WorldWideScience

Sample records for dna vaccine encoding

  1. Enhanced immunogenicity of DNA fusion vaccine encoding secreted hepatitis B surface antigen and chemokine RANTES

    International Nuclear Information System (INIS)

    Kim, Seung Jo; Suh, Dongchul; Park, Sang Eun; Park, Jeong-Sook; Byun, Hyang-Min; Lee, Chan; Lee, Sun Young; Kim, Inho; Oh, Yu-Kyoung

    2003-01-01

    To increase the potency of DNA vaccines, we constructed genetic fusion vaccines encoding antigen, secretion signal, and/or chemokine RANTES. The DNA vaccines encoding secreted hepatitis B surface antigen (HBsAg) were constructed by inserting HBsAg gene into an expression vector with an endoplasmic reticulum (ER)-targeting secretory signal sequence. The plasmid encoding secretory HBsAg (pER/HBs) was fused to cDNA of RANTES, generating pER/HBs/R. For comparison, HBsAg genes were cloned into pVAX1 vector with no signal sequence (pHBs), and further linked to the N-terminus of RANTES (pHBs/R). Immunofluorescence study showed the cytoplasmic localization of HBsAg protein expressed from pHBs and pHBs/R, but not from pER/HBs and pER/HBs/R at 48 h after transfection. In mice, RANTES-fused DNA vaccines more effectively elicited the levels of HBsAg-specific IgG antibodies than pHBs. All the DNA vaccines induced higher levels of IgG 2a rather than IgG 1 antibodies. Of RANTES-fused vaccines, pER/HBs/R encoding the secreted fusion protein revealed much higher humoral and CD8 + T cell-stimulating responses compared to pHBs/R. These results suggest that the immunogenicity of DNA vaccines could be enhanced by genetic fusion to a secretory signal peptide sequence and RANTES

  2. Encoded novel forms of HSP70 or a cytolytic protein increase DNA vaccine potency.

    Science.gov (United States)

    Garrod, Tamsin; Grubor-Bauk, Branka; Yu, Stanley; Gargett, Tessa; Gowans, Eric J

    2014-01-01

    In humans, DNA vaccines have failed to demonstrate the equivalent levels of immunogenicity that were shown in smaller animals. Previous studies have encoded adjuvants, predominantly cytokines, within these vaccines in an attempt to increase antigen-specific immune responses. However, these strategies have lacked breadth of innate immune activation and have led to disappointing results in clinical trials. Damage associated molecular patterns (DAMPs) have been identified as pattern recognition receptor (PRR) agonists. DAMPs can bind to a wide range of PRRs on dendritic cells (DCs) and thus our studies have aimed to utilize this characteristic to act as an adjuvant in a DNA vaccine approach. Specifically, HSP70 has been identified as a DAMP, but has been limited by its lack of accessibility to PRRs in and on DCs. Here, we discuss the promising results achieved with the inclusion of membrane-bound or secreted HSP70 into a DNA vaccine encoding HIV gag as the model immunogen.

  3. Immunogenicity of DNA vaccines encoding simian immunodeficiency virus antigen targeted to dendritic cells in rhesus macaques.

    Directory of Open Access Journals (Sweden)

    Matthias Tenbusch

    Full Text Available BACKGROUND: Targeting antigens encoded by DNA vaccines to dendritic cells (DCs in the presence of adjuvants enhances their immunogenicity and efficacy in mice. METHODOLOGY/PRINCIPAL FINDINGS: To explore the immunogenicity of this approach in non-human primates, we generated a single chain antibody to the antigen uptake receptor DEC-205 expressed on rhesus macaque DCs. DNA vaccines encoding this single chain antibody fused to the SIV capsid protein were delivered to six monkeys each by either intramuscular electroporation or conventional intramuscular injection co-injected or not with poly ICLC, a stabilized poly I: C analogue, as adjuvant. Antibodies to capsid were induced by the DC-targeting and non-targeting control DNA delivered by electroporation while conventional DNA immunization at a 10-fold higher dose of DNA failed to induce detectable humoral immune responses. Substantial cellular immune responses were also observed after DNA electroporation of both DNAs, but stronger responses were induced by the non-targeting vaccine. Conventional immunization with the DC-targeting DNA at a 10-fold higher dose did not give rise to substantial cellular immune responses, neither when co-injected with poly ICLC. CONCLUSIONS/SIGNIFICANCE: The study confirms the potent immunogenicity of DNA vaccines delivered by electroporation. Targeting the DNA via a single chain antibody to DEC-205 expressed by DCs, however, does not improve the immunogenicity of the antigens in non-human primates.

  4. Enhancement of the priming efficacy of DNA vaccines encoding dendritic cell-targeted antigens by synergistic toll-like receptor ligands

    Directory of Open Access Journals (Sweden)

    Kornbluth Richard S

    2009-08-01

    Full Text Available Abstract Background Targeting of protein antigens to dendritic cells (DC via the DEC205 receptor enhances presentation of antigen-derived peptides on MHC-I and MHC-II molecules and, in the presence of costimulatory signals, antigen-specific immune responses. The immunogenicity and efficacy of DNA vaccination can also be enhanced by fusing the encoded antigen to single chain antibodies directed against DEC205. To further improve this strategy, we evaluated different toll-like receptor ligands (TLR and CD40 ligands (CD40L as adjuvants for DNA vaccines encoding a DEC205-single-chain antibody fused to the ovalbumin model antigen or HIV-1 Gag and assessed the priming efficacy of DNA in a DNA prime adenoviral vector boost immunization regimen. Results Mice were primed with the adjuvanted DEC-205 targeted DNA vaccines and boosted with adenoviral vectors encoding the same antigens. CD8+ T cell responses were determined after the adenoviral booster immunization, to determine how well the different DNA immunization regimens prime for the adenoviral boost. In the absence of adjuvants, targeting of DNA-encoded ovalbumin to DCs suppressed CD8+ T-cell responses after the adenoviral booster immunization. CD8+ T-cell responses to the DEC205 targeted DNA vaccines increased only slightly by adding either the TLR-9 ligand CpG, the TLR-3 ligand Poly I:C, or CD40 ligand expression plasmids. However, the combination of both TLR-ligands led to a strong enhancement of CD8+ T-cell responses compared to a non-targeted DNA vaccine. This finding was confirmed using HIV Gag as antigen. Conclusion Although DNA prime adenoviral vector boost immunizations belong to the strongest inducers of cytotoxic T cell responses in different animal models and humans, the CD8+ T cell responses can be further improved by targeting the DNA encoded antigen to DEC205 in the presence of synergistic TLR ligands CpG and Poly I:C.

  5. Frequency and persistency of DNA vaccine encoding GP25 by oral on common carp

    Directory of Open Access Journals (Sweden)

    Sri Nuryati

    2015-05-01

    Full Text Available ABSTRACT Koi herpesvirus (KHV is a major viral pathogen that infects common carp and koi. KHV disease outbreak is happened in almost all centre of common carp culture in Indonesia and caused mass mortality. Deoxyribonucleic acid (DNA vaccination method is one of ways to cope with KHV infection. Vaccines were commonly given by injection. The aim of this research was to get frequency and persistency of DNA vaccine encoding GP25 given by oral delivery method in common carp. This research would like to determine dose, frequency of vaccination, persistency of DNA vaccine and culture medium for the bacterial host. DNA vaccine persistency test was done by using polymerase chain reaction (PCR method with the specific primer for GP25 gene. The results showed that level of DNA vaccine that could be detected in feed was 7.56 ng (equal to 1.598×1010 copies. Efficient culture medium for Escherichia coli DH5α carrying DNA vaccine was LB triptone. Feeding fish with diet supplemented with 1 mL E. coli DH5α containing DNA vaccine for each fish and two times a week allowed persistence of DNA vaccine in kindney and spleen. Keywords: common carp, KHV, DNA vaccine, GP25, persistance  ABSTRAK Koi herpesvirus (KHV adalah virus patogen utama yang menginfeksi ikan mas dan ikan koi. Wabah penyakit KHV terjadi di hampir semua sentra budidaya ikan mas di Indonesia dan menyebabkan kematian massal ikan. Metode vaksinasi DNA merupakan salah satu cara yang dapat dilakukan untuk menanggulangi serangan KHV. Pemberian vaksin umumnya dilakukan dengan cara injeksi. Tujuan penelitian ini adalah untuk menguji frekuensi dan persistensi vaksin DNA GP25 antivirus KHV yang diberikan melalui oral pada ikan mas. Pada penelitian ini dilakukan uji dosis, frekuensi pemberian vaksin, persistensi vaksin DNA, dan media kultur bakteri inang. Persistensi vaksin DNA dianalisis menggunakan metode PCR dengan primer spesifik gen GP25. Hasil penelitian menunjukkan bahwa dosis vaksin DNA yang

  6. Mucosal delivery of a transmission-blocking DNA vaccine encoding Giardia lamblia CWP2 by Salmonella typhimurium bactofection vehicle.

    Science.gov (United States)

    Abdul-Wahid, Aws; Faubert, Gaétan

    2007-12-05

    In this study, we investigated the use of Salmonella typhimurium (STM1 strain) as a bactofection vehicle to deliver a transmission-blocking DNA vaccine (TBDV) plasmid to the intestinal immune system. The gene encoding the full length cyst wall protein-2 (CWP2) from Giardia lamblia was subcloned into the pCDNA3 mammalian expression vector and stably introduced into S. typhimurium STM1. Eight-week-old female BALB/c mice were orally immunized every 2 weeks, for a total of three immunizations. Vaccinated and control mice were sacrificed 1 week following the last injection. Administration of the DNA vaccine led to the production of CWP2-specific cellular immune responses characterized by a mixed Th1/Th2 response. Using ELISA, antigen-specific IgA and IgG antibodies were detected in intestinal secretions. Moreover, analysis of sera demonstrated that the DNA immunization also stimulated the production of CWP2-specific IgG antibodies that were mainly of the IgG2a isotype. Finally, challenge infection with live Giardia muris cysts revealed that mice receiving the CWP2-encoding DNA vaccine were able to reduce cyst shedding by approximately 60% compared to control mice. These results demonstrate, for the first time, the development of parasite transmission-blocking immunity at the intestinal level following the administration of a mucosal DNA vaccine delivered by S. typhimurium STM1.

  7. Efficacy of DNA vaccine encoding koi herpesvirus glycoprotein GP-25in common carp juvenile by immersion

    Directory of Open Access Journals (Sweden)

    Soko Nuswantoro

    2013-11-01

    Full Text Available Koi herpesvirus (KHV is a herpesvirus that particularly infects and causes mass mortality to koi and common carp. Therefore, the protection of common carp from KHV infection is urgently needed. In this study, we developed an application of DNA vaccine encoding KHV glycoprotein-25 by immersion method to increase survival of common carp against KHV infection. A total of 400 common carp juveniles at 30-day-old were immersed in 1-L water containing 1.3×108CFU/mL of the killed Escherichia coli cells carrying DNA vaccine. Three frequencies and three duration of fish immersion were tested, namely: 1×30 minutes, 1×60 minutes, 1× 90 minutes, 2×90 minutes and 3×90 minutes by interval of 24 hours. Reversetranscription polymerase chain reaction analysis showed that DNA vaccine was successfully expressed in the vaccinated fish. Fish at twenty eight days post vaccination were challenged by injecting 10-4 mL of KHV per fish. The result showed that vaccination by 1×30 minutes immersion allowed 61% of fish survived, and this was significantly higher (p<0.05 compared to control (without vaccination, but it was similar among vaccination treatments (p>0.05. The relative percent survival of vaccinated fish were also similar among treatments (p>0.05. DNA vaccination has increased fish survival about two fold higher compared to unvaccinated fish control (26.67%. Thus, DNA vaccination was effectively delivered by immersion for 1×30 minutes, and this technique can be useful to level up the resistance of common carp juveniles against KHV infection. Keywords: DNA vaccine, KHV, glycoprotein, immersion, common carp

  8. DNA vaccines for aquacultured fish

    DEFF Research Database (Denmark)

    Lorenzen, Niels; LaPatra, S.E.

    2005-01-01

    of licensing and public acceptance of the technology. The potential benefits of DNA vaccines for farmed fish include improved animal welfare, reduced environmental impacts of aquaculture activities, increased food quality and quantity, and more sustainable production. Testing under commercial production......Deoxyribonucleic acid (DNA) vaccination is based on the administration of the gene encoding the vaccine antigen, rather than the antigen itself. Subsequent expression of the antigen by cells in the vaccinated hosts triggers the host immune system. Among the many experimental DNA vaccines tested...... in various animal species as well as in humans, the vaccines against rhabdovirus diseases in fish have given some of the most promising results. A single intramuscular (IM) injection of microgram amounts of DNA induces rapid and long-lasting protection in farmed salmonids against economically important...

  9. Prior DNA vaccination does not interfere with the live-attenuated measles vaccine.

    Science.gov (United States)

    Premenko-Lanier, Mary; Rota, Paul; Rhodes, Gary; Bellini, William; McChesney, Michael

    2004-01-26

    The currently used live-attenuated measles vaccine is very effective although maternal antibody prevents its administration prior to 6 months of age. We are investigating the ability of a DNA vaccine encoding the measles viral hemagglutinin, fusion and nucleoprotein to protect newborn infants from measles. Here, we show that a measles DNA vaccine protects juvenile macaques from pathogenic measles virus challenge and that macaques primed and boosted with this DNA vaccine have anemnestic antibody and cell-mediated responses after vaccination with a live-attenuated canine distemper-measles vaccine. Therefore, this DNA vaccine administered to newborn infants may not hinder the subsequent use of live-attenuated measles vaccine.

  10. MicroRNA expression in rainbow trout (Oncorhynchus mykiss) vaccinated with a DNA vaccine encoding the glycoprotein gene of Viral hemorrhagic septicemia virus

    DEFF Research Database (Denmark)

    Bela-Ong, Dennis; Schyth, Brian Dall; Lorenzen, Niels

    particularly to sea-farmed rainbow trout and thus necessitates strategies to mitigate potential disease outbreaks. A DNA vaccine encoding the glycoprotein gene of VHSV has been developed and shown to elicit protective immune responses in laboratory trials. It is important to identify key factors as biomarkers...

  11. Preclinical and clinical safety studies on DNA vaccines.

    NARCIS (Netherlands)

    Schalk, Johanna A C; Mooi, Frits R; Berbers, Guy A M; Aerts, Leon A G J M van; Ovelgönne, Hans; Kimman, Tjeerd G

    2007-01-01

    DNA vaccines are based on the transfer of genetic material, encoding an antigen, to the cells of the vaccine recipient. Despite high expectations of DNA vaccines as a result of promising preclinical data their clinical utility remains unproven. However, much data is gathered in preclinical and

  12. Cationic lipid-formulated DNA vaccine against hepatitis B virus: immunogenicity of MIDGE-Th1 vectors encoding small and large surface antigen in comparison to a licensed protein vaccine.

    Directory of Open Access Journals (Sweden)

    Anne Endmann

    Full Text Available Currently marketed vaccines against hepatitis B virus (HBV based on the small (S hepatitis B surface antigen (HBsAg fail to induce a protective immune response in about 10% of vaccinees. DNA vaccination and the inclusion of PreS1 and PreS2 domains of HBsAg have been reported to represent feasible strategies to improve the efficacy of HBV vaccines. Here, we evaluated the immunogenicity of SAINT-18-formulated MIDGE-Th1 vectors encoding the S or the large (L protein of HBsAg in mice and pigs. In both animal models, vectors encoding the secretion-competent S protein induced stronger humoral responses than vectors encoding the L protein, which was shown to be retained mainly intracellularly despite the presence of a heterologous secretion signal. In pigs, SAINT-18-formulated MIDGE-Th1 vectors encoding the S protein elicited an immune response of the same magnitude as the licensed protein vaccine Engerix-B, with S protein-specific antibody levels significantly higher than those considered protective in humans, and lasting for at least six months after the third immunization. Thus, our results provide not only the proof of concept for the SAINT-18-formulated MIDGE-Th1 vector approach but also confirm that with a cationic-lipid formulation, a DNA vaccine at a relatively low dose can elicit an immune response similar to a human dose of an aluminum hydroxide-adjuvanted protein vaccine in large animals.

  13. Formulation and delivery of dermal DNA vaccines

    NARCIS (Netherlands)

    van den Berg, J.H.

    2009-01-01

    DNA vaccination is an appealing strategy of active vaccination, leading to the intracellular production of the encoding antigen which results in an efficient activation of an antigen specific immune response. Intradermal DNA tattooing was recently developed as a simple and robust method to induce

  14. Safety and immunogenicity of a novel therapeutic DNA vaccine encoding chicken type II collagen for rheumatoid arthritis in normal rats.

    Science.gov (United States)

    Juan, Long; Xiao, Zhao; Song, Yun; Zhijian, Zhang; Jing, Jin; Kun, Yu; Yuna, Hao; Dongfa, Dai; Lili, Ding; Liuxin, Tan; Fei, Liang; Nan, Liu; Fang, Yuan; Yuying, Sun; Yongzhi, Xi

    2015-01-01

    Current clinically available treatments for rheumatoid arthritis (RA) fail to cure the disease or unsatisfactorily halt disease progression. To overcome these limitations, the development of therapeutic DNA vaccines and boosters may offer new promising strategies. Because type II collagen (CII) as a critical autoantigen in RA and native chicken type II collagen (nCCII) has been used to effectively treat RA, we previously developed a novel therapeutic DNA vaccine encoding CCII (pcDNA-CCOL2A1) with efficacy comparable to that of the current "gold standard", methotrexate(MTX). Here, we systemically evaluated the safety and immunogenicity of the pcDNA-CCOL2A1 vaccine in normal Wistar rats. Group 1 received only a single intramuscular injection into the hind leg with pcDNA-CCOL2A1 at the maximum dosage of 3 mg/kg on day 0; Group 2 was injected with normal saline (NS) as a negative control. All rats were monitored daily for any systemic adverse events, reactions at the injection site, and changes in body weights. Plasma and tissues from all experimental rats were collected on day 14 for routine examinations of hematology and biochemistry parameters, anti-CII IgG antibody reactivity, and histopathology. Our results indicated clearly that at the maximum dosage of 3 mg/kg, the pcDNA-CCOL2A1 vaccine was safe and well-tolerated. No abnormal clinical signs or deaths occurred in the pcDNA-CCOL2A1 group compared with the NS group. Furthermore, no major alterations were observed in hematology, biochemistry, and histopathology, even at the maximum dose. In particularly, no anti-CII IgG antibodies were detected in vaccinated normal rats at 14 d after vaccination; this was relevant because we previously demonstrated that the pcDNA-CCOL2A1 vaccine, when administered at the therapeutic dosage of 300 μg/kg alone, did not induce anti-CII IgG antibody production and significantly reduced levels of anti-CII IgG antibodies in the plasma of rats with established collagen-induced arthritis

  15. Protective effect of the DNA vaccine encoding the major house dust mite allergens on allergic inflammation in the murine model of house dust mite allergy

    Directory of Open Access Journals (Sweden)

    Lee Jaechun

    2006-02-01

    Full Text Available Abstract Background Vaccination with naked DNA encoding antigen induces cellular and humoral immunity characterized by the activation of specific Th1 cells. Objective To evaluate the effects of vaccination with mixed naked DNA plasmids encoding Der p 1, Der p 2, Der p 3, Der f 1, Der f 2, and Der f 3, the major house dust mite allergens on the allergic inflammation to the whole house dust mites (HDM crude extract. Methods Three hundred micrograms of these gene mixtures were injected into muscle of BALB/c mice. Control mice were injected with the pcDNA 3.1 blank vector. After 3 weeks, the mice were actively sensitized and inhaled with the whole house dust mite extract intranasally. Results The vaccinated mice showed a significantly decreased synthesis of total and HDM-specific IgE compared with controls. Analysis of the cytokine profile of lymphocytes after challenge with HDM crude extract revealed that mRNA expression of interferon-γ was higher in the vaccinated mice than in the controls. Reduced infiltration of inflammatory cells and the prominent infiltration of CD8+ T cells were observed in histology of lung tissue from the vaccinated mice. Conclusion Vaccination with DNA encoding the major house dust mite allergens provides a promising approach for treating allergic responses to whole house dust mite allergens.

  16. Immunogenicity and protective efficacy of Semliki forest virus replicon-based DNA vaccines encoding goatpox virus structural proteins

    International Nuclear Information System (INIS)

    Zheng Min; Jin Ningyi; Liu Qi; Huo Xiaowei; Li Yang; Hu Bo; Ma Haili; Zhu Zhanbo; Cong Yanzhao; Li Xiao; Jin Minglan; Zhu Guangze

    2009-01-01

    Goatpox, caused by goatpox virus (GTPV), is an acute feverish and contagious disease in goats often associated with high morbidity and high mortality. To resolve potential safety risks and vaccination side effects of existing live attenuated goatpox vaccine (AV41), two Semliki forest virus (SFV) replicon-based bicistronic expression DNA vaccines (pCSm-AAL and pCSm-BAA) which encode GTPV structural proteins corresponding to the Vaccinia virus proteins A27, L1, A33, and B5, respectively, were constructed. Then, theirs ability to induce humoral and cellular response in mice and goats, and protect goats against virulent virus challenge were evaluated. The results showed that, vaccination with pCSm-AAL and pCSm-BAA in combination could elicit strong humoral and cellular responses in mice and goats, provide partial protection against viral challenge in goats, and reduce disease symptoms. Additionally, priming vaccination with the above-mentioned DNA vaccines could significantly reduce the goats' side reactions from boosting vaccinations with current live vaccine (AV41), which include skin lesions at the inoculation site and fevers. Data obtained in this study could not only facilitate improvement of the current goatpox vaccination strategy, but also provide valuable guidance to suitable candidates for evaluation and development of orthopoxvirus vaccines.

  17. DNA Vaccine Electroporation and Molecular Adjuvants

    Science.gov (United States)

    2016-03-16

    Suschak and Schmaljohn DNA Vaccine Electroporation and Molecular Adjuvants 1 Abstract To date, there is no protective vaccine for Ebola virus...the formulation of DNA launched virus-like particles (VLP). In this case, the antigen is encoded in one DNA plasmid, while structural proteins are...Virol, 2010. 155(12): p. 2083-103. 2. Feldmann, H. and T.W. Geisbert, Ebola haemorrhagic fever. Lancet, 2011. 377(9768): p. 849-62. 3. Hart, M.K

  18. DNA/MVA Vaccines for HIV/AIDS

    Directory of Open Access Journals (Sweden)

    Smita S. Iyer

    2014-02-01

    Full Text Available Since the initial proof-of-concept studies examining the ability of antigen-encoded plasmid DNA to serve as an immunogen, DNA vaccines have evolved as a clinically safe and effective platform for priming HIV-specific cellular and humoral responses in heterologous “prime-boost” vaccination regimens. Direct injection of plasmid DNA into the muscle induces T- and B-cell responses against foreign antigens. However, the insufficient magnitude of this response has led to the development of approaches for enhancing the immunogenicity of DNA vaccines. The last two decades have seen significant progress in the DNA-based vaccine platform with optimized plasmid constructs, improved delivery methods, such as electroporation, the use of molecular adjuvants and novel strategies combining DNA with viral vectors and subunit proteins. These innovations are paving the way for the clinical application of DNA-based HIV vaccines. Here, we review preclinical studies on the DNA-prime/modified vaccinia Ankara (MVA-boost vaccine modality for HIV. There is a great deal of interest in enhancing the immunogenicity of DNA by engineering DNA vaccines to co-express immune modulatory adjuvants. Some of these adjuvants have demonstrated encouraging results in preclinical and clinical studies, and these data will be examined, as well.

  19. Assessment of a DNA vaccine encoding an anchored-glycosylphosphatidylinositol tegumental antigen complexed to protamine sulphate on immunoprotection against murine schistosomiasis

    Directory of Open Access Journals (Sweden)

    Eduardo JM Nascimento

    2007-02-01

    Full Text Available Protamine sulphate/DNA complexes have been shown to protect DNA from DNase digestion in a lipid system for gene transfer. A DNA-based vaccine complexed to protamine sulphate was used to induce an immune response against Schistosoma mansoni anchored-glycosylphosphatidylinositol tegumental antigen in BALB/c mice. The protection elicited ranged from 33 to 44%. The spectrum of the elicited immune response induced by the vaccine formulation without protamine was characterized by a high level of IgG (IgG1> IgG2a. Protamine sulphate added to the DNA vaccine formulation retained the green fluorescent protein encoding-plasmid longer in muscle and spleen. The experiments in vivo showed that under protamine sulphate effect, the scope of protection remained unchanged, but a modulation in antibody production (IgG1= IgG2a was observed.

  20. Immunogenicity of a DNA-launched replicon-based canine parvovirus DNA vaccine expressing VP2 antigen in dogs.

    Science.gov (United States)

    Dahiya, Shyam S; Saini, Mohini; Kumar, Pankaj; Gupta, Praveen K

    2012-10-01

    A replicon-based DNA vaccine encoding VP2 gene of canine parvovirus (CPV) was developed by cloning CPV-VP2 gene into a replicon-based DNA vaccine vector (pAlpha). The characteristics of a replicon-based DNA vaccine like, self-amplification of transcripts and induction of apoptosis were analyzed in transfected mammalian cells. When the pAlpha-CPV-VP2 was injected intradermal as DNA-launched replicon-based DNA vaccine in dogs, it induced CPV-specific humoral and cell mediated immune responses. The virus neutralization antibody and lymphocyte proliferative responses were higher than conventional CPV DNA vaccine and commercial CPV vaccine. These results indicated that DNA-launched replicon-based CPV DNA vaccine was effective in inducing both CPV-specific humoral and cellular immune responses and can be considered as effective alternative to conventional CPV DNA vaccine and commercial CPV vaccine. Crown Copyright © 2012. Published by Elsevier India Pvt Ltd. All rights reserved.

  1. LAMP-1-chimeric DNA vaccines enhance the antibody response in Japanese flounder, Paralichthys olivaceus.

    Science.gov (United States)

    Rondón-Barragán, Iang; Nozaki, Reiko; Hirono, Ikuo; Kondo, Hidehiro

    2017-08-01

    DNA vaccination is one method to protect farmed fish from viral and bacterial diseases. Chimeric antigens encoded by DNA vaccines have been shown to increase the resistance to viral diseases. Here, we sequenced the gene encoding lysosome-associated membrane protein-1 from Japanese flounder, Paralichthys olivaceus, (JfLAMP-1) and assessed its use in a chimeric DNA vaccine fused with the major capsule protein (MCP) from red seabream iridovirus (RSIV). JfLAMP-1 cDNA has a length of 1248 bp encoding 415 aa, which contains transmembrane and cytoplasmic domains. JfLAMP-1 is constitutively expressed in several tissues and its expression in spleen was upregulated following injection of formalin-killed cells (FKC) of Edwardsiella tarda. Immunofluorescence analysis showed that JfLAMP-1 is distributed in the small and large granules in the cytoplasm and groups close to the nucleus. The DNA encoding the luminal domain of JfLAMP-1 was replaced with the gene for the RSIV MCP, and the construct was cloned in an expression vector (pCIneo). Fish vaccinated with pCLAMP-MCP had significantly higher antibody levels than fish vaccinated with pCIneo vector harboring the MCP gene (p day 30 post-vaccination. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Attenuated Salmonella enterica serovar Typhi and Shigella flexneri 2a strains mucosally deliver DNA vaccines encoding measles virus hemagglutinin, inducing specific immune responses and protection in cotton rats.

    Science.gov (United States)

    Pasetti, Marcela F; Barry, Eileen M; Losonsky, Genevieve; Singh, Mahender; Medina-Moreno, Sandra M; Polo, John M; Ulmer, Jeffrey; Robinson, Harriet; Sztein, Marcelo B; Levine, Myron M

    2003-05-01

    Measles remains a leading cause of child mortality in developing countries. Residual maternal measles antibodies and immunologic immaturity dampen immunogenicity of the current vaccine in young infants. Because cotton rat respiratory tract is susceptible to measles virus (MV) replication after intranasal (i.n.) challenge, this model can be used to assess the efficacy of MV vaccines. Pursuing a new measles vaccine strategy that might be effective in young infants, we used attenuated Salmonella enterica serovar Typhi CVD 908-htrA and Shigella flexneri 2a CVD 1208 vaccines to deliver mucosally to cotton rats eukaryotic expression plasmid pGA3-mH and Sindbis virus-based DNA replicon pMSIN-H encoding MV hemagglutinin (H). The initial i.n. dose-response with bacterial vectors alone identified a well-tolerated dosage (1 x 10(9) to 7 x 10(9) CFU) and a volume (20 micro l) that elicited strong antivector immune responses. Animals immunized i.n. on days 0, 28, and 76 with bacterial vectors carrying DNA plasmids encoding MV H or immunized parenterally with these naked DNA vaccine plasmids developed MV plaque reduction neutralizing antibodies and proliferative responses against MV antigens. In a subsequent experiment of identical design, cotton rats were challenged with wild-type MV 1 month after the third dose of vaccine or placebo. MV titers were significantly reduced in lung tissue of animals immunized with MV DNA vaccines delivered either via bacterial live vectors or parenterally. Since attenuated serovar Typhi and S. flexneri can deliver measles DNA vaccines mucosally in cotton rats, inducing measles immune responses (including neutralizing antibodies) and protection, boosting strategies can now be evaluated in animals primed with MV DNA vaccines.

  3. A Multiantigenic DNA Vaccine That Induces Broad Hepatitis C Virus-Specific T-Cell Responses in Mice.

    Science.gov (United States)

    Gummow, Jason; Li, Yanrui; Yu, Wenbo; Garrod, Tamsin; Wijesundara, Danushka; Brennan, Amelia J; Mullick, Ranajoy; Voskoboinik, Ilia; Grubor-Bauk, Branka; Gowans, Eric J

    2015-08-01

    There are 3 to 4 million new hepatitis C virus (HCV) infections annually around the world, but no vaccine is available. Robust T-cell mediated responses are necessary for effective clearance of the virus, and DNA vaccines result in a cell-mediated bias. Adjuvants are often required for effective vaccination, but during natural lytic viral infections damage-associated molecular patterns (DAMPs) are released, which act as natural adjuvants. Hence, a vaccine that induces cell necrosis and releases DAMPs will result in cell-mediated immunity (CMI), similar to that resulting from natural lytic viral infection. We have generated a DNA vaccine with the ability to elicit strong CMI against the HCV nonstructural (NS) proteins (3, 4A, 4B, and 5B) by encoding a cytolytic protein, perforin (PRF), and the antigens on a single plasmid. We examined the efficacy of the vaccines in C57BL/6 mice, as determined by gamma interferon enzyme-linked immunosorbent spot assay, cell proliferation studies, and intracellular cytokine production. Initially, we showed that encoding the NS4A protein in a vaccine which encoded only NS3 reduced the immunogenicity of NS3, whereas including PRF increased NS3 immunogenicity. In contrast, the inclusion of NS4A increased the immunogenicity of the NS3, NS4B, andNS5B proteins, when encoded in a DNA vaccine that also encoded PRF. Finally, vaccines that also encoded PRF elicited similar levels of CMI against each protein after vaccination with DNA encoding NS3, NS4A, NS4B, and NS5B compared to mice vaccinated with DNA encoding only NS3 or NS4B/5B. Thus, we have developed a promising "multiantigen" vaccine that elicits robust CMI. Since their development, vaccines have reduced the global burden of disease. One strategy for vaccine development is to use commercially viable DNA technology, which has the potential to generate robust immune responses. Hepatitis C virus causes chronic liver infection and is a leading cause of liver cancer. To date, no vaccine is

  4. Induction of cytotoxic T-cell responses by gene gun DNA vaccination with minigenes encoding influenza A virus HA and NP CTL-epitopes

    DEFF Research Database (Denmark)

    Fomsgaard, A; Nielsen, H V; Kirkby, N

    1999-01-01

    degree of controllability. We have examined the induction of murine CTL's by this approach using DNA plasmid minigene vaccines encoding known mouse K(k) minimal CTL epitopes (8 amino acids) from the influenza A virus hemagglutinin and nucleoprotein. We here report that such an approach is feasible...

  5. Development of DNA vaccines for fish

    DEFF Research Database (Denmark)

    Heppell, Joël; Lorenzen, Niels; Armstrong, Neil K.

    1998-01-01

    Disease control is one of the major concerns in the aquaculture industry. However, there are no vaccines available for the prevention of many piscine infectious diseases, especially those of viral and parasitic origin. DNA-based vaccination could circumvent several problems associated with tradit......Disease control is one of the major concerns in the aquaculture industry. However, there are no vaccines available for the prevention of many piscine infectious diseases, especially those of viral and parasitic origin. DNA-based vaccination could circumvent several problems associated...... with traditional methods of immunization, but little is known on its efficacy in fish. The luciferase and lacZ reporter genes were used to characterize expression of plasmid-encoded genes in rainbow trout and zebra fish injected intramuscularly. For a given dose of DNA, the luciferase activity was higher in fish...... than in mouse muscle. The enzyme activity in fish peaked with 1 μg of DNA and remained constant for over 12 weeks, but it was not limited to the injected muscle since luciferase activity was also detected in the gills. Thin sections of rainbow trout muscle injected with the lacZ reporter gene showed...

  6. Gene-gun DNA vaccination aggravates respiratory syncytial virus-induced pneumonitis

    DEFF Research Database (Denmark)

    Bartholdy, Christina; Olszewska, Wieslawa; Stryhn, Anette

    2004-01-01

    elicited with recombinant vaccinia virus expressing the complete RSV M2 protein, but stronger than those induced by a similar DNA construct without the beta2m gene. DNA vaccination led to enhanced pulmonary disease after RSV challenge, with increased weight loss and cell recruitment to the lung. Depletion......A CD8+ T-cell memory response to respiratory syncytial virus (RSV) was generated by using a DNA vaccine construct encoding the dominant Kd-restricted epitope from the viral transcription anti-terminator protein M2 (M2(82-90)), linked covalently to human beta2-microglobulin (beta2m). Cutaneous gene...... of CD8+ T cells reduced, but did not abolish, enhancement of disease. Mice vaccinated with a construct encoding a class I-restricted lymphocytic choriomeningitis virus epitope and beta2m suffered more severe weight loss after RSV infection than unvaccinated RSV-infected mice, although RSV-specific CD8...

  7. Vaccination of carp against SVCV with an oral DNA vaccine or an insect cells-based subunit vaccine.

    Science.gov (United States)

    Embregts, C W E; Rigaudeau, D; Tacchi, L; Pijlman, G P; Kampers, L; Veselý, T; Pokorová, D; Boudinot, P; Wiegertjes, G F; Forlenza, M

    2018-03-19

    We recently reported on a successful vaccine for carp against SVCV based on the intramuscular injection of a DNA plasmid encoding the SVCV glycoprotein (SVCV-G). This shows that the intramuscular (i.m.) route of vaccination is suitable to trigger protective responses against SVCV, and that the SVCV G-protein is a suitable vaccine antigen. Yet, despite the general success of DNA vaccines, especially against fish rhabdoviruses, their practical implementation still faces legislative as well as consumer's acceptance concerns. Furthermore, the i.m. route of plasmid administration is not easily combined with most of the current vaccination regimes largely based on intraperitoneal or immersion vaccination. For this reason, in the current study we evaluated possible alternatives to a DNA-based i.m. injectable vaccine using the SVCV-G protein as the vaccine antigen. To this end, we tested two parallel approaches: the first based on the optimization of an alginate encapsulation method for oral delivery of DNA and protein antigens; the second based on the baculovirus recombinant expression of transmembrane SVCV-G protein in insect cells, administered as whole-cell subunit vaccine through the oral and injection route. In addition, in the case of the oral DNA vaccine, we also investigated the potential benefits of the mucosal adjuvants Escherichia coli lymphotoxin subunit B (LTB). Despite the use of various vaccine types, doses, regimes, and administration routes, no protection was observed, contrary to the full protection obtained with our reference i.m. DNA vaccine. The limited protection observed under the various conditions used in this study, the nature of the host, of the pathogen, the type of vaccine and encapsulation method, will therefore be discussed in details to provide an outlook for future vaccination strategies against SVCV. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  8. Combined virus-like particle and fusion protein-encoding DNA vaccination of cotton rats induces protection against respiratory syncytial virus without causing vaccine-enhanced disease

    Energy Technology Data Exchange (ETDEWEB)

    Hwang, Hye Suk; Lee, Young-Tae; Kim, Ki-Hye; Park, Soojin; Kwon, Young-Man; Lee, Youri; Ko, Eun-Ju; Jung, Yu-Jin [Center for Inflammation, Immunity & Infection, Institute for Biomedical Sciences and Department of Biology, Georgia State University, Atlanta, GA (United States); Lee, Jong Seok [Center for Inflammation, Immunity & Infection, Institute for Biomedical Sciences and Department of Biology, Georgia State University, Atlanta, GA (United States); National Institute of Biological Resources, Incheon (Korea, Republic of); Kim, Yu-Jin [Center for Inflammation, Immunity & Infection, Institute for Biomedical Sciences and Department of Biology, Georgia State University, Atlanta, GA (United States); Lee, Yu-Na; Kim, Min-Chul [Center for Inflammation, Immunity & Infection, Institute for Biomedical Sciences and Department of Biology, Georgia State University, Atlanta, GA (United States); Animal and Plant Quarantine Agency, Gyeonggi-do, Gimcheon, Gyeongsangbukdo (Korea, Republic of); Cho, Minkyoung [Center for Inflammation, Immunity & Infection, Institute for Biomedical Sciences and Department of Biology, Georgia State University, Atlanta, GA (United States); Kang, Sang-Moo, E-mail: skang24@gsu.edu [Center for Inflammation, Immunity & Infection, Institute for Biomedical Sciences and Department of Biology, Georgia State University, Atlanta, GA (United States)

    2016-07-15

    A safe and effective vaccine against respiratory syncytial virus (RSV) should confer protection without causing vaccine-enhanced disease. Here, using a cotton rat model, we investigated the protective efficacy and safety of an RSV combination vaccine composed of F-encoding plasmid DNA and virus-like particles containing RSV fusion (F) and attachment (G) glycoproteins (FFG-VLP). Cotton rats with FFG-VLP vaccination controlled lung viral replication below the detection limit, and effectively induced neutralizing activity and antibody-secreting cell responses. In comparison with formalin inactivated RSV (FI-RSV) causing severe RSV disease after challenge, FFG-VLP vaccination did not cause weight loss, airway hyper-responsiveness, IL-4 cytokines, histopathology, and infiltrates of proinflammatory cells such as eosinophils. FFG-VLP was even more effective in preventing RSV-induced pulmonary inflammation than live RSV infections. This study provides evidence that FFG-VLP can be developed into a safe and effective RSV vaccine candidate. - Highlights: • Combined RSV FFG VLP vaccine is effective in inducing F specific responses. • FFG VLP vaccine confers RSV neutralizing activity and viral control in cotton rats. • Cotton rats with RSV FFG VLP vaccination do not show vaccine-enhanced disease. • Cotton rats with FFG VLP vaccine induce F specific antibody secreting cell responses. • Cotton rats with FFG VLP do not induce lung cellular infiltrates and Th2 cytokine.

  9. Combined virus-like particle and fusion protein-encoding DNA vaccination of cotton rats induces protection against respiratory syncytial virus without causing vaccine-enhanced disease

    International Nuclear Information System (INIS)

    Hwang, Hye Suk; Lee, Young-Tae; Kim, Ki-Hye; Park, Soojin; Kwon, Young-Man; Lee, Youri; Ko, Eun-Ju; Jung, Yu-Jin; Lee, Jong Seok; Kim, Yu-Jin; Lee, Yu-Na; Kim, Min-Chul; Cho, Minkyoung; Kang, Sang-Moo

    2016-01-01

    A safe and effective vaccine against respiratory syncytial virus (RSV) should confer protection without causing vaccine-enhanced disease. Here, using a cotton rat model, we investigated the protective efficacy and safety of an RSV combination vaccine composed of F-encoding plasmid DNA and virus-like particles containing RSV fusion (F) and attachment (G) glycoproteins (FFG-VLP). Cotton rats with FFG-VLP vaccination controlled lung viral replication below the detection limit, and effectively induced neutralizing activity and antibody-secreting cell responses. In comparison with formalin inactivated RSV (FI-RSV) causing severe RSV disease after challenge, FFG-VLP vaccination did not cause weight loss, airway hyper-responsiveness, IL-4 cytokines, histopathology, and infiltrates of proinflammatory cells such as eosinophils. FFG-VLP was even more effective in preventing RSV-induced pulmonary inflammation than live RSV infections. This study provides evidence that FFG-VLP can be developed into a safe and effective RSV vaccine candidate. - Highlights: • Combined RSV FFG VLP vaccine is effective in inducing F specific responses. • FFG VLP vaccine confers RSV neutralizing activity and viral control in cotton rats. • Cotton rats with RSV FFG VLP vaccination do not show vaccine-enhanced disease. • Cotton rats with FFG VLP vaccine induce F specific antibody secreting cell responses. • Cotton rats with FFG VLP do not induce lung cellular infiltrates and Th2 cytokine.

  10. DNA vaccine expressing herpes simplex virus 1 glycoprotein C and D protects mice against herpes simplex keratitis

    OpenAIRE

    Li-Li Dong; Ru Tang; Yu-Jia Zhai; Tejsu Malla; Kai Hu

    2017-01-01

    AIM: To investigate whether DNA vaccine encoding herpes simplex virus 1 (HSV-1) glycoprotein C (gC) and glycoprotein D (gD) will achieve better protective effect against herpes simplex keratitis (HSK) than DNA vaccine encoding gD alone. METHODS: DNA vaccine expressing gD or gC combined gD (gD.gC) were constructed and carried by chitosan nanoparticle. The expression of fusion protein gD and gC were detected in DNA/nanoparticle transfected 293T cells by Western-blot. For immunization, mice w...

  11. Loss of long term protection with the inclusion of HIV pol to a DNA vaccine encoding gag.

    Science.gov (United States)

    Garrod, Tamsin J; Gargett, Tessa; Yu, Wenbo; Major, Lee; Burrell, Christopher J; Wesselingh, Steven; Suhrbier, Andreas; Grubor-Bauk, Branka; Gowans, Eric J

    2014-11-04

    Traditional vaccine strategies that induce antibody responses have failed to protect against HIV infection in clinical trials, and thus cell-mediated immunity is now an additional criterion. Recent clinical trials that aimed to induce strong T cell responses failed to do so. Therefore, to enhance induction of protective T cell responses, it is crucial that the optimum antigen combination is chosen. Limited research has been performed into the number of antigens selected for an HIV vaccine. This study aimed to compare DNA vaccines encoding either a single HIV antigen or a combination of two antigens, using intradermal vaccination of C57BL/6 mice. Immune assays were performed on splenocytes, and in vivo protection was examined by challenge with a chimeric virus, EcoHIV, able to infect mouse but not human leukocytes, at 10 days (short term) and 60 days (long term) post final vaccination. At 60 days there was significantly lower frequency of induced antigen-specific CD8(+) T cells in the spleens of pCMVgag-pol-vaccinated mice compared with mice which received pCMVgag only. Most importantly, short term viral control of EcoHIV was similar for pCMVgag and pCMVgag-pol-vaccinated mice at day 10, but only the pCMVgag-vaccinated significantly controlled EcoHIV at day 60 compared with pCMV-vaccinated mice, showing that control was reduced with the inclusion of the HIV pol gene. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. A DNA Vaccine Protects Human Immune Cells against Zika Virus Infection in Humanized Mice

    Directory of Open Access Journals (Sweden)

    Guohua Yi

    2017-11-01

    Full Text Available A DNA vaccine encoding prM and E protein has been shown to induce protection against Zika virus (ZIKV infection in mice and monkeys. However, its effectiveness in humans remains undefined. Moreover, identification of which immune cell types are specifically infected in humans is unclear. We show that human myeloid cells and B cells are primary targets of ZIKV in humanized mice. We also show that a DNA vaccine encoding full length prM and E protein protects humanized mice from ZIKV infection. Following administration of the DNA vaccine, humanized DRAG mice developed antibodies targeting ZIKV as measured by ELISA and neutralization assays. Moreover, following ZIKV challenge, vaccinated animals presented virtually no detectable virus in human cells and in serum, whereas unvaccinated animals displayed robust infection, as measured by qRT-PCR. Our results utilizing humanized mice show potential efficacy for a targeted DNA vaccine against ZIKV in humans.

  13. Evaluation of humoral and cellular immune responses to a DNA vaccine encoding chicken type II collagen for rheumatoid arthritis in normal rats.

    Science.gov (United States)

    Xiao, Zhao; Juan, Long; Song, Yun; Zhijian, Zhang; Jing, Jin; Kun, Yu; Yuna, Hao; Dongfa, Dai; Lili, Ding; Liuxin, Tan; Fei, Liang; Nan, Liu; Fang, Yuan; Yuying, Sun; Yongzhi, Xi

    2015-01-01

    A major challenge in the development of effective therapies for rheumatoid arthritis (RA) is finding a method for the specific inhibition of the inflammatory disease processes without the induction of generalized immunosuppression. Of note, the development of therapeutic DNA vaccines and boosters that may restore immunological tolerance remains a high priority. pcDNA-CCOL2A1 is a therapeutic DNA vaccine encoding chicken type II collagen(CCII). This vaccine was developed by our laboratory and has been shown to exhibit efficacy comparable to that of the current "gold standard" treatment, methotrexate (MTX). Here, we used enzyme-linked immunosorbent assays with anti-CII IgG antibodies, quantified the expression levels of Th1, Th2, and Th3 cytokines, and performed flow cytometric analyses of different T-cell subsets, including Th1, Th2, Th17, Tc, Ts, Treg, and CD4(+)CD29(+)T cells to systemically evaluate humoral and cellular immune responses to pcDNA-CCOL2A1 vaccine in normal rats. Similar to our observations at maximum dosage of 3 mg/kg, vaccination of normal rats with 300 μg/kg pcDNA-CCOL2A1 vaccine did not induce the production of anti-CII IgG. Furthermore, no significant changes were observed in the expression levels of pro-inflammatory cytokines interleukin (IL)-1α, IL-5, IL-6, IL-12(IL-23p40), monocyte chemotactic protein (MCP)-1, macrophage inflammatory protein (MIP)-1α, regulated on activation in normal T-cell expressed and secreted (RANTES), receptor activator for nuclear factor-κB ligand (RANKL), and granulocyte colony-stimulating factor (G-CSF) or anti-inflammatory cytokines IL-4 and IL-10 in vaccinated normal rats relative to that in controls(P > 0.05). However, transforming growth factor (TGF)-β levels were significantly increased on days 10 and 14, while interferon (IFN)-γ and tumor necrosis factor (TNF)-α levels were significantly decreased on days 28 and 35 after vaccination(P 0.05), with the exception of Treg cells, which were significantly

  14. Safety and efficacy of a xenogeneic DNA vaccine encoding for human tyrosinase as adjunctive treatment for oral malignant melanoma in dogs following surgical excision of the primary tumor.

    Science.gov (United States)

    Grosenbaugh, Deborah A; Leard, A Timothy; Bergman, Philip J; Klein, Mary K; Meleo, Karri; Susaneck, Steven; Hess, Paul R; Jankowski, Monika K; Jones, Pamela D; Leibman, Nicole F; Johnson, Maribeth H; Kurzman, Ilene D; Wolchok, Jedd D

    2011-12-01

    To evaluate the safety and efficacy of a vaccine containing plasmid DNA with an insert encoding human tyrosinase (ie, huTyr vaccine) as adjunctive treatment for oral malignant melanoma (MM) in dogs. 111 dogs (58 prospectively enrolled in a multicenter clinical trial and 53 historical controls) with stage II or III oral MM (modified World Health Organization staging scale, I to IV) in which locoregional disease control was achieved. 58 dogs received an initial series of 4 injections of huTyr vaccine (102 μg of DNA/injection) administered transdermally by use of a needle-free IM vaccination device. Dogs were monitored for adverse reactions. Surviving dogs received booster injections at 6-month intervals thereafter. Survival time for vaccinates was compared with that of historical control dogs via Kaplan-Meier survival analysis for the outcome of death. Kaplan-Meier analysis of survival time until death attributable to MM was determined to be significantly improved for dogs that received the huTyr vaccine, compared with that of historical controls. However, median survival time could not be determined for vaccinates because dogs as adjunctive treatment for oral MM. Response to DNA vaccination in dogs with oral MM may be useful in development of plasmid DNA vaccination protocols for human patients with similar disease.

  15. Next generation sequencing of DNA-launched Chikungunya vaccine virus

    Energy Technology Data Exchange (ETDEWEB)

    Hidajat, Rachmat; Nickols, Brian [Medigen, Inc., 8420 Gas House Pike, Suite S, Frederick, MD 21701 (United States); Forrester, Naomi [Institute for Human Infections and Immunity, Sealy Center for Vaccine Development and Department of Pathology, University of Texas Medical Branch, GNL, 301 University Blvd., Galveston, TX 77555 (United States); Tretyakova, Irina [Medigen, Inc., 8420 Gas House Pike, Suite S, Frederick, MD 21701 (United States); Weaver, Scott [Institute for Human Infections and Immunity, Sealy Center for Vaccine Development and Department of Pathology, University of Texas Medical Branch, GNL, 301 University Blvd., Galveston, TX 77555 (United States); Pushko, Peter, E-mail: ppushko@medigen-usa.com [Medigen, Inc., 8420 Gas House Pike, Suite S, Frederick, MD 21701 (United States)

    2016-03-15

    Chikungunya virus (CHIKV) represents a pandemic threat with no approved vaccine available. Recently, we described a novel vaccination strategy based on iDNA® infectious clone designed to launch a live-attenuated CHIKV vaccine from plasmid DNA in vitro or in vivo. As a proof of concept, we prepared iDNA plasmid pCHIKV-7 encoding the full-length cDNA of the 181/25 vaccine. The DNA-launched CHIKV-7 virus was prepared and compared to the 181/25 virus. Illumina HiSeq2000 sequencing revealed that with the exception of the 3′ untranslated region, CHIKV-7 viral RNA consistently showed a lower frequency of single-nucleotide polymorphisms than the 181/25 RNA including at the E2-12 and E2-82 residues previously identified as attenuating mutations. In the CHIKV-7, frequencies of reversions at E2-12 and E2-82 were 0.064% and 0.086%, while in the 181/25, frequencies were 0.179% and 0.133%, respectively. We conclude that the DNA-launched virus has a reduced probability of reversion mutations, thereby enhancing vaccine safety. - Highlights: • Chikungunya virus (CHIKV) is an emerging pandemic threat. • In vivo DNA-launched attenuated CHIKV is a novel vaccine technology. • DNA-launched virus was sequenced using HiSeq2000 and compared to the 181/25 virus. • DNA-launched virus has lower frequency of SNPs at E2-12 and E2-82 attenuation loci.

  16. Next generation sequencing of DNA-launched Chikungunya vaccine virus

    International Nuclear Information System (INIS)

    Hidajat, Rachmat; Nickols, Brian; Forrester, Naomi; Tretyakova, Irina; Weaver, Scott; Pushko, Peter

    2016-01-01

    Chikungunya virus (CHIKV) represents a pandemic threat with no approved vaccine available. Recently, we described a novel vaccination strategy based on iDNA® infectious clone designed to launch a live-attenuated CHIKV vaccine from plasmid DNA in vitro or in vivo. As a proof of concept, we prepared iDNA plasmid pCHIKV-7 encoding the full-length cDNA of the 181/25 vaccine. The DNA-launched CHIKV-7 virus was prepared and compared to the 181/25 virus. Illumina HiSeq2000 sequencing revealed that with the exception of the 3′ untranslated region, CHIKV-7 viral RNA consistently showed a lower frequency of single-nucleotide polymorphisms than the 181/25 RNA including at the E2-12 and E2-82 residues previously identified as attenuating mutations. In the CHIKV-7, frequencies of reversions at E2-12 and E2-82 were 0.064% and 0.086%, while in the 181/25, frequencies were 0.179% and 0.133%, respectively. We conclude that the DNA-launched virus has a reduced probability of reversion mutations, thereby enhancing vaccine safety. - Highlights: • Chikungunya virus (CHIKV) is an emerging pandemic threat. • In vivo DNA-launched attenuated CHIKV is a novel vaccine technology. • DNA-launched virus was sequenced using HiSeq2000 and compared to the 181/25 virus. • DNA-launched virus has lower frequency of SNPs at E2-12 and E2-82 attenuation loci.

  17. DNA Vaccine Encoding the Chimeric Form of Schistosoma mansoni Sm-TSP2 and Sm29 Confers Partial Protection against Challenge Infection.

    Directory of Open Access Journals (Sweden)

    Natan Raimundo Gonçalves de Assis

    Full Text Available Schistosomiasis is an important parasitic disease worldwide that affects more than 207 million people in 76 countries and causes approximately 250,000 deaths per year. The best long-term strategy to control schistosomiasis is through immunization combined with drug treatment. Due to the ability of DNA vaccines to generate humoral and cellular immune responses, such vaccines are considered a promising approach against schistosomiasis. Sm29 and tetraspanin-2 (Sm-TSP2 are two proteins that are located in the S. mansoni tegument of adult worms and schistosomula and induce high levels of protection through recombinant protein immunization. In this study, we transfected BHK-21 cells with plasmids encoding Sm29, Sm-TSP2 or a chimera containing both genes. Using RT-PCR analysis and western blot, we confirmed that the DNA vaccine constructs were transcribed and translated, respectively, in BHK-21 cells. After immunization of mice, we evaluated the reduction in worm burden. We observed worm burden reductions of 17-22%, 22%, 31-32% and 24-32% in animals immunized with the pUMVC3/Sm29, pUMVC3/SmTSP-2, pUMVC3/Chimera and pUMVC3/Sm29 + pUMVC3/SmTSP-2 plasmids, respectively. We evaluated the humoral response elicited by DNA vaccines, and animals immunized with pUMVC3/Sm29 and pUMVC3/Sm29 + pUMVC3/SmTSP-2 showed higher titers of anti-Sm29 antibodies. The cytokine profile produced by the spleen cells of immunized mice was then evaluated. We observed higher production of Th1 cytokines, such as TNF-α and IFN-γ, in vaccinated mice and no significant production of IL-4 and IL-5. The DNA vaccines tested in this study showed the ability to generate a protective immune response against schistosomiasis, probably through the production of Th1 cytokines. However, future strategies aiming to optimize the protective response induced by a chimeric DNA construct need to be developed.

  18. DNA Vaccine Encoding the Chimeric Form of Schistosoma mansoni Sm-TSP2 and Sm29 Confers Partial Protection against Challenge Infection

    Science.gov (United States)

    Gonçalves de Assis, Natan Raimundo; Batistoni de Morais, Suellen; Figueiredo, Bárbara Castro Pimentel; Ricci, Natasha Delaqua; de Almeida, Leonardo Augusto; da Silva Pinheiro, Carina; Martins, Vicente de Paulo; Oliveira, Sergio Costa

    2015-01-01

    Schistosomiasis is an important parasitic disease worldwide that affects more than 207 million people in 76 countries and causes approximately 250,000 deaths per year. The best long-term strategy to control schistosomiasis is through immunization combined with drug treatment. Due to the ability of DNA vaccines to generate humoral and cellular immune responses, such vaccines are considered a promising approach against schistosomiasis. Sm29 and tetraspanin-2 (Sm-TSP2) are two proteins that are located in the S. mansoni tegument of adult worms and schistosomula and induce high levels of protection through recombinant protein immunization. In this study, we transfected BHK-21 cells with plasmids encoding Sm29, Sm-TSP2 or a chimera containing both genes. Using RT-PCR analysis and western blot, we confirmed that the DNA vaccine constructs were transcribed and translated, respectively, in BHK-21 cells. After immunization of mice, we evaluated the reduction in worm burden. We observed worm burden reductions of 17-22%, 22%, 31-32% and 24-32% in animals immunized with the pUMVC3/Sm29, pUMVC3/SmTSP-2, pUMVC3/Chimera and pUMVC3/Sm29 + pUMVC3/SmTSP-2 plasmids, respectively. We evaluated the humoral response elicited by DNA vaccines, and animals immunized with pUMVC3/Sm29 and pUMVC3/Sm29 + pUMVC3/SmTSP-2 showed higher titers of anti-Sm29 antibodies. The cytokine profile produced by the spleen cells of immunized mice was then evaluated. We observed higher production of Th1 cytokines, such as TNF-α and IFN-γ, in vaccinated mice and no significant production of IL-4 and IL-5. The DNA vaccines tested in this study showed the ability to generate a protective immune response against schistosomiasis, probably through the production of Th1 cytokines. However, future strategies aiming to optimize the protective response induced by a chimeric DNA construct need to be developed. PMID:25942636

  19. Trial watch: Naked and vectored DNA-based anticancer vaccines.

    Science.gov (United States)

    Bloy, Norma; Buqué, Aitziber; Aranda, Fernando; Castoldi, Francesca; Eggermont, Alexander; Cremer, Isabelle; Sautès-Fridman, Catherine; Fucikova, Jitka; Galon, Jérôme; Spisek, Radek; Tartour, Eric; Zitvogel, Laurence; Kroemer, Guido; Galluzzi, Lorenzo

    2015-05-01

    One type of anticancer vaccine relies on the administration of DNA constructs encoding one or multiple tumor-associated antigens (TAAs). The ultimate objective of these preparations, which can be naked or vectored by non-pathogenic viruses, bacteria or yeast cells, is to drive the synthesis of TAAs in the context of an immunostimulatory milieu, resulting in the (re-)elicitation of a tumor-targeting immune response. In spite of encouraging preclinical results, the clinical efficacy of DNA-based vaccines employed as standalone immunotherapeutic interventions in cancer patients appears to be limited. Thus, efforts are currently being devoted to the development of combinatorial regimens that allow DNA-based anticancer vaccines to elicit clinically relevant immune responses. Here, we discuss recent advances in the preclinical and clinical development of this therapeutic paradigm.

  20. Rapid DNA vaccination against Burkholderia pseudomallei flagellin by tattoo or intranasal application.

    Science.gov (United States)

    Lankelma, Jacqueline M; Wagemakers, Alex; Birnie, Emma; Haak, Bastiaan W; Trentelman, Jos J A; Weehuizen, Tassili A F; Ersöz, Jasmin; Roelofs, Joris J T H; Hovius, Joppe W; Wiersinga, W Joost; Bins, Adriaan D

    2017-11-17

    Melioidosis is a severe infectious disease with a high mortality that is endemic in South-East Asia and Northern Australia. The causative pathogen, Burkholderia pseudomallei, is listed as potential bioterror weapon due to its high virulence and potential for easy dissemination. Currently, there is no licensed vaccine for prevention of melioidosis. Here, we explore the use of rapid plasmid DNA vaccination against B. pseudomallei flagellin for protection against respiratory challenge. We tested three flagellin DNA vaccines with different subcellular targeting designs. C57BL/6 mice were vaccinated via skin tattoo on day 0, 3 and 6 before intranasal challenge with B. pseudomallei on day 21. Next, the most effective construct was used as single vaccination on day 0 by tattoo or intranasal formulation. Mice were sacrificed 72 hours post-challenge to assess bacterial loads, cytokine responses, inflammation and microscopic lesions. A construct encoding a cellular secretion signal resulted in the most effective protection against melioidosis via tattooing, with a 10-fold reduction in bacterial loads in lungs and distant organs compared to the empty vector. Strikingly, a single intranasal administration of the same vaccine resulted in >1000-fold lower bacterial loads and increased survival. Pro-inflammatory cytokine responses were significantly diminished and strong reductions in markers for distant organ damage were observed. A rapid vaccination scheme using flagellin DNA tattoo provides significant protection against intranasal challenge with B. pseudomallei, markedly improved by a single administration via airway mucosa. Hence intranasal vaccination with flagellin-encoding DNA may be applicable when acute mass vaccination is indicated and warrants further testing.

  1. The past, current and future trends in DNA vaccine immunisations

    Directory of Open Access Journals (Sweden)

    Sidgi Syed Anwer Abdo Hasson

    2015-05-01

    Full Text Available This review focuses on DNA vaccines, denoting the last two decades since the early substantiation of preclinical protection was published in Science in 1993 by Ulmer et al. In spite of being safely administered and easily engineered and manufactured DNA vaccine, it holds the future prospects of immunization by inducing potent cellular immune responses against infectious and non-infectious diseases. It is well documented that injection of DNA plasmid encoding a desired gene of interest can result in the subsequent expression of its products and lead to the induction of an immune response within a host. This is pertinent to prophylactic and therapeutic vaccination approach when the peculiar gene produces a protective epitope from a pathogen. The recent studies demonstrated by a number of research centers showed that these immune responses evoke protective immunity against several infectious diseases and cancers, which provides adequate support for the use of this approach. We attempt in this review to provide an informative and unbiased overview of the general principles and concept of DNA vaccines technology with a summary of a novel approach to the DNA vaccine, present investigations that describe the mechanism(s of protective immunity provoked by DNA immunization and to highlight the advantages and disadvantages of DNA immunisation.

  2. Intranasal delivery of cationic PLGA nano/microparticles-loaded FMDV DNA vaccine encoding IL-6 elicited protective immunity against FMDV challenge.

    Directory of Open Access Journals (Sweden)

    Gang Wang

    Full Text Available Mucosal vaccination has been demonstrated to be an effective means of eliciting protective immunity against aerosol infections of foot and mouth disease virus (FMDV and various approaches have been used to improve mucosal response to this pathogen. In this study, cationic PLGA (poly(lactide-co-glycolide nano/microparticles were used as an intranasal delivery vehicle as a means administering FMDV DNA vaccine encoding the FMDV capsid protein and the bovine IL-6 gene as a means of enhancing mucosal and systemic immune responses in animals. Three eukaryotic expression plasmids with or without bovine IL-6 gene (pc-P12A3C, pc-IL2AP12A3C and pc-P12AIL3C were generated. The two latter plasmids were designed with the IL-6 gene located either before or between the P12A and 3C genes, respectively, as a means of determining if the location of the IL-6 gene affected capsid assembly and the subsequent immune response. Guinea pigs and rats were intranasally vaccinated with the respective chitosan-coated PLGA nano/microparticles-loaded FMDV DNA vaccine formulations. Animals immunized with pc-P12AIL3C (followed by animals vaccinated with pc-P12A3C and pc-IL2AP12A3C developed the highest levels of antigen-specific serum IgG and IgA antibody responses and the highest levels of sIgA (secretory IgA present in mucosal tissues. However, the highest levels of neutralizing antibodies were generated in pc-IL2AP12A3C-immunized animals (followed by pc-P12AIL3C- and then in pc-P12A3C-immunized animals. pc-IL2AP12A3C-immunized animals also developed stronger cell mediated immune responses (followed by pc-P12AIL3C- and pc-P12A3C-immunized animals as evidenced by antigen-specific T-cell proliferation and expression levels of IFN-γ by both CD4+ and CD8+ splenic T cells. The percentage of animals protected against FMDV challenge following immunizations with pc-IL2AP12A3C, pc-P12AIL3C or pc-P12A3C were 3/5, 1/5 and 0/5, respectively. These data suggested that intranasal delivery

  3. DNA vaccine expressing herpes simplex virus 1 glycoprotein C and D protects mice against herpes simplex keratitis

    Directory of Open Access Journals (Sweden)

    Li-Li Dong

    2017-11-01

    Full Text Available AIM: To investigate whether DNA vaccine encoding herpes simplex virus 1 (HSV-1 glycoprotein C (gC and glycoprotein D (gD will achieve better protective effect against herpes simplex keratitis (HSK than DNA vaccine encoding gD alone. METHODS: DNA vaccine expressing gD or gC combined gD (gD.gC were constructed and carried by chitosan nanoparticle. The expression of fusion protein gD and gC were detected in DNA/nanoparticle transfected 293T cells by Western-blot. For immunization, mice were inoculated with DNA/nanoparticle for 3 times with 2wk interval, and two weeks after the final immunization, the specific immune responses and clinical degrees of primary HSK were evaluated. RESULTS: Fusion protein gD.gC could be expressed successfully in cultured 293T cells. And, pRSC-gC.gD-IL21 DNA/chitosan nanoparticle could effectively elicit strongest humoral and cellular immune response in primary HSK mice evidenced by higher levels of specific neutralizing antibody and sIgA production, enhanced cytotoxicities of splenocytes and nature killer cells (NK, when compared with those of gD alone or mocked vaccine immunized mice. As a result, gC-based vaccine immunized mice showed least HSK disease. CONCLUSION: gC-based DNA vaccine could effectively prevent the progress of primary HSK, suggesting that this DNA vaccine could be a promising vaccine for HSK treatment in the future.

  4. DNA vaccine expressing herpes simplex virus 1 glycoprotein C and D protects mice against herpes simplex keratitis

    Science.gov (United States)

    Dong, Li-Li; Tang, Ru; Zhai, Yu-Jia; Malla, Tejsu; Hu, Kai

    2017-01-01

    AIM To investigate whether DNA vaccine encoding herpes simplex virus 1 (HSV-1) glycoprotein C (gC) and glycoprotein D (gD) will achieve better protective effect against herpes simplex keratitis (HSK) than DNA vaccine encoding gD alone. METHODS DNA vaccine expressing gD or gC combined gD (gD.gC) were constructed and carried by chitosan nanoparticle. The expression of fusion protein gD and gC were detected in DNA/nanoparticle transfected 293T cells by Western-blot. For immunization, mice were inoculated with DNA/nanoparticle for 3 times with 2wk interval, and two weeks after the final immunization, the specific immune responses and clinical degrees of primary HSK were evaluated. RESULTS Fusion protein gD.gC could be expressed successfully in cultured 293T cells. And, pRSC-gC.gD-IL21 DNA/chitosan nanoparticle could effectively elicit strongest humoral and cellular immune response in primary HSK mice evidenced by higher levels of specific neutralizing antibody and sIgA production, enhanced cytotoxicities of splenocytes and nature killer cells (NK), when compared with those of gD alone or mocked vaccine immunized mice. As a result, gC-based vaccine immunized mice showed least HSK disease. CONCLUSION gC-based DNA vaccine could effectively prevent the progress of primary HSK, suggesting that this DNA vaccine could be a promising vaccine for HSK treatment in the future. PMID:29181304

  5. Efficacy of chimeric DNA vaccines encoding Eimeria tenella 5401 and chicken IFN-γ or IL-2 against coccidiosis in chickens.

    Science.gov (United States)

    Song, Xiaokai; Huang, Xinmei; Yan, Ruofeng; Xu, Lixin; Li, Xiangrui

    2015-09-01

    Chimeric DNA vaccines encoding Eimeria tenella (E. tenella) surface antigen 5401 were constructed and their efficacies against E. tenella challenge were studied. The open reading frame (ORF) of 5401 was cloned into the prokaryotic expression vector pGEX-4T2 to express the recombinant protein and the expressed recombinant protein was identified by Western blot. The ORF of 5401 and chicken cytokine gene IFN-γ or IL-2 were cloned into the eukaryotic expression vector pVAX1 consecutively to construct DNA vaccines pVAX-5401-IFN-γ, pVAX-5401-IL-2 and pVAX-5401. The expression of aim genes in vivo was detected by reverse transcription-polymerase chain reaction and Western blot. Fourteen-day-old chickens were inoculated twice at an interval of 7 days with 100 µg of plasmids pVAX-5401, pVAX-5401-IFN-γ and pVAX-5401-IL-2 or 200 µg of recombinant 5401 protein by leg intramuscular injection, respectively. Seven days after the second inoculation, all chickens except the unchallenged control group were challenged orally with 5 × 10(4) sporulated oocysts of E. tenella. Seven days after challenge, all chickens were weighted and slaughtered to determine the effects of immunization. The results showed the recombinant protein was about 90 kDa and reacted with antiserum against soluble sporozoites. The animal experiment showed that all the DNA vaccines pVAX-5401, pVAX-5401-IFN-γ or pVAX-5401-IL-2 and the recombinant 5401 protein could obviously alleviate body weight loss and cecal lesions as compared with non-vaccinated challenged control and empty vector pVAX1control. Furthermore, pVAX-5401-IFN-γ or pVAX-5401-IL-2 induced anti-coccidial index (ACI) of 180.01 or 177.24 which were significantly higher than that of pVAX-5401. The results suggested that 5401 was an effective candidate antigen for vaccine. This finding also suggested that chicken IFN-γ or IL-2 could effectively improve the efficacies of DNA vaccines against avian coccidiosis. Copyright © 2015 Elsevier

  6. Phase 1 study of pandemic H1 DNA vaccine in healthy adults.

    Directory of Open Access Journals (Sweden)

    Michelle C Crank

    Full Text Available A novel, swine-origin influenza A (H1N1 virus was detected worldwide in April 2009, and the World Health Organization (WHO declared a global pandemic that June. DNA vaccine priming improves responses to inactivated influenza vaccines. We describe the rapid production and clinical evaluation of a DNA vaccine encoding the hemagglutinin protein of the 2009 pandemic A/California/04/2009(H1N1 influenza virus, accomplished nearly two months faster than production of A/California/07/2009(H1N1 licensed monovalent inactivated vaccine (MIV.20 subjects received three H1 DNA vaccinations (4 mg intramuscularly with Biojector at 4-week intervals. Eighteen subjects received an optional boost when the licensed H1N1 MIV became available. The interval between the third H1 DNA injection and MIV boost was 3-17 weeks. Vaccine safety was assessed by clinical observation, laboratory parameters, and 7-day solicited reactogenicity. Antibody responses were assessed by ELISA, HAI and neutralization assays, and T cell responses by ELISpot and flow cytometry.Vaccinations were safe and well-tolerated. As evaluated by HAI, 6/20 developed positive responses at 4 weeks after third DNA injection and 13/18 at 4 weeks after MIV boost. Similar results were detected in neutralization assays. T cell responses were detected after DNA and MIV. The antibody responses were significantly amplified by the MIV boost, however, the boost did not increased T cell responses induced by DNA vaccine.H1 DNA vaccine was produced quickly, was well-tolerated, and had modest immunogenicity as a single agent. Other HA DNA prime-MIV boost regimens utilizing one DNA prime vaccination and longer boost intervals have shown significant immunogenicity. Rapid and large-scale production of HA DNA vaccines has the potential to contribute to an efficient response against future influenza pandemics.Clinicaltrials.gov NCT00973895.

  7. A DNA vaccine encoding multiple HIV CD4 epitopes elicits vigorous polyfunctional, long-lived CD4+ and CD8+ T cell responses.

    Directory of Open Access Journals (Sweden)

    Daniela Santoro Rosa

    Full Text Available T-cell based vaccines against HIV have the goal of limiting both transmission and disease progression by inducing broad and functionally relevant T cell responses. Moreover, polyfunctional and long-lived specific memory T cells have been associated to vaccine-induced protection. CD4(+ T cells are important for the generation and maintenance of functional CD8(+ cytotoxic T cells. We have recently developed a DNA vaccine encoding 18 conserved multiple HLA-DR-binding HIV-1 CD4 epitopes (HIVBr18, capable of eliciting broad CD4(+ T cell responses in multiple HLA class II transgenic mice. Here, we evaluated the breadth and functional profile of HIVBr18-induced immune responses in BALB/c mice. Immunized mice displayed high-magnitude, broad CD4(+/CD8(+ T cell responses, and 8/18 vaccine-encoded peptides were recognized. In addition, HIVBr18 immunization was able to induce polyfunctional CD4(+ and CD8(+ T cells that proliferate and produce any two cytokines (IFNγ/TNFα, IFNγ/IL-2 or TNFα/IL-2 simultaneously in response to HIV-1 peptides. For CD4(+ T cells exclusively, we also detected cells that proliferate and produce all three tested cytokines simultaneously (IFNγ/TNFα/IL-2. The vaccine also generated long-lived central and effector memory CD4(+ T cells, a desirable feature for T-cell based vaccines. By virtue of inducing broad, polyfunctional and long-lived T cell responses against conserved CD4(+ T cell epitopes, combined administration of this vaccine concept may provide sustained help for CD8(+ T cells and antibody responses- elicited by other HIV immunogens.

  8. Vaccination with DNA encoding truncated enterohemorrhagic Escherichia coli (EHEC factor for adherence-1 gene (efa-1’ confers protective immunity to mice infected with E. coli O157:H7

    Directory of Open Access Journals (Sweden)

    Roberto eRiquelme-Neira

    2016-01-01

    Full Text Available Enterohemorrhagic Escherichia coli (EHEC O157:H7 is the predominant causative agent of hemorrhagic colitis in humans and is the cause of haemolytic uraemic syndrome and other illnesses. Cattle have been implicated as the main reservoir of this organism. Here, we evaluated the immunogenicity and protective efficacy of a DNA vaccine encoding conserved sequences of truncated EHEC factor for adherence-1 (efa-1’ in a mouse model. Intranasal administration of plasmid DNA carrying the efa-1’ gene (pVAXefa-1’ into C57BL/6 mice elicited both humoral and cellular immune responses. In animals immunized with pVAXefa-1`, EHEC-secreted protein-specific IgM and IgG antibodies were detected in sera at day 45. Anti-EHEC-secreted protein sIgA was also detected in nasal and bronchoalveolar lavages. In addition, antigen-specific T-cell-proliferation, IL-10 and IFN-γ were observed upon re-stimulation with either heat-killed bacteria or EHEC-secreted proteins. Vaccinated animals were also protected against challenge with E. coli O157:H7 strain EDL933. These results suggest that DNA vaccine encoding efa-1´ have therapeutic potential in interventions against EHEC infections. This approach could lead to a new strategy in the production of vaccines that prevent infections in cattle.

  9. Oral DNA Vaccine in Chickens

    Directory of Open Access Journals (Sweden)

    Seyed Davoud Jazayeri

    2012-01-01

    Full Text Available Attenuated Salmonella has been used as a carrier for DNA vaccine. However, in vitro and in vivo studies on the bacteria following transfection of plasmid DNA were poorly studied. In this paper, eukaryotic expression plasmids encoding avian influenza virus (AIV subtype H5N1 genes, pcDNA3.1/HA, NA, and NP, were transfected into an attenuated Salmonella enteric typhimurium SV4089. In vitro stability of the transfected plasmids into Salmonella were over 90% after 100 generations. The attenuated Salmonella were able to invade MCF-7 (1.2% and MCF-10A (0.5% human breast cancer cells. Newly hatched specific-pathogen-free (SPF chicks were inoculated once by oral gavage with 109 colony-forming unit (CFU of the attenuated Salmonella. No abnormal clinical signs or deaths were recorded after inoculation. Viable bacteria were detected 3 days after inoculation by plating from spleen, liver, and cecum. Fluorescent in situ hybridization (FISH and polymerase chain reaction (PCR were carried out for confirmation. Salmonella was not detected in blood cultures although serum antibody immune responses to Salmonella O antiserum group D1 factor 1, 9, and 12 antigens were observed in all the inoculated chickens after 7 days up to 35 days. Our results showed that live attenuated S. typhimurium SV4089 harboring pcDNA3.1/HA, NA, and NP may provide a unique alternative as a carrier for DNA oral vaccine in chickens.

  10. Increase in DNA vaccine efficacy by virosome delivery and co-expression of a cytolytic protein.

    Science.gov (United States)

    Gargett, Tessa; Grubor-Bauk, Branka; Miller, Darren; Garrod, Tamsin; Yu, Stanley; Wesselingh, Steve; Suhrbier, Andreas; Gowans, Eric J

    2014-06-01

    The potential of DNA vaccines has not been realised due to suboptimal delivery, poor antigen expression and the lack of localised inflammation, essential for antigen presentation and an effective immune response to the immunogen. Initially, we examined the delivery of a DNA vaccine encoding a model antigen, luciferase (LUC), to the respiratory tract of mice by encapsulation in a virosome. Virosomes that incorporated influenza virus haemagglutinin effectively delivered DNA to cells in the mouse respiratory tract and resulted in antigen expression and systemic and mucosal immune responses to the immunogen after an intranasal (IN) prime/intradermal (ID) boost regimen, whereas a multidose ID regimen only generated systemic immunity. We also examined systemic immune responses to LUC after ID vaccination with a DNA vaccine, which also encoded one of the several cytolytic or toxic proteins. Although the herpes simplex virus thymidine kinase, in the presence of the prodrug, ganciclovir, resulted in cell death, this failed to increase the humoral or cell-mediated immune responses. In contrast, the co-expression of LUC with the rotavirus non-structural protein 4 (NSP4) protein or a mutant form of mouse perforin, proteins which are directly cytolytic, resulted in increased LUC-specific humoral and cell-mediated immunity. On the other hand, co-expression of LUC with diphtheria toxin subunit A or overexpression of perforin or NSP4 resulted in a lower level of immunity. In summary, the efficacy of DNA vaccines can be improved by targeted IN delivery of DNA or by the induction of cell death in vaccine-targeted cells after ID delivery.

  11. Endoplasmic reticulum targeting sequence enhances HBV-specific cytotoxic T lymphocytes induced by a CTL epitope-based DNA vaccine

    International Nuclear Information System (INIS)

    Xu Wei; Chu Yiwei; Zhang Ruihua; Xu Huanbin; Wang Ying; Xiong Sidong

    2005-01-01

    CD8 + T cells play a critical role in protective immunity against Hepatitis B Virus (HBV). Epitope-based DNA vaccines expressing HBV-dominant CTL epitopes can be used as candidate vaccines capable of inducing cytotoxic T Lymphocytes (CTL) responses. A plasmid DNA encoding a CTL epitope of HBV core antigen, HBc 18-27 , was constructed. Intramuscular immunization of C57BL/6 mice with this DNA vaccine resulted in successful induction of HBV-specific CTL responses. In order to promote transportation of the peptide into endoplasmic reticulum (ER) to bind to MHC class I molecules for optimal class I antigen presentation, an ER targeting sequence (ERTS) was fused with the C 18-27 encoding gene. ERTS fusion significantly enhanced specific CD8 + T cell responses in terms of CTL cytolysis as well as IFN-γ secretion. This enhancement was correlated with promoted epitope presentation on target cell surface. We report here an enhanced immunogenicity of an epitope-based DNA vaccine using an ER targeting signal sequence, which has significant implications for future design of therapeutic HBV vaccine

  12. DNA vaccines encoding proteins from wild-type and attenuated canine distemper virus protect equally well against wild-type virus challenge.

    Science.gov (United States)

    Nielsen, Line; Jensen, Trine Hammer; Kristensen, Birte; Jensen, Tove Dannemann; Karlskov-Mortensen, Peter; Lund, Morten; Aasted, Bent; Blixenkrone-Møller, Merete

    2012-10-01

    Immunity induced by DNA vaccines containing the hemagglutinin (H) and nucleoprotein (N) genes of wild-type and attenuated canine distemper virus (CDV) was investigated in mink (Mustela vison), a highly susceptible natural host of CDV. All DNA-immunized mink seroconverted, and significant levels of virus-neutralizing (VN) antibodies were present on the day of challenge with wild-type CDV. The DNA vaccines also primed the cell-mediated memory responses, as indicated by an early increase in the number of interferon-gamma (IFN-γ)-producing lymphocytes after challenge. Importantly, the wild-type and attenuated CDV DNA vaccines had a long-term protective effect against wild-type CDV challenge. The vaccine-induced immunity induced by the H and N genes from wild-type CDV and those from attenuated CDV was comparable. Because these two DNA vaccines were shown to protect equally well against wild-type virus challenge, it is suggested that the genetic/antigenic heterogeneity between vaccine strains and contemporary wild-type strains are unlikely to cause vaccine failure.

  13. DNA fusion gene vaccines

    DEFF Research Database (Denmark)

    Holst, Peter Johannes; Bassi, Maria Rosaria; Thomsen, Allan Randrup

    2010-01-01

    DNA vaccines are versatile and safe, but limited immunogenicity has prevented their use in the clinical setting. Experimentally, immunogenicity may be enhanced by the use of new delivery technologies, by coadministration of cytokines and pathogen-associated molecular patterns, or by fusion...... of antigens into molecular domains that enhance antigen presentation. More specifically, the immunogenicity of DNA vaccines may benefit from increased protein synthesis, increased T-cell help and MHC class I presentation, and the addition of a range of specific cytokines and pathogen-associated molecular...... with viral-vectored vaccines, various synergistic components may need to be incorporated into DNA vaccines. From the perspective of the future clinical use of DNA vaccines, it has been suggested that antigen presentation should be improved and cytokine coadministration attempted. However, even...

  14. Enhanced anti-tumor effect of a gene gun-delivered DNA vaccine encoding the human papillomavirus type 16 oncoproteins genetically fused to the herpes simplex virus glycoprotein D

    Directory of Open Access Journals (Sweden)

    M.O. Diniz

    2011-05-01

    Full Text Available Anti-cancer DNA vaccines have attracted growing interest as a simple and non-invasive method for both the treatment and prevention of tumors induced by human papillomaviruses. Nonetheless, the low immunogenicity of parenterally administered vaccines, particularly regarding the activation of cytotoxic CD8+ T cell responses, suggests that further improvements in both vaccine composition and administration routes are still required. In the present study, we report the immune responses and anti-tumor effects of a DNA vaccine (pgD-E7E6E5 expressing three proteins (E7, E6, and E5 of the human papillomavirus type 16 genetically fused to the glycoprotein D of the human herpes simplex virus type 1, which was administered to mice by the intradermal (id route using a gene gun. A single id dose of pgD-E7E6E5 (2 µg/dose induced a strong activation of E7-specific interferon-γ (INF-γ-producing CD8+ T cells and full prophylactic anti-tumor effects in the vaccinated mice. Three vaccine doses inhibited tumor growth in 70% of the mice with established tumors. In addition, a single vaccine dose consisting of the co-administration of pgD-E7E6E5 and the vector encoding interleukin-12 or granulocyte-macrophage colony-stimulating factor further enhanced the therapeutic anti-tumor effects and conferred protection to 60 and 50% of the vaccinated mice, respectively. In conclusion, id administration of pgD-E7E6E5 significantly enhanced the immunogenicity and anti-tumor effects of the DNA vaccine, representing a promising administration route for future clinical trials.

  15. Canine distemper virus DNA vaccination of mink can overcome interference by maternal antibodies.

    Science.gov (United States)

    Jensen, Trine Hammer; Nielsen, Line; Aasted, Bent; Pertoldi, Cino; Blixenkrone-Møller, Merete

    2015-03-10

    Canine distemper virus (CDV) is highly contagious and can cause severe disease against which conventional live vaccines are ineffective in the presence of maternal antibodies. Vaccination in the presences of maternal antibodies was challenged by vaccination of 5 days old and 3 weeks old mink kits with CDV DNA vaccines. Virus neutralising (VN) antibody responses were induced in mink kits vaccinated with a plasmid encoding the haemaglutinin protein (H) of CDV (n=5, pCDV-H) or a combination of the H, fusion (F) and nucleoprotein (N) of CDV (n=5, pCDV-HFN). These DNA vaccinated kits were protected against virulent experimental infection with field strains of CDV. The pCDV-H was more efficient in inducing protective immunity in the presence of maternal antibodies compared to the pCDV-HFN. The results show that DNA vaccination with the pCDV-H or pCDV-HFN (n=4) only given once at 5 days of age induces virus specific immune response in neonatal mink and protection against virulent CDV exposure later in life. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. Strategies to enhance immunogenicity of cDNA vaccine encoded antigens by modulation of antigen processing

    NARCIS (Netherlands)

    Platteel, Anouk C M; Marit de Groot, A; Andersen, Peter; Ovaa, Huib; Kloetzel, Peter M; Mishto, Michele; Sijts, Alice J A M

    2016-01-01

    Most vaccines are based on protective humoral responses while for intracellular pathogens CD8(+) T cells are regularly needed to provide protection. However, poor processing efficiency of antigens is often a limiting factor in CD8(+) T cell priming, hampering vaccine efficacy. The multistage cDNA

  17. A Built-In CpG Adjuvant in RSV F Protein DNA Vaccine Drives a Th1 Polarized and Enhanced Protective Immune Response

    Directory of Open Access Journals (Sweden)

    Yao Ma

    2018-01-01

    Full Text Available Human respiratory syncytial virus (RSV is the most significant cause of acute lower respiratory infection in children. However, there is no licensed vaccine available. Here, we investigated the effect of five or 20 copies of C-Class of CpG ODN (CpG-C motif incorporated into a plasmid DNA vaccine encoding RSV fusion (F glycoprotein on the vaccine-induced immune response. The addition of CpG-C motif enhanced serum binding and virus-neutralizing antibody responses in BALB/c mice immunized with the DNA vaccines. Moreover, mice vaccinated with CpG-modified vaccines, especially with the higher 20 copies, resulted in an enhanced shift toward a Th1-biased antibody and T-cell response, a decrease in pulmonary pathology and virus replication, and a decrease in weight loss after RSV challenge. This study suggests that CpG-C motif, cloned into the backbone of DNA vaccine encoding RSV F glycoprotein, functions as a built-in adjuvant capable of improving the efficacy of DNA vaccine against RSV infection.

  18. The future of human DNA vaccines.

    Science.gov (United States)

    Li, Lei; Saade, Fadi; Petrovsky, Nikolai

    2012-12-31

    DNA vaccines have evolved greatly over the last 20 years since their invention, but have yet to become a competitive alternative to conventional protein or carbohydrate based human vaccines. Whilst safety concerns were an initial barrier, the Achilles heel of DNA vaccines remains their poor immunogenicity when compared to protein vaccines. A wide variety of strategies have been developed to optimize DNA vaccine immunogenicity, including codon optimization, genetic adjuvants, electroporation and sophisticated prime-boost regimens, with each of these methods having its advantages and limitations. Whilst each of these methods has contributed to incremental improvements in DNA vaccine efficacy, more is still needed if human DNA vaccines are to succeed commercially. This review foresees a final breakthrough in human DNA vaccines will come from application of the latest cutting-edge technologies, including "epigenetics" and "omics" approaches, alongside traditional techniques to improve immunogenicity such as adjuvants and electroporation, thereby overcoming the current limitations of DNA vaccines in humans. Copyright © 2012 Elsevier B.V. All rights reserved.

