dimensional surface is well studied with map makers spending the last few centuries attempting to create maps that preserve proportion and area. Using these techniques, various meshing schemes for the unit sphere were investigated.

  17. Tip-enhanced fluorescence with radially polarized illumination for monitoring loop-mediated isothermal amplification on Hepatitis C virus cDNA

    Science.gov (United States)

    Wei, Shih-Chung; Chuang, Tsung-Liang; Wang, Da-Shin; Lu, Hui-Hsin; Gu, Frank X.; Sung, Kung-Bin; Lin, Chii-Wann

    2015-02-01

    A tip nanobiosensor for monitoring DNA replication was presented. The effects of excitation power and polarization on tip-enhanced fluorescence (TEF) were assessed with the tip immersed in fluorescein isothiocyanate solution first. The photon count rose on average fivefold with radially polarized illumination at 50 mW. We then used polymerase-functionalized tips for monitoring loop-mediated isothermal amplification on Hepatitis C virus cDNA. The amplicon-SYBR Green I complex was detected and compared to real-time loop-mediated isothermal amplification. The signals of the reaction using 4 and 0.004 ng/μl templates were detected 10 and 30 min earlier, respectively. The results showed the potential of TEF in developing a nanobiosensor for real-time DNA amplification.

  18. Influence of orientation mismatch on charge transport across grain boundaries in tri-isopropylsilylethynyl (TIPS) pentacene thin films.

    Science.gov (United States)

    Steiner, Florian; Poelking, Carl; Niedzialek, Dorota; Andrienko, Denis; Nelson, Jenny

    2017-05-03

    We present a multi-scale model for charge transport across grain boundaries in molecular electronic materials that incorporates packing disorder, electrostatic and polarisation effects. We choose quasi two-dimensional films of tri-isopropylsilylethynyl pentacene (TIPS-P) as a model system representative of technologically relevant crystalline organic semiconductors. We use atomistic molecular dynamics, with a force-field specific for TIPS-P, to generate and equilibrate polycrystalline two-dimensional thin films. The energy landscape is obtained by calculating contributions from electrostatic interactions and polarization. The variation in these contributions leads to energetic barriers between grains. Subsequently, charge transport is simulated using a kinetic Monte-Carlo algorithm. Two-grain systems with varied mutual orientation are studied. We find relatively little effect of long grain boundaries due to the presence of low impedance pathways. However, effects could be more pronounced for systems with limited inter-grain contact areas. Furthermore, we present a lattice model to generalize the model for small molecular systems. In the general case, depending on molecular architecture and packing, grain boundaries can result in interfacial energy barriers, traps or a combination of both with qualitatively different effects on charge transport.

  19. Picosecond charge transport in rutile at high carrier densities studiedby transient terahertz spectroscopy

    Czech Academy of Sciences Publication Activity Database

    Zajac, Vít; Němec, Hynek; Kužel, Petr

    2016-01-01

    Roč. 94, č. 11 (2016), 1-9, č. článku 115206. ISSN 1098-0121 R&D Projects: GA ČR GA13-12386S Institutional support: RVO:68378271 Keywords : terahertz spectroscopy * charge transport * TiO 2 * rutile * ultrafast spectroscopy Subject RIV: BM - Solid Matter Physics ; Magnetism Impact factor: 3.736, year: 2014

  20. Surface potential, charging and local current transport of individual Ge quantum dots grown by molecular beam epitaxy

    Energy Technology Data Exchange (ETDEWEB)

    Singha, R.K. [Department of Physics, Visva-Bharati, Santiniketan 731235 (India); Manna, S.; Bar, R.; Das, S. [Department of Physics, Indian Institute of Technology-Kharagpur, Kharagpur 721302 (India); Ray, S.K., E-mail: physkr@phy.iitkgp.ernet.in [Department of Physics, Indian Institute of Technology-Kharagpur, Kharagpur 721302 (India)

    2017-06-15

    Highlights: We have elaborately explained the individual Ge QD charging phenomena and current transport, which is very important to understand the Ge/Si nano devices. This paper will give a flavor to properly understand these phenomena linked together along with the photocurrent mechanism which is related to the Ge/Si valence band offset. • Both the CAFM and KPFM techniques point out the functionality of doping nature of the underneath Si substrate on the aforementioned characteristics of Ge QDs. • Analysis of the surface potential mapping using KPFM technique yields an approximate valence band offset measurement which is required to understand the intra-valence transition of holes for the realization of long wavelength infrared photodetector. • KPFM and CAFM can be utilized to explore the charging/discharging phenomena of dots and their composition variations. • Current-voltage (I–V) characteristics of the individual Ge QD strongly depends on the individual QD size. • Energy band diagrams for diamond tip and Ge QD shows the higher barrier for electrons and lower barrier for holes allowing the easy tunneling for holes to dominate the transport. - Abstract: It is fundamentally important to understand the nanoscale electronic properties of a single quantum dot (QD) contrary to an ensemble of QDs. Kelvin probe force microscopy (KPFM) and conductive atomic force microscopy (CAFM) are two important tools, which could be employed to probe surface potential, charging phenomena, and current transport mechanism of individual QD. We demonstrate the aforementioned characteristics of self-assembled Ge QDs, which was grown on Si substrates by solid source molecular beam epitaxy driven by the Stranski-Krastanov method. Study reveals that each Ge QD acts as charge storage node even at zero applied bias. The shape, size and density of QDs could be well probed by CAFM and KPFM, whereas QD facets could be better resolved by the conductive tip. The CAFM investigation