WorldWideScience

Sample records for dna testing strategies

  1. The clinical utility of HPV DNA testing in cervical cancer screening strategies.

    Science.gov (United States)

    Bhatla, Neerja; Moda, Nidhi

    2009-09-01

    Cervical cancer continues to be the commonest cause of death among women in developing countries, largely due to the failure to the inability to sustain effective cytology-based screening programs. While this burden may come down following implementation of the human papillomavirus (HPV) vaccine, screening will still be required. HPV DNA testing is a promising new technology for cervical cancer prevention and is the most reproducible of all cervical cancer screening tests. Presently, the two assays most widely used for the detection of genital types are the polymerase chain reaction (PCR) and Hybrid Capture 2 assays (hc2). Rapid, affordable tests are expected to be available soon. HPV DNA testing can be used in a variety of clinical scenarios that include primary screening in women older than 30 yr; as an adjunctive test to cytology; in the triage of women with an equivocal cytologic report, e.g., ASC-US; or for follow-up post-treatment for cervical intraepithelial neoplasia (CIN). HPV DNA testing can also be performed on self-collected samples, which allows screening in remote areas and also in women who refuse gynecologic examination.

  2. HPV DNA test

    Science.gov (United States)

    ... is generally not recommended for detecting low-risk HPV infections. ... Human papilloma virus - testing; Abnormal Pap smear - HPV testing; LSIL-HPV testing, Low-grade dysplasia - HPV testing; HSIL - HPV testing; High-grade dysplasia - HPV testing; HPV ...

  3. Electrochemical biosensing strategies for DNA methylation analysis.

    Science.gov (United States)

    Hossain, Tanvir; Mahmudunnabi, Golam; Masud, Mostafa Kamal; Islam, Md Nazmul; Ooi, Lezanne; Konstantinov, Konstantin; Hossain, Md Shahriar Al; Martinac, Boris; Alici, Gursel; Nguyen, Nam-Trung; Shiddiky, Muhammad J A

    2017-02-17

    DNA methylation is one of the key epigenetic modifications of DNA that results from the enzymatic addition of a methyl group at the fifth carbon of the cytosine base. It plays a crucial role in cellular development, genomic stability and gene expression. Aberrant DNA methylation is responsible for the pathogenesis of many diseases including cancers. Over the past several decades, many methodologies have been developed to detect DNA methylation. These methodologies range from classical molecular biology and optical approaches, such as bisulfite sequencing, microarrays, quantitative real-time PCR, colorimetry, Raman spectroscopy to the more recent electrochemical approaches. Among these, electrochemical approaches offer sensitive, simple, specific, rapid, and cost-effective analysis of DNA methylation. Additionally, electrochemical methods are highly amenable to miniaturization and possess the potential to be multiplexed. In recent years, several reviews have provided information on the detection strategies of DNA methylation. However, to date, there is no comprehensive evaluation of electrochemical DNA methylation detection strategies. Herein, we address the recent developments of electrochemical DNA methylation detection approaches. Furthermore, we highlight the major technical and biological challenges involved in these strategies and provide suggestions for the future direction of this important field.

  4. Strategies for detection of transfusion-transmitted viruses eluding identification by conventional serologic tests. I. Radioimmunoassay for picogram quantities of DNA

    Energy Technology Data Exchange (ETDEWEB)

    Neurath, A.R.; Strick, N. (New York Blood Center, NY (USA))

    1983-09-01

    The unavailability of serological tests for detection of several not yet characterized infectious agents transmitted by blood transfusion or by blood products prompted the development of alternative tests based on utilization of labeled nucleic acid probes specific for genomes of each of these agents. The prerequisite for the preparation of such probes is the demonstration in human plasma of nucleic acid sequences distinct from those present in host DNA or in genes of already characterized viruses occurring in plasma of infected individuals. To accomplish this, ultrasensitive tests for nucleic acids not dependent on their base sequence are needed. The authors describe a radioimmunoassay (RIA) for picogram quantities of DNA. Plasma (serum) specimens are treated with proteinase K in the presence of sodium dodecyl sulfate and extracted with phenol. Nucleic acids are precipitated with ethanol in the presence of dextran (mol.wt. approx. 5X10/sup 5/) as carrier. Subsequently, DNA from the redissolved samples is adsorbed onto polylysine-coated wells of microtiter plates and detected by a double-antibody RIA using anti-DNA autoantibodies from NZB/NZW mice and /sup 125/I-labelled antibodies to mouse immunoglobulins. DNA which did not hybridize with human DNA was detected by this method in sera containing hepatitis B virus used as a model system.

  5. DNA vaccination strategies against infectious diseases.

    Science.gov (United States)

    Watts, A M; Kennedy, R C

    1999-08-01

    DNA immunisation represents a novel approach to vaccine and immunotherapeutic development. Injection of plasmid DNA encoding a foreign gene of interest can result in the subsequent expression of the foreign gene products and the induction of an immune response within a host. This is relevant to prophylactic and therapeutic vaccination strategies when the foreign gene represents a protective epitope from a pathogen. The recent demonstration by a number of laboratories that these immune responses evoke protective immunity against some infectious diseases and cancers provides support for the use of this approach. In this article, we attempt to present an informative and unbiased representation of the field of DNA immunisation. The focus is on studies that impart information on the development of vaccination strategies against a number of human and animal pathogens. Investigations that describe the mechanism(s) of protective immunity induced by DNA immunisation highlight the advantages and disadvantages of this approach to developing vaccines within a given system. A variety of systems in which DNA vaccination has resulted in the induction of protective immunity, as well as the correlates associated with these protective immune responses, will be described. Particular attention will focus on systems involving parasitic diseases. Finally, the potential of DNA immunisation is discussed as it relates to veterinary medicine and its role as a possible vaccine strategy against animal coccidioses.

  6. Counselor Hypothesis-Testing Strategies.

    Science.gov (United States)

    Strohmer, Douglas C.; Newman, Lisa J.

    1983-01-01

    Reports two experiments relevant to the questioning strategies counselors use in testing their hypotheses about clients. Results supported the idea that counselors are able to take a tentative hypothesis about a client and test its accuracy against additional independent, unbiased observations of the client. (LLL)

  7. DNA testing in hereditary neuropathies.

    LENUS (Irish Health Repository)

    Murphy, Sinéad M

    2013-01-01

    The inherited neuropathies are a clinically and genetically heterogeneous group of disorders in which there have been rapid advances in the last two decades. Molecular genetic testing is now an integral part of the evaluation of patients with inherited neuropathies. In this chapter we describe the genes responsible for the primary inherited neuropathies. We briefly discuss the clinical phenotype of each of the known inherited neuropathy subgroups, describe algorithms for molecular genetic testing of affected patients and discuss genetic counseling. The basic principles of careful phenotyping, documenting an accurate family history, and testing the available genes in an appropriate manner should identify the vast majority of individuals with CMT1 and many of those with CMT2. In this chapter we also describe the current methods of genetic testing. As advances are made in molecular genetic technologies and improvements are made in bioinformatics, it is likely that the current time-consuming methods of DNA sequencing will give way to quicker and more efficient high-throughput methods, which are briefly discussed here.

  8. DNA testing in hereditary neuropathies.

    Science.gov (United States)

    Murphy, Sinéad M; Laurá, Matilde; Reilly, Mary M

    2013-01-01

    The inherited neuropathies are a clinically and genetically heterogeneous group of disorders in which there have been rapid advances in the last two decades. Molecular genetic testing is now an integral part of the evaluation of patients with inherited neuropathies. In this chapter we describe the genes responsible for the primary inherited neuropathies. We briefly discuss the clinical phenotype of each of the known inherited neuropathy subgroups, describe algorithms for molecular genetic testing of affected patients and discuss genetic counseling. The basic principles of careful phenotyping, documenting an accurate family history, and testing the available genes in an appropriate manner should identify the vast majority of individuals with CMT1 and many of those with CMT2. In this chapter we also describe the current methods of genetic testing. As advances are made in molecular genetic technologies and improvements are made in bioinformatics, it is likely that the current time-consuming methods of DNA sequencing will give way to quicker and more efficient high-throughput methods, which are briefly discussed here. Copyright © 2013 Elsevier B.V. All rights reserved.

  9. Recognition of hairpin DNA from coil DNA by electrospray mass spectrometry with annealing strategy

    Institute of Scientific and Technical Information of China (English)

    Bo Zheng; Yi Quan Liu; Gu Yuan

    2012-01-01

    This research presented an annealing strategy to identify hairpin DNA from coil DNA with the same base composition but different arrangements using electrospray mass spectrometry (ESI-MS).A series of single-stranded DNA were annealed with their complementary sequences,respectively.All the five pairs of hairpin DNA and coil DNA were unambiguously distinguished by ESIMS with annealing strategy.This research offers a potential method to probe the DNA structure by comparing with mass spectral characteristics.

  10. Paternity testing that involves a DNA mixture.

    Science.gov (United States)

    Mortera, Julia; Vecchiotti, Carla; Zoppis, Silvia; Merigioli, Sara

    2016-07-01

    Here we analyse a complex disputed paternity case, where the DNA of the putative father was extracted from his corpse that had been inhumed for over 20 years. This DNA was contaminated and appears to be a mixture of at least two individuals. Furthermore, the mother's DNA was not available. The DNA mixture was analysed so as to predict the most probable genotypes of each contributor. The major contributor's profile was then used to compute the likelihood ratio for paternity. We also show how to take into account a dropout allele and the possibility of mutation in paternity testing.

  11. Discourse and Deliberation Testing a Collaborative Strategy

    CERN Document Server

    Walker, M A

    1995-01-01

    A discourse strategy is a strategy for communicating with another agent. Designing effective dialogue systems requires designing agents that can choose among discourse strategies. We claim that the design of effective strategies must take cognitive factors into account, propose a new method for testing the hypothesized factors, and present experimental results on an effective strategy for supporting deliberation. The proposed method of computational dialogue simulation provides a new empirical basis for computational linguistics.

  12. Strategies and hurdles using DNA vaccines to fish.

    Science.gov (United States)

    Hølvold, Linn B; Myhr, Anne I; Dalmo, Roy A

    2014-01-01

    DNA vaccinations against fish viral diseases as IHNV at commercial level in Canada against VHSV at experimental level are both success stories. DNA vaccination strategies against many other viral diseases have, however, not yet yielded sufficient results in terms of protection. There is an obvious need to combat many other viral diseases within aquaculture where inactivated vaccines fail. There are many explanations to why DNA vaccine strategies against other viral diseases fail to induce protective immune responses in fish. These obstacles include: 1) too low immunogenicity of the transgene, 2) too low expression of the transgene that is supposed to induce protection, 3) suboptimal immune responses, and 4) too high degradation rate of the delivered plasmid DNA. There are also uncertainties with regard distribution and degradation of DNA vaccines that may have implications for safety and regulatory requirements that need to be clarified. By combining plasmid DNA with different kind of adjuvants one can increase the immunogenicity of the transgene antigen - and perhaps increase the vaccine efficacy. By using molecular adjuvants with or without in combination with targeting assemblies one may expect different responses compared with naked DNA. This includes targeting of DNA vaccines to antigen presenting cells as a central factor in improving their potencies and efficacies by means of encapsulating the DNA vaccine in certain carriers systems that may increase transgene and MHC expression. This review will focus on DNA vaccine delivery, by the use of biodegradable PLGA particles as vehicles for plasmid DNA mainly in fish.

  13. Testing Strategies for Model-Based Development

    Science.gov (United States)

    Heimdahl, Mats P. E.; Whalen, Mike; Rajan, Ajitha; Miller, Steven P.

    2006-01-01

    This report presents an approach for testing artifacts generated in a model-based development process. This approach divides the traditional testing process into two parts: requirements-based testing (validation testing) which determines whether the model implements the high-level requirements and model-based testing (conformance testing) which determines whether the code generated from a model is behaviorally equivalent to the model. The goals of the two processes differ significantly and this report explores suitable testing metrics and automation strategies for each. To support requirements-based testing, we define novel objective requirements coverage metrics similar to existing specification and code coverage metrics. For model-based testing, we briefly describe automation strategies and examine the fault-finding capability of different structural coverage metrics using tests automatically generated from the model.

  14. Regional strategy tested in Caribbean.

    Science.gov (United States)

    1984-01-01

    Barbados, St. Vincent, and St. Lucia have joined forces in the world's 1st regional Contraceptive Social Marketing (CSM) effort -- the Caribbean CSM. The Barbados Family Planning Association (BFPS) is overseeing the operation, which begins selling 2 contraceptive pills and a condom in early February. Costs and start-up times were shaved by adopting brand names and advertising materials from Jamaica's highly successful CSM project. Jamaica's popular "Panther" condom and "Perle" oral contraceptive (OC) are being used by the Caribbean CSM project. Perle's 9-year-old package has been redesigned and the Caribbean CSM project also is selling a 2nd, low-dose version called "Perle-LD." The products are manufactured in the US by Syntex as Noriday and Norminest, respectively. But the regional approach's financial gains also had a debit side, most notably a tripling of bureaucratic procedures. Part of project difficulties stem from differences among the 3 Caribbean countries. While sharing a common cultural heritage, St. Lucians speak a patois dialect in addition to the English prevalent on the other islands. The biggest hurdle was overcoming an economic disparity between Barbados and its less affluent neighbors, St. Vincent and St. Lucia. The CSM project decided to try a 2-tier product pricing strategy. In US currency, prices run $1.75 per cycle for both OCs on Barbados, but $1.26 on St. Vincent and St. Lucia. A Panther 3-pack costs 75 cents on Barbados and 42 cents on the othe 2 islands. The project is being promoted with generic family planning media advertisements. The project also has held physician orientation seminars on each island. The pilot program will be accompanied by retailer training seminars. In addition the project may introduce a spermicidal foaming tablet, once the US Food and Drug Administration approvs a new American-made product. The unique Caribbean CSM project may spread an idea as potent as the family planning message. Its success could transmit the

  15. Designing new strategy for controlling DNA orientation in biosensors

    Science.gov (United States)

    Feng, Chao; Ding, Hong-ming; Ren, Chun-lai; Ma, Yu-qiang

    2015-01-01

    Orientation controllable DNA biosensors hold great application potentials in recognizing small molecules and detecting DNA hybridization. Though electric field is usually used to control the orientation of DNA molecules, it is also of great importance and significance to seek for other triggered methods to control the DNA orientation. Here, we design a new strategy for controlling DNA orientation in biosensors. The main idea is to copolymerize DNA molecules with responsive polymers that can show swelling/deswelling transitions due to the change of external stimuli, and then graft the copolymers onto an uncharged substrate. In order to highlight the responsive characteristic, we take thermo-responsive polymers as an example, and reveal multi-responsive behavior and the underlying molecular mechanism of the DNA orientation by combining dissipative particle dynamics simulation and molecular theory. Since swelling/deswelling transitions can be also realized by using other stimuli-responsive (like pH and light) polymers, the present strategy is universal, which can enrich the methods of controlling DNA orientation and may assist with the design of the next generation of biosensors. PMID:26400770

  16. Language Learning Strategies and Test Anxiety

    Science.gov (United States)

    Shomoossi, Nematullah; Kooshan, Mohsen; Ketabi, Saeed

    2008-01-01

    The role of learner's strategies and skills in learning a foreign language has been investigated in the last three decades. However, the part it plays in ESP achievement tests is not seriously treated. Moreover, as students take the final exam, their chief complaint concerns the idea of test anxiety as a debilitating factor. Therefore, the present…

  17. Building a successful board-test strategy

    CERN Document Server

    Scheiber, Stephen

    2001-01-01

    Written in a clear and thoughtful style, Building a Successful Board-Test Strategy, Second Edition offers an integrated approach to the complicated process of developing the test strategies most suited to a company's profile and philosophy. This book also provides comprehensive coverage of the specifics of electronic test equipment as well as those broader issues of management and marketing that shape a manufacturer's ""image of quality.""In this new edition, the author adds still more ""war stories,"" relevant examples from his own experience, which will guide his readers in their dec

  18. Next Generation Sequencing of Ancient DNA: Requirements, Strategies and Perspectives

    Directory of Open Access Journals (Sweden)

    Michael Knapp

    2010-07-01

    Full Text Available The invention of next-generation-sequencing has revolutionized almost all fields of genetics, but few have profited from it as much as the field of ancient DNA research. From its beginnings as an interesting but rather marginal discipline, ancient DNA research is now on its way into the centre of evolutionary biology. In less than a year from its invention next-generation-sequencing had increased the amount of DNA sequence data available from extinct organisms by several orders of magnitude. Ancient DNA  research is now not only adding a temporal aspect to evolutionary studies and allowing for the observation of evolution in real time, it also provides important data to help understand the origins of our own species. Here we review progress that has been made in next-generation-sequencing of ancient DNA over the past five years and evaluate sequencing strategies and future directions.

  19. Practical Strategies to Improve Test Efficiency

    Institute of Scientific and Technical Information of China (English)

    DING Zhigang; WANG Hongcheng; LING Lianghe

    2007-01-01

    This paper introduces strategies to detect software bugs in earlier life cycle stage in order to improve test efficiency. Static analysis tool is one of the effective methods to reveal software bugs during software development. Three popular static analysis tools are introduced, two of which, PolySpace and Splint, are compared with each other by analyzing a set of test cases generatedd by the authors. PolySpace can reveal 60% bugs with 100% R/W ratio (ratio of real bugs and total warnings), while Splint reveal 73.3% bugs with 44% R/W ratio. And they are good at finding different categories of bugs. Two strategies are concluded to improve test efficiency, under the guideline that static analysis tools should be used in finding different categories of bugs according to their features. The first one aims at finding bugs as many as possible, while the second concentrates to reduce the average time on bug revelation. Experimental data shows the first strategy can find 100% bugs with 60% RAN ratio, the second one find 80% bugs with 66.7% R/W ratio. Experiment results prove that these two strategies can improve the test efficiency in both fault coverage and testing time.

  20. Isothermal DNA amplification in bioanalysis: strategies and applications.

    Science.gov (United States)

    Kim, Joonyul; Easley, Christopher J

    2011-01-01

    Isothermal DNA amplification is an alternative to PCR-based amplification for point-of-care diagnosis. Since the early 1990s, the approach has been refined into a simple, rapid and cost-effective tool by means of several distinct strategies. Input signals have been diversified from DNA to RNA, protein or small organic molecules by translating these signals into input DNA before amplification, thus allowing assays on various classes of biomolecules. In situ detection of single biomolecules has been achieved using an isothermal method, leveraging localized signal amplification in an intact specimen. A few pioneering studies to develop a homogenous isothermal protein assay have successfully translated structure-switching of a probe upon target binding into input DNA for isothermal amplification. In addition to the detection of specific targets, isothermal methods have made whole-genome amplification of single cells possible owing to the unbiased, linear nature of the amplification process as well as the large size of amplified products given by ϕ29 DNA polymerase. These applications have been devised with the four isothermal amplification strategies covered in this review: strand-displacement amplification, rolling circle amplification, helicase-dependent amplification and recombinase polymerase amplification.

  1. Synthetic Strategies Toward DNA-Coated Colloids that Crystallize.

    Science.gov (United States)

    Wang, Yufeng; Wang, Yu; Zheng, Xiaolong; Ducrot, Étienne; Lee, Myung-Goo; Yi, Gi-Ra; Weck, Marcus; Pine, David J

    2015-08-26

    We report on synthetic strategies to fabricate DNA-coated micrometer-sized colloids that, upon thermal annealing, self-assemble into various crystal structures. Colloids of a wide range of chemical compositions, including poly(styrene), poly(methyl methacrylate), titania, silica, and a silica-methacrylate hybrid material, are fabricated with smooth particle surfaces and a dense layer of surface functional anchors. Single-stranded oligonucleotides with a short sticky end are covalently grafted onto particle surfaces employing a strain-promoted alkyne-azide cycloaddition reaction resulting in DNA coatings with areal densities an order of magnitude higher than previously reported. Our approach allows the DNA-coated colloids not only to aggregate upon cooling but also to anneal and rearrange while still bound together, leading to the formation of colloidal crystal compounds when particles of different sizes or different materials are combined.

  2. A Fractual Mechanical Testing and Design Strategy for FRC Structures

    DEFF Research Database (Denmark)

    Stang, Henrik; Olesen, John Forbes

    1999-01-01

    A unified testing and design strategy for fibre reinforced concrete structures is summarised. The strategy is based on fracture mechanical concepts. Emphasis is placed on material characterisation and testing specifications.......A unified testing and design strategy for fibre reinforced concrete structures is summarised. The strategy is based on fracture mechanical concepts. Emphasis is placed on material characterisation and testing specifications....

  3. A Fractual Mechanical Testing and Design Strategy for FRC Structures

    DEFF Research Database (Denmark)

    Stang, Henrik; Olesen, John Forbes

    1999-01-01

    A unified testing and design strategy for fibre reinforced concrete structures is summarised. The strategy is based on fracture mechanical concepts. Emphasis is placed on material characterisation and testing specifications.......A unified testing and design strategy for fibre reinforced concrete structures is summarised. The strategy is based on fracture mechanical concepts. Emphasis is placed on material characterisation and testing specifications....

  4. DNA replication, repair, and repair tests. [Rat; human leukocytes

    Energy Technology Data Exchange (ETDEWEB)

    Lambert, B.

    1980-09-01

    The rate of inhibition and recovery of DNA synthesis can be used in a rapid assay system to detect genotoxic potentials of chemicals. Also, the observation that an agent stimulates DNA repair in a test system indicates its ability to cause damage in DNA. Different experimental approaches to the study of repair synthesis are discussed.

  5. An integrated strategy combining DNA walking and NGS to detect GMOs.

    Science.gov (United States)

    Fraiture, Marie-Alice; Herman, Philippe; Papazova, Nina; De Loose, Marc; Deforce, Dieter; Ruttink, Tom; Roosens, Nancy H

    2017-10-01

    Recently, we developed a DNA walking system for the detection and characterization of a broad spectrum of GMOs in routine analysis of food/feed matrices. Here, we present a new version with improved throughput and sensitivity by coupling the DNA walking system to Pacific Bioscience® Next-generation sequencing technology. The performance of the new strategy was thoroughly assessed through several assays. First, we tested its detection and identification capability on grains with high or low GMO content. Second, the potential impacts of food processing were investigated using rice noodle samples. Finally, GMO mixtures and a real-life sample were analyzed to illustrate the applicability of the proposed strategy in routine GMO analysis. In all tested samples, the presence of multiple GMOs was unambiguously proven by the characterization of transgene flanking regions and the combinations of elements that are typical for transgene constructs. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  6. Experimental strategies for studying transcription factor-DNA binding specificities.

    Science.gov (United States)

    Geertz, Marcel; Maerkl, Sebastian J

    2010-12-01

    Specific binding of transcription factors (TFs) determines in a large part the connectivity of gene regulatory networks as well as the quantitative level of gene expression. A multiplicity of both experimental and computational methods is currently used to discover and characterize the underlying TF-DNA interactions. Experimental methods can be further subdivided into in vitro- and in vivo-based approaches, each accenting different aspects of TF-binding events. In this review we summarize the flexibility and performance of a selection of both types of experimental methods. In conclusion, we argue that a serial combination of methods with different throughput and data type constitutes an optimal experimental strategy.

  7. DNA nanotechnology from the test tube to the cell.

    Science.gov (United States)

    Chen, Yuan-Jyue; Groves, Benjamin; Muscat, Richard A; Seelig, Georg

    2015-09-01

    The programmability of Watson-Crick base pairing, combined with a decrease in the cost of synthesis, has made DNA a widely used material for the assembly of molecular structures and dynamic molecular devices. Working in cell-free settings, researchers in DNA nanotechnology have been able to scale up system complexity and quantitatively characterize reaction mechanisms to an extent that is infeasible for engineered gene circuits or other cell-based technologies. However, the most intriguing applications of DNA nanotechnology - applications that best take advantage of the small size, biocompatibility and programmability of DNA-based systems - lie at the interface with biology. Here, we review recent progress in the transition of DNA nanotechnology from the test tube to the cell. We highlight key successes in the development of DNA-based imaging probes, prototypes of smart therapeutics and drug delivery systems, and explore the future challenges and opportunities for cellular DNA nanotechnology.

  8. Mobile Software Testing – Automated Test Case Design Strategies

    Directory of Open Access Journals (Sweden)

    Selvam R,

    2011-04-01

    Full Text Available Mobile devices are poised to challenge PCs as the application platform of choice, with 500 million mobile internet devices expected to ship in 2012 compared to 150 million PCs. The convergence ofall digital devices into mobile platform model augments the software companies, software developer, and venture capitalist firms to turn their focus into mobile application platform (for example mobile social networking application like face book and mobile VOIP like Skype a futuristic platform for increased revenue, new challenges and growth potential. But the commercial success of these applications depends on their working smoothly and securely on a wide variety of handheld devices and wireless networks. More and more virtual mobile application stores are built on the web. The web itself is in the transforming form to adapt to the mobile devices to thrive on. The sudden growth in the mobile application and the complexity in the divergence of the devices that uses these applications present increased challenges and opportunities for the software testing companies and software testers to conquerthis small device. Performing such testing quickly and cost-effectively greatly expands the market for such applications. This paper deals the nuances of Automated Test Case Design Strategies for Mobile Software Testing.

  9. Deep Borehole Field Test Laboratory and Borehole Testing Strategy

    Energy Technology Data Exchange (ETDEWEB)

    Kuhlman, Kristopher L. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Brady, Patrick V. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); MacKinnon, Robert J. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Heath, Jason E. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Herrick, Courtney G. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Jensen, Richard P. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Gardner, W. Payton [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Sevougian, S. David [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Bryan, Charles R. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Jang, Je-Hun [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Stein, Emily R. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Bauer, Stephen J. [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States); Daley, Tom [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Freifeld, Barry M. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Birkholzer, Jens [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Spane, Frank A. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States)

    2016-09-19

    Deep Borehole Disposal (DBD) of high-level radioactive wastes has been considered an option for geological isolation for many years (Hess et al. 1957). Recent advances in drilling technology have decreased costs and increased reliability for large-diameter (i.e., ≥50 cm [19.7”]) boreholes to depths of several kilometers (Beswick 2008; Beswick et al. 2014). These advances have therefore also increased the feasibility of the DBD concept (Brady et al. 2009; Cornwall 2015), and the current field test design will demonstrate the DBD concept and these advances. The US Department of Energy (DOE) Strategy for the Management and Disposal of Used Nuclear Fuel and High-Level Radioactive Waste (DOE 2013) specifically recommended developing a research and development plan for DBD. DOE sought input or expression of interest from States, local communities, individuals, private groups, academia, or any other stakeholders willing to host a Deep Borehole Field Test (DBFT). The DBFT includes drilling two boreholes nominally 200m [656’] apart to approximately 5 km [16,400’] total depth, in a region where crystalline basement is expected to begin at less than 2 km depth [6,560’]. The characterization borehole (CB) is the smaller-diameter borehole (i.e., 21.6 cm [8.5”] diameter at total depth), and will be drilled first. The geologic, hydrogeologic, geochemical, geomechanical and thermal testing will take place in the CB. The field test borehole (FTB) is the larger-diameter borehole (i.e., 43.2 cm [17”] diameter at total depth). Surface handling and borehole emplacement of test package will be demonstrated using the FTB to evaluate engineering feasibility and safety of disposal operations (SNL 2016).

  10. A blind testing design for authenticating ancient DNA sequences.

    Science.gov (United States)

    Yang, H; Golenberg, E M; Shoshani, J

    1997-04-01

    Reproducibility is a serious concern among researchers of ancient DNA. We designed a blind testing procedure to evaluate laboratory accuracy and authenticity of ancient DNA obtained from closely related extant and extinct species. Soft tissue and bones of fossil and contemporary museum proboscideans were collected and identified based on morphology by one researcher, and other researchers carried out DNA testing on the samples, which were assigned anonymous numbers. DNA extracted using three principal isolation methods served as template in PCR amplifications of a segment of the cytochrome b gene (mitochondrial genome), and the PCR product was directly sequenced and analyzed. The results show that such a blind testing design performed in one laboratory, when coupled with phylogenetic analysis, can nonarbitrarily test the consistency and reliability of ancient DNA results. Such reproducible results obtained from the blind testing can increase confidence in the authenticity of ancient sequences obtained from postmortem specimens and avoid bias in phylogenetic analysis. A blind testing design may be applicable as an alternative to confirm ancient DNA results in one laboratory when independent testing by two laboratories is not available.

  11. A Rorschach Test for Visual Classification Strategies

    Science.gov (United States)

    Watson, Andrew B.; Rosenholtz, Ruth; Null, Cynthia H. (Technical Monitor)

    1996-01-01

    Contemporary models of pattern, detection and discrimination often employ template matching, but there have been few direct tests of this proposition. Adopting a method developed by Ahumada, we have analyzed how human observers discriminate between two letters of the alphabet ('c' and 'x'). The stimulus consisted of a one degree tall letter plus a four degree field of static white noise, both displayed for 16 frames at a 67 Hz frame rate. Our font and display dimensions approximated those of Solomon and Pelli. The observer identified the letter presented. A QUEST staircase varied letter contrast to maintain a 75% correct rate. For each trial, we preserved the information required to reconstruct the noise field. Possible trial categories based on (signal, response) pairs are: (c,c), (c,x), (x,c), (x,x). Noise fields were averaged separately for each category, and a final classification image was obtained by averaging the four mean images after inverting the sign of categories in which x was the response. If the observer employs a template, it should be revealed in the classification image. The lowpass-filtered classification image derived from 2048 responses of one observer is shown here, along with the corresponding ideal template. An approximation to the ideal template can be seen appropriately located within the classification image. We have also simulated and will discuss the classification images expected from various discrimination models in this experimental context. The construction of classification images appears to be a powerful tool for studying classification strategies used by human observers. Like a Rorschach test, it surreptitiously discovers the inner desires of the visual system.

  12. Efficient Two-Stage Group Testing Algorithms for DNA Screening

    CERN Document Server

    Huber, Michael

    2011-01-01

    Group testing algorithms are very useful tools for DNA library screening. Building on recent work by Levenshtein (2003) and Tonchev (2008), we construct in this paper new infinite classes of combinatorial structures, the existence of which are essential for attaining the minimum number of individual tests at the second stage of a two-stage disjunctive testing algorithm.

  13. DNA methylome profiling of maternal peripheral blood and placentas reveal potential fetal DNA markers for non-invasive prenatal testing.

    Science.gov (United States)

    Xiang, Yuqian; Zhang, Junyu; Li, Qiaoli; Zhou, Xinyao; Wang, Teng; Xu, Mingqing; Xia, Shihui; Xing, Qinghe; Wang, Lei; He, Lin; Zhao, Xinzhi

    2014-09-01

    Utilizing epigenetic (DNA methylation) differences to differentiate between maternal peripheral blood (PBL) and fetal (placental) DNA has been a promising strategy for non-invasive prenatal testing (NIPT). However, the differentially methylated regions (DMRs) have yet to be fully ascertained. In the present study, we performed genome-wide comparative methylome analysis between maternal PBL and placental DNA from pregnancies of first trimester by methylated DNA immunoprecipitation-sequencing (MeDIP-Seq) and Infinium HumanMethylation450 BeadChip assays. A total of 36 931 DMRs and 45 804 differentially methylated sites (DMSs) covering the whole genome, exclusive of the Y chromosome, were identified via MeDIP-Seq and Infinium 450k array, respectively, of which 3759 sites in 2188 regions were confirmed by both methods. Not only did we find the previously reported potential fetal DNA markers in our identified DMRs/DMSs but also we verified fully the identified DMRs/DMSs in the validation round by MassARRAY EpiTYPER. The screened potential fetal DNA markers may be used for NIPT on aneuploidies and other chromosomal diseases, such as cri du chat syndrome and velo-cardio-facial syndrome. In addition, these potential markers may have application in the early diagnosis of placental dysfunction, such as pre-eclampsia.

  14. Maternal Plasma DNA and RNA Sequencing for Prenatal Testing.

    Science.gov (United States)

    Tamminga, Saskia; van Maarle, Merel; Henneman, Lidewij; Oudejans, Cees B M; Cornel, Martina C; Sistermans, Erik A

    2016-01-01

    Cell-free DNA (cfDNA) testing has recently become indispensable in diagnostic testing and screening. In the prenatal setting, this type of testing is often called noninvasive prenatal testing (NIPT). With a number of techniques, using either next-generation sequencing or single nucleotide polymorphism-based approaches, fetal cfDNA in maternal plasma can be analyzed to screen for rhesus D genotype, common chromosomal aneuploidies, and increasingly for testing other conditions, including monogenic disorders. With regard to screening for common aneuploidies, challenges arise when implementing NIPT in current prenatal settings. Depending on the method used (targeted or nontargeted), chromosomal anomalies other than trisomy 21, 18, or 13 can be detected, either of fetal or maternal origin, also referred to as unsolicited or incidental findings. For various biological reasons, there is a small chance of having either a false-positive or false-negative NIPT result, or no result, also referred to as a "no-call." Both pre- and posttest counseling for NIPT should include discussing potential discrepancies. Since NIPT remains a screening test, a positive NIPT result should be confirmed by invasive diagnostic testing (either by chorionic villus biopsy or by amniocentesis). As the scope of NIPT is widening, professional guidelines need to discuss the ethics of what to offer and how to offer. In this review, we discuss the current biochemical, clinical, and ethical challenges of cfDNA testing in the prenatal setting and its future perspectives including novel applications that target RNA instead of DNA.

  15. Surface-assisted DNA self-assembly: An enzyme-free strategy towards formation of branched DNA lattice.

    Science.gov (United States)

    Bhanjadeo, Madhabi M; Nayak, Ashok K; Subudhi, Umakanta

    2017-04-01

    DNA based self-assembled nanostructures and DNA origami has proven useful for organizing nanomaterials with firm precision. However, for advanced applications like nanoelectronics and photonics, large-scale organization of self-assembled branched DNA (bDNA) into periodic lattices is desired. In this communication for the first time we report a facile method of self-assembly of Y-shaped bDNA nanostructures on the cationic surface of Aluminum (Al) foil to prepare periodic two dimensional (2D) bDNA lattice. Particularly those Y-shaped bDNA structures having smaller overhangs and unable to self-assemble in solution, they are easily assembled on the surface of Al foil in the absence of ligase. Field emission scanning electron microscopy (FESEM) analysis shows homogenous distribution of two-dimensional bDNA lattices across the Al foil. When the assembled bDNA structures were recovered from the Al foil and electrophoresed in nPAGE only higher order polymeric bDNA structures were observed without a trace of monomeric structures which confirms the stability and high yield of the bDNA lattices. Therefore, this enzyme-free economic and efficient strategy for developing bDNA lattices can be utilized in assembling various nanomaterials for functional molecular components towards development of DNA based self-assembled nanodevices. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Test-Taking Strategies of Arab EFL Learners on Multiple Choice Tests

    Science.gov (United States)

    Al Fraidan, Abdullah; Al-Khalaf, Khadija

    2012-01-01

    Many studies have focused on the function of learners' strategies in a variety of EFL domains. However, research on test-taking strategies (TTSs) has been limited, even though such strategies might influence test scores and, as a result, test validity. Motivated by this fact and in light of our own experience as EFL test-makers, this article will…

  17. Teaching TOEIC/TOEFL Test-Taking Strategies.

    Science.gov (United States)

    Forster, Douglas E.; Karn, Richard

    Teaching strategies are outlined for teachers of English as a second language to use in improving students' listening and reading comprehension skills specifically for two standardized tests: the Test of English for International Communication (TOEIC) and the Test of English as a Foreign Language (TOEFL). The strategies presented are not intended…

  18. Motivational and Cognitive Test-Taking Strategies and Their Influence on Test Performance in Mathematics

    Science.gov (United States)

    Peng, Yun; Hong, Eunsook; Mason, Elsa

    2014-01-01

    A structural equation model of relationships among testing-related motivation variables (test value, effort, self-efficacy, and test anxiety), test-taking strategies (test tactics and metacognitive strategies), gender, and math test performance were examined with a sample of 10th graders (N = 438; 182 males and 256 females). In general, motivation…

  19. Cell-free DNA testing after combined test: factors affecting the uptake.

    Science.gov (United States)

    Maiz, Nerea; Alzola, Irune; Murua, Emerson J; Rodríguez Santos, Javier

    2016-11-01

    First, to assess what was the uptake of cell free DNA (cfDNA) testing after a combined test and the maternal and fetal factors that influenced this decision, and second, to assess the uptake and factors that influence the choice of invasive testing. This observational retrospective study included 1083 singleton pregnancies who had a combined test for screening for Down syndrome between 11 (+) (0) and 13 (+) (6) weeks. Multivariate logistic regression analysis was used to determine which factors affected the uptake of cfDNA test and invasive testing among risk for trisomies 21, 18, and 13, maternal characteristics and fetal nuchal translucency (NT) thickness. Two-hundred fifty-seven (23.7%) women had a cfDNA test, 89 (8.2%) had an invasive test, and 737 (68.1%) had no further test. The uptake of cfDNA increased with the risk for trisomies (p < 0.001), maternal age (p = 0.013), and was higher in nulliparous women (p = 0.004). The uptake of invasive test increased with the risk for trisomies (p < 0.001) and NT thickness (p < 0.001). This study shows that the uptake of cfDNA testing increases with the risk for trisomies, maternal age, and is higher in nulliparous, whereas the uptake of invasive testing increases with the risk for trisomies and NT thickness.

  20. Virus DNA packaging: the strategy used by phage lambda.

    Science.gov (United States)

    Catalano, C E; Cue, D; Feiss, M

    1995-06-01

    Phage lambda, like a number of other large DNA bacteriophages and the herpesviruses, produces concatemeric DNA during DNA replication. The concatemeric DNA is processed to produce unit-length, virion DNA by cutting at specific sites along the concatemer. DNA cutting is co-ordinated with DNA packaging, the process of translocation of the cut DNA into the preformed capsid precursor, the prohead. A key player in the lambda DNA packaging process is the phage-encoded enzyme terminase, which is involved in (i) recognition of the concatemeric lambda DNA; (ii) initiation of packaging, which includes the introduction of staggered nicks at cosN to generate the cohesive ends of virion DNA and the binding of the prohead; (iii) DNA packaging, possibly including the ATP-driven DNA translocation; and (iv) following translocation, the cutting of the terminal cosN to complete DNA packaging. To one side of cosN is the site cosB, which plays a role in the initiation of packaging; along with ATP, cosB stimulates the efficiency and adds fidelity to the endonuclease activity of terminase in cutting cosN. cosB is essential for the formation of a post-cleavage complex with terminase, complex I, that binds the prohead, forming a ternary assembly, complex II. Terminase interacts with cosN through its large subunit, gpA, and the small terminase subunit, gpNu1, interacts with cosB. Packaging follows complex II formation. cosN is flanked on the other side by the site cosQ, which is needed for termination, but not initiation, of DNA packaging. cosQ is required for cutting of the second cosN, i.e. the cosN at which termination occurs. DNA packaging in lambda has aspects that differ from other lambda DNA transactions. Unlike the site-specific recombination system of lambda, for DNA packaging the initial site-specific protein assemblage gives way to a mobile, translocating complex, and unlike the DNA replication system of lambda, the same protein machinery is used for both initiation and

  1. Test-selection Strategies for Probabilistic Networks

    NARCIS (Netherlands)

    Sent, D.

    2005-01-01

    Decision-support systems are used in a large variety of domains. In the medical domain, such systems can be equipped with a patient-specific facility that indicates which diagnostic test or combination of tests should be performed. Current systems, however, do not take into account that tests might

  2. Noninvasive prenatal paternity testing (NIPAT) through maternal plasma DNA sequencing

    DEFF Research Database (Denmark)

    Jiang, Haojun; Xie, Yifan; Li, Xuchao

    2016-01-01

    Short tandem repeats (STRs) and single nucleotide polymorphisms (SNPs) have been already used to perform noninvasive prenatal paternity testing from maternal plasma DNA. The frequently used technologies were PCR followed by capillary electrophoresis and SNP typing array, respectively. Here, we...... developed a noninvasive prenatal paternity testing (NIPAT) based on SNP typing with maternal plasma DNA sequencing. We evaluated the influence factors (minor allele frequency (MAF), the number of total SNP, fetal fraction and effective sequencing depth) and designed three different selective SNP panels...... paternity test using STR multiplex system. Our study here proved that the maternal plasma DNA sequencing-based technology is feasible and accurate in determining paternity, which may provide an alternative in forensic application in the future....

  3. HAlign: Fast multiple similar DNA/RNA sequence alignment based on the centre star strategy.

    Science.gov (United States)

    Zou, Quan; Hu, Qinghua; Guo, Maozu; Wang, Guohua

    2015-08-01

    Multiple sequence alignment (MSA) is important work, but bottlenecks arise in the massive MSA of homologous DNA or genome sequences. Most of the available state-of-the-art software tools cannot address large-scale datasets, or they run rather slowly. The similarity of homologous DNA sequences is often ignored. Lack of parallelization is still a challenge for MSA research. We developed two software tools to address the DNA MSA problem. The first employed trie trees to accelerate the centre star MSA strategy. The expected time complexity was decreased to linear time from square time. To address large-scale data, parallelism was applied using the hadoop platform. Experiments demonstrated the performance of our proposed methods, including their running time, sum-of-pairs scores and scalability. Moreover, we supplied two massive DNA/RNA MSA datasets for further testing and research. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  4. DNA familial binding profiles made easy: comparison of various motif alignment and clustering strategies.

    Directory of Open Access Journals (Sweden)

    Shaun Mahony

    2007-03-01

    Full Text Available Transcription factor (TF proteins recognize a small number of DNA sequences with high specificity and control the expression of neighbouring genes. The evolution of TF binding preference has been the subject of a number of recent studies, in which generalized binding profiles have been introduced and used to improve the prediction of new target sites. Generalized profiles are generated by aligning and merging the individual profiles of related TFs. However, the distance metrics and alignment algorithms used to compare the binding profiles have not yet been fully explored or optimized. As a result, binding profiles depend on TF structural information and sometimes may ignore important distinctions between subfamilies. Prediction of the identity or the structural class of a protein that binds to a given DNA pattern will enhance the analysis of microarray and ChIP-chip data where frequently multiple putative targets of usually unknown TFs are predicted. Various comparison metrics and alignment algorithms are evaluated (a total of 105 combinations. We find that local alignments are generally better than global alignments at detecting eukaryotic DNA motif similarities, especially when combined with the sum of squared distances or Pearson's correlation coefficient comparison metrics. In addition, multiple-alignment strategies for binding profiles and tree-building methods are tested for their efficiency in constructing generalized binding models. A new method for automatic determination of the optimal number of clusters is developed and applied in the construction of a new set of familial binding profiles which improves upon TF classification accuracy. A software tool, STAMP, is developed to host all tested methods and make them publicly available. This work provides a high quality reference set of familial binding profiles and the first comprehensive platform for analysis of DNA profiles. Detecting similarities between DNA motifs is a key step in the

  5. Polymerase chain reaction and conventional DNA tests in detection of HPV DNA in cytologically normal and abnormal cervical scrapes

    DEFF Research Database (Denmark)

    Kalia, A.; Jalava, T.; Nieminen, P.

    1992-01-01

    Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test......Med.mikrobiologi, polymerase chain reaction, DNA tests, human papillomavirus (HPV), cervical smear, hybridisation, cytologi, affiProbe HPV test, ViraType test...

  6. Testing microscopes between market and scientific strategies

    OpenAIRE

    Ratcliff, Marc

    2007-01-01

    This paper claims that the testing of microscopes during the eighteenth century reveals specific types of interaction between makers and users and links between scientific and economic interests. Basic procedures for the comparison and test of microscopes existed already in the Enlightenment although many historians thought that these were invented during the nineteenth century. The paper discusses three kinds of tests, advertising, the admission of a microscope in the laboratory, and finally...

  7. Cascaded multiple amplification strategy for ultrasensitive detection of HIV/HCV virus DNA.

    Science.gov (United States)

    Wang, Kun; Fan, Daoqing; Liu, Yaqing; Dong, Shaojun

    2017-01-15

    Ultrasensitive detection of HIV and HCV virus DNA is of great importance for early accurate diagnostics and therapy of HIV virus-infected patients. Herein, to our best knowledge, it is the first to use DNA cascaded multiple amplification strategy for ultrasensitive detection of HIV virus DNA with G-quadruplex-specific fluorescent or colorimetric probes as signal carriers. The developed strategy also exhibited universal applicability for HCV virus DNA detection. After reaction for about 4h, high sensitivity and specificity can be achieved at both fluorescent and colorimetric strategies (limit of detection (LOD) of 10 fM and 0.5pM were reached for fluorescent and colorimetric detection, respectively). And the single-based mismatched DNA even can be distinguished by naked eyes. It is believed that the cascaded multiple amplification strategy presents a huge advance in sensing platform and potential application in future clinical diagnosis.

  8. DNA replication and transcription: An innovative teaching strategy.

    Science.gov (United States)

    Fossey, Annabel; Hancock, Carolyn

    2005-11-01

    First-year students in genetics at the University of KwaZulu-Natal, South Africa, attend two general biology modules, one in each semester. Teaching involves four formal lectures per week of 45 min each, one 3-h practical, and one lecture period tutorial. These students, graduating from secondary education, are well schooled in rote leaning but are limited in critical thinking and find assessment questions belonging to the higher levels of Bloom's taxonomy difficult. All students attend the formal lectures together, up to 300 students, whereas for the tutorials they are grouped into small groups, no more than 40 students in a tutorial class, allowing for innovative teaching strategies. Students find the processes of DNA replication and transcription difficult because of the sequential steps involved in the processes together with limitations imposed by the enzymes involved. Furthermore, they find the significance and relationships between the different components of the processes very difficult. A tutorial was developed in which students are requested to demonstrate replication with line drawings, which are then used in various iterations of transcription. The tutorial is administered in the presence of a tutor that guides the step by step execution of the tutorial while stimulating active participation. In the past 2 years, the presentation of this and other similar tutorials in genetics has improved overall class performance on average by 15%. Furthermore, students seem to display a greater retention from the first year to the second, which was previously rather limited. A survey among first-year students revealed that the implementation of this tutorial facilitated studying and recall by helping students to organize thoughts, picture the sequence of events, understand fundamental concepts, and create a feeling of confidence.

  9. One-pot DNA construction for synthetic biology: the Modular Overlap-Directed Assembly with Linkers (MODAL) strategy

    Science.gov (United States)

    Casini, Arturo; MacDonald, James T.; Jonghe, Joachim De; Christodoulou, Georgia; Freemont, Paul S.; Baldwin, Geoff S.; Ellis, Tom

    2014-01-01

    Overlap-directed DNA assembly methods allow multiple DNA parts to be assembled together in one reaction. These methods, which rely on sequence homology between the ends of DNA parts, have become widely adopted in synthetic biology, despite being incompatible with a key principle of engineering: modularity. To answer this, we present MODAL: a Modular Overlap-Directed Assembly with Linkers strategy that brings modularity to overlap-directed methods, allowing assembly of an initial set of DNA parts into a variety of arrangements in one-pot reactions. MODAL is accompanied by a custom software tool that designs overlap linkers to guide assembly, allowing parts to be assembled in any specified order and orientation. The in silico design of synthetic orthogonal overlapping junctions allows for much greater efficiency in DNA assembly for a variety of different methods compared with using non-designed sequence. In tests with three different assembly technologies, the MODAL strategy gives assembly of both yeast and bacterial plasmids, composed of up to five DNA parts in the kilobase range with efficiencies of between 75 and 100%. It also seamlessly allows mutagenesis to be performed on any specified DNA parts during the process, allowing the one-step creation of construct libraries valuable for synthetic biology applications. PMID:24153110

  10. One-pot DNA construction for synthetic biology: the Modular Overlap-Directed Assembly with Linkers (MODAL) strategy.

    Science.gov (United States)

    Casini, Arturo; MacDonald, James T; De Jonghe, Joachim; Christodoulou, Georgia; Freemont, Paul S; Baldwin, Geoff S; Ellis, Tom

    2014-01-01

    Overlap-directed DNA assembly methods allow multiple DNA parts to be assembled together in one reaction. These methods, which rely on sequence homology between the ends of DNA parts, have become widely adopted in synthetic biology, despite being incompatible with a key principle of engineering: modularity. To answer this, we present MODAL: a Modular Overlap-Directed Assembly with Linkers strategy that brings modularity to overlap-directed methods, allowing assembly of an initial set of DNA parts into a variety of arrangements in one-pot reactions. MODAL is accompanied by a custom software tool that designs overlap linkers to guide assembly, allowing parts to be assembled in any specified order and orientation. The in silico design of synthetic orthogonal overlapping junctions allows for much greater efficiency in DNA assembly for a variety of different methods compared with using non-designed sequence. In tests with three different assembly technologies, the MODAL strategy gives assembly of both yeast and bacterial plasmids, composed of up to five DNA parts in the kilobase range with efficiencies of between 75 and 100%. It also seamlessly allows mutagenesis to be performed on any specified DNA parts during the process, allowing the one-step creation of construct libraries valuable for synthetic biology applications.

  11. A strategy for skin irritation testing.

    Science.gov (United States)

    Robinson, Michael K; Perkins, Mary A

    2002-03-01

    Skin irritation safety testing and risk assessment for new products, and the ingredients they contain, is a critical requirement before market introduction. In the past, much of this skin testing required the use of experimental animals. However, new current best approaches for skin corrosion and skin irritation testing and risk assessment are being defined, obviating the need for animal test methods. Several in vitro skin corrosion test methods have been endorsed after successful validation and are gaining acceptance by regulatory authorities. In vitro test methods for acute, cumulative (repeat exposure), and chronic (prolonged exposure) skin irritation are under development. Though not yet validated, many are being used successfully for testing and risk assessment purposes as documented through an expanding literature. Likewise, a novel acute irritation patch test in human subjects is providing a valid and ethical alternative to animal testing for prediction of chemical skin irritation potential. An array of other human test methods also have been developed and used for the prediction of cumulative/chronic skin irritation and the general skin compatibility of finished products. The development of instrumental methods (e.g., transepidermal water loss, capacitance, and so on) has provided the means for analyzing various biophysical properties of human skin and changes in these properties caused by exposure to irritants. However, these methods do not directly measure skin inflammation. A recently introduced skin surface tape sampling procedure has been shown to detect changes in skin surface cytokine recovery that correlate with inflammatory skin changes associated with chemical irritant exposures or existing dermatitis. It holds promise for more objective quantification of skin irritation events, including subclinical (sensory) irritation, in the future.

  12. In-situ thermal testing program strategy

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1995-06-01

    In the past year the Yucca Mountain Site Characterization Project has implemented a new Program Approach to the licensing process. The Program Approach suggests a step-wise approach to licensing in which the early phases will require less site information than previously planned and necessitate a lesser degree of confidence in the longer-term performance of the repository. Under the Program Approach, the thermal test program is divided into two principal phases: (1) short-term in situ tests (in the 1996 to 2000 time period) and laboratory thermal tests to obtain preclosure information, parameters, and data along with bounding information for postclosure performance; and (2) longer-term in situ tests to obtain additional data regarding postclosure performance. This effort necessitates a rethinking of the testing program because the amount of information needed for the initial licensing phase is less than previously planned. This document proposes a revised and consolidated in situ thermal test program (including supporting laboratory tests) that is structured to meet the needs of the Program Approach. A customer-supplier model is used to define the Project data needs. These data needs, along with other requirements, were then used to define a set of conceptual experiments that will provide the required data within the constraints of the Program Approach schedule. The conceptual thermal tests presented in this document represent a consolidation and update of previously defined tests that should result in a more efficient use of Project resources. This document focuses on defining the requirements and tests needed to satisfy the goal of a successful license application in 2001, should the site be found suitable.

  13. The Interpretation of Lineage Markers in Forensic DNA Testing

    Science.gov (United States)

    Buckleton, J.S.; Krawczak, M.; Weir, B.S.

    2011-01-01

    Mitochondrial DNA (mtDNA) and the non-recombining portion of the Y chromosome are inherited matrilinealy and patrilinealy, respectively, and without recombination. Collectively they are termed ‘lineage markers’. Lineage markers may be used in forensic testing of an item, such as a hair from a crime scene, against a hypothesised source, or in relationship testing. An estimate of the evidential weight of a match is usually provided by a count of the occurrence in some database of the mtDNA or Y-STR haplotype under consideration. When the factual statement of a count in the database is applied to a case, issues of relevance of the database and sampling uncertainty may arise. In this paper, we re-examine the issues of sampling uncertainty, the relevance of the database, and the combination of autosomal and lineage marker evidence. We also review the recent developments by C.H. Brenner. PMID:21397888

  14. Reading Test-taking Strategies in General Training IELTS

    Directory of Open Access Journals (Sweden)

    Vahede Nosrati

    2015-10-01

    Full Text Available The significance of gaining a better understanding of how test-taking strategies are used has been recognized by researchers. Considering this fact, this study aimed at investigating the test-taking strategies which were employed by IELTS candidates in reading comprehension test. Besides, it tried to take into account the differences among strategies used for different tasks. In order to gather data, two instruments were employed: the think-aloud protocol, and an IELTS reading test. The obtained data were analyzed and interpreted qualitatively by the researcher. The findings indicated that candidates employed 15 different strategies which were categorized in 3 stages, pre-reading, reading, and post-reading stages. Furthermore, it was revealed that test-takers used certain strategies differently, depending on the type of the task. The findings provide a better understanding of strategy use among IELTS candidates and help teachers to improve their approaches toward teaching and learning goals. Keywords: Test-taking Strategy, Test-taker, Reading Comprehension, Language Learning Strategy, IELTS

  15. False-positive Human Papillomavirus DNA tests in cervical screening

    DEFF Research Database (Denmark)

    Rebolj, Matejka; Pribac, Igor; Lynge, Elsebeth

    2011-01-01

    Based on data from randomised controlled trials (RCT) on primary cervical screening, it has been reported that the problem of more frequent false-positive tests in Human Papillomavirus (HPV) DNA screening compared to cytology could be overcome. However, these reports predominantly operated...

  16. Sperm chromatin dispersion test in the assessment of DNA fragmentation and aneuploidy in human spermatozoa.

    Science.gov (United States)

    Balasuriya, A; Speyer, B; Serhal, P; Doshi, A; Harper, J C

    2011-05-01

    Sperm DNA damage is thought to be increased in men with male factor infertility. Previous studies suggest a correlation between sperm DNA fragmentation and aneuploidy. The sperm chromatin dispersion (SCD) test was modified to produce the Halosperm Kit. The SCD-fluorescent in-situ hybridization (FISH) test allows the simultaneous detection of DNA fragmentation and aneuploidy on the same sperm cell. The objectives of this study were to validate the SCD, SCD-FISH and Halosperm tests for the analysis of sperm DNA fragmentation and compare them to the sperm chromatin structure assay (SCSA). Semen samples from 20 males undergoing IVF/intracytoplasmic sperm injection were processed using FISH, SCD-FISH, SCD and Halosperm, and compared with SCSA results. There was a significant difference between FISH and SCD-FISH results in the detection of aneuploidy (P=0.000) and the level of sperm DNA fragmentation in the samples subjected to SCSA and SCD (P=0.001) or SCSA and SCD-FISH (P=0.001). There was no significant correlation between DNA fragmentation and aneuploidy. If sperm aneuploidy is to be determined, more reliable results will be obtained if FISH is performed rather than SCD-FISH. A lack of validation and unknown clinical significance question the value of DNA fragmentation assays. DNA damage in the male germ line may result in adverse clinical outcomes and the pathophysiology and clinical consequences of sperm DNA damage are being actively researched. Many DNA fragmentation assays such as the Halosperm Kit have been developed recently and are now available at a commercial level. Unfortunately, aimed at vulnerable couples with difficulty conceiving, many of these tests have not been clinically validated. Despite its plausible appeal and fervour of its supporters, the benefits of widespread DNA testing that only achieves the distressing of couples with the knowledge that effectual therapeutic strategies are absent are questionable. Commercially, however, it is no doubt

  17. Test-Taking Strategies. Research Brief

    Science.gov (United States)

    Walker, Karen

    2010-01-01

    Much has been written about student preparation for standardized tests such as: get enough sleep, do not eat sugary food or drinks, eat a well-balanced meal, wear comfortable clothing, bring appropriate supplies especially extra #2 pencils, answer every question, write neatly and legibly, deduce wrong answers immediately and use all of the time…

  18. Cell free fetal DNA testing in maternal blood of Romanian pregnant women

    Directory of Open Access Journals (Sweden)

    Viorica E Radoi

    2015-10-01

    Full Text Available Background: The discovery of circulating fetal DNA in maternal blood led to the discovery of new strategies to perform noninvasive testing for prenatal diagnosis. Objective: The purpose of the study was to detect fetal aneuploidy at chromosomes 13, 18, 21, X, and Y by analysis of fetal cell-free DNA from maternal blood, without endangering pregnancy. Materials and Methods: This retrospective study has been performed in Bucharest at Medlife Maternal and Fetal Medicine Department between 2013-2014. In total 201 women were offered noninvasive prenatal test. Maternal plasma samples were collected from women at greater than 9 weeks of gestation after informed consent and genetics counseling. Results: From 201 patients; 28 (13.93% had screening test with high risk for trisomy 21, 116 (57.71% had advanced maternal age, 1 (0.49% had second trimester ultrasound markers and the remaining 56 patients (27.86% performed the test on request. Of those patients, 189 (94.02% had a “low risk” result (99% risk all for trisomy 21 (T21. T21 was confirmed by amniocentesis in 1 patient and the other 4 patients declined confirmation. The 7 remaining patients (3.48% had a low fetal fraction of DNA. Conclusion: It is probably that prenatal diagnosis using fetal DNA in maternal blood would play an increasingly role in the future practice of prenatal testing because of high accuracy.

  19. STRATEGY/RESULT FOR SRF TEST INFRASTRUCTURES

    CERN Document Server

    Weingarten, W

    2011-01-01

    The report summarizes the requirements needed to further develop the technology of RF superconductivity for accelerator application beyond the present state of the art. In relation to emerging European accelerator projects present collaboration schemes are identified. The required test capacities are described and compared with the available ones. Based on a short historical review, the actual performance limits of superconducting cavities are evaluated and measures are proposed to overcome them.

  20. DNA vaccine prime and recombinant FPV vaccine boost: an important candidate immunization strategy to control bluetongue virus type 1.

    Science.gov (United States)

    Li, Junping; Yang, Tao; Xu, Qingyuan; Sun, Encheng; Feng, Yufei; Lv, Shuang; Zhang, Qin; Wang, Haixiu; Wu, Donglai

    2015-10-01

    Bluetongue virus (BTV) is the causative agent of bluetongue (BT), an important sheep disease that caused great economic loss to the sheep industry. There are 26 BTV serotypes based on the outer protein VP2. However, the serotypes BTV-1 and BTV-16 are the two most prevalent serotypes in China. Vaccination is the most effective method of preventing viral infections. Therefore, the need for an effective vaccine against BTV is urgent. In this study, DNA vaccines and recombinant fowlpox virus (rFPV) vaccines expressing VP2 alone or VP2 in combination with VP5 or co-expressing the VP2 and VP5 proteins of BTV-1 were evaluated in both mice and sheep. Several strategies were tested in mice, including DNA vaccine prime and boost, rFPV vaccine prime and boost, and DNA vaccine prime and rFPV vaccine boost. We then determined the best vaccine strategy in sheep. Our results indicated that a strategy combining a DNA vaccine prime (co-expressing VP2 and VP5) followed by an rFPV vaccine boost (co-expressing VP2 and VP5) induced a high titer of neutralizing antibodies in sheep. Therefore, our data suggest that a DNA vaccine consisting of a pCAG-(VP2+VP5) prime and an rFPV-(VP2+VP5) boost is an important candidate for the design of a novel vaccine against BTV-1.

  1. mRNA and DNA PCR tests in cutaneous tuberculosis

    Directory of Open Access Journals (Sweden)

    Chandanmal Suthar

    2013-01-01

    Full Text Available Background: The microbiologic diagnosis of cutaneous tuberculosis is difficult because most lesions harbor only a small number of mycobacteria that cannot usually be detected by staining for the organism or by culture. Nucleic acid amplification tests based on the polymerase chain reaction (PCR are potentially useful in this situation. Aims: To evaluate the utility of mRNA PCR and DNA PCR in the diagnosis of cutaneous tuberculosis. Methods: Biopsies from 28 cases of cutaneous tuberculosis and 19 controls with other diseases were subjected to microbiologic tests including direct smears for mycobacteria, culture and both mRNA PCR and DNA PCR. The laboratory was blinded to the clinical diagnosis. Results: None of the patients or controls showed a positive reaction on mRNA PCR test. Seven of 28 cases and 5 out of 19 controls showed a positive result on DNA PCR test yielding a sensitivity of 25% and a specificity of 73.7%. Conclusion: The results of PCR tests in cutaneous tuberculosis should be interpreted in the light of clinical and histopathological findings.

  2. Vocabulary test Strategies used by the Students to answer Vocabulary Test the Reading Comprehension of TOEFL

    Directory of Open Access Journals (Sweden)

    Suyatman Suyatman

    2017-10-01

    Full Text Available Test of English as a foreign Language or TOEFL is a standardized test of English for non-native speaker. It consists of three parts or three sections of tests. In Reading Comprehension test, it consists of vocabulary test. To get better result of score, it needs strategies. The purposes of this study are to know the strategies used by the students to answer the vocabulary test on reading section of TOEFL, to know the most strategy used by the students, to know the least strategy used by the students and to know the distribution of strategies used by the students to answer the Vocabulary test of Reading Comprehension of the TOEFL. The researcher used descriptive qualitative research. The subject was twelve students. The instrument was questionnaire that consisted of thirty questions. Data analyzes technique was by using mean score. The result of the research showed that; (1 students used all strategies to answer the vocabulary test of reading comprehension of TOEFL. (2 the most strategies used by the students was ‘Looking for contextual clues to the meaning of unknown words.(3 the least strategy used by the students to answer vocabulary test was ‘Developing a new vocabulary study system, and (4 the distribution of the strategy number 1 was 3.88,strategy number 2 was 3.61, number 3 was 2.94, number four was 2.91, strategy number 5 was3.88, strategy number six was 3.47, strategy number seven was 3.69, strategy number eight was 3.02, strategy number nine was 3.00 and the last strategy was 3.13.

  3. A primer design strategy for PCR amplification of GC-rich DNA sequences.

    Science.gov (United States)

    Li, Li-Yan; Li, Qiang; Yu, Yan-Hong; Zhong, Mei; Yang, Lei; Wu, Qing-Hong; Qiu, Yu-Rong; Luo, Shen-Qiu

    2011-06-01

    To establish a primer design method for amplification of GC-rich DNA sequences. A group of 15 pairs of primers with higher T(m) (>79.7°C) and lower level ΔT(m) (designed to amplify GC-rich sequences (66.0%-84.0%). The statistical analysis of primer parameters and GC content of PCR products was performed and compared with literatures. Other control experiments were conducted using shortened primers for GC-rich PCR amplifications in this study, and the statistical analysis of shortened primer parameters and GC content of PCR products was performed compared with primers not shortened. A group of 26 pairs of primers were designed to test the applicability of this primer designing strategy in amplifications of non-GC-rich sequences (35.2%-53.5%). All the DNA sequences in this study were successfully amplified. Statistical analyses show that the T(m) and ΔT(m) were the main factors influencing amplifications. This primer designing strategy offered a perfect tool for amplification of GC-rich sequences. It proves that the secondary structures cannot be formed at higher annealing temperature conditions (>65°C), and we can overcome this difficulty easily by designing primers and using higher annealing temperature. Crown Copyright © 2011. Published by Elsevier Inc. All rights reserved.

  4. Marking Strategies in Metacognition-Evaluated Computer-Based Testing

    Science.gov (United States)

    Chen, Li-Ju; Ho, Rong-Guey; Yen, Yung-Chin

    2010-01-01

    This study aimed to explore the effects of marking and metacognition-evaluated feedback (MEF) in computer-based testing (CBT) on student performance and review behavior. Marking is a strategy, in which students place a question mark next to a test item to indicate an uncertain answer. The MEF provided students with feedback on test results…

  5. Genotoxicity of refinery waste assessed by some DNA damage tests.

    Science.gov (United States)

    Gupta, Amit Kumar; Ahmad, Irshad; Ahmad, Masood

    2015-04-01

    Refinery waste effluent is well known to contain polycyclic aromatic hydrocarbons, phenols and heavy metals as potentially genotoxic substances. The aim of the present study was to assess the genotoxic potential of Mathura refinery wastewater (MRWW) by various in vitro tests including the single cell gel electrophoresis, plasmid nicking assay and S1 nuclease assay. Treatment of human lymphocytes to different MRWW concentrations (0.15×, 0.3×, 0.5× and 0.78×) caused the formation of comets of which the mean tail lengths increased proportionately and differed significantly from those of unexposed controls. The toxic effect of MRWW on DNA was also studied by plasmid nicking assay and S1 nuclease assay. Strand breaks formation in the MRWW treated pBR322 plasmid confirmed its genotoxic effect. Moreover, a dose dependent increase in cleavage of calf thymus DNA in S1 nuclease assay was also suggestive of the DNA damaging potential of MRWW. A higher level of ROS generation in the test water sample was recorded which might be contributing to its genotoxicity. Interaction between the constituents of MRWW and calf thymus DNA was also ascertained by UV-visible spectroscopy.

  6. Strategy for Innovation in Soil Tests Illustrated for P Tests

    NARCIS (Netherlands)

    Reijneveld, A.; Termorshuizen, A.; Vedder, H.; Oenema, O.

    2014-01-01

    Soil phosphorus (P) tests are used for P fertilization recommendations, environmental evaluations, and occasionally for legislation purposes. The basis of fertilization recommendation as function of soil P status was established in the 1950s-1960s. Since then the agroeconomic environment has altered

  7. Cost-Effectiveness Analysis of Different Genetic Testing Strategies for Lynch Syndrome in Taiwan.

    Science.gov (United States)

    Chen, Ying-Erh; Kao, Sung-Shuo; Chung, Ren-Hua

    2016-01-01

    Patients with Lynch syndrome (LS) have a significantly increased risk of developing colorectal cancer (CRC) and other cancers. Genetic screening for LS among patients with newly diagnosed CRC aims to identify mutations in the disease-causing genes (i.e., the DNA mismatch repair genes) in the patients, to offer genetic testing for relatives of the patients with the mutations, and then to provide early prevention for the relatives with the mutations. Several genetic tests are available for LS, such as DNA sequencing for MMR genes and tumor testing using microsatellite instability and immunohistochemical analyses. Cost-effectiveness analyses of different genetic testing strategies for LS have been performed in several studies from different countries such as the US and Germany. However, a cost-effectiveness analysis for the testing has not yet been performed in Taiwan. In this study, we evaluated the cost-effectiveness of four genetic testing strategies for LS described in previous studies, while population-specific parameters, such as the mutation rates of the DNA mismatch repair genes and treatment costs for CRC in Taiwan, were used. The incremental cost-effectiveness ratios based on discounted life years gained due to genetic screening were calculated for the strategies relative to no screening and to the previous strategy. Using the World Health Organization standard, which was defined based on Taiwan's Gross Domestic Product per capita, the strategy based on immunohistochemistry as a genetic test followed by BRAF mutation testing was considered to be highly cost-effective relative to no screening. Our probabilistic sensitivity analysis results also suggest that the strategy has a probability of 0.939 of being cost-effective relative to no screening based on the commonly used threshold of $50,000 to determine cost-effectiveness. To the best of our knowledge, this is the first cost-effectiveness analysis for evaluating different genetic testing strategies for LS in

  8. Strategies for cardiopulmonary exercise testing of pectus excavatum patients

    Directory of Open Access Journals (Sweden)

    Moh H. Malek

    2008-01-01

    Full Text Available The purpose of this paper is to provide strategies for cardiopulmonary exercise testing of pectus excavatum patients. Currently, there are no standardized methods for assessing cardiovascular and pulmonary responses in this population; therefore, making comparisons across studies is difficult if not impossible. These strategies are intended for physicians, pulmonary technicians, exercise physiologists, and other healthcare professionals who conduct cardiopulmonary exercise testing on pectus excavatum patients. By using the strategies outlined in this report, comparisons across studies can be made, and the effects of pectus excavatum on cardiopulmonary function can be assessed with greater detail.

  9. A test of the domain-specific acculturation strategy hypothesis.

    Science.gov (United States)

    Miller, Matthew J; Yang, Minji; Lim, Robert H; Hui, Kayi; Choi, Na-Yeun; Fan, Xiaoyan; Lin, Li-Ling; Grome, Rebekah E; Farrell, Jerome A; Blackmon, Sha'kema

    2013-01-01

    Acculturation literature has evolved over the past several decades and has highlighted the dynamic ways in which individuals negotiate experiences in multiple cultural contexts. The present study extends this literature by testing M. J. Miller and R. H. Lim's (2010) domain-specific acculturation strategy hypothesis-that individuals might use different acculturation strategies (i.e., assimilated, bicultural, separated, and marginalized strategies; J. W. Berry, 2003) across behavioral and values domains-in 3 independent cluster analyses with Asian American participants. Present findings supported the domain-specific acculturation strategy hypothesis as 67% to 72% of participants from 3 independent samples using different strategies across behavioral and values domains. Consistent with theory, a number of acculturation strategy cluster group differences emerged across generational status, acculturative stress, mental health symptoms, and attitudes toward seeking professional psychological help. Study limitations and future directions for research are discussed.

  10. Testing of DNA isolation for the identification of hemp

    Directory of Open Access Journals (Sweden)

    Tomáš Vyhnánek

    2015-12-01

    Full Text Available Hemp is diploid organism (2n = 2x = 20, genome size 534 Mb with nine pairs of autosomes plus XX (♀ or XY (♂ chromosomes. Cannabis sativa L. is an important economic plant for the production of food, fibre, oils, and intoxicants. Genotypes (varieties or chemovar of hemp with low Δ9-tetrahydrocannabinol content are used for industrial applications. Varieties with high Δ9-tetrahydrocannabinol or high cannabidiol content are used for medicinal applications. Biochemical and molecular methods can be used for identification and classification. An important step for molecular biology methods is to obtain the matrix of the native and sufficiently pure DNA. We tested two different experimental variant of samples (20 mg and 100 mg of seeds, oilcake and dried flowers for analysis of the Italian variety Carmagnola for analysis (harvested in 2014, Hempoint Ltd., Czech Republic. The DNeasy® Plant Mini Kit (Qiagen, GE was used to isolate the DNA. The DNA concentration and purity was assessed by agarose electrophoresis and via a spectrophotometer. Samples of lower weight yielded lower values of DNA concentration (average 16.30 - 38.90 ng.µL-1, but with better purity than samples of higher weight (ratio A260nm/A280nm for low-weight samples was near 1.80. To test the applicability of DNA analysis, we used two SSR markers (CAN1347 and CAN2913. PCR products were separated on 1% agarose and on 8% polyacrylamide electrophoresis. DNA samples obtained from samples of higher weight exhibited less PCR amplification than samples of lower weight. We found no effect of sample weight on the formation of non-specific amplification products during the PCR reaction. Based on our results we can be recommended for practical isolation procedure using DNeasy® Plant Mini Kit with lower of sample weight (20 mg. In future work the procedure for DNA isolating from wheat-cannabis products, e. g. breads, rolls or pasta, will be optimized.

