DEFF Research Database (Denmark)
Holst, Peter Johannes; Bassi, Maria Rosaria; Thomsen, Allan Randrup
2010-01-01
DNA vaccines are versatile and safe, but limited immunogenicity has prevented their use in the clinical setting. Experimentally, immunogenicity may be enhanced by the use of new delivery technologies, by coadministration of cytokines and pathogen-associated molecular patterns, or by fusion...... of antigens into molecular domains that enhance antigen presentation. More specifically, the immunogenicity of DNA vaccines may benefit from increased protein synthesis, increased T-cell help and MHC class I presentation, and the addition of a range of specific cytokines and pathogen-associated molecular...... with viral-vectored vaccines, various synergistic components may need to be incorporated into DNA vaccines. From the perspective of the future clinical use of DNA vaccines, it has been suggested that antigen presentation should be improved and cytokine coadministration attempted. However, even...
The future of human DNA vaccines.
Li, Lei; Saade, Fadi; Petrovsky, Nikolai
2012-12-31
DNA vaccines have evolved greatly over the last 20 years since their invention, but have yet to become a competitive alternative to conventional protein or carbohydrate based human vaccines. Whilst safety concerns were an initial barrier, the Achilles heel of DNA vaccines remains their poor immunogenicity when compared to protein vaccines. A wide variety of strategies have been developed to optimize DNA vaccine immunogenicity, including codon optimization, genetic adjuvants, electroporation and sophisticated prime-boost regimens, with each of these methods having its advantages and limitations. Whilst each of these methods has contributed to incremental improvements in DNA vaccine efficacy, more is still needed if human DNA vaccines are to succeed commercially. This review foresees a final breakthrough in human DNA vaccines will come from application of the latest cutting-edge technologies, including "epigenetics" and "omics" approaches, alongside traditional techniques to improve immunogenicity such as adjuvants and electroporation, thereby overcoming the current limitations of DNA vaccines in humans. Copyright © 2012 Elsevier B.V. All rights reserved.
Weiss, Walter R.; Kumar, Anita; Jiang, George; Williams, Jackie; Bostick, Anthony; Conteh, Solomon; Fryauff, David; Aguiar, Joao; Singh, Manmohan; O'Hagan, Derek T.; Ulmer, Jeffery B.; Richie, Thomas L.
2007-01-01
Background We have previously described a four antigen malaria vaccine consisting of DNA plasmids boosted by recombinant poxviruses which protects a high percentage of rhesus monkeys against Plasmodium knowlesi (Pk) malaria. This is a multi-stage vaccine that includes two pre-erythrocytic antigens, PkCSP and PkSSP2(TRAP), and two erythrocytic antigens, PkAMA-1 and PkMSP-1(42kD). The present study reports three further experiments where we investigate the effects of DNA dose, timing, and formulation. We also compare vaccines utilizing only the pre-erythrocytic antigens with the four antigen vaccine. Methodology In three experiments, rhesus monkeys were immunized with malaria vaccines using DNA plasmid injections followed by boosting with poxvirus vaccine. A variety of parameters were tested, including formulation of DNA on poly-lactic co-glycolide (PLG) particles, varying the number of DNA injections and the amount of DNA, varying the interval between the last DNA injection to the poxvirus boost from 7 to 21 weeks, and using vaccines with from one to four malaria antigens. Monkeys were challenged with Pk sporozoites given iv 2 to 4 weeks after the poxvirus injection, and parasitemia was measured by daily Giemsa stained blood films. Immune responses in venous blood samples taken after each vaccine injection were measured by ELIspot production of interferon-γ, and by ELISA. Conclusions 1) the number of DNA injections, the formulation of the DNA plasmids, and the interval between the last DNA injection and the poxvirus injection are critical to vaccine efficacy. However, the total dose used for DNA priming is not as important; 2) the blood stage antigens PkAMA-1 and PkMSP-1 were able to protect against high parasitemias as part of a genetic vaccine where antigen folding is not well defined; 3) immunization with PkSSP2 DNA inhibited immune responses to PkCSP DNA even when vaccinations were given into separate legs; and 4) in a counter-intuitive result, higher
DNA vaccines for aquacultured fish
DEFF Research Database (Denmark)
Lorenzen, Niels; LaPatra, S.E.
2005-01-01
of licensing and public acceptance of the technology. The potential benefits of DNA vaccines for farmed fish include improved animal welfare, reduced environmental impacts of aquaculture activities, increased food quality and quantity, and more sustainable production. Testing under commercial production......Deoxyribonucleic acid (DNA) vaccination is based on the administration of the gene encoding the vaccine antigen, rather than the antigen itself. Subsequent expression of the antigen by cells in the vaccinated hosts triggers the host immune system. Among the many experimental DNA vaccines tested...... in various animal species as well as in humans, the vaccines against rhabdovirus diseases in fish have given some of the most promising results. A single intramuscular (IM) injection of microgram amounts of DNA induces rapid and long-lasting protection in farmed salmonids against economically important...
Directory of Open Access Journals (Sweden)
Smita S. Iyer
2014-02-01
Full Text Available Since the initial proof-of-concept studies examining the ability of antigen-encoded plasmid DNA to serve as an immunogen, DNA vaccines have evolved as a clinically safe and effective platform for priming HIV-specific cellular and humoral responses in heterologous “prime-boost” vaccination regimens. Direct injection of plasmid DNA into the muscle induces T- and B-cell responses against foreign antigens. However, the insufficient magnitude of this response has led to the development of approaches for enhancing the immunogenicity of DNA vaccines. The last two decades have seen significant progress in the DNA-based vaccine platform with optimized plasmid constructs, improved delivery methods, such as electroporation, the use of molecular adjuvants and novel strategies combining DNA with viral vectors and subunit proteins. These innovations are paving the way for the clinical application of DNA-based HIV vaccines. Here, we review preclinical studies on the DNA-prime/modified vaccinia Ankara (MVA-boost vaccine modality for HIV. There is a great deal of interest in enhancing the immunogenicity of DNA by engineering DNA vaccines to co-express immune modulatory adjuvants. Some of these adjuvants have demonstrated encouraging results in preclinical and clinical studies, and these data will be examined, as well.
Indian Academy of Sciences (India)
diseases. Keywords. DNA vaccine, immune response, antibodies, infectious diseases. GENERAL .... tein vaccines require expensive virus/protein purification tech- niques as ... sphere continue to remain major health hazards in developing nations. ... significance since it can be produced at a very low cost and can be stored ...
Prior DNA vaccination does not interfere with the live-attenuated measles vaccine.
Premenko-Lanier, Mary; Rota, Paul; Rhodes, Gary; Bellini, William; McChesney, Michael
2004-01-26
The currently used live-attenuated measles vaccine is very effective although maternal antibody prevents its administration prior to 6 months of age. We are investigating the ability of a DNA vaccine encoding the measles viral hemagglutinin, fusion and nucleoprotein to protect newborn infants from measles. Here, we show that a measles DNA vaccine protects juvenile macaques from pathogenic measles virus challenge and that macaques primed and boosted with this DNA vaccine have anemnestic antibody and cell-mediated responses after vaccination with a live-attenuated canine distemper-measles vaccine. Therefore, this DNA vaccine administered to newborn infants may not hinder the subsequent use of live-attenuated measles vaccine.
Interference of an ERM-vaccine with a VHS-DNA vaccine in rainbow trout
DEFF Research Database (Denmark)
Lorenzen, Ellen; Einer-Jensen, Katja; Rasmussen, Jesper Skou
Simultaneous vaccination of fish against several diseases is often desirable in order to minimise cost and handling of the fish. Intramuscular DNA-vaccination of rainbow trout against viral haemorrhagic septicaemia virus (VHSV) has proved to provide very good protection. However, preliminary...... results showed that intraperitoneal injection of a commercial vaccine against Enteric Redmouth Disease (ERM) based on formalin-killed bacteria in oil adjuvant immediately followed by intramuscular injection of an experimental DNA-vaccine against VHSV, decreased the protective effect of the DNA......-vaccine against challenge with VHSV 11 weeks post vaccination (pv). This experiment was performed with rainbow trout of 30 g injected with 0.5 g VHS-DNA vaccine. The experiment was later repeated with smaller fish (2.5g) and using two different doses of DNA-vaccine, 1 g and 0.05 g. Both doses provided good...
Polymer multilayer tattooing for enhanced DNA vaccination
Demuth, Peter C.; Min, Younjin; Huang, Bonnie; Kramer, Joshua A.; Miller, Andrew D.; Barouch, Dan H.; Hammond, Paula T.; Irvine, Darrell J.
2013-04-01
DNA vaccines have many potential benefits but have failed to generate robust immune responses in humans. Recently, methods such as in vivo electroporation have demonstrated improved performance, but an optimal strategy for safe, reproducible, and pain-free DNA vaccination remains elusive. Here we report an approach for rapid implantation of vaccine-loaded polymer films carrying DNA, immune-stimulatory RNA, and biodegradable polycations into the immune-cell-rich epidermis, using microneedles coated with releasable polyelectrolyte multilayers. Films transferred into the skin following brief microneedle application promoted local transfection and controlled the persistence of DNA and adjuvants in the skin from days to weeks, with kinetics determined by the film composition. These ‘multilayer tattoo’ DNA vaccines induced immune responses against a model HIV antigen comparable to electroporation in mice, enhanced memory T-cell generation, and elicited 140-fold higher gene expression in non-human primate skin than intradermal DNA injection, indicating the potential of this strategy for enhancing DNA vaccination.
Polymer multilayer tattooing for enhanced DNA vaccination
DeMuth, Peter C.; Min, Younjin; Huang, Bonnie; Kramer, Joshua A.; Miller, Andrew D.; Barouch, Dan H.; Hammond, Paula T.; Irvine, Darrell J.
2014-01-01
DNA vaccines have many potential benefits but have failed to generate robust immune responses in humans. Recently, methods such as in vivo electroporation have demonstrated improved performance, but an optimal strategy for safe, reproducible, and pain-free DNA vaccination remains elusive. Here we report an approach for rapid implantation of vaccine-loaded polymer films carrying DNA, immune-stimulatory RNA, and biodegradable polycations into the immune-cell-rich epidermis, using microneedles coated with releasable polyelectrolyte multilayers. Films transferred into the skin following brief microneedle application promoted local transfection and controlled the persistence of DNA and adjuvants in the skin from days to weeks, with kinetics determined by the film composition. These “multilayer tattoo” DNA vaccines induced immune responses against a model HIV antigen comparable to electroporation in mice, enhanced memory T-cell generation, and elicited 140-fold higher gene expression in non-human primate skin than intradermal DNA injection, indicating the potential of this strategy for enhancing DNA vaccination. PMID:23353628
Liao, Jing-Fong; Lee, Jin-Ching; Lin, Chun-Kuang; Wei, Kuo-Chen; Chen, Pin-Yuan; Yang, Hung-Wei
2017-01-01
The strong immunogenicity induction is the powerful weapon to prevent the virus infections. This study demonstrated that one-step synthesis of DNA polyplex vaccine in microneedle (MN) patches can induce high immunogenicity through intradermal vaccination and increase the vaccine stability for storage outside the cold chain. More negative charged DNA vaccine was entrapped into the needle region of MNs followed by DNA polyplex formation with branched polyethylenimine (bPEI) pre-coated in the cavities of polydimethylsiloxane (PDMS) molds that can deliver more DNA vaccine to immune-cell rich epidermis with high transfection efficiency. Our data in this study support the safety and immunogenicity of the MN-based vaccine; the MN patch delivery system induced an immune response 3.5-fold as strong as seen with conventional intramuscular administration; the DNA polyplex formulation provided excellent vaccine stability at high temperature (could be stored at 45ºC for at least 4 months); the DNA vaccine is expected to be manufactured at low cost and not generate sharps waste. We think this study is significant to public health because there is a pressing need for an effective vaccination in developing countries. PMID:28819449
Vaccination of carp against SVCV with an oral DNA vaccine or an insect cells-based subunit vaccine.
Embregts, C W E; Rigaudeau, D; Tacchi, L; Pijlman, G P; Kampers, L; Veselý, T; Pokorová, D; Boudinot, P; Wiegertjes, G F; Forlenza, M
2018-03-19
We recently reported on a successful vaccine for carp against SVCV based on the intramuscular injection of a DNA plasmid encoding the SVCV glycoprotein (SVCV-G). This shows that the intramuscular (i.m.) route of vaccination is suitable to trigger protective responses against SVCV, and that the SVCV G-protein is a suitable vaccine antigen. Yet, despite the general success of DNA vaccines, especially against fish rhabdoviruses, their practical implementation still faces legislative as well as consumer's acceptance concerns. Furthermore, the i.m. route of plasmid administration is not easily combined with most of the current vaccination regimes largely based on intraperitoneal or immersion vaccination. For this reason, in the current study we evaluated possible alternatives to a DNA-based i.m. injectable vaccine using the SVCV-G protein as the vaccine antigen. To this end, we tested two parallel approaches: the first based on the optimization of an alginate encapsulation method for oral delivery of DNA and protein antigens; the second based on the baculovirus recombinant expression of transmembrane SVCV-G protein in insect cells, administered as whole-cell subunit vaccine through the oral and injection route. In addition, in the case of the oral DNA vaccine, we also investigated the potential benefits of the mucosal adjuvants Escherichia coli lymphotoxin subunit B (LTB). Despite the use of various vaccine types, doses, regimes, and administration routes, no protection was observed, contrary to the full protection obtained with our reference i.m. DNA vaccine. The limited protection observed under the various conditions used in this study, the nature of the host, of the pathogen, the type of vaccine and encapsulation method, will therefore be discussed in details to provide an outlook for future vaccination strategies against SVCV. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.
DNA Vaccine Electroporation and Molecular Adjuvants
2016-03-16
Suschak and Schmaljohn DNA Vaccine Electroporation and Molecular Adjuvants 1 Abstract To date, there is no protective vaccine for Ebola virus...the formulation of DNA launched virus-like particles (VLP). In this case, the antigen is encoded in one DNA plasmid, while structural proteins are...Virol, 2010. 155(12): p. 2083-103. 2. Feldmann, H. and T.W. Geisbert, Ebola haemorrhagic fever. Lancet, 2011. 377(9768): p. 849-62. 3. Hart, M.K
Dahiya, Shyam S; Saini, Mohini; Kumar, Pankaj; Gupta, Praveen K
2012-10-01
A replicon-based DNA vaccine encoding VP2 gene of canine parvovirus (CPV) was developed by cloning CPV-VP2 gene into a replicon-based DNA vaccine vector (pAlpha). The characteristics of a replicon-based DNA vaccine like, self-amplification of transcripts and induction of apoptosis were analyzed in transfected mammalian cells. When the pAlpha-CPV-VP2 was injected intradermal as DNA-launched replicon-based DNA vaccine in dogs, it induced CPV-specific humoral and cell mediated immune responses. The virus neutralization antibody and lymphocyte proliferative responses were higher than conventional CPV DNA vaccine and commercial CPV vaccine. These results indicated that DNA-launched replicon-based CPV DNA vaccine was effective in inducing both CPV-specific humoral and cellular immune responses and can be considered as effective alternative to conventional CPV DNA vaccine and commercial CPV vaccine. Crown Copyright © 2012. Published by Elsevier India Pvt Ltd. All rights reserved.
Preclinical and clinical safety studies on DNA vaccines.
Schalk, Johanna A C; Mooi, Frits R; Berbers, Guy A M; Aerts, Leon A G J M van; Ovelgönne, Hans; Kimman, Tjeerd G
2007-01-01
DNA vaccines are based on the transfer of genetic material, encoding an antigen, to the cells of the vaccine recipient. Despite high expectations of DNA vaccines as a result of promising preclinical data their clinical utility remains unproven. However, much data is gathered in preclinical and
Formulation and delivery of dermal DNA vaccines
van den Berg, J.H.
2009-01-01
DNA vaccination is an appealing strategy of active vaccination, leading to the intracellular production of the encoding antigen which results in an efficient activation of an antigen specific immune response. Intradermal DNA tattooing was recently developed as a simple and robust method to induce
DEFF Research Database (Denmark)
LaPatra, S.E.; Corbeil, S.; Jones, G.R.
2001-01-01
A DNA vaccine against a fish rhabdovirus, infectious hematopoietic necrosis virus (IHNV), was shown to provide significant protection as soon as 4 d after intramuscular vaccination in 2 g rainbow trout (Oncorhynchus mykiss) held at 15 degreesC. Nearly complete protection was also observed at late......-protection against IHNV challenge for a transient period of time, whereas a rabies virus DNA vaccine was not protective. This indication of distinct early and late protective mechanisms was not dependent on DNA vaccine doses from 0.1 to 2.5 mug....
Development of DNA vaccines for fish
DEFF Research Database (Denmark)
Heppell, Joël; Lorenzen, Niels; Armstrong, Neil K.
1998-01-01
Disease control is one of the major concerns in the aquaculture industry. However, there are no vaccines available for the prevention of many piscine infectious diseases, especially those of viral and parasitic origin. DNA-based vaccination could circumvent several problems associated with tradit......Disease control is one of the major concerns in the aquaculture industry. However, there are no vaccines available for the prevention of many piscine infectious diseases, especially those of viral and parasitic origin. DNA-based vaccination could circumvent several problems associated...... with traditional methods of immunization, but little is known on its efficacy in fish. The luciferase and lacZ reporter genes were used to characterize expression of plasmid-encoded genes in rainbow trout and zebra fish injected intramuscularly. For a given dose of DNA, the luciferase activity was higher in fish...... than in mouse muscle. The enzyme activity in fish peaked with 1 μg of DNA and remained constant for over 12 weeks, but it was not limited to the injected muscle since luciferase activity was also detected in the gills. Thin sections of rainbow trout muscle injected with the lacZ reporter gene showed...
Lipopolysaccharide contamination in intradermal DNA vaccination : toxic impurity or adjuvant?
Berg, J.H. van den; Quaak, S.G.L.; Beijnen, J.H.; Hennink, W.E.; Storm, G.; Schumacher, T.N.; Haanen, J.B.A.G.; Nuijen, B.
Purpose: Lipopolysaccharides (LPS) are known both as potential adjuvants for vaccines and as toxic impurity in pharmaceutical preparations. The aim of this study was to assess the role of LPS in intradermal DNA vaccination administered by DNA tattooing. Method: Micewere vaccinated with a model DNA
Dunham, Stephen P; Bruce, Jennifer; Klein, Dieter; Flynn, J Norman; Golder, Matthew C; MacDonald, Susan; Jarrett, Oswald; Neil, James C
2006-11-30
Protection against feline immunodeficiency virus (FIV) has been achieved using a variety of vaccines notably whole inactivated virus (WIV) and DNA. However protection against more virulent isolates, typical of those encountered in natural infections, has been difficult to achieve. In an attempt to improve protection against virulent FIV(GL8), we combined both DNA and WIV vaccines in a "prime-boost" approach. Thirty cats were divided into four groups receiving vaccinations and one unvaccinated control group. Following viral challenge, two vaccinated animals, one receiving DNA alone and one the prime-boost vaccine remained free of viraemia, whilst all controls became viraemic. Animals vaccinated with WIV showed apparent early enhancement of infection at 2 weeks post challenge (pc) with higher plasma viral RNA loads than control animals or cats immunised with DNA alone. Despite this, animals vaccinated with WIV or DNA alone showed significantly lower proviral loads in peripheral blood mononuclear cells and mesenteric lymph node cells, whilst those receiving the DNA-WIV prime-boost vaccine showed significantly lower proviral loads in PBMC, than control animals, at 35 weeks pc. Therefore both DNA and WIV vaccines conferred limited protection against viral challenge but the combination of WIV and DNA in a prime-boost approach appeared to offer no significant advantage over either vaccine alone.
Immunogenicity of an HPV-16 L2 DNA vaccine
Hitzeroth, Inga I.; Passmore, Jo-Ann S.; Shephard, Enid; Stewart, Debbie; Müller, Martin; Williamson, Anna-Lise; Rybicki, Edward P.; Kast, W. Martin
2009-01-01
The ability to elicit cross-neutralizing antibodies makes human papillomavirus (HPV) L2 capsid protein a possible HPV vaccine. We examined and compared the humoral response of mice immunised with a HPV-16 L2 DNA vaccine or with HPV-16 L2 protein. The L2 DNA vaccine elicited a non-neutralising antibody response unlike the L2 protein. L2 DNA vaccination suppressed the growth of L2-expressing C3 tumor cells, which is a T cell mediated effect, demonstrating that the lack of non-neutralizing antibody induction by L2 DNA was not caused by lack of T cell immunogenicity of the construct. PMID:19559114
Directory of Open Access Journals (Sweden)
Yingying Xu
2014-07-01
Full Text Available Intranasal delivery of DNA vaccines has become a popular research area recently. It offers some distinguished advantages over parenteral and other routes of vaccine administration. Nasal mucosa as site of vaccine administration can stimulate respiratory mucosal immunity by interacting with the nasopharyngeal-associated lymphoid tissues (NALT. Different kinds of DNA vaccines are investigated to provide protection against respiratory infectious diseases including tuberculosis, coronavirus, influenza and respiratory syncytial virus (RSV etc. DNA vaccines have several attractive development potential, such as producing cross-protection towards different virus subtypes, enabling the possibility of mass manufacture in a relatively short time and a better safety profile. The biggest obstacle to DNA vaccines is low immunogenicity. One of the approaches to enhance the efficacy of DNA vaccine is to improve DNA delivery efficiency. This review provides insight on the development of intranasal DNA vaccine for respiratory infections, with special attention paid to the strategies to improve the delivery of DNA vaccines using non-viral delivery agents.
Next generation sequencing of DNA-launched Chikungunya vaccine virus
Energy Technology Data Exchange (ETDEWEB)
Hidajat, Rachmat; Nickols, Brian [Medigen, Inc., 8420 Gas House Pike, Suite S, Frederick, MD 21701 (United States); Forrester, Naomi [Institute for Human Infections and Immunity, Sealy Center for Vaccine Development and Department of Pathology, University of Texas Medical Branch, GNL, 301 University Blvd., Galveston, TX 77555 (United States); Tretyakova, Irina [Medigen, Inc., 8420 Gas House Pike, Suite S, Frederick, MD 21701 (United States); Weaver, Scott [Institute for Human Infections and Immunity, Sealy Center for Vaccine Development and Department of Pathology, University of Texas Medical Branch, GNL, 301 University Blvd., Galveston, TX 77555 (United States); Pushko, Peter, E-mail: ppushko@medigen-usa.com [Medigen, Inc., 8420 Gas House Pike, Suite S, Frederick, MD 21701 (United States)
2016-03-15
Chikungunya virus (CHIKV) represents a pandemic threat with no approved vaccine available. Recently, we described a novel vaccination strategy based on iDNA® infectious clone designed to launch a live-attenuated CHIKV vaccine from plasmid DNA in vitro or in vivo. As a proof of concept, we prepared iDNA plasmid pCHIKV-7 encoding the full-length cDNA of the 181/25 vaccine. The DNA-launched CHIKV-7 virus was prepared and compared to the 181/25 virus. Illumina HiSeq2000 sequencing revealed that with the exception of the 3′ untranslated region, CHIKV-7 viral RNA consistently showed a lower frequency of single-nucleotide polymorphisms than the 181/25 RNA including at the E2-12 and E2-82 residues previously identified as attenuating mutations. In the CHIKV-7, frequencies of reversions at E2-12 and E2-82 were 0.064% and 0.086%, while in the 181/25, frequencies were 0.179% and 0.133%, respectively. We conclude that the DNA-launched virus has a reduced probability of reversion mutations, thereby enhancing vaccine safety. - Highlights: • Chikungunya virus (CHIKV) is an emerging pandemic threat. • In vivo DNA-launched attenuated CHIKV is a novel vaccine technology. • DNA-launched virus was sequenced using HiSeq2000 and compared to the 181/25 virus. • DNA-launched virus has lower frequency of SNPs at E2-12 and E2-82 attenuation loci.
Next generation sequencing of DNA-launched Chikungunya vaccine virus
International Nuclear Information System (INIS)
Hidajat, Rachmat; Nickols, Brian; Forrester, Naomi; Tretyakova, Irina; Weaver, Scott; Pushko, Peter
2016-01-01
Chikungunya virus (CHIKV) represents a pandemic threat with no approved vaccine available. Recently, we described a novel vaccination strategy based on iDNA® infectious clone designed to launch a live-attenuated CHIKV vaccine from plasmid DNA in vitro or in vivo. As a proof of concept, we prepared iDNA plasmid pCHIKV-7 encoding the full-length cDNA of the 181/25 vaccine. The DNA-launched CHIKV-7 virus was prepared and compared to the 181/25 virus. Illumina HiSeq2000 sequencing revealed that with the exception of the 3′ untranslated region, CHIKV-7 viral RNA consistently showed a lower frequency of single-nucleotide polymorphisms than the 181/25 RNA including at the E2-12 and E2-82 residues previously identified as attenuating mutations. In the CHIKV-7, frequencies of reversions at E2-12 and E2-82 were 0.064% and 0.086%, while in the 181/25, frequencies were 0.179% and 0.133%, respectively. We conclude that the DNA-launched virus has a reduced probability of reversion mutations, thereby enhancing vaccine safety. - Highlights: • Chikungunya virus (CHIKV) is an emerging pandemic threat. • In vivo DNA-launched attenuated CHIKV is a novel vaccine technology. • DNA-launched virus was sequenced using HiSeq2000 and compared to the 181/25 virus. • DNA-launched virus has lower frequency of SNPs at E2-12 and E2-82 attenuation loci.
Construction and analysis of experimental DNA vaccines against megalocytivirus.
Zhang, Min; Hu, Yong-Hua; Xiao, Zhi-Zhong; Sun, Yun; Sun, Li
2012-11-01
Iridoviruses are large double-stranded DNA viruses with icosahedral capsid. The Iridoviridae family contains five genera, one of which is Megalocytivirus. Megalocytivirus has emerged in recent years as an important pathogen to a wide range of marine and freshwater fish. In this study, we aimed at developing effective genetic vaccines against megalocytivirus affecting farmed fish in China. For this purpose, we constructed seven DNA vaccines based on seven genes of rock bream iridovirus isolate 1 from China (RBIV-C1), a megalocytivirus with a host range that includes Japanese flounder (Paralichthys olivaceus) and turbot (Scophthalmus maximus). The protective potentials of these vaccines were examined in a turbot model. The results showed that after vaccination via intramuscular injection, the vaccine plasmids were distributed in spleen, kidney, muscle, and liver, and transcription of the vaccine genes and production of the vaccine proteins were detected in these tissues. Following challenge with a lethal-dose of RBIV-C1, fish vaccinated with four of the seven DNA vaccines exhibited significantly higher levels of survival compared to control fish. Of these four protective DNA vaccines, pCN86, which is a plasmid that expresses an 86-residue viral protein, induced the highest protection. Immunological analysis showed that pCN86 was able to (i) stimulate the respiratory burst of head kidney macrophages at 14 d, 21 d, and 28 d post-vaccination, (ii) upregulate the expression of immune relevant genes involved in innate and adaptive immunity, and (iii) induce production of serum antibodies that, when incubated with RBIV-C1 before infection, significantly reduced viral loads in kidney and spleen following viral infection of turbot. Taken together, these results indicate that pCN86 is an effective DNA vaccine that may be used in the control of megalocytivirus-associated diseases in aquaculture. Copyright © 2012 Elsevier Ltd. All rights reserved.
Rapid outer-surface protein C DNA tattoo vaccination protects against Borrelia afzelii infection.
Wagemakers, A; Mason, L M K; Oei, A; de Wever, B; van der Poll, T; Bins, A D; Hovius, J W R
2014-12-01
Borrelia afzelii is the predominant Borrelia species causing Lyme borreliosis in Europe. Currently there is no human vaccine against Lyme borreliosis, and most research focuses on recombinant protein vaccines against Borrelia burgdorferi sensu stricto. DNA tattooing is a novel vaccination method that can be applied in a rapid vaccination schedule. We vaccinated C3H/HeN mice with B. afzelii strain PKo OspC (outer-surface protein C) using a codon-optimized DNA vaccine tattoo and compared this with recombinant protein vaccination in a 0-2-4 week vaccination schedule. We also assessed protection by DNA tattoo in a 0-3-6 day schedule. DNA tattoo and recombinant OspC vaccination induced comparable total IgG responses, with a lower IgG1/IgG2a ratio after DNA tattoo. Two weeks after syringe-challenge with 5 × 10(5) B. afzelii spirochetes most vaccinated mice had negative B. afzelii tissue DNA loads and all were culture negative. Furthermore, DNA tattoo vaccination in a 0-3-6 day regimen also resulted in negative Borrelia loads and cultures after challenge. To conclude, DNA vaccination by tattoo was fully protective against B. afzelii challenge in mice in a rapid vaccination protocol, and induces a favorable humoral immunity compared to recombinant protein vaccination. Rapid DNA tattoo is a promising vaccination strategy against spirochetes.
Phase 1 study of pandemic H1 DNA vaccine in healthy adults.
Directory of Open Access Journals (Sweden)
Michelle C Crank
Full Text Available A novel, swine-origin influenza A (H1N1 virus was detected worldwide in April 2009, and the World Health Organization (WHO declared a global pandemic that June. DNA vaccine priming improves responses to inactivated influenza vaccines. We describe the rapid production and clinical evaluation of a DNA vaccine encoding the hemagglutinin protein of the 2009 pandemic A/California/04/2009(H1N1 influenza virus, accomplished nearly two months faster than production of A/California/07/2009(H1N1 licensed monovalent inactivated vaccine (MIV.20 subjects received three H1 DNA vaccinations (4 mg intramuscularly with Biojector at 4-week intervals. Eighteen subjects received an optional boost when the licensed H1N1 MIV became available. The interval between the third H1 DNA injection and MIV boost was 3-17 weeks. Vaccine safety was assessed by clinical observation, laboratory parameters, and 7-day solicited reactogenicity. Antibody responses were assessed by ELISA, HAI and neutralization assays, and T cell responses by ELISpot and flow cytometry.Vaccinations were safe and well-tolerated. As evaluated by HAI, 6/20 developed positive responses at 4 weeks after third DNA injection and 13/18 at 4 weeks after MIV boost. Similar results were detected in neutralization assays. T cell responses were detected after DNA and MIV. The antibody responses were significantly amplified by the MIV boost, however, the boost did not increased T cell responses induced by DNA vaccine.H1 DNA vaccine was produced quickly, was well-tolerated, and had modest immunogenicity as a single agent. Other HA DNA prime-MIV boost regimens utilizing one DNA prime vaccination and longer boost intervals have shown significant immunogenicity. Rapid and large-scale production of HA DNA vaccines has the potential to contribute to an efficient response against future influenza pandemics.Clinicaltrials.gov NCT00973895.
A multilateral effort to develop DNA vaccines against falciparum malaria.
Kumar, Sanjai; Epstein, Judith E; Richie, Thomas L; Nkrumah, Francis K; Soisson, Lorraine; Carucci, Daniel J; Hoffman, Stephen L
2002-03-01
Scientists from several organizations worldwide are working together to develop a multistage, multigene DNA-based vaccine against Plasmodium falciparum malaria. This collaborative vaccine development effort is named Multi-Stage DNA-based Malaria Vaccine Operation. An advisory board of international experts in vaccinology, malariology and field trials provides the scientific oversight to support the operation. This article discusses the rationale for the approach, underlying concepts and the pre-clinical development process, and provides a brief outline of the plans for the clinical testing of a multistage, multiantigen malaria vaccine based on DNA plasmid immunization technology.
Multivalent human papillomavirus l1 DNA vaccination utilizing electroporation.
Directory of Open Access Journals (Sweden)
Kihyuck Kwak
Full Text Available Naked DNA vaccines can be manufactured simply and are stable at ambient temperature, but require improved delivery technologies to boost immunogenicity. Here we explore in vivo electroporation for multivalent codon-optimized human papillomavirus (HPV L1 and L2 DNA vaccination.Balb/c mice were vaccinated three times at two week intervals with a fusion protein comprising L2 residues ∼11-88 of 8 different HPV types (11-88×8 or its DNA expression vector, DNA constructs expressing L1 only or L1+L2 of a single HPV type, or as a mixture of several high-risk HPV types and administered utilizing electroporation, i.m. injection or gene gun. Serum was collected two weeks and 3 months after the last vaccination. Sera from immunized mice were tested for in-vitro neutralization titer, and protective efficacy upon passive transfer to naive mice and vaginal HPV challenge. Heterotypic interactions between L1 proteins of HPV6, HPV16 and HPV18 in 293TT cells were tested by co-precipitation using type-specific monoclonal antibodies.Electroporation with L2 multimer DNA did not elicit detectable antibody titer, whereas DNA expressing L1 or L1+L2 induced L1-specific, type-restricted neutralizing antibodies, with titers approaching those induced by Gardasil. Co-expression of L2 neither augmented L1-specific responses nor induced L2-specific antibodies. Delivery of HPV L1 DNA via in vivo electroporation produces a stronger antibody response compared to i.m. injection or i.d. ballistic delivery via gene gun. Reduced neutralizing antibody titers were observed for certain types when vaccinating with a mixture of L1 (or L1+L2 vectors of multiple HPV types, likely resulting from heterotypic L1 interactions observed in co-immunoprecipitation studies. High titers were restored by vaccinating with individual constructs at different sites, or partially recovered by co-expression of L2, such that durable protective antibody titers were achieved for each type
The past, current and future trends in DNA vaccine immunisations
Directory of Open Access Journals (Sweden)
Sidgi Syed Anwer Abdo Hasson
2015-05-01
Full Text Available This review focuses on DNA vaccines, denoting the last two decades since the early substantiation of preclinical protection was published in Science in 1993 by Ulmer et al. In spite of being safely administered and easily engineered and manufactured DNA vaccine, it holds the future prospects of immunization by inducing potent cellular immune responses against infectious and non-infectious diseases. It is well documented that injection of DNA plasmid encoding a desired gene of interest can result in the subsequent expression of its products and lead to the induction of an immune response within a host. This is pertinent to prophylactic and therapeutic vaccination approach when the peculiar gene produces a protective epitope from a pathogen. The recent studies demonstrated by a number of research centers showed that these immune responses evoke protective immunity against several infectious diseases and cancers, which provides adequate support for the use of this approach. We attempt in this review to provide an informative and unbiased overview of the general principles and concept of DNA vaccines technology with a summary of a novel approach to the DNA vaccine, present investigations that describe the mechanism(s of protective immunity provoked by DNA immunization and to highlight the advantages and disadvantages of DNA immunisation.
Production optimisation of a DNA vaccine candidate against ...
African Journals Online (AJOL)
Plasmid DNA (pDNA) vaccines are promising means to prevent and treat infectious diseases, such as leishmaniasis, but immunisation protocols require large amounts of supercoiled plasmid DNA (scpDNA). Although pDNA can be produced at a reasonable cost in bioreactors; this scale of production may not be the best ...
Immunisation against PCV2 structural protein by DNA vaccination of mice
DEFF Research Database (Denmark)
Kamstrup, Søren; Barfoed, Annette Malene; Frimann, Tine
2004-01-01
the capsid protein of PCV2 was cloned in a DNA vaccination plasmid and expression of capsid protein was demonstrated in vitro. Mice were gene gun vaccinated three timesand all mice responded serologically by raising antibodies against PCV2. The results suggest, that DNA based vaccination might offer...
Directory of Open Access Journals (Sweden)
Marilda Carlos Vidotto
2007-08-01
Full Text Available The vaccination with DNA is one of the most promising immunization techniques against a pathogens variety and tumors, for which the conventional methods have not been efficient. DNA vaccines are capable to induce immune humoral and cellular response, directed to lymphocytes CD4+ and CD8+, without the necessity of live microorganisms. In spite of the great potential of inducing protective immunity, the DNA vaccine not always has success. The immunity depends on several factors such as the selection of the target gene, construction of the expression vector, frequency and via of administration of the vaccine, amount of DNA, location of the antigen codified by the plasmid and age, health and species of vaccinated animals. This revision shows the development of some vaccines of DNA for diseases of interest in the veterinary and human medicine.A vacinação com DNA é uma das mais promissoras técnicas de imunização contra uma variedade de patógenos e tumores, para os quais os métodos convencionais não tem sido eficientes. Vacinas de DNA são capazes de induzir resposta imune humoral e celular, tanto para resposta de linfócitos CD4+ quanto CD8+, sem a necessidade de microrganismos vivos. Apesar do grande potencial de induzir imunidade protetora, a vacina de DNA nem sempre apresenta bons resultados. A imunidade depende de vários fatores como a seleção do gene alvo, construção do vetor de expressão, freqüência e via de administração da vacina, quantidade de DNA, localização do antígeno codificado pelo plasmídio e idade, saúde e espécies de animais vacinados. Esta revisão relata o desenvolvimento de algumas vacinas de DNA para doenças de interesse na medicina veterinária e humana.
Directory of Open Access Journals (Sweden)
Seyed Davoud Jazayeri
2012-01-01
Full Text Available Attenuated Salmonella has been used as a carrier for DNA vaccine. However, in vitro and in vivo studies on the bacteria following transfection of plasmid DNA were poorly studied. In this paper, eukaryotic expression plasmids encoding avian influenza virus (AIV subtype H5N1 genes, pcDNA3.1/HA, NA, and NP, were transfected into an attenuated Salmonella enteric typhimurium SV4089. In vitro stability of the transfected plasmids into Salmonella were over 90% after 100 generations. The attenuated Salmonella were able to invade MCF-7 (1.2% and MCF-10A (0.5% human breast cancer cells. Newly hatched specific-pathogen-free (SPF chicks were inoculated once by oral gavage with 109 colony-forming unit (CFU of the attenuated Salmonella. No abnormal clinical signs or deaths were recorded after inoculation. Viable bacteria were detected 3 days after inoculation by plating from spleen, liver, and cecum. Fluorescent in situ hybridization (FISH and polymerase chain reaction (PCR were carried out for confirmation. Salmonella was not detected in blood cultures although serum antibody immune responses to Salmonella O antiserum group D1 factor 1, 9, and 12 antigens were observed in all the inoculated chickens after 7 days up to 35 days. Our results showed that live attenuated S. typhimurium SV4089 harboring pcDNA3.1/HA, NA, and NP may provide a unique alternative as a carrier for DNA oral vaccine in chickens.
Production and pharmaceutical formulation of plasmid DNA vaccines
van der Heijden, I.
2013-01-01
Research leading to the thesis ‘Production and pharmaceutical formulation of plasmid DNA vaccines‘ can be divided into two parts. The first part describes the development of a Good Manufacturing Practice (GMP) compliant plasmid DNA production process of pDNA vaccines for the treatment of Human
Peng, Shiwen; Qiu, Jin; Yang, Andrew; Yang, Benjamin; Jeang, Jessica; Wang, Joshua W; Chang, Yung-Nien; Brayton, Cory; Roden, Richard B S; Hung, Chien-Fu; Wu, T-C
2016-01-01
Human papillomavirus (HPV) has been identified as the primary etiologic factor of cervical cancer as well as subsets of anogenital and oropharyngeal cancers. The two HPV viral oncoproteins, E6 and E7, are uniquely and consistently expressed in all HPV infected cells and are therefore promising targets for therapeutic vaccination. Both recombinant naked DNA and protein-based HPV vaccines have been demonstrated to elicit HPV-specific CD8+ T cell responses that provide therapeutic effects against HPV-associated tumor models. Here we examine the immunogenicity in a preclinical model of priming with HPV DNA vaccine followed by boosting with filterable aggregates of HPV 16 L2E6E7 fusion protein (TA-CIN). We observed that priming twice with an HPV DNA vaccine followed by a single TA-CIN booster immunization generated the strongest antigen-specific CD8+ T cell response compared to other prime-boost combinations tested in C57BL/6 mice, whether naïve or bearing the HPV16 E6/E7 transformed syngeneic tumor model, TC-1. We showed that the magnitude of antigen-specific CD8+ T cell response generated by the DNA vaccine prime, TA-CIN protein vaccine boost combinatorial strategy is dependent on the dose of TA-CIN protein vaccine. In addition, we found that a single booster immunization comprising intradermal or intramuscular administration of TA-CIN after priming twice with an HPV DNA vaccine generated a comparable boost to E7-specific CD8+ T cell responses. We also demonstrated that the immune responses elicited by the DNA vaccine prime, TA-CIN protein vaccine boost strategy translate into potent prophylactic and therapeutic antitumor effects. Finally, as seen for repeat TA-CIN protein vaccination, we showed that the heterologous DNA prime and protein boost vaccination strategy is well tolerated by mice. Our results provide rationale for future clinical testing of HPV DNA vaccine prime, TA-CIN protein vaccine boost immunization regimen for the control of HPV-associated diseases.
Frequency and persistency of DNA vaccine encoding GP25 by oral on common carp
Directory of Open Access Journals (Sweden)
Sri Nuryati
2015-05-01
Full Text Available ABSTRACT Koi herpesvirus (KHV is a major viral pathogen that infects common carp and koi. KHV disease outbreak is happened in almost all centre of common carp culture in Indonesia and caused mass mortality. Deoxyribonucleic acid (DNA vaccination method is one of ways to cope with KHV infection. Vaccines were commonly given by injection. The aim of this research was to get frequency and persistency of DNA vaccine encoding GP25 given by oral delivery method in common carp. This research would like to determine dose, frequency of vaccination, persistency of DNA vaccine and culture medium for the bacterial host. DNA vaccine persistency test was done by using polymerase chain reaction (PCR method with the specific primer for GP25 gene. The results showed that level of DNA vaccine that could be detected in feed was 7.56 ng (equal to 1.598×1010 copies. Efficient culture medium for Escherichia coli DH5α carrying DNA vaccine was LB triptone. Feeding fish with diet supplemented with 1 mL E. coli DH5α containing DNA vaccine for each fish and two times a week allowed persistence of DNA vaccine in kindney and spleen. Keywords: common carp, KHV, DNA vaccine, GP25, persistance ABSTRAK Koi herpesvirus (KHV adalah virus patogen utama yang menginfeksi ikan mas dan ikan koi. Wabah penyakit KHV terjadi di hampir semua sentra budidaya ikan mas di Indonesia dan menyebabkan kematian massal ikan. Metode vaksinasi DNA merupakan salah satu cara yang dapat dilakukan untuk menanggulangi serangan KHV. Pemberian vaksin umumnya dilakukan dengan cara injeksi. Tujuan penelitian ini adalah untuk menguji frekuensi dan persistensi vaksin DNA GP25 antivirus KHV yang diberikan melalui oral pada ikan mas. Pada penelitian ini dilakukan uji dosis, frekuensi pemberian vaksin, persistensi vaksin DNA, dan media kultur bakteri inang. Persistensi vaksin DNA dianalisis menggunakan metode PCR dengan primer spesifik gen GP25. Hasil penelitian menunjukkan bahwa dosis vaksin DNA yang
Trial watch: Naked and vectored DNA-based anticancer vaccines.
Bloy, Norma; Buqué, Aitziber; Aranda, Fernando; Castoldi, Francesca; Eggermont, Alexander; Cremer, Isabelle; Sautès-Fridman, Catherine; Fucikova, Jitka; Galon, Jérôme; Spisek, Radek; Tartour, Eric; Zitvogel, Laurence; Kroemer, Guido; Galluzzi, Lorenzo
2015-05-01
One type of anticancer vaccine relies on the administration of DNA constructs encoding one or multiple tumor-associated antigens (TAAs). The ultimate objective of these preparations, which can be naked or vectored by non-pathogenic viruses, bacteria or yeast cells, is to drive the synthesis of TAAs in the context of an immunostimulatory milieu, resulting in the (re-)elicitation of a tumor-targeting immune response. In spite of encouraging preclinical results, the clinical efficacy of DNA-based vaccines employed as standalone immunotherapeutic interventions in cancer patients appears to be limited. Thus, efforts are currently being devoted to the development of combinatorial regimens that allow DNA-based anticancer vaccines to elicit clinically relevant immune responses. Here, we discuss recent advances in the preclinical and clinical development of this therapeutic paradigm.
Directory of Open Access Journals (Sweden)
Srinivas Rao
Full Text Available Sustained outbreaks of highly pathogenic avian influenza (HPAI H5N1 in avian species increase the risk of reassortment and adaptation to humans. The ability to contain its spread in chickens would reduce this threat and help maintain the capacity for egg-based vaccine production. While vaccines offer the potential to control avian disease, a major concern of current vaccines is their potency and inability to protect against evolving avian influenza viruses.The ability of DNA vaccines encoding hemagglutinin (HA proteins from different HPAI H5N1 serotypes was evaluated for its ability to elicit neutralizing antibodies and to protect against homologous and heterologous HPAI H5N1 strain challenge in mice and chickens after DNA immunization by needle and syringe or with a pressure injection device. These vaccines elicited antibodies that neutralized multiple strains of HPAI H5N1 when given in combinations containing up to 10 HAs. The response was dose-dependent, and breadth was determined by the choice of the influenza virus HA in the vaccine. Monovalent and trivalent HA vaccines were tested first in mice and conferred protection against lethal H5N1 A/Vietnam/1203/2004 challenge 68 weeks after vaccination. In chickens, protection was observed against heterologous strains of HPAI H5N1 after vaccination with a trivalent H5 serotype DNA vaccine with doses as low as 5 microg DNA given twice either by intramuscular needle injection or with a needle-free device.DNA vaccines offer a generic approach to influenza virus immunization applicable to multiple animal species. In addition, the ability to substitute plasmids encoding different strains enables rapid adaptation of the vaccine to newly evolving field isolates.
Jin, Dong; Yu, Xin; Chen, Bing; Li, Zhitao; Ding, Jia; Zhao, Xiuyun; Qi, Gaofu
2017-06-01
Development of EGF and VEGF vaccines with high antigenicity for combined immunotherapy of EGF-EGFR signaling-dependent epithelial tumors such as breast cancer. EGF genes from mouse, human and chicken were randomly assembled to chimeric genes by DNA shuffling, then a chimeric EGF was selected out by PCR, SDS-PAGE and immunization for combined immunotherapy of breast cancer with a previously constructed chimeric VEGF vaccine from shuffling. Combined vaccination with chimeric EGF and VEGF from shuffling could induce high titer of antibodies against EGF and VEGF to inhibit tumor growth and angiogenesis, and improve the survival rate of mice with breast cancer. Combined vaccination with EGF and VEGF from shuffling showed better immunotherapy on EGF-EGFR signaling-dependent epithelial tumors such as breast cancer than the single-agent EGF vaccination.
Field testing of Schistosoma japonicum DNA vaccines in cattle in China.
Shi, Fuhui; Zhang, Yaobi; Lin, Jiaojiao; Zuo, Xin; Shen, Wei; Cai, Yiumin; Ye, Ping; Bickle, Quentin D; Taylor, Martin G
2002-11-01
Vaccines are needed to reduce the zoonotic reservoir of Schistosoma japonicum infection in bovines in China. We have developed two experimental DNA vaccines and have already shown these to be capable of inducing partial protection in water buffalo naturally exposed to the risk of S. japonicum infection in the field. We now report a similar field trial in cattle, the other major bovine reservoir host species in China. Groups of cattle were vaccinated with the VRSj28 vaccine or the VRSj23 vaccine, or, to test whether protection could be enhanced by combination vaccination, with both these DNA vaccines together. After vaccination, the cattle were exposed to natural infection in the field for a period of 54 days. Worm and egg counts carried out at the end of the experiment showed that each of the vaccine groups showed partial resistance, and that combined vaccination was not more effective than vaccination with the individual plasmids.
Kim, Yeu-Chun; Song, Jae-Min; Lipatov, Aleksandr S.; Choi, Seong-O; Lee, Jeong Woo; Donis, Ruben O.; Compans, Richard W.; Kang, Sang-Moo; Prausnitz, Mark R.
2012-01-01
Effective public health responses to an influenza pandemic require an effective vaccine that can be manufactured and administered to large populations in the shortest possible time. In this study, we evaluated a method for vaccination against avian influenza virus that uses a DNA vaccine for rapid manufacturing and delivered by a microneedle skin patch for simplified administration and increased immunogenicity. We prepared patches containing 700 µm-long microneedles coated with an avian H5 influenza hemagglutinin DNA vaccine from A/Viet Nam/1203/04 influenza virus. The coating DNA dose increased with DNA concentration in the coating solution and the number of dip coating cycles. Coated DNA was released into the skin tissue by dissolution within minutes. Vaccination of mice using microneedles induced higher levels of antibody responses and hemagglutination inhibition titers, and improved protection against lethal infection with avian influenza as compared to conventional intramuscular delivery of the same dose of the DNA vaccine. Additional analysis showed that the microneedle coating solution containing carboxymethylcellulose and a surfactant may have negatively affected the immunogenicity of the DNA vaccine. Overall, this study shows that DNA vaccine delivery by microneedles can be a promising approach for improved vaccination to mitigate an influenza pandemic. PMID:22504442
Song, Xiaokai; Ren, Zhe; Yan, Ruofeng; Xu, Lixin; Li, Xiangrui
2015-06-04
Avian coccidiosis is mostly caused by mixed infection of several Eimeria species under natural conditions and immunity to avian coccidiosis is largely dependent on T-cell immune response. In this study, 14 T-cell epitope fragments from eight antigens of Eimeria tenella (E. tenella), Eimeria necatrix (E. necatrix), Eimeria maxima (E. maxima) and Eimeria acervulina (E. acervulina) were ligated with pVAX1 producing 14 monovalent DNA vaccines, respectively. Protective immunity of the monovalent DNA vaccines was assessed by in vivo challenge experiments and then four most protective fragments of each species were chosen to construct multivalent epitope DNA vaccines with or without chicken IL-2 as genetic adjuvant. Protective efficacies of the epitope DNA vaccines on chickens against E. tenella, E. necatrix, E. maxima and E. acervulina were evaluated. The results showed that the constructed multivalent epitope DNA vaccines significantly increased body weight gain, alleviated enteric lesions and reduced oocyst output of the infected birds. Especially, the multivalent epitope DNA vaccines of pVAX1-NA4-1-TA4-1-LDH-2-EMCDPK-1 and pVAX1-NA4-1-TA4-1-LDH-2-EMCDPK-1-IL-2 not only significantly increased body weight gain, alleviated enteric lesions and reduced oocyst output of the infected birds, but also resulted in anti-coccidial index (ACI) more than 170 against E. tenella, E. necatrix, E. maxima and E. acervulina, which indicated they could induce protective immunity against E. tenella, E. necatrix, E. maxima and E. acervulina. Our findings suggest the constructed multivalent epitope DNA vaccines are the potential candidate multivalent vaccines against mixed infection of Eimeria. Copyright © 2015 Elsevier Ltd. All rights reserved.
Vaccination of rhesus macaques with a vif-deleted simian immunodeficiency virus proviral DNA vaccine
International Nuclear Information System (INIS)
Sparger, Ellen E.; Dubie, Robert A.; Shacklett, Barbara L.; Cole, Kelly S.; Chang, W.L.; Luciw, Paul A.
2008-01-01
Studies in non-human primates, with simian immunodeficiency virus (SIV) and simian/human immunodeficiency virus (SHIV) have demonstrated that live-attenuated viral vaccines are highly effective; however these vaccine viruses maintain a low level of pathogenicity. Lentivirus attenuation associated with deletion of the viral vif gene carries a significantly reduced risk for pathogenicity, while retaining the potential for virus replication of low magnitude in the host. This report describes a vif-deleted simian immunodeficiency virus (SIV)mac239 provirus that was tested as an attenuated proviral DNA vaccine by inoculation of female rhesus macaques. SIV-specific interferon-γ enzyme-linked immunospot responses of low magnitude were observed after immunization with plasmid containing the vif-deleted SIV provirus. However, vaccinated animals displayed strong sustained virus-specific T cell proliferative responses and increasing antiviral antibody titers. These immune responses suggested either persistent vaccine plasmid expression or low level replication of vif-deleted SIV in the host. Immunized and unvaccinated macaques received a single high dose vaginal challenge with pathogenic SIVmac251. A transient suppression of challenge virus load and a greater median survival time was observed for vaccinated animals. However, virus loads for vaccinated and unvaccinated macaques were comparable by twenty weeks after challenge and overall survival curves for the two groups were not significantly different. Thus, a vif-deleted SIVmac239 proviral DNA vaccine is immunogenic and capable of inducing a transient suppression of pathogenic challenge virus, despite severe attenuation of the vaccine virus
DNA priming for seasonal influenza vaccine: a phase 1b double-blind randomized clinical trial.
Directory of Open Access Journals (Sweden)
Julie E Ledgerwood
Full Text Available The efficacy of current influenza vaccines is limited in vulnerable populations. DNA vaccines can be produced rapidly, and may offer a potential strategy to improve vaccine immunogenicity, indicated by studies with H5 influenza DNA vaccine prime followed by inactivated vaccine boost.Four sites enrolled healthy adults, randomized to receive 2011/12 seasonal influenza DNA vaccine prime (n=65 or phosphate buffered saline (PBS (n=66 administered intramuscularly with Biojector. All subjects received the 2012/13 seasonal inactivated influenza vaccine, trivalent (IIV3 36 weeks after the priming injection. Vaccine safety and tolerability was the primary objective and measurement of antibody response by hemagglutination inhibition (HAI was the secondary objective.The DNA vaccine prime-IIV3 boost regimen was safe and well tolerated. Significant differences in HAI responses between the DNA vaccine prime and the PBS prime groups were not detected in this study.While DNA priming significantly improved the response to a conventional monovalent H5 vaccine in a previous study, it was not effective in adults using seasonal influenza strains, possibly due to pre-existing immunity to the prime, unmatched prime and boost antigens, or the lengthy 36 week boost interval. Careful optimization of the DNA prime-IIV3 boost regimen as related to antigen matching, interval between vaccinations, and pre-existing immune responses to influenza is likely to be needed in further evaluations of this vaccine strategy. In particular, testing this concept in younger age groups with less prior exposure to seasonal influenza strains may be informative.ClinicalTrials.gov NCT01498718.
Development of novel vaccines using DNA shuffling and screening strategies.
Locher, Christopher P; Soong, Nay Wei; Whalen, Robert G; Punnonen, Juha
2004-02-01
DNA shuffling and screening technologies recombine and evolve genes in vitro to rapidly obtain molecules with improved biological activity and fitness. In this way, genes from related strains are bred like plants or livestock and their successive progeny are selected. These technologies have also been called molecular breeding-directed molecular evolution. Recent developments in bioinformatics-assisted computer programs have facilitated the design, synthesis and analysis of DNA shuffled libraries of chimeric molecules. New applications in vaccine development are among the key features of DNA shuffling and screening technologies because genes from several strains or antigenic variants of pathogens can be recombined to create novel molecules capable of inducing immune responses that protect against infections by multiple strains of pathogens. In addition, molecules such as co-stimulatory molecules and cytokines have been evolved to have improved T-cell proliferation and cytokine production compared with the wild-type human molecules. These molecules can be used to immunomodulate vaccine responsiveness and have multiple applications in infectious diseases, cancer, allergy and autoimmunity. Moreover, DNA shuffling and screening technologies can facilitate process development of vaccine manufacturing through increased expression of recombinant polypeptides and viruses. Therefore, DNA shuffling and screening technologies can overcome some of the challenges that vaccine development currently faces.
PML-RARA-targeted DNA vaccine induces protective immunity in a mouse model of leukemia.
Padua, Rose Ann; Larghero, Jerome; Robin, Marie; le Pogam, Carol; Schlageter, Marie-Helene; Muszlak, Sacha; Fric, Jan; West, Robert; Rousselot, Philippe; Phan, Thi Hai; Mudde, Liesbeth; Teisserenc, Helene; Carpentier, Antoine F; Kogan, Scott; Degos, Laurent; Pla, Marika; Bishop, J Michael; Stevenson, Freda; Charron, Dominique; Chomienne, Christine
2003-11-01
Despite improved molecular characterization of malignancies and development of targeted therapies, acute leukemia is not curable and few patients survive more than 10 years after diagnosis. Recently, combinations of different therapeutic strategies (based on mechanisms of apoptosis, differentiation and cytotoxicity) have significantly increased survival. To further improve outcome, we studied the potential efficacy of boosting the patient's immune response using specific immunotherapy. In an animal model of acute promyelocytic leukemia, we developed a DNA-based vaccine by fusing the human promyelocytic leukemia-retinoic acid receptor-alpha (PML-RARA) oncogene to tetanus fragment C (FrC) sequences. We show for the first time that a DNA vaccine specifically targeted to an oncoprotein can have a pronounced effect on survival, both alone and when combined with all-trans retinoic acid (ATRA). The survival advantage is concomitant with time-dependent antibody production and an increase in interferon-gamma (IFN-gamma). We also show that ATRA therapy on its own triggers an immune response in this model. When DNA vaccination and conventional ATRA therapy are combined, they induce protective immune responses against leukemia progression in mice and may provide a new approach to improve clinical outcome in human leukemia.
Gamboa-León, R; Paraguai de Souza, E; Borja-Cabrera, G P; Santos, F N; Myashiro, L M; Pinheiro, R O; Dumonteil, E; Palatnik-de-Sousa, C B
2006-05-29
The nucleoside hydrolase (NH36) of Leishmania (L.) donovani is a vital enzyme which releases purines or pyrimidines of foreign DNA to be used in the synthesis of parasite DNA. As a bivalent DNA vaccine, the VR1012-NH36 was immunoprotective against visceral and cutaneous murine leishmaniasis. In this work we tested the immunotherapy against Leishmania (L.) chagasi infection, using two doses of 100 or 20 microg VR1012-NH36 vaccine (i.m. route), and, as a possible immunomodulator, aqueous garlic extract (8 mg/kg/day by the i.p. route), which was effective in immunotherapy of cutaneous murine leishmaniasis. Liver parasitic load was significantly reduced following treatment with 100 microg (91%) and 20 microg (77%) of the DNA vaccine, and by 20 microg DNA vaccine and garlic extract (76%) (p=0.023). Survival was 33% for saline controls, 100% for the 100 microg vaccine, and 83 and 67% for the 20 microg vaccine with and without garlic extract addition, respectively. Garlic treatment alone did not reduce parasite load (p>0.05), but increased survival (100%). The NH36-DNA vaccine was highly effective as a new tool for the therapy and control of visceral leishmaniasis, while the mild protective effect of garlic might be related to an unspecific enhancement of IFN-gamma secretion.
Next Generation Immunotherapy for Pancreatic Cancer: DNA Vaccination is Seeking New Combo Partners.
Cappello, Paola; Curcio, Claudia; Mandili, Giorgia; Roux, Cecilia; Bulfamante, Sara; Novelli, Francesco
2018-02-16
Pancreatic Ductal Adenocarcinoma (PDA) is an almost incurable radio- and chemo-resistant tumor, and its microenvironment is characterized by a strong desmoplastic reaction associated with a significant infiltration of T regulatory lymphocytes and myeloid-derived suppressor cells (Tregs, MDSC). Investigating immunological targets has identified a number of metabolic and cytoskeletal related molecules, which are typically recognized by circulating antibodies. Among these molecules we have investigated alpha-enolase (ENO1), a glycolytic enzyme that also acts a plasminogen receptor. ENO1 is also recognized by T cells in PDA patients, so we developed a DNA vaccine that targets ENO1. This efficiently induces many immunological processes (antibody formation and complement-dependent cytotoxicity (CDC)-mediated tumor killing, infiltration of effector T cells, reduction of infiltration of myeloid and Treg suppressor cells), which significantly increase the survival of genetically engineered mice that spontaneously develop pancreatic cancer. Although promising, the ENO1 DNA vaccine does not completely eradicate the tumor, which, after an initial growth inhibition, returns to proliferate again, especially when Tregs and MDSC ensue in the tumor mass. This led us to develop possible strategies for combinatorial treatments aimed to broaden and sustain the antitumor immune response elicited by DNA vaccination. Based on the data we have obtained in recent years, this review will discuss the biological bases of possible combinatorial treatments (chemotherapy, PI3K inhibitors, tumor-associated macrophages, ENO1 inhibitors) that could be effective in amplifying the response induced by the immune vaccination in PDA.
Protective effect of a polyvalent influenza DNA vaccine in pigs
DEFF Research Database (Denmark)
Karlsson, Ingrid; Borggren, Marie; Rosenstierne, Maiken Worsøe
2018-01-01
Background Influenza A virus in swine herds represents a major problem for the swine industry and poses a constant threat for the emergence of novel pandemic viruses and the development of more effective influenza vaccines for pigs is desired. By optimizing the vector backbone and using a needle...... needle-free delivery to the skin, we immunized pigs with two different doses (500 μg and 800 μg) of an influenza DNA vaccine based on six genes of pandemic origin, including internally expressed matrix and nucleoprotein and externally expressed hemagglutinin and neuraminidase as previously demonstrated....... Two weeks following immunization, the pigs were challenged with the 2009 pandemic H1N1 virus. Results When challenged with 2009 pandemic H1N1, 0/5 vaccinated pigs (800 μg DNA) became infected whereas 5/5 unvaccinated control pigs were infected. The pigs vaccinated with the low dose (500 μg DNA) were...
A DNA vaccine against yellow fever virus: development and evaluation.
Directory of Open Access Journals (Sweden)
Milton Maciel
2015-04-01
Full Text Available Attenuated yellow fever (YF virus 17D/17DD vaccines are the only available protection from YF infection, which remains a significant source of morbidity and mortality in the tropical areas of the world. The attenuated YF virus vaccine, which is used worldwide, generates both long-lasting neutralizing antibodies and strong T-cell responses. However, on rare occasions, this vaccine has toxic side effects that can be fatal. This study presents the design of two non-viral DNA-based antigen formulations and the characterization of their expression and immunological properties. The two antigen formulations consist of DNA encoding the full-length envelope protein (p/YFE or the full-length envelope protein fused to the lysosomal-associated membrane protein signal, LAMP-1 (pL/YFE, aimed at diverting antigen processing/presentation through the major histocompatibility complex II precursor compartments. The immune responses triggered by these formulations were evaluated in H2b and H2d backgrounds, corresponding to the C57Bl/6 and BALB/c mice strains, respectively. Both DNA constructs were able to induce very strong T-cell responses of similar magnitude against almost all epitopes that are also generated by the YF 17DD vaccine. The pL/YFE formulation performed best overall. In addition to the T-cell response, it was also able to stimulate high titers of anti-YF neutralizing antibodies comparable to the levels elicited by the 17DD vaccine. More importantly, the pL/YFE vaccine conferred 100% protection against the YF virus in intracerebrally challenged mice. These results indicate that pL/YFE DNA is an excellent vaccine candidate and should be considered for further developmental studies.
A DNA vaccine against yellow fever virus: development and evaluation.
Maciel, Milton; Cruz, Fábia da Silva Pereira; Cordeiro, Marli Tenório; da Motta, Márcia Archer; Cassemiro, Klécia Marília Soares de Melo; Maia, Rita de Cássia Carvalho; de Figueiredo, Regina Célia Bressan Queiroz; Galler, Ricardo; Freire, Marcos da Silva; August, Joseph Thomas; Marques, Ernesto T A; Dhalia, Rafael
2015-04-01
Attenuated yellow fever (YF) virus 17D/17DD vaccines are the only available protection from YF infection, which remains a significant source of morbidity and mortality in the tropical areas of the world. The attenuated YF virus vaccine, which is used worldwide, generates both long-lasting neutralizing antibodies and strong T-cell responses. However, on rare occasions, this vaccine has toxic side effects that can be fatal. This study presents the design of two non-viral DNA-based antigen formulations and the characterization of their expression and immunological properties. The two antigen formulations consist of DNA encoding the full-length envelope protein (p/YFE) or the full-length envelope protein fused to the lysosomal-associated membrane protein signal, LAMP-1 (pL/YFE), aimed at diverting antigen processing/presentation through the major histocompatibility complex II precursor compartments. The immune responses triggered by these formulations were evaluated in H2b and H2d backgrounds, corresponding to the C57Bl/6 and BALB/c mice strains, respectively. Both DNA constructs were able to induce very strong T-cell responses of similar magnitude against almost all epitopes that are also generated by the YF 17DD vaccine. The pL/YFE formulation performed best overall. In addition to the T-cell response, it was also able to stimulate high titers of anti-YF neutralizing antibodies comparable to the levels elicited by the 17DD vaccine. More importantly, the pL/YFE vaccine conferred 100% protection against the YF virus in intracerebrally challenged mice. These results indicate that pL/YFE DNA is an excellent vaccine candidate and should be considered for further developmental studies.
A DNA Vaccine against Yellow Fever Virus: Development and Evaluation
Maciel, Milton; Cruz, Fábia da Silva Pereira; Cordeiro, Marli Tenório; da Motta, Márcia Archer; Cassemiro, Klécia Marília Soares de Melo; Maia, Rita de Cássia Carvalho; de Figueiredo, Regina Célia Bressan Queiroz; Galler, Ricardo; Freire, Marcos da Silva; August, Joseph Thomas; Marques, Ernesto T. A.; Dhalia, Rafael
2015-01-01
Attenuated yellow fever (YF) virus 17D/17DD vaccines are the only available protection from YF infection, which remains a significant source of morbidity and mortality in the tropical areas of the world. The attenuated YF virus vaccine, which is used worldwide, generates both long-lasting neutralizing antibodies and strong T-cell responses. However, on rare occasions, this vaccine has toxic side effects that can be fatal. This study presents the design of two non-viral DNA-based antigen formulations and the characterization of their expression and immunological properties. The two antigen formulations consist of DNA encoding the full-length envelope protein (p/YFE) or the full-length envelope protein fused to the lysosomal-associated membrane protein signal, LAMP-1 (pL/YFE), aimed at diverting antigen processing/presentation through the major histocompatibility complex II precursor compartments. The immune responses triggered by these formulations were evaluated in H2b and H2d backgrounds, corresponding to the C57Bl/6 and BALB/c mice strains, respectively. Both DNA constructs were able to induce very strong T-cell responses of similar magnitude against almost all epitopes that are also generated by the YF 17DD vaccine. The pL/YFE formulation performed best overall. In addition to the T-cell response, it was also able to stimulate high titers of anti-YF neutralizing antibodies comparable to the levels elicited by the 17DD vaccine. More importantly, the pL/YFE vaccine conferred 100% protection against the YF virus in intracerebrally challenged mice. These results indicate that pL/YFE DNA is an excellent vaccine candidate and should be considered for further developmental studies. PMID:25875109
Directory of Open Access Journals (Sweden)
Asha Jayakumar
2011-06-01
Full Text Available Leishmania (Viannia parasites present particular challenges, as human and murine immune responses to infection are distinct from other Leishmania species, indicating a unique interaction with the host. Further, vaccination studies utilizing small animal models indicate that modalities and antigens that prevent infection by other Leishmania species are generally not protective.Using a newly developed mouse model of chronic L. (Viannia panamensis infection and the heterologous DNA prime - modified vaccinia virus Ankara (MVA boost vaccination modality, we examined whether the conserved vaccine candidate antigen tryparedoxin peroxidase (TRYP could provide protection against infection/disease.Heterologous prime - boost (DNA/MVA vaccination utilizing TRYP antigen can provide protection against disease caused by L. (V. panamensis. However, protection is dependent on modulating the innate immune response using the TLR1/2 agonist Pam3CSK4 during DNA priming. Prime-boost vaccination using DNA alone fails to protect. Prior to infection protectively vaccinated mice exhibit augmented CD4 and CD8 IFNγ and memory responses as well as decreased IL-10 and IL-13 responses. IL-13 and IL-10 have been shown to be independently critical for disease in this model. CD8 T cells have an essential role in mediating host defense, as CD8 depletion reversed protection in the vaccinated mice; vaccinated mice depleted of CD4 T cells remained protected. Hence, vaccine-induced protection is dependent upon TLR1/2 activation instructing the generation of antigen specific CD8 cells and restricting IL-13 and IL-10 responses.Given the general effectiveness of prime-boost vaccination, the recalcitrance of Leishmania (Viannia to vaccine approaches effective against other species of Leishmania is again evident. However, prime-boost vaccination modality can with modulation induce protective responses, indicating that the delivery system is critical. Moreover, these results suggest that
International Nuclear Information System (INIS)
Tretyakova, Irina; Nickols, Brian; Hidajat, Rachmat; Jokinen, Jenny; Lukashevich, Igor S.; Pushko, Peter
2014-01-01
Yellow fever (YF) causes an acute hemorrhagic fever disease in tropical Africa and Latin America. To develop a novel experimental YF vaccine, we applied iDNA infectious clone technology. The iDNA represents plasmid that encodes the full-length RNA genome of 17D vaccine downstream from a cytomegalovirus (CMV) promoter. The vaccine was designed to transcribe the full-length viral RNA and to launch 17D vaccine virus in vitro and in vivo. Transfection with 10 ng of iDNA plasmid was sufficient to start replication of vaccine virus in vitro. Safety of the parental 17D and iDNA-derived 17D viruses was confirmed in AG129 mice deficient in receptors for IFN-α/β/γ. Finally, direct vaccination of BALB/c mice with a single 20 μg dose of iDNA plasmid resulted in seroconversion and elicitation of virus-specific neutralizing antibodies in animals. We conclude that iDNA immunization approach combines characteristics of DNA and attenuated vaccines and represents a promising vaccination strategy for YF. - Highlights: • The iDNA ® platform combines advantages of DNA and live attenuated vaccines. • Yellow fever (YF) 17D vaccine was launched from iDNA plasmid in vitro and in vivo. • Safety of iDNA-generated 17D virus was confirmed in AG129 mice. • BALB/c mice seroconverted after a single-dose vaccination with iDNA. • YF virus-neutralizing response was elicited in iDNA-vaccinated mice
Energy Technology Data Exchange (ETDEWEB)
Tretyakova, Irina; Nickols, Brian; Hidajat, Rachmat [Medigen, Inc., 8420 Gas House Pike, Suite S, Frederick, MD 21701 (United States); Jokinen, Jenny; Lukashevich, Igor S. [Department of Pharmacology and Toxicology, School of Medicine, Center for Predictive Medicine and Emerging Infectious Diseases, University of Louisville, Louisville, KY (United States); Pushko, Peter, E-mail: ppushko@medigen-usa.com [Medigen, Inc., 8420 Gas House Pike, Suite S, Frederick, MD 21701 (United States)
2014-11-15
Yellow fever (YF) causes an acute hemorrhagic fever disease in tropical Africa and Latin America. To develop a novel experimental YF vaccine, we applied iDNA infectious clone technology. The iDNA represents plasmid that encodes the full-length RNA genome of 17D vaccine downstream from a cytomegalovirus (CMV) promoter. The vaccine was designed to transcribe the full-length viral RNA and to launch 17D vaccine virus in vitro and in vivo. Transfection with 10 ng of iDNA plasmid was sufficient to start replication of vaccine virus in vitro. Safety of the parental 17D and iDNA-derived 17D viruses was confirmed in AG129 mice deficient in receptors for IFN-α/β/γ. Finally, direct vaccination of BALB/c mice with a single 20 μg dose of iDNA plasmid resulted in seroconversion and elicitation of virus-specific neutralizing antibodies in animals. We conclude that iDNA immunization approach combines characteristics of DNA and attenuated vaccines and represents a promising vaccination strategy for YF. - Highlights: • The iDNA{sup ®} platform combines advantages of DNA and live attenuated vaccines. • Yellow fever (YF) 17D vaccine was launched from iDNA plasmid in vitro and in vivo. • Safety of iDNA-generated 17D virus was confirmed in AG129 mice. • BALB/c mice seroconverted after a single-dose vaccination with iDNA. • YF virus-neutralizing response was elicited in iDNA-vaccinated mice.
Directory of Open Access Journals (Sweden)
Ros Chapman
Full Text Available In an effort to make affordable vaccines suitable for the regions most affected by HIV-1, we have constructed stable vaccines that express an HIV-1 subtype C mosaic Gag immunogen (BCG-GagM, MVA-GagM and DNA-GagM. Mosaic immunogens have been designed to address the tremendous diversity of this virus. Here we have shown that GagM buds from cells infected and transfected with MVA-GagM and DNA-GagM respectively and forms virus-like particles. Previously we showed that a BCG-GagM prime MVA-GagM boost generated strong cellular immune responses in mice. In this study immune responses to the DNA-GagM and MVA-GagM vaccines were evaluated in homologous and heterologous prime-boost vaccinations. The DNA homologous prime boost vaccination elicited predominantly CD8+ T cells while the homologous MVA vaccination induced predominantly CD4+ T cells. A heterologous DNA-GagM prime MVA-GagM boost induced strong, more balanced Gag CD8+ and CD4+ T cell responses and that were predominantly of an effector memory phenotype. The immunogenicity of the mosaic Gag (GagM was compared to a naturally occurring subtype C Gag (GagN using a DNA homologous vaccination regimen. DNA-GagN expresses a natural Gag with a sequence that was closest to the consensus sequence of subtype C viruses sampled in South Africa. DNA-GagM homologous vaccination induced cumulative HIV-1 Gag-specific IFN-γ ELISPOT responses that were 6.5-fold higher than those induced by the DNA-GagN vaccination. Similarly, DNA-GagM vaccination generated 7-fold higher levels of cytokine-positive CD8+ T cells than DNA-GagN, indicating that this subtype C mosaic Gag elicits far more potent immune responses than a consensus-type Gag. Cells transfected and infected with DNA-GagM and MVA-GagM respectively, expressed high levels of GagM and produced budding virus-like particles. Our data indicates that a heterologous prime boost regimen using DNA and MVA vaccines expressing HIV-1 subtype C mosaic Gag is highly
Directory of Open Access Journals (Sweden)
Zhong-Yuan Chen
2018-01-01
Full Text Available Andrias davidianus ranavirus (ADRV is an emerging viral pathogen that causes severe systemic hemorrhagic disease in Chinese giant salamanders. There is an urgent need for developing an effective vaccine against this fatal disease. In this study, DNA vaccines containing the ADRV 2L gene (pcDNA-2L and the 58L gene (pcDNA-58L were respectively constructed, and their immune protective effects were evaluated in Chinese giant salamanders. In vitro and in vivo expression of the vaccine plasmids were confirmed in transfected cells and muscle tissues of vaccinated Chinese giant salamanders by using immunoblot analysis or RT-PCR. Following ADRV challenge, the Chinese giant salamanders vaccinated with pcDNA-2L showed a relative percent survival (RPS of 66.7%, which was significant higher than that in Chinese giant salamanders immunized with pcDNA-58L (RPS of 3.3%. Moreover, the specific antibody against ADRV was detected in Chinese giant salamanders vaccinated with pcDNA-2L at 14 and 21 days post-vaccination by indirect enzyme-linked immunosorbent assay (ELISA. Transcriptional analysis revealed that the expression levels of immune-related genes including type I interferon (IFN, myxovirus resistance (Mx, major histocompatibility complex class IA (MHC IA, and immunoglobulin M (IgM were strongly up-regulated after vaccination with pcDNA-2L. Furthermore, vaccination with pcDNA-2L significantly suppressed the virus replication, which was seen by a low viral load in the spleen of Chinese giant salamander survivals after ADRV challenge. These results indicated that pcDNA-2L could induce a significant innate immune response and an adaptive immune response involving both humoral and cell-mediated immunity that conferred effective protection against ADRV infection, and might be a potential vaccine candidate for controlling ADRV disease in Chinese giant salamanders.
Lankelma, Jacqueline M; Wagemakers, Alex; Birnie, Emma; Haak, Bastiaan W; Trentelman, Jos J A; Weehuizen, Tassili A F; Ersöz, Jasmin; Roelofs, Joris J T H; Hovius, Joppe W; Wiersinga, W Joost; Bins, Adriaan D
2017-11-17
Melioidosis is a severe infectious disease with a high mortality that is endemic in South-East Asia and Northern Australia. The causative pathogen, Burkholderia pseudomallei, is listed as potential bioterror weapon due to its high virulence and potential for easy dissemination. Currently, there is no licensed vaccine for prevention of melioidosis. Here, we explore the use of rapid plasmid DNA vaccination against B. pseudomallei flagellin for protection against respiratory challenge. We tested three flagellin DNA vaccines with different subcellular targeting designs. C57BL/6 mice were vaccinated via skin tattoo on day 0, 3 and 6 before intranasal challenge with B. pseudomallei on day 21. Next, the most effective construct was used as single vaccination on day 0 by tattoo or intranasal formulation. Mice were sacrificed 72 hours post-challenge to assess bacterial loads, cytokine responses, inflammation and microscopic lesions. A construct encoding a cellular secretion signal resulted in the most effective protection against melioidosis via tattooing, with a 10-fold reduction in bacterial loads in lungs and distant organs compared to the empty vector. Strikingly, a single intranasal administration of the same vaccine resulted in >1000-fold lower bacterial loads and increased survival. Pro-inflammatory cytokine responses were significantly diminished and strong reductions in markers for distant organ damage were observed. A rapid vaccination scheme using flagellin DNA tattoo provides significant protection against intranasal challenge with B. pseudomallei, markedly improved by a single administration via airway mucosa. Hence intranasal vaccination with flagellin-encoding DNA may be applicable when acute mass vaccination is indicated and warrants further testing.
Directory of Open Access Journals (Sweden)
Touihri Leila
2012-12-01
Full Text Available Abstract Background During the vaccination campaigns, puppies younger than 3 months old are not targeted and remain unvaccinated for at least the first year of their lives. Almost half of the reported rabid dogs are 6 months or younger. Hence, we should recommend the vaccination against rabies of young puppies. Unfortunately, owing to the exposure of puppies to infections with either canine parvovirus (CPV or distemper virus (CDV after the intervention of the vaccinators, owners are reluctant to vaccinate puppies against rabies. Therefore, it is necessary to include the CPV and CDV valences in the vaccine against rabies. Multivalent DNA-based vaccination in dogs, including rabies and distemper valences, could help in raising vaccine coverage. Methods We have designed monovalent and multivalent DNA-based vaccine candidates for in vitro and in vivo assays. These plasmids encode to the rabies virus glycoprotein and/or the canine distemper virus hemagglutinin. The first strategy of multivalent DNA-based vaccination is by mixing plasmids encoding to a single antigen each. The second is by simply fusing the genes of the antigens together. The third is by adding the foot and mouth disease virus (FMDV 2A oligopeptide gene into the antigen genes. The last strategy is by the design and use of a bicistronic plasmid with an “Internal Ribosome Entry Site” (IRES domain. Results The monovalent construct against canine distemper was efficiently validated by inducing higher humoral immune responses compared to cell-culture-derived vaccine both in mice and dogs. All multivalent plasmids efficiently expressed both valences after in vitro transfection of BHK-21 cells. In BALB/c mice, the bicistronic IRES-dependant construct was the most efficient inducer of virus-neutralizing antibodies against both valences. It was able to induce better humoral immune responses compared to the administration of either cell-culture-derived vaccines or monovalent plasmids. The
Touihri, Leila; Ahmed, Sami Belhaj; Chtourou, Yacine; Daoud, Rahma; Bahloul, Chokri
2012-12-27
During the vaccination campaigns, puppies younger than 3 months old are not targeted and remain unvaccinated for at least the first year of their lives. Almost half of the reported rabid dogs are 6 months or younger. Hence, we should recommend the vaccination against rabies of young puppies. Unfortunately, owing to the exposure of puppies to infections with either canine parvovirus (CPV) or distemper virus (CDV) after the intervention of the vaccinators, owners are reluctant to vaccinate puppies against rabies. Therefore, it is necessary to include the CPV and CDV valences in the vaccine against rabies. Multivalent DNA-based vaccination in dogs, including rabies and distemper valences, could help in raising vaccine coverage. We have designed monovalent and multivalent DNA-based vaccine candidates for in vitro and in vivo assays. These plasmids encode to the rabies virus glycoprotein and/or the canine distemper virus hemagglutinin. The first strategy of multivalent DNA-based vaccination is by mixing plasmids encoding to a single antigen each. The second is by simply fusing the genes of the antigens together. The third is by adding the foot and mouth disease virus (FMDV) 2A oligopeptide gene into the antigen genes. The last strategy is by the design and use of a bicistronic plasmid with an "Internal Ribosome Entry Site" (IRES) domain. The monovalent construct against canine distemper was efficiently validated by inducing higher humoral immune responses compared to cell-culture-derived vaccine both in mice and dogs. All multivalent plasmids efficiently expressed both valences after in vitro transfection of BHK-21 cells. In BALB/c mice, the bicistronic IRES-dependant construct was the most efficient inducer of virus-neutralizing antibodies against both valences. It was able to induce better humoral immune responses compared to the administration of either cell-culture-derived vaccines or monovalent plasmids. The FMDV 2A was also efficient in the design of multivalent
Next Generation Immunotherapy for Pancreatic Cancer: DNA Vaccination is Seeking New Combo Partners
Directory of Open Access Journals (Sweden)
Paola Cappello
2018-02-01
Full Text Available Pancreatic Ductal Adenocarcinoma (PDA is an almost incurable radio- and chemo-resistant tumor, and its microenvironment is characterized by a strong desmoplastic reaction associated with a significant infiltration of T regulatory lymphocytes and myeloid-derived suppressor cells (Tregs, MDSC. Investigating immunological targets has identified a number of metabolic and cytoskeletal related molecules, which are typically recognized by circulating antibodies. Among these molecules we have investigated alpha-enolase (ENO1, a glycolytic enzyme that also acts a plasminogen receptor. ENO1 is also recognized by T cells in PDA patients, so we developed a DNA vaccine that targets ENO1. This efficiently induces many immunological processes (antibody formation and complement-dependent cytotoxicity (CDC-mediated tumor killing, infiltration of effector T cells, reduction of infiltration of myeloid and Treg suppressor cells, which significantly increase the survival of genetically engineered mice that spontaneously develop pancreatic cancer. Although promising, the ENO1 DNA vaccine does not completely eradicate the tumor, which, after an initial growth inhibition, returns to proliferate again, especially when Tregs and MDSC ensue in the tumor mass. This led us to develop possible strategies for combinatorial treatments aimed to broaden and sustain the antitumor immune response elicited by DNA vaccination. Based on the data we have obtained in recent years, this review will discuss the biological bases of possible combinatorial treatments (chemotherapy, PI3K inhibitors, tumor-associated macrophages, ENO1 inhibitors that could be effective in amplifying the response induced by the immune vaccination in PDA.