  19. Virus neutralizing antibody response in mice and dogs with a bicistronic DNA vaccine encoding rabies virus glycoprotein and canine parvovirus VP2.

    Science.gov (United States)

    Patial, Sonika; Chaturvedi, V K; Rai, A; Saini, M; Chandra, Rajesh; Saini, Y; Gupta, Praveen K

    2007-05-16

    A bicistronic DNA vaccine against rabies and parvovirus infection of dogs was developed by subcloning rabies glycoprotein and canine parvovirus (CPV) VP2 genes into a bicistronic vector. After characterizing the expression of both the proteins in vitro, the bicistronic DNA vaccine was injected in mice and induced immune response was compared with monocistronic DNA vaccines. There was no significant difference in ELISA and virus neutralizing (VN) antibody responses against rabies and CPV in mice immunized with either bicistronic or monocistronic DNA vaccine. Further, there was significantly similar protection in mice immunized with either bicistronic or monocistronic rabies DNA vaccine on rabies virus challenge. Similarly, dogs immunized with monocistronic and bicistronic DNA vaccines developed comparable VN antibodies against rabies and CPV. This study indicated that bicistronic DNA vaccine can be used in dogs to induce virus neutralizing immune responses against both rabies and CPV.

  20. Plasmid DNA initiates replication of yellow fever vaccine in vitro and elicits virus-specific immune response in mice.

    Science.gov (United States)

    Tretyakova, Irina; Nickols, Brian; Hidajat, Rachmat; Jokinen, Jenny; Lukashevich, Igor S; Pushko, Peter

    2014-11-01

    Yellow fever (YF) causes an acute hemorrhagic fever disease in tropical Africa and Latin America. To develop a novel experimental YF vaccine, we applied iDNA infectious clone technology. The iDNA represents plasmid that encodes the full-length RNA genome of 17D vaccine downstream from a cytomegalovirus (CMV) promoter. The vaccine was designed to transcribe the full-length viral RNA and to launch 17D vaccine virus in vitro and in vivo. Transfection with 10 ng of iDNA plasmid was sufficient to start replication of vaccine virus in vitro. Safety of the parental 17D and iDNA-derived 17D viruses was confirmed in AG129 mice deficient in receptors for IFN-α/β/γ. Finally, direct vaccination of BALB/c mice with a single 20 μg dose of iDNA plasmid resulted in seroconversion and elicitation of virus-specific neutralizing antibodies in animals. We conclude that iDNA immunization approach combines characteristics of DNA and attenuated vaccines and represents a promising vaccination strategy for YF. Copyright © 2014 Elsevier Inc. All rights reserved.

  1. Engineering nanoparticle-coated bacteria as oral DNA vaccines for cancer immunotherapy.

    Science.gov (United States)

    Hu, Qinglian; Wu, Min; Fang, Chun; Cheng, Changyong; Zhao, Mengmeng; Fang, Weihuan; Chu, Paul K; Ping, Yuan; Tang, Guping

    2015-04-08

    Live attenuated bacteria are of increasing importance in biotechnology and medicine in the emerging field of cancer immunotherapy. Oral DNA vaccination mediated by live attenuated bacteria often suffers from low infection efficiency due to various biological barriers during the infection process. To this end, we herein report, for the first time, a new strategy to engineer cationic nanoparticle-coated bacterial vectors that can efficiently deliver oral DNA vaccine for efficacious cancer immunotherapy. By coating live attenuated bacteria with synthetic nanoparticles self-assembled from cationic polymers and plasmid DNA, the protective nanoparticle coating layer is able to facilitate bacteria to effectively escape phagosomes, significantly enhance the acid tolerance of bacteria in stomach and intestines, and greatly promote dissemination of bacteria into blood circulation after oral administration. Most importantly, oral delivery of DNA vaccines encoding autologous vascular endothelial growth factor receptor 2 (VEGFR2) by this hybrid vector showed remarkable T cell activation and cytokine production. Successful inhibition of tumor growth was also achieved by efficient oral delivery of VEGFR2 with nanoparticle-coated bacterial vectors due to angiogenesis suppression in the tumor vasculature and tumor necrosis. This proof-of-concept work demonstrates that coating live bacterial cells with synthetic nanoparticles represents a promising strategy to engineer efficient and versatile DNA vaccines for the era of immunotherapy.

  2. Tailoring DNA vaccines: designing strategies against HER2 positive cancers

    Directory of Open Access Journals (Sweden)

    Cristina eMarchini

    2013-05-01

    Full Text Available The crucial role of HER2 in epithelial transformation and its selective overexpression on cancer tissues makes it an ideal target for cancer immunotherapies such as passive immunotherapy with Trastuzumab. There are, however, a number of concerns regarding the use of monoclonal antibodies which include resistance, repeated treatments, considerable costs and side effects that make active immunotherapies against HER2 desirable alternative approaches. The efficacy of anti-HER2 DNA vaccination has been widely demonstrated in transgenic cancer-prone mice, which recapitulate several features of human breast cancers. Nonetheless, the rational design of a cancer vaccine able to trigger a long lasting immunity, and thus prevent tumor recurrence in patients, would require the understanding of how tolerance and immunosuppression regulate antitumor immune responses and, at the same time, the identification of the most immunogenic portions of the target protein. We herein retrace the findings that led to our most promising DNA vaccines that, by encoding human/rat chimeric forms of HER2, are able to circumvent peripheral tolerance. Preclinical data obtained with these chimeric DNA vaccines have provided the rationale for their use in an ongoing phase I clinical trial (EudraCT 2011-001104-34.

  3. A Comparison of Red Fluorescent Proteins to Model DNA Vaccine Expression by Whole Animal In Vivo Imaging.

    Science.gov (United States)

    Kinnear, Ekaterina; Caproni, Lisa J; Tregoning, John S

    2015-01-01

    DNA vaccines can be manufactured cheaply, easily and rapidly and have performed well in pre-clinical animal studies. However, clinical trials have so far been disappointing, failing to evoke a strong immune response, possibly due to poor antigen expression. To improve antigen expression, improved technology to monitor DNA vaccine transfection efficiency is required. In the current study, we compared plasmid encoded tdTomato, mCherry, Katushka, tdKatushka2 and luciferase as reporter proteins for whole animal in vivo imaging. The intramuscular, subcutaneous and tattooing routes were compared and electroporation was used to enhance expression. We observed that overall, fluorescent proteins were not a good tool to assess expression from DNA plasmids, with a highly heterogeneous response between animals. Of the proteins used, intramuscular delivery of DNA encoding either tdTomato or luciferase gave the clearest signal, with some Katushka and tdKatushka2 signal observed. Subcutaneous delivery was weakly visible and nothing was observed following DNA tattooing. DNA encoding haemagglutinin was used to determine whether immune responses mirrored visible expression levels. A protective immune response against H1N1 influenza was induced by all routes, even after a single dose of DNA, though qualitative differences were observed, with tattooing leading to high antibody responses and subcutaneous DNA leading to high CD8 responses. We conclude that of the reporter proteins used, expression from DNA plasmids can best be assessed using tdTomato or luciferase. But, the disconnect between visible expression level and immunogenicity suggests that in vivo whole animal imaging of fluorescent proteins has limited utility for predicting DNA vaccine efficacy.

  4. Increased humoral immunity by DNA vaccination using an alpha-tocopherol-based adjuvant

    DEFF Research Database (Denmark)

    Karlsson, Ingrid; Borggren, Marie; Nielsen, Jens

    2017-01-01

    approaches. We tested whether the emulsion-based and alpha-tocopherol containing adjuvant Diluvac Forte® has the ability to enhance the immunogenicity of a naked DNA vaccine (i.e., plasmid DNA). As a model vaccine, we used plasmids encoding both a surface-exposed viral glycoprotein (hemagglutinin......) and an internal non-glycosylated nucleoprotein in the Th1/Th2 balanced CB6F1 mouse model. The naked DNA (50 µg) was premixed at a 1:1 volume/volume ratio with Diluvac Forte®, an emulsion containing different concentrations of alpha-tocopherol, the emulsion alone or endotoxin-free phosphate-buffered saline (PBS......). The animals received two intracutaneous immunizations spaced 3 weeks apart. When combined with Diluvac Forte® or the emulsion containing alpha-tocopherol, the DNA vaccine induced a more potent and balanced immunoglobulin G (IgG)1 and IgG2c response, and both IgG subclass responses were significantly enhanced...

  5. Plasmid DNA initiates replication of yellow fever vaccine in vitro and elicits virus-specific immune response in mice

    International Nuclear Information System (INIS)

    Tretyakova, Irina; Nickols, Brian; Hidajat, Rachmat; Jokinen, Jenny; Lukashevich, Igor S.; Pushko, Peter

    2014-01-01

    Yellow fever (YF) causes an acute hemorrhagic fever disease in tropical Africa and Latin America. To develop a novel experimental YF vaccine, we applied iDNA infectious clone technology. The iDNA represents plasmid that encodes the full-length RNA genome of 17D vaccine downstream from a cytomegalovirus (CMV) promoter. The vaccine was designed to transcribe the full-length viral RNA and to launch 17D vaccine virus in vitro and in vivo. Transfection with 10 ng of iDNA plasmid was sufficient to start replication of vaccine virus in vitro. Safety of the parental 17D and iDNA-derived 17D viruses was confirmed in AG129 mice deficient in receptors for IFN-α/β/γ. Finally, direct vaccination of BALB/c mice with a single 20 μg dose of iDNA plasmid resulted in seroconversion and elicitation of virus-specific neutralizing antibodies in animals. We conclude that iDNA immunization approach combines characteristics of DNA and attenuated vaccines and represents a promising vaccination strategy for YF. - Highlights: • The iDNA ® platform combines advantages of DNA and live attenuated vaccines. • Yellow fever (YF) 17D vaccine was launched from iDNA plasmid in vitro and in vivo. • Safety of iDNA-generated 17D virus was confirmed in AG129 mice. • BALB/c mice seroconverted after a single-dose vaccination with iDNA. • YF virus-neutralizing response was elicited in iDNA-vaccinated mice

  6. Plasmid DNA initiates replication of yellow fever vaccine in vitro and elicits virus-specific immune response in mice

    Energy Technology Data Exchange (ETDEWEB)

    Tretyakova, Irina; Nickols, Brian; Hidajat, Rachmat [Medigen, Inc., 8420 Gas House Pike, Suite S, Frederick, MD 21701 (United States); Jokinen, Jenny; Lukashevich, Igor S. [Department of Pharmacology and Toxicology, School of Medicine, Center for Predictive Medicine and Emerging Infectious Diseases, University of Louisville, Louisville, KY (United States); Pushko, Peter, E-mail: ppushko@medigen-usa.com [Medigen, Inc., 8420 Gas House Pike, Suite S, Frederick, MD 21701 (United States)

    2014-11-15

    Yellow fever (YF) causes an acute hemorrhagic fever disease in tropical Africa and Latin America. To develop a novel experimental YF vaccine, we applied iDNA infectious clone technology. The iDNA represents plasmid that encodes the full-length RNA genome of 17D vaccine downstream from a cytomegalovirus (CMV) promoter. The vaccine was designed to transcribe the full-length viral RNA and to launch 17D vaccine virus in vitro and in vivo. Transfection with 10 ng of iDNA plasmid was sufficient to start replication of vaccine virus in vitro. Safety of the parental 17D and iDNA-derived 17D viruses was confirmed in AG129 mice deficient in receptors for IFN-α/β/γ. Finally, direct vaccination of BALB/c mice with a single 20 μg dose of iDNA plasmid resulted in seroconversion and elicitation of virus-specific neutralizing antibodies in animals. We conclude that iDNA immunization approach combines characteristics of DNA and attenuated vaccines and represents a promising vaccination strategy for YF. - Highlights: • The iDNA{sup ®} platform combines advantages of DNA and live attenuated vaccines. • Yellow fever (YF) 17D vaccine was launched from iDNA plasmid in vitro and in vivo. • Safety of iDNA-generated 17D virus was confirmed in AG129 mice. • BALB/c mice seroconverted after a single-dose vaccination with iDNA. • YF virus-neutralizing response was elicited in iDNA-vaccinated mice.

  7. Can VHS virus bypass the protective immunity induced by DNA vaccination in rainbow trout?

    DEFF Research Database (Denmark)

    Sepúlveda, Dagoberto; Lorenzen, Niels

    2016-01-01

    DNA vaccines encoding viral glycoproteins have been very successful for induction of protective immunity against diseases caused by rhabdoviruses in cultured fish species. However, the vaccine concept is based on a single viral gene and since RNA viruses are known to possess high variability...... and adaptation capacity, this work aimed at evaluating whether viral haemorrhagic septicaemia virus (VHSV), an RNA virus and member of Rhabdoviridae family, was able to evade the protective immune response induced by the DNA vaccination of rainbow trout. The experiments comprised repeated passages of a highly...... pathogenic VHSV isolate in a fish cell line in the presence of neutralizing fish serum (in vitro approach), and in rainbow trout immunized with the VHS DNA vaccine (in vivo approach). For the in vitro approach, the virus collected from the last passage (passaged virus) was as sensitive as the parental virus...

  8. A DNA vaccine against yellow fever virus: development and evaluation.

    Directory of Open Access Journals (Sweden)

    Milton Maciel

    2015-04-01

    Full Text Available Attenuated yellow fever (YF virus 17D/17DD vaccines are the only available protection from YF infection, which remains a significant source of morbidity and mortality in the tropical areas of the world. The attenuated YF virus vaccine, which is used worldwide, generates both long-lasting neutralizing antibodies and strong T-cell responses. However, on rare occasions, this vaccine has toxic side effects that can be fatal. This study presents the design of two non-viral DNA-based antigen formulations and the characterization of their expression and immunological properties. The two antigen formulations consist of DNA encoding the full-length envelope protein (p/YFE or the full-length envelope protein fused to the lysosomal-associated membrane protein signal, LAMP-1 (pL/YFE, aimed at diverting antigen processing/presentation through the major histocompatibility complex II precursor compartments. The immune responses triggered by these formulations were evaluated in H2b and H2d backgrounds, corresponding to the C57Bl/6 and BALB/c mice strains, respectively. Both DNA constructs were able to induce very strong T-cell responses of similar magnitude against almost all epitopes that are also generated by the YF 17DD vaccine. The pL/YFE formulation performed best overall. In addition to the T-cell response, it was also able to stimulate high titers of anti-YF neutralizing antibodies comparable to the levels elicited by the 17DD vaccine. More importantly, the pL/YFE vaccine conferred 100% protection against the YF virus in intracerebrally challenged mice. These results indicate that pL/YFE DNA is an excellent vaccine candidate and should be considered for further developmental studies.

  9. A DNA vaccine against yellow fever virus: development and evaluation.

    Science.gov (United States)

    Maciel, Milton; Cruz, Fábia da Silva Pereira; Cordeiro, Marli Tenório; da Motta, Márcia Archer; Cassemiro, Klécia Marília Soares de Melo; Maia, Rita de Cássia Carvalho; de Figueiredo, Regina Célia Bressan Queiroz; Galler, Ricardo; Freire, Marcos da Silva; August, Joseph Thomas; Marques, Ernesto T A; Dhalia, Rafael

    2015-04-01

    Attenuated yellow fever (YF) virus 17D/17DD vaccines are the only available protection from YF infection, which remains a significant source of morbidity and mortality in the tropical areas of the world. The attenuated YF virus vaccine, which is used worldwide, generates both long-lasting neutralizing antibodies and strong T-cell responses. However, on rare occasions, this vaccine has toxic side effects that can be fatal. This study presents the design of two non-viral DNA-based antigen formulations and the characterization of their expression and immunological properties. The two antigen formulations consist of DNA encoding the full-length envelope protein (p/YFE) or the full-length envelope protein fused to the lysosomal-associated membrane protein signal, LAMP-1 (pL/YFE), aimed at diverting antigen processing/presentation through the major histocompatibility complex II precursor compartments. The immune responses triggered by these formulations were evaluated in H2b and H2d backgrounds, corresponding to the C57Bl/6 and BALB/c mice strains, respectively. Both DNA constructs were able to induce very strong T-cell responses of similar magnitude against almost all epitopes that are also generated by the YF 17DD vaccine. The pL/YFE formulation performed best overall. In addition to the T-cell response, it was also able to stimulate high titers of anti-YF neutralizing antibodies comparable to the levels elicited by the 17DD vaccine. More importantly, the pL/YFE vaccine conferred 100% protection against the YF virus in intracerebrally challenged mice. These results indicate that pL/YFE DNA is an excellent vaccine candidate and should be considered for further developmental studies.

  10. A DNA Vaccine against Yellow Fever Virus: Development and Evaluation

    Science.gov (United States)

    Maciel, Milton; Cruz, Fábia da Silva Pereira; Cordeiro, Marli Tenório; da Motta, Márcia Archer; Cassemiro, Klécia Marília Soares de Melo; Maia, Rita de Cássia Carvalho; de Figueiredo, Regina Célia Bressan Queiroz; Galler, Ricardo; Freire, Marcos da Silva; August, Joseph Thomas; Marques, Ernesto T. A.; Dhalia, Rafael

    2015-01-01

    Attenuated yellow fever (YF) virus 17D/17DD vaccines are the only available protection from YF infection, which remains a significant source of morbidity and mortality in the tropical areas of the world. The attenuated YF virus vaccine, which is used worldwide, generates both long-lasting neutralizing antibodies and strong T-cell responses. However, on rare occasions, this vaccine has toxic side effects that can be fatal. This study presents the design of two non-viral DNA-based antigen formulations and the characterization of their expression and immunological properties. The two antigen formulations consist of DNA encoding the full-length envelope protein (p/YFE) or the full-length envelope protein fused to the lysosomal-associated membrane protein signal, LAMP-1 (pL/YFE), aimed at diverting antigen processing/presentation through the major histocompatibility complex II precursor compartments. The immune responses triggered by these formulations were evaluated in H2b and H2d backgrounds, corresponding to the C57Bl/6 and BALB/c mice strains, respectively. Both DNA constructs were able to induce very strong T-cell responses of similar magnitude against almost all epitopes that are also generated by the YF 17DD vaccine. The pL/YFE formulation performed best overall. In addition to the T-cell response, it was also able to stimulate high titers of anti-YF neutralizing antibodies comparable to the levels elicited by the 17DD vaccine. More importantly, the pL/YFE vaccine conferred 100% protection against the YF virus in intracerebrally challenged mice. These results indicate that pL/YFE DNA is an excellent vaccine candidate and should be considered for further developmental studies. PMID:25875109

  11. An Oral DNA Vaccine Encoding Endoglin Eradicates Breast Tumors by Blocking Their Blood Supply

    National Research Council Canada - National Science Library

    Reisfeld, Ralph A

    2007-01-01

    In an effort to meet the urgent need for the development of novel and effective treatments for metastatic breast cancer, we developed and evaluated a novel, oral DNA vaccine targeting endoglin (CD105...

  12. DNA prime/Adenovirus boost malaria vaccine encoding P. falciparum CSP and AMA1 induces sterile protection associated with cell-mediated immunity.

    Directory of Open Access Journals (Sweden)

    Ilin Chuang

    Full Text Available BACKGROUND: Gene-based vaccination using prime/boost regimens protects animals and humans against malaria, inducing cell-mediated responses that in animal models target liver stage malaria parasites. We tested a DNA prime/adenovirus boost malaria vaccine in a Phase 1 clinical trial with controlled human malaria infection. METHODOLOGY/PRINCIPAL FINDINGS: The vaccine regimen was three monthly doses of two DNA plasmids (DNA followed four months later by a single boost with two non-replicating human serotype 5 adenovirus vectors (Ad. The constructs encoded genes expressing P. falciparum circumsporozoite protein (CSP and apical membrane antigen-1 (AMA1. The regimen was safe and well-tolerated, with mostly mild adverse events that occurred at the site of injection. Only one AE (diarrhea, possibly related to immunization, was severe (Grade 3, preventing daily activities. Four weeks after the Ad boost, 15 study subjects were challenged with P. falciparum sporozoites by mosquito bite, and four (27% were sterilely protected. Antibody responses by ELISA rose after Ad boost but were low (CSP geometric mean titer 210, range 44-817; AMA1 geometric mean micrograms/milliliter 11.9, range 1.5-102 and were not associated with protection. Ex vivo IFN-γ ELISpot responses after Ad boost were modest (CSP geometric mean spot forming cells/million peripheral blood mononuclear cells 86, range 13-408; AMA1 348, range 88-1270 and were highest in three protected subjects. ELISpot responses to AMA1 were significantly associated with protection (p = 0.019. Flow cytometry identified predominant IFN-γ mono-secreting CD8+ T cell responses in three protected subjects. No subjects with high pre-existing anti-Ad5 neutralizing antibodies were protected but the association was not statistically significant. SIGNIFICANCE: The DNA/Ad regimen provided the highest sterile immunity achieved against malaria following immunization with a gene-based subunit vaccine (27%. Protection

  13. DNA Vaccines

    Indian Academy of Sciences (India)

    diseases. Keywords. DNA vaccine, immune response, antibodies, infectious diseases. GENERAL .... tein vaccines require expensive virus/protein purification tech- niques as ... sphere continue to remain major health hazards in developing nations. ... significance since it can be produced at a very low cost and can be stored ...

  14. Early life DNA vaccination with the H gene of Canine distemper virus induces robust protection against distemper

    DEFF Research Database (Denmark)

    Jensen, Trine Hammer; Nielsen, Line; Aasted, Bent

    2009-01-01

    Young mink kits (n = 8)were vaccinated withDNA plasmids encoding the viral haemagglutinin protein (H) of a vaccine strain of Canine distemper virus (CDV). Virus neutralising (VN) antibodieswere induced after 2 immunisations and after the third immunisation all kits had high VN antibody titres...

  15. Incomplete effector/memory differentiation of antigen-primed CD8+ T cells in gene gun DNA-vaccinated mice

    DEFF Research Database (Denmark)

    Bartholdy, Christina; Stryhn, Anette; Hansen, Nils Jacob Vest

    2003-01-01

    DNA vaccination is an efficient way to induce CD8+ T cell memory, but it is still unclear to what extent such memory responses afford protection in vivo. To study this, we induced CD8+ memory responses directed towards defined viral epitopes, using DNA vaccines encoding immunodominant MHC class I......-restricted epitopes of lymphocytic choriomeningitis virus covalently linked to beta2-microglobulin. This vaccine construct primed for a stronger recall response than did a more conventional minigene construct. Despite this, vaccinated mice were only protected against systemic infection whereas protection against...... sites. Thus, our DNA vaccine induces a long-lived memory CD8+ T cell population that provides efficient protection against high-dose systemic infection. However, viral replication in solid non-lymphoid organs is not curtailed sufficiently fast to prevent significant virus-induced inflammation. Our...

  16. Multivalent HA DNA vaccination protects against highly pathogenic H5N1 avian influenza infection in chickens and mice.

    Directory of Open Access Journals (Sweden)

    Srinivas Rao

    Full Text Available Sustained outbreaks of highly pathogenic avian influenza (HPAI H5N1 in avian species increase the risk of reassortment and adaptation to humans. The ability to contain its spread in chickens would reduce this threat and help maintain the capacity for egg-based vaccine production. While vaccines offer the potential to control avian disease, a major concern of current vaccines is their potency and inability to protect against evolving avian influenza viruses.The ability of DNA vaccines encoding hemagglutinin (HA proteins from different HPAI H5N1 serotypes was evaluated for its ability to elicit neutralizing antibodies and to protect against homologous and heterologous HPAI H5N1 strain challenge in mice and chickens after DNA immunization by needle and syringe or with a pressure injection device. These vaccines elicited antibodies that neutralized multiple strains of HPAI H5N1 when given in combinations containing up to 10 HAs. The response was dose-dependent, and breadth was determined by the choice of the influenza virus HA in the vaccine. Monovalent and trivalent HA vaccines were tested first in mice and conferred protection against lethal H5N1 A/Vietnam/1203/2004 challenge 68 weeks after vaccination. In chickens, protection was observed against heterologous strains of HPAI H5N1 after vaccination with a trivalent H5 serotype DNA vaccine with doses as low as 5 microg DNA given twice either by intramuscular needle injection or with a needle-free device.DNA vaccines offer a generic approach to influenza virus immunization applicable to multiple animal species. In addition, the ability to substitute plasmids encoding different strains enables rapid adaptation of the vaccine to newly evolving field isolates.

  17. Superior induction of T cell responses to conserved HIV-1 regions by electroporated alphavirus replicon DNA compared to that with conventional plasmid DNA vaccine.

    Science.gov (United States)

    Knudsen, Maria L; Mbewe-Mvula, Alice; Rosario, Maximillian; Johansson, Daniel X; Kakoulidou, Maria; Bridgeman, Anne; Reyes-Sandoval, Arturo; Nicosia, Alfredo; Ljungberg, Karl; Hanke, Tomás; Liljeström, Peter

    2012-04-01

    Vaccination using "naked" DNA is a highly attractive strategy for induction of pathogen-specific immune responses; however, it has been only weakly immunogenic in humans. Previously, we constructed DNA-launched Semliki Forest virus replicons (DREP), which stimulate pattern recognition receptors and induce augmented immune responses. Also, in vivo electroporation was shown to enhance immune responses induced by conventional DNA vaccines. Here, we combine these two approaches and show that in vivo electroporation increases CD8(+) T cell responses induced by DREP and consequently decreases the DNA dose required to induce a response. The vaccines used in this study encode the multiclade HIV-1 T cell immunogen HIVconsv, which is currently being evaluated in clinical trials. Using intradermal delivery followed by electroporation, the DREP.HIVconsv DNA dose could be reduced to as low as 3.2 ng to elicit frequencies of HIV-1-specific CD8(+) T cells comparable to those induced by 1 μg of a conventional pTH.HIVconsv DNA vaccine, representing a 625-fold molar reduction in dose. Responses induced by both DREP.HIVconsv and pTH.HIVconsv were further increased by heterologous vaccine boosts employing modified vaccinia virus Ankara MVA.HIVconsv and attenuated chimpanzee adenovirus ChAdV63.HIVconsv. Using the same HIVconsv vaccines, the mouse observations were supported by an at least 20-fold-lower dose of DNA vaccine in rhesus macaques. These data point toward a strategy for overcoming the low immunogenicity of DNA vaccines in humans and strongly support further development of the DREP vaccine platform for clinical evaluation.

  18. Immunity induced shortly after DNA vaccination of rainbow trout against rhabdoviruses protects against heterologous virus but not against bacterial pathogens

    DEFF Research Database (Denmark)

    Lorenzen, Niels; Lorenzen, Ellen; Einer-Jensen, Katja

    2002-01-01

    whereas no increased survival was found upon challenge with bacterial pathogens. Within two months after vaccination, the cross-protection disappeared while the specific immunity to homologous virus remained high. The early immunity induced by the DNA vaccines thus appeared to involve short-lived non......It was recently reported that DNA vaccination of rainbow trout fingerlings against viral hemorrhagic septicaemia virus (VHSV) induced protection within 8 days after intramuscular injection of plasmid DNA. In order to analyse the specificity of this early immunity, fish were vaccinated with plasmid...... DNA encoding the VHSV or the infectious haematopoietic necrosis virus (IHNV) glycoprotein genes and later challenged with homologous or heterologous pathogens. Challenge experiments revealed that immunity established shortly after vaccination was cross-protective between the two viral pathogens...

  19. DNA vaccination protects mice against Zika virus-induced damage to the testes

    Science.gov (United States)

    Griffin, Bryan D.; Muthumani, Kar; Warner, Bryce M.; Majer, Anna; Hagan, Mable; Audet, Jonathan; Stein, Derek R.; Ranadheera, Charlene; Racine, Trina; De La Vega, Marc-Antoine; Piret, Jocelyne; Kucas, Stephanie; Tran, Kaylie N.; Frost, Kathy L.; De Graff, Christine; Soule, Geoff; Scharikow, Leanne; Scott, Jennifer; McTavish, Gordon; Smid, Valerie; Park, Young K.; Maslow, Joel N.; Sardesai, Niranjan Y.; Kim, J. Joseph; Yao, Xiao-jian; Bello, Alexander; Lindsay, Robbin; Boivin, Guy; Booth, Stephanie A.; Kobasa, Darwyn; Embury-Hyatt, Carissa; Safronetz, David; Weiner, David B.; Kobinger, Gary P.

    2017-01-01

    Zika virus (ZIKV) is an emerging pathogen causally associated with serious sequelae in fetuses, inducing fetal microcephaly and other neurodevelopment defects. ZIKV is primarily transmitted by mosquitoes, but can persist in human semen and sperm, and sexual transmission has been documented. Moreover, exposure of type-I interferon knockout mice to ZIKV results in severe damage to the testes, epididymis and sperm. Candidate ZIKV vaccines have shown protective efficacy in preclinical studies carried out in animal models, and several vaccines have entered clinical trials. Here, we report that administration of a synthetic DNA vaccine encoding ZIKV pre-membrane and envelope (prME) completely protects mice against ZIKV-associated damage to the testes and sperm and prevents viral persistence in the testes following challenge with a contemporary strain of ZIKV. These data suggest that DNA vaccination merits further investigation as a potential means to reduce ZIKV persistence in the male reproductive tract. PMID:28589934

  20. New vaccine strategies against enterotoxigenic Escherichia coli: II: Enhanced systemic and secreted antibody responses against the CFA/I fimbriae by priming with DNA and boosting with a live recombinant Salmonella vaccine

    Directory of Open Access Journals (Sweden)

    M.O. Lásaro

    1999-02-01

    Full Text Available The induction of systemic (IgG and mucosal (IgA antibody responses against the colonization factor I antigen (CFA/I of enterotoxigenic Escherichia coli (ETEC was evaluated in mice primed with an intramuscularly delivered CFA/I-encoding DNA vaccine followed by two oral immunizations with a live recombinant Salmonella typhimurium vaccine strain expressing the ETEC antigen. The booster effect induced by the oral immunization was detected two weeks and one year after the administration of the DNA vaccine. The DNA-primed/Salmonella-boosted vaccination regime showed a synergistic effect on the induced CFA/I-specific systemic and secreted antibody levels which could not be attained by either immunization strategy alone. These results suggest that the combined use of DNA vaccines and recombinant Salmonella vaccine strains can be a useful immunization strategy against enteric pathogens.

  1. A novel DNA vaccine technology conveying protection against a lethal herpes simplex viral challenge in mice.

    Directory of Open Access Journals (Sweden)

    Julie L Dutton

    Full Text Available While there are a number of licensed veterinary DNA vaccines, to date, none have been licensed for use in humans. Here, we demonstrate that a novel technology designed to enhance the immunogenicity of DNA vaccines protects against lethal herpes simplex virus 2 (HSV-2 challenge in a murine model. Polynucleotides were modified by use of a codon optimization algorithm designed to enhance immune responses, and the addition of an ubiquitin-encoding sequence to target the antigen to the proteasome for processing and to enhance cytotoxic T cell responses. We show that a mixture of these codon-optimized ubiquitinated and non-ubiquitinated constructs encoding the same viral envelope protein, glycoprotein D, induced both B and T cell responses, and could protect against lethal viral challenge and reduce ganglionic latency. The optimized vaccines, subcloned into a vector suitable for use in humans, also provided a high level of protection against the establishment of ganglionic latency, an important correlate of HSV reactivation and candidate endpoint for vaccines to proceed to clinical trials.

  2. Safety and Immunogenicity of an Anti-Zika Virus DNA Vaccine - Preliminary Report.

    Science.gov (United States)

    Tebas, Pablo; Roberts, Christine C; Muthumani, Kar; Reuschel, Emma L; Kudchodkar, Sagar B; Zaidi, Faraz I; White, Scott; Khan, Amir S; Racine, Trina; Choi, Hyeree; Boyer, Jean; Park, Young K; Trottier, Sylvie; Remigio, Celine; Krieger, Diane; Spruill, Susan E; Bagarazzi, Mark; Kobinger, Gary P; Weiner, David B; Maslow, Joel N

    2017-10-04

    Background Although Zika virus (ZIKV) infection is typically self-limiting, other associated complications such as congenital birth defects and the Guillain-Barré syndrome are well described. There are no approved vaccines against ZIKV infection. Methods In this phase 1, open-label clinical trial, we evaluated the safety and immunogenicity of a synthetic, consensus DNA vaccine (GLS-5700) encoding the ZIKV premembrane and envelope proteins in two groups of 20 participants each. The participants received either 1 mg or 2 mg of vaccine intradermally, with each injection followed by electroporation (the use of a pulsed electric field to introduce the DNA sequence into cells) at baseline, 4 weeks, and 12 weeks. Results The median age of the participants was 38 years, and 60% were women; 78% were white, and 22% black; in addition, 30% were Hispanic. At the interim analysis at 14 weeks (i.e., after the third dose of vaccine), no serious adverse events were reported. Local reactions at the vaccination site (e.g., injection-site pain, redness, swelling, and itching) occurred in approximately 50% of the participants. After the third dose of vaccine, binding antibodies (as measured on enzyme-linked immunosorbent assay) were detected in all the participants, with geometric mean titers of 1642 and 2871 in recipients of 1 mg and 2 mg of vaccine, respectively. Neutralizing antibodies developed in 62% of the samples on Vero-cell assay. On neuronal-cell assay, there was 90% inhibition of ZIKV infection in 70% of the serum samples and 50% inhibition in 95% of the samples. The intraperitoneal injection of postvaccination serum protected 103 of 112 IFNAR knockout mice (bred with deletion of genes encoding interferon-α and interferon-β receptors) (92%) that were challenged with a lethal dose of ZIKV-PR209 strain; none of the mice receiving baseline serum survived the challenge. Survival was independent of the neutralization titer. Conclusions In this phase 1, open-label clinical

  3. Enhancement of immune response induced by DNA vaccine cocktail expressing complete LACK and TSA genes against Leishmania major.

    Science.gov (United States)

    Ghaffarifar, Fatemeh; Jorjani, Ogholniaz; Sharifi, Zohreh; Dalimi, Abdolhossein; Hassan, Zuhair M; Tabatabaie, Fatemeh; Khoshzaban, Fariba; Hezarjaribi, Hajar Ziaei

    2013-04-01

    Leishmaniasis is an important disease in humans. Leishmania homologue of receptor for Activated C Kinase (LACK) and thiol specific antioxidant (TSA) as immuno-dominant antigens of Leishmania major are considered the most promising molecules for a DNA vaccine. We constructed a DNA cocktail, containing plasmids encoding LACK and TSA genes of Leishmania major and evaluated the immune response and survival rate in BALB/c mice. IgG and Interferon gamma values were noticeably increased in the immunized group with DNA cocktail vaccine, which were significantly higher than those in the single-gene vaccinated and control groups (p 0.05). The immunized mice with the cocktail DNA vaccine presented a considerable reduction in diameter of lesion compared to other groups and a significant difference was observed (p < 0.05) in this regard. The survival time of the immunized mice with the cocktail DNA vaccine was significantly higher than that in the other groups (p < 0.05) after their being challenged with Leishmania major. The findings of this study indicated that the cocktail DNA vaccine increased the cellular response and survival rate and induced protection against infection with Leishmania in the mice. © 2012 The Authors © 2012 APMIS.

  4. A BCR/ABL-hIL-2 DNA Vaccine Enhances the Immune Responses in BALB/c Mice

    Directory of Open Access Journals (Sweden)

    Yanan Qin

    2013-01-01

    Full Text Available The use of a DNA vaccine encoding the BCR/ABL fusion gene is thought to be a promising approach for patients with chronic myeloid leukemia (CML to eradicate minimal residual disease after treatment with chemotherapy or targeted therapy. In this study, our strategy employs genetic technology to create a DNA vaccine encoding the BCR/ABL fusion and human interleukin-2 (hIL-2 genes. The successfully constructed plasmids BCR/ABL-pIRES-hIL-2, BCR/ABL-pIRES, and pIRES-hIL-2 were delivered intramuscularly to BALB/c mice at 14-day intervals for three cycles. The transcription and expression of the BCR/ABL and hIL-2 genes were found in the injected muscle tissues. The interferon-γ (IFN-γ serum levels were increased, and the splenic CD4+/CD8+ T cell ratio was significantly decreased in the BCR/ABL-pIRES-hIL-2-injected mice. Furthermore, specific antibodies against K562 cells could be detected by indirect immunofluorescence. These results indicate that a DNA vaccine containing BCR/ABL and hIL-2 together may elicit increased in vivo humoral and cellular immune responses in BALB/c mice.

  5. Can VHS Virus Bypass the Protective Immunity Induced by DNA Vaccination in Rainbow Trout?

    Directory of Open Access Journals (Sweden)

    Dagoberto Sepúlveda

    Full Text Available DNA vaccines encoding viral glycoproteins have been very successful for induction of protective immunity against diseases caused by rhabdoviruses in cultured fish species. However, the vaccine concept is based on a single viral gene and since RNA viruses are known to possess high variability and adaptation capacity, this work aimed at evaluating whether viral haemorrhagic septicaemia virus (VHSV, an RNA virus and member of Rhabdoviridae family, was able to evade the protective immune response induced by the DNA vaccination of rainbow trout. The experiments comprised repeated passages of a highly pathogenic VHSV isolate in a fish cell line in the presence of neutralizing fish serum (in vitro approach, and in rainbow trout immunized with the VHS DNA vaccine (in vivo approach. For the in vitro approach, the virus collected from the last passage (passaged virus was as sensitive as the parental virus to serum neutralization, suggesting that the passaging did not promote the selection of virus populations able to bypass the neutralization by serum antibodies. Also, in the in vivo approach, where virus was passaged several times in vaccinated fish, no increased virulence nor increased persistence in vaccinated fish was observed in comparison with the parental virus. However, some of the vaccinated fish did get infected and could transmit the infection to naïve cohabitant fish. The results demonstrated that the DNA vaccine induced a robust protection, but also that the immunity was non-sterile. It is consequently important not to consider vaccinated fish as virus free in veterinary terms.

  6. On the efficacy of malaria DNA vaccination with magnetic gene vectors.

    Science.gov (United States)

    Nawwab Al-Deen, Fatin; Ma, Charles; Xiang, Sue D; Selomulya, Cordelia; Plebanski, Magdalena; Coppel, Ross L

    2013-05-28

    We investigated the efficacy and types of immune responses from plasmid malaria DNA vaccine encoding VR1020-PyMSP119 condensed on the surface of polyethyleneimine (PEI)-coated SPIONs. In vivo mouse studies were done firstly to determine the optimum magnetic vector composition, and then to observe immune responses elicited when magnetic vectors were introduced via different administration routes. Higher serum antibody titers against PyMSP119 were observed with intraperitoneal and intramuscular injections than subcutaneous and intradermal injections. Robust IgG2a and IgG1 responses were observed for intraperitoneal administration, which could be due to the physiology of peritoneum as a major reservoir of macrophages and dendritic cells. Heterologous DNA prime followed by single protein boost vaccination regime also enhanced IgG2a, IgG1, and IgG2b responses, indicating the induction of appropriate memory immunity that can be elicited by protein on recall. These outcomes support the possibility to design superparamagnetic nanoparticle-based DNA vaccines to optimally evoke desired antibody responses, useful for a variety of diseases including malaria. Copyright © 2013 Elsevier B.V. All rights reserved.

  7. Interference of an ERM-vaccine with a VHS-DNA vaccine in rainbow trout

    DEFF Research Database (Denmark)

    Lorenzen, Ellen; Einer-Jensen, Katja; Rasmussen, Jesper Skou

    Simultaneous vaccination of fish against several diseases is often desirable in order to minimise cost and handling of the fish. Intramuscular DNA-vaccination of rainbow trout against viral haemorrhagic septicaemia virus (VHSV) has proved to provide very good protection. However, preliminary...... results showed that intraperitoneal injection of a commercial vaccine against Enteric Redmouth Disease (ERM) based on formalin-killed bacteria in oil adjuvant immediately followed by intramuscular injection of an experimental DNA-vaccine against VHSV, decreased the protective effect of the DNA......-vaccine against challenge with VHSV 11 weeks post vaccination (pv). This experiment was performed with rainbow trout of 30 g injected with 0.5 g VHS-DNA vaccine. The experiment was later repeated with smaller fish (2.5g) and using two different doses of DNA-vaccine, 1 g and 0.05 g. Both doses provided good...

  8. Design of different strategies of multivalent DNA-based vaccination against rabies and canine distemper in mice and dogs

    Directory of Open Access Journals (Sweden)

    Touihri Leila

    2012-12-01

    Full Text Available Abstract Background During the vaccination campaigns, puppies younger than 3 months old are not targeted and remain unvaccinated for at least the first year of their lives. Almost half of the reported rabid dogs are 6 months or younger. Hence, we should recommend the vaccination against rabies of young puppies. Unfortunately, owing to the exposure of puppies to infections with either canine parvovirus (CPV or distemper virus (CDV after the intervention of the vaccinators, owners are reluctant to vaccinate puppies against rabies. Therefore, it is necessary to include the CPV and CDV valences in the vaccine against rabies. Multivalent DNA-based vaccination in dogs, including rabies and distemper valences, could help in raising vaccine coverage. Methods We have designed monovalent and multivalent DNA-based vaccine candidates for in vitro and in vivo assays. These plasmids encode to the rabies virus glycoprotein and/or the canine distemper virus hemagglutinin. The first strategy of multivalent DNA-based vaccination is by mixing plasmids encoding to a single antigen each. The second is by simply fusing the genes of the antigens together. The third is by adding the foot and mouth disease virus (FMDV 2A oligopeptide gene into the antigen genes. The last strategy is by the design and use of a bicistronic plasmid with an “Internal Ribosome Entry Site” (IRES domain. Results The monovalent construct against canine distemper was efficiently validated by inducing higher humoral immune responses compared to cell-culture-derived vaccine both in mice and dogs. All multivalent plasmids efficiently expressed both valences after in vitro transfection of BHK-21 cells. In BALB/c mice, the bicistronic IRES-dependant construct was the most efficient inducer of virus-neutralizing antibodies against both valences. It was able to induce better humoral immune responses compared to the administration of either cell-culture-derived vaccines or monovalent plasmids. The

  9. Design of different strategies of multivalent DNA-based vaccination against rabies and canine distemper in mice and dogs.

    Science.gov (United States)

    Touihri, Leila; Ahmed, Sami Belhaj; Chtourou, Yacine; Daoud, Rahma; Bahloul, Chokri

    2012-12-27

    During the vaccination campaigns, puppies younger than 3 months old are not targeted and remain unvaccinated for at least the first year of their lives. Almost half of the reported rabid dogs are 6 months or younger. Hence, we should recommend the vaccination against rabies of young puppies. Unfortunately, owing to the exposure of puppies to infections with either canine parvovirus (CPV) or distemper virus (CDV) after the intervention of the vaccinators, owners are reluctant to vaccinate puppies against rabies. Therefore, it is necessary to include the CPV and CDV valences in the vaccine against rabies. Multivalent DNA-based vaccination in dogs, including rabies and distemper valences, could help in raising vaccine coverage. We have designed monovalent and multivalent DNA-based vaccine candidates for in vitro and in vivo assays. These plasmids encode to the rabies virus glycoprotein and/or the canine distemper virus hemagglutinin. The first strategy of multivalent DNA-based vaccination is by mixing plasmids encoding to a single antigen each. The second is by simply fusing the genes of the antigens together. The third is by adding the foot and mouth disease virus (FMDV) 2A oligopeptide gene into the antigen genes. The last strategy is by the design and use of a bicistronic plasmid with an "Internal Ribosome Entry Site" (IRES) domain. The monovalent construct against canine distemper was efficiently validated by inducing higher humoral immune responses compared to cell-culture-derived vaccine both in mice and dogs. All multivalent plasmids efficiently expressed both valences after in vitro transfection of BHK-21 cells. In BALB/c mice, the bicistronic IRES-dependant construct was the most efficient inducer of virus-neutralizing antibodies against both valences. It was able to induce better humoral immune responses compared to the administration of either cell-culture-derived vaccines or monovalent plasmids. The FMDV 2A was also efficient in the design of multivalent

  10. Vector optimization and needle-free intradermal application of a broadly protective polyvalent influenza A DNA vaccine for pigs and humans

    DEFF Research Database (Denmark)

    Borggren, Marie; Nielsen, Jens; Bragstad, Karoline

    2015-01-01

    such as the induction of cellular and humoral immunity, inherent safety and rapid production time. We have previously developed a DNA vaccine encoding selected influenza proteins of pandemic origin and demonstrated broad protective immune responses in ferrets and pigs. In this study, we evaluated our DNA vaccine......The threat posed by the 2009 pandemic H1N1 virus emphasized the need for new influenza A virus vaccines inducing a broad cross-protective immune response for use in both humans and pigs. An effective and broad influenza vaccine for pigs would greatly benefit the pork industry and contribute...... to public health by diminishing the risk of emerging highly pathogenic reassortants. Current inactivated protein vaccines against swine influenza produce only short-lived immunity and have no efficacy against heterologous strains. DNA vaccines are a potential alternative with advantages...

  11. Polymer multilayer tattooing for enhanced DNA vaccination

    Science.gov (United States)

    Demuth, Peter C.; Min, Younjin; Huang, Bonnie; Kramer, Joshua A.; Miller, Andrew D.; Barouch, Dan H.; Hammond, Paula T.; Irvine, Darrell J.

    2013-04-01

    DNA vaccines have many potential benefits but have failed to generate robust immune responses in humans. Recently, methods such as in vivo electroporation have demonstrated improved performance, but an optimal strategy for safe, reproducible, and pain-free DNA vaccination remains elusive. Here we report an approach for rapid implantation of vaccine-loaded polymer films carrying DNA, immune-stimulatory RNA, and biodegradable polycations into the immune-cell-rich epidermis, using microneedles coated with releasable polyelectrolyte multilayers. Films transferred into the skin following brief microneedle application promoted local transfection and controlled the persistence of DNA and adjuvants in the skin from days to weeks, with kinetics determined by the film composition. These ‘multilayer tattoo’ DNA vaccines induced immune responses against a model HIV antigen comparable to electroporation in mice, enhanced memory T-cell generation, and elicited 140-fold higher gene expression in non-human primate skin than intradermal DNA injection, indicating the potential of this strategy for enhancing DNA vaccination.

  12. Polymer multilayer tattooing for enhanced DNA vaccination

    Science.gov (United States)

    DeMuth, Peter C.; Min, Younjin; Huang, Bonnie; Kramer, Joshua A.; Miller, Andrew D.; Barouch, Dan H.; Hammond, Paula T.; Irvine, Darrell J.

    2014-01-01

    DNA vaccines have many potential benefits but have failed to generate robust immune responses in humans. Recently, methods such as in vivo electroporation have demonstrated improved performance, but an optimal strategy for safe, reproducible, and pain-free DNA vaccination remains elusive. Here we report an approach for rapid implantation of vaccine-loaded polymer films carrying DNA, immune-stimulatory RNA, and biodegradable polycations into the immune-cell-rich epidermis, using microneedles coated with releasable polyelectrolyte multilayers. Films transferred into the skin following brief microneedle application promoted local transfection and controlled the persistence of DNA and adjuvants in the skin from days to weeks, with kinetics determined by the film composition. These “multilayer tattoo” DNA vaccines induced immune responses against a model HIV antigen comparable to electroporation in mice, enhanced memory T-cell generation, and elicited 140-fold higher gene expression in non-human primate skin than intradermal DNA injection, indicating the potential of this strategy for enhancing DNA vaccination. PMID:23353628

  13. Self-Assembly DNA Polyplex Vaccine inside Dissolving Microneedles for High-Potency Intradermal Vaccination

    Science.gov (United States)

    Liao, Jing-Fong; Lee, Jin-Ching; Lin, Chun-Kuang; Wei, Kuo-Chen; Chen, Pin-Yuan; Yang, Hung-Wei

    2017-01-01

    The strong immunogenicity induction is the powerful weapon to prevent the virus infections. This study demonstrated that one-step synthesis of DNA polyplex vaccine in microneedle (MN) patches can induce high immunogenicity through intradermal vaccination and increase the vaccine stability for storage outside the cold chain. More negative charged DNA vaccine was entrapped into the needle region of MNs followed by DNA polyplex formation with branched polyethylenimine (bPEI) pre-coated in the cavities of polydimethylsiloxane (PDMS) molds that can deliver more DNA vaccine to immune-cell rich epidermis with high transfection efficiency. Our data in this study support the safety and immunogenicity of the MN-based vaccine; the MN patch delivery system induced an immune response 3.5-fold as strong as seen with conventional intramuscular administration; the DNA polyplex formulation provided excellent vaccine stability at high temperature (could be stored at 45ºC for at least 4 months); the DNA vaccine is expected to be manufactured at low cost and not generate sharps waste. We think this study is significant to public health because there is a pressing need for an effective vaccination in developing countries. PMID:28819449

  14. Antiangiogenic immunotherapy targeting Flk-1, DNA vaccine and adoptive T cell transfer, inhibits ocular neovascularization

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Han [Department of Ophthalmology, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-Ku, Fukuoka 812-8582 (Japan); Sonoda, Koh-Hei, E-mail: sonodak@med.kyushu-u.ac.jp [Department of Ophthalmology, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-Ku, Fukuoka 812-8582 (Japan); Hijioka, Kuniaki; Qiao, Hong; Oshima, Yuji; Ishibashi, Tatsuro [Department of Ophthalmology, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-Ku, Fukuoka 812-8582 (Japan)

    2009-04-17

    Ocular neovascularization (NV) is the primary cause of blindness in a wide range of ocular diseases. The exact mechanism underlying the pathogenesis of ocular NV is not yet well understood, and so there is no satisfactory therapy for ocular NV. Here, we describe a strategy targeting Flk-1, a self-antigen overexpressed on proliferating endothelial cells in ocular NV, by antiangiogenic immunotherapy-DNA vaccine and adoptive T cell therapy. An oral DNA vaccine encoding Flk-1 carried by attenuated Salmonella typhimurium markedly suppressed development of laser-induced choroidal NV. We further demonstrated that adoptive transfer of vaccine-induced CD8{sup +} T cells reduced pathological preretinal NV, with a concomitant facilitation of physiological revascularization after oxygen-induced retinal vessel obliteration. However, physiological retinal vascular development was unaffected in neonatal mice transferred with vaccine-induced CD8{sup +} T cells. These findings suggested that antiangiogenic immunotherapy targeting Flk-1 such as vaccination and adoptive immunotherapy may contribute to future therapies for ocular NV.

  15. Antiangiogenic immunotherapy targeting Flk-1, DNA vaccine and adoptive T cell transfer, inhibits ocular neovascularization

    International Nuclear Information System (INIS)

    Zhang, Han; Sonoda, Koh-Hei; Hijioka, Kuniaki; Qiao, Hong; Oshima, Yuji; Ishibashi, Tatsuro

    2009-01-01

    Ocular neovascularization (NV) is the primary cause of blindness in a wide range of ocular diseases. The exact mechanism underlying the pathogenesis of ocular NV is not yet well understood, and so there is no satisfactory therapy for ocular NV. Here, we describe a strategy targeting Flk-1, a self-antigen overexpressed on proliferating endothelial cells in ocular NV, by antiangiogenic immunotherapy-DNA vaccine and adoptive T cell therapy. An oral DNA vaccine encoding Flk-1 carried by attenuated Salmonella typhimurium markedly suppressed development of laser-induced choroidal NV. We further demonstrated that adoptive transfer of vaccine-induced CD8 + T cells reduced pathological preretinal NV, with a concomitant facilitation of physiological revascularization after oxygen-induced retinal vessel obliteration. However, physiological retinal vascular development was unaffected in neonatal mice transferred with vaccine-induced CD8 + T cells. These findings suggested that antiangiogenic immunotherapy targeting Flk-1 such as vaccination and adoptive immunotherapy may contribute to future therapies for ocular NV.

  16. Protective immunity and lack of histopathological damage two years after DNA vaccination against infectious hematopoietic necrosis virus in trout

    Science.gov (United States)

    Kurath, Gael; Garver, Kyle A.; Corbeil, Serge; Elliott, Diane G.; Anderson, Eric D.; LaPatra, Scott E.

    2006-01-01

    The DNA vaccine pIHNw-G encodes the glycoprotein of the fish rhabdovirus infectious hematopoietic necrosis virus (IHNV). Vaccine performance in rainbow trout was measured 3, 6, 13, 24, and 25 months after vaccination. At three months all fish vaccinated with 0.1 μg pIHNw-G had detectable neutralizing antibody (NAb) and they were completely protected from lethal IHNV challenge with a relative percent survival (RPS) of 100% compared to control fish. Viral challenges at 6, 13, 24, and 25 months post-vaccination showed protection with RPS values of 47–69%, while NAb seroprevalence declined to undetectable levels. Passive transfer experiments with sera from fish after two years post-vaccination were inconsistent but significant protection was observed in some cases. The long-term duration of protection observed here defined a third temporal phase in the immune response to IHNV DNA vaccination, characterized by reduced but significant levels of protection, and decline or absence of detectable NAb titers. Examination of multiple tissues showed an absence of detectable long-term histopathological damage due to DNA vaccination.

  17. DNA vaccine encoding myristoylated membrane protein (MMP) of rock bream iridovirus (RBIV) induces protective immunity in rock bream (Oplegnathus fasciatus).

    Science.gov (United States)

    Jung, Myung-Hwa; Nikapitiya, Chamilani; Jung, Sung-Ju

    2018-02-01

    Rock bream iridovirus (RBIV) causes severe mass mortalities in rock bream (Oplegnathus fasciatus) in Korea. In this study, we investigated the potential of viral membrane protein to induce antiviral status protecting rock bream against RBIV infection. We found that fish administered with ORF008L (myristoylated membrane protein, MMP) vaccine exhibited significantly higher levels of survival compared to ORF007L (major capsid protein, MCP). Moreover, ORF008L-based DNA vaccinated fish showed significant protection at 4 and 8 weeks post vaccination (wpv) than non-vaccinated fish after infected with RBIV (6.7 × 10 5 ) at 23 °C, with relative percent survival (RPS) of 73.36% and 46.72%, respectively. All of the survivors from the first RBIV infection were strongly protected (100% RPS) from re-infected with RBIV (1.1 × 10 7 ) at 100 dpi. In addition, the MMP (ORF008L)-based DNA vaccine significantly induced the gene expression of TLR3 (14.2-fold), MyD88 (11.6-fold), Mx (84.7-fold), ISG15 (8.7-fold), PKR (25.6-fold), MHC class I (13.3-fold), Fas (6.7-fold), Fas ligand (6.7-fold), caspase9 (17.0-fold) and caspase3 (15.3-fold) at 7 days post vaccination in the muscle (vaccine injection site). Our results showed the induction of immune responses and suggest the possibility of developing preventive measures against RBIV using myristoylated membrane protein-based DNA vaccine. Copyright © 2018 Elsevier Ltd. All rights reserved.

  18. Long-Term Reduction of High Blood Pressure by Angiotensin II DNA Vaccine in Spontaneously Hypertensive Rats.

    Science.gov (United States)

    Koriyama, Hiroshi; Nakagami, Hironori; Nakagami, Futoshi; Osako, Mariana Kiomy; Kyutoku, Mariko; Shimamura, Munehisa; Kurinami, Hitomi; Katsuya, Tomohiro; Rakugi, Hiromi; Morishita, Ryuichi

    2015-07-01

    Recent research on vaccination has extended its scope from infectious diseases to chronic diseases, including Alzheimer disease, dyslipidemia, and hypertension. The aim of this study was to design DNA vaccines for high blood pressure and eventually develop human vaccine therapy to treat hypertension. Plasmid vector encoding hepatitis B core-angiotensin II (Ang II) fusion protein was injected into spontaneously hypertensive rats using needleless injection system. Anti-Ang II antibody was successfully produced in hepatitis B core-Ang II group, and antibody response against Ang II was sustained for at least 6 months. Systolic blood pressure was consistently lower in hepatitis B core-Ang II group after immunization, whereas blood pressure reduction was continued for at least 6 months. Perivascular fibrosis in heart tissue was also significantly decreased in hepatitis B core-Ang II group. Survival rate was significantly improved in hepatitis B core-Ang II group. This study demonstrated that Ang II DNA vaccine to spontaneously hypertensive rats significantly lowered high blood pressure for at least 6 months. In addition, Ang II DNA vaccines induced an adequate humoral immune response while avoiding the activation of self-reactive T cells, assessed by ELISPOT assay. Future development of DNA vaccine to treat hypertension may provide a new therapeutic option to treat hypertension. © 2015 American Heart Association, Inc.

  19. Investigation of DNA Integration into Reproductive Organs Following Intramuscular Injection of DNA in Mice

    Directory of Open Access Journals (Sweden)

    Fatemeh Vahedi

    2012-10-01

    Full Text Available Background: DNA immunization with plasmid DNA encoding bacterial, viral, parasitic, and tumor antigens has been reported to trigger protective immunity. The use of plasmid DNA vaccinations against many diseases has produced promising results in animal and human clinical trials; however, safety concerns about the use of DNA vaccines exist, such as the possibility of integration into the host genome, and elicitation of adverse immune responses. Methods: In this study, we examined the potential integration and bio-distribution of pcDNA3.1+PA, a new vaccine candidate with GenBank accession # EF550208, encoding the PA63 gene, in reproductive organs of mice; ovaries and uterus in female, and testis in male. Animals of both sexes were injected intramuscularly with pcDNA3.1+PA. Host genome integration and tissue distribution were examined using PCR and RT-PCR two times monthly for six months. Results: RT-PCR confirmed that pcDNA3.1+PA was not integrated into the host genome and did not enter reproductive organs. Conclusions: This finding has important implications for the use of pcDNA3.1+PA plasmid as a vaccine and opens new perspectives in the DNA vaccine area.

  20. [Therapeutic effect of a novel recombinant vaccine encoding chicken collagen type II procollagen gene on collagen-induced arthritis in rat].

    Science.gov (United States)

    Song, Xin-qiang; Luo, Yuan; Wang, Dan; Liu, Shu-guang; Liu, Jin-feng; Yuan, Fang; Xue, Hong; Liu, Nan; Liang, Fei; Sun, Yu-ying; Xi, Yong-zhi

    2006-08-08

    To investigate the therapeutic effect of gene vaccine encoding chicken collagen type II (CC II) on collagen-induced arthritis (CIA) comprehensively. Three groups (CIA) were given a single intravenous injection of plasmid pcDNA-CCOL2A1 (20 microg/kg, 200 microg/kg, 400 microg/kg) respectively and one group (CIA) was injected 200 microg/kg pcDNA3.1 as a control. The effect of gene vaccine (pcDNA-CCOL2A1) was evaluated according to the arthritis score, radiological and histological examinations. The severity of arthritis of CIA rats which were administered 200 microg/kg pcDNA-CCOL2A1 was significantly reduced from the fifth day. According to the radiological and histological examinations, the articular cartilage as well as subchondral bone trabeculae are similar to those of the normal groups, so the bone and articular cartilage structure were protected after treatment with 200 microg/kg pcDNA-CCOL2A1 with a little synovial hyperplasia. The therapeutic effect of 200 microg/kg pcDNA-CCOL2A1 group has significant difference in comparison with that of the pcDNA3.1 group (P 0.05). The new gene vaccine pcDNA-CCOL2A1 has significant therapeutic effect on CIA rats, and the treatment may therefore be an effective strategy for RA patient clinically.

  1. Linear DNA vaccine prepared by large-scale PCR provides protective immunity against H1N1 influenza virus infection in mice.

    Science.gov (United States)

    Wang, Fei; Chen, Quanjiao; Li, Shuntang; Zhang, Chenyao; Li, Shanshan; Liu, Min; Mei, Kun; Li, Chunhua; Ma, Lixin; Yu, Xiaolan

    2017-06-01

    Linear DNA vaccines provide effective vaccination. However, their application is limited by high cost and small scale of the conventional polymerase chain reaction (PCR) generally used to obtain sufficient amounts of DNA effective against epidemic diseases. In this study, a two-step, large-scale PCR was established using a low-cost DNA polymerase, RKOD, expressed in Pichia pastoris. Two linear DNA vaccines encoding influenza H1N1 hemagglutinin (HA) 1, LEC-HA, and PTO-LEC-HA (with phosphorothioate-modified primers), were produced by the two-step PCR. Protective effects of the vaccines were evaluated in a mouse model. BALB/c mice were immunized three times with the vaccines or a control DNA fragment. All immunized animals were challenged by intranasal administration of a lethal dose of influenza H1N1 virus 2 weeks after the last immunization. Sera of the immunized animals were tested for the presence of HA-specific antibodies, and the total IFN-γ responses induced by linear DNA vaccines were measured. The results showed that the DNA vaccines but not the control DNA induced strong antibody and IFN-γ responses. Additionally, the PTO-LEC-HA vaccine effectively protected the mice against the lethal homologous mouse-adapted virus, with a survival rate of 100% versus 70% in the LEC-HA-vaccinated group, showing that the PTO-LEC-HA vaccine was more effective than LEC-HA. In conclusion, the results indicated that the linear H1N1 HA-coding DNA vaccines induced significant immune responses and protected mice against a lethal virus challenge. Thus, the low-cost, two-step, large-scale PCR can be considered a potential tool for rapid manufacturing of linear DNA vaccines against emerging infectious diseases. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Evaluation of protective effect of multiantigenic DNA vaccine encoding MIC3 and ROP18 antigen segments of Toxoplasma gondii in mice.

    Science.gov (United States)

    Qu, Daofeng; Han, Jianzhong; Du, Aifang

    2013-07-01

    The high incidence and severe damage caused by Toxoplasma gondii infection clearly indicates the need for the development of a vaccine. In this study, we evaluated the immune responses and protection against toxoplasmosis by immunizing ICR mice with a multiantigenic DNA vaccine. To develop the multiantigenic vaccine, two T. gondii antigens, MIC3 and ROP18, selected on the basis of previous studies were chosen. ICR mice were immunized subcutaneously with PBS, empty pcDNA3.1 vector, pMIC3, pROP18, and pROP18-MIC3, respectively. The results of lymphocyte proliferation assay, cytokine, and antibody determinations showed that mice immunized with pROP18-MIC3 elicited stronger humoral and Th1-type cellular immune responses than those immunized with single-gene plasmids, empty plasmid, or phosphate-buffered saline. After a lethal challenge with the highly virulent T. gondii RH strain, a prolonged survival time in pROP18-MIC3-immunized mice was observed in comparison to control groups. Our study indicates that the introduction of multiantigenic DNA vaccine is more powerful and efficient than single-gene vaccine, and deserves further evaluation and development.

  3. Prime-boost BCG vaccination with DNA vaccines based in β-defensin-2 and mycobacterial antigens ESAT6 or Ag85B improve protection in a tuberculosis experimental model.

    Science.gov (United States)

    Cervantes-Villagrana, Alberto R; Hernández-Pando, Rogelio; Biragyn, Arya; Castañeda-Delgado, Julio; Bodogai, Monica; Martínez-Fierro, Margarita; Sada, Eduardo; Trujillo, Valentin; Enciso-Moreno, Antonio; Rivas-Santiago, Bruno

    2013-01-11

    The World Health Organization (WHO) has estimated that there are about 8 million new cases annually of active Tuberculosis (TB). Despite its irregular effectiveness (0-89%), the Bacillus Calmette-Guérin) BCG is the only vaccine available worldwide for prevention of TB; thus, the design is important of novel and more efficient vaccination strategies. Considering that β-defensin-2 is an antimicrobial peptide that induces dendritic cell maturation through the TLR-4 receptor and that both ESAT-6 and Ag85B are immunodominant mycobacterial antigens and efficient activators of the protective immune response, we constructed two DNA vaccines by the fusion of the gene encoding β-defensin-2 and antigens ESAT6 (pDE) and 85B (pDA). After confirming efficient local antigen expression that induced high and stable Interferon gamma (IFN-γ) production in intramuscular (i.m.) vaccinated Balb/c mice, groups of mice were vaccinated with DNA vaccines in a prime-boost regimen with BCG and with BCG alone, and 2 months later were challenged with the mild virulence reference strain H37Rv and the highly virulent clinical isolate LAM 5186. The level of protection was evaluated by survival, lung bacilli burdens, and extension of tissue damage (pneumonia). Vaccination with both DNA vaccines showed similar protection to that of BCG. After the challenge with the highly virulent Mycobacterium tuberculosis strain, animals that were prime-boosted with BCG and then boosted with both DNA vaccines showed significant higher survival and less tissue damage than mice vaccinated only with BCG. These results suggest that improvement of BCG vaccination, such as the prime-boost DNA vaccine, represents a more efficient vaccination scheme against TB. Copyright © 2012 Elsevier Ltd. All rights reserved.

  4. Time course study of in situ expression of antigens following DNA-vaccination against VHS in rainbow trout (Oncorhynchus mykiss Walbaum) fry

    DEFF Research Database (Denmark)

    Lorenzen, Ellen; Lorenzen, Niels; Einer-Jensen, Katja

    2005-01-01

    The present study was performed as a time course study of fish vaccinated with 20 mu g plasmid DNA vaccine encoding either the VHSV G-protein or the VHSV N-protein. Samples of the injection site were collected sequentially over a 7-week period. The study revealed an intense positive staining by i...

  5. Safety and immunogenicity of an oral DNA vaccine encoding Sip of Streptococcus agalactiae from Nile tilapia Oreochromis niloticus delivered by live attenuated Salmonella typhimurium.

    Science.gov (United States)

    Huang, L Y; Wang, K Y; Xiao, D; Chen, D F; Geng, Y; Wang, J; He, Y; Wang, E L; Huang, J L; Xiao, G Y

    2014-05-01

    Attenuated Salmonella typhimurium SL7207 was used as a carrier for a reconstructed DNA vaccine against Streptococcus agalactiae. A 1.02 kb DNA fragment, encoding for a portion of the surface immunogenic protein (Sip) of S. agalactiae was inserted into pVAX1. The recombinant plasmid pVAX1-sip was transfected in EPC cells to detect the transient expression by an indirect immunofluorescence assay, together with Western blot analysis. The pVAX1-sip was transformed by electroporation into SL7207. The stability of pVAX1-sip into Salmonella was over 90% after 50 generations with antibiotic selection in vitro while remained stable over 80% during 35 generations under antibiotic-free conditions. The LD50 of SL/pVAX1-sip was 1.7 × 10(11) CFU/fish by intragastric administration which indicated a quite low virulence. Tilapias were inoculated orally at 10(8) CFU/fish, the recombinant bacteria were found present in intestinal tract, spleens and livers and eventually eliminated from the tissues 4 weeks after immunization. Fish immunized at 10(7), 10(8) and 10(9) CFU/fish with different immunization times caused various levels of serum antibody and an effective protection against lethal challenge with the wild-type strain S. agalactiae. Integration studies showed that the pVAX1-sip did not integrate with tilapia chromosomes. The DNA vaccine SL/pVAX1-sip was proved to be safe and effective in protecting tilapias against S. agalactiae infection. Copyright © 2014 Elsevier Ltd. All rights reserved.

  6. C3d enhanced DNA vaccination induced humoral immune response to glycoprotein C of pseudorabies virus

    International Nuclear Information System (INIS)

    Tong Tiezhu; Fan Huiying; Tan Yadi; Xiao Shaobo; Ling Jieyu; Chen Huanchun; Guo Aizhen

    2006-01-01

    Murine C3d were utilized to enhance immunogenicity of pseudorabies virus (PrV) gC DNA vaccination. Three copies of C3d and four copies of CR2-binding domain M28 4 were fused, respectively, to truncated gC gene encoding soluble glycoprotein C (sgC) in pcDNA3.1. BALB/c mice were, respectively, immunized with recombinant plasmids, blank vector, and inactivated vaccine. The antibody ELISA titer for sgC-C3d 3 DNA was 49-fold more than that for sgC DNA, and the neutralizing antibody obtained 8-fold rise. Protection of mice from death after lethal PrV (316 LD 5 ) challenge was augmented from 25% to 100%. Furthermore, C3d fusion increased Th2-biased immune response by inducing IL-4 production. The IL-4 level for sgC-C3d 3 DNA immunization approached that for the inactivated vaccine. Compared to C3d, M28 enhanced sgC DNA immunogenicity to a lesser extent. In conclusion, we demonstrated that murine C3d fusion significantly enhanced gC DNA immunity by directing Th1-biased to a balanced and more effective Th1/Th2 response

  7. Insight into the potential for DNA idiotypic fusion vaccines designed for patients by analysing xenogeneic anti-idiotypic antibody responses

    Science.gov (United States)

    Forconi, Francesco; King, Catherine A; Sahota, Surinder S; Kennaway, Christopher K; Russell, Nigel H; Stevenson, Freda K

    2002-01-01

    DNA vaccines induce immune responses against encoded proteins, and have clear potential for cancer vaccines. For B-cell tumours, idiotypic (Id) immunoglobulin encoded by the variable region genes provides a target antigen. When assembled as single chain Fv (scFv), and fused to an immunoenhancing sequence from tetanus toxin (TT), DNA fusion vaccines induce anti-Id antibodies. In lymphoma models, these antibodies have a critical role in mediating protection. For application to patients with lymphoma, two questions arise: first, whether pre-existing antibody against TT affects induction of anti-scFv antibodies; second, whether individual human scFv fusion sequences are able to fold consistently to generate antibodies able to recognize private conformational Id determinants expressed by tumour cells. Using xenogeneic vaccination with scFv sequences from four patients, we have shown that pre-existing anti-TT immunity slows, but does not prevent, anti-Id antibody responses. To determine folding, we have monitored the ability of nine DNAscFv–FrC patients' vaccines to induce xenogeneic anti-Id antibodies. Antibodies were induced in all cases, and were strikingly specific for each patient's immunoglobulin with little cross-reactivity between patients, even when similar VH or VL genes were involved. Blocking experiments with human serum confirmed reactivity against private determinants in 26–97% of total antibody. Both immunoglobulin G1 (IgG1) and IgG2a subclasses were present at 1·3 : 1–15 : 1 consistent with a T helper 2-dominated response. Xenogeneic vaccination provides a simple route for testing individual patients' DNAscFv–FrC fusion vaccines, and offers a strategy for production of anti-Id antibodies. The findings underpin the approach of DNA idiotypic fusion vaccination for patients with B-cell tumours. PMID:12225361

  8. Oral Vaccination Based on DNA-Chitosan Nanoparticles against Schistosoma mansoni Infection

    Directory of Open Access Journals (Sweden)

    Carolina R. Oliveira

    2012-01-01

    Full Text Available The development of a vaccine would be essential for the control of schistosomiasis, which is recognized as the most important human helminth infection in terms of morbidity and mortality. A new approach of oral vaccination with DNA-chitosan nanoparticles appears interesting because of their great stability and the ease of target accessibility, besides chitosan immunostimulatory properties. Here we described that chitosan nanoparticles loaded with plasmid DNA encoding Rho1-GTPase protein of Schistosoma mansoni, prepared at different molar ratios of primary amines to DNA phosphate anion (N/P, were able to complex electrostatically with DNA and condense it into positively charged nanostructures. Nanoparticles were able to maintain zeta potential and size characteristics in media that simulate gastric (SGF and intestinal fluids (SIF. Further in vivo studies showed that oral immunization was not able to induce high levels of specific antibodies but induced high levels of the modulatory cytokine IL-10. This resulted in a significative reduce of liver pathology, although it could not protect mice of infection challenge with S. mansoni worms. Mice immunized only with chitosan nanoparticles presented 47% of protection against parasite infection, suggesting an important role of chitosan in inducing a protective immune response against schistosomiasis, which will be more explored in further studies.

  9. The effect of co-administration of DNA carrying chicken interferon-gamma gene on protection of chickens against infectious bursal disease by DNA-mediated vaccination.

    Science.gov (United States)

    Hsieh, Ming Kun; Wu, Ching Ching; Lin, Tsang Long

    2006-11-17

    The purpose of the present study was to determine whether DNA vaccination by co-administration of DNA coding for chicken interferon-gamma (IFN-gamma) gene and DNA encoding for the VP243 gene of IBDV could enhance immune response and protection efficacy of chickens against challenge by IBDV. Plasmids carrying VP243 gene of IBDV strain variant E (VE) (P/VP243/E) and chicken IFN-gamma gene (P/cIFN-gamma) were constructed, respectively. One-day-old chickens were intramuscularly injected with P/VP243/E, or P/cIFN-gamma, or both once, twice, or three times into the thigh muscle of one leg or the thigh muscles of two separate legs at weekly intervals. Chickens were orally challenged with IBDV strain VE at 3 weeks of age and observed for 10 days. Chickens receiving two plasmids in the same site two times had significantly higher (Pprotection and those receiving two plasmids in the same sites did not have any protection against IBD. The enzyme-linked immunosorbent assay (ELISA) and virus neutralization (VN) titers to IBDV of chickens in the groups with three doses of P/VP243/E were significantly higher (Pprotected by DNA vaccination did not have detectable IBDV antigen in the bursae as determined by immunofluorescent antibody assay (IFA). The results indicated that co-administration of plasmid encoding chicken IFN-gamma gene with plasmid encoding a large segment gene of the IBDV did not enhance immune response and protection against challenge by IBDV.

  10. Enhanced immune response and protective effects of nano-chitosan-based DNA vaccine encoding T cell epitopes of Esat-6 and FL against Mycobacterium tuberculosis infection.

    Directory of Open Access Journals (Sweden)

    Ganzhu Feng

    Full Text Available Development of a novel and effective vaccine against Mycobacterium tuberculosis (M.tb is a challenging for preventing TB infection. In this study, a novel nanoparticle-based recombinant DNA vaccine was developed, which contains Esat-6 three T cell epitopes (Esat-6/3e and fms-like tyrosine kinase 3 ligand (FL genes (termed Esat-6/3e-FL, and was enveloped with chitosan (CS nanoparticles (nano-chitosan. The immunologic and protective efficacy of the nano-chitosan-based DNA vaccine (termed nano-Esat-6/3e-FL was assessed in C57BL/6 mice after intramuscular prime vaccination with the plasmids DNA and nasal boost with the Esat-6/3e peptides. The results showed that the immunized mice remarkably elicited enhanced T cell responses and protection against M.tb H37Rv challenge. These findings indicate that the nano-chitosan can significantly elevate the immunologic and protective effects of the DNA vaccine, and the nano-Esat-6/3e-FL is a useful vaccine for preventing M.tb infection in mice.

  11. Induction of Th1 type response by DNA vaccinations with N, M, and E genes against SARS-CoV in mice

    International Nuclear Information System (INIS)

    Jin Huali; Xiao Chong; Chen Ze; Kang Youmin; Ma Yijie; Zhu Kaichun; Xie Qifa; Tu Yixian; Yu Yang; Wang Bin

    2005-01-01

    Vaccination against the SARS-CoV infection is an attractive means to control the spread of viruses in public. In this study, we employed a DNA vaccine technology with the levamisole, our newly discovered chemical adjuvant, to generate Th1 type of response. To avoid the enhancement antibody issue, genes encoding the nucleocapsid, membrane, and envelope protein of SARS-CoV were cloned and their expressions in mammalian cells were determined. After the intramuscular introduction into animals, we observed that the constructs of the E, M, and N genes could induce high levels of specific antibodies, T cell proliferations, IFN-γ, DTH responses, and in vivo cytotoxic T cells activities specifically against SARS-CoV antigens. The highest immune responses were generated by the construct encoding the nucleocapsid protein. The results suggest that the N, M, and E genes could be used as the targets to prevent SARS-CoV infection in the DNA vaccine development

  12. DNA-encoded chemical libraries - achievements and remaining challenges.

    Science.gov (United States)

    Favalli, Nicholas; Bassi, Gabriele; Scheuermann, Jörg; Neri, Dario

    2018-04-23

    DNA-encoded chemical libraries (DECLs) are collections of compounds, individually coupled to DNA tags serving as amplifiable identification barcodes. Since individual compounds can be identified by the associated DNA tag, they can be stored as a mixture, allowing the synthesis and screening of combinatorial libraries of unprecedented size, facilitated by the implementation of split-and-pool synthetic procedures or other experimental methodologies. In this review, we briefly present relevant concepts and technologies, which are required for the implementation and interpretation of screening procedures with DNA-encoded chemical libraries. Moreover, we illustrate some success stories, detailing how novel ligands were discovered from encoded libraries. Finally, we critically review what can realistically be achieved with the technology at the present time, highlighting challenges and opportunities for the future. © 2018 Federation of European Biochemical Societies.

  13. Targeted DNA vaccines for enhanced induction of idiotype-specific B and T cells

    International Nuclear Information System (INIS)

    Fredriksen, Agnete B.; Sandlie, Inger; Bogen, Bjarne

    2012-01-01

    Background: Idiotypes (Id) are antigenic determinants localized in variable (V) regions of Ig. Id-specific T and B cells (antibodies) play a role in immunotherapy of Id + tumors. However, vaccine strategies that enhance Id-specific responses are needed. Methods: Id + single-chain fragment variable (scFv) from multiple myelomas and B cell lymphomas were prepared in a fusion format that bivalently target surface molecules on antigen-presenting cells (APC). APC-specific targeting units were either scFv from APC-specific mAb (anti-MHC II, anti-CD40) or chemokines (MIP-1α, RANTES). Homodimeric Id-vaccines were injected intramuscularly or intradermally as plasmids in mice, combined with electroporation. Results: (i) Transfected cells secreted plasmid-encoded Id + fusion proteins to extracellular fluid followed by binding of vaccine molecules to APC. (ii) Targeted vaccine molecules increased Id-specific B and T cell responses. (iii) Bivalency and xenogeneic sequences both contributed to enhanced responses. (iv) Targeted Id DNA vaccines induced tumor resistance against challenges with Id + tumors. (v) Human MIP-1α targeting units enhanced Id-specific responses in mice, due to a cross reaction with murine chemokine receptors. Thus, targeted vaccines designed for humans can be quality tested in mice. (vi) Human Id + scFv from four multiple myeloma patients were inserted into the vaccine format and were successfully tested in mice. (vii) Human MIP-1α vaccine proteins enhanced human T cell responses in vitro. (viii) A hypothetical model for how the APC-targeted vaccine molecules enhance Id-specific T and B cells is presented. Conclusion: Targeted DNA Id-vaccines show promising results in preclinical studies, paving the way for testing in patients.

  14. Targeted DNA vaccines for enhanced induction of idiotype-specific B and T cells

    Energy Technology Data Exchange (ETDEWEB)

    Fredriksen, Agnete B.; Sandlie, Inger; Bogen, Bjarne, E-mail: bjarne.bogen@medisin.uio.no [Centre for Immune Regulation, Institute of Immunology, University of Oslo and Oslo University Hospital, Oslo (Norway)

    2012-10-30

    Background: Idiotypes (Id) are antigenic determinants localized in variable (V) regions of Ig. Id-specific T and B cells (antibodies) play a role in immunotherapy of Id{sup +} tumors. However, vaccine strategies that enhance Id-specific responses are needed. Methods: Id{sup +} single-chain fragment variable (scFv) from multiple myelomas and B cell lymphomas were prepared in a fusion format that bivalently target surface molecules on antigen-presenting cells (APC). APC-specific targeting units were either scFv from APC-specific mAb (anti-MHC II, anti-CD40) or chemokines (MIP-1α, RANTES). Homodimeric Id-vaccines were injected intramuscularly or intradermally as plasmids in mice, combined with electroporation. Results: (i) Transfected cells secreted plasmid-encoded Id{sup +} fusion proteins to extracellular fluid followed by binding of vaccine molecules to APC. (ii) Targeted vaccine molecules increased Id-specific B and T cell responses. (iii) Bivalency and xenogeneic sequences both contributed to enhanced responses. (iv) Targeted Id DNA vaccines induced tumor resistance against challenges with Id{sup +} tumors. (v) Human MIP-1α targeting units enhanced Id-specific responses in mice, due to a cross reaction with murine chemokine receptors. Thus, targeted vaccines designed for humans can be quality tested in mice. (vi) Human Id{sup +} scFv from four multiple myeloma patients were inserted into the vaccine format and were successfully tested in mice. (vii) Human MIP-1α vaccine proteins enhanced human T cell responses in vitro. (viii) A hypothetical model for how the APC-targeted vaccine molecules enhance Id-specific T and B cells is presented. Conclusion: Targeted DNA Id-vaccines show promising results in preclinical studies, paving the way for testing in patients.

  15. Lipopolysaccharide contamination in intradermal DNA vaccination : toxic impurity or adjuvant?

    NARCIS (Netherlands)

    Berg, J.H. van den; Quaak, S.G.L.; Beijnen, J.H.; Hennink, W.E.; Storm, G.; Schumacher, T.N.; Haanen, J.B.A.G.; Nuijen, B.

    Purpose: Lipopolysaccharides (LPS) are known both as potential adjuvants for vaccines and as toxic impurity in pharmaceutical preparations. The aim of this study was to assess the role of LPS in intradermal DNA vaccination administered by DNA tattooing. Method: Micewere vaccinated with a model DNA

  16. Prime-boost vaccination using DNA and whole inactivated virus vaccines provides limited protection against virulent feline immunodeficiency virus.

    Science.gov (United States)

    Dunham, Stephen P; Bruce, Jennifer; Klein, Dieter; Flynn, J Norman; Golder, Matthew C; MacDonald, Susan; Jarrett, Oswald; Neil, James C

    2006-11-30

    Protection against feline immunodeficiency virus (FIV) has been achieved using a variety of vaccines notably whole inactivated virus (WIV) and DNA. However protection against more virulent isolates, typical of those encountered in natural infections, has been difficult to achieve. In an attempt to improve protection against virulent FIV(GL8), we combined both DNA and WIV vaccines in a "prime-boost" approach. Thirty cats were divided into four groups receiving vaccinations and one unvaccinated control group. Following viral challenge, two vaccinated animals, one receiving DNA alone and one the prime-boost vaccine remained free of viraemia, whilst all controls became viraemic. Animals vaccinated with WIV showed apparent early enhancement of infection at 2 weeks post challenge (pc) with higher plasma viral RNA loads than control animals or cats immunised with DNA alone. Despite this, animals vaccinated with WIV or DNA alone showed significantly lower proviral loads in peripheral blood mononuclear cells and mesenteric lymph node cells, whilst those receiving the DNA-WIV prime-boost vaccine showed significantly lower proviral loads in PBMC, than control animals, at 35 weeks pc. Therefore both DNA and WIV vaccines conferred limited protection against viral challenge but the combination of WIV and DNA in a prime-boost approach appeared to offer no significant advantage over either vaccine alone.

  17. Protective efficacy of cationic-PLGA microspheres loaded with DNA vaccine encoding the sip gene of Streptococcus agalactiae in tilapia.

    Science.gov (United States)

    Ma, Yan-Ping; Ke, Hao; Liang, Zhi-Ling; Ma, Jiang-Yao; Hao, Le; Liu, Zhen-Xing

    2017-07-01

    Streptococcus agalactiae (S. agalactiae) is an important fish pathogen, which has received more attention in the past decade due to the increasing economic losses in the tilapia industry worldwide. As existing effective vaccines of S. agalactiae in fish have obvious disadvantage, to select immunoprotective antigens and package materials would undoubtedly contribute to the development of novel oral vaccines. In the present study, surface immunogenic protein (sip) was selected from the S. agalactiae serovar I a genomes as immunogenic protein in DNA vaccine form with cationic chitosan and biodegradable and biocompatible PLGA. The pcSip plasmid in cationic-PLGA was successfully expressed in tissues of immunized tilapia and the immunogenicity was assessed in tilapia challenge model. A significant increase was observed in the cytokine levels of IL-1β, TNF-α, CC1, CC2 in spleen and kidney tissues. Furthermore, immunized tilapia conferred different levels of protection against challenge with a lethal dose of highly virulent serovar I a S. agalactiae. Our results indicated that the pcSip plasmid in cationic-PLGA induced high level of antibodies and protection against S. agalactiae infection, could be effective oral DNA vaccine candidates. Copyright © 2017 Elsevier Ltd. All rights reserved.

  18. Immunogenicity of an HPV-16 L2 DNA vaccine

    Science.gov (United States)

    Hitzeroth, Inga I.; Passmore, Jo-Ann S.; Shephard, Enid; Stewart, Debbie; Müller, Martin; Williamson, Anna-Lise; Rybicki, Edward P.; Kast, W. Martin

    2009-01-01

    The ability to elicit cross-neutralizing antibodies makes human papillomavirus (HPV) L2 capsid protein a possible HPV vaccine. We examined and compared the humoral response of mice immunised with a HPV-16 L2 DNA vaccine or with HPV-16 L2 protein. The L2 DNA vaccine elicited a non-neutralising antibody response unlike the L2 protein. L2 DNA vaccination suppressed the growth of L2-expressing C3 tumor cells, which is a T cell mediated effect, demonstrating that the lack of non-neutralizing antibody induction by L2 DNA was not caused by lack of T cell immunogenicity of the construct. PMID:19559114

  19. Tolerogenic β2-glycoprotein I DNA vaccine and FK506 as an adjuvant attenuates experimental obstetric antiphospholipid syndrome.

