WorldWideScience

Sample records for dna segment encoding

  1. Cloning of cDNA encoding steroid 11β-hydroxylase (P450c11)

    International Nuclear Information System (INIS)

    Chua, S.C.; Szabo, P.; Vitek, A.; Grzeschik, K.H.; John, M.; White, P.C.

    1987-01-01

    The authors have isolated bovine and human adrenal cDNA clones encoding the adrenal cytochrome P-450 specific for 11β-hydroxylation (P450c11). A bovine adrenal cDNA library constructed in the bacteriophage λ vector gt10 was probed with a previously isolated cDNA clone corresponding to part of the 3' untranslated region of the 4.2-kilobase (kb) mRNA encoding P450c11. Several clones with 3.2-kb cDNA inserts were isolated. Sequence analysis showed that they overlapped the original probe by 300 base pairs (bp). Combined cDNA and RNA sequence data demonstrated a continuous open reading frame of 1509 bases. P450c11 is predicted to contain 479 amino acid residues in the mature protein in addition to a 24-residue amino-terminal mitochondrial signal sequence. A bovine clone was used to isolate a homologous clone with a 3.5-kb insert from a human adrenal cDNA library. A region of 1100 bp was 81% homologous to 769 bp of the coding sequence of the bovine cDNA except for a 400-bp segment presumed to be an unprocessed intron. Hybridization of the human cDNA to DNA from a panel of human-rodent somatic cell hybrid lines and in situ hybridization to metaphase spreads of human chromosomes localized the gene to the middle of the long arm of chromosome 8. These data should be useful in developing reagents for heterozygote detection and prenatal diagnosis of 11β-hydroxylase deficiency, the second most frequent cause of congenital adrenal hyperplasia

  2. DNA-encoded chemical libraries - achievements and remaining challenges.

    Science.gov (United States)

    Favalli, Nicholas; Bassi, Gabriele; Scheuermann, Jörg; Neri, Dario

    2018-04-23

    DNA-encoded chemical libraries (DECLs) are collections of compounds, individually coupled to DNA tags serving as amplifiable identification barcodes. Since individual compounds can be identified by the associated DNA tag, they can be stored as a mixture, allowing the synthesis and screening of combinatorial libraries of unprecedented size, facilitated by the implementation of split-and-pool synthetic procedures or other experimental methodologies. In this review, we briefly present relevant concepts and technologies, which are required for the implementation and interpretation of screening procedures with DNA-encoded chemical libraries. Moreover, we illustrate some success stories, detailing how novel ligands were discovered from encoded libraries. Finally, we critically review what can realistically be achieved with the technology at the present time, highlighting challenges and opportunities for the future. © 2018 Federation of European Biochemical Societies.

  3. Storing data encoded DNA in living organisms

    Science.gov (United States)

    Wong,; Pak C. , Wong; Kwong K. , Foote; Harlan, P [Richland, WA

    2006-06-06

    Current technologies allow the generation of artificial DNA molecules and/or the ability to alter the DNA sequences of existing DNA molecules. With a careful coding scheme and arrangement, it is possible to encode important information as an artificial DNA strand and store it in a living host safely and permanently. This inventive technology can be used to identify origins and protect R&D investments. It can also be used in environmental research to track generations of organisms and observe the ecological impact of pollutants. Today, there are microorganisms that can survive under extreme conditions. As well, it is advantageous to consider multicellular organisms as hosts for stored information. These living organisms can provide as memory housing and protection for stored data or information. The present invention provides well for data storage in a living organism wherein at least one DNA sequence is encoded to represent data and incorporated into a living organism.

  4. DNA-Encoded Dynamic Combinatorial Chemical Libraries.

    Science.gov (United States)

    Reddavide, Francesco V; Lin, Weilin; Lehnert, Sarah; Zhang, Yixin

    2015-06-26

    Dynamic combinatorial chemistry (DCC) explores the thermodynamic equilibrium of reversible reactions. Its application in the discovery of protein binders is largely limited by difficulties in the analysis of complex reaction mixtures. DNA-encoded chemical library (DECL) technology allows the selection of binders from a mixture of up to billions of different compounds; however, experimental results often show low a signal-to-noise ratio and poor correlation between enrichment factor and binding affinity. Herein we describe the design and application of DNA-encoded dynamic combinatorial chemical libraries (EDCCLs). Our experiments have shown that the EDCCL approach can be used not only to convert monovalent binders into high-affinity bivalent binders, but also to cause remarkably enhanced enrichment of potent bivalent binders by driving their in situ synthesis. We also demonstrate the application of EDCCLs in DNA-templated chemical reactions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Toward a Better Compression for DNA Sequences Using Huffman Encoding.

    Science.gov (United States)

    Al-Okaily, Anas; Almarri, Badar; Al Yami, Sultan; Huang, Chun-Hsi

    2017-04-01

    Due to the significant amount of DNA data that are being generated by next-generation sequencing machines for genomes of lengths ranging from megabases to gigabases, there is an increasing need to compress such data to a less space and a faster transmission. Different implementations of Huffman encoding incorporating the characteristics of DNA sequences prove to better compress DNA data. These implementations center on the concepts of selecting frequent repeats so as to force a skewed Huffman tree, as well as the construction of multiple Huffman trees when encoding. The implementations demonstrate improvements on the compression ratios for five genomes with lengths ranging from 5 to 50 Mbp, compared with the standard Huffman tree algorithm. The research hence suggests an improvement on all such DNA sequence compression algorithms that use the conventional Huffman encoding. The research suggests an improvement on all DNA sequence compression algorithms that use the conventional Huffman encoding. Accompanying software is publicly available (AL-Okaily, 2016 ).

  6. Molecular characterization of genome segments 1 and 3 encoding two capsid proteins of Antheraea mylitta cytoplasmic polyhedrosis virus

    Directory of Open Access Journals (Sweden)

    Chakrabarti Mrinmay

    2010-08-01

    Full Text Available Abstract Background Antheraea mylitta cytoplasmic polyhedrosis virus (AmCPV, a cypovirus of Reoviridae family, infects Indian non-mulberry silkworm, Antheraea mylitta, and contains 11 segmented double stranded RNA (S1-S11 in its genome. Some of its genome segments (S2 and S6-S11 have been previously characterized but genome segments encoding viral capsid have not been characterized. Results In this study genome segments 1 (S1 and 3 (S3 of AmCPV were converted to cDNA, cloned and sequenced. S1 consisted of 3852 nucleotides, with one long ORF of 3735 nucleotides and could encode a protein of 1245 amino acids with molecular mass of ~141 kDa. Similarly, S3 consisted of 3784 nucleotides having a long ORF of 3630 nucleotides and could encode a protein of 1210 amino acids with molecular mass of ~137 kDa. BLAST analysis showed 20-22% homology of S1 and S3 sequence with spike and capsid proteins, respectively, of other closely related cypoviruses like Bombyx mori CPV (BmCPV, Lymantria dispar CPV (LdCPV, and Dendrolimus punctatus CPV (DpCPV. The ORFs of S1 and S3 were expressed as 141 kDa and 137 kDa insoluble His-tagged fusion proteins, respectively, in Escherichia coli M15 cells via pQE-30 vector, purified through Ni-NTA chromatography and polyclonal antibodies were raised. Immunoblot analysis of purified polyhedra, virion particles and virus infected mid-gut cells with the raised anti-p137 and anti-p141 antibodies showed specific immunoreactive bands and suggest that S1 and S3 may code for viral structural proteins. Expression of S1 and S3 ORFs in insect cells via baculovirus recombinants showed to produce viral like particles (VLPs by transmission electron microscopy. Immunogold staining showed that S3 encoded proteins self assembled to form viral outer capsid and VLPs maintained their stability at different pH in presence of S1 encoded protein. Conclusion Our results of cloning, sequencing and functional analysis of AmCPV S1 and S3 indicate that S3

  7. 2D Barcode for DNA Encoding

    OpenAIRE

    Elena Purcaru; Cristian Toma

    2011-01-01

    The paper presents a solution for endcoding/decoding DNA information in 2D barcodes. First part focuses on the existing techniques and symbologies in 2D barcodes field. The 2D barcode PDF417 is presented as starting point. The adaptations and optimizations on PDF417 and on DataMatrix lead to the solution - DNA2DBC - DeoxyriboNucleic Acid Two Dimensional Barcode. The second part shows the DNA2DBC encoding/decoding process step by step. In conclusions are enumerated the most important features ...

  8. Chemical Space of DNA-Encoded Libraries.

    Science.gov (United States)

    Franzini, Raphael M; Randolph, Cassie

    2016-07-28

    In recent years, DNA-encoded chemical libraries (DECLs) have attracted considerable attention as a potential discovery tool in drug development. Screening encoded libraries may offer advantages over conventional hit discovery approaches and has the potential to complement such methods in pharmaceutical research. As a result of the increased application of encoded libraries in drug discovery, a growing number of hit compounds are emerging in scientific literature. In this review we evaluate reported encoded library-derived structures and identify general trends of these compounds in relation to library design parameters. We in particular emphasize the combinatorial nature of these libraries. Generally, the reported molecules demonstrate the ability of this technology to afford hits suitable for further lead development, and on the basis of them, we derive guidelines for DECL design.

  9. Development and Synthesis of DNA-Encoded Benzimidazole Library.

    Science.gov (United States)

    Ding, Yun; Chai, Jing; Centrella, Paolo A; Gondo, Chenaimwoyo; DeLorey, Jennifer L; Clark, Matthew A

    2018-04-25

    Encoded library technology (ELT) is an effective approach to the discovery of novel small-molecule ligands for biological targets. A key factor for the success of the technology is the chemical diversity of the libraries. Here we report the development of DNA-conjugated benzimidazoles. Using 4-fluoro-3-nitrobenzoic acid as a key synthon, we synthesized a 320 million-member DNA-encoded benzimidazole library using Fmoc-protected amino acids, amines and aldehydes as diversity elements. Affinity selection of the library led to the discovery of a novel, potent and specific antagonist of the NK3 receptor.

  10. Characterization and immunological identification of cDNA clones encoding two human DNA topoisomerase II isozymes

    International Nuclear Information System (INIS)

    Chung, T.D.Y.; Drake, F.H.; Tan, K.B.; Per, S.R.; Crooke, S.T.; Mirabelli, C.K.

    1989-01-01

    Several DNA topoisomerase II partial cDNA clones obtained from a human Raji-HN2 cDNA library were sequenced and two classes of nucleotide sequences were found. One member of the first class, SP1, was identical to an internal fragment of human HeLa cell Topo II cDNA described earlier. A member of the second class, SP11, shared extensive nucleotide (75%) and predicted peptide (92%) sequence similarities with the first two-thirds of HeLa Topo II. Each class of cDNAs hybridized to unique, nonoverlapping restriction enzyme fragments of genomic DNA from several human cell lines. Synthetic 24-mer oligonucleotide probes specific for each cDNA class hybridized to 6.5-kilobase mRNAs; furthermore, hybridization of probe specific for one class was not blocked by probe specific for the other. Antibodies raised against a synthetic SP1-encoded dodecapeptide specifically recognized the 170-kDa form of Topo II, while antibodies raised against the corresponding SP11-encoded dodecapeptide, or a second unique SP11-encoded tridecapeptide, selectively recognized the 180-kDa form of Topo II. These data provide genetic and immunochemical evidence for two Topo II isozymes

  11. Identification of a mammalian nuclear factor and human cDNA-encoded proteins that recognize DNA containing apurinic sites

    International Nuclear Information System (INIS)

    Lenz, J.; Okenquist, S.A.; LoSardo, J.E.; Hamilton, K.K.; Doetsch, P.W.

    1990-01-01

    Damage to DNA can have lethal or mutagenic consequences for cells unless it is detected and repaired by cellular proteins. Repair depends on the ability of cellular factors to distinguish the damaged sites. Electrophoretic binding assays were used to identify a factor from the nuclei of mammalian cells that bound to DNA containing apurinic sites. A binding assay based on the use of β-galactosidase fusion proteins was subsequently used to isolate recombinant clones of human cDNAs that encoded apurinic DNA-binding proteins. Two distinct human cDNAs were identified that encoded proteins that bound apurinic DNA preferentially over undamaged, methylated, or UV-irradiated DNA. These approaches may offer a general method for the detection of proteins that recognize various types of DNA damage and for the cloning of genes encoding such proteins

  12. Implementation of digital image encryption algorithm using logistic function and DNA encoding

    Science.gov (United States)

    Suryadi, MT; Satria, Yudi; Fauzi, Muhammad

    2018-03-01

    Cryptography is a method to secure information that might be in form of digital image. Based on past research, in order to increase security level of chaos based encryption algorithm and DNA based encryption algorithm, encryption algorithm using logistic function and DNA encoding was proposed. Digital image encryption algorithm using logistic function and DNA encoding use DNA encoding to scramble the pixel values into DNA base and scramble it in DNA addition, DNA complement, and XOR operation. The logistic function in this algorithm used as random number generator needed in DNA complement and XOR operation. The result of the test show that the PSNR values of cipher images are 7.98-7.99 bits, the entropy values are close to 8, the histogram of cipher images are uniformly distributed and the correlation coefficient of cipher images are near 0. Thus, the cipher image can be decrypted perfectly and the encryption algorithm has good resistance to entropy attack and statistical attack.

  13. A Novel Image Encryption Algorithm Based on DNA Encoding and Spatiotemporal Chaos

    Directory of Open Access Journals (Sweden)

    Chunyan Song

    2015-10-01

    Full Text Available DNA computing based image encryption is a new, promising field. In this paper, we propose a novel image encryption scheme based on DNA encoding and spatiotemporal chaos. In particular, after the plain image is primarily diffused with the bitwise Exclusive-OR operation, the DNA mapping rule is introduced to encode the diffused image. In order to enhance the encryption, the spatiotemporal chaotic system is used to confuse the rows and columns of the DNA encoded image. The experiments demonstrate that the proposed encryption algorithm is of high key sensitivity and large key space, and it can resist brute-force attack, entropy attack, differential attack, chosen-plaintext attack, known-plaintext attack and statistical attack.

  14. Molecular cloning of growth hormone encoding cDNA of Indian

    Indian Academy of Sciences (India)

    A modified rapid amplification of cDNA ends (RACE) strategy has been developed for cloning highly conserved cDNA sequences. Using this modified method, the growth hormone (GH) encoding cDNA sequences of Labeo rohita, Cirrhina mrigala and Catla catla have been cloned, characterized and overexpressed in ...

  15. Molecular dynamics simulations of the adsorption of DNA segments onto graphene oxide

    International Nuclear Information System (INIS)

    Chen, Junlang; Chen, Shude; Chen, Liang; Wang, Yu

    2014-01-01

    Molecular dynamics simulations were performed to investigate the dynamic process of DNA segments’ adsorption on graphene oxide (GO) in aqueous solution. We find that DNA segments finally ‘stand on’ GO’s surface. Due to energy penalty and electrostatic repulsion, DNA segments cannot lie on the surface of GO with their helical axes parallel to GO’s surface. Both π–π stacking and electrostatic interactions contribute to their binding affinity between the contacting basepair and GO. The results are of great importance to understand the interactions between DNA segments and GO. (paper)

  16. DNA-encoded libraries - an efficient small molecule discovery technology for the biomedical sciences.

    Science.gov (United States)

    Kunig, Verena; Potowski, Marco; Gohla, Anne; Brunschweiger, Andreas

    2018-06-27

    DNA-encoded compound libraries are a highly attractive technology for the discovery of small molecule protein ligands. These compound collections consist of small molecules covalently connected to individual DNA sequences carrying readable information about the compound structure. DNA-tagging allows for efficient synthesis, handling and interrogation of vast numbers of chemically synthesized, drug-like compounds. They are screened on proteins by an efficient, generic assay based on Darwinian principles of selection. To date, selection of DNA-encoded libraries allowed for the identification of numerous bioactive compounds. Some of these compounds uncovered hitherto unknown allosteric binding sites on target proteins; several compounds proved their value as chemical biology probes unraveling complex biology; and the first examples of clinical candidates that trace their ancestry to a DNA-encoded library were reported. Thus, DNA-encoded libraries proved their value for the biomedical sciences as a generic technology for the identification of bioactive drug-like molecules numerous times. However, large scale experiments showed that even the selection of billions of compounds failed to deliver bioactive compounds for the majority of proteins in an unbiased panel of target proteins. This raises the question of compound library design.

  17. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Namhai Chua; Kush, A.

    1993-02-16

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids.

  18. DNA-encoded chemical libraries: advancing beyond conventional small-molecule libraries.

    Science.gov (United States)

    Franzini, Raphael M; Neri, Dario; Scheuermann, Jörg

    2014-04-15

    DNA-encoded chemical libraries (DECLs) represent a promising tool in drug discovery. DECL technology allows the synthesis and screening of chemical libraries of unprecedented size at moderate costs. In analogy to phage-display technology, where large antibody libraries are displayed on the surface of filamentous phage and are genetically encoded in the phage genome, DECLs feature the display of individual small organic chemical moieties on DNA fragments serving as amplifiable identification barcodes. The DNA-tag facilitates the synthesis and allows the simultaneous screening of very large sets of compounds (up to billions of molecules), because the hit compounds can easily be identified and quantified by PCR-amplification of the DNA-barcode followed by high-throughput DNA sequencing. Several approaches have been used to generate DECLs, differing both in the methods used for library encoding and for the combinatorial assembly of chemical moieties. For example, DECLs can be used for fragment-based drug discovery, displaying a single molecule on DNA or two chemical moieties at the extremities of complementary DNA strands. DECLs can vary substantially in the chemical structures and the library size. While ultralarge libraries containing billions of compounds have been reported containing four or more sets of building blocks, also smaller libraries have been shown to be efficient for ligand discovery. In general, it has been found that the overall library size is a poor predictor for library performance and that the number and diversity of the building blocks are rather important indicators. Smaller libraries consisting of two to three sets of building blocks better fulfill the criteria of drug-likeness and often have higher quality. In this Account, we present advances in the DECL field from proof-of-principle studies to practical applications for drug discovery, both in industry and in academia. DECL technology can yield specific binders to a variety of target

  19. Horse cDNA clones encoding two MHC class I genes

    Energy Technology Data Exchange (ETDEWEB)

    Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.

    1994-12-31

    Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

  20. Cloning of Salmonella typhimurium DNA encoding mutagenic DNA repair

    International Nuclear Information System (INIS)

    Thomas, S.M.; Sedgwick, S.G.

    1989-01-01

    Mutagenic DNA repair in Escherichia coli is encoded by the umuDC operon. Salmonella typhimurium DNA which has homology with E. coli umuC and is able to complement E. coli umuC122::Tn5 and umuC36 mutations has been cloned. Complementation of umuD44 mutants and hybridization with E. coli umuD also occurred, but these activities were much weaker than with umuC. Restriction enzyme mapping indicated that the composition of the cloned fragment is different from the E. coli umuDC operon. Therefore, a umu-like function of S. typhimurium has been found; the phenotype of this function is weaker than that of its E. coli counterpart, which is consistent with the weak mutagenic response of S. typhimurium to UV compared with the response in E. coli

  1. Spectral entropy criteria for structural segmentation in genomic DNA sequences

    International Nuclear Information System (INIS)

    Chechetkin, V.R.; Lobzin, V.V.

    2004-01-01

    The spectral entropy is calculated with Fourier structure factors and characterizes the level of structural ordering in a sequence of symbols. It may efficiently be applied to the assessment and reconstruction of the modular structure in genomic DNA sequences. We present the relevant spectral entropy criteria for the local and non-local structural segmentation in DNA sequences. The results are illustrated with the model examples and analysis of intervening exon-intron segments in the protein-coding regions

  2. Cloning, sequencing and expression of cDNA encoding growth ...

    Indian Academy of Sciences (India)

    Unknown

    of medicine, animal husbandry, fish farming and animal ..... northern pike (Esox lucius) growth hormone; Mol. Mar. Biol. ... prolactin 1-luciferase fusion gene in African catfish and ... 1988 Cloning and sequencing of cDNA that encodes goat.

  3. Novel p38α MAP kinase inhibitors identified from yoctoReactor DNA-encoded small molecule library

    DEFF Research Database (Denmark)

    Petersen, L. K.; Blakskjær, P.; Chaikuad, A.

    2016-01-01

    A highly specific and potent (7 nM cellular IC50) inhibitor of p38α kinase was identified directly from a 12.6 million membered DNA-encoded small molecule library. This was achieved using the high fidelity yoctoReactor technology (yR) for preparing the DNA-encoded library, and a homogeneous...... interactions. Moreover, the crystal structure showed, that although buried in the p38α active site, the original DNA attachment point of the compound was accessible through a channel created by the distorted P-loop conformation. This study demonstrates the usability of DNA-encoded library technologies...

  4. Isolation and characterisation of the cDNA encoding a glycosylated accessory protein of pea chloroplast DNA polymerase.

    OpenAIRE

    Gaikwad, A; Tewari, K K; Kumar, D; Chen, W; Mukherjee, S K

    1999-01-01

    The cDNA encoding p43, a DNA binding protein from pea chloroplasts (ct) that binds to cognate DNA polymerase and stimulates the polymerase activity, has been cloned and characterised. The characteristic sequence motifs of hydroxyproline-rich glyco-proteins (HRGP) are present in the cDNA corres-ponding to the N-terminal domain of the mature p43. The protein was found to be highly O-arabinosylated. Chemically deglycosylated p43 (i.e. p29) retains its binding to both DNA and pea ct-DNA polymeras...

  5. DNA probes

    International Nuclear Information System (INIS)

    Castelino, J.

    1992-01-01

    The creation of DNA probes for detection of specific nucleotide segments differs from ligand detection in that it is a chemical rather than an immunological reaction. Complementary DNA or RNA is used in place of the antibody and is labelled with 32 P. So far, DNA probes have been successfully employed in the diagnosis of inherited disorders, infectious diseases, and for identification of human oncogenes. The latest approach to the diagnosis of communicable and parasitic infections is based on the use of deoxyribonucleic acid (DNA) probes. The genetic information of all cells is encoded by DNA and DNA probe approach to identification of pathogens is unique because the focus of the method is the nucleic acid content of the organism rather than the products that the nucleic acid encodes. Since every properly classified species has some unique nucleotide sequences that distinguish it from every other species, each organism's genetic composition is in essence a finger print that can be used for its identification. In addition to this specificity, DNA probes offer other advantages in that pathogens may be identified directly in clinical specimens

  6. Recombinant DNA specifying the human amyloid. beta. precursor protein (ABPP) encodes a 95-kDa polypeptide

    Energy Technology Data Exchange (ETDEWEB)

    Mita, S; Sadlock, J; Herbert, J; Schon, E A

    1988-10-11

    Although the ABPP gene give rise to multiple mRNAs, the primary translation product of this gene is unknown. The longest published cDNA sequences predict a 770-aa polypeptide of 87 kDa. However, in immunoblots, ABPP migrated as a single species of >92 kDa in rat brain, and in human, as a species of 95-100 kDa in non-membrane bound form, as multiple species of 110-135 kDa in membrane-associated form and as a 130-kDa species in fibroblasts. The sizes of these larger species relative to the MW of ABPP predicted from the cDNA sequences have been attributed to postranslational modification. However, the authors have isolated a cDNA (lambdaHAP2) from a human fetal muscle lambdagt11 cDNA library encoding an 843-aa polypeptide with a deduced MW of 94,642. This cDNA contains both exons encoding an 843-aa polypeptide with a deduced MW of 94.642. This cDNA contains both exons encoding the protease inhibitor domains. Primer extension analysis indicates that the 5' terminus of this cDNA is 14 nt from a transcriptional start site. This cDNA, encoding the longest ABPP described to date, may explain some of the observations on the sizes of tissue-derived ABPP.

  7. Enhanced immunogenicity of DNA fusion vaccine encoding secreted hepatitis B surface antigen and chemokine RANTES

    International Nuclear Information System (INIS)

    Kim, Seung Jo; Suh, Dongchul; Park, Sang Eun; Park, Jeong-Sook; Byun, Hyang-Min; Lee, Chan; Lee, Sun Young; Kim, Inho; Oh, Yu-Kyoung

    2003-01-01

    To increase the potency of DNA vaccines, we constructed genetic fusion vaccines encoding antigen, secretion signal, and/or chemokine RANTES. The DNA vaccines encoding secreted hepatitis B surface antigen (HBsAg) were constructed by inserting HBsAg gene into an expression vector with an endoplasmic reticulum (ER)-targeting secretory signal sequence. The plasmid encoding secretory HBsAg (pER/HBs) was fused to cDNA of RANTES, generating pER/HBs/R. For comparison, HBsAg genes were cloned into pVAX1 vector with no signal sequence (pHBs), and further linked to the N-terminus of RANTES (pHBs/R). Immunofluorescence study showed the cytoplasmic localization of HBsAg protein expressed from pHBs and pHBs/R, but not from pER/HBs and pER/HBs/R at 48 h after transfection. In mice, RANTES-fused DNA vaccines more effectively elicited the levels of HBsAg-specific IgG antibodies than pHBs. All the DNA vaccines induced higher levels of IgG 2a rather than IgG 1 antibodies. Of RANTES-fused vaccines, pER/HBs/R encoding the secreted fusion protein revealed much higher humoral and CD8 + T cell-stimulating responses compared to pHBs/R. These results suggest that the immunogenicity of DNA vaccines could be enhanced by genetic fusion to a secretory signal peptide sequence and RANTES

  8. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

    1993-02-16

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a pu GOVERNMENT RIGHTS This application was funded under Department of Energy Contract DE-AC02-76ER01338. The U.S. Government has certain rights under this application and any patent issuing thereon.

  9. Cloning and sequencing of cDNA encoding human DNA topoisomerase II and localization of the gene to chromosome region 17q21-22

    International Nuclear Information System (INIS)

    Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.

    1988-01-01

    Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes

  10. Segmentation of tumor ultrasound image in HIFU therapy based on texture and boundary encoding

    International Nuclear Information System (INIS)

    Zhang, Dong; Xu, Menglong; Quan, Long; Yang, Yan; Qin, Qianqing; Zhu, Wenbin

    2015-01-01

    It is crucial in high intensity focused ultrasound (HIFU) therapy to detect the tumor precisely with less manual intervention for enhancing the therapy efficiency. Ultrasound image segmentation becomes a difficult task due to signal attenuation, speckle effect and shadows. This paper presents an unsupervised approach based on texture and boundary encoding customized for ultrasound image segmentation in HIFU therapy. The approach oversegments the ultrasound image into some small regions, which are merged by using the principle of minimum description length (MDL) afterwards. Small regions belonging to the same tumor are clustered as they preserve similar texture features. The mergence is completed by obtaining the shortest coding length from encoding textures and boundaries of these regions in the clustering process. The tumor region is finally selected from merged regions by a proposed algorithm without manual interaction. The performance of the method is tested on 50 uterine fibroid ultrasound images from HIFU guiding transducers. The segmentations are compared with manual delineations to verify its feasibility. The quantitative evaluation with HIFU images shows that the mean true positive of the approach is 93.53%, the mean false positive is 4.06%, the mean similarity is 89.92%, the mean norm Hausdorff distance is 3.62% and the mean norm maximum average distance is 0.57%. The experiments validate that the proposed method can achieve favorable segmentation without manual initialization and effectively handle the poor quality of the ultrasound guidance image in HIFU therapy, which indicates that the approach is applicable in HIFU therapy. (paper)

  11. Interaction of carbon nano tubes with DNA segments

    International Nuclear Information System (INIS)

    Peressinotto, Valdirene Sullas Teixeira

    2007-01-01

    Single- and double-stranded DNA (deoxyribonucleic acid) molecules can strongly bind to single-walled carbon nanotubes (SWNT) via non-covalent interactions. Under certain conditions, the DNA molecule spontaneously self-assembles into a helical wrapping around the tubular structure of the carbon nanotubes to form DNA/SWNT hybrids, which are both stable and soluble in water. This system has recently received extensive attention, since, besides rendering SWNTs dispersible in water as individual tubes, the DNA hybrids are very promising candidates for many applications in nanotechnology and molecular biology. All the possible applications for DNA-SWNT hybrids require, however, a fully understanding of DNA-nanotube wrapping mechanism which is still lacking in the literature. In this context, the aim of this work was to investigate the non-covalent interaction in aqueous medium between SWNTs and synthetic DNA segments having a known nucleotide sequence. Initially, the study was focused on poly d(GT)n sequences (n = 10, 30 and 45) that contain a sequence of alternating guanine and thymine bases and for which the efficiency to disperse and separate carbon nanotubes has already been demonstrated. Besides the size of GT sequences, the effects of ionic strength and pH in the interaction were also investigated. Afterwards, we studied the interaction of SWNT with DNA molecules that contain only a single type of nitrogenous base (DNA homopolymers), which has not been reported in details in the literature. We investigated homopolymers of poly dA 20 , poly dT 20 , poly dC 20 and the duplex poly dA 20 :dT 20 . Most of the study was carried out with small-diameter HiPco SWNTs (with diameters between 0.7 and 1.2 nm). In some studies, SWNTs with diameter around 1.4 nm, synthesized via laser ablation and arc-discharge methods, were also investigated. The arc-discharge nanotubes used in this study were functionalized with carboxylic groups (-COOH) due to their purification using strong

  12. Attenuation of pathogenic Rift Valley fever virus strain through the chimeric S-segment encoding sandfly fever phlebovirus NSs or a dominant-negative PKR.

    Science.gov (United States)

    Nishiyama, Shoko; Slack, Olga A L; Lokugamage, Nandadeva; Hill, Terence E; Juelich, Terry L; Zhang, Lihong; Smith, Jennifer K; Perez, David; Gong, Bin; Freiberg, Alexander N; Ikegami, Tetsuro

    2016-11-16

    Rift Valley fever is a mosquito-borne zoonotic disease affecting ruminants and humans. Rift Valley fever virus (RVFV: family Bunyaviridae, genus Phlebovirus) causes abortions and fetal malformations in ruminants, and hemorrhagic fever, encephalitis, or retinitis in humans. The live-attenuated MP-12 vaccine is conditionally licensed for veterinary use in the US. However, this vaccine lacks a marker for the differentiation of vaccinated from infected animals (DIVA). NSs gene is dispensable for RVFV replication, and thus, rMP-12 strains lacking NSs gene is applicable to monitor vaccinated animals. However, the immunogenicity of MP-12 lacking NSs was not as high as parental MP-12. Thus, chimeric MP-12 strains encoding NSs from either Toscana virus (TOSV), sandfly fever Sicilian virus (SFSV) or Punta Toro virus Adames strain (PTA) were characterized previously. Although chimeric MP-12 strains are highly immunogenic, the attenuation through the S-segment remains unknown. Using pathogenic ZH501 strain, we aimed to demonstrate the attenuation of ZH501 strain through chimeric S-segment encoding either the NSs of TOSV, SFSV, PTA, or Punta Toro virus Balliet strain (PTB). In addition, we characterized rZH501 encoding a human dominant-negative PKR (PKRΔE7), which also enhances the immunogenicity of MP-12. Study done on mice revealed that attenuation of rZH501 occurred through the S-segment encoding either PKRΔE7 or SFSV NSs. However, rZH501 encoding either TOSV, PTA, or PTB NSs in the S-segment uniformly caused lethal encephalitis. Our results indicated that the S-segments encoding PKRΔE7 or SFSV NSs are attenuated and thus applicable toward next generation MP-12 vaccine candidates that encode a DIVA marker.