  11. Surveyor Nuclease: a new strategy for a rapid identification of heteroplasmic mitochondrial DNA mutations in patients with respiratory chain defects.

    Science.gov (United States)

    Bannwarth, Sylvie; Procaccio, Vincent; Paquis-Flucklinger, Veronique

    2005-06-01

    Molecular analysis of mitochondrial DNA (mtDNA) is a critical step in diagnosis and genetic counseling of respiratory chain defects. No fast method is currently available for the identification of unknown mtDNA point mutations. We have developed a new strategy based on complete mtDNA PCR amplification followed by digestion with a mismatch-specific DNA endonuclease, Surveyor Nuclease. This enzyme, a member of the CEL nuclease family of plant DNA endonucleases, cleaves double-strand DNA at any mismatch site including base substitutions and small insertions/deletions. After digestion, cleavage products are separated and analyzed by agarose gel electrophoresis. The size of the digestion products indicates the location of the mutation, which is then confirmed and characterized by sequencing. Although this method allows the analysis of 2 kb mtDNA amplicons and the detection of multiple mutations within the same fragment, it does not lead to the identification of homoplasmic base substitutions. Homoplasmic pathogenic mutations have been described. Nevertheless, most homoplasmic base substitutions are neutral polymorphisms while deleterious mutations are typically heteroplasmic. Here, we report that this method can be used to detect mtDNA mutations such as m.3243A>G tRNA(Leu) and m.14709T>C tRNA(Glu) even when they are present at levels as low as 3% in DNA samples derived from patients with respiratory chain defects. Then, we tested five patients suffering from a mitochondrial respiratory chain defect and we identified a variant (m.16189T>C) in two of them, which was previously associated with susceptibility to diabetes and cardiomyopathy. In conclusion, this method can be effectively used to rapidly and completely screen the entire human mitochondrial genome for heteroplasmic mutations and in this context represents an important advance for the diagnosis of mitochondrial diseases.

  12. Strategy for genotoxicity testing: hazard identification and risk assessment in relation to in vitro testing.

    Science.gov (United States)

    Thybaud, V; Aardema, M; Clements, J; Dearfield, K; Galloway, S; Hayashi, M; Jacobson-Kram, D; Kirkland, D; MacGregor, J T; Marzin, D; Ohyama, W; Schuler, M; Suzuki, H; Zeiger, E

    2007-02-03

    This report summarizes the proceedings of the September 9-10, 2005 meeting of the Expert Working Group on Hazard Identification and Risk Assessment in Relation to In Vitro Testing, part of an initiative on genetic toxicology. The objective of the Working Group was to develop recommendations for interpretation of results from tests commonly included in regulatory genetic toxicology test batteries, and to propose an appropriate strategy for follow-up testing when positive in vitro results were obtained in these assays. The Group noted the high frequency of positive in vitro findings in the genotoxicity test batteries with agents found not to be carcinogenic and thought not to pose a carcinogenic health hazard to humans. The Group agreed that a set of consensus principles for appropriate interpretation and follow-up testing when initial in vitro tests are positive was needed. Current differences in emphasis and policy among different regulatory agencies were recognized as a basis of this need. Using a consensus process among a balanced group of recognized international authorities from industry, government, and academia, it was agreed that a strategy based on these principles should include guidance on: (1) interpretation of initial results in the "core" test battery; (2) criteria for determining when follow-up testing is needed; (3) criteria for selecting appropriate follow-up tests; (4) definition of when the evidence is sufficient to define the mode of action and the relevance to human exposure; and (5) definition of approaches to evaluate the degree of health risk under conditions of exposure of the species of concern (generally the human). A framework for addressing these issues was discussed, and a general "decision tree" was developed that included criteria for assessing the need for further testing, selecting appropriate follow-up tests, and determining a sufficient weight of evidence to attribute a level of risk and stop testing. The discussion included case

  13. Towards an integrated in vitro strategy for estrogenicity testing

    NARCIS (Netherlands)

    Wang, S.; Aarts, H.J.M.; Haan, de L.H.J.; Argyriou, D.; Peijnenburg, A.A.C.M.; Rietjens, I.M.C.M.; Bovee, T.F.H.

    2014-01-01

    In order to define an in vitro integrated testing strategy (ITS) for estrogenicity, a set of 23 reference compounds representing diverse chemical classes were tested in a series of in vitro assays including proliferation and reporter gene assays. Outcomes of these assays were combined with published

  14. Using eDNA to experimentally test ungulate browsing preferences.

    Science.gov (United States)

    Nichols, Ruth V; Cromsigt, Joris P G M; Spong, Göran

    2015-01-01

    Large herbivores may affect ecosystem processes and states, but such effects can be difficult to quantify, especially within multispecies assemblages. To better understand such processes and improve our predictive ability of systems undergoing change, herbivore diets can be studied using controlled feeding trials (or cafeteria tests). With some wildlife, such as large herbivores, it is impractical to empirically verify these findings, because it requires visually observing animals in forested environments, which can disturb them from their natural behaviors. Yet, in field-based cafeteria trials it is nearly impossible to differentiate selection between herbivore species that forage on similar plants and make very similar bite marks. However, during browsing ungulates leave saliva residue which includes some buccal cells and DNA that can be extracted for species identification. Here we used a newly developed eDNA-based method (biteDNA) to test the browsing preferences of four sympatric ungulate species in the wild. Overall, food preferences varied between species, but all species strongly preferred deciduous over coniferous species. Our method allows the study of plant-animal interactions in multispecies assemblages at very fine detail.

  15. Tailoring DNA vaccines: designing strategies against HER2 positive cancers

    Directory of Open Access Journals (Sweden)

    Cristina eMarchini

    2013-05-01

    Full Text Available The crucial role of HER2 in epithelial transformation and its selective overexpression on cancer tissues makes it an ideal target for cancer immunotherapies such as passive immunotherapy with Trastuzumab. There are, however, a number of concerns regarding the use of monoclonal antibodies which include resistance, repeated treatments, considerable costs and side effects that make active immunotherapies against HER2 desirable alternative approaches. The efficacy of anti-HER2 DNA vaccination has been widely demonstrated in transgenic cancer-prone mice, which recapitulate several features of human breast cancers. Nonetheless, the rational design of a cancer vaccine able to trigger a long lasting immunity, and thus prevent tumor recurrence in patients, would require the understanding of how tolerance and immunosuppression regulate antitumor immune responses and, at the same time, the identification of the most immunogenic portions of the target protein. We herein retrace the findings that led to our most promising DNA vaccines that, by encoding human/rat chimeric forms of HER2, are able to circumvent peripheral tolerance. Preclinical data obtained with these chimeric DNA vaccines have provided the rationale for their use in an ongoing phase I clinical trial (EudraCT 2011-001104-34.

  16. Optimizing Feedlot Diagnostic Testing Strategies Using Test Characteristics, Disease Prevalence, and Relative Costs of Misdiagnosis.

    Science.gov (United States)

    Theurer, Miles E; White, Brad J; Renter, David G

    2015-11-01

    Diagnostic tests are commonly used by feedlot practitioners and range from clinical observations to more advanced physiologic testing. Diagnostic sensitivity and specificity, estimated prevalence in the population, and the costs of misdiagnoses need to be considered when selecting a diagnostic test strategy and interpreting results. This article describes methods for evaluating diagnostic strategies using economic outcomes to evaluate the most appropriate strategy for the expected situation. The diagnostic sensitivity and specificity, and expected prevalence influence the likelihood of misdiagnosis in a given population, and the estimated direct economic impact can be used to quantify differences among diagnostic strategies.

  17. Testing evolutionary hypotheses for DNA barcoding failure in willows.

    Science.gov (United States)

    Twyford, Alex D

    2014-10-01

    The goal of DNA barcoding is to enable the rapid identification of taxa from short diagnostic DNA sequence profiles. But how feasible is this objective when many evolutionary processes, such as hybridization and selective sweeps, cause alleles to be shared among related taxa? In this issue of Molecular Ecology, Percy et al. (2014) test the full suite of seven candidate plant barcoding loci in a broad geographic sample of willow species. They show exceptional plastid haplotype sharing between species across continents, with most taxa not possessing a unique barcode sequence. Using population genetic and molecular dating analyses, they implicate hybridization and selective sweeps, but not incomplete lineage sorting, as the historical processes causing widespread haplotype sharing among willow taxa. This study represents an exceptional case of how poorly barcoding can perform, and highlights methodological issues using universal organellar regions for species identification.

  18. On Test-taking Strategies in Reading Test from Cognitive and Metacognitive Perspective

    Institute of Scientific and Technical Information of China (English)

    李欧

    2008-01-01

    Reading comprehension is a complex process wherein readers actively participate the activities of cognition, metatcognition and decoding information. In reading test, cognitive and metacognitive stategies always occur at the same time. Based on theories about learning strategies, this paper discusses test-taking strategies from a theoretical level.

  19. GMOtrack: generator of cost-effective GMO testing strategies.

    Science.gov (United States)

    Novak, Petra Krau; Gruden, Kristina; Morisset, Dany; Lavrac, Nada; Stebih, Dejan; Rotter, Ana; Zel, Jana

    2009-01-01

    Commercialization of numerous genetically modified organisms (GMOs) has already been approved worldwide, and several additional GMOs are in the approval process. Many countries have adopted legislation to deal with GMO-related issues such as food safety, environmental concerns, and consumers' right of choice, making GMO traceability a necessity. The growing extent of GMO testing makes it important to study optimal GMO detection and identification strategies. This paper formally defines the problem of routine laboratory-level GMO tracking as a cost optimization problem, thus proposing a shift from "the same strategy for all samples" to "sample-centered GMO testing strategies." An algorithm (GMOtrack) for finding optimal two-phase (screening-identification) testing strategies is proposed. The advantages of cost optimization with increasing GMO presence on the market are demonstrated, showing that optimization approaches to analytic GMO traceability can result in major cost reductions. The optimal testing strategies are laboratory-dependent, as the costs depend on prior probabilities of local GMO presence, which are exemplified on food and feed samples. The proposed GMOtrack approach, publicly available under the terms of the General Public License, can be extended to other domains where complex testing is involved, such as safety and quality assurance in the food supply chain.

  20. Collecting in collections: a PCR strategy and primer set for DNA barcoding of decades-old dried museum specimens.

    Science.gov (United States)

    Mitchell, Andrew

    2015-09-01

    Natural history museums are vastly underutilized as a source of material for DNA analysis because of perceptions about the limitations of DNA degradation in older specimens. Despite very few exceptions, most DNA barcoding projects, which aim to obtain sequence data from all species, generally use specimens collected specifically for that purpose, instead of the wealth of identified material in museums, constrained by the lack of suitable PCR methods. Any techniques that extend the utility of museum specimens for DNA analysis therefore are highly valuable. This study first tested the effects of specimen age and PCR amplicon size on PCR success rates in pinned insect specimens, then developed a PCR primer set and amplification strategy allowing greatly increased utilization of older museum specimens for DNA barcoding. PCR success rates compare favourably with the few published studies utilizing similar aged specimens, and this new strategy has the advantage of being easily automated for high-throughput laboratory workflows. The strategy uses hemi-nested, degenerate, M13-tailed PCR primers to amplify two overlapping amplicons, using two PCRs per amplicon (i.e. four PCRs per DNA sample). Initial PCR products are reamplified using an internal primer and a M13 primer. Together the two PCR amplicons yield 559 bp of the COI gene from Coleoptera, Lepidoptera, Diptera, Hemiptera, Odonata and presumably also other insects. BARCODE standard-compliant data were recovered from 67% (56 of 84) of specimens up to 25 years old, and 51% (102 of 197) of specimens up to 55 years old. Given the time, cost and specialist expertise required for fieldwork and identification, 'collecting in collections' is a viable alternative allowing researchers to capitalize on the knowledge captured by curation work in decades past.

  1. Recursive Algorithm and Alternate Operation Strategy in Sequential Tests

    Institute of Scientific and Technical Information of China (English)

    XU Hong-lin; CHEN Zhan-qi; GUO Lue

    2009-01-01

    Based on the sequential probability ratio test (SPRT) developed by Wald, an improved method for successful probability test of missile flight is proposed. A recursive algorithm and its program in Matlab are designed to calculate the real risk level of the sequential test decision and the average number of samples under various test conditions. A concept, that is "rejecting as soon as possible", is put forward and an alternate operation strategy is conducted. The simulation results show that it can reduce the test expenses.

  2. Molecular beacon-based enzyme-free strategy for amplified DNA detection.

    Science.gov (United States)

    Huang, Jiahao; Wu, Jueqi; Li, Zhigang

    2016-05-15

    We report an enzyme-free, sensitive strategy for DNA detections through fluorescence amplification. The sensing method employs molecular beacons (MBs) and two single-stranded helper DNA probes. In the presence of a DNA target, it binds and opens an MB. This triggers the hybridizations between the MB and helper probes, and consequently releases the DNA target, which becomes available to react with another MB and enhances the fluorescence emission of the MBs. The detection limit of the proposed strategy is 0.58 pM, which is about 3 orders of magnitude better than the conventional MB-based method. This method is also fast and exhibits good selectivity. It is superior to previous MB-based amplification approaches employing enzymes or nanomaterials.

  3. Data reproducibility of pace strategy in a laboratory test run

    Science.gov (United States)

    de França, Elias; Xavier, Ana Paula; Hirota, Vinicius Barroso; Côrrea, Sônia Cavalcanti; Caperuto, Érico Chagas

    2016-01-01

    This data paper contains data related to a reproducibility test for running pacing strategy in an intermittent running test until exhaustion. Ten participants underwent a crossover study (test and retest) with an intermittent running test. The test was composed of three-minute sets (at 1 km/h above Onset Blood Lactate Accumulation) until volitional exhaustion. To assess pace strategy change, in the first test participants chose the rest time interval (RTI) between sets (ranging from 30 to 60 s) and in the second test the maximum RTI values were either the RTI chosen in the first test (maximum RTI value), or less if desired. To verify the reproducibility of the test, rating perceived exertion (RPE), heart rate (HR) and blood plasma lactate concentration ([La]p) were collected at rest, immediately after each set and at the end of the tests. As results, RTI, RPE, HR, [La]p and time to exhaustion were not statistically different (p>0.05) between test and retest, as well as they demonstrated good intraclass correlation. PMID:27081672

  4. A comparative approach between heterologous prime-boost vaccination strategy and DNA vaccinations for rabies.

    Science.gov (United States)

    Borhani, Kiandokht; Ajorloo, Mehdi; Bamdad, Taravat; Mozhgani, Sayed Hamid Reza; Ghaderi, Mostafa; Gholami, Ali Reza

    2015-04-01

    Rabies is a widespread neurological zoonotic disease causing significant mortality rates, especially in developing countries. Although a vaccine for rabies is available, its production and scheduling are costly in such countries. Advances in recombinant DNA technology have made it a good candidate for an affordable vaccine. Among the proteins of rabies virus, the Glycoprotein (RVG) has been the major target for new vaccine development which plays the principal role in providing complete protection against RV challenge. The aim of this study is to produce recombinant RVG which could be a DNA vaccine candidate and to evaluate the efficiency of this construct in a prime-boost vaccination regimen, compared to commercial vaccine. Cloning to pcDNA3.1(+) and expression of rabies virus glycoprotein gene in BSR cell  line were performed followed by SDS-PAGE and Western blot analysis of the expressed glycoprotein. The resulting genetic construct was used as a DNA vaccine by injecting 80 µg of the plasmid to MNRI mice twice. Prime-Boost vaccination strategy was performed using 80 µg plasmid construct as prime dose and the second dose of an inactivated rabies virus vaccine. Production of rabies virus neutralizing antibody (RVNA) titers of the serum samples were determined by RFFIT. In comparisons between heterologous prime-boost vaccination strategy and DNA vaccinations, the potency of group D that received Prime-Boost vaccine with the second dose of pcDNA3.1(+)-Gp was enhanced significantly compared to the group C which had received pcDNA3.1(+)-Gp as first injection. In this study, RVGP expressing construct was used in a comparative approach between Prime-Boost vaccination strategy and DNA vaccination and compared with the standard method of rabies vaccination. It was concluded that this strategy could lead to induction of acceptable humoral immunity.

  5. Test-Taking Strategies in L2 Assessment: The Test of English for International Communication Speaking Test.

    Science.gov (United States)

    Huang, Heng-Tsung Danny

    2016-08-01

    This research explored the test-taking strategies associated with the Test of English for International Communication Speaking Test (TOEIC-S) and their relationship with test performance. Capitalizing on two sets of TOEIC-S and a custom-made strategy inventory, the researcher collected data from a total of 215 Taiwanese English learners consisting of 84 males and 131 females with an average age of 20.1 years (SD = 2.6). Quantitative data analysis gave rise to three major findings. First, TOEIC-S test-taking strategy use constituted a multi-faceted construct that involved multiple types of strategic behaviors. Second, these strategic behaviors matched those allowing test-takers to communicate both in real life and in the workplace. Third, communication strategy use and cognitive strategy use both contributed significantly to TOEIC-S performance.

  6. Listening strategy use, test anxiety and test performance of intermediate and advanced Iranian EFL learners

    Directory of Open Access Journals (Sweden)

    Raoof Hamzavi

    2014-08-01

    Full Text Available Learning a foreign language has been related with some kind of strategic knowledge on the one hand, and some level of (test-taking apprehension or tension on the other hand, although a small amount of anxiety is normally expected as a natural warning symptom. The current study aimed at investigating the relationship between listening strategy use, test anxiety, and listening test performance of Iranian intermediate and advanced EFL learners. To this end, eighty (40 intermediate and 40 advanced Iranian EFL learners took part in the study by completing Lee’s (1997 Listening Comprehension Strategy Questionnaire, Sarason’s (1975 Test Anxiety Scale (TAS, and two monologues of Listening test performance selected from Listening part of TOEFL. The results of Pearson product moment correlation analyses revealed a significant negative correlation between test anxiety and listening test performance, but a significant positive association between listening strategy use and listening test performance. Furthermore, the results of multiple regression analyses indicated listening strategy use was a stronger predictor of listening test performance. Additionally, the results of independent samples t-test showed a significant difference between Iranian intermediate and advanced EFL learners regarding both their listening strategy use and level of test anxiety.

  7. HyRAM Testing Strategy and Quality Design Elements.

    Energy Technology Data Exchange (ETDEWEB)

    Reynolds, John Thomas

    2014-12-01

    Strategy document and tentative schedule for testing of HyRAM, a software toolkit that integrates data and methods relevant to assessing the safety of hydrogen fueling and storage infrastructure. Because proposed and existing features in HyRAM that support testing are important factors in this discussion, relevant design considerations of HyRAM are also discussed. However, t his document does not cover all of HyRAM desig n, nor is the full HyRAM software development schedule included.

  8. Curriculum and Testing Strategies to Maximize Special Education STAAR Achievement

    Science.gov (United States)

    Johnson, William L.; Johnson, Annabel M.; Johnson, Jared W.

    2015-01-01

    This document is from a presentation at the 2015 annual conference of the Science Teachers Association of Texas (STAT). The two sessions (each listed as feature sessions at the state conference) examined classroom strategies the presenter used in his chemistry classes to maximize Texas end-of-course chemistry test scores for his special population…

  9. Strategies for discovery and validation of methylated and hydroxymethylated DNA biomarkers.

    Science.gov (United States)

    Olkhov-Mitsel, Ekaterina; Bapat, Bharati

    2012-10-01

    DNA methylation, consisting of the addition of a methyl group at the fifth-position of cytosine in a CpG dinucleotide, is one of the most well-studied epigenetic mechanisms in mammals with important functions in normal and disease biology. Disease-specific aberrant DNA methylation is a well-recognized hallmark of many complex diseases. Accordingly, various studies have focused on characterizing unique DNA methylation marks associated with distinct stages of disease development as they may serve as useful biomarkers for diagnosis, prognosis, prediction of response to therapy, or disease monitoring. Recently, novel CpG dinucleotide modifications with potential regulatory roles such as 5-hydroxymethylcytosine, 5-formylcytosine, and 5-carboxylcytosine have been described. These potential epigenetic marks cannot be distinguished from 5-methylcytosine by many current strategies and may potentially compromise assessment and interpretation of methylation data. A large number of strategies have been described for the discovery and validation of DNA methylation-based biomarkers, each with its own advantages and limitations. These strategies can be classified into three main categories: restriction enzyme digestion, affinity-based analysis, and bisulfite modification. In general, candidate biomarkers are discovered using large-scale, genome-wide, methylation sequencing, and/or microarray-based profiling strategies. Following discovery, biomarker performance is validated in large independent cohorts using highly targeted locus-specific assays. There are still many challenges to the effective implementation of DNA methylation-based biomarkers. Emerging innovative methylation and hydroxymethylation detection strategies are focused on addressing these gaps in the field of epigenetics. The development of DNA methylation- and hydroxymethylation-based biomarkers is an exciting and rapidly evolving area of research that holds promise for potential applications in diverse clinical

  10. Test-taking Strategies & Performance on Reading Comprehension Tests by Iranian EFL Learners

    Directory of Open Access Journals (Sweden)

    Natasha Pourdana

    2012-07-01

    Full Text Available This study attempted to explore the possible relationship between test-taking strategies and (a successful performance on English as a Foreign Language (EFL reading comprehension, (b EFL learners’ level of language proficiency. To accomplish the purpose of this study, 68 students of English translation of both genders were randomly selected and placed in the three Beginner, Intermediate and Advanced levels, at Alborz Institute for Higher Education, Qazvin, Iran. Analysis of Variances (ANOVA proved that there was a significant and positive correlation between the scores in reading comprehension test and Oxford Placement Test. While the scores in reading comprehension test did not show any significant correlations with using the majority of test-taking strategies, they had a relatively low and negative but significant correlation with test management strategy. The findings in this study were interpreted as the low knowledge of test-taking strategies in Iranian EFL context and the importance of attending to the cognitive processes effective in taking language tests was emphasized.  Keywords: Test-taking, Strategies, EFL, Reading Comprehension, Proficiency level

  11. Hypothesis testing in students: Sequences, stages, and instructional strategies

    Science.gov (United States)

    Moshman, David; Thompson, Pat A.

    Six sequences in the development of hypothesis-testing conceptions are proposed, involving (a) interpretation of the hypothesis; (b) the distinction between using theories and testing theories; (c) the consideration of multiple possibilities; (d) the relation of theory and data; (e) the nature of verification and falsification; and (f) the relation of truth and falsity. An alternative account is then provided involving three global stages: concrete operations, formal operations, and a postformal metaconstructivestage. Relative advantages and difficulties of the stage and sequence conceptualizations are discussed. Finally, three families of teaching strategy are distinguished, which emphasize, respectively: (a) social transmission of knowledge; (b) carefully sequenced empirical experience by the student; and (c) self-regulated cognitive activity of the student. It is argued on the basis of Piaget's theory that the last of these plays a crucial role in the construction of such logical reasoning strategies as those involved in testing hypotheses.

  12. A dual amplification fluorescent strategy for sensitive detection of DNA methyltransferase activity based on strand displacement amplification and DNAzyme amplification.

    Science.gov (United States)

    Cui, Wanling; Wang, Lei; Jiang, Wei

    2016-03-15

    DNA methyltransferase (MTase) plays a critical role in many biological processes and has been regarded as a predictive cancer biomarker and a therapeutic target in cancer treatment. Sensitive detection of DNA MTase activity is essential for early cancer diagnosis and therapeutics. Here, we developed a dual amplification fluorescent strategy for sensitive detection of DNA MTase activity based on strand displacement amplification (SDA) and DNAzyme amplification. A trifunctional double-stranded DNA (dsDNA) probe was designed including a methylation site for DNA MTase recognition, a complementary sequence of 8-17 DNAzyme for synthesizing DNAzyme, and a nicking site for nicking enzyme cleavage. Firstly, the trifunctional dsDNA probe was methylated by DNA MTase to form the methylated dsDNA. Subsequently, HpaII restriction endonuclease specifically cleaved the residue of unmethylated dsDNA. Next, under the action of polymerase and nicking enzyme, the methylared dsDNA initiated SDA, releasing numbers of 8-17 DNAzymes. Finally, the released 8-17 DNAzymes triggered DNAzyme amplification reaction to induce a significant fluorescence enhancement. This strategy could detect DNA MTase activity as low as 0.0082U/mL. Additionally, the strategy was successfully applied for evaluating the inhibitions of DNA MTase using two anticancer drugs, 5-azacytidine and 5-aza-2'-deoxycytidine. The results indicate the proposed strategy has a potential application in early cancer diagnosis and therapeutics.

  13. Binding and elution strategy for improved performance of arginine affinity chromatography in supercoiled plasmid DNA purification.

    Science.gov (United States)

    Sousa, F; Prazeres, D M F; Queiroz, J A

    2009-02-01

    New interesting strategies for plasmid DNA (pDNA) purification were designed, exploiting affinity interactions between amino acids and nucleic acids. The potential application of arginine-based chromatography to purify pDNA has been recently described in our work; however, to achieve higher efficiency and selectivity in arginine affinity chromatography, it is essential to characterize the behaviour of binding/elution of supercoiled (sc) isoforms. In this study, two different strategies based on increased sodium chloride (225-250 mm) or arginine (20-70 mm) stepwise gradients are described to purify sc isoforms. Thus, it was proved that well-defined binding/elution conditions are crucial to enhance the purification performance, resulting in an improvement of the final plasmids yields and transfection efficiency, as this could represent a significant impact on therapeutic applications of the purified sc isoform. Copyright (c) 2008 John Wiley & Sons, Ltd.

  14. Test strategies for industrial testers for converter controls equipment

    Science.gov (United States)

    Oleniuk, P.; Di Cosmo, M.; Kasampalis, V.; Nisbet, D.; Todd, B.; Uznański, S.

    2017-04-01

    Power converters and their controls electronics are key elements for the operation of the CERN accelerator complex, having a direct impact on its availability. To prevent early-life failures and provide means to verify electronics, a set of industrial testers is used throughout the converters controls electronics' life cycle. The roles of the testers are to validate mass production during the manufacturing phase and to provide means to diagnose and repair failed modules that are brought back from operation. In the converter controls electronics section of the power converters group in the technology department of CERN (TE/EPC/CCE), two main test platforms have been adopted: a PXI platform for mixed analogue-digital functional tests and a JTAG Boundary-Scan platform for digital interconnection and functional tests. Depending on the functionality of the device under test, the appropriate test platforms are chosen. This paper is a follow-up to results presented at the TWEPP 2015 conference, adding the boundary scan test platform and the first results from exploitation of the test system. This paper reports on the test software, hardware design and test strategy applied for a number of devices that has resulted in maximizing test coverage and minimizing test design effort.

  15. Collaborative testing as a learning strategy in nursing education.

    Science.gov (United States)

    Sandahl, Sheryl S

    2010-01-01

    A primary goal of nursing education is to prepare nurses to work collaboratively as members of interprofessional health care teams on behalf of patients. Collaborative testing is a collaborative learning strategy used to foster knowledge development, critical thinking in decision making, and group processing skills. This study incorporated a quasi-experimental design with a comparison group to examine the effect of collaborative testing as a learning strategy on student learning and retention of course content as well as group process skills and student perceptions of their learning and anxiety. The setting was a baccalaureate nursing program; the sample consisted of two groups of senior students enrolled in Medical-Surgical Nursing II. Student learning, as measured by unit examination scores, was greater for students taking examinations collaboratively compared to individually. Retention of course content, as measured by final examination scores, was not greater for students taking examinations collaboratively compared to individually. Student perceptions were overwhelmingly positive, with students reporting increased learning as a result of the collaborative testing experiences. Despite the lack of data to support increased retention, collaborative testing may be a learning strategy worth implementing in nursing education. Students reported more positive interactions and collaboration with their peers, skills required by the professional nurse.

  16. Anti-dsDNA antibodies in systemic lupus erythematosus: A combination of two quantitative methods and the ANA pattern is the most efficient strategy of detection.

    Science.gov (United States)

    Almeida González, Delia; Roces Varela, Alfredo; Marcelino Rodríguez, Itahisa; González Vera, Alexander; Delgado Sánchez, Mónica; Aznar Esquivel, Antonio; Casañas Rodríguez, Carlos; Cabrera de León, Antonio

    2015-12-01

    Several methods have been used to measure anti-double-stranded DNA auto-antibody (anti-dsDNA). Our aim was to determine the most efficient strategy to test anti-dsDNA in systemic lupus erythematosus (SLE). In this study, anti-dsDNA and anti-nuclear antibody (ANA) tests were requested for 644 patients. Anti-dsDNA was tested by RIA, ELISA and CLIA in all patients. The results indicated that 78 patients had a positive anti-dsDNA test according to at least one of the methods. After a 3-year follow-up period only 26 patients were diagnosed with SLE. We evaluated each method and combination of methods. Specificity and positive predictive value (PPV) increased with the number of assay methods used (p=0.002 for trend), and PPV was 100% in patients whose results were positive by all three anti-dsDNA assay methods. The proportion of anti-dsDNA-positive patients who had SLE was highest (82%; p b 0.001) among those with a homogeneous pattern of ANA staining, followed by those with a speckled pattern. In ANA positive patients, when only RIA was considered, 59% of anti-dsDNA-positive patients had SLE, but when RIA and CLIA were both considered, all patients with positive results on both tests had SLE. The combination of RIA+CLIA in patients with homogeneous and speckled ANA staining showed a similar cost and higher sensitivity than RIA alone in ANA positive patients (p b 0.001). We conclude that the most efficient strategy was to combine simultaneously two quantitative and sensitive methods but only in patients with a homogeneous or speckled pattern of ANA staining. This approach maximized specificity and PPV, and reduced costs.

  17. Towards an alternative testing strategy for nanomaterials used in nanomedicine

    DEFF Research Database (Denmark)

    Dusinska, M; Boland, S; Saunders, M

    2015-01-01

    project ( www.nanotest-fp7.eu ) was a better understanding of mechanisms of interactions of NPs employed in nanomedicine with cells, tissues and organs and to address critical issues relating to toxicity testing especially with respect to alternatives to tests on animals. Here we describe an approach...... towards alternative testing strategies for hazard and risk assessment of nanomaterials, highlighting the adaptation of standard methods demanded by the special physicochemical features of nanomaterials and bioavailability studies. The work has assessed a broad range of toxicity tests, cell models and NP...... of scientists, politicians and the public about potential health hazards associated with NPs need to be answered. With the variety of exposure routes available, there is potential for NPs to reach every organ in the body but we know little about the impact this might have. The main objective of the FP7 NanoTEST...

  18. Sequencing the hypervariable regions of human mitochondrial DNA using massively parallel sequencing: Enhanced data acquisition for DNA samples encountered in forensic testing.

    Science.gov (United States)

    Davis, Carey; Peters, Dixie; Warshauer, David; King, Jonathan; Budowle, Bruce

    2015-03-01

    Mitochondrial DNA testing is a useful tool in the analysis of forensic biological evidence. In cases where nuclear DNA is damaged or limited in quantity, the higher copy number of mitochondrial genomes available in a sample can provide information about the source of a sample. Currently, Sanger-type sequencing (STS) is the primary method to develop mitochondrial DNA profiles. This method is laborious and time consuming. Massively parallel sequencing (MPS) can increase the amount of information obtained from mitochondrial DNA samples while improving turnaround time by decreasing the numbers of manipulations and more so by exploiting high throughput analyses to obtain interpretable results. In this study 18 buccal swabs, three different tissue samples from five individuals, and four bones samples from casework were sequenced at hypervariable regions I and II using STS and MPS. Sample enrichment for STS and MPS was PCR-based. Library preparation for MPS was performed using Nextera® XT DNA Sample Preparation Kit and sequencing was performed on the MiSeq™ (Illumina, Inc.). MPS yielded full concordance of base calls with STS results, and the newer methodology was able to resolve length heteroplasmy in homopolymeric regions. This study demonstrates short amplicon MPS of mitochondrial DNA is feasible, can provide information not possible with STS, and lays the groundwork for development of a whole genome sequencing strategy for degraded samples.

  19. Polymorphic DNA sequences and their application in paternity testing; Polimorficzne sekwencje DNA i ich zastosowanie w dochodzeniu spornego ojcostwa

    Energy Technology Data Exchange (ETDEWEB)

    Slomski, R. [Polska Akademia Nauk, Poznan (Poland). Zaklad Genetyki Czlowieka]|[Akademia Rolnicza, Poznan (Poland)]|[Laboratorium Genetyki Molekularnej, Poznan (Poland); Kwiatkowska, J.; Chlebowska, H. [Polska Akademia Nauk, Poznan (Poland). Zaklad Genetyki Czlowieka; Siemieniallo, B. [Akademia Rolnicza, Poznan (Poland); Slomska, M. [Laboratorium Genetyki Molekularnej, Poznan (Poland)

    1994-12-31

    Characteristics of polymorphic sequences of DNA, especially satellite, mini satellite and micro satellite sequences are presented. Own experience from the use of multi and single locus analysis of DNA in paternity testing has been compared with the results of research in other laboratories. Critical points of both types of analysis are discussed. (author). 53 refs, 4 figs, 2 tabs.

  20. Proteomics insights into DNA damage response and translating this knowledge to clinical strategies

    DEFF Research Database (Denmark)

    von Stechow, Louise; Olsen, Jesper V

    2017-01-01

    Spectrometry (MS)-based proteomics emerged as method of choice for global studies of proteins and their posttranslational modifications (PTMs). MS-based studies of the DDR have aided in delineating DNA damage-induced signalling responses. Those studies identified changes in abundance, interactions...... and modification of proteins in the context of genotoxic stress. Here we review ground-breaking MS-based proteomics studies, which analysed changes in protein abundance, protein-protein and protein-DNA interactions, phosphorylation, acetylation, ubiquitylation, SUMOylation and Poly(ADP-ribose)ylation (PARylation......Genomic instability is a critical driver in the process of cancer formation. At the same time, inducing DNA damage by irradiation or genotoxic compounds constitutes a key therapeutic strategy to kill fast-dividing cancer cells. Sensing of DNA lesions initiates a complex set of signalling pathways...

  1. Progress and Strategies for Testing of Materials for Solar Panels

    Energy Technology Data Exchange (ETDEWEB)

    Kurtz, Sarah

    2017-04-25

    Accelerated testing is key to confident launch of a new product. However, for new products like solar panels, the best approach is not always clear. The challenge for materials manufacturers is that test times can be long. Also, small-coupon testing may not predict the behavior in the full-size module, but testing of the full-size module is too expensive. As a result, solar panel test standards like IEC 61215 are useful, but are not sufficient. Material manufacturers have needed to define their own test protocols. This presentation will review some historical data (e.g., data show that manufacturers are making great progress toward reducing encapsulant discoloration) and describe advances in material testing (for example, new techniques are being demonstrated on how to more quantitatively assess adhesion, detect tendency for delamination, and understand how encapsulant properties affect other properties like cracking of cells). The International PV Quality Assurance Task Force has been researching climate-specific weathering tests toward the goal of defining international standards that would simplify qualification and quality assurance testing for materials. The status of these tests and the strategies for how to organize these standards to best meet the needs of the industry will be discussed.

  2. Mega primer-mediated molecular cloning strategy for chimaeragenesis and long DNA fragment insertion.

    Science.gov (United States)

    Zhang, Hui; Liu, Chang-Jun; Jiang, Hui; Zhou, Lu; Li, Wen-Ying; Zhu, Ling-Yun; Wu, Lei; Meng, Er; Zhang, Dong-Yi

    2017-04-30

    Molecular cloning methods based on primer and overlap-extension PCR are widely used due to their simplicity, reliability, low cost and high efficiency. In this article, an efficient mega primer-mediated (MP) cloning strategy for chimaeragenesis and long DNA fragment insertion is presented. MP cloning is a seamless, restriction/ligation-independent method that requires only three steps: (i) the first PCR for mega primer generation; (ii) the second PCR for exponential amplification mediated by the mega primers and (iii) DpnI digestion and transformation. Most importantly, for chimaeragenesis, genes can be assembled and constructed into the plasmid vector in a single PCR step. By employing this strategy, we successfully inserted four DNA fragments (approximately 500 bp each) into the same vector simultaneously. In conclusion, the strategy proved to be a simple and efficient tool for seamless cloning.

  3. Ultraspecific electrochemical DNA biosensor by coupling spontaneous cascade DNA branch migration and dual-signaling sensing strategy.

    Science.gov (United States)

    Wang, Ting; Zhou, Lili; Bai, Shulian; Zhang, Zhang; Li, Junlong; Jing, Xiaoying; Xie, Guoming

    2016-04-15

    Using spontaneous cascade DNA branch migration and dual-signaling sensing strategy, we developed a novel universal electrochemical biosensor for the highly specific and sensitive detection of nucleic acids. A target strand (Ts) competitively hybridized with a ferrocene (Fc)-labeled signal probe (Fc-S1), which was blocked by a protector strand (Ps), after strand displacement to form the Ts/Fc-S1 duplex. A methylene blue (MB)-modified signal probe (MB-S2) was immobilized on the Au electrode surface by hybridizing with a thiolated capture probe (Cp). Then, the obtained reactants (Ts/Fc-S1 and MB-S2/Cp) suffered spontaneous DNA branch migration and produced two hybridization products (Fc-S1/Cp and MB-S2/Ts). These reactions led to the dissociation of MB molecules and the collection of Fc molecules. The detection mechanism of this DNA biosensor involved distance variation between the redox tags and the Au electrode, which was associated with target-induced cascade DNA branch migration. Moreover, we rationally designed the cascade DNA branch migration to occur spontaneously with ΔG° ≈ 0, at which slight thermodynamic changes caused by base mismatch exerted a disproportionately large effect on the hybridization yield. This "signal-on/off" sensing system exhibited a remarkable analytical performance and an ultrahigh discrimination capability even against a single-base mismatch. The maximum discrimination factor (DF) of base mutations or alterations can reach 17.9. Therefore, our electrochemical biosensor might hold a great potential for further applications in biomedical research and early clinical diagnosis.

  4. Characterization of swine stress gene by DNA testing using plucked hair as a source of DNA

    Directory of Open Access Journals (Sweden)

    Bastos Reginaldo Gaspar

    2000-01-01

    Full Text Available The swine stress gene (hal in recessive homozygotes (nn leads to porcine stress syndrome (PSS, and is associated with pale, soft, exudative pork (PSE. In heterozygosis (Nn it is linked to poor carcass quality. A total of 179 pigs (86 Large White, 69 Landrace, 12 Duroc and 12 Pietrain were characterized as normal homozygotes (NN, heterozygotes or recessive homozygotes following amplification of a target region of the hal gene using the polymerase chain reaction (PCR, followed by a restriction endonuclease assay. Plucked hair was used as a source of genomic DNA. The resulting PCR was digested with the restriction enzyme CfoI, followed by agarose gel electrophoresis. Of 179 animals tested, 70% were NN, 28% were Nn, and 2% were nn. The frequency of heterozygotes was higher (P < 0.05 in Landrace (0.43 for Nn than in Large White pigs (0.09 for Nn. Nine of the 12 Pietrain animals were Nn and three were nn, suggesting a high frequency for the n allele in this breed. These results may be related to the incidence of PSS and PSE in these two breeds, both of which are widely used in breeding programs. The utilization of plucked hair as the source of genomic DNA was a non-invasive and quick method to screen farm animals.

  5. Comparing Cost-Effectiveness of HIV Testing Strategies: Targeted and Routine Testing in Washington, DC.

    Directory of Open Access Journals (Sweden)

    Amanda D Castel

    Full Text Available Routine HIV testing is an essential approach to identifying undiagnosed infections, linking people to care and treatment, and preventing new infections. In Washington, DC, where HIV prevalence is 2.4%, a combination of routine and targeted testing approaches has been implemented since 2006.We sought to evaluate the cost effectiveness of the District of Columbia (DC Department of Health's routine and targeted HIV testing implementation strategies. We collected HIV testing data from 3 types of DC Department of Health-funded testing sites (clinics, hospitals, and community-based organizations; collected testing and labor costs; and calculated effectiveness measures including cost per new diagnosis and cost per averted transmission.Compared to routine testing, targeted testing resulted in higher positivity rates (1.33% vs. 0.44%. Routine testing averted 34.30 transmissions per year compared to targeted testing at 17.78. The cost per new diagnosis was lower for targeted testing ($2,467 vs. $7,753 per new diagnosis as was the cost per transmission averted ($33,160 vs. $104,205. When stratified by testing site, both testing approaches were most cost effective in averting new transmissions when conducted by community based organizations ($25,037 routine; $33,123 targeted compared to hospitals or clinics.While routine testing identified more newly diagnosed infections and averted more infections than targeted testing, targeted testing is more cost effective per diagnosis and per transmission averted overall. Given the high HIV prevalence in DC, the DC Department of Health's implementation strategy should continue to encourage routine testing implementation with emphasis on a combined testing strategy among community-based organizations.

  6. Stool-based DNA testing, a new noninvasive method for colorectal cancer screening, the first report from Iran

    Institute of Scientific and Technical Information of China (English)

    Mohammad Reza Abbaszadegan; Azadeh Aarabi; Alireza Tavasoli; Arash Velayati; Hamid Reza Sima; Hassan Vosooghinia; Mehdi Farzadnia; Hamid Asadzedeh; Mehran Gholamin; Ezzat Dadkhah

    2007-01-01

    AIM: To detect tumor-associated DNA changes in stool samples among Iranian patients with colorectal cancer (CRC) compared to healthy individuals using BAT-26, 16 hypermethylation and long DNA markers.METHODS: Stool DNA was isolated from 45 subjects including 25 CRC patients and 20 healthy individuals using a new, fast and easy extraction method. Long DNA associated with tumor was detected using polymerase chain reaction method. Microsatellite studies were performed utilizing denaturating polyacrylamide gel to determine the instability of BAT-26. Methylation status of p16 promoter was analyzed using methylation-specific PCR (MSP).RESULTS: The results showed a significant difference in existence of long DNA (16 in patients vs 1 in controls, P < 0.001) and/716 (5 in patients vs none in controls, P = 0.043) in the stool samples of two groups. Long DNA was detected in 64% of CRC patients; whereas just one of the healthy individuals was positive for Long DNA. P16 methylation was found in 20% of patients and in none of healthy individuals. Instability of BAT-26 was not detected in any of stool samples.CONCLUSION: We could detect colorectal cancer related genetic alterations by analyzing stool DNA with a sensitivity of 64% and 20% and a specificity of 95% and 100% for Long DNA and p16 respectively.A noninvasive molecular stool-based DNA testing can provide a screening strategy in high-risk individuals.However,additional testing on more samples is necessary from Iranian subjects to determine the exact specificity and sensitivity of these markers.

  7. Integrated testing strategy (ITS) for bioaccumulation assessment under REACH

    DEFF Research Database (Denmark)

    Lombardo, Anna; Roncaglioni, Alessandra; Benfentati, Emilio

    2014-01-01

    in a dossier. REACH promotes the use of alternative methods to replace, refine and reduce the use of animal (eco)toxicity testing. Within the EU OSIRIS project, integrated testing strategies (ITSs) have been developed for the rational use of non-animal testing approaches in chemical hazard assessment. Here we...... methods are used only as last resort. Using the ITS, in vivo testing could be waived for about 67% of the examined compounds, but bioaccumulation potential could be estimated on the basis of non-animal methods. The presented ITS is freely available through a web tool. © 2014 Elsevier Ltd....... present an ITS for evaluating the bioaccumulation potential of organic chemicals. The scheme includes the use of all available data (also the non-optimal ones), waiving schemes, analysis of physicochemical properties related to the end point and alternative methods (both in silico and in vitro). In vivo...

  8. Testing and assessment strategies, including alternative and new approaches

    DEFF Research Database (Denmark)

    Meyer, Otto A.

    2003-01-01

    The object of toxicological testing is to predict possible adverse effect in humans when exposed to chemicals whether used as industrial chemicals, pharmaceuticals or pesticides. Animal models are predominantly used in identifying potential hazards of chemicals. The use of laboratory animals raises...... ethical concern. However, irrespective of animal welfare it is an important aspect of the discipline of toxicology that the primary object is human health. The ideal testing and assessment strategy is simple to use all the available test methods and preferably more in laboratory animal species from which...... we get as many data as possible in order to obtain the most extensive database for the toxicological evaluation of a chemical. Consequently, the society has decided that certain group of chemicals should be tested accordingly. However, realising that, this idea is not obtainable in practice because...

  9. Verification of sex from harvested sea otters using DNA testing

    Science.gov (United States)

    Scribner, K.T.; Green, B.A.; Gorbics, C.; Bodkin, J.

    2005-01-01

    We used molecular genetic methods to determine the sex of 138 sea otters (Enhydra lutris) harvested from 3 regions of Alaska from 1994 to 1997, to assess the accuracy of post-harvest field-sexing. We also tested each of a series of factors associated with errors in field-sexing of sea otters, including male or female bias, age-class bias, regional bias, and bias associated with hunt characteristics. Blind control results indicated that sex was determined with 100% accuracy using polymerase chain reaction (PCR) amplification using primers that co-amplify the zinc finger-Y-X gene, located on both the mammalian Y- and X-chromosomes, and Testes Determining Factor (TDF), located on the mammalian Y-chromosome. DNA-based sexing revealed that 12.3% of the harvested sea otters were incorrectly sexed in the field, with most errors (13 of 17) occurring as males incorrectly reported as females. Thus, female harvest was overestimated. Using logistic regression analysis, we detected no statistical association of incorrect determination of sex in the field with age class, hunt region, or hunt type. The error in field-sexing appears to be random, at least with respect to the variables evaluated in this study.

  10. Cyber Security Test Strategy for Non-safety Display System

    Energy Technology Data Exchange (ETDEWEB)

    Son, Han Seong [Joongbu University, Geumsan (Korea, Republic of); Kim, Hee Eun [KAIST, Daejeon (Korea, Republic of)

    2016-10-15

    Cyber security has been a big issue since the instrumentation and control (I and C) system of nuclear power plant (NPP) is digitalized. A cyber-attack on NPP should be dealt with seriously because it might cause not only economic loss but also the radioactive material release. Researches on the consequences of cyber-attack onto NPP from a safety point of view have been conducted. A previous study shows the risk effect brought by initiation of event and deterioration of mitigation function by cyber terror. Although this study made conservative assumptions and simplifications, it gives an insight on the effect of cyber-attack. Another study shows that the error on a non-safety display system could cause wrong actions of operators. According to this previous study, the failure of the operator action caused by a cyber-attack on a display system might threaten the safety of the NPP by limiting appropriate mitigation actions. This study suggests a test strategy focusing on the cyber-attack on the information and display system, which might cause the failure of operator. The test strategy can be suggested to evaluate and complement security measures. Identifying whether a cyber-attack on the information and display system can affect the mitigation actions of operator, the strategy to obtain test scenarios is suggested. The failure of mitigation scenario is identified first. Then, for the test target in the scenario, software failure modes are applied to identify realistic failure scenarios. Testing should be performed for those scenarios to confirm the integrity of data and to assure effectiveness of security measures.

  11. Association testing strategy for data from dense marker panels.

    Directory of Open Access Journals (Sweden)

    Donghyung Lee

    Full Text Available Genome wide association studies have been usually analyzed in a univariate manner. The commonly used univariate tests have one degree of freedom and assume an additive mode of inheritance. The experiment-wise significance of these univariate statistics is obtained by adjusting for multiple testing. Next generation sequencing studies, which assay 10-20 million variants, are beginning to come online. For these studies, the strategy of additive univariate testing and multiple testing adjustment is likely to result in a loss of power due to (1 the substantial multiple testing burden and (2 the possibility of a non-additive causal mode of inheritance. To reduce the power loss we propose: a new method (1 to summarize in a single statistic the strength of the association signals coming from all not-very-rare variants in a linkage disequilibrium block and (2 to incorporate, in any linkage disequilibrium block statistic, the strength of the association signals under multiple modes of inheritance. The proposed linkage disequilibrium block test consists of the sum of squares of nominally significant univariate statistics. We compare the performance of this method to the performance of existing linkage disequilibrium block/gene-based methods. Simulations show that (1 extending methods to combine testing for multiple modes of inheritance leads to substantial power gains, especially for a recessive mode of inheritance, and (2 the proposed method has a good overall performance. Based on simulation results, we provide practical advice on choosing suitable methods for applied analyses.

  12. Novel elution strategy for monitoring DNA counter-migration in the presence of electroosmotic flow.

    Science.gov (United States)

    Zabzdyr, Jennifer L; Lillard, Sheri J

    2004-06-25

    The migration behavior of native (i.e., unlabelled) DNA in the presence of electroosmotic flow (EOF) was investigated in bare fused-silica capillaries. Employing a novel elution strategy, the influence of EOF on the net mobility of DNA was assessed by collecting the DNA that migrated anodically (i.e., against EOF) and out of the capillary inlet. Various conditions of pH and buffer-zone continuity were employed to characterize this phenomenon. Tris acid (TA, pH 5.14) and Tris base (TB, pH 9.36) were used as buffers in continuous systems, in which the capillary and the inlet reservoir contain the same buffer, and discontinuous systems, in which the capillary contains either TA or TB, and the inlet reservoir contains water. DNA that was ejected into the inlet vial was subsequently analyzed by capillary electrophoresis-laser-induced fluorescence. Both phiX174/HaeIII DNA and the beta-actin product of single-cell reverse transcriptase-polymerase chain reaction were used as DNA samples in this study. The mechanism of elution was found to depend on bulk flow, in the case of continuous solutions. However, with the discontinuous system, a localized decrease in EOF generated in the capillary tip appeared to impact elution. These findings serve to introduce an alternative approach for characterizing the mobility of highly charged species.

  13. Testing the efficacy of a multi-component DNA-prime/DNA-boost vaccine against Trypanosoma cruzi infection in dogs.

    Directory of Open Access Journals (Sweden)

    José E Aparicio-Burgos

    Full Text Available BACKGROUND: Trypanosoma cruzi, the etiologic agent of Chagas Disease, is a major vector borne health problem in Latin America and an emerging infectious disease in the United States. METHODS: We tested the efficacy of a multi-component DNA-prime/DNA-boost vaccine (TcVac1 against experimental T. cruzi infection in a canine model. Dogs were immunized with antigen-encoding plasmids and cytokine adjuvants, and two weeks after the last immunization, challenged with T. cruzi trypomastigotes. We measured antibody responses by ELISA and haemagglutination assay, parasitemia and infectivity to triatomines by xenodiagnosis, and performed electrocardiography and histology to assess myocardial damage and tissue pathology. RESULTS: Vaccination with TcVac1 elicited parasite-and antigen-specific IgM and IgG (IgG2>IgG1 responses. Upon challenge infection, TcVac1-vaccinated dogs, as compared to non-vaccinated controls dogs, responded to T. cruzi with a rapid expansion of antibody response, moderately enhanced CD8(+ T cell proliferation and IFN-γ production, and suppression of phagocytes' activity evidenced by decreased myeloperoxidase and nitrite levels. Subsequently, vaccinated dogs controlled the acute parasitemia by day 37 pi (44 dpi in non-vaccinated dogs, and exhibited a moderate decline in infectivity to triatomines. TcVac1-immunized dogs did not control the myocardial parasite burden and electrocardiographic and histopatholgic cardiac alterations that are the hallmarks of acute Chagas disease. During the chronic stage, TcVac1-vaccinated dogs exhibited a moderate decline in cardiac alterations determined by EKG and anatomo-/histo-pathological analysis while chronically-infected/non-vaccinated dogs continued to exhibit severe EKG alterations. CONCLUSIONS: Overall, these results demonstrated that TcVac1 provided a partial resistance to T. cruzi infection and Chagas disease, and provide an impetus to improve the vaccination strategy against Chagas disease.

  14. Nuclear thermal propulsion test facility requirements and development strategy

    Science.gov (United States)

    Allen, George C.; Warren, John; Clark, J. S.

    1991-01-01

    The Nuclear Thermal Propulsion (NTP) subpanel of the Space Nuclear Propulsion Test Facilities Panel evaluated facility requirements and strategies for nuclear thermal propulsion systems development. High pressure, solid core concepts were considered as the baseline for the evaluation, with low pressure concepts an alternative. The work of the NTP subpanel revealed that a wealth of facilities already exists to support NTP development, and that only a few new facilities must be constructed. Some modifications to existing facilities will be required. Present funding emphasis should be on long-lead-time items for the major new ground test facility complex and on facilities supporting nuclear fuel development, hot hydrogen flow test facilities, and low power critical facilities.

  15. Nuclear thermal propulsion test facility requirements and development strategy

    Science.gov (United States)

    Allen, George C.; Clark, John S.; Warren, John; Perkins, David R.; Martinell, John

    1992-01-01

    The Nuclear Thermal Propulsion (NTP) subpanel of the Space Nuclear Propulsion Test Facilities Panel evaluated facility requirements and strategies for nuclear thermal propulsion systems development. High pressure, solid core concepts were considered as the baseline for the evaluation, with low pressure concepts an alternative. The work of the NTP subpanel revealed that a wealth of facilities already exists to support NTP development, and that only a few new facilities must be constructed. Some modifications to existing facilities will be required. Present funding emphasis should be on long-lead-time items for the major new ground test facility complex and on facilities supporting nuclear fuel development, hot hydrogen flow test facilities, and low power critical facilities.

  16. Uptake of genetic counselling and predictive DNA testing in hypertrophic cardiomyopathy

    National Research Council Canada - National Science Library

    Christiaans, Imke; Birnie, Erwin; Bonsel, Gouke J; Wilde, Arthur A.M; van Langen, Irene M

    2008-01-01

    .... In 97 hypertrophic cardiomyopathy families with a sarcomere gene mutation we retrospectively determined uptake of genetic counselling and predictive DNA testing in relatives within 1 year after...

  17. Analysis of Test Takers' Metacognitive and Cognitive Strategy Use and EFL Reading Test Performance: A Multi-Sample SEM Approach

    Science.gov (United States)

    Zhang, Limei; Goh, Christine C. M.; Kunnan, Antony John

    2014-01-01

    This study investigates the relationships between test takers' metacognitive and cognitive strategy use through a questionnaire and their test performance on an English as a Foreign Language reading test. A total of 593 Chinese college test takers responded to a 38-item metacognitive and cognitive strategy questionnaire and a 50-item reading test.…

  18. Maximizing efficacy of endocrine tests: importance of decision-focused testing strategies and appropriate patient preparation.

    Science.gov (United States)

    Klee, G G

    1999-08-01

    The efficacy of endocrine tests depends on the choice of tests, the preparation of the patients, the integrity of the specimens, the quality of the measurements, and the validity of the reference data. Close dialogue among the clinicians, the laboratory, and the patients is a key factor for optimal patient care. The characteristics of urine and plasma samples and the advantages and limitations of paired test measurements are presented. The importance of test sequence strategies, provocative or inhibitory procedures, and elimination of drug interferences is illustrated with four cases involving Cushing syndrome, pheochromocytoma, primary aldosteronism, and hypercalcemia. For each of these scenarios, key clinical issues are highlighted, along with discussions of the best test strategies, including which medications are likely to interfere. The importance of targeting laboratory tests to answer well-focused clinical decisions is emphasized. The roles of some time-honored provocative procedures are questioned in light of more sensitive and specific analytic methods. The importance of decision-focused analytical tolerance limits is emphasized by demonstrating the impact of analytic bias on downstream medical resource utilization. User-friendly support systems to facilitate the implementation of test strategies and postanalytic tracking of patient outcomes are presented as essential requirements for quality medical practice.

  19. Integrating non-animal test information into an adaptive testing strategy - skin sensitization proof of concept case.

    Science.gov (United States)

    Jaworska, Joanna; Harol, Artsiom; Kern, Petra S; Gerberick, G Frank

    2011-01-01

    There is an urgent need to develop data integration and testing strategy frameworks allowing interpretation of results from animal alternative test batteries. To this end, we developed a Bayesian Network Integrated Testing Strategy (BN ITS) with the goal to estimate skin sensitization hazard as a test case of previously developed concepts (Jaworska et al., 2010). The BN ITS combines in silico, in chemico, and in vitro data related to skin penetration, peptide reactivity, and dendritic cell activation, and guides testing strategy by Value of Information (VoI). The approach offers novel insights into testing strategies: there is no one best testing strategy, but the optimal sequence of tests depends on information at hand, and is chemical-specific. Thus, a single generic set of tests as a replacement strategy is unlikely to be most effective. BN ITS offers the possibility of evaluating the impact of generating additional data on the target information uncertainty reduction before testing is commenced.

  20. Cognitive decision strategies adopted by consumers in reminder difference tests: Influence of the authenticity test.

    Science.gov (United States)

    Stocks, M; Shepherd, D; Lee, H-S; van Hout, D; Hautus, M J

    2017-07-01

    Discrimination tests are used in food companies to quantify small differences between products. Within the diversity of methods available, some are quicker to conduct, whereas others are more sensitive or statistically powerful. One class of methods includes the reminder tasks in which the reference product is given before tasting the actual test stimuli. During the task, such a 'reminder' can be compared directly to each test stimulus, or alternatively, only serve to prime the memory of the judge without being taken into account in decision-making. Previous research with trained judges provided evidence for the latter process while research with untrained consumers has provided some evidence for the former process. Two studies were conducted with untrained consumers using the A Not-AR and 2-AFCR reminder tasks. Objectives were to determine the decision strategies used in, and the relative sensitivity of the tasks. In addition, the use of an "authenticity test" was explored to see if this has a positive effect on test performance. In the first study, mayonnaise and ice tea with small stimulus differences (d'decision strategy used, though the use of an authenticity test increased the sensitivity for these small differences, as it improved the performance of 6 out of 8 tests. In the second study, ice teas with larger stimulus differences (at two levels) were tested using the A Not-AR and 2-AFCR tasks, in comparison to the same-different task. The results showed that consumers use the less optimal strategies and that the authenticity test decreases performance, which is contradictory to the results of the first study. It seems that for very small stimulus differences the authenticity test can improve performance, but with larger differences the authenticity test decreases performance; it seems to confuse the judges. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Identifying main drivers and testing control strategies for CCHFV spread.

    Science.gov (United States)

    Hoch, T; Breton, E; Josse, M; Deniz, A; Guven, E; Vatansever, Z

    2016-03-01

    Crimean Congo Haemorrhagic Fever (CCHF) is an emerging zoonotic disease. The causative agent is a virus (CCHFV), mainly transmitted by ticks of the species Hyalomma marginatum in Eastern Europe and Turkey. In order to test potential scenarios for the control of pathogen spread, the basic reproduction number (R0) for CCHF was calculated. This calculation was based on a population dynamics model and parameter values from the literature for pathogen transmission. The tick population dynamics model takes into account the major processes involved and gives estimates for tick survival from one stage to the other and number of feeding ticks. It also considers the influence of abiotic (meteorological variables) and biotic factors (host densities) on model outputs, which were compared with data collected in Central Anatolia (Turkey). R0 computation was thereafter used to test control strategies and especially the effect of acaricide treatment. Simulation results indicate that such treatments could have valuable effects provided that the acaricide is applied regularly throughout the spring and summer, and over several years. Furthermore, a sensitivity analysis to abiotic and biotic factors showed that, even though temperature has a strong impact on model outputs, host (mainly hare) densities also play a role. The kind of model we have developed provides insight into the ability of different strategies to prevent and control disease spread and has proved its relevance when associated with field trials.

  2. The Effect of Test Expectations on Study Strategies and Test Performance: A Metacognitive Perspective

    Science.gov (United States)

    Abd-El-Fattah, Sabry M.

    2011-01-01

    The aim of the present study was to investigate whether university students can adjust their study strategies to meet the cognitive demands of testing; a metacognitive self-regulatory skill. One hundred and fifty undergraduates attended three lectures as part of a course on the psychology of individual differences. These participants were then…

  3. Entropy Beacon: A Hairpin-Free DNA Amplification Strategy for Efficient Detection of Nucleic Acids.

    Science.gov (United States)

    Lv, Yifan; Cui, Liang; Peng, Ruizi; Zhao, Zilong; Qiu, Liping; Chen, Huapei; Jin, Cheng; Zhang, Xiao-Bing; Tan, Weihong

    2015-12-01

    Here, we propose an efficient strategy for enzyme- and hairpin-free nucleic acid detection called an entropy beacon (abbreviated as Ebeacon). Different from previously reported DNA hybridization/displacement-based strategies, Ebeacon is driven forward by increases in the entropy of the system, instead of free energy released from new base-pair formation. Ebeacon shows high sensitivity, with a detection limit of 5 pM target DNA in buffer and 50 pM in cellular homogenate. Ebeacon also benefits from the hairpin-free amplification strategy and zero-background, excellent thermostability from 20 °C to 50 °C, as well as good resistance to complex environments. In particular, based on the huge difference between the breathing rate of a single base pair and two adjacent base pairs, Ebeacon also shows high selectivity toward base mutations, such as substitution, insertion, and deletion and, therefore, is an efficient nucleic acid detection method, comparable to most reported enzyme-free strategies.

  4. Integrated testing strategy (ITS) for bioaccumulation assessment under REACH.

    Science.gov (United States)

    Lombardo, Anna; Roncaglioni, Alessandra; Benfentati, Emilio; Nendza, Monika; Segner, Helmut; Fernández, Alberto; Kühne, Ralph; Franco, Antonio; Pauné, Eduard; Schüürmann, Gerrit

    2014-08-01

    REACH (registration, evaluation, authorisation and restriction of chemicals) regulation requires that all the chemicals produced or imported in Europe above 1 tonne/year are registered. To register a chemical, physicochemical, toxicological and ecotoxicological information needs to be reported in a dossier. REACH promotes the use of alternative methods to replace, refine and reduce the use of animal (eco)toxicity testing. Within the EU OSIRIS project, integrated testing strategies (ITSs) have been developed for the rational use of non-animal testing approaches in chemical hazard assessment. Here we present an ITS for evaluating the bioaccumulation potential of organic chemicals. The scheme includes the use of all available data (also the non-optimal ones), waiving schemes, analysis of physicochemical properties related to the end point and alternative methods (both in silico and in vitro). In vivo methods are used only as last resort. Using the ITS, in vivo testing could be waived for about 67% of the examined compounds, but bioaccumulation potential could be estimated on the basis of non-animal methods. The presented ITS is freely available through a web tool. Copyright © 2014 Elsevier Ltd. All rights reserved.

  5. Problem-Solving Test: Analysis of DNA Damage Recognizing Proteins in Yeast and Human Cells

    Science.gov (United States)

    Szeberenyi, Jozsef

    2013-01-01

    The experiment described in this test was aimed at identifying DNA repair proteins in human and yeast cells. Terms to be familiar with before you start to solve the test: DNA repair, germline mutation, somatic mutation, inherited disease, cancer, restriction endonuclease, radioactive labeling, [alpha-[superscript 32]P]ATP, [gamma-[superscript…

  6. Injection molded nanofluidic chips: Fabrication method and functional tests using single-molecule DNA experiments

    DEFF Research Database (Denmark)

    Utko, Pawel; Persson, Karl Fredrik; Kristensen, Anders;

    2011-01-01

    We demonstrate that fabrication of nanofluidic systems can be greatly simplified by injection molding of polymers. We functionally test our devices by single-molecule DNA experiments in nanochannels.......We demonstrate that fabrication of nanofluidic systems can be greatly simplified by injection molding of polymers. We functionally test our devices by single-molecule DNA experiments in nanochannels....

  7. Size-based molecular diagnostics using plasma DNA for noninvasive prenatal testing

    NARCIS (Netherlands)

    Yu, S.C.; Chan, K.C.; Zheng, Y.W.; Jiang, P.; Liao, G.J.; Sun, H; Akolekar, R.; Leung, T.Y.; Go, A.T.; Vugt, J.M.G. van; Minekawa, R.; Oudejans, C.B.; Nicolaides, K.H.; Chiu, R.W.; Lo, Y.M.

    2014-01-01

    Noninvasive prenatal testing using fetal DNA in maternal plasma is an actively researched area. The current generation of tests using massively parallel sequencing is based on counting plasma DNA sequences originating from different genomic regions. In this study, we explored a different approach th

  8. Problem-Solving Test: Analysis of DNA Damage Recognizing Proteins in Yeast and Human Cells

    Science.gov (United States)

    Szeberenyi, Jozsef

    2013-01-01

    The experiment described in this test was aimed at identifying DNA repair proteins in human and yeast cells. Terms to be familiar with before you start to solve the test: DNA repair, germline mutation, somatic mutation, inherited disease, cancer, restriction endonuclease, radioactive labeling, [alpha-[superscript 32]P]ATP, [gamma-[superscript…

  9. Standing of nucleic acid testing strategies in veterinary diagnosis laboratories to uncover Mycobacterium tuberculosis complex members

    Directory of Open Access Journals (Sweden)

    Pedro eCosta

    2014-10-01

    Full Text Available Nucleic acid testing (NAT designate any molecular approach used for the detection, identification and characterization of pathogenic microorganisms, enabling the rapid, specific and sensitive diagnostic of infectious diseases, such as tuberculosis. These assays have been widely used since the 90´s of the last century in human clinical laboratories and, subsequently, also in veterinary diagnostics. Most NAT strategies are based in the polymerase chain reaction (PCR and its several enhancements and variations. From the conventional PCR, real-time PCR and its combinations, isothermal DNA amplification, to the nanotechnologies, here we review how the NAT assays have been applied to decipher if and which member of the Mycobacterium tuberculosis complex is present in a clinical sample. Recent advances in DNA sequencing also brought new challenges and have made possible to generate rapidly and at a low cost, large amounts of sequence data. This revolution with the high-throughput sequencing (HTS technologies makes whole genome sequencing (WGS and metagenomics the trendiest NAT strategies, today. The ranking of NAT techniques in the field of clinical diagnostics is rising, and we provide a SWOT (Strengths, Weaknesses, Opportunities and Threats analysis with our view of the use of molecular diagnosis for detecting tuberculosis in veterinary laboratories, notwithstanding the gold standard being still the classical culture of the agent. The complementary use of both classical and molecular diagnosis approaches is recommended to speed the diagnostic, enabling a fast decision by competent authorities and rapid tackling of the disease.

  10. Standing of nucleic acid testing strategies in veterinary diagnosis laboratories to uncover Mycobacterium tuberculosis complex members.

    Science.gov (United States)

    Costa, Pedro; Botelho, Ana; Couto, Isabel; Viveiros, Miguel; Inácio, João

    2014-01-01

    Nucleic acid testing (NAT) designate any molecular approach used for the detection, identification, and characterization of pathogenic microorganisms, enabling the rapid, specific, and sensitive diagnostic of infectious diseases, such as tuberculosis. These assays have been widely used since the 90s of the last century in human clinical laboratories and, subsequently, also in veterinary diagnostics. Most NAT strategies are based in the polymerase chain reaction (PCR) and its several enhancements and variations. From the conventional PCR, real-time PCR and its combinations, isothermal DNA amplification, to the nanotechnologies, here we review how the NAT assays have been applied to decipher if and which member of the Mycobacterium tuberculosis complex is present in a clinical sample. Recent advances in DNA sequencing also brought new challenges and have made possible to generate rapidly and at a low cost, large amounts of sequence data. This revolution with the high-throughput sequencing (HTS) technologies makes whole genome sequencing (WGS) and metagenomics the trendiest NAT strategies, today. The ranking of NAT techniques in the field of clinical diagnostics is rising, and we provide a SWOT (Strengths, Weaknesses, Opportunities, and Threats) analysis with our view of the use of molecular diagnostics for detecting tuberculosis in veterinary laboratories, notwithstanding the gold standard being still the classical culture of the agent. The complementary use of both classical and molecular diagnostics approaches is recommended to speed the diagnostic, enabling a fast decision by competent authorities and rapid tackling of the disease.

  11. Estrogen receptor testing and 10-year mortality from breast cancer: A model for determining testing strategy

    Directory of Open Access Journals (Sweden)

    Christopher Naugler

    2012-01-01

    Full Text Available Background: The use of adjuvant tamoxifen therapy in the treatment of estrogen receptor (ER expressing breast carcinomas represents a major advance in personalized cancer treatment. Because there is no benefit (and indeed there is increased morbidity and mortality associated with the use of tamoxifen therapy in ER-negative breast cancer, its use is restricted to women with ER expressing cancers. However, correctly classifying cancers as ER positive or negative has been challenging given the high reported false negative test rates for ER expression in surgical specimens. In this paper I model practice recommendations using published information from clinical trials to address the question of whether there is a false negative test rate above which it is more efficacious to forgo ER testing and instead treat all patients with tamoxifen regardless of ER test results. Methods: I used data from randomized clinical trials to model two different hypothetical treatment strategies: (1 the current strategy of treating only ER positive women with tamoxifen and (2 an alternative strategy where all women are treated with tamoxifen regardless of ER test results. The variables used in the model are literature-derived survival rates of the different combinations of ER positivity and treatment with tamoxifen, varying true ER positivity rates and varying false negative ER testing rates. The outcome variable was hypothetical 10-year survival. Results: The model predicted that there will be a range of true ER rates and false negative test rates above which it would be more efficacious to treat all women with breast cancer with tamoxifen and forgo ER testing. This situation occurred with high true positive ER rates and false negative ER test rates in the range of 20-30%. Conclusions: It is hoped that this model will provide an example of the potential importance of diagnostic error on clinical outcomes and furthermore will give an example of how the effect of that

  12. Effects of Direct-to-Consumer Advertising and Clinical Guidelines on Appropriate Use of Human Papillomavirus DNA Tests

    Science.gov (United States)

    2011-01-01

    Background Both clinical guidelines and direct-to-consumer (DTC) advertising influence use of new health care technologies, but little is known about their relative effects. The introduction of a cervical cancer screening test in 2000 offered a unique opportunity to assess the two strategies. Objective To evaluate the effects of clinical guidelines and a targeted DTC advertising campaign on overall and appropriate use of human papillomavirus (HPV) DNA tests. Research Design Quasi-experimental study using difference-in-differences analysis. Data were MarketScan private insurance claims for 500,000 women ages 21 to 64 enrolled at least 12 consecutive months from January 2001 through December 2005. Results Both clinical guidelines and DTC advertising were associated with increases in overall HPV DNA test use. DTC advertising was associated with a statistically significant increase in HPV DNA test use in two groups of DTC cities (+5.57 percent, padvertising was associated with comparable increases in the probability of appropriate and inappropriate use of the HPV DNA test in primary screening. Clinical guideline releases from the American College of Obstetricians and Gynecologists, and by a co-sponsored panel, were associated with greater increases in HPV DNA tests for appropriate primary screening than for inappropriate primary screening (β=0.3347, padvertising was associated with increased overall use of a cervical cancer screening test, while clinical guidelines were differentially associated with increased appropriate use. These findings suggest distinct influences of consumer marketing and professional guidelines on the use of health care products and services. PMID:21150798

  13. Sampling strategy and potential utility of indels for DNA barcoding of closely related plant species: a case study in taxus.