    Science.gov (United States)

    Chao, Ya-Hsuan; Chen, Der-Yuan; Lan, Joung-Liang; Tang, Kuo-Tung; Lin, Chi-Chien

    2018-01-01

    DNA vaccines have recently emerged as a therapeutic agent for treating autoimmune diseases, such as multiple sclerosis. Antiphospholipid antibody syndrome (APS) is an autoimmune disease characterized by β2-glycoprotein I (β2-GPI)-targeting antiphospholipid antibodies (APAs) and vascular thrombosis or obstetrical complications. To examine the therapeutic potential of a β2-GPI DNA vaccine, we administered a vaccine mixed with FK506 as an adjuvant to a mouse model of obstetric APS. First, the pCMV3-β2-GPI DNA vaccine, which encodes the full-length human β2-GPI gene, was constructed. Then, we administered the β2-GPI DNA vaccine in 0.1 ml of saline, mixed with or without 100 μg of FK506, intramuscularly to the mice on days 28, 35 and 42. Blood titers of the anti-β2-GPI antibody, platelet counts, activated partial thromboplastin times (aPTTs), and the percentage of fetal loss were measured. We also stimulated murine splenic T cells ex vivo with β2-GPI and determined the T helper cell proportion and cytokine secretion. The administration of the β2-GPI DNA vaccine mixed with FK506 reduced the blood IgG anti-β2-GPI antibody titers and suppressed APS manifestations in mice. The combination also suppressed interferon-γ and interleukin (IL)-17A secretion but increased the Treg cell proportion and IL-10 secretion in murine splenic T cells following ex vivo stimulation with β2-GPI. Our results demonstrated the therapeutic efficacy of a β2-GPI DNA vaccine and FK506 as an adjuvant in a murine model of obstetric APS. Possible mechanisms include the inhibition of Th1 and Th17 responses and the up-regulation of Treg cells.

  20. Intranasal DNA Vaccine for Protection against Respiratory Infectious Diseases: The Delivery Perspectives

    Directory of Open Access Journals (Sweden)

    Yingying Xu

    2014-07-01

    Full Text Available Intranasal delivery of DNA vaccines has become a popular research area recently. It offers some distinguished advantages over parenteral and other routes of vaccine administration. Nasal mucosa as site of vaccine administration can stimulate respiratory mucosal immunity by interacting with the nasopharyngeal-associated lymphoid tissues (NALT. Different kinds of DNA vaccines are investigated to provide protection against respiratory infectious diseases including tuberculosis, coronavirus, influenza and respiratory syncytial virus (RSV etc. DNA vaccines have several attractive development potential, such as producing cross-protection towards different virus subtypes, enabling the possibility of mass manufacture in a relatively short time and a better safety profile. The biggest obstacle to DNA vaccines is low immunogenicity. One of the approaches to enhance the efficacy of DNA vaccine is to improve DNA delivery efficiency. This review provides insight on the development of intranasal DNA vaccine for respiratory infections, with special attention paid to the strategies to improve the delivery of DNA vaccines using non-viral delivery agents.

  1. Glycoprotein-Specific Antibodies Produced by DNA Vaccination Protect Guinea Pigs from Lethal Argentine and Venezuelan Hemorrhagic Fever

    Science.gov (United States)

    Golden, Joseph W.; Maes, Piet; Kwilas, Steven A.; Ballantyne, John

    2016-01-01

    ABSTRACT Several members of the Arenaviridae can cause acute febrile diseases in humans, often resulting in lethality. The use of convalescent-phase human plasma is an effective treatment in humans infected with arenaviruses, particularly species found in South America. Despite this, little work has focused on developing potent and defined immunotherapeutics against arenaviruses. In the present study, we produced arenavirus neutralizing antibodies by DNA vaccination of rabbits with plasmids encoding the full-length glycoprotein precursors of Junín virus (JUNV), Machupo virus (MACV), and Guanarito virus (GTOV). Geometric mean neutralizing antibody titers, as measured by the 50% plaque reduction neutralization test (PRNT50), exceeded 5,000 against homologous viruses. Antisera against each targeted virus exhibited limited cross-species binding and, to a lesser extent, cross-neutralization. Anti-JUNV glycoprotein rabbit antiserum protected Hartley guinea pigs from lethal intraperitoneal infection with JUNV strain Romero when the antiserum was administered 2 days after challenge and provided some protection (∼30%) when administered 4 days after challenge. Treatment starting on day 6 did not protect animals. We further formulated an IgG antibody cocktail by combining anti-JUNV, -MACV, and -GTOV antibodies produced in DNA-vaccinated rabbits. This cocktail protected 100% of guinea pigs against JUNV and GTOV lethal disease. We then expanded on this cocktail approach by simultaneously vaccinating rabbits with a combination of plasmids encoding glycoproteins from JUNV, MACV, GTOV, and Sabia virus (SABV). Sera collected from rabbits vaccinated with the combination vaccine neutralized all four targets. These findings support the concept of using a DNA vaccine approach to generate a potent pan-arenavirus immunotherapeutic. IMPORTANCE Arenaviruses are an important family of emerging viruses. In infected humans, convalescent-phase plasma containing neutralizing antibodies can

  2. Highly immunogenic prime–boost DNA vaccination protects chickens against challenge with homologous and heterologous H5N1 virus

    Directory of Open Access Journals (Sweden)

    Anna Stachyra

    2014-01-01

    Full Text Available Highly pathogenic avian influenza viruses (HPAIVs cause huge economic losses in the poultry industry because of high mortality rate in infected flocks and trade restrictions. Protective antibodies, directed mainly against hemagglutinin (HA, are the primary means of protection against influenza outbreaks. A recombinant DNA vaccine based on the sequence of H5 HA from the H5N1/A/swan/Poland/305-135V08/2006 strain of HPAIV was prepared. Sequence manipulation included deletion of the proteolytic cleavage site to improve protein stability, codon usage optimization to improve translation and stability of RNA in host cells, and cloning into a commercially available vector to enable expression in animal cells. Naked plasmid DNA was complexed with a liposomal carrier and the immunization followed the prime–boost strategy. The immunogenic potential of the DNA vaccine was first proved in broilers in near-to-field conditions resembling a commercial farm. Next, the protective activity of the vaccine was confirmed in SPF layer-type chickens. Experimental infections (challenge experiments indicated that 100% of vaccinated chickens were protected against H5N1 of the same clade and that 70% of them were protected against H5N1 influenza virus of a different clade. Moreover, the DNA vaccine significantly limited (or even eliminated transmission of the virus to contact control chickens. Two intramuscular doses of DNA vaccine encoding H5 HA induced a strong protective response in immunized chicken. The effective protection lasted for a minimum 8 weeks after the second dose of the vaccine and was not limited to the homologous H5N1 virus. In addition, the vaccine reduced shedding of the virus.

  3. A vaccine encoding conserved promiscuous HIV CD4 epitopes induces broad T cell responses in mice transgenic to multiple common HLA class II molecules.

    Directory of Open Access Journals (Sweden)

    Susan Pereira Ribeiro

    Full Text Available Current HIV vaccine approaches are focused on immunogens encoding whole HIV antigenic proteins that mainly elicit cytotoxic CD8+ responses. Mounting evidence points toward a critical role for CD4+ T cells in the control of immunodeficiency virus replication, probably due to cognate help. Vaccine-induced CD4+ T cell responses might, therefore, have a protective effect in HIV replication. In addition, successful vaccines may have to elicit responses to multiple epitopes in a high proportion of vaccinees, to match the highly variable circulating strains of HIV. Using rational vaccine design, we developed a DNA vaccine encoding 18 algorithm-selected conserved, "promiscuous" (multiple HLA-DR-binding B-subtype HIV CD4 epitopes - previously found to be frequently recognized by HIV-infected patients. We assessed the ability of the vaccine to induce broad T cell responses in the context of multiple HLA class II molecules using different strains of HLA class II- transgenic mice (-DR2, -DR4, -DQ6 and -DQ8. Mice displayed CD4+ and CD8+ T cell responses of significant breadth and magnitude, and 16 out of the 18 encoded epitopes were recognized. By virtue of inducing broad responses against conserved CD4+ T cell epitopes that can be recognized in the context of widely diverse, common HLA class II alleles, this vaccine concept may cope both with HIV genetic variability and increased population coverage. The vaccine may thus be a source of cognate help for HIV-specific CD8+ T cells elicited by conventional immunogens, in a wide proportion of vaccinees.

  4. Enhanced cellular immune response against SIV Gag induced by immunization with DNA vaccines expressing assembly and release-defective SIV Gag proteins

    International Nuclear Information System (INIS)

    Bu Zhigao; Ye Ling; Compans, Richard W.; Yang Chinglai

    2003-01-01

    Codon-optimized genes were synthesized for the SIVmac239 Gag, a mutant Gag with mutations in the major homology region, and a chimeric Gag containing a protein destruction signal at the N-terminus of Gag. The mutant and chimeric Gag were expressed at levels comparable to that observed for the wild-type Gag protein but their stability and release into the medium were found to be significantly reduced. Immunization of mice with DNA vectors encoding the mutant or chimeric Gag induced fourfold higher levels of anti-SIV Gag CD4 T cell responses than the DNA vector encoding the wild-type SIV Gag. Moreover, anti-SIV Gag CD8 T cell responses induced by DNA vectors encoding the mutant or chimeric Gag were found to be 5- to 10-fold higher than those induced by the DNA construct for the wild-type Gag. These results indicate that mutations disrupting assembly and/or stability of the SIV Gag protein effectively enhance its immunogenicity when expressed from DNA vaccines

  5. Subtype C gp140 Vaccine Boosts Immune Responses Primed by the South African AIDS Vaccine Initiative DNA-C2 and MVA-C HIV Vaccines after More than a 2-Year Gap.

    Science.gov (United States)

    Gray, Glenda E; Mayer, Kenneth H; Elizaga, Marnie L; Bekker, Linda-Gail; Allen, Mary; Morris, Lynn; Montefiori, David; De Rosa, Stephen C; Sato, Alicia; Gu, Niya; Tomaras, Georgia D; Tucker, Timothy; Barnett, Susan W; Mkhize, Nonhlanhla N; Shen, Xiaoying; Downing, Katrina; Williamson, Carolyn; Pensiero, Michael; Corey, Lawrence; Williamson, Anna-Lise

    2016-06-01

    A phase I safety and immunogenicity study investigated South African AIDS Vaccine Initiative (SAAVI) HIV-1 subtype C (HIV-1C) DNA vaccine encoding Gag-RT-Tat-Nef and gp150, boosted with modified vaccinia Ankara (MVA) expressing matched antigens. Following the finding of partial protective efficacy in the RV144 HIV vaccine efficacy trial, a protein boost with HIV-1 subtype C V2-deleted gp140 with MF59 was added to the regimen. A total of 48 participants (12 U.S. participants and 36 Republic of South Africa [RSA] participants) were randomized to receive 3 intramuscular (i.m.) doses of SAAVI DNA-C2 of 4 mg (months 0, 1, and 2) and 2 i.m. doses of SAAVI MVA-C of 1.45 × 10(9) PFU (months 4 and 5) (n = 40) or of a placebo (n = 8). Approximately 2 years after vaccination, 27 participants were rerandomized to receive gp140/MF59 at 100 μg or placebo, as 2 i.m. injections, 3 months apart. The vaccine regimen was safe and well tolerated. After the DNA-MVA regimen, CD4(+) T-cell and CD8(+) T-cell responses occurred in 74% and 32% of the participants, respectively. The protein boost increased CD4(+) T-cell responses to 87% of the subjects. All participants developed tier 1 HIV-1C neutralizing antibody responses as well as durable Env binding antibodies that recognized linear V3 and C5 peptides. The HIV-1 subtype C DNA-MVA vaccine regimen showed promising cellular immunogenicity. Boosting with gp140/MF59 enhanced levels of binding and neutralizing antibodies as well as CD4(+) T-cell responses to HIV-1 envelope. (This study has been registered at ClinicalTrials.gov under registration no. NCT00574600 and NCT01423825.). Copyright © 2016 Gray et al.

  6. Approaches towards DNA vaccination against a skin ciliate parasite in fish.

    Directory of Open Access Journals (Sweden)

    Louise von Gersdorff Jørgensen

    Full Text Available Rainbow trout (Oncorhynchus mykiss were immunized with plasmid DNA vaccine constructs encoding selected antigens from the parasite Ichthyophthirius multifiliis. Two immobilization antigens (I-ags and one cysteine protease were tested as genetic vaccine antigen candidates. Antigenicity was evaluated by immunostaining of transfected fish cells using I-ag specific mono- and polyclonal antibodies. I. multifiliis specific antibody production, regulation of immune-relevant genes and/or protection in terms of parasite burden or mortality was measured to evaluate the induced immune response in vaccinated fish. Apart from intramuscular injection, needle free injection and gene gun delivery were tested as alternative administration techniques. For the I-ags the complement protein fragment C3d and the termini of the viral haemorrhagic septicaemia virus glyco(Gprotein (VHSV G were tested as opsonisation and cellular localisation mediators, respectively, while the full length viral G protein was tested as molecular adjuvant. Expression of I-ags in transfected fish cells was demonstrated for several constructs and by immunohistochemistry it was possible to detect expression of a secreted form of the Iag52B in the muscle cells of injected fish. Up-regulations of mRNA coding for IgM, MHC I, MHC II and TCR β, respectively, were observed in muscle tissue at the injection site in selected trials. In the spleen up-regulations were found for IFN-γ and IL-10. The highest up-regulations were seen following co-administration of I-ag and cysteine protease plasmid constructs. This correlated with a slight elevation of an I. multifiliis specific antibody response. However, in spite of detectable antigen expression and immune reactions, none of the tested vaccination strategies provided significant protection. This might suggest an insufficiency of DNA vaccination alone to trigger protective mechanisms against I. multifiliis or that other or additional parasite antigens

  7. Storing data encoded DNA in living organisms

    Science.gov (United States)

    Wong,; Pak C. , Wong; Kwong K. , Foote; Harlan, P [Richland, WA

    2006-06-06

    Current technologies allow the generation of artificial DNA molecules and/or the ability to alter the DNA sequences of existing DNA molecules. With a careful coding scheme and arrangement, it is possible to encode important information as an artificial DNA strand and store it in a living host safely and permanently. This inventive technology can be used to identify origins and protect R&D investments. It can also be used in environmental research to track generations of organisms and observe the ecological impact of pollutants. Today, there are microorganisms that can survive under extreme conditions. As well, it is advantageous to consider multicellular organisms as hosts for stored information. These living organisms can provide as memory housing and protection for stored data or information. The present invention provides well for data storage in a living organism wherein at least one DNA sequence is encoded to represent data and incorporated into a living organism.

  8. DNA-Encoded Dynamic Combinatorial Chemical Libraries.

    Science.gov (United States)

    Reddavide, Francesco V; Lin, Weilin; Lehnert, Sarah; Zhang, Yixin

    2015-06-26

    Dynamic combinatorial chemistry (DCC) explores the thermodynamic equilibrium of reversible reactions. Its application in the discovery of protein binders is largely limited by difficulties in the analysis of complex reaction mixtures. DNA-encoded chemical library (DECL) technology allows the selection of binders from a mixture of up to billions of different compounds; however, experimental results often show low a signal-to-noise ratio and poor correlation between enrichment factor and binding affinity. Herein we describe the design and application of DNA-encoded dynamic combinatorial chemical libraries (EDCCLs). Our experiments have shown that the EDCCL approach can be used not only to convert monovalent binders into high-affinity bivalent binders, but also to cause remarkably enhanced enrichment of potent bivalent binders by driving their in situ synthesis. We also demonstrate the application of EDCCLs in DNA-templated chemical reactions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Construction and analysis of experimental DNA vaccines against megalocytivirus.

    Science.gov (United States)

    Zhang, Min; Hu, Yong-Hua; Xiao, Zhi-Zhong; Sun, Yun; Sun, Li

    2012-11-01

    Iridoviruses are large double-stranded DNA viruses with icosahedral capsid. The Iridoviridae family contains five genera, one of which is Megalocytivirus. Megalocytivirus has emerged in recent years as an important pathogen to a wide range of marine and freshwater fish. In this study, we aimed at developing effective genetic vaccines against megalocytivirus affecting farmed fish in China. For this purpose, we constructed seven DNA vaccines based on seven genes of rock bream iridovirus isolate 1 from China (RBIV-C1), a megalocytivirus with a host range that includes Japanese flounder (Paralichthys olivaceus) and turbot (Scophthalmus maximus). The protective potentials of these vaccines were examined in a turbot model. The results showed that after vaccination via intramuscular injection, the vaccine plasmids were distributed in spleen, kidney, muscle, and liver, and transcription of the vaccine genes and production of the vaccine proteins were detected in these tissues. Following challenge with a lethal-dose of RBIV-C1, fish vaccinated with four of the seven DNA vaccines exhibited significantly higher levels of survival compared to control fish. Of these four protective DNA vaccines, pCN86, which is a plasmid that expresses an 86-residue viral protein, induced the highest protection. Immunological analysis showed that pCN86 was able to (i) stimulate the respiratory burst of head kidney macrophages at 14 d, 21 d, and 28 d post-vaccination, (ii) upregulate the expression of immune relevant genes involved in innate and adaptive immunity, and (iii) induce production of serum antibodies that, when incubated with RBIV-C1 before infection, significantly reduced viral loads in kidney and spleen following viral infection of turbot. Taken together, these results indicate that pCN86 is an effective DNA vaccine that may be used in the control of megalocytivirus-associated diseases in aquaculture. Copyright © 2012 Elsevier Ltd. All rights reserved.

  10. Rapid outer-surface protein C DNA tattoo vaccination protects against Borrelia afzelii infection.

    Science.gov (United States)

    Wagemakers, A; Mason, L M K; Oei, A; de Wever, B; van der Poll, T; Bins, A D; Hovius, J W R

    2014-12-01

    Borrelia afzelii is the predominant Borrelia species causing Lyme borreliosis in Europe. Currently there is no human vaccine against Lyme borreliosis, and most research focuses on recombinant protein vaccines against Borrelia burgdorferi sensu stricto. DNA tattooing is a novel vaccination method that can be applied in a rapid vaccination schedule. We vaccinated C3H/HeN mice with B. afzelii strain PKo OspC (outer-surface protein C) using a codon-optimized DNA vaccine tattoo and compared this with recombinant protein vaccination in a 0-2-4 week vaccination schedule. We also assessed protection by DNA tattoo in a 0-3-6 day schedule. DNA tattoo and recombinant OspC vaccination induced comparable total IgG responses, with a lower IgG1/IgG2a ratio after DNA tattoo. Two weeks after syringe-challenge with 5 × 10(5) B. afzelii spirochetes most vaccinated mice had negative B. afzelii tissue DNA loads and all were culture negative. Furthermore, DNA tattoo vaccination in a 0-3-6 day regimen also resulted in negative Borrelia loads and cultures after challenge. To conclude, DNA vaccination by tattoo was fully protective against B. afzelii challenge in mice in a rapid vaccination protocol, and induces a favorable humoral immunity compared to recombinant protein vaccination. Rapid DNA tattoo is a promising vaccination strategy against spirochetes.

  11. Toward a Better Compression for DNA Sequences Using Huffman Encoding.

    Science.gov (United States)

    Al-Okaily, Anas; Almarri, Badar; Al Yami, Sultan; Huang, Chun-Hsi

    2017-04-01

    Due to the significant amount of DNA data that are being generated by next-generation sequencing machines for genomes of lengths ranging from megabases to gigabases, there is an increasing need to compress such data to a less space and a faster transmission. Different implementations of Huffman encoding incorporating the characteristics of DNA sequences prove to better compress DNA data. These implementations center on the concepts of selecting frequent repeats so as to force a skewed Huffman tree, as well as the construction of multiple Huffman trees when encoding. The implementations demonstrate improvements on the compression ratios for five genomes with lengths ranging from 5 to 50 Mbp, compared with the standard Huffman tree algorithm. The research hence suggests an improvement on all such DNA sequence compression algorithms that use the conventional Huffman encoding. The research suggests an improvement on all DNA sequence compression algorithms that use the conventional Huffman encoding. Accompanying software is publicly available (AL-Okaily, 2016 ).

  12. Prime-Boost Vaccination Using Chemokine-Fused gp120 DNA and HIV Envelope Peptides Activates Both Immediate and Long-Term Memory Cellular Responses in Rhesus Macaques

    Directory of Open Access Journals (Sweden)

    Hong Qin

    2010-01-01

    Full Text Available HIV vaccine candidates with improved immunogenicity and induction of mucosal T-cell immunity are needed. A prime-boost strategy using a novel HIV glycoprotein 120 DNA vaccine was employed to immunize rhesus macaques. The DNA vaccine encoded a chimeric gp120 protein in fusion with monocyte chemoattractant protein-3, which was hypothesized to improve the ability of antigen-presenting cells to capture viral antigen through chemokine receptor-mediated endocytosis. DNA vaccination induced virus-reactive T cells in peripheral blood, detectable by T cell proliferation, INFγ ELISPOT and sustained IL-6 production, without humoral responses. With a peptide-cocktail vaccine containing a set of conserved polypeptides of HIV-1 envelope protein, given by nasogastric administration, primed T-cell immunity was significantly boosted. Surprisingly, long-term and peptide-specific mucosal memory T-cell immunity was detected in both vaccinated macaques after one year. Therefore, data from this investigation offer proof-of-principle for potential effectiveness of the prime-boost strategy with a chemokine-fused gp120 DNA and warrant further testing in the nonhuman primate models for developing as a potential HIV vaccine candidate in humans.

  13. DNA vaccine encoding nucleocapsid and surface proteins of wild type canine distemper virus protects its natural host against distemper.

    Science.gov (United States)

    Cherpillod, P; Tipold, A; Griot-Wenk, M; Cardozo, C; Schmid, I; Fatzer, R; Schobesberger, M; Zurbriggen, R; Bruckner, L; Roch, F; Vandevelde, M; Wittek, R; Zurbriggen, A

    2000-07-01

    Canine distemper virus (CDV), a member of the genus Morbillivirus induces a highly infectious, frequently lethal disease in dogs and other carnivores. Current vaccines against canine distemper consisting of attenuated viruses have been in use for many years and have greatly reduced the incidence of distemper in the dog population. However, certain strains may not guarantee adequate protection and others can induce post vaccinal encephalitis. We tested a DNA vaccine for its ability to protect dogs, the natural host of CDV, against distemper. We constructed plasmids containing the nucleocapsid, the fusion, and the attachment protein genes of a virulent canine distemper virus strain. Mice inoculated with these plasmids developed humoral and cellular immune responses against CDV antigens. Dogs immunized with the expression plasmids developed virus-neutralizing antibodies. Significantly, vaccinated dogs were protected against challenge with virulent CDV, whereas unvaccinated animals succumbed to distemper.

  14. Immunization with a DNA vaccine encoding Toxoplasma gondii Superoxide dismutase (TgSOD) induces partial immune protection against acute toxoplasmosis in BALB/c mice.

    Science.gov (United States)

    Liu, Yuan; Cao, Aiping; Li, Yawen; Li, Xun; Cong, Hua; He, Shenyi; Zhou, Huaiyu

    2017-06-07

    Toxoplasma gondii (T. gondii) is an obligate intracellular protozoan parasite that infects all warm-blooded animals including humans and causes toxoplasmosis. An effective vaccine could be an ideal choice for preventing and controlling toxoplasmosis. T. gondii Superoxide dismutase (TgSOD) might participate in affecting the intracellular growth of both bradyzoite and tachyzoite forms. In the present study, the TgSOD gene was used to construct a DNA vaccine (pEGFP-SOD). TgSOD gene was amplified and inserted into eukaryotic vector pEGFP-C1 and formed the DNA vaccine pEGFP-SOD. Then the BALB/c mice were immunized intramuscularly with the DNA vaccine and those injected with pEGFP-C1, PBS or nothing were treated as controls. Four weeks after the last immunization, all mouse groups followed by challenging intraperitoneally with tachyzoites of T. gondii ME49 strain. Results showed higher levels of total IgG, IgG2α in the sera and interferon gamma (IFN-γ) in the splenocytes from pEGFP-SOD inoculated mice than those unvaccinated, or inoculated with either empty plasmid vector or PBS. The proportions of CD4 + T cells and CD8 + T cells in the spleen from pEGFP-SOD inoculated mice were significantly (p < 0.05) increased compared to control groups. In addition, the survival time of mice immunized with pEGFP-SOD was significantly prolonged as compared to the controls (p < 0.05) although all the mice died. The present study revealed that the DNA vaccine triggered strong humoral and cellular immune responses, and aroused partial protective immunity against acute T. gondii infection in BALB/c mice. The collective data suggests the SOD may be a potential vaccine candidate for further development.

  15. DNA vaccination with a plasmid encoding LACK-TSA fusion against Leishmania major infection in BALB/c mice.

    Science.gov (United States)

    Maspi, N; Ghaffarifar, F; Sharifi, Z; Dalimi, A; Khademi, S Z

    2017-12-01

    Vaccination would be the most important strategy for the prevention and elimination of leishmaniasis. The aim of the present study was to compare the immune responses induced following DNA vaccination with LACK (Leishmania analogue of the receptor kinase C), TSA (Thiol-specific-antioxidant) genes alone or LACK-TSA fusion against cutaneous leishmaniasis (CL). Cellular and humoral immune responses were evaluated before and after challenge with Leishmania major (L. major). In addition, the mean lesion size was also measured from 3th week post-infection. All immunized mice showed a partial immunity characterized by higher interferon (IFN)-γ and Immunoglobulin G (IgG2a) levels compared to control groups (pTSA fusion. Mean lesion sizes reduced significantly in all immunized mice compared with control groups at 7th week post-infection (pTSA and TSA groups than LACK group after challenge (pTSA antigens against CL. Furthermore, this study demonstrated that a bivalent vaccine can induce stronger immune responses and protection against infectious challenge with L. major.

  16. Glycoprotein-Specific Antibodies Produced by DNA Vaccination Protect Guinea Pigs from Lethal Argentine and Venezuelan Hemorrhagic Fever.

    Science.gov (United States)

    Golden, Joseph W; Maes, Piet; Kwilas, Steven A; Ballantyne, John; Hooper, Jay W

    2016-01-20

    Several members of the Arenaviridae can cause acute febrile diseases in humans, often resulting in lethality. The use of convalescent-phase human plasma is an effective treatment in humans infected with arenaviruses, particularly species found in South America. Despite this, little work has focused on developing potent and defined immunotherapeutics against arenaviruses. In the present study, we produced arenavirus neutralizing antibodies by DNA vaccination of rabbits with plasmids encoding the full-length glycoprotein precursors of Junín virus (JUNV), Machupo virus (MACV), and Guanarito virus (GTOV). Geometric mean neutralizing antibody titers, as measured by the 50% plaque reduction neutralization test (PRNT(50)), exceeded 5,000 against homologous viruses. Antisera against each targeted virus exhibited limited cross-species binding and, to a lesser extent, cross-neutralization. Anti-JUNV glycoprotein rabbit antiserum protected Hartley guinea pigs from lethal intraperitoneal infection with JUNV strain Romero when the antiserum was administered 2 days after challenge and provided some protection (∼30%) when administered 4 days after challenge. Treatment starting on day 6 did not protect animals. We further formulated an IgG antibody cocktail by combining anti-JUNV, -MACV, and -GTOV antibodies produced in DNA-vaccinated rabbits. This cocktail protected 100% of guinea pigs against JUNV and GTOV lethal disease. We then expanded on this cocktail approach by simultaneously vaccinating rabbits with a combination of plasmids encoding glycoproteins from JUNV, MACV, GTOV, and Sabia virus (SABV). Sera collected from rabbits vaccinated with the combination vaccine neutralized all four targets. These findings support the concept of using a DNA vaccine approach to generate a potent pan-arenavirus immunotherapeutic. Arenaviruses are an important family of emerging viruses. In infected humans, convalescent-phase plasma containing neutralizing antibodies can mitigate the

  17. Co-administration of the polysaccharide of Lycium barbarum with DNA vaccine of Chlamydophila abortus augments protection.

    Science.gov (United States)

    Ling, Yong; Li, Shaowen; Yang, Junjing; Yuan, Jilei; He, Cheng

    2011-01-01

    Lycium barbarum polysaccharides (LBP) can stimulate moderate immune responses therefore could potentially be used as a substitute for oil adjuvants in veterinary vaccines. In the present study, it was shown that the isolated active component of LBP3a, combined with a DNA vaccine encoding the major outer membrane protein (MOMP) of Chlamydophila abortus, induced protection in mice against challenge. Sixty BALB/c mice were randomly assigned to 5 groups. Sub-fractions of polysaccharide LBP3a, at 12.5, 25 and 50 mg/kg concentrations, respectively, were mixed with a pCI-neo::MOMP (pMOMP) vaccine. Mice administrated with pCI-neo + LBP3a were served as a control. All mice were inoculated at day 0, 14, and 28, and challenged on day 44. The effects of LBp3a on serum antibody levels, in vitro lymphocyte proliferation, the activity of interleaukin-2 (IL-2), interferon-γ (IFN-γ), tumor necrosis factor α(TNF-α)and chlamydia clearance were determined. A combination of DNA vaccine and LBP3a induced significantly higher antibody levels in mice, higher T cell proliferation and higher levels of IFN-γ and IL-2. Mice immunized with DNA and LBP3a also showed significantly higher levels of chlamydia clearance in mice spleens and a greater Th1 immune response. The immunoenhancement induced by 25 mg/kg LBP3a is more effective than that induced by a 12.5 and 50 mg/kg. This implies that LBP3a at 25 mg/kg has a high potential to be used as an effective adjuvant with a DNA vaccine against swine Chlamydophila abortus.

  18. Military Infectious Diseases Update on Vaccine Development

    Science.gov (United States)

    2011-01-24

    Licensed live vaccines (polio, MMR) - Radiation- attenuated sporozoites - Genetically- attenuated sporozoites 2011 MHS Conference Whole Organism...Not sufficiently attenuated Seattle Biomedical , Gates Foundation, WEHI and USMMVP 2011 MHS Conference Subunit approach- RTS,S Vaccine RTS,S is...Ad Boost  DNA plasmids [Prime] – Encoding malaria proteins CSP and AMA1  Adenovirus 5 ( attenuated )[Boost] – Encoding malaria proteins CSP and AMA1

  19. 2D Barcode for DNA Encoding

    OpenAIRE

    Elena Purcaru; Cristian Toma

    2011-01-01

    The paper presents a solution for endcoding/decoding DNA information in 2D barcodes. First part focuses on the existing techniques and symbologies in 2D barcodes field. The 2D barcode PDF417 is presented as starting point. The adaptations and optimizations on PDF417 and on DataMatrix lead to the solution - DNA2DBC - DeoxyriboNucleic Acid Two Dimensional Barcode. The second part shows the DNA2DBC encoding/decoding process step by step. In conclusions are enumerated the most important features ...

  20. A multilateral effort to develop DNA vaccines against falciparum malaria.

    Science.gov (United States)

    Kumar, Sanjai; Epstein, Judith E; Richie, Thomas L; Nkrumah, Francis K; Soisson, Lorraine; Carucci, Daniel J; Hoffman, Stephen L

    2002-03-01

    Scientists from several organizations worldwide are working together to develop a multistage, multigene DNA-based vaccine against Plasmodium falciparum malaria. This collaborative vaccine development effort is named Multi-Stage DNA-based Malaria Vaccine Operation. An advisory board of international experts in vaccinology, malariology and field trials provides the scientific oversight to support the operation. This article discusses the rationale for the approach, underlying concepts and the pre-clinical development process, and provides a brief outline of the plans for the clinical testing of a multistage, multiantigen malaria vaccine based on DNA plasmid immunization technology.

  1. GM-CSF increases mucosal and systemic immunogenicity of an H1N1 influenza DNA vaccine administered into the epidermis of non-human primates.

    Directory of Open Access Journals (Sweden)

    Peter T Loudon

    2010-06-01

    Full Text Available The recent H5N1 avian and H1N1 swine-origin influenza virus outbreaks reaffirm that the threat of a world-wide influenza pandemic is both real and ever-present. Vaccination is still considered the best strategy for protection against influenza virus infection but a significant challenge is to identify new vaccine approaches that offer accelerated production, broader protection against drifted and shifted strains, and the capacity to elicit anti-viral immune responses in the respiratory tract at the site of viral entry. As a safe alternative to live attenuated vaccines, the mucosal and systemic immunogenicity of an H1N1 influenza (A/New Caledonia/20/99 HA DNA vaccine administered by particle-mediated epidermal delivery (PMED or gene gun was analyzed in rhesus macaques.Macaques were immunized at weeks 0, 8, and 16 using a disposable single-shot particle-mediated delivery device designed for clinical use that delivers plasmid DNA directly into cells of the epidermis. Significant levels of hemagglutination inhibiting (HI antibodies and cytokine-secreting HA-specific T cells were observed in the periphery of macaques following 1-3 doses of the PMED HA DNA vaccine. In addition, HA DNA vaccination induced detectable levels of HA-specific mucosal antibodies and T cells in the lung and gut-associated lymphoid tissues of vaccinated macaques. Importantly, co-delivery of a DNA encoding the rhesus macaque GM-CSF gene was found to significantly enhance both the systemic and mucosal immunogenicity of the HA DNA vaccine.These results provide strong support for the development of a particle-mediated epidermal DNA vaccine for protection against respiratory pathogens such as influenza and demonstrate, for the first time, the ability of skin-delivered GM-CSF to serve as an effective mucosal adjuvant for vaccine induction of immune responses in the gut and respiratory tract.

  2. Multivalent human papillomavirus l1 DNA vaccination utilizing electroporation.

    Directory of Open Access Journals (Sweden)

    Kihyuck Kwak

    Full Text Available Naked DNA vaccines can be manufactured simply and are stable at ambient temperature, but require improved delivery technologies to boost immunogenicity. Here we explore in vivo electroporation for multivalent codon-optimized human papillomavirus (HPV L1 and L2 DNA vaccination.Balb/c mice were vaccinated three times at two week intervals with a fusion protein comprising L2 residues ∼11-88 of 8 different HPV types (11-88×8 or its DNA expression vector, DNA constructs expressing L1 only or L1+L2 of a single HPV type, or as a mixture of several high-risk HPV types and administered utilizing electroporation, i.m. injection or gene gun. Serum was collected two weeks and 3 months after the last vaccination. Sera from immunized mice were tested for in-vitro neutralization titer, and protective efficacy upon passive transfer to naive mice and vaginal HPV challenge. Heterotypic interactions between L1 proteins of HPV6, HPV16 and HPV18 in 293TT cells were tested by co-precipitation using type-specific monoclonal antibodies.Electroporation with L2 multimer DNA did not elicit detectable antibody titer, whereas DNA expressing L1 or L1+L2 induced L1-specific, type-restricted neutralizing antibodies, with titers approaching those induced by Gardasil. Co-expression of L2 neither augmented L1-specific responses nor induced L2-specific antibodies. Delivery of HPV L1 DNA via in vivo electroporation produces a stronger antibody response compared to i.m. injection or i.d. ballistic delivery via gene gun. Reduced neutralizing antibody titers were observed for certain types when vaccinating with a mixture of L1 (or L1+L2 vectors of multiple HPV types, likely resulting from heterotypic L1 interactions observed in co-immunoprecipitation studies. High titers were restored by vaccinating with individual constructs at different sites, or partially recovered by co-expression of L2, such that durable protective antibody titers were achieved for each type

  3. Chemical Space of DNA-Encoded Libraries.

    Science.gov (United States)

    Franzini, Raphael M; Randolph, Cassie

    2016-07-28

    In recent years, DNA-encoded chemical libraries (DECLs) have attracted considerable attention as a potential discovery tool in drug development. Screening encoded libraries may offer advantages over conventional hit discovery approaches and has the potential to complement such methods in pharmaceutical research. As a result of the increased application of encoded libraries in drug discovery, a growing number of hit compounds are emerging in scientific literature. In this review we evaluate reported encoded library-derived structures and identify general trends of these compounds in relation to library design parameters. We in particular emphasize the combinatorial nature of these libraries. Generally, the reported molecules demonstrate the ability of this technology to afford hits suitable for further lead development, and on the basis of them, we derive guidelines for DECL design.

  4. The synergistic effect of combined immunization with a DNA vaccine and chimeric yellow fever/dengue virus leads to strong protection against dengue.

    Directory of Open Access Journals (Sweden)

    Adriana S Azevedo

    Full Text Available The dengue envelope glycoprotein (E is the major component of virion surface and its ectodomain is composed of domains I, II and III. This protein is the main target for the development of a dengue vaccine with induction of neutralizing antibodies. In the present work, we tested two different vaccination strategies, with combined immunizations in a prime/booster regimen or simultaneous inoculation with a DNA vaccine (pE1D2 and a chimeric yellow fever/dengue 2 virus (YF17D-D2. The pE1D2 DNA vaccine encodes the ectodomain of the envelope DENV2 protein fused to t-PA signal peptide, while the YF17D-D2 was constructed by replacing the prM and E genes from the 17D yellow fever vaccine virus by those from DENV2. Balb/c mice were inoculated with these two vaccines by different prime/booster or simultaneous immunization protocols and most of them induced a synergistic effect on the elicited immune response, mainly in neutralizing antibody production. Furthermore, combined immunization remarkably increased protection against a lethal dose of DENV2, when compared to each vaccine administered alone. Results also revealed that immunization with the DNA vaccine, regardless of the combination with the chimeric virus, induced a robust cell immune response, with production of IFN-γ by CD8+ T lymphocytes.

  5. Optimization of HIV-1 Envelope DNA Vaccine Candidates within Three Different Animal Models, Guinea Pigs, Rabbits and Cynomolgus Macaques.

    Science.gov (United States)

    Borggren, Marie; Vinner, Lasse; Andresen, Betina Skovgaard; Grevstad, Berit; Repits, Johanna; Melchers, Mark; Elvang, Tara Laura; Sanders, Rogier W; Martinon, Frédéric; Dereuddre-Bosquet, Nathalie; Bowles, Emma Joanne; Stewart-Jones, Guillaume; Biswas, Priscilla; Scarlatti, Gabriella; Jansson, Marianne; Heyndrickx, Leo; Grand, Roger Le; Fomsgaard, Anders

    2013-07-19

    HIV-1 DNA vaccines have many advantageous features. Evaluation of HIV-1 vaccine candidates often starts in small animal models before macaque and human trials. Here, we selected and optimized DNA vaccine candidates through systematic testing in rabbits for the induction of broadly neutralizing antibodies (bNAb). We compared three different animal models: guinea pigs, rabbits and cynomolgus macaques. Envelope genes from the prototype isolate HIV-1 Bx08 and two elite neutralizers were included. Codon-optimized genes, encoded secreted gp140 or membrane bound gp150, were modified for expression of stabilized soluble trimer gene products, and delivered individually or mixed. Specific IgG after repeated i.d. inoculations with electroporation confirmed in vivo expression and immunogenicity. Evaluations of rabbits and guinea pigs displayed similar results. The superior DNA construct in rabbits was a trivalent mix of non-modified codon-optimized gp140 envelope genes. Despite NAb responses with some potency and breadth in guinea pigs and rabbits, the DNA vaccinated macaques displayed less bNAb activity. It was concluded that a trivalent mix of non-modified gp140 genes from rationally selected clinical isolates was, in this study, the best option to induce high and broad NAb in the rabbit model, but this optimization does not directly translate into similar responses in cynomolgus macaques.

  6. Optimization of HIV-1 Envelope DNA Vaccine Candidates within Three Different Animal Models, Guinea Pigs, Rabbits and Cynomolgus Macaques

    Directory of Open Access Journals (Sweden)

    Roger Le Grand

    2013-07-01

    Full Text Available HIV-1 DNA vaccines have many advantageous features. Evaluation of HIV-1 vaccine candidates often starts in small animal models before macaque and human trials. Here, we selected and optimized DNA vaccine candidates through systematic testing in rabbits for the induction of broadly neutralizing antibodies (bNAb. We compared three different animal models: guinea pigs, rabbits and cynomolgus macaques. Envelope genes from the prototype isolate HIV-1 Bx08 and two elite neutralizers were included. Codon-optimized genes, encoded secreted gp140 or membrane bound gp150, were modified for expression of stabilized soluble trimer gene products, and delivered individually or mixed. Specific IgG after repeated i.d. inoculations with electroporation confirmed in vivo expression and immunogenicity. Evaluations of rabbits and guinea pigs displayed similar results. The superior DNA construct in rabbits was a trivalent mix of non-modified codon-optimized gp140 envelope genes. Despite NAb responses with some potency and breadth in guinea pigs and rabbits, the DNA vaccinated macaques displayed less bNAb activity. It was concluded that a trivalent mix of non-modified gp140 genes from rationally selected clinical isolates was, in this study, the best option to induce high and broad NAb in the rabbit model, but this optimization does not directly translate into similar responses in cynomolgus macaques.

  7. Comparison of vaccine efficacy for different antigen delivery systems for infectious pancreatic necrosis virus vaccines in Atlantic salmon (Salmo salar L.) in a cohabitation challenge model.

    Science.gov (United States)

    Munang'andu, Hetron M; Fredriksen, Børge N; Mutoloki, Stephen; Brudeseth, Bjørn; Kuo, Tsun-Yung; Marjara, Inderjit S; Dalmo, Roy A; Evensen, Øystein

    2012-06-08

    Two strains of IPNV made by reverse genetics on the Norwegian Sp strain NVI-015 (GenBank AY379740) backbone encoding the virulent (T(217)A(221)) and avirulent (P(217)T(221)) motifs were used to prepare inactivated whole virus (IWV), nanoparticle vaccines with whole virus, Escherichia coli subunit encoding truncated VP2-TA and VP2-PT, VP2-TA and VP2-PT fusion antigens with putative translocating domains of Pseudomonas aeruginosa exotoxin, and plasmid DNA encoding segment A of the TA strain. Post challenge survival percentages (PCSP) showed that IWV vaccines conferred highest protection (PCSP=42-53) while nanoparticle, sub-unit recombinant and DNA vaccines fell short of the IWV vaccines in Atlantic salmon (Salmo salar L.) postsmolts challenged with the highly virulent Sp strain NVI-015 (TA strain) of IPNV after 560 degree days post vaccination. Antibody levels induced by these vaccines did not show antigenic differences between the virulent and avirulent motifs for vaccines made with the same antigen dose and delivery system after 8 weeks post vaccination. Our findings show that fish vaccinated with less potent vaccines comprising of nanoparticle, DNA and recombinant vaccines got infected much earlier and yielded to higher infection rates than fish vaccinated with IWV vaccines that were highly potent. Ability of the virulent (T(217)A(221)) and avirulent (P(217)T(221)) motifs to limit establishment of infection showed equal protection for vaccines made of the same antigen dose and delivery systems. Prevention of tissue damage linked to viral infection was eminent in the more potent vaccines than the less protective ones. Hence, there still remains the challenge of developing highly efficacious vaccines with the ability to eliminate the post challenge carrier state in IPNV vaccinology. Copyright © 2012 Elsevier Ltd. All rights reserved.

  8. Development and Synthesis of DNA-Encoded Benzimidazole Library.

    Science.gov (United States)

    Ding, Yun; Chai, Jing; Centrella, Paolo A; Gondo, Chenaimwoyo; DeLorey, Jennifer L; Clark, Matthew A

    2018-04-25

    Encoded library technology (ELT) is an effective approach to the discovery of novel small-molecule ligands for biological targets. A key factor for the success of the technology is the chemical diversity of the libraries. Here we report the development of DNA-conjugated benzimidazoles. Using 4-fluoro-3-nitrobenzoic acid as a key synthon, we synthesized a 320 million-member DNA-encoded benzimidazole library using Fmoc-protected amino acids, amines and aldehydes as diversity elements. Affinity selection of the library led to the discovery of a novel, potent and specific antagonist of the NK3 receptor.

  9. Production optimisation of a DNA vaccine candidate against ...

    African Journals Online (AJOL)

    Plasmid DNA (pDNA) vaccines are promising means to prevent and treat infectious diseases, such as leishmaniasis, but immunisation protocols require large amounts of supercoiled plasmid DNA (scpDNA). Although pDNA can be produced at a reasonable cost in bioreactors; this scale of production may not be the best ...

  10. Immunisation against PCV2 structural protein by DNA vaccination of mice

    DEFF Research Database (Denmark)

    Kamstrup, Søren; Barfoed, Annette Malene; Frimann, Tine

    2004-01-01

    the capsid protein of PCV2 was cloned in a DNA vaccination plasmid and expression of capsid protein was demonstrated in vitro. Mice were gene gun vaccinated three timesand all mice responded serologically by raising antibodies against PCV2. The results suggest, that DNA based vaccination might offer...

  11. Characterization and immunological identification of cDNA clones encoding two human DNA topoisomerase II isozymes

    International Nuclear Information System (INIS)

    Chung, T.D.Y.; Drake, F.H.; Tan, K.B.; Per, S.R.; Crooke, S.T.; Mirabelli, C.K.

    1989-01-01

    Several DNA topoisomerase II partial cDNA clones obtained from a human Raji-HN2 cDNA library were sequenced and two classes of nucleotide sequences were found. One member of the first class, SP1, was identical to an internal fragment of human HeLa cell Topo II cDNA described earlier. A member of the second class, SP11, shared extensive nucleotide (75%) and predicted peptide (92%) sequence similarities with the first two-thirds of HeLa Topo II. Each class of cDNAs hybridized to unique, nonoverlapping restriction enzyme fragments of genomic DNA from several human cell lines. Synthetic 24-mer oligonucleotide probes specific for each cDNA class hybridized to 6.5-kilobase mRNAs; furthermore, hybridization of probe specific for one class was not blocked by probe specific for the other. Antibodies raised against a synthetic SP1-encoded dodecapeptide specifically recognized the 170-kDa form of Topo II, while antibodies raised against the corresponding SP11-encoded dodecapeptide, or a second unique SP11-encoded tridecapeptide, selectively recognized the 180-kDa form of Topo II. These data provide genetic and immunochemical evidence for two Topo II isozymes

  12. Immunization with plasmid DNA encoding the hemagglutinin and the nucleoprotein confers robust protection against a lethal canine distemper virus challenge.

    Science.gov (United States)

    Dahl, Lotte; Jensen, Trine Hammer; Gottschalck, Elisabeth; Karlskov-Mortensen, Peter; Jensen, Tove Dannemann; Nielsen, Line; Andersen, Mads Klindt; Buckland, Robin; Wild, T Fabian; Blixenkrone-Møller, Merete

    2004-09-09

    We have investigated the protective effect of immunization of a highly susceptible natural host of canine distemper virus (CDV) with DNA plasmids encoding the viral nucleoprotein (N) and hemagglutinin (H). The combined intradermal and intramuscular routes of immunization elicited high virus-neutralizing serum antibody titres in mink (Mustela vison). To mimic natural exposure, we also conducted challenge infection by horizontal transmission from infected contact animals. Other groups received a lethal challenge infection by administration to the mucosae of the respiratory tract and into the muscle. One of the mink vaccinated with N plasmid alone developed severe disease after challenge. In contrast, vaccination with the H plasmid together with the N plasmid conferred solid protection against disease and we were unable to detect CDV infection in PBMCs or in different tissues after challenge. Our findings show that DNA immunization by the combined intradermal and intramuscular routes can confer solid protective immunity against naturally transmitted morbillivirus infection and disease.

  13. Identification of a mammalian nuclear factor and human cDNA-encoded proteins that recognize DNA containing apurinic sites

    International Nuclear Information System (INIS)

    Lenz, J.; Okenquist, S.A.; LoSardo, J.E.; Hamilton, K.K.; Doetsch, P.W.

    1990-01-01

    Damage to DNA can have lethal or mutagenic consequences for cells unless it is detected and repaired by cellular proteins. Repair depends on the ability of cellular factors to distinguish the damaged sites. Electrophoretic binding assays were used to identify a factor from the nuclei of mammalian cells that bound to DNA containing apurinic sites. A binding assay based on the use of β-galactosidase fusion proteins was subsequently used to isolate recombinant clones of human cDNAs that encoded apurinic DNA-binding proteins. Two distinct human cDNAs were identified that encoded proteins that bound apurinic DNA preferentially over undamaged, methylated, or UV-irradiated DNA. These approaches may offer a general method for the detection of proteins that recognize various types of DNA damage and for the cloning of genes encoding such proteins

  14. Eimeria maxima microneme protein 2 delivered as DNA vaccine and recombinant protein induces immunity against experimental homogenous challenge.

    Science.gov (United States)

    Huang, Jingwei; Zhang, Zhenchao; Li, Menghui; Song, Xiaokai; Yan, Ruofeng; Xu, Lixin; Li, Xiangrui

    2015-10-01

    E. maxima is one of the seven species of Eimeria that infects chicken. Until now, only a few antigenic genes of E. maxima have been reported. In the present study, the immune protective effects against E. maxima challenge of recombinant protein and DNA vaccine encoding EmMIC2 were evaluated. Two-week-old chickens were randomly divided into five groups. The experimental group of chickens was immunized with 100 μg DNA vaccine pVAX1-MIC2 or 200 μg rEmMIC2 protein while the control group of chickens was injected with pVAX1 plasmid or sterile PBS. The results showed that the anti-EmMIC2 antibody titers of both rEmMIC2 protein and pVAX1-MIC2 groups were significantly higher as compared to PBS and pVAX1 control (Pmaxima challenge and it could be an effective antigen candidate for the development of new vaccines against E. maxima. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  15. Implementation of digital image encryption algorithm using logistic function and DNA encoding

    Science.gov (United States)

    Suryadi, MT; Satria, Yudi; Fauzi, Muhammad

    2018-03-01

    Cryptography is a method to secure information that might be in form of digital image. Based on past research, in order to increase security level of chaos based encryption algorithm and DNA based encryption algorithm, encryption algorithm using logistic function and DNA encoding was proposed. Digital image encryption algorithm using logistic function and DNA encoding use DNA encoding to scramble the pixel values into DNA base and scramble it in DNA addition, DNA complement, and XOR operation. The logistic function in this algorithm used as random number generator needed in DNA complement and XOR operation. The result of the test show that the PSNR values of cipher images are 7.98-7.99 bits, the entropy values are close to 8, the histogram of cipher images are uniformly distributed and the correlation coefficient of cipher images are near 0. Thus, the cipher image can be decrypted perfectly and the encryption algorithm has good resistance to entropy attack and statistical attack.

  16. HIV-1 p24(gag derived conserved element DNA vaccine increases the breadth of immune response in mice.

    Directory of Open Access Journals (Sweden)

    Viraj Kulkarni

    Full Text Available Viral diversity is considered a major impediment to the development of an effective HIV-1 vaccine. Despite this diversity, certain protein segments are nearly invariant across the known HIV-1 Group M sequences. We developed immunogens based on the highly conserved elements from the p24(gag region according to two principles: the immunogen must (i include strictly conserved elements of the virus that cannot mutate readily, and (ii exclude both HIV regions capable of mutating without limiting virus viability, and also immunodominant epitopes located in variable regions. We engineered two HIV-1 p24(gag DNA immunogens that express 7 highly Conserved Elements (CE of 12-24 amino acids in length and differ by only 1 amino acid in each CE ('toggle site', together covering >99% of the HIV-1 Group M sequences. Altering intracellular trafficking of the immunogens changed protein localization, stability, and also the nature of elicited immune responses. Immunization of C57BL/6 mice with p55(gag DNA induced poor, CD4(+ mediated cellular responses, to only 2 of the 7 CE; in contrast, vaccination with p24CE DNA induced cross-clade reactive, robust T cell responses to 4 of the 7 CE. The responses were multifunctional and composed of both CD4(+ and CD8(+ T cells with mature cytotoxic phenotype. These findings provide a method to increase immune response to universally conserved Gag epitopes, using the p24CE immunogen. p24CE DNA vaccination induced humoral immune responses similar in magnitude to those induced by p55(gag, which recognize the virus encoded p24(gag protein. The inclusion of DNA immunogens composed of conserved elements is a promising vaccine strategy to induce broader immunity by CD4(+ and CD8(+ T cells to additional regions of Gag compared to vaccination with p55(gag DNA, achieving maximal cross-clade reactive cellular and humoral responses.

  17. The humoral immune response to recombinant nucleocapsid antigen of canine distemper virus in dogs vaccinated with attenuated distemper virus or DNA encoding the nucleocapsid of wild-type virus.

    Science.gov (United States)

    Griot-Wenk, M E; Cherpillod, P; Koch, A; Zurbriggen, R; Bruckner, L; Wittek, R; Zurbriggen, A

    2001-06-01

    This study compared the humoral immune response against the nucleocapsid-(N) protein of canine distemper virus (CDV) of dogs vaccinated with a multivalent vaccine against parvo-, adeno-, and parainfluenza virus and leptospira combined with either the attenuated CDV Onderstepoort strain (n = 15) or an expression plasmid containing the N-gene of CDV (n = 30). The vaccinations were applied intramuscularly three times at 2-week intervals beginning at the age of 6 weeks. None of the pre-immune sera recognized the recombinant N-protein, confirming the lack of maternal antibodies at this age. Immunization with DNA vaccine for CDV resulted in positive serum N-specific IgG response. However, their IgG (and IgA) titres were lower than those of CDV-vaccinated dogs. Likewise, DNA-vaccinated dogs did not show an IgM peak. There was no increase in N-specific serum IgE titres in either group. Serum titres to the other multivalent vaccine components were similar in both groups.

  18. Immunogenicity and efficacy of a bivalent DNA vaccine containing LeIF and TSA genes against murine cutaneous leishmaniasis.

    Science.gov (United States)

    Maspi, Nahid; Ghaffarifar, Fatemeh; Sharifi, Zohreh; Dalimi, Abdolhossein; Dayer, Mohammad Saaid

    2017-03-01

    There is no effective vaccine for the prevention and elimination of leishmaniasis. For this reason, we assessed the protective effects of DNA vaccines containing LeIF, TSA genes alone, or LeIF-TSA fusion against cutaneous leishmaniasis pEGFP-N1 plasmid (empty vector) and phosphate buffer saline (PBS) were used as control groups. Therefore, cellular and humoral immune responses were evaluated before and after the challenge with Leishmania major. Lesion diameter was also measured 3-12 weeks after challenge. All immunized mice with plasmid DNA encoding Leishmania antigens induced the partial immunity characterized by increased IFN-γ and IgG2a levels compared with control groups (p TSA, and LeIF-TSA, respectively, than in PBS group at 12th week post infection. IFN/IL-4 and IgG2a/IgG1 ratios indicated that group receiving LeIF-TSA fusion had the highest IFN-γ and IgG2a levels. In this study, DNA immunization promoted Th1 immune response characterized by higher IFN-γ and IgG2a levels and also reduction in lesion size. These results showed that a bivalent vaccine containing two distinct antigens may induce more potent immune responses against leishmaniasis. © 2017 APMIS. Published by John Wiley & Sons Ltd.

  19. Tattoo Delivery of a Semliki Forest Virus-Based Vaccine Encoding Human Papillomavirus E6 and E7

    Directory of Open Access Journals (Sweden)

    Stephanie van de Wall

    2015-03-01

    Full Text Available The skin is an attractive organ for immunization because of the presence of antigen-presenting cells. Intradermal delivery via tattooing has demonstrated superior vaccine immunogenicity of DNA vaccines in comparison to conventional delivery methods. In this study, we explored the efficacy of tattoo injection of a tumor vaccine based on recombinant Semliki Forest virus replicon particles (rSFV targeting human papillomavirus (HPV. Tattoo injection of rSFV particles resulted in antigen expression in both the skin and draining lymph nodes. In comparison with intramuscular injection, the overall antigen expression determined at the site of administration and draining lymph nodes was 10-fold lower upon tattoo injection. Delivery of SFV particles encoding the E6 and E7 antigens of human papillomavirus type 16 (SFVeE6,7 via tattooing resulted in HPV-specific cytotoxic T cells and in vivo therapeutic antitumor response. Strikingly, despite the observed lower overall transgene expression, SFVeE6,7 delivered via tattoo injection resulted in higher or equal levels of immune responses as compared to intramuscular injection. The intrinsic immunogenic potential of tattooing provides a benefit for immunotherapy based on an alphavirus.

  20. Tattoo Delivery of a Semliki Forest Virus-Based Vaccine Encoding Human Papillomavirus E6 and E7

    Science.gov (United States)

    van de Wall, Stephanie; Walczak, Mateusz; van Rooij, Nienke; Hoogeboom, Baukje-Nynke; Meijerhof, Tjarko; Nijman, Hans W.; Daemen, Toos

    2015-01-01

    The skin is an attractive organ for immunization because of the presence of antigen-presenting cells. Intradermal delivery via tattooing has demonstrated superior vaccine immunogenicity of DNA vaccines in comparison to conventional delivery methods. In this study, we explored the efficacy of tattoo injection of a tumor vaccine based on recombinant Semliki Forest virus replicon particles (rSFV) targeting human papillomavirus (HPV). Tattoo injection of rSFV particles resulted in antigen expression in both the skin and draining lymph nodes. In comparison with intramuscular injection, the overall antigen expression determined at the site of administration and draining lymph nodes was 10-fold lower upon tattoo injection. Delivery of SFV particles encoding the E6 and E7 antigens of human papillomavirus type 16 (SFVeE6,7) via tattooing resulted in HPV-specific cytotoxic T cells and in vivo therapeutic antitumor response. Strikingly, despite the observed lower overall transgene expression, SFVeE6,7 delivered via tattoo injection resulted in higher or equal levels of immune responses as compared to intramuscular injection. The intrinsic immunogenic potential of tattooing provides a benefit for immunotherapy based on an alphavirus. PMID:26343186

  1. A Novel Image Encryption Algorithm Based on DNA Encoding and Spatiotemporal Chaos

    Directory of Open Access Journals (Sweden)

    Chunyan Song

    2015-10-01

    Full Text Available DNA computing based image encryption is a new, promising field. In this paper, we propose a novel image encryption scheme based on DNA encoding and spatiotemporal chaos. In particular, after the plain image is primarily diffused with the bitwise Exclusive-OR operation, the DNA mapping rule is introduced to encode the diffused image. In order to enhance the encryption, the spatiotemporal chaotic system is used to confuse the rows and columns of the DNA encoded image. The experiments demonstrate that the proposed encryption algorithm is of high key sensitivity and large key space, and it can resist brute-force attack, entropy attack, differential attack, chosen-plaintext attack, known-plaintext attack and statistical attack.

  2. Production and pharmaceutical formulation of plasmid DNA vaccines

    NARCIS (Netherlands)

    van der Heijden, I.

    2013-01-01

    Research leading to the thesis ‘Production and pharmaceutical formulation of plasmid DNA vaccines‘ can be divided into two parts. The first part describes the development of a Good Manufacturing Practice (GMP) compliant plasmid DNA production process of pDNA vaccines for the treatment of Human

  3. Induction of protective immune responses in mice by double DNA ...

    African Journals Online (AJOL)

    Purpose: To investigate the efficacy of a double DNA vaccine encoding of Brucella melitensis omp31 gene and of Escherichia coli eae gene in inducing protective immune response in a mouse model. Methods: After performing PCR assays and cloning both the eae and omp31 genes, the generated DNA vaccines were ...

  4. Field testing of Schistosoma japonicum DNA vaccines in cattle in China.

    Science.gov (United States)

    Shi, Fuhui; Zhang, Yaobi; Lin, Jiaojiao; Zuo, Xin; Shen, Wei; Cai, Yiumin; Ye, Ping; Bickle, Quentin D; Taylor, Martin G

    2002-11-01

    Vaccines are needed to reduce the zoonotic reservoir of Schistosoma japonicum infection in bovines in China. We have developed two experimental DNA vaccines and have already shown these to be capable of inducing partial protection in water buffalo naturally exposed to the risk of S. japonicum infection in the field. We now report a similar field trial in cattle, the other major bovine reservoir host species in China. Groups of cattle were vaccinated with the VRSj28 vaccine or the VRSj23 vaccine, or, to test whether protection could be enhanced by combination vaccination, with both these DNA vaccines together. After vaccination, the cattle were exposed to natural infection in the field for a period of 54 days. Worm and egg counts carried out at the end of the experiment showed that each of the vaccine groups showed partial resistance, and that combined vaccination was not more effective than vaccination with the individual plasmids.

  5. Increased immunogenicity of avian influenza DNA vaccine delivered to the skin using a microneedle patch

    Science.gov (United States)

    Kim, Yeu-Chun; Song, Jae-Min; Lipatov, Aleksandr S.; Choi, Seong-O; Lee, Jeong Woo; Donis, Ruben O.; Compans, Richard W.; Kang, Sang-Moo; Prausnitz, Mark R.

    2012-01-01

    Effective public health responses to an influenza pandemic require an effective vaccine that can be manufactured and administered to large populations in the shortest possible time. In this study, we evaluated a method for vaccination against avian influenza virus that uses a DNA vaccine for rapid manufacturing and delivered by a microneedle skin patch for simplified administration and increased immunogenicity. We prepared patches containing 700 µm-long microneedles coated with an avian H5 influenza hemagglutinin DNA vaccine from A/Viet Nam/1203/04 influenza virus. The coating DNA dose increased with DNA concentration in the coating solution and the number of dip coating cycles. Coated DNA was released into the skin tissue by dissolution within minutes. Vaccination of mice using microneedles induced higher levels of antibody responses and hemagglutination inhibition titers, and improved protection against lethal infection with avian influenza as compared to conventional intramuscular delivery of the same dose of the DNA vaccine. Additional analysis showed that the microneedle coating solution containing carboxymethylcellulose and a surfactant may have negatively affected the immunogenicity of the DNA vaccine. Overall, this study shows that DNA vaccine delivery by microneedles can be a promising approach for improved vaccination to mitigate an influenza pandemic. PMID:22504442

  6. Molecular cloning of growth hormone encoding cDNA of Indian

    Indian Academy of Sciences (India)

    A modified rapid amplification of cDNA ends (RACE) strategy has been developed for cloning highly conserved cDNA sequences. Using this modified method, the growth hormone (GH) encoding cDNA sequences of Labeo rohita, Cirrhina mrigala and Catla catla have been cloned, characterized and overexpressed in ...

  7. Vacunas de ADN: inducción de la respuesta inmunitaria DNA Vaccines: Induction of the immune response

    Directory of Open Access Journals (Sweden)

    Javier Mota-Sánchez

    2009-01-01

    Full Text Available La efectividad de las vacunas y la inmunización en la prevención de las enfermedades infecciosas es uno de los grandes avances de la medicina. En la actualidad, el acceso a la tecnología de punta en el área de la genómica y la proteómica ha hecho posible acelerar el desarrollo de nuevos modelos de vacunas con características mejoradas en aspectos fundamentales, como la inmunogenicidad y la seguridad. A casi dos décadas del primer informe, en el cual se demostró que un gen puede expresarse mediante la inyección directa de ADN desnudo, las vacunas de ADN han probado ser eficientes para inducir una respuesta inmunitaria protectora contra parásitos, virus y bacterias en diversos modelos animales. Esta revisión tiene por objetivo presentar un panorama general de las vacunas de ADN y los mecanismos mediante los cuales la inmunización con antígenos insertados en vectores de ADN (plásmidos inducen una respuesta inmunitaria.The effectiveness of vaccines and immunization in the prevention of infectious diseases is one of the greatest successes in medicine. In recent years, with access to cutting edge genomic and proteomic technology, it is possible to accelerate the development of new and improved vaccines with better immunogenicity and safety characteristics. Since the first report almost two decades ago, where it was demonstrated that gene expression is possible by directed injection of naked DNA, DNA vaccines have been proven to induce protective immune responses against parasites, virus and bacterium in diverse animal disease models. This review aims to present an overview about DNA vaccines and the mechanisms by which immune responses are induced after immunization with plasmid DNA-encoded antigens.

  8. Vaccination of rhesus macaques with a vif-deleted simian immunodeficiency virus proviral DNA vaccine

    International Nuclear Information System (INIS)

    Sparger, Ellen E.; Dubie, Robert A.; Shacklett, Barbara L.; Cole, Kelly S.; Chang, W.L.; Luciw, Paul A.

    2008-01-01

    Studies in non-human primates, with simian immunodeficiency virus (SIV) and simian/human immunodeficiency virus (SHIV) have demonstrated that live-attenuated viral vaccines are highly effective; however these vaccine viruses maintain a low level of pathogenicity. Lentivirus attenuation associated with deletion of the viral vif gene carries a significantly reduced risk for pathogenicity, while retaining the potential for virus replication of low magnitude in the host. This report describes a vif-deleted simian immunodeficiency virus (SIV)mac239 provirus that was tested as an attenuated proviral DNA vaccine by inoculation of female rhesus macaques. SIV-specific interferon-γ enzyme-linked immunospot responses of low magnitude were observed after immunization with plasmid containing the vif-deleted SIV provirus. However, vaccinated animals displayed strong sustained virus-specific T cell proliferative responses and increasing antiviral antibody titers. These immune responses suggested either persistent vaccine plasmid expression or low level replication of vif-deleted SIV in the host. Immunized and unvaccinated macaques received a single high dose vaginal challenge with pathogenic SIVmac251. A transient suppression of challenge virus load and a greater median survival time was observed for vaccinated animals. However, virus loads for vaccinated and unvaccinated macaques were comparable by twenty weeks after challenge and overall survival curves for the two groups were not significantly different. Thus, a vif-deleted SIVmac239 proviral DNA vaccine is immunogenic and capable of inducing a transient suppression of pathogenic challenge virus, despite severe attenuation of the vaccine virus

  9. DNA priming for seasonal influenza vaccine: a phase 1b double-blind randomized clinical trial.

    Directory of Open Access Journals (Sweden)

    Julie E Ledgerwood

    Full Text Available The efficacy of current influenza vaccines is limited in vulnerable populations. DNA vaccines can be produced rapidly, and may offer a potential strategy to improve vaccine immunogenicity, indicated by studies with H5 influenza DNA vaccine prime followed by inactivated vaccine boost.Four sites enrolled healthy adults, randomized to receive 2011/12 seasonal influenza DNA vaccine prime (n=65 or phosphate buffered saline (PBS (n=66 administered intramuscularly with Biojector. All subjects received the 2012/13 seasonal inactivated influenza vaccine, trivalent (IIV3 36 weeks after the priming injection. Vaccine safety and tolerability was the primary objective and measurement of antibody response by hemagglutination inhibition (HAI was the secondary objective.The DNA vaccine prime-IIV3 boost regimen was safe and well tolerated. Significant differences in HAI responses between the DNA vaccine prime and the PBS prime groups were not detected in this study.While DNA priming significantly improved the response to a conventional monovalent H5 vaccine in a previous study, it was not effective in adults using seasonal influenza strains, possibly due to pre-existing immunity to the prime, unmatched prime and boost antigens, or the lengthy 36 week boost interval. Careful optimization of the DNA prime-IIV3 boost regimen as related to antigen matching, interval between vaccinations, and pre-existing immune responses to influenza is likely to be needed in further evaluations of this vaccine strategy. In particular, testing this concept in younger age groups with less prior exposure to seasonal influenza strains may be informative.ClinicalTrials.gov NCT01498718.

  10. Development of novel vaccines using DNA shuffling and screening strategies.

    Science.gov (United States)

    Locher, Christopher P; Soong, Nay Wei; Whalen, Robert G; Punnonen, Juha

    2004-02-01

    DNA shuffling and screening technologies recombine and evolve genes in vitro to rapidly obtain molecules with improved biological activity and fitness. In this way, genes from related strains are bred like plants or livestock and their successive progeny are selected. These technologies have also been called molecular breeding-directed molecular evolution. Recent developments in bioinformatics-assisted computer programs have facilitated the design, synthesis and analysis of DNA shuffled libraries of chimeric molecules. New applications in vaccine development are among the key features of DNA shuffling and screening technologies because genes from several strains or antigenic variants of pathogens can be recombined to create novel molecules capable of inducing immune responses that protect against infections by multiple strains of pathogens. In addition, molecules such as co-stimulatory molecules and cytokines have been evolved to have improved T-cell proliferation and cytokine production compared with the wild-type human molecules. These molecules can be used to immunomodulate vaccine responsiveness and have multiple applications in infectious diseases, cancer, allergy and autoimmunity. Moreover, DNA shuffling and screening technologies can facilitate process development of vaccine manufacturing through increased expression of recombinant polypeptides and viruses. Therefore, DNA shuffling and screening technologies can overcome some of the challenges that vaccine development currently faces.

  11. Recombinant invasive Lactococcus lactis can transfer DNA vaccines either directly to dendritic cells or across an epithelial cell monolayer.

    Science.gov (United States)

    de Azevedo, Marcela; Meijerink, Marjolein; Taverne, Nico; Pereira, Vanessa Bastos; LeBlanc, Jean Guy; Azevedo, Vasco; Miyoshi, Anderson; Langella, Philippe; Wells, Jerry M; Chatel, Jean-Marc

    2015-09-11

    Lactococcus lactis (L. lactis), a generally regarded as safe (GRAS) bacterium has recently been investigated as a mucosal delivery vehicle for DNA vaccines. Because of its GRAS status, L. lactis represents an attractive alternative to attenuated pathogens. Previous studies showed that eukaryotic expression plasmids could be delivered into intestinal epithelial cells (IECs) by L. lactis, or recombinant invasive strains of L. lactis, leading to heterologous protein expression. Although expression of antigens in IECs might lead to vaccine responses, it would be of interest to know whether uptake of L. lactis DNA vaccines by dendritic cells (DCs) could lead to antigen expression as they are unique in their ability to induce antigen-specific T cell responses. To test this, we incubated mouse bone marrow-derived DCs (BMDCs) with invasive L. lactis strains expressing either Staphylococcus aureus Fibronectin Binding Protein A (LL-FnBPA+), or Listeria monocytogenes mutated Internalin A (LL-mInlA+), both strains carrying a plasmid DNA vaccine (pValac) encoding for the cow milk allergen β-lactoglobulin (BLG). We demonstrated that they can transfect BMDCs, inducing the secretion of the pro-inflammatory cytokine IL-12. We also measured the capacity of strains to invade a polarized monolayer of IECs, mimicking the situation encountered in the gastrointestinal tract. Gentamycin survival assay in these cells showed that LL-mInlA+ is 100 times more invasive than L. lactis. The cross-talk between differentiated IECs, BMDCs and bacteria was also evaluated using an in vitro transwell co-culture model. Co-incubation of strains in this model showed that DCs incubated with LL-mInlA+ containing pValac:BLG could express significant levels of BLG. These results suggest that DCs could sample bacteria containing the DNA vaccine across the epithelial barrier and express the antigen. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  12. Membrane and envelope virus proteins co-expressed as lysosome associated membrane protein (LAMP fused antigens: a potential tool to develop DNA vaccines against flaviviruses

    Directory of Open Access Journals (Sweden)

    Rafael Dhalia

    2009-12-01

    Full Text Available Vaccination is the most practical and cost-effective strategy to prevent the majority of the flavivirus infection to which there is an available vaccine. However, vaccines based on attenuated virus can potentially promote collateral side effects and even rare fatal reactions. Given this scenario, the developent of alternative vaccination strategies such as DNA-based vaccines encoding specific flavivirus sequences are being considered. Endogenous cytoplasmic antigens, characteristically plasmid DNA-vaccine encoded, are mainly presented to the immune system through Major Histocompatibility Complex class I - MHC I molecules. The MHC I presentation via is mostly associated with a cellular cytotoxic response and often do not elicit a satisfactory humoral response. One of the main strategies to target DNA-encoded antigens to the MHC II compartment is expressing the antigen within the Lysosome-Associated Membrane Protein (LAMP. The flavivirus envelope protein is recognized as the major virus surface protein and the main target for neutralizing antibodies. Different groups have demonstrated that co-expression of flavivirus membrane and envelope proteins in mammalian cells, fused with the carboxyl-terminal of LAMP, is able to induce satisfactory levels of neutralizing antibodies. Here we reviewed the use of the envelope flavivirus protein co-expression strategy as LAMP chimeras with the aim of developing DNA vaccines for dengue, West Nile and yellow fever viruses.A vacinação é a estratégia mais prática e o melhor custo-benefício para prevenir a maioria das infecções dos flavivirus, para os quais existe vacina disponível. Entretanto, as vacinas baseadas em vírus atenuados podem potencialmente promover efeitos colaterais e, mais raramente, reações fatais. Diante deste cenário, o desenvolvimento de estratégias alternativas de vacinação, como vacinas baseadas em DNA codificando seqüências específicas dos flavivirus, está sendo considerado

  13. Protection of Rhesus Monkeys by a DNA Prime/Poxvirus Boost Malaria Vaccine Depends on Optimal DNA Priming and Inclusion of Blood Stage Antigens

    Science.gov (United States)

    Weiss, Walter R.; Kumar, Anita; Jiang, George; Williams, Jackie; Bostick, Anthony; Conteh, Solomon; Fryauff, David; Aguiar, Joao; Singh, Manmohan; O'Hagan, Derek T.; Ulmer, Jeffery B.; Richie, Thomas L.

    2007-01-01

    Background We have previously described a four antigen malaria vaccine consisting of DNA plasmids boosted by recombinant poxviruses which protects a high percentage of rhesus monkeys against Plasmodium knowlesi (Pk) malaria. This is a multi-stage vaccine that includes two pre-erythrocytic antigens, PkCSP and PkSSP2(TRAP), and two erythrocytic antigens, PkAMA-1 and PkMSP-1(42kD). The present study reports three further experiments where we investigate the effects of DNA dose, timing, and formulation. We also compare vaccines utilizing only the pre-erythrocytic antigens with the four antigen vaccine. Methodology In three experiments, rhesus monkeys were immunized with malaria vaccines using DNA plasmid injections followed by boosting with poxvirus vaccine. A variety of parameters were tested, including formulation of DNA on poly-lactic co-glycolide (PLG) particles, varying the number of DNA injections and the amount of DNA, varying the interval between the last DNA injection to the poxvirus boost from 7 to 21 weeks, and using vaccines with from one to four malaria antigens. Monkeys were challenged with Pk sporozoites given iv 2 to 4 weeks after the poxvirus injection, and parasitemia was measured by daily Giemsa stained blood films. Immune responses in venous blood samples taken after each vaccine injection were measured by ELIspot production of interferon-γ, and by ELISA. Conclusions 1) the number of DNA injections, the formulation of the DNA plasmids, and the interval between the last DNA injection and the poxvirus injection are critical to vaccine efficacy. However, the total dose used for DNA priming is not as important; 2) the blood stage antigens PkAMA-1 and PkMSP-1 were able to protect against high parasitemias as part of a genetic vaccine where antigen folding is not well defined; 3) immunization with PkSSP2 DNA inhibited immune responses to PkCSP DNA even when vaccinations were given into separate legs; and 4) in a counter-intuitive result, higher

  14. Immunotherapy against visceral leishmaniasis with the nucleoside hydrolase-DNA vaccine of Leishmania donovani.

    Science.gov (United States)

    Gamboa-León, R; Paraguai de Souza, E; Borja-Cabrera, G P; Santos, F N; Myashiro, L M; Pinheiro, R O; Dumonteil, E; Palatnik-de-Sousa, C B

    2006-05-29

    The nucleoside hydrolase (NH36) of Leishmania (L.) donovani is a vital enzyme which releases purines or pyrimidines of foreign DNA to be used in the synthesis of parasite DNA. As a bivalent DNA vaccine, the VR1012-NH36 was immunoprotective against visceral and cutaneous murine leishmaniasis. In this work we tested the immunotherapy against Leishmania (L.) chagasi infection, using two doses of 100 or 20 microg VR1012-NH36 vaccine (i.m. route), and, as a possible immunomodulator, aqueous garlic extract (8 mg/kg/day by the i.p. route), which was effective in immunotherapy of cutaneous murine leishmaniasis. Liver parasitic load was significantly reduced following treatment with 100 microg (91%) and 20 microg (77%) of the DNA vaccine, and by 20 microg DNA vaccine and garlic extract (76%) (p=0.023). Survival was 33% for saline controls, 100% for the 100 microg vaccine, and 83 and 67% for the 20 microg vaccine with and without garlic extract addition, respectively. Garlic treatment alone did not reduce parasite load (p>0.05), but increased survival (100%). The NH36-DNA vaccine was highly effective as a new tool for the therapy and control of visceral leishmaniasis, while the mild protective effect of garlic might be related to an unspecific enhancement of IFN-gamma secretion.

  15. Protective effect of a polyvalent influenza DNA vaccine in pigs

    DEFF Research Database (Denmark)

    Karlsson, Ingrid; Borggren, Marie; Rosenstierne, Maiken Worsøe

    2018-01-01

    Background Influenza A virus in swine herds represents a major problem for the swine industry and poses a constant threat for the emergence of novel pandemic viruses and the development of more effective influenza vaccines for pigs is desired. By optimizing the vector backbone and using a needle...... needle-free delivery to the skin, we immunized pigs with two different doses (500 μg and 800 μg) of an influenza DNA vaccine based on six genes of pandemic origin, including internally expressed matrix and nucleoprotein and externally expressed hemagglutinin and neuraminidase as previously demonstrated....... Two weeks following immunization, the pigs were challenged with the 2009 pandemic H1N1 virus. Results When challenged with 2009 pandemic H1N1, 0/5 vaccinated pigs (800 μg DNA) became infected whereas 5/5 unvaccinated control pigs were infected. The pigs vaccinated with the low dose (500 μg DNA) were...

  16. Improved vaccine protection against retrovirus infection after co-administration of adenoviral vectors encoding viral antigens and type I interferon subtypes

    Directory of Open Access Journals (Sweden)

    Groitl Peter

    2011-09-01

    Full Text Available Abstract Background Type I interferons (IFNs exhibit direct antiviral effects, but also distinct immunomodulatory properties. In this study, we analyzed type I IFN subtypes for their effect on prophylactic adenovirus-based anti-retroviral vaccination of mice against Friend retrovirus (FV or HIV. Results Mice were vaccinated with adenoviral vectors encoding FV Env and Gag proteins alone or in combination with vectors encoding IFNα1, IFNα2, IFNα4, IFNα5, IFNα6, IFNα9 or IFNβ. Only the co-administration of adenoviral vectors encoding IFNα2, IFNα4, IFNα6 and IFNα9 resulted in strongly improved immune protection of vaccinated mice from subsequent FV challenge infection with high control over FV-induced splenomegaly and reduced viral loads. The level of protection correlated with augmented virus-specific CD4+ T cell responses and enhanced antibody titers. Similar results were obtained when mice were vaccinated against HIV with adenoviral vectors encoding HIV Env and Gag-Pol in combination with various type I IFN encoding vectors. Here mainly CD4+ T cell responses were enhanced by IFNα subtypes. Conclusions Our results indicate that certain IFNα subtypes have the potential to improve the protective effect of adenovirus-based vaccines against retroviruses. This correlated with augmented virus-specific CD4+ T cell and antibody responses. Thus, co-expression of select type I IFNs may be a valuable tool for the development of anti-retroviral vaccines.

  17. DNA-encoded libraries - an efficient small molecule discovery technology for the biomedical sciences.

    Science.gov (United States)

    Kunig, Verena; Potowski, Marco; Gohla, Anne; Brunschweiger, Andreas

    2018-06-27

    DNA-encoded compound libraries are a highly attractive technology for the discovery of small molecule protein ligands. These compound collections consist of small molecules covalently connected to individual DNA sequences carrying readable information about the compound structure. DNA-tagging allows for efficient synthesis, handling and interrogation of vast numbers of chemically synthesized, drug-like compounds. They are screened on proteins by an efficient, generic assay based on Darwinian principles of selection. To date, selection of DNA-encoded libraries allowed for the identification of numerous bioactive compounds. Some of these compounds uncovered hitherto unknown allosteric binding sites on target proteins; several compounds proved their value as chemical biology probes unraveling complex biology; and the first examples of clinical candidates that trace their ancestry to a DNA-encoded library were reported. Thus, DNA-encoded libraries proved their value for the biomedical sciences as a generic technology for the identification of bioactive drug-like molecules numerous times. However, large scale experiments showed that even the selection of billions of compounds failed to deliver bioactive compounds for the majority of proteins in an unbiased panel of target proteins. This raises the question of compound library design.

  18. Immuno-efficacy of DNA vaccines encoding PLP1 and ROP18 against experimental Toxoplasma gondii infection in mice.

    Science.gov (United States)

    Chen, Yajun; Yu, Miao; Hemandez, J A; Li, Jiexi; Yuan, Zi-Guo; Yan, Haikuo

    2018-05-01

    We constructed a new plasmid pIRESneo/ROP18/PLP1 that was injected intramuscularly into Kunming mice to evaluate its immune efficacy. The immunized mice exhibited significantly increased serum IgG2a levels, lymphocyte counts and Th1-type cytokine (IL-2, IL-12 and IFN-γ) levels. Moreover, the immunized mice exhibited longer survival times (44.7 ± 2.1 days for ROP18/PLP1 and 47.2 ± 2.9 days for ROP18/PLP1 + IL-18) and lower brain cyst burden (68.9% for ROP18/PLP1 and 72.4% for ROP18/PLP1 + IL-18) than control mice after T. gondii challenge. Our results demonstrate that the multiple-gene DNA vaccine including both ROP18 and PLP1 elicits greater protection against T. gondii challenge and stronger immunogenicity than single-gene vaccines. Copyright © 2018 Elsevier Inc. All rights reserved.

  19. Heterologous prime-boost vaccination with DNA and MVA vaccines, expressing HIV-1 subtype C mosaic Gag virus-like particles, is highly immunogenic in mice.

    Directory of Open Access Journals (Sweden)

    Ros Chapman

    Full Text Available In an effort to make affordable vaccines suitable for the regions most affected by HIV-1, we have constructed stable vaccines that express an HIV-1 subtype C mosaic Gag immunogen (BCG-GagM, MVA-GagM and DNA-GagM. Mosaic immunogens have been designed to address the tremendous diversity of this virus. Here we have shown that GagM buds from cells infected and transfected with MVA-GagM and DNA-GagM respectively and forms virus-like particles. Previously we showed that a BCG-GagM prime MVA-GagM boost generated strong cellular immune responses in mice. In this study immune responses to the DNA-GagM and MVA-GagM vaccines were evaluated in homologous and heterologous prime-boost vaccinations. The DNA homologous prime boost vaccination elicited predominantly CD8+ T cells while the homologous MVA vaccination induced predominantly CD4+ T cells. A heterologous DNA-GagM prime MVA-GagM boost induced strong, more balanced Gag CD8+ and CD4+ T cell responses and that were predominantly of an effector memory phenotype. The immunogenicity of the mosaic Gag (GagM was compared to a naturally occurring subtype C Gag (GagN using a DNA homologous vaccination regimen. DNA-GagN expresses a natural Gag with a sequence that was closest to the consensus sequence of subtype C viruses sampled in South Africa. DNA-GagM homologous vaccination induced cumulative HIV-1 Gag-specific IFN-γ ELISPOT responses that were 6.5-fold higher than those induced by the DNA-GagN vaccination. Similarly, DNA-GagM vaccination generated 7-fold higher levels of cytokine-positive CD8+ T cells than DNA-GagN, indicating that this subtype C mosaic Gag elicits far more potent immune responses than a consensus-type Gag. Cells transfected and infected with DNA-GagM and MVA-GagM respectively, expressed high levels of GagM and produced budding virus-like particles. Our data indicates that a heterologous prime boost regimen using DNA and MVA vaccines expressing HIV-1 subtype C mosaic Gag is highly

  20. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Namhai Chua; Kush, A.

    1993-02-16

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids.

  1. DNA-encoded chemical libraries: advancing beyond conventional small-molecule libraries.

    Science.gov (United States)

    Franzini, Raphael M; Neri, Dario; Scheuermann, Jörg

    2014-04-15

    DNA-encoded chemical libraries (DECLs) represent a promising tool in drug discovery. DECL technology allows the synthesis and screening of chemical libraries of unprecedented size at moderate costs. In analogy to phage-display technology, where large antibody libraries are displayed on the surface of filamentous phage and are genetically encoded in the phage genome, DECLs feature the display of individual small organic chemical moieties on DNA fragments serving as amplifiable identification barcodes. The DNA-tag facilitates the synthesis and allows the simultaneous screening of very large sets of compounds (up to billions of molecules), because the hit compounds can easily be identified and quantified by PCR-amplification of the DNA-barcode followed by high-throughput DNA sequencing. Several approaches have been used to generate DECLs, differing both in the methods used for library encoding and for the combinatorial assembly of chemical moieties. For example, DECLs can be used for fragment-based drug discovery, displaying a single molecule on DNA or two chemical moieties at the extremities of complementary DNA strands. DECLs can vary substantially in the chemical structures and the library size. While ultralarge libraries containing billions of compounds have been reported containing four or more sets of building blocks, also smaller libraries have been shown to be efficient for ligand discovery. In general, it has been found that the overall library size is a poor predictor for library performance and that the number and diversity of the building blocks are rather important indicators. Smaller libraries consisting of two to three sets of building blocks better fulfill the criteria of drug-likeness and often have higher quality. In this Account, we present advances in the DECL field from proof-of-principle studies to practical applications for drug discovery, both in industry and in academia. DECL technology can yield specific binders to a variety of target

  2. Protective Immunity Induced by DNA Vaccination against Ranavirus Infection in Chinese Giant Salamander Andrias davidianus

    Directory of Open Access Journals (Sweden)

    Zhong-Yuan Chen

    2018-01-01

    Full Text Available Andrias davidianus ranavirus (ADRV is an emerging viral pathogen that causes severe systemic hemorrhagic disease in Chinese giant salamanders. There is an urgent need for developing an effective vaccine against this fatal disease. In this study, DNA vaccines containing the ADRV 2L gene (pcDNA-2L and the 58L gene (pcDNA-58L were respectively constructed, and their immune protective effects were evaluated in Chinese giant salamanders. In vitro and in vivo expression of the vaccine plasmids were confirmed in transfected cells and muscle tissues of vaccinated Chinese giant salamanders by using immunoblot analysis or RT-PCR. Following ADRV challenge, the Chinese giant salamanders vaccinated with pcDNA-2L showed a relative percent survival (RPS of 66.7%, which was significant higher than that in Chinese giant salamanders immunized with pcDNA-58L (RPS of 3.3%. Moreover, the specific antibody against ADRV was detected in Chinese giant salamanders vaccinated with pcDNA-2L at 14 and 21 days post-vaccination by indirect enzyme-linked immunosorbent assay (ELISA. Transcriptional analysis revealed that the expression levels of immune-related genes including type I interferon (IFN, myxovirus resistance (Mx, major histocompatibility complex class IA (MHC IA, and immunoglobulin M (IgM were strongly up-regulated after vaccination with pcDNA-2L. Furthermore, vaccination with pcDNA-2L significantly suppressed the virus replication, which was seen by a low viral load in the spleen of Chinese giant salamander survivals after ADRV challenge. These results indicated that pcDNA-2L could induce a significant innate immune response and an adaptive immune response involving both humoral and cell-mediated immunity that conferred effective protection against ADRV infection, and might be a potential vaccine candidate for controlling ADRV disease in Chinese giant salamanders.