  13. DNA probes

    Energy Technology Data Exchange (ETDEWEB)

    Castelino, J

    1993-12-31

    The creation of DNA probes for detection of specific nucleotide segments differs from ligand detection in that it is a chemical rather than an immunological reaction. Complementary DNA or RNA is used in place of the antibody and is labelled with {sup 32}P. So far, DNA probes have been successfully employed in the diagnosis of inherited disorders, infectious diseases, and for identification of human oncogenes. The latest approach to the diagnosis of communicable and parasitic infections is based on the use of deoxyribonucleic acid (DNA) probes. The genetic information of all cells is encoded by DNA and DNA probe approach to identification of pathogens is unique because the focus of the method is the nucleic acid content of the organism rather than the products that the nucleic acid encodes. Since every properly classified species has some unique nucleotide sequences that distinguish it from every other species, each organism`s genetic composition is in essence a finger print that can be used for its identification. In addition to this specificity, DNA probes offer other advantages in that pathogens may be identified directly in clinical specimens 10 figs, 2 tabs

  14. A Novel Audio Cryptosystem Using Chaotic Maps and DNA Encoding

    Directory of Open Access Journals (Sweden)

    S. J. Sheela

    2017-01-01

    Full Text Available Chaotic maps have good potential in security applications due to their inherent characteristics relevant to cryptography. This paper introduces a new audio cryptosystem based on chaotic maps, hybrid chaotic shift transform (HCST, and deoxyribonucleic acid (DNA encoding rules. The scheme uses chaotic maps such as two-dimensional modified Henon map (2D-MHM and standard map. The 2D-MHM which has sophisticated chaotic behavior for an extensive range of control parameters is used to perform HCST. DNA encoding technology is used as an auxiliary tool which enhances the security of the cryptosystem. The performance of the algorithm is evaluated for various speech signals using different encryption/decryption quality metrics. The simulation and comparison results show that the algorithm can achieve good encryption results and is able to resist several cryptographic attacks. The various types of analysis revealed that the algorithm is suitable for narrow band radio communication and real-time speech encryption applications.

  15. Molecular cloning and sequence of cDNA encoding the plasma membrane proton pump (H+-ATPase) of Arabidopsis thaliana

    International Nuclear Information System (INIS)

    Harper, J.F.; Surowy, T.K.; Sussman, M.R.

    1989-01-01

    In plants, the transport of solutes across the plasma membrane is driven by a proton pump (H + -ATPase) that produces an electric potential and pH gradient. The authors isolated and sequenced a full-length cDNA clone that encodes this enzyme in Arabidopsis thaliana. The protein predicted from its nucleotide sequence encodes 959 amino acids and has a molecular mass of 104,207 Da. The plant protein shows structural features common to a family of cation-translocating ATPases found in the plasma membrane of prokaryotic and eukaryotic cells, with the greatest overall identity in amino acid sequence (36%) to the H + -ATPase observed in the plasma membrane of fungi. The structure predicted from a hydropathy plant contains at least eight transmembrane segments, with most of the protein (73%) extending into the cytoplasm and only 5% of the residues exposed on the external surface. Unique features of the plant enzyme include diverged sequences at the amino and carboxyl termini as well as greater hydrophilic character in three extracellular loops

  16. Multi-Probe Based Artificial DNA Encoding and Matching Classifier for Hyperspectral Remote Sensing Imagery

    Directory of Open Access Journals (Sweden)

    Ke Wu

    2016-08-01

    Full Text Available In recent years, a novel matching classification strategy inspired by the artificial deoxyribonucleic acid (DNA technology has been proposed for hyperspectral remote sensing imagery. Such a method can describe brightness and shape information of a spectrum by encoding the spectral curve into a DNA strand, providing a more comprehensive way for spectral similarity comparison. However, it suffers from two problems: data volume is amplified when all of the bands participate in the encoding procedure and full-band comparison degrades the importance of bands carrying key information. In this paper, a new multi-probe based artificial DNA encoding and matching (MADEM method is proposed. In this method, spectral signatures are first transformed into DNA code words with a spectral feature encoding operation. After that, multiple probes for interesting classes are extracted to represent the specific fragments of DNA strands. During the course of spectral matching, the different probes are compared to obtain the similarity of different types of land covers. By computing the absolute vector distance (AVD between different probes of an unclassified spectrum and the typical DNA code words from the database, the class property of each pixel is set as the minimum distance class. The main benefit of this strategy is that the risk of redundant bands can be deeply reduced and critical spectral discrepancies can be enlarged. Two hyperspectral image datasets were tested. Comparing with the other classification methods, the overall accuracy can be improved from 1.22% to 10.09% and 1.19% to 15.87%, respectively. Furthermore, the kappa coefficient can be improved from 2.05% to 15.29% and 1.35% to 19.59%, respectively. This demonstrated that the proposed algorithm outperformed other traditional classification methods.

  17. Molecular cloning and expression of cDNA encoding a lumenal calcium binding glycoprotein from sarcoplasmic reticulum

    International Nuclear Information System (INIS)

    Leberer, E.; Charuk, J.H.M.; MacLennan, D.H.; Green, N.M.

    1989-01-01

    Antibody screening was used to isolate a cDNA encoding the 160-kDa glycoprotein of rabbit skeletal muscle sarcoplasmic reticulum. The cDNA is identical to that encoding the 53-kDa glycoprotein except that it contains an in-frame insertion of 1,308 nucleotides near its 5' end, apparently resulting from alternative splicing. The protein encoded by the cDNA would contain a 19-residue NH 2 -terminal signal sequence and a 453-residue COOH-terminal sequence identical to the 53-kDa glycoprotein. It would also contain a 436-amino acid insert between these sequences. This insert would be highly acidic, suggesting that it might bind Ca 2+ . The purified 160-kDa glycoprotein and the glycoprotein expressed in COS-1 cells transfected with cDNA encoding the 160-kDa glycoprotein were shown to bind 45 C 2+ in a gel overlay assay. The protein was shown to be located in the lumen of the sarcoplasmic reticulum and to be associated through Ca 2+ with the membrane. The authors propose that this lumenal Ca 2+ binding glycoprotein of the sarcoplasmic reticulum be designated sarcalumenin

  18. Non-canonical ribosomal DNA segments in the human genome, and nucleoli functioning.

    Science.gov (United States)

    Kupriyanova, Natalia S; Netchvolodov, Kirill K; Sadova, Anastasia A; Cherepanova, Marina D; Ryskov, Alexei P

    2015-11-10

    Ribosomal DNA (rDNA) in the human genome is represented by tandem repeats of 43 kb nucleotide sequences that form nucleoli organizers (NORs) on each of five pairs of acrocentric chromosomes. RDNA-similar segments of different lengths are also present on (NOR)(-) chromosomes. Many of these segments contain nucleotide substitutions, supplementary microsatellite clusters, and extended deletions. Recently, it was shown that, in addition to ribosome biogenesis, nucleoli exhibit additional functions, such as cell-cycle regulation and response to stresses. In particular, several stress-inducible loci located in the ribosomal intergenic spacer (rIGS) produce stimuli-specific noncoding nucleolus RNAs. By mapping the 5'/3' ends of the rIGS segments scattered throughout (NOR)(-) chromosomes, we discovered that the bonds in the rIGS that were most often susceptible to disruption in the rIGS were adjacent to, or overlapped with stimuli-specific inducible loci. This suggests the interconnection of the two phenomena - nucleoli functioning and the scattering of rDNA-like sequences on (NOR)(-) chromosomes. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Expression analysis of a ''Cucurbita'' cDNA encoding endonuclease

    International Nuclear Information System (INIS)

    Szopa, J.

    1995-01-01

    The nuclear matrices of plant cell nuclei display intrinsic nuclease activity which consists in nicking supercoiled DNA. A cDNA encoding a 32 kDa endonuclease has been cloned and sequenced. The nucleotide and deduced amino-acid sequences show high homology to known 14-3-3-protein sequences from other sources. The amino-acid sequence shows agreement with consensus sequences for potential phosphorylation by protein kinase A and C and for calcium, lipid and membrane-binding sites. The nucleotide-binding site is also present within the conserved part of the sequence. By Northern blot analysis, the differential expression of the corresponding mRNA was detected; it was the strongest in sink tissues. The endonuclease activity found on DNA-polyacrylamide gel electrophoresis coincided with mRNA content and was the highest in tuber. (author). 22 refs, 6 figs

  20. Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

    Directory of Open Access Journals (Sweden)

    Zuiter Afnan

    2012-08-01

    Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

  1. Molecular species identification of Central European ground beetles (Coleoptera: Carabidae using nuclear rDNA expansion segments and DNA barcodes

    Directory of Open Access Journals (Sweden)

    Raupach Michael J

    2010-09-01

    Full Text Available Abstract Background The identification of vast numbers of unknown organisms using DNA sequences becomes more and more important in ecological and biodiversity studies. In this context, a fragment of the mitochondrial cytochrome c oxidase I (COI gene has been proposed as standard DNA barcoding marker for the identification of organisms. Limitations of the COI barcoding approach can arise from its single-locus identification system, the effect of introgression events, incomplete lineage sorting, numts, heteroplasmy and maternal inheritance of intracellular endosymbionts. Consequently, the analysis of a supplementary nuclear marker system could be advantageous. Results We tested the effectiveness of the COI barcoding region and of three nuclear ribosomal expansion segments in discriminating ground beetles of Central Europe, a diverse and well-studied invertebrate taxon. As nuclear markers we determined the 18S rDNA: V4, 18S rDNA: V7 and 28S rDNA: D3 expansion segments for 344 specimens of 75 species. Seventy-three species (97% of the analysed species could be accurately identified using COI, while the combined approach of all three nuclear markers provided resolution among 71 (95% of the studied Carabidae. Conclusion Our results confirm that the analysed nuclear ribosomal expansion segments in combination constitute a valuable and efficient supplement for classical DNA barcoding to avoid potential pitfalls when only mitochondrial data are being used. We also demonstrate the high potential of COI barcodes for the identification of even closely related carabid species.

  2. Molecular species identification of Central European ground beetles (Coleoptera: Carabidae) using nuclear rDNA expansion segments and DNA barcodes.

    Science.gov (United States)

    Raupach, Michael J; Astrin, Jonas J; Hannig, Karsten; Peters, Marcell K; Stoeckle, Mark Y; Wägele, Johann-Wolfgang

    2010-09-13

    The identification of vast numbers of unknown organisms using DNA sequences becomes more and more important in ecological and biodiversity studies. In this context, a fragment of the mitochondrial cytochrome c oxidase I (COI) gene has been proposed as standard DNA barcoding marker for the identification of organisms. Limitations of the COI barcoding approach can arise from its single-locus identification system, the effect of introgression events, incomplete lineage sorting, numts, heteroplasmy and maternal inheritance of intracellular endosymbionts. Consequently, the analysis of a supplementary nuclear marker system could be advantageous. We tested the effectiveness of the COI barcoding region and of three nuclear ribosomal expansion segments in discriminating ground beetles of Central Europe, a diverse and well-studied invertebrate taxon. As nuclear markers we determined the 18S rDNA: V4, 18S rDNA: V7 and 28S rDNA: D3 expansion segments for 344 specimens of 75 species. Seventy-three species (97%) of the analysed species could be accurately identified using COI, while the combined approach of all three nuclear markers provided resolution among 71 (95%) of the studied Carabidae. Our results confirm that the analysed nuclear ribosomal expansion segments in combination constitute a valuable and efficient supplement for classical DNA barcoding to avoid potential pitfalls when only mitochondrial data are being used. We also demonstrate the high potential of COI barcodes for the identification of even closely related carabid species.

  3. Convolutional encoder-decoder for breast mass segmentation in digital breast tomosynthesis

    Science.gov (United States)

    Zhang, Jun; Ghate, Sujata V.; Grimm, Lars J.; Saha, Ashirbani; Cain, Elizabeth Hope; Zhu, Zhe; Mazurowski, Maciej A.

    2018-02-01

    Digital breast tomosynthesis (DBT) is a relatively new modality for breast imaging that can provide detailed assessment of dense tissue within the breast. In the domains of cancer diagnosis, radiogenomics, and resident education, it is important to accurately segment breast masses. However, breast mass segmentation is a very challenging task, since mass regions have low contrast difference between their neighboring tissues. Notably, the task might become more difficult in cases that were assigned BI-RADS 0 category since this category includes many lesions that are of low conspicuity and locations that were deemed to be overlapping normal tissue upon further imaging and were not sent to biopsy. Segmentation of such lesions is of particular importance in the domain of reader performance analysis and education. In this paper, we propose a novel deep learning-based method for segmentation of BI-RADS 0 lesions in DBT. The key components of our framework are an encoding path for local-to-global feature extraction, and a decoding patch to expand the images. To address the issue of limited training data, in the training stage, we propose to sample patches not only in mass regions but also in non-mass regions. We utilize a Dice-like loss function in the proposed network to alleviate the class-imbalance problem. The preliminary results on 40 subjects show promise of our method. In addition to quantitative evaluation of the method, we present a visualization of the results that demonstrate both the performance of the algorithm as well as the difficulty of the task at hand.

  4. Sequence of a cloned cDNA encoding human ribosomal protein S11

    Energy Technology Data Exchange (ETDEWEB)

    Lott, J B; Mackie, G A

    1988-02-11

    The authors have isolated a cloned cDNA that encodes human ribosomal protein (rp) S11 by screening a human fibroblast cDNA library with a labelled 204 bp DNA fragment encompassing residues 212-416 of pRS11, a rat rp Sll cDNA clone. The human rp S11 cloned cDNA consists of 15 residues of the 5' leader, the entire coding sequence and all 51 residues of the 3' untranslated region. The predicted amino acid sequence of 158 residues is identical to rat rpS11. The nucleotide sequence in the coding region differs, however, from that in rat in the first position in two codons and in the third position in 44 codons.

  5. Isolation, nucleotide sequence and expression of a cDNA encoding feline granulocyte colony-stimulating factor.

    Science.gov (United States)

    Dunham, S P; Onions, D E

    2001-06-21

    A cDNA encoding feline granulocyte colony stimulating factor (fG-CSF) was cloned from alveolar macrophages using the reverse transcriptase-polymerase chain reaction. The cDNA is 949 bp in length and encodes a predicted mature protein of 174 amino acids. Recombinant fG-CSF was expressed as a glutathione S-transferase fusion and purified by affinity chromatography. Biological activity of the recombinant protein was demonstrated using the murine myeloblastic cell line GNFS-60, which showed an ED50 for fG-CSF of approximately 2 ng/ml. Copyright 2001 Academic Press.

  6. Characterization of cDNA encoding human placental anticoagulant protein (PP4): Homology with the lipocortin family

    International Nuclear Information System (INIS)

    Grundmann, U.; Abel, K.J.; Bohn, H.; Loebermann, H.; Lottspeich, F.; Kuepper, H.

    1988-01-01

    A cDNA library prepared from human placenta was screened for sequences encoding the placental protein 4 (PP4). PP4 is an anticoagulant protein that acts as an indirect inhibitor of the thromboplastin-specific complex, which is involved in the blood coagulation cascade. Partial amino acid sequence information from PP4-derived cyanogen bromide fragments was used to design three oligonucleotide probes for screening the library. From 10 6 independent recombinants, 18 clones were identified that hybridized to all three probes. These 18 recombinants contained cDNA inserts encoding a protein of 320 amino acid residues. In addition to the PP4 cDNA the authors identified 9 other recombinants encoding a protein with considerable similarity (74%) to PP4, which was termed PP4-X. PP4 and PP4-X belong to the lipocortin family, as judged by their homology to lipocortin I and calpactin I

  7. Enhancement of the priming efficacy of DNA vaccines encoding dendritic cell-targeted antigens by synergistic toll-like receptor ligands

    Directory of Open Access Journals (Sweden)

    Kornbluth Richard S

    2009-08-01

    Full Text Available Abstract Background Targeting of protein antigens to dendritic cells (DC via the DEC205 receptor enhances presentation of antigen-derived peptides on MHC-I and MHC-II molecules and, in the presence of costimulatory signals, antigen-specific immune responses. The immunogenicity and efficacy of DNA vaccination can also be enhanced by fusing the encoded antigen to single chain antibodies directed against DEC205. To further improve this strategy, we evaluated different toll-like receptor ligands (TLR and CD40 ligands (CD40L as adjuvants for DNA vaccines encoding a DEC205-single-chain antibody fused to the ovalbumin model antigen or HIV-1 Gag and assessed the priming efficacy of DNA in a DNA prime adenoviral vector boost immunization regimen. Results Mice were primed with the adjuvanted DEC-205 targeted DNA vaccines and boosted with adenoviral vectors encoding the same antigens. CD8+ T cell responses were determined after the adenoviral booster immunization, to determine how well the different DNA immunization regimens prime for the adenoviral boost. In the absence of adjuvants, targeting of DNA-encoded ovalbumin to DCs suppressed CD8+ T-cell responses after the adenoviral booster immunization. CD8+ T-cell responses to the DEC205 targeted DNA vaccines increased only slightly by adding either the TLR-9 ligand CpG, the TLR-3 ligand Poly I:C, or CD40 ligand expression plasmids. However, the combination of both TLR-ligands led to a strong enhancement of CD8+ T-cell responses compared to a non-targeted DNA vaccine. This finding was confirmed using HIV Gag as antigen. Conclusion Although DNA prime adenoviral vector boost immunizations belong to the strongest inducers of cytotoxic T cell responses in different animal models and humans, the CD8+ T cell responses can be further improved by targeting the DNA encoded antigen to DEC205 in the presence of synergistic TLR ligands CpG and Poly I:C.

  8. Lab-on-a-chip platform for high throughput drug discovery with DNA-encoded chemical libraries

    Science.gov (United States)

    Grünzner, S.; Reddavide, F. V.; Steinfelder, C.; Cui, M.; Busek, M.; Klotzbach, U.; Zhang, Y.; Sonntag, F.

    2017-02-01

    The fast development of DNA-encoded chemical libraries (DECL) in the past 10 years has received great attention from pharmaceutical industries. It applies the selection approach for small molecular drug discovery. Because of the limited choices of DNA-compatible chemical reactions, most DNA-encoded chemical libraries have a narrow structural diversity and low synthetic yield. There is also a poor correlation between the ranking of compounds resulted from analyzing the sequencing data and the affinity measured through biochemical assays. By combining DECL with dynamical chemical library, the resulting DNA-encoded dynamic library (EDCCL) explores the thermodynamic equilibrium of reversible reactions as well as the advantages of DNA encoded compounds for manipulation/detection, thus leads to enhanced signal-to-noise ratio of the selection process and higher library quality. However, the library dynamics are caused by the weak interactions between the DNA strands, which also result in relatively low affinity of the bidentate interaction, as compared to a stable DNA duplex. To take advantage of both stably assembled dual-pharmacophore libraries and EDCCLs, we extended the concept of EDCCLs to heat-induced EDCCLs (hi-EDCCLs), in which the heat-induced recombination process of stable DNA duplexes and affinity capture are carried out separately. To replace the extremely laborious and repetitive manual process, a fully automated device will facilitate the use of DECL in drug discovery. Herein we describe a novel lab-on-a-chip platform for high throughput drug discovery with hi-EDCCL. A microfluidic system with integrated actuation was designed which is able to provide a continuous sample circulation by reducing the volume to a minimum. It consists of a cooled and a heated chamber for constant circulation. The system is capable to generate stable temperatures above 75 °C in the heated chamber to melt the double strands of the DNA and less than 15 °C in the cooled chamber

  9. Biomolecule-to-fluorescent-color encoder: modulation of fluorescence emission via DNA structural changes

    Science.gov (United States)

    Nishimura, Takahiro; Ogura, Yusuke; Yamada, Kenji; Ohno, Yuko; Tanida, Jun

    2014-01-01

    A biomolecule-to-fluorescent-color (B/F) encoder for optical readout of biomolecular information is proposed. In the B/F encoder, a set of fluorescence wavelengths and their intensity levels are used for coding of a biomolecular signal. A hybridization chain reaction of hairpin DNAs labeled with fluorescent reporters was performed to generate the fluorescence color codes. The fluorescence is modulated via fluorescence resonance energy transfer, which is controlled by DNA structural changes. The results demonstrate that fluorescent color codes can be configured based on two wavelengths and five intensities using the B/F encoder, and the assigned codes can be retrieved via fluorescence measurements. PMID:25071950

  10. Wavelet-based Encoding Scheme for Controlling Size of Compressed ECG Segments in Telecardiology Systems.

    Science.gov (United States)

    Al-Busaidi, Asiya M; Khriji, Lazhar; Touati, Farid; Rasid, Mohd Fadlee; Mnaouer, Adel Ben

    2017-09-12

    One of the major issues in time-critical medical applications using wireless technology is the size of the payload packet, which is generally designed to be very small to improve the transmission process. Using small packets to transmit continuous ECG data is still costly. Thus, data compression is commonly used to reduce the huge amount of ECG data transmitted through telecardiology devices. In this paper, a new ECG compression scheme is introduced to ensure that the compressed ECG segments fit into the available limited payload packets, while maintaining a fixed CR to preserve the diagnostic information. The scheme automatically divides the ECG block into segments, while maintaining other compression parameters fixed. This scheme adopts discrete wavelet transform (DWT) method to decompose the ECG data, bit-field preserving (BFP) method to preserve the quality of the DWT coefficients, and a modified running-length encoding (RLE) scheme to encode the coefficients. The proposed dynamic compression scheme showed promising results with a percentage packet reduction (PR) of about 85.39% at low percentage root-mean square difference (PRD) values, less than 1%. ECG records from MIT-BIH Arrhythmia Database were used to test the proposed method. The simulation results showed promising performance that satisfies the needs of portable telecardiology systems, like the limited payload size and low power consumption.

  11. Encoded novel forms of HSP70 or a cytolytic protein increase DNA vaccine potency.

    Science.gov (United States)

    Garrod, Tamsin; Grubor-Bauk, Branka; Yu, Stanley; Gargett, Tessa; Gowans, Eric J

    2014-01-01

    In humans, DNA vaccines have failed to demonstrate the equivalent levels of immunogenicity that were shown in smaller animals. Previous studies have encoded adjuvants, predominantly cytokines, within these vaccines in an attempt to increase antigen-specific immune responses. However, these strategies have lacked breadth of innate immune activation and have led to disappointing results in clinical trials. Damage associated molecular patterns (DAMPs) have been identified as pattern recognition receptor (PRR) agonists. DAMPs can bind to a wide range of PRRs on dendritic cells (DCs) and thus our studies have aimed to utilize this characteristic to act as an adjuvant in a DNA vaccine approach. Specifically, HSP70 has been identified as a DAMP, but has been limited by its lack of accessibility to PRRs in and on DCs. Here, we discuss the promising results achieved with the inclusion of membrane-bound or secreted HSP70 into a DNA vaccine encoding HIV gag as the model immunogen.

  12. Sequence of a cDNA encoding turtle high mobility group 1 protein.

    Science.gov (United States)

    Zheng, Jifang; Hu, Bi; Wu, Duansheng

    2005-07-01

    In order to understand sequence information about turtle HMG1 gene, a cDNA encoding HMG1 protein of the Chinese soft-shell turtle (Pelodiscus sinensis) was amplified by RT-PCR from kidney total RNA, and was cloned, sequenced and analyzed. The results revealed that the open reading frame (ORF) of turtle HMG1 cDNA is 606 bp long. The ORF codifies 202 amino acid residues, from which two DNA-binding domains and one polyacidic region are derived. The DNA-binding domains share higher amino acid identity with homologues sequences of chicken (96.5%) and mammalian (74%) than homologues sequence of rainbow trout (67%). The polyacidic region shows 84.6% amino acid homology with the equivalent region of chicken HMG1 cDNA. Turtle HMG1 protein contains 3 Cys residues located at completely conserved positions. Conservation in sequence and structure suggests that the functions of turtle HMG1 cDNA may be highly conserved during evolution. To our knowledge, this is the first report of HMG1 cDNA sequence in any reptilian.

  13. Molecular mechanisms for protein-encoded inheritance

    Science.gov (United States)

    Wiltzius, Jed J. W.; Landau, Meytal; Nelson, Rebecca; Sawaya, Michael R.; Apostol, Marcin I.; Goldschmidt, Lukasz; Soriaga, Angela B.; Cascio, Duilio; Rajashankar, Kanagalaghatta; Eisenberg, David

    2013-01-01

    Strains are phenotypic variants, encoded by nucleic acid sequences in chromosomal inheritance and by protein “conformations” in prion inheritance and transmission. But how is a protein “conformation” stable enough to endure transmission between cells or organisms? Here new polymorphic crystal structures of segments of prion and other amyloid proteins offer structural mechanisms for prion strains. In packing polymorphism, prion strains are encoded by alternative packings (polymorphs) of β-sheets formed by the same segment of a protein; in a second mechanism, segmental polymorphism, prion strains are encoded by distinct β-sheets built from different segments of a protein. Both forms of polymorphism can produce enduring “conformations,” capable of encoding strains. These molecular mechanisms for transfer of information into prion strains share features with the familiar mechanism for transfer of information by nucleic acid inheritance, including sequence specificity and recognition by non-covalent bonds. PMID:19684598

  14. The DNA-encoded nucleosome organization of a eukaryotic genome.

    Science.gov (United States)

    Kaplan, Noam; Moore, Irene K; Fondufe-Mittendorf, Yvonne; Gossett, Andrea J; Tillo, Desiree; Field, Yair; LeProust, Emily M; Hughes, Timothy R; Lieb, Jason D; Widom, Jonathan; Segal, Eran

    2009-03-19

    Nucleosome organization is critical for gene regulation. In living cells this organization is determined by multiple factors, including the action of chromatin remodellers, competition with site-specific DNA-binding proteins, and the DNA sequence preferences of the nucleosomes themselves. However, it has been difficult to estimate the relative importance of each of these mechanisms in vivo, because in vivo nucleosome maps reflect the combined action of all influencing factors. Here we determine the importance of nucleosome DNA sequence preferences experimentally by measuring the genome-wide occupancy of nucleosomes assembled on purified yeast genomic DNA. The resulting map, in which nucleosome occupancy is governed only by the intrinsic sequence preferences of nucleosomes, is similar to in vivo nucleosome maps generated in three different growth conditions. In vitro, nucleosome depletion is evident at many transcription factor binding sites and around gene start and end sites, indicating that nucleosome depletion at these sites in vivo is partly encoded in the genome. We confirm these results with a micrococcal nuclease-independent experiment that measures the relative affinity of nucleosomes for approximately 40,000 double-stranded 150-base-pair oligonucleotides. Using our in vitro data, we devise a computational model of nucleosome sequence preferences that is significantly correlated with in vivo nucleosome occupancy in Caenorhabditis elegans. Our results indicate that the intrinsic DNA sequence preferences of nucleosomes have a central role in determining the organization of nucleosomes in vivo.

  15. Immunogenicity of DNA vaccines encoding simian immunodeficiency virus antigen targeted to dendritic cells in rhesus macaques.

    Directory of Open Access Journals (Sweden)

    Matthias Tenbusch

    Full Text Available BACKGROUND: Targeting antigens encoded by DNA vaccines to dendritic cells (DCs in the presence of adjuvants enhances their immunogenicity and efficacy in mice. METHODOLOGY/PRINCIPAL FINDINGS: To explore the immunogenicity of this approach in non-human primates, we generated a single chain antibody to the antigen uptake receptor DEC-205 expressed on rhesus macaque DCs. DNA vaccines encoding this single chain antibody fused to the SIV capsid protein were delivered to six monkeys each by either intramuscular electroporation or conventional intramuscular injection co-injected or not with poly ICLC, a stabilized poly I: C analogue, as adjuvant. Antibodies to capsid were induced by the DC-targeting and non-targeting control DNA delivered by electroporation while conventional DNA immunization at a 10-fold higher dose of DNA failed to induce detectable humoral immune responses. Substantial cellular immune responses were also observed after DNA electroporation of both DNAs, but stronger responses were induced by the non-targeting vaccine. Conventional immunization with the DC-targeting DNA at a 10-fold higher dose did not give rise to substantial cellular immune responses, neither when co-injected with poly ICLC. CONCLUSIONS/SIGNIFICANCE: The study confirms the potent immunogenicity of DNA vaccines delivered by electroporation. Targeting the DNA via a single chain antibody to DEC-205 expressed by DCs, however, does not improve the immunogenicity of the antigens in non-human primates.

  16. Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity.

    Science.gov (United States)

    Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K

    2016-02-17

    Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  17. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    2000-07-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  18. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    1999-05-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 12 figs.

  19. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

    1999-05-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  20. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    1995-03-21

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 11 figures.

  1. RNase-L regulates the stability of mitochondrial DNA-encoded mRNAs in mouse embryo fibroblasts

    International Nuclear Information System (INIS)

    Chandrasekaran, Krish; Mehrabian, Zara; Li Xiaoling; Hassel, Bret

    2004-01-01

    Accelerated decrease in the levels of mitochondrial DNA-encoded mRNA (mt-mRNA) occurs in neuronal cells exposed either to the excitatory amino acid, glutamate or to the sodium ionophore, monensin, suggesting a role of mitochondrial RNase(s) on the stability of mt-mRNAs. Here we report that in mouse embryo fibroblasts that are devoid of the interferon-regulated RNase, RNase-L, the monensin-induced decrease in the half-life of mt-mRNA was reduced. In monensin (250 nM)-treated RNase-L +/+ cells the average half-life of mt-mRNA, determined after termination of transcription with actinomycin D, was found to be 3 h, whereas in monensin-treated RNase-L -/- cells the half-life of mt-mRNA was >6 h. In contrast, the stability of nuclear DNA-encoded β-actin mRNA was unaffected. Induction of RNase-L expression in mouse 3T3 fibroblasts further decreased the monensin-induced reduction in mt-mRNA half-life to 1.5 h. The results indicate that the RNase-L-dependent decrease in mtDNA-encoded mRNA transcript levels occurs through a decrease in the half-life of mt-mRNA, and that RNase-L may play a role in the stability of mt-mRNA

  2. Digitally encoded DNA nanostructures for multiplexed, single-molecule protein sensing with nanopores

    Science.gov (United States)

    Bell, Nicholas A. W.; Keyser, Ulrich F.