Saccharomyces boulardii improves humoral immune response to DNA vaccines against leptospirosis.
Silveira, Marcelle Moura; Conceição, Fabricio Rochedo; Mendonça, Marcelo; Moreira, Gustavo Marçal Schmidt Garcia; Da Cunha, Carlos Eduardo Pouey; Conrad, Neida Lucia; Oliveira, Patrícia Diaz de; Hartwig, Daiane Drawanz; De Leon, Priscila Marques Moura; Moreira, Ângela Nunes
2017-02-01
Saccharomyces boulardii may improve the immune response by enhancing the production of anti-inflammatory cytokines, T-cell proliferation and dendritic cell activation. The immunomodulator effect of this probiotic has never been tested with DNA vaccines, which frequently induce low antibody titers. This study evaluated the capacity of Saccharomyces boulardii to improve the humoral and cellular immune responses using DNA vaccines coding for the leptospiral protein fragments LigAni and LigBrep. BALB/c mice were fed with rodent-specific feed containing 108 c.f.u. of Saccharomycesboulardii per gram. Animals were immunized three times intramuscularly with 100 µg of pTARGET plasmids containing the coding sequences for the above mentioned proteins. Antibody titers were measured by indirect ELISA. Expression levels of IL-4, IL-10, IL-12, IL-17, IFN-γ and TGF-β were determined by quantitative real-time PCR from RNA extracted from whole blood, after an intraperitoneal boost with 50 µg of the recombinant proteins.Results/Key findings. Antibody titers increased significantly after the second and third application when pTARGET/ligAni and pTARGET/ligBrep were used to vaccinate the animals in comparison with the control group (PSaccharomyces boulardii. The results suggested that Saccharomyces boulardii has an immunomodulator effect in DNA vaccines, mainly by stimulating the humoral response, which is often limited in this kind of vaccine. Therefore, the use of Saccharomyces boulardii as immunomodulator represents a new alternative strategy for more efficient DNA vaccination.
Engineering nanoparticle-coated bacteria as oral DNA vaccines for cancer immunotherapy.
Hu, Qinglian; Wu, Min; Fang, Chun; Cheng, Changyong; Zhao, Mengmeng; Fang, Weihuan; Chu, Paul K; Ping, Yuan; Tang, Guping
2015-04-08
Live attenuated bacteria are of increasing importance in biotechnology and medicine in the emerging field of cancer immunotherapy. Oral DNA vaccination mediated by live attenuated bacteria often suffers from low infection efficiency due to various biological barriers during the infection process. To this end, we herein report, for the first time, a new strategy to engineer cationic nanoparticle-coated bacterial vectors that can efficiently deliver oral DNA vaccine for efficacious cancer immunotherapy. By coating live attenuated bacteria with synthetic nanoparticles self-assembled from cationic polymers and plasmid DNA, the protective nanoparticle coating layer is able to facilitate bacteria to effectively escape phagosomes, significantly enhance the acid tolerance of bacteria in stomach and intestines, and greatly promote dissemination of bacteria into blood circulation after oral administration. Most importantly, oral delivery of DNA vaccines encoding autologous vascular endothelial growth factor receptor 2 (VEGFR2) by this hybrid vector showed remarkable T cell activation and cytokine production. Successful inhibition of tumor growth was also achieved by efficient oral delivery of VEGFR2 with nanoparticle-coated bacterial vectors due to angiogenesis suppression in the tumor vasculature and tumor necrosis. This proof-of-concept work demonstrates that coating live bacterial cells with synthetic nanoparticles represents a promising strategy to engineer efficient and versatile DNA vaccines for the era of immunotherapy.
International Nuclear Information System (INIS)
Rong, Yefei; Jin, Dayong; Wu, Wenchuan; Lou, Wenhui; Wang, Danshong; Kuang, Tiantao; Ni, Xiaoling; Qin, Xinyu
2009-01-01
Pancreatic cancer is a common, highly lethal disease with a rising incidence. MUC1 is a tumor-associated antigen that is over-expressed in pancreatic adenocarcinoma. Active immunotherapy that targets MUC1 could have great treatment value. Here we investigated the preventive and therapeutic effect of a MUC1 DNA vaccine on the pancreatic cancer. MUC1-various tandem repeat units(VNTR) DNA vaccine was produced by cloning one repeat of VNTR and inserting the cloned gene into the pcDNA3.1. In the preventive group, female C57BL/6 mice were immunized with the vaccine, pcDNA3.1 or PBS; and challenged with panc02-MUC1 or panc02 cell. In the therapeutic group the mice were challenged with panc02-MUC1 or panc02 cell, and then immunized with the vaccine, pcDNA3.1 or PBS. The tumor size and the survival time of the animals were compared between these groups. The DNA vaccine pcDNA3.1-VNTR could raise cytotoxic T lymphocyte (CTL) activity specific for MUC1. In the preventive experiment, the mice survival time was significantly longer in the vaccine group than in the control groups (P < 0.05). In the therapeutic experiment, the DNA vaccine prolonged the survival time of the panc02-MUC1-bearing mice (P < 0.05). In both the preventive and therapeutic experiments, the tumor size was significantly less in the vaccine group than in the control groups (P < 0.05). This pcDNA3.1-VNTR vaccine, however, could not prevent the mice attacked by panc02 cells and had no therapeutic effect on the mice attacked by panc02 cells. The MUC1 DNA vaccine pcDNA3.1-VNTR could induce a significant MUC1-specific CTL response; and had both prophylactic and therapeutic effect on panc02-MUC1 tumors. This vaccine might be used as a new adjuvant strategy against pancreatic cancer
Yang, Hung-Wei; Ye, Ling; Guo, Xin Dong; Yang, Chinglai; Compans, Richard W; Prausnitz, Mark R
2017-01-01
Ebola DNA vaccine is incorporated into PLGA-PLL/γPGA nanoparticles and administered to skin using a microneedle (MN) patch. The nanoparticle delivery system increases vaccine thermostability and immunogenicity compared to free vaccine. Vaccination by MN patch produces stronger immune responses than intramuscular administration. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
2013-05-21
...] Availability of an Environmental Assessment for Field Testing a Canine Lymphoma Vaccine, DNA AGENCY: Animal and... Canine Lymphoma Vaccine, DNA. The environmental assessment, which is based on a risk analysis prepared to... biological product: Requester: Merial, Inc. Product: Canine Lymphoma Vaccine, DNA. Possible Field Test...
Gene-gun DNA vaccination aggravates respiratory syncytial virus-induced pneumonitis
DEFF Research Database (Denmark)
Bartholdy, Christina; Olszewska, Wieslawa; Stryhn, Anette
2004-01-01
elicited with recombinant vaccinia virus expressing the complete RSV M2 protein, but stronger than those induced by a similar DNA construct without the beta2m gene. DNA vaccination led to enhanced pulmonary disease after RSV challenge, with increased weight loss and cell recruitment to the lung. Depletion......A CD8+ T-cell memory response to respiratory syncytial virus (RSV) was generated by using a DNA vaccine construct encoding the dominant Kd-restricted epitope from the viral transcription anti-terminator protein M2 (M2(82-90)), linked covalently to human beta2-microglobulin (beta2m). Cutaneous gene...... of CD8+ T cells reduced, but did not abolish, enhancement of disease. Mice vaccinated with a construct encoding a class I-restricted lymphocytic choriomeningitis virus epitope and beta2m suffered more severe weight loss after RSV infection than unvaccinated RSV-infected mice, although RSV-specific CD8...
Knudsen, Maria L; Mbewe-Mvula, Alice; Rosario, Maximillian; Johansson, Daniel X; Kakoulidou, Maria; Bridgeman, Anne; Reyes-Sandoval, Arturo; Nicosia, Alfredo; Ljungberg, Karl; Hanke, Tomás; Liljeström, Peter
2012-04-01
Vaccination using "naked" DNA is a highly attractive strategy for induction of pathogen-specific immune responses; however, it has been only weakly immunogenic in humans. Previously, we constructed DNA-launched Semliki Forest virus replicons (DREP), which stimulate pattern recognition receptors and induce augmented immune responses. Also, in vivo electroporation was shown to enhance immune responses induced by conventional DNA vaccines. Here, we combine these two approaches and show that in vivo electroporation increases CD8(+) T cell responses induced by DREP and consequently decreases the DNA dose required to induce a response. The vaccines used in this study encode the multiclade HIV-1 T cell immunogen HIVconsv, which is currently being evaluated in clinical trials. Using intradermal delivery followed by electroporation, the DREP.HIVconsv DNA dose could be reduced to as low as 3.2 ng to elicit frequencies of HIV-1-specific CD8(+) T cells comparable to those induced by 1 μg of a conventional pTH.HIVconsv DNA vaccine, representing a 625-fold molar reduction in dose. Responses induced by both DREP.HIVconsv and pTH.HIVconsv were further increased by heterologous vaccine boosts employing modified vaccinia virus Ankara MVA.HIVconsv and attenuated chimpanzee adenovirus ChAdV63.HIVconsv. Using the same HIVconsv vaccines, the mouse observations were supported by an at least 20-fold-lower dose of DNA vaccine in rhesus macaques. These data point toward a strategy for overcoming the low immunogenicity of DNA vaccines in humans and strongly support further development of the DREP vaccine platform for clinical evaluation.
Canine distemper virus DNA vaccination of mink can overcome interference by maternal antibodies.
Jensen, Trine Hammer; Nielsen, Line; Aasted, Bent; Pertoldi, Cino; Blixenkrone-Møller, Merete
2015-03-10
Canine distemper virus (CDV) is highly contagious and can cause severe disease against which conventional live vaccines are ineffective in the presence of maternal antibodies. Vaccination in the presences of maternal antibodies was challenged by vaccination of 5 days old and 3 weeks old mink kits with CDV DNA vaccines. Virus neutralising (VN) antibody responses were induced in mink kits vaccinated with a plasmid encoding the haemaglutinin protein (H) of CDV (n=5, pCDV-H) or a combination of the H, fusion (F) and nucleoprotein (N) of CDV (n=5, pCDV-HFN). These DNA vaccinated kits were protected against virulent experimental infection with field strains of CDV. The pCDV-H was more efficient in inducing protective immunity in the presence of maternal antibodies compared to the pCDV-HFN. The results show that DNA vaccination with the pCDV-H or pCDV-HFN (n=4) only given once at 5 days of age induces virus specific immune response in neonatal mink and protection against virulent CDV exposure later in life. Copyright © 2015 Elsevier Ltd. All rights reserved.
Tailoring DNA vaccines: designing strategies against HER2 positive cancers
Directory of Open Access Journals (Sweden)
Cristina eMarchini
2013-05-01
Full Text Available The crucial role of HER2 in epithelial transformation and its selective overexpression on cancer tissues makes it an ideal target for cancer immunotherapies such as passive immunotherapy with Trastuzumab. There are, however, a number of concerns regarding the use of monoclonal antibodies which include resistance, repeated treatments, considerable costs and side effects that make active immunotherapies against HER2 desirable alternative approaches. The efficacy of anti-HER2 DNA vaccination has been widely demonstrated in transgenic cancer-prone mice, which recapitulate several features of human breast cancers. Nonetheless, the rational design of a cancer vaccine able to trigger a long lasting immunity, and thus prevent tumor recurrence in patients, would require the understanding of how tolerance and immunosuppression regulate antitumor immune responses and, at the same time, the identification of the most immunogenic portions of the target protein. We herein retrace the findings that led to our most promising DNA vaccines that, by encoding human/rat chimeric forms of HER2, are able to circumvent peripheral tolerance. Preclinical data obtained with these chimeric DNA vaccines have provided the rationale for their use in an ongoing phase I clinical trial (EudraCT 2011-001104-34.
Emmenegger, E.J.; Kurath, G.
2008-01-01
The emergence of spring viremia of carp virus (SVCV) in the United States constitutes a potentially serious alien pathogen threat to susceptible fish stocks in North America. A DNA vaccine with an SVCV glycoprotein (G) gene from a North American isolate was constructed. In order to test the vaccine a challenge model utilizing a specific pathogen-free domestic koi stock and a cold water stress treatment was also developed. We have conducted four trial studies demonstrating that the pSGnc DNA vaccine provided protection in vaccinated fish against challenge at low, moderate, and high virus doses of the homologous virus. The protection was significant (p DNA immunized fish were challenged 28-days post-vaccination (546 degree-days) and experienced low mortalities varying from 10 to 50% with relative percent survivals ranging from 50 to 88%. The non-vaccinated controls and mock construct vaccinated fish encountered high cumulative percent mortalities ranging from 70 to 100%. This is the first report of a SVCV DNA vaccine being tested successfully in koi. These experiments prove that the SVCV DNA (pSGnc) vaccine can elicit specific reproducible protection and validates its potential use as a prophylactic vaccine in koi and other vulnerable North American fish stocks.
Tretyakova, Irina; Nickols, Brian; Hidajat, Rachmat; Jokinen, Jenny; Lukashevich, Igor S; Pushko, Peter
2014-11-01
Yellow fever (YF) causes an acute hemorrhagic fever disease in tropical Africa and Latin America. To develop a novel experimental YF vaccine, we applied iDNA infectious clone technology. The iDNA represents plasmid that encodes the full-length RNA genome of 17D vaccine downstream from a cytomegalovirus (CMV) promoter. The vaccine was designed to transcribe the full-length viral RNA and to launch 17D vaccine virus in vitro and in vivo. Transfection with 10 ng of iDNA plasmid was sufficient to start replication of vaccine virus in vitro. Safety of the parental 17D and iDNA-derived 17D viruses was confirmed in AG129 mice deficient in receptors for IFN-α/β/γ. Finally, direct vaccination of BALB/c mice with a single 20 μg dose of iDNA plasmid resulted in seroconversion and elicitation of virus-specific neutralizing antibodies in animals. We conclude that iDNA immunization approach combines characteristics of DNA and attenuated vaccines and represents a promising vaccination strategy for YF. Copyright © 2014 Elsevier Inc. All rights reserved.
A DNA Vaccine Protects Human Immune Cells against Zika Virus Infection in Humanized Mice
Directory of Open Access Journals (Sweden)
Guohua Yi
2017-11-01
Full Text Available A DNA vaccine encoding prM and E protein has been shown to induce protection against Zika virus (ZIKV infection in mice and monkeys. However, its effectiveness in humans remains undefined. Moreover, identification of which immune cell types are specifically infected in humans is unclear. We show that human myeloid cells and B cells are primary targets of ZIKV in humanized mice. We also show that a DNA vaccine encoding full length prM and E protein protects humanized mice from ZIKV infection. Following administration of the DNA vaccine, humanized DRAG mice developed antibodies targeting ZIKV as measured by ELISA and neutralization assays. Moreover, following ZIKV challenge, vaccinated animals presented virtually no detectable virus in human cells and in serum, whereas unvaccinated animals displayed robust infection, as measured by qRT-PCR. Our results utilizing humanized mice show potential efficacy for a targeted DNA vaccine against ZIKV in humans.
International Nuclear Information System (INIS)
Kim, Seung Jo; Suh, Dongchul; Park, Sang Eun; Park, Jeong-Sook; Byun, Hyang-Min; Lee, Chan; Lee, Sun Young; Kim, Inho; Oh, Yu-Kyoung
2003-01-01
To increase the potency of DNA vaccines, we constructed genetic fusion vaccines encoding antigen, secretion signal, and/or chemokine RANTES. The DNA vaccines encoding secreted hepatitis B surface antigen (HBsAg) were constructed by inserting HBsAg gene into an expression vector with an endoplasmic reticulum (ER)-targeting secretory signal sequence. The plasmid encoding secretory HBsAg (pER/HBs) was fused to cDNA of RANTES, generating pER/HBs/R. For comparison, HBsAg genes were cloned into pVAX1 vector with no signal sequence (pHBs), and further linked to the N-terminus of RANTES (pHBs/R). Immunofluorescence study showed the cytoplasmic localization of HBsAg protein expressed from pHBs and pHBs/R, but not from pER/HBs and pER/HBs/R at 48 h after transfection. In mice, RANTES-fused DNA vaccines more effectively elicited the levels of HBsAg-specific IgG antibodies than pHBs. All the DNA vaccines induced higher levels of IgG 2a rather than IgG 1 antibodies. Of RANTES-fused vaccines, pER/HBs/R encoding the secreted fusion protein revealed much higher humoral and CD8 + T cell-stimulating responses compared to pHBs/R. These results suggest that the immunogenicity of DNA vaccines could be enhanced by genetic fusion to a secretory signal peptide sequence and RANTES
Rondón-Barragán, Iang; Nozaki, Reiko; Hirono, Ikuo; Kondo, Hidehiro
2017-08-01
DNA vaccination is one method to protect farmed fish from viral and bacterial diseases. Chimeric antigens encoded by DNA vaccines have been shown to increase the resistance to viral diseases. Here, we sequenced the gene encoding lysosome-associated membrane protein-1 from Japanese flounder, Paralichthys olivaceus, (JfLAMP-1) and assessed its use in a chimeric DNA vaccine fused with the major capsule protein (MCP) from red seabream iridovirus (RSIV). JfLAMP-1 cDNA has a length of 1248 bp encoding 415 aa, which contains transmembrane and cytoplasmic domains. JfLAMP-1 is constitutively expressed in several tissues and its expression in spleen was upregulated following injection of formalin-killed cells (FKC) of Edwardsiella tarda. Immunofluorescence analysis showed that JfLAMP-1 is distributed in the small and large granules in the cytoplasm and groups close to the nucleus. The DNA encoding the luminal domain of JfLAMP-1 was replaced with the gene for the RSIV MCP, and the construct was cloned in an expression vector (pCIneo). Fish vaccinated with pCLAMP-MCP had significantly higher antibody levels than fish vaccinated with pCIneo vector harboring the MCP gene (p day 30 post-vaccination. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Soko Nuswantoro
2013-11-01
Full Text Available Koi herpesvirus (KHV is a herpesvirus that particularly infects and causes mass mortality to koi and common carp. Therefore, the protection of common carp from KHV infection is urgently needed. In this study, we developed an application of DNA vaccine encoding KHV glycoprotein-25 by immersion method to increase survival of common carp against KHV infection. A total of 400 common carp juveniles at 30-day-old were immersed in 1-L water containing 1.3×108CFU/mL of the killed Escherichia coli cells carrying DNA vaccine. Three frequencies and three duration of fish immersion were tested, namely: 1×30 minutes, 1×60 minutes, 1× 90 minutes, 2×90 minutes and 3×90 minutes by interval of 24 hours. Reversetranscription polymerase chain reaction analysis showed that DNA vaccine was successfully expressed in the vaccinated fish. Fish at twenty eight days post vaccination were challenged by injecting 10-4 mL of KHV per fish. The result showed that vaccination by 1×30 minutes immersion allowed 61% of fish survived, and this was significantly higher (p<0.05 compared to control (without vaccination, but it was similar among vaccination treatments (p>0.05. The relative percent survival of vaccinated fish were also similar among treatments (p>0.05. DNA vaccination has increased fish survival about two fold higher compared to unvaccinated fish control (26.67%. Thus, DNA vaccination was effectively delivered by immersion for 1×30 minutes, and this technique can be useful to level up the resistance of common carp juveniles against KHV infection. Keywords: DNA vaccine, KHV, glycoprotein, immersion, common carp
Modulation of immune response to rDNA hepatitis B vaccination by psychological stress
L. Jabaaij (Lea); J. van Hattum (Jan); A.J.J.M. Vingerhoets (Ad); F.G. Oostveen (Frank); H.J. Duivenvoorden (Hugo); R.E. Ballieux (Rudy)
1996-01-01
textabstractIn a previous study it was shown that antibody formation after vaccination with a low-dose recombinant DNA (rDNA) hepatitis B vaccine was negatively influenced by psychological stress. The present study was designed to assess whether the same inverse relation between HBs-antibody levels
Zhao, Yan; Cao, Yongsheng; Cui, Lihong; Ma, Bo; Mu, Xiaoyu; Li, Yanwei; Zhang, Zhihui; Li, Dan; Wei, Wei; Gao, Mingchun; Wang, Junwei
2014-01-01
DNA vaccine is a promising strategy for protection against virus infection. However, little is known on the efficacy of vaccination with two plasmids for expressing the glycoprotein D (gD) and glycoprotein B (gB) of duck enteritis virus (DEV) in inducing immune response and immunoprotection against virulent virus infection in Pekin ducks. In this study, two eukaryotic expressing plasmids of pcDNA3.1-gB and pcDNA3.1-gD were constructed. Following transfection, the gB and gD expressions in DF1 cells were detected. Groups of ducks were vaccinated with pcDNA3.1-gB and/or pcDNA3.1-gD, and boosted with the same vaccine on day 14 post primary vaccination. We found that intramuscular vaccinations with pcDNA3.1-gB and/or pcDNA3.1-gD, but not control plasmid, stimulated a high frequency of CD4+ and CD8+ T cells in Pekin ducks, particularly with both plasmids. Similarly, vaccination with these plasmids, particularly with both plasmids, promoted higher levels of neutralization antibodies against DEV in Pekin ducks. More importantly, vaccination with both plasmids significantly reduced the virulent DEV-induced mortality in Pekin ducks. Our data indicated that vaccination with plasmids for expressing both gB and gD induced potent cellular and humoral immunity against DEV in Pekin ducks. Therefore, this vaccination strategy may be used for the prevention of DEV infection in Pekin ducks.
Directory of Open Access Journals (Sweden)
Johannes S Gach
Full Text Available Little is known about the humoral immune response against DNA prime-recombinant adenovirus 5 (rAd5 boost HIV vaccine among HIV-infected patients on long-term suppressive antiretroviral therapy (ART. Previous studies emphasized cellular immune responses; however, current research suggests both cellular and humoral responses are likely required for a successful therapeutic vaccine. Thus, we aimed to understand antibody response and function induced by vaccination of ART-treated HIV-1-infected patients with immune recovery. All subjects participated in EraMune 02, an open-label randomized clinical trial of ART intensification followed by a six plasmid DNA prime (envA, envB, envC, gagB, polB, nefB and rAd5 boost HIV vaccine with matching inserts. Antibody binding levels were determined with a recently developed microarray approach. We also analyzed neutralization efficiency and antibody-dependent cellular cytotoxicity (ADCC. We found that the DNA prime-rAd5 boost vaccine induced a significant cross-clade HIV-specific antibody response, which correlated with antibody neutralization efficiency. However, despite the increase in antibody binding levels, the vaccine did not significantly stimulate neutralization or ADCC responses. This finding was also reflected by a lack of change in total CD4+ cell associated HIV DNA in those who received the vaccine. Our results have important implications for further therapeutic vaccine design and administration, especially in HIV-1 infected patients, as boosting of preexisting antibody responses are unlikely to lead to clearance of latent proviruses in the HIV reservoir.
An endogenous immune adjuvant released by necrotic cells for enhancement of DNA vaccine potency.
Dorostkar, Rohollah; Bamdad, Taravat; Parsania, Masoud; Pouriayevali, Hassan
2012-12-01
Improving vaccine potency in the induction of a strong cell-mediated cytotoxicity can enhance the efficacy of vaccines. Necrotic cells and the supernatant of necrotic tumor cells are attractive adjuvants, on account of their ability to recruit antigen-presenting cells to the site of antigen synthesis as well as its ability to stimulate the maturation of dendritic cells. To evaluate the utility of supernatant of necrotic tumor cells as a DNA vaccine adjuvant in a murine model. The supernatant of EL4 necrotic cells was co-administered with a DNA vaccine expressing the glycoprotein B of Herpes simplex virus-1 as an antigen model under the control of Cytomegalovirus promoter. C57BL/6 mice were vaccinated three times at two weeks intervals with glycoprotein B DNA vaccine and supernatant of necrotic EL4 cells. Five days after the last immunization, cell cytotoxicity, IFN-γ and IL-4 were evaluated. The obtained data showed that the production of IFN-γ from the splenocytes after antigenic stimulation in the presence of the supernatant of necrotic EL4 cells was significantly higher than the other groups (pEL4 cells in the mice immunized with DNA vaccine and supernatant of necrotic EL4 cells comparing to the other groups (p<0.001). The supernatant of necrotic cells contains adjuvant properties that can be considered as a candidate for tumor vaccination.
Griot, Christian; Moser, Christian; Cherpillod, Pascal; Bruckner, Lukas; Wittek, Riccardo; Zurbriggen, Andreas; Zurbriggen, Rinaldo
2004-01-26
Canine distemper (CD) is a disease in carnivores caused by CD virus (CDV), a member of the morbillivirus genus. It still is a threat to the carnivore and ferret population. The currently used modified attenuated live vaccines have several drawbacks of which lack of appropriate protection from severe infection is the most outstanding one. In addition, puppies up to the age of 6-8 weeks cannot be immunized efficiently due to the presence of maternal antibodies. In this study, a DNA prime modified live vaccine boost strategy was investigated in puppies in order to determine if vaccinated neonatal dogs induce a neutralizing immune response which is supposed to protect animals from a CDV challenge. Furthermore, a single DNA vaccination of puppies, 14 days after birth and in the presence of high titers of CDV neutralizing maternal antibodies, induced a clear and significant priming effect observed as early as 3 days after the subsequent booster with a conventional CDV vaccine. It was shown that the priming effect develops faster and to higher titers in puppies preimmunized with DNA 14 days after birth than in those vaccinated 28 days after birth. Our results demonstrate that despite the presence of maternal antibodies puppies can be vaccinated using the CDV DNA vaccine, and that this vaccination has a clear priming effect leading to a solid immune response after a booster with a conventional CDV vaccine.
Development of Tat-Conjugated Dendrimer for Transdermal DNA Vaccine Delivery.
Bahadoran, Azadeh; Moeini, Hassan; Bejo, Mohd Hair; Hussein, Mohd Zobir; Omar, Abdul Rahman
In order to enhance cellular uptake and to facilitate transdermal delivery of DNA vaccine, polyamidoamine (PAMAM) dendrimers conjugated with HIV transactivator of transcription (TAT) was developed. First, the plasmid DNA (pIRES-H5/GFP) nanoparticle was formulated using PAMAM dendrimer and TAT peptide and then characterized for surface charge, particle size, DNA encapsulation and protection of the pIRES-H5/GFP DNA plasmid to enzymatic digestion. Subsequently, the potency of the TAT-conjugated dendrimer for gene delivery was evaluated through in vitro transfection into Vero cells followed by gene expression analysis including western blotting, fluorescent microscopy and PCR. The effect of the TAT peptide on cellular uptake of DNA vaccine was studied by qRT-PCR and flow cytometry. Finally, the ability of TAT-conjugated PAMAM dendrimer for transdermal delivery of the DNA plasmid was assessed through artificial membranes followed by qRT-PCR and flow cytometry. TAT-conjugated PAMAM dendrimer showed the ability to form a compact and nanometre-sized polyplexes with the plasmid DNA, having the size range of 105 to 115 nm and a positive charge of +42 to +45 mV over the N/P ratio of 6:1(+/-). In vitro transfection analysis into Vero cells confirms the high potency of TAT-conjugated PAMAM dendrimer to enhance the cellular uptake of DNA vaccine. The permeability value assay through artificial membranes reveals that TAT-conjugated PAMAM has more capacity for transdermal delivery of the DNA compared to unmodified PAMAM dendrimer (Pdendrimer is a promising non-viral vector for transdermal use.This article is open to POST-PUBLICATION REVIEW. Registered readers (see "For Readers") may comment by clicking on ABSTRACT on the issue's contents page.
Directory of Open Access Journals (Sweden)
Li-Li Dong
2017-11-01
Full Text Available AIM: To investigate whether DNA vaccine encoding herpes simplex virus 1 (HSV-1 glycoprotein C (gC and glycoprotein D (gD will achieve better protective effect against herpes simplex keratitis (HSK than DNA vaccine encoding gD alone. METHODS: DNA vaccine expressing gD or gC combined gD (gD.gC were constructed and carried by chitosan nanoparticle. The expression of fusion protein gD and gC were detected in DNA/nanoparticle transfected 293T cells by Western-blot. For immunization, mice were inoculated with DNA/nanoparticle for 3 times with 2wk interval, and two weeks after the final immunization, the specific immune responses and clinical degrees of primary HSK were evaluated. RESULTS: Fusion protein gD.gC could be expressed successfully in cultured 293T cells. And, pRSC-gC.gD-IL21 DNA/chitosan nanoparticle could effectively elicit strongest humoral and cellular immune response in primary HSK mice evidenced by higher levels of specific neutralizing antibody and sIgA production, enhanced cytotoxicities of splenocytes and nature killer cells (NK, when compared with those of gD alone or mocked vaccine immunized mice. As a result, gC-based vaccine immunized mice showed least HSK disease. CONCLUSION: gC-based DNA vaccine could effectively prevent the progress of primary HSK, suggesting that this DNA vaccine could be a promising vaccine for HSK treatment in the future.
Dong, Li-Li; Tang, Ru; Zhai, Yu-Jia; Malla, Tejsu; Hu, Kai
2017-01-01
AIM To investigate whether DNA vaccine encoding herpes simplex virus 1 (HSV-1) glycoprotein C (gC) and glycoprotein D (gD) will achieve better protective effect against herpes simplex keratitis (HSK) than DNA vaccine encoding gD alone. METHODS DNA vaccine expressing gD or gC combined gD (gD.gC) were constructed and carried by chitosan nanoparticle. The expression of fusion protein gD and gC were detected in DNA/nanoparticle transfected 293T cells by Western-blot. For immunization, mice were inoculated with DNA/nanoparticle for 3 times with 2wk interval, and two weeks after the final immunization, the specific immune responses and clinical degrees of primary HSK were evaluated. RESULTS Fusion protein gD.gC could be expressed successfully in cultured 293T cells. And, pRSC-gC.gD-IL21 DNA/chitosan nanoparticle could effectively elicit strongest humoral and cellular immune response in primary HSK mice evidenced by higher levels of specific neutralizing antibody and sIgA production, enhanced cytotoxicities of splenocytes and nature killer cells (NK), when compared with those of gD alone or mocked vaccine immunized mice. As a result, gC-based vaccine immunized mice showed least HSK disease. CONCLUSION gC-based DNA vaccine could effectively prevent the progress of primary HSK, suggesting that this DNA vaccine could be a promising vaccine for HSK treatment in the future. PMID:29181304
Best, Simon R.; Peng, Shiwen; Juang, Chi-Mou; Hung, Chien-Fu; Hannaman, Drew; Saunders, John R.; Wu, T.-C.; Pai, Sara I.
2009-01-01
DNA vaccines are an attractive approach to eliciting antigen-specific immunity. Intracellular targeting of tumor antigens through its linkage to immunostimulatory molecules such as calreticulin (CRT) can improve antigen processing and presentation through the MHC Class I pathway and increase cytotoxic CD8+ T cell production. However, even with these enhancements, the efficacy of such immunotherapeutic strategies is dependent on the identification of an effective route and method of DNA administration. Electroporation and gene gun-mediated particle delivery are leading methods of DNA vaccine delivery that can generate protective and therapeutic levels of immune responses in experimental models. In this study, we perform a head-to-head comparison of three methods of vaccination – conventional intramuscular injection, electroporation mediated intramuscular delivery, and epidermal gene gun-mediated particle delivery - in the ability to generate antigen specific cytotoxic CD8+ T cell responses as well as anti-tumor immune responses against an HPV-16 E7 expressing tumor cell line using the pNGVL4a-CRT/E7(detox) DNA vaccine. Vaccination via electroporation generated the highest number of E7-specific cytotoxic CD8+ T cells, which correlated to improved outcomes in the treatment of growing tumors. In addition, we demonstrate that electroporation results in significantly higher levels of circulating protein compared to gene gun or intramuscular vaccination, which likely enhances calreticulin’s role as a local tumor anti-angiogenesis agent. We conclude that electroporation is a promising method for delivery of HPV DNA vaccines and should be considered for DNA vaccine delivery in human clinical trials. PMID:19622402
Increased humoral immunity by DNA vaccination using an alpha-tocopherol-based adjuvant
DEFF Research Database (Denmark)
Karlsson, Ingrid; Borggren, Marie; Nielsen, Jens
2017-01-01
approaches. We tested whether the emulsion-based and alpha-tocopherol containing adjuvant Diluvac Forte® has the ability to enhance the immunogenicity of a naked DNA vaccine (i.e., plasmid DNA). As a model vaccine, we used plasmids encoding both a surface-exposed viral glycoprotein (hemagglutinin......) and an internal non-glycosylated nucleoprotein in the Th1/Th2 balanced CB6F1 mouse model. The naked DNA (50 µg) was premixed at a 1:1 volume/volume ratio with Diluvac Forte®, an emulsion containing different concentrations of alpha-tocopherol, the emulsion alone or endotoxin-free phosphate-buffered saline (PBS......). The animals received two intracutaneous immunizations spaced 3 weeks apart. When combined with Diluvac Forte® or the emulsion containing alpha-tocopherol, the DNA vaccine induced a more potent and balanced immunoglobulin G (IgG)1 and IgG2c response, and both IgG subclass responses were significantly enhanced...
Can VHS Virus Bypass the Protective Immunity Induced by DNA Vaccination in Rainbow Trout?
Directory of Open Access Journals (Sweden)
Dagoberto Sepúlveda
Full Text Available DNA vaccines encoding viral glycoproteins have been very successful for induction of protective immunity against diseases caused by rhabdoviruses in cultured fish species. However, the vaccine concept is based on a single viral gene and since RNA viruses are known to possess high variability and adaptation capacity, this work aimed at evaluating whether viral haemorrhagic septicaemia virus (VHSV, an RNA virus and member of Rhabdoviridae family, was able to evade the protective immune response induced by the DNA vaccination of rainbow trout. The experiments comprised repeated passages of a highly pathogenic VHSV isolate in a fish cell line in the presence of neutralizing fish serum (in vitro approach, and in rainbow trout immunized with the VHS DNA vaccine (in vivo approach. For the in vitro approach, the virus collected from the last passage (passaged virus was as sensitive as the parental virus to serum neutralization, suggesting that the passaging did not promote the selection of virus populations able to bypass the neutralization by serum antibodies. Also, in the in vivo approach, where virus was passaged several times in vaccinated fish, no increased virulence nor increased persistence in vaccinated fish was observed in comparison with the parental virus. However, some of the vaccinated fish did get infected and could transmit the infection to naïve cohabitant fish. The results demonstrated that the DNA vaccine induced a robust protection, but also that the immunity was non-sterile. It is consequently important not to consider vaccinated fish as virus free in veterinary terms.
A Multiantigenic DNA Vaccine That Induces Broad Hepatitis C Virus-Specific T-Cell Responses in Mice.
Gummow, Jason; Li, Yanrui; Yu, Wenbo; Garrod, Tamsin; Wijesundara, Danushka; Brennan, Amelia J; Mullick, Ranajoy; Voskoboinik, Ilia; Grubor-Bauk, Branka; Gowans, Eric J
2015-08-01
There are 3 to 4 million new hepatitis C virus (HCV) infections annually around the world, but no vaccine is available. Robust T-cell mediated responses are necessary for effective clearance of the virus, and DNA vaccines result in a cell-mediated bias. Adjuvants are often required for effective vaccination, but during natural lytic viral infections damage-associated molecular patterns (DAMPs) are released, which act as natural adjuvants. Hence, a vaccine that induces cell necrosis and releases DAMPs will result in cell-mediated immunity (CMI), similar to that resulting from natural lytic viral infection. We have generated a DNA vaccine with the ability to elicit strong CMI against the HCV nonstructural (NS) proteins (3, 4A, 4B, and 5B) by encoding a cytolytic protein, perforin (PRF), and the antigens on a single plasmid. We examined the efficacy of the vaccines in C57BL/6 mice, as determined by gamma interferon enzyme-linked immunosorbent spot assay, cell proliferation studies, and intracellular cytokine production. Initially, we showed that encoding the NS4A protein in a vaccine which encoded only NS3 reduced the immunogenicity of NS3, whereas including PRF increased NS3 immunogenicity. In contrast, the inclusion of NS4A increased the immunogenicity of the NS3, NS4B, andNS5B proteins, when encoded in a DNA vaccine that also encoded PRF. Finally, vaccines that also encoded PRF elicited similar levels of CMI against each protein after vaccination with DNA encoding NS3, NS4A, NS4B, and NS5B compared to mice vaccinated with DNA encoding only NS3 or NS4B/5B. Thus, we have developed a promising "multiantigen" vaccine that elicits robust CMI. Since their development, vaccines have reduced the global burden of disease. One strategy for vaccine development is to use commercially viable DNA technology, which has the potential to generate robust immune responses. Hepatitis C virus causes chronic liver infection and is a leading cause of liver cancer. To date, no vaccine is
Rapid outer-surface protein C DNA tattoo vaccination protects against Borrelia afzelii infection
Wagemakers, A.; Mason, L. M. K.; Oei, A.; de Wever, B.; van der Poll, T.; Bins, A. D.; Hovius, J. W. R.
2014-01-01
Borrelia afzelii is the predominant Borrelia species causing Lyme borreliosis in Europe. Currently there is no human vaccine against Lyme borreliosis, and most research focuses on recombinant protein vaccines against Borrelia burgdorferi sensu stricto. DNA tattooing is a novel vaccination method
Complementing nuclear techniques with DNA vaccine technologies for improving animal health
International Nuclear Information System (INIS)
Relucio, J.L.V.; Dacanay, M.E.K.; Maligalig, A.C.S.; Ramos, E.A.; Santos, A.D.; Torres-Villanueva, C.A.T.; Osorio, R.G.; Deocaris, C.C.
2005-01-01
The use of nuclear methods can enhance several features of DNA vaccines in protecting livestock against pathogens. While DNA vaccines already have several advantages over their traditional predecessors (e.g. cheap production, stability over a wide range of temperature, amenability to genetic manipulation, and no risk of reversion to pathogenicity), conventional gene delivery systems make immunization of livestock and aquaculture populations tedious. For this reason, we are developing radiation-synthesized intelligent delivery systems for DNA vaccines. We encapsulated a reporter construct pCMV·SPORT-β-gal in radiation-synthesized κ-carrageenan-polyvinylpyrrolidone microspheres IP20 (for stomach release) and IP18 (for intestinal release). The DNA-loaded polymers were orally administered to Oreochromis niloticus (black Nile tilapia), and whole organs were stained with X-gal to observe β-galactosidase activity. Intense staining was observed in the stomach regions with IP20, while minimal staining was observed with IP18. The gills, in contrast, did not express β-galactosidase activity. Our results show evidence of the successful gene delivery capabilities of radiation-synthesized microspheres. When monitoring the progress of an animal's immune response after DNA immunization, non-invasive and sensitive methods are preferred. We also evaluated chicken egg-yolk polyclonal antibody response (chIgY) after direct intramuscular inoculation of the Hepatitis B Surface antigen expression vector pRc/CMV-HBs(S). Radioimmunoassay (RIA) was done to maximize sensitivity for determining antibody levels. Polyclonal antibody titres were observed to have increased after six weeks. Results of the RIA using the chIgY were comparable to that of immunized sera. Our findings indicate that chIgY could offer a cheaper and more animal-friendly antibody source and could be derived with the advantage of epitope specificity through DNA vaccination. (author)
Optimised electroporation mediated DNA vaccination for treatment of prostate cancer.
LENUS (Irish Health Repository)
Ahmad, Sarfraz
2010-01-01
ABSTRACT: BACKGROUND: Immunological therapies enhance the ability of the immune system to recognise and destroy cancer cells via selective killing mechanisms. DNA vaccines have potential to activate the immune system against specific antigens, with accompanying potent immunological adjuvant effects from unmethylated CpG motifs as on prokaryotic DNA. We investigated an electroporation driven plasmid DNA vaccination strategy in animal models for treatment of prostate cancer. METHODS: Plasmid expressing human PSA gene (phPSA) was delivered in vivo by intra-muscular electroporation, to induce effective anti-tumour immune responses against prostate antigen expressing tumours. Groups of male C57 BL\\/6 mice received intra-muscular injections of phPSA plasmid. For phPSA delivery, quadriceps muscle was injected with 50 mug plasmid. After 80 seconds, square-wave pulses were administered in sequence using a custom designed pulse generator and acustom-designed applicator with 2 needles placed through the skin central to the muscle. To determine an optimum treatment regimen, three different vaccination schedules were investigated. In a separate experiment, the immune potential of the phPSA vaccine was further enhanced with co- administration of synthetic CpG rich oligonucleotides. One week after last vaccination, the mice were challenged subcutaneously with TRAMPC1\\/hPSA (prostate cancer cell line stably expressing human PSA) and tumour growth was monitored. Serum from animals was examined by ELISA for anti-hPSA antibodies and for IFNgamma. Histological assessment of the tumours was also carried out. In vivo and in vitro cytotoxicity assays were performed with splenocytes from treated mice. RESULTS: The phPSA vaccine therapy significantly delayed the appearance of tumours and resulted in prolonged survival of the animals. Four-dose vaccination regimen provided optimal immunological effects. Co - administration of the synthetic CpG with phPSA increased anti-tumour responses
Can VHS virus bypass the protective immunity induced by DNA vaccination in rainbow trout?
DEFF Research Database (Denmark)
Sepúlveda, Dagoberto; Lorenzen, Niels
2016-01-01
DNA vaccines encoding viral glycoproteins have been very successful for induction of protective immunity against diseases caused by rhabdoviruses in cultured fish species. However, the vaccine concept is based on a single viral gene and since RNA viruses are known to possess high variability...... and adaptation capacity, this work aimed at evaluating whether viral haemorrhagic septicaemia virus (VHSV), an RNA virus and member of Rhabdoviridae family, was able to evade the protective immune response induced by the DNA vaccination of rainbow trout. The experiments comprised repeated passages of a highly...... pathogenic VHSV isolate in a fish cell line in the presence of neutralizing fish serum (in vitro approach), and in rainbow trout immunized with the VHS DNA vaccine (in vivo approach). For the in vitro approach, the virus collected from the last passage (passaged virus) was as sensitive as the parental virus...
Xenogeneic murine tyrosinase DNA vaccine for malignant melanoma of the digit of dogs.
Manley, C A; Leibman, N F; Wolchok, J D; Rivière, I C; Bartido, S; Craft, D M; Bergman, P J
2011-01-01
Malignant melanoma of dogs is a highly aggressive neoplasm and is the 2nd most common digit tumor. Metastatic disease is a common sequela for which few effective treatment options exist. Studies show that xenogeneic tyrosinase DNA vaccination yields immune responses and prolongation of survival in dogs with oral malignant melanoma. Describe clinical findings and tumor characteristics of a cohort of dogs with digit malignant melanoma, and evaluate the prognostic utility of a proposed staging system. Determine if a novel xenogeneic DNA vaccine is safe and potentially effective for treatment of dogs with digit melanoma. Fifty-eight dogs with digit malignant melanoma treated at the Animal Medical Center between 2004 and 2007. Retrospective, medical records review of dogs with digit melanoma treated with xenogeneic DNA vaccine. Overall median survival time (MST) for dogs treated with loco-regional control and xenogeneic DNA vaccine was 476 days with a 1-year survival rate of 63%. MST for dogs presenting with metastasis was 105 days versus 533 days for dogs presenting without metastasis (P dogs in the latter group were alive at 2 and 3 years. A proposed staging system proved prognostic with stages I-IV dogs surviving >952, >1,093, 321, and 76 days, respectively. The xenogeneic murine tyrosinase DNA vaccine was safe and appears effective when used in conjunction with local and regional disease control. The proposed staging system was prognostic in this study and future studies might benefit from utilizing this staging system. Copyright © 2010 by the American College of Veterinary Internal Medicine.
Holechek, Susan A; McAfee, Megan S; Nieves, Lizbeth M; Guzman, Vanessa P; Manhas, Kavita; Fouts, Timothy; Bagley, Kenneth; Blattman, Joseph N
2016-11-04
In order for vaccines to induce efficacious immune responses against mucosally transmitted pathogens, such as HIV-1, activated lymphocytes must efficiently migrate to and enter targeted mucosal sites. We have previously shown that all-trans retinoic acid (ATRA) can be used as a vaccine adjuvant to enhance mucosal CD8 + T cell responses during vaccination and improve protection against mucosal viral challenge. However, the ATRA formulation is incompatible with most recombinant vaccines, and the teratogenic potential of ATRA at high doses limits its usage in many clinical settings. We hypothesized that increasing in vivo production of retinoic acid (RA) during vaccination with a DNA vector expressing retinaldehyde dehydrogenase 2 (RALDH2), the rate-limiting enzyme in RA biosynthesis, could similarly provide enhanced programming of mucosal homing to T cell responses while avoiding teratogenic effects. Administration of a RALDH2- expressing plasmid during immunization with a HIVgag DNA vaccine resulted in increased systemic and mucosal CD8 + T cell numbers with an increase in both effector and central memory T cells. Moreover, mice that received RALDH2 plasmid during DNA vaccination were more resistant to intravaginal challenge with a recombinant vaccinia virus expressing the same HIVgag antigen (VACVgag). Thus, RALDH2 can be used as an alternative adjuvant to ATRA during DNA vaccination leading to an increase in both systemic and mucosal T cell immunity and better protection from viral infection at mucosal sites. Copyright © 2016 Elsevier Ltd. All rights reserved.
Increase in DNA vaccine efficacy by virosome delivery and co-expression of a cytolytic protein.
Gargett, Tessa; Grubor-Bauk, Branka; Miller, Darren; Garrod, Tamsin; Yu, Stanley; Wesselingh, Steve; Suhrbier, Andreas; Gowans, Eric J
2014-06-01
The potential of DNA vaccines has not been realised due to suboptimal delivery, poor antigen expression and the lack of localised inflammation, essential for antigen presentation and an effective immune response to the immunogen. Initially, we examined the delivery of a DNA vaccine encoding a model antigen, luciferase (LUC), to the respiratory tract of mice by encapsulation in a virosome. Virosomes that incorporated influenza virus haemagglutinin effectively delivered DNA to cells in the mouse respiratory tract and resulted in antigen expression and systemic and mucosal immune responses to the immunogen after an intranasal (IN) prime/intradermal (ID) boost regimen, whereas a multidose ID regimen only generated systemic immunity. We also examined systemic immune responses to LUC after ID vaccination with a DNA vaccine, which also encoded one of the several cytolytic or toxic proteins. Although the herpes simplex virus thymidine kinase, in the presence of the prodrug, ganciclovir, resulted in cell death, this failed to increase the humoral or cell-mediated immune responses. In contrast, the co-expression of LUC with the rotavirus non-structural protein 4 (NSP4) protein or a mutant form of mouse perforin, proteins which are directly cytolytic, resulted in increased LUC-specific humoral and cell-mediated immunity. On the other hand, co-expression of LUC with diphtheria toxin subunit A or overexpression of perforin or NSP4 resulted in a lower level of immunity. In summary, the efficacy of DNA vaccines can be improved by targeted IN delivery of DNA or by the induction of cell death in vaccine-targeted cells after ID delivery.
Energy Technology Data Exchange (ETDEWEB)
Yamshchikov, Vladimir, E-mail: yaximik@gmail.com; Manuvakhova, Marina; Rodriguez, Efrain; Hébert, Charles
2017-01-15
ABSTRACT: For the development of a human West Nile (WN) infectious DNA (iDNA) vaccine, we created highly attenuated chimeric virus W1806 with the serological identity of highly virulent WN-NY99. Earlier, we attempted to utilize mutations found in the E protein of the SA14-14-2 vaccine to bring safety of W1806 to the level acceptable for human use (). Here, we analyzed effects of the SA14-14-2 changes on growth properties and neurovirulence of W1806. A set including the E138K, K279M, K439R and G447D changes was identified as the perspective subset for satisfying the target safety profile without compromising immunogenicity of the vaccine candidate. The genetic stability of the attenuated phenotype was found to be unsatisfactory being dependent on a subset of attenuating changes incorporated in W1806. Elucidation of underlying mechanisms influencing selection of pathways for restoration of the envelope protein functionality will facilitate resolution of the emerged genetic stability issue. - Highlights: •Effect of mutations in E on properties of WN1806 is determined. •A subset of attenuating mutations suitable for a human vaccine is defined. •Mechanism of attenuation is proposed and illustrated. •Underlying mechanisms of neurovirulence reversion are suggested.
Li-Li Dong; Ru Tang; Yu-Jia Zhai; Tejsu Malla; Kai Hu
2017-01-01
AIM: To investigate whether DNA vaccine encoding herpes simplex virus 1 (HSV-1) glycoprotein C (gC) and glycoprotein D (gD) will achieve better protective effect against herpes simplex keratitis (HSK) than DNA vaccine encoding gD alone. METHODS: DNA vaccine expressing gD or gC combined gD (gD.gC) were constructed and carried by chitosan nanoparticle. The expression of fusion protein gD and gC were detected in DNA/nanoparticle transfected 293T cells by Western-blot. For immunization, mice w...
Ghaffarifar, Fatemeh; Jorjani, Ogholniaz; Sharifi, Zohreh; Dalimi, Abdolhossein; Hassan, Zuhair M; Tabatabaie, Fatemeh; Khoshzaban, Fariba; Hezarjaribi, Hajar Ziaei
2013-04-01
Leishmaniasis is an important disease in humans. Leishmania homologue of receptor for Activated C Kinase (LACK) and thiol specific antioxidant (TSA) as immuno-dominant antigens of Leishmania major are considered the most promising molecules for a DNA vaccine. We constructed a DNA cocktail, containing plasmids encoding LACK and TSA genes of Leishmania major and evaluated the immune response and survival rate in BALB/c mice. IgG and Interferon gamma values were noticeably increased in the immunized group with DNA cocktail vaccine, which were significantly higher than those in the single-gene vaccinated and control groups (p 0.05). The immunized mice with the cocktail DNA vaccine presented a considerable reduction in diameter of lesion compared to other groups and a significant difference was observed (p < 0.05) in this regard. The survival time of the immunized mice with the cocktail DNA vaccine was significantly higher than that in the other groups (p < 0.05) after their being challenged with Leishmania major. The findings of this study indicated that the cocktail DNA vaccine increased the cellular response and survival rate and induced protection against infection with Leishmania in the mice. © 2012 The Authors © 2012 APMIS.
Calarota, Sandra A; Weiner, David B
2004-06-01
It is clear that the development of a safe and effective vaccine for human immunodeficiency virus type 1 (HIV-1) remains a crucial goal for controlling the acquired immunodeficiency syndrome epidemic. At present, it is not clear what arm of the immune response correlates with protection from HIV-1 infection or disease. Therefore, a strong cellular and humoral immune response will likely be needed to control this infection. Among different vaccine alternatives, DNA vaccines appeared more than a decade ago, demonstrating important qualities of inducing both humoral and cellular immune responses in animal models. However, after several years and various clinical studies in humans, supporting the safety of the HIV-DNA vaccine strategies, it has become clear that their potency should be improved. One way to modulate and enhance the immune responses induced by a DNA vaccine is by including genetic adjuvants such as cytokines, chemokines, or T-cell costimulatory molecules as part of the vaccine itself. Particularly, vaccine immunogenicity can be modulated by factors that attract professional antigen-presenting cells, provide additional costimulation, or enhance the uptake of plasmid DNA. This review focuses on developments in the coadministration of molecular adjuvants for the enhancement of HIV-1 DNA-vaccine potency.
Wang, Fei; Chen, Quanjiao; Li, Shuntang; Zhang, Chenyao; Li, Shanshan; Liu, Min; Mei, Kun; Li, Chunhua; Ma, Lixin; Yu, Xiaolan
2017-06-01
Linear DNA vaccines provide effective vaccination. However, their application is limited by high cost and small scale of the conventional polymerase chain reaction (PCR) generally used to obtain sufficient amounts of DNA effective against epidemic diseases. In this study, a two-step, large-scale PCR was established using a low-cost DNA polymerase, RKOD, expressed in Pichia pastoris. Two linear DNA vaccines encoding influenza H1N1 hemagglutinin (HA) 1, LEC-HA, and PTO-LEC-HA (with phosphorothioate-modified primers), were produced by the two-step PCR. Protective effects of the vaccines were evaluated in a mouse model. BALB/c mice were immunized three times with the vaccines or a control DNA fragment. All immunized animals were challenged by intranasal administration of a lethal dose of influenza H1N1 virus 2 weeks after the last immunization. Sera of the immunized animals were tested for the presence of HA-specific antibodies, and the total IFN-γ responses induced by linear DNA vaccines were measured. The results showed that the DNA vaccines but not the control DNA induced strong antibody and IFN-γ responses. Additionally, the PTO-LEC-HA vaccine effectively protected the mice against the lethal homologous mouse-adapted virus, with a survival rate of 100% versus 70% in the LEC-HA-vaccinated group, showing that the PTO-LEC-HA vaccine was more effective than LEC-HA. In conclusion, the results indicated that the linear H1N1 HA-coding DNA vaccines induced significant immune responses and protected mice against a lethal virus challenge. Thus, the low-cost, two-step, large-scale PCR can be considered a potential tool for rapid manufacturing of linear DNA vaccines against emerging infectious diseases. Copyright © 2017 Elsevier B.V. All rights reserved.
DNA vaccination of pigs with open reading frame 1-7 of PRRS virus
DEFF Research Database (Denmark)
Barfoed, Annette Malene; Blixenkrone-Møller, Merete; Jensen, Merethe Holm
2004-01-01
We cloned all open reading frames of a Danish isolate of porcine reproductive and respiratory syndrome (PRRS) virus in DNA vaccination vectors. Pigs were vaccinated using a gene gun with each single construct (ORF1, ORF2, ORF3, ORF4, ORF5, ORF6, or ORF7) or combinations thereof. Vaccination...
Cervantes-Villagrana, Alberto R; Hernández-Pando, Rogelio; Biragyn, Arya; Castañeda-Delgado, Julio; Bodogai, Monica; Martínez-Fierro, Margarita; Sada, Eduardo; Trujillo, Valentin; Enciso-Moreno, Antonio; Rivas-Santiago, Bruno
2013-01-11
The World Health Organization (WHO) has estimated that there are about 8 million new cases annually of active Tuberculosis (TB). Despite its irregular effectiveness (0-89%), the Bacillus Calmette-Guérin) BCG is the only vaccine available worldwide for prevention of TB; thus, the design is important of novel and more efficient vaccination strategies. Considering that β-defensin-2 is an antimicrobial peptide that induces dendritic cell maturation through the TLR-4 receptor and that both ESAT-6 and Ag85B are immunodominant mycobacterial antigens and efficient activators of the protective immune response, we constructed two DNA vaccines by the fusion of the gene encoding β-defensin-2 and antigens ESAT6 (pDE) and 85B (pDA). After confirming efficient local antigen expression that induced high and stable Interferon gamma (IFN-γ) production in intramuscular (i.m.) vaccinated Balb/c mice, groups of mice were vaccinated with DNA vaccines in a prime-boost regimen with BCG and with BCG alone, and 2 months later were challenged with the mild virulence reference strain H37Rv and the highly virulent clinical isolate LAM 5186. The level of protection was evaluated by survival, lung bacilli burdens, and extension of tissue damage (pneumonia). Vaccination with both DNA vaccines showed similar protection to that of BCG. After the challenge with the highly virulent Mycobacterium tuberculosis strain, animals that were prime-boosted with BCG and then boosted with both DNA vaccines showed significant higher survival and less tissue damage than mice vaccinated only with BCG. These results suggest that improvement of BCG vaccination, such as the prime-boost DNA vaccine, represents a more efficient vaccination scheme against TB. Copyright © 2012 Elsevier Ltd. All rights reserved.
Encoded novel forms of HSP70 or a cytolytic protein increase DNA vaccine potency.
Garrod, Tamsin; Grubor-Bauk, Branka; Yu, Stanley; Gargett, Tessa; Gowans, Eric J
2014-01-01
In humans, DNA vaccines have failed to demonstrate the equivalent levels of immunogenicity that were shown in smaller animals. Previous studies have encoded adjuvants, predominantly cytokines, within these vaccines in an attempt to increase antigen-specific immune responses. However, these strategies have lacked breadth of innate immune activation and have led to disappointing results in clinical trials. Damage associated molecular patterns (DAMPs) have been identified as pattern recognition receptor (PRR) agonists. DAMPs can bind to a wide range of PRRs on dendritic cells (DCs) and thus our studies have aimed to utilize this characteristic to act as an adjuvant in a DNA vaccine approach. Specifically, HSP70 has been identified as a DAMP, but has been limited by its lack of accessibility to PRRs in and on DCs. Here, we discuss the promising results achieved with the inclusion of membrane-bound or secreted HSP70 into a DNA vaccine encoding HIV gag as the model immunogen.
Patial, Sonika; Chaturvedi, V K; Rai, A; Saini, M; Chandra, Rajesh; Saini, Y; Gupta, Praveen K
2007-05-16
A bicistronic DNA vaccine against rabies and parvovirus infection of dogs was developed by subcloning rabies glycoprotein and canine parvovirus (CPV) VP2 genes into a bicistronic vector. After characterizing the expression of both the proteins in vitro, the bicistronic DNA vaccine was injected in mice and induced immune response was compared with monocistronic DNA vaccines. There was no significant difference in ELISA and virus neutralizing (VN) antibody responses against rabies and CPV in mice immunized with either bicistronic or monocistronic DNA vaccine. Further, there was significantly similar protection in mice immunized with either bicistronic or monocistronic rabies DNA vaccine on rabies virus challenge. Similarly, dogs immunized with monocistronic and bicistronic DNA vaccines developed comparable VN antibodies against rabies and CPV. This study indicated that bicistronic DNA vaccine can be used in dogs to induce virus neutralizing immune responses against both rabies and CPV.
International Nuclear Information System (INIS)
Rajapaksa, A.E.; Qi, Aisha; Yeo, L.; Friend, J.
2010-01-01
Full text: The increase in the need for effective delivery of potelll vaccines against infectious diseases, require robust yet straightforward pro duction of encapsulated DNA-laden aerosols. Aerosol delivery of drugs represents the next generation of vaccine delivery where the drug is deposited into the lung, which provides an ideal, non-invasive route. Moreover, several features of D A vaccines make them more attractive than conventional vaccines; thus, DNA vaccines have gained global interest for a variety of applications. However, several limitations such as ineffective cellular uptake and intracellular delivery, and degradation of DNA need to be overcome before clin ical applications. In this study, a novel and scalable engineered technique has been developed to create a biodegradable polymer system, which enables controlled delivery of a well designed DNA vaccine for immuno-therapeutics. Surface Acoustic Wave (SAW) atomisation has been found as useful mechanism for atomising fluid samples for medical and industrial devices. It is a straightforward method for synthesising un-agglomerated biodegradable nanoparti cles (<250 nm) in the absence of organic solvents which would represent a major breakthrough for biopharmaceutical encapsulation and delivery. Nano-scale polymer particles for DNA vaccines deliv ery were obtained through an evaporative process of the initial aerosol created by surface acoustic waves at 8-150 MHz, the final size of which could be controlled by modifying the initial polymer concen tration and solid contents. Thus, SAW atomiser represents a promising alternative for the development of a low power device for producing nano-engineered vaccines with a controlled and narrow size distribution as delivery system for genetic immuno-therapeutics.
Directory of Open Access Journals (Sweden)
Xiaoyan Zheng
2017-05-01
Full Text Available Dengue virus (DV is the causal pathogen of dengue fever, which is one of the most rapidly spread mosquito-borne disease worldwide and has become a severe public health problem. Currently, there is no specific treatment for dengue; thus, a vaccine would be an effective countermeasure to reduce the morbidity and mortality. Although, the chimeric Yellow fever dengue tetravalent vaccine has been approved in some countries, it is still necessary to develop safer, more effective, and less costly vaccines. In this study, a DNA vaccine candidate pVAX1-D1ME expressing the prME protein of DV1 was inoculated in BALB/c mice via intramuscular injection or electroporation, and the immunogenicity and protection were evaluated. Compared with traditional intramuscular injection, administration with 50 μg pVAX1-D1ME via electroporation with three immunizations induced persistent humoral and cellular immune responses and effectively protected mice against lethal DV1 challenge. In addition, immunization with a bivalent vaccine consisting of pVAX1-D1ME and pVAX1-D2ME via electroporation generated a balanced IgG response and neutralizing antibodies against DV1 and DV2 and could protect mice from lethal challenge with DV1 and DV2. This study sheds new light on developing a dengue tetravalent DNA vaccine.
Zheng, Xiaoyan; Chen, Hui; Wang, Ran; Fan, Dongying; Feng, Kaihao; Gao, Na; An, Jing
2017-01-01
Dengue virus (DV) is the causal pathogen of dengue fever, which is one of the most rapidly spread mosquito-borne disease worldwide and has become a severe public health problem. Currently, there is no specific treatment for dengue; thus, a vaccine would be an effective countermeasure to reduce the morbidity and mortality. Although, the chimeric Yellow fever dengue tetravalent vaccine has been approved in some countries, it is still necessary to develop safer, more effective, and less costly vaccines. In this study, a DNA vaccine candidate pVAX1-D1ME expressing the prME protein of DV1 was inoculated in BALB/c mice via intramuscular injection or electroporation, and the immunogenicity and protection were evaluated. Compared with traditional intramuscular injection, administration with 50 μg pVAX1-D1ME via electroporation with three immunizations induced persistent humoral and cellular immune responses and effectively protected mice against lethal DV1 challenge. In addition, immunization with a bivalent vaccine consisting of pVAX1-D1ME and pVAX1-D2ME via electroporation generated a balanced IgG response and neutralizing antibodies against DV1 and DV2 and could protect mice from lethal challenge with DV1 and DV2. This study sheds new light on developing a dengue tetravalent DNA vaccine.
Directory of Open Access Journals (Sweden)
Matthias Tenbusch
Full Text Available BACKGROUND: Targeting antigens encoded by DNA vaccines to dendritic cells (DCs in the presence of adjuvants enhances their immunogenicity and efficacy in mice. METHODOLOGY/PRINCIPAL FINDINGS: To explore the immunogenicity of this approach in non-human primates, we generated a single chain antibody to the antigen uptake receptor DEC-205 expressed on rhesus macaque DCs. DNA vaccines encoding this single chain antibody fused to the SIV capsid protein were delivered to six monkeys each by either intramuscular electroporation or conventional intramuscular injection co-injected or not with poly ICLC, a stabilized poly I: C analogue, as adjuvant. Antibodies to capsid were induced by the DC-targeting and non-targeting control DNA delivered by electroporation while conventional DNA immunization at a 10-fold higher dose of DNA failed to induce detectable humoral immune responses. Substantial cellular immune responses were also observed after DNA electroporation of both DNAs, but stronger responses were induced by the non-targeting vaccine. Conventional immunization with the DC-targeting DNA at a 10-fold higher dose did not give rise to substantial cellular immune responses, neither when co-injected with poly ICLC. CONCLUSIONS/SIGNIFICANCE: The study confirms the potent immunogenicity of DNA vaccines delivered by electroporation. Targeting the DNA via a single chain antibody to DEC-205 expressed by DCs, however, does not improve the immunogenicity of the antigens in non-human primates.
Nielsen, Line; Jensen, Trine Hammer; Kristensen, Birte; Jensen, Tove Dannemann; Karlskov-Mortensen, Peter; Lund, Morten; Aasted, Bent; Blixenkrone-Møller, Merete
2012-10-01
Immunity induced by DNA vaccines containing the hemagglutinin (H) and nucleoprotein (N) genes of wild-type and attenuated canine distemper virus (CDV) was investigated in mink (Mustela vison), a highly susceptible natural host of CDV. All DNA-immunized mink seroconverted, and significant levels of virus-neutralizing (VN) antibodies were present on the day of challenge with wild-type CDV. The DNA vaccines also primed the cell-mediated memory responses, as indicated by an early increase in the number of interferon-gamma (IFN-γ)-producing lymphocytes after challenge. Importantly, the wild-type and attenuated CDV DNA vaccines had a long-term protective effect against wild-type CDV challenge. The vaccine-induced immunity induced by the H and N genes from wild-type CDV and those from attenuated CDV was comparable. Because these two DNA vaccines were shown to protect equally well against wild-type virus challenge, it is suggested that the genetic/antigenic heterogeneity between vaccine strains and contemporary wild-type strains are unlikely to cause vaccine failure.
DNA vaccination protects mice against Zika virus-induced damage to the testes
Griffin, Bryan D.; Muthumani, Kar; Warner, Bryce M.; Majer, Anna; Hagan, Mable; Audet, Jonathan; Stein, Derek R.; Ranadheera, Charlene; Racine, Trina; De La Vega, Marc-Antoine; Piret, Jocelyne; Kucas, Stephanie; Tran, Kaylie N.; Frost, Kathy L.; De Graff, Christine; Soule, Geoff; Scharikow, Leanne; Scott, Jennifer; McTavish, Gordon; Smid, Valerie; Park, Young K.; Maslow, Joel N.; Sardesai, Niranjan Y.; Kim, J. Joseph; Yao, Xiao-jian; Bello, Alexander; Lindsay, Robbin; Boivin, Guy; Booth, Stephanie A.; Kobasa, Darwyn; Embury-Hyatt, Carissa; Safronetz, David; Weiner, David B.; Kobinger, Gary P.
2017-01-01
Zika virus (ZIKV) is an emerging pathogen causally associated with serious sequelae in fetuses, inducing fetal microcephaly and other neurodevelopment defects. ZIKV is primarily transmitted by mosquitoes, but can persist in human semen and sperm, and sexual transmission has been documented. Moreover, exposure of type-I interferon knockout mice to ZIKV results in severe damage to the testes, epididymis and sperm. Candidate ZIKV vaccines have shown protective efficacy in preclinical studies carried out in animal models, and several vaccines have entered clinical trials. Here, we report that administration of a synthetic DNA vaccine encoding ZIKV pre-membrane and envelope (prME) completely protects mice against ZIKV-associated damage to the testes and sperm and prevents viral persistence in the testes following challenge with a contemporary strain of ZIKV. These data suggest that DNA vaccination merits further investigation as a potential means to reduce ZIKV persistence in the male reproductive tract. PMID:28589934
On the efficacy of malaria DNA vaccination with magnetic gene vectors.
Nawwab Al-Deen, Fatin; Ma, Charles; Xiang, Sue D; Selomulya, Cordelia; Plebanski, Magdalena; Coppel, Ross L
2013-05-28
We investigated the efficacy and types of immune responses from plasmid malaria DNA vaccine encoding VR1020-PyMSP119 condensed on the surface of polyethyleneimine (PEI)-coated SPIONs. In vivo mouse studies were done firstly to determine the optimum magnetic vector composition, and then to observe immune responses elicited when magnetic vectors were introduced via different administration routes. Higher serum antibody titers against PyMSP119 were observed with intraperitoneal and intramuscular injections than subcutaneous and intradermal injections. Robust IgG2a and IgG1 responses were observed for intraperitoneal administration, which could be due to the physiology of peritoneum as a major reservoir of macrophages and dendritic cells. Heterologous DNA prime followed by single protein boost vaccination regime also enhanced IgG2a, IgG1, and IgG2b responses, indicating the induction of appropriate memory immunity that can be elicited by protein on recall. These outcomes support the possibility to design superparamagnetic nanoparticle-based DNA vaccines to optimally evoke desired antibody responses, useful for a variety of diseases including malaria. Copyright © 2013 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Bartholdy, Christina; Stryhn, Anette; Hansen, Nils Jacob Vest
2003-01-01
DNA vaccination is an efficient way to induce CD8+ T cell memory, but it is still unclear to what extent such memory responses afford protection in vivo. To study this, we induced CD8+ memory responses directed towards defined viral epitopes, using DNA vaccines encoding immunodominant MHC class I......-restricted epitopes of lymphocytic choriomeningitis virus covalently linked to beta2-microglobulin. This vaccine construct primed for a stronger recall response than did a more conventional minigene construct. Despite this, vaccinated mice were only protected against systemic infection whereas protection against...... sites. Thus, our DNA vaccine induces a long-lived memory CD8+ T cell population that provides efficient protection against high-dose systemic infection. However, viral replication in solid non-lymphoid organs is not curtailed sufficiently fast to prevent significant virus-induced inflammation. Our...
Low-dose radiation enhances therapeutic HPV DNA vaccination in tumor-bearing hosts.
Tseng, Chih-Wen; Trimble, Cornelia; Zeng, Qi; Monie, Archana; Alvarez, Ronald D; Huh, Warner K; Hoory, Talia; Wang, Mei-Cheng; Hung, Chien-Fu; Wu, T-C
2009-05-01
Current therapeutic approaches to treatment of patients with bulky cervical cancer are based on conventional in situ ablative modalities including cisplatin-based chemotherapy and radiation therapy. The 5-year survival of patients with nonresectable disease is dismal. Because over 99% of squamous cervical cancer is caused by persistent infection with an oncogenic strain of human papillomavirus (HPV), particularly type 16 and viral oncoproteins E6 and E7 are functionally required for disease initiation and persistence, HPV-targeted immune strategies present a compelling opportunity in which to demonstrate proof of principle. Sublethal doses of radiation and chemotherapeutic agents have been shown to have synergistic effect in combination with either vaccination against cancer-specific antigens, or with passive transfer of tumor-specific cytotoxic T lymphocytes (CTLs). Here, we explored the combination of low-dose radiation therapy with DNA vaccination with calreticulin (CRT) linked to the mutated form of HPV-16 E7 antigen (E7(detox)), CRT/E7(detox) in the treatment of E7-expressing TC-1 tumors. We observed that TC-1 tumor-bearing mice treated with radiotherapy combined with CRT/E7(detox) DNA vaccination generated significant therapeutic antitumor effects and the highest frequency of E7-specific CD8(+) T cells in the tumors and spleens of treated mice. Furthermore, treatment with radiotherapy was shown to render the TC-1 tumor cells more susceptible to lysis by E7-specific CTLs. In addition, we observed that treatment with radiotherapy during the second DNA vaccination generated the highest frequency of E7-specific CD8(+) T cells in the tumors and spleens of TC-1 tumor-bearing mice. Finally, TC-1 tumor-bearing mice treated with the chemotherapy in combination with radiation and CRT/E7(detox) DNA vaccination generate significantly enhanced therapeutic antitumor effects. The clinical implications of the study are discussed.
Protective immunity conferred by porcine circovirus 2 ORF2-based DNA vaccine in mice.
Sylla, Seydou; Cong, Yan-Long; Sun, Yi-Xue; Yang, Gui-Lian; Ding, Xue-Mei; Yang, Zhan-Qing; Zhou, Yu-Long; Yang, Minnan; Wang, Chun-Feng; Ding, Zhuang
2014-07-01
Post-weaning multisystemic wasting syndrome (PMWS) associated with porcine circovirus type 2 (PCV2) has caused the swine industry significant health challenges and economic damage. Although inactivated and subunit vaccines against PMWS have been used widely, so far no DNA vaccine is available. In this study, with the aim of exploring a new route for developing a vaccine against PCV2, the immunogenicity of a DNA vaccine was evaluated in mice. The pEGFP-N1 vector was used to construct a PCV2 Cap gene recombinant vaccine. To assess the immunogenicity of pEGFP-Cap, 80 BALB/c mice were immunized three times at 2 weekly intervals with pEGFP-Cap, LG-strain vaccine, pEGFP-N1 vector or PBS and then challenged with PCV2. IgG and cytokines were assessed by indirect ELISA and ELISA, respectively. Specimens stained with hematoxylin and eosin (HE) and immunohistochemistry (IHC) techniques were examined histopathologically. It was found that vaccination of the mice with the pEGFP-Cap induced solid protection against PCV2 infection through induction of highly specific serum IgG antibodies and cytokines (IFN-γ and IL-10), and a small PCV2 viral load. The mice treated with the pEGFP-Cap and LG-strain developed no histopathologically detectable lesions (HE stain) and IHC techniques revealed only a few positive cells. Thus, this study demonstrated that recombinant pEGFP-Cap substantially alleviates PCV2 infection in mice and provides evidence that a DNA vaccine could be an alternative to PCV2 vaccines against PMWS. © 2014 The Societies and Wiley Publishing Asia Pty Ltd.
Vaginal DNA vaccination against infectious diseases transmitted through the vagina.
Kanazawa, Takanori; Takashima, Yuuki; Okada, Hiroaki
2012-06-01
There is an urgent need for the development of vaccines against genital virus infections that are transmitted through heterosexual intercourse, including the HIV and HPV. In general, the surface of female genital mucosa, including vaginal mucosa, is the most common site of initiation of these infections. Thus, it is becoming clear that successful vaccines must induce both cellular and humoral immune responses in both the local genital tract and systemically. We believe that a strong vaginal immune response could be obtained by inducing strong gene expression of antigen-coding DNA in the local targeted tissue. In order to improve transfection efficiency in the vagina, it is important that methods allowing breakthrough of the various barriers, such as the epithelial layer, cellular and nuclear membrane, are developed. Therefore, systems providing less invasive and more effective delivery into the subepithelial layer are required. In this review, we will introduce our studies into efficient vaginal DNA vaccination methods, focusing on the effects of the menstrual cycle, utilization of the combination of functional peptides, and use of a needle-free injector.
DNA technology for diagnosis and vaccines for infectious diseases
International Nuclear Information System (INIS)
Notani, N.K.
1992-01-01
Three or four general strategies are adopted for the control of infectious diseases. Early diagnosis, vaccination and chemotherapy. In the situations where there is transfer through mosquitoes or ticks from alternate hosts, control of the vector and of the infection in the alternate host are additional measures to be taken. This Chapter looks at the problems of disease control from the perspective of genetics, since molecular genetics now provides powerful tools in the form of radiolabelled DNA probes and clones of selected segments, useful for diagnosis as well as for vaccine design
DNA technology for diagnosis and vaccines for infectious diseases
Energy Technology Data Exchange (ETDEWEB)
Notani, N K
1993-12-31
Three or four general strategies are adopted for the control of infectious diseases. Early diagnosis, vaccination and chemotherapy. In the situations where there is transfer through mosquitoes or ticks from alternate hosts, control of the vector and of the infection in the alternate host are additional measures to be taken. This Chapter looks at the problems of disease control from the perspective of genetics, since molecular genetics now provides powerful tools in the form of radiolabelled DNA probes and clones of selected segments, useful for diagnosis as well as for vaccine design
DEFF Research Database (Denmark)
Lorenzen, Ellen; Einer-Jensen, Katja; Martinussen, T.
2000-01-01
Viral hemorrhagic septicemia (VHS) in rainbow trout Oncorhynchus mykiss is caused by VHS virus (VHSV), which belongs to the rhabdovirus family. Among the different strategies for immunizing fish with a recombinant vaccine, genetic immunization has recently proven to be highly effective. To further...... investigate the potential for protecting fish against VHS by DNA vaccination, experiments were conducted to determine the amount of plasmid DNA needed for induction of protective immunity. The time to onset of immunity and the duration of protection following administration of a protective vaccine dose were...... serologically different from the isolate used for vaccine development. Following administration of 1 mug of a DNA vaccine, significant protection against VHS was observed in the fish as early as 8 d postvaccination. At 168 d postvaccination, the fish had increased in size by a factor of 10 and protection...
Safety and Immunogenicity of an Anti-Zika Virus DNA Vaccine - Preliminary Report.
Tebas, Pablo; Roberts, Christine C; Muthumani, Kar; Reuschel, Emma L; Kudchodkar, Sagar B; Zaidi, Faraz I; White, Scott; Khan, Amir S; Racine, Trina; Choi, Hyeree; Boyer, Jean; Park, Young K; Trottier, Sylvie; Remigio, Celine; Krieger, Diane; Spruill, Susan E; Bagarazzi, Mark; Kobinger, Gary P; Weiner, David B; Maslow, Joel N
2017-10-04
Background Although Zika virus (ZIKV) infection is typically self-limiting, other associated complications such as congenital birth defects and the Guillain-Barré syndrome are well described. There are no approved vaccines against ZIKV infection. Methods In this phase 1, open-label clinical trial, we evaluated the safety and immunogenicity of a synthetic, consensus DNA vaccine (GLS-5700) encoding the ZIKV premembrane and envelope proteins in two groups of 20 participants each. The participants received either 1 mg or 2 mg of vaccine intradermally, with each injection followed by electroporation (the use of a pulsed electric field to introduce the DNA sequence into cells) at baseline, 4 weeks, and 12 weeks. Results The median age of the participants was 38 years, and 60% were women; 78% were white, and 22% black; in addition, 30% were Hispanic. At the interim analysis at 14 weeks (i.e., after the third dose of vaccine), no serious adverse events were reported. Local reactions at the vaccination site (e.g., injection-site pain, redness, swelling, and itching) occurred in approximately 50% of the participants. After the third dose of vaccine, binding antibodies (as measured on enzyme-linked immunosorbent assay) were detected in all the participants, with geometric mean titers of 1642 and 2871 in recipients of 1 mg and 2 mg of vaccine, respectively. Neutralizing antibodies developed in 62% of the samples on Vero-cell assay. On neuronal-cell assay, there was 90% inhibition of ZIKV infection in 70% of the serum samples and 50% inhibition in 95% of the samples. The intraperitoneal injection of postvaccination serum protected 103 of 112 IFNAR knockout mice (bred with deletion of genes encoding interferon-α and interferon-β receptors) (92%) that were challenged with a lethal dose of ZIKV-PR209 strain; none of the mice receiving baseline serum survived the challenge. Survival was independent of the neutralization titer. Conclusions In this phase 1, open-label clinical
Directory of Open Access Journals (Sweden)
M.O. Lásaro
1999-02-01
Full Text Available The induction of systemic (IgG and mucosal (IgA antibody responses against the colonization factor I antigen (CFA/I of enterotoxigenic Escherichia coli (ETEC was evaluated in mice primed with an intramuscularly delivered CFA/I-encoding DNA vaccine followed by two oral immunizations with a live recombinant Salmonella typhimurium vaccine strain expressing the ETEC antigen. The booster effect induced by the oral immunization was detected two weeks and one year after the administration of the DNA vaccine. The DNA-primed/Salmonella-boosted vaccination regime showed a synergistic effect on the induced CFA/I-specific systemic and secreted antibody levels which could not be attained by either immunization strategy alone. These results suggest that the combined use of DNA vaccines and recombinant Salmonella vaccine strains can be a useful immunization strategy against enteric pathogens.
The role of peptide and DNA vaccines in myeloid leukemia immunotherapy
Directory of Open Access Journals (Sweden)
Lin Chen
2013-02-01
Full Text Available Abstract While chemotherapy and targeted therapy are successful in inducing the remission of myeloid leukemia as acute myeloid leukemia (AML and chronic myeloid leukemia (CML, the disease remains largely incurable. This observation is likely due to the drug resistance of leukemic cells, which are responsible for disease relapse. Myeloid leukemia vaccines may most likely be beneficial for eradicating minimal residual disease after treatment with chemotherapy or targeted therapy. Several targeted immunotherapies using leukemia vaccines have been heavily investigated in clinical and preclinical trials. This review will focus on peptides and DNA vaccines in the context of myeloid leukemias, and optimal strategies for enhancing the efficacy of vaccines based on myeloid leukemia immunization are also summarized.
Koriyama, Hiroshi; Nakagami, Hironori; Nakagami, Futoshi; Osako, Mariana Kiomy; Kyutoku, Mariko; Shimamura, Munehisa; Kurinami, Hitomi; Katsuya, Tomohiro; Rakugi, Hiromi; Morishita, Ryuichi
2015-07-01
Recent research on vaccination has extended its scope from infectious diseases to chronic diseases, including Alzheimer disease, dyslipidemia, and hypertension. The aim of this study was to design DNA vaccines for high blood pressure and eventually develop human vaccine therapy to treat hypertension. Plasmid vector encoding hepatitis B core-angiotensin II (Ang II) fusion protein was injected into spontaneously hypertensive rats using needleless injection system. Anti-Ang II antibody was successfully produced in hepatitis B core-Ang II group, and antibody response against Ang II was sustained for at least 6 months. Systolic blood pressure was consistently lower in hepatitis B core-Ang II group after immunization, whereas blood pressure reduction was continued for at least 6 months. Perivascular fibrosis in heart tissue was also significantly decreased in hepatitis B core-Ang II group. Survival rate was significantly improved in hepatitis B core-Ang II group. This study demonstrated that Ang II DNA vaccine to spontaneously hypertensive rats significantly lowered high blood pressure for at least 6 months. In addition, Ang II DNA vaccines induced an adequate humoral immune response while avoiding the activation of self-reactive T cells, assessed by ELISPOT assay. Future development of DNA vaccine to treat hypertension may provide a new therapeutic option to treat hypertension. © 2015 American Heart Association, Inc.