    Science.gov (United States)

    Liu, Jie; Provan, Jim; Gao, Lian-Ming; Li, De-Zhu

    2012-01-01

    Although DNA barcoding has become a useful tool for species identification and biodiversity surveys in plant sciences, there remains little consensus concerning appropriate sampling strategies and the treatment of indels. To address these two issues, we sampled 39 populations for nine Taxus species across their entire ranges, with two to three individuals per population randomly sampled. We sequenced one core DNA barcode (matK) and three supplementary regions (trnH-psbA, trnL-trnF and ITS) for all samples to test the effects of sampling design and the utility of indels. Our results suggested that increasing sampling within-population did not change the clustering of individuals, and that meant within-population P-distances were zero for most populations in all regions. Based on the markers tested here, comparison of methods either including or excluding indels indicated that discrimination and nodal support of monophyletic groups were significantly increased when indels were included. Thus we concluded that one individual per population was adequate to represent the within-population variation in these species for DNA barcoding, and that intra-specific sampling was best focused on representing the entire ranges of certain taxa. We also found that indels occurring in the chloroplast trnL-trnF and trnH-psbA regions were informative to differentiate among for closely related taxa barcoding, and we proposed that indel-coding methods should be considered for use in future for closed related plant species DNA barcoding projects on or below generic level.

  14. [Selection of suitable polypropylene tubes for DNA testing using real-time PCR].

    Science.gov (United States)

    Shimizu, Eri; Futo, Satoshi; Masubuchi, Tomoko; Minegishi, Yasutaka; Kasahara, Masaki; Akiyama, Hiroshi; Teshima, Reiko; Hino, Akihiro; Mano, Jyunichi; Furui, Satoshi; Kitta, Kazumi

    2010-01-01

    Polypropylene microtubes (tubes) are generally used for bio-material tests in addition to PCR tests such as genetically modified organism (GMO) testings. However, the choice of suitable tubes is quite important, because it might influence the results: DNA binding and/or elution of chemical substances sometimes occurs. In this study, we established methods to select tubes with the most suitable characteristics for DNA testing.

  15. Granulocyte-macrophage colony-stimulating factor DNA prime-protein boost strategy to enhance efficacy of a recombinant pertussis DNA vaccine

    Institute of Scientific and Technical Information of China (English)

    Qing-tian LI; Yong-zhang ZHU; Jia-you CHU; Ke DONG; Ping HE; Chun-yan FENG; Bao-yu HU; Shu-min ZHANG; Xiao-kui GUO

    2006-01-01

    Aim: To investigate a new strategy to enhance the efficacy of a recombinant pertussis DNA vaccine. The strategy is co-injection with cytokine plasmids as prime, and boosted with purified homologous proteins. Method: A recombinant pertussis DNA vaccine containing the pertussis toxin subunit 1 (PTS1), fragments of the filamentous hemagglutinin (FHA) gene and pertactin (PRN) gene encoding filamentous hemagglutinin and pertactin were constructed. Balb/c mice were immunized with several DNA vaccines and antigen-specific antibodies anti-PTSl, anti-PRN, anti-FHA, cytokines interleukin (IL)-10, IL-4, IFN-γ, TNF-oc, and spleno-cyte-proliferation assay were used to describe immune responses. Results: The recombinant DNA vaccine could elicit similar immune responses in mice as that of separate plasmids encoding the 3 fragments, respectively. Mice immunized with DNA and boosted with the corresponding protein elicited more antibodies than those that received DNA as boost. In particular, when the mice were co-immunized with murine granulocyte-macrophage colony-stimulating factor plasmids and boosted with proteins, all 4 cytokines and the 3 antigen-specific antibodies were significantly increased compared to the pVAXl group. Anti-PTSl, anti-FHA, IL-4 and TNF-α elicited in the colony stimulating factor (CSF) prime-protein boost group showed significant increase compared to all the other groups. Conclusion: This prime and boost strategy has proven to be very useful in improving the immunogenicity of DNA vaccines against pertussis.

  16. The Five Immune Forces Impacting DNA-Based Cancer Immunotherapeutic Strategy

    Directory of Open Access Journals (Sweden)

    Suneetha Amara

    2017-03-01

    Full Text Available DNA-based vaccine strategy is increasingly realized as a viable cancer treatment approach. Strategies to enhance immunogenicity utilizing tumor associated antigens have been investigated in several pre-clinical and clinical studies. The promising outcomes of these studies have suggested that DNA-based vaccines induce potent T-cell effector responses and at the same time cause only minimal side-effects to cancer patients. However, the immune evasive tumor microenvironment is still an important hindrance to a long-term vaccine success. Several options are currently under various stages of study to overcome immune inhibitory effect in tumor microenvironment. Some of these approaches include, but are not limited to, identification of neoantigens, mutanome studies, designing fusion plasmids, vaccine adjuvant modifications, and co-treatment with immune-checkpoint inhibitors. In this review, we follow a Porter’s analysis analogy, otherwise commonly used in business models, to analyze various immune-forces that determine the potential success and sustainable positive outcomes following DNA vaccination using non-viral tumor associated antigens in treatment against cancer.

  17. Evaluating the effectiveness of training strategies: performance goals and testing.

    Science.gov (United States)

    Foshay, Wellesley R; Tinkey, Peggy T

    2007-01-01

    The Public Health Service policy, Animal Welfare Act regulations, and the Guide for the Care and Use of Laboratory Animals all require that institutions provide training for personnel engaged in animal research. Most research facilities have developed training programs to meet these requirements but may not have developed ways of assessing the effectiveness of these programs. Omission of this critical activity often leads to training that is ineffective, inefficient, or unnecessary. Evaluating the effectiveness of biomedical research and animal care training should involve a combination of assessments of performance, competence and knowledge, and appropriate tests for each type of knowledge, used at appropriate time intervals. In this article, the hierarchical relationship between performance, competence, and knowledge is described. The discussion of cognitive and psychomotor knowledge includes the important distinction between declarative and procedural knowledge. Measurement of performance is described and can include a variety of indirect and direct measurement techniques. Each measurement option has its own profile of strengths and weaknesses in terms of measurement validity, reliability, and costs of development and delivery. It is important to understand the tradeoffs associated with each measurement option, and to make appropriate choices of measurement strategy based on these tradeoffs arrayed against considerations of frequency, criticality, difficulty of learning, logistics, and budget. The article concludes with an example of how these measurement strategies can be combined into a cost-effective assessment plan for a biomedical research facility.

  18. Design of Sequentially Randomized Trials for Testing Adaptive Treatment Strategies

    Science.gov (United States)

    Ogbagaber, Semhar B.; Karp, Jordan; Wahed, Abdus S.

    2016-01-01

    An adaptive treatment strategy (ATS) is an outcome-guided algorithm that allows personalized treatment of complex diseases based on patients’ disease status and treatment history. Conditions such as AIDS, depression, and cancer usually require several stages of treatment due to the chronic, multifactorial nature of illness progression and management. Sequential multiple assignment randomized (SMAR) designs permit simultaneous inference about multiple ATSs, where patients are sequentially randomized to treatments at different stages depending upon response status. The purpose of the article is to develop a sample size formula to ensure adequate power for comparing two or more ATSs. Based on a Wald-type statistic for comparing multiple ATSs with a continuous endpoint, we develop a sample size formula and test it through simulation studies. We show via simulation that the proposed sample size formula maintains the nominal power. The proposed sample size formula is not applicable to designs with time-to-event endpoints but the formula will be useful for practitioners while designing SMAR trials to compare adaptive treatment strategies. PMID:26412033

  19. Strategies in the preparation of DNA oligonucleotide arrays for diagnostic applications.

    Science.gov (United States)

    Beaucage, S L

    2001-08-01

    This report emphasizes the interfacial chemistry that is required to ensure proper attachment of oligonucleotides onto the surface of microarrays. For example, strategies for the covalent attachment of pre-synthesized oligonucleotides to glass slides, gold films, polyacrylamide gel pads, polypyrrole films, and optical fibers are surveyed in an attempt to better define the parameters for optimal formation and detection of DNA hybrids. These parameters include among others, the nature and length of the linkers attaching oligonucleotides to the arrays, and the surface density of oligonucleotides required for unhindered hybridization with DNA targets. Sensitive detection methods such as the use of light-scattering techniques, molecular beacons, surface plasmon resonance, attenuated total internal reflection-FTIR, and the evanescent field excitation of fluorescence from surface-bound fluorophores have been developed to study the kinetics and specificity of hybridization events. Finally, the synthesis of oligonucleotides directly on glass surfaces and polypropylene sheets has been investigated to enable DNA sequencing by hybridization and achieve oligonucleotide densities of ca. 10(6) sequences per cm(2) on DNA chips.

  20. Prenatal and newborn paternity testing with DNA analysis.

    Science.gov (United States)

    Csete, K; Beer, Zs; Varga, T

    2005-01-17

    In rape against youthful girls which yields pregnancy after the abortion DNA examinations can be performed from the aborted foetal material to provide evidence of paternity of the suspect. In our present work we demonstrate six cases: four of them are rape cases and two where the mother abandoned her newborn baby. These cases proved that DNA-STR profiles can be determined from foetus after the abortion and perpetrator of a rape can be found. Due to our result we suggest that not only placenta but also bloody vernix caseosa is useful tissue for identifying the putative mother because vernix caseosa can be the carrier of the mother's blood.

  1. Investigating CSI: portrayals of DNA testing on a forensic crime show and their potential effects.

    Science.gov (United States)

    Ley, Barbara L; Jankowski, Natalie; Brewer, Paul R

    2012-01-01

    The popularity of forensic crime shows such as CSI has fueled debate about their potential social impact. This study considers CSI's potential effects on public understandings regarding DNA testing in the context of judicial processes, the policy debates surrounding crime laboratory procedures, and the forensic science profession, as well as an effect not discussed in previous accounts: namely, the show's potential impact on public understandings of DNA and genetics more generally. To develop a theoretical foundation for research on the "CSI effect," it draws on cultivation theory, social cognitive theory, and audience reception studies. It then uses content analysis and textual analysis to illuminate how the show depicts DNA testing. The results demonstrate that CSI tends to depict DNA testing as routine, swift, useful, and reliable and that it echoes broader discourses about genetics. At times, however, the show suggests more complex ways of thinking about DNA testing and genetics.

  2. Primary ovary choriocarcinoma: individual DNA polymorphic analysis as a strategy to confirm diagnosis and treatment

    Directory of Open Access Journals (Sweden)

    Fernando Nalesso

    2013-04-01

    Full Text Available Primary choriocarcinoma of the ovary is rare. Furthermore, this tumor can arise from gestational tissue or pure germ cells of the ovary, with the latter resulting in non-gestational choriocarcinoma. While the clinical characteristics and histology of both tumor types are identical, differentiation of these tumors is necessary for effective treatment. One strategy for the differentiation of these tumors types is to assay for the presence of paternal DNA. Accordingly, in the present case, a patient with primary choriocarcinoma of the ovary with a non-gestational origin was confirmed by DNA analysis. The patient subsequently exhibited an excellent response to chemotherapy, and following surgery, achieved complete remission. A pathological analysis of surgical specimens further confirmed the absence of tumor.

  3. Integrated preclinical photosafety testing strategy for systemically applied pharmaceuticals.

    Science.gov (United States)

    Schümann, Jens; Boudon, Stéphanie; Ulrich, Peter; Loll, Nathalie; Garcia, Déborah; Schaffner, René; Streich, Jeannine; Kittel, Birgit; Bauer, Daniel

    2014-05-01

    Phototoxic properties of systemically applied pharmaceuticals may be the cause of serious adverse drug reactions. Therefore, a reliable preclinical photosafety assessment strategy, combining in vitro and in vivo approaches in a quantitative manner, is important and has not been described so far. Here, we report the establishment of an optimized modified murine local lymph node assay (LLNA), adapted for phototoxicity assessment of systemically applied compounds, as well as the test results for 34 drug candidates in this in vivo photo-LLNA. The drug candidates were selected based on their ability to absorb ultraviolet/visible light and the photo irritation factors (PIFs) determined in the well-established in vitro 3T3 neutral red uptake phototoxicity test. An in vivo phototoxic potential was identified for 13 of these drug candidates. The use of multiple dose levels in the described murine in vivo phototoxicity studies enabled the establishment of no- and/or lowest-observed-adverse-effect levels (NOAELs/LOAELs), also supporting human photosafety assessment. An in vitro-in vivo correlation demonstrated that a drug candidate classified as "phototoxic" in vitro is not necessarily phototoxic in vivo. However, the probability for a drug candidate to cause phototoxicity in vivo clearly correlated with the magnitude of the phototoxicity identified in vitro.

  4. Targeting DNA base pair mismatch with artificial nucleobases. Advances and perspectives in triple helix strategy.

    Science.gov (United States)

    Malnuit, Vincent; Duca, Maria; Benhida, Rachid

    2011-01-21

    This review, divided into three sections, describes the contribution of the chemists' community to the development and application of triple helix strategy by using artificial nucleic acids, particularly for the recognition of DNA sequences incorporating base pair inversions. Firstly, the development of nucleobases that recognise CG inversion is surveyed followed secondly by specific recognition of TA inverted base pair. Finally, we point out in the last section recent perspectives and applications, driven from knowledge in nucleic acids interactions, in the growing field of nanotechnology and supramolecular chemistry at the border area of physics, chemistry and molecular biology.

  5. Comparison of the HeLa DNA-synthesis inhibition test and the Ames test for screening of mutagenic carcinogens

    Energy Technology Data Exchange (ETDEWEB)

    Painter, R.B.; Howard, R.

    1978-01-01

    The action of most mutagens is mediated by damage to DNA, which causes at least a temporary inhibition of DNA syntesis in mammalian cells. Assays for mammalian DNA-synthesis inhibition, both in vivo (mouse testes) and in vitro (HeLa cells), have been proposed as possible screening tests for mutagenic carcinogens. The mouse system has recently been chekced with 100 chemicals; of 88 known carcinogens and/or mutagens in this group, 76 were positive. The most generally used non-animal screening procedure is the Ames test, which uses auxotrophic strains of Salmonella typhimurium to measure mutagenesis. In this communication we summarize our results with 19 chemicals tested in HeLa cells and show that they correlate very well with the results obtained in the Ames test. Most of these chemicals act by alkylation, but an intercalator (adriamycin) is included among them as well as aflatoxin B/sub 1/, whose action is not established.

  6. Molecular cloning of growth hormone encoding cDNA of Indian major carps by a modified rapid amplification of cDNA ends strategy

    Indian Academy of Sciences (India)

    T Venugopal; S Mathavan; T J Pandian

    2002-06-01

    A modified rapid amplification of cDNA ends (RACE) strategy has been developed for cloning highly conserved cDNA sequences. Using this modified method, the growth hormone (GH) encoding cDNA sequences of Labeo rohita, Cirrhina mrigala and Catla catla have been cloned, characterized and overexpressed in Escherichia coli. These sequences show 96–98% homology to each other and are about 85% homologous to that of common carp. Besides, an attempt has been made for the first time to describe a 3-D model of the fish GH protein.

  7. Molecular cloning of growth hormone encoding cDNA of Indian major carps by a modified rapid amplification of cDNA ends strategy.

    Science.gov (United States)

    Venugopal, T; Mathavan, S; Pandian, T J

    2002-06-01

    A modified rapid amplification of cDNA ends (RACE) strategy has been developed for cloning highly conserved cDNA sequences. Using this modified method, the growth hormone (GH) encoding cDNA sequences of Labeo rohita, Cirrhina mrigala and Catla catla have been cloned, characterized and overexpressed in Escherichia coli. These sequences show 96-98% homology to each other and are about 85% homologous to that of common carp. Besides, an attempt has been made for the first time to describe a 3-D model of the fish GH protein.

  8. Non-invasive prenatal testing using cell-free fetal DNA in maternal circulation.

    Science.gov (United States)

    Liao, Gary J W; Gronowski, Ann M; Zhao, Zhen

    2014-01-20

    The identification of cell-free fetal DNA (cffDNA) in maternal circulation has made non-invasive prenatal testing (NIPT) possible. Maternal plasma cell free DNA is a mixture of maternal and fetal DNA, of which, fetal DNA represents a minor population in maternal plasma. Therefore, methods with high sensitivity and precision are required to detect and differentiate fetal DNA from the large background of maternal DNA. In recent years, technical advances in the molecular analysis of fetal DNA (e.g., digital PCR and massively parallel sequencing (MPS)) has enabled the successful implementation of noninvasive testing into clinical practice, such as fetal sex assessment, RhD genotyping, and fetal chromosomal aneuploidy detection.With the ability to decipher the entire fetal genome from maternal plasma DNA, we foresee that an increased number of non-invasive prenatal tests will be available for detecting many single-gene disorders in the near future. This review briefly summarizes the technical aspects of the NIPT and application of NIPT in clinical practice.

  9. [DNA synthesis inhibition test of INAH by cultured human fibroblasts].

    Science.gov (United States)

    Nishio, K; Yanagisawa, K

    1986-03-20

    The most commonly used screening test of carcinogens is the Ames test. But this system occasionally shows false positive and false negative. Painter's method is one which has been developed to minimize false results. Now we test by Painter's method isonicotinic acid hydrazide, which shows negative in the Ames test but positive in an animal test. INAH showed positive by Painter's method. More chemicals are now under study for their carcinogenicity by Painter's method.

  10. A retrospective approach to testing the DNA barcoding method.

    Directory of Open Access Journals (Sweden)

    David G Chapple

    Full Text Available A decade ago, DNA barcoding was proposed as a standardised method for identifying existing species and speeding the discovery of new species. Yet, despite its numerous successes across a range of taxa, its frequent failures have brought into question its accuracy as a short-cut taxonomic method. We use a retrospective approach, applying the method to the classification of New Zealand skinks as it stood in 1977 (primarily based upon morphological characters, and compare it to the current taxonomy reached using both morphological and molecular approaches. For the 1977 dataset, DNA barcoding had moderate-high success in identifying specimens (78-98%, and correctly flagging specimens that have since been confirmed as distinct taxa (77-100%. But most matching methods failed to detect the species complexes that were present in 1977. For the current dataset, there was moderate-high success in identifying specimens (53-99%. For both datasets, the capacity to discover new species was dependent on the methodological approach used. Species delimitation in New Zealand skinks was hindered by the absence of either a local or global barcoding gap, a result of recent speciation events and hybridisation. Whilst DNA barcoding is potentially useful for specimen identification and species discovery in New Zealand skinks, its error rate could hinder the progress of documenting biodiversity in this group. We suggest that integrated taxonomic approaches are more effective at discovering and describing biodiversity.

  11. Tungsten disulfide nanosheet and exonuclease III co-assisted amplification strategy for highly sensitive fluorescence polarization detection of DNA glycosylase activity.

    Science.gov (United States)

    Zhao, Jingjin; Ma, Yefei; Kong, Rongmei; Zhang, Liangliang; Yang, Wen; Zhao, Shulin

    2015-08-05

    Herein, we introduced a tungsten disulfide (WS2) nanosheet and exonuclease III (Exo III) co-assisted signal amplification strategy for highly sensitive fluorescent polarization (FP) assay of DNA glycosylase activity. Two DNA glycosylases, uracil-DNA glycosylase (UDG) and human 8-oxoG DNA glycosylase 1 (hOGG1), were tested. A hairpin-structured probe (HP) which contained damaged bases in the stem was used as the substrate. The removal of damaged bases from substrate by DNA glycosylase would lower the melting temperature of HP. The HP was then opened and hybridized with a FAM dye-labeled single strand DNA (DP), generating a duplex with a recessed 3'-terminal of DP. This design facilitated the Exo III-assisted amplification by repeating the hybridization and digestion of DP, liberating numerous FAM fluorophores which could not be adsorbed on WS2 nanosheet. Thus, the final system exhibited a small FP signal. However, in the absence of DNA glycosylases, no hybridization between DP and HP was occurred, hampering the hydrolysis of DP by Exo III. The intact DP was then adsorbed on the surface of WS2 nanosheet that greatly amplified the mass of the labeled-FAM fluorophore, resulting in a large FP value. With the co-assisted amplification strategy, the sensitivity was substantially improved. In addition, this method was applied to detect UDG activity in cell extracts. The study of the inhibition of UDG was also performed. Furthermore, this method is simple in design, easy in implementation, and selective, which holds potential applications in the DNA glycosylase related mechanism research and molecular diagnostics.

  12. Detection of complex hemoglobinopathies: recommendations on screening and DNA testing

    Directory of Open Access Journals (Sweden)

    E. Baysal

    2011-12-01

    Full Text Available The following recommendations should be taken into account during the evaluation and elucidation of the complex hemoglobinopathies: a in complex hemoglobinopathies performing DNA studies on all family members might be essential; b complex gene-gene interactions offer major diagnostic challenges both at the technical and clinical level; c hematological & DNA analyses must be run in parallel. Some cases may be straight forward but others may require indepth DNA work-up; d co-inheritance of a-thalassemia offers added challenge as it may affect phenotype significantly; e sickle cell anemia (SS, co-inherited with a-thal, can be a phenocopy of Sβ0-thal. The HbA2 increase can be mistaken for Sβ-thal. DNA Sequencing is imperative; f only a selected number of normal MCV, MCH, borderline HbA2 cases must be referred for DNA analysis. However, in certain cases, following hematological and family evaluation, the β and d genes may need to be sequenced; g DNA Sequencing will increasingly become the method of choice for screening and DNA mutation analysis. However, new methods like MLPA-which analyzes gene dosage- must be used more commonly to rule out deletion mutants to avoid false negative sequencing results; h these recommendations should be reviewed every 2-3 years reflecting new methods, new findings and new findings from ethnic groups. 诊断和说明复杂血红蛋白病时,建议考虑以下几点: a)针对复杂的血红蛋白病,有必要对所有家庭成员开展DNA研究;b 复杂的基因-基因交互作用可能使诊断在技术和临床层面上颇受挑战;c 血液和DNA分析须同时进行。 有些病例简单,但另外一些病例可能需要开展深层次的DNA检查;d 由于α型地中海贫血可能严重影响表型,α型地中海贫血的共同继承特征更具挑战;e 共同继承α型地中海贫血的镰状细胞贫血(SS),可以作为Sβ0型地中海贫血的显型。 HbA2增

  13. Lay perceptions of predictive testing for diabetes based on DNA test results versus family history assessment: a focus group study

    Directory of Open Access Journals (Sweden)

    Cornel Martina C

    2011-07-01

    Full Text Available Abstract Background This study assessed lay perceptions of issues related to predictive genetic testing for multifactorial diseases. These perceived issues may differ from the "classic" issues, e.g. autonomy, discrimination, and psychological harm that are considered important in predictive testing for monogenic disorders. In this study, type 2 diabetes was used as an example, and perceptions with regard to predictive testing based on DNA test results and family history assessment were compared. Methods Eight focus group interviews were held with 45 individuals aged 35-70 years with (n = 3 and without (n = 1 a family history of diabetes, mixed groups of these two (n = 2, and diabetes patients (n = 2. All interviews were transcribed and analysed using Atlas-ti. Results Most participants believed in the ability of a predictive test to identify people at risk for diabetes and to motivate preventive behaviour. Different reasons underlying motivation were considered when comparing DNA test results and a family history risk assessment. A perceived drawback of DNA testing was that diabetes was considered not severe enough for this type of risk assessment. In addition, diabetes family history assessment was not considered useful by some participants, since there are also other risk factors involved, not everyone has a diabetes family history or knows their family history, and it might have a negative influence on family relations. Respect for autonomy of individuals was emphasized more with regard to DNA testing than family history assessment. Other issues such as psychological harm, discrimination, and privacy were only briefly mentioned for both tests. Conclusion The results suggest that most participants believe a predictive genetic test could be used in the prevention of multifactorial disorders, such as diabetes, but indicate points to consider before both these tests are applied. These considerations differ with regard to the method of assessment

  14. DNA elements reducing transcriptional gene silencing revealed by a novel screening strategy.

    Directory of Open Access Journals (Sweden)

    Naoki Kishimoto

    Full Text Available Transcriptional gene silencing (TGS--a phenomenon observed in endogenous genes/transgenes in eukaryotes--is a huge hindrance to transgenic technology and occurs mainly when the genes involved share sequence homology in their promoter regions. TGS depends on chromosomal position, suggesting the existence of genomic elements that suppress TGS. However, no systematic approach to identify such DNA elements has yet been reported. Here, we developed a successful novel screening strategy to identify such elements (anti-silencing regions-ASRs, based on their ability to protect a flanked transgene from TGS. A silenced transgenic tobacco plant in which a subsequently introduced transgene undergoes obligatory promoter-homology dependent TGS in trans allowed the ability of DNA elements to prevent TGS to be used as the screening criterion. We also identified ASRs in a genomic library from a different plant species (Lotus japonicus: a perennial legume; the ASRs include portions of Ty1/copia retrotransposon-like and pararetrovirus-like sequences; the retrotransposon-like sequences also showed interspecies anti-TGS activity in a TGS-induction system in Arabidopsis. Anti-TGS elements could provide effective tools to reduce TGS and ensure proper regulation of transgene expression. Furthermore, the screening strategy described here will also facilitate the efficient identification of new classes of anti-TGS elements.

  15. Size-based molecular diagnostics using plasma DNA for noninvasive prenatal testing.

    Science.gov (United States)

    Yu, Stephanie C Y; Chan, K C Allen; Zheng, Yama W L; Jiang, Peiyong; Liao, Gary J W; Sun, Hao; Akolekar, Ranjit; Leung, Tak Y; Go, Attie T J I; van Vugt, John M G; Minekawa, Ryoko; Oudejans, Cees B M; Nicolaides, Kypros H; Chiu, Rossa W K; Lo, Y M Dennis

    2014-06-10

    Noninvasive prenatal testing using fetal DNA in maternal plasma is an actively researched area. The current generation of tests using massively parallel sequencing is based on counting plasma DNA sequences originating from different genomic regions. In this study, we explored a different approach that is based on the use of DNA fragment size as a diagnostic parameter. This approach is dependent on the fact that circulating fetal DNA molecules are generally shorter than the corresponding maternal DNA molecules. First, we performed plasma DNA size analysis using paired-end massively parallel sequencing and microchip-based capillary electrophoresis. We demonstrated that the fetal DNA fraction in maternal plasma could be deduced from the overall size distribution of maternal plasma DNA. The fetal DNA fraction is a critical parameter affecting the accuracy of noninvasive prenatal testing using maternal plasma DNA. Second, we showed that fetal chromosomal aneuploidy could be detected by observing an aberrant proportion of short fragments from an aneuploid chromosome in the paired-end sequencing data. Using this approach, we detected fetal trisomy 21 and trisomy 18 with 100% sensitivity (T21: 36/36; T18: 27/27) and 100% specificity (non-T21: 88/88; non-T18: 97/97). For trisomy 13, the sensitivity and specificity were 95.2% (20/21) and 99% (102/103), respectively. For monosomy X, the sensitivity and specificity were both 100% (10/10 and 8/8). Thus, this study establishes the principle of size-based molecular diagnostics using plasma DNA. This approach has potential applications beyond noninvasive prenatal testing to areas such as oncology and transplantation monitoring.

  16. Barnes maze testing strategies with small and large rodent models.

    Science.gov (United States)

    Rosenfeld, Cheryl S; Ferguson, Sherry A

    2014-02-26

    Spatial learning and memory of laboratory rodents is often assessed via navigational ability in mazes, most popular of which are the water and dry-land (Barnes) mazes. Improved performance over sessions or trials is thought to reflect learning and memory of the escape cage/platform location. Considered less stressful than water mazes, the Barnes maze is a relatively simple design of a circular platform top with several holes equally spaced around the perimeter edge. All but one of the holes are false-bottomed or blind-ending, while one leads to an escape cage. Mildly aversive stimuli (e.g. bright overhead lights) provide motivation to locate the escape cage. Latency to locate the escape cage can be measured during the session; however, additional endpoints typically require video recording. From those video recordings, use of automated tracking software can generate a variety of endpoints that are similar to those produced in water mazes (e.g. distance traveled, velocity/speed, time spent in the correct quadrant, time spent moving/resting, and confirmation of latency). Type of search strategy (i.e. random, serial, or direct) can be categorized as well. Barnes maze construction and testing methodologies can differ for small rodents, such as mice, and large rodents, such as rats. For example, while extra-maze cues are effective for rats, smaller wild rodents may require intra-maze cues with a visual barrier around the maze. Appropriate stimuli must be identified which motivate the rodent to locate the escape cage. Both Barnes and water mazes can be time consuming as 4-7 test trials are typically required to detect improved learning and memory performance (e.g. shorter latencies or path lengths to locate the escape platform or cage) and/or differences between experimental groups. Even so, the Barnes maze is a widely employed behavioral assessment measuring spatial navigational abilities and their potential disruption by genetic, neurobehavioral manipulations, or drug

  17. A highly efficient strategy to determine genotypes of genetically-engineered mice using genomic DNA purified from hair roots.

    Science.gov (United States)

    Otaño-Rivera, Víctor; Boakye, Amma; Grobe, Nadja; Almutairi, Mohammed M; Kursan, Shams; Mattis, Lesan K; Castrop, Hayo; Gurley, Susan B; Elased, Khalid M; Boivin, Gregory P; Di Fulvio, Mauricio

    2017-04-01

    Genotyping of genetically-engineered mice is necessary for the effective design of breeding strategies and identification of mutant mice. This process relies on the identification of DNA markers introduced into genomic sequences of mice, a task usually performed using the polymerase chain reaction (PCR). Clearly, the limiting step in genotyping is isolating pure genomic DNA. Isolation of mouse DNA for genotyping typically involves painful procedures such as tail snip, digit removal, or ear punch. Although the harvesting of hair has previously been proposed as a source of genomic DNA, there has been a perceived complication and reluctance to use this non-painful technique because of low DNA yields and fear of contamination. In this study we developed a simple, economic, and efficient strategy using Chelex® resins to purify genomic DNA from hair roots of mice which are suitable for genotyping. Upon comparison with standard DNA purification methods using a commercially available kit, we demonstrate that Chelex® efficiently and consistently purifies high-quality DNA from hair roots, minimizing pain, shortening time and reducing costs associated with the determination of accurate genotypes. Therefore, the use of hair roots combined with Chelex® is a reliable and more humane alternative for DNA genotyping.

  18. Analysis of Problem Solving Strategies on the Kohs Block Design Test.

    Science.gov (United States)

    Rozencwajg, Paulette

    1991-01-01

    Presents results of study investigating cognitive strategies involved in the Kohs Block Design test. Reports that the study's purposes were to improve the distinction between syncretic and analytic strategies, match strategies with field dependence level, and assess metacognitive skills. Discusses findings of three strategies: syncretic, analytic,…

  19. Electrochemical DNA probe for Hg(2+) detection based on a triple-helix DNA and Multistage Signal Amplification Strategy.

    Science.gov (United States)

    Wang, Huan; Zhang, Yihe; Ma, Hongmin; Ren, Xiang; Wang, Yaoguang; Zhang, Yong; Wei, Qin

    2016-12-15

    In this work, an ultrasensitive electrochemical sensor was developed for detection of Hg(2+). Gold nanoparticles decorated bovine serum albumin reduction of graphene oxide (AuNP-BSA-rGO) were used as subsurface material for the immobilization of triple-helix DNA. The triple-helix DNA containing a thiol labelled single-stranded DNA (sDNA) and a thymine-rich DNA (T-rich DNA), which could be unwinded in the present of Hg(2+) to form more stable thymine-Hg(2+)-thymine (T-Hg(2+)-T) complex. T-Hg(2+)-T complex was then removed and the sDNA was left on the electrode. At this time, gold nanoparticle carrying thiol labelled cytosine-rich complementary DNA (cDNA-AuNP) could bind with the free sDNA. Meanwhile, the other free cDNA on AuNP could bind with each other in the present of Ag(+) to form the stable cytosine-Ag(+)-cytosine (C-Ag(+)-C) complex and circle amplification. Plenty of C-Ag(+)-C could form silver nanoclusters by electrochemical reduction and the striping signal of Ag could be measured for purpose of the final electrochemical detection of Hg(2+). This sensor could detect Hg(2+) over a wide concentration range from 0.1 to 130nM with a detection limit of 0.03nM.

  20. Strategy Effects on Word Searching in Japanese Letter Fluency Tests: Evidence from the NIRS Findings

    Science.gov (United States)

    Hatta, Takeshi; Kanari, Ayano; Mase, Mitsuhito; Nagano, Yuko; Shirataki, Tatsuaki; Hibino, Shinji

    2009-01-01

    Strategy effects on word searching in the Japanese letter fluency test were investigated using the Near-infrared Spectroscopy (NIRS). Participants were given a Japanese letter fluency test and they were classified into two types of strategy users, based on analysis of their recorded verbal responses. One group, AIUEO-order strategy users, employed…

  1. Price leadership strategy or branding strategy:an empirical test of indigenous Chinese exporters

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    The effects of price leadership strategies and branding strategies on the export performance of indigenous Chinese exporters with a focus on developing country markets and developed country markets are examined based on the principles of strategy-environment co-alignment and marketing segmentation theory. Findings suggest that when focusing on developing country markets, the use of a branding strategy is more likely to enhance export performance. When focusing on developed country markets, neither the use o...

  2. Tungsten disulfide nanosheet and exonuclease III co-assisted amplification strategy for highly sensitive fluorescence polarization detection of DNA glycosylase activity

    Energy Technology Data Exchange (ETDEWEB)

    Zhao, Jingjin; Ma, Yefei [Key Laboratory for the Chemistry and Molecular Engineering of Medicinal Resources of Education Ministry, Guangxi Normal University, Guilin, 541004 (China); Kong, Rongmei [The Key Laboratory of Life-Organic Analysis, College of Chemistry and Chemical Engineering, Qufu Normal University, Qufu, Shandong 273165 (China); Zhang, Liangliang, E-mail: liangzhang319@163.com [Key Laboratory for the Chemistry and Molecular Engineering of Medicinal Resources of Education Ministry, Guangxi Normal University, Guilin, 541004 (China); Yang, Wen; Zhao, Shulin [Key Laboratory for the Chemistry and Molecular Engineering of Medicinal Resources of Education Ministry, Guangxi Normal University, Guilin, 541004 (China)

    2015-08-05

    Herein, we introduced a tungsten disulfide (WS{sub 2}) nanosheet and exonuclease III (Exo III) co-assisted signal amplification strategy for highly sensitive fluorescent polarization (FP) assay of DNA glycosylase activity. Two DNA glycosylases, uracil-DNA glycosylase (UDG) and human 8-oxoG DNA glycosylase 1 (hOGG1), were tested. A hairpin-structured probe (HP) which contained damaged bases in the stem was used as the substrate. The removal of damaged bases from substrate by DNA glycosylase would lower the melting temperature of HP. The HP was then opened and hybridized with a FAM dye-labeled single strand DNA (DP), generating a duplex with a recessed 3′-terminal of DP. This design facilitated the Exo III-assisted amplification by repeating the hybridization and digestion of DP, liberating numerous FAM fluorophores which could not be adsorbed on WS{sub 2} nanosheet. Thus, the final system exhibited a small FP signal. However, in the absence of DNA glycosylases, no hybridization between DP and HP was occurred, hampering the hydrolysis of DP by Exo III. The intact DP was then adsorbed on the surface of WS{sub 2} nanosheet that greatly amplified the mass of the labeled-FAM fluorophore, resulting in a large FP value. With the co-assisted amplification strategy, the sensitivity was substantially improved. In addition, this method was applied to detect UDG activity in cell extracts. The study of the inhibition of UDG was also performed. Furthermore, this method is simple in design, easy in implementation, and selective, which holds potential applications in the DNA glycosylase related mechanism research and molecular diagnostics. - Highlights: • A fluorescence polarization strategy for DNA glycosylase activity detection was developed. • The present method was based on WS{sub 2} nanosheet and exonuclease III co-assisted signal amplification. • A high sensitivity and desirable selectivity were achieved. • This method provides a promising universal platform for DNA

  3. Mendelian breeding units versus standard sampling strategies: Mitochondrial DNA variation in southwest Sardinia

    Science.gov (United States)

    Sanna, Daria; Pala, Maria; Cossu, Piero; Dedola, Gian Luca; Melis, Sonia; Fresu, Giovanni; Morelli, Laura; Obinu, Domenica; Tonolo, Giancarlo; Secchi, Giannina; Triunfo, Riccardo; Lorenz, Joseph G.; Scheinfeldt, Laura; Torroni, Antonio; Robledo, Renato; Francalacci, Paolo

    2011-01-01

    We report a sampling strategy based on Mendelian Breeding Units (MBUs), representing an interbreeding group of individuals sharing a common gene pool. The identification of MBUs is crucial for case-control experimental design in association studies. The aim of this work was to evaluate the possible existence of bias in terms of genetic variability and haplogroup frequencies in the MBU sample, due to severe sample selection. In order to reach this goal, the MBU sampling strategy was compared to a standard selection of individuals according to their surname and place of birth. We analysed mitochondrial DNA variation (first hypervariable segment and coding region) in unrelated healthy subjects from two different areas of Sardinia: the area around the town of Cabras and the western Campidano area. No statistically significant differences were observed when the two sampling methods were compared, indicating that the stringent sample selection needed to establish a MBU does not alter original genetic variability and haplogroup distribution. Therefore, the MBU sampling strategy can be considered a useful tool in association studies of complex traits. PMID:21734814

  4. Mendelian breeding units versus standard sampling strategies: mitochondrial DNA variation in southwest Sardinia

    Directory of Open Access Journals (Sweden)

    Daria Sanna

    2011-01-01

    Full Text Available We report a sampling strategy based on Mendelian Breeding Units (MBUs, representing an interbreeding group of individuals sharing a common gene pool. The identification of MBUs is crucial for case-control experimental design in association studies. The aim of this work was to evaluate the possible existence of bias in terms of genetic variability and haplogroup frequencies in the MBU sample, due to severe sample selection. In order to reach this goal, the MBU sampling strategy was compared to a standard selection of individuals according to their surname and place of birth. We analysed mitochondrial DNA variation (first hypervariable segment and coding region in unrelated healthy subjects from two different areas of Sardinia: the area around the town of Cabras and the western Campidano area. No statistically significant differences were observed when the two sampling methods were compared, indicating that the stringent sample selection needed to establish a MBU does not alter original genetic variability and haplogroup distribution. Therefore, the MBU sampling strategy can be considered a useful tool in association studies of complex traits.

  5. A Strategy for Automatic Quality Signing and Verification Processes for Hardware and Software Testing

    Directory of Open Access Journals (Sweden)

    Mohammed I. Younis

    2010-01-01

    Circuits in a production line. Comparatively, our result demonstrates that the proposed strategy outperforms the traditional block partitioning strategy with the mutant score of 100% to 90%, respectively, with the same number of test cases.

  6. First-trimester contingent screening for trisomy 21 by biomarkers and maternal blood cell-free DNA testing.

    Science.gov (United States)

    Nicolaides, K H; Wright, D; Poon, L C; Syngelaki, A; Gil, M M

    2013-07-01

    To define risk cut-offs with corresponding detection rates (DR) and false-positive rates (FPR) in screening for trisomy 21 using maternal age and combinations of first-trimester biomarkers in order to determine which women should undergo contingent maternal blood cell-free (cf) DNA testing. From singleton pregnancies undergoing screening for aneuploidies at three UK hospitals between March 2006 and May 2012, we analyzed prospectively collected data on the following biomarkers: fetal nuchal translucency thickness (NT) and ductus venosus pulsatility index for veins (DV-PIV) at 11 + 0 to 13 + 6 weeks' gestation and serum free β-human chorionic gonadotropin (β-hCG), pregnancy-associated plasma protein-A (PAPP-A), placental growth factor (PlGF) and alpha-fetoprotein (AFP) at 8 + 0 to 13 + 6 weeks. Estimates of risk cut-offs, DRs and FPRs were derived for combinations of biomarkers and these were used to define the best strategy for contingent cfDNA testing. In contingent screening, detection of 98% of fetuses with trisomy 21 at an overall invasive testing rate 21% and 11% of cases identified by first-line screening using the combined test alone, using the combined test with the addition of serum PlGF and AFP and using the combined test with the addition of PlGF, AFP and DV-PIV, respectively. Effective first-trimester screening for trisomy 21, with DR of 98% and invasive testing rate < 0.5%, can be potentially achieved by contingent screening incorporating biomarkers and cfDNA testing. Copyright © 2013 ISUOG. Published by John Wiley & Sons, Ltd.

  7. State of the art in non-animal approaches for skin sensitization testing: from individual test methods towards testing strategies.

    Science.gov (United States)

    Ezendam, Janine; Braakhuis, Hedwig M; Vandebriel, Rob J

    2016-12-01

    The hazard assessment of skin sensitizers relies mainly on animal testing, but much progress is made in the development, validation and regulatory acceptance and implementation of non-animal predictive approaches. In this review, we provide an update on the available computational tools and animal-free test methods for the prediction of skin sensitization hazard. These individual test methods address mostly one mechanistic step of the process of skin sensitization induction. The adverse outcome pathway (AOP) for skin sensitization describes the key events (KEs) that lead to skin sensitization. In our review, we have clustered the available test methods according to the KE they inform: the molecular initiating event (MIE/KE1)-protein binding, KE2-keratinocyte activation, KE3-dendritic cell activation and KE4-T cell activation and proliferation. In recent years, most progress has been made in the development and validation of in vitro assays that address KE2 and KE3. No standardized in vitro assays for T cell activation are available; thus, KE4 cannot be measured in vitro. Three non-animal test methods, addressing either the MIE, KE2 or KE3, are accepted as OECD test guidelines, and this has accelerated the development of integrated or defined approaches for testing and assessment (e.g. testing strategies). The majority of these approaches are mechanism-based, since they combine results from multiple test methods and/or computational tools that address different KEs of the AOP to estimate skin sensitization potential and sometimes potency. Other approaches are based on statistical tools. Until now, eleven different testing strategies have been published, the majority using the same individual information sources. Our review shows that some of the defined approaches to testing and assessment are able to accurately predict skin sensitization hazard, sometimes even more accurate than the currently used animal test. A few defined approaches are developed to provide an

  8. Belgian recommendations on ANA, anti-dsDNA and anti-ENA antibody testing.

    Science.gov (United States)

    Van Blerk, M; Bossuyt, X; Humbel, R; Mewis, A; Servais, G; Tomasi, J P; Van Campenhout, C; Van Hoovels, L; Vercammen, M; Damoiseaux, J; Coucke, W; Van de Walle, P

    2014-04-01

    Autoantibodies to nuclear antigens, i.e. antinuclear antibodies (ANA), antibodies to double-stranded DNA (dsDNA) and extractable nuclear antigens (ENA), are useful as diagnostic markers for a variety of autoimmune diseases. In March 2010, the Belgian national External Quality Assessment Scheme sent a questionnaire on ANA, anti-dsDNA and anti-ENA antibody testing designed by the Dutch EASI (European Autoimmunity Standardization Initiative) team, to all clinical laboratories performing ANA testing. Virtually all laboratories completed the questionnaire (97·7%, 127/130). This paper discusses the results of this questionnaire and provides valuable information on the state-of-the-art of ANA, anti-dsDNA and anti-ENA antibody testing as practiced in the Belgian laboratories. In addition, this work presents practical recommendations developed by the members of the advisory board of the scheme as a result of the outcome of this study.

  9. Nanostructured SERS-electrochemical biosensors for testing of anticancer drug interactions with DNA.

    Science.gov (United States)

    Ilkhani, Hoda; Hughes, Taylor; Li, Jing; Zhong, Chuan Jian; Hepel, Maria

    2016-06-15

    Widely used anti-cancer treatments involving chemotherapeutic drugs result in cancer cell damage due to their strong interaction with DNA. In this work, we have developed laboratory biosensors for screening chemotherapeutic drugs and to aid in the assessment of DNA modification/damage caused by these drugs. The sensors utilize surface-enhanced Raman scattering (SERS) spectroscopy and electrochemical methods to monitor sensory film modification and observe the drug-DNA reactivity. The self-assembled monolayer protected gold-disk electrode (AuDE) was coated with a reduced graphene oxide (rGO), decorated with plasmonic gold-coated Fe2Ni@Au magnetic nanoparticles functionalized with double-stranded DNA (dsDNA), a sequence of the breast cancer gene BRCA1. The nanobiosensors AuDE/SAM/rGO/Fe2Ni@Au/dsDNA were then subjected to the action of a model chemotherapeutic drug, doxorubicin (DOX), to assess the DNA modification and its dose dependence. The designed novel nanobiosensors offer SERS/electrochemical transduction, enabling chemically specific and highly sensitive analytical signals generation. The SERS measurements have corroborated the DOX intercalation into the DNA duplex whereas the electrochemical scans have indicated that the DNA modification by DOX proceeds in a concentration dependent manner, with limit of detection LOD=8 µg/mL (S/N=3), with semilog linearity over 3 orders of magnitude. These new biosensors are sensitive to agents that interact with DNA and facilitate the analysis of functional groups for determination of the binding mode. The proposed nanobiosensors can be applied in the first stage of the drug development for testing the interactions of new drugs with DNA before the drug efficacy can be assessed in more expensive testing in vitro and in vivo.

  10. Locating hybrid individuals in the red wolf (Canis rufus) experimental population area using a spatially targeted sampling strategy and faecal DNA genotyping.

    Science.gov (United States)

    Adams, Jennifer R; Lucash, Chris; Schutte, Leslie; Waits, Lisette P

    2007-05-01

    Hybridization with coyotes (Canis latrans) continues to threaten the recovery of endangered red wolves (Canis rufus) in North Carolina and requires the development of new strategies to detect and remove coyotes and hybrids. Here, we combine a spatially targeted faecal collection strategy with a previously published reference genotype data filtering method and a genetic test for coyote ancestry to screen portions of the red wolf experimental population area for the presence of nonred wolf canids. We also test the accuracy of our maximum-likelihood assignment test for identifying hybrid individuals using eight microsatellite loci instead of the original 18 loci and compare its performance to the Bayesian approach implemented in newhybrids. We obtained faecal DNA genotypes for 89 samples, 73 of which were matched to 23 known individuals. The performance of two sampling strategies - comprehensive sweep and opportunistic spot-check was evaluated. The opportunistic spot-check sampling strategy required less effort than the comprehensive sweep sampling strategy but identified fewer individuals. Six hybrids or coyotes were detected and five of these individuals were subsequently captured and removed from the population. The accuracy and power of the genetic test for coyote ancestry is decreased when using eight loci; however, nonred wolf canids are identified with high frequency. This combination of molecular and traditional field-based approaches has great potential for addressing the challenge of hybridization in other species and ecosystems.

  11. Effects of a test taking strategy on postsecondary computer assisted chemistry assessments

    Science.gov (United States)

    Manco, Sharon Ann

    Metacognitive test taking strategies have proven advantageous in improving content-based test scores in a wide variety of disciplines and age/grade levels using traditional paper-and-pencil tests. However, despite the increase in computer assisted assessment (CAA), little research has examined whether these test taking strategies are effective for computer assisted tests. Research was conducted to determine if learning a proven test taking strategy would improve the online quiz scores of six university students in an introductory chemistry course intended for science, technology, engineering and math majors. Participants completed six to ten chemistry quizzes prior to intervention---learning the test taking strategy---and four to eight chemistry quizzes after intervention. Results indicated that, while students learned the strategy, it had little effect on their online chemistry quiz scores. Additionally, at the end of the semester, participants completed a satisfaction survey indicating general satisfaction with having learned the test taking strategy and generalization to other courses and types of tests. Furthermore, results suggest that adaptations to the on-line delivery method of the quizzes and to the test taking strategies may improve the robustness of the effect. Due to the increased use of computer assisted assessment, additional research is warranted to determine appropriate test taking strategies for online tests.

  12. The Testing Effect: Illustrating a Fundamental Concept and Changing Study Strategies

    Science.gov (United States)

    Einstein, Gilles O.; Mullet, Hillary G.; Harrison, Tyler L.

    2012-01-01

    An important recent finding is that testing improves learning and memory. In this article, the authors describe a demonstration that illustrates this principle and helps students incorporate more testing into their learning. The authors asked students to read one text using a Study-Study strategy and one text using a Study-Test strategy. One week…

  13. An adaptive, object oriented strategy for base calling in DNA sequence analysis.

    Science.gov (United States)

    Giddings, M C; Brumley, R L; Haker, M; Smith, L M

    1993-01-01

    An algorithm has been developed for the determination of nucleotide sequence from data produced in fluorescence-based automated DNA sequencing instruments employing the four-color strategy. This algorithm takes advantage of object oriented programming techniques for modularity and extensibility. The algorithm is adaptive in that data sets from a wide variety of instruments and sequencing conditions can be used with good results. Confidence values are provided on the base calls as an estimate of accuracy. The algorithm iteratively employs confidence determinations from several different modules, each of which examines a different feature of the data for accurate peak identification. Modules within this system can be added or removed for increased performance or for application to a different task. In comparisons with commercial software, the algorithm performed well. Images PMID:8233787

  14. Early Adoption of a Multitarget Stool DNA Test for Colorectal Cancer Screening.

    Science.gov (United States)

    Finney Rutten, Lila J; Jacobson, Robert M; Wilson, Patrick M; Jacobson, Debra J; Fan, Chun; Kisiel, John B; Sweetser, Seth; Tulledge-Scheitel, Sidna M; St Sauver, Jennifer L

    2017-05-01

    To characterize early adoption of a novel multitarget stool DNA (MT-sDNA) screening test for colorectal cancer (CRC) screening and to test the hypothesis that adoption differs by demographic characteristics and prior CRC screening behavior and proceeds predictably over time. We used the Rochester Epidemiology Project research infrastructure to assess the use of the MT-sDNA screening test in adults aged 50 to 75 years living in Olmsted County, Minnesota, in 2014 and identified 27,147 individuals eligible or due for screening colonoscopy from November 1, 2014, through November 30, 2015. We used electronic Current Procedure Terminology and Health Care Common Procedure codes to evaluate early adoption of the MT-sDNA screening test in this population and to test whether early adoption varies by age, sex, race, and prior CRC screening behavior. Overall, 2193 (8.1%) and 974 (3.6%) individuals were screened by colonoscopy and MT-sDNA, respectively. Age, sex, race, and prior CRC screening behavior were significantly and independently associated with MT-sDNA screening use compared with colonoscopy use after adjustment for all other variables (Pscreening increased over time and were highest in those aged 50 to 54 years, women, whites, and those who had a history of screening. The use of the MT-sDNA screening test varied predictably by insurance coverage. The rates of colonoscopy decreased over time, whereas overall CRC screening rates remained steady. The results of the present study are generally consistent with predictions derived from prior research and the diffusion of innovation framework, pointing to increasing use of the new screening test over time and early adoption by younger patients, women, whites, and those with prior CRC screening. Copyright © 2017 Mayo Foundation for Medical Education and Research. Published by Elsevier Inc. All rights reserved.

  15. Graphene-Assisted Label-Free Homogeneous Electrochemical Biosensing Strategy based on Aptamer-Switched Bidirectional DNA Polymerization.

    Science.gov (United States)

    Wang, Wenxiao; Ge, Lei; Sun, Ximei; Hou, Ting; Li, Feng

    2015-12-30

    In this contribution, taking the discrimination ability of graphene over single-stranded (ss) DNA/double-stranded (ds) DNA in combination with the electrochemical impedance transducer, we developed a novel label-free homogeneous electrochemical biosensor using graphene-modified glassy carbon electrode (GCE) as the sensing platform. To convert the specific aptamer-target recognition into ultrasensitive electrochemical signal output, a novel aptamer-switched bidirectional DNA polymerization (BDP) strategy, capable of both target recycling and exponential signal amplification, was compatibly developed in this study. In this strategy, all the designed DNA structures could be adsorbed on the graphene/GCE and, thus, serve as the electrochemical impedance signal reporter, while the target acts as a trigger of this BDP reaction, in which these designed DNA structures are bound together and, then, converted to long dsDNA duplex. The distinct difference in electrochemical impedance spectroscopy between the designed structures and generated long dsDNA duplex on the graphene/GCE allows label-free and homogeneous detection of target down to femto-gram level. The target can be displaced from aptamer through the polymerization to initiate the next recognition-polymerization cycle. Herein, the design and signaling principle of aptamer-switched BDP amplification system were elucidated, and the working conditions were optimized. This method not only provides a universal platform for electrochemical biosensing but also shows great potential in biological process researches and clinic diagnostics.

  16. Bioinformatics Approaches for Fetal DNA Fraction Estimation in Noninvasive Prenatal Testing

    Directory of Open Access Journals (Sweden)

    Xianlu Laura Peng

    2017-02-01

    Full Text Available The discovery of cell-free fetal DNA molecules in plasma of pregnant women has created a paradigm shift in noninvasive prenatal testing (NIPT. Circulating cell-free DNA in maternal plasma has been increasingly recognized as an important proxy to detect fetal abnormalities in a noninvasive manner. A variety of approaches for NIPT using next-generation sequencing have been developed, which have been rapidly transforming clinical practices nowadays. In such approaches, the fetal DNA fraction is a pivotal parameter governing the overall performance and guaranteeing the proper clinical interpretation of testing results. In this review, we describe the current bioinformatics approaches developed for estimating the fetal DNA fraction and discuss their pros and cons.

  17. Testing the feasibility of DNA typing for human identification by PCR and an oligonucleotide ligation assay

    Energy Technology Data Exchange (ETDEWEB)

    Delahunty, C.; Ankener, W.; Deng, Qiang [Univ. of Washington, Seattle, WA (United States)] [and others

    1996-06-01

    The use of DNA typing in human genome analysis is increasing and finding widespread application in the area of forensic and paternity testing. In this report, we explore the feasibility of typing single nucleotide polymorphisms (SNPs) by using a semiautomated method for analyzing human DNA samples. In this approach, PCR is used to amplify segments of human DNA containing a common SNP. Allelic nucleotides in the amplified product are then typed by a calorimetric implementation of the oligonucleotide ligation assay (OLA). The results of the combined assay, PCR/OLA, are read directly by a spectrophotometer; the absorbances are compiled and the genotypes are automatically determined. A panel of 20 markers has been developed for DNA typing and has been tested using a sample panel from the CEPH pedigrees (CEPH parents). The results of this typing, as well as the potential to apply this method to larger populations, are discussed. 62 refs., 2 figs., 4 tabs.

  18. A likelihood ratio test for species membership based on DNA sequence data

    DEFF Research Database (Denmark)

    Matz, Mikhail V.; Nielsen, Rasmus

    2005-01-01

    DNA barcoding as an approach for species identification is rapidly increasing in popularity. However, it remains unclear which statistical procedures should accompany the technique to provide a measure of uncertainty. Here we describe a likelihood ratio test which can be used to test if a sampled...... sequence is a member of an a priori specified species. We investigate the performance of the test using coalescence simulations, as well as using the real data from butterflies and frogs representing two kinds of challenge for DNA barcoding: extremely low and extremely high levels of sequence variability....

  19. Comparative testing of DNA segmentation algorithms using benchmark simulations.

    Science.gov (United States)

    Elhaik, Eran; Graur, Dan; Josic, Kresimir

    2010-05-01

    Numerous segmentation methods for the detection of compositionally homogeneous domains within genomic sequences have been proposed. Unfortunately, these methods yield inconsistent results. Here, we present a benchmark consisting of two sets of simulated genomic sequences for testing the performances of segmentation algorithms. Sequences in the first set are composed of fixed-sized homogeneous domains, distinct in their between-domain guanine and cytosine (GC) content variability. The sequences in the second set are composed of a mosaic of many short domains and a few long ones, distinguished by sharp GC content boundaries between neighboring domains. We use these sets to test the performance of seven segmentation algorithms in the literature. Our results show that recursive segmentation algorithms based on the Jensen-Shannon divergence outperform all other algorithms. However, even these algorithms perform poorly in certain instances because of the arbitrary choice of a segmentation-stopping criterion.

  20. Strategies for Ground Based Testing of Manned Lunar Surface Systems

    Science.gov (United States)

    Beyer, Jeff; Peacock, Mike; Gill, Tracy

    2009-01-01

    Integrated testing (such as Multi-Element Integrated Test (MEIT)) is critical to reducing risks and minimizing problems encountered during assembly, activation, and on-orbit operation of large, complex manned spacecraft. Provides the best implementation of "Test Like You Fly:. Planning for integrated testing needs to begin at the earliest stages of Program definition. Program leadership needs to fully understand and buy in to what integrated testing is and why it needs to be performed. As Program evolves and design and schedules mature, continually look for suitable opportunities to perform testing where enough components are together in one place at one time. The benefits to be gained are well worth the costs.

  1. 78 FR 29698 - Availability of an Environmental Assessment for Field Testing a Canine Lymphoma Vaccine, DNA

    Science.gov (United States)

    2013-05-21

    ... Service has prepared an environmental assessment concerning authorization to ship for the purpose of field testing, and then to field test, an unlicensed Canine Lymphoma Vaccine, DNA. The environmental assessment... Animal and Plant Health Inspection Service Availability of an Environmental Assessment for Field...

  2. Concepts, tools, and strategies for effluent testing: An international survey

    Science.gov (United States)

    Whole effluent testing (also called Direct Toxicity Assessment) remains a critical long-term assessment tool for aquatic environmental protection. Use of animal alternative approaches for wastewater testing is expected to increase as more regulatory authorities routinely require ...

  3. Testing - Smart strategy for safety and mission quality

    Science.gov (United States)

    Rodney, George A.

    The paper is concerned with the need for a comprehensive test plan for the Space Station Freedom (SST) that would fully verify specification compliance and be based on an error budget. In particular, attention is given to some lessons learned from other NASA programs and the principal challenges for SSF testing, including phase C/D/E agreements, testing parameters, phase testing, and the human element. The importance of close teamwork between the NASA/Contractor systems engineers and assurance engineers is emphasized.

  4. Teaching Posttraining : Influencing Diagnostic Strategy with Instructions at Test

    Science.gov (United States)

    Kulatunga-Moruzi, Chan; Brooks, Lee R.; Norman, Geoffrey R.

    2011-01-01

    It is believed that medical diagnosis involves two complementary processes, analytic and similarity-based. There is considerable debate as to which of these processes defines diagnostic expertise and how best to teach clinical diagnosis and reduce diagnostic errors. The purpose of these studies is to document the use of these strategies in medical…

  5. Teaching Posttraining : Influencing Diagnostic Strategy with Instructions at Test

    Science.gov (United States)

    Kulatunga-Moruzi, Chan; Brooks, Lee R.; Norman, Geoffrey R.

    2011-01-01

    It is believed that medical diagnosis involves two complementary processes, analytic and similarity-based. There is considerable debate as to which of these processes defines diagnostic expertise and how best to teach clinical diagnosis and reduce diagnostic errors. The purpose of these studies is to document the use of these strategies in medical…

  6. Mobile Software Testing: Thoughts, Strategies, Challenges, and Experimental Study

    Directory of Open Access Journals (Sweden)

    Mohammed Akour

    2016-06-01

    Full Text Available Mobile devices have become more pervasive in our daily lives, and are gradually replacing regular computers to perform traditional processes like Internet browsing, editing photos, playing videos and sound track, and reading different files. The importance of mobile devices in our life necessitates more concerns of the reliability and compatibility of mobile applications, and thus, testing these applications arises as an important phase in mobile devices adaption process. This paper addressed various research directions on mobile applications testing by investigating essential concepts, scope, features and requirements for testing mobile application. We highlight the similarities and the differences between mobile APP testing and mobile web testing. Furthermore, we discuss and compare different mobile testing approaches and environments, and provide the challenges as emergent needs in test environments. As a case study, we compared the testing experience of hybrid application in an emulator and a real world device. The purpose of the experiment is to verify to which extent a virtual device can emulate a complete client experience. Set of experiments are conducted where five android mobile browsers are tested. Each browser will be on a real device as well as an emulated device with the same features (CPU used, memory size, etc. The application will be tested on the following metrics: Performance and function/behavior testing.

  7. The Interaction between Cognitive Test-Taking Strategies, Reading Ability, and Reading Comprehension Test Performance of Iranian EFL Learners

    Science.gov (United States)

    Ghafournia, Narjes; Afghari, Akbar

    2013-01-01

    The study scrutinized the probable interaction between using cognitive test-taking strategies, reading proficiency, and reading comprehension test performance of Iranian postgraduate students, who studied English as a foreign language. The study also probed the extent to which the participants' test performance was related to the use of certain…

  8. Genetic citizenship: DNA testing and the Israeli Law of Return.

    Science.gov (United States)

    McGonigle, Ian V; Herman, Lauren W

    2015-07-01

    The Israeli State recently announced that it may begin to use genetic tests to determine whether potential immigrants are Jewish or not. This development would demand a rethinking of Israeli law on the issue of the definition of Jewishness. In this article, we discuss the historical and legal context of secular and religious definitions of Jewishness and rights to immigration in the State of Israel. We give a brief overview of different ways in which genes have been regarded as Jewish, and we discuss the relationship between this new use of genetics and the society with which it is co-produced. In conclusion, we raise several questions about future potential impacts of Jewish genetics on Israeli law and society.

  9. Testing Strategies and Methodologies for the Max Launch Abort System

    Science.gov (United States)

    Schaible, Dawn M.; Yuchnovicz, Daniel E.

    2011-01-01

    The National Aeronautics and Space Administration (NASA) Engineering and Safety Center (NESC) was tasked to develop an alternate, tower-less launch abort system (LAS) as risk mitigation for the Orion Project. The successful pad abort flight demonstration test in July 2009 of the "Max" launch abort system (MLAS) provided data critical to the design of future LASs, while demonstrating the Agency s ability to rapidly design, build and fly full-scale hardware at minimal cost in a "virtual" work environment. Limited funding and an aggressive schedule presented a challenge for testing of the complex MLAS system. The successful pad abort flight demonstration test was attributed to the project s systems engineering and integration process, which included: a concise definition of, and an adherence to, flight test objectives; a solid operational concept; well defined performance requirements, and a test program tailored to reducing the highest flight test risks. The testing ranged from wind tunnel validation of computational fluid dynamic simulations to component ground tests of the highest risk subsystems. This paper provides an overview of the testing/risk management approach and methodologies used to understand and reduce the areas of highest risk - resulting in a successful flight demonstration test.

  10. Design of a testing strategy using non-animal based test methods: lessons learnt from the ACuteTox project.

    Science.gov (United States)

    Kopp-Schneider, Annette; Prieto, Pilar; Kinsner-Ovaskainen, Agnieszka; Stanzel, Sven

    2013-06-01

    In the framework of toxicology, a testing strategy can be viewed as a series of steps which are taken to come to a final prediction about a characteristic of a compound under study. The testing strategy is performed as a single-step procedure, usually called a test battery, using simultaneously all information collected on different endpoints, or as tiered approach in which a decision tree is followed. Design of a testing strategy involves statistical considerations, such as the development of a statistical prediction model. During the EU FP6 ACuteTox project, several prediction models were proposed on the basis of statistical classification algorithms which we illustrate here. The final choice of testing strategies was not based on statistical considerations alone. However, without thorough statistical evaluations a testing strategy cannot be identified. We present here a number of observations made from the statistical viewpoint which relate to the development of testing strategies. The points we make were derived from problems we had to deal with during the evaluation of this large research project. A central issue during the development of a prediction model is the danger of overfitting. Procedures are presented to deal with this challenge. Copyright © 2012 Elsevier Ltd. All rights reserved.

  11. Development of an efficient process intensification strategy for enhancing Pfu DNA polymerase production in recombinant Escherichia coli.

    Science.gov (United States)

    Hu, Jian-Hua; Wang, Feng; Liu, Chun-Zhao

    2015-04-01

    An efficient induction strategy that consisted of multiple additions of small doses of isopropyl-β-D-thiogalactopyranoside (IPTG) in the early cell growth phase was developed for enhancing Pfu DNA polymerase production in Escherichia coli. In comparison to the most commonly used method of a single induction of 1 mM IPTG, the promising induction strategy resulted in an increase in the Pfu activity of 13.5% in shake flasks, while simultaneously decreasing the dose of IPTG by nearly half. An analysis of the intracellular IPTG concentrations indicated that the cells need to maintain an optimum intracellular IPTG concentration after 6 h for efficient Pfu DNA polymerase production. A significant increase in the Pfu DNA polymerase activity of 31.5% under the controlled dissolved oxygen concentration of 30% in a 5 L fermentor was achieved using the multiple IPTG induction strategy in comparison with the single IPTG induction. The induction strategy using multiple inputs of IPTG also avoided over accumulation of IPTG and reduced the cost of Pfu DNA polymerase production.

  12. Noninvasive Prenatal Paternity Testing (NIPAT) through Maternal Plasma DNA Sequencing: A Pilot Study.

    Science.gov (United States)

    Jiang, Haojun; Xie, Yifan; Li, Xuchao; Ge, Huijuan; Deng, Yongqiang; Mu, Haofang; Feng, Xiaoli; Yin, Lu; Du, Zhou; Chen, Fang; He, Nongyue

    2016-01-01

    Short tandem repeats (STRs) and single nucleotide polymorphisms (SNPs) have been already used to perform noninvasive prenatal paternity testing from maternal plasma DNA. The frequently used technologies were PCR followed by capillary electrophoresis and SNP typing array, respectively. Here, we developed a noninvasive prenatal paternity testing (NIPAT) based on SNP typing with maternal plasma DNA sequencing. We evaluated the influence factors (minor allele frequency (MAF), the number of total SNP, fetal fraction and effective sequencing depth) and designed three different selective SNP panels in order to verify the performance in clinical cases. Combining targeted deep sequencing of selective SNP and informative bioinformatics pipeline, we calculated the combined paternity index (CPI) of 17 cases to determine paternity. Sequencing-based NIPAT results fully agreed with invasive prenatal paternity test using STR multiplex system. Our study here proved that the maternal plasma DNA sequencing-based technology is feasible and accurate in determining paternity, which may provide an alternative in forensic application in the future.

  13. Value and Feasibility of HPV DNA Test in Cervical Scraping Smears

    Institute of Scientific and Technical Information of China (English)

    WU Sufang; LIAO Guoning; MA Ding; CHEN Gang; WANG Wei; XU Qian; GU Hainian; LU Yunping; ZHOU Liping; DU Juan; LI Fujun

    2005-01-01

    To investigate the reliability and feasibility of human papillomavirus (HPV) DNA test in cervical scraping smears with polymerase chain reaction (PCR), 131 cases of cervical scraping specimens were collected, and the positive rates and accuracy of HPV infection were determined in normal subjects and cervical cancer patients. GP5+/GP6+ and E7 primer pairs designed for detecting HPV L1 and HPV type 16 E7 were tested in this study. Our results showed that positive rates of HPV DNA in normal population and cervical cancer patients were 32.99 % and 73.53 % respectively and there was significant difference between them (P<0. 001). In normal subjects, detection rates of HPV DNA with GP5+/GP6+ and E7 primer pairs were 27.84 % and 16.49 % respectively, with statistically significant difference between them (P>0.05). However the detection rates in cervical cancer patients were 38.24 % and 67.65 % for the two markers, with a significant difference found between them (P<0.05). It is concluded that HPV DNA test with PCR for cervical scraping smears was feasible. GP5+/GP6+ primer pairs may be a useful probe to screen HPV infection in normal population, but they are not sensitive enough in cervical cancer patients. It is suggested that high risk type HPV DNA test was very useful in population with high risk of cervical cancer.

  14. A covalent and cleavable antibody-DNA conjugation strategy for sensitive protein detection via immuno-PCR

    Science.gov (United States)

    van Buggenum, Jessie A. G. L.; Gerlach, Jan P.; Eising, Selma; Schoonen, Lise; van Eijl, Roderick A. P. M.; Tanis, Sabine E. J.; Hogeweg, Mark; Hubner, Nina C.; van Hest, Jan C.; Bonger, Kimberly M.; Mulder, Klaas W.

    2016-01-01

    Immuno-PCR combines specific antibody-based protein detection with the sensitivity of PCR-based quantification through the use of antibody-DNA conjugates. The production of such conjugates depends on the availability of quick and efficient conjugation strategies for the two biomolecules. Here, we present an approach to produce cleavable antibody-DNA conjugates, employing the fast kinetics of the inverse electron-demand Diels-Alder reaction between tetrazine and trans-cyclooctene (TCO). Our strategy consists of three steps. First, antibodies are functionalized with chemically cleavable NHS-s-s-tetrazine. Subsequently, double-stranded DNA is functionalized with TCO by enzymatic addition of N3-dATP and coupling to trans-Cyclooctene-PEG12-Dibenzocyclooctyne (TCO-PEG12-DBCO). Finally, conjugates are quickly and efficiently obtained by mixing the functionalized antibodies and dsDNA at low molar ratios of 1:2. In addition, introduction of a chemically cleavable disulphide linker facilitates release and sensitive detection of the dsDNA after immuno-staining. We show specific and sensitive protein detection in immuno-PCR for human epidermal stem cell markers, ITGA6 and ITGB1, and the differentiation marker Transglutaminase 1 (TGM1). We anticipate that the production of chemically cleavable antibody-DNA conjugates will provide a solid basis for the development of multiplexed immuno-PCR experiments and immuno-sequencing methodologies. PMID:26947912

  15. An Investigation of the Learning Strategies as Bias Factors in Second Language Cloze Tests

    Science.gov (United States)

    Ajideh, Parviz; Yaghoubi-Notash, Massoud; Khalili, Abdolreza

    2017-01-01

    The present study investigated the contribution of the EFL students' learning strategies to the explanation of the variance in their results on language tests. More specifically, it examined the role of these strategies as bias factors in the results of English cloze tests. Based on this aim, first, 158 intermediate EFL learners were selected from…

  16. Automated detection of test fixture strategies and smells

    NARCIS (Netherlands)

    Greiler, M.S.; Van Deursen, A.; Storey, M.-A.

    2013-01-01

    Paper accepted for publication in the Proceedings of the Sixth International Conference on Software Testing, Verification and Validation, IEEE Computer Society, 18-22 March 2013, ISBN 978-1-4673-5961-0, doi: 10.1109/ICST.2013.45 Designing automated tests is a challenging task. One important concern

  17. Automated detection of test fixture strategies and smells

    NARCIS (Netherlands)

    Greiler, M.S.; Van Deursen, A.; Storey, M.-A.

    2013-01-01

    Paper accepted for publication in the Proceedings of the Sixth International Conference on Software Testing, Verification and Validation, IEEE Computer Society, 18-22 March 2013, ISBN 978-1-4673-5961-0, doi: 10.1109/ICST.2013.45 Designing automated tests is a challenging task. One important concern

  18. Polymorphisms in the CAG repeat--a source of error in Huntington disease DNA testing.

    Science.gov (United States)

    Yu, S; Fimmel, A; Fung, D; Trent, R J

    2000-12-01

    Five of 400 patients (1.3%), referred for Huntington disease DNA testing, demonstrated a single allele on CAG alone, but two alleles when the CAG + CCG repeats were measured. The PCR assay failed to detect one allele in the CAG alone assay because of single-base silent polymorphisms in the penultimate or the last CAG repeat. The region around and within the CAG repeat sequence in the Huntington disease gene is a hot-spot for DNA polymorphisms, which can occur in up to 1% of subjects tested for Huntington disease. These polymorphisms may interfere with amplification by PCR, and so have the potential to produce a diagnostic error.