    2016-07-01

    The simultaneous detection of a large number of different analytes is important in bionanotechnology research and in diagnostic applications. Nanopore sensing is an attractive method in this regard as the approach can be integrated into small, portable device architectures, and there is significant potential for detecting multiple sub-populations in a sample. Here, we show that highly multiplexed sensing of single molecules can be achieved with solid-state nanopores by using digitally encoded DNA nanostructures. Based on the principles of DNA origami, we designed a library of DNA nanostructures in which each member contains a unique barcode; each bit in the barcode is signalled by the presence or absence of multiple DNA dumbbell hairpins. We show that a 3-bit barcode can be assigned with 94% accuracy by electrophoretically driving the DNA structures through a solid-state nanopore. Select members of the library were then functionalized to detect a single, specific antibody through antigen presentation at designed positions on the DNA. This allows us to simultaneously detect four different antibodies of the same isotype at nanomolar concentration levels.

  3. Identification of pummelo cultivars by using a panel of 25 selected SNPs and 12 DNA segments.

    Directory of Open Access Journals (Sweden)

    Bo Wu

    Full Text Available Pummelo cultivars are usually difficult to identify morphologically, especially when fruits are unavailable. The problem was addressed in this study with the use of two methods: high resolution melting analysis of SNPs and sequencing of DNA segments. In the first method, a set of 25 SNPs with high polymorphic information content were selected from SNPs predicted by analyzing ESTs and sequenced DNA segments. High resolution melting analysis was then used to genotype 260 accessions including 55 from Myanmar, and 178 different genotypes were thus identified. A total of 99 cultivars were assigned to 86 different genotypes since the known somatic mutants were identical to their original genotypes at the analyzed SNP loci. The Myanmar samples were genotypically different from each other and from all other samples, indicating they were derived from sexual propagation. Statistical analysis showed that the set of SNPs was powerful enough for identifying at least 1000 pummelo genotypes, though the discrimination power varied in different pummelo groups and populations. In the second method, 12 genomic DNA segments of 24 representative pummelo accessions were sequenced. Analysis of the sequences revealed the existence of a high haplotype polymorphism in pummelo, and statistical analysis showed that the segments could be used as genetic barcodes that should be informative enough to allow reliable identification of 1200 pummelo cultivars. The high level of haplotype diversity and an apparent population structure shown by DNA segments and by SNP genotypes, respectively, were discussed in relation to the origin and domestication of the pummelo species.

  4. Molecular cloning and functional expression of a human cDNA encoding the antimutator enzyme 8-hydroxyguanine-DNA glycosylase

    Science.gov (United States)

    Roldán-Arjona, Teresa; Wei, Ying-Fei; Carter, Kenneth C.; Klungland, Arne; Anselmino, Catherine; Wang, Rui-Ping; Augustus, Meena; Lindahl, Tomas

    1997-01-01

    The major mutagenic base lesion in DNA caused by exposure to reactive oxygen species is 8-hydroxyguanine (8-oxo-7,8-dihydroguanine). In bacteria and Saccharomyces cerevisiae, this damaged base is excised by a DNA glycosylase with an associated lyase activity for chain cleavage. We have cloned, sequenced, and expressed a human cDNA with partial sequence homology to the relevant yeast gene. The encoded 47-kDa human enzyme releases free 8-hydroxyguanine from oxidized DNA and introduces a chain break in a double-stranded oligonucleotide specifically at an 8-hydroxyguanine residue base paired with cytosine. Expression of the human protein in a DNA repair-deficient E. coli mutM mutY strain partly suppresses its spontaneous mutator phenotype. The gene encoding the human enzyme maps to chromosome 3p25. These results show that human cells have an enzyme that can initiate base excision repair at mutagenic DNA lesions caused by active oxygen. PMID:9223306

  5. Characterization of the cDNA encoding human nucleophosmin and studies of its role in normal and abnormal growth

    International Nuclear Information System (INIS)

    Chan, Waiyee; Liu, Qingrong; Borjigin, J.; Busch, H.; Rennert, O.M.; Tease, L.A.; Chan, Puikwong

    1989-01-01

    A cDNA encoding human nucleophosmin (protein B23) was obtained by screening a human placental cDNA library in δgtll first with monoclonal antibody to rat nucleophosmin and then with confirmed partial cDNA of human nucleophosmin as probes. The cDNA had 1,311 bp with a coding sequence encoding a protein of 294 amino acids. The identity of the cDNA was confirmed by the presence of encoded amino acid sequences identical with those determined by sequencing pure rat nucleophosmin (a total of 138 amino acids). The most striking feature of the sequence is an acidic cluster located in the middle of the molecule. The cluster consists of 26 Asp/Glu and 1 Phe and Ala. Comparison of human nucleophosmin and Xenopus nucleolar protein NO38 shows 64.3% sequence identity. The N-terminal 130 amino acids of human nucleophosmin also bear 50% identity with that of Xenopus nucleoplasmin. Northern blot analysis of rat liver total RNA with a partial nucleophosmin cDNA as probe demonstrated a homogeneous mRNA band of about 1.6 kb. Similar observations were made in hypertrophic rat liver and Novikoff hepatoma. When the protein levels were compared with Western blot immunoassays, Navikoff hepatoma showed 20 times more nucleophosmin, while only about 5 times more nucleophosmin was observed in hypertrophic rat liver than in unstimulated normal liver

  6. Identification of the gene encoding the 65-kilodalton DNA-binding protein of herpes simplex virus type 1

    International Nuclear Information System (INIS)

    Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.

    1988-01-01

    Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment

  7. Isolation and characterization of human cDNA clones encoding the α and the α' subunits of casein kinase II

    International Nuclear Information System (INIS)

    Lozeman, F.J.; Litchfield, D.W.; Piening, C.; Takio, Koji; Walsh, K.A.; Krebs, E.G.

    1990-01-01

    Casein kinase II is a widely distributed protein serine/threonine kinase. The holoenzyme appears to be a tetramer, containing two α or α' subunits (or one of each) and two β subunits. Complementary DNA clones encoding the subunits of casein kinase II were isolated from a human T-cell λgt 10 library using cDNA clones isolated from Drosophila melanogasten. One of the human cDNA clones (hT4.1) was 2.2 kb long, including a coding region of 1176 bp preceded by 156 bp (5' untranslated region) and followed by 871 bp (3' untranslated region). The hT4.1 close was nearly identical in size and sequence with a cDNA clone from HepG2 human hepatoma cultured cells. Another of the human T-cell cDNA clones (hT9.1) was 1.8 kb long, containing a coding region of 1053 bp preceded by 171 by (5' untranslated region) and followed by 550 bp (3' untranslated region). Amino acid sequences deduced from these two cDNA clones were about 85% identical. Most of the difference between the two encoded polypeptides was in the carboxy-terminal region, but heterogeneity was distributed throughout the molecules. Partial amino acid sequence was determined in a mixture of α and α' subunits from bovine lung casein kinase II. The bovine sequences aligned with the 2 human cDNA-encoded polypeptides with only 2 discrepancies out of 535 amino acid positions. This confirmed that the two human T-cell cDNA clones encoded the α and α' subunits of casein kinase II. These studies show that there are two distinct catalytic subunits for casein II (α and α') and that the sequence of these subunits is largely conserved between the bovine and the human

  8. Interaction of carbon nano tubes with DNA segments; Interacao de nanotubos de carbono com segmentos de DNA

    Energy Technology Data Exchange (ETDEWEB)

    Peressinotto, Valdirene Sullas Teixeira

    2007-07-01

    Single- and double-stranded DNA (deoxyribonucleic acid) molecules can strongly bind to single-walled carbon nanotubes (SWNT) via non-covalent interactions. Under certain conditions, the DNA molecule spontaneously self-assembles into a helical wrapping around the tubular structure of the carbon nanotubes to form DNA/SWNT hybrids, which are both stable and soluble in water. This system has recently received extensive attention, since, besides rendering SWNTs dispersible in water as individual tubes, the DNA hybrids are very promising candidates for many applications in nanotechnology and molecular biology. All the possible applications for DNA-SWNT hybrids require, however, a fully understanding of DNA-nanotube wrapping mechanism which is still lacking in the literature. In this context, the aim of this work was to investigate the non-covalent interaction in aqueous medium between SWNTs and synthetic DNA segments having a known nucleotide sequence. Initially, the study was focused on poly d(GT)n sequences (n = 10, 30 and 45) that contain a sequence of alternating guanine and thymine bases and for which the efficiency to disperse and separate carbon nanotubes has already been demonstrated. Besides the size of GT sequences, the effects of ionic strength and pH in the interaction were also investigated. Afterwards, we studied the interaction of SWNT with DNA molecules that contain only a single type of nitrogenous base (DNA homopolymers), which has not been reported in details in the literature. We investigated homopolymers of poly dA{sub 20}, poly dT{sub 20}, poly dC{sub 20} and the duplex poly dA{sub 20}:dT{sub 20}. Most of the study was carried out with small-diameter HiPco SWNTs (with diameters between 0.7 and 1.2 nm). In some studies, SWNTs with diameter around 1.4 nm, synthesized via laser ablation and arc-discharge methods, were also investigated. The arc-discharge nanotubes used in this study were functionalized with carboxylic groups (-COOH) due to their

  9. Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

    Directory of Open Access Journals (Sweden)

    Utut Widyastuti Suharsono

    2008-11-01

    Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

  10. Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata.

    Science.gov (United States)

    Pasion, S G; Hines, J C; Aebersold, R; Ray, D S

    1992-01-01

    A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.

  11. Discovery of Potent and Selective Inhibitors for ADAMTS-4 through DNA-Encoded Library Technology (ELT).

    Science.gov (United States)

    Ding, Yun; O'Keefe, Heather; DeLorey, Jennifer L; Israel, David I; Messer, Jeffrey A; Chiu, Cynthia H; Skinner, Steven R; Matico, Rosalie E; Murray-Thompson, Monique F; Li, Fan; Clark, Matthew A; Cuozzo, John W; Arico-Muendel, Christopher; Morgan, Barry A

    2015-08-13

    The aggrecan degrading metalloprotease ADAMTS-4 has been identified as a novel therapeutic target for osteoarthritis. Here, we use DNA-encoded Library Technology (ELT) to identify novel ADAMTS-4 inhibitors from a DNA-encoded triazine library by affinity selection. Structure-activity relationship studies based on the selection information led to the identification of potent and highly selective inhibitors. For example, 4-(((4-(6,7-dimethoxy-3,4-dihydroisoquinolin-2(1H)-yl)-6-(((4-methylpiperazin-1-yl)methyl)amino)-1,3,5-triazin-2-yl)amino)methyl)-N-ethyl-N-(m-tolyl)benzamide has IC50 of 10 nM against ADAMTS-4, with >1000-fold selectivity over ADAMT-5, MMP-13, TACE, and ADAMTS-13. These inhibitors have no obvious zinc ligand functionality.

  12. Cloning of the human androgen receptor cDNA

    International Nuclear Information System (INIS)

    Govindan, M.V.; Burelle, M.; Cantin, C.; Kabrie, C.; Labrie, F.; Lachance, Y.; Leblanc, G.; Lefebvre, C.; Patel, P.; Simard, J.

    1988-01-01

    The authors discuss how in order to define the functional domains of the human androgen receptor, complementary DNA (cDNA) clones encoding the human androgen receptor (hAR) have been isolated from a human testis λgtll cDNA library using synthetic oligonnucleotide probes, homologous to segments of the human glucocorticoid, estradiol and progesterone receptors. The cDNA clones corresponding to the human glucocorticoid, estradiol and progesterone receptors were eliminated after cross-hybridization with their respective cDNA probes and/or after restriction mapping of the cDNA clones. The remaining cDNA clones were classified into different groups after analysis by restriction digestion and cross-hybridization. Two of the largest cDNA clones from each group were inserted into an expression vector in both orientations. The linearized plasmids were used as templates in in vitro transcription with T7 RNA polymerase. Subsequent in vitro translation of the purified transcripts in rabbit reticulocyte lysate followed by sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE) permitted the characterization of the encoded polyeptides. The expressed proteins larger than 30,000 Da were analyzed for their ability to bind tritium-labelled dihydrotestosterone ([ 3 H] DHT) with high affinity and specificity

  13. Isolation and structure of a cDNA encoding the B1 (CD20) cell-surface antigen of human B lymphocytes

    International Nuclear Information System (INIS)

    Tender, T.F.; Streuli, M.; Schlossman, S.F.; Saito, H.

    1988-01-01

    The B1 (CD20) molecule is a M/sub r/ 33,000 phosphoprotein on the surface of human B lymphocytes that may serve a central role in the homoral immune response by regulating B-cell proliferation and differentiation. In this report, a cDNA clone that encodes the B1 molecule was isolated and the amino acid sequence of B1 was determined. B-cell-specific cDNA clones were selected from a human tonsillar cDNA library by differential hybridization with labeled cDNA derived from either size-fractionated B-cell mRNA or size-fractionated T-cell mRNA. Of the 261 cDNA clones isolated, 3 cross-hybridizing cDNA clones were chosen as potential candidates for encoding B1 based on their selective hybridization to RNA from B1-positive cell lines. The longest clone, pB1-21, contained a 2.8-kilobase insert with an 891-base-pair open reading frame that encodes a protein of 33 kDa. mRNA synthesized from the pB1-21 cDNA clone in vitro was translated into a protein of the same apparent molecular weight as B1. Limited proteinase digestion of the pB1-21 translation product and B1 generated peptides of the same sizes, indicating that the pB1-21 cDNA encodes the B1 molecule. Gel blot analysis indicated that pB1-21 hybridized with two mRNA species of 2.8 and 3.4 kilobases only in B1-positive cell lines. The amino acid sequence deduced from the pB1-21 nucleotide sequence apparently lacks a signal sequence and contains three extensive hydrophobic regions. The deduced B1 amino acid sequence shows no significant homology with other known patients

  14. cDNA encoding a polypeptide including a hev ein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

    2000-07-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  15. Avian reovirus L2 genome segment sequences and predicted structure/function of the encoded RNA-dependent RNA polymerase protein

    Directory of Open Access Journals (Sweden)

    Xu Wanhong

    2008-12-01

    Full Text Available Abstract Background The orthoreoviruses are infectious agents that possess a genome comprised of 10 double-stranded RNA segments encased in two concentric protein capsids. Like virtually all RNA viruses, an RNA-dependent RNA polymerase (RdRp enzyme is required for viral propagation. RdRp sequences have been determined for the prototype mammalian orthoreoviruses and for several other closely-related reoviruses, including aquareoviruses, but have not yet been reported for any avian orthoreoviruses. Results We determined the L2 genome segment nucleotide sequences, which encode the RdRp proteins, of two different avian reoviruses, strains ARV138 and ARV176 in order to define conserved and variable regions within reovirus RdRp proteins and to better delineate structure/function of this important enzyme. The ARV138 L2 genome segment was 3829 base pairs long, whereas the ARV176 L2 segment was 3830 nucleotides long. Both segments were predicted to encode λB RdRp proteins 1259 amino acids in length. Alignments of these newly-determined ARV genome segments, and their corresponding proteins, were performed with all currently available homologous mammalian reovirus (MRV and aquareovirus (AqRV genome segment and protein sequences. There was ~55% amino acid identity between ARV λB and MRV λ3 proteins, making the RdRp protein the most highly conserved of currently known orthoreovirus proteins, and there was ~28% identity between ARV λB and homologous MRV and AqRV RdRp proteins. Predictive structure/function mapping of identical and conserved residues within the known MRV λ3 atomic structure indicated most identical amino acids and conservative substitutions were located near and within predicted catalytic domains and lining RdRp channels, whereas non-identical amino acids were generally located on the molecule's surfaces. Conclusion The ARV λB and MRV λ3 proteins showed the highest ARV:MRV identity values (~55% amongst all currently known ARV and MRV

  16. Spot detection and image segmentation in DNA microarray data.

    Science.gov (United States)

    Qin, Li; Rueda, Luis; Ali, Adnan; Ngom, Alioune

    2005-01-01

    Following the invention of microarrays in 1994, the development and applications of this technology have grown exponentially. The numerous applications of microarray technology include clinical diagnosis and treatment, drug design and discovery, tumour detection, and environmental health research. One of the key issues in the experimental approaches utilising microarrays is to extract quantitative information from the spots, which represent genes in a given experiment. For this process, the initial stages are important and they influence future steps in the analysis. Identifying the spots and separating the background from the foreground is a fundamental problem in DNA microarray data analysis. In this review, we present an overview of state-of-the-art methods for microarray image segmentation. We discuss the foundations of the circle-shaped approach, adaptive shape segmentation, histogram-based methods and the recently introduced clustering-based techniques. We analytically show that clustering-based techniques are equivalent to the one-dimensional, standard k-means clustering algorithm that utilises the Euclidean distance.

  17. The Statistical Segment Length of DNA: Opportunities for Biomechanical Modeling in Polymer Physics and Next-Generation Genomics.

    Science.gov (United States)

    Dorfman, Kevin D

    2018-02-01

    The development of bright bisintercalating dyes for deoxyribonucleic acid (DNA) in the 1990s, most notably YOYO-1, revolutionized the field of polymer physics in the ensuing years. These dyes, in conjunction with modern molecular biology techniques, permit the facile observation of polymer dynamics via fluorescence microscopy and thus direct tests of different theories of polymer dynamics. At the same time, they have played a key role in advancing an emerging next-generation method known as genome mapping in nanochannels. The effect of intercalation on the bending energy of DNA as embodied by a change in its statistical segment length (or, alternatively, its persistence length) has been the subject of significant controversy. The precise value of the statistical segment length is critical for the proper interpretation of polymer physics experiments and controls the phenomena underlying the aforementioned genomics technology. In this perspective, we briefly review the model of DNA as a wormlike chain and a trio of methods (light scattering, optical or magnetic tweezers, and atomic force microscopy (AFM)) that have been used to determine the statistical segment length of DNA. We then outline the disagreement in the literature over the role of bisintercalation on the bending energy of DNA, and how a multiscale biomechanical approach could provide an important model for this scientifically and technologically relevant problem.

  18. Increased mRNA expression of a laminin-binding protein in human colon carcinoma: Complete sequence of a full-length cDNA encoding the protein

    International Nuclear Information System (INIS)

    Yow, Hsiukang; Wong, Jau Min; Chen, Hai Shiene; Lee, C.; Steele, G.D. Jr.; Chen, Lanbo

    1988-01-01

    Reliable markers to distinguish human colon carcinoma from normal colonic epithelium are needed particularly for poorly differentiated tumors where no useful marker is currently available. To search for markers the authors constructed cDNA libraries from human colon carcinoma cell lines and screened for clones that hybridize to a greater degree with mRNAs of colon carcinomas than with their normal counterparts. Here they report one such cDNA clone that hybridizes with a 1.2-kilobase (kb) mRNA, the level of which is ∼9-fold greater in colon carcinoma than in adjacent normal colonic epithelium. Blot hybridization of total RNA from a variety of human colon carcinoma cell lines shows that the level of this 1.2-kb mRNA in poorly differentiated colon carcinomas is as high as or higher than that in well-differentiated carcinomas. Molecular cloning and complete sequencing of cDNA corresponding to the full-length open reading frame of this 1.2-kb mRNA unexpectedly show it to contain all the partial cDNA sequence encoding 135 amino acid residues previously reported for a human laminin receptor. The deduced amino acid sequence suggests that this putative laminin-binding protein from human colon carcinomas consists of 295 amino acid residues with interesting features. There is an unusual C-terminal 70-amino acid segment, which is trypsin-resistant and highly negatively charged

  19. Stacking denoising auto-encoders in a deep network to segment the brainstem on MRI in brain cancer patients: A clinical study.

    Science.gov (United States)

    Dolz, Jose; Betrouni, Nacim; Quidet, Mathilde; Kharroubi, Dris; Leroy, Henri A; Reyns, Nicolas; Massoptier, Laurent; Vermandel, Maximilien

    2016-09-01

    Delineation of organs at risk (OARs) is a crucial step in surgical and treatment planning in brain cancer, where precise OARs volume delineation is required. However, this task is still often manually performed, which is time-consuming and prone to observer variability. To tackle these issues a deep learning approach based on stacking denoising auto-encoders has been proposed to segment the brainstem on magnetic resonance images in brain cancer context. Additionally to classical features used in machine learning to segment brain structures, two new features are suggested. Four experts participated in this study by segmenting the brainstem on 9 patients who underwent radiosurgery. Analysis of variance on shape and volume similarity metrics indicated that there were significant differences (p<0.05) between the groups of manual annotations and automatic segmentations. Experimental evaluation also showed an overlapping higher than 90% with respect to the ground truth. These results are comparable, and often higher, to those of the state of the art segmentation methods but with a considerably reduction of the segmentation time. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. Synthesis of DNA block copolymers with extended nucleic acid segments by enzymatic ligation : cut and paste large hybrid architectures

    NARCIS (Netherlands)

    Ayaz, Meryem S.; Kwak, Minseok; Alemdaroglu, Fikri E.; Wang, Jie; Berger, Ruediger; Herrmann, Andreas; Berger, Rüdiger

    2011-01-01

    Ultra-high molecular weight DNA/polymer hybrid materials were prepared employing molecular biology techniques. Nucleic acid restriction and ligation enzymes were used to generate linear DNA di- and triblock copolymers that contain up to thousands of base pairs in the DNA segments.

  1. Arabidopsis thaliana GYRB3 does not encode a DNA gyrase subunit.

    Directory of Open Access Journals (Sweden)

    Katherine M Evans-Roberts

    2010-03-01

    Full Text Available DNA topoisomerases are enzymes that control the topology of DNA in all cells. DNA gyrase is unique among the topoisomerases in that it is the only enzyme that can actively supercoil DNA using the free energy of ATP hydrolysis. Until recently gyrase was thought to be unique to bacteria, but has now been discovered in plants. The genome of the model plant, Arabidopsis thaliana, is predicted to encode four gyrase subunits: AtGyrA, AtGyrB1, AtGyrB2 and AtGyrB3.We found, contrary to previous data, that AtGyrB3 is not essential to the survival of A. thaliana. Bioinformatic analysis suggests AtGyrB3 is considerably shorter than other gyrase B subunits, lacking part of the ATPase domain and other key motifs found in all type II topoisomerases; but it does contain a putative DNA-binding domain. Partially purified AtGyrB3 cannot bind E. coli GyrA or support supercoiling. AtGyrB3 cannot complement an E. coli gyrB temperature-sensitive strain, whereas AtGyrB2 can. Yeast two-hybrid analysis suggests that AtGyrB3 cannot bind to AtGyrA or form a dimer.These data strongly suggest that AtGyrB3 is not a gyrase subunit but has another unknown function. One possibility is that it is a nuclear protein with a role in meiosis in pollen.

  2. Systematic evaluation and optimization of modification reactions of oligonucleotides with amines and carboxylic acids for the synthesis of DNA-encoded chemical libraries.

    Science.gov (United States)

    Franzini, Raphael M; Samain, Florent; Abd Elrahman, Maaly; Mikutis, Gediminas; Nauer, Angela; Zimmermann, Mauro; Scheuermann, Jörg; Hall, Jonathan; Neri, Dario

    2014-08-20

    DNA-encoded chemical libraries are collections of small molecules, attached to DNA fragments serving as identification barcodes, which can be screened against multiple protein targets, thus facilitating the drug discovery process. The preparation of large DNA-encoded chemical libraries crucially depends on the availability of robust synthetic methods, which enable the efficient conjugation to oligonucleotides of structurally diverse building blocks, sharing a common reactive group. Reactions of DNA derivatives with amines and/or carboxylic acids are particularly attractive for the synthesis of encoded libraries, in view of the very large number of building blocks that are commercially available. However, systematic studies on these reactions in the presence of DNA have not been reported so far. We first investigated conditions for the coupling of primary amines to oligonucleotides, using either a nucleophilic attack on chloroacetamide derivatives or a reductive amination on aldehyde-modified DNA. While both methods could be used for the production of secondary amines, the reductive amination approach was generally associated with higher yields and better purity. In a second endeavor, we optimized conditions for the coupling of a diverse set of 501 carboxylic acids to DNA derivatives, carrying primary and secondary amine functions. The coupling efficiency was generally higher for primary amines, compared to secondary amine substituents, but varied considerably depending on the structure of the acids and on the synthetic methods used. Optimal reaction conditions could be found for certain sets of compounds (with conversions >80%), but multiple reaction schemes are needed when assembling large libraries with highly diverse building blocks. The reactions and experimental conditions presented in this article should facilitate the synthesis of future DNA-encoded chemical libraries, while outlining the synthetic challenges that remain to be overcome.

  3. Deep 3D Convolutional Encoder Networks With Shortcuts for Multiscale Feature Integration Applied to Multiple Sclerosis Lesion Segmentation.

    Science.gov (United States)

    Brosch, Tom; Tang, Lisa Y W; Youngjin Yoo; Li, David K B; Traboulsee, Anthony; Tam, Roger

    2016-05-01

    We propose a novel segmentation approach based on deep 3D convolutional encoder networks with shortcut connections and apply it to the segmentation of multiple sclerosis (MS) lesions in magnetic resonance images. Our model is a neural network that consists of two interconnected pathways, a convolutional pathway, which learns increasingly more abstract and higher-level image features, and a deconvolutional pathway, which predicts the final segmentation at the voxel level. The joint training of the feature extraction and prediction pathways allows for the automatic learning of features at different scales that are optimized for accuracy for any given combination of image types and segmentation task. In addition, shortcut connections between the two pathways allow high- and low-level features to be integrated, which enables the segmentation of lesions across a wide range of sizes. We have evaluated our method on two publicly available data sets (MICCAI 2008 and ISBI 2015 challenges) with the results showing that our method performs comparably to the top-ranked state-of-the-art methods, even when only relatively small data sets are available for training. In addition, we have compared our method with five freely available and widely used MS lesion segmentation methods (EMS, LST-LPA, LST-LGA, Lesion-TOADS, and SLS) on a large data set from an MS clinical trial. The results show that our method consistently outperforms these other methods across a wide range of lesion sizes.

  4. DNA methyl transferases are differentially expressed in the human anterior eye segment.

    Science.gov (United States)

    Bonnin, Nicolas; Belville, Corinne; Chiambaretta, Frédéric; Sapin, Vincent; Blanchon, Loïc

    2014-08-01

    DNA methylation is an epigenetic mark involved in the control of genes expression. Abnormal epigenetic events have been reported in human pathologies but weakly documented in eye diseases. The purpose of this study was to establish DNMT mRNA and protein expression levels in the anterior eye segment tissues and their related (primary or immortalized) cell cultures as a first step towards future in vivo and in vitro methylomic studies. Total mRNA was extracted from human cornea, conjunctiva, anterior lens capsule, trabeculum and related cell cultures (cornea epithelial, trabecular meshwork, keratocytes for primary cells; and HCE, Chang, B-3 for immortalized cells). cDNA was quantified by real-time PCR using specific primers for DNMT1, 2, 3A, 3B and 3L. Immunolocalization assays were carried out on human cornea using specific primary antibodies for DNMT1, 2 and 3A, 3B and 3L. All DNMT transcripts were detected in human cornea, conjunctiva, anterior lens capsule, trabeculum and related cells but showed statistically different expression patterns between tissues and cells. DNMT2 protein presented a specific and singular expression pattern in corneal endothelium. This study produced the first inventory of the expression patterns of DNMTs in human adult anterior eye segment. Our research highlights that DNA methylation cannot be ruled out as a way to bring new insights into well-known ocular diseases. In addition, future DNA methylation studies using various cells as experimental models need to be conducted with attention to approach the results analysis from a global tissue perspective. © 2014 Acta Ophthalmologica Scandinavica Foundation. Published by John Wiley & Sons Ltd.

  5. Light-dependent, plastome-wide association of the plastid-encoded RNA polymerase with chloroplast DNA.

    Science.gov (United States)

    Finster, Sabrina; Eggert, Erik; Zoschke, Reimo; Weihe, Andreas; Schmitz-Linneweber, Christian

    2013-12-01

    Plastid genes are transcribed by two types of RNA polymerases: a plastid-encoded eubacterial-type RNA polymerase (PEP) and nuclear-encoded phage-type RNA polymerases (NEPs). To investigate the spatio-temporal expression of PEP, we tagged its α-subunit with a hemagglutinin epitope (HA). Transplastomic tobacco plants were generated and analyzed for the distribution of the tagged polymerase in plastid sub-fractions, and associated genes were identified under various light conditions. RpoA:HA was detected as early as the 3rd day after imbibition, and was constitutively expressed in green tissue over 60 days of plant development. We found that the tagged polymerase subunit preferentially associated with the plastid membranes, and was less abundant in the soluble stroma fraction. Attachment of RpoA:HA to the membrane fraction during early seedling development was independent of DNA, but at later stages of development, DNA appears to facilitate attachment of the polymerase to membranes. To survey PEP-dependent transcription units, we probed for nucleic acids enriched in RpoA:HA precipitates using a tobacco chloroplast whole-genome tiling array. The most strongly co-enriched DNA fragments represent photosynthesis genes (e.g. psbA, psbC, psbD and rbcL), whose expression is known to be driven by PEP promoters, while NEP-dependent genes were less abundant in RpoA:HA precipitates. Additionally, we demonstrate that the association of PEP with photosynthesis-related genes was reduced during the dark period, indicating that plastome-wide PEP-DNA association is a light-dependent process. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

  6. Isolation and characterization of two cDNA clones encoding for glutamate dehydrogenase in Nicotiana plumbaginifolia.

    Science.gov (United States)

    Ficarelli, A; Tassi, F; Restivo, F M

    1999-03-01

    We have isolated two full length cDNA clones encoding Nicotiana plumbaginifolia NADH-glutamate dehydrogenase. Both clones share amino acid boxes of homology corresponding to conserved GDH catalytic domains and putative mitochondrial targeting sequence. One clone shows a putative EF-hand loop. The level of the two transcripts is affected differently by carbon source.

  7. Synthesis of DNA

    Science.gov (United States)

    Mariella, Jr., Raymond P.