Stability analysis for a general age-dependent vaccination model
International Nuclear Information System (INIS)
El Doma, M.
1995-05-01
An SIR epidemic model of a general age-dependent vaccination model is investigated when the fertility, mortality and removal rates depends on age. We give threshold criteria of the existence of equilibriums and perform stability analysis. Furthermore a critical vaccination coverage that is sufficient to eradicate the disease is determined. (author). 12 refs
DEFF Research Database (Denmark)
Lorenzen, Niels; Lorenzen, Ellen; Einer-Jensen, Katja
2002-01-01
whereas no increased survival was found upon challenge with bacterial pathogens. Within two months after vaccination, the cross-protection disappeared while the specific immunity to homologous virus remained high. The early immunity induced by the DNA vaccines thus appeared to involve short-lived non......It was recently reported that DNA vaccination of rainbow trout fingerlings against viral hemorrhagic septicaemia virus (VHSV) induced protection within 8 days after intramuscular injection of plasmid DNA. In order to analyse the specificity of this early immunity, fish were vaccinated with plasmid...... DNA encoding the VHSV or the infectious haematopoietic necrosis virus (IHNV) glycoprotein genes and later challenged with homologous or heterologous pathogens. Challenge experiments revealed that immunity established shortly after vaccination was cross-protective between the two viral pathogens...
Li, Jun; Shi, Jian-Li; Wu, Xiao-Yan; Fu, Fang; Yu, Jiang; Yuan, Xiao-Yuan; Peng, Zhe; Cong, Xiao-Yan; Xu, Shao-Jian; Sun, Wen-Bo; Cheng, Kai-Hui; Du, Yi-Jun; Wu, Jia-Qiang; Wang, Jin-Bao; Huang, Bao-Hua
2015-06-01
Nowadays, adjuvant is still important for boosting immunity and improving resistance in animals. In order to boost the immunity of porcine circovirus type 2 (PCV2) DNA vaccine, CpG motifs were inserted. In this study, the dose-effect was studied, and the immunity of PCV2 DNA vaccines by recombinant open reading frame 2 (ORF2) gene and CpG motifs was evaluated. Three-week-old Changbai piglets were inoculated intramuscularly with 200 μg, 400 μg, and 800 μg DNA vaccines containing 14 and 18 CpG motifs, respectively. Average gain and rectum temperature were recorded everyday during the experiments. Blood was collected from the piglets after vaccination to detect the changes of specific antibodies, interleukin-2, and immune cells every week. Tissues were collected for histopathology and polymerase chain reaction. The results indicated that compared to those of the control piglets, all concentrations of two DNA vaccines could induce PCV2-specific antibodies. A cellular immunity test showed that PCV2-specific lymphocytes proliferated the number of TH, TC, and CD3+ positive T-cells raised in the blood of DNA vaccine immune groups. There was no distinct pathological damage and viremia occurring in pigs that were inoculated with DNA vaccines, but there was some minor pathological damage in the control group. The results demonstrated that CpG motifs as an adjuvant could boost the humoral and cellular immunity of pigs to PCV2, especially in terms of cellular immunity. Comparing two DNA vaccines that were constructed, the one containing 18 CpG motifs was more effective. This is the first report that CpG motifs as an adjuvant insert to the PCV2 DNA vaccine could boost immunity.
van Drunen Littel-van den Hurk, Sylvia; Lawman, Zoe; Snider, Marlene; Wilson, Don; van den Hurk, Jan V; Ellefsen, Barry; Hannaman, Drew
2013-02-01
Bovine viral diarrhea virus (BVDV) is a pathogen of major importance in cattle, so there is a need for new effective vaccines. DNA vaccines induce balanced immune responses and are relatively inexpensive and thus promising for both human and veterinary applications. In this study, newborn calves with maternal antibodies were vaccinated intramuscularly (i.m.) with a BVDV E2 DNA vaccine with the TriGrid Delivery System for i.m. delivery (TDS-IM). Two doses of this vaccine spaced 6 or 12 weeks apart were sufficient to induce significant virus-neutralizing antibody titers, numbers of activated T cells, and reduction in viral shedding and clinical presentations after BVDV-2 challenge. In contrast to the placebo-treated animals, the vaccinated calves did not lose any weight, which is an excellent indicator of the well-being of an animal and has a significant economic impact. Furthermore, the interval between the two vaccinations did not influence the magnitude of the immune responses or degree of clinical protection, and a third immunization was not necessary or beneficial. Since electroporation may enhance not only the magnitude but also the duration of immunity after DNA immunization, the interval between vaccination and challenge was extended in a second trial, which showed that two doses of this E2 DNA vaccine again significantly reduced clinical disease against BVDV for several months. These results are promising and support this technology for use against infectious diseases in cattle and large species, including humans, in general.
Goldhaber-Fiebert, Jeremy D.; Stout, Natasha K.; Salomon, Joshua A.; Kuntz, Karen M.; Goldie, Sue J.
2011-01-01
Background The availability of human papillomavirus (HPV) DNA testing and vaccination against HPV types 16 and 18 (HPV-16,18) motivates questions about the cost-effectiveness of cervical cancer prevention in the United States for unvaccinated older women and for girls eligible for vaccination. Methods An empirically calibrated model was used to assess the quality-adjusted life years (QALYs), lifetime costs, and incremental cost-effectiveness ratios (2004 US dollars per QALY) of screening, vaccination of preadolescent girls, and vaccination combined with screening. Screening varied by initiation age (18, 21, or 25 years), interval (every 1, 2, 3, or 5 years), and test (HPV DNA testing of cervical specimens or cytologic evaluation of cervical cells with a Pap test). Testing strategies included: 1) cytology followed by HPV DNA testing for equivocal cytologic results (cytology with HPV test triage); 2) HPV DNA testing followed by cytology for positive HPV DNA results (HPV test with cytology triage); and 3) combined HPV DNA testing and cytology. Strategies were permitted to switch once at age 25, 30, or 35 years. Results For unvaccinated women, triennial cytology with HPV test triage, beginning by age 21 years and switching to HPV testing with cytology triage at age 30 years, cost $78 000 per QALY compared with the next best strategy. For girls vaccinated before age 12 years, this same strategy, beginning at age 25 years and switching at age 35 years, cost $41 000 per QALY with screening every 5 years and $188 000 per QALY screening triennially, each compared with the next best strategy. These strategies were more effective and cost-effective than screening women of all ages with cytology alone or cytology with HPV triage annually or biennially. Conclusions For both vaccinated and unvaccinated women, age-based screening by use of HPV DNA testing as a triage test for equivocal results in younger women and as a primary screening test in older women is expected to be more
Targeted DNA vaccines for enhanced induction of idiotype-specific B and T cells
International Nuclear Information System (INIS)
Fredriksen, Agnete B.; Sandlie, Inger; Bogen, Bjarne
2012-01-01
Background: Idiotypes (Id) are antigenic determinants localized in variable (V) regions of Ig. Id-specific T and B cells (antibodies) play a role in immunotherapy of Id + tumors. However, vaccine strategies that enhance Id-specific responses are needed. Methods: Id + single-chain fragment variable (scFv) from multiple myelomas and B cell lymphomas were prepared in a fusion format that bivalently target surface molecules on antigen-presenting cells (APC). APC-specific targeting units were either scFv from APC-specific mAb (anti-MHC II, anti-CD40) or chemokines (MIP-1α, RANTES). Homodimeric Id-vaccines were injected intramuscularly or intradermally as plasmids in mice, combined with electroporation. Results: (i) Transfected cells secreted plasmid-encoded Id + fusion proteins to extracellular fluid followed by binding of vaccine molecules to APC. (ii) Targeted vaccine molecules increased Id-specific B and T cell responses. (iii) Bivalency and xenogeneic sequences both contributed to enhanced responses. (iv) Targeted Id DNA vaccines induced tumor resistance against challenges with Id + tumors. (v) Human MIP-1α targeting units enhanced Id-specific responses in mice, due to a cross reaction with murine chemokine receptors. Thus, targeted vaccines designed for humans can be quality tested in mice. (vi) Human Id + scFv from four multiple myeloma patients were inserted into the vaccine format and were successfully tested in mice. (vii) Human MIP-1α vaccine proteins enhanced human T cell responses in vitro. (viii) A hypothetical model for how the APC-targeted vaccine molecules enhance Id-specific T and B cells is presented. Conclusion: Targeted DNA Id-vaccines show promising results in preclinical studies, paving the way for testing in patients.
Targeted DNA vaccines for enhanced induction of idiotype-specific B and T cells
Energy Technology Data Exchange (ETDEWEB)
Fredriksen, Agnete B.; Sandlie, Inger; Bogen, Bjarne, E-mail: bjarne.bogen@medisin.uio.no [Centre for Immune Regulation, Institute of Immunology, University of Oslo and Oslo University Hospital, Oslo (Norway)
2012-10-30
Background: Idiotypes (Id) are antigenic determinants localized in variable (V) regions of Ig. Id-specific T and B cells (antibodies) play a role in immunotherapy of Id{sup +} tumors. However, vaccine strategies that enhance Id-specific responses are needed. Methods: Id{sup +} single-chain fragment variable (scFv) from multiple myelomas and B cell lymphomas were prepared in a fusion format that bivalently target surface molecules on antigen-presenting cells (APC). APC-specific targeting units were either scFv from APC-specific mAb (anti-MHC II, anti-CD40) or chemokines (MIP-1α, RANTES). Homodimeric Id-vaccines were injected intramuscularly or intradermally as plasmids in mice, combined with electroporation. Results: (i) Transfected cells secreted plasmid-encoded Id{sup +} fusion proteins to extracellular fluid followed by binding of vaccine molecules to APC. (ii) Targeted vaccine molecules increased Id-specific B and T cell responses. (iii) Bivalency and xenogeneic sequences both contributed to enhanced responses. (iv) Targeted Id DNA vaccines induced tumor resistance against challenges with Id{sup +} tumors. (v) Human MIP-1α targeting units enhanced Id-specific responses in mice, due to a cross reaction with murine chemokine receptors. Thus, targeted vaccines designed for humans can be quality tested in mice. (vi) Human Id{sup +} scFv from four multiple myeloma patients were inserted into the vaccine format and were successfully tested in mice. (vii) Human MIP-1α vaccine proteins enhanced human T cell responses in vitro. (viii) A hypothetical model for how the APC-targeted vaccine molecules enhance Id-specific T and B cells is presented. Conclusion: Targeted DNA Id-vaccines show promising results in preclinical studies, paving the way for testing in patients.
International Nuclear Information System (INIS)
Xu Wei; Chu Yiwei; Zhang Ruihua; Xu Huanbin; Wang Ying; Xiong Sidong
2005-01-01
CD8 + T cells play a critical role in protective immunity against Hepatitis B Virus (HBV). Epitope-based DNA vaccines expressing HBV-dominant CTL epitopes can be used as candidate vaccines capable of inducing cytotoxic T Lymphocytes (CTL) responses. A plasmid DNA encoding a CTL epitope of HBV core antigen, HBc 18-27 , was constructed. Intramuscular immunization of C57BL/6 mice with this DNA vaccine resulted in successful induction of HBV-specific CTL responses. In order to promote transportation of the peptide into endoplasmic reticulum (ER) to bind to MHC class I molecules for optimal class I antigen presentation, an ER targeting sequence (ERTS) was fused with the C 18-27 encoding gene. ERTS fusion significantly enhanced specific CD8 + T cell responses in terms of CTL cytolysis as well as IFN-γ secretion. This enhancement was correlated with promoted epitope presentation on target cell surface. We report here an enhanced immunogenicity of an epitope-based DNA vaccine using an ER targeting signal sequence, which has significant implications for future design of therapeutic HBV vaccine
Kurath, Gael; Garver, Kyle A.; Corbeil, Serge; Elliott, Diane G.; Anderson, Eric D.; LaPatra, Scott E.
2006-01-01
The DNA vaccine pIHNw-G encodes the glycoprotein of the fish rhabdovirus infectious hematopoietic necrosis virus (IHNV). Vaccine performance in rainbow trout was measured 3, 6, 13, 24, and 25 months after vaccination. At three months all fish vaccinated with 0.1 μg pIHNw-G had detectable neutralizing antibody (NAb) and they were completely protected from lethal IHNV challenge with a relative percent survival (RPS) of 100% compared to control fish. Viral challenges at 6, 13, 24, and 25 months post-vaccination showed protection with RPS values of 47–69%, while NAb seroprevalence declined to undetectable levels. Passive transfer experiments with sera from fish after two years post-vaccination were inconsistent but significant protection was observed in some cases. The long-term duration of protection observed here defined a third temporal phase in the immune response to IHNV DNA vaccination, characterized by reduced but significant levels of protection, and decline or absence of detectable NAb titers. Examination of multiple tissues showed an absence of detectable long-term histopathological damage due to DNA vaccination.
International Nuclear Information System (INIS)
Amin, M.M.; Hafez, E.N.
2015-01-01
Current strategies for the control of toxoplasmosis are based on chemotherapy, however successful vaccine has also been demonstrated. The present study aims to assess the effect of the vaccination with radiation-attenuated tachyzoites in challenged mice regarding histopathological alteration and DNA damage of hepatocytes. Sixty mice were equally divided as follow: Group I left as a normal control group II was infected with 2x10 3 RH virulent tachyzoite s (infected control). Groups III and IV were subdivided into two subgroups a and b where subgroups III a and IV a were vaccinate d with 2.47 mw-min/cm 2 UV and 0.3 KGy gamma radiation – attenuate d tachyzoites respectively without challenge (as vaccine control). Subgroups III b and IV b were vaccinate d with UV and gamma radiation - attenuated tachyzoites and challenged after three weeks with 2x10 3 RH virulent tachyzoites. Livers were examined for histopathological changes and DNA comet assay. It was observed that acute infection with Toxoplasma tachyzoites produced toxic effects which lead to severe damage in liver tissues and DNA of hepatocytes. Meanwhile, the protective effect of UV or gamma radiation-attenuated tachyzoites vaccine resulted in the maintenance of normal histopathological characteristics and DNA of hepatocyte s and UV irradiation is better in its protective capacity
Sarbu, Luminita; Kitchell, Barbara E; Bergman, Philip J
2017-02-01
Objectives A xenogeneic human tyrosinase DNA vaccine was developed for treatment of dogs with oral malignant melanoma (Oncept; Merial). No studies have evaluated the safety or efficacy of this vaccine in cats. The purpose of this study was to evaluate the safety of the canine melanoma vaccine in cats diagnosed with melanoma. Methods Medical records were reviewed from cats diagnosed with malignant melanoma and treated with the canine melanoma DNA vaccine (Oncept). Data regarding signalment, melanoma location, treatments received, vaccine adverse effects and cause of death were collected. Results A total of 114 melanoma vaccines were administered to 24 cats. Seven cats (11.4%) had clinical adverse effects from a total of 13 vaccines classified as grade 1 or 2 based on the Veterinary Cooperative Oncology Group's common terminology criteria for adverse events v1.1. These included pain on vaccine administration, brief muscle fasciculation, transient inappetence, depression, nausea and mild increase in pigmentation at the injection site. Nineteen cats were deceased at study close. The most common cause of death was melanoma (14 cats). Hematological and biochemical changes were observed in six cats, five of which had concurrent disease or treatments that likely caused or greatly contributed to the laboratory abnormalities found. Therefore, these adverse events were considered unlikely to be caused by the melanoma vaccine. One cat had transient grade 1 hypoalbuminemia, which was possibly caused by the vaccination but not thoroughly evaluated. Conclusions and relevance The canine melanoma DNA vaccine can be safely administered to cats, with minimal risk of adverse effects.
Duong, Huu Thuy Trang; Kim, Nak Won; Thambi, Thavasyappan; Giang Phan, V H; Lee, Min Sang; Yin, Yue; Jeong, Ji Hoon; Lee, Doo Sung
2018-01-10
Successful delivery of a DNA vaccine to antigen-presenting cells and their subsequent stimulation of CD4 + and CD8 + T cell immunity remains an inefficient process. In general, the delivery of prophylactic vaccines is mainly mired by low transfection efficacy, poor immunogenicity, and safety issues from the materials employed. Currently, several strategies have been exploited to improve immunogenicity, but an effective strategy for safe and pain-free delivery of DNA vaccines is complicated. Herein, we report the rapid delivery of polyplex-based DNA vaccines using microneedle arrays coated with a polyelectrolyte multilayer assembly of charge reversal pH-responsive copolymer and heparin. The charge reversal pH-responsive copolymer, composed of oligo(sulfamethazine)-b-poly(ethylene glycol)-b-poly(amino urethane) (OSM-b-PEG-b-PAEU), was used as a triggering layer in the polyelectrolyte multilayer assembly on microneedles. Charge reversal characteristics of this copolymer, that is, the OSM-b-PEG-b-PAEU copolymer exhibit, positive charge at low pH (pH4.03) and becoming negative charge when exposed to physiological pH conditions (pH7.4), allowing the facile assembly and disassembly of polyelectrolyte multilayers. The electrostatic repulsion between heparin and OSM-b-PEG-b-PAEU charge reversal copolymer triggered the release of DNA vaccines. DNA vaccines laden on microneedles are effectively transfected into RAW 264.7 macrophage cells in vitro. Vaccination of BALB/c mice by DNA vaccine-loaded microneedle arrays coated with a polyelectrolyte multilayer generated antigen-specific robust immune responses. These findings provide potential strategy of charge reversal pH-responsive copolymers coated microneedles for DNA vaccine delivery. Copyright © 2017. Published by Elsevier B.V.
Directory of Open Access Journals (Sweden)
Viraj Kulkarni
Full Text Available HIV sequence diversity and potential decoy epitopes are hurdles in the development of an effective AIDS vaccine. A DNA vaccine candidate comprising of highly conserved p24(gag elements (CE induced robust immunity in all 10 vaccinated macaques, whereas full-length gag DNA vaccination elicited responses to these conserved elements in only 5 of 11 animals, targeting fewer CE per animal. Importantly, boosting CE-primed macaques with DNA expressing full-length p55(gag increased both magnitude of CE responses and breadth of Gag immunity, demonstrating alteration of the hierarchy of epitope recognition in the presence of pre-existing CE-specific responses. Inclusion of a conserved element immunogen provides a novel and effective strategy to broaden responses against highly diverse pathogens by avoiding decoy epitopes, while focusing responses to critical viral elements for which few escape pathways exist.
Chao, Ya-Hsuan; Chen, Der-Yuan; Lan, Joung-Liang; Tang, Kuo-Tung; Lin, Chi-Chien
2018-01-01
DNA vaccines have recently emerged as a therapeutic agent for treating autoimmune diseases, such as multiple sclerosis. Antiphospholipid antibody syndrome (APS) is an autoimmune disease characterized by β2-glycoprotein I (β2-GPI)-targeting antiphospholipid antibodies (APAs) and vascular thrombosis or obstetrical complications. To examine the therapeutic potential of a β2-GPI DNA vaccine, we administered a vaccine mixed with FK506 as an adjuvant to a mouse model of obstetric APS. First, the pCMV3-β2-GPI DNA vaccine, which encodes the full-length human β2-GPI gene, was constructed. Then, we administered the β2-GPI DNA vaccine in 0.1 ml of saline, mixed with or without 100 μg of FK506, intramuscularly to the mice on days 28, 35 and 42. Blood titers of the anti-β2-GPI antibody, platelet counts, activated partial thromboplastin times (aPTTs), and the percentage of fetal loss were measured. We also stimulated murine splenic T cells ex vivo with β2-GPI and determined the T helper cell proportion and cytokine secretion. The administration of the β2-GPI DNA vaccine mixed with FK506 reduced the blood IgG anti-β2-GPI antibody titers and suppressed APS manifestations in mice. The combination also suppressed interferon-γ and interleukin (IL)-17A secretion but increased the Treg cell proportion and IL-10 secretion in murine splenic T cells following ex vivo stimulation with β2-GPI. Our results demonstrated the therapeutic efficacy of a β2-GPI DNA vaccine and FK506 as an adjuvant in a murine model of obstetric APS. Possible mechanisms include the inhibition of Th1 and Th17 responses and the up-regulation of Treg cells.
Energy Technology Data Exchange (ETDEWEB)
Zhang, Han [Department of Ophthalmology, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-Ku, Fukuoka 812-8582 (Japan); Sonoda, Koh-Hei, E-mail: sonodak@med.kyushu-u.ac.jp [Department of Ophthalmology, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-Ku, Fukuoka 812-8582 (Japan); Hijioka, Kuniaki; Qiao, Hong; Oshima, Yuji; Ishibashi, Tatsuro [Department of Ophthalmology, Graduate School of Medical Sciences, Kyushu University, 3-1-1 Maidashi, Higashi-Ku, Fukuoka 812-8582 (Japan)
2009-04-17
Ocular neovascularization (NV) is the primary cause of blindness in a wide range of ocular diseases. The exact mechanism underlying the pathogenesis of ocular NV is not yet well understood, and so there is no satisfactory therapy for ocular NV. Here, we describe a strategy targeting Flk-1, a self-antigen overexpressed on proliferating endothelial cells in ocular NV, by antiangiogenic immunotherapy-DNA vaccine and adoptive T cell therapy. An oral DNA vaccine encoding Flk-1 carried by attenuated Salmonella typhimurium markedly suppressed development of laser-induced choroidal NV. We further demonstrated that adoptive transfer of vaccine-induced CD8{sup +} T cells reduced pathological preretinal NV, with a concomitant facilitation of physiological revascularization after oxygen-induced retinal vessel obliteration. However, physiological retinal vascular development was unaffected in neonatal mice transferred with vaccine-induced CD8{sup +} T cells. These findings suggested that antiangiogenic immunotherapy targeting Flk-1 such as vaccination and adoptive immunotherapy may contribute to future therapies for ocular NV.
International Nuclear Information System (INIS)
Zhang, Han; Sonoda, Koh-Hei; Hijioka, Kuniaki; Qiao, Hong; Oshima, Yuji; Ishibashi, Tatsuro
2009-01-01
Ocular neovascularization (NV) is the primary cause of blindness in a wide range of ocular diseases. The exact mechanism underlying the pathogenesis of ocular NV is not yet well understood, and so there is no satisfactory therapy for ocular NV. Here, we describe a strategy targeting Flk-1, a self-antigen overexpressed on proliferating endothelial cells in ocular NV, by antiangiogenic immunotherapy-DNA vaccine and adoptive T cell therapy. An oral DNA vaccine encoding Flk-1 carried by attenuated Salmonella typhimurium markedly suppressed development of laser-induced choroidal NV. We further demonstrated that adoptive transfer of vaccine-induced CD8 + T cells reduced pathological preretinal NV, with a concomitant facilitation of physiological revascularization after oxygen-induced retinal vessel obliteration. However, physiological retinal vascular development was unaffected in neonatal mice transferred with vaccine-induced CD8 + T cells. These findings suggested that antiangiogenic immunotherapy targeting Flk-1 such as vaccination and adoptive immunotherapy may contribute to future therapies for ocular NV.
DEFF Research Database (Denmark)
Borggren, Marie; Nielsen, Jens; Karlsson, Ingrid
2016-01-01
of the optimized DNA vaccine were evaluated in groups of five to six pigs. The DNA vaccine consisted of six selected influenza genes of pandemic origin, including internally expressed matrix and nucleoprotein and externally expressed hemagglutinin and neuraminidase. RESULTS: Needle-free vaccination of growing pigs...
Directory of Open Access Journals (Sweden)
Rebecca Brocato
Full Text Available Andes virus (ANDV is the predominant cause of hantavirus pulmonary syndrome (HPS in South America and the only hantavirus known to be transmitted person-to-person. There are no vaccines, prophylactics, or therapeutics to prevent or treat this highly pathogenic disease (case-fatality 35-40%. Infection of Syrian hamsters with ANDV results in a disease that closely mimics human HPS in incubation time, symptoms of respiratory distress, and disease pathology. Here, we evaluated the feasibility of two postexposure prophylaxis strategies in the ANDV/hamster lethal disease model. First, we evaluated a natural product, human polyclonal antibody, obtained as fresh frozen plasma (FFP from a HPS survivor. Second, we used DNA vaccine technology to manufacture a polyclonal immunoglobulin-based product that could be purified from the eggs of vaccinated ducks (Anas platyrhynchos. The natural "despeciation" of the duck IgY (i.e., Fc removed results in an immunoglobulin predicted to be minimally reactogenic in humans. Administration of ≥ 5,000 neutralizing antibody units (NAU/kg of FFP-protected hamsters from lethal disease when given up to 8 days after intranasal ANDV challenge. IgY/IgYΔFc antibodies purified from the eggs of DNA-vaccinated ducks effectively neutralized ANDV in vitro as measured by plaque reduction neutralization tests (PRNT. Administration of 12,000 NAU/kg of duck egg-derived IgY/IgYΔFc protected hamsters when administered up to 8 days after intranasal challenge and 5 days after intramuscular challenge. These experiments demonstrate that convalescent FFP shows promise as a postexposure HPS prophylactic. Moreover, these data demonstrate the feasibility of using DNA vaccine technology coupled with the duck/egg system to manufacture a product that could supplement or replace FFP. The DNA vaccine-duck/egg system can be scaled as needed and obviates the necessity of using limited blood products obtained from a small number of HPS survivors. This
C3d enhanced DNA vaccination induced humoral immune response to glycoprotein C of pseudorabies virus
International Nuclear Information System (INIS)
Tong Tiezhu; Fan Huiying; Tan Yadi; Xiao Shaobo; Ling Jieyu; Chen Huanchun; Guo Aizhen
2006-01-01
Murine C3d were utilized to enhance immunogenicity of pseudorabies virus (PrV) gC DNA vaccination. Three copies of C3d and four copies of CR2-binding domain M28 4 were fused, respectively, to truncated gC gene encoding soluble glycoprotein C (sgC) in pcDNA3.1. BALB/c mice were, respectively, immunized with recombinant plasmids, blank vector, and inactivated vaccine. The antibody ELISA titer for sgC-C3d 3 DNA was 49-fold more than that for sgC DNA, and the neutralizing antibody obtained 8-fold rise. Protection of mice from death after lethal PrV (316 LD 5 ) challenge was augmented from 25% to 100%. Furthermore, C3d fusion increased Th2-biased immune response by inducing IL-4 production. The IL-4 level for sgC-C3d 3 DNA immunization approached that for the inactivated vaccine. Compared to C3d, M28 enhanced sgC DNA immunogenicity to a lesser extent. In conclusion, we demonstrated that murine C3d fusion significantly enhanced gC DNA immunity by directing Th1-biased to a balanced and more effective Th1/Th2 response
MPT-51/CpG DNA vaccine protects mice against Mycobacterium tuberculosis.
Silva, Bruna Daniella de Souza; da Silva, Ediane Batista; do Nascimento, Ivan Pereira; Dos Reis, Michelle Cristina Guerreiro; Kipnis, André; Junqueira-Kipnis, Ana Paula
2009-07-16
Tuberculosis (TB) is a severe infectious disease that kills approximately two million people worldwide every year. Because BCG protection is variable and does not protects adults, there is a great need for a new vaccine against TB that does not represent a risk for immunocompromised patients and that is also capable of protecting adult individuals. MPT-51 is a protein found in the genome of mycobacteria and binds to the fibronectin of the extracellular matrix, which may have a role in host tissue attachment and virulence. In order to test the usefulness of MPT-51 as a subunit vaccine, BALB/c were vaccinated and challenged with Mycobacterium tuberculosis. The infection of BALB/c with M. tuberculosis increased the number of IFN-gamma(+) T lymphocytes specific to MPT-51 in the spleen and lungs. Inoculation with rMPT-51/FIA and with rMPT-51/CpG DNA in non-infected BALB/c increased the amounts of IFN-gamma(+) T lymphocytes. Inoculation with rMPT-51/FIA also induced a humoral response specific to MPT-51. CFU counts of lung tissues done 60 days after infection showed a reduction of about 2 log in the bacteria load in the group of animals inoculated with rMPT-51/CpG DNA. These results make MPT-51 a valuable component to be further evaluated in the development of other subunit vaccines.
DEFF Research Database (Denmark)
Borggren, Marie; Nielsen, Jens; Bragstad, Karoline
2015-01-01
such as the induction of cellular and humoral immunity, inherent safety and rapid production time. We have previously developed a DNA vaccine encoding selected influenza proteins of pandemic origin and demonstrated broad protective immune responses in ferrets and pigs. In this study, we evaluated our DNA vaccine......The threat posed by the 2009 pandemic H1N1 virus emphasized the need for new influenza A virus vaccines inducing a broad cross-protective immune response for use in both humans and pigs. An effective and broad influenza vaccine for pigs would greatly benefit the pork industry and contribute...... to public health by diminishing the risk of emerging highly pathogenic reassortants. Current inactivated protein vaccines against swine influenza produce only short-lived immunity and have no efficacy against heterologous strains. DNA vaccines are a potential alternative with advantages...
Directory of Open Access Journals (Sweden)
Merika T Koday
Full Text Available Recent avian and swine-origin influenza virus outbreaks illustrate the ongoing threat of influenza pandemics. We investigated immunogenicity and protective efficacy of a multi-antigen (MA universal influenza DNA vaccine consisting of HA, M2, and NP antigens in cynomolgus macaques. Following challenge with a heterologous pandemic H1N1 strain, vaccinated animals exhibited significantly lower viral loads and more rapid viral clearance when compared to unvaccinated controls. The MA DNA vaccine induced robust serum and mucosal antibody responses but these high antibody titers were not broadly neutralizing. In contrast, the vaccine induced broadly-reactive NP specific T cell responses that cross-reacted with the challenge virus and inversely correlated with lower viral loads and inflammation. These results demonstrate that a MA DNA vaccine that induces strong cross-reactive T cell responses can, independent of neutralizing antibody, mediate significant cross-protection in a nonhuman primate model and further supports development as an effective approach to induce broad protection against circulating and emerging influenza strains.
Directory of Open Access Journals (Sweden)
Yan Cao
2013-01-01
Full Text Available Schistosomiasis, caused by infection with Schistosoma species, remains an important parasitic zoonosis. Thioredoxin glutathione reductase of Schistosoma japonicum (SjTGR plays an important role in the development of the parasite and for its survival. Here we present a recombinant plasmid DNA vaccine, pVAX1/SjTGR, to estimate its protection against S. japonicum in BALB/c mice. The DNA vaccine administrated by particle bombardment induced higher protection than by intramuscular injection. All animals vaccinated with pVAX1/SjTGR developed significant specific anti-SjTGR antibodies than control groups. Moreover, animals immunized by gene gun exhibited a splenocyte proliferative response, with an increase in IFN-γ and IL-4. The recombinant plasmid administrated by gene gun achieved a medium protective efficacy of 27.83–38.83% ( of worm reduction and 40.38–44.51% ( of liver egg count reduction. It suggests that different modes of administering a DNA vaccine can influence the protective efficacy induced by the vaccine. Interestingly, from the enzymatic activity results, we found that worms obtained from pVAX1/SjTGR-vaccinated animals expressed lower enzymatic activity than the control group and the antibodies weakened the enzymatic activity of SjTGR in vitro, too. It implies that the high-level antibodies may contribute to the protective effects.
Gray, Glenda E; Mayer, Kenneth H; Elizaga, Marnie L; Bekker, Linda-Gail; Allen, Mary; Morris, Lynn; Montefiori, David; De Rosa, Stephen C; Sato, Alicia; Gu, Niya; Tomaras, Georgia D; Tucker, Timothy; Barnett, Susan W; Mkhize, Nonhlanhla N; Shen, Xiaoying; Downing, Katrina; Williamson, Carolyn; Pensiero, Michael; Corey, Lawrence; Williamson, Anna-Lise
2016-06-01
A phase I safety and immunogenicity study investigated South African AIDS Vaccine Initiative (SAAVI) HIV-1 subtype C (HIV-1C) DNA vaccine encoding Gag-RT-Tat-Nef and gp150, boosted with modified vaccinia Ankara (MVA) expressing matched antigens. Following the finding of partial protective efficacy in the RV144 HIV vaccine efficacy trial, a protein boost with HIV-1 subtype C V2-deleted gp140 with MF59 was added to the regimen. A total of 48 participants (12 U.S. participants and 36 Republic of South Africa [RSA] participants) were randomized to receive 3 intramuscular (i.m.) doses of SAAVI DNA-C2 of 4 mg (months 0, 1, and 2) and 2 i.m. doses of SAAVI MVA-C of 1.45 × 10(9) PFU (months 4 and 5) (n = 40) or of a placebo (n = 8). Approximately 2 years after vaccination, 27 participants were rerandomized to receive gp140/MF59 at 100 μg or placebo, as 2 i.m. injections, 3 months apart. The vaccine regimen was safe and well tolerated. After the DNA-MVA regimen, CD4(+) T-cell and CD8(+) T-cell responses occurred in 74% and 32% of the participants, respectively. The protein boost increased CD4(+) T-cell responses to 87% of the subjects. All participants developed tier 1 HIV-1C neutralizing antibody responses as well as durable Env binding antibodies that recognized linear V3 and C5 peptides. The HIV-1 subtype C DNA-MVA vaccine regimen showed promising cellular immunogenicity. Boosting with gp140/MF59 enhanced levels of binding and neutralizing antibodies as well as CD4(+) T-cell responses to HIV-1 envelope. (This study has been registered at ClinicalTrials.gov under registration no. NCT00574600 and NCT01423825.). Copyright © 2016 Gray et al.
Xu, Yan; Cheng, Hao; Zhao, Ke-Jia; Zhu, Ke-Jian; Zhang, Xing
2007-11-01
This paper was to study the angiogenic inhibitory effect and the potential antitumor effect of the constructed recombinant DNA vaccine CRT/HPV6bE7 in vivo. The C57BL/6 mice were vaccinated respectively with recombinant CRT/HPV6bE7 DNA plamids. The inhibitory effects on angiogenesis of generated vaccines in vivo were evaluated by a bFGF-induced angiogenesis assay using the Matrigel kit. To investigate the potential antitumor effect, the mean tumor weights, sizes and tumor appearing times were measured in C57BL/6 mice treated with HPV6bE7-expressing B16 cells. The results indicated that the recombinants CRT180/HPV6bE7 and CRT180 showed strong anti-angiogenic effects in bFGF-induced angiogenesis in vivo. Moreover, CRT180/HPV6bE7 and CRT180 DNA vaccines could significantly inhibit the tumor growth in tumor challenge experiment, and CRT180/HPV6bE7 was superior to other vaccines in delaying tumor formation time, limiting tumor size and weight in tumor protection experiment. In conclusion, recombinant CRT180/HPV6bE7 DNA could elicit a most efficient anti-angiogenic effect and inhibit tumor growth in mice inoculated with DNA vaccines. The antiangiogenic activity of CRT were suggested residing in a domain between CRT 120-180 aa.
Juan, Long; Xiao, Zhao; Song, Yun; Zhijian, Zhang; Jing, Jin; Kun, Yu; Yuna, Hao; Dongfa, Dai; Lili, Ding; Liuxin, Tan; Fei, Liang; Nan, Liu; Fang, Yuan; Yuying, Sun; Yongzhi, Xi
2015-01-01
Current clinically available treatments for rheumatoid arthritis (RA) fail to cure the disease or unsatisfactorily halt disease progression. To overcome these limitations, the development of therapeutic DNA vaccines and boosters may offer new promising strategies. Because type II collagen (CII) as a critical autoantigen in RA and native chicken type II collagen (nCCII) has been used to effectively treat RA, we previously developed a novel therapeutic DNA vaccine encoding CCII (pcDNA-CCOL2A1) with efficacy comparable to that of the current "gold standard", methotrexate(MTX). Here, we systemically evaluated the safety and immunogenicity of the pcDNA-CCOL2A1 vaccine in normal Wistar rats. Group 1 received only a single intramuscular injection into the hind leg with pcDNA-CCOL2A1 at the maximum dosage of 3 mg/kg on day 0; Group 2 was injected with normal saline (NS) as a negative control. All rats were monitored daily for any systemic adverse events, reactions at the injection site, and changes in body weights. Plasma and tissues from all experimental rats were collected on day 14 for routine examinations of hematology and biochemistry parameters, anti-CII IgG antibody reactivity, and histopathology. Our results indicated clearly that at the maximum dosage of 3 mg/kg, the pcDNA-CCOL2A1 vaccine was safe and well-tolerated. No abnormal clinical signs or deaths occurred in the pcDNA-CCOL2A1 group compared with the NS group. Furthermore, no major alterations were observed in hematology, biochemistry, and histopathology, even at the maximum dose. In particularly, no anti-CII IgG antibodies were detected in vaccinated normal rats at 14 d after vaccination; this was relevant because we previously demonstrated that the pcDNA-CCOL2A1 vaccine, when administered at the therapeutic dosage of 300 μg/kg alone, did not induce anti-CII IgG antibody production and significantly reduced levels of anti-CII IgG antibodies in the plasma of rats with established collagen-induced arthritis
Approaches towards DNA vaccination against a skin ciliate parasite in fish.
Directory of Open Access Journals (Sweden)
Louise von Gersdorff Jørgensen
Full Text Available Rainbow trout (Oncorhynchus mykiss were immunized with plasmid DNA vaccine constructs encoding selected antigens from the parasite Ichthyophthirius multifiliis. Two immobilization antigens (I-ags and one cysteine protease were tested as genetic vaccine antigen candidates. Antigenicity was evaluated by immunostaining of transfected fish cells using I-ag specific mono- and polyclonal antibodies. I. multifiliis specific antibody production, regulation of immune-relevant genes and/or protection in terms of parasite burden or mortality was measured to evaluate the induced immune response in vaccinated fish. Apart from intramuscular injection, needle free injection and gene gun delivery were tested as alternative administration techniques. For the I-ags the complement protein fragment C3d and the termini of the viral haemorrhagic septicaemia virus glyco(Gprotein (VHSV G were tested as opsonisation and cellular localisation mediators, respectively, while the full length viral G protein was tested as molecular adjuvant. Expression of I-ags in transfected fish cells was demonstrated for several constructs and by immunohistochemistry it was possible to detect expression of a secreted form of the Iag52B in the muscle cells of injected fish. Up-regulations of mRNA coding for IgM, MHC I, MHC II and TCR β, respectively, were observed in muscle tissue at the injection site in selected trials. In the spleen up-regulations were found for IFN-γ and IL-10. The highest up-regulations were seen following co-administration of I-ag and cysteine protease plasmid constructs. This correlated with a slight elevation of an I. multifiliis specific antibody response. However, in spite of detectable antigen expression and immune reactions, none of the tested vaccination strategies provided significant protection. This might suggest an insufficiency of DNA vaccination alone to trigger protective mechanisms against I. multifiliis or that other or additional parasite antigens
Directory of Open Access Journals (Sweden)
Yao Ma
2018-01-01
Full Text Available Human respiratory syncytial virus (RSV is the most significant cause of acute lower respiratory infection in children. However, there is no licensed vaccine available. Here, we investigated the effect of five or 20 copies of C-Class of CpG ODN (CpG-C motif incorporated into a plasmid DNA vaccine encoding RSV fusion (F glycoprotein on the vaccine-induced immune response. The addition of CpG-C motif enhanced serum binding and virus-neutralizing antibody responses in BALB/c mice immunized with the DNA vaccines. Moreover, mice vaccinated with CpG-modified vaccines, especially with the higher 20 copies, resulted in an enhanced shift toward a Th1-biased antibody and T-cell response, a decrease in pulmonary pathology and virus replication, and a decrease in weight loss after RSV challenge. This study suggests that CpG-C motif, cloned into the backbone of DNA vaccine encoding RSV F glycoprotein, functions as a built-in adjuvant capable of improving the efficacy of DNA vaccine against RSV infection.
Directory of Open Access Journals (Sweden)
Anna Stachyra
2014-01-01
Full Text Available Highly pathogenic avian influenza viruses (HPAIVs cause huge economic losses in the poultry industry because of high mortality rate in infected flocks and trade restrictions. Protective antibodies, directed mainly against hemagglutinin (HA, are the primary means of protection against influenza outbreaks. A recombinant DNA vaccine based on the sequence of H5 HA from the H5N1/A/swan/Poland/305-135V08/2006 strain of HPAIV was prepared. Sequence manipulation included deletion of the proteolytic cleavage site to improve protein stability, codon usage optimization to improve translation and stability of RNA in host cells, and cloning into a commercially available vector to enable expression in animal cells. Naked plasmid DNA was complexed with a liposomal carrier and the immunization followed the prime–boost strategy. The immunogenic potential of the DNA vaccine was first proved in broilers in near-to-field conditions resembling a commercial farm. Next, the protective activity of the vaccine was confirmed in SPF layer-type chickens. Experimental infections (challenge experiments indicated that 100% of vaccinated chickens were protected against H5N1 of the same clade and that 70% of them were protected against H5N1 influenza virus of a different clade. Moreover, the DNA vaccine significantly limited (or even eliminated transmission of the virus to contact control chickens. Two intramuscular doses of DNA vaccine encoding H5 HA induced a strong protective response in immunized chicken. The effective protection lasted for a minimum 8 weeks after the second dose of the vaccine and was not limited to the homologous H5N1 virus. In addition, the vaccine reduced shedding of the virus.
DEFF Research Database (Denmark)
Lorenzen, Niels; Lorenzen, Ellen; Einer-Jensen, Katja
2001-01-01
-vaccination respectively, revealed that a highly protective and lasting immunity was established shortly after vaccination, in accordance with earlier experiments with larger fish. The defence mechanisms activated by the DNA vaccine are thus functional at an early life-stage in rainbow trout....
Abdul-Wahid, Aws; Faubert, Gaétan
2007-12-05
In this study, we investigated the use of Salmonella typhimurium (STM1 strain) as a bactofection vehicle to deliver a transmission-blocking DNA vaccine (TBDV) plasmid to the intestinal immune system. The gene encoding the full length cyst wall protein-2 (CWP2) from Giardia lamblia was subcloned into the pCDNA3 mammalian expression vector and stably introduced into S. typhimurium STM1. Eight-week-old female BALB/c mice were orally immunized every 2 weeks, for a total of three immunizations. Vaccinated and control mice were sacrificed 1 week following the last injection. Administration of the DNA vaccine led to the production of CWP2-specific cellular immune responses characterized by a mixed Th1/Th2 response. Using ELISA, antigen-specific IgA and IgG antibodies were detected in intestinal secretions. Moreover, analysis of sera demonstrated that the DNA immunization also stimulated the production of CWP2-specific IgG antibodies that were mainly of the IgG2a isotype. Finally, challenge infection with live Giardia muris cysts revealed that mice receiving the CWP2-encoding DNA vaccine were able to reduce cyst shedding by approximately 60% compared to control mice. These results demonstrate, for the first time, the development of parasite transmission-blocking immunity at the intestinal level following the administration of a mucosal DNA vaccine delivered by S. typhimurium STM1.
Oral Vaccination Based on DNA-Chitosan Nanoparticles against Schistosoma mansoni Infection
Directory of Open Access Journals (Sweden)
Carolina R. Oliveira
2012-01-01
Full Text Available The development of a vaccine would be essential for the control of schistosomiasis, which is recognized as the most important human helminth infection in terms of morbidity and mortality. A new approach of oral vaccination with DNA-chitosan nanoparticles appears interesting because of their great stability and the ease of target accessibility, besides chitosan immunostimulatory properties. Here we described that chitosan nanoparticles loaded with plasmid DNA encoding Rho1-GTPase protein of Schistosoma mansoni, prepared at different molar ratios of primary amines to DNA phosphate anion (N/P, were able to complex electrostatically with DNA and condense it into positively charged nanostructures. Nanoparticles were able to maintain zeta potential and size characteristics in media that simulate gastric (SGF and intestinal fluids (SIF. Further in vivo studies showed that oral immunization was not able to induce high levels of specific antibodies but induced high levels of the modulatory cytokine IL-10. This resulted in a significative reduce of liver pathology, although it could not protect mice of infection challenge with S. mansoni worms. Mice immunized only with chitosan nanoparticles presented 47% of protection against parasite infection, suggesting an important role of chitosan in inducing a protective immune response against schistosomiasis, which will be more explored in further studies.
Efficacy of a DNA Vaccine Carrying Eimeria maxima Gam56 Antigen Gene against Coccidiosis in Chickens
Xu, Jinjun; Zhang, Yan
2013-01-01
To control coccidiosis without using prophylactic medications, a DNA vaccine targeting the gametophyte antigen Gam56 from Eimeria maxima in chickens was constructed, and the immunogenicity and protective effects were evaluated. The ORF of Gam56 gene was cloned into an eukaryotic expression vector pcDNA3.1(zeo)+. Expression of Gam56 protein in COS-7 cells transfected with recombinant plasmid pcDNA-Gam56 was confirmed by indirect immunofluorescence assay. The DNA vaccine was injected intramuscularly to yellow feathered broilers of 1-week old at 3 dosages (25, 50, and 100 µg/chick). Injection was repeated once 1 week later. One week after the second injection, birds were challenged orally with 5×104 sporulated oocysts of E. maxima, then weighed and killed at day 8 post challenge. Blood samples were collected and examined for specific peripheral blood lymphocyte proliferation activity and serum antibody levels. Compared with control groups, the administration of pcDNA-Gam56 vaccine markedly increased the lymphocyte proliferation activity (P<0.05) at day 7 and 14 after the first immunization. The level of lymphocyte proliferation started to decrease on day 21 after the first immunization. A similar trend was seen in specific antibody levels. Among the 3 pcDNA-Gam56 immunized groups, the median dosage group displayed the highest lymphocyte proliferation and antibody levels (P<0.05). The median dosage group had the greatest relative body weight gain (89.7%), and the greatest oocyst shedding reduction (53.7%). These results indicate that median dosage of DNA vaccine had good immunogenicity and immune protection effects, and may be used in field applications for coccidiosis control. PMID:23710081
A recoding method to improve the humoral immune response to an HIV DNA vaccine.
Directory of Open Access Journals (Sweden)
Yaoxing Huang
Full Text Available This manuscript describes a novel strategy to improve HIV DNA vaccine design. Employing a new information theory based bioinformatic algorithm, we identify a set of nucleotide motifs which are common in the coding region of HIV, but are under-represented in genes that are highly expressed in the human genome. We hypothesize that these motifs contribute to the poor protein expression of gag, pol, and env genes from the c-DNAs of HIV clinical isolates. Using this approach and beginning with a codon optimized consensus gag gene, we recode the nucleotide sequence so as to remove these motifs without modifying the amino acid sequence. Transfecting the recoded DNA sequence into a human kidney cell line results in doubling the gag protein expression level compared to the codon optimized version. We then turn both sequences into DNA vaccines and compare induced antibody response in a murine model. Our sequence, which has the motifs removed, induces a five-fold increase in gag antibody response compared to the codon optimized vaccine.
DEFF Research Database (Denmark)
Barfoed, Annette Malene; Kirstensen, Birte; Dannemann-Jensen, Tove
2004-01-01
Using the nucleoprotein of porcine reproductive and respiratory syndrome virus as model antigen, we optimised parameters for gene gun vaccination of pigs, including firing pressure and vaccination site. As criteria for optimisation, we characterised particle penetration and local tissue damage...... by histology. For selected combinations, vaccination efficiency in terms of antibody response was studied. Gene gun vaccination on ear alone was as efficient as a multi-site (ear, thorax, inguinal area, tongue mucosa) gene gun approach, and more efficient than combined intramuscular (i.m.)/intradermal (i.......d.) injection of plasmid DNA. This indicates, that the ear is an attractive site for gene gun vaccination of pigs....
Directory of Open Access Journals (Sweden)
Kar Muthumani
Full Text Available An effective HIV vaccine will most likely require the induction of strong T-cell responses, broadly neutralizing antibodies (bNAbs, and the elicitation of antibody-dependent cellular cytotoxicity (ADCC. Previously, we demonstrated the induction of strong HIV/SIV cellular immune responses in macaques and humans using synthetic consensus DNA immunogens delivered via adaptive electroporation (EP. However, the ability of this improved DNA approach to prime for relevant antibody responses has not been previously studied. Here, we investigate the immunogenicity of consensus DNA constructs encoding gp140 sequences from HIV-1 subtypes A, B, C and D in a DNA prime-protein boost vaccine regimen. Mice and guinea pigs were primed with single- and multi-clade DNA via EP and boosted with recombinant gp120 protein. Sera were analyzed for gp120 binding and induction of neutralizing antibody activity. Immunization with recombinant Env protein alone induced low-titer binding antibodies with limited neutralization breath. In contrast, the synthetic DNA prime-protein boost protocol induced significantly higher antibody binding titers. Furthermore, sera from DNA prime-protein boost groups were able to neutralize a broader range of viruses in a panel of tier 1 clade B viruses as well as multiple tier 1 clade A and clade C viruses. Further investigation of synthetic DNA prime plus adaptive EP plus protein boost appears warranted.
Smith, Larry R; Wloch, Mary K; Chaplin, Jennifer A; Gerber, Michele; Rolland, Alain P
2013-09-25
2013 marks a milestone year for plasmid DNA vaccine development as a first-in-class cytomegalovirus (CMV) DNA vaccine enters pivotal phase 3 testing. This vaccine consists of two plasmids expressing CMV antigens glycoprotein B (gB) and phosphoprotein 65 (pp65) formulated with a CRL1005 poloxamer and benzalkonium chloride (BAK) delivery system designed to enhance plasmid expression. The vaccine's planned initial indication under investigation is for prevention of CMV reactivation in CMV-seropositive (CMV⁺) recipients of an allogeneic hematopoietic stem cell transplant (HCT). A randomized, double-blind placebo-controlled phase 2 proof-of-concept study provided initial evidence of the safety of this product in CMV⁺ HCT recipients who underwent immune ablation conditioning regimens. This study revealed a significant reduction in viral load endpoints and increased frequencies of pp65-specific interferon-γ-producing T cells in vaccine recipients compared to placebo recipients. The results of this endpoint-defining trial provided the basis for defining the primary and secondary endpoints of a global phase 3 trial in HCT recipients. A case study is presented here describing the development history of this vaccine from product concept to initiation of the phase 3 trial.
For t 2 DNA vaccine prevents Forcipomyia taiwana (biting midge) allergy in a mouse model.
Lee, M-F; Song, P-P; Lin, T-M; Chiu, Y-T; Chen, Y-H
2016-04-01
Forcipomyia taiwana (biting midge) is the most prevalent allergenic biting insect in Taiwan, and 60% of the exposed subjects develop allergic reactions. Subjects with insect allergy frequently limit their outdoor activities to avoid the annoyingly intense itchy allergic reactions, leading to significant worsening of their quality of life. Allergen-specific immunotherapy is the only known therapy that provides long-term host immune tolerance to the allergen, but is time-consuming and cumbersome. This study tested whether the For t 2 DNA vaccine can prevent allergic symptoms in For t 2-sensitized mice. Two consecutive shots of For t 2 DNA vaccine were given to mice with a 7-day interval before sensitization with recombinant For t 2 proteins, using the two-step sensitization protocol reported previously. The For t 2 DNA vaccine at 50 μg prevented the production of For t 2-specific IgE (P allergy in the future. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Deng, Shu-xuan; Cai, Ming-sheng; Cui, Wei; Huang, Jin-lu; Li, Mei-li
2014-01-01
Goose parvovirus (GPV) is a highly contagious and deadly disease for goslings and Muscovy ducklings. To compare the differences in immune response of geese immunized with GPV-VP1 DNA-based and live attenuated vaccines. Shitou geese were immunized once with either 20 μg pcDNA-GPV-VP1 DNA gene vaccine by gene gun bombardment via intramuscular injection, or 300 μg by i.m. injection, or 300 μL live attenuated vaccine by i.m. injection, whereas 300 μg pcDNA3.1 (+) i.m. or 300 μL saline i.m. were used as positive and negative controls, respectively. Each group comprised 28 animals. Peripheral blood samples were collected from 2-210 days after immunization and the proliferation of T lymphocytes, the number of CD4(+) and CD8(+) T cells and the level of IgG assessed. Statistical analysis was performed using a one-way analysis of variance with group multiple comparisons via Tukey's test. The pcDNA-GPV-VP1 DNA and attenuated vaccine induced cellular and humoral responses, and there were no differences between the 20 and 300 μg group in the responses of proliferation of T lymphocyte and the CD8(+) T-cell. However, as to CD4(+) T-cell response and humoral immunity, the 20 μg group performed better than the 300 μg group, which induced better cellular and humoral immunity than live attenuated vaccine. This study showed that it is possible to induce both cellular and humoral response using DNA-based vaccines and that the pcDNA-GPV-VP1 DNA gene vaccine induced better cellular and humoral immunity than live attenuated vaccine.
Borthwick, Nicola J; Lane, Thirusha; Moyo, Nathifa; Crook, Alison; Shim, Jung Min; Baines, Ian; Wee, Edmund G; Hawkins, Philip N; Gillmore, Julian D; Hanke, Tomáš; Pepys, Mark B
2018-01-01
The failure of DNA vaccination in humans, in contrast to its efficacy in some species, is unexplained. Observational and interventional experimental evidence suggests that DNA immunogenicity may be prevented by binding of human serum amyloid P component (SAP). SAP is the single normal DNA binding protein in human plasma. The drug (R)-1-[6-[(R)-2-carboxypyrrolidin-1-yl]-6-oxo-hexanoyl]pyrrolidine-2-carboxylic acid (CPHPC, miridesap), developed for treatment of systemic amyloidosis and Alzheimer's disease, depletes circulating SAP by 95-99%. The proof-of-concept HIV-CORE 003 clinical trial tested whether SAP depletion by CPHPC would enhance the immune response in human volunteers to DNA vaccination delivering the HIVconsv immunogen derived from conserved sub-protein regions of HIV-1. Human volunteers received 3 intramuscular immunizations with an experimental DNA vaccine (DDD) expressing HIV-1-derived immunogen HIVconsv, with or without prior depletion of SAP by CPHPC. All subjects were subsequently boosted by simian (chimpanzee) adenovirus (C)- and poxvirus MVA (M)-vectored vaccines delivering the same immunogen. After administration of each vaccine modality, the peak total magnitudes, kinetics, functionality and memory subsets of the T-cell responses to HIVconsv were thoroughly characterized. No differences were observed between the CPHPC treated and control groups in any of the multiple quantitative and qualitative parameters of the T-cell responses to HIVconsv, except that after SAP depletion, there was a statistically significantly greater breadth of T-cell specificities, that is the number of recognized epitopes, following the DDDC vaccination. The protocol used here for SAP depletion by CPHPC prior to DNA vaccination produced only a very modest suggestion of enhanced immunogenicity. Further studies will be required to determine whether SAP depletion might have a practical value in DNA vaccination for other plasmid backbones and/or immunogens. Clinicaltrials
Hu, Kai; Malla, Tejsu; Zhai, Yujia; Dong, Lili; Tang, Ru
2015-01-01
To evaluate the comparative effect of topical versus intramuscular administration of nanoparticle-carried DNA vaccine in preventing corneal herpes simplex virus type 1 (HSV-1) infection. Nanoparticle [polyethylenimine (PEI)-Fe3O4]-carried DNA vaccine (PEI-Fe3O4-pRSC-gD-IL-21) or DNA vaccine (pRSC-gD-IL-21) alone were topically versus intramuscularly inoculated into one eye each of mice on days 0, 14 and 28. Three weeks after the final immunization, the specific immune responses and clinical degrees of primary herpes simplex keratitis were evaluated. Topical inoculation of nanoparticle-carried DNA vaccine induced mice to generate similar levels of specific HSV-1-neutralizing antibody, IFN-γ and IL-4 in serum and specific killing (cytotoxicity) and proliferative activities of the splenic lymphocytes, but a significantly higher level of secretory IgA in tears compared to those of intramuscular inoculation. More importantly, the mice inoculated topically showed a significantly decreased herpes simplex keratitis severity than the mice inoculated intramuscularly after HSV-1 challenge on the corneas of the mice. Topical inoculation of nanoparticle-carried DNA vaccine elicits a stronger specific local immune response and more effectively inhibits herpes simplex keratitis as compared to intramuscular inoculation in an HSV-1 ocular challenge mouse model. Thus, topical administration may be a promising inoculating route for the nanoparticle-carried DNA vaccine to prevent corneal infections. © 2015 S. Karger AG, Basel.
Directory of Open Access Journals (Sweden)
Sandhya Vasan
Full Text Available DNA-based vaccines have been safe but weakly immunogenic in humans to date.We sought to determine the safety, tolerability, and immunogenicity of ADVAX, a multigenic HIV-1 DNA vaccine candidate, injected intramuscularly by in vivo electroporation (EP in a Phase-1, double-blind, randomized placebo-controlled trial in healthy volunteers. Eight volunteers each received 0.2 mg, 1 mg, or 4 mg ADVAX or saline placebo via EP, or 4 mg ADVAX via standard intramuscular injection at weeks 0 and 8. A third vaccination was administered to eleven volunteers at week 36. EP was safe, well-tolerated and considered acceptable for a prophylactic vaccine. EP delivery of ADVAX increased the magnitude of HIV-1-specific cell mediated immunity by up to 70-fold over IM injection, as measured by gamma interferon ELISpot. The number of antigens to which the response was detected improved with EP and increasing dosage. Intracellular cytokine staining analysis of ELISpot responders revealed both CD4+ and CD8+ T cell responses, with co-secretion of multiple cytokines.This is the first demonstration in healthy volunteers that EP is safe, tolerable, and effective in improving the magnitude, breadth and durability of cellular immune responses to a DNA vaccine candidate.ClinicalTrials.gov NCT00545987.
DEFF Research Database (Denmark)
Embregts, Carmen W. E.; Rigaudeau, Dimitri; Veselý, Tomas
2017-01-01
Although spring viremia of carp virus (SVCV) can cause high mortalities in common carp, a commercial vaccine is not available for worldwide use. Here, we report a DNA vaccine based on the expression of the SVCV glycoprotein (G) which, when injected in the muscle even at a single low dose of 0.1 μg...... DNA/g of fish, confers up to 100% protection against a subsequent bath challenge with SVCV. Importantly, to best validate vaccine efficacy, we also optimized a reliable bath challenge model closely mimicking a natural infection, based on a prolonged exposure of carp to SVCV at 15°C. Using...... this optimized bath challenge, we showed a strong age-dependent susceptibility of carp to SVCV, with high susceptibility at young age (3 months) and a full resistance at 9 months. We visualized local expression of the G protein and associated early inflammatory response by immunohistochemistry and described...
International Nuclear Information System (INIS)
Zheng Min; Jin Ningyi; Liu Qi; Huo Xiaowei; Li Yang; Hu Bo; Ma Haili; Zhu Zhanbo; Cong Yanzhao; Li Xiao; Jin Minglan; Zhu Guangze
2009-01-01
Goatpox, caused by goatpox virus (GTPV), is an acute feverish and contagious disease in goats often associated with high morbidity and high mortality. To resolve potential safety risks and vaccination side effects of existing live attenuated goatpox vaccine (AV41), two Semliki forest virus (SFV) replicon-based bicistronic expression DNA vaccines (pCSm-AAL and pCSm-BAA) which encode GTPV structural proteins corresponding to the Vaccinia virus proteins A27, L1, A33, and B5, respectively, were constructed. Then, theirs ability to induce humoral and cellular response in mice and goats, and protect goats against virulent virus challenge were evaluated. The results showed that, vaccination with pCSm-AAL and pCSm-BAA in combination could elicit strong humoral and cellular responses in mice and goats, provide partial protection against viral challenge in goats, and reduce disease symptoms. Additionally, priming vaccination with the above-mentioned DNA vaccines could significantly reduce the goats' side reactions from boosting vaccinations with current live vaccine (AV41), which include skin lesions at the inoculation site and fevers. Data obtained in this study could not only facilitate improvement of the current goatpox vaccination strategy, but also provide valuable guidance to suitable candidates for evaluation and development of orthopoxvirus vaccines.
Immunotherapy for Alzheimer's disease: DNA- and protein-based epitope vaccines.
Davtyan, Hayk; Petrushina, Irina; Ghochikyan, Anahit
2014-01-01
Active immunotherapy for Alzheimer's disease (AD) is aimed to induce antibodies specific to amyloid-beta (Aβ) that are capable to reduce the level of Aβ in the CNS of Alzheimer's disease patients. First clinical trial AN-1792 that was based on vaccination with full-length Aβ42 showed that safe and effective AD vaccine should induce high titers of anti-Aβ antibodies without activation of harmful autoreactive T cells. Replacement of self-T cell epitope with foreign epitope, keeping self-B cell epitope intact, may allow to induce high titers of anti-Aβ antibodies while avoiding the activation of T cells specific to Aβ. Here we describe the protocols for evaluation of AD DNA- or multiple antigenic peptide (MAP)-based epitope vaccines composed of Aβ(1-11) B cell epitope fused to synthetic T cell epitope PADRE (Aβ(1-11)-PADRE). All protocols could be used for testing any epitope vaccine constructed in your lab and composed of other T cell epitopes using the appropriate peptides in tests for evaluation of humoral and cellular immune responses.
Platteel, Anouk C M; Marit de Groot, A; Andersen, Peter; Ovaa, Huib; Kloetzel, Peter M; Mishto, Michele; Sijts, Alice J A M
2016-01-01
Most vaccines are based on protective humoral responses while for intracellular pathogens CD8(+) T cells are regularly needed to provide protection. However, poor processing efficiency of antigens is often a limiting factor in CD8(+) T cell priming, hampering vaccine efficacy. The multistage cDNA
Antiviral immunity in fish – functional analysis using DNA vaccination as a tool
DEFF Research Database (Denmark)
Lorenzen, Niels; Lorenzen, Ellen; Einer-Jensen, Katja
2013-01-01
fingerlings. Vaccination of fish at an early stage appears advantageous, since larger fish require higher doses of vaccine to be protected. Even in fish with an average size of 0.5 g at the time of vaccination, good protection can be obtained. Interestingly, immunity is established already a few days after...... and cellular components both play a role in the long lasting protection. The similarity of the functional immune response profile to that induced by a natural virus infection is striking and is most likely one of the major reasons for the efficacy of the rhabdovirus DNA vaccines. Although other elements like...... protein gene suggest that the structural requirements for antigenicity are different from the requirements for immunogenicity....
Virginio, Veridiana Gomes; Gonchoroski, Taylor; Paes, Jéssica Andrade; Schuck, Desirée Cigaran; Zaha, Arnaldo; Ferreira, Henrique Bunselmeyer
2014-10-07
Mycoplasma hyopneumoniae is the etiological agent of porcine enzootic pneumonia (PEP) and causes major economic losses to the pig industry worldwide. Commercially available vaccines provide only partial protection and are relatively expensive. In this study, we assessed the humoral and cellular immune responses to three recombinant antigens of M. hyopneumoniae. Immune responses to selected domains of the P46, HSP70 and MnuA antigens (P46102-253, HSP70212-601 and MnuA182-378), delivered as recombinant subunit or DNA vaccines, were evaluated in BALB/c mice. All purified recombinant antigens and two DNA vaccines, pcDNA3.1(+)/HSP70212-601 and pcDNA3.1(+)/MnuA182-378, elicited a strong humoral immune response, indicated by high IgG levels in the serum. The cellular immune response was assessed by detection of IFN-γ, IL-10 and IL-4 in splenocyte culture supernatants. The recombinant subunit and DNA vaccines induced Th1-polarized immune responses, as evidenced by increased levels of IFN-γ. All recombinant subunit vaccines and the pcDNA3.1(+)/MnuA182-378 vaccine also induced the secretion of IL-10, a Th2-type cytokine, in large quantities. The mixed Th1/Th2-type response may elicit an effective immune response against M. hyopneumoniae, suggesting that P46102-253, HSP70212-601 and MnuA182-378 are potential novel and promising targets for the development of vaccines against PEP. Copyright © 2014 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Li Pan; Chen Simu; Jiang Yuhong; Jiang Jiayu; Zhang Zhirong; Sun Xun
2013-01-01
To construct mannosylated liposomes/protamine/DNA (LPD) carriers for DNA vaccine targeting to dendritic cells (DCs), a mannosylated cholesterol derivative (Man-C6-Chol) was synthesized via simple ester linkage and amide bonds. Then, the Man-C6-Chol was applied to LPD formulation as a synthetic ligand. The physicochemical properties of mannosylated LPD (Man-LPD) were first evaluated, including the size and zeta potential, morphology and the ability to protect DNA against DNase I degradation. Man-LPD showed a small size with a stable viral-like structure. In comparison to non-mannose liposomes/LPD (Man-free liposomes/LPD), mannosylated liposomes/LPD (Man-liposomes/Man-LPD) exhibited higher efficiency in both intracellular uptake (2.3-fold) and transfection (4.5-fold) in vitro. Subsequent MTT assays indicated that the LPD carriers had low toxicity on the tested cells. Afterwards, the investigation into the maturation activation on primary bone marrow-derived DCs (BMDCs) showed that both Man-LPD and Man-free LPD induced remarkable up-regulation of CD80, CD86 and CD40 on BMDCs. Inspired by these studies, we can conclude that the synthetic mannosylated LPD targeting to DCs was a potential carrier for DNA vaccine. (paper)
Zhang, Yonghong; Liang, Shuang; Li, Xiujin; Wang, Liyue; Zhang, Jianlou; Xu, Jian; Huo, Shanshan; Cao, Xuebin; Zhong, Zhenyu; Zhong, Fei
2015-07-09
Our previous study showed that IL-2 and IL-7 could mutually enhance the immunogenicity of canine parvovirus VP2 DNA vaccine, although the underlying mechanism remained unknown. Here, we used the OVA gene as a DNA vaccine in a mouse model to test their enhancement on DNA vaccine immunogenicity and to explore the molecular mechanism. Results showed that both IL-2 and IL-7 genes significantly increased the immunogenicity of OVA DNA vaccine in mice. Co-administration of IL-2 and IL-7 genes with OVA DNA significantly increased OVA-specific antibody titers, T cell proliferation and IFN-γ production compared with IL-2 or IL-7 alone, confirming that IL-2 and IL-7 mutually enhanced DNA vaccine immunogenicity. Mechanistically, we have shown that IL-2 significantly stimulated generation of IL-7 receptor-expressing lymphocytes, and that IL-7 significantly induced IL-2 receptor expression. These results contribute to an explanation of the mechanism of the mutual effects of IL-2 and IL-7 on enhancing DNA vaccine immunogenicity and provided a basis for further investigation on their mutual effects on adjuvant activity and immune regulation. Copyright © 2015 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Kornbluth Richard S
2009-08-01
Full Text Available Abstract Background Targeting of protein antigens to dendritic cells (DC via the DEC205 receptor enhances presentation of antigen-derived peptides on MHC-I and MHC-II molecules and, in the presence of costimulatory signals, antigen-specific immune responses. The immunogenicity and efficacy of DNA vaccination can also be enhanced by fusing the encoded antigen to single chain antibodies directed against DEC205. To further improve this strategy, we evaluated different toll-like receptor ligands (TLR and CD40 ligands (CD40L as adjuvants for DNA vaccines encoding a DEC205-single-chain antibody fused to the ovalbumin model antigen or HIV-1 Gag and assessed the priming efficacy of DNA in a DNA prime adenoviral vector boost immunization regimen. Results Mice were primed with the adjuvanted DEC-205 targeted DNA vaccines and boosted with adenoviral vectors encoding the same antigens. CD8+ T cell responses were determined after the adenoviral booster immunization, to determine how well the different DNA immunization regimens prime for the adenoviral boost. In the absence of adjuvants, targeting of DNA-encoded ovalbumin to DCs suppressed CD8+ T-cell responses after the adenoviral booster immunization. CD8+ T-cell responses to the DEC205 targeted DNA vaccines increased only slightly by adding either the TLR-9 ligand CpG, the TLR-3 ligand Poly I:C, or CD40 ligand expression plasmids. However, the combination of both TLR-ligands led to a strong enhancement of CD8+ T-cell responses compared to a non-targeted DNA vaccine. This finding was confirmed using HIV Gag as antigen. Conclusion Although DNA prime adenoviral vector boost immunizations belong to the strongest inducers of cytotoxic T cell responses in different animal models and humans, the CD8+ T cell responses can be further improved by targeting the DNA encoded antigen to DEC205 in the presence of synergistic TLR ligands CpG and Poly I:C.
Directory of Open Access Journals (Sweden)
Johanna Poecheim
2015-12-01
Full Text Available Adjuvants enhance immunogenicity of vaccines through either targeted antigen delivery or stimulation of immune receptors. Three cationic nanoparticle formulations were evaluated for their potential as carriers for a DNA vaccine, and muramyl dipeptide (MDP as immunostimulatory agent, to induce and increase immunogenicity of Mycobacterium tuberculosis antigen encoding plasmid DNA (pDNA. The formulations included (1 trimethyl chitosan (TMC nanoparticles, (2 a squalene-in-water nanoemulsion, and (3 a mineral oil-in-water nanoemulsion. The adjuvant effect of the pDNA-nanocomplexes was evaluated by serum antibody analysis in immunized mice. All three carriers display a strong adjuvant effect, however, only TMC nanoparticles were capable to bias immune responses towards Th1. pDNA naturally contains immunostimulatory unmethylated CpG motifs that are recognized by Toll-like receptor 9 (TLR-9. In mechanistic in vitro studies, activation of TLR-9 and the ability to enhance immunogenicity by simultaneously targeting TLR-9 and NOD-like receptor 2 (NLR-2 was determined by proinflammatory cytokine release in RAW264.7 macrophages. pDNA in combination with MDP was shown to significantly increase proinflammatory cytokine release in a synergistic manner, dependent on NLR-2 activation. In summary, novel pDNA-Ag85A loaded nanoparticle formulations, which induce antigen specific immune responses in mice were developed, taking advantage of the synergistic combinations of TLR and NLR agonists to increase the adjuvanticity of the carriers used.
Cashman, Kathleen A.; Wilkinson, Eric R.; Wollen, Suzanne E.; Shamblin, Joshua D.; Zelko, Justine M.; Bearss, Jeremy J.; Zeng, Xiankun; Broderick, Kate E.; Schmaljohn, Connie S.
2017-01-01
ABSTRACT We previously developed optimized DNA vaccines against both Lassa fever and Ebola hemorrhagic fever viruses and demonstrated that they were protective individually in guinea pig and nonhuman primate models. In this study, we vaccinated groups of strain 13 guinea pigs two times, four weeks apart with 50 µg of each DNA vaccine or a mock vaccine at discrete sites by intradermal electroporation. Five weeks following the second vaccinations, guinea pigs were exposed to lethal doses of Lassa virus, Ebola virus, or a combination of both viruses simultaneously. None of the vaccinated guinea pigs, regardless of challenge virus and including the coinfected group, displayed weight loss, fever or other disease signs, and all survived to the study endpoint. All of the mock-vaccinated guinea pigs that were infected with Lassa virus, and all but one of the EBOV-infected mock-vaccinated guinea pigs succumbed. In order to determine if the dual-agent vaccination strategy could protect against both viruses if exposures were temporally separated, we held the surviving vaccinates in BSL-4 for approximately 120 days to perform a cross-challenge experiment in which guinea pigs originally infected with Lassa virus received a lethal dose of Ebola virus and those originally infected with Ebola virus were infected with a lethal dose of Lassa virus. All guinea pigs remained healthy and survived to the study endpoint. This study clearly demonstrates that DNA vaccines against Lassa and Ebola viruses can elicit protective immunity against both individual virus exposures as well as in a mixed-infection environment. PMID:29135337
Pereira, V B; da Cunha, V P; Preisser, T M; Souza, B M; Turk, M Z; De Castro, C P; Azevedo, M S P; Miyoshi, A
2017-06-01
A regimen utilizing Bacille Calmette-Guerin (BCG) and another vaccine system as a booster may represent a promising strategy for the development of an efficient tuberculosis vaccine for adults. In a previous work, we confirmed the ability of Lactococcus lactis fibronectin-binding protein A (FnBPA+) (pValac:ESAT-6), a live mucosal DNA vaccine, to produce a specific immune response in mice after oral immunization. In this study, we examined the immunogenicity of this strain as a booster for the BCG vaccine in mice. After immunization, cytokine and immunoglobulin profiles were measured. The BCG prime L. lactis FnBPA+ (pValac:ESAT-6) boost group was the most responsive group, with a significant increase in splenic pro-inflammatory cytokines IL-17, IFN-γ, IL-6 and TNF-α compared with the negative control. Based on the results obtained here, we demonstrated that L. lactis FnBPA+ (pValac:ESAT-6) was able to increase the BCG vaccine general immune response. This work is of great scientific and social importance because it represents the first step towards the development of a booster to the BCG vaccine using L. lactis as a DNA delivery system. © 2017 The Society for Applied Microbiology.
Abeta DNA vaccination for Alzheimer's disease: focus on disease prevention.
Cribbs, David H
2010-04-01
several significant advantages, including lower cost and the typical immunization protocol should be much less intrusive to the patient relative to passive therapy, in the advent of Abeta-antibody immune complex-induced adverse events the patients will have to receive immuno-supperssive therapy for an extended period until the anti Abeta antibody levels drop naturally as the effects of the vaccine decays over time. Obviously, improvements in vaccine design are needed to improve both the safety, as well as the efficacy of anti-Abeta immunotherapy. The focus of this review is on the advantages of DNA vaccination for anti-Abeta immunotherapy, and the major hurdles, such as immunosenescence, selection of appropriate molecular adjuvants, universal T cell epitopes, and possibly a polyepitope design based on utilizing existing memory T cells in the general population that were generated in response to childhood or seasonal vaccines, as well as various infections. Ultimately, we believe that the further refinement of our AD DNA epitope vaccines, possibly combined with a prime boost regime will facilitate translation to human clinical trials in either very early AD, or preferably in preclinical stage individuals identified by validated AD biomarkers.
Clinical Development of a Cytomegalovirus DNA Vaccine: From Product Concept to Pivotal Phase 3 Trial
Directory of Open Access Journals (Sweden)
Michele Gerber
2013-09-01
Full Text Available 2013 marks a milestone year for plasmid DNA vaccine development as a first-in-class cytomegalovirus (CMV DNA vaccine enters pivotal phase 3 testing. This vaccine consists of two plasmids expressing CMV antigens glycoprotein B (gB and phosphoprotein 65 (pp65 formulated with a CRL1005 poloxamer and benzalkonium chloride (BAK delivery system designed to enhance plasmid expression. The vaccine’s planned initial indication under investigation is for prevention of CMV reactivation in CMV-seropositive (CMV+ recipients of an allogeneic hematopoietic stem cell transplant (HCT. A randomized, double-blind placebo-controlled phase 2 proof-of-concept study provided initial evidence of the safety of this product in CMV+ HCT recipients who underwent immune ablation conditioning regimens. This study revealed a significant reduction in viral load endpoints and increased frequencies of pp65-specific interferon-γ-producing T cells in vaccine recipients compared to placebo recipients. The results of this endpoint-defining trial provided the basis for defining the primary and secondary endpoints of a global phase 3 trial in HCT recipients. A case study is presented here describing the development history of this vaccine from product concept to initiation of the phase 3 trial.
Directory of Open Access Journals (Sweden)
Peter T Loudon
2010-06-01
Full Text Available The recent H5N1 avian and H1N1 swine-origin influenza virus outbreaks reaffirm that the threat of a world-wide influenza pandemic is both real and ever-present. Vaccination is still considered the best strategy for protection against influenza virus infection but a significant challenge is to identify new vaccine approaches that offer accelerated production, broader protection against drifted and shifted strains, and the capacity to elicit anti-viral immune responses in the respiratory tract at the site of viral entry. As a safe alternative to live attenuated vaccines, the mucosal and systemic immunogenicity of an H1N1 influenza (A/New Caledonia/20/99 HA DNA vaccine administered by particle-mediated epidermal delivery (PMED or gene gun was analyzed in rhesus macaques.Macaques were immunized at weeks 0, 8, and 16 using a disposable single-shot particle-mediated delivery device designed for clinical use that delivers plasmid DNA directly into cells of the epidermis. Significant levels of hemagglutination inhibiting (HI antibodies and cytokine-secreting HA-specific T cells were observed in the periphery of macaques following 1-3 doses of the PMED HA DNA vaccine. In addition, HA DNA vaccination induced detectable levels of HA-specific mucosal antibodies and T cells in the lung and gut-associated lymphoid tissues of vaccinated macaques. Importantly, co-delivery of a DNA encoding the rhesus macaque GM-CSF gene was found to significantly enhance both the systemic and mucosal immunogenicity of the HA DNA vaccine.These results provide strong support for the development of a particle-mediated epidermal DNA vaccine for protection against respiratory pathogens such as influenza and demonstrate, for the first time, the ability of skin-delivered GM-CSF to serve as an effective mucosal adjuvant for vaccine induction of immune responses in the gut and respiratory tract.
Kinnear, Ekaterina; Caproni, Lisa J; Tregoning, John S
2015-01-01
DNA vaccines can be manufactured cheaply, easily and rapidly and have performed well in pre-clinical animal studies. However, clinical trials have so far been disappointing, failing to evoke a strong immune response, possibly due to poor antigen expression. To improve antigen expression, improved technology to monitor DNA vaccine transfection efficiency is required. In the current study, we compared plasmid encoded tdTomato, mCherry, Katushka, tdKatushka2 and luciferase as reporter proteins for whole animal in vivo imaging. The intramuscular, subcutaneous and tattooing routes were compared and electroporation was used to enhance expression. We observed that overall, fluorescent proteins were not a good tool to assess expression from DNA plasmids, with a highly heterogeneous response between animals. Of the proteins used, intramuscular delivery of DNA encoding either tdTomato or luciferase gave the clearest signal, with some Katushka and tdKatushka2 signal observed. Subcutaneous delivery was weakly visible and nothing was observed following DNA tattooing. DNA encoding haemagglutinin was used to determine whether immune responses mirrored visible expression levels. A protective immune response against H1N1 influenza was induced by all routes, even after a single dose of DNA, though qualitative differences were observed, with tattooing leading to high antibody responses and subcutaneous DNA leading to high CD8 responses. We conclude that of the reporter proteins used, expression from DNA plasmids can best be assessed using tdTomato or luciferase. But, the disconnect between visible expression level and immunogenicity suggests that in vivo whole animal imaging of fluorescent proteins has limited utility for predicting DNA vaccine efficacy.
Use of DNA vaccination for determination of onset of adaptive immunity in rainbow trout fry
DEFF Research Database (Denmark)
Rasmussen, Jesper Skou; Lorenzen, Ellen; Kjær, Torben Egil
2013-01-01
). The fish were challenged by immersion at different times post vaccination. Protective immunity was induced in both sizes of fish, but whereas clear-cut specific protection was evident in the fish vaccinated at 0.5g, the results suggested that the protection in the fish vaccinated at 0.25 g was mainly due......Vaccine producers often recommend a minimum size of 5g for vaccination of rainbow trout, but implementation of prophylactic vaccination in smaller sized fish would be an advantage for several infectious diseases. To implement a cost efficient vaccination strategy, it is important to know...... the duration and nature of the protective immunity induced by the vaccines in the fish. The present work aimed at determination of the smallest size at which specific immunity could be induced in rainbow trout fry by DNA vaccination against viral haemorrhagic septicaemia (VHS). Earlier experiments revealed...
Ling, Yong; Li, Shaowen; Yang, Junjing; Yuan, Jilei; He, Cheng
2011-01-01
Lycium barbarum polysaccharides (LBP) can stimulate moderate immune responses therefore could potentially be used as a substitute for oil adjuvants in veterinary vaccines. In the present study, it was shown that the isolated active component of LBP3a, combined with a DNA vaccine encoding the major outer membrane protein (MOMP) of Chlamydophila abortus, induced protection in mice against challenge. Sixty BALB/c mice were randomly assigned to 5 groups. Sub-fractions of polysaccharide LBP3a, at 12.5, 25 and 50 mg/kg concentrations, respectively, were mixed with a pCI-neo::MOMP (pMOMP) vaccine. Mice administrated with pCI-neo + LBP3a were served as a control. All mice were inoculated at day 0, 14, and 28, and challenged on day 44. The effects of LBp3a on serum antibody levels, in vitro lymphocyte proliferation, the activity of interleaukin-2 (IL-2), interferon-γ (IFN-γ), tumor necrosis factor α(TNF-α)and chlamydia clearance were determined. A combination of DNA vaccine and LBP3a induced significantly higher antibody levels in mice, higher T cell proliferation and higher levels of IFN-γ and IL-2. Mice immunized with DNA and LBP3a also showed significantly higher levels of chlamydia clearance in mice spleens and a greater Th1 immune response. The immunoenhancement induced by 25 mg/kg LBP3a is more effective than that induced by a 12.5 and 50 mg/kg. This implies that LBP3a at 25 mg/kg has a high potential to be used as an effective adjuvant with a DNA vaccine against swine Chlamydophila abortus.
Evaluation of cellular responses for a chimeric HBsAg-HCV core DNA vaccine in BALB/c mice
Directory of Open Access Journals (Sweden)
Maryam Yazdanian
2015-01-01
Conclusion: Fusion of HBsAg to HCVcp in the context of a DNA vaccine modality could augment Th1-oriented cellular and CTL responses toward a protective epitope, comparable to that of HCVcp (subunit HCV vaccine immunization.