  19. Practical aspects of mutagenicity testing strategy: an industrial perspective.

    Science.gov (United States)

    Gollapudi, B B; Krishna, G

    2000-11-20

    Genetic toxicology studies play a central role in the development and marketing of new chemicals for pharmaceutical, agricultural, industrial, and consumer use. During the discovery phase of product development, rapid screening tests that require minimal amounts of test materials are used to assist in the design and prioritization of new molecules. At this stage, a modified Salmonella reverse mutation assay and an in vitro micronucleus test with mammalian cell culture are frequently used for screening. Regulatory genetic toxicology studies are conducted with a short list of compounds using protocols that conform to various international guidelines. A set of four assays usually constitutes the minimum test battery that satisfies global requirements. This set includes a bacterial reverse mutation assay, an in vitro cytogenetic test with mammalian cell culture, an in vitro gene mutation assay in mammalian cell cultures, and an in vivo rodent bone marrow micronucleus test. Supplementary studies are conducted in certain instances either as a follow-up to the findings from this initial testing battery and/or to satisfy a regulatory requirement. Currently available genetic toxicology assays have helped the scientific and industrial community over the past several decades in evaluating the mutagenic potential of chemical agents. The emerging field of toxicogenomics has the potential to redefine our ability to study the response of cells to genetic damage and hence our ability to study threshold phenomenon.

  20. Adaptive and qualitative changes in encoding strategy with experience: evidence from the test-expectancy paradigm.

    Science.gov (United States)

    Finley, Jason R; Benjamin, Aaron S

    2012-05-01

    Three experiments demonstrated learners' abilities to adaptively and qualitatively accommodate their encoding strategies to the demands of an upcoming test. Stimuli were word pairs. In Experiment 1, test expectancy was induced for either cued recall (of targets given cues) or free recall (of targets only) across 4 study-test cycles of the same test format, followed by a final critical cycle featuring either the expected or the unexpected test format. For final tests of both cued and free recall, participants who had expected that test format outperformed those who had not. This disordinal interaction, supported by recognition and self-report data, demonstrated not mere differences in effort based on anticipated test difficulty, but rather qualitative and appropriate differences in encoding strategies based on expected task demands. Participants also came to appropriately modulate metacognitive monitoring (Experiment 2) and study-time allocation (Experiment 3) across study-test cycles. Item and associative recognition performance, as well as self-report data, revealed shifts in encoding strategies across trials; these results were used to characterize and evaluate the different strategies that participants employed for cued versus free recall and to assess the optimality of participants' metacognitive control of encoding strategies. Taken together, these data illustrate a sophisticated form of metacognitive control, in which learners qualitatively shift encoding strategies to match the demands of anticipated tests.

  1. Detection of Human Papillomavirus DNA by AffiProbe HPV-DNA Test Kit in Cervical Scrapes or Biopsies-Histopathologic Correlates

    OpenAIRE

    Pekka Nieminen; Tarja Jalava; Arja Kallio; Marjut Ranki; Jorma Paavonen

    1994-01-01

    Objective: The aim of this study was to evaluate and compare the efficacy of punch biopsies and cervical scrapes in the detection of human papillomavirus (HPV) DNA from the cervix and compare the results with the histopathologic diagnosis. Methods: The specimens were collected simultaneously, and HPV DNA was detected using a liquid hybridization test. Results: Biopsies and scrapes were equally efficient, but each detected only two-thirds of all HPV-DNA-positive patients. Thus, the positivity ...

  2. submitter Test strategies for industrial testers for converter controls equipment

    CERN Document Server

    Oleniuk, P; Kasampalis, V; Nisbet, D; Todd, B; Uznański, S

    2017-01-01

    Power converters and their controls electronics are key elements for the operation of the CERN accelerator complex, having a direct impact on its availability. To prevent early-life failures and provide means to verify electronics, a set of industrial testers is used throughout the converters controls electronics' life cycle. The roles of the testers are to validate mass production during the manufacturing phase and to provide means to diagnose and repair failed modules that are brought back from operation. In the converter controls electronics section of the power converters group in the technology department of CERN (TE/EPC/CCE), two main test platforms have been adopted: a PXI platform for mixed analogue-digital functional tests and a JTAG Boundary-Scan platform for digital interconnection and functional tests. Depending on the functionality of the device under test, the appropriate test platforms are chosen. This paper is a follow-up to results presented at the TWEPP 2015 conference, adding the boundary s...

  3. Impulsivity and Speed-Accuracy Strategies in Intelligence Test Performance.

    Science.gov (United States)

    Phillips, Louise H.; Rabbitt, Patrick M. A.

    1995-01-01

    Whether relations between intelligence test performance and information processing measures depend on individual differences in speed-accuracy preferences rather than capacity limitations and whether the impact of strategic variables changes with increasing age or extraversion was studied with 83 adults ages 50 to 79 years. Results are discussed…

  4. Alternative testing strategies for predicting developmental toxicity of antifungal compound

    NARCIS (Netherlands)

    Li, H.

    2016-01-01

    Determination of safe human exposure levels of chemicals in toxicological risk assessments largely relies on animal toxicity data. In these toxicity studies, the highest number of animals are used for reproductive and developmental toxicity testing. Because of economic and ethical reasons, there is

  5. Pilot Test of an Innovative Interprofessional Education Assessment Strategy

    Science.gov (United States)

    Emmert, Michelle Christine

    2011-01-01

    The primary goal of this study was to test an innovative way of assessing students' teamwork skills in a controlled environment. Twenty-four second year students from Western University of Health Sciences (WesternU) participated in the experimental group and 22 third year students from WesternU participated in the control group. Students in the…

  6. Uptake of genetic counselling and predictive DNA testing in hypertrophic cardiomyopathy

    NARCIS (Netherlands)

    Christiaans, Imke; Birnie, Erwin; Bonsel, Gouke J.; Wilde, Arthur A.M.; van Langen, Irene M.

    2008-01-01

    Hypertrophic cardiomyopathy is a common autosomal dominant disease, associated with heart failure and arrhythmias predisposing to sudden cardiac death. After the detection of the causal mutation in the proband predictive DNA testing of relatives is possible (cascade screening). Prevention of sudden

  7. VHDL-AMS fault simulation for testing DNA bio-sensing arrays

    NARCIS (Netherlands)

    Kerkhoff, H.G.; Zhang, X.; Liu, H.; Richardson, A.; Nouet, P.; Azais, F.; Zhang, Xiao

    2005-01-01

    The market of microelectronic fluidic arrays for biomedical applications, like DNA determination, is rapidly increasing. In order to evaluate these systems in terms of required design-for-test structures, fault simulations in both fluidic and electronic domains are necessary. VHDL-AMS can be used su

  8. Should sperm DNA fragmentation testing be included in the male infertility work-up?

    Science.gov (United States)

    Lewis, Sheena E M

    2015-08-01

    A response to the editorial 'Are we ready to incorporate sperm DNA fragmentation testing into our male infertility work-up? A plea for more robust studies' by Erma Drobnis and Martin Johnson. Copyright © 2015 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.

  9. Second Language Reading Topic Familiarity and Test Score: Test-Taking Strategies for Multiple-Choice Comprehension Questions

    Science.gov (United States)

    Lee, Jia-Ying

    2011-01-01

    The main purpose of this study was to compare the strategies used by Chinese-speaking students when confronted with familiar versus unfamiliar topics in a multiple-choice format reading comprehension test. The focus was on describing what students do when they are taking reading comprehension tests by asking students to verbalize their thoughts.…

  10. DNA-testing for BRCA1/2 prior to genetic counselling in patients with breast cancer: design of an intervention study, DNA-direct

    NARCIS (Netherlands)

    Sie, A.S.; Spruijt, L.; Zelst-Stams, W.A. van; Mensenkamp, A.R.; Ligtenberg, M.J.L.; Brunner, H.G.; Prins, J.B.; Hoogerbrugge-van der Linden, N.

    2012-01-01

    BACKGROUND: Current practice for patients with breast cancer referred for genetic counseling, includes face-to-face consultations with a genetic counselor prior to and following DNA-testing. This is based on guidelines regarding Huntington's disease in anticipation of high psychosocial impact of DNA

  11. Clinical significance of HPV-DNA testing for precancerous cervical lesionS

    OpenAIRE

    Moarcăs, M; Georgescu, IC; Brătilă, E; Badea, M.; Cîrstoiu, ECM

    2014-01-01

    Cervical screening by using cytology was proven efficient in reducing the mortality secondary to cervical cancer, but this method has limitations. High risk HPV infection is essential for cervical cancer development so HPV testing is a new tool used for screening patients for cervical neoplasia. HPV testing was proven most useful for women over 30 years old, in cases in which cytology identified ASC-US and after treatment for CIN. This article outlines the clinical significance of HPV-DNA tes...

  12. Uniparental disomy in Robertsonian translocations: strategies for uniparental disomy testing.

    Science.gov (United States)

    Yip, Moh-Ying

    2014-04-01

    Robertsonian translocations (ROBs) are whole arm rearrangements involving the acrocentric chromosomes 13-15 and 21-22 and carriers are at increased risk for aneuploidy and thus uniparental disomy (UPD). Chromosomes 14 and 15 are imprinted with expression of genes dependent on the parental origin of the chromosome. Correction of a trisomic or monosomic conceptus for chromosomes 14 or 15 would lead to one of the established UPD 14mat/pat or UPD 15 (Prader-Willi/Angelman) syndromes (PWS/AS). In view of this, prenatal UPD testing should be considered for balanced carriers of a ROB, fetuses with a familial or de novo balanced ROB that contains chromosome 14 or 15 or with a normal karyotype when a parent is a carrier of a balanced ROB with a 14 or 15. Individuals with congenital anomalies and an abnormal phenotype and carry a ROB involving the two imprinted chromosomes should also be UPD tested.

  13. Cross-Cloud Testing Strategies Over Cloud Computing

    Directory of Open Access Journals (Sweden)

    Mr. Nageswararao,

    2014-06-01

    Full Text Available Cloud computing is the new paradigm to deliver all the hosted services over internet on demand. The ultimate goal of cloud computing paradigm is to realize computing as a utility. The cloud is rapidly maturing towards its goal to support a wide variety of enterprise and consumer services and real-world applications. Recently a movement towards cross cloud also called as multi-clouds or inters clouds or cloud-of-clouds has emerged which take advantage of multiple independent cloud provider offers for cloud resilience and dependability. This cross cloud represents the next logical wave in computing, enabling complex hybrid applications, cost and performance optimization, enhanced reliability, customer flexibility and lock-in avoidance. Providing testing as a service (TaaS in cross clouds become hot topics in industry. Testing heterogeneous e-commerce sites, Software as a Service solutions, and Cloud based applications is extremely challenging.

  14. Novel Preclinical Testing Strategies for Treatment of Metastatic Pheochromocytoma

    Science.gov (United States)

    2014-09-01

    21285984; PubMed Central PMCID: PMC3049604. 3. Lin G, Hill DK, Andrejeva G, Boult JK, Troy H, Fong AC, et al. Dichloroacetate induces autophagy in...testing. Author Contributions Conceived and designed the experiments: JFP AST GGS. Performed the experiments: JFP PGK SF AG. Analyzed the data: JFP PGK...GGS AST. Contributed reagents/materials/analysis tools: SF AG KP GGS. Wrote the paper: JFP AST KP GGS. References 1. DeLellis RA, Lloyd RV, Heitz PU

  15. AOF LTAO mode: reconstruction strategy and first test results

    Science.gov (United States)

    Oberti, Sylvain; Kolb, Johann; Le Louarn, Miska; La Penna, Paolo; Madec, Pierre-Yves; Neichel, Benoit; Sauvage, Jean-François; Fusco, Thierry; Donaldson, Robert; Soenke, Christian; Suárez Valles, Marcos; Arsenault, Robin

    2016-07-01

    GALACSI is the Adaptive Optics (AO) system serving the instrument MUSE in the framework of the Adaptive Optics Facility (AOF) project. Its Narrow Field Mode (NFM) is a Laser Tomography AO (LTAO) mode delivering high resolution in the visible across a small Field of View (FoV) of 7.5" diameter around the optical axis. From a reconstruction standpoint, GALACSI NFM intends to optimize the correction on axis by estimating the turbulence in volume via a tomographic process, then projecting the turbulence profile onto one single Deformable Mirror (DM) located in the pupil, close to the ground. In this paper, the laser tomographic reconstruction process is described. Several methods (virtual DM, virtual layer projection) are studied, under the constraint of a single matrix vector multiplication. The pseudo-synthetic interaction matrix model and the LTAO reconstructor design are analysed. Moreover, the reconstruction parameter space is explored, in particular the regularization terms. Furthermore, we present here the strategy to define the modal control basis and split the reconstruction between the Low Order (LO) loop and the High Order (HO) loop. Finally, closed loop performance obtained with a 3D turbulence generator will be analysed with respect to the most relevant system parameters to be tuned.

  16. Evaluation of DNA fragmentation in llama (Lama glama) sperm using the sperm chromatin dispersion test.

    Science.gov (United States)

    Carretero, M I; Lombardo, D; Arraztoa, C C; Giuliano, S M; Gambarotta, M C; Neild, D M

    2012-03-01

    The integrity of sperm chromatin is now viewed as an important factor in male fertility and in early embryonic development. The objectives of this study were: (1) adapt the simple and inexpensive sperm chromatin dispersion (SCD) test to evaluate DNA fragmentation in llama sperm and establish the halo patterns observed in this species, (2) determine an effective and reliable positive control for this technique and (3) evaluate correlation between the SCD test and the toluidine blue (TB) stain. To adapt the SCD test, three different mercaptoethanol (ME) concentrations were assayed (2.5%, 5% and 10% ME). To determine an effective positive control, three treatments (incubation at 100 °C for 30 min, incubation with 0.3 M NaOH for 30 min at room temperature and exposure to UV light for 2h) were assayed. The concentration selected to use in the SCD test was 5% ME, because it produced the largest halo while still conserving the structure of the core. Four DNA dispersion patterns were clearly observed: (I) nuclei with large DNA dispersion halos; (II) nuclei with medium halos; (III) nuclei with very small halos and (IV) nuclei with no halo. All treatments used as positive controls were effective in producing DNA fragmentation. A high correlation (r=0.84, P=0.03) was observed between spermatozoa without halos and TB positive cells. To conclude, SCD patterns in llama sperm have been established as well as a repeatable positive control for the assay. The SCD test and TB stain are simple and inexpensive techniques that can be used to evaluate DNA damage in llama sperm.

  17. Multi-purpose utility of circulating plasma DNA testing in patients with advanced cancers.

    Science.gov (United States)

    Perkins, Geraldine; Yap, Timothy A; Pope, Lorna; Cassidy, Amy M; Dukes, Juliet P; Riisnaes, Ruth; Massard, Christophe; Cassier, Philippe A; Miranda, Susana; Clark, Jeremy; Denholm, Katie A; Thway, Khin; Gonzalez De Castro, David; Attard, Gerhardt; Molife, L Rhoda; Kaye, Stan B; Banerji, Udai; de Bono, Johann S

    2012-01-01

    Tumor genomic instability and selective treatment pressures result in clonal disease evolution; molecular stratification for molecularly targeted drug administration requires repeated access to tumor DNA. We hypothesized that circulating plasma DNA (cpDNA) in advanced cancer patients is largely derived from tumor, has prognostic utility, and can be utilized for multiplex tumor mutation sequencing when repeat biopsy is not feasible. We utilized the Sequenom MassArray System and OncoCarta panel for somatic mutation profiling. Matched samples, acquired from the same patient but at different time points were evaluated; these comprised formalin-fixed paraffin-embedded (FFPE) archival tumor tissue (primary and/or metastatic) and cpDNA. The feasibility, sensitivity, and specificity of this high-throughput, multiplex mutation detection approach was tested utilizing specimens acquired from 105 patients with solid tumors referred for participation in Phase I trials of molecularly targeted drugs. The median cpDNA concentration was 17 ng/ml (range: 0.5-1600); this was 3-fold higher than in healthy volunteers. Moreover, higher cpDNA concentrations associated with worse overall survival; there was an overall survival (OS) hazard ratio of 2.4 (95% CI 1.4, 4.2) for each 10-fold increase in cpDNA concentration and in multivariate analyses, cpDNA concentration, albumin, and performance status remained independent predictors of OS. These data suggest that plasma DNA in these cancer patients is largely derived from tumor. We also observed high detection concordance for critical 'hot-spot' mutations (KRAS, BRAF, PIK3CA) in matched cpDNA and archival tumor tissue, and important differences between archival tumor and cpDNA. This multiplex sequencing assay can be utilized to detect somatic mutations from plasma in advanced cancer patients, when safe repeat tumor biopsy is not feasible and genomic analysis of archival tumor is deemed insufficient. Overall, circulating nucleic acid

  18. Multi-purpose utility of circulating plasma DNA testing in patients with advanced cancers.

    Directory of Open Access Journals (Sweden)

    Geraldine Perkins

    Full Text Available Tumor genomic instability and selective treatment pressures result in clonal disease evolution; molecular stratification for molecularly targeted drug administration requires repeated access to tumor DNA. We hypothesized that circulating plasma DNA (cpDNA in advanced cancer patients is largely derived from tumor, has prognostic utility, and can be utilized for multiplex tumor mutation sequencing when repeat biopsy is not feasible. We utilized the Sequenom MassArray System and OncoCarta panel for somatic mutation profiling. Matched samples, acquired from the same patient but at different time points were evaluated; these comprised formalin-fixed paraffin-embedded (FFPE archival tumor tissue (primary and/or metastatic and cpDNA. The feasibility, sensitivity, and specificity of this high-throughput, multiplex mutation detection approach was tested utilizing specimens acquired from 105 patients with solid tumors referred for participation in Phase I trials of molecularly targeted drugs. The median cpDNA concentration was 17 ng/ml (range: 0.5-1600; this was 3-fold higher than in healthy volunteers. Moreover, higher cpDNA concentrations associated with worse overall survival; there was an overall survival (OS hazard ratio of 2.4 (95% CI 1.4, 4.2 for each 10-fold increase in cpDNA concentration and in multivariate analyses, cpDNA concentration, albumin, and performance status remained independent predictors of OS. These data suggest that plasma DNA in these cancer patients is largely derived from tumor. We also observed high detection concordance for critical 'hot-spot' mutations (KRAS, BRAF, PIK3CA in matched cpDNA and archival tumor tissue, and important differences between archival tumor and cpDNA. This multiplex sequencing assay can be utilized to detect somatic mutations from plasma in advanced cancer patients, when safe repeat tumor biopsy is not feasible and genomic analysis of archival tumor is deemed insufficient. Overall, circulating nucleic

  19. Pitfalls of establishing DNA barcoding systems in protists: the cryptophyceae as a test case.

    Directory of Open Access Journals (Sweden)

    Kerstin Hoef-Emden

    Full Text Available A DNA barcode is a preferrably short and highly variable region of DNA supposed to facilitate a rapid identification of species. In many protistan lineages, a lack of species-specific morphological characters hampers an identification of species by light or electron microscopy, and difficulties to perform mating experiments in laboratory cultures also do not allow for an identification of biological species. Thus, testing candidate barcode markers as well as establishment of accurately working species identification systems are more challenging than in multicellular organisms. In cryptic species complexes the performance of a potential barcode marker can not be monitored using morphological characters as a feedback, but an inappropriate choice of DNA region may result in artifactual species trees for several reasons. Therefore a priori knowledge of the systematics of a group is required. In addition to identification of known species, methods for an automatic delimitation of species with DNA barcodes have been proposed. The Cryptophyceae provide a mixture of systematically well characterized as well as badly characterized groups and are used in this study to test the suitability of some of the methods for protists. As species identification method the performance of blast in searches against badly to well-sampled reference databases has been tested with COI-5P and 5'-partial LSU rDNA (domains A to D of the nuclear LSU rRNA gene. In addition the performance of two different methods for automatic species delimitation, fixed thresholds of genetic divergence and the general mixed Yule-coalescent model (GMYC, have been examined. The study demonstrates some pitfalls of barcoding methods that have to be taken care of. Also a best-practice approach towards establishing a DNA barcode system in protists is proposed.

  20. Characteristics of test anxiety among medical students and congruence of strategies to address it

    Directory of Open Access Journals (Sweden)

    John Encandela

    2014-08-01

    Full Text Available Introduction: Medical students may experience test anxiety associated with ‘high stakes’ exams, such as Step 1 of the United States Medical Licensing Examination. Methods: We collected qualitative responses about test anxiety at three points in time from 93 second-year medical students engaged in studying for and taking Step 1. Results: Causes of test anxiety as reported by students were related to negative self-talk during preparation for the exam. Effects of anxiety had to do with emotional well-being, cognitive functioning, and physical well-being. Strategies included socializing with others and a variety of cognitive and physical approaches. Comparison of individuals’ strategies with causes and effects showed some congruence, but substantial incongruence between the types of strategies chosen and the reported causes and effects of test anxiety. Discussion: Students’ adoption of a ‘menu’ of strategies rather than one or two carefully selected strategies suggest inefficiencies that might be addressed by interventions, such as advisor-directed conversations with students and incorporating student self-assessment and strategies for managing anxiety within courses on test-taking. Such interventions are in need of further study. An annotated list of evidence-based strategies would be helpful to students and educators. Most important, test anxiety should be viewed by medical educators as a ‘real’ experience, and students would benefit from educator support.

  1. DNA-testing for BRCA1/2 prior to genetic counselling in patients with breast cancer: design of an intervention study, DNA-direct

    Directory of Open Access Journals (Sweden)

    Sie Aisha S

    2012-05-01

    Full Text Available Abstract Background Current practice for patients with breast cancer referred for genetic counseling, includes face-to-face consultations with a genetic counselor prior to and following DNA-testing. This is based on guidelines regarding Huntington’s disease in anticipation of high psychosocial impact of DNA-testing for mutations in BRCA1/2 genes. The initial consultation covers generic information regarding hereditary breast cancer and the (impossibilities of DNA-testing, prior to such testing. Patients with breast cancer may see this information as irrelevant or unnecessary because individual genetic advice depends on DNA-test results. Also, verbal information is not always remembered well by patients. A different format for this information prior to DNA-testing is possible: replacing initial face-to-face genetic counseling (DNA-intake procedure by telephone, written and digital information sent to patients’ homes (DNA-direct procedure. Methods/design In this intervention study, 150 patients with breast cancer referred to the department of Clinical Genetics of the Radboud University Nijmegen Medical Centre are given the choice between two procedures, DNA-direct (intervention group or DNA-intake (usual care, control group. During a triage telephone call, patients are excluded if they have problems with Dutch text, family communication, or of psychological or psychiatric nature. Primary outcome measures are satisfaction and psychological distress. Secondary outcome measures are determinants for the participant’s choice of procedure, waiting and processing times, and family characteristics. Data are collected by self-report questionnaires at baseline and following completion of genetic counseling. A minority of participants will receive an invitation for a 30 min semi-structured telephone interview, e.g. confirmed carriers of a BRCA1/2 mutation, and those who report problems with the procedure. Discussion This study compares current practice

  2. Validation through Understanding Test-Taking Strategies: An Illustration With the CELPIP-General Reading Pilot Test Using Structural Equation Modeling

    Science.gov (United States)

    Wu, Amery D.; Stone, Jake E.

    2016-01-01

    This article explores an approach for test score validation that examines test takers' strategies for taking a reading comprehension test. The authors formulated three working hypotheses about score validity pertaining to three types of test-taking strategy (comprehending meaning, test management, and test-wiseness). These hypotheses were…

  3. Time Truncated Testing Strategy using Multiple Testers: Lognormal Distributed Lifetime

    Directory of Open Access Journals (Sweden)

    Itrat Batool Naqvi

    2014-06-01

    Full Text Available In this study, group acceptance sampling plan proposed by Aslam et al. (2011 is reconsidered when the lifetime variant of the test item follows lognormal distribution. The optimal plan parameters are obtained by considering various pre-specified parameters. The plan parameters are obtained using the non-linear optimization solution using two points approach. The advantage of the proposed plan is discussed over the existing plan using the single point approach and the proposed plan is more efficient than the existing plan.

  4. TRAINING STRATEGIES FOR LISTENING SUB-TEST IN IELTS

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    The listening sub-test in IELTS is divided into four sections:section one and two test candidates’survival skills in the U.K.;section three and four,candidates’study skills,Ih trainingpractice,the instructor may divide the listening material intotwo parts.In the first part—survival English,culturalbackground knowledge of daily life in the U.K.should be takenas the training focus.Dialogues concerning a new arrival’s dailyactivities in the U.K.may be chosen as listening material.Thesecond part,Academic English training is the most challengingtask.To understand a university lecture or academic interview,a good command of academic vocabulary is essential,so theinstructor should design some exercises to help students memorizeacademic vocabulary.The training focus for the academicEnglish part is the skill of grasping the main points of a lecture orinterview.Students should show how to write outlines andsummaries.Gap-fill and T&F&N forms may be adopted forsummary and outline training.

  5. TOXICITY TESTING IN THE 21ST CENTURY: A VISION AND A STRATEGY

    DEFF Research Database (Denmark)

    Krewski, D.; Acosta, D.; Andersen, M.

    2010-01-01

    With the release of the landmark report Toxicity Testing in the 21st Century: A Vision and a Strategy, the U. S. National Academy of Sciences, in 2007, precipitated a major change in the way toxicity testing is conducted. It envisions increased efficiency in toxicity testing and decreased animal ...

  6. Test Takers' Performance Appraisals, Appraisal Calibration, and Cognitive and Metacognitive Strategy Use

    Science.gov (United States)

    Phakiti, Aek

    2016-01-01

    The current study explores the nature and relationships among test takers' performance appraisals, appraisal calibration, and reported cognitive and metacognitive strategy use in a language test situation. Performance appraisals are executive processes of strategic competence for judging test performance (e.g., evaluating the correctness or…

  7. College Students' Study Strategies as a Function of Testing: An Investigation into Metacognitive Self-Regulation

    Science.gov (United States)

    Ross, Margaret E.; Green, Samuel B.; Salisbury-Glennon, Jill D.; Tollefson, Nona

    2006-01-01

    We conducted the present study to investigate whether college students adjust their study strategies to meet the cognitive demands of testing, a metacognitive self-regulatory skill. Participants were randomly assigned to one of the two testing conditions. In one condition we told participants to study for a test that required deep-level cognitive…

  8. DNA vaccination protects mice against Zika virus-induced damage to the testes

    Science.gov (United States)

    Griffin, Bryan D.; Muthumani, Kar; Warner, Bryce M.; Majer, Anna; Hagan, Mable; Audet, Jonathan; Stein, Derek R.; Ranadheera, Charlene; Racine, Trina; De La Vega, Marc-Antoine; Piret, Jocelyne; Kucas, Stephanie; Tran, Kaylie N.; Frost, Kathy L.; De Graff, Christine; Soule, Geoff; Scharikow, Leanne; Scott, Jennifer; McTavish, Gordon; Smid, Valerie; Park, Young K.; Maslow, Joel N.; Sardesai, Niranjan Y.; Kim, J. Joseph; Yao, Xiao-jian; Bello, Alexander; Lindsay, Robbin; Boivin, Guy; Booth, Stephanie A.; Kobasa, Darwyn; Embury-Hyatt, Carissa; Safronetz, David; Weiner, David B.; Kobinger, Gary P.

    2017-01-01

    Zika virus (ZIKV) is an emerging pathogen causally associated with serious sequelae in fetuses, inducing fetal microcephaly and other neurodevelopment defects. ZIKV is primarily transmitted by mosquitoes, but can persist in human semen and sperm, and sexual transmission has been documented. Moreover, exposure of type-I interferon knockout mice to ZIKV results in severe damage to the testes, epididymis and sperm. Candidate ZIKV vaccines have shown protective efficacy in preclinical studies carried out in animal models, and several vaccines have entered clinical trials. Here, we report that administration of a synthetic DNA vaccine encoding ZIKV pre-membrane and envelope (prME) completely protects mice against ZIKV-associated damage to the testes and sperm and prevents viral persistence in the testes following challenge with a contemporary strain of ZIKV. These data suggest that DNA vaccination merits further investigation as a potential means to reduce ZIKV persistence in the male reproductive tract. PMID:28589934

  9. Refined Exercise testing can aid DNA-based Diagnosis in Muscle Channelopathies

    Science.gov (United States)

    Tan, S. Veronica; Matthews, Emma; Barber, Melissa; Burge, James A; Rajakulendran, Sanjeev; Fialho, Doreen; Sud, Richa; Haworth, Andrea; Koltzenburg, Martin; Hanna, Michael G

    2010-01-01

    Objective To improve the accuracy of genotype prediction and guide genetic testing in patients with muscle channelopathies we applied and refined specialised electrophysiological exercise test parameters. Methods We studied 56 genetically confirmed patients and 65 controls using needle electromyography, the long exercise test, and short exercise tests at room temperature, after cooling, and rewarming. Results Concordant amplitude-and-area decrements were more reliable than amplitude-only measurements when interpreting patterns of change during the short exercise tests. Concordant amplitude-and-area pattern I and pattern II decrements of >20% were 100% specific for PMC and MC respectively. When decrements at room temperature and after cooling were 20% allow more reliable interpretation of the short exercise tests and aid accurate DNA-based diagnosis. In patients with negative exercise tests, specific clinical features are helpful in differentiating sodium from chloride channel myotonia. A modified algorithm is suggested.. PMID:21387378

  10. Multitarget stool DNA tests increases colorectal cancer screening among previously noncompliant Medicare patients.

    Science.gov (United States)

    Prince, Mark; Lester, Lynn; Chiniwala, Rupal; Berger, Barry

    2017-01-21

    To determine the uptake of noninvasive multitarget stool DNA (mt-sDNA) in a cohort of colorectal cancer (CRC) screening non-compliant average-risk Medicare patients. This cross sectional primary care office-based study examined mt-sDNA uptake in routine clinical practice among 393 colorectal cancer screening non-compliant Medicare patients ages 50-85 ordered by 77 physicians in a multispecialty group practice (USMD Physician Services, Dallas, TX) from October, 2014-September, 2015. Investigators performed a Health Insurance Portability and Accountability Act compliant retrospective review of electronic health records to identify mt-sDNA use in patients who were either > 10 years since last colonoscopy and/or > 1 year since last fecal occult blood test. Test positive patients were advised to get diagnostic colonoscopy and thereafter patients were characterized by the most clinically significant lesion documented on histopathology of biopsies or excisional tissue. Descriptive statistics were employed. Key outcome measures included mt-sDNA compliance and diagnostic colonoscopy compliance on positive cases. Over 12 mo, 77 providers ordered 393 mt-sDNA studies with 347 completed (88.3% compliance). Patient mean age was 69.8 (50-85) and patients were 64% female. Mt-sDNA was negative in 85.3% (296/347) and positive in 14.7% (51/347). Follow-up colonoscopy was performed in 49 positive patients (96.1% colonoscopy compliance) with two patients lost to follow up. Index findings included: colon cancer (4/49, 8.2%), advanced adenomas (21/49, 42.9%), non-advanced adenomas (15/49, 30.6%), and negative results (9/49, 18.4%). The positive predictive value for advanced colorectal lesions was 51.0% and for any colorectal neoplasia was 81.6%. The mean age of patients with colorectal cancer was 70.3 and all CRC's were localized Stage I (2) and Stage II (2), three were located in the proximal colon and one was located in the distal colon. Mt-sDNA provided medical benefit to screening

  11. Restarting and recentering genetic algorithm variations for DNA fragment assembly: The necessity of a multi-strategy approach.

    Science.gov (United States)

    Hughes, James Alexander; Houghten, Sheridan; Ashlock, Daniel

    2016-12-01

    DNA Fragment assembly - an NP-Hard problem - is one of the major steps in of DNA sequencing. Multiple strategies have been used for this problem, including greedy graph-based algorithms, deBruijn graphs, and the overlap-layout-consensus approach. This study focuses on the overlap-layout-consensus approach. Heuristics and computational intelligence methods are combined to exploit their respective benefits. These algorithm combinations were able to produce high quality results surpassing the best results obtained by a number of competitive algorithms specially designed and tuned for this problem on thirteen of sixteen popular benchmarks. This work also reinforces the necessity of using multiple search strategies as it is clearly observed that algorithm performance is dependent on problem instance; without a deeper look into many searches, top solutions could be missed entirely. Copyright © 2016. Published by Elsevier Ireland Ltd.

  12. Mechanisms of a novel anticancer therapeutic strategy involving atmospheric pressure plasma-mediated apoptosis and DNA strand break formation.

    Science.gov (United States)

    Chung, Woo-Hyun

    2016-01-01

    Atmospheric pressure plasma has been developed for a variety of biomedical applications due to its chemically reactive components. Recently, the plasma has emerged as a promising novel cancer therapy based on its ability to selectively ablate cancer cells while leaving normal cells essentially unaffected. The therapeutic effect of plasma is attributed to intracellular generation of reactive oxygen/nitrogen species (ROS/RNS) leading to mitochondria-mediated apoptosis and to activation of the DNA damage checkpoint signaling pathway via severe DNA strand break formation. However, the biochemical mechanisms responsible for appropriate activation of these physiological events and which pathway is more crucial for plasma-mediated cytotoxicity have not been clarified. Understanding the molecular link between ROS/RNS-mediated apoptosis and DNA damage-involved chromosome instability is critical for the development of more efficacious therapeutic strategies for selective killing of diverse cancer cells.

  13. Quantum dot-DNA aptamer conjugates coupled with capillary electrophoresis: A universal strategy for ratiometric detection of organophosphorus pesticides.

    Science.gov (United States)

    Tang, Tingting; Deng, Jingjing; Zhang, Min; Shi, Guoyue; Zhou, Tianshu

    2016-01-01

    Based on the highly sensitivity and stable-fluorescence of water-soluble CdTe/CdS core-shell quantum dots (QDs) with broad-specificity DNA aptamers, a novel ratiometric detection strategy was proposed for the sensitive detection of organophosphorus pesticides by capillary electrophoresis with laser-induced fluorescence (CE-LIF). The as-prepared QDs were first conjugated with the amino-modified oligonucleotide (AMO) by amidation reaction, which is partial complementary to the DNA aptamer of organophosphorus pesticides. Then QD-labeled AMO (QD-AMO) was incubated with the DNA aptamer to form QD-AMO-aptamer duplex. When the target organophosphorus pesticides were added, they could specifically bind the DNA aptamer, leading to the cleavage of QD-AMO-aptamer duplex, accompany with the release of QD-AMO. As a result, the ratio of peak height between QD-AMO and QD-AMO-aptamer duplex changed in the detection process of CE-LIF. This strategy was subsequently applied for the detection of phorate, profenofos, isocarbophos, and omethoate with the detection limits of 0.20, 0.10, 0.17, and 0.23μM, respectively. This is the first report about using QDs as the signal indicators for organophosphorus pesticides detection based on broad-specificity DNA aptamers by CE-LIF, thus contributing to extend the scope of application of QDs in different fields. The proposed method has great potential to be a universal strategy for rapid detection of aptamer-specific small molecule targets by simply changing the types of aptamer sequences.

  14. DNA Sequence Determination by Hybridization: A Strategy for Efficient Large-Scale Sequencing

    Science.gov (United States)

    Drmanac, R.; Drmanac, S.; Strezoska, Z.; Paunesku, T.; Labat, I.; Zeremski, M.; Snoddy, J.; Funkhouser, W. K.; Koop, B.; Hood, L.; Crkvenjakov, R.

    1993-06-01

    The concept of sequencing by hybridization (SBH) makes use of an array of all possible n-nucleotide oligomers (n-mers) to identify n-mers present in an unknown DNA sequence. Computational approaches can then be used to assemble the complete sequence. As a validation of this concept, the sequences of three DNA fragments, 343 base pairs in length, were determined with octamer oligonucleotides. Possible applications of SBH include physical mapping (ordering) of overlapping DNA clones, sequence checking, DNA fingerprinting comparisons of normal and disease-causing genes, and the identification of DNA fragments with particular sequence motifs in complementary DNA and genomic libraries. The SBH techniques may accelerate the mapping and sequencing phases of the human genome project.

  15. Quantification of Plasmodiophora brassicae Using a DNA-Based Soil Test Facilitates Sustainable Oilseed Rape Production

    Directory of Open Access Journals (Sweden)

    Ann-Charlotte Wallenhammar

    2016-04-01

    Full Text Available Outbreaks of clubroot disease caused by the soil-borne obligate parasite Plasmodiophora brassicae are common in oilseed rape (OSR in Sweden. A DNA-based soil testing service that identifies fields where P. brassicae poses a significant risk of clubroot infection is now commercially available. It was applied here in field surveys to monitor the prevalence of P. brassicae DNA in field soils intended for winter OSR production and winter OSR field experiments. In 2013 in Scania, prior to planting, P. brassicae DNA was detected in 60% of 45 fields on 10 of 18 farms. In 2014, P. brassicae DNA was detected in 44% of 59 fields in 14 of 36 farms, in the main winter OSR producing region in southern Sweden. P. brassicae was present indicative of a risk for >10% yield loss with susceptible cultivars (>1300 DNA copies g soil−1 in 47% and 44% of fields in 2013 and 2014 respectively. Furthermore, P. brassicae DNA was indicative of sites at risk of complete crop failure if susceptible cultivars were grown (>50 000 copies g−1 soil in 14% and 8% of fields in 2013 and 2014, respectively. A survey of all fields at Lanna research station in western Sweden showed that P. brassicae was spread throughout the farm, as only three of the fields (20% showed infection levels below the detection limit for P.brassicae DNA, while the level was >50,000 DNA copies g−1 soil in 20% of the fields. Soil-borne spread is of critical importance and soil scraped off footwear showed levels of up to 682 million spores g−1 soil. Soil testing is an important tool for determining the presence of P. brassicae and providing an indication of potential yield loss, e.g., in advisory work on planning for a sustainable OSR crop rotation. This soil test is gaining acceptance as a tool that increases the likelihood of success in precision agriculture and in applied research conducted in commercial oilseed fields and at research stations. The present application highlights the importance of

  16. DNA-based analytical strategies for the detection of genetically modified organisms and of allergens in foods

    OpenAIRE

    Hahn, Alexandra

    2009-01-01

    DNA-based methodologies have become an integral part of food and feed analysis and are commonly applied in different fields such as the analysis of genetically modified organisms (GMO) and the detection of allergens. The method development performed in this study was focussed on novel strategies meeting different demands of GMO and allergen analysis. The new ligation-dependent probe amplification (LPA) technique and the established real-time PCR technology were used to develop and to validate...

  17. Aptamer-based colorimetric detection of proteins using a branched DNA cascade amplification strategy and unmodified gold nanoparticles.

    Science.gov (United States)

    Chang, Chia-Chen; Chen, Chen-Yu; Chuang, Tsung-Liang; Wu, Tzu-Heng; Wei, Shu-Chen; Liao, Hongen; Lin, Chii-Wann

    2016-04-15

    A branched DNA amplification strategy was employed to design a colorimetric aptameric biosensor using unmodified gold nanoparticles (AuNPs). First, a programmed DNA dendritic nanostructure was formed using two double-stranded substrate DNAs and two single-stranded auxiliary DNAs as assembly components via a target-assisted cascade amplification reaction, and it was then captured by DNA sensing probe-stabilized AuNPs. The release of sensing probes from AuNPs led to the formation of unstable AuNPs, promoting salt-induced aggregation. By integrating the signal amplification capacity of the branched DNA cascade reaction and unmodified AuNPs as a sensing indicator, this amplified colorimetric sensing strategy allows protein detection with high sensitivity (at the femtomole level) and selectivity. The limit of detection of this approach for VEGF was lower than those of other aptamer-based detection methods. Moreover, this assay provides modification-free and enzyme-free protein detection without sophisticated instrumentation and might be generally applicable to the detection of other protein targets in the future.

  18. BENEFITS OF AN APPLICATION OF EVOLUTIONARY STRATEGY IN THE PROCESS OF TEST DATA GENERATION

    Directory of Open Access Journals (Sweden)

    Marek ŻUKOWICZ

    2016-04-01

    Full Text Available The aim of the article is to highlight the advantages that can be obtained through the use of evolutionary strategy in software testing, specifically in the process of test data generation. The first chapter introduces the reader to the topic of the article. Presents information of the problem of software quality, test data fitness and quality criteria. The second chapter provides an overview of the publication in which is described the test data generation problem by using evolu-tionary strategies. In this chapter there are presented, different approaches to address the optimization problem of test data selection. The third chapter sets out the advantages which in the opinion of the author result from the application of evolutionary strategy in the process of test data generation. In this section have been drawn conclusions from the article, from books listed in the bibliography. The author of the article presents advantages of evolutionary strategy too as a person, which tests a software in practise. The last chapter in addition to summaries and conclusions, proposes the author to suggest in which issues related to testing could be used evolutionary strategies.

  19. Alternative Testing Strategies for Nanomaterials: State of the Science and Considerations for Risk Analysis.

    Science.gov (United States)

    Shatkin, J A; Ong, K J

    2016-08-01

    The rapid growth of the nanotechnology industry has warranted equal progress in the nanotoxicology and risk assessment fields. In vivo models have traditionally been used to determine human and environmental risk for chemicals; however, the use of these tests has limitations, and there are global appeals to develop reliable alternatives to animal testing. Many have investigated the use of alternative (nonanimal) testing methods and strategies have quickly developed and resulted in the generation of large toxicological data sets for numerous nanomaterials (NMs). Due to the novel physicochemical properties of NMs that are related to surface characteristics, the approach toward toxicity test development has distinct considerations from traditional chemicals, bringing new requirements for adapting these approaches for NMs. The methodical development of strategies that combine multiple alternative tests can be useful for predictive NM risk assessment and help screening-level decision making. This article provides an overview of the main developments in alternative methods and strategies for reducing uncertainty in NM risk assessment, including advantages and disadvantages of in vitro, ex vivo, and in silico methods, and examples of existing comprehensive strategies. In addition, knowledge gaps are identified toward improvements for experimental and strategy design, specifically highlighting the need to represent realistic exposure scenarios and to consider NM-specific concerns such as characterization, assay interferences, and standardization. Overall, this article aims to improve the reliability and utility of alternative testing methods and strategies for risk assessment of manufactured NMs.

  20. Forensic individual age estimation with DNA: From initial approaches to methylation tests.

    Science.gov (United States)

    Freire-Aradas, A; Phillips, C; Lareu, M V

    2017-07-01

    Individual age estimation is a key factor in forensic science analysis that can provide very useful information applicable to criminal, legal, and anthropological investigations. Forensic age inference was initially based on morphological inspection or radiography and only later began to adopt molecular approaches. However, a lack of accuracy or technical problems hampered the introduction of these DNA-based methodologies in casework analysis. A turning point occurred when the epigenetic signature of DNA methylation was observed to gradually change during an individual´s lifespan. In the last four years, the number of publications reporting DNA methylation age-correlated changes has gradually risen and the forensic community now has a range of age methylation tests applicable to forensic casework. Most forensic age predictor models have been developed based on blood DNA samples, but additional tissues are now also being explored. This review assesses the most widely adopted genes harboring methylation sites, detection technologies, statistical age-predictive analyses, and potential causes of variation in age estimates. Despite the need for further work to improve predictive accuracy and establishing a broader range of tissues for which tests can analyze the most appropriate methylation sites, several forensic age predictors have now been reported that provide consistency in their prediction accuracies (predictive error of ±4 years); this makes them compelling tools with the potential to contribute key information to help guide criminal investigations. Copyright © 2017 Central Police University.

  1. The effect of alternative testing strategies and bio-exclusion practices on Johne's disease risk in test-negative herds.

    Science.gov (United States)

    More, S J; Sergeant, E S G; Strain, S; Cashman, W; Kenny, Kevin; Graham, D

    2013-03-01

    Herd classification is a key component of national Johne's disease (JD) control programs. Herds are categorized on the basis of test results, and separate sub-programs are followed for test-positive and test-negative herds. However, a test-negative herd result does not necessarily equate to JD freedom for reasons relating to disease pathogenesis and available diagnostic tests. Thus, in several countries, JD control programs define test-negative herds as having a "low risk" of infection below a specified prevalence. However, the approach is qualitative, and little quantitative work is available on herd-level estimates of probability of freedom in test-negative herds. This paper examines the effect over time of alternative testing strategies and bio-exclusion practices on JD risk in test-negative herds. A simulation model was developed in the programming language R. Key model inputs included sensitivity and specificity estimates for 3 individual animal diagnostic tests (serum ELISA, milk ELISA, and fecal culture), design prevalence, testing options, and testing costs. Key model outputs included the probability that infection will be detected if present at the design prevalence or greater (herd sensitivity; SeH), the probability that infection in the herd is either absent or at very low prevalence (i.e., less than the design prevalence; ProbF), the probability of an uninfected herd producing a false-positive result [P(False+)], and mean testing cost (HerdCost) for different testing strategies. The output ProbF can be updated periodically, incorporating data from additional herd testing and information on cattle purchases, and could form the basis for an output-based approach to herd classification. A high ProbF is very difficult to achieve, reflecting the low sensitivity of the evaluated tests. Moreover, ProbF is greatly affected by any risk of introduction of infection, decreasing in herds with poor bio-exclusion practices despite ongoing negative test results. The

  2. Effectiveness comparison of partially executed t-way test suite based generated by existing strategies

    Science.gov (United States)

    Othman, Rozmie R.; Ahmad, Mohd Zamri Zahir; Ali, Mohd Shaiful Aziz Rashid; Zakaria, Hasneeza Liza; Rahman, Md. Mostafijur

    2015-05-01

    Consuming 40 to 50 percent of software development cost, software testing is one of the most resource consuming activities in software development lifecycle. To ensure an acceptable level of quality and reliability of a typical software product, it is desirable to test every possible combination of input data under various configurations. Due to combinatorial explosion problem, considering all exhaustive testing is practically impossible. Resource constraints, costing factors as well as strict time-to-market deadlines are amongst the main factors that inhibit such consideration. Earlier work suggests that sampling strategy (i.e. based on t-way parameter interaction or called as t-way testing) can be effective to reduce number of test cases without effecting the fault detection capability. However, for a very large system, even t-way strategy will produce a large test suite that need to be executed. In the end, only part of the planned test suite can be executed in order to meet the aforementioned constraints. Here, there is a need for test engineers to measure the effectiveness of partially executed test suite in order for them to assess the risk they have to take. Motivated by the abovementioned problem, this paper presents the effectiveness comparison of partially executed t-way test suite generated by existing strategies using tuples coverage method. Here, test engineers can predict the effectiveness of the testing process if only part of the original test cases is executed.

  3. Qualitative research on point-of-care testing strategies and programs for HIV.

    Science.gov (United States)

    Engel, Nora; Pant Pai, Nitika

    2015-01-01

    Point-of-care (POC) testing in communities, home settings and primary healthcare centers plays an important role in cutting delays in HIV diagnosis and in the uptake of voluntary testing and counseling. Qualitative research methods have important potential to overcome the current challenges in expanding HIV POC testing programs and strategies, by examining the diagnostic processes, complex inter-relationships and patterns involved in making POC diagnostics work in real-world settings. This article reviews existing qualitative studies on POC testing strategies and programs for HIV. Qualitative research on POC diagnostics around the uptake of POC tests, the actual diagnostic and testing processes involved, the influence of POC tests on clinical decision-making, communication of decisions and decisions exercised by patients are limited. Equally limited are studies that explore adaptation of POC programs to various socio-cultural contexts. More qualitative research is needed to inform test developers, funders and policymakers.

  4. Sequencing strategy of mitochondrial HV1 and HV2 DNA with length heteroplasmy

    DEFF Research Database (Denmark)

    Rasmussen, Erik Michael; Sørensen, E; Eriksen, Birthe

    2002-01-01

    We describe a method to obtain reliable mitochondrial DNA (mtDNA) sequences downstream of the homopolymeric stretches with length heteroplasmy in the sequencing direction. The method is based on the use of junction primers that bind to a part of the homopolymeric stretch and the first 2-4 bases...

  5. An Effective Strategy to Build Up a Balanced Test Suite for Spectrum-Based Fault Localization

    Directory of Open Access Journals (Sweden)

    Ning Li

    2016-01-01

    Full Text Available During past decades, many automated software faults diagnosis techniques including Spectrum-Based Fault Localization (SBFL have been proposed to improve the efficiency of software debugging activity. In the field of SBFL, suspiciousness calculation is closely related to the number of failed and passed test cases. Studies have shown that the ratio of the number of failed and passed test case has more significant impact on the accuracy of SBFL than the total number of test cases, and a balanced test suite is more beneficial to improving the accuracy of SBFL. Based on theoretical analysis, we proposed an PNF (Passed test cases, Not execute Faulty statement strategy to reduce test suite and build up a more balanced one for SBFL, which can be used in regression testing. We evaluated the strategy making experiments using the Siemens program and Space program. Experiments indicated that our PNF strategy can be used to construct a new test suite effectively. Compared with the original test suite, the new one has smaller size (average 90% test case was reduced in experiments and more balanced ratio of failed test cases to passed test cases, while it has the same statement coverage and fault localization accuracy.

  6. [Paternity testing based on the analysis of DNA and its revision].

    Science.gov (United States)

    Vrtĕl, R; Vodicka, R; Loyka, S; Santavý, J

    2008-01-01

    Paternity testing is nowadays mostly based on the analysis of DNA short tandem repeats (STR). Number and selection of STR loci differ according to identification kit producers and also particular laboratories. This article refers a revision of formerly excluded paternity. The cause of the mismatch was revealed by the enlargement of STR loci panel and reciprocal evaluation of samples and paternity was on the contrary confirmed. Different possibilities of failures, their consequences and preventions are also discussed.

  7. DNA

    Science.gov (United States)

    Stent, Gunther S.

    1970-01-01

    This history for molecular genetics and its explanation of DNA begins with an analysis of the Golden Jubilee essay papers, 1955. The paper ends stating that the higher nervous system is the one major frontier of biological inquiry which still offers some romance of research. (Author/VW)

  8. Power-aware testing and test strategies for low power devices

    CERN Document Server

    Girard, Patrick; Wen, Xiaoqing

    2010-01-01

    Power-aware testing methods for conventional circuits and systems are explored in this volume, while providing safe testing techniques without compromising reliability. State-of-the-art industrial practices are discusses, as well as EDA solutions.

  9. Joseon funerary texts tested using ancient DNA analysis of a Korean mummy.

    Science.gov (United States)

    Oh, Chang Seok; Koh, Bou-Ja; Yoo, Dong Soo; Park, Jun Bum; Min, So Ri; Kim, Yi-Suk; Lee, Sang Sup; Ge, Jianye; Seo, Seung Bum; Shin, Dong Hoon

    2015-06-01

    In Korea, ancient DNA (aDNA) analysis has been applied to investigations into the genetic affiliations of mummies found in Joseon Dynasty tombs (1392-1910 CE), becoming now indispensable tool for researches studying human remains from archaeological sites. In the course of our recent examinations on a Korean mummy of Joseon Dynasty, we discovered many teeth contained in a pouch. And in fact, the historical literature on the topic of Joseon funerals contain general accounts of pouches in which an individual's lost teeth were collected over the course of a lifetime and, after death, placed in the coffin with the body. To test the veracity of the historical texts, the present study undertook aDNA analyses and compared the results between specifically questioned (Q) samples (teeth) and known (K) samples (brain and bone) from the mummy to ensure that they came from the same individual. Although the Q-K comparison of autosomal short tandem repeat results did not show full concordance due to allelic drop-outs in some loci, our statistical calculation indicated that the teeth in the pouch are highly likely those of the mummy. Additionally, Q-K comparison of mitochondrial DNA sequence results showed 100% matches between samples. There results, in short, could not gainsay the conjecture that the teeth samples originated from the person buried in the tomb; and if so, he must have kept his teeth for a long time after their loss. As the application of aDNA analysis to Korean mummy studies develops, there will be other opportunities to test historical documents, particularly those referring to funerary rites.

  10. Noninvasive Prenatal Paternity Testing (NIPAT) through Maternal Plasma DNA Sequencing: A Pilot Study

    Science.gov (United States)

    Ge, Huijuan; Deng, Yongqiang; Mu, Haofang; Feng, Xiaoli; Yin, Lu; Du, Zhou; Chen, Fang; He, Nongyue

    2016-01-01

    Short tandem repeats (STRs) and single nucleotide polymorphisms (SNPs) have been already used to perform noninvasive prenatal paternity testing from maternal plasma DNA. The frequently used technologies were PCR followed by capillary electrophoresis and SNP typing array, respectively. Here, we developed a noninvasive prenatal paternity testing (NIPAT) based on SNP typing with maternal plasma DNA sequencing. We evaluated the influence factors (minor allele frequency (MAF), the number of total SNP, fetal fraction and effective sequencing depth) and designed three different selective SNP panels in order to verify the performance in clinical cases. Combining targeted deep sequencing of selective SNP and informative bioinformatics pipeline, we calculated the combined paternity index (CPI) of 17 cases to determine paternity. Sequencing-based NIPAT results fully agreed with invasive prenatal paternity test using STR multiplex system. Our study here proved that the maternal plasma DNA sequencing-based technology is feasible and accurate in determining paternity, which may provide an alternative in forensic application in the future. PMID:27631491

  11. Value and feasibility of HPV DNA test in cervical scraping smears.

    Science.gov (United States)

    Wu, Sufang; Chen, Gang; Wang, Wei; Xu, Qian; Gu, Hainian; Lu, Yunping; Zhou, Liping; Du, Juan; Li, Fujun; Liao, Guoning; Ma, Ding

    2005-01-01

    To investigate the reliability and feasibility of human papillomavirus (HPV) DNA test in cervical scraping smears with polymerase chain reaction (PCR), 131 cases of cervical scraping specimens were collected, and the positive rates and accuracy of HPV infection were determined in normal subjects and cervical cancer patients. GP5+/GP6+ and E7 primer pairs designed for detecting HPV L1 and HPV type 16 E7 were tested in this study. Our results showed that positive rates of HPV DNA in normal population and cervical cancer patients were 32.99% and 73.53% respectively and there was significant difference between them (P 0.05). However the detection rates in cervical cancer patients were 38.24% and 67.65% for the two markers, with a significant difference found between them (P scraping smears was feasible. GP5+/GP6+ primer pairs may be a useful probe to screen HPV infection in normal population, but they are not sensitive enough in cervical cancer patients. It is suggested that high risk type HPV DNA test was very useful in population with high risk of cervical cancer.

  12. To test or to treat? An analysis of influenza testing and antiviral treatment strategies using economic computer modeling.

    Directory of Open Access Journals (Sweden)

    Bruce Y Lee

    Full Text Available BACKGROUND: Due to the unpredictable burden of pandemic influenza, the best strategy to manage testing, such as rapid or polymerase chain reaction (PCR, and antiviral medications for patients who present with influenza-like illness (ILI is unknown. METHODOLOGY/PRINCIPAL FINDINGS: We developed a set of computer simulation models to evaluate the potential economic value of seven strategies under seasonal and pandemic influenza conditions: (1 using clinical judgment alone to guide antiviral use, (2 using PCR to determine whether to initiate antivirals, (3 using a rapid (point-of-care test to determine antiviral use, (4 using a combination of a point-of-care test and clinical judgment, (5 using clinical judgment and confirming the diagnosis with PCR testing, (6 treating all with antivirals, and (7 not treating anyone with antivirals. For healthy younger adults ( or = 65 years old, in both seasonal and pandemic influenza scenarios, employing PCR was the most cost-effective option, with the closest competitor being clinical judgment (when judgment accuracy > or = 50%. Point-of-care testing plus clinical judgment was cost-effective with higher probabilities of influenza. Treating all symptomatic ILI patients with antivirals was cost-effective only in older adults. CONCLUSIONS/SIGNIFICANCE: Our study delineated the conditions under which different testing and antiviral strategies may be cost-effective, showing the importance of accuracy, as seen with PCR or highly sensitive clinical judgment.

  13. Development and validation of an rDNA operon based primer walking strategy applicable to de novo bacterial genome finishing.

    Directory of Open Access Journals (Sweden)

    Alexander William Eastman

    2015-01-01

    Full Text Available Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing

  14. An alternative strategy to western blot as a confirmatory diagnostic test for HIV infection.

    Science.gov (United States)

    Feng, Xia; Wang, Jibao; Gao, Zhiyun; Tian, Yu; Zhang, Ling; Chen, Huichao; Zhang, Tong; Xiao, Lin; Yao, Jun; Xing, Wenge; Qiu, Maofeng; Jiang, Yan

    2017-03-01

    In China, western blot (WB) is the recommended procedure for the diagnosis of HIV infection. However, this technique is time consuming and labor intensive, and its complexity restricts wide application in resource-limited regions. The aim of this study was to evaluate the efficacy of a dry blood spots (DBS)-urine paired enzyme-linked immunosorbent assay (ELISA) test, instead of WB, for HIV antibody detection. Plasma, DBS, and urine samples were collected from 1213 subjects from different populations. Two diagnostic testing strategies were conducted in parallel. The equivalence of the paired ELISA and WB strategies was assessed. A diagnosis of HIV was determined in 250 subjects according to the paired ELISA test, and in 249 according to the WB strategy. The discordant case was judged HIV-positive during follow-up. In total, 18 subjects were diagnosed with possible HIV using the paired ELISA test, among whom, 11 subjects tested negative with WB, and one was confirmed to be HIV-positive during follow-up. For the remaining 945 subjects, both strategies indicated a negative result. The kappa test indicated good conformity (kappa=0.954) between the two diagnostic strategies. The DBS-urine paired ELISA could be applied as an alternative to WB in HIV diagnosis, which would be valuable in resource-limited regions owing to the associated affordability and ease of use. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  15. A universal strategy to interpret DNA profiles that does not require a definition of low-copy-number.

    Science.gov (United States)

    Gill, Peter; Buckleton, John

    2010-07-01

    In this paper we critically examine the causes of the underlying confusion that relates to the issue of low-template (LT) DNA profile interpretation. Firstly, there is much difficulty in attempting to distinguish between LT-DNA vs. conventional DNA because there is no discrete 'cut-off' point that can be reasonably defined or evaluated. LT-DNA is loosely characterised by drop-out (where alleles may be missing) and drop-in (where additional alleles may be present). We have previously described probabilistic methods that can be used to incorporate these phenomena using likelihood ratio (LR) principles. This is preferred to the random man not excluded (RMNE) method, because we cannot identify a coherent way forward within the restrictions provided by this framework. Most LT-DNA profiles are interpreted using a 'consensus' profile method, we called this the 'biological model', where only those alleles that are duplicated in consecutive tests are reported. We recognise that there is an increased need for probabilistic models to take precedence over the biological model. These models are required for all kinds of DNA profiles, not just those that are believed to be low-template. We also recognise that there is a need for education and training if the methods we recommend are to be widely introduced.

  16. Validation of a sensitive DNA walking strategy to characterise unauthorised GMOs using model food matrices mimicking common rice products.

    Science.gov (United States)

    Fraiture, Marie-Alice; Herman, Philippe; Taverniers, Isabel; De Loose, Marc; Van Nieuwerburgh, Filip; Deforce, Dieter; Roosens, Nancy H

    2015-04-15

    To identify unauthorised GMOs in food and feed matrices, an integrated approach has recently been developed targeting pCAMBIA family vectors, highly present in transgenic plants. Their presence is first assessed by qPCR screening and is subsequently confirmed by characterising the transgene flanking regions, using DNA walking. Here, the DNA walking performance has been thoroughly tested for the first time, regarding the targeted DNA quality and quantity. Several assays, on model food matrices mimicking common rice products, have allowed to determine the limit of detection as well as the potential effects of food mixture and processing. This detection system allows the identification of transgenic insertions as low as 10 HGEs and was not affected by the presence of untargeted DNA. Moreover, despite the clear impact of food processing on DNA quality, this method was able to cope with degraded DNA. Given its specificity, sensitivity, reliability, applicability and practicability, the proposed approach is a key detection tool, easily implementable in enforcement laboratories. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  17. Testing a social psychological model of strategy use with students of english as a foreign language.

    Science.gov (United States)

    Hsiao, Tsung-Yuan

    2004-12-01

    This replication study tested MacIntyre's Social Psychological Model of Strategy Use. Participants were 137 first-year college students (100 men and 37 women), all in their late teens or early 20s, learning English as a foreign language in a university in Taiwan. McIntyre specified three conditions for use of language-learning strategies in his model: awareness of the strategy, having a reason to use it, and not having a reason not to use it. Stepwise multiple regression analyses of data measured by Oxford's 50-item Strategy Inventory for Language Learning partially support this model because only Knowledge about the Strategy (representing the first condition) and Difficulty about Using It (representing the third condition) made significant independent contributions to the prediction of use of most of the 50 strategies. Close examination of the results poses questions about MacIntyre and Noels' thesis, as implied in their revised model, that reason to use the strategy and reason not to use the strategy are independent. The present replication suggests a need for further revision of the model. Use of methods more advanced than the multiple regression is recommended to test and refine the model.

  18. An Investigation of the Effectiveness of Vocabulary Learning Strategies on Iranian EFL Learners' Vocabulary Test Score

    Science.gov (United States)

    Rahimy, Ramin; Shams, Kiana

    2012-01-01

    This study aims to investigate the effectiveness of vocabulary learning strategies on Iranian EFL learners' vocabulary test score. To achieve this aim, fifty Intermediate level students from Kish English Institute were randomly selected from among fifteen classes after administering the Oxford Placement Test (OPT). Then, an intermediate level…

  19. Test-and-Treat Strategies for Helicobacter pylori in Uninvestigated Dyspepsia: A Canadian Economic Anaylsis

    Directory of Open Access Journals (Sweden)

    John K Marshall

    2000-01-01

    Full Text Available BACKGROUND: Recognition of the pivotal role of Helicobacter pylori in the pathogenesis of peptic ulcer disease has revolutionized primary care approaches to dyspepsia. Decision analysis was used to compare the cost effectiveness of empirical ranitidine with a test and treat strategy using either H pylori serology or the 13carbon-urea breath test (13C-UBT.

  20. Strategies Underlying Psychometric Test Responses in Young and Middle-aged Adults of Varying Educational Background.

    Science.gov (United States)

    Macrae, Kristina S.

    The aim of this study was to investigate the strategies leading to test item responses in 60 young (20-25 years) and 60 middle-aged (35-40 years) adults, whose highest level of education had been either secondary, technical or university. Subjects were individually administered a 12 item test similar to Raven's Progressive Matrices, and were…

  1. The Effects of Using Selected Metacognitive Strategies on ACT Mathematics Sub-Test Scores

    Science.gov (United States)

    LeMay, Jeffrey W.

    2016-01-01

    This quasi-experimental post-test only control group designed quantitative study examined whether or not members of an experimental group of participants who utilized two metacognitive strategy training regimens experienced a significant increase in their ACT mathematics sub-test scores compared to a group of students who did not utilize either of…

  2. Strategies Underlying Psychometric Test Responses in Young and Middle-aged Adults of Varying Educational Background.

    Science.gov (United States)

    Macrae, Kristina S.

    The aim of this study was to investigate the strategies leading to test item responses in 60 young (20-25 years) and 60 middle-aged (35-40 years) adults, whose highest level of education had been either secondary, technical or university. Subjects were individually administered a 12 item test similar to Raven's Progressive Matrices, and were…

  3. Voices of University Students with ADHD about Test-Taking: Behaviors, Needs, and Strategies

    Science.gov (United States)

    Ofiesh, Nicole; Moniz, Erin; Bisagno, Joan

    2015-01-01

    In order to understand the test-taking behavior, needs, and strategies of postsecondary students with Attention Deficit Hyperactivity Disorder (ADHD), focus group comments from 17 university students with ADHD were analyzed. These comments formed the basis for a series of research studies that are in progress regarding test-taking and individuals…

  4. Do Attachment Style and Emotion Regulation Strategies Indicate Distress in Predictive Testing?

    NARCIS (Netherlands)

    L.B. van der Meer (Lucienne); M.A.J. van Duijn (Marijtje A. J.); E.J. Giltay (Erik); A. Tibben (Arend)

    2015-01-01

    textabstractPredictive genetic testing for a neurogenetic disorder evokes strong emotions, and may lead to distress. The aim of this study is to investigate whether attachment style and emotion regulation strategies are associated with distress in persons who present for predictive testing for a neu

  5. Mitochondrial DNA copy number augments performance of A1C and oral glucose tolerance testing in the prediction of type 2 diabetes

    Science.gov (United States)

    Cho, Seong Beom; Koh, InSong; Nam, Hye-Young; Jeon, Jae-Pil; Lee, Hong Kyu; Han, Bok-Ghee

    2017-01-01

    Here, we tested the performance of the mitochondrial DNA copy number (mtDNA-CN) in predicting future type 2 diabetes (n = 1108). We used the baseline clinical data (age, sex, body mass index, waist-to-hip ratio, systolic and diastolic blood pressure) and the mtDNA-CN, hemoglobin A1c (A1C) levels and results of oral glucose tolerance test (OGTT) including fasting plasma glucose, 1-hour glucose, and 2-hour glucose levels, to predict future diabetes. We built a prediction model using the baseline data and the diabetes status at biannual follow-up of 8 years. The mean area under curve (AUC) for all follow-ups of the full model including all variables was 0.92 ± 0.04 (mean ± standard deviation), while that of the model excluding the mtDNA-CN was 0.90 ± 0.03. The sensitivity of the f4ull model was much greater than that of the model not including mtDNA-CN: the mean sensitivities of the model with and without mtDNA-CN were 0.60 ± 0.06 and 0.53 ± 0.04, respectively. We found that the mtDNA-CN of peripheral leukocytes is a biomarker that augments the predictive power for future diabetes of A1C and OGTT. We believe that these results could provide invaluable information for developing strategies for the management of diabetes. PMID:28251996

  6. A strategy for antimicrobial regulation based on fluorescent conjugated oligomer-DNA hybrid hydrogels.

    Science.gov (United States)

    Cao, Ali; Tang, Yanli; Liu, Yue; Yuan, Huanxiang; Liu, Libing

    2013-06-21

    New fluorescent oligo(phenylene ethynylene)-DNA hydrogels have been prepared and used for the controllable biocidal activity driven by DNase. This study opens a new way of controllable drug release and antimicrobial regulation.

  7. Combination of cascade chemical reactions with graphene-DNA interaction to develop new strategy for biosensor fabrication.

    Science.gov (United States)

    Zhu, Xiaoli; Sun, Liya; Chen, Yangyang; Ye, Zonghuang; Shen, Zhongming; Li, Genxi

    2013-09-15

    Graphene, a single atom thick and two dimensional carbon nano-material, has been proven to possess many unique properties, one of which is the recent discovery that it can interact with single-stranded DNA through noncovalent π-π stacking. In this work, we demonstrate that a new strategy to fabricate many kinds of biosensors can be developed by combining this property with cascade chemical reactions. Taking the fabrication of glucose sensor as an example, while the detection target, glucose, may regulate the graphene-DNA interaction through three cascade chemical reactions, electrochemical techniques are employed to detect the target-regulated graphene-DNA interaction. Experimental results show that in a range from 5μM to 20mM, the glucose concentration is in a natural logarithm with the logarithm of the amperometric response, suggesting a best detection limit and detection range. The proposed biosensor also shows favorable selectivity, and it has the advantage of no need for labeling. What is more, by controlling the cascade chemical reactions, detection of a variety of other targets may be achieved, thus the strategy proposed in this work may have a wide application potential in the future.

  8. Organization and evolution of Gorilla centromeric DNA from old strategies to new approaches

    OpenAIRE

    Catacchio, C. R.; Ragone, R.; Chiatante, G.; M. Ventura

    2015-01-01

    The centromere/kinetochore interaction is responsible for the pairing and segregation of replicated chromosomes in eukaryotes. Centromere DNA is portrayed as scarcely conserved, repetitive in nature, quickly evolving and protein-binding competent. Among primates, the major class of centromeric DNA is the pancentromeric α-satellite, made of arrays of 171 bp monomers, repeated in a head-to-tail pattern. α-satellite sequences can either form tandem heterogeneous monomeric arrays or assemble in h...

  9. Strategy for the extraction of yeast DNA from artisan agave must for quantitative PCR analysis.

    Science.gov (United States)

    Kirchmayr, Manuel Reinhart; Segura-Garcia, Luis Eduardo; Flores-Berrios, Ericka Patricia; Gschaedler, Anne

    2011-11-01

    An efficient method for the direct extraction of yeast genomic DNA from agave must was developed. The optimized protocol, which was based on silica-adsorption of DNA on microcolumns, included an enzymatic cell wall degradation step followed by prolonged lysis with hot detergent. The resulting extracts were suitable templates for subsequent qPCR assays that quantified mixed yeast populations in artisan Mexican mezcal fermentations. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  10. Do Attachment Style and Emotion Regulation Strategies Indicate Distress in Predictive Testing?

    Science.gov (United States)

    van der Meer, Lucienne B; van Duijn, Erik; Giltay, Erik J; Tibben, Aad

    2015-10-01

    Predictive genetic testing for a neurogenetic disorder evokes strong emotions, and may lead to distress. The aim of this study is to investigate whether attachment style and emotion regulation strategies are associated with distress in persons who present for predictive testing for a neurogenetic disorder, and whether these psychological traits predict distress after receiving test results. Self-report scales were used to assess attachment insecurity (anxiety and avoidance) and maladaptive emotion regulation strategies (self-blame, rumination, catastrophizing) in adults at 50 % risk for Huntington's Disease (HD), Cerebral Autosomal Dominant Arteriopathy with Subcortical Infarcts and Leukoencephalopathy (CADASIL), and Hereditary Cerebral Hemorrhage With Amyloidosis - Dutch type (HCHWA-D), when they presented for predictive testing. Distress was measured before testing and twice (within 2 months and between 6 and 8 months) after receiving test results. Pearson correlations and linear regression were used to analyze whether attachment style and emotion regulation strategies indicated distress. In 98 persons at risk for HD, CADASIL, or HCHWA-D, attachment anxiety and catastrophizing were associated with distress before predictive testing. Attachment anxiety predicted distress up to 2 months after testing. Clinicians may consider looking for signs of attachment anxiety and catastrophizing in persons who present for predictive testing, to see who may be vulnerable for distress during and after testing.

  11. Comparison of potential protection conferred by three immunization strategies (protein/protein, DNA/DNA, and DNA/protein) against Brucella infection using Omp2b in BALB/c Mice.

    Science.gov (United States)

    Golshani, Maryam; Rafati, Sima; Nejati-Moheimani, Mehdi; Ghasemian, Melina; Bouzari, Saeid

    2016-12-25

    In the present study, immunogenicity and protective efficacy of the Brucella outer membrane protein 2b (Omp2b) was evaluated in BALB/c mice using Protein/Protein, DNA/DNA and DNA/Protein vaccine strategies. Immunization of mice with three vaccine regimens elicited a strong specific IgG response (higher IgG2a titers over IgG1 titers) and provided Th1-oriented immune response. Vaccination of BALB/c mice with the DNA/Pro regimen induced higher levels of IFN-γ/IL-2 and conferred more protection levels against B. melitenisis and B. abortus challenge than did the protein or DNA alone. In conclusion, Omp2b is able to stimulate specific immune responses and to confer cross protection against B. melitensis and B. abortus infection. Therefore, it could be introduced as a new potential candidate for the development of a subunit vaccine against Brucella infection. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Sequence-constructive SELEX: a new strategy for screening DNA aptamer binding to Globo H.