    2008-11-18

    A method of synthesizing a desired double-stranded DNA of a predetermined length and of a predetermined sequence. Preselected sequence segments that will complete the desired double-stranded DNA are determined. Preselected segment sequences of DNA that will be used to complete the desired double-stranded DNA are provided. The preselected segment sequences of DNA are assembled to produce the desired double-stranded DNA.

  8. Mucosal delivery of a transmission-blocking DNA vaccine encoding Giardia lamblia CWP2 by Salmonella typhimurium bactofection vehicle.

    Science.gov (United States)

    Abdul-Wahid, Aws; Faubert, Gaétan

    2007-12-05

    In this study, we investigated the use of Salmonella typhimurium (STM1 strain) as a bactofection vehicle to deliver a transmission-blocking DNA vaccine (TBDV) plasmid to the intestinal immune system. The gene encoding the full length cyst wall protein-2 (CWP2) from Giardia lamblia was subcloned into the pCDNA3 mammalian expression vector and stably introduced into S. typhimurium STM1. Eight-week-old female BALB/c mice were orally immunized every 2 weeks, for a total of three immunizations. Vaccinated and control mice were sacrificed 1 week following the last injection. Administration of the DNA vaccine led to the production of CWP2-specific cellular immune responses characterized by a mixed Th1/Th2 response. Using ELISA, antigen-specific IgA and IgG antibodies were detected in intestinal secretions. Moreover, analysis of sera demonstrated that the DNA immunization also stimulated the production of CWP2-specific IgG antibodies that were mainly of the IgG2a isotype. Finally, challenge infection with live Giardia muris cysts revealed that mice receiving the CWP2-encoding DNA vaccine were able to reduce cyst shedding by approximately 60% compared to control mice. These results demonstrate, for the first time, the development of parasite transmission-blocking immunity at the intestinal level following the administration of a mucosal DNA vaccine delivered by S. typhimurium STM1.

  9. Achievements, Challenges, and Opportunities in DNA-Encoded Library Research: An Academic Point of View.

    Science.gov (United States)

    Yuen, Lik Hang; Franzini, Raphael M

    2017-05-04

    DNA-encoded chemical libraries (DECLs) are pools of DNA-tagged small molecules that enable facile screening and identification of bio-macromolecule binders. The successful development of DECLs has led to their increasingly important role in drug development, and screening hits have entered clinical trials. In this review, we summarize the development and currently active research areas of DECLs with a focus on contributions from groups at academic institutes. We further look at opportunities and future directions of DECL research in medicinal chemistry and chemical biology based on the symbiotic relationship between academia and industry. Challenges associated with the application of DECLs in academic drug discovery are further discussed. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Construction of a cDNA library from human retinal pigment epithelial cells challenged with rod outer segments.

    Science.gov (United States)

    Cavaney, D M; Rakoczy, P E; Constable, I J

    1995-05-01

    To study genes expressed by retinal pigment epithelial (RPE) cells during phagocytosis and digestion of rod outer segments (ROS), a complementary (c)DNA library was produced using an in-vitro model. The cDNA library can be used to study molecular changes which contribute to the development of diseases due to a failure in outer segment phagocytosis and digestion by RPE cells. Here we demonstrate a way to study genes and their functions using a molecular biological approach and describing the first step involved in this process, the construction of a cDNA library. Human RPE cells obtained from the eyes of a seven-year-old donor were cultured and challenged with bovine ROS. The culture was harvested and total RNA was extracted. Complementary DNA was transcribed from the messenger (m)RNA and was directionally cloned into the LambdaGEM-4 bacteriophage vector successfully. Some clones were picked and the DNA extracted, to determine the size of the inserts as a measure of the quality of the library. Molecular biology and cell culture are important tools to be used in eye research, especially in areas where tissue is limiting and animal models are not available. We now have a ROS challenged RPE cDNA library which will be used to identify genes responsible for degrading phagocytosed debris within the retinal pigment epithelium.

  11. Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions

    Science.gov (United States)

    Gardner, Shea N; Mariella, Jr., Raymond P; Christian, Allen T; Young, Jennifer A; Clague, David S

    2013-06-25

    A method of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths.

  12. Thigh muscle segmentation of chemical shift encoding-based water-fat magnetic resonance images: The reference database MyoSegmenTUM.

    Directory of Open Access Journals (Sweden)

    Sarah Schlaeger

    Full Text Available Magnetic resonance imaging (MRI can non-invasively assess muscle anatomy, exercise effects and pathologies with different underlying causes such as neuromuscular diseases (NMD. Quantitative MRI including fat fraction mapping using chemical shift encoding-based water-fat MRI has emerged for reliable determination of muscle volume and fat composition. The data analysis of water-fat images requires segmentation of the different muscles which has been mainly performed manually in the past and is a very time consuming process, currently limiting the clinical applicability. An automatization of the segmentation process would lead to a more time-efficient analysis. In the present work, the manually segmented thigh magnetic resonance imaging database MyoSegmenTUM is presented. It hosts water-fat MR images of both thighs of 15 healthy subjects and 4 patients with NMD with a voxel size of 3.2x2x4 mm3 with the corresponding segmentation masks for four functional muscle groups: quadriceps femoris, sartorius, gracilis, hamstrings. The database is freely accessible online at https://osf.io/svwa7/?view_only=c2c980c17b3a40fca35d088a3cdd83e2. The database is mainly meant as ground truth which can be used as training and test dataset for automatic muscle segmentation algorithms. The segmentation allows extraction of muscle cross sectional area (CSA and volume. Proton density fat fraction (PDFF of the defined muscle groups from the corresponding images and quadriceps muscle strength measurements/neurological muscle strength rating can be used for benchmarking purposes.

  13. Agrobacterium T-DNA-encoded protein Atu6002 interferes with the host auxin response

    Science.gov (United States)

    Lacroix, Benoît; Gizatullina, Diana I.; Babst, Benjamin A.; Gifford, Andrew N.; Citovsky, Vitaly

    2013-01-01

    Summary Several genes in the Agrobacterium tumefaciens transferred (T) DNA encode proteins that are involved in developmental alterations leading to the formation of tumors in infected plants. We investigated the role of the protein encoded by the Atu6002 gene, the function of which is completely unknown. The Atu6002 expression occurs in Agrobacterium-induced tumors, and is also activated upon activation of plant cell division by growth hormones. Within the expressing plant cells, the Atu6002 protein is targeted to the plasma membrane. Interestingly, constitutive ectopic expression of Atu6002 in transgenic tobacco plants lead to a severe developmental phenotype characterized by stunted growth, shorter internodes, lanceolate leaves, increased branching, and modified flower morphology. These Atu6002-expressing plants also displayed impaired response to auxin. However, auxin cellular uptake and polar transport were not significantly inhibited in these plants, suggesting that Atu6002 interferes with auxin perception or signaling pathways. PMID:24128370

  14. Isolation and characterization of cDNA clones for human erythrocyte β-spectrin

    International Nuclear Information System (INIS)

    Prchal, J.T.; Morley, B.J.; Yoon, S.H.; Coetzer, T.L.; Palek, J.; Conboy, J.G.; Kan, Y.W.

    1987-01-01

    Spectrin is an important structural component of the membrane skeleton that underlies and supports the erythrocyte plasma membrane. It is composed of nonidentical α (M/sub r/ 240,000) and β (M/sub r/ 220,000) subunits, each of which contains multiple homologous 106-amino acid segments. The authors report here the isolation and characterization of a human erythroid-specific β-spectrin cDNA clone that encodes parts of the β-9 through β-12 repeat segments. This cDNA was used as a hybridization probe to assign the β-spectrin gene to human chromosome 14 and to begin molecular analysis of the gene and its mRNA transcripts. RNA transfer blot analysis showed that the reticulocyte β-spectrin mRNA is 7.8 kilobases in length. Southern blot analysis of genomic DNA revealed the presence of restriction fragment length polymorphisms (RFLPs) within the β-spectrin gene locus. The isolation of human spectrin cDNA probes and the identification of closely linked RFLPs will facilitate analysis of mutant spectrin genes causing congenital hemolytic anemias associated with quantitative and qualitative spectrin abnormalities

  15. Cloning and expression of a cDNA encoding human sterol carrier protein 2

    International Nuclear Information System (INIS)

    Yamamoto, Ritsu; Kallen, C.B.; Babalola, G.O.; Rennert, H.; Strauss, J.F. III; Billheimer, J.T.

    1991-01-01

    The authors report the cloning and expression of a cDNA encoding human sterol carrier protein 2 (SCP 2 ). The 1.3-kilobase (kb) cDNA contains an open reading frame which encompasses a 143-amino acid sequence which is 89% identical to the rat SCP 2 amino acid sequence. The deduced amino acid sequence of the polypeptide reveals a 20-residue amino-terminal leader sequence in front of the mature polypeptide, which contains a carboxyl-terminal tripeptide (Ala-Lys-Leu) related to the peroxisome targeting sequence. The expressed cDNA in COS-7 cells yields a 15.3-kDa polypeptide and increased amounts of a 13.2-kDa polypeptide, both reacting with a specific rabbit antiserum to rat liver SCP 2 . The cDNA insert hybridizes with 3.2- and 1.8-kb mRNA species in human liver poly(A) + RNA. In human fibroblasts and placenta the 1.8-kb mRNA was most abundant. Southern blot analysis suggests either that there are multiple copies of the SCP 2 gene in the human genome or that the SCP 2 gene is very large. Coexpression of the SCP 2 cDNA with expression vectors for cholesterol side-chain cleavage enzyme and adrenodoxin resulted in a 2.5-fold enhancement of progestin synthesis over that obtained with expression of the steroidogenic enzyme system alone. These findings are concordant with the notion that SCP 2 plays a role in regulating steroidogenesis, among other possible functions

  16. Cloning of a cDNA encoding a novel human nuclear phosphoprotein belonging to the WD-40 family

    DEFF Research Database (Denmark)

    Honoré, B; Leffers, H; Madsen, Peder

    1994-01-01

    We have cloned and expressed in vaccinia virus a cDNA encoding an ubiquitous 501-amino-acid (aa) phosphoprotein that corresponds to protein IEF SSP 9502 (79,400 Da, pI 4.5) in the master 2-D-gel keratinocyte protein database [Celis et al., Electrophoresis 14 (1993) 1091-1198]. The deduced aa...

  17. cDNA sequences of two inducible T-cell genes

    Energy Technology Data Exchange (ETDEWEB)

    Kwon, B.S. (Indiana Univ. School of Medicine, Indianapolis (USA) Guthrie Research Institute, Sayre, PA (USA)); Weissman, S.M. (Yale Univ., New Haven, CT (USA))

    1989-03-01

    The authors have previously described a set of human T-lymphocyte-specific cDNA clones isolated by a modified differential screening procedure. Apparent full-length cDNAs containing the sequences of 14 of the 16 initial isolates were sequenced and were found to represent five different species of mRNA; three of the five species were identical to previously reported cDNA sequences of preproenkephalin, T-cell-replacing factor, and a serine esterase, respectively. The other two species, 4-1BB and L2G25B, were inducible sequences found in mRNA from both a cytolytic T-lymphocyte and a helper T-lymphocyte clone and were not previously described in T-cell mRNA; these mRNA sequences encode peptides of 256 and 92 amino acids, respectively. Both peptides contain putative leader sequences. The protein encoded by 4-1BB also has a potential membrane anchor segment and other features also seen in known receptor proteins.

  18. Nucleotide sequence of Phaseolus vulgaris L. alcohol dehydrogenase encoding cDNA and three-dimensional structure prediction of the deduced protein.

    Science.gov (United States)

    Amelia, Kassim; Khor, Chin Yin; Shah, Farida Habib; Bhore, Subhash J

    2015-01-01

    Common beans (Phaseolus vulgaris L.) are widely consumed as a source of proteins and natural products. However, its yield needs to be increased. In line with the agenda of Phaseomics (an international consortium), work of expressed sequence tags (ESTs) generation from bean pods was initiated. Altogether, 5972 ESTs have been isolated. Alcohol dehydrogenase (AD) encoding gene cDNA was a noticeable transcript among the generated ESTs. This AD is an important enzyme; therefore, to understand more about it this study was undertaken. The objective of this study was to elucidate P. vulgaris L. AD (PvAD) gene cDNA sequence and to predict the three-dimensional (3D) structure of deduced protein. positive and negative strands of the PvAD cDNA clone were sequenced using M13 forward and M13 reverse primers to elucidate the nucleotide sequence. Deduced PvAD cDNA and protein sequence was analyzed for their basic features using online bioinformatics tools. Sequence comparison was carried out using bl2seq program, and tree-view program was used to construct a phylogenetic tree. The secondary structures and 3D structure of PvAD protein were predicted by using the PHYRE automatic fold recognition server. The sequencing results analysis showed that PvAD cDNA is 1294 bp in length. It's open reading frame encodes for a protein that contains 371 amino acids. Deduced protein sequence analysis showed the presence of putative substrate binding, catalytic Zn binding, and NAD binding sites. Results indicate that the predicted 3D structure of PvAD protein is analogous to the experimentally determined crystal structure of s-nitrosoglutathione reductase from an Arabidopsis species. The 1294 bp long PvAD cDNA encodes for 371 amino acid long protein that contains conserved domains required for biological functions of AD. The predicted deduced PvAD protein's 3D structure reflects the analogy with the crystal structure of Arabidopsis thaliana s-nitrosoglutathione reductase. Further study is required

  19. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  20. Isolation and sequence of complementary DNA encoding human extracellular superoxide dismutase

    International Nuclear Information System (INIS)

    Hjalmarsson, K.; Marklund, S.L.; Engstroem, A.; Edlund, T.

    1987-01-01

    A complementary DNA (cDNA) clone from a human placenta cDNA library encoding extracellular superoxide dismutase has been isolated and the nucleotide sequence determined. The cDNA has a very high G + C content. EC-SOD is synthesized with a putative 18-amino acid signal peptide, preceding the 222 amino acids in the mature enzyme, indicating that the enzyme is a secretory protein. The first 95 amino acids of the mature enzyme show no sequence homology with other sequenced proteins and there is one possible N-glycosylation site (Asn-89). The amino acid sequence from residues 96-193 shows strong homology (∼ 50%) with the final two-thirds of the sequences of all know eukaryotic CuZn SODs, whereas the homology with the P. leiognathi CuZn SOD is clearly lower. The ligands to Cu and Zn, the cysteines forming the intrasubunit disulfide bridge in the CuZn SODs, and the arginine found in all CuZn SODs in the entrance to the active site can all be identified in EC-SOD. A comparison with bovine CuZn SOD, the three-dimensional structure of which is known, reveals that the homologies occur in the active site and the divergencies are in the part constituting the subunit contact area in CuZn SOD. Amino acid sequence 194-222 in the carboxyl-terminal end of EC-SOD is strongly hydrophilic and contains nine amino acids with a positive charge. This sequence probably confers the affinity of EC-SOD for heparin and heparan sulfate. An analysis of the amino acid sequence homologies with CuZn SODs from various species indicates that the EC-SODs may have evolved form the CuZn SODs before the evolution of fungi and plants

  1. Molecular Mechanisms of Innate Immune Inhibition by Non-Segmented Negative-Sense RNA Viruses

    Energy Technology Data Exchange (ETDEWEB)

    Chatterjee, Srirupa; Basler, Christopher F.; Amarasinghe, Gaya K.; Leung, Daisy W.

    2016-08-01

    The host innate immune system serves as the first line of defense against viral infections. Germline-encoded pattern recognition receptors detect molecular patterns associated with pathogens and activate innate immune responses. Of particular relevance to viral infections are those pattern recognition receptors that activate type I interferon responses, which establish an antiviral state. The order Mononegavirales is composed of viruses that possess single-stranded, non-segmented negative-sense (NNS) RNA genomes and are important human pathogens that consistently antagonize signaling related to type I interferon responses. NNS viruses have limited encoding capacity compared to many DNA viruses, and as a likely consequence, most open reading frames encode multifunctional viral proteins that interact with host factors in order to evade host cell defenses while promoting viral replication. In this review, we will discuss the molecular mechanisms of innate immune evasion by select NNS viruses. A greater understanding of these interactions will be critical in facilitating the development of effective therapeutics and viral countermeasures.

  2. A Potato cDNA Encoding a Homologue of Mammalian Multidrug Resistant P-Glycoprotein

    Science.gov (United States)

    Wang, W.; Takezawa, D.; Poovaiah, B. W.

    1996-01-01

    A homologue of the multidrug resistance (MDR) gene was obtained while screening a potato stolon tip cDNA expression library with S-15-labeled calmodulin. The mammalian MDR gene codes for a membrane-bound P-glycoprotein (170-180 kDa) which imparts multidrug resistance to cancerous cells. The potato cDNA (PMDR1) codes for a polypeptide of 1313 amino acid residues (ca. 144 kDa) and its structural features are very similar to the MDR P-glycoprotein. The N-terminal half of the PMDR1-encoded protein shares striking homology with its C-terminal half, and each half contains a conserved ATP-binding site and six putative transmembrane domains. Southern blot analysis indicated that potato has one or two MDR-like genes. PMDR1 mRNA is constitutively expressed in all organs studied with higher expression in the stem and stolon tip. The PMDR1 expression was highest during tuber initiation and decreased during tuber development.

  3. Bridging two scholarly islands enriches both: COI DNA barcodes for species identification versus human mitochondrial variation for the study of migrations and pathologies.

    Science.gov (United States)

    Thaler, David S; Stoeckle, Mark Y

    2016-10-01

    DNA barcodes for species identification and the analysis of human mitochondrial variation have developed as independent fields even though both are based on sequences from animal mitochondria. This study finds questions within each field that can be addressed by reference to the other. DNA barcodes are based on a 648-bp segment of the mitochondrially encoded cytochrome oxidase I. From most species, this segment is the only sequence available. It is impossible to know whether it fairly represents overall mitochondrial variation. For modern humans, the entire mitochondrial genome is available from thousands of healthy individuals. SNPs in the human mitochondrial genome are evenly distributed across all protein-encoding regions arguing that COI DNA barcode is representative. Barcode variation among related species is largely based on synonymous codons. Data on human mitochondrial variation support the interpretation that most - possibly all - synonymous substitutions in mitochondria are selectively neutral. DNA barcodes confirm reports of a low variance in modern humans compared to nonhuman primates. In addition, DNA barcodes allow the comparison of modern human variance to many other extant animal species. Birds are a well-curated group in which DNA barcodes are coupled with census and geographic data. Putting modern human variation in the context of intraspecies variation among birds shows humans to be a single breeding population of average variance.

  4. Frequency and persistency of DNA vaccine encoding GP25 by oral on common carp

    Directory of Open Access Journals (Sweden)

    Sri Nuryati

    2015-05-01

    Full Text Available ABSTRACT Koi herpesvirus (KHV is a major viral pathogen that infects common carp and koi. KHV disease outbreak is happened in almost all centre of common carp culture in Indonesia and caused mass mortality. Deoxyribonucleic acid (DNA vaccination method is one of ways to cope with KHV infection. Vaccines were commonly given by injection. The aim of this research was to get frequency and persistency of DNA vaccine encoding GP25 given by oral delivery method in common carp. This research would like to determine dose, frequency of vaccination, persistency of DNA vaccine and culture medium for the bacterial host. DNA vaccine persistency test was done by using polymerase chain reaction (PCR method with the specific primer for GP25 gene. The results showed that level of DNA vaccine that could be detected in feed was 7.56 ng (equal to 1.598×1010 copies. Efficient culture medium for Escherichia coli DH5α carrying DNA vaccine was LB triptone. Feeding fish with diet supplemented with 1 mL E. coli DH5α containing DNA vaccine for each fish and two times a week allowed persistence of DNA vaccine in kindney and spleen. Keywords: common carp, KHV, DNA vaccine, GP25, persistance  ABSTRAK Koi herpesvirus (KHV adalah virus patogen utama yang menginfeksi ikan mas dan ikan koi. Wabah penyakit KHV terjadi di hampir semua sentra budidaya ikan mas di Indonesia dan menyebabkan kematian massal ikan. Metode vaksinasi DNA merupakan salah satu cara yang dapat dilakukan untuk menanggulangi serangan KHV. Pemberian vaksin umumnya dilakukan dengan cara injeksi. Tujuan penelitian ini adalah untuk menguji frekuensi dan persistensi vaksin DNA GP25 antivirus KHV yang diberikan melalui oral pada ikan mas. Pada penelitian ini dilakukan uji dosis, frekuensi pemberian vaksin, persistensi vaksin DNA, dan media kultur bakteri inang. Persistensi vaksin DNA dianalisis menggunakan metode PCR dengan primer spesifik gen GP25. Hasil penelitian menunjukkan bahwa dosis vaksin DNA yang

  5. A cDNA encoding a pRB-binding protein with properties of the transcription factor E2F

    DEFF Research Database (Denmark)

    Helin, K; Lees, J A; Vidal, M

    1992-01-01

    The retinoblastoma protein (pRB) plays an important role in the control of cell proliferation, apparently by binding to and regulating cellular transcription factors such as E2F. Here we describe the characterization of a cDNA clone that encodes a protein with properties of E2F. This clone, RBP3...

  6. SnoVault and encodeD: A novel object-based storage system and applications to ENCODE metadata.

    Directory of Open Access Journals (Sweden)

    Benjamin C Hitz

    Full Text Available The Encyclopedia of DNA elements (ENCODE project is an ongoing collaborative effort to create a comprehensive catalog of functional elements initiated shortly after the completion of the Human Genome Project. The current database exceeds 6500 experiments across more than 450 cell lines and tissues using a wide array of experimental techniques to study the chromatin structure, regulatory and transcriptional landscape of the H. sapiens and M. musculus genomes. All ENCODE experimental data, metadata, and associated computational analyses are submitted to the ENCODE Data Coordination Center (DCC for validation, tracking, storage, unified processing, and distribution to community resources and the scientific community. As the volume of data increases, the identification and organization of experimental details becomes increasingly intricate and demands careful curation. The ENCODE DCC has created a general purpose software system, known as SnoVault, that supports metadata and file submission, a database used for metadata storage, web pages for displaying the metadata and a robust API for querying the metadata. The software is fully open-source, code and installation instructions can be found at: http://github.com/ENCODE-DCC/snovault/ (for the generic database and http://github.com/ENCODE-DCC/encoded/ to store genomic data in the manner of ENCODE. The core database engine, SnoVault (which is completely independent of ENCODE, genomic data, or bioinformatic data has been released as a separate Python package.

  7. Cloning and chromosomal assignment of a human cDNA encoding a T cell- and natural killer cell-specific trypsin-like serine protease

    International Nuclear Information System (INIS)

    Gershenfeld, H.K.; Hershberger, R.J.; Shows, T.B.; Weissman, I.L.

    1988-01-01

    A cDNA clone encoding a human T cell- and natural killer cell-specific serine protease was obtained by screening a phage λgt10 cDNA library from phytohemagglutinin-stimulated human peripheral blood lymphocytes with the mouse Hanukah factor cDNA clone. In an RNA blot-hybridization analysis, this human Hanukah factor cDNA hybridized with a 1.3-kilobase band in allogeneic-stimulated cytotoxic T cells and the Jurkat cell line, but this transcript was not detectable in normal muscle, liver, tonsil, or thymus. By dot-blot hybridization, this cDNA hybridized with RNA from three cytolytic T-cell clones and three noncytolytic T-cell clones grown in vitro as well as with purified CD16 + natural killer cells and CD3 + , CD16 - T-cell large granular lymphocytes from peripheral blood lymphocytes (CD = cluster designation). The nucleotide sequence of this cDNA clone encodes a predicted serine protease of 262 amino acids. The active enzyme is 71% and 77% similar to the mouse sequence at the amino acid and DNA level, respectively. The human and mouse sequences conserve the active site residues of serine proteases--the trypsin-specific Asp-189 and all 10 cysteine residues. The gene for the human Hanukah factor serine protease is located on human chromosome 5. The authors propose that this trypsin-like serine protease may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells

  8. Identification of a cryptic prokaryotic promoter within the cDNA encoding the 5' end of dengue virus RNA genome.

    Directory of Open Access Journals (Sweden)

    Dongsheng Li

    Full Text Available Infectious cDNA clones of RNA viruses are important research tools, but flavivirus cDNA clones have proven difficult to assemble and propagate in bacteria. This has been attributed to genetic instability and/or host cell toxicity, however the mechanism leading to these difficulties has not been fully elucidated. Here we identify and characterize an efficient cryptic bacterial promoter in the cDNA encoding the dengue virus (DENV 5' UTR. Following cryptic transcription in E. coli, protein expression initiated at a conserved in-frame AUG that is downstream from the authentic DENV initiation codon, yielding a DENV polyprotein fragment that was truncated at the N-terminus. A more complete understanding of constitutive viral protein expression in E. coli might help explain the cloning and propagation difficulties generally observed with flavivirus cDNA.

  9. The effect of co-administration of DNA carrying chicken interferon-gamma gene on protection of chickens against infectious bursal disease by DNA-mediated vaccination.

    Science.gov (United States)

    Hsieh, Ming Kun; Wu, Ching Ching; Lin, Tsang Long

    2006-11-17

    The purpose of the present study was to determine whether DNA vaccination by co-administration of DNA coding for chicken interferon-gamma (IFN-gamma) gene and DNA encoding for the VP243 gene of IBDV could enhance immune response and protection efficacy of chickens against challenge by IBDV. Plasmids carrying VP243 gene of IBDV strain variant E (VE) (P/VP243/E) and chicken IFN-gamma gene (P/cIFN-gamma) were constructed, respectively. One-day-old chickens were intramuscularly injected with P/VP243/E, or P/cIFN-gamma, or both once, twice, or three times into the thigh muscle of one leg or the thigh muscles of two separate legs at weekly intervals. Chickens were orally challenged with IBDV strain VE at 3 weeks of age and observed for 10 days. Chickens receiving two plasmids in the same site two times had significantly higher (Pprotection and those receiving two plasmids in the same sites did not have any protection against IBD. The enzyme-linked immunosorbent assay (ELISA) and virus neutralization (VN) titers to IBDV of chickens in the groups with three doses of P/VP243/E were significantly higher (Pprotected by DNA vaccination did not have detectable IBDV antigen in the bursae as determined by immunofluorescent antibody assay (IFA). The results indicated that co-administration of plasmid encoding chicken IFN-gamma gene with plasmid encoding a large segment gene of the IBDV did not enhance immune response and protection against challenge by IBDV.

  10. Pnrc2 regulates 3'UTR-mediated decay of segmentation clock-associated transcripts during zebrafish segmentation.

    Science.gov (United States)

    Gallagher, Thomas L; Tietz, Kiel T; Morrow, Zachary T; McCammon, Jasmine M; Goldrich, Michael L; Derr, Nicolas L; Amacher, Sharon L

    2017-09-01

    Vertebrate segmentation is controlled by the segmentation clock, a molecular oscillator that regulates gene expression and cycles rapidly. The expression of many genes oscillates during segmentation, including hairy/Enhancer of split-related (her or Hes) genes, which encode transcriptional repressors that auto-inhibit their own expression, and deltaC (dlc), which encodes a Notch ligand. We previously identified the tortuga (tor) locus in a zebrafish forward genetic screen for genes involved in cyclic transcript regulation and showed that cyclic transcripts accumulate post-splicing in tor mutants. Here we show that cyclic mRNA accumulation in tor mutants is due to loss of pnrc2, which encodes a proline-rich nuclear receptor co-activator implicated in mRNA decay. Using an inducible in vivo reporter system to analyze transcript stability, we find that the her1 3'UTR confers Pnrc2-dependent instability to a heterologous transcript. her1 mRNA decay is Dicer-independent and likely employs a Pnrc2-Upf1-containing mRNA decay complex. Surprisingly, despite accumulation of cyclic transcripts in pnrc2-deficient embryos, we find that cyclic protein is expressed normally. Overall, we show that Pnrc2 promotes 3'UTR-mediated decay of developmentally-regulated segmentation clock transcripts and we uncover an additional post-transcriptional regulatory layer that ensures oscillatory protein expression in the absence of cyclic mRNA decay. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Isolation and characterization of cDNA encoding the 80-kDa subunit protein of the human autoantigen Ku (p70/p80) recognized by autoantibodies from patients with scleroderma-polymyositis overlap syndrome

    International Nuclear Information System (INIS)

    Mimori, Tsuneyo; Ohosone, Yasuo; Hama, Nobuaki; Suwa, Akira; Akizuki, Masashi; Homma, Mitsuo; Griffith, A.J.; Hardin, J.A.

    1990-01-01

    Anti-Ku (p70/p80) autoantibodies in patients with scleroderma-polymyositis overlap syndrome recognize a 70-kDa/80-kDa protein heterodimer which binds to terminal regions of double-stranded DNA. In the present study, the authors isolated full-length cDNAs that encode the 80-kDa Ku subunit. Initial screening of a human spleen cDNA library with anti-Ku antibodies yielded a cDNA of 1.0 kilobase (kb) (termed K71) encoding a portion of the 80-kDa Ku polypeptide (identification based on immunological criteria). In RNA blots, this cDNA hybridized with two mRNAs of 3.4 and 2.6 kb. In vitro transcription and translation experiments produced an immunoprecipitable polypeptide which comigrated with the 80-kDa Ku subunit. The Ku80-6 cDNA proved to be 3304 nucleotides in length, with an additional poly(A) tail, closely approximating the size of the larger mRNA. It contains a single long open reading frame encoding 732 amino acids. The putative polypeptide has a high content of acidic amino acids and a region with periodic repeat of leucine in every seventh position which may form the leucine zipper structure. In genomic DNA blots, probes derived from the opposite ends of cDNA Ku80-6 hybridized with several nonoverlapping restriction fragments from human leukocyte DNA, indicating that the gene encoding the 80-kDa Ku polypeptide is divided into several exons by intervening sequences

  12. The protein encoded by the proto-oncogene DEK changes the topology of chromatin and reduces the efficiency of DNA replication in a chromatin-specific manner

    DEFF Research Database (Denmark)

    Alexiadis, V; Waldmann, T; Andersen, Jens S.

    2000-01-01

    The structure of chromatin regulates the genetic activity of the underlying DNA sequence. We report here that the protein encoded by the proto-oncogene DEK, which is involved in acute myelogenous leukemia, induces alterations of the superhelical density of DNA in chromatin. The change in topology...