  3. Horse cDNA clones encoding two MHC class I genes

    Energy Technology Data Exchange (ETDEWEB)

    Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.

    1994-12-31

    Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

  4. Saccharomyces boulardii improves humoral immune response to DNA vaccines against leptospirosis.

    Science.gov (United States)

    Silveira, Marcelle Moura; Conceição, Fabricio Rochedo; Mendonça, Marcelo; Moreira, Gustavo Marçal Schmidt Garcia; Da Cunha, Carlos Eduardo Pouey; Conrad, Neida Lucia; Oliveira, Patrícia Diaz de; Hartwig, Daiane Drawanz; De Leon, Priscila Marques Moura; Moreira, Ângela Nunes

    2017-02-01

    Saccharomyces boulardii may improve the immune response by enhancing the production of anti-inflammatory cytokines, T-cell proliferation and dendritic cell activation. The immunomodulator effect of this probiotic has never been tested with DNA vaccines, which frequently induce low antibody titers. This study evaluated the capacity of Saccharomyces boulardii to improve the humoral and cellular immune responses using DNA vaccines coding for the leptospiral protein fragments LigAni and LigBrep. BALB/c mice were fed with rodent-specific feed containing 108 c.f.u. of Saccharomycesboulardii per gram. Animals were immunized three times intramuscularly with 100 µg of pTARGET plasmids containing the coding sequences for the above mentioned proteins. Antibody titers were measured by indirect ELISA. Expression levels of IL-4, IL-10, IL-12, IL-17, IFN-γ and TGF-β were determined by quantitative real-time PCR from RNA extracted from whole blood, after an intraperitoneal boost with 50 µg of the recombinant proteins.Results/Key findings. Antibody titers increased significantly after the second and third application when pTARGET/ligAni and pTARGET/ligBrep were used to vaccinate the animals in comparison with the control group (PSaccharomyces boulardii. The results suggested that Saccharomyces boulardii has an immunomodulator effect in DNA vaccines, mainly by stimulating the humoral response, which is often limited in this kind of vaccine. Therefore, the use of Saccharomyces boulardii as immunomodulator represents a new alternative strategy for more efficient DNA vaccination.

  5. Vaccination with a Plasmodium chabaudi adami multivalent DNA vaccine cross-protects A/J mice against challenge with P. c. adami DK and virulent Plasmodium chabaudi chabaudi AS parasites.

    Science.gov (United States)

    Scorza, T; Grubb, K; Cambos, M; Santamaria, C; Tshikudi Malu, D; Spithill, T W

    2008-06-01

    A current goal of malaria vaccine research is the development of vaccines that will cross-protect against multiple strains of malaria. In the present study, the breadth of cross-reactivity induced by a 30K multivalent DNA vaccine has been evaluated in susceptible A/J mice (H-2a) against infection with the Plasmodium chabaudi adami DK strain and a virulent parasite subspecies, Plasmodium chabaudi chabaudi AS. Immunized A/J mice were significantly protected against infection with both P. c. adami DK (31-40% reduction in cumulative parasitemia) and P. c. chabaudi AS parasites, where a 30-39% reduction in cumulative parasitemia as well as enhanced survival was observed. The 30K vaccine-induced specific IFN-gamma production by splenocytes in response to native antigens from both P. c. chabaudi AS and P. c. adami DK. Specific antibodies reacting with surface antigens expressed on P. c. adami DS and P. c. chabaudi AS infected red blood cells, and with opsonizing properties, were detected. These results suggest that multivalent vaccines encoding conserved antigens can feasibly induce immune cross-reactivity that span Plasmodium strains and subspecies and can protect hosts of distinct major histocompatibility complex haplotypes.

  6. Induction of protective and therapeutic anti-pancreatic cancer immunity using a reconstructed MUC1 DNA vaccine

    International Nuclear Information System (INIS)

    Rong, Yefei; Jin, Dayong; Wu, Wenchuan; Lou, Wenhui; Wang, Danshong; Kuang, Tiantao; Ni, Xiaoling; Qin, Xinyu

    2009-01-01

    Pancreatic cancer is a common, highly lethal disease with a rising incidence. MUC1 is a tumor-associated antigen that is over-expressed in pancreatic adenocarcinoma. Active immunotherapy that targets MUC1 could have great treatment value. Here we investigated the preventive and therapeutic effect of a MUC1 DNA vaccine on the pancreatic cancer. MUC1-various tandem repeat units(VNTR) DNA vaccine was produced by cloning one repeat of VNTR and inserting the cloned gene into the pcDNA3.1. In the preventive group, female C57BL/6 mice were immunized with the vaccine, pcDNA3.1 or PBS; and challenged with panc02-MUC1 or panc02 cell. In the therapeutic group the mice were challenged with panc02-MUC1 or panc02 cell, and then immunized with the vaccine, pcDNA3.1 or PBS. The tumor size and the survival time of the animals were compared between these groups. The DNA vaccine pcDNA3.1-VNTR could raise cytotoxic T lymphocyte (CTL) activity specific for MUC1. In the preventive experiment, the mice survival time was significantly longer in the vaccine group than in the control groups (P < 0.05). In the therapeutic experiment, the DNA vaccine prolonged the survival time of the panc02-MUC1-bearing mice (P < 0.05). In both the preventive and therapeutic experiments, the tumor size was significantly less in the vaccine group than in the control groups (P < 0.05). This pcDNA3.1-VNTR vaccine, however, could not prevent the mice attacked by panc02 cells and had no therapeutic effect on the mice attacked by panc02 cells. The MUC1 DNA vaccine pcDNA3.1-VNTR could induce a significant MUC1-specific CTL response; and had both prophylactic and therapeutic effect on panc02-MUC1 tumors. This vaccine might be used as a new adjuvant strategy against pancreatic cancer

  7. Recombinant Breast Cancer Vaccines

    National Research Council Canada - National Science Library

    Pilon, Shari

    1999-01-01

    .... To generate cytosolic proteins, (cytE2, cytE2A), the ER signal sequence was deleted. Vaccination of BALB/c mice with DNA encoding transmembrane E2 or E2A induced anti-ErbB-2 antibodies and anti-tumor immunity, with E2 being more potent than E2A...

  8. Ebola Vaccination Using a DNA Vaccine Coated on PLGA-PLL/γPGA Nanoparticles Administered Using a Microneedle Patch.

    Science.gov (United States)

    Yang, Hung-Wei; Ye, Ling; Guo, Xin Dong; Yang, Chinglai; Compans, Richard W; Prausnitz, Mark R

    2017-01-01

    Ebola DNA vaccine is incorporated into PLGA-PLL/γPGA nanoparticles and administered to skin using a microneedle (MN) patch. The nanoparticle delivery system increases vaccine thermostability and immunogenicity compared to free vaccine. Vaccination by MN patch produces stronger immune responses than intramuscular administration. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Cloning of Salmonella typhimurium DNA encoding mutagenic DNA repair

    International Nuclear Information System (INIS)

    Thomas, S.M.; Sedgwick, S.G.

    1989-01-01

    Mutagenic DNA repair in Escherichia coli is encoded by the umuDC operon. Salmonella typhimurium DNA which has homology with E. coli umuC and is able to complement E. coli umuC122::Tn5 and umuC36 mutations has been cloned. Complementation of umuD44 mutants and hybridization with E. coli umuD also occurred, but these activities were much weaker than with umuC. Restriction enzyme mapping indicated that the composition of the cloned fragment is different from the E. coli umuDC operon. Therefore, a umu-like function of S. typhimurium has been found; the phenotype of this function is weaker than that of its E. coli counterpart, which is consistent with the weak mutagenic response of S. typhimurium to UV compared with the response in E. coli

  10. 78 FR 29698 - Availability of an Environmental Assessment for Field Testing a Canine Lymphoma Vaccine, DNA

    Science.gov (United States)

    2013-05-21

    ...] Availability of an Environmental Assessment for Field Testing a Canine Lymphoma Vaccine, DNA AGENCY: Animal and... Canine Lymphoma Vaccine, DNA. The environmental assessment, which is based on a risk analysis prepared to... biological product: Requester: Merial, Inc. Product: Canine Lymphoma Vaccine, DNA. Possible Field Test...

  11. Antiviral Biologic Produced in DNA Vaccine/Goose Platform Protects Hamsters Against Hantavirus Pulmonary Syndrome When Administered Post-exposure.

    Directory of Open Access Journals (Sweden)

    Nicole Haese

    Full Text Available Andes virus (ANDV and ANDV-like viruses are responsible for most hantavirus pulmonary syndrome (HPS cases in South America. Recent studies in Chile indicate that passive transfer of convalescent human plasma shows promise as a possible treatment for HPS. Unfortunately, availability of convalescent plasma from survivors of this lethal disease is very limited. We are interested in exploring the concept of using DNA vaccine technology to produce antiviral biologics, including polyclonal neutralizing antibodies for use in humans. Geese produce IgY and an alternatively spliced form, IgYΔFc, that can be purified at high concentrations from egg yolks. IgY lacks the properties of mammalian Fc that make antibodies produced in horses, sheep, and rabbits reactogenic in humans. Geese were vaccinated with an ANDV DNA vaccine encoding the virus envelope glycoproteins. All geese developed high-titer neutralizing antibodies after the second vaccination, and maintained high-levels of neutralizing antibodies as measured by a pseudovirion neutralization assay (PsVNA for over 1 year. A booster vaccination resulted in extraordinarily high levels of neutralizing antibodies (i.e., PsVNA80 titers >100,000. Analysis of IgY and IgYΔFc by epitope mapping show these antibodies to be highly reactive to specific amino acid sequences of ANDV envelope glycoproteins. We examined the protective efficacy of the goose-derived antibody in the hamster model of lethal HPS. α-ANDV immune sera, or IgY/IgYΔFc purified from eggs, were passively transferred to hamsters subcutaneously starting 5 days after an IM challenge with ANDV (25 LD50. Both immune sera, and egg-derived purified IgY/IgYΔFc, protected 8 of 8 and 7 of 8 hamsters, respectively. In contrast, all hamsters receiving IgY/IgYΔFc purified from normal geese (n=8, or no-treatment (n=8, developed lethal HPS. These findings demonstrate that the DNA vaccine/goose platform can be used to produce a candidate antiviral

  12. HIV-1 Env DNA vaccine plus protein boost delivered by EP expands B- and T-cell responses and neutralizing phenotype in vivo.

    Directory of Open Access Journals (Sweden)

    Kar Muthumani

    Full Text Available An effective HIV vaccine will most likely require the induction of strong T-cell responses, broadly neutralizing antibodies (bNAbs, and the elicitation of antibody-dependent cellular cytotoxicity (ADCC. Previously, we demonstrated the induction of strong HIV/SIV cellular immune responses in macaques and humans using synthetic consensus DNA immunogens delivered via adaptive electroporation (EP. However, the ability of this improved DNA approach to prime for relevant antibody responses has not been previously studied. Here, we investigate the immunogenicity of consensus DNA constructs encoding gp140 sequences from HIV-1 subtypes A, B, C and D in a DNA prime-protein boost vaccine regimen. Mice and guinea pigs were primed with single- and multi-clade DNA via EP and boosted with recombinant gp120 protein. Sera were analyzed for gp120 binding and induction of neutralizing antibody activity. Immunization with recombinant Env protein alone induced low-titer binding antibodies with limited neutralization breath. In contrast, the synthetic DNA prime-protein boost protocol induced significantly higher antibody binding titers. Furthermore, sera from DNA prime-protein boost groups were able to neutralize a broader range of viruses in a panel of tier 1 clade B viruses as well as multiple tier 1 clade A and clade C viruses. Further investigation of synthetic DNA prime plus adaptive EP plus protein boost appears warranted.

  13. DNA vaccine protects ornamental koi (Cyprinus carpio koi) against North American spring viremia of carp virus

    Science.gov (United States)

    Emmenegger, E.J.; Kurath, G.

    2008-01-01

    The emergence of spring viremia of carp virus (SVCV) in the United States constitutes a potentially serious alien pathogen threat to susceptible fish stocks in North America. A DNA vaccine with an SVCV glycoprotein (G) gene from a North American isolate was constructed. In order to test the vaccine a challenge model utilizing a specific pathogen-free domestic koi stock and a cold water stress treatment was also developed. We have conducted four trial studies demonstrating that the pSGnc DNA vaccine provided protection in vaccinated fish against challenge at low, moderate, and high virus doses of the homologous virus. The protection was significant (p DNA immunized fish were challenged 28-days post-vaccination (546 degree-days) and experienced low mortalities varying from 10 to 50% with relative percent survivals ranging from 50 to 88%. The non-vaccinated controls and mock construct vaccinated fish encountered high cumulative percent mortalities ranging from 70 to 100%. This is the first report of a SVCV DNA vaccine being tested successfully in koi. These experiments prove that the SVCV DNA (pSGnc) vaccine can elicit specific reproducible protection and validates its potential use as a prophylactic vaccine in koi and other vulnerable North American fish stocks.

  14. Cloning, sequencing and expression of cDNA encoding growth ...

    Indian Academy of Sciences (India)

    Unknown

    of medicine, animal husbandry, fish farming and animal ..... northern pike (Esox lucius) growth hormone; Mol. Mar. Biol. ... prolactin 1-luciferase fusion gene in African catfish and ... 1988 Cloning and sequencing of cDNA that encodes goat.

  15. Modulation of immune response to rDNA hepatitis B vaccination by psychological stress

    NARCIS (Netherlands)

    L. Jabaaij (Lea); J. van Hattum (Jan); A.J.J.M. Vingerhoets (Ad); F.G. Oostveen (Frank); H.J. Duivenvoorden (Hugo); R.E. Ballieux (Rudy)

    1996-01-01

    textabstractIn a previous study it was shown that antibody formation after vaccination with a low-dose recombinant DNA (rDNA) hepatitis B vaccine was negatively influenced by psychological stress. The present study was designed to assess whether the same inverse relation between HBs-antibody levels

  16. Duck enteritis virus glycoprotein D and B DNA vaccines induce immune responses and immunoprotection in Pekin ducks.

    Science.gov (United States)

    Zhao, Yan; Cao, Yongsheng; Cui, Lihong; Ma, Bo; Mu, Xiaoyu; Li, Yanwei; Zhang, Zhihui; Li, Dan; Wei, Wei; Gao, Mingchun; Wang, Junwei

    2014-01-01

    DNA vaccine is a promising strategy for protection against virus infection. However, little is known on the efficacy of vaccination with two plasmids for expressing the glycoprotein D (gD) and glycoprotein B (gB) of duck enteritis virus (DEV) in inducing immune response and immunoprotection against virulent virus infection in Pekin ducks. In this study, two eukaryotic expressing plasmids of pcDNA3.1-gB and pcDNA3.1-gD were constructed. Following transfection, the gB and gD expressions in DF1 cells were detected. Groups of ducks were vaccinated with pcDNA3.1-gB and/or pcDNA3.1-gD, and boosted with the same vaccine on day 14 post primary vaccination. We found that intramuscular vaccinations with pcDNA3.1-gB and/or pcDNA3.1-gD, but not control plasmid, stimulated a high frequency of CD4+ and CD8+ T cells in Pekin ducks, particularly with both plasmids. Similarly, vaccination with these plasmids, particularly with both plasmids, promoted higher levels of neutralization antibodies against DEV in Pekin ducks. More importantly, vaccination with both plasmids significantly reduced the virulent DEV-induced mortality in Pekin ducks. Our data indicated that vaccination with plasmids for expressing both gB and gD induced potent cellular and humoral immunity against DEV in Pekin ducks. Therefore, this vaccination strategy may be used for the prevention of DEV infection in Pekin ducks.

  17. An endogenous immune adjuvant released by necrotic cells for enhancement of DNA vaccine potency.

    Science.gov (United States)

    Dorostkar, Rohollah; Bamdad, Taravat; Parsania, Masoud; Pouriayevali, Hassan

    2012-12-01

    Improving vaccine potency in the induction of a strong cell-mediated cytotoxicity can enhance the efficacy of vaccines. Necrotic cells and the supernatant of necrotic tumor cells are attractive adjuvants, on account of their ability to recruit antigen-presenting cells to the site of antigen synthesis as well as its ability to stimulate the maturation of dendritic cells. To evaluate the utility of supernatant of necrotic tumor cells as a DNA vaccine adjuvant in a murine model. The supernatant of EL4 necrotic cells was co-administered with a DNA vaccine expressing the glycoprotein B of Herpes simplex virus-1 as an antigen model under the control of Cytomegalovirus promoter. C57BL/6 mice were vaccinated three times at two weeks intervals with glycoprotein B DNA vaccine and supernatant of necrotic EL4 cells. Five days after the last immunization, cell cytotoxicity, IFN-γ and IL-4 were evaluated. The obtained data showed that the production of IFN-γ from the splenocytes after antigenic stimulation in the presence of the supernatant of necrotic EL4 cells was significantly higher than the other groups (pEL4 cells in the mice immunized with DNA vaccine and supernatant of necrotic EL4 cells comparing to the other groups (p<0.001). The supernatant of necrotic cells contains adjuvant properties that can be considered as a candidate for tumor vaccination.

  18. Early DNA vaccination of puppies against canine distemper in the presence of maternally derived immunity.

    Science.gov (United States)

    Griot, Christian; Moser, Christian; Cherpillod, Pascal; Bruckner, Lukas; Wittek, Riccardo; Zurbriggen, Andreas; Zurbriggen, Rinaldo

    2004-01-26

    Canine distemper (CD) is a disease in carnivores caused by CD virus (CDV), a member of the morbillivirus genus. It still is a threat to the carnivore and ferret population. The currently used modified attenuated live vaccines have several drawbacks of which lack of appropriate protection from severe infection is the most outstanding one. In addition, puppies up to the age of 6-8 weeks cannot be immunized efficiently due to the presence of maternal antibodies. In this study, a DNA prime modified live vaccine boost strategy was investigated in puppies in order to determine if vaccinated neonatal dogs induce a neutralizing immune response which is supposed to protect animals from a CDV challenge. Furthermore, a single DNA vaccination of puppies, 14 days after birth and in the presence of high titers of CDV neutralizing maternal antibodies, induced a clear and significant priming effect observed as early as 3 days after the subsequent booster with a conventional CDV vaccine. It was shown that the priming effect develops faster and to higher titers in puppies preimmunized with DNA 14 days after birth than in those vaccinated 28 days after birth. Our results demonstrate that despite the presence of maternal antibodies puppies can be vaccinated using the CDV DNA vaccine, and that this vaccination has a clear priming effect leading to a solid immune response after a booster with a conventional CDV vaccine.

  19. Novel p38α MAP kinase inhibitors identified from yoctoReactor DNA-encoded small molecule library

    DEFF Research Database (Denmark)

    Petersen, L. K.; Blakskjær, P.; Chaikuad, A.

    2016-01-01

    A highly specific and potent (7 nM cellular IC50) inhibitor of p38α kinase was identified directly from a 12.6 million membered DNA-encoded small molecule library. This was achieved using the high fidelity yoctoReactor technology (yR) for preparing the DNA-encoded library, and a homogeneous...... interactions. Moreover, the crystal structure showed, that although buried in the p38α active site, the original DNA attachment point of the compound was accessible through a channel created by the distorted P-loop conformation. This study demonstrates the usability of DNA-encoded library technologies...

  20. Isolation and characterisation of the cDNA encoding a glycosylated accessory protein of pea chloroplast DNA polymerase.

    OpenAIRE

    Gaikwad, A; Tewari, K K; Kumar, D; Chen, W; Mukherjee, S K

    1999-01-01

    The cDNA encoding p43, a DNA binding protein from pea chloroplasts (ct) that binds to cognate DNA polymerase and stimulates the polymerase activity, has been cloned and characterised. The characteristic sequence motifs of hydroxyproline-rich glyco-proteins (HRGP) are present in the cDNA corres-ponding to the N-terminal domain of the mature p43. The protein was found to be highly O-arabinosylated. Chemically deglycosylated p43 (i.e. p29) retains its binding to both DNA and pea ct-DNA polymeras...

  1. Nanocarriers for DNA Vaccines: Co-Delivery of TLR-9 and NLR-2 Ligands Leads to Synergistic Enhancement of Proinflammatory Cytokine Release

    Directory of Open Access Journals (Sweden)

    Johanna Poecheim

    2015-12-01

    Full Text Available Adjuvants enhance immunogenicity of vaccines through either targeted antigen delivery or stimulation of immune receptors. Three cationic nanoparticle formulations were evaluated for their potential as carriers for a DNA vaccine, and muramyl dipeptide (MDP as immunostimulatory agent, to induce and increase immunogenicity of Mycobacterium tuberculosis antigen encoding plasmid DNA (pDNA. The formulations included (1 trimethyl chitosan (TMC nanoparticles, (2 a squalene-in-water nanoemulsion, and (3 a mineral oil-in-water nanoemulsion. The adjuvant effect of the pDNA-nanocomplexes was evaluated by serum antibody analysis in immunized mice. All three carriers display a strong adjuvant effect, however, only TMC nanoparticles were capable to bias immune responses towards Th1. pDNA naturally contains immunostimulatory unmethylated CpG motifs that are recognized by Toll-like receptor 9 (TLR-9. In mechanistic in vitro studies, activation of TLR-9 and the ability to enhance immunogenicity by simultaneously targeting TLR-9 and NOD-like receptor 2 (NLR-2 was determined by proinflammatory cytokine release in RAW264.7 macrophages. pDNA in combination with MDP was shown to significantly increase proinflammatory cytokine release in a synergistic manner, dependent on NLR-2 activation. In summary, novel pDNA-Ag85A loaded nanoparticle formulations, which induce antigen specific immune responses in mice were developed, taking advantage of the synergistic combinations of TLR and NLR agonists to increase the adjuvanticity of the carriers used.

  2. Development of Tat-Conjugated Dendrimer for Transdermal DNA Vaccine Delivery.

    Science.gov (United States)

    Bahadoran, Azadeh; Moeini, Hassan; Bejo, Mohd Hair; Hussein, Mohd Zobir; Omar, Abdul Rahman

    In order to enhance cellular uptake and to facilitate transdermal delivery of DNA vaccine, polyamidoamine (PAMAM) dendrimers conjugated with HIV transactivator of transcription (TAT) was developed. First, the plasmid DNA (pIRES-H5/GFP) nanoparticle was formulated using PAMAM dendrimer and TAT peptide and then characterized for surface charge, particle size, DNA encapsulation and protection of the pIRES-H5/GFP DNA plasmid to enzymatic digestion. Subsequently, the potency of the TAT-conjugated dendrimer for gene delivery was evaluated through in vitro transfection into Vero cells followed by gene expression analysis including western blotting, fluorescent microscopy and PCR. The effect of the TAT peptide on cellular uptake of DNA vaccine was studied by qRT-PCR and flow cytometry. Finally, the ability of TAT-conjugated PAMAM dendrimer for transdermal delivery of the DNA plasmid was assessed through artificial membranes followed by qRT-PCR and flow cytometry. TAT-conjugated PAMAM dendrimer showed the ability to form a compact and nanometre-sized polyplexes with the plasmid DNA, having the size range of 105 to 115 nm and a positive charge of +42 to +45 mV over the N/P ratio of 6:1(+/-).  In vitro transfection analysis into Vero cells confirms the high potency of TAT-conjugated PAMAM dendrimer to enhance the cellular uptake of DNA vaccine.  The permeability value assay through artificial membranes reveals that TAT-conjugated PAMAM has more capacity for transdermal delivery of the DNA compared to unmodified PAMAM dendrimer (Pdendrimer is a promising non-viral vector for transdermal use.This article is open to POST-PUBLICATION REVIEW. Registered readers (see "For Readers") may comment by clicking on ABSTRACT on the issue's contents page.

  3. Elimination of immunodominant epitopes from multispecific DNA-based vaccines allows induction of CD8 T cells that have a striking antiviral potential

    DEFF Research Database (Denmark)

    Riedl, Petra; Wieland, Andreas; Lamberth, Kasper

    2009-01-01

    Immunodominance limits the TCR diversity of specific antiviral CD8 T cell responses elicited by vaccination or infection. To prime multispecific T cell responses, we constructed DNA vaccines that coexpress chimeric, multidomain Ags (with CD8 T cell-defined epitopes of the hepatitis B virus (HBV...... cell immunity by multidomain Ags. The "weak" (i.e., easily suppressed) K(b)/C(93-100)-specific CD8 T cell response was efficiently elicited by a HBV core Ag-encoding vector in 1.4HBV-S(mut) tg mice (that harbor a replicating HBV genome that produces HBV surface, core, and precore Ag in the liver). K......(b)/C(93-100)-specific CD8 T cells accumulated in the liver of vaccinated 1.4HBV-S(mut) transgenic mice where they suppressed HBV replication. Subdominant epitopes in vaccines can hence prime specific CD8 T cell immunity in a tolerogenic milieu that delivers specific antiviral effects to HBV...

  4. Conservation in gene encoding Mycobacterium tuberculosis antigen Rv2660 and a high predicted population coverage of H56 multistage vaccine in South Africa.

    Science.gov (United States)

    Perez-Martinez, Angy P; Ong, Edison; Zhang, Lixin; Marrs, Carl F; He, Yongqun; Yang, Zhenhua

    2017-11-01

    H56/AERAS-456+IC31 (H56), composed of two early secretion proteins, Ag85B and ESAT-6, and a latency associated protein, Rv2660, and the IC31 Intercell adjuvant, is a new fusion subunit vaccine candidate designed to induce immunity against both new infection and reactivation of latent tuberculosis infection. Efficacy of subunit vaccines may be affected by the diversity of vaccine antigens among clinical strains and the extent of recognition by the diverse HLA molecules in the recipient population. Although a previous study showed the conservative nature of Ag85B- and ESAT-6-encoding genes, genetic diversity of Rv2660c that encodes RV2660 is largely unknown. The population coverage of H56 as a whole yet remains to be assessed. The present study was conducted to address these important knowledge gaps. DNA sequence analysis of Rv2660c found no variation among 83 of the 84 investigated clinical strains belonging to four genetic lineages. H56 was predicted to have as high as 99.6% population coverage in the South Africa population using the Immune Epitope Database (IEDB) Population Coverage Tool. Further comparison of H56 population coverage between South African Blacks and Caucasians based on the phenotypic frequencies of binding MHC Class I and Class II supertype alleles found that all of the nine MHC-I and six of eight MHC-II human leukocyte antigen (HLA) supertype alleles analyzed were significantly differentially expressed between the two subpopulations. This finding suggests the presence of race-specific functional binding motifs of MHC-I and MHC-II HLA alleles, which, in turn, highlights the importance of including diverse populations in vaccine clinical evaluation. In conclusion, H56 vaccine is predicted to have a promising population coverage in South Africa; this study demonstrates the utility of integrating comparative genomics and bioinformatics in bridging animal and clinical studies of novel TB vaccines. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Sequential priming with simian immunodeficiency virus (SIV) DNA vaccines, with or without encoded cytokines, and a replicating adenovirus-SIV recombinant followed by protein boosting does not control a pathogenic SIVmac251 mucosal challenge.

    Science.gov (United States)

    Demberg, Thorsten; Boyer, Jean D; Malkevich, Nina; Patterson, L Jean; Venzon, David; Summers, Ebonita L; Kalisz, Irene; Kalyanaraman, V S; Lee, Eun Mi; Weiner, David B; Robert-Guroff, Marjorie

    2008-11-01

    Previously, combination DNA/nonreplicating adenovirus (Ad)- or poxvirus-vectored vaccines have strongly protected against SHIV(89.6P), DNAs expressing cytokines have modulated immunity elicited by DNA vaccines, and replication-competent Ad-recombinant priming and protein boosting has strongly protected against simian immunodeficiency virus (SIV) challenge. Here we evaluated a vaccine strategy composed of these promising components. Seven rhesus macaques per group were primed twice with multigenic SIV plasmid DNA with or without interleukin-12 (IL-12) DNA or IL-15 DNA. After a multigenic replicating Ad-SIV immunization, all groups received two booster immunizations with SIV gp140 and SIV Nef protein. Four control macaques received control DNA plasmids, empty Ad vector, and adjuvant. All vaccine components were immunogenic, but the cytokine DNAs had little effect. Macaques that received IL-15-DNA exhibited higher peak anti-Nef titers, a more rapid anti-Nef anamnestic response postchallenge, and expanded CD8(CM) T cells 2 weeks postchallenge compared to the DNA-only group. Other immune responses were indistinguishable between groups. Overall, no protection against intrarectal challenge with SIV(mac251) was observed, although immunized non-Mamu-A*01 macaques as a group exhibited a statistically significant 1-log decline in acute viremia compared to non-Mamu-A*01 controls. Possible factors contributing to the poor outcome include administration of cytokine DNAs to sites different from the Ad recombinants (intramuscular and intratracheal, respectively), too few DNA priming immunizations, a suboptimal DNA delivery method, failure to ensure delivery of SIV and cytokine plasmids to the same cell, and instability and short half-life of the IL-15 component. Future experiments should address these issues to determine if this combination approach is able to control a virulent SIV challenge.

  6. Hantavirus Gc induces long-term immune protection via LAMP-targeting DNA vaccine strategy.

    Science.gov (United States)

    Jiang, Dong-Bo; Zhang, Jin-Peng; Cheng, Lin-Feng; Zhang, Guan-Wen; Li, Yun; Li, Zi-Chao; Lu, Zhen-Hua; Zhang, Zi-Xin; Lu, Yu-Chen; Zheng, Lian-He; Zhang, Fang-Lin; Yang, Kun

    2018-02-01

    Hemorrhagic fever with renal syndrome (HFRS) occurs widely throughout Eurasia. Unfortunately, there is no effective treatment, and prophylaxis remains the best option against the major pathogenic agent, hantaan virus (HTNV), which is an Old World hantavirus. However, the absence of cellular immune responses and immunological memory hampers acceptance of the current inactivated HFRS vaccine. Previous studies revealed that a lysosome-associated membrane protein 1 (LAMP1)-targeting strategy involving a DNA vaccine based on the HTNV glycoprotein Gn successfully conferred long-term immunity, and indicated that further research on Gc, another HTNV antigen, was warranted. Plasmids encoding Gc and lysosome-targeted Gc, designated pVAX-Gc and pVAX-LAMP/Gc, respectively, were constructed. Proteins of interest were identified by fluorescence microscopy following cell line transfection. Five groups of 20 female BALB/c mice were subjected to the following inoculations: inactivated HTNV vaccine, pVAX-LAMP/Gc, pVAX-Gc, and, as the negative controls, pVAX-LAMP or the blank vector pVAX1. Humoral and cellular immunity were assessed by enzyme-linked immunosorbent assays (ELISAs) and 15-mer peptide enzyme-linked immunospot (ELISpot) epitope mapping assays. Repeated immunization with pVAX-LAMP/Gc enhanced adaptive immune responses, as demonstrated by the specific and neutralizing antibody titers and increased IFN-γ production. The inactivated vaccine induced a comparable humoral reaction, but the negative controls only elicited insignificant responses. Using a mouse model of HTNV challenge, the in vivo protection conferred by the inactivated vaccine and Gc-based constructs (with/without LAMP recombination) was confirmed. Evidence of pan-epitope reactions highlighted the long-term cellular response to the LAMP-targeting strategy, and histological observations indicated the safety of the LAMP-targeting vaccines. The long-term protective immune responses induced by pVAX-LAMP/Gc may be

  7. Rapid outer-surface protein C DNA tattoo vaccination protects against Borrelia afzelii infection

    NARCIS (Netherlands)

    Wagemakers, A.; Mason, L. M. K.; Oei, A.; de Wever, B.; van der Poll, T.; Bins, A. D.; Hovius, J. W. R.

    2014-01-01

    Borrelia afzelii is the predominant Borrelia species causing Lyme borreliosis in Europe. Currently there is no human vaccine against Lyme borreliosis, and most research focuses on recombinant protein vaccines against Borrelia burgdorferi sensu stricto. DNA tattooing is a novel vaccination method

  8. Enhanced Efficacy of a Codon-Optimized DNA Vaccine Encoding the Glycoprotein Precursor Gene of Lassa Virus in a Guinea Pig Disease Model When Delivered by Dermal Electroporation

    Directory of Open Access Journals (Sweden)

    Niranjan Y. Sardesai

    2013-07-01

    Full Text Available Lassa virus (LASV causes a severe, often fatal, hemorrhagic fever endemic to West Africa. Presently, there are no FDA-licensed medical countermeasures for this disease. In a pilot study, we constructed a DNA vaccine (pLASV-GPC that expressed the LASV glycoprotein precursor gene (GPC. This plasmid was used to vaccinate guinea pigs (GPs using intramuscular electroporation as the delivery platform. Vaccinated GPs were protected from lethal infection (5/6 with LASV compared to the controls. However, vaccinated GPs experienced transient viremia after challenge, although lower than the mock-vaccinated controls. In a follow-on study, we developed a new device that allowed for both the vaccine and electroporation pulse to be delivered to the dermis. We also codon-optimized the GPC sequence of the vaccine to enhance expression in GPs. Together, these innovations resulted in enhanced efficacy of the vaccine. Unlike the pilot study where neutralizing titers were not detected until after virus challenge, modest neutralizing titers were detected in guinea pigs before challenge, with escalating titers detected after challenge. The vaccinated GPs were never ill and were not viremic at any timepoint. The combination of the codon-optimized vaccine and dermal electroporation delivery is a worthy candidate for further development.

  9. Complementing nuclear techniques with DNA vaccine technologies for improving animal health

    International Nuclear Information System (INIS)

    Relucio, J.L.V.; Dacanay, M.E.K.; Maligalig, A.C.S.; Ramos, E.A.; Santos, A.D.; Torres-Villanueva, C.A.T.; Osorio, R.G.; Deocaris, C.C.

    2005-01-01

    The use of nuclear methods can enhance several features of DNA vaccines in protecting livestock against pathogens. While DNA vaccines already have several advantages over their traditional predecessors (e.g. cheap production, stability over a wide range of temperature, amenability to genetic manipulation, and no risk of reversion to pathogenicity), conventional gene delivery systems make immunization of livestock and aquaculture populations tedious. For this reason, we are developing radiation-synthesized intelligent delivery systems for DNA vaccines. We encapsulated a reporter construct pCMV·SPORT-β-gal in radiation-synthesized κ-carrageenan-polyvinylpyrrolidone microspheres IP20 (for stomach release) and IP18 (for intestinal release). The DNA-loaded polymers were orally administered to Oreochromis niloticus (black Nile tilapia), and whole organs were stained with X-gal to observe β-galactosidase activity. Intense staining was observed in the stomach regions with IP20, while minimal staining was observed with IP18. The gills, in contrast, did not express β-galactosidase activity. Our results show evidence of the successful gene delivery capabilities of radiation-synthesized microspheres. When monitoring the progress of an animal's immune response after DNA immunization, non-invasive and sensitive methods are preferred. We also evaluated chicken egg-yolk polyclonal antibody response (chIgY) after direct intramuscular inoculation of the Hepatitis B Surface antigen expression vector pRc/CMV-HBs(S). Radioimmunoassay (RIA) was done to maximize sensitivity for determining antibody levels. Polyclonal antibody titres were observed to have increased after six weeks. Results of the RIA using the chIgY were comparable to that of immunized sera. Our findings indicate that chIgY could offer a cheaper and more animal-friendly antibody source and could be derived with the advantage of epitope specificity through DNA vaccination. (author)

  10. Optimised electroporation mediated DNA vaccination for treatment of prostate cancer.

    LENUS (Irish Health Repository)

    Ahmad, Sarfraz

    2010-01-01

    ABSTRACT: BACKGROUND: Immunological therapies enhance the ability of the immune system to recognise and destroy cancer cells via selective killing mechanisms. DNA vaccines have potential to activate the immune system against specific antigens, with accompanying potent immunological adjuvant effects from unmethylated CpG motifs as on prokaryotic DNA. We investigated an electroporation driven plasmid DNA vaccination strategy in animal models for treatment of prostate cancer. METHODS: Plasmid expressing human PSA gene (phPSA) was delivered in vivo by intra-muscular electroporation, to induce effective anti-tumour immune responses against prostate antigen expressing tumours. Groups of male C57 BL\\/6 mice received intra-muscular injections of phPSA plasmid. For phPSA delivery, quadriceps muscle was injected with 50 mug plasmid. After 80 seconds, square-wave pulses were administered in sequence using a custom designed pulse generator and acustom-designed applicator with 2 needles placed through the skin central to the muscle. To determine an optimum treatment regimen, three different vaccination schedules were investigated. In a separate experiment, the immune potential of the phPSA vaccine was further enhanced with co- administration of synthetic CpG rich oligonucleotides. One week after last vaccination, the mice were challenged subcutaneously with TRAMPC1\\/hPSA (prostate cancer cell line stably expressing human PSA) and tumour growth was monitored. Serum from animals was examined by ELISA for anti-hPSA antibodies and for IFNgamma. Histological assessment of the tumours was also carried out. In vivo and in vitro cytotoxicity assays were performed with splenocytes from treated mice. RESULTS: The phPSA vaccine therapy significantly delayed the appearance of tumours and resulted in prolonged survival of the animals. Four-dose vaccination regimen provided optimal immunological effects. Co - administration of the synthetic CpG with phPSA increased anti-tumour responses

  11. Coadministration of cruzipain and GM-CSF DNAs, a new immunotherapeutic vaccine against Trypanosoma cruzi infection.

    Science.gov (United States)

    Cerny, Natacha; Sánchez Alberti, Andrés; Bivona, Augusto E; De Marzi, Mauricio C; Frank, Fernanda M; Cazorla, Silvia I; Malchiodi, Emilio L

    2016-01-01

    Therapeutic vaccine research and development are especially important in Chagas disease considering the characteristics of the chronic infection and the number of people in the Americas living with a parasite infection for decades. We have previously reported the efficacy of attenuated Salmonella enterica (S) carrying plasmid encoding cruzipain (SCz) to protect against Trypanosoma cruzi infection. In the present work we investigated whether Cz DNA vaccine immunotherapy could be effective in controlling an ongoing T. cruzi infection in mice. We here report the intramuscular administration of naked Cz DNA or the oral administration of Salmonella as Cz DNA delivery system as therapeutic vaccines in mice during acute or chronic infection. The coadministration of a plasmid encoding GM-CSF improved vaccine performance, indicating that the stimulation of innate immune cells is needed in the event of an ongoing infection. These therapeutic vaccines were able to address the response to a protective and sustained Th1 biased profile not only against Cz but also against a variety of parasite antigens. The combined therapeutic vaccine during the chronic phase of infection prevents tissue pathology as shown by a reduced level of enzyme activity characteristic of tissue damage and a tissue status compatible with normal tissue. The obtained results suggest that immunotherapy with Cz and GM-CSF DNAs, either alone or in combination with other drug treatments, may represent a promising alternative for Chagas disease therapy.

  12. Recombinant DNA specifying the human amyloid. beta. precursor protein (ABPP) encodes a 95-kDa polypeptide

    Energy Technology Data Exchange (ETDEWEB)

    Mita, S; Sadlock, J; Herbert, J; Schon, E A

    1988-10-11

    Although the ABPP gene give rise to multiple mRNAs, the primary translation product of this gene is unknown. The longest published cDNA sequences predict a 770-aa polypeptide of 87 kDa. However, in immunoblots, ABPP migrated as a single species of >92 kDa in rat brain, and in human, as a species of 95-100 kDa in non-membrane bound form, as multiple species of 110-135 kDa in membrane-associated form and as a 130-kDa species in fibroblasts. The sizes of these larger species relative to the MW of ABPP predicted from the cDNA sequences have been attributed to postranslational modification. However, the authors have isolated a cDNA (lambdaHAP2) from a human fetal muscle lambdagt11 cDNA library encoding an 843-aa polypeptide with a deduced MW of 94,642. This cDNA contains both exons encoding an 843-aa polypeptide with a deduced MW of 94.642. This cDNA contains both exons encoding the protease inhibitor domains. Primer extension analysis indicates that the 5' terminus of this cDNA is 14 nt from a transcriptional start site. This cDNA, encoding the longest ABPP described to date, may explain some of the observations on the sizes of tissue-derived ABPP.

  13. KISS1 can be used as a novel target for developing a DNA immunocastration vaccine in ram lambs.

    Science.gov (United States)

    Han, Yanguo; Liu, Guiqiong; Jiang, Xunping; Ijaz, Nabeel; Tesema, Birhanu; Xie, Guangyue

    2015-02-04

    KISS1 gene-encoding kisspeptins are critical for the onset of puberty and control of adult fertility. This study investigated whether KISS1 can be used as a novel target for immunocastration. Human KISS1 was fused with the HBsAg-S gene for constructing an antibiotic-free recombinant plasmid pKS-asd that coded for 31.168 kDa target fusion protein. Six male Hu sheep lambs were divided into two equal groups, treatment and control. The vaccine (1mg/ram lamb) prepared in saline solution was injected into lambs at weeks 0, 3 and 6 of the experiment, respectively. Vaccine efficacy was evaluated in terms of KISS1-specific IgG antibody response, serum testosterone levels, scrotal circumference, testicular weight, length and breadth, extent of testicular tissue damage, and sexual behaviour changes. The specific anti-KISS1 antibody titre in vaccinated animals was significantly higher than that in controls (pvaccinated animals showed lower serum testosterone level, testicular weight and length and smaller scrotal circumference than those in controls (pvaccinated animals was suppressed; sexual behaviours in vaccinated animals were significantly lower (pvaccine induced a strong antibody response and resulted in the suppression of gonadal function and sexual behaviour in animals, demonstrating that KISS1 can be used as a novel target for developing a DNA immunocastration vaccine. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Xenogeneic murine tyrosinase DNA vaccine for malignant melanoma of the digit of dogs.

    Science.gov (United States)

    Manley, C A; Leibman, N F; Wolchok, J D; Rivière, I C; Bartido, S; Craft, D M; Bergman, P J

    2011-01-01

    Malignant melanoma of dogs is a highly aggressive neoplasm and is the 2nd most common digit tumor. Metastatic disease is a common sequela for which few effective treatment options exist. Studies show that xenogeneic tyrosinase DNA vaccination yields immune responses and prolongation of survival in dogs with oral malignant melanoma. Describe clinical findings and tumor characteristics of a cohort of dogs with digit malignant melanoma, and evaluate the prognostic utility of a proposed staging system. Determine if a novel xenogeneic DNA vaccine is safe and potentially effective for treatment of dogs with digit melanoma. Fifty-eight dogs with digit malignant melanoma treated at the Animal Medical Center between 2004 and 2007. Retrospective, medical records review of dogs with digit melanoma treated with xenogeneic DNA vaccine. Overall median survival time (MST) for dogs treated with loco-regional control and xenogeneic DNA vaccine was 476 days with a 1-year survival rate of 63%. MST for dogs presenting with metastasis was 105 days versus 533 days for dogs presenting without metastasis (P dogs in the latter group were alive at 2 and 3 years. A proposed staging system proved prognostic with stages I-IV dogs surviving >952, >1,093, 321, and 76 days, respectively. The xenogeneic murine tyrosinase DNA vaccine was safe and appears effective when used in conjunction with local and regional disease control. The proposed staging system was prognostic in this study and future studies might benefit from utilizing this staging system. Copyright © 2010 by the American College of Veterinary Internal Medicine.

  15. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

    1993-02-16

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a pu GOVERNMENT RIGHTS This application was funded under Department of Energy Contract DE-AC02-76ER01338. The U.S. Government has certain rights under this application and any patent issuing thereon.

  16. Retinaldehyde dehydrogenase 2 as a molecular adjuvant for enhancement of mucosal immunity during DNA vaccination.

    Science.gov (United States)

    Holechek, Susan A; McAfee, Megan S; Nieves, Lizbeth M; Guzman, Vanessa P; Manhas, Kavita; Fouts, Timothy; Bagley, Kenneth; Blattman, Joseph N

    2016-11-04

    In order for vaccines to induce efficacious immune responses against mucosally transmitted pathogens, such as HIV-1, activated lymphocytes must efficiently migrate to and enter targeted mucosal sites. We have previously shown that all-trans retinoic acid (ATRA) can be used as a vaccine adjuvant to enhance mucosal CD8 + T cell responses during vaccination and improve protection against mucosal viral challenge. However, the ATRA formulation is incompatible with most recombinant vaccines, and the teratogenic potential of ATRA at high doses limits its usage in many clinical settings. We hypothesized that increasing in vivo production of retinoic acid (RA) during vaccination with a DNA vector expressing retinaldehyde dehydrogenase 2 (RALDH2), the rate-limiting enzyme in RA biosynthesis, could similarly provide enhanced programming of mucosal homing to T cell responses while avoiding teratogenic effects. Administration of a RALDH2- expressing plasmid during immunization with a HIVgag DNA vaccine resulted in increased systemic and mucosal CD8 + T cell numbers with an increase in both effector and central memory T cells. Moreover, mice that received RALDH2 plasmid during DNA vaccination were more resistant to intravaginal challenge with a recombinant vaccinia virus expressing the same HIVgag antigen (VACVgag). Thus, RALDH2 can be used as an alternative adjuvant to ATRA during DNA vaccination leading to an increase in both systemic and mucosal T cell immunity and better protection from viral infection at mucosal sites. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. Immune-enhancing effect of nano-DNA vaccine encoding a gene of the prME protein of Japanese encephalitis virus and BALB/c mouse granulocyte-macrophage colony-stimulating factor.

    Science.gov (United States)

    Zhai, Yongzhen; Zhou, Yan; Li, Ximei; Feng, Guohe

    2015-07-01

    Plasmid-encoded granulocyte-macrophage colony-stimulating factor (GM‑CSF) is an adjuvant for genetic vaccines; however, how GM-CSF enhances immunogenicity remains to be elucidated. In the present study, it was demonstrated that injection of a plasmid encoding the premembrane (prM) and envelope (E) protein of Japanese encephalitis virus and mouse GM-CSF (pJME/GM-CSF) into mouse muscle recruited large and multifocal conglomerates of macrophages and granulocytes, predominantly neutrophils. During the peak of the infiltration, an appreciable number of immature dendritic cells (DCs) appeared, although no T and B-cells was detected. pJME/GM-CSF increased the number of splenic DCs and the expression of major histocompatibility complex class II (MHCII) on splenic DC, and enhanced the antigenic capture, processing and presentation functions of splenic DCs, and the cell-mediated immunity induced by the vaccine. These findings suggested that the immune-enhancing effect by pJME/GM-CSF was associated with infiltrate size and the appearance of integrin αx (CD11c)+cells. Chitosan-pJME/GM-CSF nanoparticles, prepared by coacervation via intramuscular injection, outperformed standard pJME/GM-CSF administrations in DC recruitment, antigen processing and presentation, and vaccine enhancement. This revealed that muscular injection of chitosan‑pJME/GM-CSF nanoparticles may enhance the immunoadjuvant properties of GM-CSF.

  18. Cloning and sequencing of cDNA encoding human DNA topoisomerase II and localization of the gene to chromosome region 17q21-22

    International Nuclear Information System (INIS)

    Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.

    1988-01-01

    Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes

  19. Generation of Gene-Engineered Chimeric DNA Molecules for Specific Therapy of Autoimmune Diseases

    Science.gov (United States)

    Gesheva, Vera; Szekeres, Zsuzsanna; Mihaylova, Nikolina; Dimitrova, Iliyana; Nikolova, Maria; Erdei, Anna; Prechl, Jozsef

    2012-01-01

    Abstract Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by the development of self-reactive B and T cells and autoantibody production. In particular, double-stranded DNA-specific B cells play an important role in lupus progression, and their selective elimination is a reasonable approach for effective therapy of SLE. DNA-based vaccines aim at the induction of immune response against the vector-encoded antigen. Here, we are exploring, as a new DNA-based therapy of SLE, a chimeric DNA molecule encoding a DNA-mimotope peptide, and the Fv but not the immunogenic Fc fragment of an FcγRIIb-specific monoclonal antibody. This DNA construct was inserted in the expression vector pNut and used as a naked DNA vaccine in a mouse model of lupus. The chimeric DNA molecule can be expressed in eukaryotic cells and cross-links cell surface receptors on DNA-specific B cells, delivering an inhibitory intracellular signal. Intramuscular administration of the recombinant DNA molecule to lupus-prone MRL/lpr mice prevented increase in IgG anti-DNA antibodies and was associated with a low degree of proteinuria, modulation of cytokine profile, and suppression of lupus nephritis. PMID:23075110

  20. ZIKA-001: Safety and Immunogenicity of an Engineered DNA Vaccine Against ZIKA virus infection

    Science.gov (United States)

    Tebas, Pablo; Roberts, Christine C; Muthumani, Kar; Reuschel, Emma; White, Scott; Khan, Amir S; Racine, Trina; Choi, Hyeree; Zaidi, Faraz; Boyer, Jean; Kudchodkar, Sagar; Park, Young K; Trottier, Sylvie; Remigio, Celine; Krieger, Diane; Kobinger, Gary P; Weiner, David; Maslow, Joel

    2017-01-01

    suggesting that the humoral response generated by the vaccine is protective in this model. Conclusion Our trial shows for the first time in humans the safety and immunogenicity of an engineered DNA encoding consensus viral protein against ZIKV. Future studies will evaluate the effectiveness of the vaccine. Disclosures C. C. Roberts, GeneOne: Member, Salary. S. White, GeneOne: Member, Salary. A. S. Khan, Inovio: Employee and Shareholder, Salary and Stock. J. Boyer, Inovio: Employee and Shareholder, Salary and Stock. Y. K. Park, GeneOne: Board Member, CEO and Employee, Salary and Stock. S. Trottier, Canadian Institutes of Health Research: Investigator, Research grant. C. Remigio, GeneOne: Employee and Shareholder, Salary and Stock. G. P. Kobinger, GeneOne: Grant Investigator and Scientific Advisor, Grant recipient and Research support. D. Weiner, GeneOne: Grant Investigator and Scientific Advisor, Grant recipient, Licensing agreement or royalty and Stock. J. Maslow, GeneOne: Employee, Salary and Stock.

  1. Therapeutic DNA vaccination of vertically HIV-infected children: report of the first pediatric randomised trial (PEDVAC).

    Science.gov (United States)

    Palma, Paolo; Romiti, Maria Luisa; Montesano, Carla; Santilli, Veronica; Mora, Nadia; Aquilani, Angela; Dispinseri, Stefania; Tchidjou, Hyppolite K; Montano, Marco; Eriksson, Lars E; Baldassari, Stefania; Bernardi, Stefania; Scarlatti, Gabriella; Wahren, Britta; Rossi, Paolo

    2013-01-01

    Twenty vertically HIV-infected children, 6-16 years of age, with stable viral load control and CD4+ values above 400 cells/mm(3). Ten subjects continued their ongoing antiretroviral treatment (ART, Group A) and 10 were immunized with a HIV-DNA vaccine in addition to their previous therapy (ART and vaccine, Group B). The genetic vaccine represented HIV-1 subtypes A, B and C, encoded Env, Rev, Gag and RT and had no additional adjuvant. Immunizations took place at weeks 0, 4 and 12, with a boosting dose at week 36. Monitoring was performed until week 60 and extended to week 96. Safety data showed good tolerance of the vaccine. Adherence to ART remained high and persistent during the study and did not differ significantly between controls and vaccinees. Neither group experienced either virological failure or a decline of CD4+ counts from baseline. Higher HIV-specific cellular immune responses were noted transiently to Gag but not to other components of the vaccine. Lymphoproliferative responses to a virion antigen HIV-1 MN were higher in the vaccinees than in the controls (p = 0.047), whereas differences in reactivity to clade-specific Gag p24, RT or Env did not reach significance. Compared to baseline, the percentage of HIV-specific CD8+ lymphocytes releasing perforin in the Group B was higher after the vaccination schedule had been completed (p = 0.031). No increased CD8+ perforin levels were observed in control Group A. The present study demonstrates the feasibility, safety and moderate immunogenicity of genetic vaccination in vertically HIV-infected children, paving the way for amplified immunotherapeutic approaches in the pediatric population. clinicaltrialsregister.eu _2007-002359-18IT.

  2. Therapeutic DNA vaccination of vertically HIV-infected children: report of the first pediatric randomised trial (PEDVAC.

    Directory of Open Access Journals (Sweden)

    Paolo Palma

    Full Text Available SUBJECTS: Twenty vertically HIV-infected children, 6-16 years of age, with stable viral load control and CD4+ values above 400 cells/mm(3. INTERVENTION: Ten subjects continued their ongoing antiretroviral treatment (ART, Group A and 10 were immunized with a HIV-DNA vaccine in addition to their previous therapy (ART and vaccine, Group B. The genetic vaccine represented HIV-1 subtypes A, B and C, encoded Env, Rev, Gag and RT and had no additional adjuvant. Immunizations took place at weeks 0, 4 and 12, with a boosting dose at week 36. Monitoring was performed until week 60 and extended to week 96. RESULTS: Safety data showed good tolerance of the vaccine. Adherence to ART remained high and persistent during the study and did not differ significantly between controls and vaccinees. Neither group experienced either virological failure or a decline of CD4+ counts from baseline. Higher HIV-specific cellular immune responses were noted transiently to Gag but not to other components of the vaccine. Lymphoproliferative responses to a virion antigen HIV-1 MN were higher in the vaccinees than in the controls (p = 0.047, whereas differences in reactivity to clade-specific Gag p24, RT or Env did not reach significance. Compared to baseline, the percentage of HIV-specific CD8+ lymphocytes releasing perforin in the Group B was higher after the vaccination schedule had been completed (p = 0.031. No increased CD8+ perforin levels were observed in control Group A. CONCLUSIONS: The present study demonstrates the feasibility, safety and moderate immunogenicity of genetic vaccination in vertically HIV-infected children, paving the way for amplified immunotherapeutic approaches in the pediatric population. TRIAL REGISTRATION: clinicaltrialsregister.eu _2007-002359-18IT.

  3. Enhancement of human immunodeficiency virus type 1-DNA vaccine potency through incorporation of T-helper 1 molecular adjuvants.

    Science.gov (United States)

    Calarota, Sandra A; Weiner, David B

    2004-06-01

    It is clear that the development of a safe and effective vaccine for human immunodeficiency virus type 1 (HIV-1) remains a crucial goal for controlling the acquired immunodeficiency syndrome epidemic. At present, it is not clear what arm of the immune response correlates with protection from HIV-1 infection or disease. Therefore, a strong cellular and humoral immune response will likely be needed to control this infection. Among different vaccine alternatives, DNA vaccines appeared more than a decade ago, demonstrating important qualities of inducing both humoral and cellular immune responses in animal models. However, after several years and various clinical studies in humans, supporting the safety of the HIV-DNA vaccine strategies, it has become clear that their potency should be improved. One way to modulate and enhance the immune responses induced by a DNA vaccine is by including genetic adjuvants such as cytokines, chemokines, or T-cell costimulatory molecules as part of the vaccine itself. Particularly, vaccine immunogenicity can be modulated by factors that attract professional antigen-presenting cells, provide additional costimulation, or enhance the uptake of plasmid DNA. This review focuses on developments in the coadministration of molecular adjuvants for the enhancement of HIV-1 DNA-vaccine potency.

  4. DNA vaccination of pigs with open reading frame 1-7 of PRRS virus

    DEFF Research Database (Denmark)

    Barfoed, Annette Malene; Blixenkrone-Møller, Merete; Jensen, Merethe Holm

    2004-01-01

    We cloned all open reading frames of a Danish isolate of porcine reproductive and respiratory syndrome (PRRS) virus in DNA vaccination vectors. Pigs were vaccinated using a gene gun with each single construct (ORF1, ORF2, ORF3, ORF4, ORF5, ORF6, or ORF7) or combinations thereof. Vaccination...

  5. Tattoo Delivery of a Semliki Forest Virus-Based Vaccine Encoding Human Papillomavirus E6 and E7

    NARCIS (Netherlands)

    van de Wall, Stephanie; Walczak, Mateusz; van Rooij, Nienke; Hoogeboom, Baukje-Nynke; Meijerhof, Tjarko; Nijman, Hans W; Daemen, Toos

    2015-01-01

    The skin is an attractive organ for immunization because of the presence of antigen-presenting cells. Intradermal delivery via tattooing has demonstrated superior vaccine immunogenicity of DNA vaccines in comparison to conventional delivery methods. In this study, we explored the efficacy of tattoo

  6. Single-epitope DNA vaccination prevents exhaustion and facilitates a broad antiviral CD8+ T cell response during chronic viral infection

    DEFF Research Database (Denmark)

    Bartholdy, Christina; Stryhn, Anette; Christensen, Jan Pravsgaard

    2004-01-01

    Induction of a monospecific antiviral CD8+ T cell response may pose a risk to the host due to the narrow T cell response induced. At the individual level, this may result in selection of CD8+ T cell escape variants, particularly during chronic viral infection. Second, prior immunization toward a ...... with escape variants. These findings underscore that a monospecific vaccine may induce efficient protective immunity given the right set of circumstances....... of DNA vaccines encoding immunodominant epitopes of lymphocytic choriomeningitis virus (LCMV). We analyzed the spectrum of the CD8+ T cell response and the susceptibility to infection in H-2(b) and H-2(d) mice. Priming for a monospecific, CD8+ T cell response did not render mice susceptible to viral...... variants. Thus, vaccinated mice were protected against chronic infection with LCMV, and no evidence indicating biologically relevant viral escape was obtained. In parallel, a broad and sustained CD8+ T cell response was generated upon infection, and in H-2(d) mice epitope spreading was observed. Even after...

  7. Protection of rainbow trout against infectious hematopoietic necrosis virus four days after specific or semi-specific DNA vaccination

    DEFF Research Database (Denmark)

    LaPatra, S.E.; Corbeil, S.; Jones, G.R.

    2001-01-01

    A DNA vaccine against a fish rhabdovirus, infectious hematopoietic necrosis virus (IHNV), was shown to provide significant protection as soon as 4 d after intramuscular vaccination in 2 g rainbow trout (Oncorhynchus mykiss) held at 15 degreesC. Nearly complete protection was also observed at late......-protection against IHNV challenge for a transient period of time, whereas a rabies virus DNA vaccine was not protective. This indication of distinct early and late protective mechanisms was not dependent on DNA vaccine doses from 0.1 to 2.5 mug....

  8. A portable pulmonary delivery system for nano engineered DNA vaccines driven by surface acoustic wave devices

    International Nuclear Information System (INIS)

    Rajapaksa, A.E.; Qi, Aisha; Yeo, L.; Friend, J.

    2010-01-01

    Full text: The increase in the need for effective delivery of potelll vaccines against infectious diseases, require robust yet straightforward pro duction of encapsulated DNA-laden aerosols. Aerosol delivery of drugs represents the next generation of vaccine delivery where the drug is deposited into the lung, which provides an ideal, non-invasive route. Moreover, several features of D A vaccines make them more attractive than conventional vaccines; thus, DNA vaccines have gained global interest for a variety of applications. However, several limitations such as ineffective cellular uptake and intracellular delivery, and degradation of DNA need to be overcome before clin ical applications. In this study, a novel and scalable engineered technique has been developed to create a biodegradable polymer system, which enables controlled delivery of a well designed DNA vaccine for immuno-therapeutics. Surface Acoustic Wave (SAW) atomisation has been found as useful mechanism for atomising fluid samples for medical and industrial devices. It is a straightforward method for synthesising un-agglomerated biodegradable nanoparti cles (<250 nm) in the absence of organic solvents which would represent a major breakthrough for biopharmaceutical encapsulation and delivery. Nano-scale polymer particles for DNA vaccines deliv ery were obtained through an evaporative process of the initial aerosol created by surface acoustic waves at 8-150 MHz, the final size of which could be controlled by modifying the initial polymer concen tration and solid contents. Thus, SAW atomiser represents a promising alternative for the development of a low power device for producing nano-engineered vaccines with a controlled and narrow size distribution as delivery system for genetic immuno-therapeutics.

  9. Effective Protection Induced by a Monovalent DNA Vaccine against Dengue Virus (DV Serotype 1 and a Bivalent DNA Vaccine against DV1 and DV2 in Mice

    Directory of Open Access Journals (Sweden)

    Xiaoyan Zheng

    2017-05-01

    Full Text Available Dengue virus (DV is the causal pathogen of dengue fever, which is one of the most rapidly spread mosquito-borne disease worldwide and has become a severe public health problem. Currently, there is no specific treatment for dengue; thus, a vaccine would be an effective countermeasure to reduce the morbidity and mortality. Although, the chimeric Yellow fever dengue tetravalent vaccine has been approved in some countries, it is still necessary to develop safer, more effective, and less costly vaccines. In this study, a DNA vaccine candidate pVAX1-D1ME expressing the prME protein of DV1 was inoculated in BALB/c mice via intramuscular injection or electroporation, and the immunogenicity and protection were evaluated. Compared with traditional intramuscular injection, administration with 50 μg pVAX1-D1ME via electroporation with three immunizations induced persistent humoral and cellular immune responses and effectively protected mice against lethal DV1 challenge. In addition, immunization with a bivalent vaccine consisting of pVAX1-D1ME and pVAX1-D2ME via electroporation generated a balanced IgG response and neutralizing antibodies against DV1 and DV2 and could protect mice from lethal challenge with DV1 and DV2. This study sheds new light on developing a dengue tetravalent DNA vaccine.

  10. Effective Protection Induced by a Monovalent DNA Vaccine against Dengue Virus (DV) Serotype 1 and a Bivalent DNA Vaccine against DV1 and DV2 in Mice.

    Science.gov (United States)

    Zheng, Xiaoyan; Chen, Hui; Wang, Ran; Fan, Dongying; Feng, Kaihao; Gao, Na; An, Jing

    2017-01-01

    Dengue virus (DV) is the causal pathogen of dengue fever, which is one of the most rapidly spread mosquito-borne disease worldwide and has become a severe public health problem. Currently, there is no specific treatment for dengue; thus, a vaccine would be an effective countermeasure to reduce the morbidity and mortality. Although, the chimeric Yellow fever dengue tetravalent vaccine has been approved in some countries, it is still necessary to develop safer, more effective, and less costly vaccines. In this study, a DNA vaccine candidate pVAX1-D1ME expressing the prME protein of DV1 was inoculated in BALB/c mice via intramuscular injection or electroporation, and the immunogenicity and protection were evaluated. Compared with traditional intramuscular injection, administration with 50 μg pVAX1-D1ME via electroporation with three immunizations induced persistent humoral and cellular immune responses and effectively protected mice against lethal DV1 challenge. In addition, immunization with a bivalent vaccine consisting of pVAX1-D1ME and pVAX1-D2ME via electroporation generated a balanced IgG response and neutralizing antibodies against DV1 and DV2 and could protect mice from lethal challenge with DV1 and DV2. This study sheds new light on developing a dengue tetravalent DNA vaccine.

  11. Enhanced Delivery and Potency of Self-Amplifying mRNA Vaccines by Electroporation in Situ

    Directory of Open Access Journals (Sweden)

    Kaustuv Banerjee

    2013-08-01

    Full Text Available Nucleic acid-based vaccines such as viral vectors, plasmid DNA (pDNA, and mRNA are being developed as a means to address limitations of both live-attenuated and subunit vaccines. DNA vaccines have been shown to be potent in a wide variety of animal species and several products are now licensed for commercial veterinary but not human use. Electroporation delivery technologies have been shown to improve the generation of T and B cell responses from synthetic DNA vaccines in many animal species and now in humans. However, parallel RNA approaches have lagged due to potential issues of potency and production. Many of the obstacles to mRNA vaccine development have recently been addressed, resulting in a revival in the use of non-amplifying and self-amplifying mRNA for vaccine and gene therapy applications. In this paper, we explore the utility of EP for the in vivo delivery of large, self-amplifying mRNA, as measured by reporter gene expression and immunogenicity of genes encoding HIV envelope protein. These studies demonstrated that EP delivery of self-amplifying mRNA elicited strong and broad immune responses in mice, which were comparable to those induced by EP delivery of pDNA.

  12. Mucosal application of gp140 encoding DNA polyplexes to different tissues results in altered immunological outcomes in mice.

    Directory of Open Access Journals (Sweden)

    Jamie F S Mann

    Full Text Available Increasing evidence suggests that mucosally targeted vaccines will enhance local humoral and cellular responses whilst still eliciting systemic immunity. We therefore investigated the capacity of nasal, sublingual or vaginal delivery of DNA-PEI polyplexes to prime immune responses prior to mucosal protein boost vaccination. Using a plasmid expressing the model antigen HIV CN54gp140 we show that each of these mucosal surfaces were permissive for DNA priming and production of antigen-specific antibody responses. The elicitation of systemic immune responses using nasally delivered polyplexed DNA followed by recombinant protein boost vaccination was equivalent to a systemic prime-boost regimen, but the mucosally applied modality had the advantage in that significant levels of antigen-specific IgA were detected in vaginal mucosal secretions. Moreover, mucosal vaccination elicited both local and systemic antigen-specific IgG(+ and IgA(+ antibody secreting cells. Finally, using an Influenza challenge model we found that a nasal or sublingual, but not vaginal, DNA prime/protein boost regimen protected against infectious challenge. These data demonstrate that mucosally applied plasmid DNA complexed to PEI followed by a mucosal protein boost generates sufficient antigen-specific humoral antibody production to protect from mucosal viral challenge.

  13. A Novel Audio Cryptosystem Using Chaotic Maps and DNA Encoding

    Directory of Open Access Journals (Sweden)

    S. J. Sheela

    2017-01-01

    Full Text Available Chaotic maps have good potential in security applications due to their inherent characteristics relevant to cryptography. This paper introduces a new audio cryptosystem based on chaotic maps, hybrid chaotic shift transform (HCST, and deoxyribonucleic acid (DNA encoding rules. The scheme uses chaotic maps such as two-dimensional modified Henon map (2D-MHM and standard map. The 2D-MHM which has sophisticated chaotic behavior for an extensive range of control parameters is used to perform HCST. DNA encoding technology is used as an auxiliary tool which enhances the security of the cryptosystem. The performance of the algorithm is evaluated for various speech signals using different encryption/decryption quality metrics. The simulation and comparison results show that the algorithm can achieve good encryption results and is able to resist several cryptographic attacks. The various types of analysis revealed that the algorithm is suitable for narrow band radio communication and real-time speech encryption applications.

  14. A single dose of a DNA vaccine encoding apa coencapsulated with 6,6'-trehalose dimycolate in microspheres confers long-term protection against tuberculosis in Mycobacterium bovis BCG-primed mice.

    Science.gov (United States)

    Carlétti, Dyego; Morais da Fonseca, Denise; Gembre, Ana Flávia; Masson, Ana Paula; Weijenborg Campos, Lívia; Leite, Luciana C C; Rodrigues Pires, Andréa; Lannes-Vieira, Joseli; Lopes Silva, Célio; Bonato, Vânia Luiza Deperon; Horn, Cynthia

    2013-08-01

    Mycobacterium bovis BCG prime DNA (Mycobacterium tuberculosis genes)-booster vaccinations have been shown to induce greater protection against tuberculosis (TB) than BCG alone. This heterologous prime-boost strategy is perhaps the most realistic vaccination for the future of TB infection control, especially in countries where TB is endemic. Moreover, a prime-boost regimen using biodegradable microspheres seems to be a promising immunization to stimulate a long-lasting immune response. The alanine proline antigen (Apa) is a highly immunogenic glycoprotein secreted by M. tuberculosis. This study investigated the immune protection of Apa DNA vaccine against intratracheal M. tuberculosis challenge in mice on the basis of a heterologous prime-boost regimen. BALB/c mice were subcutaneously primed with BCG and intramuscularly boosted with a single dose of plasmid carrying apa and 6,6'-trehalose dimycolate (TDM) adjuvant, coencapsulated in microspheres (BCG-APA), and were evaluated 30 and 70 days after challenge. This prime-boost strategy (BCG-APA) resulted in a significant reduction in the bacterial load in the lungs, thus leading to better preservation of the lung parenchyma, 70 days postinfection compared to BCG vaccinated mice. The profound effect of this heterologous prime-boost regimen in the experimental model supports its development as a feasible strategy for prevention of TB.

  15. Multi-Probe Based Artificial DNA Encoding and Matching Classifier for Hyperspectral Remote Sensing Imagery

    Directory of Open Access Journals (Sweden)

    Ke Wu

    2016-08-01

    Full Text Available In recent years, a novel matching classification strategy inspired by the artificial deoxyribonucleic acid (DNA technology has been proposed for hyperspectral remote sensing imagery. Such a method can describe brightness and shape information of a spectrum by encoding the spectral curve into a DNA strand, providing a more comprehensive way for spectral similarity comparison. However, it suffers from two problems: data volume is amplified when all of the bands participate in the encoding procedure and full-band comparison degrades the importance of bands carrying key information. In this paper, a new multi-probe based artificial DNA encoding and matching (MADEM method is proposed. In this method, spectral signatures are first transformed into DNA code words with a spectral feature encoding operation. After that, multiple probes for interesting classes are extracted to represent the specific fragments of DNA strands. During the course of spectral matching, the different probes are compared to obtain the similarity of different types of land covers. By computing the absolute vector distance (AVD between different probes of an unclassified spectrum and the typical DNA code words from the database, the class property of each pixel is set as the minimum distance class. The main benefit of this strategy is that the risk of redundant bands can be deeply reduced and critical spectral discrepancies can be enlarged. Two hyperspectral image datasets were tested. Comparing with the other classification methods, the overall accuracy can be improved from 1.22% to 10.09% and 1.19% to 15.87%, respectively. Furthermore, the kappa coefficient can be improved from 2.05% to 15.29% and 1.35% to 19.59%, respectively. This demonstrated that the proposed algorithm outperformed other traditional classification methods.

  16. Dendritic cell mediated delivery of plasmid DNA encoding LAMP/HIV-1 Gag fusion immunogen enhances T cell epitope responses in HLA DR4 transgenic mice.

    Directory of Open Access Journals (Sweden)

    Gregory G Simon

    2010-01-01

    Full Text Available This report describes the identification and bioinformatics analysis of HLA-DR4-restricted HIV-1 Gag epitope peptides, and the application of dendritic cell mediated immunization of DNA plasmid constructs. BALB/c (H-2d and HLA-DR4 (DRA1*0101, DRB1*0401 transgenic mice were immunized with immature dendritic cells transfected by a recombinant DNA plasmid encoding the lysosome-associated membrane protein-1/HIV-1 Gag (pLAMP/gag chimera antigen. Three immunization protocols were compared: 1 primary subcutaneous immunization with 1x10(5 immature dendritic cells transfected by electroporation with the pLAMP/gag DNA plasmid, and a second subcutaneous immunization with the naked pLAMP/gag DNA plasmid; 2 primary immunization as above, and a second subcutaneous immunization with a pool of overlapping peptides spanning the HIV-1 Gag sequence; and 3 immunization twice by subcutaneous injection of the pLAMP/gag DNA plasmid. Primary immunization with pLAMP/gag-transfected dendritic cells elicited the greatest number of peptide specific T-cell responses, as measured by ex vivo IFN-gamma ELISpot assay, both in BALB/c and HLA-DR4 transgenic mice. The pLAMP/gag-transfected dendritic cells prime and naked DNA boost immunization protocol also resulted in an increased apparent avidity of peptide in the ELISpot assay. Strikingly, 20 of 25 peptide-specific T-cell responses in the HLA-DR4 transgenic mice contained sequences that corresponded, entirely or partially to 18 of the 19 human HLA-DR4 epitopes listed in the HIV molecular immunology database. Selection of the most conserved epitope peptides as vaccine targets was facilitated by analysis of their representation and variability in all reported sequences. These data provide a model system that demonstrates a the superiority of immunization with dendritic cells transfected with LAMP/gag plasmid DNA, as compared to naked DNA, b the value of HLA transgenic mice as a model system for the identification and evaluation

  17. Low-dose radiation enhances therapeutic HPV DNA vaccination in tumor-bearing hosts.

    Science.gov (United States)

    Tseng, Chih-Wen; Trimble, Cornelia; Zeng, Qi; Monie, Archana; Alvarez, Ronald D; Huh, Warner K; Hoory, Talia; Wang, Mei-Cheng; Hung, Chien-Fu; Wu, T-C

    2009-05-01

    Current therapeutic approaches to treatment of patients with bulky cervical cancer are based on conventional in situ ablative modalities including cisplatin-based chemotherapy and radiation therapy. The 5-year survival of patients with nonresectable disease is dismal. Because over 99% of squamous cervical cancer is caused by persistent infection with an oncogenic strain of human papillomavirus (HPV), particularly type 16 and viral oncoproteins E6 and E7 are functionally required for disease initiation and persistence, HPV-targeted immune strategies present a compelling opportunity in which to demonstrate proof of principle. Sublethal doses of radiation and chemotherapeutic agents have been shown to have synergistic effect in combination with either vaccination against cancer-specific antigens, or with passive transfer of tumor-specific cytotoxic T lymphocytes (CTLs). Here, we explored the combination of low-dose radiation therapy with DNA vaccination with calreticulin (CRT) linked to the mutated form of HPV-16 E7 antigen (E7(detox)), CRT/E7(detox) in the treatment of E7-expressing TC-1 tumors. We observed that TC-1 tumor-bearing mice treated with radiotherapy combined with CRT/E7(detox) DNA vaccination generated significant therapeutic antitumor effects and the highest frequency of E7-specific CD8(+) T cells in the tumors and spleens of treated mice. Furthermore, treatment with radiotherapy was shown to render the TC-1 tumor cells more susceptible to lysis by E7-specific CTLs. In addition, we observed that treatment with radiotherapy during the second DNA vaccination generated the highest frequency of E7-specific CD8(+) T cells in the tumors and spleens of TC-1 tumor-bearing mice. Finally, TC-1 tumor-bearing mice treated with the chemotherapy in combination with radiation and CRT/E7(detox) DNA vaccination generate significantly enhanced therapeutic antitumor effects. The clinical implications of the study are discussed.

  18. Protective immunity conferred by porcine circovirus 2 ORF2-based DNA vaccine in mice.

    Science.gov (United States)

    Sylla, Seydou; Cong, Yan-Long; Sun, Yi-Xue; Yang, Gui-Lian; Ding, Xue-Mei; Yang, Zhan-Qing; Zhou, Yu-Long; Yang, Minnan; Wang, Chun-Feng; Ding, Zhuang

    2014-07-01

    Post-weaning multisystemic wasting syndrome (PMWS) associated with porcine circovirus type 2 (PCV2) has caused the swine industry significant health challenges and economic damage. Although inactivated and subunit vaccines against PMWS have been used widely, so far no DNA vaccine is available. In this study, with the aim of exploring a new route for developing a vaccine against PCV2, the immunogenicity of a DNA vaccine was evaluated in mice. The pEGFP-N1 vector was used to construct a PCV2 Cap gene recombinant vaccine. To assess the immunogenicity of pEGFP-Cap, 80 BALB/c mice were immunized three times at 2 weekly intervals with pEGFP-Cap, LG-strain vaccine, pEGFP-N1 vector or PBS and then challenged with PCV2. IgG and cytokines were assessed by indirect ELISA and ELISA, respectively. Specimens stained with hematoxylin and eosin (HE) and immunohistochemistry (IHC) techniques were examined histopathologically. It was found that vaccination of the mice with the pEGFP-Cap induced solid protection against PCV2 infection through induction of highly specific serum IgG antibodies and cytokines (IFN-γ and IL-10), and a small PCV2 viral load. The mice treated with the pEGFP-Cap and LG-strain developed no histopathologically detectable lesions (HE stain) and IHC techniques revealed only a few positive cells. Thus, this study demonstrated that recombinant pEGFP-Cap substantially alleviates PCV2 infection in mice and provides evidence that a DNA vaccine could be an alternative to PCV2 vaccines against PMWS. © 2014 The Societies and Wiley Publishing Asia Pty Ltd.

  19. Vaginal DNA vaccination against infectious diseases transmitted through the vagina.

    Science.gov (United States)

    Kanazawa, Takanori; Takashima, Yuuki; Okada, Hiroaki

    2012-06-01

    There is an urgent need for the development of vaccines against genital virus infections that are transmitted through heterosexual intercourse, including the HIV and HPV. In general, the surface of female genital mucosa, including vaginal mucosa, is the most common site of initiation of these infections. Thus, it is becoming clear that successful vaccines must induce both cellular and humoral immune responses in both the local genital tract and systemically. We believe that a strong vaginal immune response could be obtained by inducing strong gene expression of antigen-coding DNA in the local targeted tissue. In order to improve transfection efficiency in the vagina, it is important that methods allowing breakthrough of the various barriers, such as the epithelial layer, cellular and nuclear membrane, are developed. Therefore, systems providing less invasive and more effective delivery into the subepithelial layer are required. In this review, we will introduce our studies into efficient vaginal DNA vaccination methods, focusing on the effects of the menstrual cycle, utilization of the combination of functional peptides, and use of a needle-free injector.

  20. DNA technology for diagnosis and vaccines for infectious diseases

    International Nuclear Information System (INIS)

    Notani, N.K.

    1992-01-01

    Three or four general strategies are adopted for the control of infectious diseases. Early diagnosis, vaccination and chemotherapy. In the situations where there is transfer through mosquitoes or ticks from alternate hosts, control of the vector and of the infection in the alternate host are additional measures to be taken. This Chapter looks at the problems of disease control from the perspective of genetics, since molecular genetics now provides powerful tools in the form of radiolabelled DNA probes and clones of selected segments, useful for diagnosis as well as for vaccine design

  1. DNA technology for diagnosis and vaccines for infectious diseases

    Energy Technology Data Exchange (ETDEWEB)

    Notani, N K

    1993-12-31

    Three or four general strategies are adopted for the control of infectious diseases. Early diagnosis, vaccination and chemotherapy. In the situations where there is transfer through mosquitoes or ticks from alternate hosts, control of the vector and of the infection in the alternate host are additional measures to be taken. This Chapter looks at the problems of disease control from the perspective of genetics, since molecular genetics now provides powerful tools in the form of radiolabelled DNA probes and clones of selected segments, useful for diagnosis as well as for vaccine design

  2. Molecular cloning and expression of cDNA encoding a lumenal calcium binding glycoprotein from sarcoplasmic reticulum

    International Nuclear Information System (INIS)

    Leberer, E.; Charuk, J.H.M.; MacLennan, D.H.; Green, N.M.

    1989-01-01

    Antibody screening was used to isolate a cDNA encoding the 160-kDa glycoprotein of rabbit skeletal muscle sarcoplasmic reticulum. The cDNA is identical to that encoding the 53-kDa glycoprotein except that it contains an in-frame insertion of 1,308 nucleotides near its 5' end, apparently resulting from alternative splicing. The protein encoded by the cDNA would contain a 19-residue NH 2 -terminal signal sequence and a 453-residue COOH-terminal sequence identical to the 53-kDa glycoprotein. It would also contain a 436-amino acid insert between these sequences. This insert would be highly acidic, suggesting that it might bind Ca 2+ . The purified 160-kDa glycoprotein and the glycoprotein expressed in COS-1 cells transfected with cDNA encoding the 160-kDa glycoprotein were shown to bind 45 C 2+ in a gel overlay assay. The protein was shown to be located in the lumen of the sarcoplasmic reticulum and to be associated through Ca 2+ with the membrane. The authors propose that this lumenal Ca 2+ binding glycoprotein of the sarcoplasmic reticulum be designated sarcalumenin

  3. Optimization of heterologous DNA-prime, protein boost regimens and site of vaccination to enhance therapeutic immunity against human papillomavirus-associated disease.

    Science.gov (United States)

    Peng, Shiwen; Qiu, Jin; Yang, Andrew; Yang, Benjamin; Jeang, Jessica; Wang, Joshua W; Chang, Yung-Nien; Brayton, Cory; Roden, Richard B S; Hung, Chien-Fu; Wu, T-C

    2016-01-01

    Human papillomavirus (HPV) has been identified as the primary etiologic factor of cervical cancer as well as subsets of anogenital and oropharyngeal cancers. The two HPV viral oncoproteins, E6 and E7, are uniquely and consistently expressed in all HPV infected cells and are therefore promising targets for therapeutic vaccination. Both recombinant naked DNA and protein-based HPV vaccines have been demonstrated to elicit HPV-specific CD8+ T cell responses that provide therapeutic effects against HPV-associated tumor models. Here we examine the immunogenicity in a preclinical model of priming with HPV DNA vaccine followed by boosting with filterable aggregates of HPV 16 L2E6E7 fusion protein (TA-CIN). We observed that priming twice with an HPV DNA vaccine followed by a single TA-CIN booster immunization generated the strongest antigen-specific CD8+ T cell response compared to other prime-boost combinations tested in C57BL/6 mice, whether naïve or bearing the HPV16 E6/E7 transformed syngeneic tumor model, TC-1. We showed that the magnitude of antigen-specific CD8+ T cell response generated by the DNA vaccine prime, TA-CIN protein vaccine boost combinatorial strategy is dependent on the dose of TA-CIN protein vaccine. In addition, we found that a single booster immunization comprising intradermal or intramuscular administration of TA-CIN after priming twice with an HPV DNA vaccine generated a comparable boost to E7-specific CD8+ T cell responses. We also demonstrated that the immune responses elicited by the DNA vaccine prime, TA-CIN protein vaccine boost strategy translate into potent prophylactic and therapeutic antitumor effects. Finally, as seen for repeat TA-CIN protein vaccination, we showed that the heterologous DNA prime and protein boost vaccination strategy is well tolerated by mice. Our results provide rationale for future clinical testing of HPV DNA vaccine prime, TA-CIN protein vaccine boost immunization regimen for the control of HPV-associated diseases.

  4. Expression analysis of a ''Cucurbita'' cDNA encoding endonuclease

    International Nuclear Information System (INIS)

    Szopa, J.

    1995-01-01

    The nuclear matrices of plant cell nuclei display intrinsic nuclease activity which consists in nicking supercoiled DNA. A cDNA encoding a 32 kDa endonuclease has been cloned and sequenced. The nucleotide and deduced amino-acid sequences show high homology to known 14-3-3-protein sequences from other sources. The amino-acid sequence shows agreement with consensus sequences for potential phosphorylation by protein kinase A and C and for calcium, lipid and membrane-binding sites. The nucleotide-binding site is also present within the conserved part of the sequence. By Northern blot analysis, the differential expression of the corresponding mRNA was detected; it was the strongest in sink tissues. The endonuclease activity found on DNA-polyacrylamide gel electrophoresis coincided with mRNA content and was the highest in tuber. (author). 22 refs, 6 figs

  5. DNA vaccination of rainbow trout against viral hemorrhagic septicemia virus: A dose-response and time-course study

    DEFF Research Database (Denmark)

    Lorenzen, Ellen; Einer-Jensen, Katja; Martinussen, T.

    2000-01-01

    Viral hemorrhagic septicemia (VHS) in rainbow trout Oncorhynchus mykiss is caused by VHS virus (VHSV), which belongs to the rhabdovirus family. Among the different strategies for immunizing fish with a recombinant vaccine, genetic immunization has recently proven to be highly effective. To further...... investigate the potential for protecting fish against VHS by DNA vaccination, experiments were conducted to determine the amount of plasmid DNA needed for induction of protective immunity. The time to onset of immunity and the duration of protection following administration of a protective vaccine dose were...... serologically different from the isolate used for vaccine development. Following administration of 1 mug of a DNA vaccine, significant protection against VHS was observed in the fish as early as 8 d postvaccination. At 168 d postvaccination, the fish had increased in size by a factor of 10 and protection...

  6. Pretreatment antigen-specific immunity and regulation - association with subsequent immune response to anti-tumor DNA vaccination.

    Science.gov (United States)

    Johnson, Laura E; Olson, Brian M; McNeel, Douglas G

    2017-07-18

    Immunotherapies have demonstrated clinical benefit for many types of cancers, however many patients do not respond, and treatment-related adverse effects can be severe. Hence many efforts are underway to identify treatment predictive biomarkers. We have reported the results of two phase I trials using a DNA vaccine encoding prostatic acid phosphatase (PAP) in patients with biochemically recurrent prostate cancer. In both trials, persistent PAP-specific Th1 immunity developed in some patients, and this was associated with favorable changes in serum PSA kinetics. In the current study, we sought to determine if measures of antigen-specific or antigen non-specific immunity were present prior to treatment, and associated with subsequent immune response, to identify possible predictive immune biomarkers. Patients who developed persistent PAP-specific, IFNγ-secreting immune responses were defined as immune "responders." The frequency of peripheral T cell and B cell lymphocytes, natural killer cells, monocytes, dendritic cells, myeloid derived suppressor cells, and regulatory T cells were assessed by flow cytometry and clinical laboratory values. PAP-specific immune responses were evaluated by cytokine secretion in vitro, and by antigen-specific suppression of delayed-type hypersensitivity to a recall antigen in an in vivo SCID mouse model. The frequency of peripheral blood cell types did not differ between the immune responder and non-responder groups. Non-responder patients tended to have higher PAP-specific IL-10 production pre-vaccination (p = 0.09). Responder patients had greater preexisting PAP-specific bystander regulatory responses that suppressed DTH to a recall antigen (p = 0.016). While our study population was small (n = 38), these results suggest that different measures of antigen-specific tolerance or regulation might help predict immunological outcome from DNA vaccination. These will be prospectively evaluated in an ongoing randomized, phase II trial.