    Science.gov (United States)

    Wang, Chin-Yu; Wu, Chung-Yi; Hung, Ting-Chun; Wong, Chi-Huey; Chen, Chung-Hsuan

    2014-09-26

    We proposed to use a novel stepwise sequence-constructive SELEX method to develop DNA aptamers that can recognize Globo H which is a tumor-associated carbohydrate antigen. A combinatorial synthetic library that consisted of DNA molecules with randomized regions of 15-bases was used as the starting library for the first SELEX procedure. The input DNA library for the second round of SELEX consisted of the extension of the 5' and 3'-ends with 7-bases that were randomized from four selected aptamers. The third round of SELEX was performed following the same procedures as described for the second round of SELEX. The experimental results indicate that the binding affinity of DNA aptamers to Globo H was enhanced when using the sequence-constructive SELEX approach. The selectivity of the DNA aptamers for related disaccharides, mannose derivatives, and Globo H analogs demonstrated the ability of the DNA aptamers to discriminate the presence of various glycans with different structures. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. A strategy of tumor treatment in mice with doxorubicin-cyclophosphamide combination based on dendritic cell activation by human double-stranded DNA preparation

    OpenAIRE

    Alyamkina, Ekaterina A; Nikolin, Valeriy P; Popova, Nelly A.; Dolgova, Evgenia V; Proskurina, Anastasia S; Orishchenko, Konstantin E.; Efremov, Yaroslav R.; Chernykh, Elena R.; Ostanin, Alexandr A.; Sidorov, Sergey V; Ponomarenko, Dmitriy M.; Zagrebelniy, Stanislav N; Bogachev, Sergey S.; Shurdov, Mikhail A

    2010-01-01

    Background Immunization of mice with tumor homogenate after combined treatment with cyclophosphamide (CP) and double-stranded DNA (dsDNA) preparation is effective at inhibition of growth of tumor challenged after the treatment. It was assumed that this inhibition might be due to activation of the antigen-presenting cells. The purpose was to develop improved antitumor strategy using mice. We studied the combined action of cytostatics doxorubicin (Dox) plus CP with subsequent dsDNA preparation ...

  14. Trading strategy based on dynamic mode decomposition: Tested in Chinese stock market

    Science.gov (United States)

    Cui, Ling-xiao; Long, Wen

    2016-11-01

    Dynamic mode decomposition (DMD) is an effective method to capture the intrinsic dynamical modes of complex system. In this work, we adopt DMD method to discover the evolutionary patterns in stock market and apply it to Chinese A-share stock market. We design two strategies based on DMD algorithm. The strategy which considers only timing problem can make reliable profits in a choppy market with no prominent trend while fails to beat the benchmark moving-average strategy in bull market. After considering the spatial information from spatial-temporal coherent structure of DMD modes, we improved the trading strategy remarkably. Then the DMD strategies profitability is quantitatively evaluated by performing SPA test to correct the data-snooping effect. The results further prove that DMD algorithm can model the market patterns well in sideways market.

  15. Agent based models for testing city evacuation strategies under a flood event as strategy to reduce flood risk

    Science.gov (United States)

    Medina, Neiler; Sanchez, Arlex; Nokolic, Igor; Vojinovic, Zoran

    2016-04-01

    This research explores the uses of Agent Based Models (ABM) and its potential to test large scale evacuation strategies in coastal cities at risk from flood events due to extreme hydro-meteorological events with the final purpose of disaster risk reduction by decreasing human's exposure to the hazard. The first part of the paper corresponds to the theory used to build the models such as: Complex adaptive systems (CAS) and the principles and uses of ABM in this field. The first section outlines the pros and cons of using AMB to test city evacuation strategies at medium and large scale. The second part of the paper focuses on the central theory used to build the ABM, specifically the psychological and behavioral model as well as the framework used in this research, specifically the PECS reference model is cover in this section. The last part of this section covers the main attributes or characteristics of human beings used to described the agents. The third part of the paper shows the methodology used to build and implement the ABM model using Repast-Symphony as an open source agent-based modelling and simulation platform. The preliminary results for the first implementation in a region of the island of Sint-Maarten a Dutch Caribbean island are presented and discussed in the fourth section of paper. The results obtained so far, are promising for a further development of the model and its implementation and testing in a full scale city

  16. Universal strategies for the DNA-encoding of libraries of small molecules using the chemical ligation of oligonucleotide tags.

    Science.gov (United States)

    Litovchick, Alexander; Clark, Matthew A; Keefe, Anthony D

    2014-01-01

    The affinity-mediated selection of large libraries of DNA-encoded small molecules is increasingly being used to initiate drug discovery programs. We present universal methods for the encoding of such libraries using the chemical ligation of oligonucleotides. These methods may be used to record the chemical history of individual library members during combinatorial synthesis processes. We demonstrate three different chemical ligation methods as examples of information recording processes (writing) for such libraries and two different cDNA-generation methods as examples of information retrieval processes (reading) from such libraries. The example writing methods include uncatalyzed and Cu(I)-catalyzed alkyne-azide cycloadditions and a novel photochemical thymidine-psoralen cycloaddition. The first reading method "relay primer-dependent bypass" utilizes a relay primer that hybridizes across a chemical ligation junction embedded in a fixed-sequence and is extended at its 3'-terminus prior to ligation to adjacent oligonucleotides. The second reading method "repeat-dependent bypass" utilizes chemical ligation junctions that are flanked by repeated sequences. The upstream repeat is copied prior to a rearrangement event during which the 3'-terminus of the cDNA hybridizes to the downstream repeat and polymerization continues. In principle these reading methods may be used with any ligation chemistry and offer universal strategies for the encoding (writing) and interpretation (reading) of DNA-encoded chemical libraries.

  17. An efficient strategy for large-scale high-throughput transposon-mediated sequencing of cDNA clones

    Science.gov (United States)

    Butterfield, Yaron S. N.; Marra, Marco A.; Asano, Jennifer K.; Chan, Susanna Y.; Guin, Ranabir; Krzywinski, Martin I.; Lee, Soo Sen; MacDonald, Kim W. K.; Mathewson, Carrie A.; Olson, Teika E.; Pandoh, Pawan K.; Prabhu, Anna-Liisa; Schnerch, Angelique; Skalska, Ursula; Smailus, Duane E.; Stott, Jeff M.; Tsai, Miranda I.; Yang, George S.; Zuyderduyn, Scott D.; Schein, Jacqueline E.; Jones, Steven J. M.

    2002-01-01

    We describe an efficient high-throughput method for accurate DNA sequencing of entire cDNA clones. Developed as part of our involvement in the Mammalian Gene Collection full-length cDNA sequencing initiative, the method has been used and refined in our laboratory since September 2000. Amenable to large scale projects, we have used the method to generate >7 Mb of accurate sequence from 3695 candidate full-length cDNAs. Sequencing is accomplished through the insertion of Mu transposon into cDNAs, followed by sequencing reactions primed with Mu-specific sequencing primers. Transposon insertion reactions are not performed with individual cDNAs but rather on pools of up to 96 clones. This pooling strategy reduces the number of transposon insertion sequencing libraries that would otherwise be required, reducing the costs and enhancing the efficiency of the transposon library construction procedure. Sequences generated using transposon-specific sequencing primers are assembled to yield the full-length cDNA sequence, with sequence editing and other sequence finishing activities performed as required to resolve sequence ambiguities. Although analysis of the many thousands (22 785) of sequenced Mu transposon insertion events revealed a weak sequence preference for Mu insertion, we observed insertion of the Mu transposon into 1015 of the possible 1024 5mer candidate insertion sites. PMID:12034834

  18. The Role of Alternative Testing Strategies in Environmental Risk Assessment of Engineered Nanomaterials

    DEFF Research Database (Denmark)

    Hjorth, Rune; Holden, Patricia; Hansen, Steffen Foss

    2017-01-01

    Within toxicology there is a pressure to find new test systems and organisms to replace, reduce and refine animal testing. In nanoecotoxicology the need for alternative testing strategies (ATS) is further emphasized as the validity of tests and risk assessment practices developed for dissolved......) workshop in Washington, D.C. and serves as the point of depature for this paper. Here we present the main outcomes by describing and defining the use of ATS for ENMs as well as discussing its future role in environmental risk science. We conclude that diversity in testing should be encouraged to avoid...

  19. Non-invasive, serum DNA pregnancy testing leading to incidental discovery of cancer: a good thing?

    Science.gov (United States)

    Prasad, Vinay

    2015-11-01

    Cell-free DNA for perinatal screening is a growing industry. Non-invasive prenatal testing (NIPT) is based on the premise that foetal DNA is able to cross the placental barrier and enter the mother's circulation, where it can be examined for chromosomal abnormalities, such as trisomy 13, 18 or 21. Such tests are expected to be widely used by pregnant women, with the annual market expected to surpass $1 billion. Recently, a number of case reports have emerged in the haematology-oncology literature. The routine use of NIPT has led to the discovery of maternal neoplasms. Most writers have concluded that this is yet another benefit of the test; however, a closer examination of the cases reveals that this incidental detection may not improve patient outcomes. In some cases, early detection provides lead time bias, but does not change the ultimate clinical outcome, and in other cases, detection constitutes earlier knowledge of a cancer whose natural history cannot be altered. Here, we explore in detail cases where cancer was incidentally discovered among women undergoing routine non-invasive pregnancy testing, and investigate whether or not these women were benefitted by the discovery.

  20. Estimating Wal-Mart's Impacts in Maryland: A Test of Identification Strategies and Endogeneity Tests

    OpenAIRE

    Michael J. Hicks

    2008-01-01

    In this paper, I estimate the impact of Wal-Mart on labor markets in Maryland. My goal is to compare estimation techniques that incorporate corrections for endogeneity of Wal-Mart's entrance and those that test for and fail to reject exogeneity in Wal-Mart's entrance decision. The instrumental variable approaches I test include those offered by Basker and Neumark et al., and a new test introduced in this paper. I also explain why differences in choice of sample time and location may lead to d...

  1. Optimal Sequential Diagnostic Strategy Generation Considering Test Placement Cost for Multimode Systems

    Directory of Open Access Journals (Sweden)

    Shigang Zhang

    2015-10-01

    Full Text Available Sequential fault diagnosis is an approach that realizes fault isolation by executing the optimal test step by step. The strategy used, i.e., the sequential diagnostic strategy, has great influence on diagnostic accuracy and cost. Optimal sequential diagnostic strategy generation is an important step in the process of diagnosis system construction, which has been studied extensively in the literature. However, previous algorithms either are designed for single mode systems or do not consider test placement cost. They are not suitable to solve the sequential diagnostic strategy generation problem considering test placement cost for multimode systems. Therefore, this problem is studied in this paper. A formulation is presented. Two algorithms are proposed, one of which is realized by system transformation and the other is newly designed. Extensive simulations are carried out to test the effectiveness of the algorithms. A real-world system is also presented. All the results show that both of them have the ability to solve the diagnostic strategy generation problem, and they have different characteristics.

  2. Optimal Sequential Diagnostic Strategy Generation Considering Test Placement Cost for Multimode Systems

    Science.gov (United States)

    Zhang, Shigang; Song, Lijun; Zhang, Wei; Hu, Zheng; Yang, Yongmin

    2015-01-01

    Sequential fault diagnosis is an approach that realizes fault isolation by executing the optimal test step by step. The strategy used, i.e., the sequential diagnostic strategy, has great influence on diagnostic accuracy and cost. Optimal sequential diagnostic strategy generation is an important step in the process of diagnosis system construction, which has been studied extensively in the literature. However, previous algorithms either are designed for single mode systems or do not consider test placement cost. They are not suitable to solve the sequential diagnostic strategy generation problem considering test placement cost for multimode systems. Therefore, this problem is studied in this paper. A formulation is presented. Two algorithms are proposed, one of which is realized by system transformation and the other is newly designed. Extensive simulations are carried out to test the effectiveness of the algorithms. A real-world system is also presented. All the results show that both of them have the ability to solve the diagnostic strategy generation problem, and they have different characteristics. PMID:26457709

  3. Chapter 4: effective search strategies for systematic reviews of medical tests.

    Science.gov (United States)

    Relevo, Rose

    2012-06-01

    This article discusses techniques that are appropriate when developing search strategies for systematic reviews of medical tests. This includes general advice for searching for systematic reviews and issues specific to systematic reviews of medical tests. Diagnostic search filters are currently not sufficiently developed for use when searching for systematic reviews. Instead, authors should construct a highly sensitive search strategy that uses both controlled vocabulary and text words. A comprehensive search should include multiple databases and sources of grey literature. A list of subject-specific databases is included in this article.

  4. 76 FR 20672 - Recommendations on In Vitro Ocular Safety Testing Methods and Strategies and Routine Use of...

    Science.gov (United States)

    2011-04-13

    ... alternative testing methods and strategies proposed to further reduce and refine the use of animals for... accepted the BCOP and ICE test methods for certain regulatory testing purposes without the need for animal... for the alternative testing methods and strategies proposed to further reduce and refine the use of...

  5. 2'-Alkynylnucleotides: A Sequence- and Spin Label-Flexible Strategy for EPR Spectroscopy in DNA.

    Science.gov (United States)

    Haugland, Marius M; El-Sagheer, Afaf H; Porter, Rachel J; Peña, Javier; Brown, Tom; Anderson, Edward A; Lovett, Janet E

    2016-07-27

    Electron paramagnetic resonance (EPR) spectroscopy is a powerful method to elucidate molecular structure through the measurement of distances between conformationally well-defined spin labels. Here we report a sequence-flexible approach to the synthesis of double spin-labeled DNA duplexes, where 2'-alkynylnucleosides are incorporated at terminal and internal positions on complementary strands. Post-DNA synthesis copper-catalyzed azide-alkyne cycloaddition (CuAAC) reactions with a variety of spin labels enable the use of double electron-electron resonance experiments to measure a number of distances on the duplex, affording a high level of detailed structural information.

  6. Utilisation of co-testing 
(human papillomavirus DNA testing and cervical cytology) after treatment of CIN: - a survey of GPs' awareness and knowledge.

    Science.gov (United States)

    Munro, Aime; Codde, Jim; Semmens, James; Leung, Yee; Spilsbury, Katrina; Williams, Vincent; Steel, Nerida; Cohen, Paul; Pavicic, Heidi; Westoby, Vicki; O'Leary, Peter

    2015-01-01

    Patients have an increased risk of persistent/recurrent cervical disease if they received treatment for a high-grade squamous intraepithelial lesion (HSIL). Consequently, understanding whether co-testing (human papillomavirus [HPV] DNA testing and cervical cytology) is fully utilised by general practitioners (GPs) is paramount. After consultation with key stakeholders, an anonymous, self-completion questionnaire was developed and disseminated to GPs who had provided cervical cytology. Responses were received from 745 GPs (30.9% response rate). A significant number (34.3%) of GPs were unaware of the use of co-testing (HPV DNA testing and cervical cytology) for the management of patients after HSIL treatment. Additionally, the majority of GPs reported they did not 'always' receive a clear follow-up plan for patients after treatment of an HSIL. GPs require further support and education to ensure successful adoption of co-testing (HPV DNA testing and cervical cytology), specifically, for patients treated for an HSIL.

  7. A test strategy for the assessment of additive attributed toxicity of tobacco products.

    Science.gov (United States)

    Kienhuis, Anne S; Staal, Yvonne C M; Soeteman-Hernández, Lya G; van de Nobelen, Suzanne; Talhout, Reinskje

    2016-08-01

    The new EU Tobacco Product Directive (TPD) prohibits tobacco products containing additives that are toxic in unburnt form or that increase overall toxicity of the product. This paper proposes a strategy to assess additive attributed toxicity in the context of the TPD. Literature was searched on toxicity testing strategies for regulatory purposes from tobacco industry and governmental institutes. Although mainly traditional in vivo testing strategies have been applied to assess toxicity of unburnt additives and increases in overall toxicity of tobacco products due to additives, in vitro tests combined with toxicogenomics and validated using biomarkers of exposure and disease are most promising in this respect. As such, tests are needed that are sensitive enough to assess additive attributed toxicity above the overall toxicity of tobacco products, which can associate assay outcomes to human risk and exposure. In conclusion, new, sensitive in vitro assays are needed to conclude whether comparable testing allows for assessment of small changes in overall toxicity attributed to additives. A more pragmatic approach for implementation on a short-term is mandated lowering of toxic emission components. Combined with risk assessment, this approach allows assessment of effectiveness of harm reduction strategies, including banning or reducing of additives.

  8. FACTORS AFFECTING RESULT IN CHINESE PROFICIENCY TEST (HSK LEVEL 6: READING SECTION AND PREPARATION STRATEGIES

    Directory of Open Access Journals (Sweden)

    Sri Haryanti

    2013-11-01

    Full Text Available Chinese Proficiency Test (HSK is an internationally standardized exam which tests and rates Chinese language proficiency. The highest level in this test is level 6. The writing part of the test consists of 3 (three parts, namely, (1 listening, (2 reading, (3 writing. Furthermore, the reading part is made of 4 components. Level 6 of this test implies a high degree of difficulty. This paper specifically looked on how to prepare effectively for participants to be able to work on the reading part in order to achieve best result. This article used the methods of literature review and observational study as well as field research and would also incorporate the author’s personal experience in taking the test into recommending strategies for doing the reading part in a level 6 HSK test. Finally, research suggested several techniques and tips that might assist participants in achieving maximum scores in handling the reading part of level 6 HSK test.

  9. FACTORS AFFECTING RESULT IN CHINESE PROFICIENCY TEST (HSK LEVEL 6 READING SECTION AND PREPARATION STRATEGIES

    Directory of Open Access Journals (Sweden)

    Sri Haryanti

    2015-02-01

    Full Text Available Chinese proficiency test (HSK is an internationally standardized exam which tests and rates Chinese language proficiency. The highest level in this test is level 6. The writing part of the test consists of 3 (three parts, namely, (1 listening, (2 reading, (3 writing. Furthermore, the reading part is made of 4 components. Level 6 of this test implies a high degree of difficulty. This paper specifically looked on how to prepare effectively for participants to be able to work on the reading part in order to achieve best result. This article used the methods of literature review and observational study as well as field research and would also incorporate the authors personal experience in taking the test into recommending strategies for doing the reading part in a level 6 HSK test. Finally, research suggested several techniques and tips that might assist participants in achieving maximum scores in handling the reading part of level 6 HSK test.

  10. Paternity test in "Mangalarga-Marchador" equines by DNA-fingerprinting

    Directory of Open Access Journals (Sweden)

    ANUNCIAÇÃO CARLOS EDUARDO

    2000-01-01

    Full Text Available GC-rich molecular minisatellite probes isolated from the human genome have presented a poor ability for individualization in horses. In this study new DNA sequences were isolated which could be used in paternity tests in horses. Genomic DNA from "Mangalarga-Marchador" horses was treated with restriction enzymes that preferentially digest non-repetitive sequences, so preserving the structure where mini and microsatellites are located. Four clones (S01, S05, S07 and S09 selected from a genomic library screened with a (TGn oligonucleotide showed similar hybridization profiles generating bands of DNA-fingerprinting type. Using these probes the individualization power obtained was 10-8, which is 10(5fold higher than that obtained with M13, another GC-rich type probe. All clones were efficient in parentage detection in crossbreedings and presented a 27 bp consensus sequence, GTTTCATTTATTATTCTTTGGAAGAAA, which was repeated 12, 18, 11 and 21 times in clones S01, S05, S07 and S09, respectively.

  11. Metacognitive Strategies and Test Performance: An Experience Sampling Analysis of Students' Learning Behavior

    Directory of Open Access Journals (Sweden)

    Ulrike E. Nett

    2012-01-01

    Full Text Available The aim of the present study was to explore students’ learning-related cognitions prior to an in-class achievement test, with a focus on metacognitive strategy use. A sample of 70 students in grade 11 (58.6% female, Mage=17.09 years completed a series of structured, state-based measures over a two-week period via the experience sampling method until the day before a class test. Results illustrated students’ self-regulatory ability to preserve their motivational and cognitive resources, with test-related cognitions evidenced significantly more often in learning-related as opposed leisure settings. Metacognitive strategy use was also found to significantly increase as the test date approached underscoring the goal-oriented nature of situated learning behaviors. Higher intercepts and increases in frequency of test-related cognitions over time positively corresponded to test performance. Of the three metacognitive strategies assessed, monitoring was found to positively correspond with test performance. Implications for future practice as well as implications for future research employing the experience sampling method are discussed.

  12. Strategies to enhance immunogenicity of cDNA vaccine encoded antigens by modulation of antigen processing

    NARCIS (Netherlands)

    Platteel, Anouk C M; Marit de Groot, A; Andersen, Peter; Ovaa, Huib; Kloetzel, Peter M; Mishto, Michele; Sijts, Alice J A M

    2016-01-01

    Most vaccines are based on protective humoral responses while for intracellular pathogens CD8(+) T cells are regularly needed to provide protection. However, poor processing efficiency of antigens is often a limiting factor in CD8(+) T cell priming, hampering vaccine efficacy. The multistage cDNA va

  13. Software-Supported USER Cloning Strategies for Site-Directed Mutagenesis and DNA Assembly

    DEFF Research Database (Denmark)

    Genee, Hans Jasper; Bonde, Mads Tvillinggaard; Bagger, Frederik Otzen

    2015-01-01

    cloning), facilitates DNA assembly and introduction of virtually any type of site-directed mutagenesis by designing optimal PCR primers for the desired genetic changes. To demonstrate the utility, we designed primers for a simultaneous two-position site-directed mutagenesis of green fluorescent protein...

  14. Organization and evolution of Gorilla centromeric DNA from old strategies to new approaches.

    Science.gov (United States)

    Catacchio, C R; Ragone, R; Chiatante, G; Ventura, M

    2015-09-21

    The centromere/kinetochore interaction is responsible for the pairing and segregation of replicated chromosomes in eukaryotes. Centromere DNA is portrayed as scarcely conserved, repetitive in nature, quickly evolving and protein-binding competent. Among primates, the major class of centromeric DNA is the pancentromeric α-satellite, made of arrays of 171 bp monomers, repeated in a head-to-tail pattern. α-satellite sequences can either form tandem heterogeneous monomeric arrays or assemble in higher-order repeats (HORs). Gorilla centromere DNA has barely been characterized, and data are mainly based on hybridizations of human alphoid sequences. We isolated and finely characterized gorilla α-satellite sequences and revealed relevant structure and chromosomal distribution similarities with other great apes as well as gorilla-specific features, such as the uniquely octameric structure of the suprachromosomal family-2 (SF2). We demonstrated for the first time the orthologous localization of alphoid suprachromosomal families-1 and -2 (SF1 and SF2) between human and gorilla in contrast to chimpanzee centromeres. Finally, the discovery of a new 189 bp monomer type in gorilla centromeres unravels clues to the role of the centromere protein B, paving the way to solve the significance of the centromere DNA's essential repetitive nature in association with its function and the peculiar evolution of the α-satellite sequence.

  15. Novel extraction strategy of ribosomal RNA and genomic DNA from cheese for PCR-based investigations.

    Science.gov (United States)

    Bonaïti, Catherine; Parayre, Sandrine; Irlinger, Françoise

    2006-03-15

    Cheese microorganisms, such as bacteria and fungi, constitute a complex ecosystem that plays a central role in cheeses ripening. The molecular study of cheese microbial diversity and activity is essential but the extraction of high quality nucleic acid may be problematic: the cheese samples are characterised by a strong buffering capacity which negatively influenced the yield of the extracted rRNA. The objective of this study is to develop an effective method for the direct and simultaneous isolation of yeast and bacterial ribosomal RNA and genomic DNA from the same cheese samples. DNA isolation was based on a protocol used for nucleic acids isolation from anaerobic digestor, without preliminary washing step with the combined use of the action of chaotropic agent (acid guanidinium thiocyanate), detergents (SDS, N-lauroylsarcosine), chelating agent (EDTA) and a mechanical method (bead beating system). The DNA purification was carried out by two washing steps of phenol-chloroform. RNA was isolated successfully after the second acid extraction step by recovering it from the phenolic phase of the first acid extraction. The novel method yielded pure preparation of undegraded RNA accessible for reverse transcription-PCR. The extraction protocol of genomic DNA and rRNA was applicable to complex ecosystem of different cheese matrices.

  16. Evaluation of prenatal RHD typing strategies on cell-free fetal DNA from maternal plasma

    NARCIS (Netherlands)

    M.G.H.M. Grootkerk-Tax; A.A. Soussan; M. de Haas; P.A. Maaskant-van Wijk; C.E. van der Schoot

    2006-01-01

    BACKGROUND: The discovery of cell-free fetal DNA in maternal plasma led to the development of assays to predict the fetal D status with RHD-specific sequences. Few assays are designed in such a way that the fetus can be typed in RHD psi mothers and that RHD psi fetuses are correctly typed. Owing to

  17. Strategies for development of functionally equivalent promoters with minimum sequence homology for transgene expression in plants: cis-elements in a novel DNA context versus domain swapping.

    Science.gov (United States)

    Bhullar, Simran; Chakravarthy, Suma; Advani, Sonia; Datta, Sudipta; Pental, Deepak; Burma, Pradeep Kumar

    2003-06-01

    The cauliflower mosaic virus 35S (35S) promoter has been extensively used for the constitutive expression of transgenes in dicotyledonous plants. The repetitive use of the same promoter is known to induce transgene inactivation due to promoter homology. As a way to circumvent this problem, we tested two different strategies for the development of synthetic promoters that are functionally equivalent but have a minimum sequence homology. Such promoters can be generated by (a) introducing known cis-elements in a novel or synthetic stretch of DNA or (b) "domain swapping," wherein domains of one promoter can be replaced with functionally equivalent domains from other heterologous promoters. We evaluated the two strategies for promoter modifications using domain A (consisting of minimal promoter and subdomain A1) of the 35S promoter as a model. A set of modified 35S promoters were developed whose strength was compared with the 35S promoter per se using beta-glucuronidase as the reporter gene. Analysis of the expression of the reporter gene in transient assay system showed that domain swapping led to a significant fall in promoter activity. In contrast, promoters developed by placing cis-elements in a novel DNA context showed levels of expression comparable with that of the 35S. Two promoter constructs Mod2A1T and Mod3A1T were then designed by placing the core sequences of minimal promoter and subdomain A1 in divergent DNA sequences. Transgenics developed in tobacco (Nicotiana tabacum) with the two constructs and with 35S as control were used to assess the promoter activity in different tissues of primary transformants. Mod2A1T and Mod3A1T were found to be active in all of the tissues tested, at levels comparable with that of 35S. Further, the expression of the Mod2A1T promoter in the seedlings of the T1 generation was also similar to that of the 35S promoter. The present strategy opens up the possibility of creating a set of synthetic promoters with minimum sequence

  18. Enzyme-regulated activation of DNAzyme: a novel strategy for a label-free colorimetric DNA ligase assay and ligase-based biosensing.

    Science.gov (United States)

    He, Kaiyu; Li, Wang; Nie, Zhou; Huang, Yan; Liu, Zhuoliang; Nie, Lihua; Yao, Shouzhuo

    2012-03-26

    The DNA nick repair catalyzed by DNA ligase is significant for fundamental life processes, such as the replication, repair, and recombination of nucleic acids. Here, we have employed ligase to regulate DNAzyme activity and developed a homogeneous, colorimetric, label-free and DNAzyme-based strategy to detect DNA ligase activity. This novel strategy relies on the ligation-trigged activation or production of horseradish peroxidase mimicking DNAzyme that catalyzes the generation of a color change signal; this results in a colorimetric assay of DNA ligase activity. Using T4 DNA ligase as a model, we have proposed two approaches to demonstrate the validity of the DNAzyme strategy. The first approach utilizes an allosteric hairpin-DNAzyme probe specifically responsive to DNA ligation; this approach has a wide detection range from 0.2 to 40 U mL(-1) and a detection limit of 0.2 U mL(-1). Furthermore, the approach was adapted to probe nucleic acid phosphorylation and single nucleotide mismatch. The second approach employs a "split DNA machine" to produce numerous DNAzymes after being reassembled by DNA ligase; this greatly enhances the detection sensitivity by a signal amplification cascade to achieve a detection limit of 0.01 U mL(-1).

  19. Development of Software and Strategies for Battery Management System Testing on HIL Simulator

    DEFF Research Database (Denmark)

    Fleischer, Christian; Barreras, Jorge Varela; Christensen, Andreas Elkjær;

    2016-01-01

    In comparison with tests conducted on real Li-ion batteries, Battery Management System (BMS) tests conducted on a Hardware-In-the-Loop (HIL) battery simulator may be more cost and time effective, more flexible and traceable, easier to reproduce and safer beyond the normal range of operation....... This is particularly the case of tests at early stages in the development process or during fault simulation. However, the use of a HIL battery simulator requires the development of software (SW) and strategies for testing. While the possibilities are immense, it should be noted that the greater the level...

  20. A comprehensive strategy to discover inhibitors of the translesion synthesis DNA polymerase κ.

    Directory of Open Access Journals (Sweden)

    Kinrin Yamanaka

    Full Text Available Human DNA polymerase kappa (pol κ is a translesion synthesis (TLS polymerase that catalyzes TLS past various minor groove lesions including N(2-dG linked acrolein- and polycyclic aromatic hydrocarbon-derived adducts, as well as N(2-dG DNA-DNA interstrand cross-links introduced by the chemotherapeutic agent mitomycin C. It also processes ultraviolet light-induced DNA lesions. Since pol κ TLS activity can reduce the cellular toxicity of chemotherapeutic agents and since gliomas overexpress pol κ, small molecule library screens targeting pol κ were conducted to initiate the first step in the development of new adjunct cancer therapeutics. A high-throughput, fluorescence-based DNA strand displacement assay was utilized to screen ∼16,000 bioactive compounds, and the 60 top hits were validated by primer extension assays using non-damaged DNAs. Candesartan cilexetil, manoalide, and MK-886 were selected as proof-of-principle compounds and further characterized for their specificity toward pol κ by primer extension assays using DNAs containing a site-specific acrolein-derived, ring-opened reduced form of γ-HOPdG. Furthermore, candesartan cilexetil could enhance ultraviolet light-induced cytotoxicity in xeroderma pigmentosum variant cells, suggesting its inhibitory effect against intracellular pol κ. In summary, this investigation represents the first high-throughput screening designed to identify inhibitors of pol κ, with the characterization of biochemical and biologically relevant endpoints as a consequence of pol κ inhibition. These approaches lay the foundation for the future discovery of compounds that can be applied to combination chemotherapy.

  1. Assessing the impact of common forensic presumptive tests on the ability to obtain results using a novel rapid DNA platform.

    Science.gov (United States)

    Donachie, Gillian E; Dawnay, Nick; Ahmed, Romana; Naif, Sarah; Duxbury, Nicola J; Tribble, Nicholas D

    2015-07-01

    The rise of DNA evidence to the forefront of forensic science has led to high sample numbers being submitted for profiling by investigators to casework laboratories: bottleneck effects are often seen resulting in slow turnaround times and sample backlog. The ParaDNA(®) Screening and Intelligence Tests have been designed to guide investigators on the viability of potential sources of DNA allowing them to determine which samples should be sent for full DNA analysis. Both tests are designed to augment the arsenal of available forensic tests for end users and be used concurrently to those commonly available. Therefore, assessing the impact that common forensic tests have on such novel technology is important to measure. The systems were tested against various potential inhibitors to which samples may be exposed as part of the investigative process. Presumptive test agents for biological materials (blood, semen and saliva) and those used as fingerprint enhancement agents were both used. The Screening Test showed a drop in performance following application of aluminium powder and cyanoacrylate (CNA) on fingerprints samples; however this drop in performance was not replicated with high template DNA. No significant effect was observed for any agent using the Intelligence Test. Therefore, both tests stand up well to the chemical agents applied and can be used by investigators with confidence that system performance will be maintained.

  2. An Automatic Testing System of Scheduling Strategies in Real-Time UNIX

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    This paper proposes a formal model of the automatic testing system for scheduling strategies in real-time UNIX and describes the algorithm of the key part of the system. The model of the system is an important technology of the automatization of software development. According to the model presented in the paper, many different kinds of automatic testing systems can be designed and developed easily. At the end of the paper, the prototype proves the feasibility of the model and design.

  3. Forging partnerships that work: a strategy for near-patient testing.

    Science.gov (United States)

    Barnes, P W

    1994-01-01

    Near-patient testing systems, which bring innovative technologies to the site of patient care, also offer management challenges to effectively integrate clinical and laboratory services. A two-tiered committee structure--composed of an umbrella "advisory" organization supported by several subcommittees operating as the "working arms" of the program--offers a viable strategy to address issues involved in implementing and monitoring near-patient testing systems.

  4. Developmental toxicology: new directions workshop: refining testing strategies and study designs.

    Science.gov (United States)

    Brannen, Kimberly C; Fenton, Suzanne E; Hansen, Deborah K; Harrouk, Wafa; Kim, James H; Shuey, Dana

    2011-10-01

    In April 2009, the International Life Sciences Institute (ILSI) Health and Environmental Sciences Institute's (HESI) Developmental and Reproductive Toxicology Technical Committee held a two-day workshop entitled "Developmental Toxicology-New Directions." The third session of the workshop focused on ways to refine animal studies to improve relevance and predictivity for human risk. The session included five presentations on: (1) considerations for refining developmental toxicology testing and data interpretation; (2) comparative embryology and considerations in study design and interpretation; (3) pharmacokinetic considerations in study design; (4) utility of genetically modified models for understanding mode-of-action; and (5) special considerations in reproductive testing for biologics. The presentations were followed by discussion by the presenters and attendees. Much of the discussion focused on aspects of refining current animal testing strategies, including use of toxicokinetic data, dose selection, tiered/triggered testing strategies, species selection, and use of alternative animal models. Another major area of discussion was use of non-animal-based testing paradigms, including how to define a "signal" or adverse effect, translating in vitro exposures to whole animal and human exposures, validation strategies, the need to bridge the existing gap between classical toxicology testing and risk assessment, and development of new technologies. Although there was general agreement among participants that the current testing strategy is effective, there was also consensus that traditional methods are resource-intensive and improved effectiveness of developmental toxicity testing to assess risks to human health is possible. This article provides a summary of the session's presentations and discussion and describes some key areas that warrant further consideration. © 2011 Wiley Periodicals, Inc.

  5. Developmental Toxicology—New Directions Workshop: Refining Testing Strategies and Study Designs

    Science.gov (United States)

    Brannen, Kimberly C.; Fenton, Suzanne E.; Hansen, Deborah K.; Harrouk, Wafa; Kim, James H.; Shuey, Dana

    2012-01-01

    In April 2009, the International Life Sciences Institute (ILSI) Health and Environmental Sciences Institute’s (HESI) Developmental and Reproductive Toxicology Technical Committee held a two-day workshop entitled “Developmental Toxicology—New Directions.” The third session of the workshop focused on ways to refine animal studies to improve relevance and predictivity for human risk. The session included five presentations on: (1) considerations for refining developmental toxicology testing and data interpretation; (2) comparative embryology and considerations in study design and interpretation; (3) pharmacokinetic considerations in study design; (4) utility of genetically modified models for understanding mode-of-action; and (5) special considerations in reproductive testing for biologics. The presentations were followed by discussion by the presenters and attendees. Much of the discussion focused on aspects of refining current animal testing strategies, including use of toxicokinetic data, dose selection, tiered/triggered testing strategies, species selection, and use of alternative animal models. Another major area of discussion was use of non-animal-based testing paradigms, including how to define a “signal” or adverse effect, translating in vitro exposures to whole animal and human exposures, validation strategies, the need to bridge the existing gap between classical toxicology testing and risk assessment, and development of new technologies. Although there was general agreement among participants that the current testing strategy is effective, there was also consensus that traditional methods are resource-intensive and improved effectiveness of developmental toxicity testing to assess risks to human health is possible. This article provides a summary of the session’s presentations and discussion and describes some key areas that warrant further consideration. PMID:22006510

  6. Learning strategies, test anxiety and academic success of primary and high- school students at biology class

    OpenAIRE

    Stražar, Klavdija

    2016-01-01

    The extent of learning success of students in school depends upon many factors, among them are having a significant impact learning strategies and influence of test anxiety. Test anxiety refers to the anxiety that occurs in individuals in situations of assessment and evaluation in school. Anxiety in humans is expressed as a long-lasting feeling of anxiety, tension and discomfort that occurs without a specific reason. Persons who are experiencing feelings of anxiety find it difficult to face a...

  7. DNA methylation analysis in self-sampled brush material as a triage test in hrHPV-positive women

    NARCIS (Netherlands)

    Boers, A.; Bosgraaf, R. P.; van Leeuwen, R. W.; Schuuring, E.; Heideman, D. A. M.; Massuger, L. F. A. G.; Verhoef, V. M. J.; Bulten, J.; Melchers, W. J. G.; van der Zee, A. G. J.; Bekkers, R. L. M.; Wisman, G. B. A.

    2014-01-01

    Background: Primary high-risk human papillomavirus (hrHPV) testing in cervical cancer screening shows relatively low specificity, which makes triage testing necessary. In this study, DNA methylation analysis was compared with cytology for triage testing in hrHPV-positive women. Moreover, feasibility

  8. DNA methylation analysis in self-sampled brush material as a triage test in hrHPV-positive women

    NARCIS (Netherlands)

    Boers, A.; Bosgraaf, R.P.; Leeuwen, R.W. van; Schuuring, E.; Heideman, D.A.; Massuger, L.F.; Verhoef, V.M.; Bulten, J.; Melchers, W.J.; Zee, A.G. van der; Bekkers, R.L.; Wisman, G.B.

    2014-01-01

    BACKGROUND: Primary high-risk human papillomavirus (hrHPV) testing in cervical cancer screening shows relatively low specificity, which makes triage testing necessary. In this study, DNA methylation analysis was compared with cytology for triage testing in hrHPV-positive women. Moreover, feasibility

  9. DNA methylation analysis in self-sampled brush material as a triage test in hrHPV-positive women

    NARCIS (Netherlands)

    Boers, A.; Bosgraaf, R. P.; van Leeuwen, R. W.; Schuuring, E.; Heideman, D. A. M.; Massuger, L. F. A. G.; Verhoef, V. M. J.; Bulten, J.; Melchers, W. J. G.; van der Zee, A. G. J.; Bekkers, R. L. M.; Wisman, G. B. A.

    2014-01-01

    Background: Primary high-risk human papillomavirus (hrHPV) testing in cervical cancer screening shows relatively low specificity, which makes triage testing necessary. In this study, DNA methylation analysis was compared with cytology for triage testing in hrHPV-positive women. Moreover, feasibility

  10. Thyroid in a jar: towards an integrated in vitro testing strategy for thyroid-active compounds

    NARCIS (Netherlands)

    Jomaa, B.

    2015-01-01

      Jomaa, B. (2015). Thyroid in a Jar: Towards an Integrated In Vitro Testing Strategy for Thyroid-Active Compounds. PhD thesis, Wageningen University, the Netherlands Abstract The aim of this thesis was to find in vitro and toxicogenomics-based alternatives to

  11. Cognitive Learning Strategy as a Partial Effect on Major Field Test in Business Results

    Science.gov (United States)

    Strang, Kenneth David

    2014-01-01

    An experiment was developed to determine if cognitive learning strategies improved standardized university business exam results. Previous studies revealed that factors such as prior ability, age, gender, and culture predicted a student's Major Field Test in Business (MFTB) score better than course content. The experiment control consisted of…

  12. Recall strategies for the verbal fluency test in patients with multiple sclerosis.

    Science.gov (United States)

    Velázquez-Cardoso, J; Marosi-Holczberger, E; Rodríguez-Agudelo, Y; Yañez-Tellez, G; Chávez-Oliveros, M

    2014-04-01

    Multiple sclerosis (MS) is a neurodegenerative disease characterised by inflammation and demyelination. It generates irreversible myelin changes, which in turn give rise to physical and cognitive disorders. The verbal fluency test (VF) has been shown to be a sensitive tool for detecting cognitive impairment in these patients. To compare quantitative and qualitative aspects of performance on semantic and phonological fluency tests between MS patients and healthy controls by analysing total words produced and strategies used (clusters and switching). We evaluated 46 patients with MS and 33 healthy controls using the VF test. The semantic VF task revealed no significant differences between groups; for the phonological task, patients demonstrated reduced word production (F [77]=2.286 P<.001) and poorer use of grouping strategies, resulting in more frequent switching (F [77]=3.808 P<.005). These results support using qualitative analysis for recall strategies, since the technique provides data about which components of the task are affected by brain damage. Clusters depend on the integrity of semantic memory, while switching has to do with developing effective search strategies, cognitive flexibility, and the ability to modify responses. Frontal lobe damage has been reported in MS, and this is consistent with results from the phonological VF test. Copyright © 2012 Sociedad Española de Neurología. Published by Elsevier Espana. All rights reserved.

  13. DNA damaging effects of carbofuran and its main metabolites on mice by micronucleus test and single cell gel electrophoresis

    Institute of Scientific and Technical Information of China (English)

    ZHOU Pei; LIU Baofeng; LU Yitong

    2005-01-01

    The DNA damaging effects of the carbamate pesticide carbofuran and its four metabolites (carbofuranphenol, 3-ketocarbofuran, 3-hydrocarbofuran and nitrosocarbofuran) on mice were evaluated by single cell gel electrophoresis (SCGE) assay and micronucleus test. KM mice were exposed to test compounds with different doses of 0.1, 0.2 and 0.4mg/kg through intraperitoneal injection two times with an internal of 24 h, and then killed by cervical dislocation 6 h after the second injection. In SCGE assay, isolated mice peripheral blood lymphocytes were employed to determine DNA damaging degree after a 1 h treatment by test compounds and a following electrophoresis. Carbofuran and carbofuranphenol showed negative results in both test and had no obvious toxicity. 3-hydrocarbofuran and nitrosocarbofuran were positive.3-ketocarbofuran could not induce micronucleus formation but caused significant DNA migration in SCGE test. These tests revealed that 3-ketocarbofuran, 3-hydrocarbofuran and nitrosocarbofuran are potential mutagesis and further research is needed.

  14. DNA methylation profiling for a confirmatory test for blood, saliva, semen, vaginal fluid and menstrual blood.

    Science.gov (United States)

    Lee, Hwan Young; Jung, Sang-Eun; Lee, Eun Hee; Yang, Woo Ick; Shin, Kyoung-Jin

    2016-09-01

    The ability to predict the type of tissues or cells from molecular profiles of crime scene samples has important practical implications in forensics. A previously reported multiplex assay using DNA methylation markers could only discriminate between 4 types of body fluids: blood, saliva, semen, and the body fluid which originates from female reproductive organ. In the present study, we selected 15 menstrual blood-specific CpG marker candidates based on analysis of 12 genome-wide DNA methylation profiles of vaginal fluid and menstrual blood. The menstrual blood-specificity of the candidate markers was confirmed by comparison with HumanMethylation450 BeadChip array data obtained for 58 samples including 12 blood, 12 saliva, 12 semen, 3 vaginal fluid, and 19 skin epidermis samples. Among 15CpG marker candidates, 3 were located in the promoter region of the SLC26A10 gene, and 2 of them (cg09696411 and cg18069290) showed high menstrual blood specificity. DNA methylation at the 2CpG markers was further tested by targeted bisulfite sequencing of 461 additional samples including 49 blood, 52 saliva, 34 semen, 125 vaginal fluid, and 201 menstrual blood. Because the 2 markers showed menstrual blood-specific methylation patterns, we modified our previous multiplex methylation SNaPshot reaction to include these 2 markers. In addition, a blood marker cg01543184 with cross reactivity to semen was replaced with cg08792630, and a semen-specific unmethylation marker cg17621389 was removed. The resultant multiplex methylation SNaPshot allowed positive identification of blood, saliva, semen, vaginal fluid and menstrual blood using the 9CpG markers which show a methylation signal only in the target body fluids. Because of the complexity in cell composition, menstrual bloods produced DNA methylation profiles that vary with menstrual cycle and sample collection methods, which are expected to provide more insight into forensic menstrual blood test. Moreover, because the developed

  15. Programming an in vitro DNA oscillator using a molecular networking strategy.

    Science.gov (United States)

    Montagne, Kevin; Plasson, Raphael; Sakai, Yasuyuki; Fujii, Teruo; Rondelez, Yannick

    2011-02-01

    Living organisms perform and control complex behaviours by using webs of chemical reactions organized in precise networks. This powerful system concept, which is at the very core of biology, has recently become a new foundation for bioengineering. Remarkably, however, it is still extremely difficult to rationally create such network architectures in artificial, non-living and well-controlled settings. We introduce here a method for such a purpose, on the basis of standard DNA biochemistry. This approach is demonstrated by assembling de novo an efficient chemical oscillator: we encode the wiring of the corresponding network in the sequence of small DNA templates and obtain the predicted dynamics. Our results show that the rational cascading of standard elements opens the possibility to implement complex behaviours in vitro. Because of the simple and well-controlled environment, the corresponding chemical network is easily amenable to quantitative mathematical analysis. These synthetic systems may thus accelerate our understanding of the underlying principles of biological dynamic modules.

  16. Model-guided ligation strategy for optimal assembly of DNA libraries.

    Science.gov (United States)

    Ng, Daphne T W; Sarkar, Casim A

    2012-10-01

    DNA ligation is essential to many molecular biology manipulations, but this reaction is often carried out by following generic guidelines or by trial and error. Maximizing the desired ligation product is especially important in DNA library construction for directed evolution experiments since library diversity is directly affected by ligation efficiency. Here, we suggest that display vectors that rely on Type IIP restriction sites for cloning should be redesigned to utilize Type IIS restriction sites instead because ligation yield is significantly improved: we observed up to 15- and 2.6-fold increases in desired products for circular and linear ligation reactions, respectively. To guide ligation optimization more rationally, we developed an easily parameterized thermodynamic model that predicts product distributions based on input DNA concentrations and free energies of the ligation events. We applied this model to study ligation reactions using a ribosome display vector redesigned with Type IIS restriction sites (pRDV2). We computationally predicted and experimentally validated the relative abundance of various products in three-piece linear ligations as well as the extent of transformation from vector-insert circular ligations. Based on our results, we provide general insights into ligation and we outline guidelines for optimizing this reaction for both in vivo and in vitro display methodologies.

  17. Dendritic structure DNA for specific metal ion biosensor based on catalytic hairpin assembly and a sensitive synergistic amplification strategy.

    Science.gov (United States)

    Zhao, Jianmin; Jing, Pei; Xue, Shuyan; Xu, Wenju

    2017-01-15

    In this work, a sensitive electrochemical biosensing to Pb(2+) was proposed based on the high specificity of DNAzymes to Pb(2+). The response signal was efficiently amplified by the catalytic hairpin assembly induced by strand replacement reaction and the formation of dendritic structure DNA (DSDNA) by layer-by-layer assembly. Firstly, in the presence of Pb(2+), the substrate strand (S1) of the Pb(2+)-specific DNAzymes was specifically cleaved by Pb(2+). Secondly, one of the two fragments (rS1) introduced into the electrode surface was hybridized with a hairpin DNA (H1) and further replaced by another hairpin DNA (H2) by the hybridization reaction of H1 with H2. The released rS1 then induced the next hybridization with H1. After repeated cycles, the catalytic recycling assembly of H2 with H1 was completed. Thirdly, two bioconjugates of Pt@Pd nanocages (Pt@PdNCs) labeled with DNA S3/S4 and electroactive toluidine blue (Tb) (Tb-S3-Pt@PdNCs and Tb-S4-Pt@PdNCs) were captured onto the resultant electrode surface through the hybridization of S3 and H2, S3 and S4, resulting in the formation of DSDNA triggered by layer-by-layer assembly. This formed DSDNA greatly facilitated the immobilization of manganese(III) meso-tetrakis (4-N-methylpyridiniumyl)-porphyrin (MnTMPyP) as mimicking enzyme. Under the synergistic catalysis of Pt@PdNCs and MnTMPyP to H2O2 reduction, the effective signal amplification of the developed Pb(2+) biosensor was achieved. As a result, the sensitive detection of the proposed electrochemical strategy for Pb(2+) was greatly improved in the range of 0.1pM-200nM with a detection limit of 0.033pM.

  18. Fecal Collection and Stabilization Methods for Improved Fecal DNA Test for Colorectal Cancer in a Screening Setting

    Directory of Open Access Journals (Sweden)

    Francesca Maria Carozzi

    2013-01-01

    Full Text Available Early detection of CRC and adenomas reduces CRC-related mortality. The optimal screening test for CRC is still a subject of debate, and molecular stool sample analysis could provide a valid alternative to conventional methods in terms of compliance and practicability. Seven fecal DNA storage systems were evaluated in two successive phases. In the first phase of the study was selected the preservative buffer able to ensure the best human DNA recovery. In the second phase was evaluated human DNA stability, amplificability and integrity in DNA extracted from selected buffer. Results showed that the best performance was obtained in samples stored in 100 mM EDTA buffer and Genefec buffer. Likewise buffer addition yielded a significant increase in DNA stability and integrity without PCR inhibition, compared to the matched aliquots with no buffer added. Our study shows that samples collected in stabilization solution stabilize DNA so that intact nucleic acids, are more effectively detectable in the molecular assay. DNA buffer preservation and storage conditions could be useful to guarantee the most consistent yield in human DNA. Stabilization buffer addition to stool samples prior to transport presents an easily implemented solution that appears to be highly effective. Overall DNA extracted from faeces preserved in preservative buffer can feasibility been used for molecular analysis leading to an increase of assay sensitivity.

  19. Quantitative analysis of genomic DNA degradation in whole blood under various storage conditions for molecular diagnostic testing.

    Science.gov (United States)

    Permenter, Jessalyn; Ishwar, Arjun; Rounsavall, Angie; Smith, Maddie; Faske, Jennifer; Sailey, Charles J; Alfaro, Maria P

    2015-12-01

    Proper storage of whole blood is crucial for isolating nucleic acids from leukocytes and to ensure adequate performance of downstream assays in the molecular diagnostic laboratory. Short-term and long-term storage recommendations are lacking for successful isolation of genomic DNA (gDNA). Container type (EDTA or heparin), temperature (4 °C and room temperature) and time (1-130 days) were assessed as criterion for sample acceptance policies. The percentage of integrated area (%Ti) between 150 and 10,000 bp from the 2200 TapeStation electropherogram was calculated to measure gDNA degradation. Refrigerated EDTA samples yielded gDNA with low %Ti (high quality). Heparinized samples stored at room temperature yielded gDNA of worst quality. Downstream analysis demonstrated that the quality of the gDNA correlated with the quality of the data; samples with high %Ti generated significantly lower levels of high molecular weight amplicons. Recommendations from these analyses include storing blood samples intended for nucleic acid isolation in EDTA tubes at 4 °C for long term storage (>10 days). gDNA should be extracted within 3 days when blood is stored at room temperature regardless of the container. Finally, refrigerated heparinized samples should not be stored longer than 9 days if expecting high quality gDNA isolates. Laboratories should consider many factors, in addition to the results obtained herein, to update their policies for sample acceptance for gDNA extraction intended for molecular genetic testing.

  20. Efficient Testing Combing Design of Experiment and Learn-to-Fly Strategies

    Science.gov (United States)

    Murphy, Patrick C.; Brandon, Jay M.

    2017-01-01

    Rapid modeling and efficient testing methods are important in a number of aerospace applications. In this study efficient testing strategies were evaluated in a wind tunnel test environment and combined to suggest a promising approach for both ground-based and flight-based experiments. Benefits of using Design of Experiment techniques, well established in scientific, military, and manufacturing applications are evaluated in combination with newly developing methods for global nonlinear modeling. The nonlinear modeling methods, referred to as Learn-to-Fly methods, utilize fuzzy logic and multivariate orthogonal function techniques that have been successfully demonstrated in flight test. The blended approach presented has a focus on experiment design and identifies a sequential testing process with clearly defined completion metrics that produce increased testing efficiency.

  1. Head-to-Head Comparison of Three Vaccination Strategies Based on DNA and Raw Insect-Derived Recombinant Proteins against Leishmania

    Science.gov (United States)

    Núñez, María del Carmen; Laurenti, Márcia D.; Gómez-Sebastián, Silvia; Rodríguez, Fernando; Pérez-Martín, Eva; Escribano, José M.

    2012-01-01

    Parasitic diseases plague billions of people among the poorest, killing millions annually, and causing additional millions of disability-adjusted life years lost. Leishmaniases affect more than 12 million people, with over 350 million people at risk. There is an urgent need for efficacious and cheap vaccines and treatments against visceral leishmaniasis (VL), its most severe form. Several vaccination strategies have been proposed but to date no head-to-head comparison was undertaken to assess which is the best in a clinical model of the disease. We simultaneously assayed three vaccination strategies against VL in the hamster model, using KMPII, TRYP, LACK, and PAPLE22 vaccine candidate antigens. Four groups of hamsters were immunized using the following approaches: 1) raw extracts of baculovirus-infected Trichoplusia ni larvae expressing individually one of the four recombinant proteins (PROT); 2) naked pVAX1 plasmids carrying the four genes individually (DNA); 3) a heterologous prime-boost (HPB) strategy involving DNA followed by PROT (DNA-PROT); and 4) a Control including empty pVAX1 plasmid followed by raw extract of wild-type baculovirus-infected T. ni larvae. Hamsters were challenged with L. infantum promastigotes and maintained for 20 weeks. While PROT vaccine was not protective, DNA vaccination achieved protection in spleen. Only DNA-PROT vaccination induced significant NO production by macrophages, accompanied by a significant parasitological protection in spleen and blood. Thus, the DNA-PROT strategy elicits strong immune responses and high parasitological protection in the clinical model of VL, better than its corresponding naked DNA or protein versions. Furthermore, we show that naked DNA coupled with raw recombinant proteins produced in insect larvae biofactories –the cheapest way of producing DNA-PROT vaccines– is a practical and cost-effective way for potential “off the shelf” supplying vaccines at very low prices for the protection against

  2. Head-to-head comparison of three vaccination strategies based on DNA and raw insect-derived recombinant proteins against Leishmania.

    Science.gov (United States)

    Todolí, Felicitat; Rodríguez-Cortés, Alhelí; Núñez, María Del Carmen; Laurenti, Márcia D; Gómez-Sebastián, Silvia; Rodríguez, Fernando; Pérez-Martín, Eva; Escribano, José M; Alberola, Jordi

    2012-01-01

    Parasitic diseases plague billions of people among the poorest, killing millions annually, and causing additional millions of disability-adjusted life years lost. Leishmaniases affect more than 12 million people, with over 350 million people at risk. There is an urgent need for efficacious and cheap vaccines and treatments against visceral leishmaniasis (VL), its most severe form. Several vaccination strategies have been proposed but to date no head-to-head comparison was undertaken to assess which is the best in a clinical model of the disease. We simultaneously assayed three vaccination strategies against VL in the hamster model, using KMPII, TRYP, LACK, and PAPLE22 vaccine candidate antigens. Four groups of hamsters were immunized using the following approaches: 1) raw extracts of baculovirus-infected Trichoplusia ni larvae expressing individually one of the four recombinant proteins (PROT); 2) naked pVAX1 plasmids carrying the four genes individually (DNA); 3) a heterologous prime-boost (HPB) strategy involving DNA followed by PROT (DNA-PROT); and 4) a Control including empty pVAX1 plasmid followed by raw extract of wild-type baculovirus-infected T. ni larvae. Hamsters were challenged with L. infantum promastigotes and maintained for 20 weeks. While PROT vaccine was not protective, DNA vaccination achieved protection in spleen. Only DNA-PROT vaccination induced significant NO production by macrophages, accompanied by a significant parasitological protection in spleen and blood. Thus, the DNA-PROT strategy elicits strong immune responses and high parasitological protection in the clinical model of VL, better than its corresponding naked DNA or protein versions. Furthermore, we show that naked DNA coupled with raw recombinant proteins produced in insect larvae biofactories -the cheapest way of producing DNA-PROT vaccines- is a practical and cost-effective way for potential "off the shelf" supplying vaccines at very low prices for the protection against

  3. Testing the Efficacy of DNA Barcodes for Identifying the Vascular Plants of Canada

    Science.gov (United States)

    Kuzmina, Maria L.; Sills, Jesse; Zakharov, Evgeny V.; Hebert, Paul D. N.

    2017-01-01

    Their relatively slow rates of molecular evolution, as well as frequent exposure to hybridization and introgression, often make it difficult to discriminate species of vascular plants with the standard barcode markers (rbcL, matK, ITS2). Previous studies have examined these constraints in narrow geographic or taxonomic contexts, but the present investigation expands analysis to consider the performance of these gene regions in discriminating the species in local floras at sites across Canada. To test identification success, we employed a DNA barcode reference library with sequence records for 96% of the 5108 vascular plant species known from Canada, but coverage varied from 94% for rbcL to 60% for ITS2 and 39% for matK. Using plant lists from 27 national parks and one scientific reserve, we tested the efficacy of DNA barcodes in identifying the plants in simulated species assemblages from six biogeographic regions of Canada using BLAST and mothur. Mean pairwise distance (MPD) and mean nearest taxon distance (MNTD) were strong predictors of barcode performance for different plant families and genera, and both metrics supported ITS2 as possessing the highest genetic diversity. All three genes performed strongly in assigning the taxa present in local floras to the correct genus with values ranging from 91% for rbcL to 97% for ITS2 and 98% for matK. However, matK delivered the highest species discrimination (~81%) followed by ITS2 (~72%) and rbcL (~44%). Despite the low number of plant taxa in the Canadian Arctic, DNA barcodes had the least success in discriminating species from this biogeographic region with resolution ranging from 36% with rbcL to 69% with matK. Species resolution was higher in the other settings, peaking in the Woodland region at 52% for rbcL and 87% for matK. Our results indicate that DNA barcoding is very effective in identifying Canadian plants to a genus, and that it performs well in discriminating species in regions where floristic diversity is

  4. A testing strategy to predict risk for drug-induced liver injury in humans using high-content screen assays and the 'rule-of-two' model.

    Science.gov (United States)

    Chen, Minjun; Tung, Chun-Wei; Shi, Qiang; Guo, Lei; Shi, Leming; Fang, Hong; Borlak, Jürgen; Tong, Weida

    2014-07-01

    Drug-induced liver injury (DILI) is a major cause of drug failures in both the preclinical and clinical phase. Consequently, improving prediction of DILI at an early stage of drug discovery will reduce the potential failures in the subsequent drug development program. In this regard, high-content screening (HCS) assays are considered as a promising strategy for the study of DILI; however, the predictive performance of HCS assays is frequently insufficient. In the present study, a new testing strategy was developed to improve DILI prediction by employing in vitro assays that was combined with the RO2 model (i.e., 'rule-of-two' defined by daily dose ≥100 mg/day & logP ≥3). The RO2 model was derived from the observation that high daily doses and lipophilicity of an oral medication were associated with significant DILI risk in humans. In the developed testing strategy, the RO2 model was used for the rational selection of candidates for HCS assays, and only the negatives predicted by the RO2 model were further investigated by HCS. Subsequently, the effects of drug treatment on cell loss, nuclear size, DNA damage/fragmentation, apoptosis, lysosomal mass, mitochondrial membrane potential, and steatosis were studied in cultures of primary rat hepatocytes. Using a set of 70 drugs with clear evidence of clinically relevant DILI, the testing strategy improved the accuracies by 10 % and reduced the number of drugs requiring experimental assessment by approximately 20 %, as compared to the HCS assay alone. Moreover, the testing strategy was further validated by including published data (Cosgrove et al. in Toxicol Appl Pharmacol 237:317-330, 2009) on drug-cytokine-induced hepatotoxicity, which improved the accuracies by 7 %. Taken collectively, the proposed testing strategy can significantly improve the prediction of in vitro assays for detecting DILI liability in an early drug discovery phase.

  5. Modelling and operation strategies of DLR's large scale thermocline test facility (TESIS)

    Science.gov (United States)

    Odenthal, Christian; Breidenbach, Nils; Bauer, Thomas

    2017-06-01

    In this work an overview of the TESIS:store thermocline test facility and its current construction status will be given. Based on this, the TESIS:store facility using sensible solid filler material is modelled with a fully transient model, implemented in MATLAB®. Results in terms of the impact of filler site and operation strategies will be presented. While low porosity and small particle diameters for the filler material are beneficial, operation strategy is one key element with potential for optimization. It is shown that plant operators have to ponder between utilization and exergetic efficiency. Different durations of the charging and discharging period enable further potential for optimizations.

  6. An economic analysis of hyperketonemia testing and propylene glycol treatment strategies in early lactation dairy cattle.

    Science.gov (United States)

    McArt, J A A; Nydam, D V; Oetzel, G R; Guard, C L

    2014-11-01

    The purpose was to develop stochastic economic models which address variation in disease risks and costs in order to evaluate different simulated on-farm testing and propylene glycol (PG) treatment strategies based on herd hyperketonemia (HYK) incidence during the first 30 DIM. Data used in model development concerning the difference in health and production consequences between HYK and non-ketotic cows were based on results from 10 studies representing over 13,000 cows from 833 dairy farms in North America, Canada, and Europe. Inputs for PG associated variables were based on a large field trial using cows from 4 free-stall dairy herds (2 in New York and 2 in Wisconsin). Four simulated on-farm testing and treatment strategies were analyzed at herd HYK incidences ranging from 5% to 80% and included: 1) treating all cows with 5d of PG starting at 5 DIM, 2) testing all cows for HYK 1 day per week (e.g. Mondays) from 3 to 16 DIM and treating all positive cows with 5d of oral PG, 3) testing all cows for HYK 2 days per week (e.g. Mondays and Thursdays) from 3 to 9 DIM and treating all positive cows with 5d of oral PG, and 4) testing all cows for HYK 3 days per week (e.g. Mondays, Wednesdays, and Fridays) from 3 to 16 DIM and treating all positive cows with 5d of oral PG. Cost-benefit analysis included the costs associated with labor to test cows, β-hydroxybutyrate test strips, labor to treat cows, PG, and the associated gain in milk production, decrease in DA and early removal risks of PG treated HYK positive cows compared to non-treated HYK positive cows. Stochastic models were developed to account for variability in the distribution of input variables. Per 100 fresh cows in a herd with an HYK incidence of 40%, the mean economic benefits of the 4 different strategies were $1088, $744, $1166, and $760, respectively. Testing cows 2 days per week from 3 to 9 DIM was the most cost-effective strategy for herds with HYK incidences between 15% and 50%; above 50%, treating all

  7. Dental Student Study Strategies: Are Self-Testing and Scheduling Related to Academic Performance?

    Science.gov (United States)

    McAndrew, Maureen; Morrow, Christina S; Atiyeh, Lindsey; Pierre, Gaëlle C

    2016-05-01

    Self-testing, a strategy wherein a student actively engages in creating questions and answers from study materials to assist with studying, has been found to be especially advantageous because it enhances future retrieval of information. Studies have found correlations among students' grade point averages (GPAs), self-testing, and rereading study strategies, as well as the spacing of study sessions over time. The aim of this study was to assess relationships among dental students' study strategies, scheduling of study time, and academic achievement. A 16-item survey requesting information on study habits, study schedules, and GPAs was distributed to 358 second-year dental students at New York University College of Dentistry. Additionally, the survey asked students to report the average number of hours per week they devoted to studying for didactic courses and preparing for hands-on preclinical courses. Of the 358 students, 94 (26%) responded to the survey. The vast majority of the respondents reported utilizing self-testing and rereading study strategies. High performers (with higher GPAs) were more likely to use self-testing, especially with flashcards, and to space their studying over multiple sessions. Lower performing students were more likely to highlight or underline their notes and to mass their study sessions or cram. Longer hours devoted to studying and practicing for simulation courses were associated with stronger performance; lower performers reported spending significantly fewer hours practicing for simulation courses. Half of the dental students surveyed said that they felt their studying would be more productive in the morning, although 84% reported doing most of their studying in the evening or late night. Sound study decisions depend on accurate regulation of ongoing learning and appropriate use and timing of evidence-based study strategies, so these results suggest that dental students may require guidance in these areas.

  8. Targeting the Parasite's DNA with Methyltriazenyl Purine Analogs Is a Safe, Selective, and Efficacious Antitrypanosomal Strategy

    NARCIS (Netherlands)

    Rodenko, B.; Wanner, M.J.; Alkhaldi, A.A.M.; Ebiloma, G.U.; Barnes, R.L.; Kaiser, M.; Brun, R.; McCulloch, R.; Koomen, G.J.; de Koning, H.P.

    2015-01-01

    The human and veterinary disease complex known as African trypanosomiasis continues to inflict significant global morbidity, mortality, and economic hardship. Drug resistance and toxic side effects of old drugs call for novel and unorthodox strategies for new and safe treatment options. We designed

  9. Potential of environmental DNA to evaluate Northern pike (Esox lucius) eradication efforts: An experimental test and case study

    Science.gov (United States)

    Dunker, Kristine J.; Sepulveda, Adam; Massengill, Robert L.; Olsen, Jeffrey B.; Russ, Ora L.; Wenburg, John K.; Antonovich, Anton

    2016-01-01

    Determining the success of invasive species eradication efforts is challenging because populations at very low abundance are difficult to detect. Environmental DNA (eDNA) sampling has recently emerged as a powerful tool for detecting rare aquatic animals; however, detectable fragments of DNA can persist over time despite absence of the targeted taxa and can therefore complicate eDNA sampling after an eradication event. This complication is a large concern for fish eradication efforts in lakes since killed fish can sink to the bottom and slowly decay. DNA released from these carcasses may remain detectable for long periods. Here, we evaluated the efficacy of eDNA sampling to detect invasive Northern pike (Esox lucius) following piscicide eradication efforts in southcentral Alaskan lakes. We used field observations and experiments to test the sensitivity of our Northern pike eDNA assay and to evaluate the persistence of detectable DNA emitted from Northern pike carcasses. We then used eDNA sampling and traditional sampling (i.e., gillnets) to test for presence of Northern pike in four lakes subjected to a piscicide-treatment designed to eradicate this species. We found that our assay could detect an abundant, free-roaming population of Northern pike and could also detect low-densities of Northern pike held in cages. For these caged Northern pike, probability of detection decreased with distance from the cage. We then stocked three lakes with Northern pike carcasses and collected eDNA samples 7, 35 and 70 days post-stocking. We detected DNA at 7 and 35 days, but not at 70 days. Finally, we collected eDNA samples ~ 230 days after four lakes were subjected to piscicide-treatments and detected Northern pike DNA in 3 of 179 samples, with a single detection at each of three lakes, though we did not catch any Northern pike in gillnets. Taken together, we found that eDNA can help to inform eradication efforts if used in conjunction with multiple lines of inquiry and sampling

  10. Potential of Environmental DNA to Evaluate Northern Pike (Esox lucius) Eradication Efforts: An Experimental Test and Case Study.

    Science.gov (United States)

    Dunker, Kristine J; Sepulveda, Adam J; Massengill, Robert L; Olsen, Jeffrey B; Russ, Ora L; Wenburg, John K; Antonovich, Anton

    2016-01-01

    Determining the success of invasive species eradication efforts is challenging because populations at very low abundance are difficult to detect. Environmental DNA (eDNA) sampling has recently emerged as a powerful tool for detecting rare aquatic animals; however, detectable fragments of DNA can persist over time despite absence of the targeted taxa and can therefore complicate eDNA sampling after an eradication event. This complication is a large concern for fish eradication efforts in lakes since killed fish can sink to the bottom and slowly decay. DNA released from these carcasses may remain detectable for long periods. Here, we evaluated the efficacy of eDNA sampling to detect invasive Northern pike (Esox lucius) following piscicide eradication efforts in southcentral Alaskan lakes. We used field observations and experiments to test the sensitivity of our Northern pike eDNA assay and to evaluate the persistence of detectable DNA emitted from Northern pike carcasses. We then used eDNA sampling and traditional sampling (i.e., gillnets) to test for presence of Northern pike in four lakes subjected to a piscicide-treatment designed to eradicate this species. We found that our assay could detect an abundant, free-roaming population of Northern pike and could also detect low-densities of Northern pike held in cages. For these caged Northern pike, probability of detection decreased with distance from the cage. We then stocked three lakes with Northern pike carcasses and collected eDNA samples 7, 35 and 70 days post-stocking. We detected DNA at 7 and 35 days, but not at 70 days. Finally, we collected eDNA samples ~ 230 days after four lakes were subjected to piscicide-treatments and detected Northern pike DNA in 3 of 179 samples, with a single detection at each of three lakes, though we did not catch any Northern pike in gillnets. Taken together, we found that eDNA can help to inform eradication efforts if used in conjunction with multiple lines of inquiry and sampling

  11. Sensitivity, specificity, and clinical value of human papillomavirus (HPV) E6/E7 mRNA assay as a triage test for cervical cytology and HPV DNA test.

    Science.gov (United States)

    Benevolo, Maria; Vocaturo, Amina; Caraceni, Donatella; French, Deborah; Rosini, Sandra; Zappacosta, Roberta; Terrenato, Irene; Ciccocioppo, Lucia; Frega, Antonio; Giorgi Rossi, Paolo

    2011-07-01

    There is evidence that testing for human papillomavirus (HPV) E6/E7 mRNA is more specific than testing for HPV DNA. A retrospective study was carried out to evaluate the performance of the PreTect HPV-Proofer E6/E7 mRNA assay (Norchip) as a triage test for cytology and HPV DNA testing. This study analyzed 1,201 women, 688 of whom had a colposcopy follow-up and 195 of whom had histology-confirmed high-grade intraepithelial neoplasia or worse (CIN2+). The proportion of positive results and the sensitivity and specificity for CIN2+ were determined for HPV mRNA in comparison to HPV DNA and cytology. All data were adjusted for follow-up completeness. Stratified by cytological grades, the HPV mRNA sensitivity was 83% (95% confidence interval [CI] = 63 to 94%) in ASC-US (atypical squamous cells of undetermined significance), 62% (95% CI = 47 to 75%) in L-SIL (low-grade squamous intraepithelial lesion), and 67% (95% CI = 57 to 76%) in H-SIL (high-grade squamous intraepithelial lesion). The corresponding figures were 99, 91, and 96%, respectively, for HPV DNA. The specificities were 82, 76, and 45%, respectively, for HPV mRNA and 29, 13, and 4%, respectively, for HPV DNA. Used as a triage test for ASC-US and L-SIL, mRNA reduced colposcopies by 79% (95% CI = 74 to 83%) and 69% (95% CI = 65 to 74%), respectively, while HPV DNA reduced colposcopies by 38% (95% CI = 32 to 44%) and by 15% (95% CI = 12 to 19%), respectively. As a HPV DNA positivity triage test, mRNA reduced colposcopies by 63% (95% CI = 60 to 66%), having 68% sensitivity (95% CI = 61 to 75%), whereas cytology at the ASC-US+ threshold reduced colposcopies by 23% (95% CI = 20 to 26%), showing 92% sensitivity (95% CI = 87 to 95%). In conclusion, PreTect HPV-Proofer mRNA can serve as a better triage test than HPV DNA to reduce colposcopy referral in both ASC-US and L-SIL. It is also more efficient than cytology for the triage of HPV DNA-positive women. Nevertheless, its low sensitivity demands a strict follow-up of

  12. Effects of Sperm DNA Fragmentation on Semen Parameters and ICSI Outcome Determined by an Improved SCD Test,Halosperm

    Directory of Open Access Journals (Sweden)

    Asuman Demiroglu Zergeroğlu

    2010-01-01

    Full Text Available Background: Sperm DNA fragmentation is known as an important cause of male infertility.The influence of sperm DNA damage on reproductive potential has been subject of many studiesindicating various results and remaining the subject controversial. In this study, we investigateddifferences of the semen parameters and intracytoplasmic sperm injection (ICSI outcome accordingto sperm DNA fragmentation levels (DFLs of patients.Materials and Methods: The DFLs were determined by Halosperm, a new improved spermchromatin dispersion (SCD test. Patients were grouped as low DNA fragmentation group (LFG≤30% and high fragmentation group (HFG >30%.Results: Our analysis showed that semen parameters including concentration of untreated spermand motility of prepared semen were low in HGF, whereas other parameters were not different.Sperm DNA fragmentation levels decreased in both groups after semen preparation by densitygradient technique.Conclusion: No difference was detected on ICSI outcomes (fertilization, embryo development,embryo cleavage, embryo quality and pregnancy rates between two group.