  13. Serine Protease Variants Encoded by Echis ocellatus Venom Gland cDNA: Cloning and Sequencing Analysis

    Directory of Open Access Journals (Sweden)

    S. S. Hasson

    2010-01-01

    Full Text Available Envenoming by Echis saw-scaled viper is the leading cause of death and morbidity in Africa due to snake bite. Despite its medical importance, there have been few investigations into the toxin composition of the venom of this viper. Here, we report the cloning of cDNA sequences encoding four groups or isoforms of the haemostasis-disruptive Serine protease proteins (SPs from the venom glands of Echis ocellatus. All these SP sequences encoded the cysteine residues scaffold that form the 6-disulphide bonds responsible for the characteristic tertiary structure of venom serine proteases. All the Echis ocellatus EoSP groups showed varying degrees of sequence similarity to published viper venom SPs. However, these groups also showed marked intercluster sequence conservation across them which were significantly different from that of previously published viper SPs. Because viper venom SPs exhibit a high degree of sequence similarity and yet exert profoundly different effects on the mammalian haemostatic system, no attempt was made to assign functionality to the new Echis ocellatus EoSPs on the basis of sequence alone. The extraordinary level of interspecific and intergeneric sequence conservation exhibited by the Echis ocellatus EoSPs and analogous serine proteases from other viper species leads us to speculate that antibodies to representative molecules should neutralise (that we will exploit, by epidermal DNA immunization the biological function of this important group of venom toxins in vipers that are distributed throughout Africa, the Middle East, and the Indian subcontinent.

  14. Molecular cloning and functional analysis of the gene encoding ...

    African Journals Online (AJOL)

    Here we report for the first time the cloning of a full-length cDNA encoding GGPPS (Jc-GGPPS) from Jatropha curcas L. The full-length cDNA was 1414 base pair (bp), with an 1110-bp open reading frame (ORF) encoding a 370- amino-acids polypeptide. Bioinformatic analysis revealed that Jc-GGPPS is a member of the ...

  15. Nucleotide sequence of a human cDNA encoding a ras-related protein (rap1B)

    Energy Technology Data Exchange (ETDEWEB)

    Pizon, V; Lerosey, I; Chardin, P; Tavitian, A [INSERM, Paris (France)

    1988-08-11

    The authors have previously characterized two human ras-related genes rap1 and rap2. Using the rap1 clone as probe they isolated and sequenced a new rap cDNA encoding the 184aa rap1B protein. The rap1B protein is 95% identical to rap1 and shares several properties with the ras protein suggesting that it could bind GTP/GDP and have a membrane location. As for rap1, the structural characteristics of rap1B suggest that the rap and ras proteins might interact on the same effector.

  16. A putative peroxidase cDNA from turnip and analysis of the encoded protein sequence.

    Science.gov (United States)

    Romero-Gómez, S; Duarte-Vázquez, M A; García-Almendárez, B E; Mayorga-Martínez, L; Cervantes-Avilés, O; Regalado, C

    2008-12-01

    A putative peroxidase cDNA was isolated from turnip roots (Brassica napus L. var. purple top white globe) by reverse transcriptase-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). Total RNA extracted from mature turnip roots was used as a template for RT-PCR, using a degenerated primer designed to amplify the highly conserved distal motif of plant peroxidases. The resulting partial sequence was used to design the rest of the specific primers for 5' and 3' RACE. Two cDNA fragments were purified, sequenced, and aligned with the partial sequence from RT-PCR, and a complete overlapping sequence was obtained and labeled as BbPA (Genbank Accession No. AY423440, named as podC). The full length cDNA is 1167bp long and contains a 1077bp open reading frame (ORF) encoding a 358 deduced amino acid peroxidase polypeptide. The putative peroxidase (BnPA) showed a calculated Mr of 34kDa, and isoelectric point (pI) of 4.5, with no significant identity with other reported turnip peroxidases. Sequence alignment showed that only three peroxidases have a significant identity with BnPA namely AtP29a (84%), and AtPA2 (81%) from Arabidopsis thaliana, and HRPA2 (82%) from horseradish (Armoracia rusticana). Work is in progress to clone this gene into an adequate host to study the specific role and possible biotechnological applications of this alternative peroxidase source.

  17. Construction of adiponectin-encoding plasmid DNA and gene therapy of non-obese type 2 diabetes mellitus.

    Science.gov (United States)

    Nan, Mei Hua; Park, Jeong-Sook; Myung, Chang-Seon

    2010-01-01

    Adiponectin (ADN), an insulin-sensitizing adipokine, stimulates glucose uptake, inhibits gluconeogenesis, and plays an important role in improving insulin sensitivity. Since blood levels of ADN are low in type 2 diabetes mellitus (DM), this study was designed to investigate the therapeutic effectiveness of increasing the ADN level through injection of plasmid DNA encoding ADN in type 2 DM. A non-obese type 2 DM mouse model was established via combined administration of streptozotocin with nicotinamide and exhibited significantly higher plasma glucose concentration and insulin resistance compared with normal controls according to oral glucose tolerance and insulin challenge tests. Plasmid DNA encoding mouse ADN from differentiated NIH3T3 adipocytes was constructed in pVAX1 (pVAX/ADN). Transfection of pVAX/ADN into various cell lines including HeLa, HT22, HEK293, HepG2, and SK-Hep1 cells, increased ADN mRNA expression levels in a dose-dependent manner. The administration of pVAX/ADN into non-obese type 2 DM mice via tail vein significantly increased the blood level of ADN and decreased the plasma glucose concentration. Moreover, the parameters related to insulin resistance (HOMA-IR) and insulin sensitivity (QUICKI) were significantly improved. These results suggest that ADN gene therapy could be a clinically effective tool for the treatment of type 2 DM.

  18. Protective effect of the DNA vaccine encoding the major house dust mite allergens on allergic inflammation in the murine model of house dust mite allergy

    Directory of Open Access Journals (Sweden)

    Lee Jaechun

    2006-02-01

    Full Text Available Abstract Background Vaccination with naked DNA encoding antigen induces cellular and humoral immunity characterized by the activation of specific Th1 cells. Objective To evaluate the effects of vaccination with mixed naked DNA plasmids encoding Der p 1, Der p 2, Der p 3, Der f 1, Der f 2, and Der f 3, the major house dust mite allergens on the allergic inflammation to the whole house dust mites (HDM crude extract. Methods Three hundred micrograms of these gene mixtures were injected into muscle of BALB/c mice. Control mice were injected with the pcDNA 3.1 blank vector. After 3 weeks, the mice were actively sensitized and inhaled with the whole house dust mite extract intranasally. Results The vaccinated mice showed a significantly decreased synthesis of total and HDM-specific IgE compared with controls. Analysis of the cytokine profile of lymphocytes after challenge with HDM crude extract revealed that mRNA expression of interferon-γ was higher in the vaccinated mice than in the controls. Reduced infiltration of inflammatory cells and the prominent infiltration of CD8+ T cells were observed in histology of lung tissue from the vaccinated mice. Conclusion Vaccination with DNA encoding the major house dust mite allergens provides a promising approach for treating allergic responses to whole house dust mite allergens.

  19. Cloning, characterization and heterologous expression of epoxide hydrolase-encoding cDNA sequences from yeasts belonging to the genera Rhodotorula and Rhodosporidium

    NARCIS (Netherlands)

    Visser, H.; Weijers, C.A.G.M.; Ooyen, van A.J.J.; Verdoes, J.C.

    2002-01-01

    Epoxide hydrolase-encoding cDNA sequences were isolated from the basidiomycetous yeast species Rhodosporidium toruloides CBS 349, Rhodosporidium toruloides CBS 14 and Rhodotorula araucariae CBS 6031 in order to evaluate the molecular data and potential application of this type of enzymes. The

  20. Characterization of cDNA encoding molt-inhibiting hormone of the crab, Cancer pagurus; expression of MIH in non-X-organ tissues.

    Science.gov (United States)

    Lu, W; Wainwright, G; Olohan, L A; Webster, S G; Rees, H H; Turner, P C

    2001-10-31

    Synthesis of ecdysteroids (molting hormones) by crustacean Y-organs is regulated by a neuropeptide, molt-inhibiting hormone (MIH), produced in eyestalk neural ganglia. We report here the molecular cloning of a cDNA encoding MIH of the edible crab, Cancer pagurus. Full-length MIH cDNA was obtained by using reverse transcription-polymerase chain reaction (RT-PCR) with degenerate oligonucleotides based upon the amino acid sequence of MIH, in conjunction with 5'- and 3'-RACE. Full-length clones of MIH cDNA were obtained that encoded a 35 amino acid putative signal peptide and the mature 78 amino acid peptide. Of various tissues examined by Northern blot analysis, the X-organ was the sole major site of expression of the MIH gene. However, a nested-PCR approach using non-degenerate MIH-specific primers indicated the presence of MIH transcripts in other tissues. Southern blot analysis indicated a simple gene arrangement with at least two copies of the MIH gene in the genome of C. pagurus. Additional Southern blotting experiments detected MIH-hybridizing bands in another Cancer species, Cancer antennarius and another crab species, Carcinus maenas.

  1. Cloning and characterization of cDNAs encoding the complete sequence of decay-accelerating factor of human complement

    International Nuclear Information System (INIS)

    Medof, M.E.; Lublin, D.M.; Holers, V.M.; Ayers, D.J.; Getty, R.R.; Leykam, J.F.; Atkinson, J.P.; Tykocinski, M.L.

    1987-01-01

    cDNAs encoding the complement decay-accelerating factor (DAF) were isolated from HeLa and differentiated HL-60 λgt cDNA libraries by screening with a codon preference oligonucleotide corresponding to DAF NH 2 -terminal amino acids 3-14. The composite cDNA sequence showed a 347-amino acid protein preceded by an NH 2 -terminal leader peptide sequence. The translated sequence beginning at the DAF NH 2 terminus encodes four contiguous ≅ 61-amino acid long repetitive units of internal homology. The repetitive regions contain four conserved cysteines, one proline, one glycine, one glycine/alanine, four leucines/isoleucines/valines, one serine, three tyrosines/phenylalanines, and on tryptophan and show striking homology to similar regions previously identified in factor B, C2, C4 binding protein, factor H, C1r, factor XIII, interleukin 2 receptor, and serum β 2 -glycoprotein I. The consensus repeats are attached to a 70-amino acid long segment rich in serine and threonine (potential O-glycosylation sites), which is in turn followed by a stretch of hydrophobic amino acids. RNA blot analysis of HeLa and HL-60 RNA revealed three DAF mRNA species of 3.1, 2.7, and 2.0 kilobases. The results indicate that portions of the DAF gene may have evolved from a DNA element common to the above proteins, that DAF cDNA predicts a COOH-terminal anchoring polypeptide, and that distinct species of DAF message are elaborated in cells

  2. Quantitative PCR is a Valuable Tool to Monitor the Performance of DNA-Encoded Chemical Library Selections.

    Science.gov (United States)

    Li, Yizhou; Zimmermann, Gunther; Scheuermann, Jörg; Neri, Dario

    2017-05-04

    Phage-display libraries and DNA-encoded chemical libraries (DECLs) represent useful tools for the isolation of specific binding molecules from large combinatorial sets of compounds. With both methods, specific binders are recovered at the end of affinity capture procedures by using target proteins of interest immobilized on a solid support. However, although the efficiency of phage-display selections is routinely quantified by counting the phage titer before and after the affinity capture step, no similar quantification procedures have been reported for the characterization of DECL selections. In this article, we describe the potential and limitations of quantitative PCR (qPCR) methods for the evaluation of selection efficiency by using a combinatorial chemical library with more than 35 million compounds. In the experimental conditions chosen for the selections, a quantification of DNA input/recovery over five orders of magnitude could be performed, revealing a successful enrichment of abundant binders, which could be confirmed by DNA sequencing. qPCR provided rapid information about the performance of selections, thus facilitating the optimization of experimental conditions. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Viruses Infecting a Freshwater Filamentous Cyanobacterium (Nostoc sp.) Encode a Functional CRISPR Array and a Proteobacterial DNA Polymerase B.

    Science.gov (United States)

    Chénard, Caroline; Wirth, Jennifer F; Suttle, Curtis A

    2016-06-14

    Here we present the first genomic characterization of viruses infecting Nostoc, a genus of ecologically important cyanobacteria that are widespread in freshwater. Cyanophages A-1 and N-1 were isolated in the 1970s and infect Nostoc sp. strain PCC 7210 but remained genomically uncharacterized. Their 68,304- and 64,960-bp genomes are strikingly different from those of other sequenced cyanophages. Many putative genes that code for proteins with known functions are similar to those found in filamentous cyanobacteria, showing a long evolutionary history in their host. Cyanophage N-1 encodes a CRISPR array that is transcribed during infection and is similar to the DR5 family of CRISPRs commonly found in cyanobacteria. The presence of a host-related CRISPR array in a cyanophage suggests that the phage can transfer the CRISPR among related cyanobacteria and thereby provide resistance to infection with competing phages. Both viruses also encode a distinct DNA polymerase B that is closely related to those found in plasmids of Cyanothece sp. strain PCC 7424, Nostoc sp. strain PCC 7120, and Anabaena variabilis ATCC 29413. These polymerases form a distinct evolutionary group that is more closely related to DNA polymerases of proteobacteria than to those of other viruses. This suggests that the polymerase was acquired from a proteobacterium by an ancestral virus and transferred to the cyanobacterial plasmid. Many other open reading frames are similar to a prophage-like element in the genome of Nostoc sp. strain PCC 7524. The Nostoc cyanophages reveal a history of gene transfers between filamentous cyanobacteria and their viruses that have helped to forge the evolutionary trajectory of this previously unrecognized group of phages. Filamentous cyanobacteria belonging to the genus Nostoc are widespread and ecologically important in freshwater, yet little is known about the genomic content of their viruses. Here we report the first genomic analysis of cyanophages infecting

  4. Molecular cloning and nucleotide sequence of cDNA for human liver arginase

    International Nuclear Information System (INIS)

    Haraguchi, Y.; Takiguchi, M.; Amaya, Y.; Kawamoto, S.; Matsuda, I.; Mori, M.

    1987-01-01

    Arginase (EC3.5.3.1) catalyzes the last step of the urea cycle in the liver of ureotelic animals. Inherited deficiency of the enzyme results in argininemia, an autosomal recessive disorder characterized by hyperammonemia. To facilitate investigation of the enzyme and gene structures and to elucidate the nature of the mutation in argininemia, the authors isolated cDNA clones for human liver arginase. Oligo(dT)-primed and random primer human liver cDNA libraries in λ gt11 were screened using isolated rat arginase cDNA as a probe. Two of the positive clones, designated λ hARG6 and λ hARG109, contained an overlapping cDNA sequence with an open reading frame encoding a polypeptide of 322 amino acid residues (predicted M/sub r/, 34,732), a 5'-untranslated sequence of 56 base pairs, a 3'-untranslated sequence of 423 base pairs, and a poly(A) segment. Arginase activity was detected in Escherichia coli cells transformed with the plasmid carrying λ hARG6 cDNA insert. RNA gel blot analysis of human liver RNA showed a single mRNA of 1.6 kilobases. The predicted amino acid sequence of human liver arginase is 87% and 41% identical with those of the rat liver and yeast enzymes, respectively. There are several highly conserved segments among the human, rat, and yeast enzymes

  5. ENCODE: A Sourcebook of Epigenomes and Chromatin Language

    Directory of Open Access Journals (Sweden)

    Maryam Yavartanoo

    2013-03-01

    Full Text Available Until recently, since the Human Genome Project, the general view has been that the majority of the human genome is composed of junk DNA and has little or no selective advantage to the organism. Now we know that this conclusion is an oversimplification. In April 2003, the National Human Genome Research Institute (NHGRI launched an international research consortium called Encyclopedia of DNA Elements (ENCODE to uncover non-coding functional elements in the human genome. The result of this project has identified a set of new DNA regulatory elements, based on novel relationships among chromatin accessibility, histone modifications, nucleosome positioning, DNA methylation, transcription, and the occupancy of sequence-specific factors. The project gives us new insights into the organization and regulation of the human genome and epigenome. Here, we sought to summarize particular aspects of the ENCODE project and highlight the features and data that have recently been released. At the end of this review, we have summarized a case study we conducted using the ENCODE epigenome data.

  6. Assessment of a DNA vaccine encoding an anchored-glycosylphosphatidylinositol tegumental antigen complexed to protamine sulphate on immunoprotection against murine schistosomiasis

    Directory of Open Access Journals (Sweden)

    Eduardo JM Nascimento

    2007-02-01

    Full Text Available Protamine sulphate/DNA complexes have been shown to protect DNA from DNase digestion in a lipid system for gene transfer. A DNA-based vaccine complexed to protamine sulphate was used to induce an immune response against Schistosoma mansoni anchored-glycosylphosphatidylinositol tegumental antigen in BALB/c mice. The protection elicited ranged from 33 to 44%. The spectrum of the elicited immune response induced by the vaccine formulation without protamine was characterized by a high level of IgG (IgG1> IgG2a. Protamine sulphate added to the DNA vaccine formulation retained the green fluorescent protein encoding-plasmid longer in muscle and spleen. The experiments in vivo showed that under protamine sulphate effect, the scope of protection remained unchanged, but a modulation in antibody production (IgG1= IgG2a was observed.

  7. The most conserved genome segments for life detection on Earth and other planets.

    Science.gov (United States)

    Isenbarger, Thomas A; Carr, Christopher E; Johnson, Sarah Stewart; Finney, Michael; Church, George M; Gilbert, Walter; Zuber, Maria T; Ruvkun, Gary

    2008-12-01

    On Earth, very simple but powerful methods to detect and classify broad taxa of life by the polymerase chain reaction (PCR) are now standard practice. Using DNA primers corresponding to the 16S ribosomal RNA gene, one can survey a sample from any environment for its microbial inhabitants. Due to massive meteoritic exchange between Earth and Mars (as well as other planets), a reasonable case can be made for life on Mars or other planets to be related to life on Earth. In this case, the supremely sensitive technologies used to study life on Earth, including in extreme environments, can be applied to the search for life on other planets. Though the 16S gene has become the standard for life detection on Earth, no genome comparisons have established that the ribosomal genes are, in fact, the most conserved DNA segments across the kingdoms of life. We present here a computational comparison of full genomes from 13 diverse organisms from the Archaea, Bacteria, and Eucarya to identify genetic sequences conserved across the widest divisions of life. Our results identify the 16S and 23S ribosomal RNA genes as well as other universally conserved nucleotide sequences in genes encoding particular classes of transfer RNAs and within the nucleotide binding domains of ABC transporters as the most conserved DNA sequence segments across phylogeny. This set of sequences defines a core set of DNA regions that have changed the least over billions of years of evolution and provides a means to identify and classify divergent life, including ancestrally related life on other planets.

  8. Prioritizing multiple therapeutic targets in parallel using automated DNA-encoded library screening

    Science.gov (United States)

    Machutta, Carl A.; Kollmann, Christopher S.; Lind, Kenneth E.; Bai, Xiaopeng; Chan, Pan F.; Huang, Jianzhong; Ballell, Lluis; Belyanskaya, Svetlana; Besra, Gurdyal S.; Barros-Aguirre, David; Bates, Robert H.; Centrella, Paolo A.; Chang, Sandy S.; Chai, Jing; Choudhry, Anthony E.; Coffin, Aaron; Davie, Christopher P.; Deng, Hongfeng; Deng, Jianghe; Ding, Yun; Dodson, Jason W.; Fosbenner, David T.; Gao, Enoch N.; Graham, Taylor L.; Graybill, Todd L.; Ingraham, Karen; Johnson, Walter P.; King, Bryan W.; Kwiatkowski, Christopher R.; Lelièvre, Joël; Li, Yue; Liu, Xiaorong; Lu, Quinn; Lehr, Ruth; Mendoza-Losana, Alfonso; Martin, John; McCloskey, Lynn; McCormick, Patti; O'Keefe, Heather P.; O'Keeffe, Thomas; Pao, Christina; Phelps, Christopher B.; Qi, Hongwei; Rafferty, Keith; Scavello, Genaro S.; Steiginga, Matt S.; Sundersingh, Flora S.; Sweitzer, Sharon M.; Szewczuk, Lawrence M.; Taylor, Amy; Toh, May Fern; Wang, Juan; Wang, Minghui; Wilkins, Devan J.; Xia, Bing; Yao, Gang; Zhang, Jean; Zhou, Jingye; Donahue, Christine P.; Messer, Jeffrey A.; Holmes, David; Arico-Muendel, Christopher C.; Pope, Andrew J.; Gross, Jeffrey W.; Evindar, Ghotas

    2017-07-01

    The identification and prioritization of chemically tractable therapeutic targets is a significant challenge in the discovery of new medicines. We have developed a novel method that rapidly screens multiple proteins in parallel using DNA-encoded library technology (ELT). Initial efforts were focused on the efficient discovery of antibacterial leads against 119 targets from Acinetobacter baumannii and Staphylococcus aureus. The success of this effort led to the hypothesis that the relative number of ELT binders alone could be used to assess the ligandability of large sets of proteins. This concept was further explored by screening 42 targets from Mycobacterium tuberculosis. Active chemical series for six targets from our initial effort as well as three chemotypes for DHFR from M. tuberculosis are reported. The findings demonstrate that parallel ELT selections can be used to assess ligandability and highlight opportunities for successful lead and tool discovery.

  9. Bacteriophage T5 encodes a homolog of the eukaryotic transcription coactivator PC4 implicated in recombination-dependent DNA replication.

    Science.gov (United States)

    Steigemann, Birthe; Schulz, Annina; Werten, Sebastiaan

    2013-11-15

    The RNA polymerase II cofactor PC4 globally regulates transcription of protein-encoding genes through interactions with unwinding DNA, the basal transcription machinery and transcription activators. Here, we report the surprising identification of PC4 homologs in all sequenced representatives of the T5 family of bacteriophages, as well as in an archaeon and seven phyla of eubacteria. We have solved the crystal structure of the full-length T5 protein at 1.9Å, revealing a striking resemblance to the characteristic single-stranded DNA (ssDNA)-binding core domain of PC4. Intriguing novel structural features include a potential regulatory region at the N-terminus and a C-terminal extension of the homodimerisation interface. The genome organisation of T5-related bacteriophages points at involvement of the PC4 homolog in recombination-dependent DNA replication, strongly suggesting that the protein corresponds to the hitherto elusive replicative ssDNA-binding protein of the T5 family. Our findings imply that PC4-like factors intervene in multiple unwinding-related processes by acting as versatile modifiers of nucleic acid conformation and raise the possibility that the eukaryotic transcription coactivator derives from ancestral DNA replication, recombination and repair factors. © 2013.

  10. Directed PCR-free engineering of highly repetitive DNA sequences

    Directory of Open Access Journals (Sweden)

    Preissler Steffen

    2011-09-01

    Full Text Available Abstract Background Highly repetitive nucleotide sequences are commonly found in nature e.g. in telomeres, microsatellite DNA, polyadenine (poly(A tails of eukaryotic messenger RNA as well as in several inherited human disorders linked to trinucleotide repeat expansions in the genome. Therefore, studying repetitive sequences is of biological, biotechnological and medical relevance. However, cloning of such repetitive DNA sequences is challenging because specific PCR-based amplification is hampered by the lack of unique primer binding sites resulting in unspecific products. Results For the PCR-free generation of repetitive DNA sequences we used antiparallel oligonucleotides flanked by restriction sites of Type IIS endonucleases. The arrangement of recognition sites allowed for stepwise and seamless elongation of repetitive sequences. This facilitated the assembly of repetitive DNA segments and open reading frames encoding polypeptides with periodic amino acid sequences of any desired length. By this strategy we cloned a series of polyglutamine encoding sequences as well as highly repetitive polyadenine tracts. Such repetitive sequences can be used for diverse biotechnological applications. As an example, the polyglutamine sequences were expressed as His6-SUMO fusion proteins in Escherichia coli cells to study their aggregation behavior in vitro. The His6-SUMO moiety enabled affinity purification of the polyglutamine proteins, increased their solubility, and allowed controlled induction of the aggregation process. We successfully purified the fusions proteins and provide an example for their applicability in filter retardation assays. Conclusion Our seamless cloning strategy is PCR-free and allows the directed and efficient generation of highly repetitive DNA sequences of defined lengths by simple standard cloning procedures.

  11. scsB, a cDNA encoding the hydrogenosomal beta subunit of succinyl-CoA synthetase from the anaerobic fungus Neocallimastix frontalis

    NARCIS (Netherlands)

    Brondijk, THC; Durand, R; vanderGiezen, M; Gottschal, JC; Prins, RA; Fevre, M

    1996-01-01

    A clone containing a Neocallimastix frontalis cDNA assumed to encode the beta subunit of succinyl-CoA synthetase (SCSB) was identified by sequence homology with prokaryotic and eukaryotic counterparts. An open reading frame of 1311 bp was found. The deduced 437 amino acid sequence showed a high

  12. Safety and immunogenicity of a novel therapeutic DNA vaccine encoding chicken type II collagen for rheumatoid arthritis in normal rats.

    Science.gov (United States)

    Juan, Long; Xiao, Zhao; Song, Yun; Zhijian, Zhang; Jing, Jin; Kun, Yu; Yuna, Hao; Dongfa, Dai; Lili, Ding; Liuxin, Tan; Fei, Liang; Nan, Liu; Fang, Yuan; Yuying, Sun; Yongzhi, Xi

    2015-01-01

    Current clinically available treatments for rheumatoid arthritis (RA) fail to cure the disease or unsatisfactorily halt disease progression. To overcome these limitations, the development of therapeutic DNA vaccines and boosters may offer new promising strategies. Because type II collagen (CII) as a critical autoantigen in RA and native chicken type II collagen (nCCII) has been used to effectively treat RA, we previously developed a novel therapeutic DNA vaccine encoding CCII (pcDNA-CCOL2A1) with efficacy comparable to that of the current "gold standard", methotrexate(MTX). Here, we systemically evaluated the safety and immunogenicity of the pcDNA-CCOL2A1 vaccine in normal Wistar rats. Group 1 received only a single intramuscular injection into the hind leg with pcDNA-CCOL2A1 at the maximum dosage of 3 mg/kg on day 0; Group 2 was injected with normal saline (NS) as a negative control. All rats were monitored daily for any systemic adverse events, reactions at the injection site, and changes in body weights. Plasma and tissues from all experimental rats were collected on day 14 for routine examinations of hematology and biochemistry parameters, anti-CII IgG antibody reactivity, and histopathology. Our results indicated clearly that at the maximum dosage of 3 mg/kg, the pcDNA-CCOL2A1 vaccine was safe and well-tolerated. No abnormal clinical signs or deaths occurred in the pcDNA-CCOL2A1 group compared with the NS group. Furthermore, no major alterations were observed in hematology, biochemistry, and histopathology, even at the maximum dose. In particularly, no anti-CII IgG antibodies were detected in vaccinated normal rats at 14 d after vaccination; this was relevant because we previously demonstrated that the pcDNA-CCOL2A1 vaccine, when administered at the therapeutic dosage of 300 μg/kg alone, did not induce anti-CII IgG antibody production and significantly reduced levels of anti-CII IgG antibodies in the plasma of rats with established collagen-induced arthritis

  13. The yeast Saccharomyces cerevisiae DNA polymerase IV: possible involvement in double strand break DNA repair.

    OpenAIRE

    Leem, S H; Ropp, P A; Sugino, A

    1994-01-01

    We identified and purified a new DNA polymerase (DNA polymerase IV), which is similar to mammalian DNA polymerase beta, from Saccharomyces cerevisiae and suggested that it is encoded by YCR14C (POLX) on chromosome III. Here, we provided a direct evidence that the purified DNA polymerase IV is indeed encoded by POLX. Strains harboring a pol4 deletion mutation exhibit neither mitotic growth defect nor a meiosis defect, suggesting that DNA polymerase IV participates in nonessential functions in ...

  14. Generation of a genetically encoded marker of rod photoreceptor outer segment growth and renewal

    Directory of Open Access Journals (Sweden)

    John J. Willoughby

    2011-10-01

    Vertebrate photoreceptors are specialized light sensing neurons. The photoreceptor outer segment is a highly modified cilium where photons of light are transduced into a chemical and electrical signal. The outer segment has the typical cilary axoneme but, in addition, it has a large number of densely packed, stacked, intramembranous discs. The molecular and cellular mechanisms that contribute to vertebrate photoreceptor outer segment morphogenesis are still largely unknown. Unlike typical cilia, the outer segment is continuously regenerated or renewed throughout the life of the animal through the combined process of distal outer segment shedding and proximal outer segment growth. The process of outer segment renewal was discovered over forty years ago, but we still lack an understanding of how photoreceptors renew their outer segments and few, if any, molecular mechanisms that regulate outer segment growth or shedding have been described. Our lack of progress in understanding how photoreceptors renew their outer segments has been hampered by the difficulty in measuring rates of renewal. We have created a new method that uses heat-shock induction of a fluorescent protein that can be used to rapidly measure outer segment growth rates. We describe this method, the stable transgenic line we created, and the growth rates observed in larval and adult rod photoreceptors using this new method. This new method will allow us to begin to define the genetic and molecular mechanisms that regulate rod outer segment renewal, a crucial aspect of photoreceptor function and, possibly, viability.

  15. MicroRNA expression in rainbow trout (Oncorhynchus mykiss) vaccinated with a DNA vaccine encoding the glycoprotein gene of Viral hemorrhagic septicemia virus

    DEFF Research Database (Denmark)

    Bela-Ong, Dennis; Schyth, Brian Dall; Lorenzen, Niels

    particularly to sea-farmed rainbow trout and thus necessitates strategies to mitigate potential disease outbreaks. A DNA vaccine encoding the glycoprotein gene of VHSV has been developed and shown to elicit protective immune responses in laboratory trials. It is important to identify key factors as biomarkers...

  16. Induction of cytotoxic T-cell responses by gene gun DNA vaccination with minigenes encoding influenza A virus HA and NP CTL-epitopes

    DEFF Research Database (Denmark)

    Fomsgaard, A; Nielsen, H V; Kirkby, N

    1999-01-01

    degree of controllability. We have examined the induction of murine CTL's by this approach using DNA plasmid minigene vaccines encoding known mouse K(k) minimal CTL epitopes (8 amino acids) from the influenza A virus hemagglutinin and nucleoprotein. We here report that such an approach is feasible...