Directory of Open Access Journals (Sweden)
Qiang Zou
2010-01-01
Full Text Available Various chemokines and cytokines as adjuvants can be used to improve efficacy of DNA vaccination. In this study, we sought to investigate if a DNA construct expressing IL-9 (designed as proV-IL9 as a molecular adjuvant enhance antigen specific immune responses elicited by the pcD-VP1 DNA vaccination. Mice immunized with pcD-VP1 combined with proV-IL9 developed a strong humoral response. In addition, the coinoculation induced significant higher level of antigen-specific cell proliferation and cytotoxic response. This agreed well with higher expression level of IFN-γ and perforin in CD8+ T cells, but not with IL-17 in these T cells. The results indicate that IL-9 induces the development of IFN-γ-producing CD8+ T cells (Tc1, but not the IL-17-producing CD8+ T cells (Tc17. Up-regulated expressions of BCL-2 and BCL-XL were exhibited in these Tc1 cells, suggesting that IL-9 may trigger antiapoptosis mechanism in these cells. Together, these results demonstrated that IL-9 used as molecular adjuvant could enhance the immunogenicity of DNA vaccination, in augmenting humoral and cellular responses and particularly promoting Tc1 activations. Thus, the IL-9 may be utilized as a potent Tc1 adjuvant for DNA vaccines.
Schultheis, Katherine; Schaefer, Hubert; Yung, Bryan S; Oh, Janet; Muthumani, Karuppiah; Humeau, Laurent; Broderick, Kate E; Smith, Trevor R F
2017-01-03
The skin is an ideal target tissue for vaccine delivery for a number of reasons. It is highly accessible, and most importantly, enriched in professional antigen presenting cells. Possessing strong similarities to human skin physiology and displaying a defined epidermis, the guinea pig is an appropriate model to study epidermal delivery of vaccine. However, whilst we have characterized the humoral responses in the guinea pig associated with skin vaccine protocols we have yet to investigate the T cell responses. In response to this inadequacy, we developed an IFN-γ ELISpot assay to characterize the cellular immune response in the peripheral blood of guinea pigs. Using a nucleoprotein (NP) influenza pDNA vaccination regimen, we characterized host T cell responses. After delivery of the DNA vaccine to the guinea pig epidermis we detected robust and rapid T cell responses. The levels of IFN-γ spot-forming units averaged approximately 5000 per million cells after two immunizations. These responses were broad in that multiple regions across the NP antigen elicited a T cell response. Interestingly, we identified a number of NP immunodominant T cell epitopes to be conserved across an outbred guinea pig population, a phenomenon which was also observed after immunization with a RSV DNA vaccine. We believe this data enhances our understanding of the cellular immune response elicited to a vaccine in guinea pigs, and globally, will advance the use of this model for vaccine development, especially those targeting skin as a delivery site. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.
DEFF Research Database (Denmark)
Bragstad, Karoline; Vinner, Lasse; Hansen, Mette Sif
2013-01-01
seasonal and emerging influenza viruses. We have developed an alternative influenza vaccine based on DNA expressing selected influenza proteins of pandemic and seasonal origin. In the current study, we investigated the protection of a polyvalent influenza DNA vaccine approach in pigs. We immunised pigs...... intradermally with a combination of influenza DNA vaccine components based on the pandemic 1918 H1N1 (M and NP genes), pandemic 2009 H1N1pdm09 (HA and NA genes) and seasonal 2005 H3N2 genes (HA and NA genes) and investigated the protection against infection with virus both homologous and heterologous to the DNA...... of this DNA vaccine to limit virus shedding may have an impact on virus spread among pigs which could possibly extend to humans as well, thereby diminishing the risk for epidemics and pandemics to evolve....
Illiano, Elena; Bissa, Massimiliano; Paolini, Francesca; Zanotto, Carlo; De Giuli Morghen, Carlo; Franconi, Rosella; Radaelli, Antonia; Venuti, Aldo
2016-10-02
The therapeutic antitumor potency of a prime-boost vaccination strategy was explored, based on the mutated, nontransforming forms of the E6 (E6 F47R ) and E7 (E7 GGG ) oncogenes of Human Papilloma Virus type 16 (HPV16), fused to the Potato virus X (PVX) coat protein (CP) sequence. Previous data showed that CP fusion improves the immunogenicity of tumor-associated antigens and may thus increase their efficacy. After verifying the correct expression of E6 F47R CP and E7 GGG CP inserted into DNA and Fowlpox virus recombinants by Western blotting and immunofluorescence, their combined use was evaluated for therapy in a pre-clinical mouse model of HPV16-related tumorigenicity. Immunization protocols were applied using homologous (DNA/DNA) or heterologous (DNA/Fowlpox) prime-boost vaccine regimens. The humoral immune responses were determined by ELISA, and the therapeutic efficacy evaluated by the delay in tumor appearance and reduced tumor volume after inoculation of syngeneic TC-1* tumor cells. Homologous DNA/DNA genetic vaccines were able to better delay tumor appearance and inhibit tumor growth when DNAE6 F47R CP and DNAE7 GGG CP were administered in combination. However, the heterologous DNA/Fowlpox vaccination strategy was able to delay tumor appearance in a higher number of animals when E6 F47R CP and in particular E7 GGG CP were administered alone. Copyright © 2016 Elsevier B.V. All rights reserved.
Xiao, Zhao; Juan, Long; Song, Yun; Zhijian, Zhang; Jing, Jin; Kun, Yu; Yuna, Hao; Dongfa, Dai; Lili, Ding; Liuxin, Tan; Fei, Liang; Nan, Liu; Fang, Yuan; Yuying, Sun; Yongzhi, Xi
2015-01-01
A major challenge in the development of effective therapies for rheumatoid arthritis (RA) is finding a method for the specific inhibition of the inflammatory disease processes without the induction of generalized immunosuppression. Of note, the development of therapeutic DNA vaccines and boosters that may restore immunological tolerance remains a high priority. pcDNA-CCOL2A1 is a therapeutic DNA vaccine encoding chicken type II collagen(CCII). This vaccine was developed by our laboratory and has been shown to exhibit efficacy comparable to that of the current "gold standard" treatment, methotrexate (MTX). Here, we used enzyme-linked immunosorbent assays with anti-CII IgG antibodies, quantified the expression levels of Th1, Th2, and Th3 cytokines, and performed flow cytometric analyses of different T-cell subsets, including Th1, Th2, Th17, Tc, Ts, Treg, and CD4(+)CD29(+)T cells to systemically evaluate humoral and cellular immune responses to pcDNA-CCOL2A1 vaccine in normal rats. Similar to our observations at maximum dosage of 3 mg/kg, vaccination of normal rats with 300 μg/kg pcDNA-CCOL2A1 vaccine did not induce the production of anti-CII IgG. Furthermore, no significant changes were observed in the expression levels of pro-inflammatory cytokines interleukin (IL)-1α, IL-5, IL-6, IL-12(IL-23p40), monocyte chemotactic protein (MCP)-1, macrophage inflammatory protein (MIP)-1α, regulated on activation in normal T-cell expressed and secreted (RANTES), receptor activator for nuclear factor-κB ligand (RANKL), and granulocyte colony-stimulating factor (G-CSF) or anti-inflammatory cytokines IL-4 and IL-10 in vaccinated normal rats relative to that in controls(P > 0.05). However, transforming growth factor (TGF)-β levels were significantly increased on days 10 and 14, while interferon (IFN)-γ and tumor necrosis factor (TNF)-α levels were significantly decreased on days 28 and 35 after vaccination(P 0.05), with the exception of Treg cells, which were significantly
Recombinant vaccines and the development of new vaccine strategies
Energy Technology Data Exchange (ETDEWEB)
Nascimento, I.P.; Leite, L.C.C. [Centro de Biotecnologia, Instituto Butantan, São Paulo, SP (Brazil)
2012-09-07
Vaccines were initially developed on an empirical basis, relying mostly on attenuation or inactivation of pathogens. Advances in immunology, molecular biology, biochemistry, genomics, and proteomics have added new perspectives to the vaccinology field. The use of recombinant proteins allows the targeting of immune responses focused against few protective antigens. There are a variety of expression systems with different advantages, allowing the production of large quantities of proteins depending on the required characteristics. Live recombinant bacteria or viral vectors effectively stimulate the immune system as in natural infections and have intrinsic adjuvant properties. DNA vaccines, which consist of non-replicating plasmids, can induce strong long-term cellular immune responses. Prime-boost strategies combine different antigen delivery systems to broaden the immune response. In general, all of these strategies have shown advantages and disadvantages, and their use will depend on the knowledge of the mechanisms of infection of the target pathogen and of the immune response required for protection. In this review, we discuss some of the major breakthroughs that have been achieved using recombinant vaccine technologies, as well as new approaches and strategies for vaccine development, including potential shortcomings and risks.
Recombinant vaccines and the development of new vaccine strategies
Directory of Open Access Journals (Sweden)
I.P. Nascimento
2012-12-01
Full Text Available Vaccines were initially developed on an empirical basis, relying mostly on attenuation or inactivation of pathogens. Advances in immunology, molecular biology, biochemistry, genomics, and proteomics have added new perspectives to the vaccinology field. The use of recombinant proteins allows the targeting of immune responses focused against few protective antigens. There are a variety of expression systems with different advantages, allowing the production of large quantities of proteins depending on the required characteristics. Live recombinant bacteria or viral vectors effectively stimulate the immune system as in natural infections and have intrinsic adjuvant properties. DNA vaccines, which consist of non-replicating plasmids, can induce strong long-term cellular immune responses. Prime-boost strategies combine different antigen delivery systems to broaden the immune response. In general, all of these strategies have shown advantages and disadvantages, and their use will depend on the knowledge of the mechanisms of infection of the target pathogen and of the immune response required for protection. In this review, we discuss some of the major breakthroughs that have been achieved using recombinant vaccine technologies, as well as new approaches and strategies for vaccine development, including potential shortcomings and risks.
Recombinant vaccines and the development of new vaccine strategies
International Nuclear Information System (INIS)
Nascimento, I.P.; Leite, L.C.C.
2012-01-01
Vaccines were initially developed on an empirical basis, relying mostly on attenuation or inactivation of pathogens. Advances in immunology, molecular biology, biochemistry, genomics, and proteomics have added new perspectives to the vaccinology field. The use of recombinant proteins allows the targeting of immune responses focused against few protective antigens. There are a variety of expression systems with different advantages, allowing the production of large quantities of proteins depending on the required characteristics. Live recombinant bacteria or viral vectors effectively stimulate the immune system as in natural infections and have intrinsic adjuvant properties. DNA vaccines, which consist of non-replicating plasmids, can induce strong long-term cellular immune responses. Prime-boost strategies combine different antigen delivery systems to broaden the immune response. In general, all of these strategies have shown advantages and disadvantages, and their use will depend on the knowledge of the mechanisms of infection of the target pathogen and of the immune response required for protection. In this review, we discuss some of the major breakthroughs that have been achieved using recombinant vaccine technologies, as well as new approaches and strategies for vaccine development, including potential shortcomings and risks
DEFF Research Database (Denmark)
Li, Yiping; Kang, H.N.; Babiuk, L.A.
2006-01-01
boosting with a recombinant E2 protein vaccine formulated with CpG ODN and 10% Emulsigen. The immunogenicity of HCV E2 vaccines was analyzed by ELISA for antibody responses, MTT assay for lymphocyte proliferation, ELISPOT for the number of interferon-gamma secreting cells, and cytotoxic T lymphocyte assays...... and shifted the immune response towards Th2-like ones in piglets. CONCLUSION: A DNA vaccine expressing a secreted form of HCV E2 protein elicited E2-specific immune responses in mice and piglets. Recombinant E2 protein vaccination following DNA immunization significantly increased the antibody response......AIM: To characterize the immunogenicity of a hepatitis C virus (HCV) E2 DNA vaccine alone or with a protein vaccine boost in murine and porcine animal models. METHODS: A DNA vaccine expressing a secreted form of HCV E2 protein was constructed and used to vaccinate mice and piglets with or without...
Construction of a trivalent candidate vaccine against Shigella species with DNA recombination
Institute of Scientific and Technical Information of China (English)
王恒樑; 冯尔玲; 林云; 廖翔; 金明; 黄留玉; 苏国富; 黄翠芬
2002-01-01
In this work asd gene of Shigella flexneri 2a strain T32 was replaced by Vibrio cholerae toxin B subunit (ctxB) gene with DNA recombination in vivo and in vitro. The resulting derivative of T32, designed as FWL01, could stably express CtxB, but its growth in LB medium depended on the presence of diaminopimelic acid (DAP). Then form I plasmid of Shigella sonnei strain S7 was labeled with strain T32 asd gene and mobilized into FWL01. Thus a trivalent candidate oral vaccine strain, designed as FSW01, was constructed. In this candidate strain, a balanced-lethal system was constituted between the host strain and the form I plasmid expressing S. sonnei O antigen. Therefore the candidate strain can express stably not only its own O antigen but also CtxB and O antigen of S. sonnei in the absence of any antibiotic. Experiments showed that FSW01 did not invade HeLa cells or cause keratoconjunctivitis in guinea pigs. However, rabbits immunized FSW01 can elicit significant immune responses. In mice and rhesus monkey models, vaccinated animals were protected against the challenges of wild S. flexneri 2a strain 2457T and S. sonnei strain S9.
Diversification of DnaA dependency for DNA replication in cyanobacterial evolution.
Ohbayashi, Ryudo; Watanabe, Satoru; Ehira, Shigeki; Kanesaki, Yu; Chibazakura, Taku; Yoshikawa, Hirofumi
2016-05-01
Regulating DNA replication is essential for all living cells. The DNA replication initiation factor DnaA is highly conserved in prokaryotes and is required for accurate initiation of chromosomal replication at oriC. DnaA-independent free-living bacteria have not been identified. The dnaA gene is absent in plastids and some symbiotic bacteria, although it is not known when or how DnaA-independent mechanisms were acquired. Here, we show that the degree of dependency of DNA replication on DnaA varies among cyanobacterial species. Deletion of the dnaA gene in Synechococcus elongatus PCC 7942 shifted DNA replication from oriC to a different site as a result of the integration of an episomal plasmid. Moreover, viability during the stationary phase was higher in dnaA disruptants than in wild-type cells. Deletion of dnaA did not affect DNA replication or cell growth in Synechocystis sp. PCC 6803 or Anabaena sp. PCC 7120, indicating that functional dependency on DnaA was already lost in some nonsymbiotic cyanobacterial lineages during diversification. Therefore, we proposed that cyanobacteria acquired DnaA-independent replication mechanisms before symbiosis and such an ancestral cyanobacterium was the sole primary endosymbiont to form a plastid precursor.
Directory of Open Access Journals (Sweden)
Eduardo JM Nascimento
2007-02-01
Full Text Available Protamine sulphate/DNA complexes have been shown to protect DNA from DNase digestion in a lipid system for gene transfer. A DNA-based vaccine complexed to protamine sulphate was used to induce an immune response against Schistosoma mansoni anchored-glycosylphosphatidylinositol tegumental antigen in BALB/c mice. The protection elicited ranged from 33 to 44%. The spectrum of the elicited immune response induced by the vaccine formulation without protamine was characterized by a high level of IgG (IgG1> IgG2a. Protamine sulphate added to the DNA vaccine formulation retained the green fluorescent protein encoding-plasmid longer in muscle and spleen. The experiments in vivo showed that under protamine sulphate effect, the scope of protection remained unchanged, but a modulation in antibody production (IgG1= IgG2a was observed.
Evaluation of an ompA-based phage-mediated DNA vaccine against Chlamydia abortus in piglets.
Ou, Changbo; Tian, Deyu; Ling, Yong; Pan, Qing; He, Qing; Eko, Francis O; He, Cheng
2013-08-01
Chlamydia abortus (C. abortus) is an obligate intracellular pathogen that causes abortion in pigs and poses a zoonotic risk in pregnant women. Although attenuated and inactivated vaccines are available, they do not provide complete protection in animals underlining the need to develop new vaccines. In this study, we tested the hypothesis that intramuscular immunization with an ompA-based phage-mediated DNA chlamydial vaccine candidate will induce significant antigen-specific cellular and humoral immune responses. Thus, groups of piglets (five per group) were immunized intramuscularly with the phage-MOMP vaccine (λ-MOMP) or a commercial live-attenuated vaccine (1B vaccine) or a GFP-expressing phage (λ-GFP) or phosphate buffered saline (PBS) (control) and antigen-specific cell-mediated and humoral immune responses were evaluated. By day 63 post-immunization, the λ-MOMP vaccine elicited significantly higher (Pabortus. Copyright © 2013 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Jensen, Trine Hammer; Nielsen, Line; Aasted, Bent
2009-01-01
Young mink kits (n = 8)were vaccinated withDNA plasmids encoding the viral haemagglutinin protein (H) of a vaccine strain of Canine distemper virus (CDV). Virus neutralising (VN) antibodieswere induced after 2 immunisations and after the third immunisation all kits had high VN antibody titres...
DEFF Research Database (Denmark)
Cuesta, Àngel M; Suárez, Eduardo; Larsen, Martin
2006-01-01
Although DNA-based cancer vaccines have been successfully tested in mouse models, a major drawback of cancer vaccination still remains, namely that tumour antigens are weak and fail to generate a vigorous immune response in tumour-bearing patients. Genetic technology offers strategies for promoti...
Golden, Joseph W.; Maes, Piet; Kwilas, Steven A.; Ballantyne, John
2016-01-01
ABSTRACT Several members of the Arenaviridae can cause acute febrile diseases in humans, often resulting in lethality. The use of convalescent-phase human plasma is an effective treatment in humans infected with arenaviruses, particularly species found in South America. Despite this, little work has focused on developing potent and defined immunotherapeutics against arenaviruses. In the present study, we produced arenavirus neutralizing antibodies by DNA vaccination of rabbits with plasmids encoding the full-length glycoprotein precursors of Junín virus (JUNV), Machupo virus (MACV), and Guanarito virus (GTOV). Geometric mean neutralizing antibody titers, as measured by the 50% plaque reduction neutralization test (PRNT50), exceeded 5,000 against homologous viruses. Antisera against each targeted virus exhibited limited cross-species binding and, to a lesser extent, cross-neutralization. Anti-JUNV glycoprotein rabbit antiserum protected Hartley guinea pigs from lethal intraperitoneal infection with JUNV strain Romero when the antiserum was administered 2 days after challenge and provided some protection (∼30%) when administered 4 days after challenge. Treatment starting on day 6 did not protect animals. We further formulated an IgG antibody cocktail by combining anti-JUNV, -MACV, and -GTOV antibodies produced in DNA-vaccinated rabbits. This cocktail protected 100% of guinea pigs against JUNV and GTOV lethal disease. We then expanded on this cocktail approach by simultaneously vaccinating rabbits with a combination of plasmids encoding glycoproteins from JUNV, MACV, GTOV, and Sabia virus (SABV). Sera collected from rabbits vaccinated with the combination vaccine neutralized all four targets. These findings support the concept of using a DNA vaccine approach to generate a potent pan-arenavirus immunotherapeutic. IMPORTANCE Arenaviruses are an important family of emerging viruses. In infected humans, convalescent-phase plasma containing neutralizing antibodies can
Xia, Yumin; Jiang, Shan; Weng, Shenhong; Lv, Xiaochun; Cheng, Hong; Fang, Chunhong
2011-12-01
Dendritic cells (DCs) can inhibit immune response by clonal anergy when immature. Recent studies have shown that immature DCs (iDCs) may serve as a live cell vaccine after specific antigen pulse based on its potential of blocking antibody production. In this study, we aimed to investigate the effects of nuclear antigen-pulsed iDCs in the treatment of lupus-like renal damages induced by anti-dsDNA antibodies. iDCs were generated from haemopoietic stem cells in bone marrow and then pulsed in vitro with nuclear antigen. The iDC vaccine and corresponding controls were injected into mice with lupus-like renal damages. The evaluation of disease was monitored by biochemical parameters and histological scores. Anti-dsDNA antibody isotypes and T-lymphocyte-produced cytokines were analysed for elucidating therapeutic mechanisms. RESULTS; The mice treated with antigen-pulsed iDCs had a sustained remission of renal damage compared with those injected with non-pulsed iDCs or other controls, including decreased anti-dsDNA antibody level, less proteinuria, lower blood urea nitrogen and serum creatinine values, and improved histological evaluation. Analysis on isotypes of anti-dsDNA antibody showed that iDC vaccine preferentially inhibited the production of IgG3, IgG2b and IgG2a. Furthermore, administration of antigen-treated iDCs to mice resulted in significantly reduced IL-2, IL-4 and IL-12 and IFN-γ produced by T-memory cells. Conversely, the vaccination of antigen-pulsed mature DCs led to increased anti-dsDNA antibody production and an aggravation of lupus-like disease in the model. CONCLUSIONS; These results suggested the high potency of iDC vaccine in preventing lupus-like renal injuries induced by pathogenic autoantibodies.
Directory of Open Access Journals (Sweden)
Callie E Bounds
Full Text Available DNA vaccination of transchromosomal bovines (TcBs with DNA vaccines expressing the codon-optimized (co glycoprotein (GP genes of Ebola virus (EBOV and Sudan virus (SUDV produce fully human polyclonal antibodies (pAbs that recognize both viruses and demonstrate robust neutralizing activity. Each TcB was vaccinated by intramuscular electroporation (IM-EP a total of four times and at each administration received 10 mg of the EBOV-GPco DNA vaccine and 10 mg of the SUDV-GPco DNA vaccine at two sites on the left and right sides, respectively. After two vaccinations, robust antibody responses (titers > 1000 were detected by ELISA against whole irradiated EBOV or SUDV and recombinant EBOV-GP or SUDV-GP (rGP antigens, with higher titers observed for the rGP antigens. Strong, virus neutralizing antibody responses (titers >1000 were detected after three vaccinations when measured by vesicular stomatitis virus-based pseudovirion neutralization assay (PsVNA. Maximal neutralizing antibody responses were identified by traditional plaque reduction neutralization tests (PRNT after four vaccinations. Neutralizing activity of human immunoglobulins (IgG purified from TcB plasma collected after three vaccinations and injected intraperitoneally (IP into mice at a 100 mg/kg dose was detected in the serum by PsVNA up to 14 days after administration. Passive transfer by IP injection of the purified IgG (100 mg/kg to groups of BALB/c mice one day after IP challenge with mouse adapted (ma EBOV resulted in 80% protection while all mice treated with non-specific pAbs succumbed. Similarly, interferon receptor 1 knockout (IFNAR(-/- mice receiving the purified IgG (100 mg/kg by IP injection one day after IP challenge with wild type SUDV resulted in 89% survival. These results are the first to demonstrate that filovirus GP DNA vaccines administered to TcBs by IM-EP can elicit neutralizing antibodies that provide post-exposure protection. Additionally, these data describe
Directory of Open Access Journals (Sweden)
Spyros A Kalams
Full Text Available DNA vaccines are a promising approach to vaccination since they circumvent the problem of vector-induced immunity. DNA plasmid cytokine adjuvants have been shown to augment immune responses in small animals and in macaques.We performed two first in human HIV vaccine trials in the US, Brazil and Thailand of an RNA-optimized truncated HIV-1 gag gene (p37 DNA derived from strain HXB2 administered either alone or in combination with dose-escalation of IL-12 or IL-15 plasmid cytokine adjuvants. Vaccinations with both the HIV immunogen and cytokine adjuvant were generally well-tolerated and no significant vaccine-related adverse events were identified. A small number of subjects developed asymptomatic low titer antibodies to IL-12 or IL-15. Cellular immunogenicity following 3 and 4 vaccinations was poor, with response rates to gag of 4.9%/8.7% among vaccinees receiving gag DNA alone, 0%/11.5% among those receiving gag DNA+IL-15, and no responders among those receiving DNA+high dose (1500 ug IL-12 DNA. However, after three doses, 44.4% (4/9 of vaccinees receiving gag DNA and intermediate dose (500 ug of IL-12 DNA demonstrated a detectable cellular immune response.This combination of HIV gag DNA with plasmid cytokine adjuvants was well tolerated. There were minimal responses to HIV gag DNA alone, and no apparent augmentation with either IL-12 or IL-15 plasmid cytokine adjuvants. Despite the promise of DNA vaccines, newer formulations or methods of delivery will be required to increase their immunogenicity.Clinicaltrials.gov NCT00115960 NCT00111605.
The role of DNA dependent protein kinase in synapsis of DNA ends
E.P.W.C. Weterings (Eric); N.S. Verkaik (Nicole); H.T. Brüggenwirth (Hennie); D.C. van Gent (Dik); J.H.J. Hoeijmakers (Jan)
2003-01-01
textabstractDNA dependent protein kinase (DNA-PK) plays a central role in the non-homologous end-joining pathway of DNA double strand break repair. Its catalytic subunit (DNA-PK(CS)) functions as a serine/threonine protein kinase. We show that DNA-PK forms a stable complex at DNA termini that blocks
Redig, Patrick T; Tully, Thomas N; Ritchie, Branson W; Roy, Alma F; Baudena, M Alexandra; Chang, Gwong-Jen J
2011-08-01
To evaluate the safety and efficacy of an experimental adjuvanted DNA-plasmid vaccine against West Nile virus (WNV) in red-tailed hawks (Buteo jamaicensis). 19 permanently disabled but otherwise healthy red-tailed hawks of mixed ages and both sexes without detectable serum antibodies against WNV. Hawks were injected IM with an experimental WNV DNA-plasmid vaccine in an aluminum-phosphate adjuvant (n = 14) or with the adjuvant only (control group; 5). All birds received 2 injections at a 3-week interval. Blood samples for serologic evaluation were collected before the first injection and 4 weeks after the second injection (day 0). At day 0, hawks were injected SC with live WNV. Pre- and postchallenge blood samples were collected at intervals for 14 days for assessment of viremia and antibody determination; oropharyngeal and cloacal swabs were collected for assessment of viral shedding. Vaccination was not associated with morbidity or deaths. Three of the vaccinated birds seroconverted after the second vaccine injection; all other birds seroconverted following the live virus injection. Vaccinated birds had significantly less severe viremia and shorter and less-intense shedding periods, compared with the control birds. Use of the WNV DNA-plasmid vaccine in red-tailed hawks was safe, and vaccination attenuated but did not eliminate both the viremia and the intensity of postchallenge shedding following live virus exposure. Further research is warranted to conclusively determine the efficacy of this vaccine preparation for protection of red-tailed hawks and other avian species against WNV-induced disease.
Directory of Open Access Journals (Sweden)
Julie L Dutton
Full Text Available While there are a number of licensed veterinary DNA vaccines, to date, none have been licensed for use in humans. Here, we demonstrate that a novel technology designed to enhance the immunogenicity of DNA vaccines protects against lethal herpes simplex virus 2 (HSV-2 challenge in a murine model. Polynucleotides were modified by use of a codon optimization algorithm designed to enhance immune responses, and the addition of an ubiquitin-encoding sequence to target the antigen to the proteasome for processing and to enhance cytotoxic T cell responses. We show that a mixture of these codon-optimized ubiquitinated and non-ubiquitinated constructs encoding the same viral envelope protein, glycoprotein D, induced both B and T cell responses, and could protect against lethal viral challenge and reduce ganglionic latency. The optimized vaccines, subcloned into a vector suitable for use in humans, also provided a high level of protection against the establishment of ganglionic latency, an important correlate of HSV reactivation and candidate endpoint for vaccines to proceed to clinical trials.
Directory of Open Access Journals (Sweden)
Viraj Kulkarni
Full Text Available Viral diversity is considered a major impediment to the development of an effective HIV-1 vaccine. Despite this diversity, certain protein segments are nearly invariant across the known HIV-1 Group M sequences. We developed immunogens based on the highly conserved elements from the p24(gag region according to two principles: the immunogen must (i include strictly conserved elements of the virus that cannot mutate readily, and (ii exclude both HIV regions capable of mutating without limiting virus viability, and also immunodominant epitopes located in variable regions. We engineered two HIV-1 p24(gag DNA immunogens that express 7 highly Conserved Elements (CE of 12-24 amino acids in length and differ by only 1 amino acid in each CE ('toggle site', together covering >99% of the HIV-1 Group M sequences. Altering intracellular trafficking of the immunogens changed protein localization, stability, and also the nature of elicited immune responses. Immunization of C57BL/6 mice with p55(gag DNA induced poor, CD4(+ mediated cellular responses, to only 2 of the 7 CE; in contrast, vaccination with p24CE DNA induced cross-clade reactive, robust T cell responses to 4 of the 7 CE. The responses were multifunctional and composed of both CD4(+ and CD8(+ T cells with mature cytotoxic phenotype. These findings provide a method to increase immune response to universally conserved Gag epitopes, using the p24CE immunogen. p24CE DNA vaccination induced humoral immune responses similar in magnitude to those induced by p55(gag, which recognize the virus encoded p24(gag protein. The inclusion of DNA immunogens composed of conserved elements is a promising vaccine strategy to induce broader immunity by CD4(+ and CD8(+ T cells to additional regions of Gag compared to vaccination with p55(gag DNA, achieving maximal cross-clade reactive cellular and humoral responses.
An Oral DNA Vaccine Encoding Endoglin Eradicates Breast Tumors by Blocking Their Blood Supply
National Research Council Canada - National Science Library
Reisfeld, Ralph A
2007-01-01
In an effort to meet the urgent need for the development of novel and effective treatments for metastatic breast cancer, we developed and evaluated a novel, oral DNA vaccine targeting endoglin (CD105...
A BCR/ABL-hIL-2 DNA Vaccine Enhances the Immune Responses in BALB/c Mice
Directory of Open Access Journals (Sweden)
Yanan Qin
2013-01-01
Full Text Available The use of a DNA vaccine encoding the BCR/ABL fusion gene is thought to be a promising approach for patients with chronic myeloid leukemia (CML to eradicate minimal residual disease after treatment with chemotherapy or targeted therapy. In this study, our strategy employs genetic technology to create a DNA vaccine encoding the BCR/ABL fusion and human interleukin-2 (hIL-2 genes. The successfully constructed plasmids BCR/ABL-pIRES-hIL-2, BCR/ABL-pIRES, and pIRES-hIL-2 were delivered intramuscularly to BALB/c mice at 14-day intervals for three cycles. The transcription and expression of the BCR/ABL and hIL-2 genes were found in the injected muscle tissues. The interferon-γ (IFN-γ serum levels were increased, and the splenic CD4+/CD8+ T cell ratio was significantly decreased in the BCR/ABL-pIRES-hIL-2-injected mice. Furthermore, specific antibodies against K562 cells could be detected by indirect immunofluorescence. These results indicate that a DNA vaccine containing BCR/ABL and hIL-2 together may elicit increased in vivo humoral and cellular immune responses in BALB/c mice.
Tiriveedhi, Venkataswarup; Tucker, Natalia; Herndon, John; Li, Lijin; Sturmoski, Mark; Ellis, Matthew; Ma, Cynthia; Naughton, Michael; Lockhart, A Craig; Gao, Feng; Fleming, Timothy; Goedegebuure, Peter; Mohanakumar, Thalachallour; Gillanders, William E
2014-12-01
Mammaglobin-A (MAM-A) is overexpressed in 40% to 80% of primary breast cancers. We initiated a phase I clinical trial of a MAM-A DNA vaccine to evaluate its safety and biologic efficacy. Patients with breast cancer with stable metastatic disease were eligible for enrollment. Safety was monitored with clinical and laboratory assessments. The CD8 T-cell response was measured by ELISPOT, flow cytometry, and cytotoxicity assays. Progression-free survival (PFS) was described using the Kaplan-Meier product limit estimator. Fourteen subjects have been treated with the MAM-A DNA vaccine and no significant adverse events have been observed. Eight of 14 subjects were HLA-A2(+), and the CD8 T-cell response to vaccination was studied in detail. Flow cytometry demonstrated a significant increase in the frequency of MAM-A-specific CD8 T cells after vaccination (0.9% ± 0.5% vs. 3.8% ± 1.2%; P cells (41 ± 32 vs. 215 ± 67 spm; P cell responses, and preliminary evidence suggests improved PFS. Additional studies are required to define the potential of the MAM-A DNA vaccine for breast cancer prevention and/or therapy. ©2014 American Association for Cancer Research.
Directory of Open Access Journals (Sweden)
Hong Qin
2010-01-01
Full Text Available HIV vaccine candidates with improved immunogenicity and induction of mucosal T-cell immunity are needed. A prime-boost strategy using a novel HIV glycoprotein 120 DNA vaccine was employed to immunize rhesus macaques. The DNA vaccine encoded a chimeric gp120 protein in fusion with monocyte chemoattractant protein-3, which was hypothesized to improve the ability of antigen-presenting cells to capture viral antigen through chemokine receptor-mediated endocytosis. DNA vaccination induced virus-reactive T cells in peripheral blood, detectable by T cell proliferation, INFγ ELISPOT and sustained IL-6 production, without humoral responses. With a peptide-cocktail vaccine containing a set of conserved polypeptides of HIV-1 envelope protein, given by nasogastric administration, primed T-cell immunity was significantly boosted. Surprisingly, long-term and peptide-specific mucosal memory T-cell immunity was detected in both vaccinated macaques after one year. Therefore, data from this investigation offer proof-of-principle for potential effectiveness of the prime-boost strategy with a chemokine-fused gp120 DNA and warrant further testing in the nonhuman primate models for developing as a potential HIV vaccine candidate in humans.
Directory of Open Access Journals (Sweden)
Ganzhu Feng
Full Text Available Development of a novel and effective vaccine against Mycobacterium tuberculosis (M.tb is a challenging for preventing TB infection. In this study, a novel nanoparticle-based recombinant DNA vaccine was developed, which contains Esat-6 three T cell epitopes (Esat-6/3e and fms-like tyrosine kinase 3 ligand (FL genes (termed Esat-6/3e-FL, and was enveloped with chitosan (CS nanoparticles (nano-chitosan. The immunologic and protective efficacy of the nano-chitosan-based DNA vaccine (termed nano-Esat-6/3e-FL was assessed in C57BL/6 mice after intramuscular prime vaccination with the plasmids DNA and nasal boost with the Esat-6/3e peptides. The results showed that the immunized mice remarkably elicited enhanced T cell responses and protection against M.tb H37Rv challenge. These findings indicate that the nano-chitosan can significantly elevate the immunologic and protective effects of the DNA vaccine, and the nano-Esat-6/3e-FL is a useful vaccine for preventing M.tb infection in mice.
Jung, Myung-Hwa; Nikapitiya, Chamilani; Jung, Sung-Ju
2018-02-01
Rock bream iridovirus (RBIV) causes severe mass mortalities in rock bream (Oplegnathus fasciatus) in Korea. In this study, we investigated the potential of viral membrane protein to induce antiviral status protecting rock bream against RBIV infection. We found that fish administered with ORF008L (myristoylated membrane protein, MMP) vaccine exhibited significantly higher levels of survival compared to ORF007L (major capsid protein, MCP). Moreover, ORF008L-based DNA vaccinated fish showed significant protection at 4 and 8 weeks post vaccination (wpv) than non-vaccinated fish after infected with RBIV (6.7 × 10 5 ) at 23 °C, with relative percent survival (RPS) of 73.36% and 46.72%, respectively. All of the survivors from the first RBIV infection were strongly protected (100% RPS) from re-infected with RBIV (1.1 × 10 7 ) at 100 dpi. In addition, the MMP (ORF008L)-based DNA vaccine significantly induced the gene expression of TLR3 (14.2-fold), MyD88 (11.6-fold), Mx (84.7-fold), ISG15 (8.7-fold), PKR (25.6-fold), MHC class I (13.3-fold), Fas (6.7-fold), Fas ligand (6.7-fold), caspase9 (17.0-fold) and caspase3 (15.3-fold) at 7 days post vaccination in the muscle (vaccine injection site). Our results showed the induction of immune responses and suggest the possibility of developing preventive measures against RBIV using myristoylated membrane protein-based DNA vaccine. Copyright © 2018 Elsevier Ltd. All rights reserved.
Golden, Joseph W; Maes, Piet; Kwilas, Steven A; Ballantyne, John; Hooper, Jay W
2016-01-20
Several members of the Arenaviridae can cause acute febrile diseases in humans, often resulting in lethality. The use of convalescent-phase human plasma is an effective treatment in humans infected with arenaviruses, particularly species found in South America. Despite this, little work has focused on developing potent and defined immunotherapeutics against arenaviruses. In the present study, we produced arenavirus neutralizing antibodies by DNA vaccination of rabbits with plasmids encoding the full-length glycoprotein precursors of Junín virus (JUNV), Machupo virus (MACV), and Guanarito virus (GTOV). Geometric mean neutralizing antibody titers, as measured by the 50% plaque reduction neutralization test (PRNT(50)), exceeded 5,000 against homologous viruses. Antisera against each targeted virus exhibited limited cross-species binding and, to a lesser extent, cross-neutralization. Anti-JUNV glycoprotein rabbit antiserum protected Hartley guinea pigs from lethal intraperitoneal infection with JUNV strain Romero when the antiserum was administered 2 days after challenge and provided some protection (∼30%) when administered 4 days after challenge. Treatment starting on day 6 did not protect animals. We further formulated an IgG antibody cocktail by combining anti-JUNV, -MACV, and -GTOV antibodies produced in DNA-vaccinated rabbits. This cocktail protected 100% of guinea pigs against JUNV and GTOV lethal disease. We then expanded on this cocktail approach by simultaneously vaccinating rabbits with a combination of plasmids encoding glycoproteins from JUNV, MACV, GTOV, and Sabia virus (SABV). Sera collected from rabbits vaccinated with the combination vaccine neutralized all four targets. These findings support the concept of using a DNA vaccine approach to generate a potent pan-arenavirus immunotherapeutic. Arenaviruses are an important family of emerging viruses. In infected humans, convalescent-phase plasma containing neutralizing antibodies can mitigate the
Wang, Shixia; Goguen, Jon D; Li, Fusheng; Lu, Shan
2011-09-09
Yersinia pestis (Y. pestis) is the causative pathogen of plague, a highly fatal disease for which an effective vaccine, especially against mucosal transmission, is still not available. Like many bacterial infections, antigen-specific antibody responses have been traditionally considered critical, if not solely responsible, for vaccine-induced protection against Y. pestis. Studies in recent years have suggested the importance of T cell immune responses against Y. pestis infection but information is still limited about the details of Y. pestis antigen-specific T cell immune responses. In current report, studies are conducted to identify the presence of CD8+ T cell epitopes in LcrV protein, the leading antigen of plague vaccine development. Furthermore, depletion of CD8+ T cells in LcrV DNA vaccinated Balb/C mice led to reduced protection against lethal intranasal challenge of Y. pestis. These findings establish that an LcrV DNA vaccine is able to elicit CD8+ T cell immune responses against specific epitopes of this key plague antigen and that a CD8+ T cell immune response is involved in LcrV DNA vaccine-elicited protection. Future studies in plague vaccine development will need to examine if the presence of detectable T cell immune responses, in particular CD8+ T-cell immune responses, will enhance the protection against Y. pestis in higher animal species or humans. Copyright © 2010 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Adriana S Azevedo
Full Text Available The dengue envelope glycoprotein (E is the major component of virion surface and its ectodomain is composed of domains I, II and III. This protein is the main target for the development of a dengue vaccine with induction of neutralizing antibodies. In the present work, we tested two different vaccination strategies, with combined immunizations in a prime/booster regimen or simultaneous inoculation with a DNA vaccine (pE1D2 and a chimeric yellow fever/dengue 2 virus (YF17D-D2. The pE1D2 DNA vaccine encodes the ectodomain of the envelope DENV2 protein fused to t-PA signal peptide, while the YF17D-D2 was constructed by replacing the prM and E genes from the 17D yellow fever vaccine virus by those from DENV2. Balb/c mice were inoculated with these two vaccines by different prime/booster or simultaneous immunization protocols and most of them induced a synergistic effect on the elicited immune response, mainly in neutralizing antibody production. Furthermore, combined immunization remarkably increased protection against a lethal dose of DENV2, when compared to each vaccine administered alone. Results also revealed that immunization with the DNA vaccine, regardless of the combination with the chimeric virus, induced a robust cell immune response, with production of IFN-γ by CD8+ T lymphocytes.
DNA vaccination in fish promotes an early chemokine-related recruitment of B cells to the muscle
DEFF Research Database (Denmark)
Castro, R.; Martínez-Alonso, S.; Fischer, U.
2013-01-01
might explain the recruitment of immune cells to the site of DNA injection. Our results suggest that B cells are involved in the initial phase of the immune response to intramuscular DNA vaccination against VHSV. This appears to be a major difference to what we know from mammalian models where T cells...
Borggren, Marie; Vinner, Lasse; Andresen, Betina Skovgaard; Grevstad, Berit; Repits, Johanna; Melchers, Mark; Elvang, Tara Laura; Sanders, Rogier W; Martinon, Frédéric; Dereuddre-Bosquet, Nathalie; Bowles, Emma Joanne; Stewart-Jones, Guillaume; Biswas, Priscilla; Scarlatti, Gabriella; Jansson, Marianne; Heyndrickx, Leo; Grand, Roger Le; Fomsgaard, Anders
2013-07-19
HIV-1 DNA vaccines have many advantageous features. Evaluation of HIV-1 vaccine candidates often starts in small animal models before macaque and human trials. Here, we selected and optimized DNA vaccine candidates through systematic testing in rabbits for the induction of broadly neutralizing antibodies (bNAb). We compared three different animal models: guinea pigs, rabbits and cynomolgus macaques. Envelope genes from the prototype isolate HIV-1 Bx08 and two elite neutralizers were included. Codon-optimized genes, encoded secreted gp140 or membrane bound gp150, were modified for expression of stabilized soluble trimer gene products, and delivered individually or mixed. Specific IgG after repeated i.d. inoculations with electroporation confirmed in vivo expression and immunogenicity. Evaluations of rabbits and guinea pigs displayed similar results. The superior DNA construct in rabbits was a trivalent mix of non-modified codon-optimized gp140 envelope genes. Despite NAb responses with some potency and breadth in guinea pigs and rabbits, the DNA vaccinated macaques displayed less bNAb activity. It was concluded that a trivalent mix of non-modified gp140 genes from rationally selected clinical isolates was, in this study, the best option to induce high and broad NAb in the rabbit model, but this optimization does not directly translate into similar responses in cynomolgus macaques.
Directory of Open Access Journals (Sweden)
Roger Le Grand
2013-07-01
Full Text Available HIV-1 DNA vaccines have many advantageous features. Evaluation of HIV-1 vaccine candidates often starts in small animal models before macaque and human trials. Here, we selected and optimized DNA vaccine candidates through systematic testing in rabbits for the induction of broadly neutralizing antibodies (bNAb. We compared three different animal models: guinea pigs, rabbits and cynomolgus macaques. Envelope genes from the prototype isolate HIV-1 Bx08 and two elite neutralizers were included. Codon-optimized genes, encoded secreted gp140 or membrane bound gp150, were modified for expression of stabilized soluble trimer gene products, and delivered individually or mixed. Specific IgG after repeated i.d. inoculations with electroporation confirmed in vivo expression and immunogenicity. Evaluations of rabbits and guinea pigs displayed similar results. The superior DNA construct in rabbits was a trivalent mix of non-modified codon-optimized gp140 envelope genes. Despite NAb responses with some potency and breadth in guinea pigs and rabbits, the DNA vaccinated macaques displayed less bNAb activity. It was concluded that a trivalent mix of non-modified gp140 genes from rationally selected clinical isolates was, in this study, the best option to induce high and broad NAb in the rabbit model, but this optimization does not directly translate into similar responses in cynomolgus macaques.
Forconi, Francesco; King, Catherine A; Sahota, Surinder S; Kennaway, Christopher K; Russell, Nigel H; Stevenson, Freda K
2002-01-01
DNA vaccines induce immune responses against encoded proteins, and have clear potential for cancer vaccines. For B-cell tumours, idiotypic (Id) immunoglobulin encoded by the variable region genes provides a target antigen. When assembled as single chain Fv (scFv), and fused to an immunoenhancing sequence from tetanus toxin (TT), DNA fusion vaccines induce anti-Id antibodies. In lymphoma models, these antibodies have a critical role in mediating protection. For application to patients with lymphoma, two questions arise: first, whether pre-existing antibody against TT affects induction of anti-scFv antibodies; second, whether individual human scFv fusion sequences are able to fold consistently to generate antibodies able to recognize private conformational Id determinants expressed by tumour cells. Using xenogeneic vaccination with scFv sequences from four patients, we have shown that pre-existing anti-TT immunity slows, but does not prevent, anti-Id antibody responses. To determine folding, we have monitored the ability of nine DNAscFv–FrC patients' vaccines to induce xenogeneic anti-Id antibodies. Antibodies were induced in all cases, and were strikingly specific for each patient's immunoglobulin with little cross-reactivity between patients, even when similar VH or VL genes were involved. Blocking experiments with human serum confirmed reactivity against private determinants in 26–97% of total antibody. Both immunoglobulin G1 (IgG1) and IgG2a subclasses were present at 1·3 : 1–15 : 1 consistent with a T helper 2-dominated response. Xenogeneic vaccination provides a simple route for testing individual patients' DNAscFv–FrC fusion vaccines, and offers a strategy for production of anti-Id antibodies. The findings underpin the approach of DNA idiotypic fusion vaccination for patients with B-cell tumours. PMID:12225361
Karlsson, Ingrid; Borggren, Marie; Jensen, Sanne Skov; Heyndrickx, Leo; Stewart-Jones, Guillaume; Scarlatti, Gabriella; Fomsgaard, Anders
2017-11-17
The induction of both neutralizing antibodies and non-neutralizing antibodies with effector functions, for example, antibody-dependent cellular cytotoxicity (ADCC), is desired in the search for effective vaccines against HIV-1. In the pursuit of novel immunogens capable of inducing an efficient antibody response, rabbits were immunized with selected antigens using different prime-boost strategies. We immunized 35 different groups of rabbits with Env antigens from clinical HIV-1 subtypes A and B, including immunization with DNA alone, protein alone, and DNA prime with protein boost. The rabbit sera were screened for ADCC activity using a GranToxiLux-based assay with human peripheral blood mononuclear cells as effector cells and CEM.NKR CCR5 cells coated with HIV-1 envelope as target cells. The groups with the highest ADCC activity were further characterized for cross-reactivity between HIV-1 subtypes. The immunogen inducing the most potent and broadest ADCC response was a trimeric gp140. The ADCC activity was highest against the HIV-1 subtype corresponding to the immunogen. The ADCC activity did not necessarily reflect neutralizing activity in the pseudovirus-TZMbl assay, but there was an overall correlation between the two antiviral activities. We present a rabbit vaccination model and an assay suitable for screening HIV-1 vaccine candidates for the induction of ADCC-mediating antibodies in addition to neutralizing antibodies. The antigens and/or immunization strategies capable of inducing antibodies with ADCC activity did not necessarily induce neutralizing activity and vice versa. Nevertheless, we identified vaccine candidates that were able to concurrently induce both types of responses and that had ADCC activity that was cross-reactive between different subtypes. When searching for an effective vaccine candidate, it is important to evaluate the antibody response using a model and an assay measuring the desired function.
Analysis of a general age-dependent vaccination model for a vertically transmitted disease
International Nuclear Information System (INIS)
El Doma, M.
1995-05-01
A SIR epidemic model of a general age-dependent vaccination for a vertically as well as horizontally transmitted disease is investigated when the total population is time dependent, and fertility, mortality and removal rates depend on age. We establish the existence and the uniqueness of the solution and obtain the asymptotic behaviour for the solution. For the steady state solution a critical vaccination coverage which will eventually eradicate the disease is determined. (author). 18 refs
Qu, Daofeng; Han, Jianzhong; Du, Aifang
2013-07-01
The high incidence and severe damage caused by Toxoplasma gondii infection clearly indicates the need for the development of a vaccine. In this study, we evaluated the immune responses and protection against toxoplasmosis by immunizing ICR mice with a multiantigenic DNA vaccine. To develop the multiantigenic vaccine, two T. gondii antigens, MIC3 and ROP18, selected on the basis of previous studies were chosen. ICR mice were immunized subcutaneously with PBS, empty pcDNA3.1 vector, pMIC3, pROP18, and pROP18-MIC3, respectively. The results of lymphocyte proliferation assay, cytokine, and antibody determinations showed that mice immunized with pROP18-MIC3 elicited stronger humoral and Th1-type cellular immune responses than those immunized with single-gene plasmids, empty plasmid, or phosphate-buffered saline. After a lethal challenge with the highly virulent T. gondii RH strain, a prolonged survival time in pROP18-MIC3-immunized mice was observed in comparison to control groups. Our study indicates that the introduction of multiantigenic DNA vaccine is more powerful and efficient than single-gene vaccine, and deserves further evaluation and development.
Directory of Open Access Journals (Sweden)
Matthias Liniger
Full Text Available Chickens lack the retinoic acid-inducible gene I (RIG-I and sense avian influenza virus (AIV infections by means of the melanoma differentiation-associated gene 5 product (chMDA5. Plasmid-driven expression of the N-terminal half of chMDA5 containing the caspase activation and recruitment domains [chMDA5(1-483] triggers interferon-β responses in chicken cells. We hypothesized that mimicking virus infection by chMDA5(1-483 expression may enhance vaccine-induced adaptive immunity. In order to test this, the potential genetic adjuvant properties of chMDA5(1-483 were evaluated in vivo in combination with a suboptimal quantity of a plasmid DNA vaccine expressing haemagglutinin (HA of H5N1 AIV. Co-administration of the HA plasmid with plasmid DNA for chMDA5(1-483 expression resulted in approximately 10-fold higher HA-specific antibody responses than injection of the HA plasmid mixed with empty vector DNA as control. Accordingly, compared with HA DNA vaccination alone, the chMDA5(1-483-adjuvanted HA DNA vaccine mediated enhanced protection against a lethal H5N1 challenge infection in chickens, with reduced clinical signs and cloacal virus shedding. These data demonstrate that innate immune activation by expression of signaling domains of RIG-I-like receptors can be exploited to enhance vaccine efficacy.
1987-10-13
after multiple passages in vivo and in vitro. J. Gen. Virol. 67, 1741- 1744. Sabin , A.B. (1985). Oral poliovirus vaccine : history of its development...IN (N NEW APPROACHES TO ATTENUATED HEPATITIS A VACCINE DEVELOPMENT: Q) CLONING AND SEQUENCING OF CELL-CULTURE ADAPTED VIRAL cDNA I ANNUAL REPORT...6ll02Bsl0 A 055 11. TITLE (Include Security Classification) New Approaches to Attenuated Hepatitis A Vaccine Development: Cloning and Sequencing of Cell
Energy Technology Data Exchange (ETDEWEB)
Hwang, Hye Suk; Lee, Young-Tae; Kim, Ki-Hye; Park, Soojin; Kwon, Young-Man; Lee, Youri; Ko, Eun-Ju; Jung, Yu-Jin [Center for Inflammation, Immunity & Infection, Institute for Biomedical Sciences and Department of Biology, Georgia State University, Atlanta, GA (United States); Lee, Jong Seok [Center for Inflammation, Immunity & Infection, Institute for Biomedical Sciences and Department of Biology, Georgia State University, Atlanta, GA (United States); National Institute of Biological Resources, Incheon (Korea, Republic of); Kim, Yu-Jin [Center for Inflammation, Immunity & Infection, Institute for Biomedical Sciences and Department of Biology, Georgia State University, Atlanta, GA (United States); Lee, Yu-Na; Kim, Min-Chul [Center for Inflammation, Immunity & Infection, Institute for Biomedical Sciences and Department of Biology, Georgia State University, Atlanta, GA (United States); Animal and Plant Quarantine Agency, Gyeonggi-do, Gimcheon, Gyeongsangbukdo (Korea, Republic of); Cho, Minkyoung [Center for Inflammation, Immunity & Infection, Institute for Biomedical Sciences and Department of Biology, Georgia State University, Atlanta, GA (United States); Kang, Sang-Moo, E-mail: skang24@gsu.edu [Center for Inflammation, Immunity & Infection, Institute for Biomedical Sciences and Department of Biology, Georgia State University, Atlanta, GA (United States)
2016-07-15
A safe and effective vaccine against respiratory syncytial virus (RSV) should confer protection without causing vaccine-enhanced disease. Here, using a cotton rat model, we investigated the protective efficacy and safety of an RSV combination vaccine composed of F-encoding plasmid DNA and virus-like particles containing RSV fusion (F) and attachment (G) glycoproteins (FFG-VLP). Cotton rats with FFG-VLP vaccination controlled lung viral replication below the detection limit, and effectively induced neutralizing activity and antibody-secreting cell responses. In comparison with formalin inactivated RSV (FI-RSV) causing severe RSV disease after challenge, FFG-VLP vaccination did not cause weight loss, airway hyper-responsiveness, IL-4 cytokines, histopathology, and infiltrates of proinflammatory cells such as eosinophils. FFG-VLP was even more effective in preventing RSV-induced pulmonary inflammation than live RSV infections. This study provides evidence that FFG-VLP can be developed into a safe and effective RSV vaccine candidate. - Highlights: • Combined RSV FFG VLP vaccine is effective in inducing F specific responses. • FFG VLP vaccine confers RSV neutralizing activity and viral control in cotton rats. • Cotton rats with RSV FFG VLP vaccination do not show vaccine-enhanced disease. • Cotton rats with FFG VLP vaccine induce F specific antibody secreting cell responses. • Cotton rats with FFG VLP do not induce lung cellular infiltrates and Th2 cytokine.
International Nuclear Information System (INIS)
Hwang, Hye Suk; Lee, Young-Tae; Kim, Ki-Hye; Park, Soojin; Kwon, Young-Man; Lee, Youri; Ko, Eun-Ju; Jung, Yu-Jin; Lee, Jong Seok; Kim, Yu-Jin; Lee, Yu-Na; Kim, Min-Chul; Cho, Minkyoung; Kang, Sang-Moo
2016-01-01
A safe and effective vaccine against respiratory syncytial virus (RSV) should confer protection without causing vaccine-enhanced disease. Here, using a cotton rat model, we investigated the protective efficacy and safety of an RSV combination vaccine composed of F-encoding plasmid DNA and virus-like particles containing RSV fusion (F) and attachment (G) glycoproteins (FFG-VLP). Cotton rats with FFG-VLP vaccination controlled lung viral replication below the detection limit, and effectively induced neutralizing activity and antibody-secreting cell responses. In comparison with formalin inactivated RSV (FI-RSV) causing severe RSV disease after challenge, FFG-VLP vaccination did not cause weight loss, airway hyper-responsiveness, IL-4 cytokines, histopathology, and infiltrates of proinflammatory cells such as eosinophils. FFG-VLP was even more effective in preventing RSV-induced pulmonary inflammation than live RSV infections. This study provides evidence that FFG-VLP can be developed into a safe and effective RSV vaccine candidate. - Highlights: • Combined RSV FFG VLP vaccine is effective in inducing F specific responses. • FFG VLP vaccine confers RSV neutralizing activity and viral control in cotton rats. • Cotton rats with RSV FFG VLP vaccination do not show vaccine-enhanced disease. • Cotton rats with FFG VLP vaccine induce F specific antibody secreting cell responses. • Cotton rats with FFG VLP do not induce lung cellular infiltrates and Th2 cytokine.
Colichón, A; Vildósola, H; Sjogren, M; Cantella, R; Rojas, C
1990-01-01
Large areas of the Amazon basin in Brazil, Colombia, Ecuador, and in the nonoriental region of the peruvian jungle have been found to be hyperendemic to Hepatitis B with high prevalence of asymptomatic carriers (11 to 25%) and, in more selected areas, Hepatitis Delta has been also reported. In the present report, we have studied 108 volunteers from six different Jivaroes communities living in a hyperendemic Hepatitis B area. They received 2 doses of DNA recombinant yeast derivated HBV vaccine. All the selected persons were HBsAb negatives, but many (80%) had antibodies to HBc. Following immunization schedule, 80% responded with the formation of HBsAb; a better seroconversion was achieved in those negatives to anticore IgG compared with those having HBcAb. We obtained 90% of seroconversion in spite of the fact that our vaccination schedule was prolonged up to 10 months from the one recommended by the manufacturer. The vaccination schedule 0,4, 14 months, and the schedule 0,4 months, had 76 and 29% of seroconversion, respectively. We want to point out three observations: 1) It is quite possible that many of the Anti-core positives, that did not respond to vaccination were carriers of HBsAg undetectable by the conventional EIA test carried out; 2) The seroconversion rate in these natives was low (up to six months after the vaccination schedule); and 3) Many of the HBcAb were false positives and many of them were recently infected. We conclude: A) It is highly important to assess the anti-HBs hyperendemic areas before attempting vaccinations; B) All persons negative to anti-HBs should be vaccinated in spite to anticore antibodies; C) Areas with difficult access could be vaccinated even until 10 months without affecting good results, and D) DNA recombinant vaccine (ENGERIX B) was well tolerated. No side effects were observed.
[Development of current smallpox vaccines].
Maksiutov, R A; Gavrilova, E V; Shchelkunov, S N
2011-01-01
The review gives data on the history of smallpox vaccination and shows the high topicality of designing the current safe vaccines against orthopoxviruses. Four generations of live smallpox, protein subunit, and DNA vaccines are considered. Analysis of the data published leads to the conclusion that it is promising to use the up-to-date generations of safe smallpox subunit or DNA vaccines for mass primary immunization with possible further revaccination with classical live vaccine.
Lee, Hyojin; Jeong, Moonsup; Oh, Jooyeon; Cho, Youngran; Shen, Xuefei; Stone, John; Yan, Jian; Rothkopf, Zachary; Khan, Amir S; Cho, Byung Mun; Park, Young K; Weiner, David B; Son, Woo-Chan; Maslow, Joel N
2017-03-07
Direct-acting antiviral treatment for hepatitis C virus (HCV) infection is costly and does not protect from re-infection. For human and chimpanzees, recovery from acute HCV infection correlates with host CD4+ and CD8+ T cell responses. DNA plasmids targeting the HCV non-structural antigens NS3, NS4, and NS5, were previously reported to induce robust and sustained T cell responses in mice and primates. These plasmids were combined with a plasmid encoding cytokine IL-28B, together named as VGX-6150. The dose-dependent T cell response and safety of VGX-6150 administered intramuscularly and followed by electroporation was assessed in mice. Immune responses plateaued at 20 μg/dose with IL-28B demonstrating significant immunoadjuvant activity. Mice administered VGX-6150 at 40, 400, and 800 μg given either as a single injection or as 14 injections given bi-weekly over 26 weeks showed no vaccine related changes in any clinical parameter compared to placebo recipients. There was no evidence of VGX-6150 accumulation at the injection site or in any organ 1 month following the 14 th vaccination. Based on these studies, the approximate lethal dose (ALD) exceeds 800 μg/dose and the NOAEL was 800 μg/dose in mouse. In conclusion, VGX-6150 appears safe and a promising preventive vaccine candidate for HCV infection.
Grosenbaugh, Deborah A; Leard, A Timothy; Bergman, Philip J; Klein, Mary K; Meleo, Karri; Susaneck, Steven; Hess, Paul R; Jankowski, Monika K; Jones, Pamela D; Leibman, Nicole F; Johnson, Maribeth H; Kurzman, Ilene D; Wolchok, Jedd D
2011-12-01
To evaluate the safety and efficacy of a vaccine containing plasmid DNA with an insert encoding human tyrosinase (ie, huTyr vaccine) as adjunctive treatment for oral malignant melanoma (MM) in dogs. 111 dogs (58 prospectively enrolled in a multicenter clinical trial and 53 historical controls) with stage II or III oral MM (modified World Health Organization staging scale, I to IV) in which locoregional disease control was achieved. 58 dogs received an initial series of 4 injections of huTyr vaccine (102 μg of DNA/injection) administered transdermally by use of a needle-free IM vaccination device. Dogs were monitored for adverse reactions. Surviving dogs received booster injections at 6-month intervals thereafter. Survival time for vaccinates was compared with that of historical control dogs via Kaplan-Meier survival analysis for the outcome of death. Kaplan-Meier analysis of survival time until death attributable to MM was determined to be significantly improved for dogs that received the huTyr vaccine, compared with that of historical controls. However, median survival time could not be determined for vaccinates because dogs as adjunctive treatment for oral MM. Response to DNA vaccination in dogs with oral MM may be useful in development of plasmid DNA vaccination protocols for human patients with similar disease.
Pasetti, Marcela F; Barry, Eileen M; Losonsky, Genevieve; Singh, Mahender; Medina-Moreno, Sandra M; Polo, John M; Ulmer, Jeffrey; Robinson, Harriet; Sztein, Marcelo B; Levine, Myron M
2003-05-01
Measles remains a leading cause of child mortality in developing countries. Residual maternal measles antibodies and immunologic immaturity dampen immunogenicity of the current vaccine in young infants. Because cotton rat respiratory tract is susceptible to measles virus (MV) replication after intranasal (i.n.) challenge, this model can be used to assess the efficacy of MV vaccines. Pursuing a new measles vaccine strategy that might be effective in young infants, we used attenuated Salmonella enterica serovar Typhi CVD 908-htrA and Shigella flexneri 2a CVD 1208 vaccines to deliver mucosally to cotton rats eukaryotic expression plasmid pGA3-mH and Sindbis virus-based DNA replicon pMSIN-H encoding MV hemagglutinin (H). The initial i.n. dose-response with bacterial vectors alone identified a well-tolerated dosage (1 x 10(9) to 7 x 10(9) CFU) and a volume (20 micro l) that elicited strong antivector immune responses. Animals immunized i.n. on days 0, 28, and 76 with bacterial vectors carrying DNA plasmids encoding MV H or immunized parenterally with these naked DNA vaccine plasmids developed MV plaque reduction neutralizing antibodies and proliferative responses against MV antigens. In a subsequent experiment of identical design, cotton rats were challenged with wild-type MV 1 month after the third dose of vaccine or placebo. MV titers were significantly reduced in lung tissue of animals immunized with MV DNA vaccines delivered either via bacterial live vectors or parenterally. Since attenuated serovar Typhi and S. flexneri can deliver measles DNA vaccines mucosally in cotton rats, inducing measles immune responses (including neutralizing antibodies) and protection, boosting strategies can now be evaluated in animals primed with MV DNA vaccines.
Designing and modeling of complex DNA vaccine based on tropomyosin protein of Boophilus genus tick.
Ranjbar, Mohamamd Mahdi; Gupta, Shishir K; Ghorban, Khodayar; Nabian, Sedigheh; Sazmand, Alireza; Taheri, Mohammad; Esfandyari, Sahar; Taheri, Maryam
2015-01-01
Boophilus tick is a bloodsucking ectoparasite that transfers some pathogens, reducing production and thus leading to economical losses in the cattle industry. Tropomyosin (TPM) protein is a salivary protein, has actin regulator activity, and plays an important role in immune reactions against parasites. In the current study, besides developing a safe, effective, and broad spectrum protective measure against Boophilus genus tick based on TPM protein, we attempted to minimize possible problems occurring in the design of polytopic vaccines. Briefly, the steps that were followed in the present study were as follows: retrieving sequences and finding the mutational/conservative regions, selecting consensus and high immunogenic epitopes of B and CD4(+) T cells by different approaches, three-dimensional structure (3D structure) prediction and representation of epitopes and highly variable/conserve regions, designing vaccinal construct by fusion of B and T cell epitopes by special patterns and improving immunogenicity, evaluation of the constructs' primary structure and posttranslational modification, calculation of hydrophobic regions, reverse translation, codon optimization, open reading frame checking, insertion of start/end codon, Kozak sequence, and finally constructing the DNA vaccine. Variation plot showed some shared epitopes among the ticks' and mites' species that some might be effective only in some species. Finally, by following the steps mentioned above, two constructs for B and T cells were achieved. Checking constructs revealed their reliability and efficacy for in vitro production and utilization. Successful in silico modeling is an essential step of designing vigorous vaccines. We developed a novel protective and therapeutic vaccine against Boophilus genus (based on TPM protein). At the next step, constructed DNA vaccine would be produced in vitro and administrated to cattle, and its potency to induction of immune response and protection against Boophilus
DEFF Research Database (Denmark)
Bela-Ong, Dennis; Schyth, Brian Dall; Lorenzen, Niels
particularly to sea-farmed rainbow trout and thus necessitates strategies to mitigate potential disease outbreaks. A DNA vaccine encoding the glycoprotein gene of VHSV has been developed and shown to elicit protective immune responses in laboratory trials. It is important to identify key factors as biomarkers...
Directory of Open Access Journals (Sweden)
Nina Movsesyan
Full Text Available BACKGROUND: The development of a safe and effective AD vaccine requires a delicate balance between providing an adequate anti-Abeta antibody response sufficient to provide therapeutic benefit, while eliminating an adverse T cell-mediated proinflammatory autoimmune response. To achieve this goal we have designed a prototype chemokine-based DNA epitope vaccine expressing a fusion protein that consists of 3 copies of the self-B cell epitope of Abeta(42 (Abeta(1-11 , a non-self T helper cell epitope (PADRE, and macrophage-derived chemokine (MDC/CCL22 as a molecular adjuvant to promote a strong anti-inflammatory Th2 phenotype. METHODS AND FINDINGS: We generated pMDC-3Abeta(1-11-PADRE construct and immunized 3xTg-AD mouse model starting at age of 3-4 months old. We demonstrated that prophylactic immunizations with the DNA epitope vaccine generated a robust Th2 immune response that induced high titers of anti-Abeta antibody, which in turn inhibited accumulation of Abeta pathology in the brains of older mice. Importantly, vaccination reduced glial activation and prevented the development of behavioral deficits in aged animals without increasing the incidence of microhemorrhages. CONCLUSIONS: Data from this transitional pre-clinical study suggest that our DNA epitope vaccine could be used as a safe and effective strategy for AD therapy. Future safety and immunology studies in large animals with the goal to achieve effective humoral immunity without adverse effects should help to translate this study to human clinical trials.
Vacunas de ADN: inducción de la respuesta inmunitaria DNA Vaccines: Induction of the immune response
Directory of Open Access Journals (Sweden)
Javier Mota-Sánchez
2009-01-01
Full Text Available La efectividad de las vacunas y la inmunización en la prevención de las enfermedades infecciosas es uno de los grandes avances de la medicina. En la actualidad, el acceso a la tecnología de punta en el área de la genómica y la proteómica ha hecho posible acelerar el desarrollo de nuevos modelos de vacunas con características mejoradas en aspectos fundamentales, como la inmunogenicidad y la seguridad. A casi dos décadas del primer informe, en el cual se demostró que un gen puede expresarse mediante la inyección directa de ADN desnudo, las vacunas de ADN han probado ser eficientes para inducir una respuesta inmunitaria protectora contra parásitos, virus y bacterias en diversos modelos animales. Esta revisión tiene por objetivo presentar un panorama general de las vacunas de ADN y los mecanismos mediante los cuales la inmunización con antígenos insertados en vectores de ADN (plásmidos inducen una respuesta inmunitaria.The effectiveness of vaccines and immunization in the prevention of infectious diseases is one of the greatest successes in medicine. In recent years, with access to cutting edge genomic and proteomic technology, it is possible to accelerate the development of new and improved vaccines with better immunogenicity and safety characteristics. Since the first report almost two decades ago, where it was demonstrated that gene expression is possible by directed injection of naked DNA, DNA vaccines have been proven to induce protective immune responses against parasites, virus and bacterium in diverse animal disease models. This review aims to present an overview about DNA vaccines and the mechanisms by which immune responses are induced after immunization with plasmid DNA-encoded antigens.
Sequence-dependent DNA deformability studied using molecular dynamics simulations.
Fujii, Satoshi; Kono, Hidetoshi; Takenaka, Shigeori; Go, Nobuhiro; Sarai, Akinori
2007-01-01
Proteins recognize specific DNA sequences not only through direct contact between amino acids and bases, but also indirectly based on the sequence-dependent conformation and deformability of the DNA (indirect readout). We used molecular dynamics simulations to analyze the sequence-dependent DNA conformations of all 136 possible tetrameric sequences sandwiched between CGCG sequences. The deformability of dimeric steps obtained by the simulations is consistent with that by the crystal structures. The simulation results further showed that the conformation and deformability of the tetramers can highly depend on the flanking base pairs. The conformations of xATx tetramers show the most rigidity and are not affected by the flanking base pairs and the xYRx show by contrast the greatest flexibility and change their conformations depending on the base pairs at both ends, suggesting tetramers with the same central dimer can show different deformabilities. These results suggest that analysis of dimeric steps alone may overlook some conformational features of DNA and provide insight into the mechanism of indirect readout during protein-DNA recognition. Moreover, the sequence dependence of DNA conformation and deformability may be used to estimate the contribution of indirect readout to the specificity of protein-DNA recognition as well as nucleosome positioning and large-scale behavior of nucleic acids.
de Azevedo, Marcela; Meijerink, Marjolein; Taverne, Nico; Pereira, Vanessa Bastos; LeBlanc, Jean Guy; Azevedo, Vasco; Miyoshi, Anderson; Langella, Philippe; Wells, Jerry M; Chatel, Jean-Marc
2015-09-11
Lactococcus lactis (L. lactis), a generally regarded as safe (GRAS) bacterium has recently been investigated as a mucosal delivery vehicle for DNA vaccines. Because of its GRAS status, L. lactis represents an attractive alternative to attenuated pathogens. Previous studies showed that eukaryotic expression plasmids could be delivered into intestinal epithelial cells (IECs) by L. lactis, or recombinant invasive strains of L. lactis, leading to heterologous protein expression. Although expression of antigens in IECs might lead to vaccine responses, it would be of interest to know whether uptake of L. lactis DNA vaccines by dendritic cells (DCs) could lead to antigen expression as they are unique in their ability to induce antigen-specific T cell responses. To test this, we incubated mouse bone marrow-derived DCs (BMDCs) with invasive L. lactis strains expressing either Staphylococcus aureus Fibronectin Binding Protein A (LL-FnBPA+), or Listeria monocytogenes mutated Internalin A (LL-mInlA+), both strains carrying a plasmid DNA vaccine (pValac) encoding for the cow milk allergen β-lactoglobulin (BLG). We demonstrated that they can transfect BMDCs, inducing the secretion of the pro-inflammatory cytokine IL-12. We also measured the capacity of strains to invade a polarized monolayer of IECs, mimicking the situation encountered in the gastrointestinal tract. Gentamycin survival assay in these cells showed that LL-mInlA+ is 100 times more invasive than L. lactis. The cross-talk between differentiated IECs, BMDCs and bacteria was also evaluated using an in vitro transwell co-culture model. Co-incubation of strains in this model showed that DCs incubated with LL-mInlA+ containing pValac:BLG could express significant levels of BLG. These results suggest that DCs could sample bacteria containing the DNA vaccine across the epithelial barrier and express the antigen. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.
Adverse effects of feline IL-12 during DNA vaccination against feline infectious peritonitis virus
Horzinek, M.C.; Haagmans, B.L.; Lintelo, E.G. te; Egberink, H.F.; Duquesne, V.; Aubert, A.; Rottier, P.J.M.
2002-01-01
Cell-mediated immunity is thought to play a decisive role in protecting cats against feline infectious peritonitis (FIP), a progressive and lethal coronavirus disease. In view of the potential of DNA vaccines to induce cell-mediated responses, their efficacy to induce protective immunity in cats was
Jiang, Xiaohong; Dalebout, Tim J; Lukashevich, Igor S; Bredenbeek, Peter J; Franco, David
2015-04-01
Yellow fever virus (YFV)-17D is an empirically developed, highly effective live-attenuated vaccine that has been administered to human beings for almost a century. YFV-17D has stood as a paradigm for a successful viral vaccine, and has been exploited as a potential virus vector for the development of recombinant vaccines against other diseases. In this study, a DNA-launched YFV-17D construct (pBeloBAC-FLYF) was explored as a new modality to the standard vaccine to combine the commendable features of both DNA vaccine and live-attenuated viral vaccine. The DNA-launched YFV-17D construct was characterized extensively both in cell culture and in mice. High titres of YFV-17D were generated upon transfection of the DNA into cells, whereas a mutant with deletion in the capsid-coding region (pBeloBAC-YF/ΔC) was restricted to a single round of infection, with no release of progeny virus. Homologous prime-boost immunization of AAD mice with both pBeloBAC-FLYF and pBeloBAC-YF/ΔC elicited specific dose-dependent cellular immune response against YFV-17D. Vaccination of A129 mice with pBeloBAC-FLYF resulted in the induction of YFV-specific neutralizing antibodies in all vaccinated subjects. These promising results underlined the potential of the DNA-launched YFV both as an alternative to standard YFV-17D vaccination and as a vaccine platform for the development of DNA-based recombinant YFV vaccines. © 2015.
Maksiutov, R A; Shchelkunov, S N
2011-01-01
Efficacy of candidate DNA-vaccines based on the variola virus natural gene A30L and artificial gene A30Lopt with modified codon usage, optimized for expression in mammalian cells, was tested. The groups of mice were intracutaneously immunized three times with three-week intervals with candidate DNA-vaccines: pcDNA_A30L or pcDNA_A30Lopt, and in three weeks after the last immunization all mice in the groups were intraperitoneally infected by the ectromelia virus K1 strain in 10 LD50 dose for the estimation of protection. It was shown that the DNA-vaccines based on natural gene A30L and codon-optimized gene A30Lopt elicited virus, thereby neutralizing the antibody response and protected mice from lethal intraperitoneal challenge with the ectromelia virus with lack of statistically significant difference.
Directory of Open Access Journals (Sweden)
Natan Raimundo Gonçalves de Assis
Full Text Available Schistosomiasis is an important parasitic disease worldwide that affects more than 207 million people in 76 countries and causes approximately 250,000 deaths per year. The best long-term strategy to control schistosomiasis is through immunization combined with drug treatment. Due to the ability of DNA vaccines to generate humoral and cellular immune responses, such vaccines are considered a promising approach against schistosomiasis. Sm29 and tetraspanin-2 (Sm-TSP2 are two proteins that are located in the S. mansoni tegument of adult worms and schistosomula and induce high levels of protection through recombinant protein immunization. In this study, we transfected BHK-21 cells with plasmids encoding Sm29, Sm-TSP2 or a chimera containing both genes. Using RT-PCR analysis and western blot, we confirmed that the DNA vaccine constructs were transcribed and translated, respectively, in BHK-21 cells. After immunization of mice, we evaluated the reduction in worm burden. We observed worm burden reductions of 17-22%, 22%, 31-32% and 24-32% in animals immunized with the pUMVC3/Sm29, pUMVC3/SmTSP-2, pUMVC3/Chimera and pUMVC3/Sm29 + pUMVC3/SmTSP-2 plasmids, respectively. We evaluated the humoral response elicited by DNA vaccines, and animals immunized with pUMVC3/Sm29 and pUMVC3/Sm29 + pUMVC3/SmTSP-2 showed higher titers of anti-Sm29 antibodies. The cytokine profile produced by the spleen cells of immunized mice was then evaluated. We observed higher production of Th1 cytokines, such as TNF-α and IFN-γ, in vaccinated mice and no significant production of IL-4 and IL-5. The DNA vaccines tested in this study showed the ability to generate a protective immune response against schistosomiasis, probably through the production of Th1 cytokines. However, future strategies aiming to optimize the protective response induced by a chimeric DNA construct need to be developed.
Gonçalves de Assis, Natan Raimundo; Batistoni de Morais, Suellen; Figueiredo, Bárbara Castro Pimentel; Ricci, Natasha Delaqua; de Almeida, Leonardo Augusto; da Silva Pinheiro, Carina; Martins, Vicente de Paulo; Oliveira, Sergio Costa
2015-01-01
Schistosomiasis is an important parasitic disease worldwide that affects more than 207 million people in 76 countries and causes approximately 250,000 deaths per year. The best long-term strategy to control schistosomiasis is through immunization combined with drug treatment. Due to the ability of DNA vaccines to generate humoral and cellular immune responses, such vaccines are considered a promising approach against schistosomiasis. Sm29 and tetraspanin-2 (Sm-TSP2) are two proteins that are located in the S. mansoni tegument of adult worms and schistosomula and induce high levels of protection through recombinant protein immunization. In this study, we transfected BHK-21 cells with plasmids encoding Sm29, Sm-TSP2 or a chimera containing both genes. Using RT-PCR analysis and western blot, we confirmed that the DNA vaccine constructs were transcribed and translated, respectively, in BHK-21 cells. After immunization of mice, we evaluated the reduction in worm burden. We observed worm burden reductions of 17-22%, 22%, 31-32% and 24-32% in animals immunized with the pUMVC3/Sm29, pUMVC3/SmTSP-2, pUMVC3/Chimera and pUMVC3/Sm29 + pUMVC3/SmTSP-2 plasmids, respectively. We evaluated the humoral response elicited by DNA vaccines, and animals immunized with pUMVC3/Sm29 and pUMVC3/Sm29 + pUMVC3/SmTSP-2 showed higher titers of anti-Sm29 antibodies. The cytokine profile produced by the spleen cells of immunized mice was then evaluated. We observed higher production of Th1 cytokines, such as TNF-α and IFN-γ, in vaccinated mice and no significant production of IL-4 and IL-5. The DNA vaccines tested in this study showed the ability to generate a protective immune response against schistosomiasis, probably through the production of Th1 cytokines. However, future strategies aiming to optimize the protective response induced by a chimeric DNA construct need to be developed. PMID:25942636
Adomako, M; St-Hilaire, S; Zheng, Y; Eley, J; Marcum, R D; Sealey, W; Donahower, B C; Lapatra, S; Sheridan, P P
2012-03-01
A DNA vaccine against infectious haematopoietic necrosis virus (IHNV) is effective at protecting rainbow trout, Oncorhynchus mykiss, against disease, but intramuscular injection is required and makes the vaccine impractical for use in the freshwater rainbow trout farming industry. Poly (D,L-lactic-co-glycolic acid) (PLGA) is a U.S. Food and Drug Administration (FDA) approved polymer that can be used to deliver DNA vaccines. We evaluated the in vivo absorption of PLGA nanoparticles containing coumarin-6 when added to a fish food pellet. We demonstrated that rainbow trout will eat PLGA nanoparticle coated feed and that these nanoparticles can be detected in the epithelial cells of the lower intestine within 96 h after feeding. We also detected low levels of gene expression and anti-IHNV neutralizing antibodies when fish were fed or intubated with PLGA nanoparticles containing IHNV G gene plasmid. A virus challenge evaluation suggested a slight increase in survival at 6 weeks post-vaccination in fish that received a high dose of the oral vaccine, but there was no difference when additional fish were challenged at 10 weeks post-vaccination. The results of this study suggest that it is possible to induce an immune response using an orally delivered DNA vaccine, but the current system needs improvement. © 2012 Blackwell Publishing Ltd.
International Nuclear Information System (INIS)
Bower, Joseph F.; Green, Thomas D.; Ross, Ted M.
2004-01-01
DNA vaccines expressing the envelope (Env) of the human immunodeficiency virus type 1 (HIV-1) have been relatively ineffective at generating high-titer, long-lasting, neutralizing antibodies in a variety of animal models. In this study, DNA vaccines were constructed to express a fusion protein of the soluble human CD4 (sCD4) and the gp120 subunit of the HIV-1 envelope. To enhance the immunogenicity of the expressed fusion protein, three copies of the murine C3d (mC3d 3 ) were added to the carboxyl terminus of the complex. Monoclonal antibodies that recognize CD4-induced epitopes on gp120 efficiently bound to sCD4-gp120 or sCD4-gp120-mC3d 3 . In addition, both sCD4-gp120 and sCD4-gp120-mC3d 3 bound to cells expressing appropriate coreceptors in the absence of cell surface hCD4. Mice (BALB/c) vaccinated with DNA vaccines expressing either gp120-mC3d 3 or sCD4-gp120-mC3d 3 elicited antibodies that neutralized homologous virus infection. However, the use of sCD4-gp120-mC3d 3 -DNA elicited the highest titers of neutralizing antibodies that persisted after depletion of anti-hCD4 antibodies. Interestingly, only mice vaccinated with DNA expressing sCD4-gp120-mC3d 3 had antibodies that elicited cross-protective neutralizing antibodies. The fusion of sCD4 to the HIV-1 envelope exposes neutralizing epitopes that elicit broad protective immunity when the fusion complex is coupled with the molecular adjuvant, C3d
Directory of Open Access Journals (Sweden)
Anne Endmann
Full Text Available Currently marketed vaccines against hepatitis B virus (HBV based on the small (S hepatitis B surface antigen (HBsAg fail to induce a protective immune response in about 10% of vaccinees. DNA vaccination and the inclusion of PreS1 and PreS2 domains of HBsAg have been reported to represent feasible strategies to improve the efficacy of HBV vaccines. Here, we evaluated the immunogenicity of SAINT-18-formulated MIDGE-Th1 vectors encoding the S or the large (L protein of HBsAg in mice and pigs. In both animal models, vectors encoding the secretion-competent S protein induced stronger humoral responses than vectors encoding the L protein, which was shown to be retained mainly intracellularly despite the presence of a heterologous secretion signal. In pigs, SAINT-18-formulated MIDGE-Th1 vectors encoding the S protein elicited an immune response of the same magnitude as the licensed protein vaccine Engerix-B, with S protein-specific antibody levels significantly higher than those considered protective in humans, and lasting for at least six months after the third immunization. Thus, our results provide not only the proof of concept for the SAINT-18-formulated MIDGE-Th1 vector approach but also confirm that with a cationic-lipid formulation, a DNA vaccine at a relatively low dose can elicit an immune response similar to a human dose of an aluminum hydroxide-adjuvanted protein vaccine in large animals.