  13. Design of different strategies of multivalent DNA-based vaccination against rabies and canine distemper in mice and dogs

    Directory of Open Access Journals (Sweden)

    Touihri Leila

    2012-12-01

    Full Text Available Abstract Background During the vaccination campaigns, puppies younger than 3 months old are not targeted and remain unvaccinated for at least the first year of their lives. Almost half of the reported rabid dogs are 6 months or younger. Hence, we should recommend the vaccination against rabies of young puppies. Unfortunately, owing to the exposure of puppies to infections with either canine parvovirus (CPV or distemper virus (CDV after the intervention of the vaccinators, owners are reluctant to vaccinate puppies against rabies. Therefore, it is necessary to include the CPV and CDV valences in the vaccine against rabies. Multivalent DNA-based vaccination in dogs, including rabies and distemper valences, could help in raising vaccine coverage. Methods We have designed monovalent and multivalent DNA-based vaccine candidates for in vitro and in vivo assays. These plasmids encode to the rabies virus glycoprotein and/or the canine distemper virus hemagglutinin. The first strategy of multivalent DNA-based vaccination is by mixing plasmids encoding to a single antigen each. The second is by simply fusing the genes of the antigens together. The third is by adding the foot and mouth disease virus (FMDV 2A oligopeptide gene into the antigen genes. The last strategy is by the design and use of a bicistronic plasmid with an “Internal Ribosome Entry Site” (IRES domain. Results The monovalent construct against canine distemper was efficiently validated by inducing higher humoral immune responses compared to cell-culture-derived vaccine both in mice and dogs. All multivalent plasmids efficiently expressed both valences after in vitro transfection of BHK-21 cells. In BALB/c mice, the bicistronic IRES-dependant construct was the most efficient inducer of virus-neutralizing antibodies against both valences. It was able to induce better humoral immune responses compared to the administration of either cell-culture-derived vaccines or monovalent plasmids. The

  14. New strategy for stable-isotope-aided, multidimensional NMR spectroscopy of DNA oligomers

    Energy Technology Data Exchange (ETDEWEB)

    Ono, Okira; Tate, Shin-Ichi; Kainosho, Masatsune [Tokyo Metropolitan Univ., Tokyo (Japan)

    1994-12-01

    Nuclear Magnetic Resonance (NMR) is the most efficient method for determining the solution structures of biomolecules. By applying multidimensional heteronuclear NMR techniques to {sup 13}C/{sup 15}N-labeled proteins, we can determine the solution structures of proteins with molecular mass of 20 to 30kDa at an accuracy similar to that of x-ray crystallography. Improvements in NMR instrumentation and techniques as well as the development of protein engineering methods for labeling proteins have rapidly advanced multidimensional heteronuclear NMR of proteins. In contrast, multidimensional heteronuclear NMR studies of nucleic acids is less advanced because there were no efficient methods for preparing large amounts of labeled DNA/RNA oligomers. In this report, we focused on the chemical synthesis of DNA oligomers labeled at specific residue(s). RNA oligomers with specific labels, which are difficult to synthesize by the enzyme method, can be synthesized by the chemical method. The specific labels are useful for conformational analysis of larger molecules such as protein-nucleic acid complexes.

  15. Strategies for PCR based detection of Burkholderia pseudomallei DNA in paraffin wax embedded tissues.

    Science.gov (United States)

    Hagen, R M; Gauthier, Y P; Sprague, L D; Vidal, D R; Zysk, G; Finke, E-J; Neubauer, H

    2002-12-01

    Recently, several cases of melioidosis imported to Europe have been reported. The diagnosis of the acute or chronic infection remains challenging. This report describes an optimised protocol for fast and reliable DNA preparation for use in two different polymerase chain reaction (PCR) assays, namely: (1) a seminested PCR assay targeting a genus specific sequence of the ribosomal protein subunit 21 (rpsU) gene and (2) a nested PCR assay targeting the gene encoding the filament forming flagellin (fliC). Various strains of Burkholderia spp, strains of closely related genera, and spleen tissue samples of experimentally infected mice were investigated. The combination of PCR and sequencing of the amplicons resulted in high sensitivity and specificity. These procedures may allow rapid, sensitive, and reliable detection of B pseudomallei DNA in routinely formalin fixed and paraffin wax embedded samples, thus providing a safe diagnostic tool and avoiding the cultivation of a risk group 3 agent. In addition, this method could be useful for retrospective histopathological investigations.

  16. Case-control association testing of common variants from sequencing of DNA pools.

    Directory of Open Access Journals (Sweden)

    Allan F McRae

    Full Text Available While genome-wide association studies (GWAS have been successful in identifying a large number of variants associated with disease, the challenge of locating the underlying causal loci remains. Sequencing of case and control DNA pools provides an inexpensive method for assessing all variation in a genomic region surrounding a significant GWAS result. However, individual variants need to be ranked in terms of the strength of their association to disease in order to prioritise follow-up by individual genotyping. A simple method for testing for case-control association in sequence data from DNA pools is presented that allows the partitioning of the variance in allele frequency estimates into components due to the sampling of chromosomes from the pool during sequencing, sampling individuals from the population and unequal contribution from individuals during pool construction. The utility of this method is demonstrated on a sequence from the alcohol dehydrogenase (ADH gene cluster on a case-control sample for heavy alcohol consumption.

  17. Signal amplification strategies for DNA and protein detection based on polymeric nanocomposites and polymerization: A review

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Shaohong; Yuan, Liang; Hua, Xin; Xu, Lingling; Liu, Songqin, E-mail: liusq@seu.edu.cn

    2015-06-02

    Highlights: • We review the innovative advances in polymer-based signal amplification. • Conceptual connectivity between different amplified methodologies is illustrated. • Examples explain the mechanisms of polymers/polymerizations-based amplification. • Several elegant applications are summarized that illustrate underlying concept. - Abstract: Demand is increasing for ultrasensitive bioassays for disease diagnosis, environmental monitoring and other research areas. This requires novel signal amplification strategies to maximize the signal output. In this review, we focus on a series of significant signal amplification strategies based on polymeric nanocomposites and polymerization. Some common polymers are used as carriers to increase the local concentration of signal probes and/or biomolecules on their surfaces or in their interiors. Some polymers with special fluorescence and optical properties can efficiently transfer the excitation energy from a single site to the whole polymer backbone. This results in superior fluorescence signal amplification due to the resulting collective effort (integration of signal). Recent polymerization-based signal amplification strategies that employ atom transfer radical polymerization (ATRP) and photo-initiated polymerization are also summarized. Several distinctive applications of polymers in ultrasensitive bioanalysis are highlighted.

  18. Highly Effective DNA Extraction Method for Nuclear Short Tandem Repeat Testing of Skeletal Remains from Mass Graves

    Science.gov (United States)

    Davoren, Jon; Vanek, Daniel; Konjhodzić, Rijad; Crews, John; Huffine, Edwin; Parsons, Thomas J.

    2007-01-01

    Aim To quantitatively compare a silica extraction method with a commonly used phenol/chloroform extraction method for DNA analysis of specimens exhumed from mass graves. Methods DNA was extracted from twenty randomly chosen femur samples, using the International Commission on Missing Persons (ICMP) silica method, based on Qiagen Blood Maxi Kit, and compared with the DNA extracted by the standard phenol/chloroform-based method. The efficacy of extraction methods was compared by real time polymerase chain reaction (PCR) to measure DNA quantity and the presence of inhibitors and by amplification with the PowerPlex 16 (PP16) multiplex nuclear short tandem repeat (STR) kit. Results DNA quantification results showed that the silica-based method extracted on average 1.94 ng of DNA per gram of bone (range 0.25-9.58 ng/g), compared with only 0.68 ng/g by the organic method extracted (range 0.0016-4.4880 ng/g). Inhibition tests showed that there were on average significantly lower levels of PCR inhibitors in DNA isolated by the organic method. When amplified with PP16, all samples extracted by silica-based method produced 16 full loci profiles, while only 75% of the DNA extracts obtained by organic technique amplified 16 loci profiles. Conclusions The silica-based extraction method showed better results in nuclear STR typing from degraded bone samples than a commonly used phenol/chloroform method. PMID:17696302

  19. Cost-effectiveness of HIV testing referral strategies among tuberculosis patients in India.

    Directory of Open Access Journals (Sweden)

    Lauren M Uhler

    Full Text Available BACKGROUND: Indian guidelines recommend routine referral for HIV testing of all tuberculosis (TB patients in the nine states with the highest HIV prevalence, and selective referral for testing elsewhere. We assessed the clinical impact and cost-effectiveness of alternative HIV testing referral strategies among TB patients in India. METHODS AND FINDINGS: We utilized a computer model of HIV and TB disease to project outcomes for patients with active TB in India. We compared life expectancy, cost, and cost-effectiveness for three HIV testing referral strategies: 1 selective referral for HIV testing of those with increased HIV risk, 2 routine referral of patients in the nine highest HIV prevalence states with selective referral elsewhere (current standard, and 3 routine referral of all patients for HIV testing. TB-related data were from the World Health Organization. HIV prevalence among TB patients was 9.0% in the highest prevalence states, 2.9% in the other states, and 4.9% overall. The selective referral strategy, beginning from age 33.50 years, had a projected discounted life expectancy of 16.88 years and a mean lifetime HIV/TB treatment cost of US$100. The current standard increased mean life expectancy to 16.90 years with additional per-person cost of US$10; the incremental cost-effectiveness ratio was US$650/year of life saved (YLS compared to selective referral. Routine referral of all patients for HIV testing increased life expectancy to 16.91 years, with an incremental cost-effectiveness ratio of US$730/YLS compared to the current standard. For HIV-infected patients cured of TB, receiving antiretroviral therapy increased survival from 4.71 to 13.87 years. Results were most sensitive to the HIV prevalence and the cost of second-line antiretroviral therapy. CONCLUSIONS: Referral of all patients with active TB in India for HIV testing will be both effective and cost-effective. While effective implementation of this strategy would require

  20. The Exploitive Mating Strategy of the Dark Triad Traits: Tests of Rape-Enabling Attitudes.

    Science.gov (United States)

    Jonason, Peter K; Girgis, Mary; Milne-Home, Josephine

    2017-01-24

    The Dark Triad traits have been repeatedly labeled as facilitating an exploitive mating strategy. However, various researchers have repeatedly conflated short-term mating or casual sex with an exploitive mating strategy. In this study using Mechanical Turk participants (N = 252; 142 men, 110 women), we provided a better test of just how sexually exploitive those high on the Dark Triad traits might be by examining how the traits related to rape-enabling attitudes. We examined how each trait may facilitate rape, whether these associations were robust to partialing the variance associated with the Big Five traits and similar in men and women, and showed that one reason why men may be more likely to rape than women is they are characterized by the Dark Triad traits more than women are. In so doing, we test the confluence model of rape that asserts that personality traits similar to the Dark Triad traits act as one pathway to rape.

  1. An extremely sensitive species-specific ARMs PCR test for the presence of tiger bone DNA.

    Science.gov (United States)

    Wetton, Jon H; Tsang, Carol S F; Roney, Chris A; Spriggs, Adrian C

    2004-02-10

    The survival of the tiger (Panthera tigris) is seriously threatened by poaching to provide raw materials for Traditional Chinese Medicines (TCMs). Most highly prized are the tiger's bones, which are used in combination with other animal and plant derivatives in pills and plasters for the treatment of rheumatism and other ailments. Hundreds of patent remedies have been produced which claim to contain tiger bone, but proof of its presence is needed, if legislation prohibiting the trade in endangered species is to be enforced. A highly sensitive tiger-specific real-time PCR assay has been developed to address this problem. Using primers specific to the tiger mitochondrial cytochrome b gene, successful amplification has been reliably achieved from blood, hair and bone as well as from a range of TCMs spiked with 0.5% tiger bone. Although capable of detecting fewer than 10 substrate molecules, the seven varieties of TCM pills and plasters tested showed no detectable trace of tiger DNA before spiking. Furthermore, sequencing several "tiger bone" fragments seized from TCM shops has shown that they actually originated from cattle and pigs. The potential effects of traditional bone preparation methods, evidence that much lower concentrations are used than alleged on TCM packaging, and substitution of bones from other species all suggest a low likelihood of detecting tiger DNA in patent medicines. Despite this, the basic methods have been thoroughly proven and can be readily applied to derivatives from other CITES protected species providing a rapid and highly sensitive forensic test for species of origin. Potential applications to the monitoring of wild populations are demonstrated by the successful identification of shed hairs and faecal samples.

  2. The DNA Repair Inhibitor DT01 as a Novel Therapeutic Strategy for Chemosensitization of Colorectal Liver Metastasis.

    Science.gov (United States)

    Herath, Nirmitha I; Devun, Flavien; Lienafa, Marie-Christine; Herbette, Aurélie; Denys, Alban; Sun, Jian-Sheng; Dutreix, Marie

    2016-01-01

    Metastatic liver disease from colorectal cancer is a significant clinical problem. This is mainly attributed to nonresectable metastases that frequently display low sensitivities to available chemotherapies and develop drug resistance partly via hyperactivation of some DNA repair functions. Combined therapies have shown some disease control; however, there is still a need for more efficient chemotherapies to achieve eradication of colorectal cancer liver metastasis. We investigated the tolerance and efficacy of a novel class of DNA repair inhibitors, Dbait, in association with conventional chemotherapy. Dbait mimics double-strand breaks and activates damage signaling, consequently inhibiting single- and double-stranded DNA repair enzyme recruitment. In vitro, Dbait treatment increases sensitivity of HT29 and HCT116 colorectal cancer cell lines. In vivo, the pharmacokinetics, biodistribution and the efficacy of the cholesterol-conjugated clinical form of Dbait, DT01, were assessed. The chemosensitizing abilities of DT01 were evaluated in association with oxaliplatin and 5-fluorouracil in intrahepatic HT29 xenografted mice used as a model for colorectal cancer liver metastasis. The high uptake of DT01 indicates that the liver is a specific target. We demonstrate significant antitumor efficacy in a liver metastasis model with DT01 treatment in combination with oxaliplatin and 5-fluorouracil (mean: 501 vs. 872 mm(2), P = 0.02) compared to chemotherapy alone. The decrease in tumor volume is further associated with significant histologic changes in necrosis, proliferation, angiogenesis and apoptosis. Repeated cycles of DT01 do not increase chemotherapy toxicity. Combining DT01 with conventional chemotherapy may prove to be a safe and effective therapeutic strategy in the treatment of metastatic liver cancer.

  3. Analysis of fingerprint samples, testing various conditions, for forensic DNA identification.

    Science.gov (United States)

    Ostojic, Lana; Wurmbach, Elisa

    2017-01-01

    Fingerprints can be of tremendous value for forensic biology, since they can be collected from a wide variety of evident types, such as handles of weapons, tools collected in criminal cases, and objects with no apparent staining. DNA obtained from fingerprints varies greatly in quality and quantity, which ultimately affects the quality of the resulting STR profiles. Additional difficulties can arise when fingerprint samples show mixed STR profiles due to the handling of multiple persons. After applying a tested protocol for sample collection (swabbing with 5% Triton X-100), DNA extraction (using an enzyme that works at elevated temperatures), and PCR amplification (AmpFlSTR® Identifiler® using 31cycles) extensive analysis was performed to better understand the challenges inherent to fingerprint samples, with the ultimate goal of developing valuable profiles (≥50% complete). The impact of time on deposited fingerprints was investigated, revealing that while the quality of profiles deteriorated, full STR profiles could still be obtained from samples after 40days of storage at room temperature. By comparing the STR profiles from fingerprints of the dominant versus the non-dominant hand, we found a slightly better quality from the non-dominant hand, which was not always significant. Substrates seem to have greater effects on fingerprints. Tests on glass, plastic, paper and metal (US Quarter dollar, made of Cu and Ni), common substrates in offices and homes, showed best results for glass, followed by plastic and paper, while almost no profiles were obtained from a Quarter dollar. Important for forensic casework, we also assessed three-person mixtures of touched fingerprint samples. Unlike routinely used approaches for sampling evidence, the surface of an object (bottle) was sectioned into six equal parts and separate samples were taken from each section. The samples were processed separately for DNA extraction and STR amplification. The results included a few single

  4. Adenovirus-based strategies overcome temozolomide resistance by silencing the O6-methylguanine-DNA methyltransferase promoter.

    Science.gov (United States)

    Alonso, Marta M; Gomez-Manzano, Candelaria; Bekele, B Nebiyou; Yung, W K Alfred; Fueyo, Juan

    2007-12-15

    Currently, the most efficacious treatment for malignant gliomas is temozolomide; however, gliomas expressing the DNA repair enzyme O(6)-methylguanine-DNA methyltransferase (MGMT) are resistant to this drug. Strong clinical evidence shows that gliomas with methylation and subsequent silencing of the MGMT promoter are sensitive to temozolomide. Based on the fact that adenoviral proteins directly target and inactivate key DNA repair genes, we hypothesized that the oncolytic adenovirus Delta-24-RGD could be successfully combined with temozolomide to overcome the reported MGMT-mediated resistance. Our studies showed that the combination of Delta-24-RGD and temozolomide induces a profound therapeutic synergy in glioma cells. We observed that Delta-24-RGD treatment overrides the temozolomide-mediated G(2)-M arrest. Furthermore, Delta-24-RGD infection was followed by down-modulation of the RNA levels of MGMT. Chromatin immunoprecipitation assays showed that Delta-24-RGD prevented the recruitment of p300 to the MGMT promoter. Importantly, using mutant adenoviruses and wild-type and dominant-negative forms of the p300 protein, we showed that Delta-24-RGD interaction with p300 was required to induce silencing of the MGMT gene. Of further clinical relevance, the combination of Delta-24-RGD and temozolomide significantly improved the survival of glioma-bearing mice. Collectively, our data provide a strong mechanistic rationale for the combination of oncolytic adenoviruses and temozolomide, and should propel the clinical testing of this therapy approach in patients with malignant gliomas.

  5. Cost and Efficacy Assessment of an Alternative Medication Compliance Urine Drug Testing Strategy.

    Science.gov (United States)

    Doyle, Kelly; Strathmann, Frederick G

    2017-02-01

    This study investigates the frequency at which quantitative results provide additional clinical benefit compared to qualitative results alone. A comparison between alternative urine drug screens and conventional screens including the assessment of cost-to-payer differences, accuracy of prescription compliance or polypharmacy/substance abuse was also included. In a reference laboratory evaluation of urine specimens from across the United States, 213 urine specimens with provided prescription medication information (302 prescriptions) were analyzed by two testing algorithms: 1) conventional immunoassay screen with subsequent reflexive testing of positive results by quantitative mass spectrometry; and 2) a combined immunoassay/qualitative mass-spectrometry screen that substantially reduced the need for subsequent testing. The qualitative screen was superior to immunoassay with reflex to mass spectrometry in confirming compliance per prescription (226/302 vs 205/302), and identifying non-prescription abuse (97 vs 71). Pharmaceutical impurities and inconsistent drug metabolite patterns were detected in only 3.8% of specimens, suggesting that quantitative results have limited benefit. The percentage difference between the conventional testing algorithm and the alternative screen was projected to be 55%, and a 2-year evaluation of test utilization as a measure of test order volume follows an exponential trend for alternative screen test orders over conventional immunoassay screens that require subsequent confirmation testing. Alternative, qualitative urine drug screens provide a less expensive, faster, and more comprehensive evaluation of patient medication compliance and drug abuse. The vast majority of results were interpretable with qualitative results alone indicating a reduced need to automatically reflex to quantitation or provide quantitation for the majority of patients. This strategy highlights a successful approach using an alternative strategy for both the

  6. Language Learner Strategies and Linguistic Competence as Factors Affecting Achievement Test Scores in English for Specific Purposes

    Science.gov (United States)

    Jurkovic, Violeta

    2010-01-01

    The article examines the effect of two factors on achievement test scores in English as a foreign language for specific purposes in higher education: preexisting linguistic competence and frequency of use of language learner strategies. The rationale for the analysis of language learner strategies as a factor affecting achievement test outcomes is…

  7. Rapid diagnostic tests as a source of DNA for Plasmodium species-specific real-time PCR

    Directory of Open Access Journals (Sweden)

    Van Esbroeck Marjan

    2011-03-01

    Full Text Available Abstract Background This study describes the use of malaria rapid diagnostic tests (RDTs as a source of DNA for Plasmodium species-specific real-time PCR. Methods First, the best method to recover DNA from RDTs was investigated and then the applicability of this DNA extraction method was assessed on 12 different RDT brands. Finally, two RDT brands (OptiMAL Rapid Malaria Test and SDFK60 malaria Ag Plasmodium falciparum/Pan test were comprehensively evaluated on a panel of clinical samples submitted for routine malaria diagnosis at ITM. DNA amplification was done with the 18S rRNA real-time PCR targeting the four Plasmodium species. Results of PCR on RDT were compared to those obtained by PCR on whole blood samples. Results Best results were obtained by isolating DNA from the proximal part of the nitrocellulose component of the RDT strip with a simple DNA elution method. The PCR on RDT showed a detection limit of 0.02 asexual parasites/μl, which was identical to the same PCR on whole blood. For all 12 RDT brands tested, DNA was detected except for one brand when a low parasite density sample was applied. In RDTs with a plastic seal covering the nitrocellulose strip, DNA extraction was hampered. PCR analysis on clinical RDT samples demonstrated correct identification for single species infections for all RDT samples with asexual parasites of P. falciparum (n = 60, Plasmodium vivax (n = 10, Plasmodium ovale (n = 10 and Plasmodium malariae (n = 10. Samples with only gametocytes were detected in all OptiMAL and in 10 of the 11 SDFK60 tests. None of the negative samples (n = 20 gave a signal by PCR on RDT. With PCR on RDT, higher Ct-values were observed than with PCR on whole blood, with a mean difference of 2.68 for OptiMAL and 3.53 for SDFK60. Mixed infections were correctly identified with PCR on RDT in 4/5 OptiMAL tests and 2/5 SDFK60 tests. Conclusions RDTs are a reliable source of DNA for Plasmodium real-time PCR. This study demonstrates the

  8. Combination of DNA-based and conventional methods to detect human leukocyte antigen polymorphism and its use for paternity testing.

    Science.gov (United States)

    Kereszturya, László; Rajczya, Katalin; Lászikb, András; Gyódia, Eva; Pénzes, Mária; Falus, András; Petrányia, Gyõzõ G

    2002-03-01

    In cases of disputed paternity, the scientific goal is to promote either the exclusion of a falsely accused man or the affiliation of the alleged father. Until now, in addition to anthropologic characteristics, the determination of genetic markers included human leukocyte antigen gene variants; erythrocyte antigens and serum proteins were used for that reason. Recombinant DNA techniques provided a new set of highly variable genetic markers based on DNA nucleotide sequence polymorphism. From the practical standpoint, the application of these techniques to paternity testing provides greater versatility than do conventional genetic marker systems. The use of methods to detect the polymorphism of human leukocyte antigen loci significantly increases the chance of validation of ambiguous results in paternity testing. The outcome of 2384 paternity cases investigated by serologic and/or DNA-based human leukocyte antigen typing was statistically analyzed. Different cases solved by DNA typing are presented involving cases with one or two accused men, exclusions and nonexclusions, and tests of the paternity of a deceased man. The results provide evidence for the advantage of the combined application of various techniques in forensic diagnostics and emphasizes the outstanding possibilities of DNA-based assays. Representative examples demonstrate the strength of combined techniques in paternity testing.

  9. A simple and accurate two-step long DNA sequences synthesis strategy to improve heterologous gene expression in pichia.

    Science.gov (United States)

    Yang, Jiang-Ke; Chen, Fang-Yuan; Yan, Xiang-Xiang; Miao, Li-Hong; Dai, Jiang-Hong

    2012-01-01

    In vitro gene chemical synthesis is a powerful tool to improve the expression of gene in heterologous system. In this study, a two-step gene synthesis strategy that combines an assembly PCR and an overlap extension PCR (AOE) was developed. In this strategy, the chemically synthesized oligonucleotides were assembled into several 200-500 bp fragments with 20-25 bp overlap at each end by assembly PCR, and then an overlap extension PCR was conducted to assemble all these fragments into a full length DNA sequence. Using this method, we de novo designed and optimized the codon of Rhizopus oryzae lipase gene ROL (810 bp) and Aspergillus niger phytase gene phyA (1404 bp). Compared with the original ROL gene and phyA gene, the codon-optimized genes expressed at a significantly higher level in yeasts after methanol induction. We believe this AOE method to be of special interest as it is simple, accurate and has no limitation with respect to the size of the gene to be synthesized. Combined with de novo design, this method allows the rapid synthesis of a gene optimized for expression in the system of choice and production of sufficient biological material for molecular characterization and biotechnological application.

  10. A simple and accurate two-step long DNA sequences synthesis strategy to improve heterologous gene expression in pichia.

    Directory of Open Access Journals (Sweden)

    Jiang-Ke Yang

    Full Text Available In vitro gene chemical synthesis is a powerful tool to improve the expression of gene in heterologous system. In this study, a two-step gene synthesis strategy that combines an assembly PCR and an overlap extension PCR (AOE was developed. In this strategy, the chemically synthesized oligonucleotides were assembled into several 200-500 bp fragments with 20-25 bp overlap at each end by assembly PCR, and then an overlap extension PCR was conducted to assemble all these fragments into a full length DNA sequence. Using this method, we de novo designed and optimized the codon of Rhizopus oryzae lipase gene ROL (810 bp and Aspergillus niger phytase gene phyA (1404 bp. Compared with the original ROL gene and phyA gene, the codon-optimized genes expressed at a significantly higher level in yeasts after methanol induction. We believe this AOE method to be of special interest as it is simple, accurate and has no limitation with respect to the size of the gene to be synthesized. Combined with de novo design, this method allows the rapid synthesis of a gene optimized for expression in the system of choice and production of sufficient biological material for molecular characterization and biotechnological application.

  11. Testing and validation of multi-lidar scanning strategies for wind energy applications: Testing and validation of multi-lidar scanning strategies for wind energy applications

    Energy Technology Data Exchange (ETDEWEB)

    Newman, Jennifer F. [School of Meteorology, University of Oklahoma, Norman Oklahoma USA; Current affiliation: National Wind Technology Center, National Renewable Energy Laboratory, Golden Colorado USA; Bonin, Timothy A. [School of Meteorology, University of Oklahoma, Norman Oklahoma USA; Current affiliation: Cooperative Institute for Research in the Environmental Sciences, University of Colorado, and National Oceanic and Atmospheric Administration/Earth System Research Laboratory, Boulder Colorado USA; Klein, Petra M. [School of Meteorology, University of Oklahoma, Norman Oklahoma USA; Wharton, Sonia [Atmospheric, Earth and Energy Division, Lawrence Livermore National Laboratory, Livermore California USA; Newsom, Rob K. [Pacific Northwest National Laboratory, Richland Washington USA

    2016-03-16

    Several factors cause lidars to measure different values of turbulence than an anemometer on a tower, including volume averaging, instrument noise, and the use of a scanning circle to estimate the wind field. One way to avoid the use of a scanning circle is to deploy multiple scanning lidars and point them toward the same volume in space to collect velocity measurements and extract high-resolution turbulence information. This paper explores the use of two multi-lidar scanning strategies, the tri-Doppler technique and the virtual tower technique, for measuring 3-D turbulence. In Summer 2013, a vertically profiling Leosphere WindCube lidar and three Halo Photonics Streamline lidars were operated at the Southern Great Plains Atmospheric Radiation Measurement site to test these multi-lidar scanning strategies. During the first half of the field campaign, all three scanning lidars were pointed at approximately the same point in space and a tri-Doppler analysis was completed to calculate the three-dimensional wind vector every second. Next, all three scanning lidars were used to build a “virtual tower” above the WindCube lidar. Results indicate that the tri-Doppler technique measures higher values of horizontal turbulence than the WindCube lidar under stable atmospheric conditions, reduces variance contamination under unstable conditions, and can measure highresolution profiles of mean wind speed and direction. The virtual tower technique provides adequate turbulence information under stable conditions but cannot capture the full temporal variability of turbulence experienced under unstable conditions because of the time needed to readjust the scans.

  12. Assessing the geographic origin of the invasive grey squirrel using DNA sequencing: Implications for management strategies

    Directory of Open Access Journals (Sweden)

    Claire D. Stevenson-Holt

    2015-01-01

    Full Text Available The invasive grey squirrel Sciurus carolinensis has become a major pest species causing negative effects to forestry and biodiversity. This study aims to assess the origin of grey squirrel within Cumbria using phylogeographic analysis to aid in management and control. The work reported analysed mitochondrial DNA sequences in the D-Loop gene of 73 grey squirrel individuals from multiple locations in the UK. The results indicate that individuals in north Cumbria are derived from individuals from Scotland and North East England. Other individuals in north Cumbria share a unique haplotype with south Cumbria and Lancashire suggesting a southerly origin and movement around or over the Cumbrian Mountain range which is thought of as a barrier to movements. The assessment of invasive species geographical origin and the identification of potential wildlife transit corridors through natural barriers are becoming more important as species shift range in response to environmental and ecological changes. With the grey squirrel population expansion also occurring in Italy, the European red squirrel may become threatened across its entire range. It is crucial to understand the population origins of the invasive grey squirrel and landscape usage to successfully manage the incursion routes and control the population.

  13. Linearly programmed DNA-based molecular computer operated on magnetic particle surface in test-tube

    Institute of Scientific and Technical Information of China (English)

    ZHAO Jian; ZHANG Zhizhou; SHI Yongyong; Li Xiuxia; HE Lin

    2004-01-01

    The postgenomic era has seen an emergence of new applications of DNA manipulation technologies, including DNA-based molecular computing. Surface DNA computing has already been reported in a number of studies that, however, all employ different mechanisms other than automaton functions. Here we describe a programmable DNA surface-computing device as a Turing machine-like finite automaton. The laboratory automaton is primarily composed of DNA (inputs, output-detectors, transition molecules as software), DNA manipulating enzymes and buffer system that solve artificial computational problems autonomously. When fluoresceins were labeled in the 5′ end of (-) strand of the input molecule, direct observation of all reaction intermediates along the time scale was made so that the dynamic process of DNA computing could be conveniently visualized. The features of this study are: (i) achievement of finite automaton functions by linearly programmed DNA computer operated on magnetic particle surface and (ii) direct detection of all DNA computing intermediates by capillary electrophoresis. Since DNA computing has the massive parallelism and feasibility for automation, this achievement sets a basis for large-scale implications of DNA computing for functional genomics in the near future.

  14. Comprehensive In Vitro Toxicity Testing of a Panel of Representative Oxide Nanomaterials: First Steps towards an Intelligent Testing Strategy.

    Directory of Open Access Journals (Sweden)

    Lucian Farcal

    Full Text Available Nanomaterials (NMs display many unique and useful physico-chemical properties. However, reliable approaches are needed for risk assessment of NMs. The present study was performed in the FP7-MARINA project, with the objective to identify and evaluate in vitro test methods for toxicity assessment in order to facilitate the development of an intelligent testing strategy (ITS. Six representative oxide NMs provided by the EC-JRC Nanomaterials Repository were tested in nine laboratories. The in vitro toxicity of NMs was evaluated in 12 cellular models representing 6 different target organs/systems (immune system, respiratory system, gastrointestinal system, reproductive organs, kidney and embryonic tissues. The toxicity assessment was conducted using 10 different assays for cytotoxicity, embryotoxicity, epithelial integrity, cytokine secretion and oxidative stress. Thorough physico-chemical characterization was performed for all tested NMs. Commercially relevant NMs with different physico-chemical properties were selected: two TiO2 NMs with different surface chemistry - hydrophilic (NM-103 and hydrophobic (NM-104, two forms of ZnO - uncoated (NM-110 and coated with triethoxycapryl silane (NM-111 and two SiO2 NMs produced by two different manufacturing techniques - precipitated (NM-200 and pyrogenic (NM-203. Cell specific toxicity effects of all NMs were observed; macrophages were the most sensitive cell type after short-term exposures (24-72h (ZnO>SiO2>TiO2. Longer term exposure (7 to 21 days significantly affected the cell barrier integrity in the presence of ZnO, but not TiO2 and SiO2, while the embryonic stem cell test (EST classified the TiO2 NMs as potentially 'weak-embryotoxic' and ZnO and SiO2 NMs as 'non-embryotoxic'. A hazard ranking could be established for the representative NMs tested (ZnO NM-110 > ZnO NM-111 > SiO2 NM-203 > SiO2 NM-200 > TiO2 NM-104 > TiO2 NM-103. This ranking was different in the case of embryonic tissues, for which TiO2

  15. Design and performance testing of a DNA extraction assay for sensitive and reliable quantification of acetic acid bacteria directly in red wine using real time PCR

    Directory of Open Access Journals (Sweden)

    Cédric eLONGIN

    2016-06-01

    Full Text Available Although strategies exist to prevent AAB contamination, the increased interest for wines with low sulfite addition leads to greater AAB spoilage. Hence there is a real need for a rapid, specific, sensitive and reliable method for detecting these spoilage bacteria. All these requirements are met by real time Polymerase Chain Reaction (or quantitative PCR; qPCR. Here, we compare existing methods of isolating DNA and their adaptation to a red wine matrix. Two different protocols for isolating DNA and three PCR mix compositions were tested to select the best method. The addition of insoluble polyvinylpolypyrrolidone (PVPP at 1% (v/v during DNA extraction using a protocol succeeded in eliminating PCR inhibitors from red wine. We developed a bacterial internal control which was efficient in avoiding false negative results due to decreases in the efficiency of DNA isolation and/or amplification. The specificity, linearity, repeatability and reproducibility of the method were evaluated. A standard curve was established for the enumeration of AAB inoculated into red wines. The limit of quantification in red wine was 3.7 log AAB/mL and about 2.8 log AAB/mL when the volume of the samples was increased from 1 mL to 10 mL. Thus the DNA extraction method developed in this paper allows sensitive and reliable AAB quantification without underestimation thanks to the presence of an internal control. Moreover, monitoring of both the AAB population and the amount of acetic acid in ethanol medium and red wine highlighted that a minimum about 6.0 log cells/mL of AAB is needed to significantly increase the production of acetic acid leading to spoilage.

  16. Design and Performance Testing of a DNA Extraction Assay for Sensitive and Reliable Quantification of Acetic Acid Bacteria Directly in Red Wine Using Real Time PCR.

    Science.gov (United States)

    Longin, Cédric; Guilloux-Benatier, Michèle; Alexandre, Hervé

    2016-01-01

    Although strategies exist to prevent AAB contamination, the increased interest for wines with low sulfite addition leads to greater AAB spoilage. Hence, there is a real need for a rapid, specific, sensitive, and reliable method for detecting these spoilage bacteria. All these requirements are met by real time Polymerase Chain Reaction (or quantitative PCR; qPCR). Here, we compare existing methods of isolating DNA and their adaptation to a red wine matrix. Two different protocols for isolating DNA and three PCR mix compositions were tested to select the best method. The addition of insoluble polyvinylpolypyrrolidone (PVPP) at 1% (v/v) during DNA extraction using a protocol succeeded in eliminating PCR inhibitors from red wine. We developed a bacterial internal control which was efficient in avoiding false negative results due to decreases in the efficiency of DNA isolation and/or amplification. The specificity, linearity, repeatability, and reproducibility of the method were evaluated. A standard curve was established for the enumeration of AAB inoculated into red wines. The limit of quantification in red wine was 3.7 log AAB/mL and about 2.8 log AAB/mL when the volume of the samples was increased from 1 to 10 mL. Thus, the DNA extraction method developed in this paper allows sensitive and reliable AAB quantification without underestimation thanks to the presence of an internal control. Moreover, monitoring of both the AAB population and the amount of acetic acid in ethanol medium and red wine highlighted that a minimum about 6.0 log cells/mL of AAB is needed to significantly increase the production of acetic acid leading to spoilage.

  17. Opportunities for an alternative integrating testing strategy for carcinogen hazard assessment?

    Science.gov (United States)

    Doktorova, Tatyana Y; Pauwels, Marleen; Vinken, Mathieu; Vanhaecke, Tamara; Rogiers, Vera

    2012-02-01

    The 2-year rodent carcinogenicity bioassay evolved more than 40 years ago, and although it is complex, long lasting, expensive, and animal consuming, it is still the only generally accepted test for assessing the carcinogenicity of chemicals. Over time, different alternative approaches have been developed with the final goal to replace the bioassay. Unfortunately, at present, none of these strategies alone provides sufficient assurance of accurate prediction. In this review paper, we discuss the major advantages and pitfalls of the existing alternative methodologies to the carcinogenicity bioassay. Finally, based on the available scientific data in the public domain, we propose what we would like to call a "feasible integrated testing strategy" which incorporates some promising alternatives, providing at the same time information on the mechanism of action and the toxic nature of the compounds tested. It is, however, clear that the adoption of whatever "new" testing scheme should be considered with caution and its effectiveness should be experimentally demonstrated in advance by addressing a reasonable number of chemical carcinogens and non-carcinogens from a variety of structural and functional classes.

  18. [High time for wide application of an opting-out strategy for HIV testing].

    Science.gov (United States)

    Dukers-Muijrers, N H T; Dukers-Muijrers, H T M; Heijman, R L J; van Leent, E J M; Coutinho, R A; Thiesbrummel, H F J; Fennema, J S A

    2007-12-01

    --Despite the current active HIV test policy, the effects of the former policy are still visible, i.e. a relatively low number of individuals that have ever been tested for HIV. --The number of HIV tests and knowledge of current HIV status has increased among visitors to the STI clinic in Amsterdam. --Nevertheless, anonymous HIV surveillance among visitors to the STI clinic shows that a considerable proportion of HIV-infected individuals (24% of men who have sex with men (MSM) and 80% of heterosexuals) are unaware of the infection. --A new opting-out strategy for HIV testing in STI clinics is recommended. --The opting-out strategy may also be applicable to other medical settings, especially those that treat target populations such as MSM, heterosexuals with STI-related symptoms, and persons originating from AIDS-endemic regions. --The opting-out system was initiated in the Amsterdam STI clinic in 2007 in order to further reduce the number of undiagnosed HIV infections.

  19. Field dependence and verbalized strategies on the portable rod-and-frame test by depressed outpatients and normal controls.

    Science.gov (United States)

    Calamari, E; Pini, M; Puleggio, A

    2000-12-01

    This study examined the relationships between scores on the cognitive style of field dependence-independence and verbalized strategies on the Portable Rod-and-Frame Test for normal and psychopathological outpatients. We attempted to verify (a) Manning's hypothesis (1991) of a correspondence between scores on field dependence and external strategies (reference to the visual field) and scores on field independence and internal strategies (reference to the body) on perceptual tasks, and (b) a tendency of depressed persons to score as field dependent, and (c) use of external verbalized strategies. A total of 50 depressed outpatients and 50 normal controls were administered the test and requested to report the strategy they had employed to solve the problem. Contrary to Manning's findings, no significant relationship was found between cognitive style and verbalized strategies in the total sample. Depressed outpatients classified as internal scored significantly higher on the Group Embedded Figures Test but appeared more field dependent on the Rod-and-Frame Test. Moreover, only for the former test did depressed outpatients score more field-dependent than controls. Finally, no significant relationship was found between the diagnosis of depression and use of external strategies; however, field dependence and the use of external strategies on the Rod-and-Frame Test were associated with more severe depressive symptoms measured by the D scale of the MMPI-2. Further research is needed to assess the role of premorbid personality structures of depression in subjective and objective aspects of Rod-and-Frame Test performance.

  20. Utilizing constructivism learning theory in collaborative testing as a creative strategy to promote essential nursing skills.

    Science.gov (United States)

    Duane, Barbara T; Satre, Maria E

    2014-01-01

    In nursing education, students participate in individual learner testing. This process follows the instructionist learning theory of a system model. However, in the practice of nursing, success depends upon collaboration with numerous people in different capacities, critical thinking, clinical reasoning, and the ability to communicate with others. Research has shown that collaborative testing, a constructivism learning activity and a form of collaborative learning, enhances students' abilities to master these areas. Collaborative testing is a clear, creative strategy which constructivists would say supports the socio-linguistic base of their learning theory. The test becomes an active implementation of peer-mediated learning where individual knowledge is enhanced through problem solving or defense of an individual position with the collaborative method. There is criticism for the testing method's potential of grade inflation and for students to receive grade benefits with little effort. After a review of various collaborative testing methods, this nursing faculty implemented a collaborative testing format that addresses both the positive and negative aspects of the process.

  1. Implementation of alternative test strategies for the safety assessment of engineered nanomaterials.

    Science.gov (United States)

    Nel, A E

    2013-12-01

    Nanotechnology introduces a new field that requires novel approaches and methods for hazard and risk assessment. For an appropriate scientific platform for safety assessment, nanoscale properties and functions of engineered nanomaterials (ENMs), including how the physicochemical properties of the materials relate to mechanisms of injury at the nano-bio interface, must be considered. Moreover, this rapidly advancing new field requires novel test strategies that allow multiple toxicants to be screened in robust, mechanism-based assays in which the bulk of the investigation can be carried out at the cellular and biomolecular level whilst maintaining limited animal use and is based on the contribution of toxicological pathways to the pathophysiology of disease. First, a predictive toxicological approach for the safety assessment of ENMs will be discussed against the background of a '21st-century vision' for using alternative test strategies (ATSs) to perform toxicological assessment of large numbers of untested chemicals, thereby reducing a backlog that could otherwise become a problem for nanotechnology. An ATS is defined here as an alternative to animal experiments or refinement/reduction alternative to traditional animal testing. Secondly, the approach of selecting pathways of toxicity to screen for the pulmonary hazard potential of carbon nanotubes and metal oxides will be discussed, as well as how to use these pathways to perform high-content or high-throughput testing and how the data can be used for hazard ranking, risk assessment, regulatory decision-making and 'safer-by-design' strategies. Finally, the utility and disadvantages of this predictive toxicological approach to ENM safety assessment, and how it can assist the 21st-century vision, will be addressed.

  2. Reliability and Validity of the Turkish Language Version of the Test of Performance Strategies

    Directory of Open Access Journals (Sweden)

    Miçooğulları Bülent Okan

    2017-03-01

    Full Text Available The aim of the present study was to examine the psychometric properties of the Test of Performance Strategies (TOPS; Thomas et al., 1999 on the Turkish population. The TOPS was designed to assess eight psychological skills and strategies used by athletes in competition (activation, automaticity, emotional control, goal-setting, imagery, relaxation, self-talk, and negative thinking and the same strategies, except negative thinking is replaced by attentional control used in training. The sample of the study included athletes who were training and competing in a wide variety of sports across a broad range of performance standards. The final sample consisted of 433 males (mean ± s: age 22.47 ± 5.30 years and 187 females (mean ± s: age 20.97 ± 4.78 years, 620 athletes in total (mean ± s: age 21.25 ± 4.87 years who voluntarily participated; TOPS was administered to all participants. Afterward, Confirmatory Factor Analysis (CFA was conducted by Analysis Moments of Structures (AMOS 18. Comparative fit index (CFI, non-normed fit index (NNFI and root mean square error of approximation (RMSEA were used to verify whether the model fit the data. Goodness-of-fit statistics were CFI= .91, NNFI= .92 and RMSEA= .056. These values showed that the tested model is coherent at a satisfactory level. Moreover, results of confirmatory factor analyses revealed that a total of four items (two items from competition and two from practice within the subscale of automaticity have been removed. The 28 items within the remaining seven subscales have been validated. In conclusion, Turkish version of TOPS is a valid and reliable instrument to assess the psychological skills and strategies used by athletes in competition and practices.

  3. Testing bidirectional associations among emotion regulation strategies and substance use: a daily diary study.

    Science.gov (United States)

    Weiss, Nicole H; Bold, Krysten W; Sullivan, Tami P; Armeli, Stephen; Tennen, Howard

    2017-04-01

    Alcohol and marijuana are widely used among college students. Emotion regulation strategies have been linked to alcohol and marijuana use, but little attention has been devoted to modeling the directionality of these associations. The aims of the current study were to test whether (a) daytime use of emotion regulation strategies influences the likelihood of evening substance use and (b) evening substance use influences the likelihood of next-day use of emotion regulation strategies. Longitudinal daily diary data were collected for 30 days via on-line surveys. Northeastern United States. A total of 1640 college students (mean age = 19.2 years, 54% female, 80% European American) were recruited each semester between Spring 2008 and Spring 2012. Daily diaries assessed emotion regulation strategies (distraction, reappraisal, problem-solving, avoidance) and substance use (any drinking, heavy drinking, marijuana use, co-use of any drinking/heavy drinking and marijuana). Covariates included gender, age, race/ethnicity, fraternity/sorority involvement and baseline depression. Daytime distraction [odds ratio (OR) = 0.95], reappraisal (OR = 0.95) and problem-solving (OR = 0.94) predicted lower odds of evening marijuana use (P-values strategies and substance use: greater daytime use of distraction, reappraisal, and problem solving predicts lower evening substance use, while higher evening substance use predicts higher next-day avoidance and reappraisal but lower next-day problem-solving. © 2016 Society for the Study of Addiction.

  4. Use of AffiProbe HPV test kit for detection of human papillomavirus DNA in genital scrapes.

    OpenAIRE

    Ranki, M; Leinonen, A W; Jalava, T. (Tiina); Nieminen, P.; Soares, V R; Paavonen, J; Kallio, A

    1990-01-01

    The presence of human papillomavirus (HPV) DNA in cervical and vaginal scrapes was analyzed by the AffiProbe HPV test kit (Orion Corp., Orion Pharmaceutica, Helsinki, Finland), which is a 1-day solution hybridization test for HPV type 6/11, 16, or 18. The AffiProbe test was compared with a commercially available dot blot test (ViraPap and ViraType tests; Life Technologies Inc., Gaithersburg, Md.). The study group consisted of 178 patients seen in a gynecological outpatient clinic. Altogether,...

  5. An improved SELEX-Seq strategy for characterizing DNA-binding specificity of transcription factor: NF-κB as an example.

    Science.gov (United States)

    Gu, Guangming; Wang, Tingting; Yang, Yang; Xu, Xinhui; Wang, Jinke

    2013-01-01

    SELEX-Seq is now the optimal high-throughput technique for characterizing DNA-binding specificities of transcription factors. In this study, we introduced an improved EMSA-based SELEX-Seq strategy with several advantages. The improvements of this strategy included: (1) using a FAM-labeled probe to track protein-DNA complex in polyacrylamide gel for rapidly recovering the protein-bound dsDNA without relying on traditional radioactive labeling or ethidium bromide staining; (2) monitoring the specificity of SELEX selection by detecting a positive and negative sequence doped into the input DNAs used in each round with PCR amplification; (3) using nested PCR to ensure the specificity of PCR amplification of the selected DNAs after each round; (4) using the nucleotides added at the 5' end of the nested PCR primers as the split barcode to code DNAs from various rounds for multiplexing sequencing samples. The split barcode minimized selection times and thus greatly simplified the current SELEX-Seq procedure. The reliability of the strategy was demonstrated by performing a successful SELEX-Seq of a well-known transcription factor, NF-κB. Therefore, this study provided a useful SELEX-Seq strategy for characterizing DNA-binding specificities of transcription factors.

  6. Field Evaluation of Alternative Testing Strategies for the Detection of HIV Infection in Beijing

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    Objective To identify a cost-efficient alternative antibody testing strategy for screening and confirmation of HIV infection by rapid simple tests (RSTs) and enzyme-linked immunosorbent assays (ELISAs). Methods Four RSTs (RST1,RST2, RST3, and RST4 ) and five ELISAs (ELISA1, ELISA2, ELISA3, ELISA4, and ELISA5) were evaluated in two phases by using banked and serum specimens prospectively collected at regional hospitals and voluntary counseling and testing (VCT)centers in Beijing. A total of 200 banked serum specimens were included in the first phase, including 62 HIV-positive, 127 HIV-negative and 11 indeterminate specimens. All specimens were tested by four RSTs and five ELISAs respectively. The second phase involved prospective testing of 389 routine specimens, including 92 HIV-positive, 287 HIV-negative, and 10 indeterminate specimens. All the specimens were tested by two RSTs (RST2 and RST4) and three ELISAs (ELISA1, ELISA3,and ELISA4), which were selected for their respective excellent sensitivity and/or specificity. Western blot (WB) was used as a gold standard for confirming the reactivity of all the specimens. Results Sensitivity, specificity, and efficacy were calculated for each assay in two phases. In the first phase, four assays (ELISA4, RST2, RST3, and RST4) had a specificity of 100%. For the determination of efficacy, ELISA4, RST2, and RST4 were selected in the second phase. ELISA1 and ELISA3 which have a sensitivity of 95.9% and 93.2% respectively also entered this phase. In the second phase, all the five assays (ELISA1, ELISA3, ELISA4, RST2, and RST4) had a sensitivity and specifity of over 90%. ELISA1 had a sensitivity of 99% and ELISA4 a specificity of 99%. Conclusion The sensitivity ELISA1 and the specificit of ELISA4 are comparable to ELISA/WB standard strategy. Application of this alternative testing strategy provides a cost-effective method for determining HIV prevalence in Beijing.

  7. Rapid DNA haplotyping using a multiplex heteroduplex approach: application to Duchenne muscular dystrophy carrier testing.

    Science.gov (United States)

    Prior, T W; Wenger, G D; Papp, A C; Snyder, P J; Sedra, M S; Bartolo, C; Moore, J W; Highsmith, W E

    1995-01-01

    A new strategy has been developed for rapid haplotype analysis based on an initial multiplex amplification of several polymorphic sites, followed by heteroduplex detection. Heteroduplexes formed between two different alleles are detected because they migrate differently than the corresponding homoduplexes in Hydrolink-MDE gel. This simple, rapid method does not depend on specific sequences such as restriction enzyme sites or CA boxes and does not require the use of isotope. This approach has been tested using commonly occurring polymorphisms spanning the dystrophin gene as a model. We describe the use of the method to assign the carrier status of females in Duchenne muscular dystrophy (DMD) pedigrees. The method may be used for other genetic diseases when mutations are unknown or there are few dinucleotide markers in the gene proximity, and for the identification of haplotype backgrounds of mutant alleles.

  8. A Multi-Core Parallelization Strategy for Statistical Significance Testing in Learning Classifier Systems.

    Science.gov (United States)

    Rudd, James; Moore, Jason H; Urbanowicz, Ryan J

    2013-11-01

    Permutation-based statistics for evaluating the significance of class prediction, predictive attributes, and patterns of association have only appeared within the learning classifier system (LCS) literature since 2012. While still not widely utilized by the LCS research community, formal evaluations of test statistic confidence are imperative to large and complex real world applications such as genetic epidemiology where it is standard practice to quantify the likelihood that a seemingly meaningful statistic could have been obtained purely by chance. LCS algorithms are relatively computationally expensive on their own. The compounding requirements for generating permutation-based statistics may be a limiting factor for some researchers interested in applying LCS algorithms to real world problems. Technology has made LCS parallelization strategies more accessible and thus more popular in recent years. In the present study we examine the benefits of externally parallelizing a series of independent LCS runs such that permutation testing with cross validation becomes more feasible to complete on a single multi-core workstation. We test our python implementation of this strategy in the context of a simulated complex genetic epidemiological data mining problem. Our evaluations indicate that as long as the number of concurrent processes does not exceed the number of CPU cores, the speedup achieved is approximately linear.

  9. Oscillatory hydraulic testing as a strategy for NAPL source zone monitoring: Laboratory experiments

    Science.gov (United States)

    Zhou, YaoQuan; Cardiff, Michael

    2017-05-01

    Non-aqueous phase liquids (NAPLs) have a complex mode of transport in heterogeneous aquifers, which can result in pools and lenses of NAPLs (the ;source zone;) that are difficult to detect and can cause long-term contamination via slow dissolution into groundwater (the ;dissolved plume;). Characterizing the extent and evolution of NAPL contamination within the source zone is a useful strategy for designing and adapting appropriate remedial actions at many contaminated sites. As a NAPL flows into a given aquifer volume, the effective hydraulic conductivity (K) and specific storage (Ss) of the volume changes associated with the viscosity and compressibility of the impinging fluid, meaning that NAPL movement may be detectable with hydraulic testing. Recently, the use of oscillatory pumping tests - in which sinusoidal pumping variations are implemented and oscillatory pressure changes are detected at monitoring locations - has been suggested as a low-impact hydraulic testing strategy for characterizing aquifer properties (Cardiff et al., 2013; Zhou et al., 2016). Here, we investigate this strategy in an experimental laboratory sandbox where dyed vegetable oil is injected and allowed to migrate as a NAPL. Initial qualitative analyses demonstrate that measurable changes in pressure signal amplitude and phase provide clear evidence for NAPL plume emplacement and migration. Using the approach developed in Zhou et al. (2016), we then apply tomographic analyses to estimate the location of effective K changes (representing fluid changes) and their movement throughout time. This approach provides a method for monitoring ongoing NAPL movement without net extraction or injection of fluid, making it advantageous in field remediation applications.

  10. Carbon isotope ratio mass spectrometry for detection of endogenous steroid use: a testing strategy.

    Science.gov (United States)

    Ahrens, Brian D; Butch, Anthony W

    2013-07-01

    Isotope ratio mass spectrometry (IRMS) testing is performed to determine if an atypical steroid profile is due to administration of an endogenous steroid. Androsterone (Andro) and etiocholanolone (Etio), and/or the androstanediols (5α- and 5β-androstane-3α,17β-diol) are typically analyzed by IRMS to determine the (13) C/(12) C ratio. The ratios of these target compounds are compared to the (13) C/(12) C ratio of an endogenous reference compound (ERC) such as 5β-pregnane-3α,20α-diol (Pdiol). Concentrations of Andro and Etio are high so (13) C/(12) C ratios can easily be measured in most urine samples. Despite the potentially improved sensitivity of the androstanediols for detecting the use of some testosterone formulations, additional processing steps are often required that increase labour costs and turnaround times. Since this can be problematic when performing large numbers of IRMS measurements, we established thresholds for Andro and Etio that can be used to determine the need for additional androstanediol testing. Using these criteria, 105 out of 2639 urine samples exceeded the Andro and/or Etio thresholds, with 52 of these samples being positive based on Andro and Etio IRMS testing alone. The remaining 53 urine samples had androstanediol IRMS testing performed and 3 samples were positive based on the androstanediol results. A similar strategy was used to establish a threshold for Pdiol to identify athletes with relatively (13) C-depleted values so that an alternative ERC can be used to confirm or establish a true endogenous reference value. Adoption of a similar strategy by other laboratories can significantly reduce IRMS sample processing and analysis times, thereby increasing testing capacity.

  11. Mud Pit Risk-Based Closure Strategy Report, Nevada Test Site, Nevada, Revision 0

    Energy Technology Data Exchange (ETDEWEB)

    Brain Hoenes

    2004-08-01

    This report presents the findings of the human and ecological risk assessment for the NTS mud pits. The risk assessment utilizes data from 52 of the 270 NTS mud pits in conjunction with corroborative data from 87 other DOE mud pits associated with nuclear testing (at locations on the NTS, in the western United States, and Alaska) as well as relevant process knowledge. Based on the risk assessment findings, the report provides a strategy for further evaluation, characterization, and closure of all 270 NTS mud pit CASs using the Streamlined Approach for Environmental Restoration (SAFER).

  12. Forensic science and the right to access to justice: Testing the efficacy of self-examination intimate DNA swabs to enhance victim-centred responses to sexual violence in low-resource environments.

    Science.gov (United States)

    Smith, Lisa L; Wetton, Jon H; Lall, Gurdeep K M; Flowe, Heather D; Jobling, Mark A

    2017-09-01

    In developed countries, DNA profiling routinely forms part of the forensic strategy in the investigation of sexual violence. Medical examinations provide opportunities for recovering DNA evidence from intimate swabs, which can be particularly probative in cases where the identity of the perpetrator is unknown and proof of intercourse between two people is required. In low-resource environments, such as developing countries, remote geographic locations, conflict (and post-conflict) affected regions and displaced communities where access to medical examinations is lacking, DNA evidence is not available to support prosecutions and perpetrators are rarely identified and held accountable for crimes of sexual violence. This paper reports the results of a proof-of-concept study testing the efficacy of a novel self-examination intimate swab designed for recovering DNA following unprotected sexual intercourse. The results of this study corroborate previous research which has demonstrated that male DNA profiles can be successfully recovered by post-coital, self-examination methods, and discusses how this novel approach could enable the integration of DNA evidence into victim-centred approaches to investigating and prosecuting sexual violence in low-resource environments. The results and discussion challenge the prevailing assumption that intimate DNA swabs must be collected by trained medical professionals in order to be of evidential value. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.

  13. A short-term in vitro test for tumour sensitivity to adriamycin based on flow cytometric DNA analysis

    DEFF Research Database (Denmark)

    Engelholm, S A; Spang-Thomsen, M; Vindeløv, L L

    1983-01-01

    A new method to test the sensitivity of tumour cells to chemotherapy is presented. Tumour cells were incubated in vitro on agar, and drug-induced cell cycle perturbation was monitored by flow cytometric DNA analysis. In the present study the method was applied to monitor the effect of adriamycin...

  14. Human papillomavirus mRNA and DNA testing in women with atypical squamous cells of undetermined significance

    DEFF Research Database (Denmark)

    Thomsen, Louise T; Dehlendorff, Christian; Junge, Jette

    2016-01-01

    In this prospective cohort study, we compared the performance of human papillomavirus (HPV) mRNA and DNA testing of women with atypical squamous cells of undetermined significance (ASC-US) during cervical cancer screening. Using a nationwide Danish pathology register, we identified women aged 30...

  15. Informed decision making about predictive DNA tests; arguments for more public visibility of personal deliberations about the good life.

    NARCIS (Netherlands)

    Boenink, Marianne; van der Burg, Simone

    2009-01-01

    Since its advent, predictive DNA testing has been perceived as a technology that may have considerable impact on the quality of people’s life. The decision whether or not to use this technology is up to the individual client. However, to enable well considered decision making both the negative as

  16. Informed decision making about predictive DNA tests; arguments for more public visibility of personal deliberations about the good life.

    NARCIS (Netherlands)

    Boenink, Marianne; van der Burg, Simone

    2009-01-01

    Since its advent, predictive DNA testing has been perceived as a technology that may have considerable impact on the quality of people’s life. The decision whether or not to use this technology is up to the individual client. However, to enable well considered decision making both the negative as we

  17. Identification of irradiated wheat by germination test, DNA comet assay and electron spin resonance

    Science.gov (United States)

    Barros, Adilson C.; Freund, Maria Teresa L.; Villavicencio, Ana Lúcia C. H.; Delincée, Henry; Arthur, Valter

    2002-03-01

    In several countries, there has been an increase in the use of radiation for food processing thus improving the quality and sanitary conditions, inhibiting pathogenic microorganisms, delaying the natural aging process and so extending product lifetime. The need to develop analytical methods to detect these irradiated products is also increasing. The goal of this research was to identify wheat irradiated using different radiation doses. Seeds were irradiated with a gamma 60Co source (Gammacell 220 GC) in the Centro de Energia Nuclear na Agricultura and the Instituto de Pesquisas Energéticas e Nucleares. Dose rate used were 1.6 and 5.8kGy/h. Applied doses were 0.0, 0.10, 0.25, 0.50, 0.75, 1.0, and 2.0kGy. After irradiation, seeds were analysed over a 6 month period. Three different detection methods were employed to determine how irradiation had modified the samples. Screening methods consisted of a germination test measuring the inhibition of shooting and rooting and analysis of DNA fragmentation. The method of electron spin resonance spectroscopy allowed a better dosimetric evaluation. These techniques make the identification of irradiated wheat with different doses possible.

  18. An ancient DNA test of a founder effect in Native American ABO blood group frequencies.

    Science.gov (United States)

    Halverson, Melissa S; Bolnick, Deborah A

    2008-11-01

    Anthropologists have assumed that reduced genetic diversity in extant Native Americans is due to a founder effect that occurred during the initial peopling of the Americas. However, low diversity could also be the result of subsequent historical events, such as the population decline following European contact. In this study, we show that autosomal DNA from ancient Native American skeletal remains can be used to investigate the low level of ABO blood group diversity in the Americas. Extant Native Americans exhibit a high frequency of blood type O, which may reflect a founder effect, genetic drift associated with the historical population decline, or natural selection in response to the smallpox epidemics that occurred following European contact. To help distinguish between these possibilities, we determined the ABO genotypes of 15 precontact individuals from eastern North America. The precontact ABO frequencies were not significantly different from those observed in extant Native Americans from the same region, but they did differ significantly from the ABO frequencies in extant Siberian populations. Studies of other precontact populations are needed to better test the three hypotheses for low ABO blood group diversity in the Americas, but our findings are most consistent with the hypothesis of a founder effect during the initial settlement of this continent.

  19. Horses for courses: a DNA-based test for race distance aptitude in thoroughbred racehorses.

    Science.gov (United States)

    Hill, Emmeline W; Ryan, Donal P; MacHugh, David E

    2012-12-01

    Variation at the myostatin (MSTN) gene locus has been shown to influence racing phenotypes in Thoroughbred horses, and in particular, early skeletal muscle development and the aptitude for racing at short distances. Specifically, a single nucleotide polymorphism (SNP) in the first intron of MSTN (g.66493737C/T) is highly predictive of best race distance among Flat racing Thoroughbreds: homozygous C/C horses are best suited to short distance races, heterozygous C/T horses are best suited to middle distance races, and homozygous T/T horses are best suited to longer distance races. Patent applications for this gene marker association, and other linked markers, have been filed. The information contained within the patent applications is exclusively licensed to the commercial biotechnology company Equinome Ltd, which provides a DNA-based test to the international Thoroughbred horse racing and breeding industry. The application of this information in the industry enables informed decision making in breeding and racing and can be used to assist selection to accelerate the rate of change of genetic types among distinct populations (Case Study 1) and within individual breeding operations (Case Study 2).

  20. Gene and DNA concepts by UNIFAL-MG entering students and the effectiveness of drama as a Molecular Biology teaching strategy

    Directory of Open Access Journals (Sweden)

    Marina Isidoro Silva

    2014-10-01

    Full Text Available The Molecular Biology concepts comprehension is important for understanding several Biological processes as well as to establish correlations and interrelations among cell processes and its interaction with the environment. The aim of this work was to evaluate the undergraduate students from the Universidade Federal de Alfenas-MG (UNIFAL-MG knowledge about gene and DNA concepts as well as to evaluate the effectiveness of drama as an innovative teaching strategy. This strategy was evaluated by the students` knowledge gain and scholar performance. The results showed the UNIFAL-MG beginners’ students presented defective concepts about gene and DNA composition and structure, probably due to deficient teaching-learning process before the University entrance. Drama was an efficient strategy to induce learning gain and to improve scholar performance of classes with a good initial level of knowledge.

  1. Operational Testing of a Combined Hardware-Software Strategy for Triage of Radiologically-Contaminated Persons.

    Science.gov (United States)

    Waller, Edward J

    2015-08-01

    After a radiological dispersal device (RDD) event, it is possible for radionuclides to enter the human body through inhalation, ingestion, and skin and wound absorption. The dominant pathway will be through inhalation. From a health physics perspective, it is important to know the magnitude of the intake to perform dosimetric assessments. From a medical perspective, removal of radionuclides leading to dose (hence risk) aversion is of high importance. The efficacy of medical decorporation strategies is extremely dependent upon the time of treatment delivery after intake. The "golden hour," or more realistically 3-4 h, is imperative when attempting to increase removal of radionuclides from extracellular fluids prior to cellular incorporation. To assist medical first response personnel in making timely decisions regarding appropriate treatment delivery modes, a software tool has been developed which compiles existing radionuclide decorporation therapy data and allows a user to perform simple triage leading to potential appropriate decorporation treatment strategies. Three triage algorithms were included: (1) multi-parameter model (MPM), (2) clinical decision guidance (CDG) model, and (3) annual limit on intake (ALI) model. A radiation triage mask (RTM) has simultaneously been developed to provide a simple and rapid hardware solution for first responders to triage internally exposed personnel in the field. The hardware/software strategy was field tested with a military medical unit and was found by end-users to be relatively simple to learn and use.

  2. How effective is drug testing as a workplace safety strategy? A systematic review of the evidence.

    Science.gov (United States)

    Pidd, Ken; Roche, Ann M

    2014-10-01

    The growing prevalence of workplace drug testing and the narrow scope of previous reviews of the evidence base necessitate a comprehensive review of research concerning the efficacy of drug testing as a workplace strategy. A systematic qualitative review of relevant research published between January 1990 and January 2013 was undertaken. Inclusion criteria were studies that evaluated the effectiveness of drug testing in deterring employee drug use or reducing workplace accident or injury rates. Methodological adequacy was assessed using a published assessment tool specifically designed to assess the quality of intervention studies. A total of 23 studies were reviewed and assessed, six of which reported on the effectiveness of testing in reducing employee drug use and 17 which reported on occupational accident or injury rates. No studies involved randomised control trials. Only one study was assessed as demonstrating strong methodological rigour. That study found random alcohol testing reduced fatal accidents in the transport industry. The majority of studies reviewed contained methodological weaknesses including; inappropriate study design, limited sample representativeness, the use of ecological data to evaluate individual behaviour change and failure to adequately control for potentially confounding variables. This latter finding is consistent with previous reviews and indicates the evidence base for the effectiveness of testing in improving workplace safety is at best tenuous. Better dissemination of the current evidence in relation to workplace drug testing is required to support evidence-informed policy and practice. There is also a pressing need for more methodologically rigorous research to evaluate the efficacy and utility of drug testing. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. Revolutions in rapid amplification of cDNA ends: new strategies for polymerase chain reaction cloning of full-length cDNA ends.

    Science.gov (United States)

    Schaefer, B C

    1995-05-20

    Rapid amplification of cDNA ends (RACE) is a polymerase chain reaction (PCR)-based technique which was developed to facilitate the cloning of full-length cDNA 5'- and 3'-ends after a partial cDNA sequence has been obtained by other methods. While RACE can yield complete sequences of cDNA ends in only a few days, the RACE procedure frequently results in the exclusive amplification of truncated cDNA ends, undermining efforts to generate full-length clones. Many investigators have suggested modifications to the RACE protocol to improve the effectiveness of the technique. Based on first-hand experience with RACE, a critical review of numerous published variations of the key steps in the RACE method is presented. Also included is a detailed, effective protocol based on RNA ligase-mediated RACE/reverse ligation-mediated PCR, as well as a demonstration of its utility.

  4. Evaluation of test-strategies for estimating probability of low prevalence of paratuberculosis in Danish dairy herds

    DEFF Research Database (Denmark)

    Sergeant, E.S.G.; Nielsen, Søren S.; Toft, Nils

    2008-01-01

    . Using this model, five herd-testing strategies were evaluated: (1) milk-ELISA on all lactating cows; (2) milk-ELISA on lactating cows 4 years old; (4) faecal culture on all lactating cows; and (5) milk-ELISA plus faecal culture in series on all lactating cows. The five testing strategies were evaluated...... using observed milk-ELISA results from 19 Danish dairy herds as well as for simulated results from the same herds assuming that they were uninfected. Whole-herd milk-ELISA was the preferred strategy, and considered the most cost-effective strategy of the five alternatives. The five strategies were all...... efficient in detecting infection, i.e. estimating a low Pr-Low in infected herds, however, Pr-Low estimates for milk-ELISA on age-cohorts were too low in simulated uninfected herds and the strategies involving faecal culture were too expensive to be of practical interest. For simulated uninfected herds...

  5. Narrative and framing: a test of an integrated message strategy in the exercise context.

    Science.gov (United States)

    Gray, Jennifer B; Harrington, Nancy G

    2011-03-01

    Health communication interventions encouraging exercise may aid in mitigating the obesity crisis in the United States. Although much research has investigated behavioral predictors of exercise, little work has explored message characteristics most persuasive in the exercise context. The purpose of this study, therefore, was to test a message strategy drawing on previous work in health behavior theory combined with persuasion theories (exemplification theory and prospect theory) to encourage positive exercise attitudes, control beliefs, and intentions. The authors report the results of a controlled experiment testing messages using gain or loss frames and narrative or statistical evidence. Results indicate that gain-framed messages are significantly more successful in promoting positive exercise variables and are perceived as more effective than are loss-framed or control messages. The authors discuss the implications of the results for future research.

  6. Screening for trisomies by cell-free DNA testing of maternal blood: consequences of a failed result.

    Science.gov (United States)

    Revello, R; Sarno, L; Ispas, A; Akolekar, R; Nicolaides, K H

    2016-06-01

    First, to report the distribution of the fetal fraction of cell-free (cf) DNA and the rate of a failed cfDNA test result in trisomies 21, 18 and 13, by comparison with pregnancies unaffected by these trisomies, second, to examine the possible effects of maternal and fetal characteristics on the fetal fraction, and third, to consider the options for further management of pregnancies with a failed result. This was a cohort study of 10 698 singleton pregnancies undergoing screening for fetal trisomies 21, 18 and 13 by cfDNA testing at 10-14 weeks' gestation. There were 160 cases of trisomy 21, 50 of trisomy 18, 16 of trisomy 13 and 10 472 were unaffected by these trisomies. Multivariate regression analysis was used to determine significant predictors of fetal fraction and a failed cfDNA test result amongst maternal and fetal characteristics. Fetal fraction decreased with increasing body mass index and maternal age, was lower in women of South Asian racial origin than in Caucasians and in assisted compared to natural conceptions. It increased with fetal crown-rump length and higher levels of serum pregnancy-associated plasma protein-A and free β-human chorionic gonadotropin. The median fetal fraction was 11.0% (interquartile range (IQR), 8.3-14.4%) in the unaffected group, 10.7% (IQR, 7.8-14.3%) in trisomy 21, 8.6% (IQR, 5.0-10.2%) in trisomy 18 and 7.0% (IQR, 6.0-9.4%) in trisomy 13. There was a failed result from cfDNA testing after first sampling in 2.9% of the unaffected group, 1.9% of trisomy 21, 8.0% of trisomy 18 and 6.3% of trisomy 13. In the cases with a failed result, 7% of women had invasive testing, mainly because of high risk from the combined test and/or presence of sonographic features suggestive of trisomies 18 and 13. All cases of trisomies were detected prenatally. In cases of a failed cfDNA test, the rate of trisomies 18 and 13, but not trisomy 21, is higher than in those with a successful test. In the management of such cases, the decision in favor

  7. mapDamage: testing for damage patterns in ancient DNA sequences.