  17. Efficacy of DNA vaccine encoding koi herpesvirus glycoprotein GP-25in common carp juvenile by immersion

    Directory of Open Access Journals (Sweden)

    Soko Nuswantoro

    2013-11-01

    Full Text Available Koi herpesvirus (KHV is a herpesvirus that particularly infects and causes mass mortality to koi and common carp. Therefore, the protection of common carp from KHV infection is urgently needed. In this study, we developed an application of DNA vaccine encoding KHV glycoprotein-25 by immersion method to increase survival of common carp against KHV infection. A total of 400 common carp juveniles at 30-day-old were immersed in 1-L water containing 1.3×108CFU/mL of the killed Escherichia coli cells carrying DNA vaccine. Three frequencies and three duration of fish immersion were tested, namely: 1×30 minutes, 1×60 minutes, 1× 90 minutes, 2×90 minutes and 3×90 minutes by interval of 24 hours. Reversetranscription polymerase chain reaction analysis showed that DNA vaccine was successfully expressed in the vaccinated fish. Fish at twenty eight days post vaccination were challenged by injecting 10-4 mL of KHV per fish. The result showed that vaccination by 1×30 minutes immersion allowed 61% of fish survived, and this was significantly higher (p<0.05 compared to control (without vaccination, but it was similar among vaccination treatments (p>0.05. The relative percent survival of vaccinated fish were also similar among treatments (p>0.05. DNA vaccination has increased fish survival about two fold higher compared to unvaccinated fish control (26.67%. Thus, DNA vaccination was effectively delivered by immersion for 1×30 minutes, and this technique can be useful to level up the resistance of common carp juveniles against KHV infection. Keywords: DNA vaccine, KHV, glycoprotein, immersion, common carp

  18. Isolation and sequence of cDNA encoding a cytochrome P-450 from an insecticide-resistant strain of the house fly, Musca domestica.

    OpenAIRE

    Feyereisen, R; Koener, J F; Farnsworth, D E; Nebert, D W

    1989-01-01

    A cDNA expression library from phenobarbital-treated house fly (Musca domestica) was screened with rabbit antisera directed against partially purified house fly cytochrome P-450. Two overlapping clones with insert lengths of 1.3 and 1.5 kilobases were isolated. The sequence of a 1629-base-pair (bp) cDNA was obtained, with an open reading frame (nucleotides 81-1610) encoding a P-450 protein of 509 residues (Mr = 58,738). The insect P-450 protein contains a hydrophobic NH2 terminus and a 22-res...

  19. Molecular phylogeny of grey mullets (Teleostei: Mugilidae) in Greece: evidence from sequence analysis of mtDNA segments.

    Science.gov (United States)

    Papasotiropoulos, Vasilis; Klossa-Kilia, Elena; Alahiotis, Stamatis N; Kilias, George

    2007-08-01

    Mitochondrial DNA sequence analysis has been used to explore genetic differentiation and phylogenetic relationships among five species of the Mugilidae family, Mugil cephalus, Chelon labrosus, Liza aurata, Liza ramada, and Liza saliens. DNA was isolated from samples originating from the Messolongi Lagoon in Greece. Three mtDNA segments (12s rRNA, 16s rRNA, and CO I) were PCR amplified and sequenced. Sequencing analysis revealed that the greatest genetic differentiation was observed between M. cephalus and all the other species studied, while C. labrosus and L. aurata were the closest taxa. Dendrograms obtained by the neighbor-joining method and Bayesian inference analysis exhibited the same topology. According to this topology, M. cephalus is the most distinct species and the remaining taxa are clustered together, with C. labrosus and L. aurata forming a single group. The latter result brings into question the monophyletic origin of the genus Liza.

  20. A model for the mechanism of strand passage by DNA gyrase

    DEFF Research Database (Denmark)

    Kampranis, S C; Bates, A D; Maxwell, A

    1999-01-01

    this mechanism by probing the topology of the bound DNA segment at distinct steps of the catalytic cycle. We propose a model in which gyrase captures a contiguous DNA segment with high probability, irrespective of the superhelical density of the DNA substrate, setting up an equilibrium of the transported segment......The mechanism of type II DNA topoisomerases involves the formation of an enzyme-operated gate in one double-stranded DNA segment and the passage of another segment through this gate. DNA gyrase is the only type II topoisomerase able to introduce negative supercoils into DNA, a feature that requires...... the enzyme to dictate the directionality of strand passage. Although it is known that this is a consequence of the characteristic wrapping of DNA by gyrase, the detailed mechanism by which the transported DNA segment is captured and directed through the DNA gate is largely unknown. We have addressed...

  1. The ada operon of Mycobacterium tuberculosis encodes two DNA methyltransferases for inducible repair of DNA alkylation damage.

    Science.gov (United States)

    Yang, Mingyi; Aamodt, Randi M; Dalhus, Bjørn; Balasingham, Seetha; Helle, Ina; Andersen, Pernille; Tønjum, Tone; Alseth, Ingrun; Rognes, Torbjørn; Bjørås, Magnar

    2011-06-10

    The ada operon of Mycobacterium tuberculosis, which encodes a composite protein of AdaA and AlkA and a separate AdaB/Ogt protein, was characterized. M. tuberculosis treated with N-methyl-N'-nitro-N-nitrosoguanidine induced transcription of the adaA-alkA and adaB genes, suggesting that M. tuberculosis mount an inducible response to methylating agents. Survival assays of the methyltransferase defective Escherichia coli mutant KT233 (ada ogt), showed that expression of the adaB gene rescued the alkylation sensitivity. Further, adaB but not adaA-alkA complemented the hypermutator phenotype of KT233. Purified AdaA-AlkA and AdaB possessed methyltransferase activity. These data suggested that AdaB counteract the cytotoxic and mutagenic effect of O(6)-methylguanine, while AdaA-AlkA most likely transfers methyl groups from innocuous methylphosphotriesters. AdaA-AlkA did not possess alkylbase DNA glycosylase activity nor rescue the alkylation sensitivity of the E. coli mutant BK2118 (tag alkA). We propose that AdaA-AlkA is a positive regulator of the adaptive response in M. tuberculosis. It thus appears that the ada operon of M. tuberculosis suppresses the mutagenic effect of alkylation but not the cytotoxic effect of lesions such as 3-methylpurines. Collectively, these data indicate that M. tuberculosis hypermutator strains with defective adaptive response genes might sustain robustness to cytotoxic alkylation DNA damage and confer a selective advantage contributing to host adaptation. Copyright © 2011 Elsevier B.V. All rights reserved.

  2. Characterization of the cDNA encoding a BPI/LBP homologue in venom gland of the hundred-pace snake Deinagkistrodon acutus

    Directory of Open Access Journals (Sweden)

    Jianrao HU, Mingfu CAO, Jiong Chen

    2009-10-01

    Full Text Available Bactericidal/permeability-increasing protein (BPI and LPS-binding protein (LBP play an important role in host defence. Current evidence shows that BPI/LBP may be widely existed in different cells and tissue types of animals. A full-length cDNA clone encoding a BPI/LBP homologue (dBPI, 1757bp in size, was characterized in venom gland of the hundred-pace snake Deinagkistrodon acutus. Its deduced amino acid sequence of 417 residues had 13.8%–21.5% identity to BPI like 1(BPIL1 and BPI like 3(BPIL3 of other animals. Conserved cysteine residues which are involved in disulfide bond formation between the final strand of the N-terminal beta sheet and the long alpha helix of BPI are identified as Cys146-Cys183 of dBPI. Phylogenetic tree analysis showed that the BPI/LBP homologues formed five large clusters and dBPI was in a large cluster including BPIL1 and BPIL3. dBPI mRNA shows a tissue specific expression in venom gland. This is the first study to identify the cDNA encoding BPI/LBP homologues from reptiles [Current Zoology 55 (5: –2009].

  3. Diverse replication-associated protein encoding circular DNA viruses in guano samples of Central-Eastern European bats.

    Science.gov (United States)

    Kemenesi, Gábor; Kurucz, Kornélia; Zana, Brigitta; Földes, Fanni; Urbán, Péter; Vlaschenko, Anton; Kravchenko, Kseniia; Budinski, Ivana; Szodoray-Parádi, Farkas; Bücs, Szilárd; Jére, Csaba; Csősz, István; Szodoray-Parádi, Abigél; Estók, Péter; Görföl, Tamás; Boldogh, Sándor; Jakab, Ferenc

    2018-03-01

    Circular replication-associated protein encoding single-stranded DNA (CRESS DNA) viruses are increasingly recognized worldwide in a variety of samples. Representative members include well-described veterinary pathogens with worldwide distribution, such as porcine circoviruses or beak and feather disease virus. In addition, numerous novel viruses belonging to the family Circoviridae with unverified pathogenic roles have been discovered in different human samples. Viruses of the family Genomoviridae have also been described as being highly abundant in different faecal and environmental samples, with case reports showing them to be suspected pathogens in human infections. In order to investigate the genetic diversity of these viruses in European bat populations, we tested guano samples from Georgia, Hungary, Romania, Serbia and Ukraine. This resulted in the detection of six novel members of the family Circoviridae and two novel members of the family Genomoviridae. Interestingly, a gemini-like virus, namely niminivirus, which was originally found in raw sewage samples in Nigeria, was also detected in our samples. We analyzed the nucleotide composition of members of the family Circoviridae to determine the possible host origins of these viruses. This study provides the first dataset on CRESS DNA viruses of European bats, and members of several novel viral species were discovered.

  4. Cloning and molecular characterization of the salt-regulated jojoba ScRab cDNA encoding a small GTP-binding protein.

    Science.gov (United States)

    Mizrahi-Aviv, Ela; Mills, David; Benzioni, Aliza; Bar-Zvi, Dudy

    2002-10-01

    Salt stress results in a massive change in gene expression. An 837 bp cDNA designated ScRab was cloned from shoot cultures of the salt tolerant jojoba (Simmondsia chinesis). The cloned cDNA encodes a full length 200 amino acid long polypeptide that bears high homology to the Rab subfamily of small GTP binding proteins, particularly, the Rab5 subfamily. ScRab expression is reduced in shoots grown in the presence of salt compared to shoots from non-stressed cultures. His6-tagged ScRAB protein was expressed in E. coli, and purified to homogeneity. The purified protein bound radiolabelled GTP. The unlabelled guanine nucleotides GTP, GTP gamma S and GDP but not ATP, CTP or UTP competed with GTP binding.

  5. A combined approach of hollow microneedles and nanocarriers for skin immunization with plasmid DNA encoding ovalbumin

    Directory of Open Access Journals (Sweden)

    Pamornpathomkul B

    2017-01-01

    Full Text Available Boonnada Pamornpathomkul,1 Adisak Wongkajornsilp,2 Wanida Laiwattanapaisal,3 Theerasak Rojanarata,1 Praneet Opanasopit,1 Tanasait Ngawhirunpat1 1Department of Pharmaceutical Technology, Faculty of Pharmacy, Pharmaceutical Development of Green Innovations Group, Silpakorn University, Nakhon Pathom, 2Department of Pharmacology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, 3Department of Clinical Chemistry, Faculty of Allied Health Sciences, Chulalongkorn University, Bangkok, Thailand Abstract: The aim of this study was to investigate the use of different types of microneedles (MNs and nanocarriers for in vitro skin permeation and in vivo immunization of plasmid DNA encoding ovalbumin (pOVA. In vitro skin permeation studies indicated that hollow MNs had a superior enhancing effect on skin permeation compared with solid MN patches, electroporation (EP patches, the combination of MN and EP patches, and untreated skin. Upon using hollow MNs combined with nanocarriers for pOVA delivery, the skin permeation was higher than for the delivery of naked pOVA, as evidenced by the increased amount of pOVA in Franz diffusion cells and immunoglobulin G (IgG antibody responses. When the hollow MNs were used for the delivery of nanocarrier:pOVA complexes into the skin of mice, they induced a stronger IgG immune response than conventional subcutaneous (SC injections. In addition, immunization of mice with the hollow MNs did not induce signs of skin infection or pinpoint bleeding. Accordingly, the hollow MNs combined with a nanocarrier delivery system is a promising approach for delivering pOVA complexes to the skin for promoting successful immunization. Keywords: hollow microneedle, solid microneedle, electroporation, plasmid DNA encoding ovalbumin, skin immunization, nanocarrier

  6. Escherichia coli rpiA gene encoding ribose phosphate isomerase A

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne; Maigaard, Marianne

    1993-01-01

    The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...

  7. Encoded libraries of chemically modified peptides.

    Science.gov (United States)

    Heinis, Christian; Winter, Greg

    2015-06-01

    The use of powerful technologies for generating and screening DNA-encoded protein libraries has helped drive the development of proteins as pharmaceutical ligands. However the development of peptides as pharmaceutical ligands has been more limited. Although encoded peptide libraries are typically several orders of magnitude larger than classical chemical libraries, can be more readily screened, and can give rise to higher affinity ligands, their use as pharmaceutical ligands is limited by their intrinsic properties. Two of the intrinsic limitations include the rotational flexibility of the peptide backbone and the limited number (20) of natural amino acids. However these limitations can be overcome by use of chemical modification. For example, the libraries can be modified to introduce topological constraints such as cyclization linkers, or to introduce new chemical entities such as small molecule ligands, fluorophores and photo-switchable compounds. This article reviews the chemistry involved, the properties of the peptide ligands, and the new opportunities offered by chemical modification of DNA-encoded peptide libraries. Copyright © 2015. Published by Elsevier Ltd.

  8. A strategy for genetic modification of the spike-encoding segment of human reovirus T3D for reovirus targeting.

    Science.gov (United States)

    van den Wollenberg, D J M; van den Hengel, S K; Dautzenberg, I J C; Cramer, S J; Kranenburg, O; Hoeben, R C

    2008-12-01

    Human Orthoreovirus Type 3 Dearing is not pathogenic to humans and has been evaluated clinically as an oncolytic agent. Its transduction efficiency and the tumor cell selectivity may be enhanced by incorporating ligands for alternative receptors. However, the genetic modification of reoviruses has been difficult, and genetic targeting of reoviruses has not been reported so far. Here we describe a technique for generating genetically targeted reoviruses. The propagation of wild-type reoviruses on cells expressing a modified sigma 1-encoding segment embedded in a conventional RNA polymerase II transcript leads to substitution of the wild-type genome segment by the modified version. This technique was used for generating reoviruses that are genetically targeted to an artificial receptor expressed on U118MG cells. These cells lack the junction adhesion molecule-1 and therefore resist infection by wild-type reoviruses. The targeted reoviruses were engineered to carry the ligand for this receptor at the C terminus of the sigma 1 spike protein. This demonstrates that the C terminus of the sigma 1 protein is a suitable locale for the insertion of oligopeptide ligands and that targeting of reoviruses is feasible. The genetically targeted viruses can be propagated using the modified U118MG cells as helper cells. This technique may be applicable for the improvement of human reoviruses as oncolytic agents.

  9. Thioredoxin suppresses microscopic hopping of T7 DNA polymerase on duplex DNA

    NARCIS (Netherlands)

    Etson, Candice M.; Hamdan, Samir M.; Richardson, Charles C.; Oijen, Antoine M. van; Richardson, Charles C.

    2010-01-01

    The DNA polymerases involved in DNA replication achieve high processivity of nucleotide incorporation by forming a complex with processivity factors. A model system for replicative DNA polymerases, the bacteriophage T7 DNA polymerase (gp5), encoded by gene 5, forms a tight, 1:1 complex with

  10. cDNA cloning of human DNA topoisomerase I. Catalytic activity of a 67.7-kDa carboxyl-terminal fragment

    International Nuclear Information System (INIS)

    D'Arpa, P.; Machlin, P.S.; Ratrie, H. III; Rothfield, N.F.; Cleveland, D.W.; Earnshaw, W.C.

    1988-01-01

    cDNA clones encoding human topoisomerase I were isolated from an expression vector library (λgt11) screened with autoimmune anti-topoisomerase I serum. One of these clones has been expressed as a fusion protein comprised of a 32-kDa fragment of the bacterial TrpE protein linked to 67.7 kDa of protein encoded by the cDNA. Three lines of evidence indicate that the cloned cDNA encodes topoisomerase I. (i) Proteolysis maps of the fusion protein and human nuclear topoisomerase I are essentially identical. (ii) The fusion protein relaxes supercoiled DNA, an activity that can be immunoprecipitated by anti-topoisomerase I serum. (iii) Sequence analysis has revealed that the longest cDNA clone (3645 base pairs) encodes a protein of 765 amino acids that shares 42% identity with Saccharomyces cerevisiae topoisomerase I. The sequence data also show that the catalytically active 67.7-kDa fragment is comprised of the carboxyl terminus

  11. DNA-Compatible Nitro Reduction and Synthesis of Benzimidazoles.

    Science.gov (United States)

    Du, Huang-Chi; Huang, Hongbing

    2017-10-18

    DNA-encoded chemical libraries have emerged as a cost-effective alternative to high-throughput screening (HTS) for hit identification in drug discovery. A key factor for productive DNA-encoded libraries is the chemical diversity of the small molecule moiety attached to an encoding DNA oligomer. The library structure diversity is often limited to DNA-compatible chemical reactions in aqueous media. Herein, we describe a facile process for reducing aryl nitro groups to aryl amines. The new protocol offers simple operation and circumvents the pyrophoric potential of the conventional method (Raney nickel). The reaction is performed in aqueous solution and does not compromise DNA structural integrity. The utility of this method is demonstrated by the versatile synthesis of benzimidazoles on DNA.

  12. Cloud-based uniform ChIP-Seq processing tools for modENCODE and ENCODE.

    Science.gov (United States)

    Trinh, Quang M; Jen, Fei-Yang Arthur; Zhou, Ziru; Chu, Kar Ming; Perry, Marc D; Kephart, Ellen T; Contrino, Sergio; Ruzanov, Peter; Stein, Lincoln D

    2013-07-22

    Funded by the National Institutes of Health (NIH), the aim of the Model Organism ENCyclopedia of DNA Elements (modENCODE) project is to provide the biological research community with a comprehensive encyclopedia of functional genomic elements for both model organisms C. elegans (worm) and D. melanogaster (fly). With a total size of just under 10 terabytes of data collected and released to the public, one of the challenges faced by researchers is to extract biologically meaningful knowledge from this large data set. While the basic quality control, pre-processing, and analysis of the data has already been performed by members of the modENCODE consortium, many researchers will wish to reinterpret the data set using modifications and enhancements of the original protocols, or combine modENCODE data with other data sets. Unfortunately this can be a time consuming and logistically challenging proposition. In recognition of this challenge, the modENCODE DCC has released uniform computing resources for analyzing modENCODE data on Galaxy (https://github.com/modENCODE-DCC/Galaxy), on the public Amazon Cloud (http://aws.amazon.com), and on the private Bionimbus Cloud for genomic research (http://www.bionimbus.org). In particular, we have released Galaxy workflows for interpreting ChIP-seq data which use the same quality control (QC) and peak calling standards adopted by the modENCODE and ENCODE communities. For convenience of use, we have created Amazon and Bionimbus Cloud machine images containing Galaxy along with all the modENCODE data, software and other dependencies. Using these resources provides a framework for running consistent and reproducible analyses on modENCODE data, ultimately allowing researchers to use more of their time using modENCODE data, and less time moving it around.

  13. Gamifying Video Object Segmentation.

    Science.gov (United States)

    Spampinato, Concetto; Palazzo, Simone; Giordano, Daniela

    2017-10-01

    Video object segmentation can be considered as one of the most challenging computer vision problems. Indeed, so far, no existing solution is able to effectively deal with the peculiarities of real-world videos, especially in cases of articulated motion and object occlusions; limitations that appear more evident when we compare the performance of automated methods with the human one. However, manually segmenting objects in videos is largely impractical as it requires a lot of time and concentration. To address this problem, in this paper we propose an interactive video object segmentation method, which exploits, on one hand, the capability of humans to identify correctly objects in visual scenes, and on the other hand, the collective human brainpower to solve challenging and large-scale tasks. In particular, our method relies on a game with a purpose to collect human inputs on object locations, followed by an accurate segmentation phase achieved by optimizing an energy function encoding spatial and temporal constraints between object regions as well as human-provided location priors. Performance analysis carried out on complex video benchmarks, and exploiting data provided by over 60 users, demonstrated that our method shows a better trade-off between annotation times and segmentation accuracy than interactive video annotation and automated video object segmentation approaches.

  14. Evaluation of protective effect of multiantigenic DNA vaccine encoding MIC3 and ROP18 antigen segments of Toxoplasma gondii in mice.

    Science.gov (United States)

    Qu, Daofeng; Han, Jianzhong; Du, Aifang

    2013-07-01

    The high incidence and severe damage caused by Toxoplasma gondii infection clearly indicates the need for the development of a vaccine. In this study, we evaluated the immune responses and protection against toxoplasmosis by immunizing ICR mice with a multiantigenic DNA vaccine. To develop the multiantigenic vaccine, two T. gondii antigens, MIC3 and ROP18, selected on the basis of previous studies were chosen. ICR mice were immunized subcutaneously with PBS, empty pcDNA3.1 vector, pMIC3, pROP18, and pROP18-MIC3, respectively. The results of lymphocyte proliferation assay, cytokine, and antibody determinations showed that mice immunized with pROP18-MIC3 elicited stronger humoral and Th1-type cellular immune responses than those immunized with single-gene plasmids, empty plasmid, or phosphate-buffered saline. After a lethal challenge with the highly virulent T. gondii RH strain, a prolonged survival time in pROP18-MIC3-immunized mice was observed in comparison to control groups. Our study indicates that the introduction of multiantigenic DNA vaccine is more powerful and efficient than single-gene vaccine, and deserves further evaluation and development.

  15. ENCODE whole-genome data in the UCSC genome browser (2011 update).

    Science.gov (United States)

    Raney, Brian J; Cline, Melissa S; Rosenbloom, Kate R; Dreszer, Timothy R; Learned, Katrina; Barber, Galt P; Meyer, Laurence R; Sloan, Cricket A; Malladi, Venkat S; Roskin, Krishna M; Suh, Bernard B; Hinrichs, Angie S; Clawson, Hiram; Zweig, Ann S; Kirkup, Vanessa; Fujita, Pauline A; Rhead, Brooke; Smith, Kayla E; Pohl, Andy; Kuhn, Robert M; Karolchik, Donna; Haussler, David; Kent, W James

    2011-01-01

    The ENCODE project is an international consortium with a goal of cataloguing all the functional elements in the human genome. The ENCODE Data Coordination Center (DCC) at the University of California, Santa Cruz serves as the central repository for ENCODE data. In this role, the DCC offers a collection of high-throughput, genome-wide data generated with technologies such as ChIP-Seq, RNA-Seq, DNA digestion and others. This data helps illuminate transcription factor-binding sites, histone marks, chromatin accessibility, DNA methylation, RNA expression, RNA binding and other cell-state indicators. It includes sequences with quality scores, alignments, signals calculated from the alignments, and in most cases, element or peak calls calculated from the signal data. Each data set is available for visualization and download via the UCSC Genome Browser (http://genome.ucsc.edu/). ENCODE data can also be retrieved using a metadata system that captures the experimental parameters of each assay. The ENCODE web portal at UCSC (http://encodeproject.org/) provides information about the ENCODE data and links for access.

  16. The Phytophthora sojae avirulence locus Avr3c encodes a multi-copy RXLR effector with sequence polymorphisms among pathogen strains.

    Directory of Open Access Journals (Sweden)

    Suomeng Dong

    Full Text Available Root and stem rot disease of soybean is caused by the oomycete Phytophthora sojae. The avirulence (Avr genes of P. sojae control race-cultivar compatibility. In this study, we identify the P. sojae Avr3c gene and show that it encodes a predicted RXLR effector protein of 220 amino acids. Sequence and transcriptional data were compared for predicted RXLR effectors occurring in the vicinity of Avr4/6, as genetic linkage of Avr3c and Avr4/6 was previously suggested. Mapping of DNA markers in a F(2 population was performed to determine whether selected RXLR effector genes co-segregate with the Avr3c phenotype. The results pointed to one RXLR candidate gene as likely to encode Avr3c. This was verified by testing selected genes by a co-bombardment assay on soybean plants with Rps3c, thus demonstrating functionality and confirming the identity of Avr3c. The Avr3c gene together with eight other predicted genes are part of a repetitive segment of 33.7 kb. Three near-identical copies of this segment occur in a tandem array. In P. sojae strain P6497, two identical copies of Avr3c occur within the repeated segments whereas the third copy of this RXLR effector has diverged in sequence. The Avr3c gene is expressed during the early stages of infection in all P. sojae strains examined. Virulent alleles of Avr3c that differ in amino acid sequence were identified in other strains of P. sojae. Gain of virulence was acquired through mutation and subsequent sequence exchanges between the two copies of Avr3c. The results illustrate the importance of segmental duplications and RXLR effector evolution in the control of race-cultivar compatibility in the P. sojae and soybean interaction.

  17. Identification of the polypeptides encoded in the unassigned reading frames 2, 4, 4L, and 5 of human mitochondrial DNA

    International Nuclear Information System (INIS)

    Mariottini, P.; Chomyn, A.; Riley, M.; Cottrell, B.; Doolittle, R.F.; Attardi, G.

    1986-01-01

    In previous work, antibodies prepared against chemically synthesized peptides predicted from the DNA sequence were used to identify the polypeptides encoded in three of the eight unassigned reading frames (URFs) of human mitochondrial DNA (mtDNA). In the present study, this approach has been extended to other human mtDNA URFs. In particular, antibodies directed against the NH 2 -terminal octapeptide of the putative URF2 product specifically precipitated component 11 of the HeLa cell mitochondrial translation products, the reaction being inhibited by the specific peptide. Similarly, antibodies directed against the COOH-terminal nonapeptide of the putative URF4 product reacted specifically with components 4 and 5, and antibodies against a COOH-terminal heptapeptide of the presumptive URF4L product reacted specifically with component 26. Antibodies against the NH 2 -terminal heptapeptide of the putative product of URF5 reacted with component 1, but only to a marginal extent; however, the results of a trypsin fingerprinting analysis of component 1 point strongly to this component as being the authentic product of URF5. The polypeptide assignments to the mtDNA URFs analyzed here are supported by the relative electrophoretic mobilities of proteins 11, 4-5, 26, and 1, which are those expected for the molecular weights predicted from the DNA sequence for the products of URF2, URF4, URF4L, and URF5, respectively. With the present assignment, seven of the eight human mtDNA URFs have been shown to be expressed in HeLa cells

  18. Cloning of a cDNA encoding the human cation-dependent mannose 6-phosphate-specific receptor

    International Nuclear Information System (INIS)

    Pohlmann, R.; Nagel, G.; Schmidt, B.

    1987-01-01

    Complementary DNA clones for the human cation-dependent mannose 6-phosphate-specific receptor have been isolated from a human placenta library in λgt11. The nucleotide sequence of the 2463-base-pair cDNA insert includes a 145-base-pair 5' untranslated region, an open reading frame of 831 base pairs corresponding to 277 amino acids, and a 1487-base-pair 3' untranslated region. The deduced amino acid sequence is colinear with that determined by amino acid sequencing of the N-terminus peptide (41 residues) and nine tryptic peptides (93 additional residues). The receptor is synthesized as a precursor with a signal peptide of 20 amino acids. The hydrophobicity profile of the receptor indicates a single membrane-spanning domain, which separates an N-terminal region containing five potential N-glycosylation sites from a C-terminal region lacking N-glycosylation sites. Thus the N-terminal (M/sub r/ = 18,299) and C-terminal (M/sub r/ ≤ 7648) segments of the mature receptor are assumed to be exposed to the extracytosolic and cytosolic sides of the membrane, respectively. Analysis of a panel of somatic cell (mouse-human) hybrids shows that the gene for the receptor is located on human chromosome 12

  19. Adenoviral DNA replication: DNA sequences and enzymes required for initiation in vitro

    International Nuclear Information System (INIS)

    Stillman, B.W.; Tamanoi, F.

    1983-01-01

    In this paper evidence is provided that the 140,000-dalton DNA polymerase is encoded by the adenoviral genome and is required for the initiation of DNA replication in vitro. The DNA sequences in the template DNA that are required for the initiation of replication have also been identified, using both plasmid DNAs and synthetic oligodeoxyribonucleotides. 48 references, 7 figures, 1 table

  20. Microarray BASICA: Background Adjustment, Segmentation, Image Compression and Analysis of Microarray Images

    Directory of Open Access Journals (Sweden)

    Jianping Hua

    2004-01-01

    Full Text Available This paper presents microarray BASICA: an integrated image processing tool for background adjustment, segmentation, image compression, and analysis of cDNA microarray images. BASICA uses a fast Mann-Whitney test-based algorithm to segment cDNA microarray images, and performs postprocessing to eliminate the segmentation irregularities. The segmentation results, along with the foreground and background intensities obtained with the background adjustment, are then used for independent compression of the foreground and background. We introduce a new distortion measurement for cDNA microarray image compression and devise a coding scheme by modifying the embedded block coding with optimized truncation (EBCOT algorithm (Taubman, 2000 to achieve optimal rate-distortion performance in lossy coding while still maintaining outstanding lossless compression performance. Experimental results show that the bit rate required to ensure sufficiently accurate gene expression measurement varies and depends on the quality of cDNA microarray images. For homogeneously hybridized cDNA microarray images, BASICA is able to provide from a bit rate as low as 5 bpp the gene expression data that are 99% in agreement with those of the original 32 bpp images.

  1. Identification and Molecular Characterization of the cDNA Encoding Cucumis melo Allergen, Cuc m 3, a Plant Pathogenesis-Related Protein

    Directory of Open Access Journals (Sweden)

    Mojtaba Sankian

    2014-05-01

    Full Text Available Background: Melon (Cucumis melo allergy is one of the most common food allergies, characterized by oral allergy syndrome. To date, two allergen molecules, Cuc m 1 and Cuc m 2, have been fully characterized in melon pulp, but there are few reports about the molecular characteristics of Cuc m 3. Methods:The Cuc m 3 cDNA has been characterized by rapid amplification of cDNA ends (RACE, which revealed a 456 base-pair (bp fragment encoding a 151-amino acid polypeptide with a predicted molecular mass of 16.97 kDa, and identified 79 and 178 bp untranslated sequences at the 5′ and 3´ ends, respectively. Results: In silico analysis showed strong similarities between Cuc m 3 and other plant pathogen-related protein 1s from cucumber, grape, bell pepper, and tomato. Conclusion: Here we report the identification and characterization of the Cuc m 3 cDNA, which will be utilized for further analyses of structural and allergenic features of this allergen

  2. The presence of two S-layer-protein-encoding genes is conserved among species related to Lactobacillus acidophilus

    NARCIS (Netherlands)

    Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.