  7. Preclinical evaluation of multi antigenic HCV DNA vaccine for the prevention of Hepatitis C virus infection.

    Science.gov (United States)

    Lee, Hyojin; Jeong, Moonsup; Oh, Jooyeon; Cho, Youngran; Shen, Xuefei; Stone, John; Yan, Jian; Rothkopf, Zachary; Khan, Amir S; Cho, Byung Mun; Park, Young K; Weiner, David B; Son, Woo-Chan; Maslow, Joel N

    2017-03-07

    Direct-acting antiviral treatment for hepatitis C virus (HCV) infection is costly and does not protect from re-infection. For human and chimpanzees, recovery from acute HCV infection correlates with host CD4+ and CD8+ T cell responses. DNA plasmids targeting the HCV non-structural antigens NS3, NS4, and NS5, were previously reported to induce robust and sustained T cell responses in mice and primates. These plasmids were combined with a plasmid encoding cytokine IL-28B, together named as VGX-6150. The dose-dependent T cell response and safety of VGX-6150 administered intramuscularly and followed by electroporation was assessed in mice. Immune responses plateaued at 20 μg/dose with IL-28B demonstrating significant immunoadjuvant activity. Mice administered VGX-6150 at 40, 400, and 800 μg given either as a single injection or as 14 injections given bi-weekly over 26 weeks showed no vaccine related changes in any clinical parameter compared to placebo recipients. There was no evidence of VGX-6150 accumulation at the injection site or in any organ 1 month following the 14 th vaccination. Based on these studies, the approximate lethal dose (ALD) exceeds 800 μg/dose and the NOAEL was 800 μg/dose in mouse. In conclusion, VGX-6150 appears safe and a promising preventive vaccine candidate for HCV infection.

  8. Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

    Directory of Open Access Journals (Sweden)

    Zuiter Afnan

    2012-08-01

    Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

  9. The role of peptide and DNA vaccines in myeloid leukemia immunotherapy

    Directory of Open Access Journals (Sweden)

    Lin Chen

    2013-02-01

    Full Text Available Abstract While chemotherapy and targeted therapy are successful in inducing the remission of myeloid leukemia as acute myeloid leukemia (AML and chronic myeloid leukemia (CML, the disease remains largely incurable. This observation is likely due to the drug resistance of leukemic cells, which are responsible for disease relapse. Myeloid leukemia vaccines may most likely be beneficial for eradicating minimal residual disease after treatment with chemotherapy or targeted therapy. Several targeted immunotherapies using leukemia vaccines have been heavily investigated in clinical and preclinical trials. This review will focus on peptides and DNA vaccines in the context of myeloid leukemias, and optimal strategies for enhancing the efficacy of vaccines based on myeloid leukemia immunization are also summarized.

  10. Improvement of the Immunogenicity of Porcine Circovirus Type 2 DNA Vaccine by Recombinant ORF2 Gene and CpG Motifs.

    Science.gov (United States)

    Li, Jun; Shi, Jian-Li; Wu, Xiao-Yan; Fu, Fang; Yu, Jiang; Yuan, Xiao-Yuan; Peng, Zhe; Cong, Xiao-Yan; Xu, Shao-Jian; Sun, Wen-Bo; Cheng, Kai-Hui; Du, Yi-Jun; Wu, Jia-Qiang; Wang, Jin-Bao; Huang, Bao-Hua

    2015-06-01

    Nowadays, adjuvant is still important for boosting immunity and improving resistance in animals. In order to boost the immunity of porcine circovirus type 2 (PCV2) DNA vaccine, CpG motifs were inserted. In this study, the dose-effect was studied, and the immunity of PCV2 DNA vaccines by recombinant open reading frame 2 (ORF2) gene and CpG motifs was evaluated. Three-week-old Changbai piglets were inoculated intramuscularly with 200 μg, 400 μg, and 800 μg DNA vaccines containing 14 and 18 CpG motifs, respectively. Average gain and rectum temperature were recorded everyday during the experiments. Blood was collected from the piglets after vaccination to detect the changes of specific antibodies, interleukin-2, and immune cells every week. Tissues were collected for histopathology and polymerase chain reaction. The results indicated that compared to those of the control piglets, all concentrations of two DNA vaccines could induce PCV2-specific antibodies. A cellular immunity test showed that PCV2-specific lymphocytes proliferated the number of TH, TC, and CD3+ positive T-cells raised in the blood of DNA vaccine immune groups. There was no distinct pathological damage and viremia occurring in pigs that were inoculated with DNA vaccines, but there was some minor pathological damage in the control group. The results demonstrated that CpG motifs as an adjuvant could boost the humoral and cellular immunity of pigs to PCV2, especially in terms of cellular immunity. Comparing two DNA vaccines that were constructed, the one containing 18 CpG motifs was more effective. This is the first report that CpG motifs as an adjuvant insert to the PCV2 DNA vaccine could boost immunity.

  11. Sequence of a cloned cDNA encoding human ribosomal protein S11

    Energy Technology Data Exchange (ETDEWEB)

    Lott, J B; Mackie, G A

    1988-02-11

    The authors have isolated a cloned cDNA that encodes human ribosomal protein (rp) S11 by screening a human fibroblast cDNA library with a labelled 204 bp DNA fragment encompassing residues 212-416 of pRS11, a rat rp Sll cDNA clone. The human rp S11 cloned cDNA consists of 15 residues of the 5' leader, the entire coding sequence and all 51 residues of the 3' untranslated region. The predicted amino acid sequence of 158 residues is identical to rat rpS11. The nucleotide sequence in the coding region differs, however, from that in rat in the first position in two codons and in the third position in 44 codons.

  12. Two doses of bovine viral diarrhea virus DNA vaccine delivered by electroporation induce long-term protective immune responses.

    Science.gov (United States)

    van Drunen Littel-van den Hurk, Sylvia; Lawman, Zoe; Snider, Marlene; Wilson, Don; van den Hurk, Jan V; Ellefsen, Barry; Hannaman, Drew

    2013-02-01

    Bovine viral diarrhea virus (BVDV) is a pathogen of major importance in cattle, so there is a need for new effective vaccines. DNA vaccines induce balanced immune responses and are relatively inexpensive and thus promising for both human and veterinary applications. In this study, newborn calves with maternal antibodies were vaccinated intramuscularly (i.m.) with a BVDV E2 DNA vaccine with the TriGrid Delivery System for i.m. delivery (TDS-IM). Two doses of this vaccine spaced 6 or 12 weeks apart were sufficient to induce significant virus-neutralizing antibody titers, numbers of activated T cells, and reduction in viral shedding and clinical presentations after BVDV-2 challenge. In contrast to the placebo-treated animals, the vaccinated calves did not lose any weight, which is an excellent indicator of the well-being of an animal and has a significant economic impact. Furthermore, the interval between the two vaccinations did not influence the magnitude of the immune responses or degree of clinical protection, and a third immunization was not necessary or beneficial. Since electroporation may enhance not only the magnitude but also the duration of immunity after DNA immunization, the interval between vaccination and challenge was extended in a second trial, which showed that two doses of this E2 DNA vaccine again significantly reduced clinical disease against BVDV for several months. These results are promising and support this technology for use against infectious diseases in cattle and large species, including humans, in general.

  13. Cost-Effectiveness of Cervical Cancer Screening With Human Papillomavirus DNA Testing and HPV-16,18 Vaccination

    Science.gov (United States)

    Goldhaber-Fiebert, Jeremy D.; Stout, Natasha K.; Salomon, Joshua A.; Kuntz, Karen M.; Goldie, Sue J.

    2011-01-01

    Background The availability of human papillomavirus (HPV) DNA testing and vaccination against HPV types 16 and 18 (HPV-16,18) motivates questions about the cost-effectiveness of cervical cancer prevention in the United States for unvaccinated older women and for girls eligible for vaccination. Methods An empirically calibrated model was used to assess the quality-adjusted life years (QALYs), lifetime costs, and incremental cost-effectiveness ratios (2004 US dollars per QALY) of screening, vaccination of preadolescent girls, and vaccination combined with screening. Screening varied by initiation age (18, 21, or 25 years), interval (every 1, 2, 3, or 5 years), and test (HPV DNA testing of cervical specimens or cytologic evaluation of cervical cells with a Pap test). Testing strategies included: 1) cytology followed by HPV DNA testing for equivocal cytologic results (cytology with HPV test triage); 2) HPV DNA testing followed by cytology for positive HPV DNA results (HPV test with cytology triage); and 3) combined HPV DNA testing and cytology. Strategies were permitted to switch once at age 25, 30, or 35 years. Results For unvaccinated women, triennial cytology with HPV test triage, beginning by age 21 years and switching to HPV testing with cytology triage at age 30 years, cost $78 000 per QALY compared with the next best strategy. For girls vaccinated before age 12 years, this same strategy, beginning at age 25 years and switching at age 35 years, cost $41 000 per QALY with screening every 5 years and $188 000 per QALY screening triennially, each compared with the next best strategy. These strategies were more effective and cost-effective than screening women of all ages with cytology alone or cytology with HPV triage annually or biennially. Conclusions For both vaccinated and unvaccinated women, age-based screening by use of HPV DNA testing as a triage test for equivocal results in younger women and as a primary screening test in older women is expected to be more

  14. Cloning of cDNA encoding steroid 11β-hydroxylase (P450c11)

    International Nuclear Information System (INIS)

    Chua, S.C.; Szabo, P.; Vitek, A.; Grzeschik, K.H.; John, M.; White, P.C.

    1987-01-01

    The authors have isolated bovine and human adrenal cDNA clones encoding the adrenal cytochrome P-450 specific for 11β-hydroxylation (P450c11). A bovine adrenal cDNA library constructed in the bacteriophage λ vector gt10 was probed with a previously isolated cDNA clone corresponding to part of the 3' untranslated region of the 4.2-kilobase (kb) mRNA encoding P450c11. Several clones with 3.2-kb cDNA inserts were isolated. Sequence analysis showed that they overlapped the original probe by 300 base pairs (bp). Combined cDNA and RNA sequence data demonstrated a continuous open reading frame of 1509 bases. P450c11 is predicted to contain 479 amino acid residues in the mature protein in addition to a 24-residue amino-terminal mitochondrial signal sequence. A bovine clone was used to isolate a homologous clone with a 3.5-kb insert from a human adrenal cDNA library. A region of 1100 bp was 81% homologous to 769 bp of the coding sequence of the bovine cDNA except for a 400-bp segment presumed to be an unprocessed intron. Hybridization of the human cDNA to DNA from a panel of human-rodent somatic cell hybrid lines and in situ hybridization to metaphase spreads of human chromosomes localized the gene to the middle of the long arm of chromosome 8. These data should be useful in developing reagents for heterozygote detection and prenatal diagnosis of 11β-hydroxylase deficiency, the second most frequent cause of congenital adrenal hyperplasia

  15. RNA-Based Vaccines in Cancer Immunotherapy

    Directory of Open Access Journals (Sweden)

    Megan A. McNamara

    2015-01-01

    Full Text Available RNA vaccines traditionally consist of messenger RNA synthesized by in vitro transcription using a bacteriophage RNA polymerase and template DNA that encodes the antigen(s of interest. Once administered and internalized by host cells, the mRNA transcripts are translated directly in the cytoplasm and then the resulting antigens are presented to antigen presenting cells to stimulate an immune response. Alternatively, dendritic cells can be loaded with either tumor associated antigen mRNA or total tumor RNA and delivered to the host to elicit a specific immune response. In this review, we will explain why RNA vaccines represent an attractive platform for cancer immunotherapy, discuss modifications to RNA structure that have been developed to optimize mRNA vaccine stability and translational efficiency, and describe strategies for nonviral delivery of mRNA vaccines, highlighting key preclinical and clinical data related to cancer immunotherapy.

  16. Induction of protective immunity against Eimeria tenella, Eimeria necatrix, Eimeria maxima and Eimeria acervulina infections using multivalent epitope DNA vaccines.

    Science.gov (United States)

    Song, Xiaokai; Ren, Zhe; Yan, Ruofeng; Xu, Lixin; Li, Xiangrui

    2015-06-04

    Avian coccidiosis is mostly caused by mixed infection of several Eimeria species under natural conditions and immunity to avian coccidiosis is largely dependent on T-cell immune response. In this study, 14 T-cell epitope fragments from eight antigens of Eimeria tenella (E. tenella), Eimeria necatrix (E. necatrix), Eimeria maxima (E. maxima) and Eimeria acervulina (E. acervulina) were ligated with pVAX1 producing 14 monovalent DNA vaccines, respectively. Protective immunity of the monovalent DNA vaccines was assessed by in vivo challenge experiments and then four most protective fragments of each species were chosen to construct multivalent epitope DNA vaccines with or without chicken IL-2 as genetic adjuvant. Protective efficacies of the epitope DNA vaccines on chickens against E. tenella, E. necatrix, E. maxima and E. acervulina were evaluated. The results showed that the constructed multivalent epitope DNA vaccines significantly increased body weight gain, alleviated enteric lesions and reduced oocyst output of the infected birds. Especially, the multivalent epitope DNA vaccines of pVAX1-NA4-1-TA4-1-LDH-2-EMCDPK-1 and pVAX1-NA4-1-TA4-1-LDH-2-EMCDPK-1-IL-2 not only significantly increased body weight gain, alleviated enteric lesions and reduced oocyst output of the infected birds, but also resulted in anti-coccidial index (ACI) more than 170 against E. tenella, E. necatrix, E. maxima and E. acervulina, which indicated they could induce protective immunity against E. tenella, E. necatrix, E. maxima and E. acervulina. Our findings suggest the constructed multivalent epitope DNA vaccines are the potential candidate multivalent vaccines against mixed infection of Eimeria. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. Isolation, nucleotide sequence and expression of a cDNA encoding feline granulocyte colony-stimulating factor.

    Science.gov (United States)

    Dunham, S P; Onions, D E

    2001-06-21

    A cDNA encoding feline granulocyte colony stimulating factor (fG-CSF) was cloned from alveolar macrophages using the reverse transcriptase-polymerase chain reaction. The cDNA is 949 bp in length and encodes a predicted mature protein of 174 amino acids. Recombinant fG-CSF was expressed as a glutathione S-transferase fusion and purified by affinity chromatography. Biological activity of the recombinant protein was demonstrated using the murine myeloblastic cell line GNFS-60, which showed an ED50 for fG-CSF of approximately 2 ng/ml. Copyright 2001 Academic Press.

  18. Green revolution vaccines, edible vaccines | Tripurani | African ...

    African Journals Online (AJOL)

    Edible vaccines are sub-unit vaccines where the selected genes are introduced into the plants and the transgenic plant is then induced to manufacture the encoded protein. Edible vaccines are mucosal-targeted vaccines where stimulation of both systematic and mucosal immune network takes place. Foods under study ...

  19. Characterization of cDNA encoding human placental anticoagulant protein (PP4): Homology with the lipocortin family

    International Nuclear Information System (INIS)

    Grundmann, U.; Abel, K.J.; Bohn, H.; Loebermann, H.; Lottspeich, F.; Kuepper, H.

    1988-01-01

    A cDNA library prepared from human placenta was screened for sequences encoding the placental protein 4 (PP4). PP4 is an anticoagulant protein that acts as an indirect inhibitor of the thromboplastin-specific complex, which is involved in the blood coagulation cascade. Partial amino acid sequence information from PP4-derived cyanogen bromide fragments was used to design three oligonucleotide probes for screening the library. From 10 6 independent recombinants, 18 clones were identified that hybridized to all three probes. These 18 recombinants contained cDNA inserts encoding a protein of 320 amino acid residues. In addition to the PP4 cDNA the authors identified 9 other recombinants encoding a protein with considerable similarity (74%) to PP4, which was termed PP4-X. PP4 and PP4-X belong to the lipocortin family, as judged by their homology to lipocortin I and calpactin I

  20. Effect of Vaccination with Irradiated Tachyzoites on Histopathological Changes and DNA Damage in Hepatocytes of Experimental Toxoplasmosis

    International Nuclear Information System (INIS)

    Amin, M.M.; Hafez, E.N.

    2015-01-01

    Current strategies for the control of toxoplasmosis are based on chemotherapy, however successful vaccine has also been demonstrated. The present study aims to assess the effect of the vaccination with radiation-attenuated tachyzoites in challenged mice regarding histopathological alteration and DNA damage of hepatocytes. Sixty mice were equally divided as follow: Group I left as a normal control group II was infected with 2x10 3 RH virulent tachyzoite s (infected control). Groups III and IV were subdivided into two subgroups a and b where subgroups III a and IV a were vaccinate d with 2.47 mw-min/cm 2 UV and 0.3 KGy gamma radiation – attenuate d tachyzoites respectively without challenge (as vaccine control). Subgroups III b and IV b were vaccinate d with UV and gamma radiation - attenuated tachyzoites and challenged after three weeks with 2x10 3 RH virulent tachyzoites. Livers were examined for histopathological changes and DNA comet assay. It was observed that acute infection with Toxoplasma tachyzoites produced toxic effects which lead to severe damage in liver tissues and DNA of hepatocytes. Meanwhile, the protective effect of UV or gamma radiation-attenuated tachyzoites vaccine resulted in the maintenance of normal histopathological characteristics and DNA of hepatocyte s and UV irradiation is better in its protective capacity

  1. Safety of administering the canine melanoma DNA vaccine (Oncept) to cats with malignant melanoma - a retrospective study.

    Science.gov (United States)

    Sarbu, Luminita; Kitchell, Barbara E; Bergman, Philip J

    2017-02-01

    Objectives A xenogeneic human tyrosinase DNA vaccine was developed for treatment of dogs with oral malignant melanoma (Oncept; Merial). No studies have evaluated the safety or efficacy of this vaccine in cats. The purpose of this study was to evaluate the safety of the canine melanoma vaccine in cats diagnosed with melanoma. Methods Medical records were reviewed from cats diagnosed with malignant melanoma and treated with the canine melanoma DNA vaccine (Oncept). Data regarding signalment, melanoma location, treatments received, vaccine adverse effects and cause of death were collected. Results A total of 114 melanoma vaccines were administered to 24 cats. Seven cats (11.4%) had clinical adverse effects from a total of 13 vaccines classified as grade 1 or 2 based on the Veterinary Cooperative Oncology Group's common terminology criteria for adverse events v1.1. These included pain on vaccine administration, brief muscle fasciculation, transient inappetence, depression, nausea and mild increase in pigmentation at the injection site. Nineteen cats were deceased at study close. The most common cause of death was melanoma (14 cats). Hematological and biochemical changes were observed in six cats, five of which had concurrent disease or treatments that likely caused or greatly contributed to the laboratory abnormalities found. Therefore, these adverse events were considered unlikely to be caused by the melanoma vaccine. One cat had transient grade 1 hypoalbuminemia, which was possibly caused by the vaccination but not thoroughly evaluated. Conclusions and relevance The canine melanoma DNA vaccine can be safely administered to cats, with minimal risk of adverse effects.

  2. Microneedle arrays coated with charge reversal pH-sensitive copolymers improve antigen presenting cells-homing DNA vaccine delivery and immune responses.

    Science.gov (United States)

    Duong, Huu Thuy Trang; Kim, Nak Won; Thambi, Thavasyappan; Giang Phan, V H; Lee, Min Sang; Yin, Yue; Jeong, Ji Hoon; Lee, Doo Sung

    2018-01-10

    Successful delivery of a DNA vaccine to antigen-presenting cells and their subsequent stimulation of CD4 + and CD8 + T cell immunity remains an inefficient process. In general, the delivery of prophylactic vaccines is mainly mired by low transfection efficacy, poor immunogenicity, and safety issues from the materials employed. Currently, several strategies have been exploited to improve immunogenicity, but an effective strategy for safe and pain-free delivery of DNA vaccines is complicated. Herein, we report the rapid delivery of polyplex-based DNA vaccines using microneedle arrays coated with a polyelectrolyte multilayer assembly of charge reversal pH-responsive copolymer and heparin. The charge reversal pH-responsive copolymer, composed of oligo(sulfamethazine)-b-poly(ethylene glycol)-b-poly(amino urethane) (OSM-b-PEG-b-PAEU), was used as a triggering layer in the polyelectrolyte multilayer assembly on microneedles. Charge reversal characteristics of this copolymer, that is, the OSM-b-PEG-b-PAEU copolymer exhibit, positive charge at low pH (pH4.03) and becoming negative charge when exposed to physiological pH conditions (pH7.4), allowing the facile assembly and disassembly of polyelectrolyte multilayers. The electrostatic repulsion between heparin and OSM-b-PEG-b-PAEU charge reversal copolymer triggered the release of DNA vaccines. DNA vaccines laden on microneedles are effectively transfected into RAW 264.7 macrophage cells in vitro. Vaccination of BALB/c mice by DNA vaccine-loaded microneedle arrays coated with a polyelectrolyte multilayer generated antigen-specific robust immune responses. These findings provide potential strategy of charge reversal pH-responsive copolymers coated microneedles for DNA vaccine delivery. Copyright © 2017. Published by Elsevier B.V.

  3. Altered response hierarchy and increased T-cell breadth upon HIV-1 conserved element DNA vaccination in macaques.

    Directory of Open Access Journals (Sweden)

    Viraj Kulkarni

    Full Text Available HIV sequence diversity and potential decoy epitopes are hurdles in the development of an effective AIDS vaccine. A DNA vaccine candidate comprising of highly conserved p24(gag elements (CE induced robust immunity in all 10 vaccinated macaques, whereas full-length gag DNA vaccination elicited responses to these conserved elements in only 5 of 11 animals, targeting fewer CE per animal. Importantly, boosting CE-primed macaques with DNA expressing full-length p55(gag increased both magnitude of CE responses and breadth of Gag immunity, demonstrating alteration of the hierarchy of epitope recognition in the presence of pre-existing CE-specific responses. Inclusion of a conserved element immunogen provides a novel and effective strategy to broaden responses against highly diverse pathogens by avoiding decoy epitopes, while focusing responses to critical viral elements for which few escape pathways exist.

  4. Effect of the Plasmid-DNA Vaccination on Macroscopic and Microscopic Damage Caused by the Experimental Chronic Trypanosoma cruzi Infection in the Canine Model

    Directory of Open Access Journals (Sweden)

    Olivia Rodríguez-Morales

    2013-01-01

    Full Text Available The dog is considered the main domestic reservoir for Trypanosoma cruzi infection and a suitable experimental animal model to study the pathological changes during the course of Chagas disease (CD. Vaccine development is one of CD prevention methods to protect people at risk. Two plasmids containing genes encoding a trans-sialidase protein (TcSP and an amastigote-specific glycoprotein (TcSSP4 were used as DNA vaccines in a canine model. Splenomegaly was not found in either of the recombinant plasmid-immunized groups; however, cardiomegaly was absent in animals immunized only with the plasmid containing the TcSSP4 gene. The inflammation of subendocardial and myocardial tissues was prevented only with the immunization with TcSSP4 gene. In conclusion, the vaccination with these genes has a partial protective effect on the enlargement of splenic and cardiac tissues during the chronic CD and on microscopic hearth damage, since both plasmids prevented splenomegaly but only one avoided cardiomegaly, and the lesions in heart tissue of dog immunized with plasmid containing the TcSSP4 gene covered only subepicardial tissue.

  5. Pharmaceutical development of the plasmid DNA vaccine pDERMATT

    NARCIS (Netherlands)

    Quaak, S.G.L.

    2009-01-01

    The discovery of tumor specific antigens and self tolerance mechanisms against these antigens led to the assumption that antigens circulating at sufficient concentration levels could break this self tolerance mechanism and evoke immunological antitumor effects. pDERMATT (plasmid DNA encoding

  6. Temperature effects on vaccine induced immunity to viruses in fish

    DEFF Research Database (Denmark)

    Lorenzen, Niels; Lorenzen, Ellen; Rasmussen, Jesper Skou

    a problem in terms of inducing a protective immune response by vaccination in aquaculture, since it is often desirable to vaccinate fish during autumn, winter, or spring. In experimental vaccination trials with rainbow trout (Oncorhynchus mykiss) using a DNA-vaccine encoding the viral glycoprotein of viral...... haemorrhagic septicaemia virus (VHSV), non-specific as well as specific immune mechanisms seemed to be delayed at low temperature. At five weeks post vaccination fish kept at 5C had no detectable response of neutralising antibodies while two thirds of the fish kept at 15C had sero-converted. While protective...... immunity was still established at both temperatures, specificity analysis suggested that protection at the lower temperature was mainly due to non-specific innate antiviral mechanisms, which appeared to last longer at low temperature. This was presumably related to a prolonged persistence of the vaccine...

  7. Vaccination with Replication Deficient Adenovectors Encoding YF-17D Antigens Induces Long-Lasting Protection from Severe Yellow Fever Virus Infection in Mice.

    Science.gov (United States)

    Bassi, Maria R; Larsen, Mads A B; Kongsgaard, Michael; Rasmussen, Michael; Buus, Søren; Stryhn, Anette; Thomsen, Allan R; Christensen, Jan P

    2016-02-01

    The live attenuated yellow fever vaccine (YF-17D) has been successfully used for more than 70 years. It is generally considered a safe vaccine, however, recent reports of serious adverse events following vaccination have raised concerns and led to suggestions that even safer YF vaccines should be developed. Replication deficient adenoviruses (Ad) have been widely evaluated as recombinant vectors, particularly in the context of prophylactic vaccination against viral infections in which induction of CD8+ T-cell mediated immunity is crucial, but potent antibody responses may also be elicited using these vectors. In this study, we present two adenobased vectors targeting non-structural and structural YF antigens and characterize their immunological properties. We report that a single immunization with an Ad-vector encoding the non-structural protein 3 from YF-17D could elicit a strong CD8+ T-cell response, which afforded a high degree of protection from subsequent intracranial challenge of vaccinated mice. However, full protection was only observed using a vector encoding the structural proteins from YF-17D. This vector elicited virus-specific CD8+ T cells as well as neutralizing antibodies, and both components were shown to be important for protection thus mimicking the situation recently uncovered in YF-17D vaccinated mice. Considering that Ad-vectors are very safe, easy to produce and highly immunogenic in humans, our data indicate that a replication deficient adenovector-based YF vaccine may represent a safe and efficient alternative to the classical live attenuated YF vaccine and should be further tested.

  8. The Capricious Nature of Bacterial Pathogens: Phasevarions and Vaccine Development

    Directory of Open Access Journals (Sweden)

    Aimee Tan

    2016-12-01

    Full Text Available Infectious diseases are a leading cause of morbidity and mortality worldwide, and vaccines are one of the most successful and cost-effective tools for disease prevention. One of the key considerations for rational vaccine development is the selection of appropriate antigens. Antigens must induce a protective immune response, and this response should be directed to stably expressed antigens so the target microbe can always be recognized by the immune system. Antigens with variable expression, due to environmental signals or phase variation (i.e., high frequency, random switching of expression, are not ideal vaccine candidates because variable expression could lead to immune evasion. Phase variation is often mediated by the presence of highly mutagenic simple tandem DNA repeats, and genes containing such sequences can be easily identified, and their use discounted as vaccine antigens reconsidered. Recent research has identified phase variably expressed DNA methyltransferases that act as global epigenetic regulators. These phase variable regulons, known as phasevarions, are associated with altered virulence phenotypes and/or expression of vaccine candidates. As such, genes encoding candidate vaccine antigens that have no obvious mechanism of phase variation may be subject to indirect, epigenetic control as part of a phasevarion. Bioinformatic and experimental studies are required to elucidate the distribution and mechanism of action of these DNA methyltransferases, and most importantly, whether they mediate epigenetic regulation of potential and current vaccine candidates. This process is essential to define the stably expressed antigen target profile of bacterial pathogens and thereby facilitate efficient, rational selection of vaccine antigens.

  9. A polyvalent influenza DNA vaccine applied by needle-free intradermal delivery induces cross-reactive humoral and cellular immune responses in pigs

    DEFF Research Database (Denmark)

    Borggren, Marie; Nielsen, Jens; Karlsson, Ingrid

    2016-01-01

    of the optimized DNA vaccine were evaluated in groups of five to six pigs. The DNA vaccine consisted of six selected influenza genes of pandemic origin, including internally expressed matrix and nucleoprotein and externally expressed hemagglutinin and neuraminidase. RESULTS: Needle-free vaccination of growing pigs...

  10. DNA vaccine-generated duck polyclonal antibodies as a postexposure prophylactic to prevent hantavirus pulmonary syndrome (HPS.

    Directory of Open Access Journals (Sweden)

    Rebecca Brocato

    Full Text Available Andes virus (ANDV is the predominant cause of hantavirus pulmonary syndrome (HPS in South America and the only hantavirus known to be transmitted person-to-person. There are no vaccines, prophylactics, or therapeutics to prevent or treat this highly pathogenic disease (case-fatality 35-40%. Infection of Syrian hamsters with ANDV results in a disease that closely mimics human HPS in incubation time, symptoms of respiratory distress, and disease pathology. Here, we evaluated the feasibility of two postexposure prophylaxis strategies in the ANDV/hamster lethal disease model. First, we evaluated a natural product, human polyclonal antibody, obtained as fresh frozen plasma (FFP from a HPS survivor. Second, we used DNA vaccine technology to manufacture a polyclonal immunoglobulin-based product that could be purified from the eggs of vaccinated ducks (Anas platyrhynchos. The natural "despeciation" of the duck IgY (i.e., Fc removed results in an immunoglobulin predicted to be minimally reactogenic in humans. Administration of ≥ 5,000 neutralizing antibody units (NAU/kg of FFP-protected hamsters from lethal disease when given up to 8 days after intranasal ANDV challenge. IgY/IgYΔFc antibodies purified from the eggs of DNA-vaccinated ducks effectively neutralized ANDV in vitro as measured by plaque reduction neutralization tests (PRNT. Administration of 12,000 NAU/kg of duck egg-derived IgY/IgYΔFc protected hamsters when administered up to 8 days after intranasal challenge and 5 days after intramuscular challenge. These experiments demonstrate that convalescent FFP shows promise as a postexposure HPS prophylactic. Moreover, these data demonstrate the feasibility of using DNA vaccine technology coupled with the duck/egg system to manufacture a product that could supplement or replace FFP. The DNA vaccine-duck/egg system can be scaled as needed and obviates the necessity of using limited blood products obtained from a small number of HPS survivors. This

  11. Approaches and Perspectives for Development of African Swine Fever Virus Vaccines

    Directory of Open Access Journals (Sweden)

    Marisa Arias

    2017-10-01

    Full Text Available African swine fever (ASF is a complex disease of swine, caused by a large DNA virus belonging to the family Asfarviridae. The disease shows variable clinical signs, with high case fatality rates, up to 100%, in the acute forms. ASF is currently present in Africa and Europe where it circulates in different scenarios causing a high socio-economic impact. In most affected regions, control has not been effective in part due to lack of a vaccine. The availability of an effective and safe ASFV vaccines would support and enforce control–eradication strategies. Therefore, work leading to the rational development of protective ASF vaccines is a high priority. Several factors have hindered vaccine development, including the complexity of the ASF virus particle and the large number of proteins encoded by its genome. Many of these virus proteins inhibit the host’s immune system thus facilitating virus replication and persistence. We review previous work aimed at understanding ASFV–host interactions, including mechanisms of protective immunity, and approaches for vaccine development. These include live attenuated vaccines, and “subunit” vaccines, based on DNA, proteins, or virus vectors. In the shorter to medium term, live attenuated vaccines are the most promising and best positioned candidates. Gaps and future research directions are evaluated.

  12. MPT-51/CpG DNA vaccine protects mice against Mycobacterium tuberculosis.

    Science.gov (United States)

    Silva, Bruna Daniella de Souza; da Silva, Ediane Batista; do Nascimento, Ivan Pereira; Dos Reis, Michelle Cristina Guerreiro; Kipnis, André; Junqueira-Kipnis, Ana Paula

    2009-07-16

    Tuberculosis (TB) is a severe infectious disease that kills approximately two million people worldwide every year. Because BCG protection is variable and does not protects adults, there is a great need for a new vaccine against TB that does not represent a risk for immunocompromised patients and that is also capable of protecting adult individuals. MPT-51 is a protein found in the genome of mycobacteria and binds to the fibronectin of the extracellular matrix, which may have a role in host tissue attachment and virulence. In order to test the usefulness of MPT-51 as a subunit vaccine, BALB/c were vaccinated and challenged with Mycobacterium tuberculosis. The infection of BALB/c with M. tuberculosis increased the number of IFN-gamma(+) T lymphocytes specific to MPT-51 in the spleen and lungs. Inoculation with rMPT-51/FIA and with rMPT-51/CpG DNA in non-infected BALB/c increased the amounts of IFN-gamma(+) T lymphocytes. Inoculation with rMPT-51/FIA also induced a humoral response specific to MPT-51. CFU counts of lung tissues done 60 days after infection showed a reduction of about 2 log in the bacteria load in the group of animals inoculated with rMPT-51/CpG DNA. These results make MPT-51 a valuable component to be further evaluated in the development of other subunit vaccines.

  13. Mucosal immunization with PLGA-microencapsulated DNA primes a SIV-specific CTL response revealed by boosting with cognate recombinant modified vaccinia virus Ankara

    International Nuclear Information System (INIS)

    Sharpe, Sally; Hanke, Tomas; Tinsley-Bown, Anne; Dennis, Mike; Dowall, Stuart; McMichael, Andrew; Cranage, Martin

    2003-01-01

    Systemically administered DNA encoding a recombinant human immunodeficiency virus (HIV) derived immunogen effectively primes a cytotoxic T lymphocyte (CTL) response in macaques. In this further pilot study we have evaluated mucosal delivery of DNA as an alternative priming strategy. Plasmid DNA, pTH.HW, encoding a multi-CTL epitope gene, was incorporated into poly(D,L-lactic-co-glycolic acid) microparticles of less than 10 μm in diameter. Five intrarectal immunizations failed to stimulate a circulating vaccine-specific CTL response in 2 Mamu-A*01 + rhesus macaques. However, 1 week after intradermal immunization with a cognate modified vaccinia virus Ankara vaccine MVA.HW, CTL responses were detected in both animals that persisted until analysis postmortem, 12 weeks after the final boost. In contrast, a weaker and less durable response was seen in an animal vaccinated with the MVA construct alone. Analysis of lymphoid tissues revealed a disseminated CTL response in peripheral and regional lymph nodes but not the spleen of both mucosally primed animals

  14. Multigenic DNA vaccine induces protective cross-reactive T cell responses against heterologous influenza virus in nonhuman primates.

    Directory of Open Access Journals (Sweden)

    Merika T Koday

    Full Text Available Recent avian and swine-origin influenza virus outbreaks illustrate the ongoing threat of influenza pandemics. We investigated immunogenicity and protective efficacy of a multi-antigen (MA universal influenza DNA vaccine consisting of HA, M2, and NP antigens in cynomolgus macaques. Following challenge with a heterologous pandemic H1N1 strain, vaccinated animals exhibited significantly lower viral loads and more rapid viral clearance when compared to unvaccinated controls. The MA DNA vaccine induced robust serum and mucosal antibody responses but these high antibody titers were not broadly neutralizing. In contrast, the vaccine induced broadly-reactive NP specific T cell responses that cross-reacted with the challenge virus and inversely correlated with lower viral loads and inflammation. These results demonstrate that a MA DNA vaccine that induces strong cross-reactive T cell responses can, independent of neutralizing antibody, mediate significant cross-protection in a nonhuman primate model and further supports development as an effective approach to induce broad protection against circulating and emerging influenza strains.

  15. Gene Gun Bombardment with DNA-Coated Golden Particles Enhanced the Protective Effect of a DNA Vaccine Based on Thioredoxin Glutathione Reductase of Schistosoma japonicum

    Directory of Open Access Journals (Sweden)

    Yan Cao

    2013-01-01

    Full Text Available Schistosomiasis, caused by infection with Schistosoma species, remains an important parasitic zoonosis. Thioredoxin glutathione reductase of Schistosoma japonicum (SjTGR plays an important role in the development of the parasite and for its survival. Here we present a recombinant plasmid DNA vaccine, pVAX1/SjTGR, to estimate its protection against S. japonicum in BALB/c mice. The DNA vaccine administrated by particle bombardment induced higher protection than by intramuscular injection. All animals vaccinated with pVAX1/SjTGR developed significant specific anti-SjTGR antibodies than control groups. Moreover, animals immunized by gene gun exhibited a splenocyte proliferative response, with an increase in IFN-γ and IL-4. The recombinant plasmid administrated by gene gun achieved a medium protective efficacy of 27.83–38.83% ( of worm reduction and 40.38–44.51% ( of liver egg count reduction. It suggests that different modes of administering a DNA vaccine can influence the protective efficacy induced by the vaccine. Interestingly, from the enzymatic activity results, we found that worms obtained from pVAX1/SjTGR-vaccinated animals expressed lower enzymatic activity than the control group and the antibodies weakened the enzymatic activity of SjTGR in vitro, too. It implies that the high-level antibodies may contribute to the protective effects.

  16. [HPV DNA vaccines expressing recombinant CRT/HPV6bE7 fusion protein inhibit tumor growth and angiogenic activity].

    Science.gov (United States)

    Xu, Yan; Cheng, Hao; Zhao, Ke-Jia; Zhu, Ke-Jian; Zhang, Xing

    2007-11-01

    This paper was to study the angiogenic inhibitory effect and the potential antitumor effect of the constructed recombinant DNA vaccine CRT/HPV6bE7 in vivo. The C57BL/6 mice were vaccinated respectively with recombinant CRT/HPV6bE7 DNA plamids. The inhibitory effects on angiogenesis of generated vaccines in vivo were evaluated by a bFGF-induced angiogenesis assay using the Matrigel kit. To investigate the potential antitumor effect, the mean tumor weights, sizes and tumor appearing times were measured in C57BL/6 mice treated with HPV6bE7-expressing B16 cells. The results indicated that the recombinants CRT180/HPV6bE7 and CRT180 showed strong anti-angiogenic effects in bFGF-induced angiogenesis in vivo. Moreover, CRT180/HPV6bE7 and CRT180 DNA vaccines could significantly inhibit the tumor growth in tumor challenge experiment, and CRT180/HPV6bE7 was superior to other vaccines in delaying tumor formation time, limiting tumor size and weight in tumor protection experiment. In conclusion, recombinant CRT180/HPV6bE7 DNA could elicit a most efficient anti-angiogenic effect and inhibit tumor growth in mice inoculated with DNA vaccines. The antiangiogenic activity of CRT were suggested residing in a domain between CRT 120-180 aa.

  17. Lab-on-a-chip platform for high throughput drug discovery with DNA-encoded chemical libraries

    Science.gov (United States)

    Grünzner, S.; Reddavide, F. V.; Steinfelder, C.; Cui, M.; Busek, M.; Klotzbach, U.; Zhang, Y.; Sonntag, F.

    2017-02-01

    The fast development of DNA-encoded chemical libraries (DECL) in the past 10 years has received great attention from pharmaceutical industries. It applies the selection approach for small molecular drug discovery. Because of the limited choices of DNA-compatible chemical reactions, most DNA-encoded chemical libraries have a narrow structural diversity and low synthetic yield. There is also a poor correlation between the ranking of compounds resulted from analyzing the sequencing data and the affinity measured through biochemical assays. By combining DECL with dynamical chemical library, the resulting DNA-encoded dynamic library (EDCCL) explores the thermodynamic equilibrium of reversible reactions as well as the advantages of DNA encoded compounds for manipulation/detection, thus leads to enhanced signal-to-noise ratio of the selection process and higher library quality. However, the library dynamics are caused by the weak interactions between the DNA strands, which also result in relatively low affinity of the bidentate interaction, as compared to a stable DNA duplex. To take advantage of both stably assembled dual-pharmacophore libraries and EDCCLs, we extended the concept of EDCCLs to heat-induced EDCCLs (hi-EDCCLs), in which the heat-induced recombination process of stable DNA duplexes and affinity capture are carried out separately. To replace the extremely laborious and repetitive manual process, a fully automated device will facilitate the use of DECL in drug discovery. Herein we describe a novel lab-on-a-chip platform for high throughput drug discovery with hi-EDCCL. A microfluidic system with integrated actuation was designed which is able to provide a continuous sample circulation by reducing the volume to a minimum. It consists of a cooled and a heated chamber for constant circulation. The system is capable to generate stable temperatures above 75 °C in the heated chamber to melt the double strands of the DNA and less than 15 °C in the cooled chamber

  18. Immunity to viral haemorrhagic septicaemia (VHS) following DNA vaccination of rainbow trout at an early life-stage

    DEFF Research Database (Denmark)

    Lorenzen, Niels; Lorenzen, Ellen; Einer-Jensen, Katja

    2001-01-01

    -vaccination respectively, revealed that a highly protective and lasting immunity was established shortly after vaccination, in accordance with earlier experiments with larger fish. The defence mechanisms activated by the DNA vaccine are thus functional at an early life-stage in rainbow trout....

  19. Efficacy of a DNA Vaccine Carrying Eimeria maxima Gam56 Antigen Gene against Coccidiosis in Chickens

    Science.gov (United States)

    Xu, Jinjun; Zhang, Yan

    2013-01-01

    To control coccidiosis without using prophylactic medications, a DNA vaccine targeting the gametophyte antigen Gam56 from Eimeria maxima in chickens was constructed, and the immunogenicity and protective effects were evaluated. The ORF of Gam56 gene was cloned into an eukaryotic expression vector pcDNA3.1(zeo)+. Expression of Gam56 protein in COS-7 cells transfected with recombinant plasmid pcDNA-Gam56 was confirmed by indirect immunofluorescence assay. The DNA vaccine was injected intramuscularly to yellow feathered broilers of 1-week old at 3 dosages (25, 50, and 100 µg/chick). Injection was repeated once 1 week later. One week after the second injection, birds were challenged orally with 5×104 sporulated oocysts of E. maxima, then weighed and killed at day 8 post challenge. Blood samples were collected and examined for specific peripheral blood lymphocyte proliferation activity and serum antibody levels. Compared with control groups, the administration of pcDNA-Gam56 vaccine markedly increased the lymphocyte proliferation activity (P<0.05) at day 7 and 14 after the first immunization. The level of lymphocyte proliferation started to decrease on day 21 after the first immunization. A similar trend was seen in specific antibody levels. Among the 3 pcDNA-Gam56 immunized groups, the median dosage group displayed the highest lymphocyte proliferation and antibody levels (P<0.05). The median dosage group had the greatest relative body weight gain (89.7%), and the greatest oocyst shedding reduction (53.7%). These results indicate that median dosage of DNA vaccine had good immunogenicity and immune protection effects, and may be used in field applications for coccidiosis control. PMID:23710081

  20. A recoding method to improve the humoral immune response to an HIV DNA vaccine.

    Directory of Open Access Journals (Sweden)

    Yaoxing Huang

    Full Text Available This manuscript describes a novel strategy to improve HIV DNA vaccine design. Employing a new information theory based bioinformatic algorithm, we identify a set of nucleotide motifs which are common in the coding region of HIV, but are under-represented in genes that are highly expressed in the human genome. We hypothesize that these motifs contribute to the poor protein expression of gag, pol, and env genes from the c-DNAs of HIV clinical isolates. Using this approach and beginning with a codon optimized consensus gag gene, we recode the nucleotide sequence so as to remove these motifs without modifying the amino acid sequence. Transfecting the recoded DNA sequence into a human kidney cell line results in doubling the gag protein expression level compared to the codon optimized version. We then turn both sequences into DNA vaccines and compare induced antibody response in a murine model. Our sequence, which has the motifs removed, induces a five-fold increase in gag antibody response compared to the codon optimized vaccine.

  1. Biomolecule-to-fluorescent-color encoder: modulation of fluorescence emission via DNA structural changes

    Science.gov (United States)

    Nishimura, Takahiro; Ogura, Yusuke; Yamada, Kenji; Ohno, Yuko; Tanida, Jun

    2014-01-01

    A biomolecule-to-fluorescent-color (B/F) encoder for optical readout of biomolecular information is proposed. In the B/F encoder, a set of fluorescence wavelengths and their intensity levels are used for coding of a biomolecular signal. A hybridization chain reaction of hairpin DNAs labeled with fluorescent reporters was performed to generate the fluorescence color codes. The fluorescence is modulated via fluorescence resonance energy transfer, which is controlled by DNA structural changes. The results demonstrate that fluorescent color codes can be configured based on two wavelengths and five intensities using the B/F encoder, and the assigned codes can be retrieved via fluorescence measurements. PMID:25071950

  2. Influence of routes and administration parameters on antibody response of pigs following DNA vaccination

    DEFF Research Database (Denmark)

    Barfoed, Annette Malene; Kirstensen, Birte; Dannemann-Jensen, Tove

    2004-01-01

    Using the nucleoprotein of porcine reproductive and respiratory syndrome virus as model antigen, we optimised parameters for gene gun vaccination of pigs, including firing pressure and vaccination site. As criteria for optimisation, we characterised particle penetration and local tissue damage...... by histology. For selected combinations, vaccination efficiency in terms of antibody response was studied. Gene gun vaccination on ear alone was as efficient as a multi-site (ear, thorax, inguinal area, tongue mucosa) gene gun approach, and more efficient than combined intramuscular (i.m.)/intradermal (i.......d.) injection of plasmid DNA. This indicates, that the ear is an attractive site for gene gun vaccination of pigs....

  3. Clinical Development of a Cytomegalovirus DNA Vaccine: From Product Concept to Pivotal Phase 3 Trial.

    Science.gov (United States)

    Smith, Larry R; Wloch, Mary K; Chaplin, Jennifer A; Gerber, Michele; Rolland, Alain P

    2013-09-25

    2013 marks a milestone year for plasmid DNA vaccine development as a first-in-class cytomegalovirus (CMV) DNA vaccine enters pivotal phase 3 testing. This vaccine consists of two plasmids expressing CMV antigens glycoprotein B (gB) and phosphoprotein 65 (pp65) formulated with a CRL1005 poloxamer and benzalkonium chloride (BAK) delivery system designed to enhance plasmid expression. The vaccine's planned initial indication under investigation is for prevention of CMV reactivation in CMV-seropositive (CMV⁺) recipients of an allogeneic hematopoietic stem cell transplant (HCT). A randomized, double-blind placebo-controlled phase 2 proof-of-concept study provided initial evidence of the safety of this product in CMV⁺ HCT recipients who underwent immune ablation conditioning regimens. This study revealed a significant reduction in viral load endpoints and increased frequencies of pp65-specific interferon-γ-producing T cells in vaccine recipients compared to placebo recipients. The results of this endpoint-defining trial provided the basis for defining the primary and secondary endpoints of a global phase 3 trial in HCT recipients. A case study is presented here describing the development history of this vaccine from product concept to initiation of the phase 3 trial.

  4. For t 2 DNA vaccine prevents Forcipomyia taiwana (biting midge) allergy in a mouse model.

    Science.gov (United States)

    Lee, M-F; Song, P-P; Lin, T-M; Chiu, Y-T; Chen, Y-H

    2016-04-01

    Forcipomyia taiwana (biting midge) is the most prevalent allergenic biting insect in Taiwan, and 60% of the exposed subjects develop allergic reactions. Subjects with insect allergy frequently limit their outdoor activities to avoid the annoyingly intense itchy allergic reactions, leading to significant worsening of their quality of life. Allergen-specific immunotherapy is the only known therapy that provides long-term host immune tolerance to the allergen, but is time-consuming and cumbersome. This study tested whether the For t 2 DNA vaccine can prevent allergic symptoms in For t 2-sensitized mice. Two consecutive shots of For t 2 DNA vaccine were given to mice with a 7-day interval before sensitization with recombinant For t 2 proteins, using the two-step sensitization protocol reported previously. The For t 2 DNA vaccine at 50 μg prevented the production of For t 2-specific IgE (P allergy in the future. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  5. Next Generation Immunotherapy for Pancreatic Cancer: DNA Vaccination is Seeking New Combo Partners.

    Science.gov (United States)

    Cappello, Paola; Curcio, Claudia; Mandili, Giorgia; Roux, Cecilia; Bulfamante, Sara; Novelli, Francesco

    2018-02-16

    Pancreatic Ductal Adenocarcinoma (PDA) is an almost incurable radio- and chemo-resistant tumor, and its microenvironment is characterized by a strong desmoplastic reaction associated with a significant infiltration of T regulatory lymphocytes and myeloid-derived suppressor cells (Tregs, MDSC). Investigating immunological targets has identified a number of metabolic and cytoskeletal related molecules, which are typically recognized by circulating antibodies. Among these molecules we have investigated alpha-enolase (ENO1), a glycolytic enzyme that also acts a plasminogen receptor. ENO1 is also recognized by T cells in PDA patients, so we developed a DNA vaccine that targets ENO1. This efficiently induces many immunological processes (antibody formation and complement-dependent cytotoxicity (CDC)-mediated tumor killing, infiltration of effector T cells, reduction of infiltration of myeloid and Treg suppressor cells), which significantly increase the survival of genetically engineered mice that spontaneously develop pancreatic cancer. Although promising, the ENO1 DNA vaccine does not completely eradicate the tumor, which, after an initial growth inhibition, returns to proliferate again, especially when Tregs and MDSC ensue in the tumor mass. This led us to develop possible strategies for combinatorial treatments aimed to broaden and sustain the antitumor immune response elicited by DNA vaccination. Based on the data we have obtained in recent years, this review will discuss the biological bases of possible combinatorial treatments (chemotherapy, PI3K inhibitors, tumor-associated macrophages, ENO1 inhibitors) that could be effective in amplifying the response induced by the immune vaccination in PDA.

  6. Evaluation of the immune response in Shitou geese (Anser anser domesticus) following immunization with GPV-VP1 DNA-based and live attenuated vaccines.

    Science.gov (United States)

    Deng, Shu-xuan; Cai, Ming-sheng; Cui, Wei; Huang, Jin-lu; Li, Mei-li

    2014-01-01

    Goose parvovirus (GPV) is a highly contagious and deadly disease for goslings and Muscovy ducklings. To compare the differences in immune response of geese immunized with GPV-VP1 DNA-based and live attenuated vaccines. Shitou geese were immunized once with either 20 μg pcDNA-GPV-VP1 DNA gene vaccine by gene gun bombardment via intramuscular injection, or 300 μg by i.m. injection, or 300 μL live attenuated vaccine by i.m. injection, whereas 300 μg pcDNA3.1 (+) i.m. or 300 μL saline i.m. were used as positive and negative controls, respectively. Each group comprised 28 animals. Peripheral blood samples were collected from 2-210 days after immunization and the proliferation of T lymphocytes, the number of CD4(+) and CD8(+) T cells and the level of IgG assessed. Statistical analysis was performed using a one-way analysis of variance with group multiple comparisons via Tukey's test. The pcDNA-GPV-VP1 DNA and attenuated vaccine induced cellular and humoral responses, and there were no differences between the 20 and 300 μg group in the responses of proliferation of T lymphocyte and the CD8(+) T-cell. However, as to CD4(+) T-cell response and humoral immunity, the 20 μg group performed better than the 300 μg group, which induced better cellular and humoral immunity than live attenuated vaccine. This study showed that it is possible to induce both cellular and humoral response using DNA-based vaccines and that the pcDNA-GPV-VP1 DNA gene vaccine induced better cellular and humoral immunity than live attenuated vaccine.

  7. Randomized phase I trial HIV-CORE 003: Depletion of serum amyloid P component and immunogenicity of DNA vaccination against HIV-1.

    Science.gov (United States)

    Borthwick, Nicola J; Lane, Thirusha; Moyo, Nathifa; Crook, Alison; Shim, Jung Min; Baines, Ian; Wee, Edmund G; Hawkins, Philip N; Gillmore, Julian D; Hanke, Tomáš; Pepys, Mark B

    2018-01-01

    The failure of DNA vaccination in humans, in contrast to its efficacy in some species, is unexplained. Observational and interventional experimental evidence suggests that DNA immunogenicity may be prevented by binding of human serum amyloid P component (SAP). SAP is the single normal DNA binding protein in human plasma. The drug (R)-1-[6-[(R)-2-carboxypyrrolidin-1-yl]-6-oxo-hexanoyl]pyrrolidine-2-carboxylic acid (CPHPC, miridesap), developed for treatment of systemic amyloidosis and Alzheimer's disease, depletes circulating SAP by 95-99%. The proof-of-concept HIV-CORE 003 clinical trial tested whether SAP depletion by CPHPC would enhance the immune response in human volunteers to DNA vaccination delivering the HIVconsv immunogen derived from conserved sub-protein regions of HIV-1. Human volunteers received 3 intramuscular immunizations with an experimental DNA vaccine (DDD) expressing HIV-1-derived immunogen HIVconsv, with or without prior depletion of SAP by CPHPC. All subjects were subsequently boosted by simian (chimpanzee) adenovirus (C)- and poxvirus MVA (M)-vectored vaccines delivering the same immunogen. After administration of each vaccine modality, the peak total magnitudes, kinetics, functionality and memory subsets of the T-cell responses to HIVconsv were thoroughly characterized. No differences were observed between the CPHPC treated and control groups in any of the multiple quantitative and qualitative parameters of the T-cell responses to HIVconsv, except that after SAP depletion, there was a statistically significantly greater breadth of T-cell specificities, that is the number of recognized epitopes, following the DDDC vaccination. The protocol used here for SAP depletion by CPHPC prior to DNA vaccination produced only a very modest suggestion of enhanced immunogenicity. Further studies will be required to determine whether SAP depletion might have a practical value in DNA vaccination for other plasmid backbones and/or immunogens. Clinicaltrials

  8. Topical Administration Is a Promising Inoculating Route versus Intramuscular Inoculation for the Nanoparticle-Carried DNA Vaccine to Prevent Corneal Infections.

    Science.gov (United States)

    Hu, Kai; Malla, Tejsu; Zhai, Yujia; Dong, Lili; Tang, Ru

    2015-01-01

    To evaluate the comparative effect of topical versus intramuscular administration of nanoparticle-carried DNA vaccine in preventing corneal herpes simplex virus type 1 (HSV-1) infection. Nanoparticle [polyethylenimine (PEI)-Fe3O4]-carried DNA vaccine (PEI-Fe3O4-pRSC-gD-IL-21) or DNA vaccine (pRSC-gD-IL-21) alone were topically versus intramuscularly inoculated into one eye each of mice on days 0, 14 and 28. Three weeks after the final immunization, the specific immune responses and clinical degrees of primary herpes simplex keratitis were evaluated. Topical inoculation of nanoparticle-carried DNA vaccine induced mice to generate similar levels of specific HSV-1-neutralizing antibody, IFN-γ and IL-4 in serum and specific killing (cytotoxicity) and proliferative activities of the splenic lymphocytes, but a significantly higher level of secretory IgA in tears compared to those of intramuscular inoculation. More importantly, the mice inoculated topically showed a significantly decreased herpes simplex keratitis severity than the mice inoculated intramuscularly after HSV-1 challenge on the corneas of the mice. Topical inoculation of nanoparticle-carried DNA vaccine elicits a stronger specific local immune response and more effectively inhibits herpes simplex keratitis as compared to intramuscular inoculation in an HSV-1 ocular challenge mouse model. Thus, topical administration may be a promising inoculating route for the nanoparticle-carried DNA vaccine to prevent corneal infections. © 2015 S. Karger AG, Basel.

  9. In vivo electroporation enhances the immunogenicity of an HIV-1 DNA vaccine candidate in healthy volunteers.

    Directory of Open Access Journals (Sweden)

    Sandhya Vasan

    Full Text Available DNA-based vaccines have been safe but weakly immunogenic in humans to date.We sought to determine the safety, tolerability, and immunogenicity of ADVAX, a multigenic HIV-1 DNA vaccine candidate, injected intramuscularly by in vivo electroporation (EP in a Phase-1, double-blind, randomized placebo-controlled trial in healthy volunteers. Eight volunteers each received 0.2 mg, 1 mg, or 4 mg ADVAX or saline placebo via EP, or 4 mg ADVAX via standard intramuscular injection at weeks 0 and 8. A third vaccination was administered to eleven volunteers at week 36. EP was safe, well-tolerated and considered acceptable for a prophylactic vaccine. EP delivery of ADVAX increased the magnitude of HIV-1-specific cell mediated immunity by up to 70-fold over IM injection, as measured by gamma interferon ELISpot. The number of antigens to which the response was detected improved with EP and increasing dosage. Intracellular cytokine staining analysis of ELISpot responders revealed both CD4+ and CD8+ T cell responses, with co-secretion of multiple cytokines.This is the first demonstration in healthy volunteers that EP is safe, tolerable, and effective in improving the magnitude, breadth and durability of cellular immune responses to a DNA vaccine candidate.ClinicalTrials.gov NCT00545987.

  10. DNA vaccines: general concerns and its applications in human and veterinary medicine/ Vacina de DNA: aspectos gerais e sua aplicação na medicina humana e veterinária

    Directory of Open Access Journals (Sweden)

    Marilda Carlos Vidotto

    2007-08-01

    Full Text Available The vaccination with DNA is one of the most promising immunization techniques against a pathogens variety and tumors, for which the conventional methods have not been efficient. DNA vaccines are capable to induce immune humoral and cellular response, directed to lymphocytes CD4+ and CD8+, without the necessity of live microorganisms. In spite of the great potential of inducing protective immunity, the DNA vaccine not always has success. The immunity depends on several factors such as the selection of the target gene, construction of the expression vector, frequency and via of administration of the vaccine, amount of DNA, location of the antigen codified by the plasmid and age, health and species of vaccinated animals. This revision shows the development of some vaccines of DNA for diseases of interest in the veterinary and human medicine.A vacinação com DNA é uma das mais promissoras técnicas de imunização contra uma variedade de patógenos e tumores, para os quais os métodos convencionais não tem sido eficientes. Vacinas de DNA são capazes de induzir resposta imune humoral e celular, tanto para resposta de linfócitos CD4+ quanto CD8+, sem a necessidade de microrganismos vivos. Apesar do grande potencial de induzir imunidade protetora, a vacina de DNA nem sempre apresenta bons resultados. A imunidade depende de vários fatores como a seleção do gene alvo, construção do vetor de expressão, freqüência e via de administração da vacina, quantidade de DNA, localização do antígeno codificado pelo plasmídio e idade, saúde e espécies de animais vacinados. Esta revisão relata o desenvolvimento de algumas vacinas de DNA para doenças de interesse na medicina veterinária e humana.

  11. Immunotherapy for Alzheimer's disease: DNA- and protein-based epitope vaccines.

    Science.gov (United States)

    Davtyan, Hayk; Petrushina, Irina; Ghochikyan, Anahit

    2014-01-01

    Active immunotherapy for Alzheimer's disease (AD) is aimed to induce antibodies specific to amyloid-beta (Aβ) that are capable to reduce the level of Aβ in the CNS of Alzheimer's disease patients. First clinical trial AN-1792 that was based on vaccination with full-length Aβ42 showed that safe and effective AD vaccine should induce high titers of anti-Aβ antibodies without activation of harmful autoreactive T cells. Replacement of self-T cell epitope with foreign epitope, keeping self-B cell epitope intact, may allow to induce high titers of anti-Aβ antibodies while avoiding the activation of T cells specific to Aβ. Here we describe the protocols for evaluation of AD DNA- or multiple antigenic peptide (MAP)-based epitope vaccines composed of Aβ(1-11) B cell epitope fused to synthetic T cell epitope PADRE (Aβ(1-11)-PADRE). All protocols could be used for testing any epitope vaccine constructed in your lab and composed of other T cell epitopes using the appropriate peptides in tests for evaluation of humoral and cellular immune responses.

  12. Sequence of a cDNA encoding turtle high mobility group 1 protein.

    Science.gov (United States)

    Zheng, Jifang; Hu, Bi; Wu, Duansheng

    2005-07-01

    In order to understand sequence information about turtle HMG1 gene, a cDNA encoding HMG1 protein of the Chinese soft-shell turtle (Pelodiscus sinensis) was amplified by RT-PCR from kidney total RNA, and was cloned, sequenced and analyzed. The results revealed that the open reading frame (ORF) of turtle HMG1 cDNA is 606 bp long. The ORF codifies 202 amino acid residues, from which two DNA-binding domains and one polyacidic region are derived. The DNA-binding domains share higher amino acid identity with homologues sequences of chicken (96.5%) and mammalian (74%) than homologues sequence of rainbow trout (67%). The polyacidic region shows 84.6% amino acid homology with the equivalent region of chicken HMG1 cDNA. Turtle HMG1 protein contains 3 Cys residues located at completely conserved positions. Conservation in sequence and structure suggests that the functions of turtle HMG1 cDNA may be highly conserved during evolution. To our knowledge, this is the first report of HMG1 cDNA sequence in any reptilian.

  13. Antiviral immunity in fish – functional analysis using DNA vaccination as a tool

    DEFF Research Database (Denmark)

    Lorenzen, Niels; Lorenzen, Ellen; Einer-Jensen, Katja

    2013-01-01

    fingerlings. Vaccination of fish at an early stage appears advantageous, since larger fish require higher doses of vaccine to be protected. Even in fish with an average size of 0.5 g at the time of vaccination, good protection can be obtained. Interestingly, immunity is established already a few days after...... and cellular components both play a role in the long lasting protection. The similarity of the functional immune response profile to that induced by a natural virus infection is striking and is most likely one of the major reasons for the efficacy of the rhabdovirus DNA vaccines. Although other elements like...... protein gene suggest that the structural requirements for antigenicity are different from the requirements for immunogenicity....

  14. Immune responses elicited by Mycoplasma hyopneumoniae recombinant antigens and DNA constructs with potential for use in vaccination against porcine enzootic pneumonia.

    Science.gov (United States)

    Virginio, Veridiana Gomes; Gonchoroski, Taylor; Paes, Jéssica Andrade; Schuck, Desirée Cigaran; Zaha, Arnaldo; Ferreira, Henrique Bunselmeyer

    2014-10-07

    Mycoplasma hyopneumoniae is the etiological agent of porcine enzootic pneumonia (PEP) and causes major economic losses to the pig industry worldwide. Commercially available vaccines provide only partial protection and are relatively expensive. In this study, we assessed the humoral and cellular immune responses to three recombinant antigens of M. hyopneumoniae. Immune responses to selected domains of the P46, HSP70 and MnuA antigens (P46102-253, HSP70212-601 and MnuA182-378), delivered as recombinant subunit or DNA vaccines, were evaluated in BALB/c mice. All purified recombinant antigens and two DNA vaccines, pcDNA3.1(+)/HSP70212-601 and pcDNA3.1(+)/MnuA182-378, elicited a strong humoral immune response, indicated by high IgG levels in the serum. The cellular immune response was assessed by detection of IFN-γ, IL-10 and IL-4 in splenocyte culture supernatants. The recombinant subunit and DNA vaccines induced Th1-polarized immune responses, as evidenced by increased levels of IFN-γ. All recombinant subunit vaccines and the pcDNA3.1(+)/MnuA182-378 vaccine also induced the secretion of IL-10, a Th2-type cytokine, in large quantities. The mixed Th1/Th2-type response may elicit an effective immune response against M. hyopneumoniae, suggesting that P46102-253, HSP70212-601 and MnuA182-378 are potential novel and promising targets for the development of vaccines against PEP. Copyright © 2014 Elsevier Ltd. All rights reserved.

  15. Dendritic cell targeted liposomes–protamine–DNA complexes mediated by synthetic mannosylated cholestrol as a potential carrier for DNA vaccine

    International Nuclear Information System (INIS)

    Li Pan; Chen Simu; Jiang Yuhong; Jiang Jiayu; Zhang Zhirong; Sun Xun

    2013-01-01

    To construct mannosylated liposomes/protamine/DNA (LPD) carriers for DNA vaccine targeting to dendritic cells (DCs), a mannosylated cholesterol derivative (Man-C6-Chol) was synthesized via simple ester linkage and amide bonds. Then, the Man-C6-Chol was applied to LPD formulation as a synthetic ligand. The physicochemical properties of mannosylated LPD (Man-LPD) were first evaluated, including the size and zeta potential, morphology and the ability to protect DNA against DNase I degradation. Man-LPD showed a small size with a stable viral-like structure. In comparison to non-mannose liposomes/LPD (Man-free liposomes/LPD), mannosylated liposomes/LPD (Man-liposomes/Man-LPD) exhibited higher efficiency in both intracellular uptake (2.3-fold) and transfection (4.5-fold) in vitro. Subsequent MTT assays indicated that the LPD carriers had low toxicity on the tested cells. Afterwards, the investigation into the maturation activation on primary bone marrow-derived DCs (BMDCs) showed that both Man-LPD and Man-free LPD induced remarkable up-regulation of CD80, CD86 and CD40 on BMDCs. Inspired by these studies, we can conclude that the synthetic mannosylated LPD targeting to DCs was a potential carrier for DNA vaccine. (paper)

  16. Mutual enhancement of IL-2 and IL-7 on DNA vaccine immunogenicity mainly involves regulations on their receptor expression and receptor-expressing lymphocyte generation.

    Science.gov (United States)

    Zhang, Yonghong; Liang, Shuang; Li, Xiujin; Wang, Liyue; Zhang, Jianlou; Xu, Jian; Huo, Shanshan; Cao, Xuebin; Zhong, Zhenyu; Zhong, Fei

    2015-07-09

    Our previous study showed that IL-2 and IL-7 could mutually enhance the immunogenicity of canine parvovirus VP2 DNA vaccine, although the underlying mechanism remained unknown. Here, we used the OVA gene as a DNA vaccine in a mouse model to test their enhancement on DNA vaccine immunogenicity and to explore the molecular mechanism. Results showed that both IL-2 and IL-7 genes significantly increased the immunogenicity of OVA DNA vaccine in mice. Co-administration of IL-2 and IL-7 genes with OVA DNA significantly increased OVA-specific antibody titers, T cell proliferation and IFN-γ production compared with IL-2 or IL-7 alone, confirming that IL-2 and IL-7 mutually enhanced DNA vaccine immunogenicity. Mechanistically, we have shown that IL-2 significantly stimulated generation of IL-7 receptor-expressing lymphocytes, and that IL-7 significantly induced IL-2 receptor expression. These results contribute to an explanation of the mechanism of the mutual effects of IL-2 and IL-7 on enhancing DNA vaccine immunogenicity and provided a basis for further investigation on their mutual effects on adjuvant activity and immune regulation. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. The DNA-encoded nucleosome organization of a eukaryotic genome.

    Science.gov (United States)

    Kaplan, Noam; Moore, Irene K; Fondufe-Mittendorf, Yvonne; Gossett, Andrea J; Tillo, Desiree; Field, Yair; LeProust, Emily M; Hughes, Timothy R; Lieb, Jason D; Widom, Jonathan; Segal, Eran

    2009-03-19

    Nucleosome organization is critical for gene regulation. In living cells this organization is determined by multiple factors, including the action of chromatin remodellers, competition with site-specific DNA-binding proteins, and the DNA sequence preferences of the nucleosomes themselves. However, it has been difficult to estimate the relative importance of each of these mechanisms in vivo, because in vivo nucleosome maps reflect the combined action of all influencing factors. Here we determine the importance of nucleosome DNA sequence preferences experimentally by measuring the genome-wide occupancy of nucleosomes assembled on purified yeast genomic DNA. The resulting map, in which nucleosome occupancy is governed only by the intrinsic sequence preferences of nucleosomes, is similar to in vivo nucleosome maps generated in three different growth conditions. In vitro, nucleosome depletion is evident at many transcription factor binding sites and around gene start and end sites, indicating that nucleosome depletion at these sites in vivo is partly encoded in the genome. We confirm these results with a micrococcal nuclease-independent experiment that measures the relative affinity of nucleosomes for approximately 40,000 double-stranded 150-base-pair oligonucleotides. Using our in vitro data, we devise a computational model of nucleosome sequence preferences that is significantly correlated with in vivo nucleosome occupancy in Caenorhabditis elegans. Our results indicate that the intrinsic DNA sequence preferences of nucleosomes have a central role in determining the organization of nucleosomes in vivo.

  18. A Phase I Double Blind, Placebo-Controlled, Randomized Study of the Safety and Immunogenicity of Electroporated HIV DNA with or without Interleukin 12 in Prime-Boost Combinations with an Ad35 HIV Vaccine in Healthy HIV-Seronegative African Adults.

    Directory of Open Access Journals (Sweden)

    Juliet Mpendo

    Full Text Available Strategies to enhance the immunogenicity of DNA vaccines in humans include i co-administration of molecular adjuvants, ii intramuscular administration followed by in vivo electroporation (IM/EP and/or iii boosting with a different vaccine. Combining these strategies provided protection of macaques challenged with SIV; this clinical trial was designed to mimic the vaccine regimen in the SIV study.Seventy five healthy, HIV-seronegative adults were enrolled into a phase 1, randomized, double-blind, placebo-controlled trial. Multi-antigenic HIV (HIVMAG plasmid DNA (pDNA vaccine alone or co-administered with pDNA encoding human Interleukin 12 (IL-12 (GENEVAX IL-12 given by IM/EP using the TriGrid Delivery System was tested in different prime-boost regimens with recombinant Ad35 HIV vaccine given IM.All local reactions but one were mild or moderate. Systemic reactions and unsolicited adverse events including laboratory abnormalities did not differ between vaccine and placebo recipients. No serious adverse events (SAEs were reported. T cell and antibody response rates after HIVMAG (x3 prime-Ad35 (x1 boost were independent of IL-12, while the magnitude of interferon gamma (IFN-γ ELISPOT responses was highest after HIVMAG (x3 without IL-12. The quality and phenotype of T cell responses shown by intracellular cytokine staining (ICS were similar between groups. Inhibition of HIV replication by autologous T cells was demonstrated after HIVMAG (x3 prime and was boosted after Ad35. HIV specific antibodies were detected only after Ad35 boost, although there was a priming effect with 3 doses of HIVMAG with or without IL-12. No anti-IL-12 antibodies were detected.The vaccines were safe, well tolerated and moderately immunogenic. Repeated administration IM/EP was well accepted. An adjuvant effect of co-administered plasmid IL-12 was not detected.ClinicalTrials.gov NCT01496989.

  19. Rapid and sustained CD4(+) T-cell-independent immunity from adenovirus-encoded vaccine antigens

    DEFF Research Database (Denmark)

    Holst, Peter J; Bartholdy, Christina; Buus, Anette Stryhn

    2007-01-01

    -linked lymphocytic choriomeningitis virus (LCMV)-derived epitopes was long-lived and protective. Notably, in contrast to full-length protein, the response elicited with the beta(2)-microglobulin-linked LCMV-derived epitope was CD4(+) T-cell independent. Furthermore, virus-specific CD8(+) T cells primed...... in the absence of CD4(+) T-cell help were sustained in the long term and able to expand and control a secondary challenge with LCMV. Our results demonstrate that modifications to the antigen used in adenovirus vaccines may be used to improve the induced T-cell response. Such a strategy for CD4(+) T-cell...... to that elicited with an adenovirus-encoded minimal epitope covalently linked to beta(2)-microglobulin. We demonstrate that the beta(2)-microglobulin-linked epitope induced an accelerated and augmented CD8(+) T-cell response. Furthermore, the immunity conferred by vaccination with beta(2)-microglobulin...

  20. Synthetic virus seeds for improved vaccine safety: Genetic reconstruction of poliovirus seeds for a PER.C6 cell based inactivated poliovirus vaccine.

    Science.gov (United States)

    Sanders, Barbara P; Edo-Matas, Diana; Papic, Natasa; Schuitemaker, Hanneke; Custers, Jerome H H V

    2015-10-13

    Safety of vaccines can be compromised by contamination with adventitious agents. One potential source of adventitious agents is a vaccine seed, typically derived from historic clinical isolates with poorly defined origins. Here we generated synthetic poliovirus seeds derived from chemically synthesized DNA plasmids encoding the sequence of wild-type poliovirus strains used in marketed inactivated poliovirus vaccines. The synthetic strains were phenotypically identical to wild-type polioviruses as shown by equivalent infectious titers in culture supernatant and antigenic content, even when infection cultures are scaled up to 10-25L bioreactors. Moreover, the synthetic seeds were genetically stable upon extended passaging on the PER.C6 cell culture platform. Use of synthetic seeds produced on the serum-free PER.C6 cell platform ensures a perfectly documented seed history and maximum control over starting materials. It provides an opportunity to maximize vaccine safety which increases the prospect of a vaccine end product that is free from adventitious agents. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. Next Generation Immunotherapy for Pancreatic Cancer: DNA Vaccination is Seeking New Combo Partners

    Directory of Open Access Journals (Sweden)

    Paola Cappello

    2018-02-01

    Full Text Available Pancreatic Ductal Adenocarcinoma (PDA is an almost incurable radio- and chemo-resistant tumor, and its microenvironment is characterized by a strong desmoplastic reaction associated with a significant infiltration of T regulatory lymphocytes and myeloid-derived suppressor cells (Tregs, MDSC. Investigating immunological targets has identified a number of metabolic and cytoskeletal related molecules, which are typically recognized by circulating antibodies. Among these molecules we have investigated alpha-enolase (ENO1, a glycolytic enzyme that also acts a plasminogen receptor. ENO1 is also recognized by T cells in PDA patients, so we developed a DNA vaccine that targets ENO1. This efficiently induces many immunological processes (antibody formation and complement-dependent cytotoxicity (CDC-mediated tumor killing, infiltration of effector T cells, reduction of infiltration of myeloid and Treg suppressor cells, which significantly increase the survival of genetically engineered mice that spontaneously develop pancreatic cancer. Although promising, the ENO1 DNA vaccine does not completely eradicate the tumor, which, after an initial growth inhibition, returns to proliferate again, especially when Tregs and MDSC ensue in the tumor mass. This led us to develop possible strategies for combinatorial treatments aimed to broaden and sustain the antitumor immune response elicited by DNA vaccination. Based on the data we have obtained in recent years, this review will discuss the biological bases of possible combinatorial treatments (chemotherapy, PI3K inhibitors, tumor-associated macrophages, ENO1 inhibitors that could be effective in amplifying the response induced by the immune vaccination in PDA.

  2. DNA vaccines elicit durable protective immunity against individual or simultaneous infections with Lassa and Ebola viruses in guinea pigs

    Science.gov (United States)

    Cashman, Kathleen A.; Wilkinson, Eric R.; Wollen, Suzanne E.; Shamblin, Joshua D.; Zelko, Justine M.; Bearss, Jeremy J.; Zeng, Xiankun; Broderick, Kate E.; Schmaljohn, Connie S.

    2017-01-01

    ABSTRACT We previously developed optimized DNA vaccines against both Lassa fever and Ebola hemorrhagic fever viruses and demonstrated that they were protective individually in guinea pig and nonhuman primate models. In this study, we vaccinated groups of strain 13 guinea pigs two times, four weeks apart with 50 µg of each DNA vaccine or a mock vaccine at discrete sites by intradermal electroporation. Five weeks following the second vaccinations, guinea pigs were exposed to lethal doses of Lassa virus, Ebola virus, or a combination of both viruses simultaneously. None of the vaccinated guinea pigs, regardless of challenge virus and including the coinfected group, displayed weight loss, fever or other disease signs, and all survived to the study endpoint. All of the mock-vaccinated guinea pigs that were infected with Lassa virus, and all but one of the EBOV-infected mock-vaccinated guinea pigs succumbed. In order to determine if the dual-agent vaccination strategy could protect against both viruses if exposures were temporally separated, we held the surviving vaccinates in BSL-4 for approximately 120 days to perform a cross-challenge experiment in which guinea pigs originally infected with Lassa virus received a lethal dose of Ebola virus and those originally infected with Ebola virus were infected with a lethal dose of Lassa virus. All guinea pigs remained healthy and survived to the study endpoint. This study clearly demonstrates that DNA vaccines against Lassa and Ebola viruses can elicit protective immunity against both individual virus exposures as well as in a mixed-infection environment. PMID:29135337

  3. PML-RARA-targeted DNA vaccine induces protective immunity in a mouse model of leukemia.

    Science.gov (United States)

    Padua, Rose Ann; Larghero, Jerome; Robin, Marie; le Pogam, Carol; Schlageter, Marie-Helene; Muszlak, Sacha; Fric, Jan; West, Robert; Rousselot, Philippe; Phan, Thi Hai; Mudde, Liesbeth; Teisserenc, Helene; Carpentier, Antoine F; Kogan, Scott; Degos, Laurent; Pla, Marika; Bishop, J Michael; Stevenson, Freda; Charron, Dominique; Chomienne, Christine

    2003-11-01

    Despite improved molecular characterization of malignancies and development of targeted therapies, acute leukemia is not curable and few patients survive more than 10 years after diagnosis. Recently, combinations of different therapeutic strategies (based on mechanisms of apoptosis, differentiation and cytotoxicity) have significantly increased survival. To further improve outcome, we studied the potential efficacy of boosting the patient's immune response using specific immunotherapy. In an animal model of acute promyelocytic leukemia, we developed a DNA-based vaccine by fusing the human promyelocytic leukemia-retinoic acid receptor-alpha (PML-RARA) oncogene to tetanus fragment C (FrC) sequences. We show for the first time that a DNA vaccine specifically targeted to an oncoprotein can have a pronounced effect on survival, both alone and when combined with all-trans retinoic acid (ATRA). The survival advantage is concomitant with time-dependent antibody production and an increase in interferon-gamma (IFN-gamma). We also show that ATRA therapy on its own triggers an immune response in this model. When DNA vaccination and conventional ATRA therapy are combined, they induce protective immune responses against leukemia progression in mice and may provide a new approach to improve clinical outcome in human leukemia.

  4. Needle-free Biojector injection of a dengue virus type 1 DNA vaccine with human immunostimulatory sequences and the GM-CSF gene increases immunogenicity and protection from virus challenge in Aotus monkeys

    International Nuclear Information System (INIS)

    Raviprakash, Kanakatte; Ewing, Dan; Simmons, Monika; Porter, Kevin R.; Jones, Trevor R.; Hayes, Curtis G.; Stout, Richard; Murphy, Gerald S.

    2003-01-01

    A dengue-1 DNA vaccine containing sequences encoding premembrane and envelope proteins (DIME) was previously shown to elicit virus neutralizing antibodies in rhesus and Aotus monkeys, and the primates were partially protected from viremia upon challenge. To increase the neutralizing antibody levels and subsequent protection from virus challenge, four strategies were evaluated: (a) coimmunization with a plasmid expressing Aotus GM-CSF gene; (b) coimmunization with a plasmid containing human immunostimulatory sequences (ISS); (c) coimmunization with both the GM-CSF gene and ISS; and (d) delivery of vaccine using the needle-free Biojector system. Vaccination with the mixed formulation containing DIME, GM-CSF gene, and ISS, by either needle injection or Biojector, led to neutralizing antibody titers that were stable for up to 6 months after vaccination. Furthermore, 6 of 7 monkeys (85%), and 7 of 8 monkeys (87%) receiving this formulation were completely protected from viremia when challenged 1 and 6 months after vaccination, respectively. This is a significant improvement compared to our previous study in which one of three monkeys (33%) receiving just the DIME vaccine was completely protected from viremia at 6 months after immunization

  5. Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity.

    Science.gov (United States)

    Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K

    2016-02-17

    Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  6. Lactococcus lactis carrying a DNA vaccine coding for the ESAT-6 antigen increases IL-17 cytokine secretion and boosts the BCG vaccine immune response.

    Science.gov (United States)

    Pereira, V B; da Cunha, V P; Preisser, T M; Souza, B M; Turk, M Z; De Castro, C P; Azevedo, M S P; Miyoshi, A

    2017-06-01

    A regimen utilizing Bacille Calmette-Guerin (BCG) and another vaccine system as a booster may represent a promising strategy for the development of an efficient tuberculosis vaccine for adults. In a previous work, we confirmed the ability of Lactococcus lactis fibronectin-binding protein A (FnBPA+) (pValac:ESAT-6), a live mucosal DNA vaccine, to produce a specific immune response in mice after oral immunization. In this study, we examined the immunogenicity of this strain as a booster for the BCG vaccine in mice. After immunization, cytokine and immunoglobulin profiles were measured. The BCG prime L. lactis FnBPA+ (pValac:ESAT-6) boost group was the most responsive group, with a significant increase in splenic pro-inflammatory cytokines IL-17, IFN-γ, IL-6 and TNF-α compared with the negative control. Based on the results obtained here, we demonstrated that L. lactis FnBPA+ (pValac:ESAT-6) was able to increase the BCG vaccine general immune response. This work is of great scientific and social importance because it represents the first step towards the development of a booster to the BCG vaccine using L. lactis as a DNA delivery system. © 2017 The Society for Applied Microbiology.

  7. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    2000-07-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  8. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    1999-05-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 12 figs.

  9. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

    1999-05-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  10. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    1995-03-21

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 11 figures.

  11. Clinical Development of a Cytomegalovirus DNA Vaccine: From Product Concept to Pivotal Phase 3 Trial

    Directory of Open Access Journals (Sweden)

    Michele Gerber

    2013-09-01

    Full Text Available 2013 marks a milestone year for plasmid DNA vaccine development as a first-in-class cytomegalovirus (CMV DNA vaccine enters pivotal phase 3 testing. This vaccine consists of two plasmids expressing CMV antigens glycoprotein B (gB and phosphoprotein 65 (pp65 formulated with a CRL1005 poloxamer and benzalkonium chloride (BAK delivery system designed to enhance plasmid expression. The vaccine’s planned initial indication under investigation is for prevention of CMV reactivation in CMV-seropositive (CMV+ recipients of an allogeneic hematopoietic stem cell transplant (HCT. A randomized, double-blind placebo-controlled phase 2 proof-of-concept study provided initial evidence of the safety of this product in CMV+ HCT recipients who underwent immune ablation conditioning regimens. This study revealed a significant reduction in viral load endpoints and increased frequencies of pp65-specific interferon-γ-producing T cells in vaccine recipients compared to placebo recipients. The results of this endpoint-defining trial provided the basis for defining the primary and secondary endpoints of a global phase 3 trial in HCT recipients. A case study is presented here describing the development history of this vaccine from product concept to initiation of the phase 3 trial.

  12. RNase-L regulates the stability of mitochondrial DNA-encoded mRNAs in mouse embryo fibroblasts

    International Nuclear Information System (INIS)

    Chandrasekaran, Krish; Mehrabian, Zara; Li Xiaoling; Hassel, Bret

    2004-01-01

    Accelerated decrease in the levels of mitochondrial DNA-encoded mRNA (mt-mRNA) occurs in neuronal cells exposed either to the excitatory amino acid, glutamate or to the sodium ionophore, monensin, suggesting a role of mitochondrial RNase(s) on the stability of mt-mRNAs. Here we report that in mouse embryo fibroblasts that are devoid of the interferon-regulated RNase, RNase-L, the monensin-induced decrease in the half-life of mt-mRNA was reduced. In monensin (250 nM)-treated RNase-L +/+ cells the average half-life of mt-mRNA, determined after termination of transcription with actinomycin D, was found to be 3 h, whereas in monensin-treated RNase-L -/- cells the half-life of mt-mRNA was >6 h. In contrast, the stability of nuclear DNA-encoded β-actin mRNA was unaffected. Induction of RNase-L expression in mouse 3T3 fibroblasts further decreased the monensin-induced reduction in mt-mRNA half-life to 1.5 h. The results indicate that the RNase-L-dependent decrease in mtDNA-encoded mRNA transcript levels occurs through a decrease in the half-life of mt-mRNA, and that RNase-L may play a role in the stability of mt-mRNA

  13. Digitally encoded DNA nanostructures for multiplexed, single-molecule protein sensing with nanopores

    Science.gov (United States)

    Bell, Nicholas A. W.; Keyser, Ulrich F.

    2016-07-01

    The simultaneous detection of a large number of different analytes is important in bionanotechnology research and in diagnostic applications. Nanopore sensing is an attractive method in this regard as the approach can be integrated into small, portable device architectures, and there is significant potential for detecting multiple sub-populations in a sample. Here, we show that highly multiplexed sensing of single molecules can be achieved with solid-state nanopores by using digitally encoded DNA nanostructures. Based on the principles of DNA origami, we designed a library of DNA nanostructures in which each member contains a unique barcode; each bit in the barcode is signalled by the presence or absence of multiple DNA dumbbell hairpins. We show that a 3-bit barcode can be assigned with 94% accuracy by electrophoretically driving the DNA structures through a solid-state nanopore. Select members of the library were then functionalized to detect a single, specific antibody through antigen presentation at designed positions on the DNA. This allows us to simultaneously detect four different antibodies of the same isotype at nanomolar concentration levels.