International Nuclear Information System (INIS)
Langbein, U.
1976-01-01
The radioprotective effects of BCG vaccines have been examined. The 3 H-thymidine incorporation into the DNA of different tissues of the guinea-pig after solitary whole-body irradiation by the doses of 160, 400, and 700 R have been used as a parameter for radiation injuries and radioprotection. The specific activity of DNA has been detected by means of liquid scintillation counting and by indirect photomeric determination of the amount at 7 h p.r. It has been revealed that independent of the chosen irradiation dose, there was no significant difference in the rate of DNA synthesis in the duodenal, testicular, bone marrow, liver, and lymphatic ganglion tissues of animals vaccinated 30 days before irradiation insultus and the rate of DNA synthesis in normal animals. Based on medical evidence, effect principles which can be observed on other antigenous radioprotective substances can be excluded this time. The dose effect curve has qualitatively the same features as the curves of cell cultures and synchronized cell systems in mammals. Furthermore, the process of DNA synthesis was observed for 56 days. During this observation period there was no significant difference to be seen in the rate of duodenal, testicular, bone marrow, and liver tissues in vaccinated and in normal animals. Only in lymphatic tissues the synthesis rate of vaccinated animals has shown a significantly more decreasing tendency than that of normal animals. A relation concerning radioprotective substances containing SH-groups and 'short-term' protectors (endotoxines) could be excluded because of medical evidence. It is suggested to carry out further tests with parameters affecting the RES in order to comprehend radioprotection after BCG vaccination. (orig./MG) [de
National Research Council Canada - National Science Library
Middlebrooks, Bobby L
2007-01-01
The gene for the protective antigen of E. rhusiopathiae will be inserted into a eukaryotic vector both for the production of a DNA vaccine and for large scale production of the recombinant protein (in vitro...
Directory of Open Access Journals (Sweden)
Zhao K
2014-09-01
Full Text Available Kai Zhao,1,* Yang Zhang,1,2,* Xiaoyan Zhang,1,* Ci Shi,1,2 Xin Wang,1 Xiaohua Wang,1 Zheng Jin,3 Shangjin Cui2 1Laboratory of Microbiology, School of Life Science, Heilongjiang University, 2Division of Swine Infectious Diseases, State Key Laboratory of Veterinary Biotechnology, Harbin Veterinary Research Institute, 3Key Laboratory of Chemical Engineering Process and Technology for High-efficiency Conversion, Heilongjiang University, Harbin, People’s Republic of China *These authors contributed equally to this work Abstract: We determined the efficacy and safety of chitosan (CS-coated poly(lactic-co-glycolic acid (PLGA nanoparticles (NPs as a delivery system for a vaccine to protect chickens against Newcastle disease virus (NDV. The newly constructed vaccine contained DNA (the F gene of NDV. The Newcastle disease virus (NDV F gene deoxyribonucleic acid (DNA plasmid (pFDNA-CS/PLGA-NPs were spherical (diameter =699.1±5.21 nm [mean ± standard deviation] and smooth, with an encapsulation efficiency of 98.1% and a Zeta potential of +6.35 mV. An in vitro release assay indicated that CS controlled the burst release of plasmid DNA, such that up to 67.4% of the entire quantity of plasmid DNA was steadily released from the pFDNA-CS/PLGA-NPs. An in vitro expression assay indicated that the expression of nanoparticles (NPs was maintained in the NPs. In an immunization test with specific pathogen-free chickens, the pFDNA-CS/PLGA-NPs induced stronger cellular, humoral, and mucosal immune responses than the plasmid DNA vaccine alone. The pFDNA-CS/PLGA-NPs did not harm 293T cells in an in vitro assay and did not harm chickens in an in vivo assay. Overall, the results indicated that CS-coated PLGA NPs can serve as an efficient and safe mucosal immune delivery system for NDV DNA vaccine.Keywords: mucosal immune delivery system, immune effect
Directory of Open Access Journals (Sweden)
Lee Jaechun
2006-02-01
Full Text Available Abstract Background Vaccination with naked DNA encoding antigen induces cellular and humoral immunity characterized by the activation of specific Th1 cells. Objective To evaluate the effects of vaccination with mixed naked DNA plasmids encoding Der p 1, Der p 2, Der p 3, Der f 1, Der f 2, and Der f 3, the major house dust mite allergens on the allergic inflammation to the whole house dust mites (HDM crude extract. Methods Three hundred micrograms of these gene mixtures were injected into muscle of BALB/c mice. Control mice were injected with the pcDNA 3.1 blank vector. After 3 weeks, the mice were actively sensitized and inhaled with the whole house dust mite extract intranasally. Results The vaccinated mice showed a significantly decreased synthesis of total and HDM-specific IgE compared with controls. Analysis of the cytokine profile of lymphocytes after challenge with HDM crude extract revealed that mRNA expression of interferon-γ was higher in the vaccinated mice than in the controls. Reduced infiltration of inflammatory cells and the prominent infiltration of CD8+ T cells were observed in histology of lung tissue from the vaccinated mice. Conclusion Vaccination with DNA encoding the major house dust mite allergens provides a promising approach for treating allergic responses to whole house dust mite allergens.
Hellerstein, Michael; Xu, Yongxian; Marino, Tracie; Lu, Shan; Yi, Hong; Wright, Elizabeth R.; Robinson, Harriet L.
2012-01-01
Here, we report on GEO-D03, a DNA vaccine that co-expresses non-infectious HIV-1 virus-like particles (VLPs) and the human cytokine, granulocyte-macrophage colony-stimulating factor (GM-CSF). The virus-like particles display the native gp160 form of the HIV-1 Envelope glycoprotein (Env) and are designed to elicit antibody against the natural form of Env on virus and virus-infected cells. The DNA-expressed HIV Gag, Pol and Env proteins also have the potential to elicit virus-specific CD4 and CD8 T cells. The purpose of the co-expressed GM-CSF is to target a cytokine that recruits, expands and differentiates macrophages and dendritic cells to the site of VLP expression. The GEO-D03 DNA vaccine is currently entered into human trials as a prime for a recombinant modified vaccinia Ankara (MVA) boost. In preclinical studies in macaques using an SIV prototype vaccine, this vaccination regimen elicited both anti-viral T cells and antibody, and provided 70% protection against acquisition during 12 weekly rectal exposures with a heterologous SIV. Higher avidity of the Env-specific Ab for the native form of the Env in the challenge virus correlated with lower likelihood of SIV infection. PMID:23111169
Dahiya, S S; Saini, M; Kumar, P; Gupta, P K
2011-01-01
A Sindbis virus replicon-based DNA vaccine containing VP2 gene of canine parvovirus (CPV) was delivered by Escherichia coli to elicit immune responses. The orally immunized dogs developed CPV-specific serum IgG and virus neutralizing antibody responses. The cellular immune responses analyzed using lymphocyte proliferation test and flow cytometry indicated CPV-specific sensitization of both CD3+CD4+ and CD3+CD8+ lymphocytes. This study demonstrated that the oral CPV DNA vaccine delivered by E. coli can be considered as a promising approach for vaccination of dogs against CPV.
ATP-dependent chromatin remodeling in the DNA-damage response
Directory of Open Access Journals (Sweden)
Lans Hannes
2012-01-01
Full Text Available Abstract The integrity of DNA is continuously challenged by metabolism-derived and environmental genotoxic agents that cause a variety of DNA lesions, including base alterations and breaks. DNA damage interferes with vital processes such as transcription and replication, and if not repaired properly, can ultimately lead to premature aging and cancer. Multiple DNA pathways signaling for DNA repair and DNA damage collectively safeguard the integrity of DNA. Chromatin plays a pivotal role in regulating DNA-associated processes, and is itself subject to regulation by the DNA-damage response. Chromatin influences access to DNA, and often serves as a docking or signaling site for repair and signaling proteins. Its structure can be adapted by post-translational histone modifications and nucleosome remodeling, catalyzed by the activity of ATP-dependent chromatin-remodeling complexes. In recent years, accumulating evidence has suggested that ATP-dependent chromatin-remodeling complexes play important, although poorly characterized, roles in facilitating the effectiveness of the DNA-damage response. In this review, we summarize the current knowledge on the involvement of ATP-dependent chromatin remodeling in three major DNA repair pathways: nucleotide excision repair, homologous recombination, and non-homologous end-joining. This shows that a surprisingly large number of different remodeling complexes display pleiotropic functions during different stages of the DNA-damage response. Moreover, several complexes seem to have multiple functions, and are implicated in various mechanistically distinct repair pathways.
Ethical issues in using a cocaine vaccine to treat and prevent cocaine abuse and dependence.
Hall, W; Carter, L
2004-08-01
A "cocaine vaccine" is a promising immunotherapeutic approach to treating cocaine dependence which induces the immune system to form antibodies that prevent cocaine from crossing the blood brain barrier to act on receptor sites in the brain. Studies in rats show that cocaine antibodies block cocaine from reaching the brain and prevent the reinstatement of cocaine self administration. A successful phase 1 trial of a human cocaine vaccine has been reported. The most promising application of a cocaine vaccine is to prevent relapse to dependence in abstinent users who voluntarily enter treatment. Any use of a vaccine to treat cocaine addicts under legal coercion raises major ethical issues. If this is done at all, it should be carefully trialled first, and only after considerable clinical experience has been obtained in using the vaccine to treat voluntary patients. There will need to be an informed community debate about what role, if any, a cocaine vaccine may have as a way of preventing cocaine addiction in children and adolescents.
Directory of Open Access Journals (Sweden)
Fatemeh Vahedi
2012-10-01
Full Text Available Background: DNA immunization with plasmid DNA encoding bacterial, viral, parasitic, and tumor antigens has been reported to trigger protective immunity. The use of plasmid DNA vaccinations against many diseases has produced promising results in animal and human clinical trials; however, safety concerns about the use of DNA vaccines exist, such as the possibility of integration into the host genome, and elicitation of adverse immune responses. Methods: In this study, we examined the potential integration and bio-distribution of pcDNA3.1+PA, a new vaccine candidate with GenBank accession # EF550208, encoding the PA63 gene, in reproductive organs of mice; ovaries and uterus in female, and testis in male. Animals of both sexes were injected intramuscularly with pcDNA3.1+PA. Host genome integration and tissue distribution were examined using PCR and RT-PCR two times monthly for six months. Results: RT-PCR confirmed that pcDNA3.1+PA was not integrated into the host genome and did not enter reproductive organs. Conclusions: This finding has important implications for the use of pcDNA3.1+PA plasmid as a vaccine and opens new perspectives in the DNA vaccine area.
Muthumani, Karuppiah; Griffin, Bryan D; Agarwal, Sangya; Kudchodkar, Sagar B; Reuschel, Emma L; Choi, Hyeree; Kraynyak, Kimberly A; Duperret, Elizabeth K; Keaton, Amelia Anne; Chung, Christopher; Kim, Yinho K; Booth, Stephanie A; Racine, Trina; Yan, Jian; Morrow, Matthew P; Jiang, Jingjing; Lee, Brian; Ramos, Stephanie; Broderick, Kate E; Reed, Charles C; Khan, Amir S; Humeau, Laurent; Ugen, Kenneth E; Park, Young K; Maslow, Joel N; Sardesai, Niranjan Y; Joseph Kim, J; Kobinger, Gary P; Weiner, David B
2016-01-01
Significant concerns have been raised owing to the rapid global spread of infection and disease caused by the mosquito-borne Zika virus (ZIKV). Recent studies suggest that ZIKV can also be transmitted sexually, further increasing the exposure risk for this virus. Associated with this spread is a dramatic increase in cases of microcephaly and additional congenital abnormalities in infants of ZIKV-infected mothers, as well as a rise in the occurrence of Guillain Barre’ syndrome in infected adults. Importantly, there are no licensed therapies or vaccines against ZIKV infection. In this study, we generate and evaluate the in vivo efficacy of a novel, synthetic, DNA vaccine targeting the pre-membrane+envelope proteins (prME) of ZIKV. Following initial in vitro development and evaluation studies of the plasmid construct, mice and non-human primates were immunised with this prME DNA-based immunogen through electroporation-mediated enhanced DNA delivery. Vaccinated animals were found to generate antigen-specific cellular and humoral immunity and neutralisation activity. In mice lacking receptors for interferon (IFN)-α/β (designated IFNAR−/−) immunisation with this DNA vaccine induced, following in vivo viral challenge, 100% protection against infection-associated weight loss or death in addition to preventing viral pathology in brain tissue. In addition, passive transfer of non-human primate anti-ZIKV immune serum protected IFNAR−/− mice against subsequent viral challenge. This study in NHP and in a pathogenic mouse model supports the importance of immune responses targeting prME in ZIKV infection and suggests that additional research on this vaccine approach may have relevance for ZIKV control and disease prevention in humans. PMID:29263859
ZIKA-001: Safety and Immunogenicity of an Engineered DNA Vaccine Against ZIKA virus infection
Tebas, Pablo; Roberts, Christine C; Muthumani, Kar; Reuschel, Emma; White, Scott; Khan, Amir S; Racine, Trina; Choi, Hyeree; Zaidi, Faraz; Boyer, Jean; Kudchodkar, Sagar; Park, Young K; Trottier, Sylvie; Remigio, Celine; Krieger, Diane; Kobinger, Gary P; Weiner, David; Maslow, Joel
2017-01-01
Abstract Background While Zika virus (ZIKV) infection is typically self-limited, congenital birth defects and Guillain-Barré syndrome are well-described. There are no therapies or vaccines against ZIKV infection. Methods ZIKA-001 is a phase I, open label, clinical trial designed to evaluate the safety, side effect profile, and immunogenicity of a synthetic, DNA vaccine (GLS-5700) targeting the pre-membrane+envelope proteins (prME) of the virus. Two groups of 20 participants received GLS-5700 at one of two dose levels: 1 mg or 2 mg DNA/dose at 0, 4, and 12 weeks. Vaccine was administered as 0.1 or 0.2 ml (1 or 2 mg) intradermal (ID) injection followed by electroporation (EP) with the CELLECTRA®-3P device Results The median age of the 40 participants was 38 (IQR 30–54) years; 60% were female 30% Latino and 78% white. No SAEs have been reported to date. Local minor AEs were injection site pain, redness, swelling and itching that occurred in half of the participants. Systemic adverse events were rare and included headache, myalgias, upper respiratory infections, fatigue/malaise and nausea. Four weeks after the first dose 25% vs. 60% of the participants in the 1 mg and 2 mg dose seroconverted. By week 6, 2 weeks after the second dose, the response was 65 and 84% respectively and 2 weeks after the third dose all participants in both dosing groups developed antibodies. At the end of the vaccination period over 60% of vaccinated person neutralized Zika virus in a vero cell assay and greater than 80% on neuronal cell targets. The protective efficacy of the antibodies generated by the vaccine was evaluated in the lethal IFNAR−/− mouse model. After the intraperitoneal administration of 0.1 ml of either baseline, week 14 serum or PBS the animals were challenged with 106 PFUs of ZIKV PR209 isolate. Whereas animals administered PBS (control) or baseline serum succumbed after a median of 5 days, those pretreated with week 14 serum from study participants survived
Directory of Open Access Journals (Sweden)
Nicole Haese
Full Text Available Andes virus (ANDV and ANDV-like viruses are responsible for most hantavirus pulmonary syndrome (HPS cases in South America. Recent studies in Chile indicate that passive transfer of convalescent human plasma shows promise as a possible treatment for HPS. Unfortunately, availability of convalescent plasma from survivors of this lethal disease is very limited. We are interested in exploring the concept of using DNA vaccine technology to produce antiviral biologics, including polyclonal neutralizing antibodies for use in humans. Geese produce IgY and an alternatively spliced form, IgYΔFc, that can be purified at high concentrations from egg yolks. IgY lacks the properties of mammalian Fc that make antibodies produced in horses, sheep, and rabbits reactogenic in humans. Geese were vaccinated with an ANDV DNA vaccine encoding the virus envelope glycoproteins. All geese developed high-titer neutralizing antibodies after the second vaccination, and maintained high-levels of neutralizing antibodies as measured by a pseudovirion neutralization assay (PsVNA for over 1 year. A booster vaccination resulted in extraordinarily high levels of neutralizing antibodies (i.e., PsVNA80 titers >100,000. Analysis of IgY and IgYΔFc by epitope mapping show these antibodies to be highly reactive to specific amino acid sequences of ANDV envelope glycoproteins. We examined the protective efficacy of the goose-derived antibody in the hamster model of lethal HPS. α-ANDV immune sera, or IgY/IgYΔFc purified from eggs, were passively transferred to hamsters subcutaneously starting 5 days after an IM challenge with ANDV (25 LD50. Both immune sera, and egg-derived purified IgY/IgYΔFc, protected 8 of 8 and 7 of 8 hamsters, respectively. In contrast, all hamsters receiving IgY/IgYΔFc purified from normal geese (n=8, or no-treatment (n=8, developed lethal HPS. These findings demonstrate that the DNA vaccine/goose platform can be used to produce a candidate antiviral
Hantavirus Gc induces long-term immune protection via LAMP-targeting DNA vaccine strategy.
Jiang, Dong-Bo; Zhang, Jin-Peng; Cheng, Lin-Feng; Zhang, Guan-Wen; Li, Yun; Li, Zi-Chao; Lu, Zhen-Hua; Zhang, Zi-Xin; Lu, Yu-Chen; Zheng, Lian-He; Zhang, Fang-Lin; Yang, Kun
2018-02-01
Hemorrhagic fever with renal syndrome (HFRS) occurs widely throughout Eurasia. Unfortunately, there is no effective treatment, and prophylaxis remains the best option against the major pathogenic agent, hantaan virus (HTNV), which is an Old World hantavirus. However, the absence of cellular immune responses and immunological memory hampers acceptance of the current inactivated HFRS vaccine. Previous studies revealed that a lysosome-associated membrane protein 1 (LAMP1)-targeting strategy involving a DNA vaccine based on the HTNV glycoprotein Gn successfully conferred long-term immunity, and indicated that further research on Gc, another HTNV antigen, was warranted. Plasmids encoding Gc and lysosome-targeted Gc, designated pVAX-Gc and pVAX-LAMP/Gc, respectively, were constructed. Proteins of interest were identified by fluorescence microscopy following cell line transfection. Five groups of 20 female BALB/c mice were subjected to the following inoculations: inactivated HTNV vaccine, pVAX-LAMP/Gc, pVAX-Gc, and, as the negative controls, pVAX-LAMP or the blank vector pVAX1. Humoral and cellular immunity were assessed by enzyme-linked immunosorbent assays (ELISAs) and 15-mer peptide enzyme-linked immunospot (ELISpot) epitope mapping assays. Repeated immunization with pVAX-LAMP/Gc enhanced adaptive immune responses, as demonstrated by the specific and neutralizing antibody titers and increased IFN-γ production. The inactivated vaccine induced a comparable humoral reaction, but the negative controls only elicited insignificant responses. Using a mouse model of HTNV challenge, the in vivo protection conferred by the inactivated vaccine and Gc-based constructs (with/without LAMP recombination) was confirmed. Evidence of pan-epitope reactions highlighted the long-term cellular response to the LAMP-targeting strategy, and histological observations indicated the safety of the LAMP-targeting vaccines. The long-term protective immune responses induced by pVAX-LAMP/Gc may be
Maspi, Nahid; Ghaffarifar, Fatemeh; Sharifi, Zohreh; Dalimi, Abdolhossein; Dayer, Mohammad Saaid
2017-03-01
There is no effective vaccine for the prevention and elimination of leishmaniasis. For this reason, we assessed the protective effects of DNA vaccines containing LeIF, TSA genes alone, or LeIF-TSA fusion against cutaneous leishmaniasis pEGFP-N1 plasmid (empty vector) and phosphate buffer saline (PBS) were used as control groups. Therefore, cellular and humoral immune responses were evaluated before and after the challenge with Leishmania major. Lesion diameter was also measured 3-12 weeks after challenge. All immunized mice with plasmid DNA encoding Leishmania antigens induced the partial immunity characterized by increased IFN-γ and IgG2a levels compared with control groups (p TSA, and LeIF-TSA, respectively, than in PBS group at 12th week post infection. IFN/IL-4 and IgG2a/IgG1 ratios indicated that group receiving LeIF-TSA fusion had the highest IFN-γ and IgG2a levels. In this study, DNA immunization promoted Th1 immune response characterized by higher IFN-γ and IgG2a levels and also reduction in lesion size. These results showed that a bivalent vaccine containing two distinct antigens may induce more potent immune responses against leishmaniasis. © 2017 APMIS. Published by John Wiley & Sons Ltd.
DEFF Research Database (Denmark)
Bragstad, Karoline; Martel, Cyril; Thomsen, Joakim S.
2011-01-01
Please cite this paper as: Bragstad et al. (2010) Pandemic influenza 1918 H1N1 and 1968 H3N2 DNA vaccines induce cross-reactive immunity in ferrets against infection with viruses drifted for decades. Influenza and Other Respiratory Viruses 5(1), 13-23. Background Alternative influenza vaccines...... and vaccine production forms are needed as the conventional protein vaccines do not induce broad cross-reactivity against drifted strains. Furthermore, fast vaccine production is especially important in a pandemic situation, and broader vaccine reactivity would diminish the need for frequent change...... in the vaccine formulations. Objective In this study, we compared the ability of pandemic influenza DNA vaccines to induce immunity against distantly related strains within a subtype with the immunity induced by conventional trivalent protein vaccines against homologous virus challenge. Methods Ferrets were...
The role of DNA dependent protein kinase in synapsis of DNA ends.
Weterings, Eric; Verkaik, Nicole S; Brüggenwirth, Hennie T; Hoeijmakers, Jan H J; van Gent, Dik C
2003-12-15
DNA dependent protein kinase (DNA-PK) plays a central role in the non-homologous end-joining pathway of DNA double strand break repair. Its catalytic subunit (DNA-PK(CS)) functions as a serine/threonine protein kinase. We show that DNA-PK forms a stable complex at DNA termini that blocks the action of exonucleases and ligases. The DNA termini become accessible after autophosphorylation of DNA-PK(CS), which we demonstrate to require synapsis of DNA ends. Interestingly, the presence of DNA-PK prevents ligation of the two synapsed termini, but allows ligation to another DNA molecule. This alteration of the ligation route is independent of the type of ligase that we used, indicating that the intrinsic architecture of the DNA-PK complex itself is not able to support ligation of the synapsed DNA termini. We present a working model in which DNA-PK creates a stable molecular bridge between two DNA ends that is remodeled after DNA-PK autophosphorylation in such a way that the extreme termini become accessible without disrupting synapsis. We infer that joining of synapsed DNA termini would require an additional protein factor.
Dual recombinant Lactococcus lactis for enhanced delivery of DNA vaccine reporter plasmid pPERDBY.
Yagnik, Bhrugu; Sharma, Drashya; Padh, Harish; Desai, Priti
2017-04-01
Food grade Lactococcus lactis has been widely used as an antigen and DNA delivery vehicle. We have previously reported the use of non-invasive L. lactis to deliver the newly constructed immunostimulatory DNA vaccine reporter plasmid, pPERDBY. In the present report, construction of dual recombinant L. lactis expressing internalin A of Listeria monocytogenes and harboring pPERDBY (LL InlA + pPERDBY) to enhance the efficiency of delivery of DNA by L. lactis is outlined. After confirmation and validation of LL InlA + pPERDBY, its DNA delivery potential was compared with previously developed non-invasive r- L. lactis::pPERDBY. The use of invasive L. lactis resulted in around threefold increases in the number of enhanced green fluorescent protein-expressing Caco-2 cells. These findings reinforce the prospective application of invasive strain of L. lactis for delivery of DNA/RNA and antigens. © 2017 The Societies and John Wiley & Sons Australia, Ltd.
DNA-dependent protein kinase inhibits AID-induced antibody gene conversion.
Directory of Open Access Journals (Sweden)
Adam J L Cook
2007-04-01
Full Text Available Affinity maturation and class switching of antibodies requires activation-induced cytidine deaminase (AID-dependent hypermutation of Ig V(DJ rearrangements and Ig S regions, respectively, in activated B cells. AID deaminates deoxycytidine bases in Ig genes, converting them into deoxyuridines. In V(DJ regions, subsequent excision of the deaminated bases by uracil-DNA glycosylase, or by mismatch repair, leads to further point mutation or gene conversion, depending on the species. In Ig S regions, nicking at the abasic sites produced by AID and uracil-DNA glycosylases results in staggered double-strand breaks, whose repair by nonhomologous end joining mediates Ig class switching. We have tested whether nonhomologous end joining also plays a role in V(DJ hypermutation using chicken DT40 cells deficient for Ku70 or the DNA-dependent protein kinase catalytic subunit (DNA-PKcs. Inactivation of the Ku70 or DNA-PKcs genes in DT40 cells elevated the rate of AID-induced gene conversion as much as 5-fold. Furthermore, DNA-PKcs-deficiency appeared to reduce point mutation. The data provide strong evidence that double-strand DNA ends capable of recruiting the DNA-dependent protein kinase complex are important intermediates in Ig V gene conversion.
Sequence dependence of electron-induced DNA strand breakage revealed by DNA nanoarrays
DEFF Research Database (Denmark)
Keller, Adrian; Rackwitz, Jenny; Cauët, Emilie
2014-01-01
The electronic structure of DNA is determined by its nucleotide sequence, which is for instance exploited in molecular electronics. Here we demonstrate that also the DNA strand breakage induced by low-energy electrons (18 eV) depends on the nucleotide sequence. To determine the absolute cross sec...
Directory of Open Access Journals (Sweden)
Eric S Rosenberg
2010-05-01
Full Text Available An effective therapeutic vaccine that could augment immune control of HIV-1 replication may abrogate or delay the need for antiretroviral therapy. AIDS Clinical Trials Group (ACTG A5187 was a phase I/II, randomized, placebo-controlled, double-blinded trial to evaluate the safety and immunogenicity of an HIV-1 DNA vaccine (VRC-HVDNA 009-00-VP in subjects treated with antiretroviral therapy during acute/early HIV-1 infection. (clinicaltrials.gov NCT00125099Twenty healthy HIV-1 infected subjects who were treated with antiretroviral therapy during acute/early HIV-1 infection and had HIV-1 RNA<50 copies/mL were randomized to receive either vaccine or placebo. The objectives of this study were to evaluate the safety and immunogenicity of the vaccine. Following vaccination, subjects interrupted antiretroviral treatment, and set-point HIV-1 viral loads and CD4 T cell counts were determined 17-23 weeks after treatment discontinuation.Twenty subjects received all scheduled vaccinations and discontinued antiretroviral therapy at week 30. No subject met a primary safety endpoint. No evidence of differences in immunogenicity were detected in subjects receiving vaccine versus placebo. There were also no significant differences in set-point HIV-1 viral loads or CD4 T cell counts following treatment discontinuation. Median set-point HIV-1 viral loads after treatment discontinuation in vaccine and placebo recipients were 3.5 and 3.7 log(10 HIV-1 RNA copies/mL, respectively.The HIV-1 DNA vaccine (VRC-HIVDNA 009-00-VP was safe but poorly immunogenic in subjects treated with antiretroviral therapy during acute/early HIV-1 infection. Viral set-points were similar between vaccine and placebo recipients following treatment interruption. However, median viral load set-points in both groups were lower than in historical controls, suggesting a possible role for antiretroviral therapy in persons with acute or early HIV-1 infection and supporting the safety of
Liu, Yuan; Cao, Aiping; Li, Yawen; Li, Xun; Cong, Hua; He, Shenyi; Zhou, Huaiyu
2017-06-07
Toxoplasma gondii (T. gondii) is an obligate intracellular protozoan parasite that infects all warm-blooded animals including humans and causes toxoplasmosis. An effective vaccine could be an ideal choice for preventing and controlling toxoplasmosis. T. gondii Superoxide dismutase (TgSOD) might participate in affecting the intracellular growth of both bradyzoite and tachyzoite forms. In the present study, the TgSOD gene was used to construct a DNA vaccine (pEGFP-SOD). TgSOD gene was amplified and inserted into eukaryotic vector pEGFP-C1 and formed the DNA vaccine pEGFP-SOD. Then the BALB/c mice were immunized intramuscularly with the DNA vaccine and those injected with pEGFP-C1, PBS or nothing were treated as controls. Four weeks after the last immunization, all mouse groups followed by challenging intraperitoneally with tachyzoites of T. gondii ME49 strain. Results showed higher levels of total IgG, IgG2α in the sera and interferon gamma (IFN-γ) in the splenocytes from pEGFP-SOD inoculated mice than those unvaccinated, or inoculated with either empty plasmid vector or PBS. The proportions of CD4 + T cells and CD8 + T cells in the spleen from pEGFP-SOD inoculated mice were significantly (p < 0.05) increased compared to control groups. In addition, the survival time of mice immunized with pEGFP-SOD was significantly prolonged as compared to the controls (p < 0.05) although all the mice died. The present study revealed that the DNA vaccine triggered strong humoral and cellular immune responses, and aroused partial protective immunity against acute T. gondii infection in BALB/c mice. The collective data suggests the SOD may be a potential vaccine candidate for further development.
Song, Xiaokai; Huang, Xinmei; Yan, Ruofeng; Xu, Lixin; Li, Xiangrui
2015-09-01
Chimeric DNA vaccines encoding Eimeria tenella (E. tenella) surface antigen 5401 were constructed and their efficacies against E. tenella challenge were studied. The open reading frame (ORF) of 5401 was cloned into the prokaryotic expression vector pGEX-4T2 to express the recombinant protein and the expressed recombinant protein was identified by Western blot. The ORF of 5401 and chicken cytokine gene IFN-γ or IL-2 were cloned into the eukaryotic expression vector pVAX1 consecutively to construct DNA vaccines pVAX-5401-IFN-γ, pVAX-5401-IL-2 and pVAX-5401. The expression of aim genes in vivo was detected by reverse transcription-polymerase chain reaction and Western blot. Fourteen-day-old chickens were inoculated twice at an interval of 7 days with 100 µg of plasmids pVAX-5401, pVAX-5401-IFN-γ and pVAX-5401-IL-2 or 200 µg of recombinant 5401 protein by leg intramuscular injection, respectively. Seven days after the second inoculation, all chickens except the unchallenged control group were challenged orally with 5 × 10(4) sporulated oocysts of E. tenella. Seven days after challenge, all chickens were weighted and slaughtered to determine the effects of immunization. The results showed the recombinant protein was about 90 kDa and reacted with antiserum against soluble sporozoites. The animal experiment showed that all the DNA vaccines pVAX-5401, pVAX-5401-IFN-γ or pVAX-5401-IL-2 and the recombinant 5401 protein could obviously alleviate body weight loss and cecal lesions as compared with non-vaccinated challenged control and empty vector pVAX1control. Furthermore, pVAX-5401-IFN-γ or pVAX-5401-IL-2 induced anti-coccidial index (ACI) of 180.01 or 177.24 which were significantly higher than that of pVAX-5401. The results suggested that 5401 was an effective candidate antigen for vaccine. This finding also suggested that chicken IFN-γ or IL-2 could effectively improve the efficacies of DNA vaccines against avian coccidiosis. Copyright © 2015 Elsevier
Huang, Jingwei; Zhang, Zhenchao; Li, Menghui; Song, Xiaokai; Yan, Ruofeng; Xu, Lixin; Li, Xiangrui
2015-10-01
E. maxima is one of the seven species of Eimeria that infects chicken. Until now, only a few antigenic genes of E. maxima have been reported. In the present study, the immune protective effects against E. maxima challenge of recombinant protein and DNA vaccine encoding EmMIC2 were evaluated. Two-week-old chickens were randomly divided into five groups. The experimental group of chickens was immunized with 100 μg DNA vaccine pVAX1-MIC2 or 200 μg rEmMIC2 protein while the control group of chickens was injected with pVAX1 plasmid or sterile PBS. The results showed that the anti-EmMIC2 antibody titers of both rEmMIC2 protein and pVAX1-MIC2 groups were significantly higher as compared to PBS and pVAX1 control (Pmaxima challenge and it could be an effective antigen candidate for the development of new vaccines against E. maxima. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
The use of recombinant DNA technology for the development of a bluetongue virus subunit vaccine
International Nuclear Information System (INIS)
Huismans, H.
1985-01-01
The double-standed RNA gene coding for the surface antigen responsible for inducing neutralising anti-bodies has been isolated, converted to DNA, and cloned in the plasmid pBR322. So far, only plasmids containing inserts smaller than the gene have been obtained. The recombinant plasmids were isolated by screening for specific antibiotic resistance markers and characterized by size, restriction enzymes and hybridization with a 32 P-labelled DNA probe made with BTV-m RNA as template. Possible strategies for the development of a bluetongue virus submit vaccine are discussed
Radhakrishnan, Sarvan Kumar; Lees-Miller, Susan P
2017-09-01
Non-homologous end joining (NHEJ) is the major pathway for the repair of ionizing radiation induced DNA double strand breaks (DSBs) in human cells. Critical to NHEJ is the DNA-dependent interaction of the Ku70/80 heterodimer with the DNA-dependent protein kinase catalytic subunit (DNA-PKcs) to form the DNA-PK holoenzyme. However, precisely how Ku recruits DNA-PKcs to DSBs ends to enhance its kinase activity has remained enigmatic, with contradictory findings reported in the literature. Here we address the role of the Ku80 C-terminal region (CTR) in the DNA-dependent interaction of Ku70/80 with DNA-PKcs using purified components and defined DNA structures. Our results show that the Ku80 CTR is required for interaction with DNA-PKcs on short segments of blunt ended 25bp dsDNA or 25bp dsDNA with a 15-base poly dA single stranded (ss) DNA extension, but this requirement is less stringent on longer dsDNA molecules (35bp blunt ended dsDNA) or 25bp duplex DNA with either a 15-base poly dT or poly dC ssDNA extension. Moreover, the DNA-PKcs-Ku complex preferentially forms on 25 bp DNA with a poly-pyrimidine ssDNA extension.Our work clarifies the role of the Ku80 CTR and dsDNA ends on the interaction of DNA-PKcs with Ku and provides key information to guide assembly and biology of NHEJ complexes. Copyright © 2017 Elsevier B.V. All rights reserved.
DEFF Research Database (Denmark)
Lorenzen, Ellen; Lorenzen, Niels; Einer-Jensen, Katja
2005-01-01
The present study was performed as a time course study of fish vaccinated with 20 mu g plasmid DNA vaccine encoding either the VHSV G-protein or the VHSV N-protein. Samples of the injection site were collected sequentially over a 7-week period. The study revealed an intense positive staining by i...
DEFF Research Database (Denmark)
Sepulveda, Dagoberto; Lorenzen, Niels
2013-01-01
, this work aims to evaluate whether VHSV is able to evade the protective immune response induced by the DNA vaccination. Earlier studies have demonstrated that VHSV can evade the neutralizing effect of monoclonal antibodies by mutations in the glycoprotein gene. One approach of the present study is therefore...... to try to isolate VHSV variants which can escape the neutralizing activity of serum from fish immunized with the DNA vaccine. To do so, a highly pathogenic VHSV isolate (DK3592B) will be repeatedly passaged in fish cell cultures in the presence of neutralizing fish serum. Another approach comprises...
Directory of Open Access Journals (Sweden)
Marina De Filette
Full Text Available West Nile virus (WNV is a mosquito-borne flavivirus that is endemic in Africa, the Middle East, Europe and the United States. There is currently no antiviral treatment or human vaccine available to treat or prevent WNV infection. DNA plasmid-based vaccines represent a new approach for controlling infectious diseases. In rodents, DNA vaccines have been shown to induce B cell and cytotoxic T cell responses and protect against a wide range of infections. In this study, we formulated a plasmid DNA vector expressing the ectodomain of the E-protein of WNV into nanoparticles by using linear polyethyleneimine (lPEI covalently bound to mannose and examined the potential of this vaccine to protect against lethal WNV infection in mice. Mice were immunized twice (prime--boost regime with the WNV DNA vaccine formulated with lPEI-mannose using different administration routes (intramuscular, intradermal and topical. In parallel a heterologous boost with purified recombinant WNV envelope (E protein was evaluated. While no significant E-protein specific humoral response was generated after DNA immunization, protein boosting of DNA-primed mice resulted in a marked increase in total neutralizing antibody titer. In addition, E-specific IL-4 T-cell immune responses were detected by ELISPOT after protein boost and CD8(+ specific IFN-γ expression was observed by flow cytometry. Challenge experiments using the heterologous immunization regime revealed protective immunity to homologous and virulent WNV infection.
Maeto, Cynthia Alejandra; Rodríguez, Ana María; Holgado, María Pía; Falivene, Juliana; Gherardi, Maria Magdalena
2017-01-01
Induction of local antiviral immune responses at the mucosal portal surfaces where HIV-1 and other viral pathogens are usually first encountered remains a primary goal for most vaccines against mucosally acquired viral infections. Exploring mucosal immunization regimes in order to find optimal vector combinations and also appropriate mucosal adjuvants in the HIV vaccine development is decisive. In this study we analyzed the interaction of DNA-IL-12 and cholera toxin B subunit (CTB) after thei...
Cre-dependent DNA recombination activates a STING-dependent innate immune response
Pépin, Geneviève; Ferrand, Jonathan; Höning, Klara; Jayasekara, W. Samantha N.; Cain, Jason E.; Behlke, Mark A.; Gough, Daniel J.; G. Williams, Bryan R.; Hornung, Veit
2016-01-01
Abstract Gene-recombinase technologies, such as Cre/loxP-mediated DNA recombination, are important tools in the study of gene function, but have potential side effects due to damaging activity on DNA. Here we show that DNA recombination by Cre instigates a robust antiviral response in mammalian cells, independent of legitimate loxP recombination. This is due to the recruitment of the cytosolic DNA sensor STING, concurrent with Cre-dependent DNA damage and the accumulation of cytoplasmic DNA. Importantly, we establish a direct interplay between this antiviral response and cell–cell interactions, indicating that low cell densities in vitro could be useful to help mitigate these effects of Cre. Taking into account the wide range of interferon stimulated genes that may be induced by the STING pathway, these results have broad implications in fields such as immunology, cancer biology, metabolism and stem cell research. Further, this study sets a precedent in the field of gene-engineering, possibly applicable to other enzymatic-based genome editing technologies. PMID:27166376
Herzog, A; Buchholz, J; Ruess-Melzer, K; Lang, J; Kaser-Hotz, B
2013-02-01
Melanoma is the most common oral tumor in dogs, characterized by rapid growth, local invasion, and high metastatic rate. The goal of this study was to evaluate the combination of radiation therapy and DNA tumor vaccine. We hypothesized, that the concurrent use would not increase toxicity. Nine dogs with oral melanoma were treated with 4 fractions of 8 Gray at 7-day intervals. The vaccine was given 4 times every 14 days, beginning at the first radiation fraction. Local acute radiation toxicities were assessed according to the VRTOG toxicity scoring scheme over a time period of 7 weeks. In none of the evaluated dogs, mucositis, dermatitis and conjunctivitis exceeded grade 2. In 3 dogs mild fever, lethargy, and local swelling at the injection site were seen after vaccine application. In conclusion, the concurrent administration of radiation therapy and vaccine was well tolerated in all dogs.
International Nuclear Information System (INIS)
Ellenberger, Dennis; Li Bin; Smith, James; Yi Hong; Folks, Thomas; Robinson, Harriet; Butera, Salvatore
2004-01-01
We developed an AIDS vaccine for Western and West-Central Africa based on a DNA plasmid vector expressing HIV-1 recombinant subtype CRF02 A G gag, pol, and env genes. To optimize the production of noninfectious HIV-like particles (VLPs) and potentially improve the effectiveness of the vaccine, we generated four potential vaccine constructs: the parental (IC2) and three modifications (IC25, IC48, and IC90) containing mutations within the HIV protease. While the parental construct IC2 expressed aggregates of Gag proteins, the IC25 construct resulted in the production of immature VLPs (the core comprises unprocessed Pr 55Gag ). The remaining two constructs (IC48 and IC90) produced mature VLPs (the core comprises processed capsid p24) in addition to immature VLPs and aggregates of Gag proteins. VLPs incorporated significant levels of mature gp120 envelope glycoprotein. Importantly, the mature VLPs were fusion competent and entered coreceptor-specific target cells. The production of multiple antigenic forms, including fusion-competent VLPs, by candidate DNA vaccine constructs may provide immunologic advantages for induction of protective cellular and humoral responses against HIV-1 proteins
Ma, Yan-Ping; Ke, Hao; Liang, Zhi-Ling; Ma, Jiang-Yao; Hao, Le; Liu, Zhen-Xing
2017-07-01
Streptococcus agalactiae (S. agalactiae) is an important fish pathogen, which has received more attention in the past decade due to the increasing economic losses in the tilapia industry worldwide. As existing effective vaccines of S. agalactiae in fish have obvious disadvantage, to select immunoprotective antigens and package materials would undoubtedly contribute to the development of novel oral vaccines. In the present study, surface immunogenic protein (sip) was selected from the S. agalactiae serovar I a genomes as immunogenic protein in DNA vaccine form with cationic chitosan and biodegradable and biocompatible PLGA. The pcSip plasmid in cationic-PLGA was successfully expressed in tissues of immunized tilapia and the immunogenicity was assessed in tilapia challenge model. A significant increase was observed in the cytokine levels of IL-1β, TNF-α, CC1, CC2 in spleen and kidney tissues. Furthermore, immunized tilapia conferred different levels of protection against challenge with a lethal dose of highly virulent serovar I a S. agalactiae. Our results indicated that the pcSip plasmid in cationic-PLGA induced high level of antibodies and protection against S. agalactiae infection, could be effective oral DNA vaccine candidates. Copyright © 2017 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Karthik Mallilankaraman
2011-01-01
Full Text Available Chikungunya virus (CHIKV is an emerging mosquito-borne alphavirus indigenous to tropical Africa and Asia. Acute illness is characterized by fever, arthralgias, conjunctivitis, rash, and sometimes arthritis. Relatively little is known about the antigenic targets for immunity, and no licensed vaccines or therapeutics are currently available for the pathogen. While the Aedes aegypti mosquito is its primary vector, recent evidence suggests that other carriers can transmit CHIKV thus raising concerns about its spread outside of natural endemic areas to new countries including the U.S. and Europe. Considering the potential for pandemic spread, understanding the development of immunity is paramount to the development of effective counter measures against CHIKV. In this study, we isolated a new CHIKV virus from an acutely infected human patient and developed a defined viral challenge stock in mice that allowed us to study viral pathogenesis and develop a viral neutralization assay. We then constructed a synthetic DNA vaccine delivered by in vivo electroporation (EP that expresses a component of the CHIKV envelope glycoprotein and used this model to evaluate its efficacy. Vaccination induced robust antigen-specific cellular and humoral immune responses, which individually were capable of providing protection against CHIKV challenge in mice. Furthermore, vaccine studies in rhesus macaques demonstrated induction of nAb responses, which mimicked those induced in convalescent human patient sera. These data suggest a protective role for nAb against CHIKV disease and support further study of envelope-based CHIKV DNA vaccines.
Loss of long term protection with the inclusion of HIV pol to a DNA vaccine encoding gag.
Garrod, Tamsin J; Gargett, Tessa; Yu, Wenbo; Major, Lee; Burrell, Christopher J; Wesselingh, Steven; Suhrbier, Andreas; Grubor-Bauk, Branka; Gowans, Eric J
2014-11-04
Traditional vaccine strategies that induce antibody responses have failed to protect against HIV infection in clinical trials, and thus cell-mediated immunity is now an additional criterion. Recent clinical trials that aimed to induce strong T cell responses failed to do so. Therefore, to enhance induction of protective T cell responses, it is crucial that the optimum antigen combination is chosen. Limited research has been performed into the number of antigens selected for an HIV vaccine. This study aimed to compare DNA vaccines encoding either a single HIV antigen or a combination of two antigens, using intradermal vaccination of C57BL/6 mice. Immune assays were performed on splenocytes, and in vivo protection was examined by challenge with a chimeric virus, EcoHIV, able to infect mouse but not human leukocytes, at 10 days (short term) and 60 days (long term) post final vaccination. At 60 days there was significantly lower frequency of induced antigen-specific CD8(+) T cells in the spleens of pCMVgag-pol-vaccinated mice compared with mice which received pCMVgag only. Most importantly, short term viral control of EcoHIV was similar for pCMVgag and pCMVgag-pol-vaccinated mice at day 10, but only the pCMVgag-vaccinated significantly controlled EcoHIV at day 60 compared with pCMV-vaccinated mice, showing that control was reduced with the inclusion of the HIV pol gene. Copyright © 2014 Elsevier B.V. All rights reserved.
National Research Council Canada - National Science Library
Mellquist-Riemenschneider, Jenny L; Garrison, Aura R; Geisbert, Joan B; Saikh, Kamal U; Heidebrink, Kelli D
2003-01-01
.... Previously, a priming dose of a DNA vaccine expressing the glycoprotein (GP) gene of MARV followed by boosting with recombinant baculovirus-derived GP protein was found to confer protective immunity to guinea pigs (Hevey et al., 2001...
Expanded breadth of the T-cell response to mosaic HIV-1 envelope DNA vaccination
Energy Technology Data Exchange (ETDEWEB)
Korber, Bette [Los Alamos National Laboratory; Fischer, William [Los Alamos National Laboratory; Wallstrom, Timothy [Los Alamos National Laboratory
2009-01-01
An effective AIDS vaccine must control highly diverse circulating strains of HIV-1. Among HIV -I gene products, the envelope (Env) protein contains variable as well as conserved regions. In this report, an informatic approach to the design of T-cell vaccines directed to HIV -I Env M group global sequences was tested. Synthetic Env antigens were designed to express mosaics that maximize the inclusion of common potential Tcell epitope (PTE) 9-mers and minimize the inclusion of rare epitopes likely to elicit strain-specific responses. DNA vaccines were evaluated using intracellular cytokine staining (ICS) in inbred mice with a standardized panel of highly conserved 15-mer PTE peptides. I, 2 and 3 mosaic sets were developed that increased theoretical epitope coverage. The breadth and magnitude ofT-cell immunity stimulated by these vaccines were compared to natural strain Env's; additional comparisons were performed on mutant Env's, including gpl60 or gpl45 with or without V regions and gp41 deletions. Among them, the 2 or 3 mosaic Env sets elicited the optimal CD4 and CD8 responses. These responses were most evident in CD8 T cells; the 3 mosaic set elicited responses to an average of 8 peptide pools compared to 2 pools for a set of3 natural Env's. Synthetic mosaic HIV -I antigens can therefore induce T-cell responses with expanded breadth and may facilitate the development of effective T -cell-based HIV -1 vaccines.
Griot-Wenk, M E; Cherpillod, P; Koch, A; Zurbriggen, R; Bruckner, L; Wittek, R; Zurbriggen, A
2001-06-01
This study compared the humoral immune response against the nucleocapsid-(N) protein of canine distemper virus (CDV) of dogs vaccinated with a multivalent vaccine against parvo-, adeno-, and parainfluenza virus and leptospira combined with either the attenuated CDV Onderstepoort strain (n = 15) or an expression plasmid containing the N-gene of CDV (n = 30). The vaccinations were applied intramuscularly three times at 2-week intervals beginning at the age of 6 weeks. None of the pre-immune sera recognized the recombinant N-protein, confirming the lack of maternal antibodies at this age. Immunization with DNA vaccine for CDV resulted in positive serum N-specific IgG response. However, their IgG (and IgA) titres were lower than those of CDV-vaccinated dogs. Likewise, DNA-vaccinated dogs did not show an IgM peak. There was no increase in N-specific serum IgE titres in either group. Serum titres to the other multivalent vaccine components were similar in both groups.
Treggiari, Elisabetta; Grant, Jessica Pauline; North, Susan Margaret
2016-06-01
A xenogeneic DNA vaccination has been licensed for use in dogs with locally controlled stage II and III oral malignant melanoma (OMM). At present, there are limited outcome data for dogs with OMM treated with surgery and immunotherapy. The aim of this study is to retrospectively review the outcome and survival of 32 dogs affected by OMM that were treated with a combination of surgery and the xenogeneic DNA vaccination (with the addition of radiotherapy in some cases) and to determine the influence of surgical margins and delay in receiving vaccination. The overall median survival time (MST) was 335 days (95% CI: 301-540 days), and the overall median progression-free survival (PFS) was 160 days (mean 182 days, 95% CI: 132-232 days). Stage, completeness of surgical margins and delay in administration of the vaccine did not appear to statistically influence survival or PFS, although these results may reflect the low statistical power of the study due to small numbers. Further studies are required to assess whether the addition of any adjuvant treatment to surgery, including immunotherapy, is able to significantly prolong survival in cases of canine oral melanoma.
Induction of Th1 type response by DNA vaccinations with N, M, and E genes against SARS-CoV in mice
International Nuclear Information System (INIS)
Jin Huali; Xiao Chong; Chen Ze; Kang Youmin; Ma Yijie; Zhu Kaichun; Xie Qifa; Tu Yixian; Yu Yang; Wang Bin
2005-01-01
Vaccination against the SARS-CoV infection is an attractive means to control the spread of viruses in public. In this study, we employed a DNA vaccine technology with the levamisole, our newly discovered chemical adjuvant, to generate Th1 type of response. To avoid the enhancement antibody issue, genes encoding the nucleocapsid, membrane, and envelope protein of SARS-CoV were cloned and their expressions in mammalian cells were determined. After the intramuscular introduction into animals, we observed that the constructs of the E, M, and N genes could induce high levels of specific antibodies, T cell proliferations, IFN-γ, DTH responses, and in vivo cytotoxic T cells activities specifically against SARS-CoV antigens. The highest immune responses were generated by the construct encoding the nucleocapsid protein. The results suggest that the N, M, and E genes could be used as the targets to prevent SARS-CoV infection in the DNA vaccine development
Directory of Open Access Journals (Sweden)
Y.X. Tu
2013-12-01
Full Text Available It has been shown that cytokines can act as molecular adjuvant to enhance the immune response induced by DNA vaccines, but it is unknown whether interleukin 33 (IL-33 can enhance the immunocontraceptive effect induced by DNA vaccines. In the present study, we explored the effects of murine IL-33 on infertility induced by Lagurus lagurus zona pellucida 3 (Lzp3 contraceptive DNA vaccine administered by the mucosal route. Plasmid pcD-Lzp3 and plasmid pcD-mIL-33 were encapsulated with chitosan to generate the nanoparticle chi-(pcD-Lzp3+pcD-mIL-33 as the DNA vaccine. Sixty female ICR mice, divided into 5 groups (n=12/group, were intranasally immunized on days 0, 14, 28, and 42. After intranasal immunization, the anti-LZP3-specific IgG in serum and IgA in vaginal secretions and feces were determined by ELISA. The results showed that chi-(pcD-Lzp3+pcD-mIL-33 co-immunization induced the highest levels of serum IgG, secreted mucosal IgA, and T cell proliferation. Importantly, mice co-immunized with chi-(pcD-Lzp3+pcD-mIL-33 had the lowest birth rate and mean litter size, which correlated with high levels of antibodies. Ovaries from infertile female mice co-immunized with chi-(pcD-Lzp3+pcD-mIL-33 showed abnormal development of ovarian follicles, indicated by atretic follicles and loss of oocytes. Our results demonstrated that intranasal delivery of the molecular adjuvant mIL-33 with chi-pcD-Lzp3 significantly increased infertility by enhancing both systemic and mucosal immune responses. Therefore, chi-(pcD-Lzp3+pcD-mIL-33 co-immunization could be a strategy for controlling the population of wild animal pests.
Directory of Open Access Journals (Sweden)
M.O. Diniz
2011-05-01
Full Text Available Anti-cancer DNA vaccines have attracted growing interest as a simple and non-invasive method for both the treatment and prevention of tumors induced by human papillomaviruses. Nonetheless, the low immunogenicity of parenterally administered vaccines, particularly regarding the activation of cytotoxic CD8+ T cell responses, suggests that further improvements in both vaccine composition and administration routes are still required. In the present study, we report the immune responses and anti-tumor effects of a DNA vaccine (pgD-E7E6E5 expressing three proteins (E7, E6, and E5 of the human papillomavirus type 16 genetically fused to the glycoprotein D of the human herpes simplex virus type 1, which was administered to mice by the intradermal (id route using a gene gun. A single id dose of pgD-E7E6E5 (2 µg/dose induced a strong activation of E7-specific interferon-γ (INF-γ-producing CD8+ T cells and full prophylactic anti-tumor effects in the vaccinated mice. Three vaccine doses inhibited tumor growth in 70% of the mice with established tumors. In addition, a single vaccine dose consisting of the co-administration of pgD-E7E6E5 and the vector encoding interleukin-12 or granulocyte-macrophage colony-stimulating factor further enhanced the therapeutic anti-tumor effects and conferred protection to 60 and 50% of the vaccinated mice, respectively. In conclusion, id administration of pgD-E7E6E5 significantly enhanced the immunogenicity and anti-tumor effects of the DNA vaccine, representing a promising administration route for future clinical trials.
Hsieh, Ming Kun; Wu, Ching Ching; Lin, Tsang Long
2006-11-17
The purpose of the present study was to determine whether DNA vaccination by co-administration of DNA coding for chicken interferon-gamma (IFN-gamma) gene and DNA encoding for the VP243 gene of IBDV could enhance immune response and protection efficacy of chickens against challenge by IBDV. Plasmids carrying VP243 gene of IBDV strain variant E (VE) (P/VP243/E) and chicken IFN-gamma gene (P/cIFN-gamma) were constructed, respectively. One-day-old chickens were intramuscularly injected with P/VP243/E, or P/cIFN-gamma, or both once, twice, or three times into the thigh muscle of one leg or the thigh muscles of two separate legs at weekly intervals. Chickens were orally challenged with IBDV strain VE at 3 weeks of age and observed for 10 days. Chickens receiving two plasmids in the same site two times had significantly higher (Pprotection and those receiving two plasmids in the same sites did not have any protection against IBD. The enzyme-linked immunosorbent assay (ELISA) and virus neutralization (VN) titers to IBDV of chickens in the groups with three doses of P/VP243/E were significantly higher (Pprotected by DNA vaccination did not have detectable IBDV antigen in the bursae as determined by immunofluorescent antibody assay (IFA). The results indicated that co-administration of plasmid encoding chicken IFN-gamma gene with plasmid encoding a large segment gene of the IBDV did not enhance immune response and protection against challenge by IBDV.
The impact of new technologies on vaccines.
Talwar, G P; Diwan, M; Razvi, F; Malhotra, R
1999-01-01
Vast changes are taking place in vaccinology consequent to the introduction of new technologies. Amongst the vaccines included in the Expanded Programme of Immunization (EPI), the pertussis vaccine has been replaced by acellular purified fractions devoid of side-effects. Non-pathogenic but immunogenic mutants of tetanus and diptheria toxins are likely to replace the toxoids. An effective vaccine against hepatitis B prepared by recombinant technology is in large-scale use. Conjugated vaccines against Haemophilus influenzae b, S. pneumococcus and meningococcus are now available, as also vaccines against mumps, rubella and measles. Combination vaccines have been devised to limit the number of injections. Vaccine delivery systems have been developed to deliver multiple doses of the vaccine at a single contact point. A genetically-engineered oral vaccine for typhoid imparts better and longer duration of immunity. Oral vaccines for cholera and other enteric infections are under clinical trials. The nose as a route for immunization is showing promise for mucosal immunity and for anti-inflammatory experimental vaccines against multiple sclerosis and insulin-dependent diabetes mellitus. The range of vaccines has expanded to include pathogens resident in the body such as Helicobacter pylori (duodenal ulcer), S. mutans (dental caries), and human papilloma virus (carcinoma of the cervix). An important progress is the recognition that DNA alone can constitute the vaccines, inducing both humoral and cell-mediated immune responses. A large number of DNA vaccines have been made and shown interesting results in experimental animals. Live recombinant vaccines against rabies and rinderpest have proven to be highly effective for controlling these infections in the field, and those for AIDS are under clinical trial. Potent adjuvants have added to the efficacy of the vaccines. New technologies have emerged to 'humanize' mouse monoclonals by genetic engineering and express these
Directory of Open Access Journals (Sweden)
Wen-Chi Wei
2014-01-01
Full Text Available Adjuvants can be used to enhance the immunogenicity of antigens and improve the efficacy of vaccines. Potent adjuvant action is known to often correlate with the activation of the transcription factor, nuclear factor-κB (NF-κB. Specific plant polysaccharides and a variety of phytochemicals from foods and traditional medicinal herbs have been shown to modulate NF-κB activation. In the present study, selected plant polysaccharides and phytochemicals were evaluated for use as a DNA vaccine adjuvant in a murine melanoma model. We observed that a specific ethanol extract fraction (DsCE-I from the tuber of a key Traditional Chinese Medicine plant, Dioscorea (山藥 Shān Yào, enhanced the protection against melanoma after immunization with a gene-based vaccine. A number of anti-inflammatory phytochemicals tested were able to partially diminish the inflammation-associated tumorigenesis elicited by LPS. Among the several phytochemical combinations investigated, the use of an adjuvant containing LPS in combination with emodin resulted in smaller tumors and higher survival rate in test mice than the use of other adjuvant treatments and the control sets in this DNA cancer vaccine model. A Dioscorea polysaccharide fraction (DsCE-I and several specific phytochemicals warrant further exploration as useful adjuvants for anticancer vaccines.
Trimble, Cornelia L.; Peng, Shiwen; Kos, Ferdynand; Gravitt, Patti; Viscidi, Raphael; Sugar, Elizabeth; Pardoll, Drew; Wu, TC
2010-01-01
Purpose: To evaluate the safety and immunogenicity of a therapeutic HPV16 DNA vaccine administered to women with HPV16+CIN2/3. Experimental Design: This phase I trial incorporated the standard ‘3+3” dose escalation design with an additional 6 patients allocated to the maximally tolerated dose (MTD). Healthy adult women with colposcopically-directed biopsy-proven HPV16+ CIN2/3 received three intramuscular (IM) vaccinations (0.5 mg, 1 mg, or 3mg) of a plasmid expressing a Sig-E7(detox)-HSP70 fusion protein on days 0, 28 and 56, and underwent standard therapeutic resection of the cervical squamocolumnar junction at day 105 (week 15). Safety and immunogenicity of the vaccine and histologic outcome based on resection at week 15 were assessed. Results: Fifteen patients were evaluable (3 each at 0.5 mg and 1mg, 9 at 3mg). The vaccine was well tolerated: most adverse events were mild transient injection-site discomfort; no dose-limiting toxicities were observed. Although HPVE7-specific T-cell responses to E7 detected by enzyme-linked immunospot assays (IFNγ) were of low frequency and magnitude, detectable increases in response subsequent to vaccination were identified in subjects in the second and third cohorts. Complete histologic regression occurred in 3/9 (33%, CI: 7%-70%)) individuals in the highest dose cohort, Although the difference is not significant, it is slightly higher than would be expected in an unvaccinated cohort (25%). Conclusions: This HPV16 DNA vaccine was safe and well tolerated. While it appears possible to elicit HPV-specific T cell responses in patients with established dysplastic lesions, other factors are likely to play a role in lesion regression. PMID:19118066
Cherpillod, P; Tipold, A; Griot-Wenk, M; Cardozo, C; Schmid, I; Fatzer, R; Schobesberger, M; Zurbriggen, R; Bruckner, L; Roch, F; Vandevelde, M; Wittek, R; Zurbriggen, A
2000-07-01
Canine distemper virus (CDV), a member of the genus Morbillivirus induces a highly infectious, frequently lethal disease in dogs and other carnivores. Current vaccines against canine distemper consisting of attenuated viruses have been in use for many years and have greatly reduced the incidence of distemper in the dog population. However, certain strains may not guarantee adequate protection and others can induce post vaccinal encephalitis. We tested a DNA vaccine for its ability to protect dogs, the natural host of CDV, against distemper. We constructed plasmids containing the nucleocapsid, the fusion, and the attachment protein genes of a virulent canine distemper virus strain. Mice inoculated with these plasmids developed humoral and cellular immune responses against CDV antigens. Dogs immunized with the expression plasmids developed virus-neutralizing antibodies. Significantly, vaccinated dogs were protected against challenge with virulent CDV, whereas unvaccinated animals succumbed to distemper.
Advances in the development of vaccines for dengue fever
Directory of Open Access Journals (Sweden)
Simmons M
2012-05-01
Full Text Available Monika Simmons1, Nimfa Teneza-Mora1, Robert Putnak21Viral and Rickettsial Diseases Department, Naval Medical Research Center, 2Division of Viral Diseases, Walter Reed Army Institute of Research, Silver Spring, MD, USAAbstract: Dengue fever is caused by the mosquito-borne dengue virus (DENV serotypes 1–4, and is the most common arboviral infection of humans in subtropical and tropical regions of the world. There are currently no prophylaxis or treatment options in the form of vaccines or antivirals, leaving vector control the only method of prevention. A particular challenge with DENV is that a successful vaccine has to be effective against all four serotypes without predisposing for antibody-mediated enhanced disease. In this review, we discuss the current lead vaccine candidates in clinical trials, as well as some second-generation vaccine candidates undergoing preclinical evaluation. In addition, we discuss DENV epidemiology, clinical disease and strategies used for Flavivirus antivirals in the past, the development of new DENV therapeutics, and their potential usefulness for prophylaxis and treatment.Keywords: tetravalent dengue vaccine, live attenuated vaccine, purified inactivated vaccine, DNA vaccine, antibody-dependent enhancement, antivirals
Penaranda, M.M.D.; LaPatra, S.E.; Kurath, G.
2011-01-01
Infectious hematopoietic necrosis virus (IHNV) is a fish rhabdovirus that causes significant mortality in salmonid species. In North America IHNV has three major genogroups designated U, M, and L. Host-specificity of the M and U genogroups of IHNV has been established both in the field and in experimental challenges, with M isolates being more prevalent and more virulent in rainbow trout (Oncorhynchus mykiss), and U isolates being more prevalent and highly virulent in sockeye salmon (Oncorhynchus nerka). In this study, efficacy of DNA vaccines containing either M (pM) or U (pU) virus glycoprotein genes was investigated during intra- and cross-genogroup challenges in rainbow trout. In virus challenges at 7 days post-vaccination (early antiviral response), both pM and pU were highly protective against either M or U IHNV. In challenges at 28 days post-vaccination (specific antiviral response), both pM and pU were protective against M IHNV but the homologous pM vaccine was significantly more protective than pU in one of two experiments. At this stage both pM and pU induced comparably high protection against U IHNV challenge. Correlates of protection were also investigated by assessing the expression of the interferon-stimulated gene Mx-1 and the production of neutralizing antibodies (NAbs) following pM or pU DNA vaccination. Mx-1 gene expression, measured at 4 and 7 days post-vaccination as an indicator of the host innate immune response, was found to be significantly higher after pM than pU vaccination in some cases. Neutralizing antibody was produced in response to the two vaccines, but antibody titers did not show consistent correlation with protection. The results show that the rainbow trout innate and adaptive immune responses have some ability to distinguish between the U and M genogroup IHNV, but overall the pM and pU vaccines were protective against both homologous and cross-genogroup challenges.
Joseph, S K; Ramaswamy, K
2013-07-18
The multivalent vaccine BmHAT, consisting of the Brugia malayi infective larval (L3) antigens heat shock protein12.6 (HSP12.6), abundant larval transcript-2 (ALT-2) and tetraspanin large extra cellular loop (TSP-LEL), was shown to be protective in rodent models from our laboratory. We hypothesize that since these antigens were identified using protective antibodies from immune endemic normal individuals, the multivalent vaccine can be augmented by natural L3 infections providing protection to the vaccinated host. This hypothesis was tested using single dose of DNA and protein or protein alone of the BmHAT vaccination in gerbils followed by live trickle L3 infection as booster dose. Vaccine-induced protection in gerbils was determined by worm establishment, micropore chamber assay and by antibody dependant cell cytotoxicity (ADCC) assay. Results were compared with the traditional prime-boost vaccination regimen. Gerbils vaccinated with BmHAT and boosted with L3 trickle infection were protected 51% (BmHAT DNA-protein) and 48% (BmHAT protein) respectively. BmHAT vaccination plus L3 trickle booster generated significant titer of antigen-specific IgG antibodies comparable to the traditional prime boost vaccination approach. BmHAT vaccination plus L3 trickle booster also generated antigen-specific cells in the spleen of vaccinated animals and these cells secreted predominantly IFN-γ and IL-4 in response to the vaccine antigens. These studies thus show that single dose of BmHAT multivalent vaccination followed by L3 trickle booster infection can confer significant protection against lymphatic filariasis. Copyright © 2013 Elsevier Ltd. All rights reserved.
Joseph, SK; Ramaswamy, K
2013-01-01
The multivalent vaccine BmHAT, consisting of the Brugia malayi infective larval (L3) antigens heat shock protein12.6 (HSP12.6), abundant larval transcript-2 (ALT-2) and tetraspanin large extra cellular loop (TSP-LEL), was shown to be protective in rodent models from our laboratory. We hypothesize that since these antigens were identified using protective antibodies from immune endemic normal individuals, the multivalent vaccine can be augmented by natural L3 infections providing protection to the vaccinated host. This hypothesis was tested using single dose of DNA and Protein or Protein alone of the BmHAT vaccination in gerbils followed by live trickle L3 infection as booster dose. Vaccine-induced protection in gerbils was determined by worm establishment, micropore chamber assay and by antibody dependant cell cytotoxicity (ADCC) assay. Results were compared with the traditional prime-boost vaccination regimen. Gerbils vaccinated with BmHAT and boosted with L3 trickle infection were protected 51% (BmHAT DNA-Protein) and 48% (BmHAT Protein) respectively. BmHAT vaccination plus L3 trickle booster generated significant titer of antigen-specific IgG antibodies comparable to the traditional prime boost vaccination approach. BmHAT vaccination plus L3 trickle booster also generated antigen-specific cells in the spleen of vaccinated animals and these cells secreted predominantly IFN-γ and IL-4 in response to the vaccine antigens. These studies thus show that single dose of BmHAT multivalent vaccination followed by L3 trickle booster infection can confer significant protection against lymphatic filariasis. PMID:23735679
Technical Transformation of Biodefense Vaccines
Lu, Shan; Wang, Shixia
2013-01-01
Biodefense vaccines are developed against a diverse group of pathogens. Vaccines were developed for some of these pathogens a long time ago but they are facing new challenges to move beyond the old manufacturing technologies. New vaccines to be developed against other pathogens have to determine whether to follow traditional vaccination strategies or to seek new approaches. Advances in basic immunology and recombinant DNA technology have fundamentally transformed the process of formulating a vaccine concept, optimizing protective antigens, and selecting the most effective vaccine delivery approach for candidate biodefense vaccines. PMID:19837293
International Nuclear Information System (INIS)
Deryabin, O.; Deryabina, O.; Verbitskiy, P.; Kordyum, V.
2005-01-01
Three forms of E2 recombinant protein were expressed in E. coli. Swine sera obtained against different forms of the recombinant protein were cross-studied with indirect ELISA. Using individual proteins as an antigen, only 15% of sera against other forms of protein reacted positively, while 100% of heterologous sera showed positive reaction with fused protein. Challenge experiments showed the existence of protective action only from the individual protein. Specificity and activity of sera obtained from the animals after control challenge was confirmed in a blocking variant of ELISA. Genetic construction used a eukaryotic vector that contained the E2 protein gene. Immunization of mice with the resulting DNA induced synthesis of specific antibodies, the titre of which increased considerably after additional single immunization with the E2 recombinant protein, expressed in E. coli. This demonstrated the effectiveness of animal priming by DNA vaccine, and the possibility of using the E2 recombinant protein in E. coli for booster vaccination. (author)
Golshani, Maryam; Rafati, Sima; Nejati-Moheimani, Mehdi; Ghasemian, Melina; Bouzari, Saeid
2016-12-25
In the present study, immunogenicity and protective efficacy of the Brucella outer membrane protein 2b (Omp2b) was evaluated in BALB/c mice using Protein/Protein, DNA/DNA and DNA/Protein vaccine strategies. Immunization of mice with three vaccine regimens elicited a strong specific IgG response (higher IgG2a titers over IgG1 titers) and provided Th1-oriented immune response. Vaccination of BALB/c mice with the DNA/Pro regimen induced higher levels of IFN-γ/IL-2 and conferred more protection levels against B. melitenisis and B. abortus challenge than did the protein or DNA alone. In conclusion, Omp2b is able to stimulate specific immune responses and to confer cross protection against B. melitensis and B. abortus infection. Therefore, it could be introduced as a new potential candidate for the development of a subunit vaccine against Brucella infection. Copyright © 2016 Elsevier B.V. All rights reserved.
Scorza, T; Grubb, K; Cambos, M; Santamaria, C; Tshikudi Malu, D; Spithill, T W
2008-06-01
A current goal of malaria vaccine research is the development of vaccines that will cross-protect against multiple strains of malaria. In the present study, the breadth of cross-reactivity induced by a 30K multivalent DNA vaccine has been evaluated in susceptible A/J mice (H-2a) against infection with the Plasmodium chabaudi adami DK strain and a virulent parasite subspecies, Plasmodium chabaudi chabaudi AS. Immunized A/J mice were significantly protected against infection with both P. c. adami DK (31-40% reduction in cumulative parasitemia) and P. c. chabaudi AS parasites, where a 30-39% reduction in cumulative parasitemia as well as enhanced survival was observed. The 30K vaccine-induced specific IFN-gamma production by splenocytes in response to native antigens from both P. c. chabaudi AS and P. c. adami DK. Specific antibodies reacting with surface antigens expressed on P. c. adami DS and P. c. chabaudi AS infected red blood cells, and with opsonizing properties, were detected. These results suggest that multivalent vaccines encoding conserved antigens can feasibly induce immune cross-reactivity that span Plasmodium strains and subspecies and can protect hosts of distinct major histocompatibility complex haplotypes.
Song, Neng; Tan, Yang; Zhang, Lingyun; Luo, Wei; Guan, Qing; Yan, Ming-Zhe; Zuo, Ruiqi; Liu, Weixiang; Luo, Feng-Ling; Zhang, Xiao-Lian
2018-04-24
Mycobacterium tuberculosis (M. tb) is emerging as a more serious pathogen due to the increased multidrug-resistant TB and co-infection of human immunodeficiency virus (HIV). The development of an effective and sensitive detection method is urgently needed for bacterial load evaluation in vaccine development, early TB diagnosis, and TB treatment. Droplet digital polymerase chain reaction (ddPCR) is a newly developed sensitive PCR method for the absolute quantification of nucleic acid concentrations. Here, we used ddPCR to quantify the circulating virulent M. tb-specific CFP10 (10-kDa culture filtrate protein, Rv3874) and Rv1768 DNA copy numbers in the blood samples from Bacille Calmette-Guerin (BCG)-vaccinated and/or virulent M. tb H37Rv-challenged rhesus monkeys. We found that ddPCR was more sensitive compared to real-time fluorescence quantitative PCR (qPCR), as the detection limits of CFP10 were 1.2 copies/μl for ddPCR, but 15.8 copies/μl for qPCR. We demonstrated that ddPCR could detect CFP10 and Rv1768 DNA after 3 weeks of infection and at least two weeks earlier than qPCR in M.tb H37Rv-challenged rhesus monkey models. DdPCR could also successfully quantify CFP10 and Rv1768 DNA copy numbers in clinical TB patients' blood samples (active pulmonary TB, extrapulmonary TB (EPTB), and infant TB). To our knowledge, this study is the first to demonstrate that ddPCR is an effective and sensitive method of measuring the circulating CFP10 and Rv1768 DNA for vaccine development, bacterial load evaluation in vivo, and early TB (including EPTB and infant TB) diagnosis as well.
Ethical and policy issues in using vaccines to treat and prevent cocaine and nicotine dependence.
Hall, Wayne; Gartner, Coral
2011-05-01
To describe the rationale of vaccines against cocaine and nicotine, to review progress in developing and trialing vaccines to treat dependence on these drugs and to discuss some of the ethical issues that may arise from their use in legally coerced addiction treatment or for prevention of addiction in adolescents. Several randomized controlled trials of cocaine and nicotine vaccines for relapse prevention have produced mixed results. The studies demonstrate that it is possible to raise antibodies to cocaine and nicotine in humans. In abstinent patients who show high levels of drug antibodies, the rewarding effects of these drugs are attenuated. Phase 2 trials have not found nicotine vaccines to be superior to placebo because only a third of those vaccinated develop sufficient levels of antibody to block the effects of nicotine. Vaccines are a novel approach to relapse prevention that need to more reliably induce immunity in a larger proportion of vaccinated patients if they are to protect against relapse after achieving abstinence. Vaccines are unlikely to prevent addiction in adolescents. Their use under legal coercion should only be considered after considerable experience with their use in voluntary patients.
SIRT6 stabilizes DNA-dependent protein kinase at chromatin for DNA double-strand break repair
DEFF Research Database (Denmark)
McCord, Ronald A; Michishita, Eriko; Hong, Tao
2009-01-01
-PKcs) to chromatin in response to DNA damage and stabilizes DNA-PKcs at chromatin adjacent to an induced site-specific DSB. Abrogation of these SIRT6 activities leads to impaired resolution of DSBs. Together, these findings elucidate a mechanism whereby regulation of dynamic interaction of a DNA repair factor......-dependent protein kinase) and promotes DNA DSB repair. In response to DSBs, SIRT6 associates dynamically with chromatin and is necessary for an acute decrease in global cellular acetylation levels on histone H3 Lysine 9. Moreover, SIRT6 is required for mobilization of the DNA-PK catalytic subunit (DNA......, and SIRT6 knockout cells exhibit genomic instability and DNA damage hypersensitivity. However, the molecular mechanisms underlying these defects are not fully understood. Here, we show that SIRT6 forms a macromolecular complex with the DNA double-strand break (DSB) repair factor DNA-PK (DNA...
Directory of Open Access Journals (Sweden)
Pamela Mancha-Agresti
2017-07-01
Full Text Available Tuberculosis (TB remains a major threat throughout the world and in 2015 it caused the death of 1.4 million people. The Bacillus Calmette-Guérin is the only existing vaccine against this ancient disease; however, it does not provide complete protection in adults. New vaccines against TB are eminently a global priority. The use of bacteria as vehicles for delivery of vaccine plasmids is a promising vaccination strategy. In this study, we evaluated the use of, an engineered invasive Lactococcus lactis (expressing Fibronectin-Binding Protein A from Staphylococcus aureus for the delivery of DNA plasmid to host cells, especially to the mucosal site as a new DNA vaccine against tuberculosis. One of the major antigens documented that offers protective responses against Mycobacterium tuberculosis is the Ag85A. L. lactis FnBPA+ (pValac:Ag85A which was obtained and used for intranasal immunization of C57BL/6 mice and the immune response profile was evaluated. In this study we observed that this strain was able to produce significant increases in the amount of pro-inflammatory cytokines (IFN-γ, TNF-α, and IL-6 in the stimulated spleen cell supernatants, showing a systemic T helper 1 (Th1 cell response. Antibody production (IgG and sIgA anti-Ag85A was also significantly increased in bronchoalveolar lavage, as well as in the serum of mice. In summary, these findings open new perspectives in the area of mucosal DNA vaccine, against specific pathogens using a Lactic Acid Bacteria such as L. lactis.
Quantitative real-time PCR study on persistence of pDNA vaccine pVax-Hsp60 TM814 in beef muscles
Czech Academy of Sciences Publication Activity Database
Orság, P.; Kvardová, V.; Raška, M.; Miller, A. D.; Ledvina, Miroslav; Turánek, J.
2008-01-01
Roč. 6, č. 11 (2008), s. 1-11 ISSN 1479-0556 R&D Projects: GA MZe QF3115 Institutional research plan: CEZ:AV0Z40550506 Keywords : DNA vaccine * real-time PCR * liposomes Subject RIV: CC - Organic Chemistry
Directory of Open Access Journals (Sweden)
Rafael Dhalia
2009-12-01
Full Text Available Vaccination is the most practical and cost-effective strategy to prevent the majority of the flavivirus infection to which there is an available vaccine. However, vaccines based on attenuated virus can potentially promote collateral side effects and even rare fatal reactions. Given this scenario, the developent of alternative vaccination strategies such as DNA-based vaccines encoding specific flavivirus sequences are being considered. Endogenous cytoplasmic antigens, characteristically plasmid DNA-vaccine encoded, are mainly presented to the immune system through Major Histocompatibility Complex class I - MHC I molecules. The MHC I presentation via is mostly associated with a cellular cytotoxic response and often do not elicit a satisfactory humoral response. One of the main strategies to target DNA-encoded antigens to the MHC II compartment is expressing the antigen within the Lysosome-Associated Membrane Protein (LAMP. The flavivirus envelope protein is recognized as the major virus surface protein and the main target for neutralizing antibodies. Different groups have demonstrated that co-expression of flavivirus membrane and envelope proteins in mammalian cells, fused with the carboxyl-terminal of LAMP, is able to induce satisfactory levels of neutralizing antibodies. Here we reviewed the use of the envelope flavivirus protein co-expression strategy as LAMP chimeras with the aim of developing DNA vaccines for dengue, West Nile and yellow fever viruses.A vacinação é a estratégia mais prática e o melhor custo-benefício para prevenir a maioria das infecções dos flavivirus, para os quais existe vacina disponível. Entretanto, as vacinas baseadas em vírus atenuados podem potencialmente promover efeitos colaterais e, mais raramente, reações fatais. Diante deste cenário, o desenvolvimento de estratégias alternativas de vacinação, como vacinas baseadas em DNA codificando seqüências específicas dos flavivirus, está sendo considerado
Underwound DNA under Tension: Structure, Elasticity, and Sequence-Dependent Behaviors
Sheinin, Maxim Y.; Forth, Scott; Marko, John F.; Wang, Michelle D.
2011-09-01
DNA melting under torsion plays an important role in a wide variety of cellular processes. In the present Letter, we have investigated DNA melting at the single-molecule level using an angular optical trap. By directly measuring force, extension, torque, and angle of DNA, we determined the structural and elastic parameters of torsionally melted DNA. Our data reveal that under moderate forces, the melted DNA assumes a left-handed structure as opposed to an open bubble conformation and is highly torsionally compliant. We have also discovered that at low forces melted DNA properties are highly dependent on DNA sequence. These results provide a more comprehensive picture of the global DNA force-torque phase diagram.
Palma, Paolo; Romiti, Maria Luisa; Montesano, Carla; Santilli, Veronica; Mora, Nadia; Aquilani, Angela; Dispinseri, Stefania; Tchidjou, Hyppolite K; Montano, Marco; Eriksson, Lars E; Baldassari, Stefania; Bernardi, Stefania; Scarlatti, Gabriella; Wahren, Britta; Rossi, Paolo
2013-01-01
Twenty vertically HIV-infected children, 6-16 years of age, with stable viral load control and CD4+ values above 400 cells/mm(3). Ten subjects continued their ongoing antiretroviral treatment (ART, Group A) and 10 were immunized with a HIV-DNA vaccine in addition to their previous therapy (ART and vaccine, Group B). The genetic vaccine represented HIV-1 subtypes A, B and C, encoded Env, Rev, Gag and RT and had no additional adjuvant. Immunizations took place at weeks 0, 4 and 12, with a boosting dose at week 36. Monitoring was performed until week 60 and extended to week 96. Safety data showed good tolerance of the vaccine. Adherence to ART remained high and persistent during the study and did not differ significantly between controls and vaccinees. Neither group experienced either virological failure or a decline of CD4+ counts from baseline. Higher HIV-specific cellular immune responses were noted transiently to Gag but not to other components of the vaccine. Lymphoproliferative responses to a virion antigen HIV-1 MN were higher in the vaccinees than in the controls (p = 0.047), whereas differences in reactivity to clade-specific Gag p24, RT or Env did not reach significance. Compared to baseline, the percentage of HIV-specific CD8+ lymphocytes releasing perforin in the Group B was higher after the vaccination schedule had been completed (p = 0.031). No increased CD8+ perforin levels were observed in control Group A. The present study demonstrates the feasibility, safety and moderate immunogenicity of genetic vaccination in vertically HIV-infected children, paving the way for amplified immunotherapeutic approaches in the pediatric population. clinicaltrialsregister.eu _2007-002359-18IT.
Directory of Open Access Journals (Sweden)
Paolo Palma
Full Text Available SUBJECTS: Twenty vertically HIV-infected children, 6-16 years of age, with stable viral load control and CD4+ values above 400 cells/mm(3. INTERVENTION: Ten subjects continued their ongoing antiretroviral treatment (ART, Group A and 10 were immunized with a HIV-DNA vaccine in addition to their previous therapy (ART and vaccine, Group B. The genetic vaccine represented HIV-1 subtypes A, B and C, encoded Env, Rev, Gag and RT and had no additional adjuvant. Immunizations took place at weeks 0, 4 and 12, with a boosting dose at week 36. Monitoring was performed until week 60 and extended to week 96. RESULTS: Safety data showed good tolerance of the vaccine. Adherence to ART remained high and persistent during the study and did not differ significantly between controls and vaccinees. Neither group experienced either virological failure or a decline of CD4+ counts from baseline. Higher HIV-specific cellular immune responses were noted transiently to Gag but not to other components of the vaccine. Lymphoproliferative responses to a virion antigen HIV-1 MN were higher in the vaccinees than in the controls (p = 0.047, whereas differences in reactivity to clade-specific Gag p24, RT or Env did not reach significance. Compared to baseline, the percentage of HIV-specific CD8+ lymphocytes releasing perforin in the Group B was higher after the vaccination schedule had been completed (p = 0.031. No increased CD8+ perforin levels were observed in control Group A. CONCLUSIONS: The present study demonstrates the feasibility, safety and moderate immunogenicity of genetic vaccination in vertically HIV-infected children, paving the way for amplified immunotherapeutic approaches in the pediatric population. TRIAL REGISTRATION: clinicaltrialsregister.eu _2007-002359-18IT.