    1996-01-01

    Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this

  3. Male infertility is significantly associated with multiple deletions in an 8.7-kb segment of sperm mtDNA in Pakistan.

    Science.gov (United States)

    Mughal, Irfan Afzal; Irfan, Asma; Jahan, Sarwat; Hameed, Abdul

    2017-06-12

    This study aimed to find a link between sperm mitochondrial DNA mutations and male infertility in Pakistan. DNA from semen samples was extracted and amplified by PCR using 7.8-kb deletion-specific primers. The PCR products were separated on agarose gel, visualized under UV-illumination, and then photographed. The results were genotyped and the data were analyzed using SPSS. Deletion analysis of the 8.7-kb fragment by long PCR revealed multiple deletions. The frequency of deletion was much higher in infertile groups as compared to the control group. Further, on comparison between different subtypes of infertile groups, the deletions were highest in the oligoasthenoteratozoospermia (OAT) group. The statistical analysis of case and control groups showed a significant association of the 8.7-kb deletion with human male infertile groups (P = 0.031), and particularly a very significant association with the OAT subgroup (P = 0.019). A significant association has been found between human male infertility and mtDNA deletions in an 8.7-kb segment of sperm mtDNA in a Pakistani population.

  4. Identification of a cDNA encoding a parathyroid hormone-like peptide from a human tumor associated with humoral hypercalcemia of malignancy

    International Nuclear Information System (INIS)

    Mangin, M.; Webb, A.C.; Dreyer, B.E.

    1988-01-01

    Humoral hypercalcemia of malignancy is a common paraneoplastic syndrome that appears to be mediated in many instances by a parathyroid hormone-like peptide. Poly(A) + RNA from a human renal carcinoma associated with this syndrome was enriched by preparative electrophoresis and used to construct an enriched cDNA library in phage λgt10. The library was screened with a codon-preference oligonucleotide synthesized on the basis of a partial N-terminal amino acid sequence from a human tumor-derived peptide, and a 2.0 kilo-base cDNA was identified. The cDNA encodes a 177 amino acid protein consisting of a 36 amino acid leader sequence and a 141 amino acid mature peptide. The first 13 amino acids of the deduced sequence of the mature peptide display strong homology to human PTH, with complete divergence thereafter. RNA blot-hybridization analysis revealed multiple transcripts in mRNA from tumors associated with the humor syndrome and also in mRNA from normal human keratinocytes. Southern blot analysis of genomic DNA from humans and rodents revealed a simple pattern compatible with a single-copy gene. The gene has been mapped to chromosome 12

  5. Autonomous assembly of synthetic oligonucleotides built from an expanded DNA alphabet. Total synthesis of a gene encoding kanamycin resistance

    Directory of Open Access Journals (Sweden)

    Kristen K. Merritt

    2014-10-01

    Full Text Available Background: Many synthetic biologists seek to increase the degree of autonomy in the assembly of long DNA (L-DNA constructs from short synthetic DNA fragments, which are today quite inexpensive because of automated solid-phase synthesis. However, the low information density of DNA built from just four nucleotide “letters”, the presence of strong (G:C and weak (A:T nucleobase pairs, the non-canonical folded structures that compete with Watson–Crick pairing, and other features intrinsic to natural DNA, generally prevent the autonomous assembly of short single-stranded oligonucleotides greater than a dozen or so.Results: We describe a new strategy to autonomously assemble L-DNA constructs from fragments of synthetic single-stranded DNA. This strategy uses an artificially expanded genetic information system (AEGIS that adds nucleotides to the four (G, A, C, and T found in standard DNA by shuffling hydrogen-bonding units on the nucleobases, all while retaining the overall Watson–Crick base-pairing geometry. The added information density allows larger numbers of synthetic fragments to self-assemble without off-target hybridization, hairpin formation, and non-canonical folding interactions. The AEGIS pairs are then converted into standard pairs to produce a fully natural L-DNA product. Here, we report the autonomous assembly of a gene encoding kanamycin resistance using this strategy. Synthetic fragments were built from a six-letter alphabet having two AEGIS components, 5-methyl-2’-deoxyisocytidine and 2’-deoxyisoguanosine (respectively S and B, at their overlapping ends. Gaps in the overlapped assembly were then filled in using DNA polymerases, and the nicks were sealed by ligase. The S:B pairs in the ligated construct were then converted to T:A pairs during PCR amplification. When cloned into a plasmid, the product was shown to make Escherichia coli resistant to kanamycin. A parallel study that attempted to assemble similarly sized genes

  6. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne

    1996-01-01

    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

  7. Isolation and characterisation of cDNA clones representing the genes encoding the major tuber storage protein (dioscorin) of yam (Dioscorea cayenensis Lam.).

    Science.gov (United States)

    Conlan, R S; Griffiths, L A; Napier, J A; Shewry, P R; Mantell, S; Ainsworth, C

    1995-06-01

    cDNA clones encoding dioscorins, the major tuber storage proteins (M(r) 32,000) of yam (Dioscorea cayenesis) have been isolated. Two classes of clone (A and B, based on hybrid release translation product sizes and nucleotide sequence differences) which are 84.1% similar in their protein coding regions, were identified. The protein encoded by the open reading frame of the class A cDNA insert is of M(r) 30,015. The difference in observed and calculated molecular mass might be attributed to glycosylation. Nucleotide sequencing and in vitro transcription/translation suggest that the class A dioscorin proteins are synthesised with signal peptides of 18 amino acid residues which are cleaved from the mature peptide. The class A and class B proteins are 69.6% similar with respect to each other, but show no sequence identity with other plant proteins or with the major tuber storage proteins of potato (patatin) or sweet potato (sporamin). Storage protein gene expression was restricted to developing tubers and was not induced by growth conditions known to induce expression of tuber storage protein genes in other plant species. The codon usage of the dioscorin genes suggests that the Dioscoreaceae are more closely related to dicotyledonous than to monocotyledonous plants.

  8. A flow cytometric assay technology based on quantum dots-encoded beads

    International Nuclear Information System (INIS)

    Wang Haiqiao; Liu Tiancai; Cao Yuancheng; Huang Zhenli; Wang Jianhao; Li Xiuqing; Zhao Yuandi

    2006-01-01

    A flow cytometric detecting technology based on quantum dots (QDs)-encoded beads has been described. Using this technology, several QDs-encoded beads with different code were identified effectively, and the target molecule (DNA sequence) in solution was also detected accurately by coupling to its complementary sequence probed on QDs-encoded beads through DNA hybridization assay. The resolution of this technology for encoded beads is resulted from two longer wavelength fluorescence identification signals (yellow and red fluorescent signals of QDs), and the third shorter wavelength fluorescence signal (green reporting signal of fluorescein isothiocyanate (FITC)) for the determination of reaction between probe and target. In experiment, because of QDs' unique optical character, only one excitation light source was needed to excite the QDs and probe dye FITC synchronously comparing with other flow cytometric assay technology. The results show that this technology has present excellent repeatability and good accuracy. It will become a promising multiple assay platform in various application fields after further improvement

  9. Klebsiella pneumoniae asparagine tDNAs are integration hotspots for different genomic islands encoding microcin E492 production determinants and other putative virulence factors present in hypervirulent strains

    Directory of Open Access Journals (Sweden)

    Andrés Esteban Marcoleta

    2016-06-01

    Full Text Available Due to the developing of multi-resistant and invasive hypervirulent strains, Klebsiella pneumoniae has become one of the most urgent bacterial pathogen threats in the last years. Genomic comparison of a growing number of sequenced isolates has allowed the identification of putative virulence factors, proposed to be acquirable mainly through horizontal gene transfer. In particular, those related with synthesizing the antibacterial peptide microcin E492 (MccE492 and salmochelin siderophores were found to be highly prevalent among hypervirulent strains. The determinants for the production of both molecules were first reported as part of a 13-kbp segment of K. pneumoniae RYC492 chromosome, and were cloned and characterized in E. coli. However, the genomic context of this segment in K. pneumoniae remained uncharacterized.In this work we provided experimental and bioinformatics evidence indicating that the MccE492 cluster is part of a highly conserved 23-kbp genomic island (GI named GIE492, that was integrated in a specific asparagine-tRNA gene (asn-tDNA and was found in a high proportion of isolates from liver abscesses sampled around the world. This element resulted to be unstable and its excision frequency increased after treating bacteria with mytomicin C and upon the overexpression of the island-encoded integrase. Besides the MccE492 genetic cluster, it invariably included an integrase-coding gene, at least 7 protein-coding genes of unknown function, and a putative transfer origin that possibly allows this GI to be mobilized through conjugation. In addition, we analyzed the asn-tDNA loci of all the available K. pneumoniae assembled chromosomes to evaluate them as GI-integration sites. Remarkably, 73% of the strains harbored at least one GI integrated in one of the four asn-tDNA present in this species, confirming them as integration hotspots. Each of these tDNAs was occupied with different frequencies, although they were 100% identical. Also, we

  10. Methylation effect on the ohmic resistance of a poly-GC DNA-like chain

    Energy Technology Data Exchange (ETDEWEB)

    Moura, F.A.B.F. de, E-mail: fidelis@fis.ufal.br [Instituto de Física, Universidade Federal de Alagoas, Maceió AL 57072-970 (Brazil); Lyra, M.L. [Instituto de Física, Universidade Federal de Alagoas, Maceió AL 57072-970 (Brazil); Almeida, M.L. de; Ourique, G.S.; Fulco, U.L.; Albuquerque, E.L. [Departamento de Biofísica e Farmacologia, Universidade Federal do Rio Grande do Norte, 59072-970, Natal-RN (Brazil)

    2016-10-14

    We determine, by using a tight-binding model Hamiltonian, the characteristic current–voltage (IxV) curves of a 5-methylated cytosine single strand poly-GC DNA-like finite segment, considering the methyl groups attached laterally to a random fraction of the cytosine basis. Striking, we found that the methylation significantly impacts the ohmic resistance (R) of the DNA-like segments, indicating that measurements of R can be used as a biosensor tool to probe the presence of anomalous methylation. - Highlights: • Ohmic resistance of finite segments of poly-CG DNA-like segments. • Possibility for the development of biosensor devices. • Methylation effect and electronic transport in DNA-like segments.

  11. Single-strand DNA molecule translocation through nanoelectrode gaps

    International Nuclear Information System (INIS)

    Zhao Xiongce; Payne, Christina M; Cummings, Peter T; Lee, James W

    2007-01-01

    Molecular dynamics simulations were performed to investigate the translocation of single-strand DNA through nanoscale electrode gaps under the action of a constant driving force. The application behind this theoretical study is a proposal to use nanoelectrodes as a screening gap as part of a rapid genomic sequencing device. Preliminary results from a series of simulations using various gap widths and driving forces suggest that the narrowest electrode gap that a single-strand DNA can pass is ∼1.5 nm. The minimum force required to initiate the translocation within nanoseconds is ∼0.3 nN. Simulations using DNA segments of various lengths indicate that the minimum initiation force is insensitive to the length of DNA. However, the average threading velocity of DNA varies appreciably from short to long DNA segments. We attribute such variation to the different nature of drag force experienced by the short and long DNA segments in the environment. It is found that DNA molecules deform significantly to fit in the shape of the nanogap during the translocation

  12. Investigation of DNA Integration into Reproductive Organs Following Intramuscular Injection of DNA in Mice

    Directory of Open Access Journals (Sweden)

    Fatemeh Vahedi

    2012-10-01

    Full Text Available Background: DNA immunization with plasmid DNA encoding bacterial, viral, parasitic, and tumor antigens has been reported to trigger protective immunity. The use of plasmid DNA vaccinations against many diseases has produced promising results in animal and human clinical trials; however, safety concerns about the use of DNA vaccines exist, such as the possibility of integration into the host genome, and elicitation of adverse immune responses. Methods: In this study, we examined the potential integration and bio-distribution of pcDNA3.1+PA, a new vaccine candidate with GenBank accession # EF550208, encoding the PA63 gene, in reproductive organs of mice; ovaries and uterus in female, and testis in male. Animals of both sexes were injected intramuscularly with pcDNA3.1+PA. Host genome integration and tissue distribution were examined using PCR and RT-PCR two times monthly for six months. Results: RT-PCR confirmed that pcDNA3.1+PA was not integrated into the host genome and did not enter reproductive organs. Conclusions: This finding has important implications for the use of pcDNA3.1+PA plasmid as a vaccine and opens new perspectives in the DNA vaccine area.

  13. Presence of a consensus DNA motif at nearby DNA sequence of the mutation susceptible CG nucleotides.

    Science.gov (United States)

    Chowdhury, Kaushik; Kumar, Suresh; Sharma, Tanu; Sharma, Ankit; Bhagat, Meenakshi; Kamai, Asangla; Ford, Bridget M; Asthana, Shailendra; Mandal, Chandi C

    2018-01-10

    Complexity in tissues affected by cancer arises from somatic mutations and epigenetic modifications in the genome. The mutation susceptible hotspots present within the genome indicate a non-random nature and/or a position specific selection of mutation. An association exists between the occurrence of mutations and epigenetic DNA methylation. This study is primarily aimed at determining mutation status, and identifying a signature for predicting mutation prone zones of tumor suppressor (TS) genes. Nearby sequences from the top five positions having a higher mutation frequency in each gene of 42 TS genes were selected from a cosmic database and were considered as mutation prone zones. The conserved motifs present in the mutation prone DNA fragments were identified. Molecular docking studies were done to determine putative interactions between the identified conserved motifs and enzyme methyltransferase DNMT1. Collective analysis of 42 TS genes found GC as the most commonly replaced and AT as the most commonly formed residues after mutation. Analysis of the top 5 mutated positions of each gene (210 DNA segments for 42 TS genes) identified that CG nucleotides of the amino acid codons (e.g., Arginine) are most susceptible to mutation, and found a consensus DNA "T/AGC/GAGGA/TG" sequence present in these mutation prone DNA segments. Similar to TS genes, analysis of 54 oncogenes not only found CG nucleotides of the amino acid Arg as the most susceptible to mutation, but also identified the presence of similar consensus DNA motifs in the mutation prone DNA fragments (270 DNA segments for 54 oncogenes) of oncogenes. Docking studies depicted that, upon binding of DNMT1 methylates to this consensus DNA motif (C residues of CpG islands), mutation was likely to occur. Thus, this study proposes that DNMT1 mediated methylation in chromosomal DNA may decrease if a foreign DNA segment containing this consensus sequence along with CG nucleotides is exogenously introduced to dividing

  14. Involvement of the yeast DNA polymerase delta in DNA repair in vivo

    Energy Technology Data Exchange (ETDEWEB)

    Giot, L. [State University of New York at Stony Brook, Stony Brook, NY. (United States); Chanet, R.; Simon, M.; Facca, C.; Faye, G.

    1997-08-15

    The POL3 encoded catalytic subunit of DNA polymerase delta possesses a highly conserved C-terminal cysteine-rich domain in Saccharomyces cerevisiae. Mutations in some of its cysteine codons display a lethal phenotype, which demonstrates an essential function of this domain. The thermosensitive mutant pol3-13, in which a serine replaces a cysteine of this domain, exhibits a range of defects in DNA repair, such as hypersensitivity to different DNA-damaging agents and deficiency for induced mutagenesis and for recombination. These phenotypes are observed at 24 degrees, a temperature at which DNA replication is almost normal; this differentiates the functions of POL3 in DNA repair and DNA replication. Since spontaneous mutagenesis and spontaneous recombination are efficient in pol3-13, we propose that POL3 plays an important role in DNA repair after irradiation, particularly in the error-prone and recombinational pathways. Extragenic suppressors of pol3-13 are allelic to sdp5-1, previously identified as an extragenic suppressor of pol3-11. SDP5, which is identical to HYS2, encodes a protein homologous to the p50 subunit of bovine and human DNA polymerase delta. SDP5 is most probably the p55 subunit of Pol delta of S. cerevisiae and seems to be associated with the catalytic subunit for both DNA replication and DNA repair. (author)

  15. Cationic lipid-formulated DNA vaccine against hepatitis B virus: immunogenicity of MIDGE-Th1 vectors encoding small and large surface antigen in comparison to a licensed protein vaccine.

    Directory of Open Access Journals (Sweden)

    Anne Endmann

    Full Text Available Currently marketed vaccines against hepatitis B virus (HBV based on the small (S hepatitis B surface antigen (HBsAg fail to induce a protective immune response in about 10% of vaccinees. DNA vaccination and the inclusion of PreS1 and PreS2 domains of HBsAg have been reported to represent feasible strategies to improve the efficacy of HBV vaccines. Here, we evaluated the immunogenicity of SAINT-18-formulated MIDGE-Th1 vectors encoding the S or the large (L protein of HBsAg in mice and pigs. In both animal models, vectors encoding the secretion-competent S protein induced stronger humoral responses than vectors encoding the L protein, which was shown to be retained mainly intracellularly despite the presence of a heterologous secretion signal. In pigs, SAINT-18-formulated MIDGE-Th1 vectors encoding the S protein elicited an immune response of the same magnitude as the licensed protein vaccine Engerix-B, with S protein-specific antibody levels significantly higher than those considered protective in humans, and lasting for at least six months after the third immunization. Thus, our results provide not only the proof of concept for the SAINT-18-formulated MIDGE-Th1 vector approach but also confirm that with a cationic-lipid formulation, a DNA vaccine at a relatively low dose can elicit an immune response similar to a human dose of an aluminum hydroxide-adjuvanted protein vaccine in large animals.

  16. Attenuated Salmonella enterica serovar Typhi and Shigella flexneri 2a strains mucosally deliver DNA vaccines encoding measles virus hemagglutinin, inducing specific immune responses and protection in cotton rats.

    Science.gov (United States)

    Pasetti, Marcela F; Barry, Eileen M; Losonsky, Genevieve; Singh, Mahender; Medina-Moreno, Sandra M; Polo, John M; Ulmer, Jeffrey; Robinson, Harriet; Sztein, Marcelo B; Levine, Myron M

    2003-05-01

    Measles remains a leading cause of child mortality in developing countries. Residual maternal measles antibodies and immunologic immaturity dampen immunogenicity of the current vaccine in young infants. Because cotton rat respiratory tract is susceptible to measles virus (MV) replication after intranasal (i.n.) challenge, this model can be used to assess the efficacy of MV vaccines. Pursuing a new measles vaccine strategy that might be effective in young infants, we used attenuated Salmonella enterica serovar Typhi CVD 908-htrA and Shigella flexneri 2a CVD 1208 vaccines to deliver mucosally to cotton rats eukaryotic expression plasmid pGA3-mH and Sindbis virus-based DNA replicon pMSIN-H encoding MV hemagglutinin (H). The initial i.n. dose-response with bacterial vectors alone identified a well-tolerated dosage (1 x 10(9) to 7 x 10(9) CFU) and a volume (20 micro l) that elicited strong antivector immune responses. Animals immunized i.n. on days 0, 28, and 76 with bacterial vectors carrying DNA plasmids encoding MV H or immunized parenterally with these naked DNA vaccine plasmids developed MV plaque reduction neutralizing antibodies and proliferative responses against MV antigens. In a subsequent experiment of identical design, cotton rats were challenged with wild-type MV 1 month after the third dose of vaccine or placebo. MV titers were significantly reduced in lung tissue of animals immunized with MV DNA vaccines delivered either via bacterial live vectors or parenterally. Since attenuated serovar Typhi and S. flexneri can deliver measles DNA vaccines mucosally in cotton rats, inducing measles immune responses (including neutralizing antibodies) and protection, boosting strategies can now be evaluated in animals primed with MV DNA vaccines.

  17. DNA damage, homology-directed repair, and DNA methylation.

    Directory of Open Access Journals (Sweden)

    Concetta Cuozzo

    2007-07-01

    Full Text Available To explore the link between DNA damage and gene silencing, we induced a DNA double-strand break in the genome of Hela or mouse embryonic stem (ES cells using I-SceI restriction endonuclease. The I-SceI site lies within one copy of two inactivated tandem repeated green fluorescent protein (GFP genes (DR-GFP. A total of 2%-4% of the cells generated a functional GFP by homology-directed repair (HR and gene conversion. However, approximately 50% of these recombinants expressed GFP poorly. Silencing was rapid and associated with HR and DNA methylation of the recombinant gene, since it was prevented in Hela cells by 5-aza-2'-deoxycytidine. ES cells deficient in DNA methyl transferase 1 yielded as many recombinants as wild-type cells, but most of these recombinants expressed GFP robustly. Half of the HR DNA molecules were de novo methylated, principally downstream to the double-strand break, and half were undermethylated relative to the uncut DNA. Methylation of the repaired gene was independent of the methylation status of the converting template. The methylation pattern of recombinant molecules derived from pools of cells carrying DR-GFP at different loci, or from an individual clone carrying DR-GFP at a single locus, was comparable. ClustalW analysis of the sequenced GFP molecules in Hela and ES cells distinguished recombinant and nonrecombinant DNA solely on the basis of their methylation profile and indicated that HR superimposed novel methylation profiles on top of the old patterns. Chromatin immunoprecipitation and RNA analysis revealed that DNA methyl transferase 1 was bound specifically to HR GFP DNA and that methylation of the repaired segment contributed to the silencing of GFP expression. Taken together, our data support a mechanistic link between HR and DNA methylation and suggest that DNA methylation in eukaryotes marks homologous recombined segments.

  18. α/sub i/-3 cDNA encodes the α subunit of G/sub k/, the stimulatory G protein of receptor-regulated K+ channels

    International Nuclear Information System (INIS)

    Codina, J.; Olate, J.; Abramowitz, J.; Mattera, R.; Cook, R.G.; Birnbaumer, L.

    1988-01-01

    cDNA cloning has identified the presence in the human genome of three genes encoding α subunits of pertussis toxin substrates, generically called G/sub i/. They are named α/sub i/-1, α/sub i/-2 and α/sub i/-3. However, none of these genes has been functionally identified with any of the α subunits of several possible G proteins, including pertussis toxin-sensitive G/sub p/'s, stimulatory to phospholipase C or A 2 , G/sub i/, inhibitory to adenylyl cyclase, or G/sub k/, stimulatory to a type of K + channels. The authors now report the nucleotide sequence and the complete predicted amino acid sequence of human liver α/sub i/-3 and the partial amino acid sequence of proteolytic fragments of the α subunit of human erythrocyte G/sub k/. The amino acid sequence of the proteolytic fragment is uniquely encoded by the cDNA of α/sub i/-3, thus identifying it as α/sub k/. The probable identity of α/sub i/-1 with α/sub p/ and possible roles for α/sub i/-2, as well as additional roles for α/sub i/-1 and α/sub i/-3 (α/sub k/) are discussed

  19. Viruses Infecting a Freshwater Filamentous Cyanobacterium (Nostoc sp. Encode a Functional CRISPR Array and a Proteobacterial DNA Polymerase B

    Directory of Open Access Journals (Sweden)

    Caroline Chénard

    2016-06-01

    Full Text Available Here we present the first genomic characterization of viruses infecting Nostoc, a genus of ecologically important cyanobacteria that are widespread in freshwater. Cyanophages A-1 and N-1 were isolated in the 1970s and infect Nostoc sp. strain PCC 7210 but remained genomically uncharacterized. Their 68,304- and 64,960-bp genomes are strikingly different from those of other sequenced cyanophages. Many putative genes that code for proteins with known functions are similar to those found in filamentous cyanobacteria, showing a long evolutionary history in their host. Cyanophage N-1 encodes a CRISPR array that is transcribed during infection and is similar to the DR5 family of CRISPRs commonly found in cyanobacteria. The presence of a host-related CRISPR array in a cyanophage suggests that the phage can transfer the CRISPR among related cyanobacteria and thereby provide resistance to infection with competing phages. Both viruses also encode a distinct DNA polymerase B that is closely related to those found in plasmids of Cyanothece sp. strain PCC 7424, Nostoc sp. strain PCC 7120, and Anabaena variabilis ATCC 29413. These polymerases form a distinct evolutionary group that is more closely related to DNA polymerases of proteobacteria than to those of other viruses. This suggests that the polymerase was acquired from a proteobacterium by an ancestral virus and transferred to the cyanobacterial plasmid. Many other open reading frames are similar to a prophage-like element in the genome of Nostoc sp. strain PCC 7524. The Nostoc cyanophages reveal a history of gene transfers between filamentous cyanobacteria and their viruses that have helped to forge the evolutionary trajectory of this previously unrecognized group of phages.

  20. Molecular cloning of the cDNA encoding follicle-stimulating hormone beta subunit of the Chinese soft-shell turtle Pelodiscus sinensis, and its gene expression.

    Science.gov (United States)

    Chien, Jung-Tsun; Shen, San-Tai; Lin, Yao-Sung; Yu, John Yuh-Lin

    2005-04-01

    Follicle-stimulating hormone (FSH) is a member of the pituitary glycoprotein hormone family. These hormones are composed of two dissimilar subunits, alpha and beta. Very little information is available regarding the nucleotide and amino acid sequence of FSHbeta in reptilian species. For better understanding of the phylogenetic diversity and evolution of FSH molecule, we have isolated and sequenced the complementary DNA (cDNA) encoding the Chinese soft-shell turtle (Pelodiscus sinensis, Family of Trionychidae) FSHbeta precursor molecule by reverse transcription-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA end (RACE) methods. The cloned Chinese soft-shell turtle FSHbeta cDNA consists of 602-bp nucleotides, including 34-bp nucleotides of the 5'-untranslated region (UTR), 396-bp of the open reading frame, and 3'-UTR of 206-bp nucleotides. It encodes a 131-amino acid precursor molecule of FSHbeta subunit with a signal peptide of 20 amino acids followed by a mature protein of 111 amino acids. Twelve cysteine residues, forming six disulfide bonds within beta-subunit and two putative asparagine-linked glycosylation sites, are also conserved in the Chinese soft-shell turtle FSHbeta subunit. The deduced amino acid sequence of the Chinese soft-shell turtle FSHbeta shares identities of 97% with Reeves's turtle (Family of Bataguridae), 83-89% with birds, 61-70% with mammals, 63-66% with amphibians and 40-58% with fish. By contrast, when comparing the FSHbeta with the beta-subunits of the Chinese soft-shell turtle luteinizing hormone and thyroid stimulating hormone, the homologies are as low as 38 and 39%, respectively. A phylogenetic tree including reptilian species of FSHbeta subunits, is presented for the first time. Out of various tissues examined, FSHbeta mRNA was only expressed in the pituitary gland and can be up-regulated by gonadotropin-releasing hormone in pituitary tissue culture as estimated by fluorescence real-time PCR analysis.

  1. Immunization with plasmid DNA encoding the hemagglutinin and the nucleoprotein confers robust protection against a lethal canine distemper virus challenge.

    Science.gov (United States)

    Dahl, Lotte; Jensen, Trine Hammer; Gottschalck, Elisabeth; Karlskov-Mortensen, Peter; Jensen, Tove Dannemann; Nielsen, Line; Andersen, Mads Klindt; Buckland, Robin; Wild, T Fabian; Blixenkrone-Møller, Merete

    2004-09-09

    We have investigated the protective effect of immunization of a highly susceptible natural host of canine distemper virus (CDV) with DNA plasmids encoding the viral nucleoprotein (N) and hemagglutinin (H). The combined intradermal and intramuscular routes of immunization elicited high virus-neutralizing serum antibody titres in mink (Mustela vison). To mimic natural exposure, we also conducted challenge infection by horizontal transmission from infected contact animals. Other groups received a lethal challenge infection by administration to the mucosae of the respiratory tract and into the muscle. One of the mink vaccinated with N plasmid alone developed severe disease after challenge. In contrast, vaccination with the H plasmid together with the N plasmid conferred solid protection against disease and we were unable to detect CDV infection in PBMCs or in different tissues after challenge. Our findings show that DNA immunization by the combined intradermal and intramuscular routes can confer solid protective immunity against naturally transmitted morbillivirus infection and disease.

  2. DNA-based machines.

    Science.gov (United States)

    Wang, Fuan; Willner, Bilha; Willner, Itamar

    2014-01-01

    The base sequence in nucleic acids encodes substantial structural and functional information into the biopolymer. This encoded information provides the basis for the tailoring and assembly of DNA machines. A DNA machine is defined as a molecular device that exhibits the following fundamental features. (1) It performs a fuel-driven mechanical process that mimics macroscopic machines. (2) The mechanical process requires an energy input, "fuel." (3) The mechanical operation is accompanied by an energy consumption process that leads to "waste products." (4) The cyclic operation of the DNA devices, involves the use of "fuel" and "anti-fuel" ingredients. A variety of DNA-based machines are described, including the construction of "tweezers," "walkers," "robots," "cranes," "transporters," "springs," "gears," and interlocked cyclic DNA structures acting as reconfigurable catenanes, rotaxanes, and rotors. Different "fuels", such as nucleic acid strands, pH (H⁺/OH⁻), metal ions, and light, are used to trigger the mechanical functions of the DNA devices. The operation of the devices in solution and on surfaces is described, and a variety of optical, electrical, and photoelectrochemical methods to follow the operations of the DNA machines are presented. We further address the possible applications of DNA machines and the future perspectives of molecular DNA devices. These include the application of DNA machines as functional structures for the construction of logic gates and computing, for the programmed organization of metallic nanoparticle structures and the control of plasmonic properties, and for controlling chemical transformations by DNA machines. We further discuss the future applications of DNA machines for intracellular sensing, controlling intracellular metabolic pathways, and the use of the functional nanostructures for drug delivery and medical applications.

  3. On the edge of language acquisition: inherent constraints on encoding multisyllabic sequences in the neonate brain.

    Science.gov (United States)

    Ferry, Alissa L; Fló, Ana; Brusini, Perrine; Cattarossi, Luigi; Macagno, Francesco; Nespor, Marina; Mehler, Jacques

    2016-05-01

    To understand language, humans must encode information from rapid, sequential streams of syllables - tracking their order and organizing them into words, phrases, and sentences. We used Near-Infrared Spectroscopy (NIRS) to determine whether human neonates are born with the capacity to track the positions of syllables in multisyllabic sequences. After familiarization with a six-syllable sequence, the neonate brain responded to the change (as shown by an increase in oxy-hemoglobin) when the two edge syllables switched positions but not when two middle syllables switched positions (Experiment 1), indicating that they encoded the syllables at the edges of sequences better than those in the middle. Moreover, when a 25 ms pause was inserted between the middle syllables as a segmentation cue, neonates' brains were sensitive to the change (Experiment 2), indicating that subtle cues in speech can signal a boundary, with enhanced encoding of the syllables located at the edges of that boundary. These findings suggest that neonates' brains can encode information from multisyllabic sequences and that this encoding is constrained. Moreover, subtle segmentation cues in a sequence of syllables provide a mechanism with which to accurately encode positional information from longer sequences. Tracking the order of syllables is necessary to understand language and our results suggest that the foundations for this encoding are present at birth. © 2015 John Wiley & Sons Ltd.

  4. Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.

    Science.gov (United States)

    Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J

    1999-01-01

    Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.