  14. Vaccination with Replication Deficient Adenovectors Encoding YF-17D Antigens Induces Long-Lasting Protection from Severe Yellow Fever Virus Infection in Mice

    DEFF Research Database (Denmark)

    Bassi, Maria R; Larsen, Mads Andreas Bay; Kongsgaard, Michael

    2016-01-01

    The live attenuated yellow fever vaccine (YF-17D) has been successfully used for more than 70 years. It is generally considered a safe vaccine, however, recent reports of serious adverse events following vaccination have raised concerns and led to suggestions that even safer YF vaccines should...... be developed. Replication deficient adenoviruses (Ad) have been widely evaluated as recombinant vectors, particularly in the context of prophylactic vaccination against viral infections in which induction of CD8+ T-cell mediated immunity is crucial, but potent antibody responses may also be elicited using......, which afforded a high degree of protection from subsequent intracranial challenge of vaccinated mice. However, full protection was only observed using a vector encoding the structural proteins from YF-17D. This vector elicited virus-specific CD8+ T cells as well as neutralizing antibodies, and both...

  15. Use of DNA vaccination for determination of onset of adaptive immunity in rainbow trout fry

    DEFF Research Database (Denmark)

    Rasmussen, Jesper Skou; Lorenzen, Ellen; Kjær, Torben Egil

    2013-01-01

    ). The fish were challenged by immersion at different times post vaccination. Protective immunity was induced in both sizes of fish, but whereas clear-cut specific protection was evident in the fish vaccinated at 0.5g, the results suggested that the protection in the fish vaccinated at 0.25 g was mainly due......Vaccine producers often recommend a minimum size of 5g for vaccination of rainbow trout, but implementation of prophylactic vaccination in smaller sized fish would be an advantage for several infectious diseases. To implement a cost efficient vaccination strategy, it is important to know...... the duration and nature of the protective immunity induced by the vaccines in the fish. The present work aimed at determination of the smallest size at which specific immunity could be induced in rainbow trout fry by DNA vaccination against viral haemorrhagic septicaemia (VHS). Earlier experiments revealed...

  16. Molecular cloning and functional expression of a human cDNA encoding the antimutator enzyme 8-hydroxyguanine-DNA glycosylase

    Science.gov (United States)

    Roldán-Arjona, Teresa; Wei, Ying-Fei; Carter, Kenneth C.; Klungland, Arne; Anselmino, Catherine; Wang, Rui-Ping; Augustus, Meena; Lindahl, Tomas

    1997-01-01

    The major mutagenic base lesion in DNA caused by exposure to reactive oxygen species is 8-hydroxyguanine (8-oxo-7,8-dihydroguanine). In bacteria and Saccharomyces cerevisiae, this damaged base is excised by a DNA glycosylase with an associated lyase activity for chain cleavage. We have cloned, sequenced, and expressed a human cDNA with partial sequence homology to the relevant yeast gene. The encoded 47-kDa human enzyme releases free 8-hydroxyguanine from oxidized DNA and introduces a chain break in a double-stranded oligonucleotide specifically at an 8-hydroxyguanine residue base paired with cytosine. Expression of the human protein in a DNA repair-deficient E. coli mutM mutY strain partly suppresses its spontaneous mutator phenotype. The gene encoding the human enzyme maps to chromosome 3p25. These results show that human cells have an enzyme that can initiate base excision repair at mutagenic DNA lesions caused by active oxygen. PMID:9223306

  17. Characterization of the cDNA encoding human nucleophosmin and studies of its role in normal and abnormal growth

    International Nuclear Information System (INIS)

    Chan, Waiyee; Liu, Qingrong; Borjigin, J.; Busch, H.; Rennert, O.M.; Tease, L.A.; Chan, Puikwong

    1989-01-01

    A cDNA encoding human nucleophosmin (protein B23) was obtained by screening a human placental cDNA library in δgtll first with monoclonal antibody to rat nucleophosmin and then with confirmed partial cDNA of human nucleophosmin as probes. The cDNA had 1,311 bp with a coding sequence encoding a protein of 294 amino acids. The identity of the cDNA was confirmed by the presence of encoded amino acid sequences identical with those determined by sequencing pure rat nucleophosmin (a total of 138 amino acids). The most striking feature of the sequence is an acidic cluster located in the middle of the molecule. The cluster consists of 26 Asp/Glu and 1 Phe and Ala. Comparison of human nucleophosmin and Xenopus nucleolar protein NO38 shows 64.3% sequence identity. The N-terminal 130 amino acids of human nucleophosmin also bear 50% identity with that of Xenopus nucleoplasmin. Northern blot analysis of rat liver total RNA with a partial nucleophosmin cDNA as probe demonstrated a homogeneous mRNA band of about 1.6 kb. Similar observations were made in hypertrophic rat liver and Novikoff hepatoma. When the protein levels were compared with Western blot immunoassays, Navikoff hepatoma showed 20 times more nucleophosmin, while only about 5 times more nucleophosmin was observed in hypertrophic rat liver than in unstimulated normal liver

  18. Identification of the gene encoding the 65-kilodalton DNA-binding protein of herpes simplex virus type 1

    International Nuclear Information System (INIS)

    Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.

    1988-01-01

    Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment

  19. Isolation and characterization of human cDNA clones encoding the α and the α' subunits of casein kinase II

    International Nuclear Information System (INIS)

    Lozeman, F.J.; Litchfield, D.W.; Piening, C.; Takio, Koji; Walsh, K.A.; Krebs, E.G.

    1990-01-01

    Casein kinase II is a widely distributed protein serine/threonine kinase. The holoenzyme appears to be a tetramer, containing two α or α' subunits (or one of each) and two β subunits. Complementary DNA clones encoding the subunits of casein kinase II were isolated from a human T-cell λgt 10 library using cDNA clones isolated from Drosophila melanogasten. One of the human cDNA clones (hT4.1) was 2.2 kb long, including a coding region of 1176 bp preceded by 156 bp (5' untranslated region) and followed by 871 bp (3' untranslated region). The hT4.1 close was nearly identical in size and sequence with a cDNA clone from HepG2 human hepatoma cultured cells. Another of the human T-cell cDNA clones (hT9.1) was 1.8 kb long, containing a coding region of 1053 bp preceded by 171 by (5' untranslated region) and followed by 550 bp (3' untranslated region). Amino acid sequences deduced from these two cDNA clones were about 85% identical. Most of the difference between the two encoded polypeptides was in the carboxy-terminal region, but heterogeneity was distributed throughout the molecules. Partial amino acid sequence was determined in a mixture of α and α' subunits from bovine lung casein kinase II. The bovine sequences aligned with the 2 human cDNA-encoded polypeptides with only 2 discrepancies out of 535 amino acid positions. This confirmed that the two human T-cell cDNA clones encoded the α and α' subunits of casein kinase II. These studies show that there are two distinct catalytic subunits for casein II (α and α') and that the sequence of these subunits is largely conserved between the bovine and the human

  20. Vaccine platform recombinant measles virus.

    Science.gov (United States)

    Mühlebach, Michael D

    2017-10-01

    The classic development of vaccines is lengthy, tedious, and may not necessarily be successful as demonstrated by the case of HIV. This is especially a problem for emerging pathogens that are newly introduced into the human population and carry the inherent risk of pandemic spread in a naïve population. For such situations, a considerable number of different platform technologies are under development. These are also under development for pathogens, where directly derived vaccines are regarded as too complicated or even dangerous due to the induction of inefficient or unwanted immune responses causing considerable side-effects as for dengue virus. Among platform technologies are plasmid-based DNA vaccines, RNA replicons, single-round infectious vector particles, or replicating vaccine-based vectors encoding (a) critical antigen(s) of the target pathogens. Among the latter, recombinant measles viruses derived from vaccine strains have been tested. Measles vaccines are among the most effective and safest life-attenuated vaccines known. Therefore, the development of Schwarz-, Moraten-, or AIK-C-strain derived recombinant vaccines against a wide range of mostly viral, but also bacterial pathogens was quite straightforward. These vaccines generally induce powerful humoral and cellular immune responses in appropriate animal models, i.e., transgenic mice or non-human primates. Also in the recent first clinical phase I trial, the results have been quite encouraging. The trial indicated the expected safety and efficacy also in human patients, interestingly independent from the level of prevalent anti-measles immunity before the trial. Thereby, recombinant measles vaccines expressing additional antigens are a promising platform for future vaccines.

  1. Evaluation of cellular responses for a chimeric HBsAg-HCV core DNA vaccine in BALB/c mice

    Directory of Open Access Journals (Sweden)

    Maryam Yazdanian

    2015-01-01

    Conclusion: Fusion of HBsAg to HCVcp in the context of a DNA vaccine modality could augment Th1-oriented cellular and CTL responses toward a protective epitope, comparable to that of HCVcp (subunit HCV vaccine immunization.

  2. Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

    Directory of Open Access Journals (Sweden)

    Utut Widyastuti Suharsono

    2008-11-01

    Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

  3. Increasing a Robust Antigen-Specific Cytotoxic T Lymphocyte Response by FMDV DNA Vaccination with IL-9 Expressing Construct

    Directory of Open Access Journals (Sweden)

    Qiang Zou

    2010-01-01

    Full Text Available Various chemokines and cytokines as adjuvants can be used to improve efficacy of DNA vaccination. In this study, we sought to investigate if a DNA construct expressing IL-9 (designed as proV-IL9 as a molecular adjuvant enhance antigen specific immune responses elicited by the pcD-VP1 DNA vaccination. Mice immunized with pcD-VP1 combined with proV-IL9 developed a strong humoral response. In addition, the coinoculation induced significant higher level of antigen-specific cell proliferation and cytotoxic response. This agreed well with higher expression level of IFN-γ and perforin in CD8+ T cells, but not with IL-17 in these T cells. The results indicate that IL-9 induces the development of IFN-γ-producing CD8+ T cells (Tc1, but not the IL-17-producing CD8+ T cells (Tc17. Up-regulated expressions of BCL-2 and BCL-XL were exhibited in these Tc1 cells, suggesting that IL-9 may trigger antiapoptosis mechanism in these cells. Together, these results demonstrated that IL-9 used as molecular adjuvant could enhance the immunogenicity of DNA vaccination, in augmenting humoral and cellular responses and particularly promoting Tc1 activations. Thus, the IL-9 may be utilized as a potent Tc1 adjuvant for DNA vaccines.

  4. Characterization of guinea pig T cell responses elicited after EP-assisted delivery of DNA vaccines to the skin.

    Science.gov (United States)

    Schultheis, Katherine; Schaefer, Hubert; Yung, Bryan S; Oh, Janet; Muthumani, Karuppiah; Humeau, Laurent; Broderick, Kate E; Smith, Trevor R F

    2017-01-03

    The skin is an ideal target tissue for vaccine delivery for a number of reasons. It is highly accessible, and most importantly, enriched in professional antigen presenting cells. Possessing strong similarities to human skin physiology and displaying a defined epidermis, the guinea pig is an appropriate model to study epidermal delivery of vaccine. However, whilst we have characterized the humoral responses in the guinea pig associated with skin vaccine protocols we have yet to investigate the T cell responses. In response to this inadequacy, we developed an IFN-γ ELISpot assay to characterize the cellular immune response in the peripheral blood of guinea pigs. Using a nucleoprotein (NP) influenza pDNA vaccination regimen, we characterized host T cell responses. After delivery of the DNA vaccine to the guinea pig epidermis we detected robust and rapid T cell responses. The levels of IFN-γ spot-forming units averaged approximately 5000 per million cells after two immunizations. These responses were broad in that multiple regions across the NP antigen elicited a T cell response. Interestingly, we identified a number of NP immunodominant T cell epitopes to be conserved across an outbred guinea pig population, a phenomenon which was also observed after immunization with a RSV DNA vaccine. We believe this data enhances our understanding of the cellular immune response elicited to a vaccine in guinea pigs, and globally, will advance the use of this model for vaccine development, especially those targeting skin as a delivery site. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  5. A DNA vaccine co-expressing Trichinella spiralis MIF and MCD-1 with murine ubiquitin induces partial protective immunity in mice.

    Science.gov (United States)

    Tang, F; Xu, L; Yan, R; Song, X; Li, X

    2013-03-01

    Co-expression of Trichinella spiralis macrophage migration inhibitory factor (TsMIF) with T. spiralis cystatin-like domain protein (TsMCD-1) in a DNA vaccine induces a Th1 immune response and partial protection against T. spiralis infection. The present study evaluated whether co-expression of mouse ubiquitin (Ub) with TsMIF and TsMCD-1 might improve the immune response against T. spiralis infection. Groups of BALB/c mice were immunized twice at 2-week intervals with 100 μg of plasmid DNA encoding either a TsMIF-TsMCD-1 fusion protein (pVAX1-Tsmif-Tsmcd-1) or an Ub-co-expressing triple fusion protein Ub-TsMIF-TsMCD-1 (pVAX1-Ub-Tsmif-Tsmcd-1). Control animals were immunized with pVAX1-Ub or blank vector plasmid. Specific antibody levels (IgG, IgG1, IgG2a, IgG2b, IgM, IgA, IgE) against the recombinant protein TsMIF-TsMCD-1, serum cytokines (interferon (IFN)-γ, interleukin (IL)-4, IL-5, transforming growth factor (TGF)-β1 and IL-17), CD4+/CD8+ T cells and cytotoxic T lymphocyte (CTL) responses were monitored. Challenge infection was performed 2 weeks after the second immunization and worm burden was assayed at 35 days post-challenge. Antibody responses induced by pVAX1-Ub-Tsmif-Tsmcd-1 were significantly lower than for TsMIF-TsMCD-1, but the vaccine induced increased levels of Th1 cytokine (IFN-γ) and increased T-cell cytotoxicity. The reduction of worm burden (37.95%) following immunization with pVAX1-Ub-Tsmif-Tsmcd-1 was significantly greater than that induced by the pVAX1-Tsmif-Tsmcd-1 vaccine (23.17%; P< 0.05).

  6. A polyvalent influenza A DNA vaccine induces heterologous immunity and protects pigs against pandemic A(H1N1)pdm09 virus infection

    DEFF Research Database (Denmark)

    Bragstad, Karoline; Vinner, Lasse; Hansen, Mette Sif

    2013-01-01

    seasonal and emerging influenza viruses. We have developed an alternative influenza vaccine based on DNA expressing selected influenza proteins of pandemic and seasonal origin. In the current study, we investigated the protection of a polyvalent influenza DNA vaccine approach in pigs. We immunised pigs...... intradermally with a combination of influenza DNA vaccine components based on the pandemic 1918 H1N1 (M and NP genes), pandemic 2009 H1N1pdm09 (HA and NA genes) and seasonal 2005 H3N2 genes (HA and NA genes) and investigated the protection against infection with virus both homologous and heterologous to the DNA...... of this DNA vaccine to limit virus shedding may have an impact on virus spread among pigs which could possibly extend to humans as well, thereby diminishing the risk for epidemics and pandemics to evolve....

  7. Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata.

    Science.gov (United States)

    Pasion, S G; Hines, J C; Aebersold, R; Ray, D S

    1992-01-01

    A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.

  8. Discovery of Potent and Selective Inhibitors for ADAMTS-4 through DNA-Encoded Library Technology (ELT).

    Science.gov (United States)

    Ding, Yun; O'Keefe, Heather; DeLorey, Jennifer L; Israel, David I; Messer, Jeffrey A; Chiu, Cynthia H; Skinner, Steven R; Matico, Rosalie E; Murray-Thompson, Monique F; Li, Fan; Clark, Matthew A; Cuozzo, John W; Arico-Muendel, Christopher; Morgan, Barry A

    2015-08-13

    The aggrecan degrading metalloprotease ADAMTS-4 has been identified as a novel therapeutic target for osteoarthritis. Here, we use DNA-encoded Library Technology (ELT) to identify novel ADAMTS-4 inhibitors from a DNA-encoded triazine library by affinity selection. Structure-activity relationship studies based on the selection information led to the identification of potent and highly selective inhibitors. For example, 4-(((4-(6,7-dimethoxy-3,4-dihydroisoquinolin-2(1H)-yl)-6-(((4-methylpiperazin-1-yl)methyl)amino)-1,3,5-triazin-2-yl)amino)methyl)-N-ethyl-N-(m-tolyl)benzamide has IC50 of 10 nM against ADAMTS-4, with >1000-fold selectivity over ADAMT-5, MMP-13, TACE, and ADAMTS-13. These inhibitors have no obvious zinc ligand functionality.

  9. Development of oral CTL vaccine using a CTP-integrated Sabin 1 poliovirus-based vector system.

    Science.gov (United States)

    Han, Seung-Soo; Lee, Jinjoo; Jung, Yideul; Kang, Myeong-Ho; Hong, Jung-Hyub; Cha, Min-Suk; Park, Yu-Jin; Lee, Ezra; Yoon, Cheol-Hee; Bae, Yong-Soo

    2015-09-11

    We developed a CTL vaccine vector by modification of the RPS-Vax system, a mucosal vaccine vector derived from a poliovirus Sabin 1 strain, and generated an oral CTL vaccine against HIV-1. A DNA fragment encoding a cytoplasmic transduction peptide (CTP) was integrated into the RPS-Vax system to generate RPS-CTP, a CTL vaccine vector. An HIV-1 p24 cDNA fragment was introduced into the RPS-CTP vector system and a recombinant poliovirus (rec-PV) named vRPS-CTP/p24 was produced. vRPS-CTP/p24 was genetically stable and efficiently induced Th1 immunity and p24-specific CTLs in immunized poliovirus receptor-transgenic (PVR-Tg) mice. In challenge experiments, PVR-Tg mice that were pre-immunized orally with vRPS-CTP/p24 were resistant to challenge with a lethal dose of p24-expressing recombinant vaccinia virus (rMVA-p24). These results suggested that the RPS-CTP vector system had potential for developing oral CTL vaccines against infectious diseases. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. Prime-boost therapeutic vaccination in mice with DNA/DNA or DNA/Fowlpox virus recombinants expressing the Human Papilloma Virus type 16 E6 and E7 mutated proteins fused to the coat protein of Potato virus X.

    Science.gov (United States)

    Illiano, Elena; Bissa, Massimiliano; Paolini, Francesca; Zanotto, Carlo; De Giuli Morghen, Carlo; Franconi, Rosella; Radaelli, Antonia; Venuti, Aldo

    2016-10-02

    The therapeutic antitumor potency of a prime-boost vaccination strategy was explored, based on the mutated, nontransforming forms of the E6 (E6 F47R ) and E7 (E7 GGG ) oncogenes of Human Papilloma Virus type 16 (HPV16), fused to the Potato virus X (PVX) coat protein (CP) sequence. Previous data showed that CP fusion improves the immunogenicity of tumor-associated antigens and may thus increase their efficacy. After verifying the correct expression of E6 F47R CP and E7 GGG CP inserted into DNA and Fowlpox virus recombinants by Western blotting and immunofluorescence, their combined use was evaluated for therapy in a pre-clinical mouse model of HPV16-related tumorigenicity. Immunization protocols were applied using homologous (DNA/DNA) or heterologous (DNA/Fowlpox) prime-boost vaccine regimens. The humoral immune responses were determined by ELISA, and the therapeutic efficacy evaluated by the delay in tumor appearance and reduced tumor volume after inoculation of syngeneic TC-1* tumor cells. Homologous DNA/DNA genetic vaccines were able to better delay tumor appearance and inhibit tumor growth when DNAE6 F47R CP and DNAE7 GGG CP were administered in combination. However, the heterologous DNA/Fowlpox vaccination strategy was able to delay tumor appearance in a higher number of animals when E6 F47R CP and in particular E7 GGG CP were administered alone. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. An Overview of Vaccination Strategies and Antigen Delivery Systems for Streptococcus agalactiae Vaccines in Nile Tilapia (Oreochromis niloticus).

    Science.gov (United States)

    Munang'andu, Hetron Mweemba; Paul, Joydeb; Evensen, Øystein

    2016-12-13

    Streptococcus agalactiae is an emerging infectious disease adversely affecting Nile tilapia ( Niloticus oreochromis ) production in aquaculture. Research carried out in the last decade has focused on developing protective vaccines using different strategies, although no review has been carried out to evaluate the efficacy of these strategies. The purpose of this review is to provide a synopsis of vaccination strategies and antigen delivery systems currently used for S. agalactiae vaccines in tilapia. Furthermore, as shown herein, current vaccine designs include the use of replicative antigen delivery systems, such as attenuated virulent strains, heterologous vectors and DNA vaccines, while non-replicative vaccines include the inactivated whole cell (IWC) and subunit vaccines encoding different S. agalactiae immunogenic proteins. Intraperitoneal vaccination is the most widely used immunization strategy, although immersion, spray and oral vaccines have also been tried with variable success. Vaccine efficacy is mostly evaluated by use of the intraperitoneal challenge model aimed at evaluating the relative percent survival (RPS) of vaccinated fish. The major limitation with this approach is that it lacks the ability to elucidate the mechanism of vaccine protection at portals of bacterial entry in mucosal organs and prevention of pathology in target organs. Despite this, indications are that the correlates of vaccine protection can be established based on antibody responses and antigen dose, although these parameters require optimization before they can become an integral part of routine vaccine production. Nevertheless, this review shows that different approaches can be used to produce protective vaccines against S. agalactiae in tilapia although there is a need to optimize the measures of vaccine efficacy.

  12. An Overview of Vaccination Strategies and Antigen Delivery Systems for Streptococcus agalactiae Vaccines in Nile Tilapia (Oreochromis niloticus)

    Science.gov (United States)

    Munang’andu, Hetron Mweemba; Paul, Joydeb; Evensen, Øystein

    2016-01-01

    Streptococcus agalactiae is an emerging infectious disease adversely affecting Nile tilapia (Niloticus oreochromis) production in aquaculture. Research carried out in the last decade has focused on developing protective vaccines using different strategies, although no review has been carried out to evaluate the efficacy of these strategies. The purpose of this review is to provide a synopsis of vaccination strategies and antigen delivery systems currently used for S. agalactiae vaccines in tilapia. Furthermore, as shown herein, current vaccine designs include the use of replicative antigen delivery systems, such as attenuated virulent strains, heterologous vectors and DNA vaccines, while non-replicative vaccines include the inactivated whole cell (IWC) and subunit vaccines encoding different S. agalactiae immunogenic proteins. Intraperitoneal vaccination is the most widely used immunization strategy, although immersion, spray and oral vaccines have also been tried with variable success. Vaccine efficacy is mostly evaluated by use of the intraperitoneal challenge model aimed at evaluating the relative percent survival (RPS) of vaccinated fish. The major limitation with this approach is that it lacks the ability to elucidate the mechanism of vaccine protection at portals of bacterial entry in mucosal organs and prevention of pathology in target organs. Despite this, indications are that the correlates of vaccine protection can be established based on antibody responses and antigen dose, although these parameters require optimization before they can become an integral part of routine vaccine production. Nevertheless, this review shows that different approaches can be used to produce protective vaccines against S. agalactiae in tilapia although there is a need to optimize the measures of vaccine efficacy. PMID:27983591

  13. Elicitation of strong immune responses by a DNA vaccine expressing a secreted form of hepatitis C virus envelope protein E2 in murine and porcine animal models

    DEFF Research Database (Denmark)

    Li, Yiping; Kang, H.N.; Babiuk, L.A.

    2006-01-01

    boosting with a recombinant E2 protein vaccine formulated with CpG ODN and 10% Emulsigen. The immunogenicity of HCV E2 vaccines was analyzed by ELISA for antibody responses, MTT assay for lymphocyte proliferation, ELISPOT for the number of interferon-gamma secreting cells, and cytotoxic T lymphocyte assays...... and shifted the immune response towards Th2-like ones in piglets. CONCLUSION: A DNA vaccine expressing a secreted form of HCV E2 protein elicited E2-specific immune responses in mice and piglets. Recombinant E2 protein vaccination following DNA immunization significantly increased the antibody response......AIM: To characterize the immunogenicity of a hepatitis C virus (HCV) E2 DNA vaccine alone or with a protein vaccine boost in murine and porcine animal models. METHODS: A DNA vaccine expressing a secreted form of HCV E2 protein was constructed and used to vaccinate mice and piglets with or without...

  14. HIV-1-Specific Antibody Response and Function after DNA Prime and Recombinant Adenovirus 5 Boost HIV Vaccine in HIV-Infected Subjects.

    Directory of Open Access Journals (Sweden)

    Johannes S Gach

    Full Text Available Little is known about the humoral immune response against DNA prime-recombinant adenovirus 5 (rAd5 boost HIV vaccine among HIV-infected patients on long-term suppressive antiretroviral therapy (ART. Previous studies emphasized cellular immune responses; however, current research suggests both cellular and humoral responses are likely required for a successful therapeutic vaccine. Thus, we aimed to understand antibody response and function induced by vaccination of ART-treated HIV-1-infected patients with immune recovery. All subjects participated in EraMune 02, an open-label randomized clinical trial of ART intensification followed by a six plasmid DNA prime (envA, envB, envC, gagB, polB, nefB and rAd5 boost HIV vaccine with matching inserts. Antibody binding levels were determined with a recently developed microarray approach. We also analyzed neutralization efficiency and antibody-dependent cellular cytotoxicity (ADCC. We found that the DNA prime-rAd5 boost vaccine induced a significant cross-clade HIV-specific antibody response, which correlated with antibody neutralization efficiency. However, despite the increase in antibody binding levels, the vaccine did not significantly stimulate neutralization or ADCC responses. This finding was also reflected by a lack of change in total CD4+ cell associated HIV DNA in those who received the vaccine. Our results have important implications for further therapeutic vaccine design and administration, especially in HIV-1 infected patients, as boosting of preexisting antibody responses are unlikely to lead to clearance of latent proviruses in the HIV reservoir.

  15. Tuberculosis: looking beyond BCG vaccines.

    Directory of Open Access Journals (Sweden)

    Mustafa Abu S

    2003-01-01

    Full Text Available Tuberculosis (TB is an infectious disease of international importance and ranks among the top 10 causes of death in the World. About one-third of the world′s population is infected with Mycobacterium tuberculosis. Every year, approximately eight million people develop active disease and two million die of TB. The currently used BCG vaccines have shown variable protective efficacies against TB in different parts of the world. Moreover, being a live vaccine, BCG can be pathogenic in immunocompromised recipients. Therefore, there is an urgent need to develop new vaccines against TB. The comparative genome analysis has revealed the existence of several M. tuberculosis-specific regions that are deleted in BCG. The work carried out to determine the immunological reactivity of proteins encoded by genes located in these regions revealed several major antigens of M. tuberculosis, including the 6 kDa early secreted antigen target (ESAT6. Immunization with ESAT6 and its peptide (aa51-70 protects mice challenged with M. tuberculosis. The protective efficacy of immunization further improves when ESAT6 is recombinantly fused with M. tuberculosis antigen 85B. In addition, ESAT6 delivered as a DNA vaccine is also protective in mice. Whether these vaccines would be safe or not cannot be speculated. The answer regarding the safety and efficacy of these vaccines has to await human trials in different parts of the world.

  16. Evaluation of an ompA-based phage-mediated DNA vaccine against Chlamydia abortus in piglets.

    Science.gov (United States)

    Ou, Changbo; Tian, Deyu; Ling, Yong; Pan, Qing; He, Qing; Eko, Francis O; He, Cheng

    2013-08-01

    Chlamydia abortus (C. abortus) is an obligate intracellular pathogen that causes abortion in pigs and poses a zoonotic risk in pregnant women. Although attenuated and inactivated vaccines are available, they do not provide complete protection in animals underlining the need to develop new vaccines. In this study, we tested the hypothesis that intramuscular immunization with an ompA-based phage-mediated DNA chlamydial vaccine candidate will induce significant antigen-specific cellular and humoral immune responses. Thus, groups of piglets (five per group) were immunized intramuscularly with the phage-MOMP vaccine (λ-MOMP) or a commercial live-attenuated vaccine (1B vaccine) or a GFP-expressing phage (λ-GFP) or phosphate buffered saline (PBS) (control) and antigen-specific cell-mediated and humoral immune responses were evaluated. By day 63 post-immunization, the λ-MOMP vaccine elicited significantly higher (Pabortus. Copyright © 2013 Elsevier B.V. All rights reserved.

  17. Isolation and structure of a cDNA encoding the B1 (CD20) cell-surface antigen of human B lymphocytes

    International Nuclear Information System (INIS)

    Tender, T.F.; Streuli, M.; Schlossman, S.F.; Saito, H.

    1988-01-01

    The B1 (CD20) molecule is a M/sub r/ 33,000 phosphoprotein on the surface of human B lymphocytes that may serve a central role in the homoral immune response by regulating B-cell proliferation and differentiation. In this report, a cDNA clone that encodes the B1 molecule was isolated and the amino acid sequence of B1 was determined. B-cell-specific cDNA clones were selected from a human tonsillar cDNA library by differential hybridization with labeled cDNA derived from either size-fractionated B-cell mRNA or size-fractionated T-cell mRNA. Of the 261 cDNA clones isolated, 3 cross-hybridizing cDNA clones were chosen as potential candidates for encoding B1 based on their selective hybridization to RNA from B1-positive cell lines. The longest clone, pB1-21, contained a 2.8-kilobase insert with an 891-base-pair open reading frame that encodes a protein of 33 kDa. mRNA synthesized from the pB1-21 cDNA clone in vitro was translated into a protein of the same apparent molecular weight as B1. Limited proteinase digestion of the pB1-21 translation product and B1 generated peptides of the same sizes, indicating that the pB1-21 cDNA encodes the B1 molecule. Gel blot analysis indicated that pB1-21 hybridized with two mRNA species of 2.8 and 3.4 kilobases only in B1-positive cell lines. The amino acid sequence deduced from the pB1-21 nucleotide sequence apparently lacks a signal sequence and contains three extensive hydrophobic regions. The deduced B1 amino acid sequence shows no significant homology with other known patients

  18. Safety and Immunogenicity of a Recombinant Adenovirus Serotype 35-Vectored HIV-1 Vaccine in Adenovirus Serotype 5 Seronegative and Seropositive Individuals.

    Science.gov (United States)

    Fuchs, Jonathan D; Bart, Pierre-Alexandre; Frahm, Nicole; Morgan, Cecilia; Gilbert, Peter B; Kochar, Nidhi; DeRosa, Stephen C; Tomaras, Georgia D; Wagner, Theresa M; Baden, Lindsey R; Koblin, Beryl A; Rouphael, Nadine G; Kalams, Spyros A; Keefer, Michael C; Goepfert, Paul A; Sobieszczyk, Magdalena E; Mayer, Kenneth H; Swann, Edith; Liao, Hua-Xin; Haynes, Barton F; Graham, Barney S; McElrath, M Juliana

    2015-05-01

    Recombinant adenovirus serotype 5 (rAd5)-vectored HIV-1 vaccines have not prevented HIV-1 infection or disease and pre-existing Ad5 neutralizing antibodies may limit the clinical utility of Ad5 vectors globally. Using a rare Ad serotype vector, such as Ad35, may circumvent these issues, but there are few data on the safety and immunogenicity of rAd35 directly compared to rAd5 following human vaccination. HVTN 077 randomized 192 healthy, HIV-uninfected participants into one of four HIV-1 vaccine/placebo groups: rAd35/rAd5, DNA/rAd5, and DNA/rAd35 in Ad5-seronegative persons; and DNA/rAd35 in Ad5-seropositive persons. All vaccines encoded the HIV-1 EnvA antigen. Antibody and T-cell responses were measured 4 weeks post boost immunization. All vaccines were generally well tolerated and similarly immunogenic. As compared to rAd5, rAd35 was equally potent in boosting HIV-1-specific humoral and cellular immunity and responses were not significantly attenuated in those with baseline Ad5 seropositivity. Like DNA, rAd35 efficiently primed rAd5 boosting. All vaccine regimens tested elicited cross-clade antibody responses, including Env V1/V2-specific IgG responses. Vaccine antigen delivery by rAd35 is well-tolerated and immunogenic as a prime to rAd5 immunization and as a boost to prior DNA immunization with the homologous insert. Further development of rAd35-vectored prime-boost vaccine regimens is warranted.

  19. Enhancement of DNA vaccine potency through linkage of antigen to filamentous bacteriophage coat protein III domain I

    DEFF Research Database (Denmark)

    Cuesta, Àngel M; Suárez, Eduardo; Larsen, Martin

    2006-01-01

    Although DNA-based cancer vaccines have been successfully tested in mouse models, a major drawback of cancer vaccination still remains, namely that tumour antigens are weak and fail to generate a vigorous immune response in tumour-bearing patients. Genetic technology offers strategies for promoti...

  20. TLR1/2 activation during heterologous prime-boost vaccination (DNA-MVA enhances CD8+ T Cell responses providing protection against Leishmania (Viannia.

    Directory of Open Access Journals (Sweden)

    Asha Jayakumar

    2011-06-01

    Full Text Available Leishmania (Viannia parasites present particular challenges, as human and murine immune responses to infection are distinct from other Leishmania species, indicating a unique interaction with the host. Further, vaccination studies utilizing small animal models indicate that modalities and antigens that prevent infection by other Leishmania species are generally not protective.Using a newly developed mouse model of chronic L. (Viannia panamensis infection and the heterologous DNA prime - modified vaccinia virus Ankara (MVA boost vaccination modality, we examined whether the conserved vaccine candidate antigen tryparedoxin peroxidase (TRYP could provide protection against infection/disease.Heterologous prime - boost (DNA/MVA vaccination utilizing TRYP antigen can provide protection against disease caused by L. (V. panamensis. However, protection is dependent on modulating the innate immune response using the TLR1/2 agonist Pam3CSK4 during DNA priming. Prime-boost vaccination using DNA alone fails to protect. Prior to infection protectively vaccinated mice exhibit augmented CD4 and CD8 IFNγ and memory responses as well as decreased IL-10 and IL-13 responses. IL-13 and IL-10 have been shown to be independently critical for disease in this model. CD8 T cells have an essential role in mediating host defense, as CD8 depletion reversed protection in the vaccinated mice; vaccinated mice depleted of CD4 T cells remained protected. Hence, vaccine-induced protection is dependent upon TLR1/2 activation instructing the generation of antigen specific CD8 cells and restricting IL-13 and IL-10 responses.Given the general effectiveness of prime-boost vaccination, the recalcitrance of Leishmania (Viannia to vaccine approaches effective against other species of Leishmania is again evident. However, prime-boost vaccination modality can with modulation induce protective responses, indicating that the delivery system is critical. Moreover, these results suggest that

  1. Self-amplifying mRNA vaccines.

    Science.gov (United States)

    Brito, Luis A; Kommareddy, Sushma; Maione, Domenico; Uematsu, Yasushi; Giovani, Cinzia; Berlanda Scorza, Francesco; Otten, Gillis R; Yu, Dong; Mandl, Christian W; Mason, Peter W; Dormitzer, Philip R; Ulmer, Jeffrey B; Geall, Andrew J

    2015-01-01

    This chapter provides a brief introduction to nucleic acid-based vaccines and recent research in developing self-amplifying mRNA vaccines. These vaccines promise the flexibility of plasmid DNA vaccines with enhanced immunogenicity and safety. The key to realizing the full potential of these vaccines is efficient delivery of nucleic acid to the cytoplasm of a cell, where it can amplify and express the encoded antigenic protein. The hydrophilicity and strong net negative charge of RNA impedes cellular uptake. To overcome this limitation, electrostatic complexation with cationic lipids or polymers and physical delivery using electroporation or ballistic particles to improve cellular uptake has been evaluated. This chapter highlights the rapid progress made in using nonviral delivery systems for RNA-based vaccines. Initial preclinical testing of self-amplifying mRNA vaccines has shown nonviral delivery to be capable of producing potent and robust innate and adaptive immune responses in small animals and nonhuman primates. Historically, the prospect of developing mRNA vaccines was uncertain due to concerns of mRNA instability and the feasibility of large-scale manufacturing. Today, these issues are no longer perceived as barriers in the widespread implementation of the technology. Currently, nonamplifying mRNA vaccines are under investigation in human clinical trials and can be produced at a sufficient quantity and quality to meet regulatory requirements. If the encouraging preclinical data with self-amplifying mRNA vaccines are matched by equivalently positive immunogenicity, potency, and tolerability in human trials, this platform could establish nucleic acid vaccines as a versatile new tool for human immunization. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. Antigen-specific immature dendritic cell vaccine ameliorates anti-dsDNA antibody-induced renal damage in a mouse model.

    Science.gov (United States)

    Xia, Yumin; Jiang, Shan; Weng, Shenhong; Lv, Xiaochun; Cheng, Hong; Fang, Chunhong

    2011-12-01

    Dendritic cells (DCs) can inhibit immune response by clonal anergy when immature. Recent studies have shown that immature DCs (iDCs) may serve as a live cell vaccine after specific antigen pulse based on its potential of blocking antibody production. In this study, we aimed to investigate the effects of nuclear antigen-pulsed iDCs in the treatment of lupus-like renal damages induced by anti-dsDNA antibodies. iDCs were generated from haemopoietic stem cells in bone marrow and then pulsed in vitro with nuclear antigen. The iDC vaccine and corresponding controls were injected into mice with lupus-like renal damages. The evaluation of disease was monitored by biochemical parameters and histological scores. Anti-dsDNA antibody isotypes and T-lymphocyte-produced cytokines were analysed for elucidating therapeutic mechanisms. RESULTS; The mice treated with antigen-pulsed iDCs had a sustained remission of renal damage compared with those injected with non-pulsed iDCs or other controls, including decreased anti-dsDNA antibody level, less proteinuria, lower blood urea nitrogen and serum creatinine values, and improved histological evaluation. Analysis on isotypes of anti-dsDNA antibody showed that iDC vaccine preferentially inhibited the production of IgG3, IgG2b and IgG2a. Furthermore, administration of antigen-treated iDCs to mice resulted in significantly reduced IL-2, IL-4 and IL-12 and IFN-γ produced by T-memory cells. Conversely, the vaccination of antigen-pulsed mature DCs led to increased anti-dsDNA antibody production and an aggravation of lupus-like disease in the model. CONCLUSIONS; These results suggested the high potency of iDC vaccine in preventing lupus-like renal injuries induced by pathogenic autoantibodies.

  3. From genomes to vaccines via the proteome

    Directory of Open Access Journals (Sweden)

    R Alan Wilson

    2004-08-01

    Full Text Available An effective vaccine against schistosomiasis mansoni would be a valuable control tool and the high levels of protection elicited in rodents and primates by radiation-attenuated cercariae provide proof of principle. A major obstacle to vaccine development is the difficulty of identifying the antigens that mediate protection, not least because of the size of the genome at 280Mb DNA encoding 14,000 to 20,000 genes. The technologies collectively called proteomics, including 2D electrophoresis, liquid chromatography and mass spectrometry, now permit any protein to be identified provided there is extensive DNA data, and preferably a genome sequence. Applied to soluble (cytosolic proteins from schistosomes, proteomics reveals the great similarity in composition between life cycle stages, with several WHO vaccine candidates amongst the most abundant constituents. The proteomic approach has been successfully applied to identify the secretions used by cercaria to penetrate host skin, the gut secretions of adult worms and the proteins exposed on the tegument surface. Soluble proteins can also be separated by 2D electrophoresis before western blotting to identify the full range of antigenic targets present in a parasite preparation. The next step is to discover which target proteins represent the weak points in the worm's defences.

  4. Human Polyclonal Antibodies Produced through DNA Vaccination of Transchromosomal Cattle Provide Mice with Post-Exposure Protection against Lethal Zaire and Sudan Ebolaviruses.

    Directory of Open Access Journals (Sweden)

    Callie E Bounds

    Full Text Available DNA vaccination of transchromosomal bovines (TcBs with DNA vaccines expressing the codon-optimized (co glycoprotein (GP genes of Ebola virus (EBOV and Sudan virus (SUDV produce fully human polyclonal antibodies (pAbs that recognize both viruses and demonstrate robust neutralizing activity. Each TcB was vaccinated by intramuscular electroporation (IM-EP a total of four times and at each administration received 10 mg of the EBOV-GPco DNA vaccine and 10 mg of the SUDV-GPco DNA vaccine at two sites on the left and right sides, respectively. After two vaccinations, robust antibody responses (titers > 1000 were detected by ELISA against whole irradiated EBOV or SUDV and recombinant EBOV-GP or SUDV-GP (rGP antigens, with higher titers observed for the rGP antigens. Strong, virus neutralizing antibody responses (titers >1000 were detected after three vaccinations when measured by vesicular stomatitis virus-based pseudovirion neutralization assay (PsVNA. Maximal neutralizing antibody responses were identified by traditional plaque reduction neutralization tests (PRNT after four vaccinations. Neutralizing activity of human immunoglobulins (IgG purified from TcB plasma collected after three vaccinations and injected intraperitoneally (IP into mice at a 100 mg/kg dose was detected in the serum by PsVNA up to 14 days after administration. Passive transfer by IP injection of the purified IgG (100 mg/kg to groups of BALB/c mice one day after IP challenge with mouse adapted (ma EBOV resulted in 80% protection while all mice treated with non-specific pAbs succumbed. Similarly, interferon receptor 1 knockout (IFNAR(-/- mice receiving the purified IgG (100 mg/kg by IP injection one day after IP challenge with wild type SUDV resulted in 89% survival. These results are the first to demonstrate that filovirus GP DNA vaccines administered to TcBs by IM-EP can elicit neutralizing antibodies that provide post-exposure protection. Additionally, these data describe

  5. Safety and immunogenicity of an HIV-1 gag DNA vaccine with or without IL-12 and/or IL-15 plasmid cytokine adjuvant in healthy, HIV-1 uninfected adults.

    Directory of Open Access Journals (Sweden)

    Spyros A Kalams

    Full Text Available DNA vaccines are a promising approach to vaccination since they circumvent the problem of vector-induced immunity. DNA plasmid cytokine adjuvants have been shown to augment immune responses in small animals and in macaques.We performed two first in human HIV vaccine trials in the US, Brazil and Thailand of an RNA-optimized truncated HIV-1 gag gene (p37 DNA derived from strain HXB2 administered either alone or in combination with dose-escalation of IL-12 or IL-15 plasmid cytokine adjuvants. Vaccinations with both the HIV immunogen and cytokine adjuvant were generally well-tolerated and no significant vaccine-related adverse events were identified. A small number of subjects developed asymptomatic low titer antibodies to IL-12 or IL-15. Cellular immunogenicity following 3 and 4 vaccinations was poor, with response rates to gag of 4.9%/8.7% among vaccinees receiving gag DNA alone, 0%/11.5% among those receiving gag DNA+IL-15, and no responders among those receiving DNA+high dose (1500 ug IL-12 DNA. However, after three doses, 44.4% (4/9 of vaccinees receiving gag DNA and intermediate dose (500 ug of IL-12 DNA demonstrated a detectable cellular immune response.This combination of HIV gag DNA with plasmid cytokine adjuvants was well tolerated. There were minimal responses to HIV gag DNA alone, and no apparent augmentation with either IL-12 or IL-15 plasmid cytokine adjuvants. Despite the promise of DNA vaccines, newer formulations or methods of delivery will be required to increase their immunogenicity.Clinicaltrials.gov NCT00115960 NCT00111605.

  6. Effect of West Nile virus DNA-plasmid vaccination on response to live virus challenge in red-tailed hawks (Buteo jamaicensis).

    Science.gov (United States)

    Redig, Patrick T; Tully, Thomas N; Ritchie, Branson W; Roy, Alma F; Baudena, M Alexandra; Chang, Gwong-Jen J

    2011-08-01

    To evaluate the safety and efficacy of an experimental adjuvanted DNA-plasmid vaccine against West Nile virus (WNV) in red-tailed hawks (Buteo jamaicensis). 19 permanently disabled but otherwise healthy red-tailed hawks of mixed ages and both sexes without detectable serum antibodies against WNV. Hawks were injected IM with an experimental WNV DNA-plasmid vaccine in an aluminum-phosphate adjuvant (n = 14) or with the adjuvant only (control group; 5). All birds received 2 injections at a 3-week interval. Blood samples for serologic evaluation were collected before the first injection and 4 weeks after the second injection (day 0). At day 0, hawks were injected SC with live WNV. Pre- and postchallenge blood samples were collected at intervals for 14 days for assessment of viremia and antibody determination; oropharyngeal and cloacal swabs were collected for assessment of viral shedding. Vaccination was not associated with morbidity or deaths. Three of the vaccinated birds seroconverted after the second vaccine injection; all other birds seroconverted following the live virus injection. Vaccinated birds had significantly less severe viremia and shorter and less-intense shedding periods, compared with the control birds. Use of the WNV DNA-plasmid vaccine in red-tailed hawks was safe, and vaccination attenuated but did not eliminate both the viremia and the intensity of postchallenge shedding following live virus exposure. Further research is warranted to conclusively determine the efficacy of this vaccine preparation for protection of red-tailed hawks and other avian species against WNV-induced disease.

  7. cDNA encoding a polypeptide including a hev ein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

    2000-07-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  8. Administration of HPV DNA vaccine via electroporation elicits the strongest CD8+ T cell immune responses compared to intramuscular injection and intradermal gene gun delivery

    Science.gov (United States)

    Best, Simon R.; Peng, Shiwen; Juang, Chi-Mou; Hung, Chien-Fu; Hannaman, Drew; Saunders, John R.; Wu, T.-C.; Pai, Sara I.

    2009-01-01

    DNA vaccines are an attractive approach to eliciting antigen-specific immunity. Intracellular targeting of tumor antigens through its linkage to immunostimulatory molecules such as calreticulin (CRT) can improve antigen processing and presentation through the MHC Class I pathway and increase cytotoxic CD8+ T cell production. However, even with these enhancements, the efficacy of such immunotherapeutic strategies is dependent on the identification of an effective route and method of DNA administration. Electroporation and gene gun-mediated particle delivery are leading methods of DNA vaccine delivery that can generate protective and therapeutic levels of immune responses in experimental models. In this study, we perform a head-to-head comparison of three methods of vaccination – conventional intramuscular injection, electroporation mediated intramuscular delivery, and epidermal gene gun-mediated particle delivery - in the ability to generate antigen specific cytotoxic CD8+ T cell responses as well as anti-tumor immune responses against an HPV-16 E7 expressing tumor cell line using the pNGVL4a-CRT/E7(detox) DNA vaccine. Vaccination via electroporation generated the highest number of E7-specific cytotoxic CD8+ T cells, which correlated to improved outcomes in the treatment of growing tumors. In addition, we demonstrate that electroporation results in significantly higher levels of circulating protein compared to gene gun or intramuscular vaccination, which likely enhances calreticulin’s role as a local tumor anti-angiogenesis agent. We conclude that electroporation is a promising method for delivery of HPV DNA vaccines and should be considered for DNA vaccine delivery in human clinical trials. PMID:19622402

  9. M cell-targeting strategy facilitates mucosal immune response and enhances protection against CVB3-induced viral myocarditis elicited by chitosan-DNA vaccine.

    Science.gov (United States)

    Ye, Ting; Yue, Yan; Fan, Xiangmei; Dong, Chunsheng; Xu, Wei; Xiong, Sidong

    2014-07-31

    Efficient delivery of antigen to mucosal associated lymphoid tissue is a first and critical step for successful induction of mucosal immunity by vaccines. Considering its potential transcytotic capability, M cell has become a more and more attractive target for mucosal vaccines. In this research, we designed an M cell-targeting strategy by which mucosal delivery system chitosan (CS) was endowed with M cell-targeting ability via conjugating with a CPE30 peptide, C terminal 30 amino acids of clostridium perfringens enterotoxin (CPE), and then evaluated its immune-enhancing ability in the context of coxsackievirus B3 (CVB3)-specific mucosal vaccine consisting of CS and a plasmid encoding CVB3 predominant antigen VP1. It had shown that similar to CS-pVP1, M cell-targeting CPE30-CS-pVP1 vaccine appeared a uniform spherical shape with about 300 nm diameter and +22 mV zeta potential, and could efficiently protect DNA from DNase I digestion. Mice were orally immunized with 4 doses of CPE30-CS-pVP1 containing 50 μg pVP1 at 2-week intervals and challenged with CVB3 4 weeks after the last immunization. Compared with CS-pVP1 vaccine, CPE30-CS-pVP1 vaccine had no obvious impact on CVB3-specific serum IgG level and splenic T cell immune responses, but significantly increased specific fecal SIgA level and augmented mucosal T cell immune responses. Consequently, much milder myocarditis and lower viral load were witnessed in CPE30-CS-pVP1 immunized group. The enhanced immunogenicity and immunoprotection were associated with the M cell-targeting ability of CPE30-CS-pVP1 which improved its mucosal uptake and transcytosis. Our findings indicated that CPE30-CS-pVP1 may represent a novel prophylactic vaccine against CVB3-induced myocarditis, and this M cell-targeting strategy indeed could be applied as a promising and universal platform for mucosal vaccine development. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. Safety and preliminary evidence of biologic efficacy of a mammaglobin-a DNA vaccine in patients with stable metastatic breast cancer.

    Science.gov (United States)

    Tiriveedhi, Venkataswarup; Tucker, Natalia; Herndon, John; Li, Lijin; Sturmoski, Mark; Ellis, Matthew; Ma, Cynthia; Naughton, Michael; Lockhart, A Craig; Gao, Feng; Fleming, Timothy; Goedegebuure, Peter; Mohanakumar, Thalachallour; Gillanders, William E

    2014-12-01

    Mammaglobin-A (MAM-A) is overexpressed in 40% to 80% of primary breast cancers. We initiated a phase I clinical trial of a MAM-A DNA vaccine to evaluate its safety and biologic efficacy. Patients with breast cancer with stable metastatic disease were eligible for enrollment. Safety was monitored with clinical and laboratory assessments. The CD8 T-cell response was measured by ELISPOT, flow cytometry, and cytotoxicity assays. Progression-free survival (PFS) was described using the Kaplan-Meier product limit estimator. Fourteen subjects have been treated with the MAM-A DNA vaccine and no significant adverse events have been observed. Eight of 14 subjects were HLA-A2(+), and the CD8 T-cell response to vaccination was studied in detail. Flow cytometry demonstrated a significant increase in the frequency of MAM-A-specific CD8 T cells after vaccination (0.9% ± 0.5% vs. 3.8% ± 1.2%; P cells (41 ± 32 vs. 215 ± 67 spm; P cell responses, and preliminary evidence suggests improved PFS. Additional studies are required to define the potential of the MAM-A DNA vaccine for breast cancer prevention and/or therapy. ©2014 American Association for Cancer Research.

  11. Involvement of CD8+ T cell-mediated immune responses in LcrV DNA vaccine induced protection against lethal Yersinia pestis challenge.

    Science.gov (United States)

    Wang, Shixia; Goguen, Jon D; Li, Fusheng; Lu, Shan

    2011-09-09

    Yersinia pestis (Y. pestis) is the causative pathogen of plague, a highly fatal disease for which an effective vaccine, especially against mucosal transmission, is still not available. Like many bacterial infections, antigen-specific antibody responses have been traditionally considered critical, if not solely responsible, for vaccine-induced protection against Y. pestis. Studies in recent years have suggested the importance of T cell immune responses against Y. pestis infection but information is still limited about the details of Y. pestis antigen-specific T cell immune responses. In current report, studies are conducted to identify the presence of CD8+ T cell epitopes in LcrV protein, the leading antigen of plague vaccine development. Furthermore, depletion of CD8+ T cells in LcrV DNA vaccinated Balb/C mice led to reduced protection against lethal intranasal challenge of Y. pestis. These findings establish that an LcrV DNA vaccine is able to elicit CD8+ T cell immune responses against specific epitopes of this key plague antigen and that a CD8+ T cell immune response is involved in LcrV DNA vaccine-elicited protection. Future studies in plague vaccine development will need to examine if the presence of detectable T cell immune responses, in particular CD8+ T-cell immune responses, will enhance the protection against Y. pestis in higher animal species or humans. Copyright © 2010 Elsevier Ltd. All rights reserved.

  12. Immunization of neonatal mice with LAMP/p55 HIV gag DNA elicits robust immune responses that last to adulthood

    International Nuclear Information System (INIS)

    Ordonhez Rigato, Paula; Maciel, Milton; Goldoni, Adriana Leticia; Piubelli, Orlando; Alves de Brito, Cyro; Fusaro, Ana Elisa; Eurico de Alencar, Liciana Xavier; August, Thomas; Torres Azevedo Marques, Ernesto; Silva Duarte, Alberto Jose da; Sato, Maria Notomi

    2010-01-01

    Successful T cell priming in early postnatal life that can generate effective long-lasting responses until adulthood is critical in HIV vaccination strategies because it prevents early sexual initiation and breastfeeding transmission of HIV. A chimeric DNA vaccine encoding p55 HIV gag associated with lysosome-associated membrane protein 1 (LAMP-1; which drives the antigen to the MIIC compartment), has been used to enhance cellular and humoral antigen-specific responses in adult mice and macaques. Herein, we investigated LAMP-1/gag vaccine immunogenicity in the neonatal period in mice and its ability to generate long-lasting effects. Neonatal vaccination with chimeric LAMP/gag generated stronger Gag-specific immune responses, as measured by the breadth of the Gag peptide-specific IFN-γ, proliferative responsiveness, cytokine production and antibody production, all of which revealed activation of CD4+ T cells as well as the generation of a more robust CTL response compared to gag vaccine alone. To induce long-lived T and B cell memory responses, it was necessary to immunize neonates with the chimeric LAMP/gag DNA vaccine. The LAMP/gag DNA vaccine strategy could be particularly useful for generating an anti-HIV immune response in the early postnatal period capable of inducing long-term immunological memory.

  13. [Escherichia coli heat-labile enterotoxin B subunit enhances the immune response against canine parvovirus VP2 in mice immunized by VP2 DNA vaccine].

    Science.gov (United States)

    Han, Dongmei; Zhong, Fei; Li, Xiujin; Wang, Wei; Wang, Xingxing; Pan, Sumin

    2011-01-01

    To investigate the effect of Escherichia coli heat-labile enterotoxin (LT) B subunit (LTB) gene on canine parvovirus (CPV) VP2 gene vaccine. The LTB gene was amplified by PCR from genomic DNA of E. coli 44815 strain. The VP2-70 fragment (210 bp) encoding major epitope of VP2 (70 amino acids) was amplified by PCR from a plasmid encoding VP2 gene. VP2-70 and LTB genes were inserted into the eukaryotic vector to construct VP2-70 gene,LTB gene and VP2-70-LTB fused gene vectors. The mice were immunized with VP2-70 vector, VP2-70-LTB fused vector, or VP2-70 vector plus LTB vector, respectively. The antibody titers at the different time were measured by using ELISA method. The spleen lymphocyte proliferation activity was analyzed by 3-(4, 5-Dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assay. The sequence of VP2-70 and LTB genes was identified. The recombinant VP2-70 and LTB proteins could be expressed in HEK293T cells in a secretory manner. The mice immunized with VP2-70 vector, VP2-70-LTB vector or VP2-70 vector plus LTB vector could generate the specific antibody against VP2 protein. The antibody titer immunized with VP2-70-LTB vector reached 1:5120 at 35 d post immunization, significantly higher than that of other two groups (P vaccine in mice.

  14. DNA vaccination in fish promotes an early chemokine-related recruitment of B cells to the muscle

    DEFF Research Database (Denmark)

    Castro, R.; Martínez-Alonso, S.; Fischer, U.

    2013-01-01

    might explain the recruitment of immune cells to the site of DNA injection. Our results suggest that B cells are involved in the initial phase of the immune response to intramuscular DNA vaccination against VHSV. This appears to be a major difference to what we know from mammalian models where T cells...

  15. Vaccination with Gag, Vif, and Nef gene fragments affords partial control of viral replication after mucosal challenge with SIVmac239.

    Science.gov (United States)

    Martins, Mauricio A; Wilson, Nancy A; Piaskowski, Shari M; Weisgrau, Kim L; Furlott, Jessica R; Bonaldo, Myrna C; Veloso de Santana, Marlon G; Rudersdorf, Richard A; Rakasz, Eva G; Keating, Karen D; Chiuchiolo, Maria J; Piatak, Michael; Allison, David B; Parks, Christopher L; Galler, Ricardo; Lifson, Jeffrey D; Watkins, David I

    2014-07-01

    Broadly targeted cellular immune responses are thought to be important for controlling replication of human and simian immunodeficiency viruses (HIV and SIV). However, eliciting such responses by vaccination is complicated by immunodominance, the preferential targeting of only a few of the many possible epitopes of a given antigen. This phenomenon may be due to the coexpression of dominant and subdominant epitopes by the same antigen-presenting cell and may be overcome by distributing these sequences among several different vaccine constructs. Accordingly, we tested whether vaccinating rhesus macaques with "minigenes" encoding fragments of Gag, Vif, and Nef resulted in broadened cellular responses capable of controlling SIV replication. We delivered these minigenes through combinations of recombinant Mycobacterium bovis BCG (rBCG), electroporated recombinant DNA (rDNA) along with an interleukin-12 (IL-12)-expressing plasmid (EP rDNA plus pIL-12), yellow fever vaccine virus 17D (rYF17D), and recombinant adenovirus serotype 5 (rAd5). Although priming with EP rDNA plus pIL-12 increased the breadth of vaccine-induced T-cell responses, this effect was likely due to the improved antigen delivery afforded by electroporation rather than modulation of immunodominance. Indeed, Mamu-A*01(+) vaccinees mounted CD8(+) T cells directed against only one subdominant epitope, regardless of the vaccination regimen. After challenge with SIVmac239, vaccine efficacy was limited to a modest reduction in set point in some of the groups and did not correlate with standard T-cell measurements. These findings suggest that broad T-cell responses elicited by conventional vectors may not be sufficient to substantially contain AIDS virus replication. Immunodominance poses a major obstacle to the generation of broadly targeted, HIV-specific cellular responses by vaccination. Here we attempted to circumvent this phenomenon and thereby broaden the repertoire of SIV-specific cellular responses by

  16. Rift Valley fever virus MP-12 vaccine encoding Toscana virus NSs retains neuroinvasiveness in mice.

    Science.gov (United States)

    Indran, Sabarish V; Lihoradova, Olga A; Phoenix, Inaia; Lokugamage, Nandadeva; Kalveram, Birte; Head, Jennifer A; Tigabu, Bersabeh; Smith, Jennifer K; Zhang, Lihong; Juelich, Terry L; Gong, Bin; Freiberg, Alexander N; Ikegami, Tetsuro

    2013-07-01

    Rift Valley fever is a mosquito-borne zoonotic disease endemic to sub-Saharan Africa. Rift Valley fever virus (RVFV; genus Phlebovirus, family Bunyaviridae) causes high rates of abortion and fetal malformation in pregnant ruminants, and haemorrhagic fever, neurological disorders or blindness in humans. The MP-12 strain is a highly efficacious and safe live-attenuated vaccine candidate for both humans and ruminants. However, MP-12 lacks a marker to differentiate infected from vaccinated animals. In this study, we originally aimed to characterize the efficacy of a recombinant RVFV MP-12 strain encoding Toscana virus (TOSV) NSs gene in place of MP-12 NSs (rMP12-TOSNSs). TOSV NSs promotes the degradation of dsRNA-dependent protein kinase (PKR) and inhibits interferon-β gene up-regulation without suppressing host general transcription. Unexpectedly, rMP12-TOSNSs increased death in vaccinated outbred mice and inbred BALB/c or C57BL/6 mice. Immunohistochemistry showed diffusely positive viral antigens in the thalamus, hypothalamus and brainstem, including the medulla. No viral antigens were detected in spleen or liver, which is similar to the antigen distribution of moribund mice infected with MP-12. These results suggest that rMP12-TOSNSs retains neuroinvasiveness in mice. Our findings demonstrate that rMP12-TOSNSs causes neuroinvasion without any hepatic disease and will be useful for studying the neuroinvasion mechanism of RVFV and TOSV.

  17. MDA5 can be exploited as efficacious genetic adjuvant for DNA vaccination against lethal H5N1 influenza virus infection in chickens.

    Directory of Open Access Journals (Sweden)

    Matthias Liniger

    Full Text Available Chickens lack the retinoic acid-inducible gene I (RIG-I and sense avian influenza virus (AIV infections by means of the melanoma differentiation-associated gene 5 product (chMDA5. Plasmid-driven expression of the N-terminal half of chMDA5 containing the caspase activation and recruitment domains [chMDA5(1-483] triggers interferon-β responses in chicken cells. We hypothesized that mimicking virus infection by chMDA5(1-483 expression may enhance vaccine-induced adaptive immunity. In order to test this, the potential genetic adjuvant properties of chMDA5(1-483 were evaluated in vivo in combination with a suboptimal quantity of a plasmid DNA vaccine expressing haemagglutinin (HA of H5N1 AIV. Co-administration of the HA plasmid with plasmid DNA for chMDA5(1-483 expression resulted in approximately 10-fold higher HA-specific antibody responses than injection of the HA plasmid mixed with empty vector DNA as control. Accordingly, compared with HA DNA vaccination alone, the chMDA5(1-483-adjuvanted HA DNA vaccine mediated enhanced protection against a lethal H5N1 challenge infection in chickens, with reduced clinical signs and cloacal virus shedding. These data demonstrate that innate immune activation by expression of signaling domains of RIG-I-like receptors can be exploited to enhance vaccine efficacy.

  18. Arabidopsis thaliana GYRB3 does not encode a DNA gyrase subunit.

    Directory of Open Access Journals (Sweden)

    Katherine M Evans-Roberts

    2010-03-01

    Full Text Available DNA topoisomerases are enzymes that control the topology of DNA in all cells. DNA gyrase is unique among the topoisomerases in that it is the only enzyme that can actively supercoil DNA using the free energy of ATP hydrolysis. Until recently gyrase was thought to be unique to bacteria, but has now been discovered in plants. The genome of the model plant, Arabidopsis thaliana, is predicted to encode four gyrase subunits: AtGyrA, AtGyrB1, AtGyrB2 and AtGyrB3.We found, contrary to previous data, that AtGyrB3 is not essential to the survival of A. thaliana. Bioinformatic analysis suggests AtGyrB3 is considerably shorter than other gyrase B subunits, lacking part of the ATPase domain and other key motifs found in all type II topoisomerases; but it does contain a putative DNA-binding domain. Partially purified AtGyrB3 cannot bind E. coli GyrA or support supercoiling. AtGyrB3 cannot complement an E. coli gyrB temperature-sensitive strain, whereas AtGyrB2 can. Yeast two-hybrid analysis suggests that AtGyrB3 cannot bind to AtGyrA or form a dimer.These data strongly suggest that AtGyrB3 is not a gyrase subunit but has another unknown function. One possibility is that it is a nuclear protein with a role in meiosis in pollen.

  19. Vaccination with an adenoviral vector encoding the tumor antigen directly linked to invariant chain induces potent CD4(+) T-cell-independent CD8(+) T-cell-mediated tumor control

    DEFF Research Database (Denmark)

    Sorensen, Maria R; Holst, Peter J; Pircher, Hanspeter

    2009-01-01

    of the vaccine antigen to invariant chain (Ii). To evaluate this strategy we used a mouse model, in which an immunodominant epitope (GP33) of the LCMV glycoprotein (GP) represents the tumor-associated neoantigen. Prophylactic vaccination of C57BL/6 mice with a replication-deficient human adenovirus 5 vector...... encoding GP linked to Ii (Ad-Ii-GP) resulted in complete protection against GP33-expressing B16.F10 tumors. Therapeutic vaccination with Ad-Ii-GP delayed tumor growth by more than 2 wk compared with sham vaccination. Notably, therapeutic vaccination with the linked vaccine was significantly better than...... the tumor degradation. Finally, Ad-Ii-GP but not Ad-GP vaccination can break the immunological non-reactivity in GP transgenic mice indicating that our vaccine strategy will prove efficient also against endogenous tumor antigens....

  20. New Approaches to Attenuated Hepatitis a Vaccine Development: Cloning and Sequencing of Cell-Culture Adapted Viral cDNA.

    Science.gov (United States)

    1987-10-13

    after multiple passages in vivo and in vitro. J. Gen. Virol. 67, 1741- 1744. Sabin , A.B. (1985). Oral poliovirus vaccine : history of its development...IN (N NEW APPROACHES TO ATTENUATED HEPATITIS A VACCINE DEVELOPMENT: Q) CLONING AND SEQUENCING OF CELL-CULTURE ADAPTED VIRAL cDNA I ANNUAL REPORT...6ll02Bsl0 A 055 11. TITLE (Include Security Classification) New Approaches to Attenuated Hepatitis A Vaccine Development: Cloning and Sequencing of Cell

  1. Synthetic biology devices and circuits for RNA-based 'smart vaccines': a propositional review.

    Science.gov (United States)

    Andries, Oliwia; Kitada, Tasuku; Bodner, Katie; Sanders, Niek N; Weiss, Ron

    2015-02-01

    Nucleic acid vaccines have been gaining attention as an alternative to the standard attenuated pathogen or protein based vaccine. However, an unrealized advantage of using such DNA or RNA based vaccination modalities is the ability to program within these nucleic acids regulatory devices that would provide an immunologist with the power to control the production of antigens and adjuvants in a desirable manner by administering small molecule drugs as chemical triggers. Advances in synthetic biology have resulted in the creation of highly predictable and modular genetic parts and devices that can be composed into synthetic gene circuits with complex behaviors. With the recent advent of modified RNA gene delivery methods and developments in the RNA replicon platform, we foresee a future in which mammalian synthetic biologists will create genetic circuits encoded exclusively on RNA. Here, we review the current repertoire of devices used in RNA synthetic biology and propose how programmable 'smart vaccines' will revolutionize the field of RNA vaccination.

  2. Systematic evaluation and optimization of modification reactions of oligonucleotides with amines and carboxylic acids for the synthesis of DNA-encoded chemical libraries.

    Science.gov (United States)

    Franzini, Raphael M; Samain, Florent; Abd Elrahman, Maaly; Mikutis, Gediminas; Nauer, Angela; Zimmermann, Mauro; Scheuermann, Jörg; Hall, Jonathan; Neri, Dario

    2014-08-20

    DNA-encoded chemical libraries are collections of small molecules, attached to DNA fragments serving as identification barcodes, which can be screened against multiple protein targets, thus facilitating the drug discovery process. The preparation of large DNA-encoded chemical libraries crucially depends on the availability of robust synthetic methods, which enable the efficient conjugation to oligonucleotides of structurally diverse building blocks, sharing a common reactive group. Reactions of DNA derivatives with amines and/or carboxylic acids are particularly attractive for the synthesis of encoded libraries, in view of the very large number of building blocks that are commercially available. However, systematic studies on these reactions in the presence of DNA have not been reported so far. We first investigated conditions for the coupling of primary amines to oligonucleotides, using either a nucleophilic attack on chloroacetamide derivatives or a reductive amination on aldehyde-modified DNA. While both methods could be used for the production of secondary amines, the reductive amination approach was generally associated with higher yields and better purity. In a second endeavor, we optimized conditions for the coupling of a diverse set of 501 carboxylic acids to DNA derivatives, carrying primary and secondary amine functions. The coupling efficiency was generally higher for primary amines, compared to secondary amine substituents, but varied considerably depending on the structure of the acids and on the synthetic methods used. Optimal reaction conditions could be found for certain sets of compounds (with conversions >80%), but multiple reaction schemes are needed when assembling large libraries with highly diverse building blocks. The reactions and experimental conditions presented in this article should facilitate the synthesis of future DNA-encoded chemical libraries, while outlining the synthetic challenges that remain to be overcome.

  3. [Serologic response to a DNA recombinant vaccine against hepatitis B in natives of the Peruvian Amazonian jungle].

    Science.gov (United States)

    Colichón, A; Vildósola, H; Sjogren, M; Cantella, R; Rojas, C

    1990-01-01

    Large areas of the Amazon basin in Brazil, Colombia, Ecuador, and in the nonoriental region of the peruvian jungle have been found to be hyperendemic to Hepatitis B with high prevalence of asymptomatic carriers (11 to 25%) and, in more selected areas, Hepatitis Delta has been also reported. In the present report, we have studied 108 volunteers from six different Jivaroes communities living in a hyperendemic Hepatitis B area. They received 2 doses of DNA recombinant yeast derivated HBV vaccine. All the selected persons were HBsAb negatives, but many (80%) had antibodies to HBc. Following immunization schedule, 80% responded with the formation of HBsAb; a better seroconversion was achieved in those negatives to anticore IgG compared with those having HBcAb. We obtained 90% of seroconversion in spite of the fact that our vaccination schedule was prolonged up to 10 months from the one recommended by the manufacturer. The vaccination schedule 0,4, 14 months, and the schedule 0,4 months, had 76 and 29% of seroconversion, respectively. We want to point out three observations: 1) It is quite possible that many of the Anti-core positives, that did not respond to vaccination were carriers of HBsAg undetectable by the conventional EIA test carried out; 2) The seroconversion rate in these natives was low (up to six months after the vaccination schedule); and 3) Many of the HBcAb were false positives and many of them were recently infected. We conclude: A) It is highly important to assess the anti-HBs hyperendemic areas before attempting vaccinations; B) All persons negative to anti-HBs should be vaccinated in spite to anticore antibodies; C) Areas with difficult access could be vaccinated even until 10 months without affecting good results, and D) DNA recombinant vaccine (ENGERIX B) was well tolerated. No side effects were observed.

  4. Shikonin enhances efficacy of a gene-based cancer vaccine via induction of RANTES

    Directory of Open Access Journals (Sweden)

    Chen Hui-Ming

    2012-04-01

    Full Text Available Abstract Background Shikonin, a phytochemical purified from Lithospermum erythrorhizon, has been shown to confer diverse pharmacological activities, including accelerating granuloma formation, wound healing, anti-inflammation and others, and is explored for immune-modifier activities for vaccination in this study. Transdermal gene-based vaccine is an attractive approach for delivery of DNA transgenes encoding specific tumor antigens to host skin tissues. Skin dendritic cells (DCs, a potent antigen-presenting cell type, is known to play a critical role in transmitting and orchestrating tumor antigen-specific immunities against cancers. The present study hence employs these various components for experimentation. Method The mRNA and protein expression of RANTES were detected by RT-PCR and ELISA, respectively. The regional expression of RANTES and tissue damage in test skin were evaluated via immunohistochemistry assay. Fluorescein isothiocyanate sensitization assay was performed to trace the trafficking of DCs from the skin vaccination site to draining lymph nodes. Adjuvantic effect of shikonin on gene gun-delivered human gp100 (hgp100 DNA cancer vaccine was studied in a human gp100-transfected B16 (B16/hgp100 tumor model. Results Among various phytochemicals tested, shikonin induced the highest level of expression of RANTES in normal skin tissues. In comparison, mouse RANTES cDNA gene transfection induced a higher level of mRANTES expression for a longer period, but caused more extensive skin damage. Topical application of shikonin onto the immunization site before gene gun-mediated vaccination augmented the population of skin DCs migrating into the draining lymph nodes. A hgp100 cDNA gene vaccination regimen with shikonin pretreatment as an adjuvant in a B16/hgp100 tumor model increased cytotoxic T lymphocyte activities in splenocytes and lymph node cells on target tumor cells. Conclusion Together, our findings suggest that shikonin can

  5. [Development of current smallpox vaccines].

    Science.gov (United States)

    Maksiutov, R A; Gavrilova, E V; Shchelkunov, S N

    2011-01-01

    The review gives data on the history of smallpox vaccination and shows the high topicality of designing the current safe vaccines against orthopoxviruses. Four generations of live smallpox, protein subunit, and DNA vaccines are considered. Analysis of the data published leads to the conclusion that it is promising to use the up-to-date generations of safe smallpox subunit or DNA vaccines for mass primary immunization with possible further revaccination with classical live vaccine.

  6. Clinical and parasitological protection in a Leishmania infantum-macaque model vaccinated with adenovirus and the recombinant A2 antigen.

    Science.gov (United States)

    Grimaldi, Gabriel; Teva, Antonio; Porrozzi, Renato; Pinto, Marcelo A; Marchevsky, Renato S; Rocha, Maria Gabrielle L; Dutra, Miriam S; Bruña-Romero, Oscar; Fernandes, Ana-Paula; Gazzinelli, Ricardo T

    2014-06-01

    Visceral leishmaniasis (VL) is a severe vector-born disease of humans and dogs caused by Leishmania donovani complex parasites. Approximately 0.2 to 0.4 million new human VL cases occur annually worldwide. In the new world, these alarming numbers are primarily due to the impracticality of current control methods based on vector reduction and dog euthanasia. Thus, a prophylactic vaccine appears to be essential for VL control. The current efforts to develop an efficacious vaccine include the use of animal models that are as close to human VL. We have previously reported a L. infantum-macaque infection model that is reliable to determine which vaccine candidates are most worthy for further development. Among the few amastigote antigens tested so far, one of specific interest is the recombinant A2 (rA2) protein that protects against experimental L. infantum infections in mice and dogs. Primates were vaccinated using three rA2-based prime-boost immunization regimes: three doses of rA2 plus recombinant human interleukin-12 (rhIL-12) adsorbed in alum (rA2/rhIL-12/alum); two doses of non-replicative adenovirus recombinant vector encoding A2 (Ad5-A2) followed by two boosts with rA2/rhIL-12/alum (Ad5-A2+rA2/rhIL12/alum); and plasmid DNA encoding A2 gene (DNA-A2) boosted with two doses of Ad5-A2 (DNA-A2+Ad5-A2). Primates received a subsequent infectious challenge with L. infantum. Vaccines, apart from being safe, were immunogenic as animals responded with increased pre-challenge production of anti-A2-specific IgG antibodies, though with some variability in the response, depending on the vaccine formulation/protocol. The relative parasite load in the liver was significantly lower in immunized macaques as compared to controls. Protection correlated with hepatic granuloma resolution, and reduction of clinical symptoms, particularly when primates were vaccinated with the Ad5-A2+rA2/rhIL12/alum protocol. The remarkable clinical protection induced by A2 in an animal model that is

  7. Designing and modeling of complex DNA vaccine based on tropomyosin protein of Boophilus genus tick.

    Science.gov (United States)

    Ranjbar, Mohamamd Mahdi; Gupta, Shishir K; Ghorban, Khodayar; Nabian, Sedigheh; Sazmand, Alireza; Taheri, Mohammad; Esfandyari, Sahar; Taheri, Maryam

    2015-01-01

    Boophilus tick is a bloodsucking ectoparasite that transfers some pathogens, reducing production and thus leading to economical losses in the cattle industry. Tropomyosin (TPM) protein is a salivary protein, has actin regulator activity, and plays an important role in immune reactions against parasites. In the current study, besides developing a safe, effective, and broad spectrum protective measure against Boophilus genus tick based on TPM protein, we attempted to minimize possible problems occurring in the design of polytopic vaccines. Briefly, the steps that were followed in the present study were as follows: retrieving sequences and finding the mutational/conservative regions, selecting consensus and high immunogenic epitopes of B and CD4(+) T cells by different approaches, three-dimensional structure (3D structure) prediction and representation of epitopes and highly variable/conserve regions, designing vaccinal construct by fusion of B and T cell epitopes by special patterns and improving immunogenicity, evaluation of the constructs' primary structure and posttranslational modification, calculation of hydrophobic regions, reverse translation, codon optimization, open reading frame checking, insertion of start/end codon, Kozak sequence, and finally constructing the DNA vaccine. Variation plot showed some shared epitopes among the ticks' and mites' species that some might be effective only in some species. Finally, by following the steps mentioned above, two constructs for B and T cells were achieved. Checking constructs revealed their reliability and efficacy for in vitro production and utilization. Successful in silico modeling is an essential step of designing vigorous vaccines. We developed a novel protective and therapeutic vaccine against Boophilus genus (based on TPM protein). At the next step, constructed DNA vaccine would be produced in vitro and administrated to cattle, and its potency to induction of immune response and protection against Boophilus

  8. Reducing AD-like pathology in 3xTg-AD mouse model by DNA epitope vaccine - a novel immunotherapeutic strategy.

    Directory of Open Access Journals (Sweden)

    Nina Movsesyan

    Full Text Available BACKGROUND: The development of a safe and effective AD vaccine requires a delicate balance between providing an adequate anti-Abeta antibody response sufficient to provide therapeutic benefit, while eliminating an adverse T cell-mediated proinflammatory autoimmune response. To achieve this goal we have designed a prototype chemokine-based DNA epitope vaccine expressing a fusion protein that consists of 3 copies of the self-B cell epitope of Abeta(42 (Abeta(1-11 , a non-self T helper cell epitope (PADRE, and macrophage-derived chemokine (MDC/CCL22 as a molecular adjuvant to promote a strong anti-inflammatory Th2 phenotype. METHODS AND FINDINGS: We generated pMDC-3Abeta(1-11-PADRE construct and immunized 3xTg-AD mouse model starting at age of 3-4 months old. We demonstrated that prophylactic immunizations with the DNA epitope vaccine generated a robust Th2 immune response that induced high titers of anti-Abeta antibody, which in turn inhibited accumulation of Abeta pathology in the brains of older mice. Importantly, vaccination reduced glial activation and prevented the development of behavioral deficits in aged animals without increasing the incidence of microhemorrhages. CONCLUSIONS: Data from this transitional pre-clinical study suggest that our DNA epitope vaccine could be used as a safe and effective strategy for AD therapy. Future safety and immunology studies in large animals with the goal to achieve effective humoral immunity without adverse effects should help to translate this study to human clinical trials.

  9. Light-dependent, plastome-wide association of the plastid-encoded RNA polymerase with chloroplast DNA.

    Science.gov (United States)

    Finster, Sabrina; Eggert, Erik; Zoschke, Reimo; Weihe, Andreas; Schmitz-Linneweber, Christian

    2013-12-01

    Plastid genes are transcribed by two types of RNA polymerases: a plastid-encoded eubacterial-type RNA polymerase (PEP) and nuclear-encoded phage-type RNA polymerases (NEPs). To investigate the spatio-temporal expression of PEP, we tagged its α-subunit with a hemagglutinin epitope (HA). Transplastomic tobacco plants were generated and analyzed for the distribution of the tagged polymerase in plastid sub-fractions, and associated genes were identified under various light conditions. RpoA:HA was detected as early as the 3rd day after imbibition, and was constitutively expressed in green tissue over 60 days of plant development. We found that the tagged polymerase subunit preferentially associated with the plastid membranes, and was less abundant in the soluble stroma fraction. Attachment of RpoA:HA to the membrane fraction during early seedling development was independent of DNA, but at later stages of development, DNA appears to facilitate attachment of the polymerase to membranes. To survey PEP-dependent transcription units, we probed for nucleic acids enriched in RpoA:HA precipitates using a tobacco chloroplast whole-genome tiling array. The most strongly co-enriched DNA fragments represent photosynthesis genes (e.g. psbA, psbC, psbD and rbcL), whose expression is known to be driven by PEP promoters, while NEP-dependent genes were less abundant in RpoA:HA precipitates. Additionally, we demonstrate that the association of PEP with photosynthesis-related genes was reduced during the dark period, indicating that plastome-wide PEP-DNA association is a light-dependent process. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

  10. Adverse effects of feline IL-12 during DNA vaccination against feline infectious peritonitis virus

    NARCIS (Netherlands)

    Horzinek, M.C.; Haagmans, B.L.; Lintelo, E.G. te; Egberink, H.F.; Duquesne, V.; Aubert, A.; Rottier, P.J.M.

    2002-01-01

    Cell-mediated immunity is thought to play a decisive role in protecting cats against feline infectious peritonitis (FIP), a progressive and lethal coronavirus disease. In view of the potential of DNA vaccines to induce cell-mediated responses, their efficacy to induce protective immunity in cats was

  11. [Comparison of protective properties of the smallpox DNA-vaccine based on the variola virus A30L gene and its variant with modified codon usage].

    Science.gov (United States)

    Maksiutov, R A; Shchelkunov, S N

    2011-01-01

    Efficacy of candidate DNA-vaccines based on the variola virus natural gene A30L and artificial gene A30Lopt with modified codon usage, optimized for expression in mammalian cells, was tested. The groups of mice were intracutaneously immunized three times with three-week intervals with candidate DNA-vaccines: pcDNA_A30L or pcDNA_A30Lopt, and in three weeks after the last immunization all mice in the groups were intraperitoneally infected by the ectromelia virus K1 strain in 10 LD50 dose for the estimation of protection. It was shown that the DNA-vaccines based on natural gene A30L and codon-optimized gene A30Lopt elicited virus, thereby neutralizing the antibody response and protected mice from lethal intraperitoneal challenge with the ectromelia virus with lack of statistically significant difference.

  12. Combined immunotherapy of breast cancer with EGF and VEGF vaccines from DNA shuffling in a mouse model.

    Science.gov (United States)

    Jin, Dong; Yu, Xin; Chen, Bing; Li, Zhitao; Ding, Jia; Zhao, Xiuyun; Qi, Gaofu

    2017-06-01

    Development of EGF and VEGF vaccines with high antigenicity for combined immunotherapy of EGF-EGFR signaling-dependent epithelial tumors such as breast cancer. EGF genes from mouse, human and chicken were randomly assembled to chimeric genes by DNA shuffling, then a chimeric EGF was selected out by PCR, SDS-PAGE and immunization for combined immunotherapy of breast cancer with a previously constructed chimeric VEGF vaccine from shuffling. Combined vaccination with chimeric EGF and VEGF from shuffling could induce high titer of antibodies against EGF and VEGF to inhibit tumor growth and angiogenesis, and improve the survival rate of mice with breast cancer. Combined vaccination with EGF and VEGF from shuffling showed better immunotherapy on EGF-EGFR signaling-dependent epithelial tumors such as breast cancer than the single-agent EGF vaccination.

  13. Enhancing T cell activation and antiviral protection by introducing the HIV-1 protein transduction domain into a DNA vaccine.

    Science.gov (United States)

    Leifert, J A; Lindencrona, J A; Charo, J; Whitton, J L

    2001-10-10

    Protein transduction domains (PTD), which can transport proteins or peptides across biological membranes, have been identified in several proteins of viral, invertebrate, and vertebrate origin. Here, we evaluate the immunological and biological consequences of including PTD in synthetic peptides and in DNA vaccines that contain CD8(+) T cell epitopes from lymphocytic choriomeningitis virus (LCMV). Synthetic PTD-peptides did not induce detectable CD8(+) T cell responses. However, fusion of an open reading frame encoding a PTD to an epitope minigene caused transfected tissue culture cells to stimulate epitope-specific T cells much more effectively. Kinetic studies indicated that the epitope reached the surface of transfected cells more rapidly and that the number of transfected cells needed to stimulate T cell responses was reduced by 35- to 50-fold when compared to cells transfected with a standard minigene plasmid. The mechanism underlying the effect of PTD linkage is not clear, but transit of the PTD-attached epitope from transfected cells to nontransfected cells (cross presentation) seemed to play, at most, a minimal role. Mice immunized once with the plasmid encoding the PTD-linked epitope showed a markedly accelerated CD8(+) T cell response and, unlike mice immunized with a standard plasmid, were completely protected against a normally lethal LCMV challenge administered only 8 days post-immunization.

  14. HIV-DNA Given with or without Intradermal Electroporation Is Safe and Highly Immunogenic in Healthy Swedish HIV-1 DNA/MVA Vaccinees: A Phase I Randomized Trial.

    Directory of Open Access Journals (Sweden)

    Charlotta Nilsson

    Full Text Available We compared safety and immunogenicity of intradermal (ID vaccination with and without electroporation (EP in a phase I randomized placebo-controlled trial of an HIV-DNA prime HIV-MVA boost vaccine in healthy Swedish volunteers.HIV-DNA plasmids encoding HIV-1 genes gp160 subtypes A, B and C; Rev B; Gag A and B and RTmut B were given ID at weeks 0, 6 and 12 in a dose of 0.6 mg. Twenty-five volunteers received vaccine using a needle-free device (ZetaJet with (n=16 or without (n=9 ID EP (Dermavax. Five volunteers were placebo recipients. Boosting with recombinant MVA-CMDR expressing HIV-1 Env, Gag, Pol of CRF01_AE (HIV-MVA or placebo was performed at weeks 24 and 40. Nine of the vaccinees received a subtype C CN54 gp140 protein boost together with HIV-MVA.The ID/EP delivery was very well tolerated. After three HIV-DNA immunizations, no statistically significant difference was seen in the IFN-γ ELISpot response rate to Gag between HIV-DNA ID/EP recipients (5/15, 33% and HIV-DNA ID recipients (1/7, 14%, p=0.6158. The first HIV-MVA or HIV-MVA+gp140 vaccination increased the IFN-γ ELISpot response rate to 18/19 (95%. CD4+ and/or CD8+ T cell responses to Gag or Env were demonstrable in 94% of vaccinees. A balanced CD4+ and CD8+ T cell response was noted, with 78% and 71% responders, respectively. IFN-γ and IL-2 dominated the CD4+ T cell response to Gag and Env. The CD8+ response to Gag was broader with expression of IFN-γ, IL-2, MIP-1β and/or CD107. No differences were seen between DNA vaccine groups. Binding antibodies were induced after the second HIV-MVA+/-gp140 in 93% of vaccinees to subtype C Env, with the highest titers among EP/gp140 recipients.Intradermal electroporation of HIV-DNA was well tolerated. Strong cell- and antibody-mediated immune responses were elicited by the HIV-DNA prime and HIV-MVA boosting regimen, with or without intradermal electroporation use.International Standard Randomised Controlled Trial Number (ISRCTN 60284968.

  15. HIV-DNA Given with or without Intradermal Electroporation Is Safe and Highly Immunogenic in Healthy Swedish HIV-1 DNA/MVA Vaccinees: A Phase I Randomized Trial.