Choi, Yoon Hong; Chapman, Ruth; Gay, Nigel; Jit, Mark
2012-05-14
Estimates of human papillomavirus (HPV) vaccine impact in clinical trials and modelling studies rely on DNA tests of cytology or biopsy specimens to determine the HPV type responsible for a cervical lesion. DNA of several oncogenic HPV types may be detectable in a specimen. However, only one type may be responsible for a particular cervical lesion. Misattribution of the causal HPV type for a particular abnormality may give rise to an apparent increase in disease due to non-vaccine HPV types following vaccination ("unmasking"). To investigate the existence and magnitude of unmasking, we analysed data from residual cytology and biopsy specimens in English women aged 20-64 years old using a stochastic type-specific individual-based model of HPV infection, progression and disease. The model parameters were calibrated to data on the prevalence of HPV DNA and cytological lesion of different grades, and used to assign causal HPV types to cervical lesions. The difference between the prevalence of all disease due to non-vaccine HPV types, and disease due to non-vaccine HPV types in the absence of vaccine HPV types, was then estimated. There could be an apparent maximum increase of 3-10% in long-term cervical cancer incidence due to non-vaccine HPV types following vaccination. Unmasking may be an important phenomenon in HPV post-vaccination epidemiology, in the same way that has been observed following pneumococcal conjugate vaccination. Copyright © 2012 Elsevier Ltd. All rights reserved.
A sequence-dependent rigid-base model of DNA
Gonzalez, O.; Petkevičiutė, D.; Maddocks, J. H.
2013-02-01
A novel hierarchy of coarse-grain, sequence-dependent, rigid-base models of B-form DNA in solution is introduced. The hierarchy depends on both the assumed range of energetic couplings, and the extent of sequence dependence of the model parameters. A significant feature of the models is that they exhibit the phenomenon of frustration: each base cannot simultaneously minimize the energy of all of its interactions. As a consequence, an arbitrary DNA oligomer has an intrinsic or pre-existing stress, with the level of this frustration dependent on the particular sequence of the oligomer. Attention is focussed on the particular model in the hierarchy that has nearest-neighbor interactions and dimer sequence dependence of the model parameters. For a Gaussian version of this model, a complete coarse-grain parameter set is estimated. The parameterized model allows, for an oligomer of arbitrary length and sequence, a simple and explicit construction of an approximation to the configuration-space equilibrium probability density function for the oligomer in solution. The training set leading to the coarse-grain parameter set is itself extracted from a recent and extensive database of a large number of independent, atomic-resolution molecular dynamics (MD) simulations of short DNA oligomers immersed in explicit solvent. The Kullback-Leibler divergence between probability density functions is used to make several quantitative assessments of our nearest-neighbor, dimer-dependent model, which is compared against others in the hierarchy to assess various assumptions pertaining both to the locality of the energetic couplings and to the level of sequence dependence of its parameters. It is also compared directly against all-atom MD simulation to assess its predictive capabilities. The results show that the nearest-neighbor, dimer-dependent model can successfully resolve sequence effects both within and between oligomers. For example, due to the presence of frustration, the model can
A sequence-dependent rigid-base model of DNA.
Gonzalez, O; Petkevičiūtė, D; Maddocks, J H
2013-02-07
A novel hierarchy of coarse-grain, sequence-dependent, rigid-base models of B-form DNA in solution is introduced. The hierarchy depends on both the assumed range of energetic couplings, and the extent of sequence dependence of the model parameters. A significant feature of the models is that they exhibit the phenomenon of frustration: each base cannot simultaneously minimize the energy of all of its interactions. As a consequence, an arbitrary DNA oligomer has an intrinsic or pre-existing stress, with the level of this frustration dependent on the particular sequence of the oligomer. Attention is focussed on the particular model in the hierarchy that has nearest-neighbor interactions and dimer sequence dependence of the model parameters. For a Gaussian version of this model, a complete coarse-grain parameter set is estimated. The parameterized model allows, for an oligomer of arbitrary length and sequence, a simple and explicit construction of an approximation to the configuration-space equilibrium probability density function for the oligomer in solution. The training set leading to the coarse-grain parameter set is itself extracted from a recent and extensive database of a large number of independent, atomic-resolution molecular dynamics (MD) simulations of short DNA oligomers immersed in explicit solvent. The Kullback-Leibler divergence between probability density functions is used to make several quantitative assessments of our nearest-neighbor, dimer-dependent model, which is compared against others in the hierarchy to assess various assumptions pertaining both to the locality of the energetic couplings and to the level of sequence dependence of its parameters. It is also compared directly against all-atom MD simulation to assess its predictive capabilities. The results show that the nearest-neighbor, dimer-dependent model can successfully resolve sequence effects both within and between oligomers. For example, due to the presence of frustration, the model can
Maspi, N; Ghaffarifar, F; Sharifi, Z; Dalimi, A; Khademi, S Z
2017-12-01
Vaccination would be the most important strategy for the prevention and elimination of leishmaniasis. The aim of the present study was to compare the immune responses induced following DNA vaccination with LACK (Leishmania analogue of the receptor kinase C), TSA (Thiol-specific-antioxidant) genes alone or LACK-TSA fusion against cutaneous leishmaniasis (CL). Cellular and humoral immune responses were evaluated before and after challenge with Leishmania major (L. major). In addition, the mean lesion size was also measured from 3th week post-infection. All immunized mice showed a partial immunity characterized by higher interferon (IFN)-γ and Immunoglobulin G (IgG2a) levels compared to control groups (pTSA fusion. Mean lesion sizes reduced significantly in all immunized mice compared with control groups at 7th week post-infection (pTSA and TSA groups than LACK group after challenge (pTSA antigens against CL. Furthermore, this study demonstrated that a bivalent vaccine can induce stronger immune responses and protection against infectious challenge with L. major.
Stability analysis of a general age-dependent vaccination model of a vertically transmitted disease
International Nuclear Information System (INIS)
El Doma, M.
1995-07-01
An SIR epidemic model of a general age-dependent vaccination of a vertically as well as horizontally transmitted disease is investigated when the population is in steady state and the fertility, mortality and removal rates depends on age. We determine the steady states and examine their stabilities. (author). 24 refs
Emerging Cancer Vaccines: The Promise of Genetic Vectors
International Nuclear Information System (INIS)
Aurisicchio, Luigi; Ciliberto, Gennaro
2011-01-01
Therapeutic vaccination against cancer is an important approach which, when combined with other therapies, can improve long-term control of cancer. In fact, the induction of adaptive immune responses against Tumor Associated Antigens (TAAs) as well as innate immunity are important factors for tumor stabilization/eradication. A variety of immunization technologies have been explored in last decades and are currently under active evaluation, such as cell-based, protein, peptide and heat-shock protein-based cancer vaccines. Genetic vaccines are emerging as promising methodologies to elicit immune responses against a wide variety of antigens, including TAAs. Amongst these, Adenovirus (Ad)-based vectors show excellent immunogenicity profile and have achieved immunological proof of concept in humans. In vivo electroporation of plasmid DNA (DNA-EP) is also a desirable vaccine technology for cancer vaccines, as it is repeatable several times, a parameter required for the long-term maintenance of anti-tumor immunity. Recent findings show that combinations of different modalities of immunization (heterologous prime/boost) are able to induce superior immune reactions as compared to single-modality vaccines. In this review, we will discuss the challenges and requirements of emerging cancer vaccines, particularly focusing on the genetic cancer vaccines currently under active development and the promise shown by Ad and DNA-EP heterologous prime-boost
Conformation-dependent DNA attraction
Li, Weifeng; Nordenskiöld, Lars; Zhou, Ruhong; Mu, Yuguang
2014-05-01
Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by molecular dynamics simulations. Using umbrella sampling, we find that for both B- and Z-form DNA, surrounding Mg2+ ions always exert themselves to screen the Coulomb repulsion between DNA phosphates, resulting in very weak attractive force. On the contrary, a tight and stable bound state is discovered for Z-DNA in the presence of Mg2+ or Na+, benefiting from their hydrophobic nature. Based on the contact surface and a dewetting process analysis, a two-stage binding process of Z-DNA is outlined: two Z-DNA first attract each other through charge screening and Mg2+ bridges to phosphate groups in the same way as that of B-DNA, after which hydrophobic contacts of the deoxyribose groups are formed via a dewetting effect, resulting in stable attraction between two Z-DNA molecules. The highlighted hydrophobic nature of Z-DNA interaction from the current study may help to understand the biological functions of Z-DNA in gene transcription.Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by
DEFF Research Database (Denmark)
Acosta, F.; Petrie, A.; Lockhart, K.
2005-01-01
vaccine or the synthetic double-stranded RNA, poly LC. In both species there was a rapid response to poly LC detectable from day 1, reaching maximum from days 3 to 9 and decreasing to background level by day 12. The peak level and return to background was reached slightly later in salmon. In both species...... the response to the VHS/DNA vaccine was slower to begin, not being detectable on days 1 and 3, but elevated levels were found on day 6. However, in the salmon part, the peak level was on day 6 and the signal disappeared by day 12, while in the rainbow trout, the response peaked at day 12 and lasted until day......The duration of the Mx mRNA response to an intramuscular injection of the viral haemorrhagic septicaemia virus (VHSV) glycoprotein (G) gene DNA vaccine as well as to the control plasmid was determined in rainbow trout at 14 degreesC over a period of 11 weeks. The Mx response was detectable on day 7...
Conformation-dependent DNA attraction.
Li, Weifeng; Nordenskiöld, Lars; Zhou, Ruhong; Mu, Yuguang
2014-06-21
Understanding how DNA molecules interact with other biomolecules is related to how they utilize their functions and is therefore critical for understanding their structure-function relationships. For a long time, the existence of Z-form DNA (a left-handed double helical version of DNA, instead of the common right-handed B-form) has puzzled the scientists, and the definitive biological significance of Z-DNA has not yet been clarified. In this study, the effects of DNA conformation in DNA-DNA interactions are explored by molecular dynamics simulations. Using umbrella sampling, we find that for both B- and Z-form DNA, surrounding Mg(2+) ions always exert themselves to screen the Coulomb repulsion between DNA phosphates, resulting in very weak attractive force. On the contrary, a tight and stable bound state is discovered for Z-DNA in the presence of Mg(2+) or Na(+), benefiting from their hydrophobic nature. Based on the contact surface and a dewetting process analysis, a two-stage binding process of Z-DNA is outlined: two Z-DNA first attract each other through charge screening and Mg(2+) bridges to phosphate groups in the same way as that of B-DNA, after which hydrophobic contacts of the deoxyribose groups are formed via a dewetting effect, resulting in stable attraction between two Z-DNA molecules. The highlighted hydrophobic nature of Z-DNA interaction from the current study may help to understand the biological functions of Z-DNA in gene transcription.
Genomic analysis of murine DNA-dependent protein kinase
International Nuclear Information System (INIS)
Fujimori, A.; Abe, M.
2003-01-01
Full text: The gene of catalytic subunit of DNA dependent protein kinase is responsible gene for SCID mice. The molecules play a critical role in non-homologous end joining including the V(D)J recombination. Contribution of the molecules to the difference of radiosensitivity and the susceptibility to cancer has been suggested. Here we show the entire nucleotide sequence of approximately 193 kbp and 84 kbp genomic regions encoding the entire DNA-PKcs gene in the mouse and chicken respectively. Retroposon was found in the intron 51 of mouse genomic DNA-PKcs gene but in human and chicken. Comparative analysis of these two species strongly suggested that only two genes, DNA-PKcs and MCM4, exist in the region of both species. Several conserved sequences and cis elements, however, were predicted. Recently, the orthologous region for the human DNA-PKcs locus was completed. The results of further comparative study will be discussed
Approaches to Preventative and Therapeutic HIV vaccines
Gray, Glenda E.; Laher, Fatima; Lazarus, Erica; Ensoli, Barbara; Corey, Lawrence
2016-01-01
Novel strategies are being researched to discover vaccines to prevent and treat HIV-1. Nonefficacious preventative vaccine approaches include bivalent recombinant gp120 alone, HIV gene insertion into an Adenovirus 5 (Ad5) virus vector and the DNA prime/Ad5 boost vaccine regimen. However, the ALVAC-HIV prime/AIDSVAX® B/E gp120 boost regimen showed 31.2% efficacy at 3.5 years, and is being investigated as clade C constructs with an additional boost. Likewise, although multiple therapeutic vaccines have failed in the past, in a non-placebo controlled trial, a Tat vaccine demonstrated immune cell restoration, reduction of immune activation, and reduced HIV-1 DNA viral load. Monoclonal antibodies for passive immunization or treatment show promise, with VRC01 entering advanced clinical trials. PMID:26985884
African Swine Fever Virus Biology and Vaccine Approaches.
Revilla, Yolanda; Pérez-Núñez, Daniel; Richt, Juergen A
2018-01-01
African swine fever (ASF) is an acute and often fatal disease affecting domestic pigs and wild boar, with severe economic consequences for affected countries. ASF is endemic in sub-Saharan Africa and the island of Sardinia, Italy. Since 2007, the virus emerged in the republic of Georgia, and since then spread throughout the Caucasus region and Russia. Outbreaks have also been reported in Belarus, Ukraine, Lithuania, Latvia, Estonia, Romania, Moldova, Czech Republic, and Poland, threatening neighboring West European countries. The causative agent, the African swine fever virus (ASFV), is a large, enveloped, double-stranded DNA virus that enters the cell by macropinocytosis and a clathrin-dependent mechanism. African Swine Fever Virus is able to interfere with various cellular signaling pathways resulting in immunomodulation, thus making the development of an efficacious vaccine very challenging. Inactivated preparations of African Swine Fever Virus do not confer protection, and the role of antibodies in protection remains unclear. The use of live-attenuated vaccines, although rendering suitable levels of protection, presents difficulties due to safety and side effects in the vaccinated animals. Several African Swine Fever Virus proteins have been reported to induce neutralizing antibodies in immunized pigs, and vaccination strategies based on DNA vaccines and recombinant proteins have also been explored, however, without being very successful. The complexity of the virus particle and the ability of the virus to modulate host immune responses are most likely the reason for this failure. Furthermore, no permanent cell lines able to sustain productive virus infection by both virulent and naturally attenuated African Swine Fever Virus strains exist so far, thus impairing basic research and the commercial production of attenuated vaccine candidates. © 2018 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Radaelli, Antonia; Nacsa, Janos; Tsai, W.-P.; Edghill-Smith, Yvette; Zanotto, Carlo; Elli, Veronica; Venzon, David; Tryniszewska, Elzbieta; Markham, Phil; Mazzara, Gail P.; Panicali, Dennis; Morghen, Carlo De Giuli; Franchini, Genoveffa
2003-01-01
A therapeutic vaccine for individuals infected with HIV-1 and treated with antiretroviral therapy (ART) should be able to replenish virus-specific CD4+ T-cells and broaden the virus-specific CD8+ T-cell response in order to maintain CD8+ T-cell function and minimize viral immune escape after ART cessation. Because a combination of DNA and recombinant poxvirus vaccine modalities induces high levels of virus-specific CD4+ T-cell response and broadens the cytolytic activity in naive macaques, we investigated whether the same results could be obtained in SIVmac251-infected macaques. The macaques studied here were long-term nonprogressors that naturally contained viremia but were nevertheless treated with a combination of antiviral drugs to assess more carefully the effect of vaccination in the context of ART. The combination of a DNA expressing the gag and pol genes (DNA-SIV-gp) of SIVmac239 followed by a recombinant fowlpox expressing the same SIVmac genes (FP-SIV-gp) was significantly more immunogenic than two immunizations of FP-SIV-gp in SIVmac251-infected macaques treated with ART. The DNA/FP combination significantly expanded and broadened Gag-specific T-cell responses measured by tetramer staining, ELISPOT, and intracellular cytokine staining and measurement of ex vivo cytolytic function. Importantly, the combination of these vaccine modalities also induced a sizeable expansion in most macaques of Gag-specific CD8-(CD4+) T-cells able to produce TNF-α. Hopefully, this modality of vaccine combination may be useful in the clinical management of HIV-1-infected individuals
The Evolution of Poxvirus Vaccines
Sánchez-Sampedro, Lucas; Perdiguero, Beatriz; Mejías-Pérez, Ernesto; García-Arriaza, Juan; Di Pilato, Mauro; Esteban, Mariano
2015-01-01
After Edward Jenner established human vaccination over 200 years ago, attenuated poxviruses became key players to contain the deadliest virus of its own family: Variola virus (VARV), the causative agent of smallpox. Cowpox virus (CPXV) and horsepox virus (HSPV) were extensively used to this end, passaged in cattle and humans until the appearance of vaccinia virus (VACV), which was used in the final campaigns aimed to eradicate the disease, an endeavor that was accomplished by the World Health Organization (WHO) in 1980. Ever since, naturally evolved strains used for vaccination were introduced into research laboratories where VACV and other poxviruses with improved safety profiles were generated. Recombinant DNA technology along with the DNA genome features of this virus family allowed the generation of vaccines against heterologous diseases, and the specific insertion and deletion of poxvirus genes generated an even broader spectrum of modified viruses with new properties that increase their immunogenicity and safety profile as vaccine vectors. In this review, we highlight the evolution of poxvirus vaccines, from first generation to the current status, pointing out how different vaccines have emerged and approaches that are being followed up in the development of more rational vaccines against a wide range of diseases. PMID:25853483
The Evolution of Poxvirus Vaccines
Directory of Open Access Journals (Sweden)
Lucas Sánchez-Sampedro
2015-04-01
Full Text Available After Edward Jenner established human vaccination over 200 years ago, attenuated poxviruses became key players to contain the deadliest virus of its own family: Variola virus (VARV, the causative agent of smallpox. Cowpox virus (CPXV and horsepox virus (HSPV were extensively used to this end, passaged in cattle and humans until the appearance of vaccinia virus (VACV, which was used in the final campaigns aimed to eradicate the disease, an endeavor that was accomplished by the World Health Organization (WHO in 1980. Ever since, naturally evolved strains used for vaccination were introduced into research laboratories where VACV and other poxviruses with improved safety profiles were generated. Recombinant DNA technology along with the DNA genome features of this virus family allowed the generation of vaccines against heterologous diseases, and the specific insertion and deletion of poxvirus genes generated an even broader spectrum of modified viruses with new properties that increase their immunogenicity and safety profile as vaccine vectors. In this review, we highlight the evolution of poxvirus vaccines, from first generation to the current status, pointing out how different vaccines have emerged and approaches that are being followed up in the development of more rational vaccines against a wide range of diseases.
Sun, Yun-Yan; Peng, Shiwen; Han, Liping; Qiu, Jin; Song, Liwen; Tsai, Yachea; Yang, Benjamin; Roden, Richard B S; Trimble, Cornelia L; Hung, Chien-Fu; Wu, T-C
2016-02-01
Two viral oncoproteins, E6 and E7, are expressed in all human papillomavirus (HPV)-infected cells, from initial infection in the genital tract to metastatic cervical cancer. Intramuscular vaccination of women with high-grade cervical intraepithelial neoplasia (CIN2/3) twice with a naked DNA vaccine, pNGVL4a-sig/E7(detox)/HSP70, and a single boost with HPVE6/E7 recombinant vaccinia vaccine (TA-HPV) elicited systemic HPV-specific CD8 T-cell responses that could traffic to the lesion and was associated with regression in some patients (NCT00788164). Here, we examine whether alteration of this vaccination regimen by administration of TA-HPV vaccination in the cervicovaginal tract, rather than intramuscular (IM) delivery, can more effectively recruit antigen-specific T cells in an orthotopic syngeneic mouse model of HPV16(+) cervical cancer (TC-1 luc). We found that pNGVL4a-sig/E7(detox)/HSP70 vaccination followed by cervicovaginal vaccination with TA-HPV increased accumulation of total and E7-specific CD8(+) T cells in the cervicovaginal tract and better controlled E7-expressing cervicovaginal TC-1 luc tumor than IM administration of TA-HPV. Furthermore, the E7-specific CD8(+) T cells in the cervicovaginal tract generated through the cervicovaginal route of vaccination expressed the α4β7 integrin and CCR9, which are necessary for the homing of the E7-specific CD8(+) T cells to the cervicovaginal tract. Finally, we show that cervicovaginal vaccination with TA-HPV can induce potent local HPV-16 E7 antigen-specific CD8(+) T-cell immune responses regardless of whether an HPV DNA vaccine priming vaccination was administered IM or within the cervicovaginal tract. Our results support future clinical translation using cervicovaginal TA-HPV vaccination. ©2015 American Association for Cancer Research.
Sun, Yun-Yan; Peng, Shiwen; Han, Liping; Qiu, Jin; Song, Liwen; Tsai, Yachea; Yang, Benjamin; Roden, Richard B.S.; Trimble, Cornelia L.; Hung, Chien-Fu; Wu, T-C
2015-01-01
Purpose Two viral oncoproteins, E6 and E7, are expressed in all human papillomavirus (HPV)-infected cells, from initial infection in the genital tract to metastatic cervical cancer. Intramuscular vaccination of women with high grade cervical intraepithelial neoplasia (CIN2/3) twice with a naked DNA vaccine, pNGVL4a-sig/E7(detox)/HSP70, and a single boost with HPVE6/E7 recombinant vaccinia vaccine (TA-HPV) elicited systemic HPV-specific CD8 T cell responses that could traffic to the lesion and was associated with regression in some patients (NCT00788164). Experimental Design Here we examine whether alteration of this vaccination regimen by administration of TA-HPV vaccination in the cervicovaginal tract, rather than IM delivery, can more effectively recruit antigen-specific T cells in an orthotopic syngeneic mouse model of HPV16+ cervical cancer (TC-1 luc). Results We found that pNGVL4a-sig/E7(detox)/HSP70 vaccination followed by cervicovaginal vaccination with TA-HPV increased accumulation of total and E7-specific CD8+ T cells in the cervicovaginal tract and better controlled E7-expressing cervicovaginal TC-1 luc tumor than IM administration of TA-HPV. Furthermore, the E7-specific CD8+ T cells in the cervicovaginal tract generated through the cervicovaginal route of vaccination expressed the α4β7 integrin and CCR9, which are necessary for the homing of the E7-specific CD8+ T cells to the cervicovaginal tract. Finally, we show that cervicovaginal vaccination with TA-HPV can induce potent local HPV-16 E7 antigen-specific CD8+ T cell immune responses regardless of whether an HPV DNA vaccine priming vaccination was administered IM or within the cervicovaginal tract. Conclusions Our results support future clinical translation using cervicovaginal TA-HPV vaccination. PMID:26420854
Ito, Yuki; Ito, Takumi; Karasawa, Satoki; Enomoto, Teruya; Nashimoto, Akihiro; Hase, Yasuyoshi; Sakamoto, Satoshi; Mimori, Tsuneyo; Matsumoto, Yoshihisa; Yamaguchi, Yuki; Handa, Hiroshi
2012-01-01
Bisphenol A (BPA) forms the backbone of plastics and epoxy resins used to produce packaging for various foods and beverages. BPA is also an estrogenic disruptor, interacting with human estrogen receptors (ER) and other related nuclear receptors. Nevertheless, the effects of BPA on human health remain unclear. The present study identified DNA-dependent protein kinase catalytic subunit (DNA-PKcs) as a novel BPA-binding protein. DNA-PKcs, in association with the Ku heterodimer (Ku70/80), is a critical enzyme involved in the repair of DNA double-strand breaks. Low levels of DNA-PK activity are previously reported to be associated with an increased risk of certain types of cancer. Although the Kd for the interaction between BPA and a drug-binding mutant of DNA-PKcs was comparatively low (137 nM), high doses of BPA were required before cellular effects were observed (100-300 μM). The results of an in vitro kinase assay showed that BPA inhibited DNA-PK kinase activity in a concentration-dependent manner. In M059K cells, BPA inhibited the phosphorylation of DNA-PKcs at Ser2056 and H2AX at Ser139 in response to ionizing radiation (IR)-irradiation. BPA also disrupted DNA-PKcs binding to Ku70/80 and increased the radiosensitivity of M059K cells, but not M059J cells (which are DNA-PKcs-deficient). Taken together, these results provide new evidence of the effects of BPA on DNA repair in mammalian cells, which are mediated via inhibition of DNA-PK activity. This study may warrant the consideration of the possible carcinogenic effects of high doses of BPA, which are mediated through its action on DNA-PK.
Stimulation of NADH-dependent microsomal DNA strand cleavage by rifamycin SV.
Kukiełka, E; Cederbaum, A I
1995-04-15
Rifamycin SV is an antibiotic anti-bacterial agent used in the treatment of tuberculosis. This drug can autoxidize, especially in the presence of metals, and generate reactive oxygen species. A previous study indicated that rifamycin SV can increase NADH-dependent microsomal production of reactive oxygen species. The current study evaluated the ability of rifamycin SV to interact with iron and increase microsomal production of hydroxyl radical, as detected by conversion of supercoiled plasmid DNA into the relaxed open circular state. The plasmid used was pBluescript II KS(-), and the forms of DNA were separated by agarose-gel electrophoresis. Incubation of rat liver microsomes with plasmid plus NADH plus ferric-ATP caused DNA strand cleavage. The addition of rifamycin SV produced a time- and concentration-dependent increase in DNA-strand cleavage. No stimulation by rifamycin SV occurred in the absence of microsomes, NADH or ferric-ATP. Stimulation occurred with other ferric complexes besides ferric-ATP, e.g. ferric-histidine, ferric-citrate, ferric-EDTA, and ferric-(NH4)2SO4. Rifamycin SV did not significantly increase the high rates of DNA strand cleavage found with NADPH as the microsomal reductant. The stimulation of NADH-dependent microsomal DNA strand cleavage was completely blocked by catalase, superoxide dismutase, GSH and a variety of hydroxyl-radical-scavenging agents, but not by anti-oxidants that prevent microsomal lipid peroxidation. Redox cycling agents, such as menadione and paraquat, in contrast with rifamycin SV, stimulated the NADPH-dependent reaction; menadione and rifamycin SV were superior to paraquat in stimulating the NADH-dependent reaction. These results indicate that rifamycin SV can, in the presence of an iron catalyst, increase microsomal production of reactive oxygen species which can cause DNA-strand cleavage. In contrast with other redox cycling agents, the stimulation by rifamycin SV is more pronounced with NADH than with NADPH as the
Vaccines prepared from translation products of cloned viral genes
International Nuclear Information System (INIS)
Patzer, J.; Obijeski, J.F.
1985-01-01
With the advent of recombinant DNA (rDNA) techniques and their application to viruses for vaccine research, there has been an explosion of information about the molecular structure and replication of many viruses. rDNA technology in conjunction with several other emerging technologies, e.g. monoclonal antibodies, solid phase synthesis of peptides and prediction of protein conformation on the basis of amino acid sequence, has provided a powerful battery of techniques that in many cases has allowed the identification of specific sites on the virion surface that elicit neutralizing antibodies. Knowledge of these sites allows one to design a subunit vaccine that utilizes one of the virion proteins or regions of a particular protein in the absence of any other viral proteins or the viral nucleic acid. The advantages of this approach are: that there are no potentially infectious agents contained in the vaccine if the inactivation procedure is incomplete, there is less chance of complications from the vaccine due to nonessential viral components in the vaccine, a purified protein or polypeptide is usually more stable than virus particles during storage, and many times larger quanitities of an antigen can be produced by rDNA techniques than by classical vaccine methods
Directory of Open Access Journals (Sweden)
Haibo Su
2017-11-01
Full Text Available Targeting of Mycobacterium tuberculosis (MTB latent antigens comprises a crucial strategy for the development of alternative tuberculosis (TB vaccine(s that protects against TB reactivation. Here, we generated a multistage DNA vaccine, A39, containing the early antigens Ag85A and Rv3425 as well as the latency-associated protein Rv2029c, which conferred protective immunity in a pre-exposure mouse model. Moreover, administration of the A39 vaccination after MTB exposure inhibited reactivation and resulted in significantly lower bacterial loads in the lungs and spleen of mice, compared to those in the control population. Subsequently, we investigated the effect of Rv2029c on innate immunity and characterized the molecular details of the interaction of this protein with the host via iTRAQ proteomic and biochemical assay analyses. Rv2029c activated macrophages, triggered the production of pro-inflammatory cytokines, and promoted toll-like receptor/mitogen-activated protein kinase (TLR/MAPK-dependent macrophage apoptosis. Furthermore, Rv2029c treatment enhanced the ability of Mycobacterium bovis Bacillus Calmette-Guérin (BCG-infected macrophages to present antigens to CD4+ T cells in vitro, which correlated with an increase in MHC-II expression. Lastly, Rv2029c-treated macrophages activated T cells, effectively polarized CD4+ and CD8+ T cells to secrete IFN-γ and IL-2, and specifically expanded a population of CD44highCD62LlowCD4+/CD8+ effector/memory cells, indicating that Rv2029c, as a specific recall antigen, contributes to Th1 polarization in T cell immunity. These results suggest that Rv2029c and A39 comprise promising targets for the development of next-generation clinical TB therapeutic vaccines.
Directory of Open Access Journals (Sweden)
Melanie Thompson
Full Text Available GV-TH-01, a Phase 1 open-label trial of a DNA prime—Modified Vaccinia Ankara (MVA boost vaccine (GOVX-B11, was undertaken in HIV infected participants on antiretroviral treatment (ART to evaluate safety and vaccine-elicited T cell responses, and explore the ability of elicited CD8+ T cells to control viral rebound during analytical treatment interruption (TI. Nine men who began antiretroviral therapy (ART within 18 months of seroconversion and had sustained plasma HIV-1 RNA <50 copies/mL for at least 6 months were enrolled. Median age was 38 years, median pre-ART HIV-1 RNA was 140,000 copies/ml and mean baseline CD4 count was 755/μl. Two DNA, followed by 2 MVA, inoculations were given 8 weeks apart. Eight subjects completed all vaccinations and TI. Clinical and laboratory adverse events were generally mild, with no serious or grade 4 events. Only reactogenicity events were considered related to study drug. No treatment emergent viral resistance was seen. The vaccinations did not reduce viral reservoirs and virus re-emerged in all participants during TI, with a median time to re-emergence of 4 weeks. Eight of 9 participants had CD8+ T cells that could be stimulated by vaccine-matched Gag peptides prior to vaccination. Vaccinations boosted these responses as well as eliciting previously undetected CD8+ responses. Elicited T cells did not display signs of exhaustion. During TI, temporal patterns of viral re-emergence and Gag-specific CD8+ T cell expansion suggested that vaccine-specific CD8+ T cells had been stimulated by re-emergent virus in only 2 of 8 participants. In these 2, transient decreases in viremia were associated with Gag selection in known CD8+ T cell epitopes. We hypothesize that escape mutations, already archived in the viral reservoir, plus a poor ability of CD8+ T cells to traffic to and control virus at sites of re-emergence, limited the therapeutic efficacy of the DNA/MVA vaccine.clinicaltrials.gov NCT01378156.
Thompson, Melanie; Heath, Sonya L; Sweeton, Bentley; Williams, Kathy; Cunningham, Pamela; Keele, Brandon F; Sen, Sharon; Palmer, Brent E; Chomont, Nicolas; Xu, Yongxian; Basu, Rahul; Hellerstein, Michael S; Kwa, Suefen; Robinson, Harriet L
2016-01-01
GV-TH-01, a Phase 1 open-label trial of a DNA prime—Modified Vaccinia Ankara (MVA) boost vaccine (GOVX-B11), was undertaken in HIV infected participants on antiretroviral treatment (ART) to evaluate safety and vaccine-elicited T cell responses, and explore the ability of elicited CD8+ T cells to control viral rebound during analytical treatment interruption (TI). Nine men who began antiretroviral therapy (ART) within 18 months of seroconversion and had sustained plasma HIV-1 RNA HIV-1 RNA was 140,000 copies/ml and mean baseline CD4 count was 755/μl. Two DNA, followed by 2 MVA, inoculations were given 8 weeks apart. Eight subjects completed all vaccinations and TI. Clinical and laboratory adverse events were generally mild, with no serious or grade 4 events. Only reactogenicity events were considered related to study drug. No treatment emergent viral resistance was seen. The vaccinations did not reduce viral reservoirs and virus re-emerged in all participants during TI, with a median time to re-emergence of 4 weeks. Eight of 9 participants had CD8+ T cells that could be stimulated by vaccine-matched Gag peptides prior to vaccination. Vaccinations boosted these responses as well as eliciting previously undetected CD8+ responses. Elicited T cells did not display signs of exhaustion. During TI, temporal patterns of viral re-emergence and Gag-specific CD8+ T cell expansion suggested that vaccine-specific CD8+ T cells had been stimulated by re-emergent virus in only 2 of 8 participants. In these 2, transient decreases in viremia were associated with Gag selection in known CD8+ T cell epitopes. We hypothesize that escape mutations, already archived in the viral reservoir, plus a poor ability of CD8+ T cells to traffic to and control virus at sites of re-emergence, limited the therapeutic efficacy of the DNA/MVA vaccine. clinicaltrials.gov NCT01378156.
Faecal shedding of canine parvovirus after modified-live vaccination in healthy adult dogs.
Freisl, M; Speck, S; Truyen, U; Reese, S; Proksch, A-L; Hartmann, K
2017-01-01
Since little is known about the persistence and faecal shedding of canine parvovirus (CPV) in dogs after modified-live vaccination, diagnostic tests for CPV can be difficult to interpret in the post-vaccination period. The primary aim of this study was to determine the incidence, duration and extent of CPV vaccine virus shedding in adult dogs and to investigate related factors, including the presence of protective antibodies, increase in anti-CPV antibody titres and development of any gastrointestinal side-effects. A secondary objective was to assess prevalence of CPV field virus shedding in clinically healthy dogs due to subclinical infections. One hundred adult, healthy privately owned dogs were vaccinated with a commercial CPV-2 modified-live vaccine (MLV). Faeces were tested for the presence of CPV DNA on days 0 (prior to vaccination), 3, 7, 14, 21 and 28 by quantitative real-time PCR. Pre- and post-vaccination serum titres were determined by haemagglutination inhibition on days 0, 7 and 28. Transient excretion of CPV DNA was detected in 2.0% of dogs before vaccination. About one quarter of dogs (23.0%) shed CPV DNA during the post-vaccination period, but field and vaccine virus differentiation by VP2 gene sequencing was only successful in few samples. Faecal CPV excretion occurred despite protective serum antibody titres. Post-vaccination CPV shedding was not related to adequate antibody response after vaccination or to the occurrence of gastrointestinal side-effects. Despite individual differences, CPV DNA was detectable for up to 28 days after vaccination, although the faecal CPV DNA load in these clinically healthy dogs was very low. Copyright © 2016 Elsevier Ltd. All rights reserved.
Hwang, Hye Suk; Kwon, Young-Man; Lee, Jong Seok; Yoo, Si-Eun; Lee, Yu-Na; Ko, Eun-Ju; Kim, Min-Chul; Cho, Min-Kyoung; Lee, Young-Tae; Jung, Yu-Jin; Lee, Ji-Yun; Li, Jian Dong; Kang, Sang-Moo
2014-01-01
This study demonstrates that immunization with non-replicating virus-like particle (FFG VLP) containing RSV F and G glycoproteins together with RSV F DNA induced T helper type 1 antibody responses to RSV F similar to live RSV infection. Upon RSV challenge 21 weeks after immunization, FFG VLP vaccination induced protection against RSV infection as shown by clearance of lung viral loads, and the absence of eosinophil infiltrates, and did not cause lung pathology. In contrast, formalin-inactivated RSV (FI-RSV) vaccination showed significant pulmonary eosinophilia, severe mucus production, and extensive histopathology resulting in a hallmark of pulmonary pathology. Substantial lung pathology was also observed in mice with RSV re-infections. High levels of systemic and local inflammatory cytokine-secreting cells were induced in mice with FI-RSV but not with FFG VLP immunization after RSV challenge. Therefore, the results provide evidence that recombinant RSV FFG VLP vaccine can confer long-term protection against RSV without causing lung pathology. PMID:25110201
Directory of Open Access Journals (Sweden)
Ilin Chuang
Full Text Available BACKGROUND: Gene-based vaccination using prime/boost regimens protects animals and humans against malaria, inducing cell-mediated responses that in animal models target liver stage malaria parasites. We tested a DNA prime/adenovirus boost malaria vaccine in a Phase 1 clinical trial with controlled human malaria infection. METHODOLOGY/PRINCIPAL FINDINGS: The vaccine regimen was three monthly doses of two DNA plasmids (DNA followed four months later by a single boost with two non-replicating human serotype 5 adenovirus vectors (Ad. The constructs encoded genes expressing P. falciparum circumsporozoite protein (CSP and apical membrane antigen-1 (AMA1. The regimen was safe and well-tolerated, with mostly mild adverse events that occurred at the site of injection. Only one AE (diarrhea, possibly related to immunization, was severe (Grade 3, preventing daily activities. Four weeks after the Ad boost, 15 study subjects were challenged with P. falciparum sporozoites by mosquito bite, and four (27% were sterilely protected. Antibody responses by ELISA rose after Ad boost but were low (CSP geometric mean titer 210, range 44-817; AMA1 geometric mean micrograms/milliliter 11.9, range 1.5-102 and were not associated with protection. Ex vivo IFN-γ ELISpot responses after Ad boost were modest (CSP geometric mean spot forming cells/million peripheral blood mononuclear cells 86, range 13-408; AMA1 348, range 88-1270 and were highest in three protected subjects. ELISpot responses to AMA1 were significantly associated with protection (p = 0.019. Flow cytometry identified predominant IFN-γ mono-secreting CD8+ T cell responses in three protected subjects. No subjects with high pre-existing anti-Ad5 neutralizing antibodies were protected but the association was not statistically significant. SIGNIFICANCE: The DNA/Ad regimen provided the highest sterile immunity achieved against malaria following immunization with a gene-based subunit vaccine (27%. Protection
Demberg, Thorsten; Boyer, Jean D; Malkevich, Nina; Patterson, L Jean; Venzon, David; Summers, Ebonita L; Kalisz, Irene; Kalyanaraman, V S; Lee, Eun Mi; Weiner, David B; Robert-Guroff, Marjorie
2008-11-01
Previously, combination DNA/nonreplicating adenovirus (Ad)- or poxvirus-vectored vaccines have strongly protected against SHIV(89.6P), DNAs expressing cytokines have modulated immunity elicited by DNA vaccines, and replication-competent Ad-recombinant priming and protein boosting has strongly protected against simian immunodeficiency virus (SIV) challenge. Here we evaluated a vaccine strategy composed of these promising components. Seven rhesus macaques per group were primed twice with multigenic SIV plasmid DNA with or without interleukin-12 (IL-12) DNA or IL-15 DNA. After a multigenic replicating Ad-SIV immunization, all groups received two booster immunizations with SIV gp140 and SIV Nef protein. Four control macaques received control DNA plasmids, empty Ad vector, and adjuvant. All vaccine components were immunogenic, but the cytokine DNAs had little effect. Macaques that received IL-15-DNA exhibited higher peak anti-Nef titers, a more rapid anti-Nef anamnestic response postchallenge, and expanded CD8(CM) T cells 2 weeks postchallenge compared to the DNA-only group. Other immune responses were indistinguishable between groups. Overall, no protection against intrarectal challenge with SIV(mac251) was observed, although immunized non-Mamu-A*01 macaques as a group exhibited a statistically significant 1-log decline in acute viremia compared to non-Mamu-A*01 controls. Possible factors contributing to the poor outcome include administration of cytokine DNAs to sites different from the Ad recombinants (intramuscular and intratracheal, respectively), too few DNA priming immunizations, a suboptimal DNA delivery method, failure to ensure delivery of SIV and cytokine plasmids to the same cell, and instability and short half-life of the IL-15 component. Future experiments should address these issues to determine if this combination approach is able to control a virulent SIV challenge.
Directory of Open Access Journals (Sweden)
Pasandideh, R.
2016-03-01
Full Text Available Foot-and-mouth disease (FMD is a severely contagious viral disease that mainly affects cloven-hoofed livestock and wildlife. This study quantifies the cytokines mRNA expression of vaccinated guinea pigs with FMD type O inactivated vaccine. Blood samples were collected from eight guinea pigs at 7 and 28 days after the first vaccination. Extracted mRNAs were reverse-transcribed into cDNA and analyzed for quantification of IFN-γ, TNF-α and IL-10 expression using relative real-time PCR assay. Our results showed that all of the genes were upregulated. The expression of TNF-α and IL-10 genes significantly increased (P<0.05 in day 28th in comparison to the day 7th post the first vaccination. It can be concluded that the vaccine induced immune responses by increasing expression of the cytokines. Therefore, effects of DNA vaccines on immune system also may be evaluated using these genes.
Fonseca, Cristina T; Pacífico, Lucila G G; Barsante, Michele M; Rassi, Tatiana; Cassali, Geovanni D; Oliveira, Sérgio C
2006-08-01
Schistosomiasis is an endemic disease that affects 200 million people worldwide. DNA-based vaccine is a promising strategy to induce protective immunity against schistosomiasis, since both humoral and cellular immune responses are involved in parasite elimination. In this study, we evaluated the ability of Sm14 cDNA alone or in association with a plasmid expressing murine interleukin (IL)-12 to induce protection against challenge infection. Mice were immunized with four doses of the DNA vaccine and the levels of protection were determined by worm burden recovery after challenge infection. Specific antibody production to rSm14 was determined by ELISA, and cytokine production was measured in splenocyte culture supernatants stimulated with rSm14 and in bronchoalveolar lavage of vaccinated mice after challenge infection. DNA immunization with pCI/Sm14 alone induced 40.5% of worm reduction. However, the use of pCI/IL-12 as adjuvant to pCI/Sm14 immunization failed to enhance protection against challenge infection. Protection induced by pCI/Sm14 immunization correlates with specific IgG antibody production against Sm14, Th1 type of immune response with high levels of interferon (IFN)-gamma and low levels of IL-4 in splenocyte culture supernatants and in bronchoalveolar lavage after challenge infection. IL-12 co-administration with pCI/Sm14 induced a significant production of nitric oxide in splenocyte culture supernatants and also lymphocyte suppression, with reduced percentage of T cells producing IFN-gamma and tumor necrosis factor-alpha.
DNA template dependent accuracy variation of nucleotide selection in transcription.
Directory of Open Access Journals (Sweden)
Harriet Mellenius
Full Text Available It has been commonly assumed that the effect of erroneous transcription of DNA genes into messenger RNAs on peptide sequence errors are masked by much more frequent errors of mRNA translation to protein. We present a theoretical model of transcriptional accuracy. It uses experimentally estimated standard free energies of double-stranded DNA and RNA/DNA hybrids and predicts a DNA template dependent transcriptional accuracy variation spanning several orders of magnitude. The model also identifies high-error as well a high-accuracy transcription motifs. The source of the large accuracy span is the context dependent variation of the stacking free energy of pairs of correct and incorrect base pairs in the ever moving transcription bubble. Our model predictions have direct experimental support from recent single molecule based identifications of transcriptional errors in the C. elegans transcriptome. Our conclusions challenge the general view that amino acid substitution errors in proteins are mainly caused by translational errors. It suggests instead that transcriptional error hotspots are the dominating source of peptide sequence errors in some DNA template contexts, while mRNA translation is the major cause of protein errors in other contexts.
Double-stranded DNA-dependent ATPase Irc3p is directly involved in mitochondrial genome maintenance.
Sedman, Tiina; Gaidutšik, Ilja; Villemson, Karin; Hou, YingJian; Sedman, Juhan
2014-12-01
Nucleic acid-dependent ATPases are involved in nearly all aspects of DNA and RNA metabolism. Previous studies have described a number of mitochondrial helicases. However, double-stranded DNA-dependent ATPases, including translocases or enzymes remodeling DNA-protein complexes, have not been identified in mitochondria of the yeast Saccharomyces cerevisae. Here, we demonstrate that Irc3p is a mitochondrial double-stranded DNA-dependent ATPase of the Superfamily II. In contrast to the other mitochondrial Superfamily II enzymes Mss116p, Suv3p and Mrh4p, which are RNA helicases, Irc3p has a direct role in mitochondrial DNA (mtDNA) maintenance. Specific Irc3p-dependent mtDNA metabolic intermediates can be detected, including high levels of double-stranded DNA breaks that accumulate in irc3Δ mutants. irc3Δ-related topology changes in rho- mtDNA can be reversed by the deletion of mitochondrial RNA polymerase RPO41, suggesting that Irc3p counterbalances adverse effects of transcription on mitochondrial genome stability. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Directory of Open Access Journals (Sweden)
Gang Wang
Full Text Available Mucosal vaccination has been demonstrated to be an effective means of eliciting protective immunity against aerosol infections of foot and mouth disease virus (FMDV and various approaches have been used to improve mucosal response to this pathogen. In this study, cationic PLGA (poly(lactide-co-glycolide nano/microparticles were used as an intranasal delivery vehicle as a means administering FMDV DNA vaccine encoding the FMDV capsid protein and the bovine IL-6 gene as a means of enhancing mucosal and systemic immune responses in animals. Three eukaryotic expression plasmids with or without bovine IL-6 gene (pc-P12A3C, pc-IL2AP12A3C and pc-P12AIL3C were generated. The two latter plasmids were designed with the IL-6 gene located either before or between the P12A and 3C genes, respectively, as a means of determining if the location of the IL-6 gene affected capsid assembly and the subsequent immune response. Guinea pigs and rats were intranasally vaccinated with the respective chitosan-coated PLGA nano/microparticles-loaded FMDV DNA vaccine formulations. Animals immunized with pc-P12AIL3C (followed by animals vaccinated with pc-P12A3C and pc-IL2AP12A3C developed the highest levels of antigen-specific serum IgG and IgA antibody responses and the highest levels of sIgA (secretory IgA present in mucosal tissues. However, the highest levels of neutralizing antibodies were generated in pc-IL2AP12A3C-immunized animals (followed by pc-P12AIL3C- and then in pc-P12A3C-immunized animals. pc-IL2AP12A3C-immunized animals also developed stronger cell mediated immune responses (followed by pc-P12AIL3C- and pc-P12A3C-immunized animals as evidenced by antigen-specific T-cell proliferation and expression levels of IFN-γ by both CD4+ and CD8+ splenic T cells. The percentage of animals protected against FMDV challenge following immunizations with pc-IL2AP12A3C, pc-P12AIL3C or pc-P12A3C were 3/5, 1/5 and 0/5, respectively. These data suggested that intranasal delivery
Characterization of a bacteriophage T4 mutant lacking DNA-dependent ATPase
International Nuclear Information System (INIS)
Behme, M.T.; Ebisuzaki, K.
1975-01-01
A DNA-dependent ATPase has previously been purified from bacteriophage T4-infected Escherichia coli. A mutant phage strain lacking this enzyme has been isolated and characterized. Although the mutant strain produced no detectable DNA-dependent ATPase, growth properties were not affected. Burst sizes were similar for the mutant phage and T4D in polAl, recB, recC, uvrA, uvrB, uvrC, and various DNA-negative E. coli. UV sensitivity and genetic recombination were normal in a variety of E. coli hosts. Mapping data indicate that the genetic locus controlling the mutant occurs near gene 56. The nonessential nature of this gene is discussed
KISS1 can be used as a novel target for developing a DNA immunocastration vaccine in ram lambs.
Han, Yanguo; Liu, Guiqiong; Jiang, Xunping; Ijaz, Nabeel; Tesema, Birhanu; Xie, Guangyue
2015-02-04
KISS1 gene-encoding kisspeptins are critical for the onset of puberty and control of adult fertility. This study investigated whether KISS1 can be used as a novel target for immunocastration. Human KISS1 was fused with the HBsAg-S gene for constructing an antibiotic-free recombinant plasmid pKS-asd that coded for 31.168 kDa target fusion protein. Six male Hu sheep lambs were divided into two equal groups, treatment and control. The vaccine (1mg/ram lamb) prepared in saline solution was injected into lambs at weeks 0, 3 and 6 of the experiment, respectively. Vaccine efficacy was evaluated in terms of KISS1-specific IgG antibody response, serum testosterone levels, scrotal circumference, testicular weight, length and breadth, extent of testicular tissue damage, and sexual behaviour changes. The specific anti-KISS1 antibody titre in vaccinated animals was significantly higher than that in controls (pvaccinated animals showed lower serum testosterone level, testicular weight and length and smaller scrotal circumference than those in controls (pvaccinated animals was suppressed; sexual behaviours in vaccinated animals were significantly lower (pvaccine induced a strong antibody response and resulted in the suppression of gonadal function and sexual behaviour in animals, demonstrating that KISS1 can be used as a novel target for developing a DNA immunocastration vaccine. Copyright © 2015 Elsevier Ltd. All rights reserved.
Force-dependent melting of supercoiled DNA at thermophilic temperatures.
Galburt, E A; Tomko, E J; Stump, W T; Ruiz Manzano, A
2014-01-01
Local DNA opening plays an important role in DNA metabolism as the double-helix must be melted before the information contained within may be accessed. Cells finely tune the torsional state of their genomes to strike a balance between stability and accessibility. For example, while mesophilic life forms maintain negatively superhelical genomes, thermophilic life forms use unique mechanisms to maintain relaxed or even positively supercoiled genomes. Here, we use a single-molecule magnetic tweezers approach to quantify the force-dependent equilibrium between DNA melting and supercoiling at high temperatures populated by Thermophiles. We show that negatively supercoiled DNA denatures at 0.5 pN lower tension at thermophilic vs. mesophilic temperatures. This work demonstrates the ability to monitor DNA supercoiling at high temperature and opens the possibility to perform magnetic tweezers assays on thermophilic systems. The data allow for an estimation of the relative energies of base-pairing and DNA bending as a function of temperature and support speculation as to different general mechanisms of DNA opening in different environments. Lastly, our results imply that average in vivo DNA tensions range between 0.3 and 1.1 pN. Copyright © 2014 Elsevier B.V. All rights reserved.
Johnson, Laura E; Olson, Brian M; McNeel, Douglas G
2017-07-18
Immunotherapies have demonstrated clinical benefit for many types of cancers, however many patients do not respond, and treatment-related adverse effects can be severe. Hence many efforts are underway to identify treatment predictive biomarkers. We have reported the results of two phase I trials using a DNA vaccine encoding prostatic acid phosphatase (PAP) in patients with biochemically recurrent prostate cancer. In both trials, persistent PAP-specific Th1 immunity developed in some patients, and this was associated with favorable changes in serum PSA kinetics. In the current study, we sought to determine if measures of antigen-specific or antigen non-specific immunity were present prior to treatment, and associated with subsequent immune response, to identify possible predictive immune biomarkers. Patients who developed persistent PAP-specific, IFNγ-secreting immune responses were defined as immune "responders." The frequency of peripheral T cell and B cell lymphocytes, natural killer cells, monocytes, dendritic cells, myeloid derived suppressor cells, and regulatory T cells were assessed by flow cytometry and clinical laboratory values. PAP-specific immune responses were evaluated by cytokine secretion in vitro, and by antigen-specific suppression of delayed-type hypersensitivity to a recall antigen in an in vivo SCID mouse model. The frequency of peripheral blood cell types did not differ between the immune responder and non-responder groups. Non-responder patients tended to have higher PAP-specific IL-10 production pre-vaccination (p = 0.09). Responder patients had greater preexisting PAP-specific bystander regulatory responses that suppressed DTH to a recall antigen (p = 0.016). While our study population was small (n = 38), these results suggest that different measures of antigen-specific tolerance or regulation might help predict immunological outcome from DNA vaccination. These will be prospectively evaluated in an ongoing randomized, phase II trial.
International Nuclear Information System (INIS)
Amin, M.M.; Hafez, E.N.; Abd Raboo, M.A.
2016-01-01
Toxocara canis is a worldwide zoonotic roundworm that infects a number of hosts including humans. It exhibits marked affinity to the nervous tissues. This study deals with the changes in the brain of Toxocara canis infected rats regarding parasitological, nitric oxide (NO) level and DNA damage compared to the effect of vaccination with gamma radiation-attenuated embryonated egg or thyme oil treatment. Eighty rats were classified into four groups (twenty each): GI (normal control); GII infected with 2500 T. canis infective eggs/ml/rat (infected control); GIII vaccinated with 800 Gy gamma-attenuated embryonated eggs (vaccinated group) and GIV infected with 2500 T. canis eggs and treated with thyme oil (thyme treated group). At the 14th day post-infection, ten rats from each group were sacrificed and the remaining were re-infected (challenged) with the same number of eggs. At the 14th days post challenge, brain tissues were taken for larval recovery, nitric oxide level evaluation and DNA damage using fragmentation and comet assay. The results exhibited a significant decrease in larval count and nitric oxide level with less damage in brain cells in thyme treated and gamma radiation-attenuated vaccinated groups compared to control infected group. It is also, concluded that vaccination using γ- rays is more effective in protection compared to using thyme oil.
Enhancing the Immunogenicity of a Tetravalent Dengue DNA Vaccine
2016-08-01
season’s influenza vaccine. There is no overlap with the proposed project. Title: Serological survey for Zika virus and other vector-borne pathogen...studying human immunology and pathogenesis of dengue virus infection Time Commitments: 5% 0.6 calendar months Supporting Agency: Military Infectious...attenuated dengue virus vaccine (LAV), and (3) inactivated dengue virus vaccine. Dengue fever ranks among the top infectious diseases that afflict
Coincident In Vitro Analysis of DNA-PK-Dependent and -Independent Nonhomologous End Joining
Directory of Open Access Journals (Sweden)
Cynthia L. Hendrickson
2010-01-01
Full Text Available In mammalian cells, DNA double-strand breaks (DSBs are primarily repaired by nonhomologous end joining (NHEJ. The current model suggests that the Ku 70/80 heterodimer binds to DSB ends and recruits DNA-PKcs to form the active DNA-dependent protein kinase, DNA-PK. Subsequently, XRCC4, DNA ligase IV, XLF and most likely, other unidentified components participate in the final DSB ligation step. Therefore, DNA-PK plays a key role in NHEJ due to its structural and regulatory functions that mediate DSB end joining. However, recent studies show that additional DNA-PK-independent NHEJ pathways also exist. Unfortunately, the presence of DNA-PKcs appears to inhibit DNA-PK-independent NHEJ, and in vitro analysis of DNA-PK-independent NHEJ in the presence of the DNA-PKcs protein remains problematic. We have developed an in vitro assay that is preferentially active for DNA-PK-independent DSB repair based solely on its reaction conditions, facilitating coincident differential biochemical analysis of the two pathways. The results indicate the biochemically distinct nature of the end-joining mechanisms represented by the DNA-PK-dependent and -independent NHEJ assays as well as functional differences between the two pathways.
International Nuclear Information System (INIS)
Iwanaga, Kentaro; Sueoka, Naoko; Sato, Akemi; Hayashi, Shinichiro; Sueoka, Eisaburo
2005-01-01
Heterogeneous nuclear ribonucleoprotein B1, an RNA binding protein, is overexpressed from the early stage of lung cancers; it is evident even in bronchial dysplasia, a premalignant lesion. We evaluated the proteins bound with hnRNP B1 and found that hnRNP B1 interacted with DNA-dependent protein kinase (DNA-PK) complex, and recombinant hnRNP B1 protein dose-dependently inhibited DNA-PK activity in vitro. To test the effect of hnRNP B1 on DNA repair, we performed comet assay after irradiation, using normal human bronchial epithelial (HBE) cells treated with siRNA for hnRNP A2/B1: reduction of hnRNP B1 treated with siRNA for hnRNP A2/B1 induced faster DNA repair in normal HBE cells. Considering these results, we assume that overexpression of hnRNP B1 occurring in the early stage of carcinogenesis inhibits DNA-PK activity, resulting in subsequent accumulation of erroneous rejoining of DNA double-strand breaks, causing tumor progression
Li, Chen-Chen; Yu, Ji-Yun; Jiang, Min; Tu, Yi-Xian; Ma, Xiao-Lin; Zhang, Fu-Chun
2011-09-01
To enhance the immunocontraceptive effect of Lagurus lagurus zona pellucida 3 DNA vaccine, and to achieve the prospect of application through the pVAX1-sig-LTB-lZP3-C3d3 different immunity pathway. Two adjuvant molecules were constructed into the recombinant plasmid pVAX1-sig-LTB-lZP3-C3d3 as DNA vaccine which contains Escherichia coli heat-labile enterotoxin B subunit and the molecular adjuvant 3 copies of C3d. The results of RT-PCR and western blot showed that the DNA vaccine was expressed in mRNA and protein level. The female C57BL/6 mice were immunized by three ways: intramuscular injection, intranasal or oral route.Antibody levels and types were detected by ELISA. ELISA results showed that recombinant plasmid pVAX1-sig-LTB-lZP3-C3d3 immunization induced specific IgG, IgA levels were significantly different comparing with control (Psig-LTB-lZP3-C3d3 can induce the specific immune response efficiently and enhance the immunocontraceptive effects.
Clinical development of Ebola vaccines
Sridhar, Saranya
2015-01-01
The ongoing outbreak of Ebola virus disease in West Africa highlighted the lack of a licensed drug or vaccine to combat the disease and has renewed the urgency to develop a pipeline of Ebola vaccines. A number of different vaccine platforms are being developed by assessing preclinical efficacy in animal models and expediting clinical development. Over 15 different vaccines are in preclinical development and 8 vaccines are now in different stages of clinical evaluation. These vaccines include DNA vaccines, virus-like particles and viral vectors such as live replicating vesicular stomatitis virus (rVSV), human and chimpanzee adenovirus, and vaccinia virus. Recently, in preliminary results reported from the first phase III trial of an Ebola vaccine, the rVSV-vectored vaccine showed promising efficacy. This review charts this rapidly advancing area of research focusing on vaccines in clinical development and discusses the future opportunities and challenges faced in the licensure and deployment of Ebola vaccines. PMID:26668751
Cole, Grace; Ali, Ahlam A; McCrudden, Cian M; McBride, John W; McCaffrey, Joanne; Robson, Tracy; Kett, Vicky L; Dunne, Nicholas J; Donnelly, Ryan F; McCarthy, Helen O
2018-03-03
Dissolvable microneedles can be employed to deliver DNA to antigen presenting cells within the skin. However, this technology faces two main challenges: the poor transfection efficacy of pDNA following release from the microneedle matrix, and the limited loading capacity of the micron-scale devices. Two-tier delivery systems combining microneedle platforms and DNA delivery vectors have increased efficacy but the challenge of increasing the loading capacity remains. This study utilised lyophilisation to increase the loading of RALA/pDNA nanoparticles within dissolvable PVA microneedles. As a result, delivery was significantly enhanced in vivo into an appropriate range for DNA vaccination (∼50 μg per array). Furthermore, modifying the manufacturing process was not detrimental to the microneedle mechanical properties or cargo functionality. It was demonstrated that arrays retained mechanical and functional stability over short term storage, and were able to elicit gene expression in vitro and in vivo. Finally, treatment with this novel formulation significantly retarded the growth of established tumours, and proved superior to standard intramuscular injection in a preclinical model of cervical cancer. Copyright © 2018. Published by Elsevier B.V.
HIV vaccines: new frontiers in vaccine development.
Duerr, Ann; Wasserheit, Judith N; Corey, Lawrence
2006-08-15
A human immunodeficiency virus (HIV) vaccine is the most promising and feasible strategy to prevent the events during acute infection that simultaneously set the course of the epidemic in the community and the course of the disease for the individual. Because safety concerns limit the use of live, attenuated HIV and inactivated HIV, a variety of alternate approaches is being investigated. Traditional antibody-mediated approaches using recombinant HIV envelope proteins have shown no efficacy in 2 phase III trials. Current HIV vaccine trials are focusing primarily on cytotoxic T lymphocyte-mediated products that use viral vectors, either alone or as boosts to DNA plasmids that contain viral genes. The most immunogenic of these products appear to be the recombinant adenovirus vector vaccines, 2 of which are now in advanced clinical development.
Zhai, Yong-Zhen; Zhou, Yan; Ma, Li; Feng, Guo-He
2014-07-01
This study aimed to investigate the immune adjuvant effect and mechanism induced by chitosan nanoparticles carrying pJME/GM-CSF. In this study, plasmid DNA (pJME/GM-CSF) was encapsulated in chitosan to prepare chitosan-pJME/GM-CSF nanoparticles using a complex coacervation process. Immunohistochemistry was used to detect the type of infiltrating cells at the site of intramuscular injection. The phenotype and functional changes of splenic DCs were measured by flow cytometry after different immunogens were injected intramuscularly. The killing activity of CTLs was assessed using the lactate dehydrogenase (LDH) release assay. The preparation of chitosan-pJME/GM-CSF nanoparticles matched the expected theoretical results. Our results also found that, after pJME/GM-CSF injection, the incoming cells were a mixture of macrophages, neutrophils, and immature DCs. Meanwhile, pJME/GM-CSF increased the expression of MHC class II molecules on splenic DCs, and enhanced their Ag capture and presentation functions. Cell-mediated immunity was induced by the vaccine. Furthermore, chitosan-pJME/GM-CSF nanoparticles outperformed the administration of standard pJME/GM-CSF in terms of DC recruitment, antigen processing and presentation, and vaccine enhancement. These findings reveal that chitosan could be used as delivery vector for DNA vaccine intramuscular immunizations, and enhance pJME/GM-CSF-induced cellular immune responses.
Jette, Nicholas; Lees-Miller, Susan P.
2014-01-01
The DNA-dependent protein kinase (DNA-PK) is a serine/threonine protein kinase composed of a large catalytic subunit (DNA-PKcs) and the Ku70/80 heterodimer. Over the past two decades, significant progress has been made in elucidating the role of DNA-PK in non-homologous end joining (NHEJ), the major pathway for repair of ionizing radiation-induced DNA double strand breaks in human cells and recently, additional roles for DNA-PK have been reported. In this review, we will describe the biochemi...
Tipping the Proteome with Gene-Based Vaccines: Weighing in on the Role of Nano materials
International Nuclear Information System (INIS)
Flores, K.J.; Craig, M.; Smith, J.J.; DeLong, R.K.; Wanekaya, A.; Dong, L.
2012-01-01
Since the first generation of DNA vaccines was introduced in 1988, remarkable improvements have been made to improve their efficacy and immunogenicity. Although human clinical trials have shown that delivery of DNA vaccines is well tolerated and safe, the potency of these vaccines in humans is somewhat less than optimal. The development of a gene-based vaccine that was effective enough to be approved for clinical use in humans would be one of, if not the most important, advance in vaccines to date. This paper highlights the literature relating to gene-based vaccines, specifically DNA vaccines, and suggests possible approaches to boost their performance. In addition, we explore the idea that combining RNA and nano materials may hold the key to successful gene-based vaccines for prevention and treatment of disease
DNA-dependent protein kinase in nonhomologous end joining: a lock with multiple keys?
Weterings, Eric; Chen, David J
2007-10-22
The DNA-dependent protein kinase (DNA-PK) is one of the central enzymes involved in DNA double-strand break (DSB) repair. It facilitates proper alignment of the two ends of the broken DNA molecule and coordinates access of other factors to the repair complex. We discuss the latest findings on DNA-PK phosphorylation and offer a working model for the regulation of DNA-PK during DSB repair.
Stability analysis for an age-dependent vaccination model
International Nuclear Information System (INIS)
El-Doma, M.
1993-05-01
The stability of an SIR epidemic model with vaccination is investigated. We determine the steady states and examine their stability. Furthermore, a critical vaccination coverage that will eventually eradicate the disease is determined. (author). 9 refs
Xrcc1-dependent and Ku-dependent DNA double-strand break repair kinetics in Arabidopsis plants.
Charbonnel, Cyril; Gallego, Maria E; White, Charles I
2010-10-01
Double-strand breakage (DSB) of DNA involves loss of information on the two strands of the DNA fibre and thus cannot be repaired by simple copying of the complementary strand which is possible with single-strand DNA damage. Homologous recombination (HR) can precisely repair DSB using another copy of the genome as template and non-homologous recombination (NHR) permits repair of DSB with little or no dependence on DNA sequence homology. In addition to the well-characterised Ku-dependent non-homologous end-joining (NHEJ) pathway, much recent attention has been focused on Ku-independent NHR. The complex interrelationships and regulation of NHR pathways remain poorly understood, even more so in the case of plants, and we present here an analysis of Ku-dependent and Ku-independent repair of DSB in Arabidopsis thaliana. We have characterised an Arabidopsis xrcc1 mutant and developed quantitative analysis of the kinetics of appearance and loss of γ-H2AX foci as a tool to measure DSB repair in dividing root tip cells of γ-irradiated plants in vivo. This approach has permitted determination of DSB repair kinetics in planta following a short pulse of γ-irradiation, establishing the existence of a Ku-independent, Xrcc1-dependent DSB repair pathway. Furthermore, our data show a role for Ku80 during the first minutes post-irradiation and that Xrcc1 also plays such a role, but only in the absence of Ku. The importance of Xrcc1 is, however, clearly visible at later times in the presence of Ku, showing that alternative end-joining plays an important role in DSB repair even in the presence of active NHEJ. © 2010 The Authors. Journal compilation © 2010 Blackwell Publishing Ltd.
When gene medication is also genetic modification--regulating DNA treatment.
Foss, Grethe S; Rogne, Sissel
2007-07-26
The molecular methods used in DNA vaccination and gene therapy resemble in many ways the methods applied in genetic modification of organisms. In some regulatory regimes, this creates an overlap between 'gene medication' and genetic modification. In Norway, an animal injected with plasmid DNA, in the form of DNA vaccine or gene therapy, currently is viewed as being genetically modified for as long as the added DNA is present in the animal. However, regulating a DNA-vaccinated animal as genetically modified creates both regulatory and practical challenges. It is also counter-intuitive to many biologists. Since immune responses can be elicited also to alter traits, the borderline between vaccination and the modification of properties is no longer distinct. In this paper, we discuss the background for the Norwegian interpretation and ways in which the regulatory challenge can be handled.
DNA repair synthesis dependent on the uvrA,B gene products
International Nuclear Information System (INIS)
Moses, R.E.; Moody, E.E.M.
1975-01-01
Ultraviolet irradiation of toluene-treated Escherichia coli causes an inhibition of replicative DNA synthesis. This is followed by the appearance of nonconservative DNA repair synthesis which does not require either the polymerase or 5' → 3' exonucleolytic activities of DNA polymerase I. The repair synthesis may be catalyzed by DNA polymerase III activity but does not require a functional DNA polymerase II. The ultraviolet-induced synthesis requires ATP and is dependent on a functional uvrA and uvrB gene product. However, other uvr gene products are not required for the synthesis. The recB function is also not required
Li, Qin; Cui, Chenchen; Higgins, Daniel A; Li, Jun
2012-09-05
The potential-dependent reorientation dynamics of double-stranded DNA (ds-DNA) attached to planar glassy carbon electrode (GCE) surfaces were investigated. The orientation state of surface-bound ds-DNA was followed by monitoring the fluorescence from a 6-carboxyfluorescein (FAM6) fluorophore covalently linked to the distal end of the DNA. Positive potentials (i.e., +0.2 V vs open circuit potential, OCP) caused the ds-DNA to align parallel to the electrode surface, resulting in strong dipole-electrode quenching of FAM6 fluorescence. Switching of the GCE potential to negative values (i.e., -0.2 V vs OCP) caused the ds-DNA to reorient perpendicular to the electrode surface, with a concomitant increase in FAM6 fluorescence. In addition to the very fast (submilliseconds) dynamics of the initial reorientation process, slow (0.1-0.9 s) relaxation of FAM6 fluorescence to intermediate levels was also observed after potential switching. These dynamics have not been previously described in the literature. They are too slow to be explained by double layer charging, and chronoamperometry data showed no evidence of such effects. Both the amplitude and rate of the dynamics were found to depend upon buffer concentration, and ds-DNA length, demonstrating a dependence on the double layer field. The dynamics are concluded to arise from previously undetected complexities in the mechanism of potential-dependent ds-DNA reorientation. The possible origins of these dynamics are discussed. A better understanding of these dynamics will lead to improved models for potential-dependent ds-DNA reorientation at electrode surfaces and will facilitate the development of advanced electrochemical devices for detection of target DNAs.
Jette, Nicholas; Lees-Miller, Susan P.
2015-01-01
The DNA-dependent protein kinase (DNA-PK) is a serine/threonine protein kinase composed of a large catalytic subunit (DNA-PKcs) and the Ku70/80 heterodimer. Over the past two decades, significant progress has been made in elucidating the role of DNA-PK in non-homologous end joining (NHEJ), the major pathway for repair of ionizing radiation-induced DNA double strand breaks in human cells and recently, additional roles for DNA-PK have been reported. In this review, we will describe the biochemistry, structure and function of DNA-PK, its roles in DNA double strand break repair and its newly described roles in mitosis and other cellular processes. PMID:25550082
Lukashevich, Igor S.; Carrion, Ricardo; Salvato, Maria S.; Mansfield, Keith; Brasky, Kathleen; Zapata, Juan; Cairo, Cristiana; Goicochea, Marco; Hoosien, Gia E.; Ticer, Anysha; Bryant, Joseph; Davis, Harry; Hammamieh, Rasha; Mayda, Maria; Jett, Marti; Patterson, Jean
2008-01-01
A single injection of ML29 reassortant vaccine for Lassa fever induces low, transient viremia, and low or moderate levels of ML29 replication in tissues of common marmosets depending on the dose of the vaccination. The vaccination elicits specific immune responses and completely protects marmosets against fatal disease by induction of sterilizing cell-mediated immunity. DNA array analysis of human peripheral blood mononuclear cells from healthy donors exposed to ML29 revealed that gene expression patterns in ML29-exposed PBMC and control, media-exposed PBMC, clustered together confirming safety profile of the ML29 in non-human primates. The ML29 reassortant is a promising vaccine candidate for Lassa fever. PMID:18692539
Recombinant vaccines: experimental and applied aspects
DEFF Research Database (Denmark)
Lorenzen, Niels
1999-01-01
Development of vaccines for aquaculture fish represent an important applied functional aspect of fish immunology research. Particularly in the case of recombinant vaccines, where a single antigen is usually expected to induce immunity to a specific pathogen, knowledge of mechanisms involved...... in induction of a protective immune response may become vital. The few recombinant vaccines licensd so far, despite much research during the last decade, illustrate that this is not a straightforward matter. However, as vaccine technology as well as our knowledge of the fish immune system is steadily improved......, these fields will open up a number of interesting research objectives of mutual benefit. Recent aspects of recombinant protein vaccines, live recombinant vaccines and DNA vaccines are discussed....
Progress towards a Leishmania vaccine.
Tabbara, Khaled S
2006-07-01
Leishmaniasis is a vector-born protozoan disease. Approximately 12 million individuals are affected worldwide with an estimated annual incidence of 1.5-2 million. Two clinical manifestations are recognized, cutaneous, and visceral, both of which are common in the Middle East. In both forms, infection is chronic, with potential deformities, persistence following cure, and lifelong risk of reactivation. Attempts to develop an effective human Leishmania vaccine have not yet succeeded. Leishmanization, a crude form of live vaccination historically originated in this part of the world. Experimental vaccination has been extensively studied in model animals in the past 2 decades. In this review, major human killed vaccine trials are surveyed, and modern trends in Leishmania vaccine development, including subunit vaccines, naked DNA vaccines, and transmission blocking vaccines are explored. Recent findings of a link between persistence of live parasites, and maintenance of long-term immunity suggest live vaccination with attenuated strains, as a future vaccination strategy.
Directory of Open Access Journals (Sweden)
Ling Ye
Full Text Available Several conserved neutralizing epitopes have been identified in the HIV Env protein and among these, the MPER of gp41 has received great attention and is widely recognized as a promising target. However, little success has been achieved in eliciting MPER-specific HIV neutralizing antibodies by a number of different vaccine strategies. We investigated the ability of HA/gp41 chimeric protein-based vaccines, which were designed to enhance the exposure of the MPER in its native conformation, to induce MPER-specific HIV neutralizing antibodies. In characterization of the HA/gp41 chimeric protein, we found that by mutating an unpaired Cys residue (Cys-14 in its HA1 subunit to a Ser residue, the modified chimeric protein HA-C14S/gp41 showed increased reactivity to a conformation-sensitive monoclonal antibody against HA and formed more stable trimers in VLPs. On the other hand, HA-C14S/gp41 and HA/gp41 chimeric proteins expressed on the cell surfaces exhibited similar reactivity to monoclonal antibodies 2F5 and 4E10. Immunization of guinea pigs using the HA-C14S/gp41 DNA or VLP vaccines induced antibodies against the HIV gp41 as well as to a peptide corresponding to a segment of MPER at higher levels than immunization by standard HIV VLPs. Further, sera from vaccinated guinea pigs were found to exhibit HIV neutralizing activities. Moreover, sera from guinea pigs vaccinated by HA-C14S/gp41 DNA and VLP vaccines but not the standard HIV VLPs, were found to neutralize HIV pseudovirions containing a SIV-4E10 chimeric Env protein. The virus neutralization could be blocked by a MPER-specific peptide, thus demonstrating induction of MPER-specific HIV neutralizing antibodies by this novel vaccine strategy. These results show that induction of MPER-specific HIV neutralizing antibodies can be achieved through a rationally designed vaccine strategy.
Directory of Open Access Journals (Sweden)
Barney S Graham
Full Text Available DNA vaccine immunogenicity has been limited by inefficient delivery. Needle-free delivery of DNA using a CO2-powered Biojector® device was compared to delivery by needle and syringe and evaluated for safety and immunogenicity.Forty adults, 18-50 years, were randomly assigned to intramuscular (IM vaccinations with DNA vaccine, VRC-HIVDNA016-00-VP, (weeks 0, 4, 8 by Biojector® 2000™ or needle and syringe (N/S and boosted IM at week 24 with VRC-HIVADV014-00-VP (rAd5 with N/S at 10(10 or 10(11 particle units (PU. Equal numbers per assigned schedule had low (≤500 or high (>500 reciprocal titers of preexisting Ad5 neutralizing antibody.120 DNA and 39 rAd5 injections were given; 36 subjects completed follow-up research sample collections. IFN-γ ELISpot response rates were 17/19 (89% for Biojector® and 13/17 (76% for N/S delivery at Week 28 (4 weeks post rAd5 boost. The magnitude of ELISpot response was about 3-fold higher in Biojector® compared to N/S groups. Similar effects on response rates and magnitude were observed for CD8+, but not CD4+ T-cell responses by ICS. Env-specific antibody responses were about 10-fold higher in Biojector-primed subjects.DNA vaccination by Biojector® was well-tolerated and compared to needle injection, primed for greater IFN-γ ELISpot, CD8+ T-cell, and antibody responses after rAd5 boosting.ClinicalTrials.gov NCT00109629.
Cysteine proteases as potential antigens in antiparasitic DNA vaccines
DEFF Research Database (Denmark)
Jørgensen, Louise von Gersdorff; Buchmann, Kurt
2011-01-01
En litteraturgennemgang af muligheder for at bruge cystein proteaser som antigener i antiparasitære vacciner.......En litteraturgennemgang af muligheder for at bruge cystein proteaser som antigener i antiparasitære vacciner....
Ebolavirus Vaccines: Progress in the Fight Against Ebola Virus Disease
Directory of Open Access Journals (Sweden)
Xiao-Xin Wu
2015-11-01
Full Text Available Ebolaviruses are highly infectious pathogens that cause lethal Ebola virus disease (EVD in humans and non-human primates (NHPs. Due to their high pathogenicity and transmissibility, as well as the potential to be misused as a bioterrorism agent, ebolaviruses would threaten the health of global populations if not controlled. In this review, we describe the origin and structure of ebolaviruses and the development of vaccines from the beginning of the 1980s, including conventional ebolavirus vaccines, DNA vaccines, Ebola virus-like particles (VLPs, vaccinia virus-based vaccines, Venezuelan equine encephalitis virus (VEEV-like replicon particles, Kunjin virus-based vaccine, recombinant Zaire Ebolavirus∆VP30, recombinant cytomegalovirus (CMV-based vaccines, recombinant rabies virus (RABV-based vaccines, recombinant paramyxovirus-based vaccines, adenovirus-based vaccines and vesicular stomatitis virus (VSV-based vaccines. No licensed vaccine or specific treatment is currently available to counteract ebolavirus infection, although DNA plasmids and several viral vector approaches have been evaluated as promising vaccine platforms. These vaccine candidates have been confirmed to be successful in protecting NHPs against lethal infection. Moreover, these vaccine candidates were successfully advanced to clinical trials. The present review provides an update of the current research on Ebola vaccines, with the aim of providing an overview on current prospects in the fight against EVD.
Munang'andu, Hetron M; Fredriksen, Børge N; Mutoloki, Stephen; Brudeseth, Bjørn; Kuo, Tsun-Yung; Marjara, Inderjit S; Dalmo, Roy A; Evensen, Øystein
2012-06-08
Two strains of IPNV made by reverse genetics on the Norwegian Sp strain NVI-015 (GenBank AY379740) backbone encoding the virulent (T(217)A(221)) and avirulent (P(217)T(221)) motifs were used to prepare inactivated whole virus (IWV), nanoparticle vaccines with whole virus, Escherichia coli subunit encoding truncated VP2-TA and VP2-PT, VP2-TA and VP2-PT fusion antigens with putative translocating domains of Pseudomonas aeruginosa exotoxin, and plasmid DNA encoding segment A of the TA strain. Post challenge survival percentages (PCSP) showed that IWV vaccines conferred highest protection (PCSP=42-53) while nanoparticle, sub-unit recombinant and DNA vaccines fell short of the IWV vaccines in Atlantic salmon (Salmo salar L.) postsmolts challenged with the highly virulent Sp strain NVI-015 (TA strain) of IPNV after 560 degree days post vaccination. Antibody levels induced by these vaccines did not show antigenic differences between the virulent and avirulent motifs for vaccines made with the same antigen dose and delivery system after 8 weeks post vaccination. Our findings show that fish vaccinated with less potent vaccines comprising of nanoparticle, DNA and recombinant vaccines got infected much earlier and yielded to higher infection rates than fish vaccinated with IWV vaccines that were highly potent. Ability of the virulent (T(217)A(221)) and avirulent (P(217)T(221)) motifs to limit establishment of infection showed equal protection for vaccines made of the same antigen dose and delivery systems. Prevention of tissue damage linked to viral infection was eminent in the more potent vaccines than the less protective ones. Hence, there still remains the challenge of developing highly efficacious vaccines with the ability to eliminate the post challenge carrier state in IPNV vaccinology. Copyright © 2012 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Riedl, Petra; Wieland, Andreas; Lamberth, Kasper
2009-01-01
Immunodominance limits the TCR diversity of specific antiviral CD8 T cell responses elicited by vaccination or infection. To prime multispecific T cell responses, we constructed DNA vaccines that coexpress chimeric, multidomain Ags (with CD8 T cell-defined epitopes of the hepatitis B virus (HBV...... cell immunity by multidomain Ags. The "weak" (i.e., easily suppressed) K(b)/C(93-100)-specific CD8 T cell response was efficiently elicited by a HBV core Ag-encoding vector in 1.4HBV-S(mut) tg mice (that harbor a replicating HBV genome that produces HBV surface, core, and precore Ag in the liver). K......(b)/C(93-100)-specific CD8 T cells accumulated in the liver of vaccinated 1.4HBV-S(mut) transgenic mice where they suppressed HBV replication. Subdominant epitopes in vaccines can hence prime specific CD8 T cell immunity in a tolerogenic milieu that delivers specific antiviral effects to HBV...
Petkevičiūtė, D; Pasi, M; Gonzalez, O; Maddocks, J H
2014-11-10
cgDNA is a package for the prediction of sequence-dependent configuration-space free energies for B-form DNA at the coarse-grain level of rigid bases. For a fragment of any given length and sequence, cgDNA calculates the configuration of the associated free energy minimizer, i.e. the relative positions and orientations of each base, along with a stiffness matrix, which together govern differences in free energies. The model predicts non-local (i.e. beyond base-pair step) sequence dependence of the free energy minimizer. Configurations can be input or output in either the Curves+ definition of the usual helical DNA structural variables, or as a PDB file of coordinates of base atoms. We illustrate the cgDNA package by comparing predictions of free energy minimizers from (a) the cgDNA model, (b) time-averaged atomistic molecular dynamics (or MD) simulations, and (c) NMR or X-ray experimental observation, for (i) the Dickerson-Drew dodecamer and (ii) three oligomers containing A-tracts. The cgDNA predictions are rather close to those of the MD simulations, but many orders of magnitude faster to compute. Both the cgDNA and MD predictions are in reasonable agreement with the available experimental data. Our conclusion is that cgDNA can serve as a highly efficient tool for studying structural variations in B-form DNA over a wide range of sequences. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Tomorrow's vector vaccines for small ruminants.