    Science.gov (United States)

    Ginolhac, Aurelien; Rasmussen, Morten; Gilbert, M Thomas P; Willerslev, Eske; Orlando, Ludovic

    2011-08-01

    Ancient DNA extracts consist of a mixture of contaminant DNA molecules, most often originating from environmental microbes, and endogenous fragments exhibiting substantial levels of DNA damage. The latter introduce specific nucleotide misincorporations and DNA fragmentation signatures in sequencing reads that could be advantageously used to argue for sequence validity. mapDamage is a Perl script that computes nucleotide misincorporation and fragmentation patterns using next-generation sequencing reads mapped against a reference genome. The Perl script outputs are further automatically processed in embedded R script in order to detect typical patterns of genuine ancient DNA sequences. The Perl script mapDamage is freely available with documentation and example files at http://geogenetics.ku.dk/all_literature/mapdamage/. The script requires prior installation of the SAMtools suite and R environment and has been validated on both GNU/Linux and MacOSX operating systems.

  8. A strategy for in vitro safety testing of nanotitania-modified textile products

    Energy Technology Data Exchange (ETDEWEB)

    Roszak, Joanna; Stępnik, Maciej; Nocuń, Marek; Ferlińska, Magdalena; Smok-Pieniążek, Anna [Nofer Institute of Occupational Medicine, 8 St Teresy St., 91-348 Łódź (Poland); Grobelny, Jarosław; Tomaszewska, Emilia [University of Lodz, Faculty of Chemistry, 163 Pomorska St, 90-236 Łódź (Poland); Wąsowicz, Wojciech [Nofer Institute of Occupational Medicine, 8 St Teresy St., 91-348 Łódź (Poland); Cieślak, Małgorzata, E-mail: cieslakm@iw.lodz.pl [Textile Research Institute, 118 Gdańska St., 90-520, Łódź (Poland)

    2013-07-15

    Highlights: • Commercially available TiO{sub 2}/Ag nanomaterials (NMs) showed higher cytotoxic effect than TiO{sub 2} NMs. • Both titania NMs in pristine form induced a weak genotoxic effect in in vitro studies. • Cytotoxic effect of textile materials modified with TiO{sub 2}/Ag NMs depended on the mode of the fiber manufacturing. • The strategy of in vitro testing of textile materials modified with NMs was proposed. -- Abstract: Titanium dioxide nanomaterials are extensively used in many applications, also for modification of textile materials. Toxicological assessment of such textile materials is currently seldom performed, mainly because of lack of appropriate guidelines. The aim of the study was to assess cytotoxic and genotoxic potential of commercially available TiO{sub 2} and TiO{sub 2}/Ag NMs in pristine form as well as polypropylene fibers modified with the NMs. Both titania NMs showed a cytotoxic effect on BALB/3T3 clone A31 and V79 fibroblasts after 72-h exposure. Both NMs induced a weak genotoxic effect in comet assay, with TiO{sub 2}/Ag being more active. In vitro micronucleus test on human lymphocytes revealed a weak mutagenic effect of both materials after 24 h of exposure. In contrast, no significant increase in micronuclei frequency was observed in the in vitro micronucleus test on V79 fibroblasts. The 24-h extracts prepared from polypropylene fibers modified with TiO{sub 2}/Ag induced a cytotoxic effect on BALB/3T3 cells which strongly depended on the mode of the fibers manufacturing. The study presents a comprehensive approach to toxicity assessment of textile fibers modified with NMs. Proposed approach may form a good “starting point” for improved future testing strategies.

  9. Comprehensive In Vitro Toxicity Testing of a Panel of Representative Oxide Nanomaterials: First Steps towards an Intelligent Testing Strategy

    Science.gov (United States)

    Farcal, Lucian; Torres Andón, Fernando; Di Cristo, Luisana; Rotoli, Bianca Maria; Bussolati, Ovidio; Bergamaschi, Enrico; Mech, Agnieszka; Hartmann, Nanna B.; Rasmussen, Kirsten; Riego-Sintes, Juan; Ponti, Jessica; Kinsner-Ovaskainen, Agnieszka; Rossi, François; Oomen, Agnes; Bos, Peter; Chen, Rui; Bai, Ru; Chen, Chunying; Rocks, Louise; Fulton, Norma; Ross, Bryony; Hutchison, Gary; Tran, Lang; Mues, Sarah; Ossig, Rainer; Schnekenburger, Jürgen; Campagnolo, Luisa; Vecchione, Lucia; Pietroiusti, Antonio; Fadeel, Bengt

    2015-01-01

    Nanomaterials (NMs) display many unique and useful physico-chemical properties. However, reliable approaches are needed for risk assessment of NMs. The present study was performed in the FP7-MARINA project, with the objective to identify and evaluate in vitro test methods for toxicity assessment in order to facilitate the development of an intelligent testing strategy (ITS). Six representative oxide NMs provided by the EC-JRC Nanomaterials Repository were tested in nine laboratories. The in vitro toxicity of NMs was evaluated in 12 cellular models representing 6 different target organs/systems (immune system, respiratory system, gastrointestinal system, reproductive organs, kidney and embryonic tissues). The toxicity assessment was conducted using 10 different assays for cytotoxicity, embryotoxicity, epithelial integrity, cytokine secretion and oxidative stress. Thorough physico-chemical characterization was performed for all tested NMs. Commercially relevant NMs with different physico-chemical properties were selected: two TiO2 NMs with different surface chemistry – hydrophilic (NM-103) and hydrophobic (NM-104), two forms of ZnO – uncoated (NM-110) and coated with triethoxycapryl silane (NM-111) and two SiO2 NMs produced by two different manufacturing techniques – precipitated (NM-200) and pyrogenic (NM-203). Cell specific toxicity effects of all NMs were observed; macrophages were the most sensitive cell type after short-term exposures (24-72h) (ZnO>SiO2>TiO2). Longer term exposure (7 to 21 days) significantly affected the cell barrier integrity in the presence of ZnO, but not TiO2 and SiO2, while the embryonic stem cell test (EST) classified the TiO2 NMs as potentially ‘weak-embryotoxic’ and ZnO and SiO2 NMs as ‘non-embryotoxic’. A hazard ranking could be established for the representative NMs tested (ZnO NM-110 > ZnO NM-111 > SiO2 NM-203 > SiO2 NM-200 > TiO2 NM-104 > TiO2 NM-103). This ranking was different in the case of embryonic tissues, for

  10. Using the Astronomy Diagnostic Test to Identify Teaching Strategies that Improve Conceptual Understanding

    Science.gov (United States)

    Deming, G. L.; Hufnagel, B.

    2002-05-01

    The Astronomy Diagnostic Test (ADT) was developed in order to assess learning in undergraduate introductory astronomy classes, but an underlying goal was to use the information supplied by the ADT to improve student learning. The ADT National Project collected pre-course (5346 students) and post-course (3842 students) test results from 97 classes at a variety of institutions in 31 states. These results have been compiled in an extensive database. The overall gain between pre-course and post-course average scores amounts to a disappointing 15%, but significant gains are identifiable for specific questions in individual classes. Results from the ADT National Project database will be presented for specific questions with minimal gains. Astronomy education researchers in Maryland are beginning to use ADT results to identify minimal gain concepts and then to modify and assess instructional strategies with the goal of improving student learning. A comparison will be made between ADT pre-course and post-course responses for several classes in which different teaching methods were used. Successful teaching strategies applicable in a variety of class settings will be offered and instructors are encouraged to become involved in assessing results in their own introductory astronomy classes. This research was supported by the National Science Foundation through grant REC-0089239.

  11. Impact of Breast Reader Assessment Strategy on mammographic radiologists' test reading performance.

    Science.gov (United States)

    Suleiman, Wasfi I; Rawashdeh, Mohammad A; Lewis, Sarah J; McEntee, Mark F; Lee, Warwick; Tapia, Kriscia; Brennan, Patrick C

    2016-06-01

    The detection of breast cancer is somewhat limited by human factors, and thus there is a need to improve reader performance. This study assesses whether radiologists who regularly undertake the education in the form of the Breast Reader Assessment Strategy (BREAST) demonstrate any changes in mammography interpretation performance over time. In 2011, 2012 and 2013, 14 radiologists independently assessed a year-specific BREAST mammographic test-set. Radiologists read a different single test-set once each year, with each comprising 60 digital mammogram cases. Radiologists marked the location of suspected lesions without computer-aided diagnosis (CAD) and assigned a confidence rating of 2 for benign and 3-5 for malignant lesions. The mean sensitivity, specificity, location sensitivity, JAFROC FOM and ROC AUC were calculated. A Kruskal-Wallis test was used to compare the readings for the 14 radiologists across the 3 years. Wilcoxon signed rank test was used to assess comparison between pairs of years. Relationships between changes in performance and radiologist characteristics were examined using a Spearman's test. Significant increases were noted in mean sensitivity (P = 0.01), specificity (P = 0.01), location sensitivity (P = 0.001) and JAFROC FOM (P = 0.001) between 2011 and 2012. Between 2012 and 2013, significant improvements were noted in mean sensitivity (P = 0.003), specificity (P = 0.002), location sensitivity (P = 0.02), JAFROC FOM (P = 0.005) and ROC AUC (P = 0.008). No statistically significant correlations were shown between the levels of improvement and radiologists' characteristics. Radiologists' who undertake the BREAST programme demonstrate significant improvements in test-set performance during a 3-year period, highlighting the value of ongoing education through the use of test-set. © 2016 The Royal Australian and New Zealand College of Radiologists.

  12. Test-set reduction in the screening step definition of a chiral separation strategy in polar organic solvents chromatography.

    Science.gov (United States)

    Ates, Hasret; Desmedt, Bart; Heyden, Yvan Vander

    2012-12-01

    The last decades, many efforts have been made to design and develop chiral separation strategies for different analytical techniques. To ensure that these strategies are broadly applicable rather large test-sets of molecules with very diverse molecules are used. The most enantioselective and complementary separation systems are then used as screening conditions in separation strategies. Potential changes in conditions e.g. implementation of new chiral selectors, requires screening of the entire set to retain the most enantioselective systems. A rational reduction of the test-sets may open new perspectives for developing and updating separation strategies. In the present work, it is investigated whether the screening step of an existing separation strategy in polar organic solvents chromatography can be reconstructed based on reduced test-set results Therefore, the structures of the 58 molecules of the test-set are digitally drawn and their optimal geometrical conformations calculated. From these conformations 3D-molecular descriptors are calculated. The test-set reduction is performed using the Kennard and Stone algorithm: compounds with the most diverse descriptors are selected. The test-sets are gradually reduced with 10% starting from 90% to 30% of the initial size. The results pointed out that with some reduced test-sets the same chromatographic systems are selected. A test-set reduction with 30% (41 remaining compounds) seems possible without losing information on the global enantioselectivity and complementarity of the tested chiral stationary phases.

  13. A competitive strategy coupled with endonuclease-assisted target recycling for DNA detection using silver-nanoparticle-tagged carbon nanospheres as labels.

    Science.gov (United States)

    Zhu, Zhu; Gao, Fenglei; Lei, Jianping; Dong, Haifeng; Ju, Huangxian

    2012-10-22

    A simple competitive strategy was designed for the sensitive detection of sequence-specific DNA by combining endonuclease-assisted target recycling and electrochemical stripping analysis of silver nanoparticles (AgNPs). The AgNP-tagged carbon nanospheres were synthesized by means of in situ reduction of Ag(+) adsorbed onto a negatively charged polyelectrolyte layer and functionalized with streptavidin for binding biotin-labeled DNA strands. The labeled strand was captured on the DNA sensor surface by competitive hybridization of biotinated primer 1 and its cleaved product. The cleaved product could be amplified in homogeneous solution by endonuclease-assisted target recycling with a Y-shaped junction DNA structure, thus leading to the correlation of the stripping signal to the target concentration. The functionalized nanosphere was characterized with X-ray photoelectron spectroscopy, scanning electron microscopy, and transmission electron microscopy. The proposed method showed a linear range from 0.1 to 1000 fM with a limit of detection of 0.066 fM (3σ) and good selectivity for base discrimination. The designed strategy provided a sensitive tool for DNA analysis and could be widely applied in bioanalysis and biomedicine.

  14. Utility of Filter Paper for Preserving Insects, Bacteria, and Host Reservoir DNA for Molecular Testing

    Directory of Open Access Journals (Sweden)

    F Karimian

    2011-12-01

    Methods: Total body or haemolymph of individual mosquitoes, sand flies or cockroaches squashed or placed on the paper respectively. Extracted DNA of five different bacteria species as well as blood specimens of human and great gerbil Rhombomys opimus was pipetted directly onto filter paper. The papers were stored in room temperature up to 12 months during 2009 until 2011. At monthly intervals, PCR was conducted using a 1-mm disk from the DNA impregnated filter paper as target DNA. PCR amplification was performed against different target genes of the organisms including the ITS2-rDNA of mosquitoes, mtDNA-COI of the sand flies and cockroaches, 16SrRNA gene of the bacteria, and the mtDNA-CytB of the vertebrates. Results: Successful PCR amplification was observed for all of the specimens regardless of the loci, taxon, or time of storage. The PCR amplification were ranged from 462 to 1500 bp and worked well for the specified target gene/s. Time of storage did not affect the amplification up to one year. Conclusion: The filter paper method is a simple and economical way to store, to preserve, and to distribute DNA samples for PCR analysis.

  15. Genotoxicity of a variety of azobenzene and aminoazobenzene compounds in the hepatocyte/DNA repair test and the Salmonella/mutagenicity test.

    Science.gov (United States)

    Mori, H; Mori, Y; Sugie, S; Yoshimi, N; Takahashi, M; Ni-i, H; Yamazaki, H; Toyoshi, K; Williams, G M

    1986-04-01

    Genotoxicity of 39 azo dye compounds of azobenzenes, aminoazobenzenes, and diaminoazobenzenes was examined in the hepatocyte primary culture/DNA repair test. Azobenzene (AzB) and 3,3'- or 4,4'-substituted azobenzenes such as (CH3)2AzB, (CH2OH)2AzB, (CH2OCOCH3)2AzB, and (CH2Cl)2AzB did not generate DNA repair, indicating lack of genotoxicity of these compounds. In contrast, all of 24 aminoazobenzenes, including those of unknown carcinogenicity, i.e., 3'-methyl-4-aminoazobenzene, 3'-CH2OH-aminoazobenzene, 3'-hydroxymethyl-N-methyl-4-aminoazobenzene, 3'-COOH-methylaminoazobenzene, 4'-formyl-N,N-dimethyl-4-aminoazobenzene, 3'-CH2Cl-dimethylaminoazobenzene, 4'-CH2Cl-dimethylaminoazobenzene, and 2'-, 3'-, or 4'-CH2OCOCH3-dimethylaminoazobenzene, elicited DNA repair synthesis. A positive DNA repair response was obtained for the 3 of 6 tested diaminoazobenzenes, i.e., N'-acetyl-N'-methyl-4-amino-dimethylaminoazobenzene, N'-acetyl-N'-methyl-4-amino-methylaminoazobenzene, and N'-acetyl-N'-methyl-4-amino-N-acetyl-methylaminoazobenzene, which are known to be carcinogenic. These results indicate that the amino group is functional for the expression of genotoxicity of azobenzene compounds. Twenty-one azobenzenes of these 3 classes were also examined for their mutagenicity in the Salmonella/mutagenicity assay. These results were almost identical with those of the DNA repair test except for several azo dyes such as AzB and 4,4'-(CH2Oacetyl)2AzB of the azobenzenes and N'-acetyl-4-amino-dimethylaminoazobenzene and N'-acetyl-N-methyl-4-amino-N-acetyl methylaminoazobenzene of the diaminoazobenzenes.

  16. [The application of mitochondrial genomics to forensic investigations based on human mitochondrial DNA testing].

    Science.gov (United States)

    Skonieczna, Katarzyna; Bednarek, Jarosław; Rogalla, Urszula; Woźniak, Marcin; Gorzkiewicz, Marta; Linkowska, Katarzyna; Duleba, Anna; Sliwka, Karol; Grzybowski, Tomasz

    2012-01-01

    In this study we present two forensic cases where mitochondrial DNA HVS I and HVS II haplotypes of evidentiary hairs match reference samples. Based on the information retrieved from mtDNA coding region of reference material, we selected single nucleotide polymorphisms (SNPs) located outside the HVS I and HVS II regions that could increase the informativeness of mtDNA analysis. The SNPs were typed via SNaPshot or dideoxy sequencing technology. In both cases the SNP results allowed for unambiguous exlusion of the evidence and for determining that reference samples originated from the same person.

  17. Six consecutive false positive cases from cell-free fetal DNA testing in a single referring centre

    Science.gov (United States)

    Dugo, Nella; Padula, Francesco; Mobili, Luisa; Brizzi, Cristiana; D’Emidio, Laura; Cignini, Pietro; Mesoraca, Alvaro; Bizzoco, Domenico; Cima, Antonella; Giorlandino, Claudio

    2014-01-01

    Introduction recent studies have proposed the introduction of cell-free fetal DNA testing (NIPT-Non Invasive Prenatal Testing) in routine clinical practice emphasizing its high sensibility and specificity. In any case, false positive and false negative findings may result from placental mosaicism, because cell-free fetal DNA originates mainly from placenta. Case we report six cases of women who underwent chorionic villus sampling (CVS) or amniocentesis to confirm the results from NIPT: two Turner syndromes, two Triple X, one Patau syndrome, one Edward syndrome. Results using classic cytogenetic analysis and, also, Array - Comparative Genomic Hybridization (Array CGH) the karyotype of all 5 fetuses was found to be normal. Conclusion results from NIPT must always be confirmed by invasive prenatal diagnosis. It is mandatory to inform the patient that the CVS and amniocentesis still represent the only form of prenatal diagnostic test available. PMID:25332757

  18. A strategy to reduce the numbers of fish used in acute ecotoxicity testing of pharmaceuticals.

    Science.gov (United States)

    Hutchinson, Thomas H; Barrett, Sarah; Buzby, Mary; Constable, David; Hartmann, Andreas; Hayes, Eileen; Huggett, Duane; Laenge, Reinhard; Lillicrap, Adam D; Straub, Jürg Oliver; Thompson, Roy S

    2003-12-01

    The pharmaceutical industry gives high priority to animal welfare in the process of drug discovery and safety assessment. In the context of environmental assessments of active pharmaceutical ingredients (APIs), existing U.S. Food and Drug Administration and draft European regulations may require testing of APIs for acute ecotoxicity to algae, daphnids, and fish (base-set ecotoxicity data used to derive the predicted no-effect concentration [PNECwater] from the most sensitive of three species). Subject to regulatory approval, it is proposed that testing can be moved from fish median lethal concentration (LC50) testing (typically using > or = 42 fish/API) to acute threshold tests using fewer fish (typically 10 fish/API). To support this strategy, we have collated base-set ecotoxicity data from regulatory studies of 91 APIs (names coded for commercial reasons). For 73 of the 91 APIs, the algal median effect concentration (EC50) and daphnid EC50 values were lower than or equal to the fish LC50 data. Thus, for approximately 80% of these APIs, algal and daphnid acute EC50 data could have been used in the absence of fish LC50 data to derive PNECwater values. For the other 18 APIs, use of an acute threshold test with a step-down factor of 3.2 is predicted to give comparable PNECwater outcomes. Based on this preliminary scenario of 91 APIs, this approach is predicted to reduce the total number of fish used from 3,822 to 1,025 (approximately 73%). The present study, although preliminary, suggests that the current regulatory requirement for fish LC50 data regarding APIs should be succeeded by fish acute threshold (step-down) test data, thereby achieving significant animal welfare benefits with no loss of data for PNECwater estimates.

  19. Reliability and Validity Test of Questionnaire on the Adaptation Strategy of Cryosphere Changes in Arid Inland River Basin

    Institute of Scientific and Technical Information of China (English)

    2011-01-01

    [Objective] The aim was to test the reliability and validity of questionnaire on the adaptation strategy of cryosphere changes in arid inland river basin. [Method] A questionnaire on "the adaptation strategy of cryosphere changes in arid inland river basin" was carried out in Urumchi River basin and Aksu River basin, and its reliability and validity were tested by means of statistical method, so as to investigate the stability and accuracy of questionnaire. [Result] Reliability analysis of questionnaire sho...

  20. Protective effect of a prime-boost strategy with plasmid DNA followed by recombinant adenovirus expressing TgAMA1 as vaccines against Toxoplasma gondii infection in mice.

    Science.gov (United States)

    Yu, Longzheng; Yamagishi, Junya; Zhang, Shoufa; Jin, Chunmei; Aboge, Gabriel Oluga; Zhang, Houshuang; Zhang, Guohong; Tanaka, Tetsuya; Fujisaki, Kozo; Nishikawa, Yoshifumi; Xuan, Xuenan

    2012-09-01

    A heterologous prime-boost strategy with priming plasmid DNA followed by recombinant virus expressing relevant antigens is known to stimulate protective immunity against intracellular parasites. In this study, we have evaluated a heterologous prime-boost strategy for immunizing mice against Toxoplasma gondii infection. Our results revealed that the prime-boost strategy using both plasmid DNA and adenoviral vector encoding TgAMA1 may stimulate both humoral and Th1/Th2 cellular immune responses specific for TgAMA1. Moreover, C57BL/6 mice immunized with the pAMA1/Ad5Null, pNull/Ad5AMA1, and pAMA1/Ad5AMA1 constructs showed survival rates of 12.5%, 37.5%, and 50%, respectively. In contrast, all the pNull/Ad5Null immunized mice died after infection with the PLK-GFP strain of T. gondii. Brain cyst burden was reduced by 23% in mice immunized with pAMA1/Ad5AMA1 compared with the pNull/Ad5AMA1 immunized mice. These results demonstrate that the heterologous DNA priming and recombinant adenovirus boost strategy may provide protective immunity against T. gondii infection.

  1. Paternity testing using microsatellite DNA markers in captive Adélie penguins (Pygoscelis adeliae).

    Science.gov (United States)

    Sakaoka, Ken; Suzuki, Isao; Kasugai, Naeko; Fukumoto, Yohei

    2014-01-01

    We investigated the paternity of 39 Adélie penguins (Pygoscelis adeliae) hatched at the Port of Nagoya Public Aquarium between 1995 and 2005 breeding seasons using microsatellite DNA markers. Among the 13 microsatellite marker loci tested in this study, eight markers amplified and were found to be polymorphic in the colony's founders of the captive population (n = 26). Multiple marker analysis confirmed that all the hatchlings shared alleles with their social fathers and that none of them were sired by any male (all males ≥4 years old in the exhibit tank during each reproductive season; n = 9-15) other than the one carrying out parental duties, except in the case of two inbred hatchlings whose half-sibling parents shared the same father. These results demonstrated that extra-pair paternity (EPP) did not occur in this captive population and that even if EPP has been detected among them, the probability of excluding all other possible fathers in the exhibit tank is extremely high based on paternity exclusion probabilities across the investigated loci. The paternity exclusion probabilities were almost the same between 1994 and 2005. The probability of identity across the investigated loci declined between the two time points, but was still high. These results are reflected in a very short history of breeding in this captive population. In other words, the parentage analyses using a suite of microsatellite markers will be less effective as generations change in small closed populations, such as zoo and aquarium populations. © 2014 Wiley Periodicals, Inc.

  2. Construction and Nonclinical Testing of a Puumala Virus Synthetic M Gene-Based DNA Vaccine

    Science.gov (United States)

    2012-12-12

    DNA vaccine constructsf Amino acid positiona PUUV M segment amino acid DNA vaccine amino acid DTK/ Ufa -97b K27c P360d Hallnas B1e PUU- M(x22) PUU- M...G 1097 S S S S L L S a M gene segment open reading frame amino acid position. b DTK/ Ufa -97, PUUV strain DTK/ Ufa (GenBank accession no. BAF49040). c

  3. Why Take an HIV Test? Concerns, Benefits, and Strategies to Promote HIV Testing among Low-Income Heterosexual African American Young Adults

    Science.gov (United States)

    Wallace, Scyatta A.; McLellan-Lemal, Eleanor; Harris, Muriel J.; Townsend, Tiffany G.; Miller, Kim S.

    2011-01-01

    A qualitative study examined perceptions of HIV testing and strategies to enhance HIV testing among HIV-negative African American heterosexual young adults (ages 18-25 years). Twenty-six focus groups (13 male groups, 13 female groups) were conducted in two low-income communities (urban and rural). All sessions were audio-recorded and transcribed.…

  4. An economic evaluation of preclinical testing strategies compared to the compulsory scrapie flock scheme in the control of classical scrapie.

    Science.gov (United States)

    Boden, Lisa; Handel, Ian; Hawkins, Neil; Houston, Fiona; Fryer, Helen; Kao, Rowland

    2012-01-01

    Cost-benefit is rarely combined with nonlinear dynamic models when evaluating control options for infectious diseases. The current strategy for scrapie in Great Britain requires that all genetically susceptible livestock in affected flocks be culled (Compulsory Scrapie Flock Scheme or CSFS). However, this results in the removal of many healthy sheep, and a recently developed pre-clinical test for scrapie now offers a strategy based on disease detection. We explore the flock level cost-effectiveness of scrapie control using a deterministic transmission model and industry estimates of costs associated with genotype testing, pre-clinical tests and the value of a sheep culled. Benefit was measured in terms of the reduction in the number of infected sheep sold on, compared to a baseline strategy of doing nothing, using Incremental Cost Effectiveness analysis to compare across strategies. As market data was not available for pre-clinical testing, a threshold analysis was used to set a unit-cost giving equal costs for CSFS and multiple pre-clinical testing (MT, one test each year for three consecutive years). Assuming a 40% within-flock proportion of susceptible genotypes and a test sensitivity of 90%, a single test (ST) was cheaper but less effective than either the CSFS or MT strategies (30 infected-sales-averted over the lifetime of the average epidemic). The MT strategy was slightly less effective than the CSFS and would be a dominated strategy unless preclinical testing was cheaper than the threshold price of £6.28, but may be appropriate for flocks with particularly valuable livestock. Though the ST is not currently recommended, the proportion of susceptible genotypes in the national flock is likely to continue to decrease; this may eventually make it a cost-effective alternative to the MT or CSFS.

  5. An economic evaluation of preclinical testing strategies compared to the compulsory scrapie flock scheme in the control of classical scrapie.

    Directory of Open Access Journals (Sweden)

    Lisa Boden

    Full Text Available Cost-benefit is rarely combined with nonlinear dynamic models when evaluating control options for infectious diseases. The current strategy for scrapie in Great Britain requires that all genetically susceptible livestock in affected flocks be culled (Compulsory Scrapie Flock Scheme or CSFS. However, this results in the removal of many healthy sheep, and a recently developed pre-clinical test for scrapie now offers a strategy based on disease detection. We explore the flock level cost-effectiveness of scrapie control using a deterministic transmission model and industry estimates of costs associated with genotype testing, pre-clinical tests and the value of a sheep culled. Benefit was measured in terms of the reduction in the number of infected sheep sold on, compared to a baseline strategy of doing nothing, using Incremental Cost Effectiveness analysis to compare across strategies. As market data was not available for pre-clinical testing, a threshold analysis was used to set a unit-cost giving equal costs for CSFS and multiple pre-clinical testing (MT, one test each year for three consecutive years. Assuming a 40% within-flock proportion of susceptible genotypes and a test sensitivity of 90%, a single test (ST was cheaper but less effective than either the CSFS or MT strategies (30 infected-sales-averted over the lifetime of the average epidemic. The MT strategy was slightly less effective than the CSFS and would be a dominated strategy unless preclinical testing was cheaper than the threshold price of £6.28, but may be appropriate for flocks with particularly valuable livestock. Though the ST is not currently recommended, the proportion of susceptible genotypes in the national flock is likely to continue to decrease; this may eventually make it a cost-effective alternative to the MT or CSFS.

  6. Suggesting a testing strategy for possible endocrine effects of drug metabolites.

    Science.gov (United States)

    Jacobsen, N W; Brooks, B W; Halling-Sørensen, B

    2012-04-01

    Most pharmaceuticals are extensively metabolized by organisms, which results in internal exposure to mixtures of parent compounds and various metabolites. Many of these metabolites are considered non-toxic, but some metabolites retain toxic properties of the parent compound or elicit other undesirable outcomes. Unfortunately, the effects of metabolites are often not considered when endocrine activities of chemicals are evaluated in vitro. In this study two approaches, an "effect-based" and a "compound-by-compound" testing design, were used to determine the effects of metabolites of the antidepressant sertraline on aromatase enzyme activity. In the "effect-based" approach, a mixture of sertraline metabolites, produced by liver microsomes, inhibited aromatase, but was less potent than sertraline. In the "compound-by-compound" testing design, three specific metabolites were evaluated individually and in mixtures. Though two N-desmethylated metabolites were more potent aromatase inhibitors than sertraline, hydroxyl ketone sertraline did not inhibit the enzyme and mixtures of these metabolites and sertraline were less potent than predicted from a concentration addition model. Our findings highlight the importance of considering aromatase inhibition, and potentially other biological activities, of pharmaceutical metabolites produced by liver microsome preparations and then comparing such observations to studies of specific metabolites available for testing in pure form. Subsequently, a five step integrated strategy for screening of the potential endocrine effects of drugs and their metabolites are proposed. Copyright © 2012 Elsevier Inc. All rights reserved.

  7. Current strategies to minimize toxicity of oxaliplatin: selection of pharmacogenomic panel tests.

    Science.gov (United States)

    Di Francia, Raffaele; Siesto, Raffaella Stefania; Valente, Daniela; Del Buono, Andrea; Pugliese, Sergio; Cecere, Sabrina; Cavaliere, Carla; Nasti, Guglielmo; Facchini, Gaetano; Berretta, Massimiliano

    2013-11-01

    Oxaliplatin is an anticancer drug routinely used to treat colorectal, gastroesophageal, ovarian, breast, head/neck, and genitourinary cancers. Discontinuation of oxaliplatin treatment is mostly because of peripheral neuropathy, more often than for tumor progression, potentially compromising patient benefit. Several strategies to prevent neurotoxicity have so far been investigated. To overcome this life-threatening side effect, while taking advantage of the antineoplastic activities of oxaliplatin, we describe in detail recent findings on the underlying mechanisms of genetic variants associated with toxicity and resistance to oxaliplatin-based chemotherapy in colorectal cancer. A comprehensive panel of eight polymorphisms, previously validated as significant markers related to oxaliplatin toxicity, is proposed and discussed. In addition, the most common available strategies or methods to prevent/minimize the toxicity were described in detail. Moreover, an early outline evaluation of the genotyping costs and methods was taken in consideration. With the availability of individual pharmacogenomic profiles, the oncologists will have new means to make treatment decisions for their patients that maximize benefit and minimize toxicity. With this purpose in mind, the clinician and lab manager should cooperate to evaluate the advantages and limitations, in terms of costs and applicability, of the most appropriate pharmacogenomic tests for routine incorporation into clinical practice.

  8. A certeza que pariu a dúvida: paternidade e DNA The certainty that engendered new doubts: DNA and paternity tests

    Directory of Open Access Journals (Sweden)

    Claudia Fonseca

    2004-08-01

    Full Text Available Atualmente, no Brasil, existe uma onda de testes de paternidade DNA (nos laboratórios públicos e em clínicas particulares que levanta reflexões interessantes quanto à interseção das esferas médica e jurídica e sua influência sobre as relações de gênero e de parentesco na sociedade contemporânea. Para analisar esse fenômeno, acompanhamos nas diferentes instâncias jurídicas em Porto Alegre (na Defensoria da República, nas Audiências de Conciliação, na Vara de Família e no Serviço Médico do Tribunal pessoas envolvidas em disputas jurídicas em torno da identidade paterna. Investigamos também como recentes mudanças nas leis de reconhecimento paterno são acionadas pelas diferentes personagens do cenário. A partir desses dados, levantamos a hipótese de que, longe de inspirar maior tranqüilidade, a simples existência do teste atiça as dúvidas. Tendo repercussões profundas sobre a nossa maneira de 'saber' quem é pai, a situação descrita nesse paper traz novos desafios para uma antropologia do conhecimento, voltada para a análise das crenças (inclusive científicas ocidentais.DNA paternity tests, in both private and public laboratories, have become popular of late throughout Brazil, raising some interesting questions as to the overlap of the legal and medical spheres in family issues. To analyze this question, we accompanied people involved in paternity disputes presenting their claims in the different judicial instances of Porto Alegre, RS (Defensoria, conciliation sessions, the court medical service, and the Family Court. We also examined how the different actors involved in this scenario interacted with recent Brazilian legislation dealing with paternity. On the basis of this experience, we raise the hypothesis that, far from inspiring greater tranquility, the simple existence of this test stirs up doubts. Reflecting profound repercussions for our manner of "knowing" paternal identity, reactions to the DNA test

  9. Simultaneous detection of human mitochondrial DNA and nuclear-inserted mitochondrial-origin sequences (NumtS) using forensic mtDNA amplification strategies and pyrosequencing technology.

    Science.gov (United States)

    Bintz, Brittania J; Dixon, Groves B; Wilson, Mark R

    2014-07-01

    Next-generation sequencing technologies enable the identification of minor mitochondrial DNA variants with higher sensitivity than Sanger methods, allowing for enhanced identification of minor variants. In this study, mixtures of human mtDNA control region amplicons were subjected to pyrosequencing to determine the detection threshold of the Roche GS Junior(®) instrument (Roche Applied Science, Indianapolis, IN). In addition to expected variants, a set of reproducible variants was consistently found in reads from one particular amplicon. A BLASTn search of the variant sequence revealed identity to a segment of a 611-bp nuclear insertion of the mitochondrial control region (NumtS) spanning the primer-binding sites of this amplicon (Nature 1995;378:489). Primers (Hum Genet 2012;131:757; Hum Biol 1996;68:847) flanking the insertion were used to confirm the presence or absence of the NumtS in buccal DNA extracts from twenty donors. These results further our understanding of human mtDNA variation and are expected to have a positive impact on the interpretation of mtDNA profiles using deep-sequencing methods in casework.

  10. [A novel immunization strategy to induce strong humoral responses against HIV-1 using combined DNA, recombinant vaccinia virus and protein vaccines].

    Science.gov (United States)

    Liu, Chang; Wang, Shu-hui; Ren, Li; Hao, Yan-ling; Zhang, Qi-cheng; Liu, Ying

    2014-11-01

    To optimize the immunization strategy against HIV-1, a DNA vaccine was combined with a recombinant vaccinia virus (rTV) vaccine and a protein vaccine. Immune responses against HIV-1 were detected in 30 female guinea pigs divided into six groups. Three groups of guinea pigs were primed with HIV-1 DNA vaccine three times, boosted with rTV at week 14, and then boosted with gp140 protein at intervals of 4, 8 or 12 weeks. Simultaneously, the other three groups of animals were primed with rTV vaccine once, and then boosted with gp140 after 4, 8 or 12 weeks. The HIV-1 specific binding antibody and neutralizing antibody, in addition to the relative affinity of these antibodies, were detected at different time points after the final administration of vaccine in each group. The DNA-rTV-gp140 immune regimen induced higher titers and affinity levels of HIV-1 gp120/gp140 antibodies and stronger V1V2-gp70 antibodies than the rTV-gp140 regimen. In the guinea pigs that underwent the DNA-rTV-gp140 regimen, the highest V1V2-gp70 antibody was induced in the 12-week-interval group. However, the avidity of antibodies was improved in the 4-week-interval group. Using the rTV-gp140 immunization strategy, guinea pigs boosted at 8 or 12 weeks after rTV priming elicited stronger humoral responses than those boosted at 4 weeks after priming. In conclusion, this study shows that the immunization strategy of HIV-1 DNA vaccine priming, followed by rTV and protein vaccine boosting, could strengthen the humoral response against HIV-1. Longer intervals were better to induce V1V2-gp70-specific antibodies, while shorter intervals were more beneficial to enhance the avidity of antibodies.

  11. Immunogenicities of Env glycoproteins from circulating HIV-1 isolates in China focusing on the strategy of "DNA prime plus protein boost"

    Institute of Scientific and Technical Information of China (English)

    WANG Zheng; WANG Shi-xia; LIU Si-yang; BAO Zuo-yi; ZHUANG Dao-min; LI Lin; ZHANG Chun-hua; ZHANG Lu; LI Jing-yun; LU Shan

    2009-01-01

    Background The adenovirus-based HIV-1 vaccine developed by Merck Company suffered from an unexpected failure in September 2007. This generated a big shift in the strategy of HIV vaccine development with renewed focus on the induction of neutralizing antibodies. A major challenge in developing an HIV-1 vaccine is to identify immunogens and adopt delivery methods that can elicit broadly neutralizing antibodies against primary isolates of different genetic subtypes.Methods Most circulating HIV-1 isolates in China are composed of clades Thai-B, CRF_BC and CRF01_AE. In order to construct DNA vaccines against these 3 HIV-1 subtypes, DNA vaccines carrying the gp120 regions from HIV-1 isolates of GX48(AE), GX79(AE), NX22(BC), GS22(BC), HN24(Thai-B) were constructed. Expression of gp120 from these DNA vaccines was detected by Western blotting in transiently transfected 293T cells. Pilot immunizations of New Zealand white rabbits were performed using the strategy of "DNA prime plus protein boost" and the neutralizing antibody response was detected in a Tzm-bl cell based assay against different HIV-1 strains.Results Response of gp120-specific antibody was relatively low after DNA primes (mean titer=10~(4.72)); however, the titer of gp120-specific antibody went up with 2 protein boosts (mean titer=10~(6.81)). Above all, neutralizing antibody (Nab) titers induced by this combined approach were much better than those elicited by DNA or protein used alone (P <0.01). Neutralizing activities of immunized rabbit sera against several pseudoviruses and laboratorial strains were evaluated, most rabbit sera primed with monovalent vaccine were capable of neutralizing only 1 of 5 viruses, however, sera primed with the polyvalent DNA vaccines were able to neutralize at least 2 of 5 viruses.Conclusion Polyvalent DNA prime plus protein boost is an effective immunization strategy to broaden the neutralization breadth and further research should be performed on the basis of this pilot study.

  12. Dipstick test for DNA-based food authentication. Application to coffee authenticity assessment.

    Science.gov (United States)

    Trantakis, Ioannis A; Spaniolas, Stelios; Kalaitzis, Panagiotis; Ioannou, Penelope C; Tucker, Gregory A; Christopoulos, Theodore K

    2012-01-25

    This paper reports DNA-based food authenticity assays, in which species identification is accomplished by the naked eye without the need of specialized instruments. Strongly colored nanoparticles (gold nanoparticles) are employed as reporters that enable visual detection. Furthermore, detection is performed in a low-cost, disposable, dipstick-type device that incorporates the required reagents in dry form, thereby avoiding multiple pipetting and incubation steps. Due to its simplicity, the method does not require highly qualified personnel. The procedure comprises the following steps: (i) PCR amplification of the DNA segment that flanks the unique SNP (species marker); (ii) a 15 min extension reaction in which DNA polymerase extends an allele-specific primer only if it is perfectly complementary with the target sequence; (iii) detection of the products of the extension reaction within a few minutes by the naked eye employing the dipstick. No purification is required prior to application of the extension products to the dipstick. The method is general and requires only a unique DNA sequence for species discrimination. The only instrument needed is a conventional thermocycler for PCR, which is common equipment in every DNA laboratory. As a model, the method was applied to the discrimination of Coffea robusta and arabica species in coffee authenticity assessment. As low as 5% of Robusta coffee can be detected in the presence of Arabica coffee.

  13. Rapid rates of sperm DNA damage after activation in tench (Tinca tinca: Teleostei, Cyprinidae) measured using a sperm chromatin dispersion test.

    Science.gov (United States)

    López-Fernández, Carmen; Gage, Matthew J G; Arroyo, Francisca; Gosálbez, Altea; Larrán, Ana M; Fernández, José L; Gosálvez, Jaime

    2009-08-01

    Spermatozoal haplotypic DNA is prone to damage, leading to male fertility problems. So far, the assessment of sperm DNA breakage has been challenging because protamines render the nuclear chromatin highly compacted. Here, we report the application of a new test to quantify DNA fragmentation in spermatozoa of an externally fertilizing teleost fish. The sperm chromatin dispersion (SCD) test uses a species-specific lysing solution to generate controlled protein depletion that, followed by DNA-specific fluorescent labelling, allows an easy morphological discrimination between nuclei affected by DNA damage. Using tench (Tinca tinca) as our model, we first trialled the test against established, but more technically demanding, assays employing in situ nick translation (ISNT) and the comet assay. The SCD test showed high concordance with ISNT, comet assay measures and a chromatin-swelling test, confirming the application of this straightforward SCD technique to various aspects of reproductive biology. Second, we examined between-male variation in DNA damage, and measured changes through time following spermatozoal activation. Between-male variation in the basal levels of average DNA damage ranged from 0 to 20% of sperm showing damage, and all showed increases in DNA fragmentation through time (0-60 min). The rates of DNA damage increase are the fastest so far recorded in sperm for a living organism, and may relate to the external fertilization mode. Our findings have relevance for broodstock selection and optimizing IVF protocols routinely used in modern aquaculture.

  14. First-trimester contingent screening for trisomies 21, 18 and 13 by biomarkers and maternal blood cell-free DNA testing.

    Science.gov (United States)

    Nicolaides, K H; Syngelaki, A; Poon, L C; Gil, M M; Wright, D

    2014-01-01

    To examine potential performance of screening for trisomies by cell-free (cf) DNA testing in maternal blood contingent on results of first-line testing by combinations of fetal translucency thickness (NT), fetal heart rate (FHR), ductus venosus pulsatility index (DV PIV), and serum-free β-human chorionic gonadotropin (β-hCG), pregnancy-associated plasma protein-A (PAPP-A), placental growth factor (PLGF) and α-fetoprotein (AFP). Performance was estimated for firstly, screening by cfDNA in all pregnancies and secondly, cfDNA testing contingent on results of first-line testing by combinations of ultrasound and biochemical markers. In first-line screening by cfDNA testing, the detection rate for trisomy 21 and trisomies 18 or 13 would be 99 and 96%, respectively, after invasive testing in 1% of the population. In contingent screening, a detection rate of 98% for trisomy 21 and 96% for trisomy 18 or 13, at an invasive testing rate of 0.7%, can be achieved by carrying out cfDNA testing in about 35, 20 and 11% of cases identified by first-line screening with the combined test alone (age, NT, FHR, β-hCG, PAPP-A), the combined test plus PLGF and AFP and the combined test plus PLGF, AFP and DV PIV, respectively. Effective first-trimester screening for trisomies can be achieved by contingent screening incorporating biomarkers and cfDNA testing. © 2013 S. Karger AG, Basel.

  15. [Lung cancer molecular testing, what role for Next Generation Sequencing and circulating tumor DNA].

    Science.gov (United States)

    Pécuchet, Nicolas; Legras, Antoine; Laurent-Puig, Pierre; Blons, Hélène

    2016-01-01

    Molecular screening has become a standard of care for patients with advanced cancers and impacts on how to treat a patient. Advances in genomic technologies with the development of high throughput sequencing methods will certainly improve the possibilities to access a more accurate molecular diagnosis and to go beyond the identification of validated targets as a large number of genes can be screened for actionable changes. Moreover, accurate high throughput testing may help tumor classification in terms of prognosis and drug sensitivity. Finally, it will be possible to assess tumor heterogeneity and changes in molecular profiles during follow-up using ultra-deep sequencing technologies and circulating tumor DNA characterization. The accumulation of somatic ADN alterations is considered as the main contributing factor in carcinogenesis. The alterations can occur at different levels: mutation, copy number variations or gene translocations resulting in altered expression of the corresponding genes or impaired protein functions. Genes involved are mainly tumor suppressors, oncogenes or ADN repair genes whose modifications in tumors will impinge cell fate and proliferation from tumor initiation to metastasis. The entire genome of various tumor types, have now been sequenced. In lung cancer, the average number of mutations is very high with more than 8.9 mutations/Mb (Network TCGAR, 2014) that is to say more than 10,000 mutations/genome. These alterations need to be classified, indeed, some are true drivers that directly impact proliferation and some are passenger mutations linked to genetic instability. The development of targeted therapies relies on the identification of oncogenic drivers. The identification of genotype-phenotype associations as in the case of EGFR-TKI (Epidermal growth factor receptor-tyrosine kinase inhibitor) and EGFR mutations in lung cancer led to the restriction of drugs to patients for which tumor genotype predicts efficacy. Tumor

  16. An integrated system of ABO typing and multiplex STR testing for forensic DNA analysis.

    Science.gov (United States)

    Jiang, Xianhua; He, Juan; Jia, Fei; Shen, Hongying; Zhao, Jinling; Chen, Chuguang; Bai, Liping; Liu, Feng; Hou, Guangwei; Guo, Faye

    2012-12-01

    A new amplification system for ABO and STR genotyping in a single reaction has been successfully developed. Two types of information can be obtained from a biological sample at one time. One is the classical information of ABO blood group typing for screening suspects and the other is STR information for individual identification. The system allows for the simultaneous detection of 15 autosomal STR loci (containing all CODIS STR loci as well as Penta D and Penta E), six ABO genotypes (O/O, B/B, A/A, A/O, A/B, and B/O) and the gender-determining locus Amelogenin. Primers are designed so that the amplicons are distributed ranging from 75bp to 500bp within a four-dye fluorescent design, leaving a fourth dye for the internal size standard. With 30 cycles, the results showed that the optimal amount of DNA template for this multiplex ranges from 250pg to 2ng and the lowest detection threshold is 125pg (as low as 63pg for ABO loci). For the DNA template outside the optimal detection range, we could adjust the number of cycles to obtain the robust profiles. Mixture studies showed that over 83% of minor alleles were detected at 1:9 ratios. The full profiles were still observed when 4ng of degraded DNA was digested by DNase I and 1ng undegraded DNA was added to 40μM haematin. Polymerase chain reaction (PCR)-based conditions including the concentrations of primers, magnesium and the Taq polymerase as well as volume, cycle numbers and annealing temperature were examined and optimised. In addition, the system was validated by 364 bloodstain samples and 32 common casework samples. According to the Chinese National Standards and Scientific Working Group on DNA Analysis Methods (SWGDAM) guidelines, our system demonstrates good detection performance and is an ideal tool for forensic DNA typing with potential application.

  17. Cost-Effectiveness Analysis of Different Testing Strategies that Use Antibody Levels to Detect Chronic Hepatitis C in Blood Donors.

    Science.gov (United States)

    Granados-García, Víctor; Contreras, Ana M; García-Peña, Carmen; Salinas-Escudero, Guillermo; Thein, Hla-Hla; Flores, Yvonne N

    2016-01-01

    We conducted a cost-effectiveness analysis of seven hepatitis C virus (HCV) testing strategies in blood donors. Three of the seven strategies were based on HCV diagnosis and reporting guidelines in Mexico and four were from previous and current recommendations outlined by the CDC. The strategies that were evaluated determine antibody levels according to the signal-to-cut-off (S/CO) ratio and use reflex Immunoblot (IMB) or HCV RNA tests to confirm true positive (TP) cases of chronic HCV infection. Costs were calculated from the perspective of the Mexican Institute of Social Security (IMSS). A decision tree model was developed to estimate the expected number of true positive cases and costs for the base-case scenarios and for the sensitivity analyses. Base-case findings indicate an extended dominance of the CDC-USA2 and CDC-USA4 options by the IMSS Mexico3 and IMSS-Mexico1 alternatives. The probabilistic sensitivity analyses results suggest that for a willingness-to-pay (WTP) range of $0-9,000 USD the IMSS-Mexico1 strategy is the most cost-effective of all strategies ($5,000 USD per TP). The IMSS-Mexico3, IMSS-Mexico2, and CDC-USA3 strategies are also cost-effective strategies that cost between $7,800 and $8,800 USD per TP case detected. The CDC-USA1 strategy was very expensive and not cost-effective. HCV antibody testing strategies based on the classification of two or three levels of the S/CO are cost-effective procedures to identify patients who require reflex IMB or HCV RNA testing to confirm chronic HCV infection.

  18. Cost-Effectiveness Analysis of Different Testing Strategies that Use Antibody Levels to Detect Chronic Hepatitis C in Blood Donors

    Science.gov (United States)

    Granados-García, Víctor; Contreras, Ana M.; García-Peña, Carmen; Salinas-Escudero, Guillermo; Thein, Hla-Hla; Flores, Yvonne N.

    2016-01-01

    Aim. We conducted a cost-effectiveness analysis of seven hepatitis C virus (HCV) testing strategies in blood donors. Methods. Three of the seven strategies were based on HCV diagnosis and reporting guidelines in Mexico and four were from previous and current recommendations outlined by the CDC. The strategies that were evaluated determine antibody levels according to the signal-to-cut-off (S/CO) ratio and use reflex Immunoblot (IMB) or HCV RNA tests to confirm true positive (TP) cases of chronic HCV infection. Costs were calculated from the perspective of the Mexican Institute of Social Security (IMSS). A decision tree model was developed to estimate the expected number of true positive cases and costs for the base-case scenarios and for the sensitivity analyses. Results. Base-case findings indicate an extended dominance of the CDC-USA2 and CDC-USA4 options by the IMSS Mexico3 and IMSS-Mexico1 alternatives. The probabilistic sensitivity analyses results suggest that for a willingness-to-pay (WTP) range of $0–9,000 USD the IMSS-Mexico1 strategy is the most cost-effective of all strategies ($5,000 USD per TP). The IMSS-Mexico3, IMSS-Mexico2, and CDC-USA3 strategies are also cost-effective strategies that cost between $7,800 and $8,800 USD per TP case detected. The CDC-USA1 strategy was very expensive and not cost-effective. Conclusions. HCV antibody testing strategies based on the classification of two or three levels of the S/CO are cost-effective procedures to identify patients who require reflex IMB or HCV RNA testing to confirm chronic HCV infection. PMID:27159320

  19. Next generation testing strategy for assessment of genomic damage: A conceptual framework and considerations.

    Science.gov (United States)

    Dearfield, Kerry L; Gollapudi, B Bhaskar; Bemis, Jeffrey C; Benz, R Daniel; Douglas, George R; Elespuru, Rosalie K; Johnson, George E; Kirkland, David J; LeBaron, Matthew J; Li, Albert P; Marchetti, Francesco; Pottenger, Lynn H; Rorije, Emiel; Tanir, Jennifer Y; Thybaud, Veronique; van Benthem, Jan; Yauk, Carole L; Zeiger, Errol; Luijten, Mirjam

    2016-09-21

    For several decades, regulatory testing schemes for genetic damage have been standardized where the tests being utilized examined mutations and structural and numerical chromosomal damage. This has served the genetic toxicity community well when most of the substances being tested were amenable to such assays. The outcome from this testing is usually a dichotomous (yes/no) evaluation of test results, and in many instances, the information is only used to determine whether a substance has carcinogenic potential or not. Over the same time period, mechanisms and modes of action (MOAs) that elucidate a wider range of genomic damage involved in many adverse health outcomes have been recognized. In addition, a paradigm shift in applied genetic toxicology is moving the field toward a more quantitative dose-response analysis and point-of-departure (PoD) determination with a focus on risks to exposed humans. This is directing emphasis on genomic damage that is likely to induce changes associated with a variety of adverse health outcomes. This paradigm shift is moving the testing emphasis for genetic damage from a hazard identification only evaluation to a more comprehensive risk assessment approach that provides more insightful information for decision makers regarding the potential risk of genetic damage to exposed humans. To enable this broader context for examining genetic damage, a next generation testing strategy needs to take into account a broader, more flexible approach to testing, and ultimately modeling, of genomic damage as it relates to human exposure. This is consistent with the larger risk assessment context being used in regulatory decision making. As presented here, this flexible approach for examining genomic damage focuses on testing for relevant genomic effects that can be, as best as possible, associated with an adverse health effect. The most desired linkage for risk to humans would be changes in loci associated with human diseases, whether in somatic

  20. The Study of Lung Cancer Personalized Medicine Through Circulating Cell Free DNA Test

    DEFF Research Database (Denmark)

    Ye, Mingzhi

    , and finally to search a better way of early diagnosis for lung cancer prevention. The study of the first large-scale sequencing effort on lung adenocarcinoma in Asian patients provides a comprehensive mutational landscape for both primary and metastatic tumours. This may thus form a basis for personalized...... mutation and clonal expansion in human blood was prevalent in cancer patients and cf-DNA somatic mutation seems to be ideal cancer early diagnosis biomarkers due to its advantages. By using cell-free tumor DNA and peripheral nodule ultra-deep sequencing (>10,000 fold), mutations from nodule tissues had...

  1. Development of Probabilistic Life Prediction Methodologies and Testing Strategies for MEMS

    Science.gov (United States)

    Jadaan, Osama M.

    2003-01-01

    This effort is to investigate probabilistic life prediction methodologies for MicroElectroMechanical Systems (MEMS) and to analyze designs that determine stochastic properties of MEMS. This includes completion of a literature survey regarding Weibull size effect in MEMS and strength testing techniques. Also of interest is the design of a proper test for the Weibull size effect in tensile specimens. The Weibull size effect is a consequence of a stochastic strength response predicted from the Weibull distribution. Confirming that MEMS strength is controlled by the Weibull distribution will enable the development of a probabilistic design methodology for MEMS - similar to the GRC developed CARES/Life program for bulk ceramics. Another potential item of interest is analysis and modeling of material interfaces for strength as well as developing a strategy to handle stress singularities at sharp corners, filets, and material interfaces. The ultimate objective of this effort is to further develop and verify the ability of the Ceramics Analysis and Reliability Evaluation of Structuredlife (CARES/Life) code to predict the time-dependent reliability of MEMS structures subjected to multiple transient loads. Along these lines work may also be performed on transient fatigue life prediction methodologies.

  2. Concordance study between the ParaDNA® Intelligence Test, a rapid DNA profiling assay, and a conventional STR typing kit (AmpFlSTR® SGM Plus®).

    Science.gov (United States)

    Ball, G; Dawnay, N; Stafford-Allen, B; Panasiuk, M; Rendell, P; Blackman, S; Duxbury, N; Wells, S

    2015-05-01

    The ParaDNA® Intelligence Test enables STR profiling directly from human biological samples and evidence items collected from crime scene in 75min. Designed for non-expert use this system allows DNA information to be available to investigators before it would typically be available from a laboratory. The ParaDNA Intelligence Test system amplifies D3S1358, D8S119, D16S539, D18S1358 and TH01 STR loci and the gender typing locus amelogenin and detects the alleles present with HyBeacon® probes. Individual DNA samples from 381 UK Caucasian individuals were analysed using AmpFlSTR® SGM Plus® and the ParaDNA Intelligence Test with the derived STR profiles compared. Here we describe the high level of concordance demonstrated between the two systems and discuss this with reference to allele frequencies and the discriminatory power offered by the ParaDNA Intelligence Test.

  3. Long span DNA paired-end-tag (DNA-PET sequencing strategy for the interrogation of genomic structural mutations and fusion-point-guided reconstruction of amplicons.

    Directory of Open Access Journals (Sweden)

    Fei Yao

    Full Text Available Structural variations (SVs contribute significantly to the variability of the human genome and extensive genomic rearrangements are a hallmark of cancer. While genomic DNA paired-end-tag (DNA-PET sequencing is an attractive approach to identify genomic SVs, the current application of PET sequencing with short insert size DNA can be insufficient for the comprehensive mapping of SVs in low complexity and repeat-rich genomic regions. We employed a recently developed procedure to generate PET sequencing data using large DNA inserts of 10-20 kb and compared their characteristics with short insert (1 kb libraries for their ability to identify SVs. Our results suggest that although short insert libraries bear an advantage in identifying small deletions, they do not provide significantly better breakpoint resolution. In contrast, large inserts are superior to short inserts in providing higher physical genome coverage for the same sequencing cost and achieve greater sensitivity, in practice, for the identification of several classes of SVs, such as copy number neutral and complex events. Furthermore, our results confirm that large insert libraries allow for the identification of SVs within repetitive sequences, which cannot be spanned by short inserts. This provides a key advantage in studying rearrangements in cancer, and we show how it can be used in a fusion-point-guided-concatenation algorithm to study focally amplified regions in cancer.

  4. Use of genotoxicity information in the development of integrated testing strategies (ITS) for skin sensitization.

    Science.gov (United States)

    Mekenyan, Ovanes; Patlewicz, Grace; Dimitrova, Gergana; Kuseva, Chanita; Todorov, Milen; Stoeva, Stoyanka; Kotov, Stefan; Donner, E Maria

    2010-10-18

    Skin sensitization is an end point of concern for various legislation in the EU, including the seventh Amendment to the Cosmetics Directive and Registration Evaluation, Authorisation and Restriction of Chemicals (REACH). Since animal testing is a last resort for REACH or banned (from 2013 onward) for the Cosmetics Directive, the use of intelligent/integrated testing strategies (ITS) as an efficient means of gathering necessary information from alternative sources (e.g., in vitro, (Q)SARs, etc.) is gaining widespread interest. Previous studies have explored correlations between mutagenicity data and skin sensitization data as a means of exploiting information from surrogate end points. The work here compares the underlying chemical mechanisms for mutagenicity and skin sensitization in an effort to evaluate the role mutagenicity information can play as a predictor of skin sensitization potential. The Tissue Metabolism Simulator (TIMES) hybrid expert system was used to compare chemical mechanisms of both end points since it houses a comprehensive set of established structure-activity relationships for both skin sensitization and mutagenicity. The evaluation demonstrated that there is a great deal of overlap between skin sensitization and mutagenicity structural alerts and their underlying chemical mechanisms. The similarities and differences in chemical mechanisms are discussed in light of available experimental data. A number of new alerts for mutagenicity were also postulated for inclusion into TIMES. The results presented show that mutagenicity information can provide useful insights on skin sensitization potential as part of an ITS and should be considered prior to any in vivo skin sensitization testing being initiated.

  5. A multi-stakeholder perspective on the use of alternative test strategies for nanomaterial safety assessment.

    Science.gov (United States)

    Nel, Andre E; Nasser, Elina; Godwin, Hilary; Avery, David; Bahadori, Tina; Bergeson, Lynn; Beryt, Elizabeth; Bonner, James C; Boverhof, Darrell; Carter, Janet; Castranova, Vince; Deshazo, J R; Hussain, Saber M; Kane, Agnes B; Klaessig, Frederick; Kuempel, Eileen; Lafranconi, Mark; Landsiedel, Robert; Malloy, Timothy; Miller, Mary Beth; Morris, Jeffery; Moss, Kenneth; Oberdorster, Gunter; Pinkerton, Kent; Pleus, Richard C; Shatkin, Jo Anne; Thomas, Russell; Tolaymat, Thabet; Wang, Amy; Wong, Jeffrey

    2013-08-27

    There has been a conceptual shift in toxicological studies from describing what happens to explaining how the adverse outcome occurs, thereby enabling a deeper and improved understanding of how biomolecular and mechanistic profiling can inform hazard identification and improve risk assessment. Compared to traditional toxicology methods, which have a heavy reliance on animals, new approaches to generate toxicological data are becoming available for the safety assessment of chemicals, including high-throughput and high-content screening (HTS, HCS). With the emergence of nanotechnology, the exponential increase in the total number of engineered nanomaterials (ENMs) in research, development, and commercialization requires a robust scientific approach to screen ENM safety in humans and the environment rapidly and efficiently. Spurred by the developments in chemical testing, a promising new toxicological paradigm for ENMs is to use alternative test strategies (ATS), which reduce reliance on animal testing through the use of in vitro and in silico methods such as HTS, HCS, and computational modeling. Furthermore, this allows for the comparative analysis of large numbers of ENMs simultaneously and for hazard assessment at various stages of the product development process and overall life cycle. Using carbon nanotubes as a case study, a workshop bringing together national and international leaders from government, industry, and academia was convened at the University of California, Los Angeles, to discuss the utility of ATS for decision-making analyses of ENMs. After lively discussions, a short list of generally shared viewpoints on this topic was generated, including a general view that ATS approaches for ENMs can significantly benefit chemical safety analysis.

  6. Invasive Candidiasis in Various Patient Populations: Incorporating Non-Culture Diagnostic Tests into Rational Management Strategies

    Directory of Open Access Journals (Sweden)

    Cornelius J. Clancy

    2016-02-01

    Full Text Available Mortality rates due to invasive candidiasis remain unacceptably high, in part because the poor sensitivity and slow turn-around time of cultures delay the initiation of antifungal treatment. β-d-glucan (Fungitell and polymerase chain reaction (PCR-based (T2Candida assays are FDA-approved adjuncts to cultures for diagnosing invasive candidiasis, but their clinical roles are unclear. We propose a Bayesian framework for interpreting non-culture test results and developing rational patient management strategies, which considers test performance and types of invasive candidiasis that are most common in various patient populations. β-d-glucan sensitivity/specificity for candidemia and intra-abdominal candidiasis is ~80%/80% and ~60%/75%, respectively. In settings with 1%–10% likelihood of candidemia, anticipated β-d-glucan positive and negative predictive values are ~4%–31% and ≥97%, respectively. Corresponding values in settings with 3%–30% likelihood of intra-abdominal candidiasis are ~7%–51% and ~78%–98%. β-d-glucan is predicted to be useful in guiding antifungal treatment for wide ranges of populations at-risk for candidemia (incidence ~5%–40% or intra-abdominal candidiasis (~7%–20%. Validated PCR-based assays should broaden windows to include populations at lower-risk for candidemia (incidence ≥~2% and higher-risk for intra-abdominal candidiasis (up to ~40%. In the management of individual patients, non-culture tests may also have value outside of these windows. The proposals we put forth are not definitive treatment guidelines, but rather represent starting points for clinical trial design and debate by the infectious diseases community. The principles presented here will be applicable to other assays as they enter the clinic, and to existing assays as more data become available from different populations.

  7. A Multi-Stakeholder Perspective on the Use of Alternative Test Strategies for Nanomaterial Safety Assessment

    Science.gov (United States)

    Nel, Andre E.; Nasser, Elina; Godwin, Hilary; Avery, David; Bahadori, Tina; Bergeson, Lynn; Beryt, Elizabeth; Bonner, James C.; Boverhof, Darrell; Carter, Janet; Castranova, Vince; DeShazo, J. R.; Hussain, Saber M.; Kane, Agnes B.; Klaessig, Fred; Kuempel, Eileen; Lafranconi, Mark; Landsiedel, Robert; Malloy, Timothy; Miller, Mary Beth; Morris, Jeffery; Moss, Kenneth; Oberdorster, Gunter; Pinkerton, Kent; Pleus, Richard C.; Shatkin, Jo Anne; Thomas, Rusty; Tolaymat, Thabet; Wang, Amy; Wong, Jeffrey

    2014-01-01

    There has been a conceptual shift in toxicological studies from describing what happens to explaining how the adverse outcome occurs, thereby enabling a deeper and improved understanding of how biomolecular and mechanistic profiling can inform hazard identification and improve risk assessment. Compared to traditional toxicology methods, which have a heavy reliance on animals, new approaches to generate toxicological data are becoming available for the safety assessment of chemicals, including high-throughput and high-content screening (HTS, HCS). With the emergence of nanotechnology, the exponential increase in the total number of engineered nanomaterials (ENMs) in research, development, and commercialization requires a robust scientific approach to screen ENM safety in humans and the environment rapidly and efficiently. Spurred by the developments in chemical testing, a promising new toxicological paradigm for ENMs is to use alternative test strategies (ATS), which reduce reliance on animal testing through the use of in vitro and in silico methods such as HTS, HCS, and computational modeling. Furthermore, this allows for the comparative analysis of large numbers of ENMs simultaneously and for hazard assessment at various stages of the product development process and overall life cycle. Using carbon nanotubes as a case study, a workshop bringing together national and international leaders from government, industry, and academia was convened at the University of California, Los Angeles to discuss the utility of ATS for decision-making analyses of ENMs. After lively discussions, a short list of generally shared viewpoints on this topic was generated, including a general view that ATS approaches for ENMs can significantly benefit chemical safety analysis. PMID:23924032

  8. Data from complete mtDNA sequencing of Tunisian centenarians: testing haplogroup association and the "golden mean" to longevity.

    Science.gov (United States)

    Costa, Marta D; Cherni, Lotfi; Fernandes, Verónica; Freitas, Fernando; Ammar El Gaaied, Amel Ben; Pereira, Luísa

    2009-04-01

    Since the mitochondrial theory of ageing was proposed, mitochondrial DNA (mtDNA) diversity has been largely studied in old people, however complete genomes are still rare, being limited to Japanese and UK/US samples. In this work, we evaluated possible longevity associated polymorphisms/haplogroups in an African population, from Tunisia, by performing complete mtDNA sequencing. This population has a mixed Eurasian/sub-Saharan mtDNA gene pool, which could potentially facilitate the evaluation of association for sub-Saharan lineages. Sub-Saharan haplogroups were shown to be significantly less represented in centenarians (9.5%) than in controls (54.5%), but it is not possible to rule out an influence of population structure, which is high in these populations. No recurrent polymorphism were more frequent in centenarians than in controls, and although the Tunisian centenarians presented less synonymous and replacement polymorphisms than controls, this difference was not statistically significant. So far, it does not seem that centenarians have significantly less mildly deleterious substitutions, not only in Tunisia but also in Japanese and UK/US samples, as tested here, not favouring a "golden mean" to longevity.

  9. Testing the effectiveness of simplified search strategies for updating systematic reviews.

    Science.gov (United States)

    Rice, Maureen; Ali, Muhammad Usman; Fitzpatrick-Lewis, Donna; Kenny, Meghan; Raina, Parminder; Sherifali, Diana

    2017-08-01

    The objective of the study was to test the overall effectiveness of a simplified search strategy (SSS) for updating systematic reviews. We identified nine systematic reviews undertaken by our research group for which both comprehensive and SSS updates were performed. Three relevant performance measures were estimated, that is, sensitivity, precision, and number needed to read (NNR). The update reference searches for all nine included systematic reviews identified a total of 55,099 citations that were screened resulting in final inclusion of 163 randomized controlled trials. As compared with reference search, the SSS resulted in 8,239 hits and had a median sensitivity of 83.3%, while precision and NNR were 4.5 times better. During analysis, we found that the SSS performed better for clinically focused topics, with a median sensitivity of 100% and precision and NNR 6 times better than for the reference searches. For broader topics, the sensitivity of the SSS was 80% while precision and NNR were 5.4 times better compared with reference search. SSS performed well for clinically focused topics and, with a median sensitivity of 100%, could be a viable alternative to a conventional comprehensive search strategy for updating this type of systematic reviews particularly considering the budget constraints and the volume of new literature being published. For broader topics, 80% sensitivity is likely to be considered too low for a systematic review update in most cases, although it might be acceptable if updating a scoping or rapid review. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Strategy Use for Reading English for General and Specific Academic Purposes in Testing and Nontesting Contexts

    Science.gov (United States)

    Chou, Mu-hsuan

    2013-01-01

    Language-use strategies are considered potentially effective approaches that learners select to accomplish a second- or foreign-language task. In the past three decades, there has been a proliferation of research concerned with learners' strategy use at different levels of language ability and the influence of L1 learner strategies on L2 language…

  11. RNA and DNA bacteriophages as molecular diagnosis controls in clinical virology: a comprehensive study of more than 45,000 routine PCR tests.

    Directory of Open Access Journals (Sweden)

    Laetitia Ninove

    Full Text Available Real-time PCR techniques are now commonly used for the detection of viral genomes in various human specimens and require for validation both external and internal controls (ECs and ICs. In particular, ICs added to clinical samples are necessary to monitor the extraction, reverse transcription, and amplification steps in order to detect false-negative results resulting from PCR-inhibition or errors in the technical procedure. Here, we performed a large scale evaluation of the use of bacteriophages as ICs in routine molecular diagnosis. This allowed to propose simple standardized procedures (i to design specific ECs for both DNA and RNA viruses and (ii to use T4 (DNA or MS2 (RNA phages as ICs in routine diagnosis. Various technical formats for using phages as ICs were optimised and validated. Subsequently, T4 and MS2 ICs were evaluated in routine real-time PCR or RT-PCR virological diagnostic tests, using a series of 8,950 clinical samples (representing 36 distinct specimen types sent to our laboratory for the detection of a variety of DNA and RNA viruses. The frequency of inefficient detection of ICs was analyzed according to the nature of the sample. Inhibitors of enzymatic reactions were detected at high frequency in specific sample types such as heparinized blood and bone marrow (>70%, broncho-alveolar liquid (41% and stools (36%. The use of T4 and MS2 phages as ICs proved to be cost-effective, flexible and adaptable to various technical procedures of real-time PCR detection in virology. It represents a valuable strategy for enhancing the quality of routine molecular diagnosis in laboratories that use in-house designed diagnostic systems, which can conveniently be associated to the use of specific synthetic ECs. The high rate of inhibitors observed in a variety of specimen types should stimulate the elaboration of improved technical protocols for the extraction and amplification of nucleic acids.

  12. RNA and DNA bacteriophages as molecular diagnosis controls in clinical virology: a comprehensive study of more than 45,000 routine PCR tests.

    Science.gov (United States)

    Ninove, Laetitia; Nougairede, Antoine; Gazin, Celine; Thirion, Laurence; Delogu, Ilenia; Zandotti, Christine; Charrel, Remi N; De Lamballerie, Xavier

    2011-02-09

    Real-time PCR techniques are now commonly used for the detection of viral genomes in various human specimens and require for validation both external and internal controls (ECs and ICs). In particular, ICs added to clinical samples are necessary to monitor the extraction, reverse transcription, and amplification steps in order to detect false-negative results resulting from PCR-inhibition or errors in the technical procedure. Here, we performed a large scale evaluation of the use of bacteriophages as ICs in routine molecular diagnosis. This allowed to propose simple standardized procedures (i) to design specific ECs for both DNA and RNA viruses and (ii) to use T4 (DNA) or MS2 (RNA) phages as ICs in routine diagnosis. Various technical formats for using phages as ICs were optimised and validated. Subsequently, T4 and MS2 ICs were evaluated in routine real-time PCR or RT-PCR virological diagnostic tests, using a series of 8,950 clinical samples (representing 36 distinct specimen types) sent to our laboratory for the detection of a variety of DNA and RNA viruses. The frequency of inefficient detection of ICs was analyzed according to the nature of the sample. Inhibitors of enzymatic reactions were detected at high frequency in specific sample types such as heparinized blood and bone marrow (>70%), broncho-alveolar liquid (41%) and stools (36%). The use of T4 and MS2 phages as ICs proved to be cost-effective, flexible and adaptable to various technical procedures of real-time PCR detection in virology. It represents a valuable strategy for enhancing the quality of routine molecular diagnosis in laboratories that use in-house designed diagnostic systems, which can conveniently be associated to the use of specific synthetic ECs. The high rate of inhibitors observed in a variety of specimen types should stimulate the elaboration of improved technical protocols for the extraction and amplification of nucleic acids.