    Science.gov (United States)

    Nilsson, Charlotta; Hejdeman, Bo; Godoy-Ramirez, Karina; Tecleab, Teghesti; Scarlatti, Gabriella; Bråve, Andreas; Earl, Patricia L; Stout, Richard R; Robb, Merlin L; Shattock, Robin J; Biberfeld, Gunnel; Sandström, Eric; Wahren, Britta

    2015-01-01

    We compared safety and immunogenicity of intradermal (ID) vaccination with and without electroporation (EP) in a phase I randomized placebo-controlled trial of an HIV-DNA prime HIV-MVA boost vaccine in healthy Swedish volunteers. HIV-DNA plasmids encoding HIV-1 genes gp160 subtypes A, B and C; Rev B; Gag A and B and RTmut B were given ID at weeks 0, 6 and 12 in a dose of 0.6 mg. Twenty-five volunteers received vaccine using a needle-free device (ZetaJet) with (n=16) or without (n=9) ID EP (Dermavax). Five volunteers were placebo recipients. Boosting with recombinant MVA-CMDR expressing HIV-1 Env, Gag, Pol of CRF01_AE (HIV-MVA) or placebo was performed at weeks 24 and 40. Nine of the vaccinees received a subtype C CN54 gp140 protein boost together with HIV-MVA. The ID/EP delivery was very well tolerated. After three HIV-DNA immunizations, no statistically significant difference was seen in the IFN-γ ELISpot response rate to Gag between HIV-DNA ID/EP recipients (5/15, 33%) and HIV-DNA ID recipients (1/7, 14%, p=0.6158). The first HIV-MVA or HIV-MVA+gp140 vaccination increased the IFN-γ ELISpot response rate to 18/19 (95%). CD4+ and/or CD8+ T cell responses to Gag or Env were demonstrable in 94% of vaccinees. A balanced CD4+ and CD8+ T cell response was noted, with 78% and 71% responders, respectively. IFN-γ and IL-2 dominated the CD4+ T cell response to Gag and Env. The CD8+ response to Gag was broader with expression of IFN-γ, IL-2, MIP-1β and/or CD107. No differences were seen between DNA vaccine groups. Binding antibodies were induced after the second HIV-MVA+/-gp140 in 93% of vaccinees to subtype C Env, with the highest titers among EP/gp140 recipients. Intradermal electroporation of HIV-DNA was well tolerated. Strong cell- and antibody-mediated immune responses were elicited by the HIV-DNA prime and HIV-MVA boosting regimen, with or without intradermal electroporation use. International Standard Randomised Controlled Trial Number (ISRCTN) 60284968.

  16. Oral DNA vaccination of rainbow trout, Oncorhynchus mykiss (Walbaum), against infectious haematopoietic necrosis virus using PLGA [Poly(D,L-Lactic-Co-Glycolic Acid)] nanoparticles.

    Science.gov (United States)

    Adomako, M; St-Hilaire, S; Zheng, Y; Eley, J; Marcum, R D; Sealey, W; Donahower, B C; Lapatra, S; Sheridan, P P

    2012-03-01

    A DNA vaccine against infectious haematopoietic necrosis virus (IHNV) is effective at protecting rainbow trout, Oncorhynchus mykiss, against disease, but intramuscular injection is required and makes the vaccine impractical for use in the freshwater rainbow trout farming industry. Poly (D,L-lactic-co-glycolic acid) (PLGA) is a U.S. Food and Drug Administration (FDA) approved polymer that can be used to deliver DNA vaccines. We evaluated the in vivo absorption of PLGA nanoparticles containing coumarin-6 when added to a fish food pellet. We demonstrated that rainbow trout will eat PLGA nanoparticle coated feed and that these nanoparticles can be detected in the epithelial cells of the lower intestine within 96 h after feeding. We also detected low levels of gene expression and anti-IHNV neutralizing antibodies when fish were fed or intubated with PLGA nanoparticles containing IHNV G gene plasmid. A virus challenge evaluation suggested a slight increase in survival at 6 weeks post-vaccination in fish that received a high dose of the oral vaccine, but there was no difference when additional fish were challenged at 10 weeks post-vaccination. The results of this study suggest that it is possible to induce an immune response using an orally delivered DNA vaccine, but the current system needs improvement. © 2012 Blackwell Publishing Ltd.

  17. Development of a human live attenuated West Nile infectious DNA vaccine: Identification of a minimal mutation set conferring the attenuation level acceptable for a human vaccine

    Energy Technology Data Exchange (ETDEWEB)

    Yamshchikov, Vladimir, E-mail: yaximik@gmail.com; Manuvakhova, Marina; Rodriguez, Efrain; Hébert, Charles

    2017-01-15

    ABSTRACT: For the development of a human West Nile (WN) infectious DNA (iDNA) vaccine, we created highly attenuated chimeric virus W1806 with the serological identity of highly virulent WN-NY99. Earlier, we attempted to utilize mutations found in the E protein of the SA14-14-2 vaccine to bring safety of W1806 to the level acceptable for human use (). Here, we analyzed effects of the SA14-14-2 changes on growth properties and neurovirulence of W1806. A set including the E138K, K279M, K439R and G447D changes was identified as the perspective subset for satisfying the target safety profile without compromising immunogenicity of the vaccine candidate. The genetic stability of the attenuated phenotype was found to be unsatisfactory being dependent on a subset of attenuating changes incorporated in W1806. Elucidation of underlying mechanisms influencing selection of pathways for restoration of the envelope protein functionality will facilitate resolution of the emerged genetic stability issue. - Highlights: •Effect of mutations in E on properties of WN1806 is determined. •A subset of attenuating mutations suitable for a human vaccine is defined. •Mechanism of attenuation is proposed and illustrated. •Underlying mechanisms of neurovirulence reversion are suggested.

  18. DNA vaccines expressing soluble CD4-envelope proteins fused to C3d elicit cross-reactive neutralizing antibodies to HIV-1

    International Nuclear Information System (INIS)

    Bower, Joseph F.; Green, Thomas D.; Ross, Ted M.

    2004-01-01

    DNA vaccines expressing the envelope (Env) of the human immunodeficiency virus type 1 (HIV-1) have been relatively ineffective at generating high-titer, long-lasting, neutralizing antibodies in a variety of animal models. In this study, DNA vaccines were constructed to express a fusion protein of the soluble human CD4 (sCD4) and the gp120 subunit of the HIV-1 envelope. To enhance the immunogenicity of the expressed fusion protein, three copies of the murine C3d (mC3d 3 ) were added to the carboxyl terminus of the complex. Monoclonal antibodies that recognize CD4-induced epitopes on gp120 efficiently bound to sCD4-gp120 or sCD4-gp120-mC3d 3 . In addition, both sCD4-gp120 and sCD4-gp120-mC3d 3 bound to cells expressing appropriate coreceptors in the absence of cell surface hCD4. Mice (BALB/c) vaccinated with DNA vaccines expressing either gp120-mC3d 3 or sCD4-gp120-mC3d 3 elicited antibodies that neutralized homologous virus infection. However, the use of sCD4-gp120-mC3d 3 -DNA elicited the highest titers of neutralizing antibodies that persisted after depletion of anti-hCD4 antibodies. Interestingly, only mice vaccinated with DNA expressing sCD4-gp120-mC3d 3 had antibodies that elicited cross-protective neutralizing antibodies. The fusion of sCD4 to the HIV-1 envelope exposes neutralizing epitopes that elicit broad protective immunity when the fusion complex is coupled with the molecular adjuvant, C3d

  19. Isolation and characterization of two cDNA clones encoding for glutamate dehydrogenase in Nicotiana plumbaginifolia.

    Science.gov (United States)

    Ficarelli, A; Tassi, F; Restivo, F M

    1999-03-01

    We have isolated two full length cDNA clones encoding Nicotiana plumbaginifolia NADH-glutamate dehydrogenase. Both clones share amino acid boxes of homology corresponding to conserved GDH catalytic domains and putative mitochondrial targeting sequence. One clone shows a putative EF-hand loop. The level of the two transcripts is affected differently by carbon source.

  20. The 3H-thymidine incorporation into the DNA of different tissues of the guinea pip after BCG-vaccination and the radiation insultus

    International Nuclear Information System (INIS)

    Langbein, U.

    1976-01-01

    The radioprotective effects of BCG vaccines have been examined. The 3 H-thymidine incorporation into the DNA of different tissues of the guinea-pig after solitary whole-body irradiation by the doses of 160, 400, and 700 R have been used as a parameter for radiation injuries and radioprotection. The specific activity of DNA has been detected by means of liquid scintillation counting and by indirect photomeric determination of the amount at 7 h p.r. It has been revealed that independent of the chosen irradiation dose, there was no significant difference in the rate of DNA synthesis in the duodenal, testicular, bone marrow, liver, and lymphatic ganglion tissues of animals vaccinated 30 days before irradiation insultus and the rate of DNA synthesis in normal animals. Based on medical evidence, effect principles which can be observed on other antigenous radioprotective substances can be excluded this time. The dose effect curve has qualitatively the same features as the curves of cell cultures and synchronized cell systems in mammals. Furthermore, the process of DNA synthesis was observed for 56 days. During this observation period there was no significant difference to be seen in the rate of duodenal, testicular, bone marrow, and liver tissues in vaccinated and in normal animals. Only in lymphatic tissues the synthesis rate of vaccinated animals has shown a significantly more decreasing tendency than that of normal animals. A relation concerning radioprotective substances containing SH-groups and 'short-term' protectors (endotoxines) could be excluded because of medical evidence. It is suggested to carry out further tests with parameters affecting the RES in order to comprehend radioprotection after BCG vaccination. (orig./MG) [de

  1. Production of a DNA Vaccine Specific for the 64 kDa Protective Antigen of Erysipelothrix rhusiopathiae

    National Research Council Canada - National Science Library

    Middlebrooks, Bobby L

    2007-01-01

    The gene for the protective antigen of E. rhusiopathiae will be inserted into a eukaryotic vector both for the production of a DNA vaccine and for large scale production of the recombinant protein (in vitro...

  2. Chitosan-coated poly(lactic-co-glycolic acid nanoparticles as an efficient delivery system for Newcastle disease virus DNA vaccine

    Directory of Open Access Journals (Sweden)

    Zhao K

    2014-09-01

    Full Text Available Kai Zhao,1,* Yang Zhang,1,2,* Xiaoyan Zhang,1,* Ci Shi,1,2 Xin Wang,1 Xiaohua Wang,1 Zheng Jin,3 Shangjin Cui2 1Laboratory of Microbiology, School of Life Science, Heilongjiang University, 2Division of Swine Infectious Diseases, State Key Laboratory of Veterinary Biotechnology, Harbin Veterinary Research Institute, 3Key Laboratory of Chemical Engineering Process and Technology for High-efficiency Conversion, Heilongjiang University, Harbin, People’s Republic of China *These authors contributed equally to this work Abstract: We determined the efficacy and safety of chitosan (CS-coated poly(lactic-co-glycolic acid (PLGA nanoparticles (NPs as a delivery system for a vaccine to protect chickens against Newcastle disease virus (NDV. The newly constructed vaccine contained DNA (the F gene of NDV. The Newcastle disease virus (NDV F gene deoxyribonucleic acid (DNA plasmid (pFDNA-CS/PLGA-NPs were spherical (diameter =699.1±5.21 nm [mean ± ­standard deviation] and smooth, with an encapsulation efficiency of 98.1% and a Zeta potential of +6.35 mV. An in vitro release assay indicated that CS controlled the burst release of plasmid DNA, such that up to 67.4% of the entire quantity of plasmid DNA was steadily released from the pFDNA-CS/PLGA-NPs. An in vitro expression assay indicated that the expression of nanoparticles (NPs was maintained in the NPs. In an immunization test with specific pathogen-free chickens, the pFDNA-CS/PLGA-NPs induced stronger cellular, humoral, and mucosal immune responses than the plasmid DNA vaccine alone. The pFDNA-CS/PLGA-NPs did not harm 293T cells in an in vitro assay and did not harm chickens in an in vivo assay. Overall, the results indicated that CS-coated PLGA NPs can serve as an efficient and safe mucosal immune delivery system for NDV DNA vaccine.Keywords: mucosal immune delivery system, immune effect

  3. Co-expression of HIV-1 virus-like particles and granulocyte-macrophage colony stimulating factor by GEO-D03 DNA vaccine

    Science.gov (United States)

    Hellerstein, Michael; Xu, Yongxian; Marino, Tracie; Lu, Shan; Yi, Hong; Wright, Elizabeth R.; Robinson, Harriet L.

    2012-01-01

    Here, we report on GEO-D03, a DNA vaccine that co-expresses non-infectious HIV-1 virus-like particles (VLPs) and the human cytokine, granulocyte-macrophage colony-stimulating factor (GM-CSF). The virus-like particles display the native gp160 form of the HIV-1 Envelope glycoprotein (Env) and are designed to elicit antibody against the natural form of Env on virus and virus-infected cells. The DNA-expressed HIV Gag, Pol and Env proteins also have the potential to elicit virus-specific CD4 and CD8 T cells. The purpose of the co-expressed GM-CSF is to target a cytokine that recruits, expands and differentiates macrophages and dendritic cells to the site of VLP expression. The GEO-D03 DNA vaccine is currently entered into human trials as a prime for a recombinant modified vaccinia Ankara (MVA) boost. In preclinical studies in macaques using an SIV prototype vaccine, this vaccination regimen elicited both anti-viral T cells and antibody, and provided 70% protection against acquisition during 12 weekly rectal exposures with a heterologous SIV. Higher avidity of the Env-specific Ab for the native form of the Env in the challenge virus correlated with lower likelihood of SIV infection. PMID:23111169

  4. An oral Sindbis virus replicon-based DNA vaccine containing VP2 gene of canine parvovirus delivered by Escherichia coli elicits immune responses in dogs.

    Science.gov (United States)

    Dahiya, S S; Saini, M; Kumar, P; Gupta, P K

    2011-01-01

    A Sindbis virus replicon-based DNA vaccine containing VP2 gene of canine parvovirus (CPV) was delivered by Escherichia coli to elicit immune responses. The orally immunized dogs developed CPV-specific serum IgG and virus neutralizing antibody responses. The cellular immune responses analyzed using lymphocyte proliferation test and flow cytometry indicated CPV-specific sensitization of both CD3+CD4+ and CD3+CD8+ lymphocytes. This study demonstrated that the oral CPV DNA vaccine delivered by E. coli can be considered as a promising approach for vaccination of dogs against CPV.

  5. Expression of chicken parvovirus VP2 in chicken embryo fibroblasts requires codon optimization for production of naked DNA and vectored meleagrid herpesvirus type 1 vaccines.

    Science.gov (United States)

    Spatz, Stephen J; Volkening, Jeremy D; Mullis, Robert; Li, Fenglan; Mercado, John; Zsak, Laszlo

    2013-10-01

    Meleagrid herpesvirus type 1 (MeHV-1) is an ideal vector for the expression of antigens from pathogenic avian organisms in order to generate vaccines. Chicken parvovirus (ChPV) is a widespread infectious virus that causes serious disease in chickens. It is one of the etiological agents largely suspected in causing Runting Stunting Syndrome (RSS) in chickens. Initial attempts to express the wild-type gene encoding the capsid protein VP2 of ChPV by insertion into the thymidine kinase gene of MeHV-1 were unsuccessful. However, transient expression of a codon-optimized synthetic VP2 gene cloned into the bicistronic vector pIRES2-Ds-Red2, could be demonstrated by immunocytochemical staining of transfected chicken embryo fibroblasts (CEFs). Red fluorescence could also be detected in these transfected cells since the red fluorescent protein gene is downstream from the internal ribosome entry site (IRES). Strikingly, fluorescence could not be demonstrated in cells transiently transfected with the bicistronic vector containing the wild-type or non-codon-optimized VP2 gene. Immunocytochemical staining of these cells also failed to demonstrate expression of wild-type VP2, indicating that the lack of expression was at the RNA level and the VP2 protein was not toxic to CEFs. Chickens vaccinated with a DNA vaccine consisting of the bicistronic vector containing the codon-optimized VP2 elicited a humoral immune response as measured by a VP2-specific ELISA. This VP2 codon-optimized bicistronic cassette was rescued into the MeHV-1 genome generating a vectored vaccine against ChPV disease.

  6. Effect of cytokine-encoding plasmid delivery on immune response to Japanese encephalitis virus DNA vaccine in mice.

    Science.gov (United States)

    Bharati, Kaushik; Appaiahgari, Mohan Babu; Vrati, Sudhanshu

    2005-01-01

    We have previously shown that immunization of mice with plasmid pMEa synthesizing Japanese encephalitis virus (JEV) envelope protein induced anti-JEV humoral and cellular immune responses. We now show that intra-muscular co-administration of mice with pMEa and pGM-CSF, encoding murine granulocyte-macrophage colony-stimulating factor or pIL-2, encoding murine interleukin-2 given 4 days after pMEa, augmented anti-JEV antibody titers. This did not enhance the level of protection in immunized mice against JEV. However, intra-dermal co-administration of pMEa and pGM-CSF in mice using the gene gun, enhanced anti-JEV antibody titers resulting in an increased level of protection in mice against lethal JEV challenge.

  7. Achievements, Challenges, and Opportunities in DNA-Encoded Library Research: An Academic Point of View.

    Science.gov (United States)

    Yuen, Lik Hang; Franzini, Raphael M

    2017-05-04

    DNA-encoded chemical libraries (DECLs) are pools of DNA-tagged small molecules that enable facile screening and identification of bio-macromolecule binders. The successful development of DECLs has led to their increasingly important role in drug development, and screening hits have entered clinical trials. In this review, we summarize the development and currently active research areas of DECLs with a focus on contributions from groups at academic institutes. We further look at opportunities and future directions of DECL research in medicinal chemistry and chemical biology based on the symbiotic relationship between academia and industry. Challenges associated with the application of DECLs in academic drug discovery are further discussed. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Connective tissue growth factor linked to the E7 tumor antigen generates potent antitumor immune responses mediated by an antiapoptotic mechanism.

    Science.gov (United States)

    Cheng, W-F; Chang, M-C; Sun, W-Z; Lee, C-N; Lin, H-W; Su, Y-N; Hsieh, C-Y; Chen, C-A

    2008-07-01

    A novel method for generating an antigen-specific cancer vaccine and immunotherapy has emerged using a DNA vaccine. However, antigen-presenting cells (APCs) have a limited life span, which hinders their long-term ability to prime antigen-specific T cells. Connective tissue growth factor (CTGF) has a role in cell survival. This study explored the intradermal administration of DNA encoding CTGF with a model tumor antigen, human papilloma virus type 16 E7. Mice vaccinated with CTGF/E7 DNA exhibited a dramatic increase in E7-specific CD4(+) and CD8(+) T-cell precursors. They also showed an impressive antitumor effect against E7-expressing tumors compared with mice vaccinated with the wild-type E7 DNA. The delivery of DNA encoding CTGF and E7 or CTGF alone could prolong the survival of transduced dendritic cells (DCs) in vivo. In addition, CTGF/E7-transduced DCs could enhance a higher number of E7-specific CD8(+) T cells than E7-transduced DCs. By prolonging the survival of APCs, DNA vaccine encoding CTGF linked to a tumor antigen represents an innovative approach to enhance DNA vaccine potency and holds promise for cancer prophylaxis and immunotherapy.

  9. Prevention of carcinoma of cervix with human papillomavirus vaccine.

    Science.gov (United States)

    Gavarasana, S; Kalasapudi, R S; Rao, T D; Thirumala, S

    2000-01-01

    Carcinoma of cervix is the most common cancer found among the women of India. Though cervical cytology screening was effective in preventing carcinoma of cervix in developed nations, it is considered unsuitable in developing countries. Recent research has established an etiological link between human papillomavirus infection and carcinoma of cervix. In this review, an attempt is made to answer the question, 'whether carcinoma of cervix can be prevented with human papillomavirus vaccine?' Literature search using Pubmed and Medline was carried out and relevant articles were reviewed. There is ample experimental evidence to show that DNA of human papillomavirus integrates with cervical cell genome. Viral genes E6 and E7 of HPV type 16 and 18 inactivate p53 function and Rb gene, thus immortalize the cervical epithelial cells. Recombinant vaccines blocked the function of E6 and E7 genes preventing development of papillomas in animals. Vaccination with HPV-VLPs encoding for genes of E6 and E7 neutralizes HPV integrated genome of malignant cells of uterine cervix. Based on experimental evidence, it is possible to prevent carcinoma of cervix with human papillomavirus vaccine, Further research is necessary to identify a effective and safe HPV vaccine, routes of administration and characteristics of potential beneficiaries.

  10. In vivo protection against ZIKV infection and pathogenesis through passive antibody transfer and active immunisation with a prMEnv DNA vaccine

    Science.gov (United States)

    Muthumani, Karuppiah; Griffin, Bryan D; Agarwal, Sangya; Kudchodkar, Sagar B; Reuschel, Emma L; Choi, Hyeree; Kraynyak, Kimberly A; Duperret, Elizabeth K; Keaton, Amelia Anne; Chung, Christopher; Kim, Yinho K; Booth, Stephanie A; Racine, Trina; Yan, Jian; Morrow, Matthew P; Jiang, Jingjing; Lee, Brian; Ramos, Stephanie; Broderick, Kate E; Reed, Charles C; Khan, Amir S; Humeau, Laurent; Ugen, Kenneth E; Park, Young K; Maslow, Joel N; Sardesai, Niranjan Y; Joseph Kim, J; Kobinger, Gary P; Weiner, David B

    2016-01-01

    Significant concerns have been raised owing to the rapid global spread of infection and disease caused by the mosquito-borne Zika virus (ZIKV). Recent studies suggest that ZIKV can also be transmitted sexually, further increasing the exposure risk for this virus. Associated with this spread is a dramatic increase in cases of microcephaly and additional congenital abnormalities in infants of ZIKV-infected mothers, as well as a rise in the occurrence of Guillain Barre’ syndrome in infected adults. Importantly, there are no licensed therapies or vaccines against ZIKV infection. In this study, we generate and evaluate the in vivo efficacy of a novel, synthetic, DNA vaccine targeting the pre-membrane+envelope proteins (prME) of ZIKV. Following initial in vitro development and evaluation studies of the plasmid construct, mice and non-human primates were immunised with this prME DNA-based immunogen through electroporation-mediated enhanced DNA delivery. Vaccinated animals were found to generate antigen-specific cellular and humoral immunity and neutralisation activity. In mice lacking receptors for interferon (IFN)-α/β (designated IFNAR−/−) immunisation with this DNA vaccine induced, following in vivo viral challenge, 100% protection against infection-associated weight loss or death in addition to preventing viral pathology in brain tissue. In addition, passive transfer of non-human primate anti-ZIKV immune serum protected IFNAR−/− mice against subsequent viral challenge. This study in NHP and in a pathogenic mouse model supports the importance of immune responses targeting prME in ZIKV infection and suggests that additional research on this vaccine approach may have relevance for ZIKV control and disease prevention in humans. PMID:29263859

  11. Pandemic influenza 1918 H1N1 and 1968 H3N2 DNA vaccines induce cross-reactive immunity in ferrets against infection with viruses drifted for decades

    DEFF Research Database (Denmark)

    Bragstad, Karoline; Martel, Cyril; Thomsen, Joakim S.

    2011-01-01

    Please cite this paper as: Bragstad et al. (2010) Pandemic influenza 1918 H1N1 and 1968 H3N2 DNA vaccines induce cross-reactive immunity in ferrets against infection with viruses drifted for decades. Influenza and Other Respiratory Viruses 5(1), 13-23. Background Alternative influenza vaccines...... and vaccine production forms are needed as the conventional protein vaccines do not induce broad cross-reactivity against drifted strains. Furthermore, fast vaccine production is especially important in a pandemic situation, and broader vaccine reactivity would diminish the need for frequent change...... in the vaccine formulations. Objective In this study, we compared the ability of pandemic influenza DNA vaccines to induce immunity against distantly related strains within a subtype with the immunity induced by conventional trivalent protein vaccines against homologous virus challenge. Methods Ferrets were...

  12. Oral Gene Application Using Chitosan-DNA Nanoparticles Induces Transferable Tolerance

    Science.gov (United States)

    Ensminger, Stephan M.; Spriewald, Bernd M.

    2012-01-01

    Oral tolerance is a promising approach to induce unresponsiveness to various antigens. The development of tolerogenic vaccines could be exploited in modulating the immune response in autoimmune disease and allograft rejection. In this study, we investigated a nonviral gene transfer strategy for inducing oral tolerance via antigen-encoding chitosan-DNA nanoparticles (NP). Oral application of ovalbumin (OVA)-encoding chitosan-DNA NP (OVA-NP) suppressed the OVA-specific delayed-type hypersensitivity (DTH) response and anti-OVA antibody formation, as well as spleen cell proliferation following OVA stimulation. Cytokine expression patterns following OVA stimulation in vitro showed a shift from a Th1 toward a Th2/Th3 response. The OVA-NP-induced tolerance was transferable from donor to naïve recipient mice via adoptive spleen cell transfer and was mediated by CD4+CD25+ T cells. These findings indicate that nonviral oral gene transfer can induce regulatory T cells for antigen-specific immune modulation. PMID:22933401

  13. Clinical and parasitological protection in a Leishmania infantum-macaque model vaccinated with adenovirus and the recombinant A2 antigen.

    Directory of Open Access Journals (Sweden)

    Gabriel Grimaldi

    2014-06-01

    Full Text Available BACKGROUND: Visceral leishmaniasis (VL is a severe vector-born disease of humans and dogs caused by Leishmania donovani complex parasites. Approximately 0.2 to 0.4 million new human VL cases occur annually worldwide. In the new world, these alarming numbers are primarily due to the impracticality of current control methods based on vector reduction and dog euthanasia. Thus, a prophylactic vaccine appears to be essential for VL control. The current efforts to develop an efficacious vaccine include the use of animal models that are as close to human VL. We have previously reported a L. infantum-macaque infection model that is reliable to determine which vaccine candidates are most worthy for further development. Among the few amastigote antigens tested so far, one of specific interest is the recombinant A2 (rA2 protein that protects against experimental L. infantum infections in mice and dogs. METHODOLOGY/PRINCIPAL FINDINGS: Primates were vaccinated using three rA2-based prime-boost immunization regimes: three doses of rA2 plus recombinant human interleukin-12 (rhIL-12 adsorbed in alum (rA2/rhIL-12/alum; two doses of non-replicative adenovirus recombinant vector encoding A2 (Ad5-A2 followed by two boosts with rA2/rhIL-12/alum (Ad5-A2+rA2/rhIL12/alum; and plasmid DNA encoding A2 gene (DNA-A2 boosted with two doses of Ad5-A2 (DNA-A2+Ad5-A2. Primates received a subsequent infectious challenge with L. infantum. Vaccines, apart from being safe, were immunogenic as animals responded with increased pre-challenge production of anti-A2-specific IgG antibodies, though with some variability in the response, depending on the vaccine formulation/protocol. The relative parasite load in the liver was significantly lower in immunized macaques as compared to controls. Protection correlated with hepatic granuloma resolution, and reduction of clinical symptoms, particularly when primates were vaccinated with the Ad5-A2+rA2/rhIL12/alum protocol. CONCLUSIONS

  14. Dual recombinant Lactococcus lactis for enhanced delivery of DNA vaccine reporter plasmid pPERDBY.

    Science.gov (United States)

    Yagnik, Bhrugu; Sharma, Drashya; Padh, Harish; Desai, Priti

    2017-04-01

    Food grade Lactococcus lactis has been widely used as an antigen and DNA delivery vehicle. We have previously reported the use of non-invasive L. lactis to deliver the newly constructed immunostimulatory DNA vaccine reporter plasmid, pPERDBY. In the present report, construction of dual recombinant L. lactis expressing internalin A of Listeria monocytogenes and harboring pPERDBY (LL InlA + pPERDBY) to enhance the efficiency of delivery of DNA by L. lactis is outlined. After confirmation and validation of LL InlA + pPERDBY, its DNA delivery potential was compared with previously developed non-invasive r- L. lactis::pPERDBY. The use of invasive L. lactis resulted in around threefold increases in the number of enhanced green fluorescent protein-expressing Caco-2 cells. These findings reinforce the prospective application of invasive strain of L. lactis for delivery of DNA/RNA and antigens. © 2017 The Societies and John Wiley & Sons Australia, Ltd.

  15. Improved humoral and cellular immune response against the gp120 V3 loop of HIV-1 following genetic immunization with a chimeric DNA vaccine encoding the V3 inserted into the hepatites B surface antigen

    DEFF Research Database (Denmark)

    Fomsgaard, A.; Nielsen, H.V.; Bryder, K.

    1998-01-01

    response and a uniform strong anti-HBs CTL response already 1 week p.i. in all mice. DNA vaccination with the chimeric MN V2/HBsAg plasmid elicited humoral responses against both viruses within 3-6 weeks which peaked at 6-12 weeks and remained stable for at least 25 weeks. In addition, specific CTL...... responses were induced in all mice against both MN V3 and HBsAg already within the first 3 weeks, lasting at least 11 weeks. Thus, HBsAg acts as a `genetic vaccine adjuvant' augmenting and accelerating the cellular and humoral immune response against the inserted MN V3 loop. Such chimeric HIV-HbsAg plasmid...

  16. Improved humoral and cellular immune responses against the gp120 V3 loop of HIV-1 following genetic immunization with a chimeric DNA vaccine encoding the V3 inserted into the hepatitis B surface antigen

    DEFF Research Database (Denmark)

    Fomsgaard, A; Nielsen, H V; Bryder, K

    1998-01-01

    response and a uniform strong anti-HBs CTL response already 1 week p.i. in all mice. DNA vaccination with the chimeric MN V3/HBsAg plasmid elicited humoral responses against both viruses within 3-6 weeks which peaked at 6-12 weeks and remained stable for at least 25 weeks. In addition, specific CTL...... responses were induced in all mice against both MN V3 and HBsAg already within the first 3 weeks, lasting at least 11 weeks. Thus, HBsAg acts as a 'genetic vaccine adjuvant' augmenting and accelerating the cellular and humoral immune response against the inserted MN V3 loop. Such chimeric HIV-HBsAg plasmid...

  17. Safety and immunogenicity of therapeutic DNA vaccination in individuals treated with antiretroviral therapy during acute/early HIV-1 infection.

    Directory of Open Access Journals (Sweden)

    Eric S Rosenberg

    2010-05-01

    Full Text Available An effective therapeutic vaccine that could augment immune control of HIV-1 replication may abrogate or delay the need for antiretroviral therapy. AIDS Clinical Trials Group (ACTG A5187 was a phase I/II, randomized, placebo-controlled, double-blinded trial to evaluate the safety and immunogenicity of an HIV-1 DNA vaccine (VRC-HVDNA 009-00-VP in subjects treated with antiretroviral therapy during acute/early HIV-1 infection. (clinicaltrials.gov NCT00125099Twenty healthy HIV-1 infected subjects who were treated with antiretroviral therapy during acute/early HIV-1 infection and had HIV-1 RNA<50 copies/mL were randomized to receive either vaccine or placebo. The objectives of this study were to evaluate the safety and immunogenicity of the vaccine. Following vaccination, subjects interrupted antiretroviral treatment, and set-point HIV-1 viral loads and CD4 T cell counts were determined 17-23 weeks after treatment discontinuation.Twenty subjects received all scheduled vaccinations and discontinued antiretroviral therapy at week 30. No subject met a primary safety endpoint. No evidence of differences in immunogenicity were detected in subjects receiving vaccine versus placebo. There were also no significant differences in set-point HIV-1 viral loads or CD4 T cell counts following treatment discontinuation. Median set-point HIV-1 viral loads after treatment discontinuation in vaccine and placebo recipients were 3.5 and 3.7 log(10 HIV-1 RNA copies/mL, respectively.The HIV-1 DNA vaccine (VRC-HIVDNA 009-00-VP was safe but poorly immunogenic in subjects treated with antiretroviral therapy during acute/early HIV-1 infection. Viral set-points were similar between vaccine and placebo recipients following treatment interruption. However, median viral load set-points in both groups were lower than in historical controls, suggesting a possible role for antiretroviral therapy in persons with acute or early HIV-1 infection and supporting the safety of

  18. Abeta DNA vaccination for Alzheimer's disease: focus on disease prevention.

    Science.gov (United States)

    Cribbs, David H

    2010-04-01

    several significant advantages, including lower cost and the typical immunization protocol should be much less intrusive to the patient relative to passive therapy, in the advent of Abeta-antibody immune complex-induced adverse events the patients will have to receive immuno-supperssive therapy for an extended period until the anti Abeta antibody levels drop naturally as the effects of the vaccine decays over time. Obviously, improvements in vaccine design are needed to improve both the safety, as well as the efficacy of anti-Abeta immunotherapy. The focus of this review is on the advantages of DNA vaccination for anti-Abeta immunotherapy, and the major hurdles, such as immunosenescence, selection of appropriate molecular adjuvants, universal T cell epitopes, and possibly a polyepitope design based on utilizing existing memory T cells in the general population that were generated in response to childhood or seasonal vaccines, as well as various infections. Ultimately, we believe that the further refinement of our AD DNA epitope vaccines, possibly combined with a prime boost regime will facilitate translation to human clinical trials in either very early AD, or preferably in preclinical stage individuals identified by validated AD biomarkers.

  19. Agrobacterium T-DNA-encoded protein Atu6002 interferes with the host auxin response

    Science.gov (United States)

    Lacroix, Benoît; Gizatullina, Diana I.; Babst, Benjamin A.; Gifford, Andrew N.; Citovsky, Vitaly

    2013-01-01

    Summary Several genes in the Agrobacterium tumefaciens transferred (T) DNA encode proteins that are involved in developmental alterations leading to the formation of tumors in infected plants. We investigated the role of the protein encoded by the Atu6002 gene, the function of which is completely unknown. The Atu6002 expression occurs in Agrobacterium-induced tumors, and is also activated upon activation of plant cell division by growth hormones. Within the expressing plant cells, the Atu6002 protein is targeted to the plasma membrane. Interestingly, constitutive ectopic expression of Atu6002 in transgenic tobacco plants lead to a severe developmental phenotype characterized by stunted growth, shorter internodes, lanceolate leaves, increased branching, and modified flower morphology. These Atu6002-expressing plants also displayed impaired response to auxin. However, auxin cellular uptake and polar transport were not significantly inhibited in these plants, suggesting that Atu6002 interferes with auxin perception or signaling pathways. PMID:24128370

  20. DNA immunization against experimental genital herpes simplex virus infection.

    Science.gov (United States)

    Bourne, N; Stanberry, L R; Bernstein, D I; Lew, D

    1996-04-01

    A nucleic acid vaccine, expressing the gene encoding herpes simplex virus (HSV) type 2 glycoprotein D (gD2) under control of the cytomegalovirus immediate-early gene promoter, was used to immunize guinea pigs against genital HSV-2 infection. The vaccine elicited humoral immune responses comparable to those seen after HSV-2 infection. Immunized animals exhibited protection from primary genital HSV-2 disease with little or no development of vesicular skin lesions and significantly reduced HSV-2 replication in the genital tract. After recovery from primary infection, immunized guinea pigs experienced significantly fewer recurrences and had significantly less HSV-2 genomic DNA detected in the sacral dorsal root ganglia compared with control animals. Thus, immunization reduced the burden of latent infection resulting from intravaginal HSV-2 challenge, and a nucleic acid vaccine expressing the HSV-2 gD2 antigen protected guinea pigs against genital herpes, limiting primary infection and reducing the magnitude of latent infection and the frequency of recurrent disease.

  1. Cloning and Characterization of the Genes Encoding the Murine Homologues of the Human Melanoma Antigens MART1 and gp100

    Science.gov (United States)

    Zhai, Yifan; Yang, James C.; Spiess, Paul; Nishimura, Michael I.; Overwijk, Willem W.; Roberts, Bruce; Restifo, Nicholas P.; Rosenberg, Steven A.

    2008-01-01

    The recent identification of genes encoding melanoma-associated antigens has opened new possibilities for the development of cancer vaccines designed to cause the rejection of established tumors. To develop a syngeneic animal model for evaluating antigen-specific vaccines in cancer therapy, the murine homologues of the human melanoma antigens MART1 and gp 100, which were specifically recognized by tumor-infiltrating lymphocytes from patients with melanoma, were cloned and sequenced from a murine B16 melanoma cDNA library. The open reading frames of murine MART1 and gp 100 encode proteins of 113- and 626-amino acids with 68.8 and 77% identity to the respective human proteins. Comparison of the DNA sequences of the murine MART1 genes, derived from normal melanocytes, the immortalized nontumorgenic melanocyte line Melan-a and the B16 melanoma, showed all to be identical. Northern and Western blot analyses confirmed that both genes encoded products that were melanocyte lineage proteins. Mice immunized with murine MART1 or gp 100 using recombinant vaccinia virus failed to produce any detectable T-cell responses or protective immunity against B16 melanoma. In contrast, immunization of mice with human gp 100 using recombinant adenoviruses elicited T cells specific for hgp100, but these T cells also cross reacted with B16 tumor in vitro and induced significant but weak protection against B16 challenge. Immunization with human and mouse gp100 together [adenovirus type 2 (Ad2)-hep100 plus recombinant vaccinia virus (rVV)-mgp100], or immunization with human gp100 (Ad2-hgp100) and boosting with heterologous vector (rVV-hgp100 or rVV-mgp100) or homologous vector (Ad2-hgp100), did not significantly enhance the protective response against B16 melanoma. These results may suggest that immunization with heterologous tumor antigen, rather than self, may be more effective as an immunotherapeutic reagent in designing antigen-specific cancer vaccines. PMID:9101410

  2. The use of recombinant DNA technology for the development of a bluetongue virus subunit vaccine

    International Nuclear Information System (INIS)

    Huismans, H.

    1985-01-01

    The double-standed RNA gene coding for the surface antigen responsible for inducing neutralising anti-bodies has been isolated, converted to DNA, and cloned in the plasmid pBR322. So far, only plasmids containing inserts smaller than the gene have been obtained. The recombinant plasmids were isolated by screening for specific antibiotic resistance markers and characterized by size, restriction enzymes and hybridization with a 32 P-labelled DNA probe made with BTV-m RNA as template. Possible strategies for the development of a bluetongue virus submit vaccine are discussed

  3. Cloning and expression of a cDNA encoding human sterol carrier protein 2

    International Nuclear Information System (INIS)

    Yamamoto, Ritsu; Kallen, C.B.; Babalola, G.O.; Rennert, H.; Strauss, J.F. III; Billheimer, J.T.

    1991-01-01

    The authors report the cloning and expression of a cDNA encoding human sterol carrier protein 2 (SCP 2 ). The 1.3-kilobase (kb) cDNA contains an open reading frame which encompasses a 143-amino acid sequence which is 89% identical to the rat SCP 2 amino acid sequence. The deduced amino acid sequence of the polypeptide reveals a 20-residue amino-terminal leader sequence in front of the mature polypeptide, which contains a carboxyl-terminal tripeptide (Ala-Lys-Leu) related to the peroxisome targeting sequence. The expressed cDNA in COS-7 cells yields a 15.3-kDa polypeptide and increased amounts of a 13.2-kDa polypeptide, both reacting with a specific rabbit antiserum to rat liver SCP 2 . The cDNA insert hybridizes with 3.2- and 1.8-kb mRNA species in human liver poly(A) + RNA. In human fibroblasts and placenta the 1.8-kb mRNA was most abundant. Southern blot analysis suggests either that there are multiple copies of the SCP 2 gene in the human genome or that the SCP 2 gene is very large. Coexpression of the SCP 2 cDNA with expression vectors for cholesterol side-chain cleavage enzyme and adrenodoxin resulted in a 2.5-fold enhancement of progestin synthesis over that obtained with expression of the steroidogenic enzyme system alone. These findings are concordant with the notion that SCP 2 plays a role in regulating steroidogenesis, among other possible functions

  4. Testing the ability of viral haemorrhagic septicaemia virus to evade the protective immune response induced in rainbow trout by DNA vaccination

    DEFF Research Database (Denmark)

    Sepulveda, Dagoberto; Lorenzen, Niels

    2013-01-01

    , this work aims to evaluate whether VHSV is able to evade the protective immune response induced by the DNA vaccination. Earlier studies have demonstrated that VHSV can evade the neutralizing effect of monoclonal antibodies by mutations in the glycoprotein gene. One approach of the present study is therefore...... to try to isolate VHSV variants which can escape the neutralizing activity of serum from fish immunized with the DNA vaccine. To do so, a highly pathogenic VHSV isolate (DK3592B) will be repeatedly passaged in fish cell cultures in the presence of neutralizing fish serum. Another approach comprises...

  5. Vaccination of mice using the West Nile virus E-protein in a DNA prime-protein boost strategy stimulates cell-mediated immunity and protects mice against a lethal challenge.

    Directory of Open Access Journals (Sweden)

    Marina De Filette

    Full Text Available West Nile virus (WNV is a mosquito-borne flavivirus that is endemic in Africa, the Middle East, Europe and the United States. There is currently no antiviral treatment or human vaccine available to treat or prevent WNV infection. DNA plasmid-based vaccines represent a new approach for controlling infectious diseases. In rodents, DNA vaccines have been shown to induce B cell and cytotoxic T cell responses and protect against a wide range of infections. In this study, we formulated a plasmid DNA vector expressing the ectodomain of the E-protein of WNV into nanoparticles by using linear polyethyleneimine (lPEI covalently bound to mannose and examined the potential of this vaccine to protect against lethal WNV infection in mice. Mice were immunized twice (prime--boost regime with the WNV DNA vaccine formulated with lPEI-mannose using different administration routes (intramuscular, intradermal and topical. In parallel a heterologous boost with purified recombinant WNV envelope (E protein was evaluated. While no significant E-protein specific humoral response was generated after DNA immunization, protein boosting of DNA-primed mice resulted in a marked increase in total neutralizing antibody titer. In addition, E-specific IL-4 T-cell immune responses were detected by ELISPOT after protein boost and CD8(+ specific IFN-γ expression was observed by flow cytometry. Challenge experiments using the heterologous immunization regime revealed protective immunity to homologous and virulent WNV infection.

  6. Novel mucosal DNA-MVA HIV vaccination in which DNA-IL-12 plus Cholera Toxin B subunit (CTB) cooperates to enhance cellular systemic and mucosal genital tract immunity

    OpenAIRE

    Maeto, Cynthia Alejandra; Rodríguez, Ana María; Holgado, María Pía; Falivene, Juliana; Gherardi, Maria Magdalena

    2017-01-01

    Induction of local antiviral immune responses at the mucosal portal surfaces where HIV-1 and other viral pathogens are usually first encountered remains a primary goal for most vaccines against mucosally acquired viral infections. Exploring mucosal immunization regimes in order to find optimal vector combinations and also appropriate mucosal adjuvants in the HIV vaccine development is decisive. In this study we analyzed the interaction of DNA-IL-12 and cholera toxin B subunit (CTB) after thei...

  7. Cloning of a cDNA encoding a novel human nuclear phosphoprotein belonging to the WD-40 family

    DEFF Research Database (Denmark)

    Honoré, B; Leffers, H; Madsen, Peder

    1994-01-01

    We have cloned and expressed in vaccinia virus a cDNA encoding an ubiquitous 501-amino-acid (aa) phosphoprotein that corresponds to protein IEF SSP 9502 (79,400 Da, pI 4.5) in the master 2-D-gel keratinocyte protein database [Celis et al., Electrophoresis 14 (1993) 1091-1198]. The deduced aa...

  8. Nucleotide sequence of Phaseolus vulgaris L. alcohol dehydrogenase encoding cDNA and three-dimensional structure prediction of the deduced protein.

    Science.gov (United States)

    Amelia, Kassim; Khor, Chin Yin; Shah, Farida Habib; Bhore, Subhash J

    2015-01-01

    Common beans (Phaseolus vulgaris L.) are widely consumed as a source of proteins and natural products. However, its yield needs to be increased. In line with the agenda of Phaseomics (an international consortium), work of expressed sequence tags (ESTs) generation from bean pods was initiated. Altogether, 5972 ESTs have been isolated. Alcohol dehydrogenase (AD) encoding gene cDNA was a noticeable transcript among the generated ESTs. This AD is an important enzyme; therefore, to understand more about it this study was undertaken. The objective of this study was to elucidate P. vulgaris L. AD (PvAD) gene cDNA sequence and to predict the three-dimensional (3D) structure of deduced protein. positive and negative strands of the PvAD cDNA clone were sequenced using M13 forward and M13 reverse primers to elucidate the nucleotide sequence. Deduced PvAD cDNA and protein sequence was analyzed for their basic features using online bioinformatics tools. Sequence comparison was carried out using bl2seq program, and tree-view program was used to construct a phylogenetic tree. The secondary structures and 3D structure of PvAD protein were predicted by using the PHYRE automatic fold recognition server. The sequencing results analysis showed that PvAD cDNA is 1294 bp in length. It's open reading frame encodes for a protein that contains 371 amino acids. Deduced protein sequence analysis showed the presence of putative substrate binding, catalytic Zn binding, and NAD binding sites. Results indicate that the predicted 3D structure of PvAD protein is analogous to the experimentally determined crystal structure of s-nitrosoglutathione reductase from an Arabidopsis species. The 1294 bp long PvAD cDNA encodes for 371 amino acid long protein that contains conserved domains required for biological functions of AD. The predicted deduced PvAD protein's 3D structure reflects the analogy with the crystal structure of Arabidopsis thaliana s-nitrosoglutathione reductase. Further study is required

  9. [Combined use of irradiation and DNA tumor vaccine to treat canine oral malignant melanoma: a pilot study].

    Science.gov (United States)

    Herzog, A; Buchholz, J; Ruess-Melzer, K; Lang, J; Kaser-Hotz, B

    2013-02-01

    Melanoma is the most common oral tumor in dogs, characterized by rapid growth, local invasion, and high metastatic rate. The goal of this study was to evaluate the combination of radiation therapy and DNA tumor vaccine. We hypothesized, that the concurrent use would not increase toxicity. Nine dogs with oral melanoma were treated with 4 fractions of 8 Gray at 7-day intervals. The vaccine was given 4 times every 14 days, beginning at the first radiation fraction. Local acute radiation toxicities were assessed according to the VRTOG toxicity scoring scheme over a time period of 7 weeks. In none of the evaluated dogs, mucositis, dermatitis and conjunctivitis exceeded grade 2. In 3 dogs mild fever, lethargy, and local swelling at the injection site were seen after vaccine application. In conclusion, the concurrent administration of radiation therapy and vaccine was well tolerated in all dogs.

  10. Optimization of a multi-gene HIV-1 recombinant subtype CRF02AG DNA vaccine for expression of multiple immunogenic forms

    International Nuclear Information System (INIS)

    Ellenberger, Dennis; Li Bin; Smith, James; Yi Hong; Folks, Thomas; Robinson, Harriet; Butera, Salvatore

    2004-01-01

    We developed an AIDS vaccine for Western and West-Central Africa based on a DNA plasmid vector expressing HIV-1 recombinant subtype CRF02 A G gag, pol, and env genes. To optimize the production of noninfectious HIV-like particles (VLPs) and potentially improve the effectiveness of the vaccine, we generated four potential vaccine constructs: the parental (IC2) and three modifications (IC25, IC48, and IC90) containing mutations within the HIV protease. While the parental construct IC2 expressed aggregates of Gag proteins, the IC25 construct resulted in the production of immature VLPs (the core comprises unprocessed Pr 55Gag ). The remaining two constructs (IC48 and IC90) produced mature VLPs (the core comprises processed capsid p24) in addition to immature VLPs and aggregates of Gag proteins. VLPs incorporated significant levels of mature gp120 envelope glycoprotein. Importantly, the mature VLPs were fusion competent and entered coreceptor-specific target cells. The production of multiple antigenic forms, including fusion-competent VLPs, by candidate DNA vaccine constructs may provide immunologic advantages for induction of protective cellular and humoral responses against HIV-1 proteins

  11. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  12. A DNA vaccine against chikungunya virus is protective in mice and induces neutralizing antibodies in mice and nonhuman primates.

    Directory of Open Access Journals (Sweden)

    Karthik Mallilankaraman

    2011-01-01

    Full Text Available Chikungunya virus (CHIKV is an emerging mosquito-borne alphavirus indigenous to tropical Africa and Asia. Acute illness is characterized by fever, arthralgias, conjunctivitis, rash, and sometimes arthritis. Relatively little is known about the antigenic targets for immunity, and no licensed vaccines or therapeutics are currently available for the pathogen. While the Aedes aegypti mosquito is its primary vector, recent evidence suggests that other carriers can transmit CHIKV thus raising concerns about its spread outside of natural endemic areas to new countries including the U.S. and Europe. Considering the potential for pandemic spread, understanding the development of immunity is paramount to the development of effective counter measures against CHIKV. In this study, we isolated a new CHIKV virus from an acutely infected human patient and developed a defined viral challenge stock in mice that allowed us to study viral pathogenesis and develop a viral neutralization assay. We then constructed a synthetic DNA vaccine delivered by in vivo electroporation (EP that expresses a component of the CHIKV envelope glycoprotein and used this model to evaluate its efficacy. Vaccination induced robust antigen-specific cellular and humoral immune responses, which individually were capable of providing protection against CHIKV challenge in mice. Furthermore, vaccine studies in rhesus macaques demonstrated induction of nAb responses, which mimicked those induced in convalescent human patient sera. These data suggest a protective role for nAb against CHIKV disease and support further study of envelope-based CHIKV DNA vaccines.

  13. Isolation and sequence of complementary DNA encoding human extracellular superoxide dismutase

    International Nuclear Information System (INIS)

    Hjalmarsson, K.; Marklund, S.L.; Engstroem, A.; Edlund, T.

    1987-01-01

    A complementary DNA (cDNA) clone from a human placenta cDNA library encoding extracellular superoxide dismutase has been isolated and the nucleotide sequence determined. The cDNA has a very high G + C content. EC-SOD is synthesized with a putative 18-amino acid signal peptide, preceding the 222 amino acids in the mature enzyme, indicating that the enzyme is a secretory protein. The first 95 amino acids of the mature enzyme show no sequence homology with other sequenced proteins and there is one possible N-glycosylation site (Asn-89). The amino acid sequence from residues 96-193 shows strong homology (∼ 50%) with the final two-thirds of the sequences of all know eukaryotic CuZn SODs, whereas the homology with the P. leiognathi CuZn SOD is clearly lower. The ligands to Cu and Zn, the cysteines forming the intrasubunit disulfide bridge in the CuZn SODs, and the arginine found in all CuZn SODs in the entrance to the active site can all be identified in EC-SOD. A comparison with bovine CuZn SOD, the three-dimensional structure of which is known, reveals that the homologies occur in the active site and the divergencies are in the part constituting the subunit contact area in CuZn SOD. Amino acid sequence 194-222 in the carboxyl-terminal end of EC-SOD is strongly hydrophilic and contains nine amino acids with a positive charge. This sequence probably confers the affinity of EC-SOD for heparin and heparan sulfate. An analysis of the amino acid sequence homologies with CuZn SODs from various species indicates that the EC-SODs may have evolved form the CuZn SODs before the evolution of fungi and plants

  14. Comparison of the Protective Efficacy of DNA and Baculovirus-Derived Protein Vaccines for EBOLA Virus in Guinea Pigs

    National Research Council Canada - National Science Library

    Mellquist-Riemenschneider, Jenny L; Garrison, Aura R; Geisbert, Joan B; Saikh, Kamal U; Heidebrink, Kelli D

    2003-01-01

    .... Previously, a priming dose of a DNA vaccine expressing the glycoprotein (GP) gene of MARV followed by boosting with recombinant baculovirus-derived GP protein was found to confer protective immunity to guinea pigs (Hevey et al., 2001...

  15. A Potato cDNA Encoding a Homologue of Mammalian Multidrug Resistant P-Glycoprotein

    Science.gov (United States)

    Wang, W.; Takezawa, D.; Poovaiah, B. W.

    1996-01-01

    A homologue of the multidrug resistance (MDR) gene was obtained while screening a potato stolon tip cDNA expression library with S-15-labeled calmodulin. The mammalian MDR gene codes for a membrane-bound P-glycoprotein (170-180 kDa) which imparts multidrug resistance to cancerous cells. The potato cDNA (PMDR1) codes for a polypeptide of 1313 amino acid residues (ca. 144 kDa) and its structural features are very similar to the MDR P-glycoprotein. The N-terminal half of the PMDR1-encoded protein shares striking homology with its C-terminal half, and each half contains a conserved ATP-binding site and six putative transmembrane domains. Southern blot analysis indicated that potato has one or two MDR-like genes. PMDR1 mRNA is constitutively expressed in all organs studied with higher expression in the stem and stolon tip. The PMDR1 expression was highest during tuber initiation and decreased during tuber development.

  16. Mucosal vaccination with heterologous viral vectored vaccine targeting subdominant SIV accessory antigens strongly inhibits early viral replication

    DEFF Research Database (Denmark)

    Xu, Huanbin; Andersson, Anne-Marie Carola; Ragonnaud, Emeline

    2017-01-01

    Conventional HIV T cell vaccine strategies have not been successful in containing acute peak viremia, nor in providing long-term control. We immunized rhesus macaques intramuscularly and rectally using a heterologous adenovirus vectored SIV vaccine regimen encoding normally weakly immunogenic tat...

  17. Prevalence and sequence variations of the genes encoding the five antigens included in the novel 5CVMB vaccine covering group B meningococcal disease.

    Science.gov (United States)

    Jacobsson, Susanne; Hedberg, Sara Thulin; Mölling, Paula; Unemo, Magnus; Comanducci, Maurizio; Rappuoli, Rino; Olcén, Per

    2009-03-04

    During the recent years, projects are in progress for designing broad-range non-capsular-based meningococcal vaccines, covering also serogroup B isolates. We have examined three genes encoding antigens (NadA, GNA1030 and GNA2091) included in a novel vaccine, i.e. the 5 Component Vaccine against Meningococcus B (5CVMB), in terms of gene prevalence and sequence variations. These data were combined with the results from a similar study, examining the two additional antigens included in the 5CVMB (fHbp and GNA2132). nadA and fHbp v. 1 were present in 38% (n=36), respectively 71% (n=67) of the isolates, whereas gna2132, gna1030 and gna2091 were present in all the Neisseria meningitidis isolates tested (n=95). The level of amino acid conservation was relatively high in GNA1030 (93%), GNA2091 (92%), and within the main variants of NadA and fHbp. GNA2132 (54% of the amino acids conserved) appeared to be the most diversified antigen. Consequently, the theoretical coverage of the 5CVMB antigens and the feasibility to use these in a broad-range meningococcal vaccine is appealing.

  18. Expanded breadth of the T-cell response to mosaic HIV-1 envelope DNA vaccination

    Energy Technology Data Exchange (ETDEWEB)

    Korber, Bette [Los Alamos National Laboratory; Fischer, William [Los Alamos National Laboratory; Wallstrom, Timothy [Los Alamos National Laboratory

    2009-01-01

    An effective AIDS vaccine must control highly diverse circulating strains of HIV-1. Among HIV -I gene products, the envelope (Env) protein contains variable as well as conserved regions. In this report, an informatic approach to the design of T-cell vaccines directed to HIV -I Env M group global sequences was tested. Synthetic Env antigens were designed to express mosaics that maximize the inclusion of common potential Tcell epitope (PTE) 9-mers and minimize the inclusion of rare epitopes likely to elicit strain-specific responses. DNA vaccines were evaluated using intracellular cytokine staining (ICS) in inbred mice with a standardized panel of highly conserved 15-mer PTE peptides. I, 2 and 3 mosaic sets were developed that increased theoretical epitope coverage. The breadth and magnitude ofT-cell immunity stimulated by these vaccines were compared to natural strain Env's; additional comparisons were performed on mutant Env's, including gpl60 or gpl45 with or without V regions and gp41 deletions. Among them, the 2 or 3 mosaic Env sets elicited the optimal CD4 and CD8 responses. These responses were most evident in CD8 T cells; the 3 mosaic set elicited responses to an average of 8 peptide pools compared to 2 pools for a set of3 natural Env's. Synthetic mosaic HIV -I antigens can therefore induce T-cell responses with expanded breadth and may facilitate the development of effective T -cell-based HIV -1 vaccines.

  19. The specificity of targeted vaccines for APC surface molecules influences the immune response phenotype.

    Directory of Open Access Journals (Sweden)

    Gunnveig Grødeland

    Full Text Available Different diseases require different immune responses for efficient protection. Thus, prophylactic vaccines should prime the immune system for the particular type of response needed for protection against a given infectious agent. We have here tested fusion DNA vaccines which encode proteins that bivalently target influenza hemagglutinins (HA to different surface molecules on antigen presenting cells (APC. We demonstrate that targeting to MHC class II molecules predominantly induced an antibody/Th2 response, whereas targeting to CCR1/3/5 predominantly induced a CD8(+/Th1 T cell response. With respect to antibodies, the polarizing effect was even more pronounced upon intramuscular (i.m delivery as compared to intradermal (i.d. vaccination. Despite these differences in induced immune responses, both vaccines protected against a viral challenge with influenza H1N1. Substitution of HA with ovalbumin (OVA demonstrated that polarization of immune responses, as a consequence of APC targeting specificity, could be extended to other antigens. Taken together, the results demonstrate that vaccination can be tailor-made to induce a particular phenotype of adaptive immune responses by specifically targeting different surface molecules on APCs.

  20. A retrospective review of outcome and survival following surgery and adjuvant xenogeneic DNA vaccination in 32 dogs with oral malignant melanoma.

    Science.gov (United States)

    Treggiari, Elisabetta; Grant, Jessica Pauline; North, Susan Margaret

    2016-06-01

    A xenogeneic DNA vaccination has been licensed for use in dogs with locally controlled stage II and III oral malignant melanoma (OMM). At present, there are limited outcome data for dogs with OMM treated with surgery and immunotherapy. The aim of this study is to retrospectively review the outcome and survival of 32 dogs affected by OMM that were treated with a combination of surgery and the xenogeneic DNA vaccination (with the addition of radiotherapy in some cases) and to determine the influence of surgical margins and delay in receiving vaccination. The overall median survival time (MST) was 335 days (95% CI: 301-540 days), and the overall median progression-free survival (PFS) was 160 days (mean 182 days, 95% CI: 132-232 days). Stage, completeness of surgical margins and delay in administration of the vaccine did not appear to statistically influence survival or PFS, although these results may reflect the low statistical power of the study due to small numbers. Further studies are required to assess whether the addition of any adjuvant treatment to surgery, including immunotherapy, is able to significantly prolong survival in cases of canine oral melanoma.

  1. Non-Replicating Adenovirus-Vectored Anthrax Vaccine

    International Nuclear Information System (INIS)

    Van Kampen, K. R.; Zhang, J.; Jex, E.; Tang, D. C.

    2007-01-01

    As bioterrorism is emerging as a national threat, it is urgent to develop a new generation of anthrax vaccines that can be rapidly produced and mass administered in an emergency setting. We have demonstrated that protective immunity against anthrax spores could be elicited in mice by intranasal administration of a non-replicating human adenovirus serotype 5 (Ad5)-derived vector encoding Bacillus anthracis protective antigen (PA) in a single-dose regimen. The potency of an Ad5 vector encoding PA was remarkably enhanced by codon optimization of the PA gene to match the tRNA pool found in human cells. This nasal vaccine can be mass-administered by non-medical personnel during a bioterrorist attack. In addition, replication-competent adenovirus (RCA)-free Ad5-vectored anthrax vaccines can be mass produced in PER.C6 cells in serum-free wave bioreactors and purified by column chromatography to meet a surge in demand. The non-replicating nature of this new generation of anthrax vaccine ensures an excellent safety profile for vaccines and the environment.(author)

  2. A cDNA encoding a pRB-binding protein with properties of the transcription factor E2F

    DEFF Research Database (Denmark)

    Helin, K; Lees, J A; Vidal, M

    1992-01-01

    The retinoblastoma protein (pRB) plays an important role in the control of cell proliferation, apparently by binding to and regulating cellular transcription factors such as E2F. Here we describe the characterization of a cDNA clone that encodes a protein with properties of E2F. This clone, RBP3...

  3. Safety and long-term immunological effects of CryJ2-LAMP plasmid vaccine in Japanese red cedar atopic subjects: A phase I study.

    Science.gov (United States)

    Su, Yan; Romeu-Bonilla, Eliezer; Anagnostou, Athanasia; Fitz-Patrick, David; Hearl, William; Heiland, Teri

    2017-12-02

    Japanese Red Cedar (JRC) pollen induced allergy affects one third of Japanese and the development of effective therapies remains an unachieved challenge. We designed a DNA vaccine encoding CryJ2 allergen from the JRC pollen and Lysosomal Associated Membrane Protein 1 (LAMP-1) to treat JRC allergy. These Phase IA and IB trials assessed safety and immunological effects of the investigational CryJ2-LAMP DNA vaccine in both non-sensitive and sensitive Japanese expatriates living in Honolulu, Hawaii. In the Phase IA trial, 6 JRC non-sensitive subjects and 9 JRC and/or Mountain Cedar (MC) sensitive subjects were given 4 vaccine doses (each 4mg/1ml) intramuscularly (IM) at 14-day intervals. Nine JRC and/or MC sensitive subjects were given 4 doses (2 mg/0.5 ml) IM at 14-day intervals. The safety and functional biomarkers were followed for 132 d. Following this, 17 of 24 subjects were recruited into the IB trial and received one booster dose (2 mg/0.5 ml) IM approximately 300 d after the first vaccination dose to which they were randomized in the first phase of the trial. All safety endpoints were met and all subjects tolerated CryJ2-LAMP vaccinations well. At the end of the IA trial, 10 out of 12 JRC sensitive and 6 out of 11 MC sensitive subjects experienced skin test negative conversion, possibly related to the CryJ2-LAMP vaccinations. Collectively, these data suggested that the CryJ2-LAMP DNA vaccine is safe and may be immunologically effective in treating JRC induced allergy.

  4. SnoVault and encodeD: A novel object-based storage system and applications to ENCODE metadata.

    Directory of Open Access Journals (Sweden)

    Benjamin C Hitz

    Full Text Available The Encyclopedia of DNA elements (ENCODE project is an ongoing collaborative effort to create a comprehensive catalog of functional elements initiated shortly after the completion of the Human Genome Project. The current database exceeds 6500 experiments across more than 450 cell lines and tissues using a wide array of experimental techniques to study the chromatin structure, regulatory and transcriptional landscape of the H. sapiens and M. musculus genomes. All ENCODE experimental data, metadata, and associated computational analyses are submitted to the ENCODE Data Coordination Center (DCC for validation, tracking, storage, unified processing, and distribution to community resources and the scientific community. As the volume of data increases, the identification and organization of experimental details becomes increasingly intricate and demands careful curation. The ENCODE DCC has created a general purpose software system, known as SnoVault, that supports metadata and file submission, a database used for metadata storage, web pages for displaying the metadata and a robust API for querying the metadata. The software is fully open-source, code and installation instructions can be found at: http://github.com/ENCODE-DCC/snovault/ (for the generic database and http://github.com/ENCODE-DCC/encoded/ to store genomic data in the manner of ENCODE. The core database engine, SnoVault (which is completely independent of ENCODE, genomic data, or bioinformatic data has been released as a separate Python package.

  5. Molecular adjuvant interleukin-33 enhances the antifertility effect of Lagurus lagurus zona pellucida 3 DNA vaccine administered by the mucosal route

    Directory of Open Access Journals (Sweden)

    Y.X. Tu

    2013-12-01

    Full Text Available It has been shown that cytokines can act as molecular adjuvant to enhance the immune response induced by DNA vaccines, but it is unknown whether interleukin 33 (IL-33 can enhance the immunocontraceptive effect induced by DNA vaccines. In the present study, we explored the effects of murine IL-33 on infertility induced by Lagurus lagurus zona pellucida 3 (Lzp3 contraceptive DNA vaccine administered by the mucosal route. Plasmid pcD-Lzp3 and plasmid pcD-mIL-33 were encapsulated with chitosan to generate the nanoparticle chi-(pcD-Lzp3+pcD-mIL-33 as the DNA vaccine. Sixty female ICR mice, divided into 5 groups (n=12/group, were intranasally immunized on days 0, 14, 28, and 42. After intranasal immunization, the anti-LZP3-specific IgG in serum and IgA in vaginal secretions and feces were determined by ELISA. The results showed that chi-(pcD-Lzp3+pcD-mIL-33 co-immunization induced the highest levels of serum IgG, secreted mucosal IgA, and T cell proliferation. Importantly, mice co-immunized with chi-(pcD-Lzp3+pcD-mIL-33 had the lowest birth rate and mean litter size, which correlated with high levels of antibodies. Ovaries from infertile female mice co-immunized with chi-(pcD-Lzp3+pcD-mIL-33 showed abnormal development of ovarian follicles, indicated by atretic follicles and loss of oocytes. Our results demonstrated that intranasal delivery of the molecular adjuvant mIL-33 with chi-pcD-Lzp3 significantly increased infertility by enhancing both systemic and mucosal immune responses. Therefore, chi-(pcD-Lzp3+pcD-mIL-33 co-immunization could be a strategy for controlling the population of wild animal pests.

  6. Vaccination with a DNA vaccine encoding Toxoplasma gondii ROP54 induces protective immunity against toxoplasmosis in mice.

    Science.gov (United States)

    Yang, Wen-Bin; Zhou, Dong-Hui; Zou, Yang; Chen, Kai; Liu, Qing; Wang, Jin-Lei; Zhu, Xing-Quan; Zhao, Guang-Hui

    2017-12-01

    Toxoplasma gondii is an obligatory intracellular protozoan, which infects most of the warm-blooded animals, causing serious public health problems and enormous economic losses worldwide. The rhoptry effector protein 54 (ROP54) has been indicated as a virulence factor that promotes Toxoplasma infection by modulating GBP2 loading onto parasite-containing vacuoles, which can modulate some aspects of the host immune response. In order to evaluate the immuno-protective value of ROP54, we constructed a eukaryotic recombinant plasmid expressing T. gondii ROP54 and intramuscularly immunized Kunming mice with this recombinant plasmid against acute and chronic toxoplasmosis. All mice immunized with pVAX-ROP54 elicited a high level of specific antibody responses, a significant increase of lymphocyte proliferation, and a significant level of Th1-type cytokines (IFN-γ, IL-2 and IL-12p70), in addition to an increased production of Th2-type cytokines (IL-4 and IL-10). These results demonstrated that pVAX-ROP54 induced significant cellular and humoral (Th1/Th2) immune responses, which extended the survival time (13.0±1.15days for pVAX-ROP54 vs 6.7±0.48days for pVAX I, 6.8±0.42days for PBS and 6.5±0.53 for blank control) and significantly reduced cyst burden (35.9% for pVAX-ROP54, 1% for pVAX I and 2% for PBS, compared with blank control) of immunized mice. These results indicate that the recombinant ROP54 plasmid can provide partial protection and might be a potential vaccine candidate against acute and chronic toxoplasmosis. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Polysaccharides from Dioscorea (山藥 Shān Yào and Other Phytochemicals Enhance Antitumor Effects Induced by DNA Vaccine Against Melanoma

    Directory of Open Access Journals (Sweden)

    Wen-Chi Wei

    2014-01-01

    Full Text Available Adjuvants can be used to enhance the immunogenicity of antigens and improve the efficacy of vaccines. Potent adjuvant action is known to often correlate with the activation of the transcription factor, nuclear factor-κB (NF-κB. Specific plant polysaccharides and a variety of phytochemicals from foods and traditional medicinal herbs have been shown to modulate NF-κB activation. In the present study, selected plant polysaccharides and phytochemicals were evaluated for use as a DNA vaccine adjuvant in a murine melanoma model. We observed that a specific ethanol extract fraction (DsCE-I from the tuber of a key Traditional Chinese Medicine plant, Dioscorea (山藥 Shān Yào, enhanced the protection against melanoma after immunization with a gene-based vaccine. A number of anti-inflammatory phytochemicals tested were able to partially diminish the inflammation-associated tumorigenesis elicited by LPS. Among the several phytochemical combinations investigated, the use of an adjuvant containing LPS in combination with emodin resulted in smaller tumors and higher survival rate in test mice than the use of other adjuvant treatments and the control sets in this DNA cancer vaccine model. A Dioscorea polysaccharide fraction (DsCE-I and several specific phytochemicals warrant further exploration as useful adjuvants for anticancer vaccines.

  8. Cloning and chromosomal assignment of a human cDNA encoding a T cell- and natural killer cell-specific trypsin-like serine protease

    International Nuclear Information System (INIS)

    Gershenfeld, H.K.; Hershberger, R.J.; Shows, T.B.; Weissman, I.L.

    1988-01-01

    A cDNA clone encoding a human T cell- and natural killer cell-specific serine protease was obtained by screening a phage λgt10 cDNA library from phytohemagglutinin-stimulated human peripheral blood lymphocytes with the mouse Hanukah factor cDNA clone. In an RNA blot-hybridization analysis, this human Hanukah factor cDNA hybridized with a 1.3-kilobase band in allogeneic-stimulated cytotoxic T cells and the Jurkat cell line, but this transcript was not detectable in normal muscle, liver, tonsil, or thymus. By dot-blot hybridization, this cDNA hybridized with RNA from three cytolytic T-cell clones and three noncytolytic T-cell clones grown in vitro as well as with purified CD16 + natural killer cells and CD3 + , CD16 - T-cell large granular lymphocytes from peripheral blood lymphocytes (CD = cluster designation). The nucleotide sequence of this cDNA clone encodes a predicted serine protease of 262 amino acids. The active enzyme is 71% and 77% similar to the mouse sequence at the amino acid and DNA level, respectively. The human and mouse sequences conserve the active site residues of serine proteases--the trypsin-specific Asp-189 and all 10 cysteine residues. The gene for the human Hanukah factor serine protease is located on human chromosome 5. The authors propose that this trypsin-like serine protease may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells

  9. A Phase I Trial of a Human Papillomavirus (HPV) DNA Vaccine for HPV16+ Cervical Intraepithelial Neoplasia 2/3

    Science.gov (United States)

    Trimble, Cornelia L.; Peng, Shiwen; Kos, Ferdynand; Gravitt, Patti; Viscidi, Raphael; Sugar, Elizabeth; Pardoll, Drew; Wu, TC

    2010-01-01

    Purpose: To evaluate the safety and immunogenicity of a therapeutic HPV16 DNA vaccine administered to women with HPV16+CIN2/3. Experimental Design: This phase I trial incorporated the standard ‘3+3” dose escalation design with an additional 6 patients allocated to the maximally tolerated dose (MTD). Healthy adult women with colposcopically-directed biopsy-proven HPV16+ CIN2/3 received three intramuscular (IM) vaccinations (0.5 mg, 1 mg, or 3mg) of a plasmid expressing a Sig-E7(detox)-HSP70 fusion protein on days 0, 28 and 56, and underwent standard therapeutic resection of the cervical squamocolumnar junction at day 105 (week 15). Safety and immunogenicity of the vaccine and histologic outcome based on resection at week 15 were assessed. Results: Fifteen patients were evaluable (3 each at 0.5 mg and 1mg, 9 at 3mg). The vaccine was well tolerated: most adverse events were mild transient injection-site discomfort; no dose-limiting toxicities were observed. Although HPVE7-specific T-cell responses to E7 detected by enzyme-linked immunospot assays (IFNγ) were of low frequency and magnitude, detectable increases in response subsequent to vaccination were identified in subjects in the second and third cohorts. Complete histologic regression occurred in 3/9 (33%, CI: 7%-70%)) individuals in the highest dose cohort, Although the difference is not significant, it is slightly higher than would be expected in an unvaccinated cohort (25%). Conclusions: This HPV16 DNA vaccine was safe and well tolerated. While it appears possible to elicit HPV-specific T cell responses in patients with established dysplastic lesions, other factors are likely to play a role in lesion regression. PMID:19118066

  10. Identification of a cryptic prokaryotic promoter within the cDNA encoding the 5' end of dengue virus RNA genome.

    Directory of Open Access Journals (Sweden)

    Dongsheng Li

    Full Text Available Infectious cDNA clones of RNA viruses are important research tools, but flavivirus cDNA clones have proven difficult to assemble and propagate in bacteria. This has been attributed to genetic instability and/or host cell toxicity, however the mechanism leading to these difficulties has not been fully elucidated. Here we identify and characterize an efficient cryptic bacterial promoter in the cDNA encoding the dengue virus (DENV 5' UTR. Following cryptic transcription in E. coli, protein expression initiated at a conserved in-frame AUG that is downstream from the authentic DENV initiation codon, yielding a DENV polyprotein fragment that was truncated at the N-terminus. A more complete understanding of constitutive viral protein expression in E. coli might help explain the cloning and propagation difficulties generally observed with flavivirus cDNA.

  11. Specificity of DNA vaccines against the U and M genogroups of infectious hematopoietic necrosis virus (IHNV) in rainbow trout (Oncorhynchus mykiss)

    Science.gov (United States)

    Penaranda, M.M.D.; LaPatra, S.E.; Kurath, G.

    2011-01-01

    Infectious hematopoietic necrosis virus (IHNV) is a fish rhabdovirus that causes significant mortality in salmonid species. In North America IHNV has three major genogroups designated U, M, and L. Host-specificity of the M and U genogroups of IHNV has been established both in the field and in experimental challenges, with M isolates being more prevalent and more virulent in rainbow trout (Oncorhynchus mykiss), and U isolates being more prevalent and highly virulent in sockeye salmon (Oncorhynchus nerka). In this study, efficacy of DNA vaccines containing either M (pM) or U (pU) virus glycoprotein genes was investigated during intra- and cross-genogroup challenges in rainbow trout. In virus challenges at 7 days post-vaccination (early antiviral response), both pM and pU were highly protective against either M or U IHNV. In challenges at 28 days post-vaccination (specific antiviral response), both pM and pU were protective against M IHNV but the homologous pM vaccine was significantly more protective than pU in one of two experiments. At this stage both pM and pU induced comparably high protection against U IHNV challenge. Correlates of protection were also investigated by assessing the expression of the interferon-stimulated gene Mx-1 and the production of neutralizing antibodies (NAbs) following pM or pU DNA vaccination. Mx-1 gene expression, measured at 4 and 7 days post-vaccination as an indicator of the host innate immune response, was found to be significantly higher after pM than pU vaccination in some cases. Neutralizing antibody was produced in response to the two vaccines, but antibody titers did not show consistent correlation with protection. The results show that the rainbow trout innate and adaptive immune responses have some ability to distinguish between the U and M genogroup IHNV, but overall the pM and pU vaccines were protective against both homologous and cross-genogroup challenges.

  12. Vaccine Mediated Protection Against Zika Virus-Induced Congenital Disease.

    Science.gov (United States)

    Richner, Justin M; Jagger, Brett W; Shan, Chao; Fontes, Camila R; Dowd, Kimberly A; Cao, Bin; Himansu, Sunny; Caine, Elizabeth A; Nunes, Bruno T D; Medeiros, Daniele B A; Muruato, Antonio E; Foreman, Bryant M; Luo, Huanle; Wang, Tian; Barrett, Alan D; Weaver, Scott C; Vasconcelos, Pedro F C; Rossi, Shannan L; Ciaramella, Giuseppe; Mysorekar, Indira U; Pierson, Theodore C; Shi, Pei-Yong; Diamond, Michael S

    2017-07-13

    The emergence of Zika virus (ZIKV) and its association with congenital malformations has prompted the rapid development of vaccines. Although efficacy with multiple viral vaccine platforms has been established in animals, no study has addressed protection during pregnancy. We tested in mice two vaccine platforms, a lipid nanoparticle-encapsulated modified mRNA vaccine encoding ZIKV prM and E genes and a live-attenuated ZIKV strain encoding an NS1 protein without glycosylation, for their ability to protect against transmission to the fetus. Vaccinated dams challenged with a heterologous ZIKV strain at embryo day 6 (E6) and evaluated at E13 showed markedly diminished levels of viral RNA in maternal, placental, and fetal tissues, which resulted in protection against placental damage and fetal demise. As modified mRNA and live-attenuated vaccine platforms can restrict in utero transmission of ZIKV in mice, their further development in humans to prevent congenital ZIKV syndrome is warranted. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Technical Transformation of Biodefense Vaccines

    Science.gov (United States)

    Lu, Shan; Wang, Shixia

    2013-01-01

    Biodefense vaccines are developed against a diverse group of pathogens. Vaccines were developed for some of these pathogens a long time ago but they are facing new challenges to move beyond the old manufacturing technologies. New vaccines to be developed against other pathogens have to determine whether to follow traditional vaccination strategies or to seek new approaches. Advances in basic immunology and recombinant DNA technology have fundamentally transformed the process of formulating a vaccine concept, optimizing protective antigens, and selecting the most effective vaccine delivery approach for candidate biodefense vaccines. PMID:19837293

  14. Isolation and characterization of cDNA encoding the 80-kDa subunit protein of the human autoantigen Ku (p70/p80) recognized by autoantibodies from patients with scleroderma-polymyositis overlap syndrome

    International Nuclear Information System (INIS)

    Mimori, Tsuneyo; Ohosone, Yasuo; Hama, Nobuaki; Suwa, Akira; Akizuki, Masashi; Homma, Mitsuo; Griffith, A.J.; Hardin, J.A.

    1990-01-01

    Anti-Ku (p70/p80) autoantibodies in patients with scleroderma-polymyositis overlap syndrome recognize a 70-kDa/80-kDa protein heterodimer which binds to terminal regions of double-stranded DNA. In the present study, the authors isolated full-length cDNAs that encode the 80-kDa Ku subunit. Initial screening of a human spleen cDNA library with anti-Ku antibodies yielded a cDNA of 1.0 kilobase (kb) (termed K71) encoding a portion of the 80-kDa Ku polypeptide (identification based on immunological criteria). In RNA blots, this cDNA hybridized with two mRNAs of 3.4 and 2.6 kb. In vitro transcription and translation experiments produced an immunoprecipitable polypeptide which comigrated with the 80-kDa Ku subunit. The Ku80-6 cDNA proved to be 3304 nucleotides in length, with an additional poly(A) tail, closely approximating the size of the larger mRNA. It contains a single long open reading frame encoding 732 amino acids. The putative polypeptide has a high content of acidic amino acids and a region with periodic repeat of leucine in every seventh position which may form the leucine zipper structure. In genomic DNA blots, probes derived from the opposite ends of cDNA Ku80-6 hybridized with several nonoverlapping restriction fragments from human leukocyte DNA, indicating that the gene encoding the 80-kDa Ku polypeptide is divided into several exons by intervening sequences

  15. Obtaining classical swine fever virus E2 recombinant protein and DNA-vaccine on the basis of one subunit

    International Nuclear Information System (INIS)

    Deryabin, O.; Deryabina, O.; Verbitskiy, P.; Kordyum, V.

    2005-01-01

    Three forms of E2 recombinant protein were expressed in E. coli. Swine sera obtained against different forms of the recombinant protein were cross-studied with indirect ELISA. Using individual proteins as an antigen, only 15% of sera against other forms of protein reacted positively, while 100% of heterologous sera showed positive reaction with fused protein. Challenge experiments showed the existence of protective action only from the individual protein. Specificity and activity of sera obtained from the animals after control challenge was confirmed in a blocking variant of ELISA. Genetic construction used a eukaryotic vector that contained the E2 protein gene. Immunization of mice with the resulting DNA induced synthesis of specific antibodies, the titre of which increased considerably after additional single immunization with the E2 recombinant protein, expressed in E. coli. This demonstrated the effectiveness of animal priming by DNA vaccine, and the possibility of using the E2 recombinant protein in E. coli for booster vaccination. (author)

  16. The protein encoded by the proto-oncogene DEK changes the topology of chromatin and reduces the efficiency of DNA replication in a chromatin-specific manner

    DEFF Research Database (Denmark)

    Alexiadis, V; Waldmann, T; Andersen, Jens S.

    2000-01-01

    The structure of chromatin regulates the genetic activity of the underlying DNA sequence. We report here that the protein encoded by the proto-oncogene DEK, which is involved in acute myelogenous leukemia, induces alterations of the superhelical density of DNA in chromatin. The change in topology...

  17. Comparison of potential protection conferred by three immunization strategies (protein/protein, DNA/DNA, and DNA/protein) against Brucella infection using Omp2b in BALB/c Mice.

    Science.gov (United States)

    Golshani, Maryam; Rafati, Sima; Nejati-Moheimani, Mehdi; Ghasemian, Melina; Bouzari, Saeid

    2016-12-25

    In the present study, immunogenicity and protective efficacy of the Brucella outer membrane protein 2b (Omp2b) was evaluated in BALB/c mice using Protein/Protein, DNA/DNA and DNA/Protein vaccine strategies. Immunization of mice with three vaccine regimens elicited a strong specific IgG response (higher IgG2a titers over IgG1 titers) and provided Th1-oriented immune response. Vaccination of BALB/c mice with the DNA/Pro regimen induced higher levels of IFN-γ/IL-2 and conferred more protection levels against B. melitenisis and B. abortus challenge than did the protein or DNA alone. In conclusion, Omp2b is able to stimulate specific immune responses and to confer cross protection against B. melitensis and B. abortus infection. Therefore, it could be introduced as a new potential candidate for the development of a subunit vaccine against Brucella infection. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Synthetic generation of influenza vaccine viruses for rapid response to pandemics.

    Science.gov (United States)

    Dormitzer, Philip R; Suphaphiphat, Pirada; Gibson, Daniel G; Wentworth, David E; Stockwell, Timothy B; Algire, Mikkel A; Alperovich, Nina; Barro, Mario; Brown, David M; Craig, Stewart; Dattilo, Brian M; Denisova, Evgeniya A; De Souza, Ivna; Eickmann, Markus; Dugan, Vivien G; Ferrari, Annette; Gomila, Raul C; Han, Liqun; Judge, Casey; Mane, Sarthak; Matrosovich, Mikhail; Merryman, Chuck; Palladino, Giuseppe; Palmer, Gene A; Spencer, Terika; Strecker, Thomas; Trusheim, Heidi; Uhlendorff, Jennifer; Wen, Yingxia; Yee, Anthony C; Zaveri, Jayshree; Zhou, Bin; Becker, Stephan; Donabedian, Armen; Mason, Peter W; Glass, John I; Rappuoli, Rino; Venter, J Craig

    2013-05-15

    During the 2009 H1N1 influenza pandemic, vaccines for the virus became available in large quantities only after human infections peaked. To accelerate vaccine availability for future pandemics, we developed a synthetic approach that very rapidly generated vaccine viruses from sequence data. Beginning with hemagglutinin (HA) and neuraminidase (NA) gene sequences, we combined an enzymatic, cell-free gene assembly technique with enzymatic error correction to allow rapid, accurate gene synthesis. We then used these synthetic HA and NA genes to transfect Madin-Darby canine kidney (MDCK) cells that were qualified for vaccine manufacture with viral RNA expression constructs encoding HA and NA and plasmid DNAs encoding viral backbone genes. Viruses for use in vaccines were rescued from these MDCK cells. We performed this rescue with improved vaccine virus backbones, increasing the yield of the essential vaccine antigen, HA. Generation of synthetic vaccine seeds, together with more efficient vaccine release assays, would accelerate responses to influenza pandemics through a system of instantaneous electronic data exchange followed by real-time, geographically dispersed vaccine production.

  19. The European Regulatory Environment of RNA-Based Vaccines.

    Science.gov (United States)

    Hinz, Thomas; Kallen, Kajo; Britten, Cedrik M; Flamion, Bruno; Granzer, Ulrich; Hoos, Axel; Huber, Christoph; Khleif, Samir; Kreiter, Sebastian; Rammensee, Hans-Georg; Sahin, Ugur; Singh-Jasuja, Harpreet; Türeci, Özlem; Kalinke, Ulrich

    2017-01-01

    A variety of different mRNA-based drugs are currently in development. This became possible, since major breakthroughs in RNA research during the last decades allowed impressive improvements of translation, stability and delivery of mRNA. This article focuses on antigen-encoding RNA-based vaccines that are either directed against tumors or pathogens. mRNA-encoded vaccines are developed both for preventive or therapeutic purposes. Most mRNA-based vaccines are directly administered to patients. Alternatively, primary autologous cells from cancer patients are modified ex vivo by the use of mRNA and then are adoptively transferred to patients. In the EU no regulatory guidelines presently exist that specifically address mRNA-based vaccines. The existing regulatory framework, however, clearly defines that mRNA-based vaccines in most cases have to be centrally approved. Interestingly, depending on whether RNA-based vaccines are directed against tumors or infectious disease, they are formally considered gene therapy products or not, respectively. Besides an overview on the current clinical use of mRNA vaccines in various therapeutic areas a detailed discussion of the current regulatory situation is provided and regulatory perspectives are discussed.

  20. Serine Protease Variants Encoded by Echis ocellatus Venom Gland cDNA: Cloning and Sequencing Analysis

    Directory of Open Access Journals (Sweden)

    S. S. Hasson

    2010-01-01

    Full Text Available Envenoming by Echis saw-scaled viper is the leading cause of death and morbidity in Africa due to snake bite. Despite its medical importance, there have been few investigations into the toxin composition of the venom of this viper. Here, we report the cloning of cDNA sequences encoding four groups or isoforms of the haemostasis-disruptive Serine protease proteins (SPs from the venom glands of Echis ocellatus. All these SP sequences encoded the cysteine residues scaffold that form the 6-disulphide bonds responsible for the characteristic tertiary structure of venom serine proteases. All the Echis ocellatus EoSP groups showed varying degrees of sequence similarity to published viper venom SPs. However, these groups also showed marked intercluster sequence conservation across them which were significantly different from that of previously published viper SPs. Because viper venom SPs exhibit a high degree of sequence similarity and yet exert profoundly different effects on the mammalian haemostatic system, no attempt was made to assign functionality to the new Echis ocellatus EoSPs on the basis of sequence alone. The extraordinary level of interspecific and intergeneric sequence conservation exhibited by the Echis ocellatus EoSPs and analogous serine proteases from other viper species leads us to speculate that antibodies to representative molecules should neutralise (that we will exploit, by epidermal DNA immunization the biological function of this important group of venom toxins in vipers that are distributed throughout Africa, the Middle East, and the Indian subcontinent.