Kyriakis, C S
2015-12-14
Inactivated and attenuated vaccines have contributed to the control or even the eradication of significant animal pathogens. However, these traditional vaccine technologies have limitations and disadvantages. Inactivated vaccines lack efficacy against certain pathogens, while attenuated vaccines are not always as safe. New technology vaccines, namely DNA and recombinant viral vector vaccines, are being developed and tested against pathogens of small ruminants. These vaccines induce both humoral and cellular immune responses, are safe to manufacture and use and can be utilized in strategies for differentiation of infected from vaccinated animals. Although there are more strict regulatory requirements for the safety standards of these vaccines, once a vaccine platform is evaluated and established, effective vaccines can be rapidly produced and deployed in the field to prevent spread of emerging pathogens. The present article offers an introduction to these next generation technologies and examples of vaccines that have been tested against important diseases of sheep and goats. Copyright © 2015 Elsevier B.V. All rights reserved.
DENGUE VACCINE, CHALLENGES, DEVELOPMENT AND STRATEGIES
Directory of Open Access Journals (Sweden)
Dewi Marbawati
2014-08-01
Full Text Available ABSTRAKPenyakit demam Dengue endemik di lebih dari 100 negara di dunia. Obat anti virus Dengue efektif belum ditemukan danpengendalian vektor dinilai kurang efektif, sehingga diperlukan upaya pencegahan dengan vaksinasi. Vaksin Dengue yangideal adalah murah, mencakup 4 serotipe, efektif dalam memberikan kekebalan, cukup diberikan sekali seumur hidup, aman,memberi kekebalan jangka panjang, stabil dalam penyimpanan dan stabil secara genetis (tidak bermutasi. Beberapakandidat vaksin yang telah dan sedang dikembangkan oleh para peneliti di seluruh dunia adalah tetravalent live attenuatedvaccine, vaksin Chimera (ChimeriVax, vaksin subunit dan vaksin DNA. Vaksin Dengue dipandang sebagai pendekatan yangefektif dan berkesinambungan dalam mengendalikan penyakit Dengue. Tahun 2003 telah terbentuk Pediatric DengueVaccine Initiative (PDVI, yaitu sebuah konsorsium internasional yang bergerak dalam advokasi untuk meyakinkanmasyarakat internasional akan penting dan mendesaknya vaksin Dengue. Konsorsium vaksin Dengue Indonesia saat iniberupaya mengembangkan vaksin Dengue dengan menggunakan strain virus lokal.Kata kunci: Dengue, virus, vaksinABSTRACTDengue fever is endemic in more than 100 countries in the world. The effective dengue antiviral drug has not been found yet,and vector control is considered less effective. Prevention program by vaccination is needed. An ideal dengue vaccine shouldbe inexpensive, covering four serotypes (tetravalent, effective in providing immunity, given once a lifetime, safe, stable instorage and genetically. Several vaccine candidates have been and are being developed included attenuated tetravalentvaccine, ChimeriVax, sub- unit vaccines and DNA vaccines. Dengue vaccine is seen as an effective and sustainable approachto controll Dengue infection. In 2003, Pediatric Dengue Vaccine Initiative (PDVI has been formed as an internationalconsortium involved in advocacy to convince the international community about the essence and urgency
DEFF Research Database (Denmark)
Fomsgaard, A; Nielsen, H V; Kirkby, N
1999-01-01
degree of controllability. We have examined the induction of murine CTL's by this approach using DNA plasmid minigene vaccines encoding known mouse K(k) minimal CTL epitopes (8 amino acids) from the influenza A virus hemagglutinin and nucleoprotein. We here report that such an approach is feasible...
International Nuclear Information System (INIS)
Zhou Hongsheng; Zhang Donghua; Wang Yaya; Dai Ming; Zhang Lu; Liu Wenli; Liu Dan; Tan Huo; Huang Zhenqian
2006-01-01
CML28 is an attractive target for antigen-specific immunotherapy. SOCS1 represents an inhibitory control mechanism for DC antigen presentation and the magnitude of adaptive immunity. In this study, we evaluated the potential for inducing CML28-specific cytotoxic T lymphocytes (CTL) responses by dendritic cells (DCs)-based vaccination. We constructed a CML28 DNA vaccine and a SOCS1 siRNA vector and then cotransfect monocyte-derived DCs. Flow cytometry analysis showed gene silencing of SOCS1 resulted in higher expressions of costimulative moleculars in DCs. Mixed lymphocyte reaction (MLR) indicated downregulation of SOCS1 stronger capability to stimulate proliferation of responder cell in DCs. The CTL assay revealed transfected DCs effectively induced autologous CML28-specific CTL responses and the lytic activities induced by SOCS1-silenced DCs were significantly higher compared with those induced by SOCS1-expressing DCs. These results in our study indicates gene silencing of SOCS1 remarkably enhanced the cytotoxicity efficiency of CML28 DNA vaccine in DCs
Increased mitochondrial DNA deletions and copy number in transfusion-dependent thalassemia
Calloway, Cassandra
2016-01-01
BACKGROUND. Iron overload is the primary cause of morbidity in transfusion-dependent thalassemia. Increase in iron causes mitochondrial dysfunction under experimental conditions, but the occurrence and significance of mitochondrial damage is not understood in patients with thalassemia. METHODS. Mitochondrial DNA (mtDNA) to nuclear DNA copy number (Mt/N) and frequency of the common 4977-bp mitochondrial deletion (ΔmtDNA4977) were quantified using a quantitative PCR assay on whole blood samples from 38 subjects with thalassemia who were receiving regular transfusions. RESULTS. Compared with healthy controls, Mt/N and ΔmtDNA4977 frequency were elevated in thalassemia (P = 0.038 and P 15 mg/g dry-weight or splenectomy, with the highest levels observed in subjects who had both risk factors (P = 0.003). Myocardial iron (MRI T2* 40/1 × 107 mtDNA, respectively (P = 0.025). Subjects with Mt/N values below the group median had significantly lower Matsuda insulin sensitivity index (5.76 ± 0.53) compared with the high Mt/N group (9.11 ± 0.95, P = 0.008). CONCLUSION. Individuals with transfusion-dependent thalassemia demonstrate age-related increase in mtDNA damage in leukocytes. These changes are markedly amplified by splenectomy and are associated with extrahepatic iron deposition. Elevated mtDNA damage in blood cells may predict the risk of iron-associated organ damage in thalassemia. FUNDING. This project was supported by Children’s Hospital & Research Center Oakland Institutional Research Award and by the National Center for Advancing Translational Sciences, NIH, through UCSF-CTSI grant UL1 TR000004. PMID:27583305
Viegas, Edna Omar; Tembe, Nelson; Nilsson, Charlotta; Meggi, Bindiya; Maueia, Cremildo; Augusto, Orvalho; Stout, Richard; Scarlatti, Gabriella; Ferrari, Guido; Earl, Patricia L; Wahren, Britta; Andersson, Sören; Robb, Merlin L; Osman, Nafissa; Biberfeld, Gunnel; Jani, Ilesh; Sandström, Eric
2017-11-27
We assessed the safety and immunogenicity of HIV-DNA priming using Zetajet™, a needle-free device intradermally followed by intramuscular HIV-MVA boosts, in 24 healthy Mozambicans. Volunteers were randomized to receive three immunizations of 600 μg (n = 10; 2 × 0.1 ml) or 1,200 μg (n = 10; 2 × 0.2 ml) of HIV-DNA (3 mg/ml), followed by two boosts of 10 8 pfu HIV-MVA. Four subjects received placebo saline injections. Vaccines and injections were safe and well tolerated with no difference between the two priming groups. After three HIV-DNA immunizations, IFN-γ ELISpot responses to Gag were detected in 9/17 (53%) vaccinees, while none responded to Envelope (Env). After the first HIV-MVA, the overall response rate to Gag and/or Env increased to 14/15 (93%); 14/15 (93%) to Gag and 13/15 (87%) to Env. There were no significant differences between the immunization groups in frequency of response to Gag and Env or magnitude of Gag responses. Env responses were significantly higher in the higher dose group (median 420 vs. 157.5 SFC/million peripheral blood mononuclear cell, p = .014). HIV-specific antibodies to subtype C gp140 and subtype B gp160 were elicited in all vaccinees after the second HIV-MVA, without differences in titers between the groups. Neutralizing antibody responses were not detected. Two (13%) of 16 vaccinees, one in each of the priming groups, exhibited antibodies mediating antibody-dependent cellular cytotoxicity to CRF01_AE. In conclusion, HIV-DNA vaccine delivered intradermally in volumes of 0.1-0.2 ml using Zetajet was safe and well tolerated. Priming with the 1,200 μg dose of HIV-DNA generated higher magnitudes of ELISpot responses to Env.
Current status of flavivirus vaccines.
Barrett, A D
2001-12-01
Although there are approximately 68 flaviviruses recognized, vaccines have been developed to control very few human flavivirus diseases. Licensed live attenuated vaccines have been developed for yellow fever (strain 17D) and Japanese encephalitis (strain SA14-14-2) viruses, and inactivated vaccines have been developed for Japanese encephalitis and tick-borne encephalitis viruses. The yellow fever live attenuated 17D vaccine is one of the most efficacious and safe vaccines developed to date and has been used to immunize more than 300 million people. A number of experimental vaccines are being developed, most notably for dengue. Candidate tetravalent live attenuated dengue vaccines are undergoing clinical trials. Other vaccines are being developed using reverse genetics, DNA vaccines, and recombinant immunogens. In addition, the yellow fever 17D vaccine has been used as a backbone to generate chimeric viruses containing the premembrane and envelope protein genes from other flaviviruses. The "Chimerivax" platform has been used to construct chimeric Japanese encephalitis and dengue viruses that are in different phases of development. Similar strategies are being used by other laboratories.
Rational design of gene-based vaccines.
Barouch, Dan H
2006-01-01
Vaccine development has traditionally been an empirical discipline. Classical vaccine strategies include the development of attenuated organisms, whole killed organisms, and protein subunits, followed by empirical optimization and iterative improvements. While these strategies have been remarkably successful for a wide variety of viruses and bacteria, these approaches have proven more limited for pathogens that require cellular immune responses for their control. In this review, current strategies to develop and optimize gene-based vaccines are described, with an emphasis on novel approaches to improve plasmid DNA vaccines and recombinant adenovirus vector-based vaccines. Copyright 2006 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.
Ebolavirus Vaccines: Progress in the Fight Against Ebola Virus Disease.
Wu, Xiao-Xin; Yao, Hang-Ping; Wu, Nan-Ping; Gao, Hai-Nv; Wu, Hai-Bo; Jin, Chang-Zhong; Lu, Xiang-Yun; Xie, Tian-Shen; Li, Lan-Juan
2015-01-01
Ebolaviruses are highly infectious pathogens that cause lethal Ebola virus disease (EVD) in humans and non-human primates (NHPs). Due to their high pathogenicity and transmissibility, as well as the potential to be misused as a bioterrorism agent, ebolaviruses would threaten the health of global populations if not controlled. In this review, we describe the origin and structure of ebolaviruses and the development of vaccines from the beginning of the 1980s, including conventional ebolavirus vaccines, DNA vaccines, Ebola virus-like particles (VLPs), vaccinia virus-based vaccines, Venezuelan equine encephalitis virus (VEEV)-like replicon particles, Kunjin virus-based vaccine, recombinant Zaire Ebolavirusx2206;VP30, recombinant cytomegalovirus (CMV)-based vaccines, recombinant rabies virus (RABV)-based vaccines, recombinant paramyxovirus-based vaccines, adenovirus-based vaccines and vesicular stomatitis virus (VSV)-based vaccines. No licensed vaccine or specific treatment is currently available to counteract ebolavirus infection, although DNA plasmids and several viral vector approaches have been evaluated as promising vaccine platforms. These vaccine candidates have been confirmed to be successful in protecting NHPs against lethal infection. Moreover, these vaccine candidates were successfully advanced to clinical trials. The present review provides an update of the current research on Ebola vaccines, with the aim of providing an overview on current prospects in the fight against EVD. © 2015 The Author(s) Published by S. Karger AG, Basel.
Carfora, Anna; Cassandro, Paola; Feola, Alessandro; La Sala, Francesco; Petrella, Raffaella; Borriello, Renata
2018-03-01
Different immunotherapeutic approaches are in the pipeline for the treatment of drug dependence. "Drug vaccines" aim to induce the immune system to produce antibodies that bind to drugs and prevent them from inducing rewarding effects in the brain. Drugs of abuse currently being tested using these new approaches are opioids, nicotine, cocaine, and methamphetamine. In human clinical trials, "cocaine and nicotine vaccines" have been shown to induce sufficient antibody levels while producing few side effects. Studies in humans, determining how these vaccines interact in combination with their target drug, are underway. However, although vaccines can become a reasonable treatment option for drugs of abuse, there are several disadvantages that must be considered. These include i) great individual variability in the formation of antibodies, ii) the lack of protection against a structurally dissimilar drug that produces the same effects as the drug of choice, and iii) the lack of an effect on the drug desire that may predispose an addict to relapse. In addition, a comprehensive overview of several crucial ethical issues has not yet been widely discussed in order to have not only a biological approach to immunotherapy of addiction. Overall, immunotherapy offers a range of possible treatment options: the pharmacological treatment of addiction, the treatment of overdoses, the prevention of toxicity to the brain or the heart, and the protection of the fetus during pregnancy. So far, the results obtained from a small-scale experiment using vaccines against cocaine and nicotine suggest that a number of important technical challenges still need to be overcome before such vaccines can be approved for clinical use.
Directory of Open Access Journals (Sweden)
Marieke van der Heiden
2018-01-01
Full Text Available BackgroundPrevention of infectious diseases is of high priority in the rapidly aging population. Unfortunately, vaccine responses in the elderly are frequently diminished. Timely vaccination of middle-aged adults might improve the immune responses to vaccines, although knowledge on pathogen-specific immune responses and factors affecting these responses, in middle-aged adults is currently limited. We thus investigated the immune responses after vaccination with Zostavax consisting of live-attenuated varicella zoster virus (VZV.MethodsBlood samples were taken pre-, 14 days, 28 days, and 1 year after a primary VZV vaccination (Zostavax at middle age (N = 53, 50–65 years of age. VZV-specific IFNγ-producing cells were measured by ELISpot, activated T-cells by flow cytometry, antibody levels and cytokine responses by fluorescent bead-based multiplex immunoassays, and whole blood cellular kinetics by TruCOUNT analysis.ResultsRobust short-term enhancement of the VZV-specific IFNγ-producing cell numbers was observed post-vaccination in the middle-aged adults. Remarkably, long-term enhancement of VZV-specific IFNγ-producing cell numbers was induced only in participants with low numbers of VZV-specific pre-vaccination IFNγ-producing cells, who were significantly older. These participants also showed enhancement of VZV-specific activated CD4 T-cells, contrary to “exhausted” VZV-specific CD8 T-cells in participants with high numbers of VZV-specific pre-vaccination IFNγ-producing cells. Finally, a high CD4/CD8 T-cell ratio was associated with low numbers of pre-vaccination VZV-specific IFNγ-producing cells.ConclusionThese results suggest that adults in their early sixties, who showed a high CD4/CD8 T-cell ratio and low numbers of VZV-specific IFNγ-producing cells, benefit from VZV vaccination. This provides important knowledge on factors affecting VZV-specific immune responses in middle-aged adults as well as for strategies to
Directory of Open Access Journals (Sweden)
Cambridge CD
2013-05-01
Full Text Available Chino D Cambridge, Shree R Singh, Alain B Waffo, Stacie J Fairley, Vida A DennisCenter for NanoBiotechnology Research (CNBR, Alabama State University, Montgomery, AL, USAAbstract: Chlamydia trachomatis is a bacterial sexually transmitted infection affecting millions of people worldwide. Previous vaccination attempts have employed the recombinant major outer membrane protein (MOMP of C. trachomatis nonetheless, with limited success, perhaps, due to stability, degradation, and delivery issues. In this study we cloned C. trachomatis recombinant MOMP DNA (DMOMP and encapsulated it in chitosan nanoparticles (DMCNP using the complex coacervation technique. Physiochemical characterizations of DMCNP included transmission and scanning electron microcopy, Fourier transform infrared and ultraviolet-visible spectroscopy, and zeta potential. Encapsulated DMOMP was 167–250 nm, with a uniform spherical shape and homogenous morphology, and an encapsulation efficiency > 90%. A slow release pattern of encapsulated DMOMP, especially in acidic solution, was observed over 7 days. The zeta potential of DMCNP was ~8.80 mV, which indicated that it was highly stable. Toxicity studies of DMCNP (25–400 µg/mL to Cos-7 cells using the MTT assay revealed minimal toxicity over 24–72 hours with >90% viable cells. Ultra-violet visible (UV-vis spectra indicated encapsulated DMOMP protection by chitosan, whereas agarose gel electrophoresis verified its protection from enzymatic degradation. Expression of MOMP protein in DMCNP-transfected Cos-7 cells was demonstrated via Western blotting and immunofluorescence microscopy. Significantly, intramuscular injection of BALB/c mice with DMCNP confirmed the delivery of encapsulated DMOMP, and expression of the MOMP gene transcript in thigh muscles and spleens. Our data show that encapsulation of DMOMP in biodegradable chitosan nanoparticles imparts stability and protection from enzymatic digestion, and enhances delivery and
Activation of cGAS-dependent antiviral responses by DNA intercalating agents.
Pépin, Geneviève; Nejad, Charlotte; Thomas, Belinda J; Ferrand, Jonathan; McArthur, Kate; Bardin, Philip G; Williams, Bryan R G; Gantier, Michael P
2017-01-09
Acridine dyes, including proflavine and acriflavine, were commonly used as antiseptics before the advent of penicillins in the mid-1940s. While their mode of action on pathogens was originally attributed to their DNA intercalating activity, work in the early 1970s suggested involvement of the host immune responses, characterized by induction of interferon (IFN)-like activities through an unknown mechanism. We demonstrate here that sub-toxic concentrations of a mixture of acriflavine and proflavine instigate a cyclic-GMP-AMP (cGAMP) synthase (cGAS)-dependent type-I IFN antiviral response. This pertains to the capacity of these compounds to induce low level DNA damage and cytoplasmic DNA leakage, resulting in cGAS-dependent cGAMP-like activity. Critically, acriflavine:proflavine pre-treatment of human primary bronchial epithelial cells significantly reduced rhinovirus infection. Collectively, our findings constitute the first evidence that non-toxic DNA binding agents have the capacity to act as indirect agonists of cGAS, to exert potent antiviral effects in mammalian cells. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Directory of Open Access Journals (Sweden)
Wei Li
2013-12-01
Full Text Available Recent studies indicate that DNA immunization is powerful in eliciting antigen-specific antibody responses in both animal and human studies. However, there is limited information on the mechanism of this effect. In particular, it is not known whether DNA immunization can also enhance the development of antigen-specific B cell development. In this report, a pilot study was conducted using plague LcrV immunogen as a model system to determine whether DNA immunization is able to enhance LcrV-specific B cell development in mice. Plague is an acute and often fatal infectious disease caused by Yersinia pestis (Y. pestis. Humoral immune responses provide critical protective immunity against plague. Previously, we demonstrated that a DNA vaccine expressing LcrV antigen can protect mice from lethal mucosal challenge. In the current study, we further evaluated whether the use of a DNA priming immunization is able to enhance the immunogenicity of a recombinant LcrV protein vaccine, and in particular, the development of LcrV-specific B cells. Our data indicate that DNA immunization was able to elicit high-level LcrV antibody responses when used alone or as part of a prime-boost immunization approach. Most significantly, DNA immunization was also able to increase the levels of LcrV-specific B cell development. The finding that DNA immunization can enhance antigen-specific B cell responses is highly significant and will help guide similar studies in other model antigen systems.
DEFF Research Database (Denmark)
Zhao, A.; Gray, F. C; MacNeill, S. A.
2006-01-01
DNA ligases join the ends of DNA molecules during replication, repair and recombination. ATP-dependent ligases are found predominantly in the eukarya and archaea whereas NAD+-dependent DNA ligases are found only in the eubacteria and in entomopoxviruses. Using the genetically tractable halophile....... volcanii also encodes an NAD+-dependent DNA ligase family member, LigN, the first such enzyme to be identified in the archaea, and present phylogenetic analysis indicating that the gene encoding this protein has been acquired by lateral gene transfer (LGT) from eubacteria. As with LigA, we show that Lig...
Enhanced Delivery and Potency of Self-Amplifying mRNA Vaccines by Electroporation in Situ
Directory of Open Access Journals (Sweden)
Kaustuv Banerjee
2013-08-01
Full Text Available Nucleic acid-based vaccines such as viral vectors, plasmid DNA (pDNA, and mRNA are being developed as a means to address limitations of both live-attenuated and subunit vaccines. DNA vaccines have been shown to be potent in a wide variety of animal species and several products are now licensed for commercial veterinary but not human use. Electroporation delivery technologies have been shown to improve the generation of T and B cell responses from synthetic DNA vaccines in many animal species and now in humans. However, parallel RNA approaches have lagged due to potential issues of potency and production. Many of the obstacles to mRNA vaccine development have recently been addressed, resulting in a revival in the use of non-amplifying and self-amplifying mRNA for vaccine and gene therapy applications. In this paper, we explore the utility of EP for the in vivo delivery of large, self-amplifying mRNA, as measured by reporter gene expression and immunogenicity of genes encoding HIV envelope protein. These studies demonstrated that EP delivery of self-amplifying mRNA elicited strong and broad immune responses in mice, which were comparable to those induced by EP delivery of pDNA.
Deep insight into white spot syndrome virus vaccines: A review
Directory of Open Access Journals (Sweden)
MA Badhul Haq
2012-02-01
Full Text Available White spot syndrome virus (WSSV, the causative virus of the disease, is found in most shrimp farming areas of the world, where it causes large economic losses to the shrimp farming industry. The potentially fatal virus has been found to be a threat not only to all shrimp species, but also to other marine and freshwater crustaceans, such as crab and crayfish. To date, no effective prophylactic treatment measures are available for viral infections in shrimp and other crustaceans. Due to current aquaculture practices and the broad host range of WSSV, intervention strategies including vaccination against this virus would be pivotal to save and protect shrimp farming. Several achievements have been attained in the search of novel vaccines for WSSV. DNA vaccination, recombinant vaccines, oral vaccination techniques and gene therapy are some of the thrust areas of focus for scientists and researchers. This review article highlights the recent trends in the development of WSSV vaccines either as DNA vaccines or recombinant vaccines and their functioning strategies as suggested by the researchers worldwide.
International Nuclear Information System (INIS)
Bu Zhigao; Ye Ling; Compans, Richard W.; Yang Chinglai
2003-01-01
Codon-optimized genes were synthesized for the SIVmac239 Gag, a mutant Gag with mutations in the major homology region, and a chimeric Gag containing a protein destruction signal at the N-terminus of Gag. The mutant and chimeric Gag were expressed at levels comparable to that observed for the wild-type Gag protein but their stability and release into the medium were found to be significantly reduced. Immunization of mice with DNA vectors encoding the mutant or chimeric Gag induced fourfold higher levels of anti-SIV Gag CD4 T cell responses than the DNA vector encoding the wild-type SIV Gag. Moreover, anti-SIV Gag CD8 T cell responses induced by DNA vectors encoding the mutant or chimeric Gag were found to be 5- to 10-fold higher than those induced by the DNA construct for the wild-type Gag. These results indicate that mutations disrupting assembly and/or stability of the SIV Gag protein effectively enhance its immunogenicity when expressed from DNA vaccines
Directory of Open Access Journals (Sweden)
Roberto eRiquelme-Neira
2016-01-01
Full Text Available Enterohemorrhagic Escherichia coli (EHEC O157:H7 is the predominant causative agent of hemorrhagic colitis in humans and is the cause of haemolytic uraemic syndrome and other illnesses. Cattle have been implicated as the main reservoir of this organism. Here, we evaluated the immunogenicity and protective efficacy of a DNA vaccine encoding conserved sequences of truncated EHEC factor for adherence-1 (efa-1’ in a mouse model. Intranasal administration of plasmid DNA carrying the efa-1’ gene (pVAXefa-1’ into C57BL/6 mice elicited both humoral and cellular immune responses. In animals immunized with pVAXefa-1`, EHEC-secreted protein-specific IgM and IgG antibodies were detected in sera at day 45. Anti-EHEC-secreted protein sIgA was also detected in nasal and bronchoalveolar lavages. In addition, antigen-specific T-cell-proliferation, IL-10 and IFN-γ were observed upon re-stimulation with either heat-killed bacteria or EHEC-secreted proteins. Vaccinated animals were also protected against challenge with E. coli O157:H7 strain EDL933. These results suggest that DNA vaccine encoding efa-1´ have therapeutic potential in interventions against EHEC infections. This approach could lead to a new strategy in the production of vaccines that prevent infections in cattle.
The recent progress in RSV vaccine technology.
Fretzayas, Andrew; Papadopoulou, Anna; Kotzia, Doxa; Moustaki, Maria
2012-12-01
The most effective way to control RSV infection would be the development of an expedient and safe vaccine. Subunit vaccines, live attenuated RSV vaccines, plasmid DNA vaccines have been tested either in human or in mouse models without reaching the ultimate goal of efficacy and safety, at least in humans. Viruses such as adenovirus, sendai virus, measles virus were also used as vectors for the generation of RSV vaccines with promising results in animal models. Recent patents describe new techniques for the generation of candidate vaccines. These patents include virus like particles as vaccine platforms, recombinant RSVs or modified RSV F protein as component of the vaccine. Despite the number of the candidate vaccines, the new RSV vaccines should overcome many obstacles before being established as effective vaccines for the control of RSV infections especially for the young infants who are more susceptible to the virus.
Induction of protective immune responses in mice by double DNA ...
African Journals Online (AJOL)
Keywords: Multiple DNA vaccine, Omp31 gene, Brucella melitensis, Eae gene, Escherichia ... Abstract, Chemical Abstracts, Embase, Index Copernicus, EBSCO, African .... a 1 % agarose gel in 1× TBE buffer, followed by ... manufacturer's protocol, the recombinant ..... Moreno S, Timon M. DNA vaccination: an immunological.
Directory of Open Access Journals (Sweden)
Myrna C Bonaldo
2000-01-01
Full Text Available The Flaviviridae is a family of about 70 mostly arthropod-borne viruses many of which are major public health problems with members being present in most continents. Among the most important are yellow fever (YF, dengue with its four serotypes and Japanese encephalitis virus. A live attenuated virus is used as a cost effective, safe and efficacious vaccine against YF but no other live flavivirus vaccines have been licensed. The rise of recombinant DNA technology and its application to study flavivirus genome structure and expression has opened new possibilities for flavivirus vaccine development. One new approach is the use of cDNAs encopassing the whole viral genome to generate infectious RNA after in vitro transcription. This methodology allows the genetic mapping of specific viral functions and the design of viral mutants with considerable potential as new live attenuated viruses. The use of infectious cDNA as a carrier for heterologous antigens is gaining importance as chimeric viruses are shown to be viable, immunogenic and less virulent as compared to the parental viruses. The use of DNA to overcome mutation rates intrinsic of RNA virus populations in conjunction with vaccine production in cell culture should improve the reliability and lower the cost for production of live attenuated vaccines. The YF virus despite a long period ignored by researchers probably due to the effectiveness of the vaccine has made a come back, both in nature as human populations grow and reach endemic areas as well as in the laboratory being a suitable model to understand the biology of flaviviruses in general and providing new alternatives for vaccine development through the use of the 17D vaccine strain.
Directory of Open Access Journals (Sweden)
Eva Calvo-Pinilla
Full Text Available Bluetongue virus (BTV belongs to the genus Orbivirus within the family Reoviridae. The development of vector-based vaccines expressing conserved protective antigens results in increased immune activation and could reduce the number of multiserotype vaccinations required, therefore providing a cost-effective product. Recent recombinant DNA technology has allowed the development of novel strategies to develop marker and safe vaccines against BTV. We have now engineered naked DNAs and recombinant modified vaccinia virus Ankara (rMVA expressing VP2, VP7 and NS1 proteins from BTV-4. IFNAR((-/- mice inoculated with DNA/rMVA-VP2,-VP7-NS1 in an heterologous prime boost vaccination strategy generated significant levels of antibodies specific of VP2, VP7, and NS1, including those with neutralizing activity against BTV-4. In addition, vaccination stimulated specific CD8(+ T cell responses against these three BTV proteins. Importantly, the vaccine combination expressing NS1, VP2 and VP7 proteins of BTV-4, elicited sterile protection against a lethal dose of homologous BTV-4 infection. Remarkably, the vaccine induced cross-protection against lethal doses of heterologous BTV-8 and BTV-1 suggesting that the DNA/rMVA-VP2,-VP7,-NS1 marker vaccine is a promising multiserotype vaccine against BTV.
Is photocleavage of DNA by YOYO-1 using a synchrotron radiation light source sequence dependent?
DEFF Research Database (Denmark)
Gilroy, Emma L.; Hoffmann, Søren Vrønning; Jones, Nykola C.
2011-01-01
) throughout the irradiation period. The dependence of LD signals on DNA sequences and on time in the intense light beam was explored and quantified for single-stranded poly(dA), poly[(dA-dT)2], calf thymus DNA (ctDNA) and Micrococcus luteus DNA (mlDNA). The DNA and ligand regions of the spectrum showed...
Directory of Open Access Journals (Sweden)
Niranjan Y. Sardesai
2013-07-01
Full Text Available Lassa virus (LASV causes a severe, often fatal, hemorrhagic fever endemic to West Africa. Presently, there are no FDA-licensed medical countermeasures for this disease. In a pilot study, we constructed a DNA vaccine (pLASV-GPC that expressed the LASV glycoprotein precursor gene (GPC. This plasmid was used to vaccinate guinea pigs (GPs using intramuscular electroporation as the delivery platform. Vaccinated GPs were protected from lethal infection (5/6 with LASV compared to the controls. However, vaccinated GPs experienced transient viremia after challenge, although lower than the mock-vaccinated controls. In a follow-on study, we developed a new device that allowed for both the vaccine and electroporation pulse to be delivered to the dermis. We also codon-optimized the GPC sequence of the vaccine to enhance expression in GPs. Together, these innovations resulted in enhanced efficacy of the vaccine. Unlike the pilot study where neutralizing titers were not detected until after virus challenge, modest neutralizing titers were detected in guinea pigs before challenge, with escalating titers detected after challenge. The vaccinated GPs were never ill and were not viremic at any timepoint. The combination of the codon-optimized vaccine and dermal electroporation delivery is a worthy candidate for further development.
Development and trial of vaccines against Brucella.
Lalsiamthara, Jonathan; Lee, John Hwa
2017-08-31
The search for ideal brucellosis vaccines remains active today. Currently, no licensed human or canine anti-brucellosis vaccines are available. In bovines, the most successful vaccine (S19) is only used in calves, as adult vaccination results in orchitis in male, prolonged infection, and possible abortion complications in pregnant female cattle. Another widely deployed vaccine (RB51) has a low protective efficacy. An ideal vaccine should exhibit a safe profile as well as enhance protective efficacy. However, currently available vaccines exhibit one or more major drawbacks. Smooth live attenuated vaccines suffer shortcomings such as residual virulence and serodiagnostic interference. Inactivated vaccines, in general, confer relatively low levels of protection. Recent developments to improve brucellosis vaccines include generation of knockout mutants by targeting genes involved in metabolism, virulence, and the lipopolysaccharide synthesis pathway, as well as generation of DNA vaccines, mucosal vaccines, and live vectored vaccines, have all produced varying degrees of success. Herein, we briefly review the bacteriology, pathogenesis, immunological implications, candidate vaccines, vaccinations, and models related to Brucella .
ATM-dependent pathways of chromatin remodelling and oxidative DNA damage responses.
Berger, N Daniel; Stanley, Fintan K T; Moore, Shaun; Goodarzi, Aaron A
2017-10-05
Ataxia-telangiectasia mutated (ATM) is a serine/threonine protein kinase with a master regulatory function in the DNA damage response. In this role, ATM commands a complex biochemical network that signals the presence of oxidative DNA damage, including the dangerous DNA double-strand break, and facilitates subsequent repair. Here, we review the current state of knowledge regarding ATM-dependent chromatin remodelling and epigenomic alterations that are required to maintain genomic integrity in the presence of DNA double-strand breaks and/or oxidative stress. We will focus particularly on the roles of ATM in adjusting nucleosome spacing at sites of unresolved DNA double-strand breaks within complex chromatin environments, and the impact of ATM on preserving the health of cells within the mammalian central nervous system.This article is part of the themed issue 'Chromatin modifiers and remodellers in DNA repair and signalling'. © 2017 The Author(s).
International Nuclear Information System (INIS)
Nakada, Shinichiro
2016-01-01
The E3 ubiquitin ligases ring finger protein (RNF) 8 and RNF168 transduce the DNA double-strand break (DSB) response (DDR) signal by ubiquitinating DSB sites. The depletion of RNF8 or RNF168 suppresses the accumulation of DNA-repair regulating factors such as 53BP1 and RAP80 at DSB sites, suggesting roles for RNF8- and RNF168-mediated ubiquitination in DSB repair. This mini-review provides a brief overview of the RNF8- and RNF168-dependent DDR-signaling and DNA-repair pathways. The choice of DNA-repair pathway when RNF8- and RNF168-mediated ubiquitination-dependent DDR signaling is negatively regulated by deubiquitinating enzymes (DUBs) is reviewed to clarify how the opposing roles of RNF8/RNF168 and DUBs regulate ubiquitination-dependent DDR signaling and the choice of DNA-repair pathway
Genome-Derived Cytosolic DNA Mediates Type I Interferon-Dependent Rejection of B Cell Lymphoma Cells
Directory of Open Access Journals (Sweden)
Yu J. Shen
2015-04-01
Full Text Available The DNA damage response (DDR induces the expression of type I interferons (IFNs, but the underlying mechanisms are poorly understood. Here, we show the presence of cytosolic DNA in different mouse and human tumor cells. Treatment of cells with genotoxic agents increased the levels of cytosolic DNA in a DDR-dependent manner. Cloning of cytosolic DNA molecules from mouse lymphoma cells suggests that cytosolic DNA is derived from unique genomic loci and has the potential to form non-B DNA structures, including R-loops. Overexpression of Rnaseh1, which resolves R-loops, reduced the levels of cytosolic DNA, type I Ifn transcripts, and type I IFN-dependent rejection of lymphoma cells. Live-cell imaging showed a dynamic contact of cytosolic DNA with mitochondria, an important organelle for innate immune recognition of cytosolic nucleotides. In summary, we found that cytosolic DNA is present in many tumor cells and contributes to the immunogenicity of tumor cells.
Farjami, Elaheh; Clima, Lilia; Gothelf, Kurt V; Ferapontova, Elena E
2010-06-01
A DNA molecular beacon approach was used for the analysis of interactions between DNA and Methylene Blue (MB) as a redox indicator of a hybridization event. DNA hairpin structures of different length and guanine (G) content were immobilized onto gold electrodes in their folded states through the alkanethiol linker at the 5'-end. Binding of MB to the folded hairpin DNA was electrochemically studied and compared with binding to the duplex structure formed by hybridization of the hairpin DNA to a complementary DNA strand. Variation of the electrochemical signal from the DNA-MB complex was shown to depend primarily on the DNA length and sequence used: the G-C base pairs were the preferential sites of MB binding in the duplex. For short 20 nts long DNA sequences, the increased electrochemical response from MB bound to the duplex structure was consistent with the increased amount of bound and electrochemically readable MB molecules (i.e. MB molecules that are available for the electron transfer (ET) reaction with the electrode). With longer DNA sequences, the balance between the amounts of the electrochemically readable MB molecules bound to the hairpin DNA and to the hybrid was opposite: a part of the MB molecules bound to the long-sequence DNA duplex seem to be electrochemically mute due to long ET distance. The increasing electrochemical response from MB bound to the short-length DNA hybrid contrasts with the decreasing signal from MB bound to the long-length DNA hybrid and allows an "off"-"on" genosensor development.
Sequence Dependencies of DNA Deformability and Hydration in the Minor Groove
Yonetani, Yoshiteru; Kono, Hidetoshi
2009-01-01
Abstract DNA deformability and hydration are both sequence-dependent and are essential in specific DNA sequence recognition by proteins. However, the relationship between the two is not well understood. Here, systematic molecular dynamics simulations of 136 DNA sequences that differ from each other in their central tetramer revealed that sequence dependence of hydration is clearly correlated with that of deformability. We show that this correlation can be illustrated by four typical cases. Most rigid basepair steps are highly likely to form an ordered hydration pattern composed of one water molecule forming a bridge between the bases of distinct strands, but a few exceptions favor another ordered hydration composed of two water molecules forming such a bridge. Steps with medium deformability can display both of these hydration patterns with frequent transition. Highly flexible steps do not have any stable hydration pattern. A detailed picture of this correlation demonstrates that motions of hydration water molecules and DNA bases are tightly coupled with each other at the atomic level. These results contribute to our understanding of the entropic contribution from water molecules in protein or drug binding and could be applied for the purpose of predicting binding sites. PMID:19686662
Excler, Jean-Louis; Robb, Merlin L; Kim, Jerome H
2014-01-01
The development of a safe and effective preventive HIV-1 vaccine remains a public health priority. Despite scientific difficulties and disappointing results, HIV-1 vaccine clinical development has, for the first time, established proof-of-concept efficacy against HIV-1 acquisition and identified vaccine-associated immune correlates of risk. The correlate of risk analysis showed that IgG antibodies against the gp120 V2 loop correlated with decreased risk of HIV infection, while Env-specific IgA directly correlated with increased risk. The development of vaccine strategies such as improved envelope proteins formulated with potent adjuvants and DNA and vectors expressing mosaics, or conserved sequences, capable of eliciting greater breadth and depth of potentially relevant immune responses including neutralizing and non-neutralizing antibodies, CD4+ and CD8+ cell-mediated immune responses, mucosal immune responses, and immunological memory, is now proceeding quickly. Additional human efficacy trials combined with other prevention modalities along with sustained funding and international collaboration remain key to bring an HIV-1 vaccine to licensure. PMID:24637946
Voltage dependency of transmission probability of aperiodic DNA molecule
Wiliyanti, V.; Yudiarsah, E.
2017-07-01
Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.
The Capricious Nature of Bacterial Pathogens: Phasevarions and Vaccine Development
Directory of Open Access Journals (Sweden)
Aimee Tan
2016-12-01
Full Text Available Infectious diseases are a leading cause of morbidity and mortality worldwide, and vaccines are one of the most successful and cost-effective tools for disease prevention. One of the key considerations for rational vaccine development is the selection of appropriate antigens. Antigens must induce a protective immune response, and this response should be directed to stably expressed antigens so the target microbe can always be recognized by the immune system. Antigens with variable expression, due to environmental signals or phase variation (i.e., high frequency, random switching of expression, are not ideal vaccine candidates because variable expression could lead to immune evasion. Phase variation is often mediated by the presence of highly mutagenic simple tandem DNA repeats, and genes containing such sequences can be easily identified, and their use discounted as vaccine antigens reconsidered. Recent research has identified phase variably expressed DNA methyltransferases that act as global epigenetic regulators. These phase variable regulons, known as phasevarions, are associated with altered virulence phenotypes and/or expression of vaccine candidates. As such, genes encoding candidate vaccine antigens that have no obvious mechanism of phase variation may be subject to indirect, epigenetic control as part of a phasevarion. Bioinformatic and experimental studies are required to elucidate the distribution and mechanism of action of these DNA methyltransferases, and most importantly, whether they mediate epigenetic regulation of potential and current vaccine candidates. This process is essential to define the stably expressed antigen target profile of bacterial pathogens and thereby facilitate efficient, rational selection of vaccine antigens.
DEFF Research Database (Denmark)
Bartholdy, Christina; Stryhn, Anette; Christensen, Jan Pravsgaard
2004-01-01
Induction of a monospecific antiviral CD8+ T cell response may pose a risk to the host due to the narrow T cell response induced. At the individual level, this may result in selection of CD8+ T cell escape variants, particularly during chronic viral infection. Second, prior immunization toward a ...... with escape variants. These findings underscore that a monospecific vaccine may induce efficient protective immunity given the right set of circumstances....... of DNA vaccines encoding immunodominant epitopes of lymphocytic choriomeningitis virus (LCMV). We analyzed the spectrum of the CD8+ T cell response and the susceptibility to infection in H-2(b) and H-2(d) mice. Priming for a monospecific, CD8+ T cell response did not render mice susceptible to viral...... variants. Thus, vaccinated mice were protected against chronic infection with LCMV, and no evidence indicating biologically relevant viral escape was obtained. In parallel, a broad and sustained CD8+ T cell response was generated upon infection, and in H-2(d) mice epitope spreading was observed. Even after...
International Nuclear Information System (INIS)
Petrov, S.I.; Gaziev, A.I.
1980-01-01
The formation of double-strand breaks in DNA of γ-irradiated ( 60 Co)Ex coli bacteria depending on the function of fast repair processes of DNA single-strand breaks, is investigated. The profiles of sedimentation of DNA Ex coli cells, irradiated at 0-2 deg C in the salt medium and in EDTA-borate buffer, are presented. It is shown that when irradiating cells in EDTA-borate buffer, the output of single- and double strand breaks in DNA is much higher than in the case of their irradiation in the minimum salt medium. The dependence of output of single-strand and double-strand breaks depending on the radiatier doze of E coli cells in the salt medium and EDTA-borate buffer, is studied. The supposition is made on the presence of a regulative interaction between the accumulation of DNA single-breaks and their repair with the formation of double-strand breaks. The functionating of fast and superfast repair processes considerably affects the formation of double-strand breaks in DNA of a bacterium cell. A considerable amount of double-breaks registered immediately after irradiation forms due to a close position of single-strand breaks on the opposite DNA strands
Development of Streptococcus agalactiae vaccines for tilapia.
Liu, Guangjin; Zhu, Jielian; Chen, Kangming; Gao, Tingting; Yao, Huochun; Liu, Yongjie; Zhang, Wei; Lu, Chengping
2016-12-21
Vaccination is a widely accepted and effective method to prevent most pathogenic diseases in aquaculture. Various species of tilapia, especially Nile tilapia Oreochromis niloticus, are farmed worldwide because of their high consumer demand. Recently, the tilapia-breeding industry has been hampered by outbreaks of Streptococcus agalactiae infection, which cause high mortality and huge economic losses. Many researchers have attempted to develop effective S. agalactiae vaccines for tilapia. This review provides a summary of the different kinds of S. agalactiae vaccines for tilapia that have been developed recently. Among the various vaccine types, inactivated S. agalactiae vaccines showed superior protection efficiency when compared with live attenuated, recombinant and DNA vaccines. With respect to vaccination method, injecting the vaccine into tilapia provided the most effective immunoprotection. Freund's incomplete adjuvant appeared to be suitable for tilapia vaccines. Other factors, such as immunization duration and number, fish size and challenge dose, also influenced the vaccine efficacy.
DNA-dependent protein kinase (DAN-PK), a key enzyme in the re-ligation of DNA double-strand breaks
International Nuclear Information System (INIS)
Hennequin, C.; Averbeck, D.
1999-01-01
Repair pathways of DNA are now defined and some important findings have been discovered in the last few years. DNA non-homologous end-joining (NEH) is a crucial process in the repair of radiation-induced double-strand breaks (DSBs). NHEj implies at least three steps: the DNA free-ends must get closer, preparation of the free-ends by exonucleases and then a transient hybridization in a region of DNA with weak homology. DNA-dependent protein kinase (DNA-PK) is the key enzyme in this process. DNA-PK is a nuclear serine/threonine kinase that comprises three components: a catalytic subunit (DNA-PK cs ) and two regulatory subunits, DNA-binding proteins, Ku80 and Ku70. The severe combined immuno-deficient (scid) mice are deficient in DNA-PK cs : this protein is involved both in DNA repair and in the V(D)J recombination of immunoglobulin and T-cell receptor genes. It is a protein-kinase of the P13-kinase family and which can phosphorylate Ku proteins, p53 and probably some other proteins still unknown. DNA-PK is an important actor of DSBs repair (induced by ionising radiations or by drugs like etoposide), but obviously it is not the only mechanism existing in the cell for this function. Some others, like homologous recombination, seem also to have a great importance for cell survival. (authors)
International Nuclear Information System (INIS)
Fukumoto, Yasunori; Kuki, Kazumasa; Morii, Mariko; Miura, Takahito; Honda, Takuya; Ishibashi, Kenichi; Hasegawa, Hitomi; Kubota, Sho; Ide, Yudai; Yamaguchi, Noritaka; Nakayama, Yuji; Yamaguchi, Naoto
2014-01-01
Highlights: • Inhibition of Src family kinases decreased γ-H2AX signal. • Inhibition of Src family increased ATM-dependent phosphorylation of Chk2 and Kap1. • shRNA-mediated knockdown of Lyn increased phosphorylation of Kap1 by ATM. • Ectopic expression of Src family kinase suppressed ATM-mediated Kap1 phosphorylation. • Src is involved in upstream signaling for inactivation of ATM signaling. - Abstract: DNA damage activates the DNA damage checkpoint and the DNA repair machinery. After initial activation of DNA damage responses, cells recover to their original states through completion of DNA repair and termination of checkpoint signaling. Currently, little is known about the process by which cells recover from the DNA damage checkpoint, a process called checkpoint recovery. Here, we show that Src family kinases promote inactivation of ataxia telangiectasia mutated (ATM)-dependent checkpoint signaling during recovery from DNA double-strand breaks. Inhibition of Src activity increased ATM-dependent phosphorylation of Chk2 and Kap1. Src inhibition increased ATM signaling both in G2 phase and during asynchronous growth. shRNA knockdown of Lyn increased ATM signaling. Src-dependent nuclear tyrosine phosphorylation suppressed ATM-mediated Kap1 phosphorylation. These results suggest that Src family kinases are involved in upstream signaling that leads to inactivation of the ATM-dependent DNA damage checkpoint
Durkin, Sarah S.; Guo, Xin; Fryrear, Kimberly A.; Mihaylova, Valia T.; Gupta, Saurabh K.; Belgnaoui, S. Mehdi; Haoudi, Abdelali; Kupfer, Gary M.; Semmes, O. John
2008-01-01
Human T-cell leukemia virus type-1 is the causative agent for adult T-cell leukemia. Previous research has established that the viral oncoprotein Tax mediates the transformation process by impairing cell cycle control and cellular response to DNA damage. We showed previously that Tax sequesters huChk2 within chromatin and impairs the response to ionizing radiation. Here we demonstrate that DNA-dependent protein kinase (DNA-PK) is a member of the Tax·Chk2 nuclear complex. The catalytic subunit, DNA-PKcs, and the regulatory subunit, Ku70, were present. Tax-containing nuclear extracts showed increased DNA-PK activity, and specific inhibition of DNA-PK prevented Tax-induced activation of Chk2 kinase activity. Expression of Tax induced foci formation and phosphorylation of H2AX. However, Tax-induced constitutive signaling of the DNA-PK pathway impaired cellular response to new damage, as reflected in suppression of ionizing radiation-induced DNA-PK phosphorylation and γH2AX stabilization. Tax co-localized with phospho-DNA-PK into nuclear speckles and a nuclear excluded Tax mutant sequestered endogenous phospho-DNA-PK into the cytoplasm, suggesting that Tax interaction with DNA-PK is an initiating event. We also describe a novel interaction between DNA-PK and Chk2 that requires Tax. We propose that Tax binds to and stabilizes a protein complex with DNA-PK and Chk2, resulting in a saturation of DNA-PK-mediated damage repair response. PMID:18957425
Peptide Vaccines for Leishmaniasis
Directory of Open Access Journals (Sweden)
Rory C. F. De Brito
2018-05-01
Full Text Available Due to an increase in the incidence of leishmaniases worldwide, the development of new strategies such as prophylactic vaccines to prevent infection and decrease the disease have become a high priority. Classic vaccines against leishmaniases were based on live or attenuated parasites or their subunits. Nevertheless, the use of whole parasite or their subunits for vaccine production has numerous disadvantages. Therefore, the use of Leishmania peptides to design more specific vaccines against leishmaniases seems promising. Moreover, peptides have several benefits in comparison with other kinds of antigens, for instance, good stability, absence of potentially damaging materials, antigen low complexity, and low-cost to scale up. By contrast, peptides are poor immunogenic alone, and they need to be delivered correctly. In this context, several approaches described in this review are useful to solve these drawbacks. Approaches, such as, peptides in combination with potent adjuvants, cellular vaccinations, adenovirus, polyepitopes, or DNA vaccines have been used to develop peptide-based vaccines. Recent advancements in peptide vaccine design, chimeric, or polypeptide vaccines and nanovaccines based on particles attached or formulated with antigenic components or peptides have been increasingly employed to drive a specific immune response. In this review, we briefly summarize the old, current, and future stands on peptide-based vaccines, describing the disadvantages and benefits associated with them. We also propose possible approaches to overcome the related weaknesses of synthetic vaccines and suggest future guidelines for their development.
Peptide Vaccines for Leishmaniasis.
De Brito, Rory C F; Cardoso, Jamille M De O; Reis, Levi E S; Vieira, Joao F; Mathias, Fernando A S; Roatt, Bruno M; Aguiar-Soares, Rodrigo Dian D O; Ruiz, Jeronimo C; Resende, Daniela de M; Reis, Alexandre B
2018-01-01
Due to an increase in the incidence of leishmaniases worldwide, the development of new strategies such as prophylactic vaccines to prevent infection and decrease the disease have become a high priority. Classic vaccines against leishmaniases were based on live or attenuated parasites or their subunits. Nevertheless, the use of whole parasite or their subunits for vaccine production has numerous disadvantages. Therefore, the use of Leishmania peptides to design more specific vaccines against leishmaniases seems promising. Moreover, peptides have several benefits in comparison with other kinds of antigens, for instance, good stability, absence of potentially damaging materials, antigen low complexity, and low-cost to scale up. By contrast, peptides are poor immunogenic alone, and they need to be delivered correctly. In this context, several approaches described in this review are useful to solve these drawbacks. Approaches, such as, peptides in combination with potent adjuvants, cellular vaccinations, adenovirus, polyepitopes, or DNA vaccines have been used to develop peptide-based vaccines. Recent advancements in peptide vaccine design, chimeric, or polypeptide vaccines and nanovaccines based on particles attached or formulated with antigenic components or peptides have been increasingly employed to drive a specific immune response. In this review, we briefly summarize the old, current, and future stands on peptide-based vaccines, describing the disadvantages and benefits associated with them. We also propose possible approaches to overcome the related weaknesses of synthetic vaccines and suggest future guidelines for their development.
From genomes to vaccines: Leishmania as a model.
Almeida, Renata; Norrish, Alan; Levick, Mark; Vetrie, David; Freeman, Tom; Vilo, Jaak; Ivens, Alasdair; Lange, Uta; Stober, Carmel; McCann, Sharon; Blackwell, Jenefer M
2002-01-01
The 35 Mb genome of Leishmania should be sequenced by late 2002. It contains approximately 8500 genes that will probably translate into more than 10 000 proteins. In the laboratory we have been piloting strategies to try to harness the power of the genome-proteome for rapid screening of new vaccine candidate. To this end, microarray analysis of 1094 unique genes identified using an EST analysis of 2091 cDNA clones from spliced leader libraries prepared from different developmental stages of Leishmania has been employed. The plan was to identify amastigote-expressed genes that could be used in high-throughput DNA-vaccine screens to identify potential new vaccine candidates. Despite the lack of transcriptional regulation that polycistronic transcription in Leishmania dictates, the data provide evidence for a high level of post-transcriptional regulation of RNA abundance during the developmental cycle of promastigotes in culture and in lesion-derived amastigotes of Leishmania major. This has provided 147 candidates from the 1094 unique genes that are specifically upregulated in amastigotes and are being used in vaccine studies. Using DNA vaccination, it was demonstrated that pooling strategies can work to identify protective vaccines, but it was found that some potentially protective antigens are masked by other disease-exacerbatory antigens in the pool. A total of 100 new vaccine candidates are currently being tested separately and in pools to extend this analysis, and to facilitate retrospective bioinformatic analysis to develop predictive algorithms for sequences that constitute potentially protective antigens. We are also working with other members of the Leishmania Genome Network to determine whether RNA expression determined by microarray analyses parallels expression at the protein level. We believe we are making good progress in developing strategies that will allow rapid translation of the sequence of Leishmania into potential interventions for disease
pH-dependence of the optical bio-sensor based on DNA-carbon nanotube
International Nuclear Information System (INIS)
Vu Thuy Huong; Quach Kha Quang; Tran Thanh Thuy; Phan Duc Anh; Ngo Van Thanh; Nguyen Ai Viet
2010-01-01
In 2006, Daniel A. Heller et al. [1] demonstrated that carbon nanotubes (CNNTs) wrapped with DNA can be placed inside living cells and detect trace amounts of harmful contaminants using near infrared light. This discovery could lead to new types of optical sensors and biomarkers at the sub cellular level. The working principle of this optical bio-sensor from DNA and CNNTs can be explained by a simple theoretical model which was introduced in [3]. In this paper, the pH-dependence of DNA and the pH-dependence of solution around CNNTs are shown by using data analysis method. By substituting them into the same model, the pH-dependence of DNA-wrapped CNNTs was elicited in this paper. The range of parameters for workable conditions of this bio-sensor was indicated that the solution should have pH from 6 to 9 and the concentration of ions should be more than a critical value. These results are according to the experimental data and the deduction about pH and salt concentration in solution. They are very useful as using such a new bio-sensor like this in living environment. (author)
Cost-effectiveness of human papillomavirus vaccination and cervical cancer screening in Thailand.
Sharma, M; Ortendahl, J; van der Ham, E; Sy, S; Kim, J J
2012-01-01
To assess the health and economic outcomes of various screening and vaccination strategies for cervical cancer prevention. Cost-effectiveness analysis from a societal perspective. Thailand. Females aged 9 years and older. Using a mathematical model of human papillomavirus (HPV) infection and cervical cancer, calibrated to epidemiological data from Thailand, we estimated the cost-effectiveness of pre-adolescent HPV vaccination, screening [visual inspection with acetic acid (VIA), HPV DNA testing, and cytology] between one and five times per lifetime in adulthood, and combined pre-adolescent vaccination and screening. Vaccine efficacy, coverage, cost, and screening frequency were varied in sensitivity analyses. Incremental cost-effectiveness ratios, expressed as cost per year of life saved (YLS). Assuming lifelong efficacy and 80% coverage, pre-adolescent HPV vaccination alone was projected to reduce the lifetime risk of cervical cancer by 55%, which was greater than any strategy of screening alone. When cost per vaccinated girl was I$10 (approximately $2 per dose) or less, HPV vaccination alone was cost saving. Pre-adolescent vaccination and HPV DNA testing five times per lifetime, starting at age 35 years, reduced the lifetime cervical cancer risk by 70%, and had a cost-effectiveness ratio less than Thailand's GDP per capita (I$8100), provided the cost per vaccinated girl was I$200 or less. Low cost pre-adolescent HPV vaccination followed by HPV screening five times per lifetime is an efficient strategy for Thailand. Costs may need to be lower, however, for this strategy to be affordable. If vaccination is not feasible, HPV DNA testing five times per lifetime is efficient. © 2011 The Authors BJOG An International Journal of Obstetrics and Gynaecology © 2011 RCOG.
A rationally designed tyrosine hydroxylase DNA vaccine induces specific antineuroblastoma immunity
DEFF Research Database (Denmark)
Huebener, Nicole; Fest, Stefan; Strandsby, Anne Bystrup
2008-01-01
Therapeutic vaccination against tumor antigens without induction of autoimmunity remains a major challenge in cancer immunotherapy. Here, we show for the first time effective therapeutic vaccination followed by suppression of established spontaneous neuroblastoma metastases using a tyrosine...... show effective therapeutic vaccination against neuroblastoma with a novel rationally designed TH minigene vaccine without induction of autoimmunity providing an important baseline for future clinical application of this strategy....
Directory of Open Access Journals (Sweden)
Juliet Mpendo
Full Text Available Strategies to enhance the immunogenicity of DNA vaccines in humans include i co-administration of molecular adjuvants, ii intramuscular administration followed by in vivo electroporation (IM/EP and/or iii boosting with a different vaccine. Combining these strategies provided protection of macaques challenged with SIV; this clinical trial was designed to mimic the vaccine regimen in the SIV study.Seventy five healthy, HIV-seronegative adults were enrolled into a phase 1, randomized, double-blind, placebo-controlled trial. Multi-antigenic HIV (HIVMAG plasmid DNA (pDNA vaccine alone or co-administered with pDNA encoding human Interleukin 12 (IL-12 (GENEVAX IL-12 given by IM/EP using the TriGrid Delivery System was tested in different prime-boost regimens with recombinant Ad35 HIV vaccine given IM.All local reactions but one were mild or moderate. Systemic reactions and unsolicited adverse events including laboratory abnormalities did not differ between vaccine and placebo recipients. No serious adverse events (SAEs were reported. T cell and antibody response rates after HIVMAG (x3 prime-Ad35 (x1 boost were independent of IL-12, while the magnitude of interferon gamma (IFN-γ ELISPOT responses was highest after HIVMAG (x3 without IL-12. The quality and phenotype of T cell responses shown by intracellular cytokine staining (ICS were similar between groups. Inhibition of HIV replication by autologous T cells was demonstrated after HIVMAG (x3 prime and was boosted after Ad35. HIV specific antibodies were detected only after Ad35 boost, although there was a priming effect with 3 doses of HIVMAG with or without IL-12. No anti-IL-12 antibodies were detected.The vaccines were safe, well tolerated and moderately immunogenic. Repeated administration IM/EP was well accepted. An adjuvant effect of co-administered plasmid IL-12 was not detected.ClinicalTrials.gov NCT01496989.
Health and economic impact of HPV 16/18 vaccination and cervical cancer screening in Eastern Africa.
Campos, Nicole G; Kim, Jane J; Castle, Philip E; Ortendahl, Jesse D; O'Shea, Meredith; Diaz, Mireia; Goldie, Sue J
2012-06-01
Eastern Africa has the world's highest cervical cancer incidence and mortality rates. We used epidemiologic data from Kenya, Mozambique, Tanzania, Uganda, and Zimbabwe to develop models of HPV-related infection and disease. For each country, we assessed HPV vaccination of girls before age 12 followed by screening with HPV DNA testing once, twice, or three times per lifetime (at ages 35, 40, 45). For women over age 30, we assessed only screening (with HPV DNA testing up to three times per lifetime or VIA at age 35). Assuming no waning immunity, mean reduction in lifetime cancer risk associated with vaccination ranged from 36 to 45%, and vaccination followed by screening once per lifetime at age 35 with HPV DNA testing ranged from 43 to 51%. For both younger and older women, the most effective screening strategy was HPV DNA testing three times per lifetime. Provided the cost per vaccinated girl was less than I$10 (I$2 per dose), vaccination had an incremental cost-effectiveness ratio [I$ (international dollars)/year of life saved (YLS)] less than the country-specific per capita GDP, a commonly cited heuristic for "very cost-effective" interventions. If the cost per vaccinated girl was between I$10 (I$2 per dose) and I$25 (I$5 per dose), vaccination followed by HPV DNA testing would save the most lives and would be considered good value for public health dollars. These results should be used to catalyze design and evaluation of HPV vaccine delivery and screening programs, and contribute to a dialogue on financing HPV vaccination in poor countries. Copyright © 2011 UICC.
Induction of protective immune responses in mice by double DNA ...
African Journals Online (AJOL)
Purpose: To investigate the efficacy of a double DNA vaccine encoding of Brucella melitensis omp31 gene and of Escherichia coli eae gene in inducing protective immune response in a mouse model. Methods: After performing PCR assays and cloning both the eae and omp31 genes, the generated DNA vaccines were ...
Hussain, Althaf I; Johnson, Jeffrey A; Da Silva Freire, Marcos; Heneine, Walid
2003-01-01
All currently licensed yellow fever (YF) vaccines are propagated in chicken embryos. Recent studies of chick cell-derived measles and mumps vaccines show evidence of two types of retrovirus particles, the endogenous avian retrovirus (EAV) and the endogenous avian leukosis virus (ALV-E), which originate from the chicken embryonic fibroblast substrates. In this study, we investigated substrate-derived avian retrovirus contamination in YF vaccines currently produced by three manufacturers (YF-vax [Connaught Laboratories], Stamaril [Aventis], and YF-FIOCRUZ [FIOCRUZ-Bio-Manguinhos]). Testing for reverse transcriptase (RT) activity was not possible because of assay inhibition. However, Western blot analysis of virus pellets with anti-ALV RT antiserum detected three distinct RT proteins in all vaccines, indicating that more than one source is responsible for the RTs present in the vaccines. PCR analysis of both chicken substrate DNA and particle-associated RNA from the YF vaccines showed no evidence of the long terminal repeat sequences of exogenous ALV subgroups A to D in any of the vaccines. In contrast, both ALV-E and EAV particle-associated RNA were detected at equivalent titers in each vaccine by RT-PCR. Quantitative real-time RT-PCR revealed 61,600, 348,000, and 1,665,000 ALV-E RNA copies per dose of Stamaril, YF-FIOCRUZ, and YF-vax vaccines, respectively. ev locus-specific PCR testing of the vaccine-associated chicken substrate DNA was positive both for the nondefective ev-12 locus in two vaccines and for the defective ev-1 locus in all three vaccines. Both intact and ev-1 pol sequences were also identified in the particle-associated RNA. To investigate the risks of transmission, serum samples from 43 YF vaccine recipients were studied. None of the samples were seropositive by an ALV-E-based Western blot assay or had detectable EAV or ALV-E RNA sequences by RT-PCR. YF vaccines produced by the three manufacturers all have particles containing EAV genomes and
Chen, Yajun; Yu, Miao; Hemandez, J A; Li, Jiexi; Yuan, Zi-Guo; Yan, Haikuo
2018-05-01
We constructed a new plasmid pIRESneo/ROP18/PLP1 that was injected intramuscularly into Kunming mice to evaluate its immune efficacy. The immunized mice exhibited significantly increased serum IgG2a levels, lymphocyte counts and Th1-type cytokine (IL-2, IL-12 and IFN-γ) levels. Moreover, the immunized mice exhibited longer survival times (44.7 ± 2.1 days for ROP18/PLP1 and 47.2 ± 2.9 days for ROP18/PLP1 + IL-18) and lower brain cyst burden (68.9% for ROP18/PLP1 and 72.4% for ROP18/PLP1 + IL-18) than control mice after T. gondii challenge. Our results demonstrate that the multiple-gene DNA vaccine including both ROP18 and PLP1 elicits greater protection against T. gondii challenge and stronger immunogenicity than single-gene vaccines. Copyright © 2018 Elsevier Inc. All rights reserved.
Efficacy of recombinant birch pollen vaccine for the treatment of birch-allergic rhinoconjunctivitis
DEFF Research Database (Denmark)
Pauli, Gabrielle; Larsen, Tina H; Rak, Sabina
2008-01-01
BACKGROUND: Recombinant DNA technology has the potential to produce allergen-specific immunotherapy vaccines with defined composition. OBJECTIVE: To evaluate the effectiveness of a new recombinant birch pollen allergen vaccine in patients with birch pollen allergy. METHODS: A multicenter, randomi......-treated group. CONCLUSION: The rBet v 1-based vaccine was safe and effective in treating birch pollen allergy, and induced a highly specific immune response.......BACKGROUND: Recombinant DNA technology has the potential to produce allergen-specific immunotherapy vaccines with defined composition. OBJECTIVE: To evaluate the effectiveness of a new recombinant birch pollen allergen vaccine in patients with birch pollen allergy. METHODS: A multicenter......, randomized, double-blind, placebo-controlled trial was undertaken to compare the following 3 vaccines in 134 adults with birch pollen allergy: recombinant birch pollen allergen vaccine (rBet v 1a), licensed birch pollen extract, natural purified birch pollen allergen (nBet v 1), and placebo. Patients...
Bissa, Massimiliano; Illiano, Elena; Pacchioni, Sole; Paolini, Francesca; Zanotto, Carlo; De Giuli Morghen, Carlo; Massa, Silvia; Franconi, Rosella; Radaelli, Antonia; Venuti, Aldo
2015-03-05
Considering the high number of new cases of cervical cancer each year that are caused by human papilloma viruses (HPVs), the development of an effective vaccine for prevention and therapy of HPV-associated cancers, and in particular against the high-risk HPV-16 genotype, remains a priority. Vaccines expressing the E6 and E7 proteins that are detectable in all HPV-positive pre-cancerous and cancer cells might support the treatment of HPV-related lesions and clear already established tumors. In this study, DNA and fowlpox virus recombinants expressing the E6F47R mutant of the HPV-16 E6 oncoprotein were generated, and their correct expression verified by RT-PCR, Western blotting and immunofluorescence. Immunization protocols were tested in a preventive or therapeutic pre-clinical mouse model of HPV-16 tumorigenicity using heterologous (DNA/FP) or homologous (DNA/DNA and FP/FP) prime/boost regimens. The immune responses and therapeutic efficacy were evaluated by ELISA, ELISPOT assays, and challenge with TC-1* cells. In the preventive protocol, while an anti-E6-specific humoral response was just detectable, a specific CD8(+) cytotoxic T-cell response was elicited in immunized mice. After the challenge, there was a delay in cancer appearance and a significant reduction of tumor volume in the two groups of E6-immunized mice, thus confirming the pivotal role of the CD8(+) T-cell response in the control of tumor growth in the absence of E6-specific antibodies. In the therapeutic protocol, in-vivo experiments resulted in a higher number of tumor-free mice after the homologous DNA/DNA or heterologous DNA/FP immunization. These data establish a preliminary indication for the prevention and treatment of HPV-related tumors by the use of DNA and avipox constructs as safe and effective immunogens following a prime/boost strategy. The combined use of recombinants expressing both E6 and E7 proteins might improve the antitumor efficacy, and should represent an important approach to
Chimeric DNA Vaccines against ErbB2{sup +} Carcinomas: From Mice to Humans
Energy Technology Data Exchange (ETDEWEB)
Quaglino, Elena; Riccardo, Federica; Macagno, Marco; Bandini, Silvio; Cojoca, Rodica; Ercole, Elisabetta [Molecular Biotechnology Center, Department of Clinical and Biological Sciences, University of Turin, 10126 Turin (Italy); Amici, Augusto [Department of Molecular Cellular and Animal Biology, University of Camerino, 62032 Camerino (Italy); Cavallo, Federica, E-mail: federica.cavallo@unito.it [2 Department of Molecular Cellular and Animal Biology, University of Camerino, 62032 Camerino (Italy)
2011-08-10
DNA vaccination exploits a relatively simple and flexible technique to generate an immune response against microbial and tumor-associated antigens (TAAs). Its effectiveness is enhanced by the application of an electrical shock in the area of plasmid injection (electroporation). In our studies we exploited a sophisticated electroporation device approved for clinical use (Cliniporator, IGEA, Carpi, Italy). As the target antigen is an additional factor that dramatically modulates the efficacy of a vaccine, we selected ErbB2 receptor as a target since it is an ideal oncoantigen. It is overexpressed on the cell membrane by several carcinomas for which it plays an essential role in driving their progression. Most oncoantigens are self-tolerated molecules. To circumvent immune tolerance we generated two plasmids (RHuT and HuRT) coding for chimeric rat/human ErbB2 proteins. Their immunogenicity was compared in wild type mice naturally tolerant for mouse ErbB2, and in transgenic mice that are also tolerant for rat or human ErbB2. In several of these mice, RHuT and HuRT elicited a stronger anti-tumor response than plasmids coding for fully human or fully rat ErbB2. The ability of heterologous moiety to blunt immune tolerance could be exploited to elicit a significant immune response in patients. A clinical trial to delay the recurrence of ErbB2{sup +} carcinomas of the oral cavity, oropharynx and hypopharynx is awaiting the approval of the Italian authorities.
Zhang, Henry T; McGrath, Leah J; Wyss, Richard; Ellis, Alan R; Stürmer, Til
2017-12-01
To improve control of confounding by frailty when estimating the effect of influenza vaccination on all-cause mortality by controlling for a published set of claims-based predictors of dependency in activities of daily living (ADL). Using Medicare claims data, a cohort of beneficiaries >65 years of age was followed from September 1, 2007, to April 12, 2008, with covariates assessed in the 6 months before follow-up. We estimated Cox proportional hazards models of all-cause mortality, with influenza vaccination as a time-varying exposure. We controlled for common demographics, comorbidities, and health care utilization variables and then added 20 ADL dependency predictors. To gauge residual confounding, we estimated pre-influenza season hazard ratios (HRs) between September 1, 2007 and January 5, 2008, which should be 1.0 in the absence of bias. A cohort of 2 235 140 beneficiaries was created, with a median follow-up of 224 days. Overall, 52% were vaccinated and 4% died during follow-up. During the pre-influenza season period, controlling for demographics, comorbidities, and health care use resulted in a HR of 0.66 (0.64, 0.67). Adding the ADL dependency predictors moved the HR to 0.68 (0.67, 0.70). Controlling for demographics and ADL dependency predictors alone resulted in a HR of 0.68 (0.66, 0.70). Results were consistent with those in the literature, with significant uncontrolled confounding after adjustment for demographics, comorbidities, and health care use. Adding ADL dependency predictors moved HRs slightly closer to the null. Of the comorbidities, health care use variables, and ADL dependency predictors, the last set reduced confounding most. However, substantial uncontrolled confounding remained. Copyright © 2017 John Wiley & Sons, Ltd.
Carlétti, Dyego; Morais da Fonseca, Denise; Gembre, Ana Flávia; Masson, Ana Paula; Weijenborg Campos, Lívia; Leite, Luciana C C; Rodrigues Pires, Andréa; Lannes-Vieira, Joseli; Lopes Silva, Célio; Bonato, Vânia Luiza Deperon; Horn, Cynthia
2013-08-01
Mycobacterium bovis BCG prime DNA (Mycobacterium tuberculosis genes)-booster vaccinations have been shown to induce greater protection against tuberculosis (TB) than BCG alone. This heterologous prime-boost strategy is perhaps the most realistic vaccination for the future of TB infection control, especially in countries where TB is endemic. Moreover, a prime-boost regimen using biodegradable microspheres seems to be a promising immunization to stimulate a long-lasting immune response. The alanine proline antigen (Apa) is a highly immunogenic glycoprotein secreted by M. tuberculosis. This study investigated the immune protection of Apa DNA vaccine against intratracheal M. tuberculosis challenge in mice on the basis of a heterologous prime-boost regimen. BALB/c mice were subcutaneously primed with BCG and intramuscularly boosted with a single dose of plasmid carrying apa and 6,6'-trehalose dimycolate (TDM) adjuvant, coencapsulated in microspheres (BCG-APA), and were evaluated 30 and 70 days after challenge. This prime-boost strategy (BCG-APA) resulted in a significant reduction in the bacterial load in the lungs, thus leading to better preservation of the lung parenchyma, 70 days postinfection compared to BCG vaccinated mice. The profound effect of this heterologous prime-boost regimen in the experimental model supports its development as a feasible strategy for prevention of TB.
Purification of influenza deoxyribonucleic acid-based vaccine using agmatine monolith.
Bicho, D; Caramelo-Nunes, C; Sousa, A; Sousa, F; Queiroz, J A; Tomaz, C T
2016-02-15
Lately, researchers have made several efforts to improve vaccine production to fight highly contagious respiratory diseases like influenza. One of the most promising options for reducing the impact of this virus is DNA vaccination. However, a large quantity of highly pure plasmid DNA (pDNA) is necessary to attain this goal. The present work describes the production and purification of the plasmid NTC7482-41H-VA2HA expressing influenza virus hemagglutinin using an agmatine monolith. This ligand was chosen to purify supercoiled (sc) pDNA from complex lysates because of its versatile multimodal character. Its natural intervention in several biological systems together with its similarity with the highly studied arginine ligand allowed the development of a simpler and more specific purification process. Agmatine works under two strategies: descending ammonium sulfate gradient and ascending sodium chloride gradient. Furthermore, pH manipulation revealed an important role in pDNA isoforms selectivity. Dynamic binding capacity (DBC) experiments were performed varying different parameters and showed an increase with pDNA concentration, while high flow rate and high pH had the opposite effect. Sc pDNA was purified with high yield and was efficient with respect to cell transfection and cell viability. This monolith showed to be appropriate to purify the plasmid NTC7482-41H-VA2HA, providing a valuable tool for pDNA influenza vaccines preparation. Copyright © 2016. Published by Elsevier B.V.
Douglas, Pauline; Ye, Ruiqiong; Trinkle-Mulcahy, Laura; Neal, Jessica A; De Wever, Veerle; Morrice, Nick A; Meek, Katheryn; Lees-Miller, Susan P
2014-06-25
The protein kinase activity of the DNA-PKcs (DNA-dependent protein kinase catalytic subunit) and its autophosphorylation are critical for DBS (DNA double-strand break) repair via NHEJ (non-homologous end-joining). Recent studies have shown that depletion or inactivation of DNA-PKcs kinase activity also results in mitotic defects. DNA-PKcs is autophosphorylated on Ser2056, Thr2647 and Thr2609 in mitosis and phosphorylated DNA-PKcs localize to centrosomes, mitotic spindles and the midbody. DNA-PKcs also interacts with PP6 (protein phosphatase 6), and PP6 has been shown to dephosphorylate Aurora A kinase in mitosis. Here we report that DNA-PKcs is phosphorylated on Ser3205 and Thr3950 in mitosis. Phosphorylation of Thr3950 is DNA-PK-dependent, whereas phosphorylation of Ser3205 requires PLK1 (polo-like kinase 1). Moreover, PLK1 phosphorylates DNA-PKcs on Ser3205 in vitro and interacts with DNA-PKcs in mitosis. In addition, PP6 dephosphorylates DNA-PKcs at Ser3205 in mitosis and after IR (ionizing radiation). DNA-PKcs also phosphorylates Chk2 on Thr68 in mitosis and both phosphorylation of Chk2 and autophosphorylation of DNA-PKcs in mitosis occur in the apparent absence of Ku and DNA damage. Our findings provide mechanistic insight into the roles of DNA-PKcs and PP6 in mitosis and suggest that DNA-PKcs' role in mitosis may be mechanistically distinct from its well-established role in NHEJ.
Bao, Huihui; Ramanathan, Aarti A; Kawalakar, Omkar; Sundaram, Senthil G; Tingey, Colleen; Bian, Charoran B; Muruganandam, Nagarajan; Vijayachari, Paluru; Sardesai, Niranjan Y; Weiner, David B; Ugen, Kenneth E; Muthumani, Karuppiah
2013-02-01
Chikungunya virus (CHIKV) is an important emerging mosquito-borne alphavirus, indigenous to tropical Africa and Asia. It can cause epidemic fever and acute illness characterized by fever and arthralgias. The epidemic cycle of this infection is similar to dengue and urban yellow fever viral infections. The generation of an efficient vaccine against CHIKV is necessary to prevent and/or control the disease manifestations of the infection. In this report, we studied immune response against a CHIKV-envelope DNA vaccine (pEnv) and the role of the CHIKV nonstructural gene 2 (nsP2) as an adjuvant for the induction of protective immune responses in a relevant mouse challenge model. When injected with the CHIKV pEnv alone, 70% of the immunized mice survived CHIKV challenge, whereas when co-injected with pEnv+pnsP2, 90% of the mice survived viral challenge. Mice also exhibited a delayed onset signs of illness, and a marked decrease in morbidity, suggesting a nsP2 mediated adjuvant effect. Co-injection of the pnsP2 adjuvant with pEnv also qualitatively and quantitatively increased antigen specific neutralizing antibody responses compared to vaccination with pEnv alone. In sum, these novel data imply that the addition of nsP2 to the pEnv vaccine enhances anti-CHIKV-Env immune responses and maybe useful to include in future CHIKV clinical vaccination strategies.
Sequence Dependent Interactions Between DNA and Single-Walled Carbon Nanotubes
Roxbury, Daniel
solution, which suggested an energy-dependent pathway. Additionally, by means of pharmacological inhibition and vector-induced gene knockout studies, the DNA-SWCNTs were shown to enter the cells via Rac1-mediated macropinocytosis.
Srs2 mediates PCNA-SUMO-dependent inhibition of DNA repair synthesis
International Nuclear Information System (INIS)
Burkovics, Peter; Sebesta, Marek; Kolesar, Peter; Sisakova, Alexandra; Marini, Victoria; Plault, Nicolas; Szukacsov, Valeria; Pinter, Lajos; Haracska, Lajos; Robert, Thomas; Kolesar, Peter; Gangloff, Serge; Krejci, Lumir
2013-01-01
Completion of DNA replication needs to be ensured even when challenged with fork progression problems or DNA damage. PCNA and its modifications constitute a molecular switch to control distinct repair pathways. In yeast, SUMOylated PCNA (S-PCNA) recruits Srs2 to sites of replication where Srs2 can disrupt Rad51 filaments and prevent homologous recombination (HR). We report here an unexpected additional mechanism by which S-PCNA and Srs2 block the synthesis-dependent extension of a recombination intermediate, thus limiting its potentially hazardous resolution in association with a cross-over. This new Srs2 activity requires the SUMO interaction motif at its C-terminus, but neither its translocase activity nor its interaction with Rad51. Srs2 binding to S-PCNA dissociates Polδ and Polη from the repair synthesis machinery, thus revealing a novel regulatory mechanism controlling spontaneous genome rearrangements. Our results suggest that cycling cells use the Siz1-dependent SUMOylation of PCNA to limit the extension of repair synthesis during template switch or HR and attenuate reciprocal DNA strand exchanges to maintain genome stability. (authors)
Directory of Open Access Journals (Sweden)
Daniela Santoro Rosa
Full Text Available T-cell based vaccines against HIV have the goal of limiting both transmission and disease progression by inducing broad and functionally relevant T cell responses. Moreover, polyfunctional and long-lived specific memory T cells have been associated to vaccine-induced protection. CD4(+ T cells are important for the generation and maintenance of functional CD8(+ cytotoxic T cells. We have recently developed a DNA vaccine encoding 18 conserved multiple HLA-DR-binding HIV-1 CD4 epitopes (HIVBr18, capable of eliciting broad CD4(+ T cell responses in multiple HLA class II transgenic mice. Here, we evaluated the breadth and functional profile of HIVBr18-induced immune responses in BALB/c mice. Immunized mice displayed high-magnitude, broad CD4(+/CD8(+ T cell responses, and 8/18 vaccine-encoded peptides were recognized. In addition, HIVBr18 immunization was able to induce polyfunctional CD4(+ and CD8(+ T cells that proliferate and produce any two cytokines (IFNγ/TNFα, IFNγ/IL-2 or TNFα/IL-2 simultaneously in response to HIV-1 peptides. For CD4(+ T cells exclusively, we also detected cells that proliferate and produce all three tested cytokines simultaneously (IFNγ/TNFα/IL-2. The vaccine also generated long-lived central and effector memory CD4(+ T cells, a desirable feature for T-cell based vaccines. By virtue of inducing broad, polyfunctional and long-lived T cell responses against conserved CD4(+ T cell epitopes, combined administration of this vaccine concept may provide sustained help for CD8(+ T cells and antibody responses- elicited by other HIV immunogens.
Screening of Viral Pathogens from Pediatric Ileal Tissue Samples after Vaccination
Directory of Open Access Journals (Sweden)
Laura Hewitson
2014-01-01
Full Text Available In 2010, researchers reported that the two US-licensed rotavirus vaccines contained DNA or DNA fragments from porcine circovirus (PCV. Although PCV, a common virus among pigs, is not thought to cause illness in humans, these findings raised several safety concerns. In this study, we sought to determine whether viruses, including PCV, could be detected in ileal tissue samples of children vaccinated with one of the two rotavirus vaccines. A broad spectrum, novel DNA detection technology, the Lawrence Livermore Microbial Detection Array (LLMDA, was utilized, and confirmation of viral pathogens using the polymerase chain reaction (PCR was conducted. The LLMDA technology was recently used to identify PCV from one rotavirus vaccine. Ileal tissue samples were analyzed from 21 subjects, aged 15–62 months. PCV was not detected in any ileal tissue samples by the LLMDA or PCR. LLMDA identified a human rotavirus A from one of the vaccinated subjects, which is likely due to a recent infection from a wild type rotavirus. LLMDA also identified human parechovirus, a common gastroenteritis viral infection, from two subjects. Additionally, LLMDA detected common gastrointestinal bacterial organisms from the Enterobacteriaceae, Bacteroidaceae, and Streptococcaceae families from several subjects. This study provides a survey of viral and bacterial pathogens from pediatric ileal samples, and may shed light on future studies to identify pathogen associations with pediatric vaccinations.