  13. Test MaxEnt in Social Strategy Transitions with Experimental Two-Person Constant Sum 2$\\times$2 Games

    CERN Document Server

    Xu, Bin

    2012-01-01

    By using laboratory experimental data, we test the uncertainty of social strategy transitions in various competing environments of fixed paired two-person constant sum $2 \\times 2$ games. It firstly shows that, the distributions of social strategy transitions are not erratic but obey the principle of the maximum entropy (MaxEnt). This finding indicates that human subject social systems and natural systems could have wider common backgrounds.

  14. Assessing the impact of next-generation rapid diagnostic tests on Plasmodium falciparum malaria elimination strategies.

    Science.gov (United States)

    Slater, Hannah C; Ross, Amanda; Ouédraogo, André Lin; White, Lisa J; Nguon, Chea; Walker, Patrick G T; Ngor, Pengby; Aguas, Ricardo; Silal, Sheetal P; Dondorp, Arjen M; La Barre, Paul; Burton, Robert; Sauerwein, Robert W; Drakeley, Chris; Smith, Thomas A; Bousema, Teun; Ghani, Azra C

    2015-12-03

    Mass-screen-and-treat and targeted mass-drug-administration strategies are being considered as a means to interrupt transmission of Plasmodium falciparum malaria. However, the effectiveness of such strategies will depend on the extent to which current and future diagnostics are able to detect those individuals who are infectious to mosquitoes. We estimate the relationship between parasite density and onward infectivity using sensitive quantitative parasite diagnostics and mosquito feeding assays from Burkina Faso. We find that a diagnostic with a lower detection limit of 200 parasites per microlitre would detect 55% of the infectious reservoir (the combined infectivity to mosquitoes of the whole population weighted by how often each individual is bitten) whereas a test with a limit of 20 parasites per microlitre would detect 83% and 2 parasites per microlitre would detect 95% of the infectious reservoir. Using mathematical models, we show that increasing the diagnostic sensitivity from 200 parasites per microlitre (equivalent to microscopy or current rapid diagnostic tests) to 2 parasites per microlitre would increase the number of regions where transmission could be interrupted with a mass-screen-and-treat programme from an entomological inoculation rate below 1 to one of up to 4. The higher sensitivity diagnostic could reduce the number of treatment rounds required to interrupt transmission in areas of lower prevalence. We predict that mass-screen-and-treat with a highly sensitive diagnostic is less effective than mass drug administration owing to the prophylactic protection provided to uninfected individuals by the latter approach. In low-transmission settings such as those in Southeast Asia, we find that a diagnostic tool with a sensitivity of 20 parasites per microlitre may be sufficient for targeted mass drug administration because this diagnostic is predicted to identify a similar village population prevalence compared with that currently detected using

  15. A study on the depression levels of children who are brought to the forensic DNA laboratory for paternity testing.

    Science.gov (United States)

    Akduman, Gülümser Gültekin

    2012-01-01

    This study aims to identify the depression levels of children who were brought to the forensic DNA laboratory for paternity testing. A total of 35 such children were enrolled in the study. Data were gathered using the parent interview form, general information form for children, and the "Child Depression Scale" as it had been tested for validity and reliability in the 6-17 year age group in the country. Data were analyzed using one-way analysis of variance and Scheffe test. The results showed that the age of children who were brought in for paternity testing created a meaningful difference in their depression scores (p < 0.01) while gender did not. In addition, c. 63% of the children in this study did not know why they were in the laboratory, which also caused a meaningful difference in depression scores (p < 0.01).

  16. Informed decision making about predictive DNA tests: arguments for more public visibility of personal deliberations about the good life.

    Science.gov (United States)

    Boenink, Marianne; van der Burg, Simone

    2010-05-01

    Since its advent, predictive DNA testing has been perceived as a technology that may have considerable impact on the quality of people's life. The decision whether or not to use this technology is up to the individual client. However, to enable well considered decision making both the negative as well as the positive freedom of the individual should be supported. In this paper, we argue that current professional and public discourse on predictive DNA-testing is lacking when it comes to supporting positive freedom, because it is usually framed in terms of risk and risk management. We show how this 'risk discourse' steers thinking on the good life in a particular way. We go on to argue that empirical research into the actual deliberation and decision making processes of individuals and families may be used to enrich the environment of personal deliberation in three ways: (1) it points at a richer set of values that deliberators can take into account, (2) it acknowledges the shared nature of genes, and (3) it shows how one might frame decisions in a non-binary way. We argue that the public sharing and discussing of stories about personal deliberations offers valuable input for others who face similar choices: it fosters their positive freedom to shape their view of the good life in relation to DNA-diagnostics. We conclude by offering some suggestions as to how to realize such public sharing of personal stories.

  17. Target-induced formation of gold amalgamation on DNA-based sensing platform for electrochemical monitoring of mercury ion coupling with cycling signal amplification strategy

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Jinfeng; Tang, Juan; Zhou, Jun; Zhang, Lan; Chen, Guonan; Tang, Dianping, E-mail: dianping.tang@fzu.edu.cn

    2014-01-31

    Graphical abstract: -- Highlights: •We report a new electrochemical sensing protocol for the detection of mercury ion. •Gold amalgamation on DNA-based sensing platform was used as nanocatalyst. •The signal was amplified by cycling signal amplification strategy. -- Abstract: Heavy metal ion pollution poses severe risks in human health and environmental pollutant, because of the likelihood of bioaccumulation and toxicity. Driven by the requirement to monitor trace-level mercury ion (Hg{sup 2+}), herein we construct a new DNA-based sensor for sensitive electrochemical monitoring of Hg{sup 2+} by coupling target-induced formation of gold amalgamation on DNA-based sensing platform with gold amalgamation-catalyzed cycling signal amplification strategy. The sensor was simply prepared by covalent conjugation of aminated poly-T{sub (25)} oligonucleotide onto the glassy carbon electrode by typical carbodiimide coupling. Upon introduction of target analyte, Hg{sup 2+} ion was intercalated into the DNA polyion complex membrane based on T–Hg{sup 2+}–T coordination chemistry. The chelated Hg{sup 2+} ion could induce the formation of gold amalgamation, which could catalyze the p-nitrophenol with the aid of NaBH{sub 4} and Ru(NH{sub 3}){sub 6}{sup 3+} for cycling signal amplification. Experimental results indicated that the electronic signal of our system increased with the increasing Hg{sup 2+} level in the sample, and has a detection limit of 0.02 nM with a dynamic range of up to 1000 nM Hg{sup 2+}. The strategy afforded exquisite selectivity for Hg{sup 2+} against other environmentally related metal ions. In addition, the methodology was evaluated for the analysis of Hg{sup 2+} in spiked tap-water samples, and the recovery was 87.9–113.8%.

  18. Efficacy of antibiotic treatment and test-based culling strategies for eradicating brucellosis in commercial swine herds.

    Science.gov (United States)

    Dieste-Pérez, L; Frankena, K; Blasco, J M; Muñoz, P M; de Jong, M C M

    2016-04-01

    Swine brucellosis caused by Brucella suis biovar 2 is an emerging disease in continental Europe. Without effective vaccines being available, the European Food Safety Authority (EFSA) recommends the full depopulation of infected herds as the only strategy to eradicate B. suis outbreaks. Using data collected from 8 herds suffering natural swine brucellosis outbreaks, we assessed the efficacy of four control strategies: (i) oxytetracycline treatment only, as a default scenario, (ii) oxytetracycline treatment combined with skin testing and removal of positive animals, (iii) oxytetracycline treatment combined with serological testing (Rose Bengal test-RBT-and indirect ELISA -iELISA-) and removal of seropositive animals and (iv) oxytetracycline treatment combined with both serological (RBT/iELISA) and skin testing and removal of positive animals. A Susceptible-Infectious-Removal model was used to estimate the reproduction ratio (R) for each strategy. According to this model, the oxytetracycline treatment alone was not effective enough to eradicate the infection. However, this antibiotic treatment combined with diagnostic testing at 4-monthly intervals plus immediate removal of positive animals showed to be effective to eradicate brucellosis independent of the diagnostic test strategy used in an acceptable time interval (1-2 years), depending on the initial number of infected animals.

  19. Buffy coat specimens remain viable as a DNA source for highly multiplexed genome-wide genetic tests after long term storage

    Directory of Open Access Journals (Sweden)

    Bowden Donald W

    2011-06-01

    Full Text Available Abstract Background Blood specimen collection at an early study visit is often included in observational studies or clinical trials for analysis of secondary outcome biomarkers. A common protocol is to store buffy coat specimens for future DNA isolation and these may remain in frozen storage for many years. It is uncertain if the DNA remains suitable for modern genome wide association (GWA genotyping. Methods We isolated DNA from 120 Action to Control Cardiovascular Risk in Diabetes (ACCORD clinical trial buffy coats sampling a range of storage times up to 9 years and other factors that could influence DNA yield. We performed TaqMan SNP and GWA genotyping to test whether the DNA retained integrity for high quality genetic analysis. Results We tested two QIAGEN automated protocols for DNA isolation, preferring the Compromised Blood Protocol despite similar yields. We isolated DNA from all 120 specimens (yield range 1.1-312 ug per 8.5 ml ACD tube of whole blood with only 3/120 samples yielding Conclusions When collected as a long term clinical trial or biobank specimen for DNA, buffy coats can be stored for up to 9 years in a -80degC frozen state and still produce high yields of DNA suitable for GWA analysis and other genetic testing. Trial Registration The Action to Control Cardiovascular Risk in Diabetes (ACCORD trial is registered with ClinicalTrials.gov, number NCT00000620.

  20. Developmental Validation of the ParaDNA® Screening System - A presumptive test for the detection of DNA on forensic evidence items.

    Science.gov (United States)

    Dawnay, Nick; Stafford-Allen, Beccy; Moore, Dave; Blackman, Stephen; Rendell, Paul; Hanson, Erin K; Ballantyne, Jack; Kallifatidis, Beatrice; Mendel, Julian; Mills, DeEtta K; Nagy, Randy; Wells, Simon

    2014-07-01

    Current assessment of whether a forensic evidence item should be submitted for STR profiling is largely based on the personal experience of the Crime Scene Investigator (CSI) and the submissions policy of the law enforcement authority involved. While there are chemical tests that can infer the presence of DNA through the detection of biological stains, the process remains mostly subjective and leads to many samples being submitted that give no profile or not being submitted although DNA is present. The ParaDNA(®) Screening System was developed to address this issue. It consists of a sampling device, pre-loaded reaction plates and detection instrument. The test uses direct PCR with fluorescent HyBeacon™ detection of PCR amplicons to identify the presence and relative amount of DNA on an evidence item and also provides a gender identification result in approximately 75 minutes. This simple-to-use design allows objective data to be acquired by both DNA analyst and non-specialist personnel, to enable a more informed submission decision to be made. The developmental validation study described here tested the sensitivity, reproducibility, accuracy, inhibitor tolerance, and performance of the ParaDNA Screening System on a range of mock evidence items. The data collected demonstrates that the ParaDNA Screening System identifies the presence of DNA on a variety of evidence items including blood, saliva and touch DNA items. Copyright © 2014 The Authors. Published by Elsevier Ireland Ltd.. All rights reserved.

  1. Fluorescent studies on the interaction of DNA and ternary lanthanide complexes with cinnamic acid-phenanthroline and antibacterial activities testing.

    Science.gov (United States)

    Sun, Hui-Juan; Wang, Ai-Ling; Chu, Hai-Bin; Zhao, Yong-Liang

    2015-03-01

    Twelve lanthanide complexes with cinnamate (cin(-) ) and 1,10-phenanthroline (phen) were synthesized and characterized. Their compositions were assumed to be RE(cin)3 phen (RE(3+)  = La(3+) , Pr(3+) , Nd(3+) , Sm(3+) , Eu(3+) , Gd(3+) , Tb(3+) , Dy(3+) , Ho(3+) , Tm(3+) , Yb(3+) , Lu(3+) ). The interaction mode between the complexes and DNA was investigated by fluorescence quenching experiment. The results indicated the complexes could bind to DNA and the main binding mode is intercalative binding. The fluorescence quenching constants of the complexes increased from La(cin)3 phen to Lu(cin)3 phen. Additionally, the antibacterial activity testing showed that the complexes exhibited excellent antibacterial ability against Escherichia coli, and the changes of antibacterial ability are in agreement with that of the fluorescence quenching constants.

  2. Enzyme therapy of xeroderma pigmentosum: safety and efficacy testing of T4N5 liposome lotion containing a prokaryotic DNA repair enzyme.

    Science.gov (United States)

    Yarosh, D; Klein, J; Kibitel, J; Alas, L; O'Connor, A; Cummings, B; Grob, D; Gerstein, D; Gilchrest, B A; Ichihashi, M; Ogoshi, M; Ueda, M; Fernandez, V; Chadwick, C; Potten, C S; Proby, C M; Young, A R; Hawk, J L

    1996-06-01

    Xeroderma pigmentosum (XP) is a rare genetic disease in which patients are defective in DNA repair and are extremely sensitive to solar UV radiation exposure. A new treatment approach was tested in these patients, in which a prokaryotic DNA repair enzyme specific for UV-induced DNA damage was delivered into the skin by means of topically applied liposomes to supplement the deficient activity. Acute and chronic safety testing in both mice and humans showed neither adverse reactions nor significant changes in serum chemistry or in skin histology. The skin of XP patients treated with the DNA repair liposomes had fewer cyclobutylpyrimidine dimers in DNA and showed less erythema than did control sites. The results encourage further clinical testing of this new enzyme therapy approach.

  3. Testing strategies to establish the safety of nanomaterials: conclusions of an ECETOC workshop.

    Science.gov (United States)

    Warheit, David B; Borm, Paul J A; Hennes, Christa; Lademann, Jürgen

    2007-06-01

    The European Centre for Ecotoxicology and Toxicology of Chemicals (ECETOC) convened a workshop in Barcelona, Spain, in November 2005 to develop testing strategies to establish the safety of nanomaterials. It brought together about 70 scientific and clinical experts from industry, academia, government agencies, research institutes, and nongovernmental organizations. The primary questions to be addressed were the following: What can we do today, and what do we need tomorrow? The three major themes of the workshop were: (1) the need for enhanced efforts in nanomaterial characterization; (2) methodologies for assessments of airborne and internal exposures to nanomaterials; and (3) evaluation of the hazard potential--primarily focusing on pulmonary or dermal routes of exposures. Some of the summary conclusions of the workshop included the following: For the development of nanoparticle characterization, the working definition of nanoparticles was defined as < 100 nm in one dimension or < 1000 nm to include aggregates and agglomerates. Moreover, it was concluded that although many physical factors can influence toxicity, including nanoparticle composition, it is dissolution, surface area and characteristics, size, size distribution, and shape that largely determine the functional, toxicological and environmental impact of nanomaterials. In addition, most of the information on potential systemic effects has thus far been derived from combustion-generated particles. With respect to the assessment of external exposures and metrics appropriate for nanoparticles, the general view of the meeting was that currently it is not possible or desirable to select one form of dose metric (i.e., mass, surface area, or particle number) as the most appropriate measure source. However, it was clear that the surface area metric was likely to be of interest and requires further development. In addition, there is a clear and immediate need to develop instruments which are smaller, more

  4. Testing DNA barcodes in closely related species of Curcuma (Zingiberaceae) from Myanmar and China.

    Science.gov (United States)

    Chen, Juan; Zhao, Jietang; Erickson, David L; Xia, Nianhe; Kress, W John

    2015-03-01

    The genus Curcuma L. is commonly used as spices, medicines, dyes and ornamentals. Owing to its economic significance and lack of clear-cut morphological differences between species, this genus is an ideal case for developing DNA barcodes. In this study, four chloroplast DNA regions (matK, rbcL, trnH-psbA and trnL-F) and one nuclear region (ITS2) were generated for 44 Curcuma species and five species from closely related genera, represented by 96 samples. PCR amplification success rate, intra- and inter-specific genetic distance variation and the correct identification percentage were taken into account to assess candidate barcode regions. PCR and sequence success rate were high in matK (89.7%), rbcL (100%), trnH-psbA (100%), trnL-F (95.7%) and ITS2 (82.6%) regions. The results further showed that four candidate chloroplast barcoding regions (matK, rbcL, trnH-psbA and trnL-F) yield no barcode gaps, indicating that the genus Curcuma represents a challenging group for DNA barcoding. The ITS2 region presented large interspecific variation and provided the highest correct identification rates (46.7%) based on BLASTClust method among the five regions. However, the ITS2 only provided 7.9% based on NJ tree method. An increase in discriminatory power needs the development of more variable markers. © 2014 John Wiley & Sons Ltd.

  5. SNPs and MALDI-TOF MS: tools for DNA typing in forensic paternity testing and anthropology.

    Science.gov (United States)

    Petkovski, Elizabet; Keyser-Tracqui, Christine; Hienne, Rémi; Ludes, Bertrand

    2005-05-01

    DNA markers used for individual identification in forensic sciences are based on repeat sequences in nuclear DNA and the mitochondrial DNA hypervariable regions 1 and 2. An alternative to these markers is the use of single nucleotide polymorphisms (SNPs). These have a particular advantage in the analysis of degraded or poor samples, which are often all that is available in forensics or anthropology. In order to study the potential of SNP analysis in these fields, 41 SNPs were selected on the basis of following criteria: conservation, lack of phenotypic expression, and frequency of occurrence in populations. Thirty-six autosomal SNPs were used for genotyping 21 inclusionary and 3 exclusionary paternity cases. The behavior of 5 X-chromosome SNPs was analyzed in a French representative population. Our approach to SNP typing is a multiplex PCR based amplification followed by simultaneous detection by primer extension (PEX) analyzed by Matrix Assisted Laser Desorption Ionization Time-of-Flight Mass Spectrometry (MALDI-TOF MS). The selected autosomal SNPs showed independent inheritance and gave clear results in paternity investigation. All X-SNPs were useful as both paternity and identification markers. PEX and MALDI-TOF MS, with their high sensitivity, precision and speed, gave a powerful method for forensic and anthropological exploitation of biallelic markers.

  6. Testing the potential of a ribosomal 16S marker for DNA metabarcoding of insects

    Directory of Open Access Journals (Sweden)

    Vasco Elbrecht

    2016-04-01

    Full Text Available Cytochrome c oxidase I (COI is a powerful marker for DNA barcoding of animals, with good taxonomic resolution and a large reference database. However, when used for DNA metabarcoding, estimation of taxa abundances and species detection are limited due to primer bias caused by highly variable primer binding sites across the COI gene. Therefore, we explored the ability of the 16S ribosomal DNA gene as an alternative metabarcoding marker for species level assessments. Ten bulk samples, each containing equal amounts of tissue from 52 freshwater invertebrate taxa, were sequenced with the Illumina NextSeq 500 system. The 16S primers amplified three more insect species than the Folmer COI primers and amplified more equally, probably due to decreased primer bias. Estimation of biomass might be less biased with 16S than with COI, although variation in read abundances of two orders of magnitudes is still observed. According to these results, the marker choice depends on the scientific question. If the goal is to obtain a taxonomic identification at the species level, then COI is more appropriate due to established reference databases and known taxonomic resolution of this marker, knowing that a greater proportion of insects will be missed using COI Folmer primers. If the goal is to obtain a more comprehensive survey the 16S marker, which requires building a local reference database, or optimised degenerated COI primers could be more appropriate.

  7. DNA barcoding in the cycadales: testing the potential of proposed barcoding markers for species identification of cycads.

    Directory of Open Access Journals (Sweden)

    Chodon Sass

    Full Text Available Barcodes are short segments of DNA that can be used to uniquely identify an unknown specimen to species, particularly when diagnostic morphological features are absent. These sequences could offer a new forensic tool in plant and animal conservation-especially for endangered species such as members of the Cycadales. Ideally, barcodes could be used to positively identify illegally obtained material even in cases where diagnostic features have been purposefully removed or to release confiscated organisms into the proper breeding population. In order to be useful, a DNA barcode sequence must not only easily PCR amplify with universal or near-universal reaction conditions and primers, but also contain enough variation to generate unique identifiers at either the species or population levels. Chloroplast regions suggested by the Plant Working Group of the Consortium for the Barcode of Life (CBoL, and two alternatives, the chloroplast psbA-trnH intergenic spacer and the nuclear ribosomal internal transcribed spacer (nrITS, were tested for their utility in generating unique identifiers for members of the Cycadales. Ease of amplification and sequence generation with universal primers and reaction conditions was determined for each of the seven proposed markers. While none of the proposed markers provided unique identifiers for all species tested, nrITS showed the most promise in terms of variability, although sequencing difficulties remain a drawback. We suggest a workflow for DNA barcoding, including database generation and management, which will ultimately be necessary if we are to succeed in establishing a universal DNA barcode for plants.

  8. DNA barcoding in the cycadales: testing the potential of proposed barcoding markers for species identification of cycads.

    Science.gov (United States)

    Sass, Chodon; Little, Damon P; Stevenson, Dennis Wm; Specht, Chelsea D

    2007-11-07

    Barcodes are short segments of DNA that can be used to uniquely identify an unknown specimen to species, particularly when diagnostic morphological features are absent. These sequences could offer a new forensic tool in plant and animal conservation-especially for endangered species such as members of the Cycadales. Ideally, barcodes could be used to positively identify illegally obtained material even in cases where diagnostic features have been purposefully removed or to release confiscated organisms into the proper breeding population. In order to be useful, a DNA barcode sequence must not only easily PCR amplify with universal or near-universal reaction conditions and primers, but also contain enough variation to generate unique identifiers at either the species or population levels. Chloroplast regions suggested by the Plant Working Group of the Consortium for the Barcode of Life (CBoL), and two alternatives, the chloroplast psbA-trnH intergenic spacer and the nuclear ribosomal internal transcribed spacer (nrITS), were tested for their utility in generating unique identifiers for members of the Cycadales. Ease of amplification and sequence generation with universal primers and reaction conditions was determined for each of the seven proposed markers. While none of the proposed markers provided unique identifiers for all species tested, nrITS showed the most promise in terms of variability, although sequencing difficulties remain a drawback. We suggest a workflow for DNA barcoding, including database generation and management, which will ultimately be necessary if we are to succeed in establishing a universal DNA barcode for plants.

  9. Comparison of post-thaw DNA integrity of boar spermatozoa assessed with the neutral comet assay and Sperm-Sus Halomax test kit.

    Science.gov (United States)

    Fraser, L; Parda, A; Filipowicz, K; Strzeżek, J

    2010-10-01

    In this study, we tested the hypothesis whether the neutral Comet assay (NCA) and the Sperm-Sus-Halomax (SSH) test kit could provide similar measurements of post-thaw DNA fragmentation of boar spermatozoa. Whole ejaculates or sperm-rich fractions of boar semen were frozen in an extender containing lactose, lipoprotein fractions isolated from ostrich egg yolk (LPFo), glycerol (lactose-LPFo-G) or in a standard boar semen extender (K3), without the addition of cryoprotective substances. In all boars, both the NCA and SSH test showed similar levels of post-thaw sperm DNA fragmentation in samples of the same ejaculates, regardless of the ejaculate collection procedure and extender. Yet, the levels of post-thaw sperm DNA damage, detected by the NCA and SSH test, were more accentuated in spermatozoa frozen in the absence of cryoprotective substances. Both the NCA and SSH detected variations among individual boars in terms of post-thaw sperm DNA fragmentation. Agreement between the measurements of the NCA and SSH was confirmed by scatter plots of differences, suggesting that the DNA integrity tests could detect the same sperm populations, which were susceptible to cryo-induced DNA damage. The findings of this study indicate that the NCA and the SSH test are effective in detecting similar levels of sperm DNA fragmentation and reinforce their importance in the assessment of frozen-thawed boar semen quality.

  10. Framework for Testing the Effectiveness of Bat and Eagle Impact-Reduction Strategies at Wind Energy Projects

    Energy Technology Data Exchange (ETDEWEB)

    Sinclair, Karin [National Renewable Energy Lab. (NREL), Golden, CO (United States); DeGeorge, Elise [National Renewable Energy Lab. (NREL), Golden, CO (United States)

    2016-04-13

    The objectives of this framework are to facilitate the study design and execution to test the effectiveness of bat and eagle impact-reduction strategies at wind energy sites. Through scientific field research, the wind industry and its partners can help determine if certain strategies are ready for operational deployment or require further development. This framework should be considered a living document to be improved upon as fatality-reduction technologies advance from the initial concepts to proven readiness (through project- and technology-specific testing) and as scientific field methods improve.

  11. Non-animal testing strategies for assessment of the skin corrosion and skin irritation potential of ingredients and finished products.

    Science.gov (United States)

    Robinson, M K; Cohen, C; de Fraissinette, A de Brugerolle; Ponec, M; Whittle, E; Fentem, J H

    2002-05-01

    The dermatotoxicologist today is faced with a dilemma. Protection of workers and consumers from skin toxicities (irritation and allergy) associated with exposure to products, and the ingredients they contain, requires toxicological skin testing prior to manufacture, transport, or marketing. Testing for skin corrosion or irritation has traditionally been conducted in animals, particularly in rabbits via the long established Draize test method. However, this procedure, among others, has been subject to criticism, both for its limited predictive capacity for human toxicity, as well as for its use of animals. In fact, legislation is pending in the European Union which would ban the sale of cosmetic products, the ingredients of which have been tested in animals. These considerations, and advancements in both in vitro skin biology and clinical testing, have helped drive an intensive effort among skin scientists to develop alternative test methods based either on in vitro test systems (e.g. using rat, pig or human skin ex vivo, or reconstructed human skin models) or ethical clinical approaches (human volunteer studies). Tools are now in place today to enable a thorough skin corrosion and irritation assessment of new ingredients and products without the need to test in animals. Herein, we describe general testing strategies and new test methods for the assessment of skin corrosion and irritation. The methods described, and utilized within industry today, provide a framework for the practicing toxicologist to support new product development initiatives through the use of reliable skin safety testing and risk assessment tools and strategies.

  12. Performance assessment of the GenoType MTBDRplus test and DNA sequencing in detection of multidrug-resistant Mycobacterium tuberculosis.

    Science.gov (United States)

    Huang, Wei-Lun; Chen, Huang-Yau; Kuo, Yuh-Min; Jou, Ruwen

    2009-08-01

    To facilitate the management of multidrug-resistant (MDR) tuberculosis, two nucleic acid sequence-based methods, the GenoType MTBDRplus test and DNA sequencing, were assessed for the rapid detection of drug-resistant Mycobacterium tuberculosis for the first time in the Asia-Pacific region. The performances of these two assays in detecting the presence of rifampin (rifampicin) (RIF) and isoniazid (INH) resistance-associated mutations in the rpoB, katG, inhA regulatory region, inhA, and oxyR-ahpC genes were compared to that of a conventional agar proportion drug susceptibility test. A total of 242 MDR and 30 pansusceptible M. tuberculosis isolates were evaluated in this study. The sensitivities obtained for RIF-resistant detection by the GenoType MTBDRplus test and by resistance gene sequencing were 95.5% and 97.9%, respectively. The sensitivities for INH resistance detection by the GenoType MTBDRplus test and by resistance gene sequencing were 81.8% and 93.4%, respectively. Together, the sensitivity for MDR tuberculosis detection was 78.5% with the GenoType MTBDRplus test and 91.3% by resistance gene sequencing. The specificity for RIF resistance, INH resistance, and MDR detection was 100% by both methods. The GenoType MTBDRplus test has the advantage of a short turnaround time for drug-resistant M. tuberculosis detection. Overall, the two assays performed equally well in detecting RIF resistance (P = 0.13). However, DNA sequencing demonstrated superior performance in detecting INH resistance (P tuberculosis (P GenoType MTBDRplus test, especially for different geographic areas with genetically diverse M. tuberculosis strains.

  13. Cell-free fetal DNA analysis in maternal plasma as a screening test for trisomy 21, 18 and 13 in twin pregnancies.

    Science.gov (United States)

    Le Conte, Grégoire; Letourneau, Alexandra; Jani, Jacques; Kleinfinger, Pascale; Lohmann, Laurence; Costa, Jean-Marc; Benachi, Alexandra

    2017-08-18

    To evaluate the utility of noninvasive prenatal testing using cell-free circulating fetal DNA (cfDNA) in screening for the three main autosomal fetal trisomies in twin pregnancies. CfDNA testing was offered to 492 patients with twin pregnancies without ultrasound anomalies as a first-line screening test or after serum screening in clinical practice. Data were collected prospectively and a retrospective analysis was performed. CfDNA analysis was performed by massively parallel sequencing. The fetal fraction threshold for test evaluation was 8%. Regression analysis was performed to investigate the effect on the test failure rate of various variables. Performance of the test is also reported. The test was performed first line (after first-trimester scan) in 377 patients and following serum screening in 115. 78.8% of pregnancies were dichorionic-diamniotic. The test failed at the first attempt in 12 (2.9%) of 420 pregnancies with available outcomes, and regression analysis demonstrated that only maternal weight was a significant independent predictor of test failure. After redraw, a result was achieved in 10 cases. CfDNA identified all 3 cases of trisomy 21, and the only case of trisomy 18. For trisomy 21, the specificity was 99.8% (95% CI [98.7% - 100.0%]). When considering the spontaneous or ART origin of pregnancies, there were no significant differences in terms of maternal weight or of no-result rate for cfDNA screening in the two groups. In twin pregnancies without fetal ultrasound abnormalities, cfDNA had a high success rate and performance. Therefore, in routine practice, cfDNA could be considered as a first- or second-line screening test. This article is protected by copyright. All rights reserved.

  14. Real-time ed end-point Polymerase Chain Reaction per la quantizzazione del DNA di Citomegalovirus: confronto tra metodi e con il test per l’antigene pp65

    Directory of Open Access Journals (Sweden)

    Tiziano Allice

    2006-03-01

    Full Text Available Quantitave Polymerase Chain Reaction (PCR for Cytomegalovirus (CMV DNA provides highly sensitive and specific data for detecting CMV as well as monitoring the infection and determining the appropriate antiviral strategy.To determine the clinical application of a recently introduced real-time (RT PCR assay for CMV DNA quantitation in peripheral blood leukocytes (PBLs and defining its correlation with the commercial quantitative end-point (EP PCR method COBAS AMPLICOR CMV Monitor and pp65 antigen test. Sequential PBL samples (n=158 from 32 liver transplanted patients with CMV asymptomatic infection and positive for CMV DNA by EP-PCR were retrospectively analysed with RT-PCR and studied according to pp65 antigen levels. A good correlation was found between RT-PCR and pp65 antigen test (r=0.691 and between the two PCR assays (r=0.761. RT-PCR data were significantly higher in pre-emptive treated patients (those with >20 pp65+positive cells, median value: 3.8 log10 copies/500,000 PBLs than in not-treated ones (2.9 logs.According to pp65 levels of 0, 1-10, 11-20, 21-50, 51-100 and >100 positive cells/200,000 PBLs, median CMV DNA load by RT-PCR was 2.6, 3.0, 3.6, 4.0. 4.2 and 4.8, log10 copies/ 500,000 PBLs, respectively (EP-PCR CMV DNA levels: 2. 8, 2.9, 3.8, 3.7, 3.9 and 4.0 logs. For samples with >20 pp65+cells, that is above the level at which pre-emptive therapy was started, RT-PCR values were significantly higher than in groups with less than 20 pp65+cells, whereas EP-PCR values did not significantly differ and showed a slower progression rate. Dilutions of DNA from CMV AD169 strain were used to probe RT-PCR reproducibility (between and intra-assay variability < 2% and sensitivity (100% detection rate at 10 copies/reaction, 28.5% with EP-PCR. A significant improvement is coming from the introduction of RT-PCR to the study of CMV DNA dynamics in differently CMV infected patients due to a more reliable quantitation of CMV DNA for moderate and high

  15. Refined Exercise testing can aid DNA-based Diagnosis in Muscle Channelopathies

    OpenAIRE

    Tan, S V; Matthews, E.; Barber, M.; Burge, J. A.; Rajakulendran, S; Fialho, D; Sud, R.; Haworth, A; Koltzenburg, M.; Hanna, M. G.

    2011-01-01

    Objective: To improve the accuracy of genotype prediction and guide genetic testing in patients with muscle channelopathies we applied and refined specialized electrophysiological exercise test parameters.Methods: We studied 56 genetically confirmed patients and 65 controls using needle electromyography, the long exercise test, and short exercise tests at room temperature, after cooling, and rewarming.Results: Concordant amplitude-and-area decrements were more reliable than amplitude-only mea...

  16. Refraining from intrusive thoughts is strategy dependent: a comment on Sugiura, et al. And a preliminary informal test of detached mindfulness, acceptance, and other strategies.

    Science.gov (United States)

    Wells, Adrian; Roussis, Panagiotis

    2014-10-01

    The control of cognition is fundamental to psychological well being. One dimension recently explored by Sugiura, Sugiura and Tanno (2013) is the perceived ability to refrain from catastrophic thinking-a construct that could be a marker of several factors. The current paper recommends deeper consideration in terms of metacognitive theory and exemplifies this by testing the effect of a strategy that focuses on abstaining from processes (detached mindfulness) vs. transforming content (acceptance, brief exposure). Fifty-six participants (M age = 21.5 yr., range = 18-42) were randomly assigned to detached mindfulness, acceptance, exposure, or a control group before watching a stressful film that induced intrusive images. Afterwards, they engaged in their respective strategies for 5 min. and the frequency of intrusive images was rated. Detached mindfulness was the only manipulation that was associated with a statistically significant lower frequency of intrusions than the control condition. It is argued that assessment of perceived skills to refrain from thinking should be conceptualized within a metacognitive framework that distinguish process- and content-oriented strategies and address the question: When is a strategy a true refrain?

  17. Epigenetic DNA Methylation Profiling with MSRE: A Quantitative NGS Approach Using a Parkinson's Disease Test Case

    Directory of Open Access Journals (Sweden)

    Adam G. Marsh

    2016-11-01

    Full Text Available Epigenetics is a rapidly developing field focused on deciphering chemical fingerprints that accumulate on human genomes over time. As the nascent idea of precision medicine expands to encompass epigenetic signatures of diagnostic and prognostic relevance, there is a need for methodologies that provide high-throughput DNA methylation profiling measurements. Here we report a novel quantification methodology for computationally reconstructing site-specific CpG methylation status from next generation sequencing (NGS data using methyl-sensitive restriction endonucleases (MSRE. An integrated pipeline efficiently incorporates raw NGS metrics into a statistical discrimination platform to identify functional linkages between shifts in epigenetic DNA methylation and disease phenotypes in samples being analyzed. In this pilot proof-of-concept study we quantify and compare DNA methylation in blood serum of individuals with Parkinson's Disease relative to matched healthy blood profiles. Even with a small study of only six samples, a high degree of statistical discrimination was achieved based on CpG methylation profiles between groups, with 1,008 statistically different CpG sites (p textless 0.0025, after false discovery rate correction. A methylation load calculation was used to assess higher order impacts of methylation shifts on genes and pathways and most notably identified FGF3, FGF8, HTT, KMTA5, MIR8073, and YWHAG as differentially methylated genes with high relevance to Parkinson's Disease and neurodegeneration (based on PubMed literature citations. Of these, KMTA5 is a histone methyl-transferase gene and HTT is Huntington Disease Protein or Huntingtin, for which there are well established neurodegenerative impacts. The future need for precision diagnostics now requires more tools for exploring epigenetic processes that may be linked to cellular dysfunction and subsequent disease progression.

  18. Use of expert judgment in the development and evaluation of risk-based inservice testing strategies for pumps and valves

    Energy Technology Data Exchange (ETDEWEB)

    McAllister, W.J.; Perdue, R.K.; Balkey, K.R.; Closky, N.B. [and others

    1996-12-01

    This paper describes a rigorous approach for quantitatively evaluating inservice testing effectiveness that evolved from two pilot plant studies. These studies prototyped methodologies for designing and selecting inservice testing (IST) strategies in a manner structured to insure that the targeted components will perform their required safety functions while minimizing life cycle inservice testing costs. The paper concentrates on the use of expert judgment in developing test effectiveness measures that move risk-based methods beyond ranking to optimization of plant IST programs. Selected results for check valves and pumps are shown to illustrate the practical significance of the approach.

  19. The diagnostic potential of maternal plasma in detecting fetal diseases by DNA test

    Directory of Open Access Journals (Sweden)

    Saha Biswajit

    2004-01-01

    Full Text Available Conventionally, DNA based investigations for fetal diseases are done by chorionic villous sampling and amniocentesis. Both are invasive techniques. Recently, molecular diagnosis has also been made possible in early pregnancy from maternal blood which is noninvasive and advantageous. Most of the researches have tried to identify the Y chromosome marker(s to detect a male fetus and paternally inherited allele. This is currently helpful to detect a very few genetic disorders including Rh D status in Rh negative women in early pregnancy and preeclampsia a few weeks preceding the clinical onset. This is a potential area for prenatal diagnosis in future.

  20. EFL Learners' Vocabulary Consolidation Strategy Use and Corresponding Performance on Vocabulary Tests

    Science.gov (United States)

    Lai, Ying-Chun

    2016-01-01

    This study describes English as a Foreign Language (EFL) learners' use of vocabulary consolidation strategies and explores the connection between strategy use and vocabulary learning outcomes. This study included 218 participants who were students from five freshman English classes at a university in Taiwan. Students' self-reports on their use of…

  1. Effect of Explicit Language Learning Strategy Instruction on Language-Test and Self-Assessment Scores

    Science.gov (United States)

    Jurkovic, Violeta

    2010-01-01

    The present article reports on the findings of a study that explored the effect of explicit language learning strategy instruction on the development of English as a foreign language within a higher education setting in mixed language ability groups. The research results indicate that explicit language learning strategy instruction that aimed at…

  2. Development of a genomic DNA reference material panel for myotonic dystrophy type 1 (DM1) genetic testing.

    Science.gov (United States)

    Kalman, Lisa; Tarleton, Jack; Hitch, Monica; Hegde, Madhuri; Hjelm, Nick; Berry-Kravis, Elizabeth; Zhou, Lili; Hilbert, James E; Luebbe, Elizabeth A; Moxley, Richard T; Toji, Lorraine

    2013-07-01

    Myotonic dystrophy type 1 (DM1) is caused by expansion of a CTG triplet repeat in the 3' untranslated region of the DMPK gene that encodes a serine-threonine kinase. Patients with larger repeats tend to have a more severe phenotype. Clinical laboratories require reference and quality control materials for DM1 diagnostic and carrier genetic testing. Well-characterized reference materials are not available. To address this need, the Centers for Disease Control and Prevention-based Genetic Testing Reference Material Coordination Program, in collaboration with members of the genetic testing community, the National Registry of Myotonic Dystrophy and Facioscapulohumeral Muscular Dystrophy Patients and Family Members, and the Coriell Cell Repositories, has established and characterized cell lines from patients with DM1 to create a reference material panel. The CTG repeats in genomic DNA samples from 10 DM1 cell lines were characterized in three clinical genetic testing laboratories using PCR and Southern blot analysis. DMPK alleles in the samples cover four of five DM1 clinical categories: normal (5 to 34 repeats), mild (50 to 100 repeats), classical (101 to 1000 repeats), and congenital (>1000 repeats). We did not identify or establish Coriell cell lines in the premutation range (35 to 49 repeats). These samples are publicly available for quality control, proficiency testing, test development, and research and should help improve the accuracy of DM1 testing.

  3. Evaluation of a modular strategy for the construction of novel polydactyl zinc finger DNA-binding proteins.

    Science.gov (United States)

    Segal, David J; Beerli, Roger R; Blancafort, Pilar; Dreier, Birgit; Effertz, Karin; Huber, Adrian; Koksch, Beate; Lund, Caren V; Magnenat, Laurent; Valente, David; Barbas, Carlos F

    2003-02-25

    In previous studies, we have developed a technology for the rapid construction of novel DNA-binding proteins with the potential to recognize any unique site in a given genome. This technology relies on the modular assembly of modified zinc finger DNA-binding domains, each of which recognizes a three bp subsite of DNA. A complete set of 64 domains would provide comprehensive recognition of any desired DNA sequence, and new proteins could be assembled by any laboratory in a matter of hours. However, a critical parameter for this approach is the extent to which each domain functions as an independent, modular unit, without influence or dependence on its neighboring domains. We therefore examined the detailed binding behavior of several modularly assembled polydactyl zinc finger proteins. We first demonstrated that 80 modularly assembled 3-finger proteins can recognize their DNA target with very high specificity using a multitarget ELISA-based specificity assay. A more detailed analysis of DNA binding specificity for eight 3-finger proteins and two 6-finger proteins was performed using a target site selection assay. Results showed that the specificity of these proteins was as good or better than that of zinc finger proteins constructed using methods that allow for interdependency. In some cases, near perfect specificity was achieved. Complications due to target site overlap were found to be restricted to only one particular amino acid interaction (involving an aspartate in position 2 of the alpha-helix) that occurs in a minority of cases. As this is the first report of target site selection for designed, well characterized 6-finger proteins, unique insights are discussed concerning the relationship of protein length and specificity. These results have important implications for the design of proteins that can recognize extended DNA sequences, as well as provide insights into the general rules of recognition for naturally occurring zinc finger proteins.

  4. Comparison of the Cobas 4800 HPV and HPV 9G DNA Chip Tests for Detection of High-Risk Human Papillomavirus in Cervical Specimens of Women with Consecutive Positive HPV Tests But Negative Pap Smears.

    Science.gov (United States)

    Jun, Sun-Young; Park, Eun Su; Kim, Jiyoung; Kang, Jun; Lee, Jae Jun; Bae, Yoonjin; Kim, Sang-Il; Maeng, Lee-So

    2015-01-01

    Detecting high-risk (HR) HPV is important for clinical management of women with persistent HPV-positive and Pap-negative results. The Cobas 4800 HPV test is the first FDA-approved HPV DNA test that can be used alone as a first-line screening tool. The HPV 9G DNA chip test is a PCR-based DNA microarray assay. We evaluated the patients of consecutive HPV-positivity on HPV 9G DNA chip test without cytologic abnormalities. We then compared the performances of HPV 9G DNA chip and the Cobas 4800 HPV tests for detecting HR HPV with each other and confirmed HPV genotyping using direct sequencing. All 214 liquid-based cytology specimens were collected from 100 women with consecutive HPV-positive and Pap-negative results on the HPV 9G DNA chip test between May 2012 and Dec 2013, but only 180 specimens were available for comparing HPV test results. The HPV 9G DNA chip and the Cobas 4800 HPV tests agreed with each other in 81.7% of the samples, and the concordance rate was greater than 97.2% for detecting HPV-16 or -18. For HR genotypes other than HPV types 16 and 18, the two tests agreed for 81.1% of the samples. The sensitivity of both assays for detecting HR HPV was 100%, regardless of HR genotypes. The HPV 9G DNA chip test may be as effective as the Cobas 4800 HPV test in detecting HR HPV, and has a similar ability to identify HPV-16 and -18.

  5. Functional testing strategy for coding genetic variants of unclear significance in MLH1 in Lynch syndrome diagnosis.

    Science.gov (United States)

    Hinrichsen, Inga; Schäfer, Dieter; Langer, Deborah; Köger, Nicole; Wittmann, Margarethe; Aretz, Stefan; Steinke, Verena; Holzapfel, Stefanie; Trojan, Jörg; König, Rainer; Zeuzem, Stefan; Brieger, Angela; Plotz, Guido

    2015-02-01

    Lynch syndrome is caused by inactivating mutations in the MLH1 gene, but genetic variants of unclear significance frequently preclude diagnosis. Functional testing can reveal variant-conferred defects in gene or protein function. Based on functional defect frequencies and clinical applicability of test systems, we developed a functional testing strategy aimed at efficiently detecting pathogenic defects in coding MLH1 variants. In this strategy, tests of repair activity and expression are prioritized over analyses of subcellular protein localization and messenger RNA (mRNA) formation. This strategy was used for four unclear coding MLH1 variants (p.Asp41His, p.Leu507Phe, p.Gln689Arg, p.Glu605del + p.Val716Met). Expression was analyzed using a transfection system, mismatch repair (MMR) activity by complementation in vitro, mRNA formation by reverse transcriptase-PCR in carrier lymphocyte mRNA, and subcellular localization with dye-labeled fusion constructs. All tests included clinically meaningful controls. The strategy enabled efficient identification of defects in two unclear variants: the p.Asp41His variant showed loss of MMR activity, whereas the compound variant p.Glu605del + p.Val716Met had a defect of expression. This expression defect was significantly stronger than the pathogenic expression reference variant analyzed in parallel, therefore the defect of the compound variant is also pathogenic. Interestingly, the expression defect was caused additively by both of the compound variants, at least one of which is non-pathogenic when occurring by itself. Tests were neutral for p.Leu507Phe and p.Gln689Arg, and the results were consistent with available clinical data. We finally discuss the improved sensitivity and efficiency of the applied strategy and its limitations in analyzing unclear coding MLH1 variants.

  6. The combined-disk boronic acid test as an accurate strategy for the detection of KPC carbapenemase in Central America.

    Science.gov (United States)

    Zúñiga, Julio; Cruz, Gerardo; Pérez, Carlos; Tarajia, Musharaf

    2016-03-31

    Carbapenemase-producing Klebsiella pneumoniae (KPC) outbreaks may cause a huge economical burden on developing countries. Furthermore, KPC can be challenging to detect. We describe the laboratory strategy for the detection of KPC from 2011 to 2013 in a tertiary care hospital in Central America with approximately 1,000 beds. A retrospective analysis of a clinical laboratory database was done to determine the pragmatic application of the combined-disk boronic acid test during a KPC outbreak in Panama. A total of 1,026 Klebsiella pneumoniae isolates were found, of which 133 were positive for KPC. The strategy during two phases was described according to the test employed as a confirmatory test for KPC. After the K. pneumoniae isolates were detected by the VITEK 2 system, blaKPC polymerase chain reaction (PCR) and the combined-disk boronic acid test were employed as a confirmatory test during phase one. The combined-disk boronic acid test was employed as a confirmatory test for KPC during phase two. The sensitivity, specificity, positive predictive value, and negative predictive value of the boronic acid test were 100%, 97%, 91%, and 100%, respectively, when blaKPC PCR was employed as a confirmatory test during the start of the outbreak. Afterwards, modified VITEK 2 system parameters resulted in 116 suspicious KPC samples and the boronic acid test confirmed 102 isolates. The use of an automated bacterial identification system and the boronic acid test for the detection of KPC was an effective and low-cost strategy for a clinical laboratory in Panama during an outbreak.

  7. Closure Strategy Nevada Test Site Area 5 Radioactive Waste Management Site

    Energy Technology Data Exchange (ETDEWEB)

    NSTec Environmental Management

    2007-03-01

    This paper presents an overview of the strategy for closure of part of the Area 5 Radioactive Waste Management Site (RWMS) at the Nevada Test Site (NTS), which is about 65 miles northwest of Las Vegas, Nevada (Figure 1). The Area 5 RWMS is in the northern part of Frenchman Flat, approximately 14 miles north of Mercury. The Area 5 RWMS encompasses 732 acres subdivided into quadrants, and is bounded by a 1,000-foot (ft)-wide buffer zone. The northwest and southwest quadrants have not been developed. The northeast and southeast quadrants have been used for disposal of unclassified low-level radioactive waste (LLW) and indefinite storage of classified materials. This paper focuses on closure of the 38 waste disposal and classified material storage units within the southeast quadrant of the Area 5 RWMS, called the ''92-Acre Area''. The U.S Department of Energy (DOE), National Nuclear Security Administration Nevada Site Office (NNSA/NSO) is currently planning to close the 92-Acre Area by 2011. Closure planning for this site must take into account the regulatory requirements for a diversity of waste streams, disposal and storage configurations, disposal history, and site conditions. For ease of discussion, the 92-Acre Area has been subdivided into six closure units defined by waste type, location, and similarity in regulatory requirements. Each of the closure units contains one or more waste disposal units; waste disposal units are also called waste disposal cells. The paper provides a brief background of the Area 5 RWMS, identifies key closure issues for the 92-Acre Area, recommends actions to address the issues, and provides the National Security Technologies, LLC (NSTec), schedule for closure.

  8. The construction and use of bacterial DNA microarrays based on an optimized two-stage PCR strategy

    Directory of Open Access Journals (Sweden)

    Pesta David

    2003-06-01

    Full Text Available Abstract Background DNA microarrays are a powerful tool with important applications such as global gene expression profiling. Construction of bacterial DNA microarrays from genomic sequence data using a two-stage PCR amplification approach for the production of arrayed DNA is attractive because it allows, in principal, the continued re-amplification of DNA fragments and facilitates further utilization of the DNA fragments for additional uses (e.g. over-expression of protein. We describe the successful construction and use of DNA microarrays by the two-stage amplification approach and discuss the technical challenges that were met and resolved during the project. Results Chimeric primers that contained both gene-specific and shared, universal sequence allowed the two-stage amplification of the 3,168 genes identified on the genome of Synechocystis sp. PCC6803, an important prokaryotic model organism for the study of oxygenic photosynthesis. The gene-specific component of the primer was of variable length to maintain uniform annealing temperatures during the 1st round of PCR synthesis, and situated to preserve full-length ORFs. Genes were truncated at 2 kb for efficient amplification, so that about 92% of the PCR fragments were full-length genes. The two-stage amplification had the additional advantage of normalizing the yield of PCR products and this improved the uniformity of DNA features robotically deposited onto the microarray surface. We also describe the techniques utilized to optimize hybridization conditions and signal-to-noise ratio of the transcription profile. The inter-lab transportability was demonstrated by the virtual error-free amplification of the entire genome complement of 3,168 genes using the universal primers in partner labs. The printed slides have been successfully used to identify differentially expressed genes in response to a number of environmental conditions, including salt stress. Conclusions The technique detailed

  9. Delta F508 testing of the DNA bank of the Royal Manchester Children's Hospital.

    Science.gov (United States)

    Schwarz, M J; Super, M; Wallis, C; Beighton, P; Newton, C; Heptinstall, L E; Summers, C; Markham, A; Hambleton, G; Webb, K W

    1990-09-01

    Details of haplotype and delta F508 status from various populations represented in the cystic fibrosis (CF) DNA bank of the Royal Manchester Children's Hospital are provided, together with information on the association of genotype and clinical status. Clinical details and DNA analyses from native English in the North-West and South-West of England (Bath), from Lancashire Pakistani families and from Afrikaans Namibian families are compared. A 78.5% incidence of delta F508 has been found in English families. Compound heterozygotes with CF and only one delta F508 gene have an increased likelihood of having milder disease, with less Pseudomonas isolated from sputum and relatively more showing either no regular respiratory pathogens or colonisation with Staphylococcus. There is also a relative increase in meconium ileus in these compound heterozygotes. The diagnosis of CF may be in doubt in some subjects negative for delta F508. Some of the Bath families have unusual haplotypes for an English population and a compound heterozygote delta F508/delta I507 has been found. There is evidence from metD analysis of the founder effect in the Afrikaans Namibian families, who have a high delta F508 incidence.

  10. DNA testing for parentage verification in a conservation nucleus of Pantaneiro horse

    Directory of Open Access Journals (Sweden)

    Fabiana Tavares Pires de Souza Sereno

    2008-01-01

    Full Text Available We investigated the genealogy of the in situ conservation nucleus of the Pantaneiro horse using DNA microsatellites by evaluating 101 horses, the group consisting of 71 adult horses (3 stallions, 40 male and 31 mares and 27 foals (14 colts and 13 fillies. Genomic DNA was extracted from hair roots and genotyped using 12 microsatellite markers (AHT4, AHT5, ASB2, ASB17, ASB23, HMS3 HMS6, HMS7, HTG4, HTG10, LEX33 and VHL20. The number of alleles per locus varied from 6 to 13, with a mean of 7.8 and the expected heterozygosity ranged from 0.544 to 0.734 (mean 0.644. The VLH20, ASB2, HTG10, ASB23 markers had a high (> 0.8 polymorphism information content and the total exclusion probability of the 12 microsatellite loci was 0.99. The genealogical study of the Pantaneiro horse using genetic markers was efficient in detecting mistakes during paternity and maternity designation and is an important tool which can be used together with traditional systems of animal identification. The use of genetic markers is recommended in the systematic control of the genealogical registrations and conservation plans to improve genetic aspects of the Pantaneiro horse.

  11. Comparison of different methods for extraction and purification of human Papillomavirus (HPV) DNA from serum samples

    Science.gov (United States)

    Azizah, N.; Hashim, U.; Nadzirah, Sh.; Arshad, M. K. Md; Ruslinda, A. R.; Gopinath, Subash C. B.

    2017-03-01

    The affectability and unwavering quality of PCR for indicative and research purposes require effective fair systems of extraction and sanitization of nucleic acids. One of the real impediments of PCR-based tests is the hindrance of the enhancement procedure by substances exhibit in clinical examples. This examination considers distinctive techniques for extraction and cleaning of viral DNA from serum tests in view of recuperation productivity as far as yield of DNA and rate recouped immaculateness of removed DNA, and rate of restraint. The best extraction strategies were the phenol/chloroform strategy and the silica gel extraction methodology for serum tests, individually. Considering DNA immaculateness, extraction technique by utilizing the phenol/chloroform strategy delivered the most tasteful results in serum tests contrasted with the silica gel, separately. The nearness of inhibitors was overcome by all DNA extraction strategies in serum tests, as confirm by semiquantitative PCR enhancement.

  12. Searching for Information on Tests: Reference Sources and a Search Strategy. Iowa Testing Programs Occasional Papers Number 38.

    Science.gov (United States)

    Jordan, Robert P.

    Research methodologies in several of the social sciences require the use of tests. When assisting social science researchers who seek information on tests, reference librarians do not, themselves, always have direct access to the instruments. Librarians should not only have the knowledge that various print and electronic database resources are…

  13. Noninvasive prenatal testing using cell-free fetal DNA in maternal plasma.

    Science.gov (United States)

    Dharajiya, Nilesh; Zwiefelhofer, Tricia; Guan, Xiaojun; Angkachatchai, Vach; Saldivar, Juan-Sebastian

    2015-01-20

    Noninvasive prenatal testing (NIPT) represents an outstanding example of how novel scientific discoveries can be quickly and successfully developed into hugely impactful clinical diagnostic tests. Since the introduction of NIPT to detect trisomy 21 in late 2011, the technology has rapidly advanced to analyze other autosomal and sex chromosome aneuploidies, and now includes the detection of subchromosomal deletion and duplication events. Here we provide a brief overview of how noninvasive prenatal testing using next-generation sequencing is performed.

  14. The introduction of a choice to learn pre-symptomatic DNA test results for BRCA or Lynch syndrome either face-to-face or by letter

    NARCIS (Netherlands)

    Voorwinden, J. S.; Jaspers, J. P. C.; ter Beest, J. G.; Kievit, Y.; Sijmons, R. H.; Oosterwijk, J. C.

    2012-01-01

    In predictive DNA testing for hereditary cancer, test results should traditionally be disclosed face-to-face. Increasingly, however, counselees ask to receive their test result at home by letter. To compare the quality of genetic counselling in the traditional way to a procedure in which counselees

  15. HPV DNA testing in population-based cervical screening (VUSA-Screen study) : results and implications

    NARCIS (Netherlands)

    Rijkaart, D. C.; Berkhof, J.; van Kemenade, F. J.; Coupe, V. M. H.; Rozendaal, L.; Heideman, D. A. M.; Verheijen, R. H. M.; Bulk, S.; Verweij, W.; Snijders, P. J. F.; Meijer, C. J. L. M.

    2012-01-01

    BACKGROUND: Human papillomavirus (HPV) testing is more sensitive than cytology for detecting high-grade cervical intraepithelial neoplasia (CIN). We evaluated the performance of high-risk HPV (hrHPV) testing in routine screening. METHODS: In all, 25 871 women (29-61) enrolled in our population-based

  16. Restriction of human papillomavirus DNA testing in primary cervical screening to women above age 30

    DEFF Research Database (Denmark)

    Rebolj, Matejka; Njor, Sisse H; Lynge, Elsebeth

    2012-01-01

    Cervical screening with human papillomavirus (HPV) testing is less specific for high-grade cervical intraepithelial neoplasia (=CIN3) than cytology. The aim of this systematic review was to determine whether a restriction of HPV testing to women aged at least 30 years would eliminate the problem....

  17. HPV DNA testing in population-based cervical screening (VUSA-Screen study) : results and implications

    NARCIS (Netherlands)

    Rijkaart, D. C.; Berkhof, J.; van Kemenade, F. J.; Coupe, V. M. H.; Rozendaal, L.; Heideman, D. A. M.; Verheijen, R. H. M.; Bulk, S.; Verweij, W.; Snijders, P. J. F.; Meijer, C. J. L. M.

    2012-01-01

    BACKGROUND: Human papillomavirus (HPV) testing is more sensitive than cytology for detecting high-grade cervical intraepithelial neoplasia (CIN). We evaluated the performance of high-risk HPV (hrHPV) testing in routine screening. METHODS: In all, 25 871 women (29-61) enrolled in our population-based

  18. Evaluation of a field-portable DNA microarray platform and nucleic acid amplification strategies for the detection of arboviruses, arthropods, and bloodmeals.

    Science.gov (United States)

    Grubaugh, Nathan D; Petz, Lawrence N; Melanson, Vanessa R; McMenamy, Scott S; Turell, Michael J; Long, Lewis S; Pisarcik, Sarah E; Kengluecha, Ampornpan; Jaichapor, Boonsong; O'Guinn, Monica L; Lee, John S

    2013-02-01

    Highly multiplexed assays, such as microarrays, can benefit arbovirus surveillance by allowing researchers to screen for hundreds of targets at once. We evaluated amplification strategies and the practicality of a portable DNA microarray platform to analyze virus-infected mosquitoes. The prototype microarray design used here targeted the non-structural protein 5, ribosomal RNA, and cytochrome b genes for the detection of flaviviruses, mosquitoes, and bloodmeals, respectively. We identified 13 of 14 flaviviruses from virus inoculated mosquitoes and cultured cells. Additionally, we differentiated between four mosquito genera and eight whole blood samples. The microarray platform was field evaluated in Thailand and successfully identified flaviviruses (Culex flavivirus, dengue-3, and Japanese encephalitis viruses), differentiated between mosquito genera (Aedes, Armigeres, Culex, and Mansonia), and detected mammalian bloodmeals (human and dog). We showed that the microarray platform and amplification strategies described here can be used to discern specific information on a wide variety of viruses and their vectors.

  19. Opportunities and Strategies for Testing and Infusion of ISRU in the Evolvable Mars Campaign

    Science.gov (United States)

    Mueller, Robert P.; Sibille, Laurent; Mantovani, James; Sanders, Gerald B.; Jones, Christopher A.

    2015-01-01

    HE Evolvable Mars Campaign (EMC) is developing the plans and systems needed for a robust, evolutionary strategy to explore cis-lunar space, the Mars sphere of influence (including the moons of Mars), and the surface of Mars. Recently, the emphasis of NASA's plans has changed to focus on the prolonged pioneering of space, rather than focusing on a single crewed mission as the ultimate goal. A sustainable, pioneering vision of space would include in-situ resource utilization (ISRU) in multiple forms and at multiple destinations: atmospheric capture of Mars CO2 and/or volatiles for consumables and propellants, regolith for bulk and refined materials, and in-situ manufacturing at the Moon, Mars, and other bodies. These resources would enable a reduction in the logistical needs from Earth for future missions, thus preparing the way for a sustained presence on Mars. Although the EMC initially relies only on propellant production for the Mars ascent vehicle via ISRU, one of its primary objectives is to prospect at every EMC destination to understand the potential for ISRU; this will permit true pioneering to be enabled after the first crew arrives at Mars. Recent and ongoing analysis has considered the possible prospecting measurements that can be performed at the asteroid returned to cis-lunar space by the Asteroid Robotic Redirect Mission (ARRM), at the lunar surface, at Phobos and Deimos, and on the surface of Mars to identify available resources for future use. These opportunities will be available on missions currently in the Evolvable Mars Campaign construct, and will also facilitate the testing and demonstration of resource acquisition, processing, storage, and useage technologies that can play a role in later missions. This analysis has also led to the identification of several objectives that should be targeted during the missions building up to and including the initial crewed missions. These objectives are mapped to strategies for incorporating ISRU to support

  20. Non-Invasive Prenatal Testing Using Cell Free DNA in Maternal Plasma: Recent Developments and Future Prospects

    Directory of Open Access Journals (Sweden)

    Peter Benn

    2014-05-01

    Full Text Available Recent advances in molecular genetic technologies have facilitated non-invasive prenatal testing (NIPT through the analysis of cell-free fetal DNA in maternal plasma. NIPT can be used to identify monogenic disorders including the identification of autosomal recessive disorders where the maternally inherited mutation needs to be identified in the presence of an excess of maternal DNA that contains the same mutation. In the future, simultaneous screening for multiple monogenic disorders is anticipated. Several NIPT methods have been developed to screen for trisomy. These have been shown to be effective for fetal trisomy 21, 18 and 13. Although the testing has been extended to sex chromosome aneuploidy, robust estimates of the efficacy are not yet available and maternal mosaicism for gain or loss of an X-chromosome needs to be considered. Using methods based on the analysis of single nucleotide polymorphisms, diandric triploidy can be identified. NIPT is being developed to identify a number of microdeletion syndromes including α-globin gene deletion. NIPT is a profoundly important development in prenatal care that is substantially advancing the individual patient and public health benefits achieved through conventional prenatal screening and diagnosis.

  1. Non-Invasive Prenatal Testing Using Cell Free DNA in Maternal Plasma: Recent Developments and Future Prospects.

    Science.gov (United States)

    Benn, Peter

    2014-05-21

    Recent advances in molecular genetic technologies have facilitated non-invasive prenatal testing (NIPT) through the analysis of cell-free fetal DNA in maternal plasma. NIPT can be used to identify monogenic disorders including the identification of autosomal recessive disorders where the maternally inherited mutation needs to be identified in the presence of an excess of maternal DNA that contains the same mutation. In the future, simultaneous screening for multiple monogenic disorders is anticipated. Several NIPT methods have been developed to screen for trisomy. These have been shown to be effective for fetal trisomy 21, 18 and 13. Although the testing has been extended to sex chromosome aneuploidy, robust estimates of the efficacy are not yet available and maternal mosaicism for gain or loss of an X-chromosome needs to be considered. Using methods based on the analysis of single nucleotide polymorphisms, diandric triploidy can be identified. NIPT is being developed to identify a number of microdeletion syndromes including α-globin gene deletion. NIPT is a profoundly important development in prenatal care that is substantially advancing the individual patient and public health benefits achieved through conventional prenatal screening and diagnosis.

  2. Advanced purification strategy for CueR, a cysteine containing copper(I) and DNA binding protein

    DEFF Research Database (Denmark)

    Balogh, Ria K.; Gyurcsik, Béla; Hunyadi-Gulyás, Éva

    2016-01-01

    , our procedure consisted of four steps supplemented by DNA digestion. Subsequent anion exchange on Sepharose FF Q 16/10, affinity chromatography on Heparin FF 16/10, second anion exchange on Source 30 Q 16/13 and gel filtration on Superdex 75 26/60 resulted in large amounts of pure CueR protein without...

  3. DNA display of PNA-tagged ligands: a versatile strategy to screen libraries and control geometry of multidentate ligands.

    Science.gov (United States)

    Winssinger, Nicolas

    2012-07-01

    Over the past decade, several technologies have emerged to access nucleic acid-tagged libraries and select the fittest compound within such libraries. This perspective focuses on recent development with PNA-tagged small molecules displayed on DNA templates for screening purposes and to probe the optimal geometry in multivalent interactions.

  4. The expression of CD123 can decrease with basophil activation: implications for the gating strategy of the basophil activation test

    OpenAIRE

    Santos, Alexandra F.; Bécares, Natalia; Stephens, Alick; Turcanu, Victor; Lack, Gideon

    2016-01-01

    Background Basophil activation test (BAT) reproduces IgE-mediated allergic reactions in vitro and has been used as a diagnostic test. Different markers can be used to identify basophils in whole blood and have implications for the outcome of the test. We aimed to assess changes in the expression of CD123 and HLA-DR following basophil activation and to select the best gating strategy for BAT using these markers. Methods BAT was performed in whole blood from 116 children. Peanut extract, anti-I...

  5. Assessment of DNA damage in coal open-cast mining workers using the cytokinesis-blocked micronucleus test and the comet assay.

    Science.gov (United States)

    León-Mejía, Grethel; Espitia-Pérez, Lyda; Hoyos-Giraldo, Luz Stella; Da Silva, Juliana; Hartmann, Andreas; Henriques, João Antônio Pêgas; Quintana, Milton

    2011-01-15

    Coal mining is one of the most important causes of environmental pollution, as large quantities of coal dust particles are emitted. Colombia-South America has large natural coal reserves and "El Cerrejón" is the world's largest open-cast mine located in the northern department of Guajira. The aim of the present study was to evaluate genotoxic effects in a population exposed to coal residues from the open-cast mine "El Cerrejón". 100 exposed workers and 100 non-exposed control individuals were included in this study. The exposed group was divided according to different mining area activities: (i). Transport of extracted coal, (ii). Equipment field maintenance, (iii). Coal stripping and, (iv). Coal embarking. Blood samples were taken to investigate biomarkers of genotoxicity, specifically, primary DNA damage as damage index (DI), tail length and% of tail DNA using the Comet assay (alkaline version) and chromosome damage as micronucleus (MN) frequency in lymphocytes. Both biomarkers showed statistically significantly higher values in the exposed group compared to the non-exposed control group. No difference was observed between the exposed groups executing different mining activities. These results indicate that exposure to coal mining residues may result in an increased genotoxic exposure in coal mining workers. We did not find a correlation between age, alcohol consumption and service time with the biomarkers of genotoxicity. Our results are the first data of genotoxic effects induced by coal mining exposure in Colombia, and thus, contribute to the exploration of test batteries use for monitoring of exposed populations and may stimulate designing control, hygiene and prevention strategies for occupational health risk assessment in developing countries. Copyright © 2010 Elsevier B.V. All rights reserved.

  6. Testing Three Species Distribution Modelling Strategies to Define Fish Assemblage Reference Conditions for Stream Bioassessment and Related Applications.

    Science.gov (United States)

    Rose, Peter M; Kennard, Mark J; Moffatt, David B; Sheldon, Fran; Butler, Gavin L

    2016-01-01

    Species distribution models are widely used for stream bioassessment, estimating changes in habitat suitability and identifying conservation priorities. We tested the accuracy of three modelling strategies (single species ensemble, multi-species response and community classification models) to predict fish assemblages at reference stream segments in coastal subtropical Australia. We aimed to evaluate each modelling strategy for consistency of predictor variable selection; determine which strategy is most suitable for stream bioassessment using fish indicators; and appraise which strategies best match other stream management applications. Five models, one single species ensemble, two multi-species response and two community classification models, were calibrated using fish species presence-absence data from 103 reference sites. Models were evaluated for generality and transferability through space and time using four external reference site datasets. Elevation and catchment slope were consistently identified as key correlates of fish assemblage composition among models. The community classification models had high omission error rates and contributed fewer taxa to the 'expected' component of the taxonomic completeness (O/E50) index than the other strategies. This potentially decreases the model sensitivity for site impact assessment. The ensemble model accurately and precisely modelled O/E50 for the training data, but produced biased predictions for the external datasets. The multi-species response models afforded relatively high accuracy and precision coupled with low bias across external datasets and had lower taxa omission rates than the community classification models. They inherently included rare, but predictable species while excluding species that were poorly modelled among all strategies. We suggest that the multi-species response modelling strategy is most suited to bioassessment using freshwater fish assemblages in our study area. At the species level

  7. Frequency of intron loss correlates with processed pseudogene abundance: a novel strategy to test the reverse transcriptase model of intron loss

    Science.gov (United States)

    2013-01-01

    Background Although intron loss in evolution has been described, the mechanism involved is still unclear. Three models have been proposed, the reverse transcriptase (RT) model, genomic deletion model and double-strand-break repair model. The RT model, also termed mRNA-mediated intron loss, suggests that cDNA molecules reverse transcribed from spliced mRNA recombine with genomic DNA causing intron loss. Many studies have attempted to test this model based on its predictions, such as simultaneous loss of adjacent introns, 3'-side bias of intron loss, and germline expression of intron-lost genes. Evidence either supporting or opposing the model has been reported. The mechanism of intron loss proposed in the RT model shares the process of reverse transcription with the formation of processed pseudogenes. If the RT model is correct, genes that have produced more processed pseudogenes are more likely to undergo intron loss. Results In the present study, we observed that the frequency of intron loss is correlated with processed pseudogene abundance by analyzing a new dataset of intron loss obtained in mice and rats. Furthermore, we found that mRNA molecules of intron-lost genes are mostly translated on free cytoplasmic ribosomes, a feature shared by mRNA molecules of the parental genes of processed pseudogenes and long interspersed elements. This feature is likely convenient for intron-lost gene mRNA molecules to be reverse transcribed. Analyses of adjacent intron loss, 3'-side bias of intron loss, and germline expression of intron-lost genes also support the RT model. Conclusions Compared with previous evidence, the correlation between the abundance of processed pseudogenes and intron loss frequency more directly supports the RT model of intron loss. Exploring such a correlation is a new strategy to test the RT model in organisms with abundant processed pseudogenes. PMID:23497167

  8. Abnormal plasma DNA profiles in early ovarian cancer using a non-invasive prenatal testing platform: implications for cancer screening.

    Science.gov (United States)

    Cohen, Paul A; Flowers, Nicola; Tong, Stephen; Hannan, Natalie; Pertile, Mark D; Hui, Lisa

    2016-08-24

    Non-invasive prenatal testing (NIPT) identifies fetal aneuploidy by sequencing cell-free DNA in the maternal plasma. Pre-symptomatic maternal malignancies have been incidentally detected during NIPT based on abnormal genomic profiles. This low coverage sequencing approach could have potential for ovarian cancer screening in the non-pregnant population. Our objective was to investigate whether plasma DNA sequencing with a clinical whole genome NIPT platform can detect early- and late-stage high-grade serous ovarian carcinomas (HGSOC). This is a case control study of prospectively-collected biobank samples comprising preoperative plasma from 32 women with HGSOC (16 'early cancer' (FIGO I-II) and 16 'advanced cancer' (FIGO III-IV)) and 32 benign controls. Plasma DNA from cases and controls were sequenced using a commercial NIPT platform and chromosome dosage measured. Sequencing data were blindly analyzed with two methods: (1) Subchromosomal changes were called using an open source algorithm WISECONDOR (WIthin-SamplE COpy Number aberration DetectOR). Genomic gains or losses ≥ 15 Mb were prespecified as "screen positive" calls, and mapped to recurrent copy number variations reported in an ovarian cancer genome atlas. (2) Selected whole chromosome gains or losses were reported using the routine NIPT pipeline for fetal aneuploidy. We detected 13/32 cancer cases using the subchromosomal analysis (sensitivity 40.6 %, 95 % CI, 23.7-59.4 %), including 6/16 early and 7/16 advanced HGSOC cases. Two of 32 benign controls had