  1. Detection of circulating Mycobacterium tuberculosis-specific DNA by droplet digital PCR for vaccine evaluation in challenged monkeys and TB diagnosis.

    Science.gov (United States)

    Song, Neng; Tan, Yang; Zhang, Lingyun; Luo, Wei; Guan, Qing; Yan, Ming-Zhe; Zuo, Ruiqi; Liu, Weixiang; Luo, Feng-Ling; Zhang, Xiao-Lian

    2018-04-24

    Mycobacterium tuberculosis (M. tb) is emerging as a more serious pathogen due to the increased multidrug-resistant TB and co-infection of human immunodeficiency virus (HIV). The development of an effective and sensitive detection method is urgently needed for bacterial load evaluation in vaccine development, early TB diagnosis, and TB treatment. Droplet digital polymerase chain reaction (ddPCR) is a newly developed sensitive PCR method for the absolute quantification of nucleic acid concentrations. Here, we used ddPCR to quantify the circulating virulent M. tb-specific CFP10 (10-kDa culture filtrate protein, Rv3874) and Rv1768 DNA copy numbers in the blood samples from Bacille Calmette-Guerin (BCG)-vaccinated and/or virulent M. tb H37Rv-challenged rhesus monkeys. We found that ddPCR was more sensitive compared to real-time fluorescence quantitative PCR (qPCR), as the detection limits of CFP10 were 1.2 copies/μl for ddPCR, but 15.8 copies/μl for qPCR. We demonstrated that ddPCR could detect CFP10 and Rv1768 DNA after 3 weeks of infection and at least two weeks earlier than qPCR in M.tb H37Rv-challenged rhesus monkey models. DdPCR could also successfully quantify CFP10 and Rv1768 DNA copy numbers in clinical TB patients' blood samples (active pulmonary TB, extrapulmonary TB (EPTB), and infant TB). To our knowledge, this study is the first to demonstrate that ddPCR is an effective and sensitive method of measuring the circulating CFP10 and Rv1768 DNA for vaccine development, bacterial load evaluation in vivo, and early TB (including EPTB and infant TB) diagnosis as well.

  2. Molecular cloning and functional analysis of the gene encoding ...

    African Journals Online (AJOL)

    Here we report for the first time the cloning of a full-length cDNA encoding GGPPS (Jc-GGPPS) from Jatropha curcas L. The full-length cDNA was 1414 base pair (bp), with an 1110-bp open reading frame (ORF) encoding a 370- amino-acids polypeptide. Bioinformatic analysis revealed that Jc-GGPPS is a member of the ...

  3. Recombinant Invasive Lactococcus lactis Carrying a DNA Vaccine Coding the Ag85A Antigen Increases INF-γ, IL-6, and TNF-α Cytokines after Intranasal Immunization

    Directory of Open Access Journals (Sweden)

    Pamela Mancha-Agresti

    2017-07-01

    Full Text Available Tuberculosis (TB remains a major threat throughout the world and in 2015 it caused the death of 1.4 million people. The Bacillus Calmette-Guérin is the only existing vaccine against this ancient disease; however, it does not provide complete protection in adults. New vaccines against TB are eminently a global priority. The use of bacteria as vehicles for delivery of vaccine plasmids is a promising vaccination strategy. In this study, we evaluated the use of, an engineered invasive Lactococcus lactis (expressing Fibronectin-Binding Protein A from Staphylococcus aureus for the delivery of DNA plasmid to host cells, especially to the mucosal site as a new DNA vaccine against tuberculosis. One of the major antigens documented that offers protective responses against Mycobacterium tuberculosis is the Ag85A. L. lactis FnBPA+ (pValac:Ag85A which was obtained and used for intranasal immunization of C57BL/6 mice and the immune response profile was evaluated. In this study we observed that this strain was able to produce significant increases in the amount of pro-inflammatory cytokines (IFN-γ, TNF-α, and IL-6 in the stimulated spleen cell supernatants, showing a systemic T helper 1 (Th1 cell response. Antibody production (IgG and sIgA anti-Ag85A was also significantly increased in bronchoalveolar lavage, as well as in the serum of mice. In summary, these findings open new perspectives in the area of mucosal DNA vaccine, against specific pathogens using a Lactic Acid Bacteria such as L. lactis.

  4. Nucleotide sequence of a human cDNA encoding a ras-related protein (rap1B)

    Energy Technology Data Exchange (ETDEWEB)

    Pizon, V; Lerosey, I; Chardin, P; Tavitian, A [INSERM, Paris (France)

    1988-08-11

    The authors have previously characterized two human ras-related genes rap1 and rap2. Using the rap1 clone as probe they isolated and sequenced a new rap cDNA encoding the 184aa rap1B protein. The rap1B protein is 95% identical to rap1 and shares several properties with the ras protein suggesting that it could bind GTP/GDP and have a membrane location. As for rap1, the structural characteristics of rap1B suggest that the rap and ras proteins might interact on the same effector.

  5. Cloning of a cDNA encoding a surface antigen of Schistosoma mansoni schistosomula recognized by sera of vassinated mice

    International Nuclear Information System (INIS)

    Dalton, J.P.; Tom, T.D.; Strand, M.

    1987-01-01

    Spleen cells of mice vaccinated with radiation-attenuated Schistosoma mansoni cercariae were used to produce monoclonal antibodies directed against newly transformed schistosomular surface antigens. One of these monoclonal antibodies recognized a polypeptide of 18 kDa. Binding was measured by radioimmunoassay. This glycoprotein was purified by monoclonal antibody immunoaffinity chromatography and a polyclonal antiserum was prepared against it. Immunofluorescence assays showed that the polyclonal antiserum bound to the surface of newly transformed schistosomula and lung-stage organisms but not to the surface of liver-stage and adult worms. Using this polyclonal antiserum we isolated recombinant clones from an adult worm cDNA expression library constructed in λgt11. Clone 654.2 contained an insert of 0.52 kilobase and hybridized to a 1.2-kilobase mRNA species from adult worms. Most importantly, clone 654.2 produced a fusion protein of 125 kDa that was reactive with sera of vaccinated mice that are capable of transferring resistance. This result encourages future vaccination trials with the fusion protein

  6. Oral Vaccination with Salmonella enterica as a Cruzipain-DNA Delivery System Confers Protective Immunity against Trypanosoma cruzi▿

    Science.gov (United States)

    Cazorla, Silvia I.; Becker, Pablo D.; Frank, Fernanda M.; Ebensen, Thomas; Sartori, María J.; Corral, Ricardo S.; Malchiodi, Emilio L.; Guzmán, Carlos A.

    2008-01-01

    To stimulate both local and systemic immune responses against Trypanosoma cruzi, Salmonella enterica serovar Typhimurium aroA was exploited as a DNA delivery system for cruzipain (SCz). In a murine model we compared SCz alone (GI) or coadministered with Salmonella carrying a plasmid encoding granulocyte-macrophage colony-stimulating factor (GII), as well as protocols in which SCz priming was followed by boosting with recombinant cruzipain (rCz) admixed with either CpG-ODN (GIII) or MALP-2, a synthetic derivative of a macrophage-activating lipopeptide of 2 kDa from Mycoplasma fermentans (GIV). The results showed that protocols that included four oral doses of SCz (GI) elicited mainly a mucosal response characterized by immunoglobulin A (IgA) secretion and proliferation of gut-associated lymphoid tissue cells, with weak systemic responses. In contrast, the protocol that included a boost with rCz plus CpG (GIII) triggered stronger systemic responses in terms of Cz-specific serum IgG titers, splenocyte proliferation, gamma interferon (IFN-γ) secretion, and delayed-type hypersensitivity response. Trypomastigote challenge of vaccinated mice resulted in significantly lower levels of parasitemia compared to controls. Protection was abolished by depletion of either CD4+ or CD8+ T cells. Parasite control was also evident from the reduction of tissue damage, as revealed by histopathologic studies and serum levels of enzymes that are markers of muscle injury in chronic Chagas' disease (i.e., creatine kinase, aspartate aminotransferase, and lactate dehydrogenase). Enhanced release of IFN-γ and interleukin-2 was observed in GI and GII upon restimulation of splenocytes in the nonparasitic phase of infection. Our results indicate that Salmonella-mediated delivery of Cz-DNA by itself promotes the elicitation of an immune response that controls T. cruzi infection, thereby reducing parasite loads and subsequent damage to muscle tissues. PMID:17967857

  7. Identification of pre-erythrocytic malaria antigens that target hepatocytes for killing in vivo and contribute to protection elicited by whole-parasite vaccination.

    Directory of Open Access Journals (Sweden)

    Lin Chen

    Full Text Available Pre-erythrocytic malaria vaccines, including those based on whole-parasite approaches, have shown protective efficacy in animal and human studies. However few pre-erythocytic antigens other than the immunodominant circumsporozoite protein (CSP have been studied in depth with the goal of developing potent subunit malaria vaccines that are suited for use in endemic areas. Here we describe a novel technique to identify pre-erythrocytic malaria antigens that contribute to protection elicited by whole-parasite vaccination in the mouse model. Our approach combines immunization with genetically attenuated parasites and challenge with DNA plasmids encoding for potential protective pre-erythrocytic malaria antigens as luciferase fusions by hydrodynamic tail vein injection. After optimizing the technique, we first showed that immunization with Pyfabb/f-, a P. yoelii genetically attenuated parasite, induces killing of CSP-presenting hepatocytes. Depletion of CD8+ but not CD4+ T cells diminished the killing of CSP-expressing hepatocytes, indicating that killing is CD8+ T cell-dependent. Finally we showed that the use of heterologous prime/boost immunization strategies that use genetically attenuated parasites and DNA vaccines enabled the characterization of a novel pre-erythrocytic antigen, Tmp21, as a contributor to Pyfabb/f- induced protection. This technique will be valuable for identification of potentially protective liver stage antigens and has the potential to contribute to the understanding of immunity elicited by whole parasite vaccination, as well as the development of effective subunit malaria vaccines.

  8. A putative peroxidase cDNA from turnip and analysis of the encoded protein sequence.

    Science.gov (United States)

    Romero-Gómez, S; Duarte-Vázquez, M A; García-Almendárez, B E; Mayorga-Martínez, L; Cervantes-Avilés, O; Regalado, C

    2008-12-01

    A putative peroxidase cDNA was isolated from turnip roots (Brassica napus L. var. purple top white globe) by reverse transcriptase-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). Total RNA extracted from mature turnip roots was used as a template for RT-PCR, using a degenerated primer designed to amplify the highly conserved distal motif of plant peroxidases. The resulting partial sequence was used to design the rest of the specific primers for 5' and 3' RACE. Two cDNA fragments were purified, sequenced, and aligned with the partial sequence from RT-PCR, and a complete overlapping sequence was obtained and labeled as BbPA (Genbank Accession No. AY423440, named as podC). The full length cDNA is 1167bp long and contains a 1077bp open reading frame (ORF) encoding a 358 deduced amino acid peroxidase polypeptide. The putative peroxidase (BnPA) showed a calculated Mr of 34kDa, and isoelectric point (pI) of 4.5, with no significant identity with other reported turnip peroxidases. Sequence alignment showed that only three peroxidases have a significant identity with BnPA namely AtP29a (84%), and AtPA2 (81%) from Arabidopsis thaliana, and HRPA2 (82%) from horseradish (Armoracia rusticana). Work is in progress to clone this gene into an adequate host to study the specific role and possible biotechnological applications of this alternative peroxidase source.

  9. Construction of adiponectin-encoding plasmid DNA and gene therapy of non-obese type 2 diabetes mellitus.

    Science.gov (United States)

    Nan, Mei Hua; Park, Jeong-Sook; Myung, Chang-Seon

    2010-01-01

    Adiponectin (ADN), an insulin-sensitizing adipokine, stimulates glucose uptake, inhibits gluconeogenesis, and plays an important role in improving insulin sensitivity. Since blood levels of ADN are low in type 2 diabetes mellitus (DM), this study was designed to investigate the therapeutic effectiveness of increasing the ADN level through injection of plasmid DNA encoding ADN in type 2 DM. A non-obese type 2 DM mouse model was established via combined administration of streptozotocin with nicotinamide and exhibited significantly higher plasma glucose concentration and insulin resistance compared with normal controls according to oral glucose tolerance and insulin challenge tests. Plasmid DNA encoding mouse ADN from differentiated NIH3T3 adipocytes was constructed in pVAX1 (pVAX/ADN). Transfection of pVAX/ADN into various cell lines including HeLa, HT22, HEK293, HepG2, and SK-Hep1 cells, increased ADN mRNA expression levels in a dose-dependent manner. The administration of pVAX/ADN into non-obese type 2 DM mice via tail vein significantly increased the blood level of ADN and decreased the plasma glucose concentration. Moreover, the parameters related to insulin resistance (HOMA-IR) and insulin sensitivity (QUICKI) were significantly improved. These results suggest that ADN gene therapy could be a clinically effective tool for the treatment of type 2 DM.

  10. A baculovirus dual expression system-based vaccine confers complete protection against lethal challenge with H9N2 avian influenza virus in mice

    Directory of Open Access Journals (Sweden)

    Ye Yu

    2011-06-01

    Full Text Available Abstract Background Avian influenza viruses of H9N2 subtype have become highly prevalent in avian species. Although these viruses generally cause only mild to moderate disease, they can infect a wide variety of species, including chickens, quail, turkeys, ducks, geese, pheasant, partridge, and pigeon, even transmitted to mammalian species, including humans, accelerating the efforts to devise protective strategies against them. Results The results showed that stronger immune responses were induced in a mouse model immunized with BV-Dual-HA than in those vaccinated with a DNA vaccine encoding the same antigen. Moreover, complete protection against lethal challenge with H9N2 virus was observed in mice. Conclusion BV-Dual-HA could be utilized as a vaccine candidate against H9N2 virus infection.

  11. A novel vaccine p846 encoding Rv3615c, Mtb10.4, and Rv2660c elicits robust immune response and alleviates lung injury induced by Mycobacterium infection.

    Science.gov (United States)

    Kong, Hongmei; Dong, Chunsheng; Xiong, Sidong

    2014-01-01

    Development of effective anti-tuberculosis (TB) vaccines is one of the important steps to improve control of TB. Cell-mediated immune response significantly affects the control of M. tuberculosis infection. Thus, vaccines able to elicit strong cellular immune response hold special advantages against TB. In this study, three well-defined mycobacterial antigens (Rv3615c, Mtb10.4 [Rv0228], and Rv2660c) were engineered as a novel triple-antigen fusion DNA vaccine p846. The p846 vaccine consists of a high density of CD4(+) and CD8(+) T-cell epitopes. Intramuscular immunization of p846 induced robust T cells mediated immune response comparable to that of bacillus Calmette-Guérin (BCG) vaccination but more effective than that of individual antigen vaccination. After mycobacterial challenge, p846 immunization decreased bacterial burden at least 15-fold compared with individual antigen-based vaccination. Notably, the lungs of mice immunized with p846 exhibited fewer inflammatory cell infiltrates and less damage than those of control group mice. Our data demonstrate that the potential of p846 vaccine to protect against TB and the feasibility of this design strategy for further TB vaccine development.

  12. Cloning, characterization and heterologous expression of epoxide hydrolase-encoding cDNA sequences from yeasts belonging to the genera Rhodotorula and Rhodosporidium

    NARCIS (Netherlands)

    Visser, H.; Weijers, C.A.G.M.; Ooyen, van A.J.J.; Verdoes, J.C.

    2002-01-01

    Epoxide hydrolase-encoding cDNA sequences were isolated from the basidiomycetous yeast species Rhodosporidium toruloides CBS 349, Rhodosporidium toruloides CBS 14 and Rhodotorula araucariae CBS 6031 in order to evaluate the molecular data and potential application of this type of enzymes. The

  13. Characterization of cDNA encoding molt-inhibiting hormone of the crab, Cancer pagurus; expression of MIH in non-X-organ tissues.

    Science.gov (United States)

    Lu, W; Wainwright, G; Olohan, L A; Webster, S G; Rees, H H; Turner, P C

    2001-10-31

    Synthesis of ecdysteroids (molting hormones) by crustacean Y-organs is regulated by a neuropeptide, molt-inhibiting hormone (MIH), produced in eyestalk neural ganglia. We report here the molecular cloning of a cDNA encoding MIH of the edible crab, Cancer pagurus. Full-length MIH cDNA was obtained by using reverse transcription-polymerase chain reaction (RT-PCR) with degenerate oligonucleotides based upon the amino acid sequence of MIH, in conjunction with 5'- and 3'-RACE. Full-length clones of MIH cDNA were obtained that encoded a 35 amino acid putative signal peptide and the mature 78 amino acid peptide. Of various tissues examined by Northern blot analysis, the X-organ was the sole major site of expression of the MIH gene. However, a nested-PCR approach using non-degenerate MIH-specific primers indicated the presence of MIH transcripts in other tissues. Southern blot analysis indicated a simple gene arrangement with at least two copies of the MIH gene in the genome of C. pagurus. Additional Southern blotting experiments detected MIH-hybridizing bands in another Cancer species, Cancer antennarius and another crab species, Carcinus maenas.

  14. Quantitative real-time PCR study on persistence of pDNA vaccine pVax-Hsp60 TM814 in beef muscles

    Czech Academy of Sciences Publication Activity Database

    Orság, P.; Kvardová, V.; Raška, M.; Miller, A. D.; Ledvina, Miroslav; Turánek, J.

    2008-01-01

    Roč. 6, č. 11 (2008), s. 1-11 ISSN 1479-0556 R&D Projects: GA MZe QF3115 Institutional research plan: CEZ:AV0Z40550506 Keywords : DNA vaccine * real-time PCR * liposomes Subject RIV: CC - Organic Chemistry

  15. Construction and Identification of a Recombinant Plasmid Encoding Echinococcus granulosus Oncosphere Antigen (EG95Abstract Background: Cystic echinococcosis (CE, as a zoonotic disease cause to health threat and economic losses. Despite implemented cont

    Directory of Open Access Journals (Sweden)

    Nahideh MAZAHERI

    2017-12-01

    Full Text Available AbstractBackground: Cystic echinococcosis (CE, as a zoonotic disease cause to health threat and economic losses. Despite implemented control programs, few countries have been able to decrease or eliminate this infection. Vaccination of the intermediate host offers an additional strategy to control the parasite transmission and EG95 antigen is considered more than the others in the vaccine issue. According to the high protection induced by the EG95 recombinant vaccine, this study was designed to construct recombinant plasmid formulation of EG95 antigen.Methods: In 2015, the Echinococcus granulosus eggs were recovered from an infected dog in Parasitological laboratory of Tarbiat Modares University in Tehran, Iran. Following hatching, the oncospheres of E. granulosus were activated to increase the presence of the desired mRNA. The extracted mRNA was transcribed to the cDNA which used as template in RT-PCR. Then the EG95 gene cloned into pET28a vector and the recombinant plasmids expression was  investigated in prokaryotic and eukaryotic cells.Results:  The recombinant plasmid encoding EG95 antigen was successfully constructed and identified by PCR, restriction enzyme digestion and sequencing. In vitro expression of the EG95 antigen was confirmed in prokary­otic and eukaryotic systems by SDS-PAGE and western blotting analysis.Conclusion: Because of potential advantages of DNA vaccines, including ability to induce long-term immune responses, low production cost and stability in different temperatures, this study carried out to construct the EG95 gene into a vector. This recombinant vector can be evaluated in further studies as a DNA vaccine may provide new prospects for the development of a vaccine against cystic hydatid disease.

  16. Efficacy of chimeric Pestivirus vaccine candidates against classical swine fever: protection and DIVA characteristics.

    Science.gov (United States)

    Eblé, P L; Geurts, Y; Quak, S; Moonen-Leusen, H W; Blome, S; Hofmann, M A; Koenen, F; Beer, M; Loeffen, W L A

    2013-03-23

    Currently no live DIVA (Differentiating Infected from Vaccinated Animals) vaccines against classical swine fever (CSF) are available. The aim of this study was to investigate whether chimeric pestivirus vaccine candidates (CP7_E2alf, Flc11 and Flc9) are able to protect pigs against clinical signs, and to reduce virus shedding and virus transmission, after a challenge with CSF virus (CSFV), 7 or 14 days after a single intramuscular vaccination. In these vaccine candidates, either the E2 or the E(rns) encoding genome region of a bovine viral diarrhoea virus strain were combined with a cDNA copy of CSFV or vice versa. Furthermore, currently available serological DIVA tests were evaluated. The vaccine candidates were compared to the C-strain. All vaccine candidates protected against clinical signs. No transmission to contact pigs was detected in the groups vaccinated with C-strain, CP7_E2alf and Flc11. Limited transmission occurred in the groups vaccinated with Flc9. All vaccine candidates would be suitable to stop on-going transmission of CSFV. For Flc11, no reliable differentiation was possible with the current E(rns)-based DIVA test. For CP7_E2alf, the distribution of the inhibition percentages was such that up to 5% false positive results may be obtained in a large vaccinated population. For Flc9 vaccinated pigs, the E2 ELISA performed very well, with an expected 0.04% false positive results in a large vaccinated population. Both CP7_E2alf and Flc9 are promising candidates to be used as live attenuated marker vaccines against CSF, with protection the best feature of CP7_E2alf, and the DIVA principle the best feature of Flc9. Copyright © 2012 Elsevier B.V. All rights reserved.

  17. Quantitative PCR is a Valuable Tool to Monitor the Performance of DNA-Encoded Chemical Library Selections.

    Science.gov (United States)

    Li, Yizhou; Zimmermann, Gunther; Scheuermann, Jörg; Neri, Dario

    2017-05-04

    Phage-display libraries and DNA-encoded chemical libraries (DECLs) represent useful tools for the isolation of specific binding molecules from large combinatorial sets of compounds. With both methods, specific binders are recovered at the end of affinity capture procedures by using target proteins of interest immobilized on a solid support. However, although the efficiency of phage-display selections is routinely quantified by counting the phage titer before and after the affinity capture step, no similar quantification procedures have been reported for the characterization of DECL selections. In this article, we describe the potential and limitations of quantitative PCR (qPCR) methods for the evaluation of selection efficiency by using a combinatorial chemical library with more than 35 million compounds. In the experimental conditions chosen for the selections, a quantification of DNA input/recovery over five orders of magnitude could be performed, revealing a successful enrichment of abundant binders, which could be confirmed by DNA sequencing. qPCR provided rapid information about the performance of selections, thus facilitating the optimization of experimental conditions. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Potential overestimation of HPV vaccine impact due to unmasking of non-vaccine types: quantification using a multi-type mathematical model.

    Science.gov (United States)

    Choi, Yoon Hong; Chapman, Ruth; Gay, Nigel; Jit, Mark

    2012-05-14

    Estimates of human papillomavirus (HPV) vaccine impact in clinical trials and modelling studies rely on DNA tests of cytology or biopsy specimens to determine the HPV type responsible for a cervical lesion. DNA of several oncogenic HPV types may be detectable in a specimen. However, only one type may be responsible for a particular cervical lesion. Misattribution of the causal HPV type for a particular abnormality may give rise to an apparent increase in disease due to non-vaccine HPV types following vaccination ("unmasking"). To investigate the existence and magnitude of unmasking, we analysed data from residual cytology and biopsy specimens in English women aged 20-64 years old using a stochastic type-specific individual-based model of HPV infection, progression and disease. The model parameters were calibrated to data on the prevalence of HPV DNA and cytological lesion of different grades, and used to assign causal HPV types to cervical lesions. The difference between the prevalence of all disease due to non-vaccine HPV types, and disease due to non-vaccine HPV types in the absence of vaccine HPV types, was then estimated. There could be an apparent maximum increase of 3-10% in long-term cervical cancer incidence due to non-vaccine HPV types following vaccination. Unmasking may be an important phenomenon in HPV post-vaccination epidemiology, in the same way that has been observed following pneumococcal conjugate vaccination. Copyright © 2012 Elsevier Ltd. All rights reserved.

  19. Emerging Cancer Vaccines: The Promise of Genetic Vectors

    International Nuclear Information System (INIS)

    Aurisicchio, Luigi; Ciliberto, Gennaro

    2011-01-01

    Therapeutic vaccination against cancer is an important approach which, when combined with other therapies, can improve long-term control of cancer. In fact, the induction of adaptive immune responses against Tumor Associated Antigens (TAAs) as well as innate immunity are important factors for tumor stabilization/eradication. A variety of immunization technologies have been explored in last decades and are currently under active evaluation, such as cell-based, protein, peptide and heat-shock protein-based cancer vaccines. Genetic vaccines are emerging as promising methodologies to elicit immune responses against a wide variety of antigens, including TAAs. Amongst these, Adenovirus (Ad)-based vectors show excellent immunogenicity profile and have achieved immunological proof of concept in humans. In vivo electroporation of plasmid DNA (DNA-EP) is also a desirable vaccine technology for cancer vaccines, as it is repeatable several times, a parameter required for the long-term maintenance of anti-tumor immunity. Recent findings show that combinations of different modalities of immunization (heterologous prime/boost) are able to induce superior immune reactions as compared to single-modality vaccines. In this review, we will discuss the challenges and requirements of emerging cancer vaccines, particularly focusing on the genetic cancer vaccines currently under active development and the promise shown by Ad and DNA-EP heterologous prime-boost

  20. Viruses Infecting a Freshwater Filamentous Cyanobacterium (Nostoc sp.) Encode a Functional CRISPR Array and a Proteobacterial DNA Polymerase B.

    Science.gov (United States)

    Chénard, Caroline; Wirth, Jennifer F; Suttle, Curtis A

    2016-06-14

    Here we present the first genomic characterization of viruses infecting Nostoc, a genus of ecologically important cyanobacteria that are widespread in freshwater. Cyanophages A-1 and N-1 were isolated in the 1970s and infect Nostoc sp. strain PCC 7210 but remained genomically uncharacterized. Their 68,304- and 64,960-bp genomes are strikingly different from those of other sequenced cyanophages. Many putative genes that code for proteins with known functions are similar to those found in filamentous cyanobacteria, showing a long evolutionary history in their host. Cyanophage N-1 encodes a CRISPR array that is transcribed during infection and is similar to the DR5 family of CRISPRs commonly found in cyanobacteria. The presence of a host-related CRISPR array in a cyanophage suggests that the phage can transfer the CRISPR among related cyanobacteria and thereby provide resistance to infection with competing phages. Both viruses also encode a distinct DNA polymerase B that is closely related to those found in plasmids of Cyanothece sp. strain PCC 7424, Nostoc sp. strain PCC 7120, and Anabaena variabilis ATCC 29413. These polymerases form a distinct evolutionary group that is more closely related to DNA polymerases of proteobacteria than to those of other viruses. This suggests that the polymerase was acquired from a proteobacterium by an ancestral virus and transferred to the cyanobacterial plasmid. Many other open reading frames are similar to a prophage-like element in the genome of Nostoc sp. strain PCC 7524. The Nostoc cyanophages reveal a history of gene transfers between filamentous cyanobacteria and their viruses that have helped to forge the evolutionary trajectory of this previously unrecognized group of phages. Filamentous cyanobacteria belonging to the genus Nostoc are widespread and ecologically important in freshwater, yet little is known about the genomic content of their viruses. Here we report the first genomic analysis of cyanophages infecting

  1. A replication defective recombinant Ad5 vaccine expressing Ebola virus GP is safe and immunogenic in healthy adults.

    Science.gov (United States)

    Ledgerwood, J E; Costner, P; Desai, N; Holman, L; Enama, M E; Yamshchikov, G; Mulangu, S; Hu, Z; Andrews, C A; Sheets, R A; Koup, R A; Roederer, M; Bailer, R; Mascola, J R; Pau, M G; Sullivan, N J; Goudsmit, J; Nabel, G J; Graham, B S

    2010-12-16

    Ebola virus causes irregular outbreaks of severe hemorrhagic fever in equatorial Africa. Case mortality remains high; there is no effective treatment and outbreaks are sporadic and unpredictable. Studies of Ebola virus vaccine platforms in non-human primates have established that the induction of protective immunity is possible and safety and human immunogenicity has been demonstrated in a previous Phase I clinical trial of a 1st generation Ebola DNA vaccine. We now report the safety and immunogenicity of a recombinant adenovirus serotype 5 (rAd5) vaccine encoding the envelope glycoprotein (GP) from the Zaire and Sudan Ebola virus species, in a randomized, placebo-controlled, double-blinded, dose escalation, Phase I human study. Thirty-one healthy adults received vaccine at 2×10(9) (n=12), or 2×10(10) (n=11) viral particles or placebo (n=8) as an intramuscular injection. Antibody responses were assessed by ELISA and neutralizing assays; and T cell responses were assessed by ELISpot and intracellular cytokine staining assays. This recombinant Ebola virus vaccine was safe and subjects developed antigen specific humoral and cellular immune responses. Published by Elsevier Ltd.

  2. ENCODE: A Sourcebook of Epigenomes and Chromatin Language

    Directory of Open Access Journals (Sweden)

    Maryam Yavartanoo

    2013-03-01

    Full Text Available Until recently, since the Human Genome Project, the general view has been that the majority of the human genome is composed of junk DNA and has little or no selective advantage to the organism. Now we know that this conclusion is an oversimplification. In April 2003, the National Human Genome Research Institute (NHGRI launched an international research consortium called Encyclopedia of DNA Elements (ENCODE to uncover non-coding functional elements in the human genome. The result of this project has identified a set of new DNA regulatory elements, based on novel relationships among chromatin accessibility, histone modifications, nucleosome positioning, DNA methylation, transcription, and the occupancy of sequence-specific factors. The project gives us new insights into the organization and regulation of the human genome and epigenome. Here, we sought to summarize particular aspects of the ENCODE project and highlight the features and data that have recently been released. At the end of this review, we have summarized a case study we conducted using the ENCODE epigenome data.

  3. Kinetics of Mx expression in rainbow trout (Oncorhynchus mykiss) and Atlantic salmon (Salmo salar L.) parr in response to VHS-DNA vaccination

    DEFF Research Database (Denmark)

    Acosta, F.; Petrie, A.; Lockhart, K.

    2005-01-01

    vaccine or the synthetic double-stranded RNA, poly LC. In both species there was a rapid response to poly LC detectable from day 1, reaching maximum from days 3 to 9 and decreasing to background level by day 12. The peak level and return to background was reached slightly later in salmon. In both species...... the response to the VHS/DNA vaccine was slower to begin, not being detectable on days 1 and 3, but elevated levels were found on day 6. However, in the salmon part, the peak level was on day 6 and the signal disappeared by day 12, while in the rainbow trout, the response peaked at day 12 and lasted until day......The duration of the Mx mRNA response to an intramuscular injection of the viral haemorrhagic septicaemia virus (VHSV) glycoprotein (G) gene DNA vaccine as well as to the control plasmid was determined in rainbow trout at 14 degreesC over a period of 11 weeks. The Mx response was detectable on day 7...

  4. Prioritizing multiple therapeutic targets in parallel using automated DNA-encoded library screening

    Science.gov (United States)

    Machutta, Carl A.; Kollmann, Christopher S.; Lind, Kenneth E.; Bai, Xiaopeng; Chan, Pan F.; Huang, Jianzhong; Ballell, Lluis; Belyanskaya, Svetlana; Besra, Gurdyal S.; Barros-Aguirre, David; Bates, Robert H.; Centrella, Paolo A.; Chang, Sandy S.; Chai, Jing; Choudhry, Anthony E.; Coffin, Aaron; Davie, Christopher P.; Deng, Hongfeng; Deng, Jianghe; Ding, Yun; Dodson, Jason W.; Fosbenner, David T.; Gao, Enoch N.; Graham, Taylor L.; Graybill, Todd L.; Ingraham, Karen; Johnson, Walter P.; King, Bryan W.; Kwiatkowski, Christopher R.; Lelièvre, Joël; Li, Yue; Liu, Xiaorong; Lu, Quinn; Lehr, Ruth; Mendoza-Losana, Alfonso; Martin, John; McCloskey, Lynn; McCormick, Patti; O'Keefe, Heather P.; O'Keeffe, Thomas; Pao, Christina; Phelps, Christopher B.; Qi, Hongwei; Rafferty, Keith; Scavello, Genaro S.; Steiginga, Matt S.; Sundersingh, Flora S.; Sweitzer, Sharon M.; Szewczuk, Lawrence M.; Taylor, Amy; Toh, May Fern; Wang, Juan; Wang, Minghui; Wilkins, Devan J.; Xia, Bing; Yao, Gang; Zhang, Jean; Zhou, Jingye; Donahue, Christine P.; Messer, Jeffrey A.; Holmes, David; Arico-Muendel, Christopher C.; Pope, Andrew J.; Gross, Jeffrey W.; Evindar, Ghotas

    2017-07-01

    The identification and prioritization of chemically tractable therapeutic targets is a significant challenge in the discovery of new medicines. We have developed a novel method that rapidly screens multiple proteins in parallel using DNA-encoded library technology (ELT). Initial efforts were focused on the efficient discovery of antibacterial leads against 119 targets from Acinetobacter baumannii and Staphylococcus aureus. The success of this effort led to the hypothesis that the relative number of ELT binders alone could be used to assess the ligandability of large sets of proteins. This concept was further explored by screening 42 targets from Mycobacterium tuberculosis. Active chemical series for six targets from our initial effort as well as three chemotypes for DHFR from M. tuberculosis are reported. The findings demonstrate that parallel ELT selections can be used to assess ligandability and highlight opportunities for successful lead and tool discovery.

  5. In silico analysis of Ta9 gene polymorphism in an Iranian Theileria annulata schizont-infected cell line S15 vaccine strain and native isolates

    Directory of Open Access Journals (Sweden)

    Habibi, G.

    2016-07-01

    Full Text Available Bovine theileriosis is a tick-borne disease caused by obligate intracellular parasites related to the genus Theileria. Cellular immune responses protect cattle against pathogens through the activation of immune cells. Nowadays, live, attenuated vaccine of Theileria annulata (T. annulata is being produced in Iran and is recommended for active cattle immunization. Detection of the immunogenic antigens and epitopes recognized by CD8+ T Lymphocytes is vital for the development of recombinant and subunit vaccines. Herein, sequences of the genes encoding Ta9, which is an important antigen recognized by bovine CD8+ T cells specific for T. annulata, in Iranian S15 vaccine strains, several Iranian isolates, as well as reference Ta9 DNA sequences registered in GeneBank were compared through polymerase chain reaction (PCR. The obtained data from DNA sequences were analyzed by using "Nucleotide", "Blast n", "BioEdit" and "IEDB" softwares. The results showed high level of variation in nucleotides and amino acids level. The observed polymorphism in Ta9 gene sequences of Iranian vaccine strains and some isolates from Iran demonstrated that this antigen contains polymorphic sequences and is active along with the specific major histocompatibility complex (MHC of the host. Polymorphic sequences and specific epitopes of Ta9 gene for CD8+ T cell provides an explanation for incomplete protection observed after inoculation of heterologous parasites in vaccinated cattle. These results have important implications for the application of Ta9 antigen for developing novel subunit vaccines.

  6. Vaccination with human papillomavirus pseudovirus-encapsidated plasmids targeted to skin using microneedles.

    Directory of Open Access Journals (Sweden)

    Rhonda C Kines

    Full Text Available Human papilloma virus-like particles (HPV VLP serve as the basis of the current licensed vaccines for HPV. We have previously shown that encapsidation of DNA expressing the model antigen M/M2 from respiratory syncytial virus (RSV in HPV pseudovirions (PsV is immunogenic when delivered intravaginally. Because the HPV capsids confer tropism for basal epithelium, they represent attractive carriers for vaccination targeted to the skin using microneedles. In this study we asked: 1 whether HPV16 VLP administered by microneedles could induce protective immune responses to HPV16 and 2 whether HPV16 PsV-encapsidated plasmids delivered by microneedles could elicit immune responses to both HPV and the antigen delivered by the transgene. Mice immunized with HPV16 VLP coated microneedles generated robust neutralizing antibody responses and were protected from HPV16 challenge. Microneedle arrays coated with HPV16-M/M2 or HPV16-F protein (genes of RSV were then tested and dose-dependent HPV and F-specific antibody responses were detected post-immunization, and M/M2-specific T-cell responses were detected post RSV challenge, respectively. HPV16 PsV-F immunized mice were fully protected from challenge with HPV16 PsV and had reduced RSV viral load in lung and nose upon intranasal RSV challenge. In summary, HPV16 PsV-encapsidated DNA delivered by microneedles induced neutralizing antibody responses against HPV and primed for antibody and T-cell responses to RSV antigens encoded by the encapsidated plasmids. Although the immunogenicity of the DNA component was just above the dose response threshold, the HPV-specific immunity was robust. Taken together, these data suggest microneedle delivery of lyophilized HPV PsV could provide a practical, thermostable combined vaccine approach that could be developed for clinical evaluation.

  7. Approaches to Preventative and Therapeutic HIV vaccines

    Science.gov (United States)

    Gray, Glenda E.; Laher, Fatima; Lazarus, Erica; Ensoli, Barbara; Corey, Lawrence

    2016-01-01

    Novel strategies are being researched to discover vaccines to prevent and treat HIV-1. Nonefficacious preventative vaccine approaches include bivalent recombinant gp120 alone, HIV gene insertion into an Adenovirus 5 (Ad5) virus vector and the DNA prime/Ad5 boost vaccine regimen. However, the ALVAC-HIV prime/AIDSVAX® B/E gp120 boost regimen showed 31.2% efficacy at 3.5 years, and is being investigated as clade C constructs with an additional boost. Likewise, although multiple therapeutic vaccines have failed in the past, in a non-placebo controlled trial, a Tat vaccine demonstrated immune cell restoration, reduction of immune activation, and reduced HIV-1 DNA viral load. Monoclonal antibodies for passive immunization or treatment show promise, with VRC01 entering advanced clinical trials. PMID:26985884

  8. Bacteriophage T5 encodes a homolog of the eukaryotic transcription coactivator PC4 implicated in recombination-dependent DNA replication.

    Science.gov (United States)

    Steigemann, Birthe; Schulz, Annina; Werten, Sebastiaan

    2013-11-15

    The RNA polymerase II cofactor PC4 globally regulates transcription of protein-encoding genes through interactions with unwinding DNA, the basal transcription machinery and transcription activators. Here, we report the surprising identification of PC4 homologs in all sequenced representatives of the T5 family of bacteriophages, as well as in an archaeon and seven phyla of eubacteria. We have solved the crystal structure of the full-length T5 protein at 1.9Å, revealing a striking resemblance to the characteristic single-stranded DNA (ssDNA)-binding core domain of PC4. Intriguing novel structural features include a potential regulatory region at the N-terminus and a C-terminal extension of the homodimerisation interface. The genome organisation of T5-related bacteriophages points at involvement of the PC4 homolog in recombination-dependent DNA replication, strongly suggesting that the protein corresponds to the hitherto elusive replicative ssDNA-binding protein of the T5 family. Our findings imply that PC4-like factors intervene in multiple unwinding-related processes by acting as versatile modifiers of nucleic acid conformation and raise the possibility that the eukaryotic transcription coactivator derives from ancestral DNA replication, recombination and repair factors. © 2013.

  9. scsB, a cDNA encoding the hydrogenosomal beta subunit of succinyl-CoA synthetase from the anaerobic fungus Neocallimastix frontalis

    NARCIS (Netherlands)

    Brondijk, THC; Durand, R; vanderGiezen, M; Gottschal, JC; Prins, RA; Fevre, M

    1996-01-01

    A clone containing a Neocallimastix frontalis cDNA assumed to encode the beta subunit of succinyl-CoA synthetase (SCSB) was identified by sequence homology with prokaryotic and eukaryotic counterparts. An open reading frame of 1311 bp was found. The deduced 437 amino acid sequence showed a high

  10. Prior DNA immunization enhances immune response to dominant and subdominant viral epitopes induced by a fowlpox-based SIVmac vaccine in long-term slow-progressor macaques infected with SIVmac251

    International Nuclear Information System (INIS)

    Radaelli, Antonia; Nacsa, Janos; Tsai, W.-P.; Edghill-Smith, Yvette; Zanotto, Carlo; Elli, Veronica; Venzon, David; Tryniszewska, Elzbieta; Markham, Phil; Mazzara, Gail P.; Panicali, Dennis; Morghen, Carlo De Giuli; Franchini, Genoveffa

    2003-01-01

    A therapeutic vaccine for individuals infected with HIV-1 and treated with antiretroviral therapy (ART) should be able to replenish virus-specific CD4+ T-cells and broaden the virus-specific CD8+ T-cell response in order to maintain CD8+ T-cell function and minimize viral immune escape after ART cessation. Because a combination of DNA and recombinant poxvirus vaccine modalities induces high levels of virus-specific CD4+ T-cell response and broadens the cytolytic activity in naive macaques, we investigated whether the same results could be obtained in SIVmac251-infected macaques. The macaques studied here were long-term nonprogressors that naturally contained viremia but were nevertheless treated with a combination of antiviral drugs to assess more carefully the effect of vaccination in the context of ART. The combination of a DNA expressing the gag and pol genes (DNA-SIV-gp) of SIVmac239 followed by a recombinant fowlpox expressing the same SIVmac genes (FP-SIV-gp) was significantly more immunogenic than two immunizations of FP-SIV-gp in SIVmac251-infected macaques treated with ART. The DNA/FP combination significantly expanded and broadened Gag-specific T-cell responses measured by tetramer staining, ELISPOT, and intracellular cytokine staining and measurement of ex vivo cytolytic function. Importantly, the combination of these vaccine modalities also induced a sizeable expansion in most macaques of Gag-specific CD8-(CD4+) T-cells able to produce TNF-α. Hopefully, this modality of vaccine combination may be useful in the clinical management of HIV-1-infected individuals

  11. The Evolution of Poxvirus Vaccines

    Science.gov (United States)

    Sánchez-Sampedro, Lucas; Perdiguero, Beatriz; Mejías-Pérez, Ernesto; García-Arriaza, Juan; Di Pilato, Mauro; Esteban, Mariano

    2015-01-01

    After Edward Jenner established human vaccination over 200 years ago, attenuated poxviruses became key players to contain the deadliest virus of its own family: Variola virus (VARV), the causative agent of smallpox. Cowpox virus (CPXV) and horsepox virus (HSPV) were extensively used to this end, passaged in cattle and humans until the appearance of vaccinia virus (VACV), which was used in the final campaigns aimed to eradicate the disease, an endeavor that was accomplished by the World Health Organization (WHO) in 1980. Ever since, naturally evolved strains used for vaccination were introduced into research laboratories where VACV and other poxviruses with improved safety profiles were generated. Recombinant DNA technology along with the DNA genome features of this virus family allowed the generation of vaccines against heterologous diseases, and the specific insertion and deletion of poxvirus genes generated an even broader spectrum of modified viruses with new properties that increase their immunogenicity and safety profile as vaccine vectors. In this review, we highlight the evolution of poxvirus vaccines, from first generation to the current status, pointing out how different vaccines have emerged and approaches that are being followed up in the development of more rational vaccines against a wide range of diseases. PMID:25853483

  12. The Evolution of Poxvirus Vaccines

    Directory of Open Access Journals (Sweden)

    Lucas Sánchez-Sampedro

    2015-04-01

    Full Text Available After Edward Jenner established human vaccination over 200 years ago, attenuated poxviruses became key players to contain the deadliest virus of its own family: Variola virus (VARV, the causative agent of smallpox. Cowpox virus (CPXV and horsepox virus (HSPV were extensively used to this end, passaged in cattle and humans until the appearance of vaccinia virus (VACV, which was used in the final campaigns aimed to eradicate the disease, an endeavor that was accomplished by the World Health Organization (WHO in 1980. Ever since, naturally evolved strains used for vaccination were introduced into research laboratories where VACV and other poxviruses with improved safety profiles were generated. Recombinant DNA technology along with the DNA genome features of this virus family allowed the generation of vaccines against heterologous diseases, and the specific insertion and deletion of poxvirus genes generated an even broader spectrum of modified viruses with new properties that increase their immunogenicity and safety profile as vaccine vectors. In this review, we highlight the evolution of poxvirus vaccines, from first generation to the current status, pointing out how different vaccines have emerged and approaches that are being followed up in the development of more rational vaccines against a wide range of diseases.

  13. Local HPV Recombinant Vaccinia Boost Following Priming with an HPV DNA Vaccine Enhances Local HPV-Specific CD8+ T-cell-Mediated Tumor Control in the Genital Tract.

    Science.gov (United States)

    Sun, Yun-Yan; Peng, Shiwen; Han, Liping; Qiu, Jin; Song, Liwen; Tsai, Yachea; Yang, Benjamin; Roden, Richard B S; Trimble, Cornelia L; Hung, Chien-Fu; Wu, T-C

    2016-02-01

    Two viral oncoproteins, E6 and E7, are expressed in all human papillomavirus (HPV)-infected cells, from initial infection in the genital tract to metastatic cervical cancer. Intramuscular vaccination of women with high-grade cervical intraepithelial neoplasia (CIN2/3) twice with a naked DNA vaccine, pNGVL4a-sig/E7(detox)/HSP70, and a single boost with HPVE6/E7 recombinant vaccinia vaccine (TA-HPV) elicited systemic HPV-specific CD8 T-cell responses that could traffic to the lesion and was associated with regression in some patients (NCT00788164). Here, we examine whether alteration of this vaccination regimen by administration of TA-HPV vaccination in the cervicovaginal tract, rather than intramuscular (IM) delivery, can more effectively recruit antigen-specific T cells in an orthotopic syngeneic mouse model of HPV16(+) cervical cancer (TC-1 luc). We found that pNGVL4a-sig/E7(detox)/HSP70 vaccination followed by cervicovaginal vaccination with TA-HPV increased accumulation of total and E7-specific CD8(+) T cells in the cervicovaginal tract and better controlled E7-expressing cervicovaginal TC-1 luc tumor than IM administration of TA-HPV. Furthermore, the E7-specific CD8(+) T cells in the cervicovaginal tract generated through the cervicovaginal route of vaccination expressed the α4β7 integrin and CCR9, which are necessary for the homing of the E7-specific CD8(+) T cells to the cervicovaginal tract. Finally, we show that cervicovaginal vaccination with TA-HPV can induce potent local HPV-16 E7 antigen-specific CD8(+) T-cell immune responses regardless of whether an HPV DNA vaccine priming vaccination was administered IM or within the cervicovaginal tract. Our results support future clinical translation using cervicovaginal TA-HPV vaccination. ©2015 American Association for Cancer Research.

  14. Local HPV Recombinant Vaccinia Boost Following Priming with an HPV DNA Vaccine Enhances Local HPV-Specific CD8+ T Cell Mediated Tumor Control in the Genital Tract

    Science.gov (United States)

    Sun, Yun-Yan; Peng, Shiwen; Han, Liping; Qiu, Jin; Song, Liwen; Tsai, Yachea; Yang, Benjamin; Roden, Richard B.S.; Trimble, Cornelia L.; Hung, Chien-Fu; Wu, T-C

    2015-01-01

    Purpose Two viral oncoproteins, E6 and E7, are expressed in all human papillomavirus (HPV)-infected cells, from initial infection in the genital tract to metastatic cervical cancer. Intramuscular vaccination of women with high grade cervical intraepithelial neoplasia (CIN2/3) twice with a naked DNA vaccine, pNGVL4a-sig/E7(detox)/HSP70, and a single boost with HPVE6/E7 recombinant vaccinia vaccine (TA-HPV) elicited systemic HPV-specific CD8 T cell responses that could traffic to the lesion and was associated with regression in some patients (NCT00788164). Experimental Design Here we examine whether alteration of this vaccination regimen by administration of TA-HPV vaccination in the cervicovaginal tract, rather than IM delivery, can more effectively recruit antigen-specific T cells in an orthotopic syngeneic mouse model of HPV16+ cervical cancer (TC-1 luc). Results We found that pNGVL4a-sig/E7(detox)/HSP70 vaccination followed by cervicovaginal vaccination with TA-HPV increased accumulation of total and E7-specific CD8+ T cells in the cervicovaginal tract and better controlled E7-expressing cervicovaginal TC-1 luc tumor than IM administration of TA-HPV. Furthermore, the E7-specific CD8+ T cells in the cervicovaginal tract generated through the cervicovaginal route of vaccination expressed the α4β7 integrin and CCR9, which are necessary for the homing of the E7-specific CD8+ T cells to the cervicovaginal tract. Finally, we show that cervicovaginal vaccination with TA-HPV can induce potent local HPV-16 E7 antigen-specific CD8+ T cell immune responses regardless of whether an HPV DNA vaccine priming vaccination was administered IM or within the cervicovaginal tract. Conclusions Our results support future clinical translation using cervicovaginal TA-HPV vaccination. PMID:26420854

  15. Vaccines prepared from translation products of cloned viral genes

    International Nuclear Information System (INIS)

    Patzer, J.; Obijeski, J.F.

    1985-01-01

    With the advent of recombinant DNA (rDNA) techniques and their application to viruses for vaccine research, there has been an explosion of information about the molecular structure and replication of many viruses. rDNA technology in conjunction with several other emerging technologies, e.g. monoclonal antibodies, solid phase synthesis of peptides and prediction of protein conformation on the basis of amino acid sequence, has provided a powerful battery of techniques that in many cases has allowed the identification of specific sites on the virion surface that elicit neutralizing antibodies. Knowledge of these sites allows one to design a subunit vaccine that utilizes one of the virion proteins or regions of a particular protein in the absence of any other viral proteins or the viral nucleic acid. The advantages of this approach are: that there are no potentially infectious agents contained in the vaccine if the inactivation procedure is incomplete, there is less chance of complications from the vaccine due to nonessential viral components in the vaccine, a purified protein or polypeptide is usually more stable than virus particles during storage, and many times larger quanitities of an antigen can be produced by rDNA techniques than by classical vaccine methods

  16. Intramuscular DNA Vaccination of Juvenile Carp against Spring Viremia of Carp Virus Induces Full Protection and Establishes a Virus-Specific B and T Cell Response

    DEFF Research Database (Denmark)

    Embregts, Carmen W. E.; Rigaudeau, Dimitri; Veselý, Tomas

    2017-01-01

    Although spring viremia of carp virus (SVCV) can cause high mortalities in common carp, a commercial vaccine is not available for worldwide use. Here, we report a DNA vaccine based on the expression of the SVCV glycoprotein (G) which, when injected in the muscle even at a single low dose of 0.1 μg...... DNA/g of fish, confers up to 100% protection against a subsequent bath challenge with SVCV. Importantly, to best validate vaccine efficacy, we also optimized a reliable bath challenge model closely mimicking a natural infection, based on a prolonged exposure of carp to SVCV at 15°C. Using...... this optimized bath challenge, we showed a strong age-dependent susceptibility of carp to SVCV, with high susceptibility at young age (3 months) and a full resistance at 9 months. We visualized local expression of the G protein and associated early inflammatory response by immunohistochemistry and described...

  17. DNA/MVA Vaccination of HIV-1 Infected Participants with Viral Suppression on Antiretroviral Therapy, followed by Treatment Interruption: Elicitation of Immune Responses without Control of Re-Emergent Virus.

    Directory of Open Access Journals (Sweden)

    Melanie Thompson

    Full Text Available GV-TH-01, a Phase 1 open-label trial of a DNA prime—Modified Vaccinia Ankara (MVA boost vaccine (GOVX-B11, was undertaken in HIV infected participants on antiretroviral treatment (ART to evaluate safety and vaccine-elicited T cell responses, and explore the ability of elicited CD8+ T cells to control viral rebound during analytical treatment interruption (TI. Nine men who began antiretroviral therapy (ART within 18 months of seroconversion and had sustained plasma HIV-1 RNA <50 copies/mL for at least 6 months were enrolled. Median age was 38 years, median pre-ART HIV-1 RNA was 140,000 copies/ml and mean baseline CD4 count was 755/μl. Two DNA, followed by 2 MVA, inoculations were given 8 weeks apart. Eight subjects completed all vaccinations and TI. Clinical and laboratory adverse events were generally mild, with no serious or grade 4 events. Only reactogenicity events were considered related to study drug. No treatment emergent viral resistance was seen. The vaccinations did not reduce viral reservoirs and virus re-emerged in all participants during TI, with a median time to re-emergence of 4 weeks. Eight of 9 participants had CD8+ T cells that could be stimulated by vaccine-matched Gag peptides prior to vaccination. Vaccinations boosted these responses as well as eliciting previously undetected CD8+ responses. Elicited T cells did not display signs of exhaustion. During TI, temporal patterns of viral re-emergence and Gag-specific CD8+ T cell expansion suggested that vaccine-specific CD8+ T cells had been stimulated by re-emergent virus in only 2 of 8 participants. In these 2, transient decreases in viremia were associated with Gag selection in known CD8+ T cell epitopes. We hypothesize that escape mutations, already archived in the viral reservoir, plus a poor ability of CD8+ T cells to traffic to and control virus at sites of re-emergence, limited the therapeutic efficacy of the DNA/MVA vaccine.clinicaltrials.gov NCT01378156.

  18. DNA/MVA Vaccination of HIV-1 Infected Participants with Viral Suppression on Antiretroviral Therapy, followed by Treatment Interruption: Elicitation of Immune Responses without Control of Re-Emergent Virus.

    Science.gov (United States)

    Thompson, Melanie; Heath, Sonya L; Sweeton, Bentley; Williams, Kathy; Cunningham, Pamela; Keele, Brandon F; Sen, Sharon; Palmer, Brent E; Chomont, Nicolas; Xu, Yongxian; Basu, Rahul; Hellerstein, Michael S; Kwa, Suefen; Robinson, Harriet L

    2016-01-01

    GV-TH-01, a Phase 1 open-label trial of a DNA prime—Modified Vaccinia Ankara (MVA) boost vaccine (GOVX-B11), was undertaken in HIV infected participants on antiretroviral treatment (ART) to evaluate safety and vaccine-elicited T cell responses, and explore the ability of elicited CD8+ T cells to control viral rebound during analytical treatment interruption (TI). Nine men who began antiretroviral therapy (ART) within 18 months of seroconversion and had sustained plasma HIV-1 RNA HIV-1 RNA was 140,000 copies/ml and mean baseline CD4 count was 755/μl. Two DNA, followed by 2 MVA, inoculations were given 8 weeks apart. Eight subjects completed all vaccinations and TI. Clinical and laboratory adverse events were generally mild, with no serious or grade 4 events. Only reactogenicity events were considered related to study drug. No treatment emergent viral resistance was seen. The vaccinations did not reduce viral reservoirs and virus re-emerged in all participants during TI, with a median time to re-emergence of 4 weeks. Eight of 9 participants had CD8+ T cells that could be stimulated by vaccine-matched Gag peptides prior to vaccination. Vaccinations boosted these responses as well as eliciting previously undetected CD8+ responses. Elicited T cells did not display signs of exhaustion. During TI, temporal patterns of viral re-emergence and Gag-specific CD8+ T cell expansion suggested that vaccine-specific CD8+ T cells had been stimulated by re-emergent virus in only 2 of 8 participants. In these 2, transient decreases in viremia were associated with Gag selection in known CD8+ T cell epitopes. We hypothesize that escape mutations, already archived in the viral reservoir, plus a poor ability of CD8+ T cells to traffic to and control virus at sites of re-emergence, limited the therapeutic efficacy of the DNA/MVA vaccine. clinicaltrials.gov NCT01378156.

  19. The yeast Saccharomyces cerevisiae DNA polymerase IV: possible involvement in double strand break DNA repair.

    OpenAIRE

    Leem, S H; Ropp, P A; Sugino, A

    1994-01-01

    We identified and purified a new DNA polymerase (DNA polymerase IV), which is similar to mammalian DNA polymerase beta, from Saccharomyces cerevisiae and suggested that it is encoded by YCR14C (POLX) on chromosome III. Here, we provided a direct evidence that the purified DNA polymerase IV is indeed encoded by POLX. Strains harboring a pol4 deletion mutation exhibit neither mitotic growth defect nor a meiosis defect, suggesting that DNA polymerase IV participates in nonessential functions in ...

  20. Faecal shedding of canine parvovirus after modified-live vaccination in healthy adult dogs.

    Science.gov (United States)

    Freisl, M; Speck, S; Truyen, U; Reese, S; Proksch, A-L; Hartmann, K

    2017-01-01

    Since little is known about the persistence and faecal shedding of canine parvovirus (CPV) in dogs after modified-live vaccination, diagnostic tests for CPV can be difficult to interpret in the post-vaccination period. The primary aim of this study was to determine the incidence, duration and extent of CPV vaccine virus shedding in adult dogs and to investigate related factors, including the presence of protective antibodies, increase in anti-CPV antibody titres and development of any gastrointestinal side-effects. A secondary objective was to assess prevalence of CPV field virus shedding in clinically healthy dogs due to subclinical infections. One hundred adult, healthy privately owned dogs were vaccinated with a commercial CPV-2 modified-live vaccine (MLV). Faeces were tested for the presence of CPV DNA on days 0 (prior to vaccination), 3, 7, 14, 21 and 28 by quantitative real-time PCR. Pre- and post-vaccination serum titres were determined by haemagglutination inhibition on days 0, 7 and 28. Transient excretion of CPV DNA was detected in 2.0% of dogs before vaccination. About one quarter of dogs (23.0%) shed CPV DNA during the post-vaccination period, but field and vaccine virus differentiation by VP2 gene sequencing was only successful in few samples. Faecal CPV excretion occurred despite protective serum antibody titres. Post-vaccination CPV shedding was not related to adequate antibody response after vaccination or to the occurrence of gastrointestinal side-effects. Despite individual differences, CPV DNA was detectable for up to 28 days after vaccination, although the faecal CPV DNA load in these clinically healthy dogs was very low. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. Development of novel prime-boost strategies based on a tri-gene fusion recombinant L. tarentolae vaccine against experimental murine visceral leishmaniasis.

    Directory of Open Access Journals (Sweden)

    Noushin Saljoughian

    Full Text Available Visceral leishmaniasis (VL is a vector-borne disease affecting humans and domestic animals that constitutes a serious public health problem in many countries. Although many antigens have been examined so far as protein- or DNA-based vaccines, none of them conferred complete long-term protection. The use of the lizard non-pathogenic to humans Leishmania (L. tarentolae species as a live vaccine vector to deliver specific Leishmania antigens is a recent approach that needs to be explored further. In this study, we evaluated the effectiveness of live vaccination in protecting BALB/c mice against L. infantum infection using prime-boost regimens, namely Live/Live and DNA/Live. As a live vaccine, we used recombinant L. tarentolae expressing the L. donovani A2 antigen along with cysteine proteinases (CPA and CPB without its unusual C-terminal extension (CPB(-CTE as a tri-fusion gene. For DNA priming, the tri-fusion gene was encoded in pcDNA formulated with cationic solid lipid nanoparticles (cSLN acting as an adjuvant. At different time points post-challenge, parasite burden and histopathological changes as well as humoral and cellular immune responses were assessed. Our results showed that immunization with both prime-boost A2-CPA-CPB(-CTE-recombinant L. tarentolae protects BALB/c mice against L. infantum challenge. This protective immunity is associated with a Th1-type immune response due to high levels of IFN-γ production prior and after challenge and with lower levels of IL-10 production after challenge, leading to a significantly higher IFN-γ/IL-10 ratio compared to the control groups. Moreover, this immunization elicited high IgG1 and IgG2a humoral immune responses. Protection in mice was also correlated with a high nitric oxide production and low parasite burden. Altogether, these results indicate the promise of the A2-CPA-CPB(-CTE-recombinant L. tarentolae as a safe live vaccine candidate against VL.

  2. Enzyme immunoassay for measurement of murine plasminogen activator inhibitor-1, employing a specific antibody produced by the DNA vaccine method.

    Science.gov (United States)

    Yamada, Takayuki; Takagi, Akira; Takeshita, Kyosuke; Yamamoto, Koji; Ito, Masafumi; Matsushita, Tadashi; Murate, Takashi; Saito, Hidehiko; Kojima, Tetsuhito

    2003-01-01

    We developed a sensitive immunoassay to determine the concentration of mouse plasminogen activator inhibitor-1. The assay was a non-competitive sandwich enzyme-linked immunosorbent assay (ELISA) based on the production of a specific polyclonal antibody against mouse plasminogen activator inhibitor type-1 (PAI-1) used both as a trapping and detecting antibody. This antibody was raised in a rabbit by direct introduction of the expression vector plasmid DNA encoding mouse PAI-1, instead of conventional immunization with the purified protein. The standard curve was constructed with a recombinant glutathione S-transferase (GST)-mouse PAI-1 fusion protein (GST-mPAI-1) and dose-response of the assay was linear for GST-mPAI-1 between 6.25 and 100 pM. In order to assess the consistency of the assay, we measured PAI-1 antigen in normal mouse pooled plasma several times. We found that the intra-assay and inter-assay coefficients of variation (CV) were 4.8% and 9.2%, respectively, indicating that the ELISA would be sufficiently repeatable and reproducible. In this assay, lipopolysaccharide (LPS)-injected mice showed substantially higher levels (22-fold) of plasma PAI-1 antigen than did control mice (12.5+/-2.4 vs. 0.58+/-0.16 nM), similar to results reported elsewhere. Taken together, the DNA vaccine method is extremely useful for preparing specific antibodies against mouse PAI-1, which can be utilized to establish the ELISA and analyze the profile of PAI-1 distributions in mice under various conditions. This approach might also be useful for immunological investigation of other coagulation factors and related proteins.

  3. Co-immunization with virus-like particle and DNA vaccines induces protection against respiratory syncytial virus infection and bronchiolitis

    Science.gov (United States)

    Hwang, Hye Suk; Kwon, Young-Man; Lee, Jong Seok; Yoo, Si-Eun; Lee, Yu-Na; Ko, Eun-Ju; Kim, Min-Chul; Cho, Min-Kyoung; Lee, Young-Tae; Jung, Yu-Jin; Lee, Ji-Yun; Li, Jian Dong; Kang, Sang-Moo

    2014-01-01

    This study demonstrates that immunization with non-replicating virus-like particle (FFG VLP) containing RSV F and G glycoproteins together with RSV F DNA induced T helper type 1 antibody responses to RSV F similar to live RSV infection. Upon RSV challenge 21 weeks after immunization, FFG VLP vaccination induced protection against RSV infection as shown by clearance of lung viral loads, and the absence of eosinophil infiltrates, and did not cause lung pathology. In contrast, formalin-inactivated RSV (FI-RSV) vaccination showed significant pulmonary eosinophilia, severe mucus production, and extensive histopathology resulting in a hallmark of pulmonary pathology. Substantial lung pathology was also observed in mice with RSV re-infections. High levels of systemic and local inflammatory cytokine-secreting cells were induced in mice with FI-RSV but not with FFG VLP immunization after RSV challenge. Therefore, the results provide evidence that recombinant RSV FFG VLP vaccine can confer long-term protection against RSV without causing lung pathology. PMID:25110201

  4. Evaluation of cytokine mRNA expression in vaccinated guinea pigs with foot-and-mouth disease type O inactivated vaccine

    Directory of Open Access Journals (Sweden)

    Pasandideh, R.

    2016-03-01

    Full Text Available Foot-and-mouth disease (FMD is a severely contagious viral disease that mainly affects cloven-hoofed livestock and wildlife. This study quantifies the cytokines mRNA expression of vaccinated guinea pigs with FMD type O inactivated vaccine. Blood samples were collected from eight guinea pigs at 7 and 28 days after the first vaccination. Extracted mRNAs were reverse-transcribed into cDNA and analyzed for quantification of IFN-γ, TNF-α and IL-10 expression using relative real-time PCR assay. Our results showed that all of the genes were upregulated. The expression of TNF-α and IL-10 genes significantly increased (P<0.05 in day 28th in comparison to the day 7th post the first vaccination. It can be concluded that the vaccine induced immune responses by increasing expression of the cytokines. Therefore, effects of DNA vaccines on immune system also may be evaluated using these genes.

  5. Co-administration of plasmid expressing IL-12 with 14-kDa Schistosoma mansoni fatty acid-binding protein cDNA alters immune response profiles and fails to enhance protection induced by Sm14 DNA vaccine alone.

    Science.gov (United States)

    Fonseca, Cristina T; Pacífico, Lucila G G; Barsante, Michele M; Rassi, Tatiana; Cassali, Geovanni D; Oliveira, Sérgio C

    2006-08-01

    Schistosomiasis is an endemic disease that affects 200 million people worldwide. DNA-based vaccine is a promising strategy to induce protective immunity against schistosomiasis, since both humoral and cellular immune responses are involved in parasite elimination. In this study, we evaluated the ability of Sm14 cDNA alone or in association with a plasmid expressing murine interleukin (IL)-12 to induce protection against challenge infection. Mice were immunized with four doses of the DNA vaccine and the levels of protection were determined by worm burden recovery after challenge infection. Specific antibody production to rSm14 was determined by ELISA, and cytokine production was measured in splenocyte culture supernatants stimulated with rSm14 and in bronchoalveolar lavage of vaccinated mice after challenge infection. DNA immunization with pCI/Sm14 alone induced 40.5% of worm reduction. However, the use of pCI/IL-12 as adjuvant to pCI/Sm14 immunization failed to enhance protection against challenge infection. Protection induced by pCI/Sm14 immunization correlates with specific IgG antibody production against Sm14, Th1 type of immune response with high levels of interferon (IFN)-gamma and low levels of IL-4 in splenocyte culture supernatants and in bronchoalveolar lavage after challenge infection. IL-12 co-administration with pCI/Sm14 induced a significant production of nitric oxide in splenocyte culture supernatants and also lymphocyte suppression, with reduced percentage of T cells producing IFN-gamma and tumor necrosis factor-alpha.

  6. Prime-boost vaccination with heterologous live vectors encoding SIV gag and multimeric HIV-1 gp160 protein: efficacy against repeated mucosal R5 clade C SHIV challenges.

    Science.gov (United States)

    Lakhashe, Samir K; Velu, Vijayakumar; Sciaranghella, Gaia; Siddappa, Nagadenahalli B; Dipasquale, Janet M; Hemashettar, Girish; Yoon, John K; Rasmussen, Robert A; Yang, Feng; Lee, Sandra J; Montefiori, David C; Novembre, Francis J; Villinger, François; Amara, Rama Rao; Kahn, Maria; Hu, Shiu-Lok; Li, Sufen; Li, Zhongxia; Frankel, Fred R; Robert-Guroff, Marjorie; Johnson, Welkin E; Lieberman, Judy; Ruprecht, Ruth M

    2011-08-05

    We sought to induce primate immunodeficiency virus-specific cellular and neutralizing antibody (nAb) responses in rhesus macaques (RM) through a bimodal vaccine approach. RM were immunized intragastrically (i.g.) with the live-attenuated Listeria monocytogenes (Lm) vector Lmdd-BdopSIVgag encoding SIVmac239 gag. SIV Gag-specific cellular responses were boosted by intranasal and intratracheal administration of replication-competent adenovirus (Ad5hr-SIVgag) encoding the same gag. To broaden antiviral immunity, the RM were immunized with multimeric HIV clade C (HIV-C) gp160 and HIV Tat. SIV Gag-specific cellular immune responses and HIV-1 nAb developed in some RM. The animals were challenged intrarectally with five low doses of R5 SHIV-1157ipEL-p, encoding a heterologous HIV-C Env (22.1% divergent to the Env immunogen). All five controls became viremic. One out of ten vaccinees was completely protected and another had low peak viremia. Sera from the completely and partially protected RM neutralized the challenge virus > 90%; these RM also had strong SIV Gag-specific proliferation of CD8⁺ T cells. Peak and area under the curve of plasma viremia (during acute phase) among vaccinees was lower than for controls, but did not attain significance. The completely protected RM showed persistently low numbers of the α4β7-expressing CD4⁺ T cells; the latter have been implicated as preferential virus targets in vivo. Thus, vaccine-induced immune responses and relatively lower numbers of potential target cells were associated with protection. Copyright © 2011 Elsevier Ltd. All rights reserved.

  7. Construction of a trivalent candidate vaccine against Shigella species with DNA recombination

    Institute of Scientific and Technical Information of China (English)

    王恒樑; 冯尔玲; 林云; 廖翔; 金明; 黄留玉; 苏国富; 黄翠芬

    2002-01-01

    In this work asd gene of Shigella flexneri 2a strain T32 was replaced by Vibrio cholerae toxin B subunit (ctxB) gene with DNA recombination in vivo and in vitro. The resulting derivative of T32, designed as FWL01, could stably express CtxB, but its growth in LB medium depended on the presence of diaminopimelic acid (DAP). Then form I plasmid of Shigella sonnei strain S7 was labeled with strain T32 asd gene and mobilized into FWL01. Thus a trivalent candidate oral vaccine strain, designed as FSW01, was constructed. In this candidate strain, a balanced-lethal system was constituted between the host strain and the form I plasmid expressing S. sonnei O antigen. Therefore the candidate strain can express stably not only its own O antigen but also CtxB and O antigen of S. sonnei in the absence of any antibiotic. Experiments showed that FSW01 did not invade HeLa cells or cause keratoconjunctivitis in guinea pigs. However, rabbits immunized FSW01 can elicit significant immune responses. In mice and rhesus monkey models, vaccinated animals were protected against the challenges of wild S. flexneri 2a strain 2457T and S. sonnei strain S9.

  8. Isolation and sequence of cDNA encoding a cytochrome P-450 from an insecticide-resistant strain of the house fly, Musca domestica.

    OpenAIRE

    Feyereisen, R; Koener, J F; Farnsworth, D E; Nebert, D W

    1989-01-01

    A cDNA expression library from phenobarbital-treated house fly (Musca domestica) was screened with rabbit antisera directed against partially purified house fly cytochrome P-450. Two overlapping clones with insert lengths of 1.3 and 1.5 kilobases were isolated. The sequence of a 1629-base-pair (bp) cDNA was obtained, with an open reading frame (nucleotides 81-1610) encoding a P-450 protein of 509 residues (Mr = 58,738). The insect P-450 protein contains a hydrophobic NH2 terminus and a 22-res...

  9. Immune protection of nonhuman primates against Ebola virus with single low-dose adenovirus vectors encoding modified GPs.

    Directory of Open Access Journals (Sweden)

    Nancy J Sullivan

    2006-06-01

    Full Text Available Ebola virus causes a hemorrhagic fever syndrome that is associated with high mortality in humans. In the absence of effective therapies for Ebola virus infection, the development of a vaccine becomes an important strategy to contain outbreaks. Immunization with DNA and/or replication-defective adenoviral vectors (rAd encoding the Ebola glycoprotein (GP and nucleoprotein (NP has been previously shown to confer specific protective immunity in nonhuman primates. GP can exert cytopathic effects on transfected cells in vitro, and multiple GP forms have been identified in nature, raising the question of which would be optimal for a human vaccine.To address this question, we have explored the efficacy of mutant GPs from multiple Ebola virus strains with reduced in vitro cytopathicity and analyzed their protective effects in the primate challenge model, with or without NP. Deletion of the GP transmembrane domain eliminated in vitro cytopathicity but reduced its protective efficacy by at least one order of magnitude. In contrast, a point mutation was identified that abolished this cytopathicity but retained immunogenicity and conferred immune protection in the absence of NP. The minimal effective rAd dose was established at 10(10 particles, two logs lower than that used previously.Expression of specific GPs alone vectored by rAd are sufficient to confer protection against lethal challenge in a relevant nonhuman primate model. Elimination of NP from the vaccine and dose reductions to 10(10 rAd particles do not diminish protection and simplify the vaccine, providing the basis for selection of a human vaccine candidate.

  10. Immune Protection of Nonhuman Primates against Ebola Virus with Single Low-Dose Adenovirus Vectors Encoding Modified GPs

    Science.gov (United States)

    Geisbert, Joan B; Shedlock, Devon J; Xu, Ling; Lamoreaux, Laurie; Custers, Jerome H. H. V; Popernack, Paul M; Yang, Zhi-Yong; Pau, Maria G; Roederer, Mario; Koup, Richard A; Goudsmit, Jaap; Jahrling, Peter B; Nabel, Gary J

    2006-01-01

    Background Ebola virus causes a hemorrhagic fever syndrome that is associated with high mortality in humans. In the absence of effective therapies for Ebola virus infection, the development of a vaccine becomes an important strategy to contain outbreaks. Immunization with DNA and/or replication-defective adenoviral vectors (rAd) encoding the Ebola glycoprotein (GP) and nucleoprotein (NP) has been previously shown to confer specific protective immunity in nonhuman primates. GP can exert cytopathic effects on transfected cells in vitro, and multiple GP forms have been identified in nature, raising the question of which would be optimal for a human vaccine. Methods and Findings To address this question, we have explored the efficacy of mutant GPs from multiple Ebola virus strains with reduced in vitro cytopathicity and analyzed their protective effects in the primate challenge model, with or without NP. Deletion of the GP transmembrane domain eliminated in vitro cytopathicity but reduced its protective efficacy by at least one order of magnitude. In contrast, a point mutation was identified that abolished this cytopathicity but retained immunogenicity and conferred immune protection in the absence of NP. The minimal effective rAd dose was established at 1010 particles, two logs lower than that used previously. Conclusions Expression of specific GPs alone vectored by rAd are sufficient to confer protection against lethal challenge in a relevant nonhuman primate model. Elimination of NP from the vaccine and dose reductions to 1010 rAd particles do not diminish protection and simplify the vaccine, providing the basis for selection of a human vaccine candidate. PMID:16683867

  11. Assessment of Radiation-Attenuated Vaccine or Thyme Oil Treatment on Controlling DNA Damage and Nitric Oxide Synthesis in Brain of Rat Infected with Toxocara canis

    International Nuclear Information System (INIS)

    Amin, M.M.; Hafez, E.N.; Abd Raboo, M.A.

    2016-01-01

    Toxocara canis is a worldwide zoonotic roundworm that infects a number of hosts including humans. It exhibits marked affinity to the nervous tissues. This study deals with the changes in the brain of Toxocara canis infected rats regarding parasitological, nitric oxide (NO) level and DNA damage compared to the effect of vaccination with gamma radiation-attenuated embryonated egg or thyme oil treatment. Eighty rats were classified into four groups (twenty each): GI (normal control); GII infected with 2500 T. canis infective eggs/ml/rat (infected control); GIII vaccinated with 800 Gy gamma-attenuated embryonated eggs (vaccinated group) and GIV infected with 2500 T. canis eggs and treated with thyme oil (thyme treated group). At the 14th day post-infection, ten rats from each group were sacrificed and the remaining were re-infected (challenged) with the same number of eggs. At the 14th days post challenge, brain tissues were taken for larval recovery, nitric oxide level evaluation and DNA damage using fragmentation and comet assay. The results exhibited a significant decrease in larval count and nitric oxide level with less damage in brain cells in thyme treated and gamma radiation-attenuated vaccinated groups compared to control infected group. It is also, concluded that vaccination using γ- rays is more effective in protection compared to using thyme oil.

  12. Enhancing the Immunogenicity of a Tetravalent Dengue DNA Vaccine

    Science.gov (United States)

    2016-08-01

    season’s influenza vaccine. There is no overlap with the proposed project. Title: Serological survey for Zika virus and other vector-borne pathogen...studying human immunology and pathogenesis of dengue virus infection Time Commitments: 5% 0.6 calendar months Supporting Agency: Military Infectious...attenuated dengue virus vaccine (LAV), and (3) inactivated dengue virus vaccine. Dengue fever ranks among the top infectious diseases that afflict

  13. [A study on the construction, expression and immunosterility of Lagurus laguru zona pellucida 3 DNA vaccine pVAX1-sig-LTB-lZP3-C3d3].

    Science.gov (United States)

    Li, Chen-Chen; Yu, Ji-Yun; Jiang, Min; Tu, Yi-Xian; Ma, Xiao-Lin; Zhang, Fu-Chun

    2011-09-01

    To enhance the immunocontraceptive effect of Lagurus lagurus zona pellucida 3 DNA vaccine, and to achieve the prospect of application through the pVAX1-sig-LTB-lZP3-C3d3 different immunity pathway. Two adjuvant molecules were constructed into the recombinant plasmid pVAX1-sig-LTB-lZP3-C3d3 as DNA vaccine which contains Escherichia coli heat-labile enterotoxin B subunit and the molecular adjuvant 3 copies of C3d. The results of RT-PCR and western blot showed that the DNA vaccine was expressed in mRNA and protein level. The female C57BL/6 mice were immunized by three ways: intramuscular injection, intranasal or oral route.Antibody levels and types were detected by ELISA. ELISA results showed that recombinant plasmid pVAX1-sig-LTB-lZP3-C3d3 immunization induced specific IgG, IgA levels were significantly different comparing with control (Psig-LTB-lZP3-C3d3 can induce the specific immune response efficiently and enhance the immunocontraceptive effects.

  14. Clinical development of Ebola vaccines

    Science.gov (United States)

    Sridhar, Saranya

    2015-01-01

    The ongoing outbreak of Ebola virus disease in West Africa highlighted the lack of a licensed drug or vaccine to combat the disease and has renewed the urgency to develop a pipeline of Ebola vaccines. A number of different vaccine platforms are being developed by assessing preclinical efficacy in animal models and expediting clinical development. Over 15 different vaccines are in preclinical development and 8 vaccines are now in different stages of clinical evaluation. These vaccines include DNA vaccines, virus-like particles and viral vectors such as live replicating vesicular stomatitis virus (rVSV), human and chimpanzee adenovirus, and vaccinia virus. Recently, in preliminary results reported from the first phase III trial of an Ebola vaccine, the rVSV-vectored vaccine showed promising efficacy. This review charts this rapidly advancing area of research focusing on vaccines in clinical development and discusses the future opportunities and challenges faced in the licensure and deployment of Ebola vaccines. PMID:26668751

  15. DNA vaccination for cervical cancer: Strategic optimisation of RALA mediated gene delivery from a biodegradable microneedle system.

    Science.gov (United States)

    Cole, Grace; Ali, Ahlam A; McCrudden, Cian M; McBride, John W; McCaffrey, Joanne; Robson, Tracy; Kett, Vicky L; Dunne, Nicholas J; Donnelly, Ryan F; McCarthy, Helen O

    2018-03-03

    Dissolvable microneedles can be employed to deliver DNA to antigen presenting cells within the skin. However, this technology faces two main challenges: the poor transfection efficacy of pDNA following release from the microneedle matrix, and the limited loading capacity of the micron-scale devices. Two-tier delivery systems combining microneedle platforms and DNA delivery vectors have increased efficacy but the challenge of increasing the loading capacity remains. This study utilised lyophilisation to increase the loading of RALA/pDNA nanoparticles within dissolvable PVA microneedles. As a result, delivery was significantly enhanced in vivo into an appropriate range for DNA vaccination (∼50 μg per array). Furthermore, modifying the manufacturing process was not detrimental to the microneedle mechanical properties or cargo functionality. It was demonstrated that arrays retained mechanical and functional stability over short term storage, and were able to elicit gene expression in vitro and in vivo. Finally, treatment with this novel formulation significantly retarded the growth of established tumours, and proved superior to standard intramuscular injection in a preclinical model of cervical cancer. Copyright © 2018. Published by Elsevier B.V.

  16. The ada operon of Mycobacterium tuberculosis encodes two DNA methyltransferases for inducible repair of DNA alkylation damage.

    Science.gov (United States)

    Yang, Mingyi; Aamodt, Randi M; Dalhus, Bjørn; Balasingham, Seetha; Helle, Ina; Andersen, Pernille; Tønjum, Tone; Alseth, Ingrun; Rognes, Torbjørn; Bjørås, Magnar

    2011-06-10

    The ada operon of Mycobacterium tuberculosis, which encodes a composite protein of AdaA and AlkA and a separate AdaB/Ogt protein, was characterized. M. tuberculosis treated with N-methyl-N'-nitro-N-nitrosoguanidine induced transcription of the adaA-alkA and adaB genes, suggesting that M. tuberculosis mount an inducible response to methylating agents. Survival assays of the methyltransferase defective Escherichia coli mutant KT233 (ada ogt), showed that expression of the adaB gene rescued the alkylation sensitivity. Further, adaB but not adaA-alkA complemented the hypermutator phenotype of KT233. Purified AdaA-AlkA and AdaB possessed methyltransferase activity. These data suggested that AdaB counteract the cytotoxic and mutagenic effect of O(6)-methylguanine, while AdaA-AlkA most likely transfers methyl groups from innocuous methylphosphotriesters. AdaA-AlkA did not possess alkylbase DNA glycosylase activity nor rescue the alkylation sensitivity of the E. coli mutant BK2118 (tag alkA). We propose that AdaA-AlkA is a positive regulator of the adaptive response in M. tuberculosis. It thus appears that the ada operon of M. tuberculosis suppresses the mutagenic effect of alkylation but not the cytotoxic effect of lesions such as 3-methylpurines. Collectively, these data indicate that M. tuberculosis hypermutator strains with defective adaptive response genes might sustain robustness to cytotoxic alkylation DNA damage and confer a selective advantage contributing to host adaptation. Copyright © 2011 Elsevier B.V. All rights reserved.

  17. HIV vaccines: new frontiers in vaccine development.

    Science.gov (United States)

    Duerr, Ann; Wasserheit, Judith N; Corey, Lawrence

    2006-08-15

    A human immunodeficiency virus (HIV) vaccine is the most promising and feasible strategy to prevent the events during acute infection that simultaneously set the course of the epidemic in the community and the course of the disease for the individual. Because safety concerns limit the use of live, attenuated HIV and inactivated HIV, a variety of alternate approaches is being investigated. Traditional antibody-mediated approaches using recombinant HIV envelope proteins have shown no efficacy in 2 phase III trials. Current HIV vaccine trials are focusing primarily on cytotoxic T lymphocyte-mediated products that use viral vectors, either alone or as boosts to DNA plasmids that contain viral genes. The most immunogenic of these products appear to be the recombinant adenovirus vector vaccines, 2 of which are now in advanced clinical development.

  18. [Effects of cell-mediated immunity induced by intramuscular chitosan-pJME/ GM-CSF nano-DNA vaccine in BAlb/c mice].

    Science.gov (United States)

    Zhai, Yong-Zhen; Zhou, Yan; Ma, Li; Feng, Guo-He

    2014-07-01

    This study aimed to investigate the immune adjuvant effect and mechanism induced by chitosan nanoparticles carrying pJME/GM-CSF. In this study, plasmid DNA (pJME/GM-CSF) was encapsulated in chitosan to prepare chitosan-pJME/GM-CSF nanoparticles using a complex coacervation process. Immunohistochemistry was used to detect the type of infiltrating cells at the site of intramuscular injection. The phenotype and functional changes of splenic DCs were measured by flow cytometry after different immunogens were injected intramuscularly. The killing activity of CTLs was assessed using the lactate dehydrogenase (LDH) release assay. The preparation of chitosan-pJME/GM-CSF nanoparticles matched the expected theoretical results. Our results also found that, after pJME/GM-CSF injection, the incoming cells were a mixture of macrophages, neutrophils, and immature DCs. Meanwhile, pJME/GM-CSF increased the expression of MHC class II molecules on splenic DCs, and enhanced their Ag capture and presentation functions. Cell-mediated immunity was induced by the vaccine. Furthermore, chitosan-pJME/GM-CSF nanoparticles outperformed the administration of standard pJME/GM-CSF in terms of DC recruitment, antigen processing and presentation, and vaccine enhancement. These findings reveal that chitosan could be used as delivery vector for DNA vaccine intramuscular immunizations, and enhance pJME/GM-CSF-induced cellular immune responses.

  19. Characterization of the cDNA encoding a BPI/LBP homologue in venom gland of the hundred-pace snake Deinagkistrodon acutus

    Directory of Open Access Journals (Sweden)

    Jianrao HU, Mingfu CAO, Jiong Chen

    2009-10-01

    Full Text Available Bactericidal/permeability-increasing protein (BPI and LPS-binding protein (LBP play an important role in host defence. Current evidence shows that BPI/LBP may be widely existed in different cells and tissue types of animals. A full-length cDNA clone encoding a BPI/LBP homologue (dBPI, 1757bp in size, was characterized in venom gland of the hundred-pace snake Deinagkistrodon acutus. Its deduced amino acid sequence of 417 residues had 13.8%–21.5% identity to BPI like 1(BPIL1 and BPI like 3(BPIL3 of other animals. Conserved cysteine residues which are involved in disulfide bond formation between the final strand of the N-terminal beta sheet and the long alpha helix of BPI are identified as Cys146-Cys183 of dBPI. Phylogenetic tree analysis showed that the BPI/LBP homologues formed five large clusters and dBPI was in a large cluster including BPIL1 and BPIL3. dBPI mRNA shows a tissue specific expression in venom gland. This is the first study to identify the cDNA encoding BPI/LBP homologues from reptiles [Current Zoology 55 (5: –2009].

  20. Tipping the Proteome with Gene-Based Vaccines: Weighing in on the Role of Nano materials

    International Nuclear Information System (INIS)

    Flores, K.J.; Craig, M.; Smith, J.J.; DeLong, R.K.; Wanekaya, A.; Dong, L.

    2012-01-01

    Since the first generation of DNA vaccines was introduced in 1988, remarkable improvements have been made to improve their efficacy and immunogenicity. Although human clinical trials have shown that delivery of DNA vaccines is well tolerated and safe, the potency of these vaccines in humans is somewhat less than optimal. The development of a gene-based vaccine that was effective enough to be approved for clinical use in humans would be one of, if not the most important, advance in vaccines to date. This paper highlights the literature relating to gene-based vaccines, specifically DNA vaccines, and suggests possible approaches to boost their performance. In addition, we explore the idea that combining RNA and nano materials may hold the key to successful gene-based vaccines for prevention and treatment of disease