Prereplicative complexes assembled in vitro support origin-dependent and independent DNA replication
On, Kin Fan; Beuron, Fabienne; Frith, David; Snijders, Ambrosius P; Morris, Edward P; Diffley, John F X
2014-01-01
Eukaryotic DNA replication initiates from multiple replication origins. To ensure each origin fires just once per cell cycle, initiation is divided into two biochemically discrete steps: the Mcm2-7 helicase is first loaded into prereplicative complexes (pre-RCs) as an inactive double hexamer by the origin recognition complex (ORC), Cdt1 and Cdc6; the helicase is then activated by a set of “firing factors.” Here, we show that plasmids containing pre-RCs assembled with purified proteins support complete and semi-conservative replication in extracts from budding yeast cells overexpressing firing factors. Replication requires cyclin-dependent kinase (CDK) and Dbf4-dependent kinase (DDK). DDK phosphorylation of Mcm2-7 does not by itself promote separation of the double hexamer, but is required for the recruitment of firing factors and replisome components in the extract. Plasmid replication does not require a functional replication origin; however, in the presence of competitor DNA and limiting ORC concentrations, replication becomes origin-dependent in this system. These experiments indicate that Mcm2-7 double hexamers can be precursors of replication and provide insight into the nature of eukaryotic DNA replication origins. PMID:24566989
Directory of Open Access Journals (Sweden)
Emma-Jo Hayton
Full Text Available HIV-1 vaccine development has advanced slowly due to viral antigenic diversity, poor immunogenicity and recently, safety concerns associated with human adenovirus serotype-5 vectors. To tackle HIV-1 variation, we designed a unique T-cell immunogen HIVconsv from functionally conserved regions of the HIV-1 proteome, which were presented to the immune system using a heterologous prime-boost combination of plasmid DNA, a non-replicating simian (chimpanzee adenovirus ChAdV-63 and a non-replicating poxvirus, modified vaccinia virus Ankara. A block-randomized, single-blind, placebo-controlled phase I trial HIV-CORE 002 administered for the first time candidate HIV-1- vaccines or placebo to 32 healthy HIV-1/2-uninfected adults in Oxford, UK and elicited high frequencies of HIV-1-specific T cells capable of inhibiting HIV-1 replication in vitro. Here, detail safety and tolerability of these vaccines are reported.Local and systemic reactogenicity data were collected using structured interviews and study-specific diary cards. Data on all other adverse events were collected using open questions. Serum neutralizing antibody titres to ChAdV-63 were determined before and after vaccination.Two volunteers withdrew for vaccine-unrelated reasons. No vaccine-related serious adverse events or reactions occurred during 190 person-months of follow-up. Local and systemic events after vaccination occurred in 27/32 individuals and most were mild (severity grade 1 and predominantly transient (<48 hours. Myalgia and flu-like symptoms were more strongly associated with MVA than ChAdV63 or DNA vectors and more common in vaccine recipients than in placebo. There were no intercurrent HIV-1 infections during follow-up. 2/24 volunteers had low ChAdV-63-neutralizing titres at baseline and 7 increased their titres to over 200 with a median (range of 633 (231-1533 post-vaccination, which is of no safety concern.These data demonstrate safety and good tolerability of the pSG2
PH- and salt-dependent molecular combing of DNA: experiments and phenomenological model
International Nuclear Information System (INIS)
Benke, Annegret; Pompe, Wolfgang; Mertig, Michael
2011-01-01
λ-DNA as well as plasmids can be successfully deposited by molecular combing on hydrophobic surfaces, for pH values ranging from 4 to 10. On polydimethylsiloxane (PDMS) substrates, the deposited DNA molecules are overstretched by about 60-100%. There is a significant influence of sodium ions (NaCl) on the surface density of the deposited DNA, with a maximum near to 100 mM NaCl for a DNA solution (28 ng μl -1 ) at pH 8. The combing process can be described by a micromechanical model including: (i) the adsorption of free moving coiled DNA at the substrate; (ii) the stretching of the coiled DNA by the preceding meniscus; (iii) the relaxation of the deposited DNA to the final length. The sticky ends of λ-DNA cause an adhesion force in the range of about 400 pN which allows a stable overstretching of the DNA by the preceding meniscus. The exposing of hidden hydrophobic bonds of the overstretched DNA leads to a stable deposition on the hydrophobic substrate. The pH-dependent density of deposited DNA as well as the observed influence of sodium ions can be explained by their screening of the negatively charged DNA backbone and sticky ends, respectively. The final DNA length can be derived from a balance of the stored elastic energy of the overstretched molecules and the energy of adhesion.
Concentration and length dependence of DNA looping in transcriptional regulation.
Directory of Open Access Journals (Sweden)
Lin Han
2009-05-01
Full Text Available In many cases, transcriptional regulation involves the binding of transcription factors at sites on the DNA that are not immediately adjacent to the promoter of interest. This action at a distance is often mediated by the formation of DNA loops: Binding at two or more sites on the DNA results in the formation of a loop, which can bring the transcription factor into the immediate neighborhood of the relevant promoter. These processes are important in settings ranging from the historic bacterial examples (bacterial metabolism and the lytic-lysogeny decision in bacteriophage, to the modern concept of gene regulation to regulatory processes central to pattern formation during development of multicellular organisms. Though there have been a variety of insights into the combinatorial aspects of transcriptional control, the mechanism of DNA looping as an agent of combinatorial control in both prokaryotes and eukaryotes remains unclear. We use single-molecule techniques to dissect DNA looping in the lac operon. In particular, we measure the propensity for DNA looping by the Lac repressor as a function of the concentration of repressor protein and as a function of the distance between repressor binding sites. As with earlier single-molecule studies, we find (at least two distinct looped states and demonstrate that the presence of these two states depends both upon the concentration of repressor protein and the distance between the two repressor binding sites. We find that loops form even at interoperator spacings considerably shorter than the DNA persistence length, without the intervention of any other proteins to prebend the DNA. The concentration measurements also permit us to use a simple statistical mechanical model of DNA loop formation to determine the free energy of DNA looping, or equivalently, the for looping.
The Five Immune Forces Impacting DNA-Based Cancer Immunotherapeutic Strategy
Directory of Open Access Journals (Sweden)
Suneetha Amara
2017-03-01
Full Text Available DNA-based vaccine strategy is increasingly realized as a viable cancer treatment approach. Strategies to enhance immunogenicity utilizing tumor associated antigens have been investigated in several pre-clinical and clinical studies. The promising outcomes of these studies have suggested that DNA-based vaccines induce potent T-cell effector responses and at the same time cause only minimal side-effects to cancer patients. However, the immune evasive tumor microenvironment is still an important hindrance to a long-term vaccine success. Several options are currently under various stages of study to overcome immune inhibitory effect in tumor microenvironment. Some of these approaches include, but are not limited to, identification of neoantigens, mutanome studies, designing fusion plasmids, vaccine adjuvant modifications, and co-treatment with immune-checkpoint inhibitors. In this review, we follow a Porter’s analysis analogy, otherwise commonly used in business models, to analyze various immune-forces that determine the potential success and sustainable positive outcomes following DNA vaccination using non-viral tumor associated antigens in treatment against cancer.
Sinha, Krishna Murari; Stephanou, Nicolas C; Gao, Feng; Glickman, Michael S; Shuman, Stewart
2007-05-18
Mycobacterium tuberculosis and other bacterial pathogens have a Ku-dependent nonhomologous end joining pathway of DNA double-strand break repair. Here we identify mycobacterial UvrD1 as a novel interaction partner for Ku in a genome-wide yeast two-hybrid screen. UvrD1 per se is a vigorous DNA-dependent ATPase but a feeble DNA helicase. Ku stimulates UvrD1 to catalyze ATP-dependent unwinding of 3'-tailed DNAs. UvrD1, Ku, and DNA form a stable ternary complex in the absence of ATP. The Ku binding determinants are located in the distinctive C-terminal segment of UvrD1. A second mycobacterial paralog, UvrD2, is a vigorous Ku-independent DNA helicase. Ablation of UvrD1 sensitizes Mycobacterium smegmatis to killing by ultraviolet and ionizing radiation and to a single chromosomal break generated by I-SceI endonuclease. The physical and functional interactions of bacterial Ku and UvrD1 highlight the potential for cross-talk between components of nonhomologous end joining and nucleotide excision repair pathways.
Thakur, Manoj; Kumar, Mohan B J; Muniyappa, K
2016-10-18
Much is known about the Escherichia coli nucleotide excision repair (NER) pathway; however, very little is understood about the proteins involved and the molecular mechanism of NER in mycobacteria. In this study, we show that Mycobacterium tuberculosis UvrB (MtUvrB), which exists in solution as a monomer, binds to DNA in a structure-dependent manner. A systematic examination of MtUvrB substrate specificity reveals that it associates preferentially with single-stranded DNA, duplexes with 3' or 5' overhangs, and linear duplex DNA with splayed arms. Whereas E. coli UvrB (EcUvrB) binds weakly to undamaged DNA and has no ATPase activity, MtUvrB possesses intrinsic ATPase activity that is greatly stimulated by both single- and double-stranded DNA. Strikingly, we found that MtUvrB, but not EcUvrB, possesses the DNA unwinding activity characteristic of an ATP-dependent DNA helicase. The helicase activity of MtUvrB proceeds in the 3' to 5' direction and is strongly modulated by a nontranslocating 5' single-stranded tail, indicating that in addition to the translocating strand it also interacts with the 5' end of the substrate. The fraction of DNA unwound by MtUvrB decreases significantly as the length of the duplex increases: it fails to unwind duplexes longer than 70 bp. These results, on one hand, reveal significant mechanistic differences between MtUvrB and EcUvrB and, on the other, support an alternative role for UvrB in the processing of key DNA replication intermediates. Altogether, our findings provide insights into the catalytic functions of UvrB and lay the foundation for further understanding of the NER pathway in M. tuberculosis.
Tang, F; Xu, L; Yan, R; Song, X; Li, X
2013-03-01
Co-expression of Trichinella spiralis macrophage migration inhibitory factor (TsMIF) with T. spiralis cystatin-like domain protein (TsMCD-1) in a DNA vaccine induces a Th1 immune response and partial protection against T. spiralis infection. The present study evaluated whether co-expression of mouse ubiquitin (Ub) with TsMIF and TsMCD-1 might improve the immune response against T. spiralis infection. Groups of BALB/c mice were immunized twice at 2-week intervals with 100 μg of plasmid DNA encoding either a TsMIF-TsMCD-1 fusion protein (pVAX1-Tsmif-Tsmcd-1) or an Ub-co-expressing triple fusion protein Ub-TsMIF-TsMCD-1 (pVAX1-Ub-Tsmif-Tsmcd-1). Control animals were immunized with pVAX1-Ub or blank vector plasmid. Specific antibody levels (IgG, IgG1, IgG2a, IgG2b, IgM, IgA, IgE) against the recombinant protein TsMIF-TsMCD-1, serum cytokines (interferon (IFN)-γ, interleukin (IL)-4, IL-5, transforming growth factor (TGF)-β1 and IL-17), CD4+/CD8+ T cells and cytotoxic T lymphocyte (CTL) responses were monitored. Challenge infection was performed 2 weeks after the second immunization and worm burden was assayed at 35 days post-challenge. Antibody responses induced by pVAX1-Ub-Tsmif-Tsmcd-1 were significantly lower than for TsMIF-TsMCD-1, but the vaccine induced increased levels of Th1 cytokine (IFN-γ) and increased T-cell cytotoxicity. The reduction of worm burden (37.95%) following immunization with pVAX1-Ub-Tsmif-Tsmcd-1 was significantly greater than that induced by the pVAX1-Tsmif-Tsmcd-1 vaccine (23.17%; P< 0.05).
Estrogen signalling and the DNA damage response in hormone dependent breast cancers
Directory of Open Access Journals (Sweden)
C Elizabeth Caldon
2014-05-01
Full Text Available Estrogen is necessary for the normal growth and development of breast tissue, but high levels of estrogen are a major risk factor for breast cancer. One mechanism by which estrogen could contribute to breast cancer is via the induction of DNA damage. This perspective discusses the mechanisms by which estrogen alters the DNA damage response (DDR and DNA repair through the regulation of key effector proteins including ATM, ATR, CHK1, BRCA1 and p53 and the feedback on estrogen receptor signalling from these proteins. We put forward the hypothesis that estrogen receptor signalling converges to suppress effective DNA repair and apoptosis in favour of proliferation. This is important in hormone-dependent breast cancer as it will affect processing of estrogen-induced DNA damage, as well as other genotoxic insults. DDR and DNA repair proteins are frequently mutated or altered in estrogen responsive breast cancer which will further change the processing of DNA damage. Finally the action of estrogen signalling on DNA damage is also relevant to the therapeutic setting as the suppression of a DNA damage response by estrogen has the potential to alter the response of cancers to anti-hormone treatment or chemotherapy that induces DNA damage.
Comparison of Current Regulatory Status for Gene-Based Vaccines in the U.S., Europe and Japan
Directory of Open Access Journals (Sweden)
Yoshikazu Nakayama
2015-03-01
Full Text Available Gene-based vaccines as typified by plasmid DNA vaccines and recombinant viral-vectored vaccines are expected as promising solutions against infectious diseases for which no effective prophylactic vaccines exist such as HIV, dengue virus, Ebola virus and malaria, and for which more improved vaccines are needed such as tuberculosis and influenza virus. Although many preclinical and clinical trials have been conducted to date, no DNA vaccines or recombinant viral-vectored vaccines expressing heterologous antigens for human use have yet been licensed in the U.S., Europe or Japan. In this research, we describe the current regulatory context for gene-based prophylactic vaccines against infectious disease in the U.S., Europe, and Japan. We identify the important considerations, in particular, on the preclinical assessments that would allow these vaccines to proceed to clinical trials, and the differences on the regulatory pathway for the marketing authorization in each region.
Directory of Open Access Journals (Sweden)
George Jiang
Full Text Available Using newer vaccine platforms which have been effective against malaria in rodent models, we tested five immunization regimens against Plasmodium knowlesi in rhesus monkeys. All vaccines included the same four P. knowlesi antigens: the pre-erythrocytic antigens CSP, SSP2, and erythrocytic antigens AMA1, MSP1. We used four vaccine platforms for prime or boost vaccinations: plasmids (DNA, alphavirus replicons (VRP, attenuated adenovirus serotype 5 (Ad, or attenuated poxvirus (Pox. These four platforms combined to produce five different prime/boost vaccine regimens: Pox alone, VRP/Pox, VRP/Ad, Ad/Pox, and DNA/Pox. Five rhesus monkeys were immunized with each regimen, and five Control monkeys received a mock vaccination. The time to complete vaccinations was 420 days. All monkeys were challenged twice with 100 P. knowlesi sporozoites given IV. The first challenge was given 12 days after the last vaccination, and the monkeys receiving the DNA/Pox vaccine were the best protected, with 3/5 monkeys sterilely protected and 1/5 monkeys that self-cured its parasitemia. There was no protection in monkeys that received Pox malaria vaccine alone without previous priming. The second sporozoite challenge was given 4 months after the first. All 4 monkeys that were protected in the first challenge developed malaria in the second challenge. DNA, VRP and Ad5 vaccines all primed monkeys for strong immune responses after the Pox boost. We discuss the high level but short duration of protection in this experiment and the possible benefits of the long interval between prime and boost.
Noninvasive vaccination against infectious diseases.
Zheng, Zhichao; Diaz-Arévalo, Diana; Guan, Hongbing; Zeng, Mingtao
2018-04-06
The development of a successful vaccine, which should elicit a combination of humoral and cellular responses to control or prevent infections, is the first step in protecting against infectious diseases. A vaccine may protect against bacterial, fungal, parasitic, or viral infections in animal models, but to be effective in humans there are some issues that should be considered, such as the adjuvant, the route of vaccination, and the antigen-carrier system. While almost all licensed vaccines are injected such that inoculation is by far the most commonly used method, injection has several potential disadvantages, including pain, cross contamination, needlestick injury, under- or overdosing, and increased cost. It is also problematic for patients from rural areas of developing countries, who must travel to a hospital for vaccine administration. Noninvasive immunizations, including oral, intranasal, and transcutaneous administration of vaccines, can reduce or eliminate pain, reduce the cost of vaccinations, and increase their safety. Several preclinical and clinical studies as well as experience with licensed vaccines have demonstrated that noninvasive vaccine immunization activates cellular and humoral immunity, which protect against pathogen infections. Here we review the development of noninvasive immunization with vaccines based on live attenuated virus, recombinant adenovirus, inactivated virus, viral subunits, virus-like particles, DNA, RNA, and antigen expression in rice in preclinical and clinical studies. We predict that noninvasive vaccine administration will be more widely applied in the clinic in the near future.
Directory of Open Access Journals (Sweden)
J.S.F. Pereira
2006-04-01
Full Text Available Anti-HBc positivity is a frequent cause of donation rejection at blood banks. Hepatitis B virus (HBV infection may also occur in HBsAg-negative patients, a situation denoted occult infection. Similarly, very low levels of HBV-DNA have also been found in the sera of patients with chronic hepatitis C virus (HCV infection, even in the absence of serum HBsAg. Initially we searched for HBV-DNA in serum of 100 blood donors and 50 HCV-infected patients who were HBsAg negative/anti-HBc positive by nested-PCR and by an HBV monitor commercial test for HBV-DNA. Anti-HBs seroconversion rates were measured in 100 blood donors and in 22 patients with chronic HCV infection after HBV vaccination to determine if the HBV vaccination could eliminate an occult HBV infection in these individuals. Occult HBV infection was detected in proportionally fewer blood donors (6/100 = 6% than chronic hepatitis C patients (12/50 = 24% (P 0.05. All subjects who were HBV-DNA(+ before the first dose of HBV vaccine (D1, became HBV-DNA(- after D1, D2, and D3. Among 22 HCV-positive patients, 10 HBV-DNA(+ and 12 HBV-DNA(-, seroconversion was observed in 9/10 (90% HBV-DNA(+ and in 9/12 (75% HBV-DNA(- subjects (P > 0.05. The disappearance of HBV-DNA in the majority of vaccinated patients suggests that residual HBV can be eliminated in patients with occult infection.
A field vaccine trial in Tanzania demonstrates partial protection ...
African Journals Online (AJOL)
Vaccination resulted in the induction of virus-specific and virus-neutralizing antibodies, whilst some cattle in the unvaccinated groups also developed ... PCR of DNA from blood samples detected AlHV-1 infection in both groups of cattle but the frequency of infection was significantly lower in the vaccinated groups.
Novel adjuvants & delivery vehicles for vaccines development: a road ahead.
Mohan, Teena; Verma, Priyanka; Rao, D Nageswara
2013-11-01
The pure recombinant and synthetic antigens used in modern day vaccines are generally less immunogenic than older style live/attenuated and killed whole organism vaccines. One can improve the quality of vaccine production by incorporating immunomodulators or adjuvants with modified delivery vehicles viz. liposomes, immune stimulating complexes (ISCOMs), micro/nanospheres apart from alum, being used as gold standard. Adjuvants are used to augment the effect of a vaccine by stimulating the immune system to respond to the vaccine, more vigorously, and thus providing increased immunity to a particular disease. Adjuvants accomplish this task by mimicking specific sets of evolutionary conserved molecules which include lipopolysaccharides (LPS), components of bacterial cell wall, endocytosed nucleic acids such as dsRNA, ssDNA and unmethylated CpG dinucleotide containing DNA. This review provides information on various vaccine adjuvants and delivery vehicles being developed to date. From literature, it seems that the humoral immune responses have been observed for most adjuvants and delivery platforms while viral-vector, ISCOMs and Montanides have shown cytotoxic T-cell response in the clinical trials. MF59 and MPL® have elicited Th1 responses, and virus-like particles (VLPs), non-degradable nanoparticle and liposomes have also generated cellular immunity. Such vaccine components have also been evaluated for alternative routes of administration with clinical success reported for intranasal delivery of viral-vectors and proteosomes and oral delivery of VLP vaccines.
Approaches and Perspectives for Development of African Swine Fever Virus Vaccines
Directory of Open Access Journals (Sweden)
Marisa Arias
2017-10-01
Full Text Available African swine fever (ASF is a complex disease of swine, caused by a large DNA virus belonging to the family Asfarviridae. The disease shows variable clinical signs, with high case fatality rates, up to 100%, in the acute forms. ASF is currently present in Africa and Europe where it circulates in different scenarios causing a high socio-economic impact. In most affected regions, control has not been effective in part due to lack of a vaccine. The availability of an effective and safe ASFV vaccines would support and enforce control–eradication strategies. Therefore, work leading to the rational development of protective ASF vaccines is a high priority. Several factors have hindered vaccine development, including the complexity of the ASF virus particle and the large number of proteins encoded by its genome. Many of these virus proteins inhibit the host’s immune system thus facilitating virus replication and persistence. We review previous work aimed at understanding ASFV–host interactions, including mechanisms of protective immunity, and approaches for vaccine development. These include live attenuated vaccines, and “subunit” vaccines, based on DNA, proteins, or virus vectors. In the shorter to medium term, live attenuated vaccines are the most promising and best positioned candidates. Gaps and future research directions are evaluated.
Is There Still Any Role for Oxidative Stress in Mitochondrial DNA-Dependent Aging?
Directory of Open Access Journals (Sweden)
Gábor Zsurka
2018-03-01
Full Text Available Recent deep sequencing data has provided compelling evidence that the spectrum of somatic point mutations in mitochondrial DNA (mtDNA in aging tissues lacks G > T transversion mutations. This fact cannot, however, be used as an argument for the missing contribution of reactive oxygen species (ROS to mitochondria-related aging because it is probably caused by the nucleotide selectivity of mitochondrial DNA polymerase γ (POLG. In contrast to point mutations, the age-dependent accumulation of mitochondrial DNA deletions is, in light of recent experimental data, still explainable by the segregation of mutant molecules generated by the direct mutagenic effects of ROS (in particular, of HO· radicals formed from H2O2 by a Fenton reaction. The source of ROS remains controversial, because the mitochondrial contribution to tissue ROS production is probably lower than previously thought. Importantly, in the discussion about the potential role of oxidative stress in mitochondria-dependent aging, ROS generated by inflammation-linked processes and the distribution of free iron also require careful consideration.
Military Infectious Diseases Update on Vaccine Development
2011-01-24
Licensed live vaccines (polio, MMR) - Radiation- attenuated sporozoites - Genetically- attenuated sporozoites 2011 MHS Conference Whole Organism...Not sufficiently attenuated Seattle Biomedical , Gates Foundation, WEHI and USMMVP 2011 MHS Conference Subunit approach- RTS,S Vaccine RTS,S is...Ad Boost DNA plasmids [Prime] – Encoding malaria proteins CSP and AMA1 Adenovirus 5 ( attenuated )[Boost] – Encoding malaria proteins CSP and AMA1
Josefsberg, Jessica O; Buckland, Barry
2012-06-01
The evolution of vaccines (e.g., live attenuated, recombinant) and vaccine production methods (e.g., in ovo, cell culture) are intimately tied to each other. As vaccine technology has advanced, the methods to produce the vaccine have advanced and new vaccine opportunities have been created. These technologies will continue to evolve as we strive for safer and more immunogenic vaccines and as our understanding of biology improves. The evolution of vaccine process technology has occurred in parallel to the remarkable growth in the development of therapeutic proteins as products; therefore, recent vaccine innovations can leverage the progress made in the broader biotechnology industry. Numerous important legacy vaccines are still in use today despite their traditional manufacturing processes, with further development focusing on improving stability (e.g., novel excipients) and updating formulation (e.g., combination vaccines) and delivery methods (e.g., skin patches). Modern vaccine development is currently exploiting a wide array of novel technologies to create safer and more efficacious vaccines including: viral vectors produced in animal cells, virus-like particles produced in yeast or insect cells, polysaccharide conjugation to carrier proteins, DNA plasmids produced in E. coli, and therapeutic cancer vaccines created by in vitro activation of patient leukocytes. Purification advances (e.g., membrane adsorption, precipitation) are increasing efficiency, while innovative analytical methods (e.g., microsphere-based multiplex assays, RNA microarrays) are improving process understanding. Novel adjuvants such as monophosphoryl lipid A, which acts on antigen presenting cell toll-like receptors, are expanding the previously conservative list of widely accepted vaccine adjuvants. As in other areas of biotechnology, process characterization by sophisticated analysis is critical not only to improve yields, but also to determine the final product quality. From a regulatory
Amino acid-dependent signaling via S6K1 and MYC is essential for regulation of rDNA transcription
Kang, Jian; Kusnadi, Eric P.; Ogden, Allison J.; Hicks, Rodney J.; Bammert, Lukas; Kutay, Ulrike; Hung, Sandy; Sanij, Elaine; Hannan, Ross D.; Hannan, Katherine M.; Pearson, Richard B.
2016-01-01
Dysregulation of RNA polymerase I (Pol I)-dependent ribosomal DNA (rDNA) transcription is a consistent feature of malignant transformation that can be targeted to treat cancer. Understanding how rDNA transcription is coupled to the availability of growth factors and nutrients will provide insight into how ribosome biogenesis is maintained in a tumour environment characterised by limiting nutrients. We demonstrate that modulation of rDNA transcription initiation, elongation and rRNA processing is an immediate, co-regulated response to altered amino acid abundance, dependent on both mTORC1 activation of S6K1 and MYC activity. Growth factors regulate rDNA transcription initiation while amino acids modulate growth factor-dependent rDNA transcription by primarily regulating S6K1-dependent rDNA transcription elongation and processing. Thus, we show for the first time amino acids regulate rRNA synthesis by a distinct, post-initiation mechanism, providing a novel model for integrated control of ribosome biogenesis that has implications for understanding how this process is dysregulated in cancer. PMID:27385002
Attenuated Shigella as a DNA Delivery Vehicle for DNA-Mediated Immunization
Sizemore, Donata R.; Branstrom, Arthur A.; Sadoff, Jerald C.
1995-10-01
Direct inoculation of DNA, in the form of purified bacterial plasmids that are unable to replicate in mammalian cells but are able to direct cell synthesis of foreign proteins, is being explored as an approach to vaccine development. Here, a highly attenuated Shigella vector invaded mammalian cells and delivered such plasmids into the cytoplasm of cells, and subsequent production of functional foreign protein was measured. Because this Shigella vector was designed to deliver DNA to colonic mucosa, the method is a potential basis for oral and other mucosal DNA immunization and gene therapy strategies.
Geometry-dependent DNA-TiO2 immobilization mechanism: A spectroscopic approach
Silva-Moraes, M. O.; Garcia-Basabe, Y.; de Souza, R. F. B.; Mota, A. J.; Passos, R. R.; Galante, D.; Fonseca Filho, H. D.; Romaguera-Barcelay, Y.; Rocco, M. L. M.; Brito, W. R.
2018-06-01
DNA nucleotides are used as a molecular recognition system on electrodes modified to be applied in the detection of various diseases, but immobilization mechanisms, as well as, charge transfers are not satisfactorily described in the literature. An electrochemical and spectroscopic study was carried out to characterize the molecular groups involved in the direct immobilization of DNA structures on the surface of nanostructured TiO2 with the aim of evaluating the influence of the geometrical aspects. X-ray photoelectron spectroscopy at O1s and P2p core levels indicate that immobilization of DNA samples occurs through covalent (Psbnd Osbnd Ti) bonds. X-ray absorption spectra at the Ti2p edge reinforce this conclusion. A new species at 138.5 eV was reported from P2p XPS spectra analysis which plays an important role in DNA-TiO2 immobilization. The Psbnd Osbnd Ti/Osbnd Ti ratio showed that quantitatively the DNA immobilization mechanism is dependent on their geometry, becoming more efficient for plasmid ds-DNA structures than for PCR ds-DNA structures. The analysis of photoabsorption spectra at C1s edge revealed that the molecular groups that participate in the C1s → LUMO electronic transitions have different pathways in the charge transfer processes at the DNA-TiO2 interface. Our results may contribute to additional studies of immobilization mechanisms understanding the influence of the geometry of different DNA molecules on nanostructured semiconductor and possible impact to the charge transfer processes with application in biosensors or aptamers.
Ye, Ting; Yue, Yan; Fan, Xiangmei; Dong, Chunsheng; Xu, Wei; Xiong, Sidong
2014-07-31
Efficient delivery of antigen to mucosal associated lymphoid tissue is a first and critical step for successful induction of mucosal immunity by vaccines. Considering its potential transcytotic capability, M cell has become a more and more attractive target for mucosal vaccines. In this research, we designed an M cell-targeting strategy by which mucosal delivery system chitosan (CS) was endowed with M cell-targeting ability via conjugating with a CPE30 peptide, C terminal 30 amino acids of clostridium perfringens enterotoxin (CPE), and then evaluated its immune-enhancing ability in the context of coxsackievirus B3 (CVB3)-specific mucosal vaccine consisting of CS and a plasmid encoding CVB3 predominant antigen VP1. It had shown that similar to CS-pVP1, M cell-targeting CPE30-CS-pVP1 vaccine appeared a uniform spherical shape with about 300 nm diameter and +22 mV zeta potential, and could efficiently protect DNA from DNase I digestion. Mice were orally immunized with 4 doses of CPE30-CS-pVP1 containing 50 μg pVP1 at 2-week intervals and challenged with CVB3 4 weeks after the last immunization. Compared with CS-pVP1 vaccine, CPE30-CS-pVP1 vaccine had no obvious impact on CVB3-specific serum IgG level and splenic T cell immune responses, but significantly increased specific fecal SIgA level and augmented mucosal T cell immune responses. Consequently, much milder myocarditis and lower viral load were witnessed in CPE30-CS-pVP1 immunized group. The enhanced immunogenicity and immunoprotection were associated with the M cell-targeting ability of CPE30-CS-pVP1 which improved its mucosal uptake and transcytosis. Our findings indicated that CPE30-CS-pVP1 may represent a novel prophylactic vaccine against CVB3-induced myocarditis, and this M cell-targeting strategy indeed could be applied as a promising and universal platform for mucosal vaccine development. Copyright © 2014 Elsevier Ltd. All rights reserved.
Radiation and Anti-Cancer Vaccines: A Winning Combination.
Cadena, Alexandra; Cushman, Taylor R; Anderson, Clark; Barsoumian, Hampartsoum B; Welsh, James W; Cortez, Maria Angelica
2018-01-30
The emerging combination of radiation therapy with vaccines is a promising new treatment plan in the fight against cancer. While many cancer vaccines such as MUC1, p53 CpG oligodeoxynucleotide, and SOX2 may be great candidates for antitumor vaccination, there still remain many investigations to be done into possible vaccine combinations. One fruitful partnership that has emerged are anti-tumor vaccines in combination with radiation. Radiation therapy was previously thought to be only a tool for directly or indirectly damaging DNA and therefore causing cancer cell death. Now, with much preclinical and clinical data, radiation has taken on the role of an in situ vaccine. With both cancer vaccines and radiation at our disposal, more and more studies are looking to combining vaccine types such as toll-like receptors, viral components, dendritic-cell-based, and subunit vaccines with radiation. While the outcomes of these combinatory efforts are promising, there is still much work to be covered. This review sheds light on the current state of affairs in cancer vaccines and how radiation will bring its story into the future.
Vaccine escape recombinants emerge after pneumococcal vaccination in the United States.
Brueggemann, Angela B; Pai, Rekha; Crook, Derrick W; Beall, Bernard
2007-11-01
The heptavalent pneumococcal conjugate vaccine (PCV7) was introduced in the United States (US) in 2000 and has significantly reduced invasive pneumococcal disease; however, the incidence of nonvaccine serotype invasive disease, particularly due to serotype 19A, has increased. The serotype 19A increase can be explained in part by expansion of a genotype that has been circulating in the US prior to vaccine implementation (and other countries since at least 1990), but also by the emergence of a novel "vaccine escape recombinant" pneumococcal strain. This strain has a genotype that previously was only associated with vaccine serotype 4, but now expresses a nonvaccine serotype 19A capsule. Based on prior evidence for capsular switching by recombination at the capsular locus, the genetic event that resulted in this novel serotype/genotype combination might be identifiable from the DNA sequence of individual pneumococcal strains. Therefore, the aim of this study was to characterise the putative recombinational event(s) at the capsular locus that resulted in the change from a vaccine to a nonvaccine capsular type. Sequencing the capsular locus flanking regions of 51 vaccine escape (progeny), recipient, and putative donor pneumococci revealed a 39 kb recombinational fragment, which included the capsular locus, flanking regions, and two adjacent penicillin-binding proteins, and thus resulted in a capsular switch and penicillin nonsusceptibility in a single genetic event. Since 2003, 37 such vaccine escape strains have been detected, some of which had evolved further. Furthermore, two new types of serotype 19A vaccine escape strains emerged in 2005. To our knowledge, this is the first time a single recombinational event has been documented in vivo that resulted in both a change of serotype and penicillin nonsusceptibility. Vaccine escape by genetic recombination at the capsular locus has the potential to reduce PCV7 effectiveness in the longer term.
DEFF Research Database (Denmark)
Peng, Wenfang; Li, Huan; Hallstrøm, Søren
2013-01-01
-adjacent motif (PAM)-dependent DNA targeting activity and mature CRISPR RNA (crRNA) production in this organism, mutants deleting individual genes of the type IA system or removing each of other Cas modules were constructed. Characterization of these mutants revealed that Cas7, Cas5, Cas6, Cas3' and Cas3......" are essential for PAM-dependent DNA targeting activity, whereas Csa5, along with all other Cas modules, is dispensable for the targeting in the crenarchaeon. Cas6 is implicated as the only enzyme for pre-crRNA processing and the crRNA maturation is independent of the DNA targeting activity. Importantly, we show...
Nielsen, Line; Søgaard, Mette; Karlskov-Mortensen, Peter; Jensen, Trine Hammer; Jensen, Tove Dannemann; Aasted, Bent; Blixenkrone-Møller, Merete
2009-07-30
The aim of the study was to investigate the different phases of the immune response after DNA immunization with the hemagglutinin and nucleoprotein genes from canine distemper virus (CDV). Although attenuated live CDV vaccines have effectively reduced the incidence of disease, canine distemper is still a problem worldwide. The broad host range of CDV creates a constant viral reservoir among wildlife animals. Our results demonstrated early humoral and cell-mediated immune responses (IFN-gamma) in DNA vaccinated mink compared to mock-vaccinated mink after challenge with a Danish wild-type CDV. The DNA vaccine-induced immunity protected the natural host against disease development.
The dog that did not bark: malaria vaccines without antibodies.
Heppner, D.G.; Schwenk, R.J.; Arnot, D.; Sauerwein, R.W.; Luty, A.J.F.
2007-01-01
To date, the only pre-blood stage vaccine to confer protection against malaria in field trials elicits both antigen-specific antibody and T-cell responses. Recent clinical trials of new heterologous prime-boost malaria vaccine regimens using DNA, fowlpox or MVA, have chiefly elicited T-cell
Grimaldi, Gabriel; Teva, Antonio; Porrozzi, Renato; Pinto, Marcelo A; Marchevsky, Renato S; Rocha, Maria Gabrielle L; Dutra, Miriam S; Bruña-Romero, Oscar; Fernandes, Ana-Paula; Gazzinelli, Ricardo T
2014-06-01
Visceral leishmaniasis (VL) is a severe vector-born disease of humans and dogs caused by Leishmania donovani complex parasites. Approximately 0.2 to 0.4 million new human VL cases occur annually worldwide. In the new world, these alarming numbers are primarily due to the impracticality of current control methods based on vector reduction and dog euthanasia. Thus, a prophylactic vaccine appears to be essential for VL control. The current efforts to develop an efficacious vaccine include the use of animal models that are as close to human VL. We have previously reported a L. infantum-macaque infection model that is reliable to determine which vaccine candidates are most worthy for further development. Among the few amastigote antigens tested so far, one of specific interest is the recombinant A2 (rA2) protein that protects against experimental L. infantum infections in mice and dogs. Primates were vaccinated using three rA2-based prime-boost immunization regimes: three doses of rA2 plus recombinant human interleukin-12 (rhIL-12) adsorbed in alum (rA2/rhIL-12/alum); two doses of non-replicative adenovirus recombinant vector encoding A2 (Ad5-A2) followed by two boosts with rA2/rhIL-12/alum (Ad5-A2+rA2/rhIL12/alum); and plasmid DNA encoding A2 gene (DNA-A2) boosted with two doses of Ad5-A2 (DNA-A2+Ad5-A2). Primates received a subsequent infectious challenge with L. infantum. Vaccines, apart from being safe, were immunogenic as animals responded with increased pre-challenge production of anti-A2-specific IgG antibodies, though with some variability in the response, depending on the vaccine formulation/protocol. The relative parasite load in the liver was significantly lower in immunized macaques as compared to controls. Protection correlated with hepatic granuloma resolution, and reduction of clinical symptoms, particularly when primates were vaccinated with the Ad5-A2+rA2/rhIL12/alum protocol. The remarkable clinical protection induced by A2 in an animal model that is
Patel, M; Carritt, K; Lane, J; Jayappa, H; Stahl, M; Bourgeois, M
2015-07-01
Four vaccines for feline leukemia virus (FeLV) are available in the United States. This study's purpose was to compare the efficacy of Nobivac feline 2-FeLV (an inactivated, adjuvanted whole-virus vaccine) and PureVax recombinant FeLV (a live, canarypox virus-vectored vaccine) following FeLV challenge. Cats were vaccinated at 9 and 12 weeks with Nobivac feline 2-FeLV (group A, n = 11) or PureVax recombinant FeLV (group B, n = 10). Group C (n = 11) comprised unvaccinated controls. At 3 months postvaccination, cats were immunosuppressed and challenged with FeLV-A/61E. The outcomes measured were persistent antigenemia at 12 weeks postchallenge (PC) and proviral DNA and viral RNA at 3 to 9 weeks PC. Persistent antigenemia was observed in 0 of 11 cats in group A, 5 of 10 cats in group B, and 10 of 11 cats in group C. Group A was significantly protected compared to those in groups B (P 0.063). The preventable fraction was 100% for group A and 45% for group B. At 9 weeks PC, proviral DNA and viral RNA were detected 1 of 11 cats in group A, 6 of 10 cats in group B, and 9 of 11 cats in group C. Nucleic acid loads were significantly lower in group A than in group C (P feline 2-FeLV-vaccinated cats were fully protected against persistent antigenemia and had significantly smaller amounts of proviral DNA and plasma viral RNA loads than PureVax recombinant FeLV-vaccinated cats and unvaccinated controls. Copyright © 2015, Patel et al.
Vaccine platform recombinant measles virus.
Mühlebach, Michael D
2017-10-01
The classic development of vaccines is lengthy, tedious, and may not necessarily be successful as demonstrated by the case of HIV. This is especially a problem for emerging pathogens that are newly introduced into the human population and carry the inherent risk of pandemic spread in a naïve population. For such situations, a considerable number of different platform technologies are under development. These are also under development for pathogens, where directly derived vaccines are regarded as too complicated or even dangerous due to the induction of inefficient or unwanted immune responses causing considerable side-effects as for dengue virus. Among platform technologies are plasmid-based DNA vaccines, RNA replicons, single-round infectious vector particles, or replicating vaccine-based vectors encoding (a) critical antigen(s) of the target pathogens. Among the latter, recombinant measles viruses derived from vaccine strains have been tested. Measles vaccines are among the most effective and safest life-attenuated vaccines known. Therefore, the development of Schwarz-, Moraten-, or AIK-C-strain derived recombinant vaccines against a wide range of mostly viral, but also bacterial pathogens was quite straightforward. These vaccines generally induce powerful humoral and cellular immune responses in appropriate animal models, i.e., transgenic mice or non-human primates. Also in the recent first clinical phase I trial, the results have been quite encouraging. The trial indicated the expected safety and efficacy also in human patients, interestingly independent from the level of prevalent anti-measles immunity before the trial. Thereby, recombinant measles vaccines expressing additional antigens are a promising platform for future vaccines.
Directory of Open Access Journals (Sweden)
Hsin-Wei Chen
Full Text Available Dengue is the leading cause of mosquito-borne viral infections and no vaccine is available now. Envelope protein domain III (ED3 is the major target for the binding of dengue virus neutralizing antibodies; however, the ED3-specifc T-cell response is less well understood. To investigate the T-cell responses to four serotypes of dengue virus (DENV-1 to 4, we immunized mice using either a tetravalent ED3-based DNA or protein vaccine, or combined both as a DNA prime-protein boost strategy (prime-boost. A significant serotype-dependent IFN-γ or IL-4 response was observed in mice immunized with either the DNA or protein vaccine. The IFN-γ response was dominant to DENV-1 to 3, whereas the IL-4 response was dominant to DENV-4. Although the similar IgG titers for the four serotypes were observed in mice immunized with the tetravalent vaccines, the neutralizing antibody titers varied and followed the order of 2 = 3>1>4. Interestingly, the lower IFN-γ response to DENV-4 is attributable to the immunodominance change between two CD4+ T-cell epitopes; one T-cell epitope located at E349-363 of DENV-1 to 3 was more immunogenic than the DENV-4 epitope E313-327. Despite DENV-4 specific IFN-γ responses were suppressed by immunodominance change, either DENV-4-specific IFN-γ or neutralizing antibody responses were still recalled after DENV-4 challenge and contributed to virus clearance. Immunization with the prime-boost elicited both IFN-γ and neutralizing antibody responses and provided better protection than either DNA or protein immunization. Our findings shed light on how ED3-based tetravalent dengue vaccines sharpen host CD4 T-cell responses and contribute to protection against dengue virus.
Nuclear techniques in schistosomiasis: Towards a schistosome vaccine
International Nuclear Information System (INIS)
Taylor, D.W.
1986-01-01
The paper reviews recent advances in schistosome research achieved through the application of nuclear techniques and aimed at the development of a vaccine. Two principal areas are discussed: first, immune effector mechanisms; and secondly, the application of hybridoma and recombinant DNA technology to the problem of production of large quantities of parasite antigens suitable for inclusion in an experimental vaccine. (author)
Directory of Open Access Journals (Sweden)
Lin Chen
Full Text Available Pre-erythrocytic malaria vaccines, including those based on whole-parasite approaches, have shown protective efficacy in animal and human studies. However few pre-erythocytic antigens other than the immunodominant circumsporozoite protein (CSP have been studied in depth with the goal of developing potent subunit malaria vaccines that are suited for use in endemic areas. Here we describe a novel technique to identify pre-erythrocytic malaria antigens that contribute to protection elicited by whole-parasite vaccination in the mouse model. Our approach combines immunization with genetically attenuated parasites and challenge with DNA plasmids encoding for potential protective pre-erythrocytic malaria antigens as luciferase fusions by hydrodynamic tail vein injection. After optimizing the technique, we first showed that immunization with Pyfabb/f-, a P. yoelii genetically attenuated parasite, induces killing of CSP-presenting hepatocytes. Depletion of CD8+ but not CD4+ T cells diminished the killing of CSP-expressing hepatocytes, indicating that killing is CD8+ T cell-dependent. Finally we showed that the use of heterologous prime/boost immunization strategies that use genetically attenuated parasites and DNA vaccines enabled the characterization of a novel pre-erythrocytic antigen, Tmp21, as a contributor to Pyfabb/f- induced protection. This technique will be valuable for identification of potentially protective liver stage antigens and has the potential to contribute to the understanding of immunity elicited by whole parasite vaccination, as well as the development of effective subunit malaria vaccines.
Motani, Kou; Ito, Shinji; Nagata, Shigekazu
2015-05-15
Cytoplasmic DNA activates cyclic GMP-AMP synthase (cGAS) to produce cyclic 2'-5'3'-5'GMP-AMP dinucleotide (2'5 'cGAMP). The binding of 2'5'cGAMP to an adaptor protein, stimulator of IFN genes (STING), activates a transcription factor, IFN regulatory factor 3, leading to the induction of IFN and chemokine gene expression. In this study, we found that the 2'5'cGAMP-dependent STING activation induced highly upregulated CXCL10 gene expression. Formation of a distinct STING dimer, which was detected by native PAGE, was induced by 2'5'cGAMP, but not 3'-5'3'-5'cGAMP. Analysis of DNase II(-/-) mice, which constitutively produce IFN-β and CXCL10, showed the accumulation of 2'5'cGAMP in their fetal livers and spleens, suggesting that the undigested DNA accumulating in DNase II(-/-) cells may have leaked from the lysosomes into the cytoplasm. The DNase II(-/-) mouse embryonic fibroblasts produced 2'5'cGAMP in a cGAS-dependent manner during apoptotic cell engulfment. However, cGAS deficiency did not impair the STING-dependent upregulation of CXCL10 in DNase II(-/-) mouse embryonic fibroblasts that was induced by apoptotic cell engulfment or DNA lipofection. These results suggest the involvement of a cGAS-independent additional DNA sensor(s) that induces the STING-dependent activation of innate immunity. Copyright © 2015 by The American Association of Immunologists, Inc.
Kaslow, David C
2004-10-01
Vaccine development requires an amalgamation of disparate disciplines and has unique economic and regulatory drivers. Non-viral gene-based delivery systems, such as formulated plasmid DNA, are new and potentially disruptive technologies capable of providing 'cheaper, simpler, and more convenient-to-use' vaccines. Typically and somewhat ironically, disruptive technologies have poorer product performance, at least in the near-term, compared with the existing conventional technologies. Because successful product development requires that the product's performance must meet or exceed the efficacy threshold for a desired application, the appropriate selection of the initial product applications for a disruptive technology is critical for its successful evolution. In this regard, the near-term successes of gene-based vaccines will likely be for protection against bacterial toxins and acute viral and bacterial infections. Recent breakthroughs, however, herald increasing rather than languishing performance improvements in the efficacy of gene-based vaccines. Whether gene-based vaccines ultimately succeed in eliciting protective immunity in humans to persistent intracellular pathogens, such as HIV, malaria and tuberculosis, for which the conventional vaccine technologies have failed, remains to be determined. A success against any one of the persistent intracellular pathogens would be sufficient proof that gene-based vaccines represent a disruptive technology against which future vaccine technologies will be measured.
International Nuclear Information System (INIS)
Egerton, J.R.
2005-01-01
For vaccine production, recombinant antigens must be protective. Identifying protective antigens or candidate antigens is an essential precursor to vaccine development. Even when a protective antigen has been identified, cloning of its gene does not lead directly to vaccine development. The fimbrial protein of Dichelobacter nodosus, the agent of foot-rot in ruminants, was known to be protective. Recombinant vaccines against this infection are ineffective if expressed protein subunits are not assembled as mature fimbriae. Antigenic competition between different, but closely related, recombinant antigens limited the use of multivalent vaccines based on this technology. Recombinant antigens may need adjuvants to enhance response. DNA vaccines, potentiated with genes for different cytokines, may replace the need for aggressive adjuvants, and especially where cellular immunity is essential for protection. The expression of antigens from animal pathogens in plants and the demonstration of some immunity to a disease like rinderpest after ingestion of these, suggests an alternative approach to vaccination by injection. Research on disease pathogenesis and the identification of candidate antigens is specific to the disease agent. The definition of expression systems and the formulation of a vaccine for each disease must be followed by research to establish safety and efficacy. Where vaccines are based on unique gene sequences, the intellectual property is likely to be protected by patent. Organizations, licensed to produce recombinant vaccines, expect to recover their costs and to make a profit. The consequence is that genetically-derived vaccines are expensive. The capacity of vaccines to help animal owners of poorer countries depends not only on quality and cost but also on the veterinary infrastructure where they are used. Ensuring the existence of an effective animal health infrastructure in developing countries is as great a challenge for the developed world as
DEFF Research Database (Denmark)
Lee, Baeck-Seung; Gapud, Eric J; Zhang, Shichuan
2013-01-01
V(D)J recombination is initiated by the RAG endonuclease, which introduces DNA double-strand breaks (DSBs) at the border between two recombining gene segments, generating two hairpin-sealed coding ends and two blunt signal ends. ATM and DNA-dependent protein kinase catalytic subunit (DNA-PKcs) ar......V(D)J recombination is initiated by the RAG endonuclease, which introduces DNA double-strand breaks (DSBs) at the border between two recombining gene segments, generating two hairpin-sealed coding ends and two blunt signal ends. ATM and DNA-dependent protein kinase catalytic subunit (DNA......-PKcs) are serine-threonine kinases that orchestrate the cellular responses to DNA DSBs. During V(D)J recombination, ATM and DNA-PKcs have unique functions in the repair of coding DNA ends. ATM deficiency leads to instability of postcleavage complexes and the loss of coding ends from these complexes. DNA...... when ATM is present and its kinase activity is intact. The ability of ATM to compensate for DNA-PKcs kinase activity depends on the integrity of three threonines in DNA-PKcs that are phosphorylation targets of ATM, suggesting that ATM can modulate DNA-PKcs activity through direct phosphorylation of DNA...
Munang'andu, Hetron Mweemba; Paul, Joydeb; Evensen, Øystein
2016-12-13
Streptococcus agalactiae is an emerging infectious disease adversely affecting Nile tilapia ( Niloticus oreochromis ) production in aquaculture. Research carried out in the last decade has focused on developing protective vaccines using different strategies, although no review has been carried out to evaluate the efficacy of these strategies. The purpose of this review is to provide a synopsis of vaccination strategies and antigen delivery systems currently used for S. agalactiae vaccines in tilapia. Furthermore, as shown herein, current vaccine designs include the use of replicative antigen delivery systems, such as attenuated virulent strains, heterologous vectors and DNA vaccines, while non-replicative vaccines include the inactivated whole cell (IWC) and subunit vaccines encoding different S. agalactiae immunogenic proteins. Intraperitoneal vaccination is the most widely used immunization strategy, although immersion, spray and oral vaccines have also been tried with variable success. Vaccine efficacy is mostly evaluated by use of the intraperitoneal challenge model aimed at evaluating the relative percent survival (RPS) of vaccinated fish. The major limitation with this approach is that it lacks the ability to elucidate the mechanism of vaccine protection at portals of bacterial entry in mucosal organs and prevention of pathology in target organs. Despite this, indications are that the correlates of vaccine protection can be established based on antibody responses and antigen dose, although these parameters require optimization before they can become an integral part of routine vaccine production. Nevertheless, this review shows that different approaches can be used to produce protective vaccines against S. agalactiae in tilapia although there is a need to optimize the measures of vaccine efficacy.
Munang’andu, Hetron Mweemba; Paul, Joydeb; Evensen, Øystein
2016-01-01
Streptococcus agalactiae is an emerging infectious disease adversely affecting Nile tilapia (Niloticus oreochromis) production in aquaculture. Research carried out in the last decade has focused on developing protective vaccines using different strategies, although no review has been carried out to evaluate the efficacy of these strategies. The purpose of this review is to provide a synopsis of vaccination strategies and antigen delivery systems currently used for S. agalactiae vaccines in tilapia. Furthermore, as shown herein, current vaccine designs include the use of replicative antigen delivery systems, such as attenuated virulent strains, heterologous vectors and DNA vaccines, while non-replicative vaccines include the inactivated whole cell (IWC) and subunit vaccines encoding different S. agalactiae immunogenic proteins. Intraperitoneal vaccination is the most widely used immunization strategy, although immersion, spray and oral vaccines have also been tried with variable success. Vaccine efficacy is mostly evaluated by use of the intraperitoneal challenge model aimed at evaluating the relative percent survival (RPS) of vaccinated fish. The major limitation with this approach is that it lacks the ability to elucidate the mechanism of vaccine protection at portals of bacterial entry in mucosal organs and prevention of pathology in target organs. Despite this, indications are that the correlates of vaccine protection can be established based on antibody responses and antigen dose, although these parameters require optimization before they can become an integral part of routine vaccine production. Nevertheless, this review shows that different approaches can be used to produce protective vaccines against S. agalactiae in tilapia although there is a need to optimize the measures of vaccine efficacy. PMID:27983591
Directory of Open Access Journals (Sweden)
Rhonda C Kines
Full Text Available Human papilloma virus-like particles (HPV VLP serve as the basis of the current licensed vaccines for HPV. We have previously shown that encapsidation of DNA expressing the model antigen M/M2 from respiratory syncytial virus (RSV in HPV pseudovirions (PsV is immunogenic when delivered intravaginally. Because the HPV capsids confer tropism for basal epithelium, they represent attractive carriers for vaccination targeted to the skin using microneedles. In this study we asked: 1 whether HPV16 VLP administered by microneedles could induce protective immune responses to HPV16 and 2 whether HPV16 PsV-encapsidated plasmids delivered by microneedles could elicit immune responses to both HPV and the antigen delivered by the transgene. Mice immunized with HPV16 VLP coated microneedles generated robust neutralizing antibody responses and were protected from HPV16 challenge. Microneedle arrays coated with HPV16-M/M2 or HPV16-F protein (genes of RSV were then tested and dose-dependent HPV and F-specific antibody responses were detected post-immunization, and M/M2-specific T-cell responses were detected post RSV challenge, respectively. HPV16 PsV-F immunized mice were fully protected from challenge with HPV16 PsV and had reduced RSV viral load in lung and nose upon intranasal RSV challenge. In summary, HPV16 PsV-encapsidated DNA delivered by microneedles induced neutralizing antibody responses against HPV and primed for antibody and T-cell responses to RSV antigens encoded by the encapsidated plasmids. Although the immunogenicity of the DNA component was just above the dose response threshold, the HPV-specific immunity was robust. Taken together, these data suggest microneedle delivery of lyophilized HPV PsV could provide a practical, thermostable combined vaccine approach that could be developed for clinical evaluation.
Canine distemper virus DNA vaccination of mink can overcome interference by maternal antibodies
DEFF Research Database (Denmark)
Jensen, Trine Hammer; Nielsen, Line; Aasted, Bent
2015-01-01
Canine distemper virus (CDV) is highly contagious and can cause severe disease against which conventional live vaccines are ineffective in the presence of maternal antibodies. Vaccination in the presences of maternal antibodies was challenged by vaccination of 5 days old and 3 weeks old mink kits...
Next-Generation Dengue Vaccines: Novel Strategies Currently Under Development
Directory of Open Access Journals (Sweden)
Anna P. Durbin
2011-09-01
Full Text Available Dengue has become the most important arboviral infection worldwide with more than 30 million cases of dengue fever estimated to occur each year. The need for a dengue vaccine is great and several live attenuated dengue candidate vaccines are proceeding through clinical evaluation. The need to induce a balanced immune response against all four DENV serotypes with a single vaccine has been a challenge for dengue vaccine developers. A live attenuated DENV chimeric vaccine produced by Sanofi Pasteur has recently entered Phase III evaluation in numerous dengue-endemic regions of the world. Viral interference between serotypes contained in live vaccines has required up to three doses of the vaccine be given over a 12-month period of time. For this reason, novel DENV candidate vaccines are being developed with the goal of achieving a protective immune response with an immunization schedule that can be given over the course of a few months. These next-generation candidates include DNA vaccines, recombinant adenovirus vectored vaccines, alphavirus replicons, and sub-unit protein vaccines. Several of these novel candidates will be discussed.
Next-generation dengue vaccines: novel strategies currently under development.
Durbin, Anna P; Whitehead, Stephen S
2011-10-01
Dengue has become the most important arboviral infection worldwide with more than 30 million cases of dengue fever estimated to occur each year. The need for a dengue vaccine is great and several live attenuated dengue candidate vaccines are proceeding through clinical evaluation. The need to induce a balanced immune response against all four DENV serotypes with a single vaccine has been a challenge for dengue vaccine developers. A live attenuated DENV chimeric vaccine produced by Sanofi Pasteur has recently entered Phase III evaluation in numerous dengue-endemic regions of the world. Viral interference between serotypes contained in live vaccines has required up to three doses of the vaccine be given over a 12-month period of time. For this reason, novel DENV candidate vaccines are being developed with the goal of achieving a protective immune response with an immunization schedule that can be given over the course of a few months. These next-generation candidates include DNA vaccines, recombinant adenovirus vectored vaccines, alphavirus replicons, and sub-unit protein vaccines. Several of these novel candidates will be discussed.
Pai, Chen-Chun; Kishkevich, Anastasiya; Deegan, Rachel S; Keszthelyi, Andrea; Folkes, Lisa; Kearsey, Stephen E; De León, Nagore; Soriano, Ignacio; de Bruin, Robertus Antonius Maria; Carr, Antony M; Humphrey, Timothy C
2017-09-12
Chromatin modification through histone H3 lysine 36 methylation by the SETD2 tumor suppressor plays a key role in maintaining genome stability. Here, we describe a role for Set2-dependent H3K36 methylation in facilitating DNA replication and the transcriptional responses to both replication stress and DNA damage through promoting MluI cell-cycle box (MCB) binding factor (MBF)-complex-dependent transcription in fission yeast. Set2 loss leads to reduced MBF-dependent ribonucleotide reductase (RNR) expression, reduced deoxyribonucleoside triphosphate (dNTP) synthesis, altered replication origin firing, and a checkpoint-dependent S-phase delay. Accordingly, prolonged S phase in the absence of Set2 is suppressed by increasing dNTP synthesis. Furthermore, H3K36 is di- and tri-methylated at these MBF gene promoters, and Set2 loss leads to reduced MBF binding and transcription in response to genotoxic stress. Together, these findings provide new insights into how H3K36 methylation facilitates DNA replication and promotes genotoxic stress responses in fission yeast. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Chen-Chun Pai
2017-09-01
Full Text Available Chromatin modification through histone H3 lysine 36 methylation by the SETD2 tumor suppressor plays a key role in maintaining genome stability. Here, we describe a role for Set2-dependent H3K36 methylation in facilitating DNA replication and the transcriptional responses to both replication stress and DNA damage through promoting MluI cell-cycle box (MCB binding factor (MBF-complex-dependent transcription in fission yeast. Set2 loss leads to reduced MBF-dependent ribonucleotide reductase (RNR expression, reduced deoxyribonucleoside triphosphate (dNTP synthesis, altered replication origin firing, and a checkpoint-dependent S-phase delay. Accordingly, prolonged S phase in the absence of Set2 is suppressed by increasing dNTP synthesis. Furthermore, H3K36 is di- and tri-methylated at these MBF gene promoters, and Set2 loss leads to reduced MBF binding and transcription in response to genotoxic stress. Together, these findings provide new insights into how H3K36 methylation facilitates DNA replication and promotes genotoxic stress responses in fission yeast.
Directory of Open Access Journals (Sweden)
Olivia Rodríguez-Morales
2013-01-01
Full Text Available The dog is considered the main domestic reservoir for Trypanosoma cruzi infection and a suitable experimental animal model to study the pathological changes during the course of Chagas disease (CD. Vaccine development is one of CD prevention methods to protect people at risk. Two plasmids containing genes encoding a trans-sialidase protein (TcSP and an amastigote-specific glycoprotein (TcSSP4 were used as DNA vaccines in a canine model. Splenomegaly was not found in either of the recombinant plasmid-immunized groups; however, cardiomegaly was absent in animals immunized only with the plasmid containing the TcSSP4 gene. The inflammation of subendocardial and myocardial tissues was prevented only with the immunization with TcSSP4 gene. In conclusion, the vaccination with these genes has a partial protective effect on the enlargement of splenic and cardiac tissues during the chronic CD and on microscopic hearth damage, since both plasmids prevented splenomegaly but only one avoided cardiomegaly, and the lesions in heart tissue of dog immunized with plasmid containing the TcSSP4 gene covered only subepicardial tissue.
Zika virus: Vaccine initiatives and obstacles
Directory of Open Access Journals (Sweden)
Reema Mukherjee
2017-01-01
Full Text Available Over 130,000 humans in Brazil are infected with Zika virus (ZIKV since March 2015, and presently 29 countries in Americas have reported local autochthonous ZIKV transmission. Besides the associated clinical features, Brazil has also reported a temporal and spatial association of ZIKV with Guillain-Barre syndrome (GBS and Zika fetal syndrome. ZIKV vaccine approaches include purified inactivated virus, nucleic acid-based vaccines (DNA, RNA, live vector vaccines, subunit vaccines, virus-like particle technologies, and live recombinant vaccines similar to the technologies used against other human flaviviruses. At present, 15 commercial entities are involved in the development of ZIKV vaccine. Vaccines developed through different approaches would have their own inherent advantages and disadvantages. The presentation of disease in different populations and lack of clarity on the pathogenesis and complications is the most important obstacle. Second, Zika belongs to a genus that is notorious for the antibody-mediated enhancement of infection, which proved to be a stumbling block during the development of the dengue vaccine. Identifying large naive and yet uninfected at-risk populations may be an obstacle to demonstrating efficacy. Next, the association of Zika with GBS is being researched since the vaccine may have the potential to provoke similar neuropathophysiologic mechanisms. Zika's association with adverse fetal outcomes necessitates that pregnant women and women of childbearing age are considered for evaluating vaccines, which form a vulnerable group for vaccine trials.
Vaccines for canine leishmaniasis
Directory of Open Access Journals (Sweden)
Clarisa B. Palatnik-De-Sousa
2012-04-01
Full Text Available Leishmaniasis is the third most important vector-borne disease worldwide. Visceral leishmaniasis (VL is a severe and frequently lethal protozoan disease of increasing incidence and severity due to infected human and dog migration, new geographical distribution of the insect due to global-warming, co-infection with immunosuppressive diseases and poverty. The disease is an anthroponosis in India and Central Africa and a canid zoonosis (ZVL in the Americas, the Middle East, Central Asia, China and the Mediterranean. The ZVL epidemic has been controlled by one or more measures including the culling of infected dogs, treatment of human cases and insecticidal treatment of homes and dogs. However, the use of vaccines is considered the most cost-effective control tool for human and canine disease. Since the severity of the disease is related to the generation of T-cell immunosuppression, effective vaccines should be capable of sustaining or enhancing the T-cell immunity. In this review we summarize the clinical and parasitological characteristics of ZVL with special focus on the cellular and humoral canine immune response and review state-of-the-art vaccine development against human and canine visceral leishmaniasis. Experimental vaccination against leishmaniasis has evolved from the practice of leishmanization with living parasites to vaccination with crude lysates, native parasite extracts to recombinant and DNA vaccination. Although more than 30 defined vaccines have been studied in laboratory models no human formulation has been licensed so far; however three second-generation canine vaccines have already been registered. As expected for a zoonotic disease, the recent preventive vaccination of dogs in Brazil has led to a reduction in the incidence of canine and human disease. The recent identification of several Leishmania proteins with T-cell epitopes anticipates development of a multiprotein vaccine that will be capable of protecting both humans
Ordonez, Heather; Shuman, Stewart
2013-05-17
We are interested in the distinctive roster of helicases of Mycobacterium, a genus of the phylum Actinobacteria that includes the human pathogen Mycobacterium tuberculosis and its avirulent relative Mycobacterium smegmatis. Here, we identify and characterize M. smegmatis Lhr as the exemplar of a novel clade of superfamily II helicases, by virtue of its biochemical specificities and signature domain organization. Lhr is a 1507-amino acid monomeric nucleic acid-dependent ATPase that uses the energy of ATP hydrolysis to drive unidirectional 3'-to-5' translocation along single strand DNA and to unwind duplexes en route. The ATPase is more active in the presence of calcium than magnesium. ATP hydrolysis is triggered by either single strand DNA or single strand RNA, yet the apparent affinity for a DNA activator is 11-fold higher than for an RNA strand of identical size and nucleobase sequence. Lhr is 8-fold better at unwinding an RNA:DNA hybrid than it is at displacing a DNA:DNA duplex of identical nucleobase sequence. The truncated derivative Lhr-(1-856) is an autonomous ATPase, 3'-to-5' translocase, and RNA:DNA helicase. Lhr-(1-856) is 100-fold better RNA:DNA helicase than DNA:DNA helicase. Lhr homologs are found in bacteria representing eight different phyla, being especially prevalent in Actinobacteria (including M. tuberculosis) and Proteobacteria (including Escherichia coli).
Recombinant Breast Cancer Vaccines
National Research Council Canada - National Science Library
Pilon, Shari
1999-01-01
.... To generate cytosolic proteins, (cytE2, cytE2A), the ER signal sequence was deleted. Vaccination of BALB/c mice with DNA encoding transmembrane E2 or E2A induced anti-ErbB-2 antibodies and anti-tumor immunity, with E2 being more potent than E2A...
Mohler, V L; Heithoff, D M; Mahan, M J; Hornitzky, M A; Thomson, P C; House, J K
2012-02-14
Intensive livestock production is associated with an increased incidence of salmonellosis. The risk of infection and the subsequent public health concern is attributed to increased pathogen exposure and disease susceptibility due to multiple stressors experienced by livestock from farm to feedlot. Traditional parenteral vaccine methods can further stress susceptible populations and cause carcass damage, adverse reactions, and resultant increased production costs. As a potential means to address these issues, in-water delivery of live attenuated vaccines affords a low cost, low-stress method for immunization of livestock populations that is not associated with the adverse handling stressors and injection reactions associated with parenteral administration. We have previously established that in-water administration of a Salmonella enterica serovar Typhimurium dam vaccine conferred significant protection in livestock. While these experimental trials hold significant promise, the ultimate measure of the vaccine will not be established until it has undergone clinical testing in the field wherein environmental and sanitary conditions are variable. Here we show that in-water administration of a S. Typhimurium dam attenuated vaccine was safe, stable, and well-tolerated in adult sheep. The dam vaccine did not alter water consumption or vaccine dosing; remained viable under a wide range of temperatures (21-37°C); did not proliferate within fecal-contaminated trough water; and was associated with minimal fecal shedding and clinical disease as a consequence of vaccination. The capacity of Salmonella dam attenuated vaccines to be delivered in drinking water to protect livestock from virulent Salmonella challenge offers an effective, economical, stressor-free Salmonella prophylaxis for intensive livestock production systems. Copyright © 2012 Elsevier Ltd. All rights reserved.
Self-amplifying mRNA vaccines.
Brito, Luis A; Kommareddy, Sushma; Maione, Domenico; Uematsu, Yasushi; Giovani, Cinzia; Berlanda Scorza, Francesco; Otten, Gillis R; Yu, Dong; Mandl, Christian W; Mason, Peter W; Dormitzer, Philip R; Ulmer, Jeffrey B; Geall, Andrew J
2015-01-01
This chapter provides a brief introduction to nucleic acid-based vaccines and recent research in developing self-amplifying mRNA vaccines. These vaccines promise the flexibility of plasmid DNA vaccines with enhanced immunogenicity and safety. The key to realizing the full potential of these vaccines is efficient delivery of nucleic acid to the cytoplasm of a cell, where it can amplify and express the encoded antigenic protein. The hydrophilicity and strong net negative charge of RNA impedes cellular uptake. To overcome this limitation, electrostatic complexation with cationic lipids or polymers and physical delivery using electroporation or ballistic particles to improve cellular uptake has been evaluated. This chapter highlights the rapid progress made in using nonviral delivery systems for RNA-based vaccines. Initial preclinical testing of self-amplifying mRNA vaccines has shown nonviral delivery to be capable of producing potent and robust innate and adaptive immune responses in small animals and nonhuman primates. Historically, the prospect of developing mRNA vaccines was uncertain due to concerns of mRNA instability and the feasibility of large-scale manufacturing. Today, these issues are no longer perceived as barriers in the widespread implementation of the technology. Currently, nonamplifying mRNA vaccines are under investigation in human clinical trials and can be produced at a sufficient quantity and quality to meet regulatory requirements. If the encouraging preclinical data with self-amplifying mRNA vaccines are matched by equivalently positive immunogenicity, potency, and tolerability in human trials, this platform could establish nucleic acid vaccines as a versatile new tool for human immunization. Copyright © 2015 Elsevier Inc. All rights reserved.
Structural basis of PAM-dependent target DNA recognition by the Cas9 endonuclease.
Anders, Carolin; Niewoehner, Ole; Duerst, Alessia; Jinek, Martin
2014-09-25
The CRISPR-associated protein Cas9 is an RNA-guided endonuclease that cleaves double-stranded DNA bearing sequences complementary to a 20-nucleotide segment in the guide RNA. Cas9 has emerged as a versatile molecular tool for genome editing and gene expression control. RNA-guided DNA recognition and cleavage strictly require the presence of a protospacer adjacent motif (PAM) in the target DNA. Here we report a crystal structure of Streptococcus pyogenes Cas9 in complex with a single-molecule guide RNA and a target DNA containing a canonical 5'-NGG-3' PAM. The structure reveals that the PAM motif resides in a base-paired DNA duplex. The non-complementary strand GG dinucleotide is read out via major-groove interactions with conserved arginine residues from the carboxy-terminal domain of Cas9. Interactions with the minor groove of the PAM duplex and the phosphodiester group at the +1 position in the target DNA strand contribute to local strand separation immediately upstream of the PAM. These observations suggest a mechanism for PAM-dependent target DNA melting and RNA-DNA hybrid formation. Furthermore, this study establishes a framework for the rational engineering of Cas9 enzymes with novel PAM specificities.
Fontaine, H; Kahi, S; Chazallon, C; Bourgine, M; Varaut, A; Buffet, C; Godon, O; Meritet, J F; Saïdi, Y; Michel, M L; Scott-Algara, D; Aboulker, J P; Pol, S
2015-01-01
The antiviral efficacy of nucleos(t)ide analogues whose main limitation is relapse after discontinuation requires long-term therapy. To overcome the risk of relapse and virological breakthrough during long-term therapy, we performed a phase I/II, open, prospective, multicentre trial using a HBV envelope-expressing DNA vaccine. 70 patients treated effectively with nucleos(t)ide analogues for a median of 3 years (HBV DNA 120 IU/mL) or impossibility of stopping treatment at week 48. Reactivation occurred in 97% of each group after a median 28 days without liver failure but with an HBV DNA <2000 IU/mL in 33%; 99% of adverse reactions were mild to moderate. Immune responses were evaluated by enzyme-linked immunosorbent spot and proliferation assays: there was no difference in the percentage of patients with interferon-γ secreting cells and a specific T-cell proliferation to HBcAg but not to HBsAg after reactivation in each group. Although it is fairly well tolerated, the HBV DNA vaccine does not decrease the risk of relapse in HBV-treated patients or the rate of virological breakthrough, and does not restore the anti-HBV immune response despite effective viral suppression by analogues. NCT00536627. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.
Poplawski, Tomasz; Blasiak, Janusz
2010-06-01
Non-homologous end joining (NHEJ) and homologous recombination repair (HRR) are the main mechanisms involved in the processing of DNA double strand breaks (DSBs) in humans. We showed previously that the oncogenic tyrosine kinase BCR/ABL stimulated DSBs repair by HRR. To evaluate the role of BCR/ABL in DSBs repair by NHEJ we examined the ability of leukemic BCR/ABL-expressing cell line BV173 to repair DNA damage induced by two DNA topoisomerase II inhibitors: etoposide and sobuzoxane. DNA lesions induced by sobuzoxane are repaired by a NHEJ pathway which is dependent on the catalytic subunit of protein kinase dependent on DNA (DNA-PK(CS); D-NHEJ), whereas damage evoked by etoposide are repaired by two distinct NHEJ pathways, dependent on or independent of DNA-PK(CS) (backup NHEJ, B-NHEJ). Cells incubated with STI571, a highly specific inhibitor of BCR/ABL, displayed resistance to these agents associated with an accelerated kinetics of DSBs repair, as measured by the neutral comet assay and pulsed field gel electrophoresis. However, in a functional NHEJ assay, cells preincubated with STI571 repaired DSBs induced by a restriction enzyme with a lower efficacy than without the preincubation and addition of wortmannin, a specific inhibitor of DNA-PK(CS), did not change efficacy of the NHEJ reaction. We suggest that BCR/ABL switch on B-NHEJ which is more error-prone then D-NHEJ and in such manner contribute to the increase of the genomic instability of leukemic cells.
Tang, F; Xu, L; Yan, R; Song, X; Li, X
2012-12-01
Plasmids expressing macrophage migration inhibitory factor (MIF) of Trichinella spiralis (TsMIF), multi-cystatin-like domain protein (MCD-1) of T. spiralis (TsMCD-1), or co-expressing TsMIF and TsMCD-1 were constructed with a pVAX1 vector. Their ability to generate a protective immune response against T. spiralis infection was evaluated in BALB/c mice. Groups of mice were immunized twice at 2-week intervals with 100 μg of recombinant plasmids pVAX1-Tsmif, pVAX1-Tsmcd-1 or pVAX1-Tsmif-Tsmcd-1. Control animals were immunized with phosphate-buffered saline (PBS) or blank vector plasmid. Specific antibody levels (IgG, IgG1, IgG2a, IgG2b, IgM, IgA, IgE) against the recombinant protein TsMIF-TsMCD-1, serum cytokines (interferon (IFN)-γ, interleukin (IL)-4, IL-5, transforming growth factor (TGF)-β1 and IL-17) and CD4+/CD8+ T cells were monitored. Challenge infection was performed 2 weeks following the second immunization and worm burden was assayed at 35 days post-challenge. Vaccination with pVAX1-Tsmif induced moderate serum IFN-γ and increases of CD4+ and CD8+ T cells, but no specific immunoglobulin antibody response. Vaccination with pVAX1-Tsmcd-1 induced a predominant Th1 antibody (IgG2a and IgG2b) response and strong levels of serum IFN-γ, and increases of CD4+ T cells. Importantly, co-expression of TsMIF and TsMCD-1 in DNA immunization produced more serum IFN-γ and markedly enhanced CD4+ and CD8+ T cells than the single DNA vaccine of the two genes. Challenge infection demonstrated that immunization with pVAX1-Tsmif-Tsmcd-1 reduced worm burdens (by 23.17%; P < 0.05).
Fuchs, Jonathan D; Bart, Pierre-Alexandre; Frahm, Nicole; Morgan, Cecilia; Gilbert, Peter B; Kochar, Nidhi; DeRosa, Stephen C; Tomaras, Georgia D; Wagner, Theresa M; Baden, Lindsey R; Koblin, Beryl A; Rouphael, Nadine G; Kalams, Spyros A; Keefer, Michael C; Goepfert, Paul A; Sobieszczyk, Magdalena E; Mayer, Kenneth H; Swann, Edith; Liao, Hua-Xin; Haynes, Barton F; Graham, Barney S; McElrath, M Juliana
2015-05-01
Recombinant adenovirus serotype 5 (rAd5)-vectored HIV-1 vaccines have not prevented HIV-1 infection or disease and pre-existing Ad5 neutralizing antibodies may limit the clinical utility of Ad5 vectors globally. Using a rare Ad serotype vector, such as Ad35, may circumvent these issues, but there are few data on the safety and immunogenicity of rAd35 directly compared to rAd5 following human vaccination. HVTN 077 randomized 192 healthy, HIV-uninfected participants into one of four HIV-1 vaccine/placebo groups: rAd35/rAd5, DNA/rAd5, and DNA/rAd35 in Ad5-seronegative persons; and DNA/rAd35 in Ad5-seropositive persons. All vaccines encoded the HIV-1 EnvA antigen. Antibody and T-cell responses were measured 4 weeks post boost immunization. All vaccines were generally well tolerated and similarly immunogenic. As compared to rAd5, rAd35 was equally potent in boosting HIV-1-specific humoral and cellular immunity and responses were not significantly attenuated in those with baseline Ad5 seropositivity. Like DNA, rAd35 efficiently primed rAd5 boosting. All vaccine regimens tested elicited cross-clade antibody responses, including Env V1/V2-specific IgG responses. Vaccine antigen delivery by rAd35 is well-tolerated and immunogenic as a prime to rAd5 immunization and as a boost to prior DNA immunization with the homologous insert. Further development of rAd35-vectored prime-boost vaccine regimens is warranted.
Sculpting humoral immunity through dengue vaccination to enhance protective immunity
Directory of Open Access Journals (Sweden)
Wayne eCrill
2012-11-01
Full Text Available Dengue viruses (DENV are the most important mosquito transmitted viral pathogens infecting humans. DENV infection produces a spectrum of disease, most commonly causing a self-limiting flu-like illness known as dengue fever; yet with increased frequency, manifesting as life-threatening dengue hemorrhagic fever (DHF. Waning cross-protective immunity from any of the four dengue serotypes may enhance subsequent infection with another heterologous serotype to increase the probability of DHF. Decades of effort to develop dengue vaccines are reaching the finishing line with multiple candidates in clinical trials. Nevertheless, concerns remain that imbalanced immunity, due to the prolonged prime-boost schedules currently used in clinical trials, could leave some vaccinees temporarily unprotected or with increased susceptibility to enhanced disease. Here we develop a DENV serotype 1 (DENV-1 DNA vaccine with the immunodominant cross-reactive B cell epitopes associated with immune enhancement removed. We compare wild-type (WT with this cross-reactivity reduced (CRR vaccine and demonstrate that both vaccines are equally protective against lethal homologous DENV-1 challenge. Under conditions mimicking natural exposure prior to acquiring protective immunity, WT vaccinated mice enhanced a normally sub-lethal heterologous DENV-2 infection resulting in DHF-like disease and 95% mortality in AG129 mice. However, CRR vaccinated mice exhibited redirected serotype-specific and protective immunity, and significantly reduced morbidity and mortality not differing from naïve mice. Thus, we demonstrate in an in vivo DENV disease model, that non-protective vaccine-induced immunity can prime vaccinees for enhanced DHF-like disease and that CRR DNA immunization significantly reduces this potential vaccine safety concern. The sculpting of immune memory by the modified vaccine and resulting redirection of humoral immunity provide insight into DENV vaccine induced immune
Linares, Lourdes Oriana; Shankar, Viswanathan; Diaz, Angela; Nucci-Sack, Anne; Strickler, Howard D; Peake, Ken; Weiss, Jocelyn; Burk, Robert D; Schlecht, Nicolas F
2015-10-01
This study investigated the association of cervical human papillomavirus (HPV) infection with cumulative psychosocial risk reflecting family disadvantage, psychological distress, and unhealthy lifestyle. The sample (N = 745) comprised sexually active female adolescent patients (12-19 yr), primarily ethnic minorities, enrolled in a free HPV vaccination program. Subjects completed questionnaires and provided cervical swabs for HPV DNA testing. Unweighted and weighted principal component analyses for categorical data were used to derive multisystemic psychosocial risk indices using 9 indicators: low socioeconomic status, lack of adult involvement, not attending high school/college, history of treatment for depression/anxiety, antisocial/delinquent behavior, number of recent sexual partners, use of alcohol, use of drugs, and dependency risk for alcohol/drugs. The association between cervical HPV (any type, high-risk types, vaccine types) assayed by polymerase chain reaction and self-reported number of psychosocial risk indicators was estimated using multivariable logistic regression. Subjects had a median of 3 psychosocial risk indicators. Multiple logistic regression analyses showed associations with unweighted and weighted number of psychosocial indicators for HPV any type (adjusted odds ratio [aOR] = 1.1; 95% confidence interval [CI], 1.0-1.2), with the strongest associations between weighted drug/alcohol use, drug/alcohol dependency risk, and antisocial/delinquent behavior and detection of HPV vaccine types (aOR = 1.5; 95% CI, 1.1-2.0) independent of number of recent sexual partners and vaccine dose (0-3). Increased HPV infections including HPV vaccine types were associated with greater number of psychosocial risk indicators even after controlling for demographics, sexual behavior, history of chlamydia, and vaccine dose.
Limitations of the BCG vaccine and new prophylaxis strategies against human tuberculosis
Directory of Open Access Journals (Sweden)
Arioldo Carvalho Vasconcelos-Junior
2009-09-01
Full Text Available BCG (Bacille Calmette Guérin, an attenuated vaccine derived from Mycobacterium bovis, is the current vaccine against tuberculosis. Notwithstanding its protection of children, BCG has failed to protect adults against active pulmonary tuberculosis, especially in countries where the disease is endemic. Any new tuberculosis vaccine should protect several categories of people, including children, adults, the elderly and immunodeppressed patients. An important feature is immunization safety for all of these classes. The aim of this review is to describe new vaccination strategies, such as subunit vaccines, DNA vaccines, vaccines with live microorganisms and vectors, and to discuss the application of these new strategies for the control and eradication of tuberculosis.
Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.
Hirsch, Matthew L; Fagan, B Matthew; Dumitru, Raluca; Bower, Jacquelyn J; Yadav, Swati; Porteus, Matthew H; Pevny, Larysa H; Samulski, R Jude
2011-01-01
Human embryonic stem cells (hESCs) are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV) single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.
Viral single-strand DNA induces p53-dependent apoptosis in human embryonic stem cells.
Directory of Open Access Journals (Sweden)
Matthew L Hirsch
Full Text Available Human embryonic stem cells (hESCs are primed for rapid apoptosis following mild forms of genotoxic stress. A natural form of such cellular stress occurs in response to recombinant adeno-associated virus (rAAV single-strand DNA genomes, which exploit the host DNA damage response for replication and genome persistence. Herein, we discovered a unique DNA damage response induced by rAAV transduction specific to pluripotent hESCs. Within hours following rAAV transduction, host DNA damage signaling was elicited as measured by increased gamma-H2AX, ser15-p53 phosphorylation, and subsequent p53-dependent transcriptional activation. Nucleotide incorporation assays demonstrated that rAAV transduced cells accumulated in early S-phase followed by the induction of apoptosis. This lethal signaling sequalae required p53 in a manner independent of transcriptional induction of Puma, Bax and Bcl-2 and was not evident in cells differentiated towards a neural lineage. Consistent with a lethal DNA damage response induced upon rAAV transduction of hESCs, empty AAV protein capsids demonstrated no toxicity. In contrast, DNA microinjections demonstrated that the minimal AAV origin of replication and, in particular, a 40 nucleotide G-rich tetrad repeat sequence, was sufficient for hESC apoptosis. Our data support a model in which rAAV transduction of hESCs induces a p53-dependent lethal response that is elicited by a telomeric sequence within the AAV origin of replication.