  5. The role of DNA repair in herpesvirus pathogenesis.

    Science.gov (United States)

    Brown, Jay C

    2014-10-01

    In cells latently infected with a herpesvirus, the viral DNA is present in the cell nucleus, but it is not extensively replicated or transcribed. In this suppressed state the virus DNA is vulnerable to mutagenic events that affect the host cell and have the potential to destroy the virus' genetic integrity. Despite the potential for genetic damage, however, herpesvirus sequences are well conserved after reactivation from latency. To account for this apparent paradox, I have tested the idea that host cell-encoded mechanisms of DNA repair are able to control genetic damage to latent herpesviruses. Studies were focused on homologous recombination-dependent DNA repair (HR). Methods of DNA sequence analysis were employed to scan herpesvirus genomes for DNA features able to activate HR. Analyses were carried out with a total of 39 herpesvirus DNA sequences, a group that included viruses from the alpha-, beta- and gamma-subfamilies. The results showed that all 39 genome sequences were enriched in two or more of the eight recombination-initiating features examined. The results were interpreted to indicate that HR can stabilize latent herpesvirus genomes. The results also showed, unexpectedly, that repair-initiating DNA features differed in alpha- compared to gamma-herpesviruses. Whereas inverted and tandem repeats predominated in alpha-herpesviruses, gamma-herpesviruses were enriched in short, GC-rich initiation sequences such as CCCAG and depleted in repeats. In alpha-herpesviruses, repair-initiating repeat sequences were found to be concentrated in a specific region (the S segment) of the genome while repair-initiating short sequences were distributed more uniformly in gamma-herpesviruses. The results suggest that repair pathways are activated differently in alpha- compared to gamma-herpesviruses. Copyright © 2014. Published by Elsevier Inc.

  6. Human Transcriptome and Chromatin Modifications: An ENCODE Perspective

    Directory of Open Access Journals (Sweden)

    Li Shen

    2013-06-01

    Full Text Available A decade-long project, led by several international research groups, called the Encyclopedia of DNA Elements (ENCODE, recently released an unprecedented amount of data. The ambitious project covers transcriptome, cistrome, epigenome, and interactome data from more than 1,600 sets of experiments in human. To make use of this valuable resource, it is important to understand the information it represents and the techniques that were used to generate these data. In this review, we introduce the data that ENCODE generated, summarize the observations from the data analysis, and revisit a computational approach that ENCODE used to predict gene expression, with a focus on the human transcriptome and its association with chromatin modifications.

  7. Gene activation by induced DNA rearrangements

    International Nuclear Information System (INIS)

    Schnipper, L.E.; Chan, V.; Sedivy, J.; Jat, P.; Sharp, P.A.

    1989-01-01

    A murine cell line (EN/NIH) containing the retroviral vector ZIPNeoSV(x)1 that was modified by deletion of the enhancer elements in the viral long terminal repeats has been used as an assay system to detect induced DNA rearrangements that result in activation of a transcriptionally silent reporter gene encoded by the viral genome. The spontaneous frequency of G418 resistance is less than 10(-7), whereas exposure to the tumor promoter 12-O-tetradecanoylphorbol-13-acetate (TPA) or the combination of UV irradiation plus TPA resulted in the emergence of drug resistant cell lines at a frequency of 5 per 10(6) and 67 per 10(6) cells, respectively. In several of the cell lines that were analyzed a low level of amplification of one of the two parental retroviral integrants was observed, whereas in others no alteration in the region of the viral genome was detected. To determine the effect of the SV40 large T antigen on induced DNA rearrangements, EN/NIH cells were transfected with a temperature sensitive (ts) mutant of SV40 T. Transfectants were maintained at the permissive temperature (33 degrees C) for varying periods of time (1-5 days) in order to vary SV40 T antigen exposure, after which they were shifted to 39.5 degrees C for selection in G418. The frequency of emergence of drug resistant cell clones increased with duration of exposure to large T antigen (9-52 per 10(6) cells over 1-5 days, respectively), and all cell lines analyzed demonstrated DNA rearrangements in the region of the neo gene. A novel 18-kilobase pair XbaI fragment was cloned from one cell line which revealed the presence of a 2.0-kilobase pair EcoRI segment containing an inverted duplication which hybridized to neo sequences. It is likely that the observed rearrangement was initiated by the specific binding of large T antigen to the SV40 origin of replication encoded within the viral genome

  8. Human tissue factor: cDNA sequence and chromosome localization of the gene

    International Nuclear Information System (INIS)

    Scarpati, E.M.; Wen, D.; Broze, G.J. Jr.; Miletich, J.P.; Flandermeyer, R.R.; Siegel, N.R.; Sadler, J.E.

    1987-01-01

    A human placenta cDNA library in λgt11 was screened for the expression of tissue factor antigens with rabbit polyclonal anti-human tissue factor immunoglobulin G. Among 4 million recombinant clones screened, one positive, λHTF8, expressed a protein that shared epitopes with authentic human brain tissue factor. The 1.1-kilobase cDNA insert of λHTF8 encoded a peptide that contained the amino-terminal protein sequence of human brain tissue factor. Northern blotting identified a major mRNA species of 2.2 kilobases and a minor species of ∼ 3.2 kilobases in poly(A) + RNA of placenta. Only 2.2-kilobase mRNA was detected in human brain and in the human monocytic U937 cell line. In U937 cells, the quantity of tissue factor mRNA was increased several fold by exposure of the cells to phorbol 12-myristate 13-acetate. Additional cDNA clones were selected by hybridization with the cDNA insert of λHTF8. These overlapping isolates span 2177 base pairs of the tissue factor cDNA sequence that includes a 5'-noncoding region of 75 base pairs, an open reading frame of 885 base pairs, a stop codon, a 3'-noncoding region of 1141 base pairs, and a poly(a) tail. The open reading frame encodes a 33-kilodalton protein of 295 amino acids. The predicted sequence includes a signal peptide of 32 or 34 amino acids, a probable extracellular factor VII binding domain of 217 or 219 amino acids, a transmembrane segment of 23 acids, and a cytoplasmic tail of 21 amino acids. There are three potential glycosylation sites with the sequence Asn-X-Thr/Ser. The 3'-noncoding region contains an inverted Alu family repetitive sequence. The tissue factor gene was localized to chromosome 1 by hybridization of the cDNA insert of λHTF8 to flow-sorted human chromosomes

  9. Cloning, expression and characterisation of a novel gene encoding ...

    African Journals Online (AJOL)

    微软用户

    2012-01-12

    Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...

  10. Identification of genes involved in DNA replication of the Autographa californica baculovirus

    NARCIS (Netherlands)

    Kool, M.; Ahrens, C. H.; Goldbach, R. W.; Rohrmann, G. F.; Vlak, J. M.

    1994-01-01

    By use of a transient replication assay, nine genes involved in DNA replication were identified in the genome of the Autographa californica baculovirus. Six genes encoding helicase, DNA polymerase, IE-1, LEF-1, LEF-2, and LEF-3 are essential for DNA replication while three genes encoding P35, IE-2,

  11. Immunogenicity and protective efficacy of Semliki forest virus replicon-based DNA vaccines encoding goatpox virus structural proteins

    International Nuclear Information System (INIS)

    Zheng Min; Jin Ningyi; Liu Qi; Huo Xiaowei; Li Yang; Hu Bo; Ma Haili; Zhu Zhanbo; Cong Yanzhao; Li Xiao; Jin Minglan; Zhu Guangze

    2009-01-01

    Goatpox, caused by goatpox virus (GTPV), is an acute feverish and contagious disease in goats often associated with high morbidity and high mortality. To resolve potential safety risks and vaccination side effects of existing live attenuated goatpox vaccine (AV41), two Semliki forest virus (SFV) replicon-based bicistronic expression DNA vaccines (pCSm-AAL and pCSm-BAA) which encode GTPV structural proteins corresponding to the Vaccinia virus proteins A27, L1, A33, and B5, respectively, were constructed. Then, theirs ability to induce humoral and cellular response in mice and goats, and protect goats against virulent virus challenge were evaluated. The results showed that, vaccination with pCSm-AAL and pCSm-BAA in combination could elicit strong humoral and cellular responses in mice and goats, provide partial protection against viral challenge in goats, and reduce disease symptoms. Additionally, priming vaccination with the above-mentioned DNA vaccines could significantly reduce the goats' side reactions from boosting vaccinations with current live vaccine (AV41), which include skin lesions at the inoculation site and fevers. Data obtained in this study could not only facilitate improvement of the current goatpox vaccination strategy, but also provide valuable guidance to suitable candidates for evaluation and development of orthopoxvirus vaccines.

  12. The putative imprinted locus D15S9 within the common deletion region for the Prader-Willi and Angelman syndromes encodes two overlapping mRNAs transcribed from opposite strands

    Energy Technology Data Exchange (ETDEWEB)

    Glenn, C.C.; Driscoll, D.J. [Univ. of Florida, Gainesville, FL (United States); Saitoh, S. [Case Western Reserve Univ., Cleveland, OH (United States)] [and others

    1994-09-01

    Prader-Willi syndrome is typically caused by a deletion of paternal 15q11-q13, or maternal uniparental disomy (UPD) of chromosome 15, while Angelman syndrome is caused by a maternal deletion or paternal UPD of the same region. Therefore, these two clinically distinct neurobehavioral syndromes result from differential expression of imprinted genes within 15q11-q13. A 3.1 kb cDNA, DN34, from the D15S9 locus within 15q11-q13 was isolated from a human fetal brain library. We showed previously that DN34 probe detects a DNA methylation imprint and therefore may represent a candidate imprinted gene. Isolation of genomic clones and DNA sequencing demonstrated that the gene segment encoding the partial cDNA DN34 was split by a 2 kb intron, but did not encode a substantial open reading frame (ORF). Preliminary analysis of expression by RT-PCR suggests that this gene is expressed in fetal but not in tested tissue types from the adult, and thus its imprinting status has not been possible to assess at present. Surprisingly, we found an ORF on the antisense strand of the DN34 cDNA. This ORF encodes a putative polypeptide of 505 amino acid residues containing a RING C{sub 3}HC{sub 4} zinc-finger motif and other features of nuclear proteins. Subsequent characterization of this gene, ZNF127, and a mouse homolog, demonstrated expression of 3.2 kb transcript from all tested fetal and adult tissues. Transcripts initiate from within a CpG-island, shown to be differentially methylated on parental alleles in the human. Interestingly, functional imprinting of the mouse homolog was subsequently demonstrated in an F{sub 1} cross by analyzing a VNTR polymorphism in the mRNA. The ZNF127 gene is intronless, has significant overlap with the DN34 gene on the antisense strand, and a 1 kb 3{prime} end within the 2 kb DN34 intron.

  13. Characterization of the human laminin beta2 chain locus (LAMB2): linkage to a gene containing a nonprocessed, transcribed LAMB2-like pseudogene (LAMB2L) and to the gene encoding glutaminyl tRNA synthetase (QARS)

    DEFF Research Database (Denmark)

    Durkin, M E; Jäger, A C; Khurana, T S

    1999-01-01

    The laminin beta2 chain is an important constituent of certain kidney and muscle basement membranes. We have generated a detailed physical map of a 110-kb genomic DNA segment surrounding the human laminin beta2 chain gene (LAMB2) on chromosome 3p21.3-->p21.2, a region paralogous with the chromosome...... 7q22-->q31 region that contains the laminin beta1 chain gene locus (LAMB1). Several CpG islands and a novel polymorphic microsatellite marker (D3S4594) were identified. The 3' end of LAMB2 lies 16 kb from the 5' end of the glutaminyl tRNA synthetase gene (QARS). About 20 kb upstream of LAMB2 we...... found a gene encoding a transcribed, non-processed LAMB2-like pseudogene (LAMB2L). The sequence of 1.75 kb of genomic DNA at the 3' end of LAMB2L was similar to exons 8-12 of the laminin beta2 chain gene. The LAMB2L-LAMB2-QARS cluster lies telomeric to the gene encoding the laminin-binding protein...

  14. Dutch-Cantonese Bilinguals Show Segmental Processing during Sinitic Language Production

    Directory of Open Access Journals (Sweden)

    Kalinka Timmer

    2017-07-01

    Full Text Available This study addressed the debate on the primacy of syllable vs. segment (i.e., phoneme as a functional unit of phonological encoding in syllabic languages by investigating both behavioral and neural responses of Dutch-Cantonese (DC bilinguals in a color-object picture naming task. Specifically, we investigated whether DC bilinguals exhibit the phonemic processing strategy, evident in monolingual Dutch speakers, during planning of their Cantonese speech production. Participants named the color of colored line-drawings in Cantonese faster when color and object matched in the first segment than when they were mismatched (e.g., 藍駱駝, /laam4/ /lok3to4/, “blue camel;” 紅饑駝, /hung4/ /lok3to4/, “red camel”. This is in contrast to previous studies in Sinitic languages that did not reveal such phoneme-only facilitation. Phonemic overlap also modulated the event-related potentials (ERPs in the 125–175, 200–300, and 300–400 ms time windows, suggesting earlier ERP modulations than in previous studies with monolingual Sinitic speakers or unbalanced Sinitic-Germanic bilinguals. Conjointly, our results suggest that, while the syllable may be considered the primary unit of phonological encoding in Sinitic languages, the phoneme can serve as the primary unit of phonological encoding, both behaviorally and neurally, for DC bilinguals. The presence/absence of a segment onset effect in Sinitic languages may be related to the proficiency in the Germanic language of bilinguals.

  15. Short segment search method for phylogenetic analysis using nested sliding windows

    Science.gov (United States)

    Iskandar, A. A.; Bustamam, A.; Trimarsanto, H.

    2017-10-01

    To analyze phylogenetics in Bioinformatics, coding DNA sequences (CDS) segment is needed for maximal accuracy. However, analysis by CDS cost a lot of time and money, so a short representative segment by CDS, which is envelope protein segment or non-structural 3 (NS3) segment is necessary. After sliding window is implemented, a better short segment than envelope protein segment and NS3 is found. This paper will discuss a mathematical method to analyze sequences using nested sliding window to find a short segment which is representative for the whole genome. The result shows that our method can find a short segment which more representative about 6.57% in topological view to CDS segment than an Envelope segment or NS3 segment.

  16. Prokaryotic DNA segregation by an actin-like filament

    DEFF Research Database (Denmark)

    Møller-Jensen, Jakob; Bugge Jensen, Rasmus; Löwe, Jan

    2002-01-01

    The mechanisms responsible for prokaryotic DNA segregation are largely unknown. The partitioning locus (par) encoded by the Escherichia coli plasmid R1 actively segregates its replicon to daughter cells. We show here that the ParM ATPase encoded by par forms dynamic actin-like filaments with prop...... point for ParM polymerization. Hence, we provide evidence for a simple prokaryotic analogue of the eukaryotic mitotic spindle apparatus.......The mechanisms responsible for prokaryotic DNA segregation are largely unknown. The partitioning locus (par) encoded by the Escherichia coli plasmid R1 actively segregates its replicon to daughter cells. We show here that the ParM ATPase encoded by par forms dynamic actin-like filaments...

  17. Isolation of cDNA encoding a newly identified major allergenic protein of rye-grass pollen: intracellular targeting to the amyloplast.

    Science.gov (United States)

    Singh, M B; Hough, T; Theerakulpisut, P; Avjioglu, A; Davies, S; Smith, P M; Taylor, P; Simpson, R J; Ward, L D; McCluskey, J

    1991-01-01

    We have identified a major allergenic protein from rye-grass pollen, tentatively designated Lol pIb of 31kDa and with pI 9.0. A cDNA clone encoding Lol pIb has been isolated, sequenced, and characterized. Lol pIb is located mainly in the starch granules. This is a distinct allergen from Lol pI, which is located in the cytosol. Lol pIb is synthesized in pollen as a pre-allergen with a transit peptide targeting the allergen to amyloplasts. Epitope mapping of the fusion protein localized the IgE binding determinant in the C-terminal domain. Images PMID:1671715

  18. Some methods of encoding simple visual images for use with a sparse distributed memory, with applications to character recognition

    Science.gov (United States)

    Jaeckel, Louis A.

    1989-01-01

    To study the problems of encoding visual images for use with a Sparse Distributed Memory (SDM), I consider a specific class of images- those that consist of several pieces, each of which is a line segment or an arc of a circle. This class includes line drawings of characters such as letters of the alphabet. I give a method of representing a segment of an arc by five numbers in a continuous way; that is, similar arcs have similar representations. I also give methods for encoding these numbers as bit strings in an approximately continuous way. The set of possible segments and arcs may be viewed as a five-dimensional manifold M, whose structure is like a Mobious strip. An image, considered to be an unordered set of segments and arcs, is therefore represented by a set of points in M - one for each piece. I then discuss the problem of constructing a preprocessor to find the segments and arcs in these images, although a preprocessor has not been developed. I also describe a possible extension of the representation.

  19. The predominant WT1 isoform (+KTS) encodes a DNA-binding protein targeting the planar cell polarity gene Scribble in renal podocytes.

    Science.gov (United States)

    Wells, Julie; Rivera, Miguel N; Kim, Woo Jae; Starbuck, Kristen; Haber, Daniel A

    2010-07-01

    WT1 encodes a tumor suppressor first identified by its inactivation in Wilms' Tumor. Although one WT1 splicing variant encodes a well-characterized zinc finger transcription factor, little is known about the function of the most prevalent WT1 isoform, whose DNA binding domain is disrupted by a three-amino acid (KTS) insertion. Using cells that conditionally express WT1(+KTS), we undertook a genome-wide chromatin immunoprecipitation and cloning analysis to identify candidate WT1(+KTS)-regulated promoters. We identified the planar cell polarity gene Scribble (SCRB) as the first WT1(+KTS) target gene in podocytes of the kidney. WT1 and SCRB expression patterns overlap precisely in developing renal glomeruli of mice, and WT1(+KTS) binds to a 33-nucleotide region within the Scribble promoter in mouse and human cell lines and kidneys. Together, our results support a role for the predominant WT1(+KTS) isoform in transcriptional regulation and suggest a link between the WT1-dependent tumor suppressor pathway and a key component of the planar cell polarity pathway.

  20. The predominant WT1 isoform (+KTS) encodes a DNA binding protein targeting the planar cell polarity gene Scribble in renal podocytes

    Science.gov (United States)

    Wells, Julie; Rivera, Miguel N.; Kim, Woo Jae; Starbuck, Kristen; Haber, Daniel A.

    2010-01-01

    WT1 encodes a tumor suppressor, first identified by its inactivation in Wilms Tumor. While one WT1 splicing variant encodes a well-characterized zinc finger transcription factor, little is known about the function of the most prevalent WT1 isoform, whose DNA binding domain is disrupted by a three amino acid (KTS) insertion. Using cells which conditionally express WT1(+KTS), we undertook a genome-wide chromatin immunoprecipitation and cloning (ChIP-cloning) analysis to identify candidate WT1(+KTS) regulated promoters. We identified the planar cell polarity (PCP) gene Scribble (SCRB) as the first WT1(+KTS) target gene in podocytes of the kidney. WT1 and SCRB expression patterns overlap precisely in developing renal glomeruli of mice, and WT1(+KTS) binds to a 33 nucleotide region within the Scribble promoter in both mouse and human cell lines and kidneys. Together, our results support a role for the predominant WT1(+KTS) isoform in transcriptional regulation and suggest a link between the WT1-dependent tumor suppressor pathway and a key component of the planar cell polarity pathway. PMID:20571064

  1. A DNA-Encoded Library of Chemical Compounds Based on Common Scaffolding Structures Reveals the Impact of Ligand Geometry on Protein Recognition.

    Science.gov (United States)

    Favalli, Nicholas; Biendl, Stefan; Hartmann, Marco; Piazzi, Jacopo; Sladojevich, Filippo; Gräslund, Susanne; Brown, Peter J; Näreoja, Katja; Schüler, Herwig; Scheuermann, Jörg; Franzini, Raphael; Neri, Dario

    2018-06-01

    A DNA-encoded chemical library (DECL) with 1.2 million compounds was synthesized by combinatorial reaction of seven central scaffolds with two sets of 343×492 building blocks. Library screening by affinity capture revealed that for some target proteins, the chemical nature of building blocks dominated the selection results, whereas for other proteins, the central scaffold also crucially contributed to ligand affinity. Molecules based on a 3,5-bis(aminomethyl)benzoic acid core structure were found to bind human serum albumin with a K d value of 6 nm, while compounds with the same substituents on an equidistant but flexible l-lysine scaffold showed 140-fold lower affinity. A 18 nm tankyrase-1 binder featured l-lysine as linking moiety, while molecules based on d-Lysine or (2S,4S)-amino-l-proline showed no detectable binding to the target. This work suggests that central scaffolds which predispose the orientation of chemical building blocks toward the protein target may enhance the screening productivity of encoded libraries. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    You Wanhui

    2012-04-01

    Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to

  3. To DNA, all information is equal

    DEFF Research Database (Denmark)

    Sennels, Lau; Bentin, Thomas

    2012-01-01

    Information storage capabilities are key in most aspects of society and the requirement for storage space is rapidly expanding. In principle, DNA could be a high-density medium for information storage. Church and coworkers recently demonstrated how binary data can be encoded, stored in, and retri......Information storage capabilities are key in most aspects of society and the requirement for storage space is rapidly expanding. In principle, DNA could be a high-density medium for information storage. Church and coworkers recently demonstrated how binary data can be encoded, stored in...

  4. Molecular cloning and characterization of the genes encoding an auxin efflux carrier and the auxin influx carriers associated with the adventitious root formation in mango (Mangifera indica L.) cotyledon segments.

    Science.gov (United States)

    Li, Yun-He; Zou, Ming-Hong; Feng, Bi-Hong; Huang, Xia; Zhang, Zhi; Sun, Guang-Ming

    2012-06-01

    Polar auxin transport (PAT) plays an important role in the adventitious root formation of mango cotyledon segments, but the molecular mechanism remains unclear. In this study, we cloned a gene encoding an auxin efflux carrier (designated as MiPIN1), and we cloned four genes encoding auxin influx carriers (designated as MiAUX1, MiAUX2, MiAUX3 and MiAUX4). The results of a phylogenetic tree analysis indicated that MiPIN1 and the MiAUXs belong to plant PIN and AUXs/LAXs groups. Quantitative real-time PCR indicated that the expression of MiPIN1 and the MiAUXs was lowest at 0 days but sharply increased on and after day 4. During the root formation in the mango cotyledon segments, the MiPIN1 expression in the distal cut surface (DCS) was always higher than the expression in the proximal cut surface (PCS) whereas the expression of the MiAUXs in the PCS was usually higher than in the DCS. This expression pattern might be result in the PAT from the DCS to the PCS, which is essential for the adventitious root formation in the PCS. Our previous study indicated that a pre-treatment of embryos with indole-3-butyric acid (IBA) significantly promoted adventitious rooting in PCS whereas a pre-treatment with 2,3,5-triiodobenzoic acid (TIBA) completely inhibited this rooting. In this study, however, IBA and TIBA pre-treatments slightly changed the expression of MiPIN1. In contrast, while the MiAUX3 and MiAUX4 expression levels were significantly up-regulated by the IBA pre-treatment, the expression levels were down-regulated by the TIBA pre-treatment. These findings imply that MiAUX3 and MiAUX4 are more sensitive to the IBA and TIBA treatments and that they might play important roles during adventitious root formation in mango cotyledon segments. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  5. The yeast Saccharomyces cerevisiae DNA polymerase IV: possible involvement in double strand break DNA repair.

    Science.gov (United States)

    Leem, S H; Ropp, P A; Sugino, A

    1994-08-11

    We identified and purified a new DNA polymerase (DNA polymerase IV), which is similar to mammalian DNA polymerase beta, from Saccharomyces cerevisiae and suggested that it is encoded by YCR14C (POLX) on chromosome III. Here, we provided a direct evidence that the purified DNA polymerase IV is indeed encoded by POLX. Strains harboring a pol4 deletion mutation exhibit neither mitotic growth defect nor a meiosis defect, suggesting that DNA polymerase IV participates in nonessential functions in DNA metabolism. The deletion strains did not exhibit UV-sensitivity. However, they did show weak sensitivity to MMS-treatment and exhibited a hyper-recombination phenotype when intragenic recombination was measured during meiosis. Furthermore, MAT alpha pol4 delta segregants had a higher frequency of illegitimate mating with a MAT alpha tester strain than that of wild-type cells. These results suggest that DNA polymerase IV participates in a double-strand break repair pathway. A 3.2kb of the POL4 transcript was weakly expressed in mitotically growing cells. During meiosis, a 2.2 kb POL4 transcript was greatly induced, while the 3.2 kb transcript stayed at constant levels. This induction was delayed in a swi4 delta strain during meiosis, while no effect was observed in a swi6 delta strain.

  6. Dictionary Based Segmentation in Volumes

    DEFF Research Database (Denmark)

    Emerson, Monica Jane; Jespersen, Kristine Munk; Jørgensen, Peter Stanley

    2015-01-01

    We present a method for supervised volumetric segmentation based on a dictionary of small cubes composed of pairs of intensity and label cubes. Intensity cubes are small image volumes where each voxel contains an image intensity. Label cubes are volumes with voxelwise probabilities for a given...... label. The segmentation process is done by matching a cube from the volume, of the same size as the dictionary intensity cubes, to the most similar intensity dictionary cube, and from the associated label cube we get voxel-wise label probabilities. Probabilities from overlapping cubes are averaged...... and hereby we obtain a robust label probability encoding. The dictionary is computed from labeled volumetric image data based on weighted clustering. We experimentally demonstrate our method using two data sets from material science – a phantom data set of a solid oxide fuel cell simulation for detecting...

  7. Structure, function and physiological consequences of virally encoded chemokine seven transmembrane receptors

    DEFF Research Database (Denmark)

    Rosenkilde, M M; Smit, M J; Waldhoer, M

    2008-01-01

    A number of human and animal herpes viruses encode G-protein coupled receptors with seven transmembrane (7TM) segments-most of which are clearly related to human chemokine receptors. It appears, that these receptors are used by the virus for immune evasion, cellular transformation, tissue targeting...... pathogenesis is still poorly understood. Here we focus on the current knowledge of structure, function and trafficking patterns of virally encoded chemokine receptors and further address the putative roles of these receptors in virus survival and host -cell and/or -immune system modulation. Finally, we...

  8. Detection of DNA hybridizations using solid-state nanopores

    International Nuclear Information System (INIS)

    Balagurusamy, Venkat S K; Weinger, Paul; Sean Ling, Xinsheng

    2010-01-01

    We report an experimental study of using DNA translocation through solid-state nanopores to detect the sequential arrangement of two double-stranded 12-mer hybridization segments on a single-stranded DNA molecule. The sample DNA is a trimer molecule formed by hybridizing three single-stranded oligonucleotides. A polystyrene bead is attached to the end of the trimer DNA, providing a mechanism in slowing down the translocation and suppressing the thermal diffusion, thereby allowing the detection of short features of DNA by standard patch-clamp electronics. The electrical signature of the translocation of a trimer molecule through a nanopore has been identified successfully in the temporal traces of ionic current. The results reported here represent the first successful attempt in using a solid-state nanopore as an ionic scanning device in resolving individual hybridization segments (or 'probes') on a DNA molecule.

  9. Detection of DNA hybridizations using solid-state nanopores

    Energy Technology Data Exchange (ETDEWEB)

    Balagurusamy, Venkat S K; Weinger, Paul; Sean Ling, Xinsheng, E-mail: Xinsheng_Ling@brown.edu [Department of Physics, Brown University, Providence, RI 02912 (United States)

    2010-08-20

    We report an experimental study of using DNA translocation through solid-state nanopores to detect the sequential arrangement of two double-stranded 12-mer hybridization segments on a single-stranded DNA molecule. The sample DNA is a trimer molecule formed by hybridizing three single-stranded oligonucleotides. A polystyrene bead is attached to the end of the trimer DNA, providing a mechanism in slowing down the translocation and suppressing the thermal diffusion, thereby allowing the detection of short features of DNA by standard patch-clamp electronics. The electrical signature of the translocation of a trimer molecule through a nanopore has been identified successfully in the temporal traces of ionic current. The results reported here represent the first successful attempt in using a solid-state nanopore as an ionic scanning device in resolving individual hybridization segments (or 'probes') on a DNA molecule.

  10. Characterization of gene expression on genomic segment 7 of infectious salmon anaemia virus

    Directory of Open Access Journals (Sweden)

    Qian Biao

    2007-03-01

    Full Text Available Abstract Background Infectious salmon anaemia (ISA virus (ISAV, an important pathogen of fish that causes disease accompanied by high mortality in marine-farmed Atlantic salmon, is the only species in the genus Isavirus, one of the five genera of the Orthomyxoviridae family. The Isavirus genome consists of eight single-stranded RNA species, and the virions have two surface glycoproteins; haemagglutinin-esterase (HE protein encoded on segment 6 and fusion (F protein encoded on segment 5. Based on the initial demonstration of two 5'-coterminal mRNA transcripts by RT-PCR, ISAV genomic segment 7 was suggested to share a similar coding strategy with segment 7 of influenza A virus, encoding two proteins. However, there appears to be confusion as to the protein sizes predicted from the two open reading frames (ORFs of ISAV segment 7 which has in turn led to confusion of the predicted protein functions. The primary goal of the present work was to clone and express these two ORFs in order to assess whether the predicted protein sizes match those of the expressed proteins so as to clarify the coding assignments, and thereby identify any additional structural proteins of ISAV. Results In the present study we show that ISAV segment 7 encodes 3 proteins with estimated molecular masses of 32, 18, and 9.5 kDa. The 18-kDa and 9.5-kDa products are based on removal of an intron each from the primary transcript (7-ORF1 so that the translation continues in the +2 and +3 reading frames, respectively. The segment 7-ORF1/3 product is variably truncated in the sequence of ISAV isolates of the European genotype. All three proteins are recognized by rabbit antiserum against the 32-kDa product of the primary transcript, as they all share the N-terminal 22 amino acids. This antiserum detected a single 35-kDa protein in Western blots of purified virus, and immunoprecipitated a 32-kDa protein in ISAV-infected TO cells. Immunofluorescence staining of infected cells with the

  11. The Mycobacterium tuberculosis Rv2540c DNA sequence encodes a bifunctional chorismate synthase

    Directory of Open Access Journals (Sweden)

    Santos Diógenes S

    2008-04-01

    Full Text Available Abstract Background The emergence of multi- and extensively-drug resistant Mycobacterium tuberculosis strains has created an urgent need for new agents to treat tuberculosis (TB. The enzymes of shikimate pathway are attractive targets to the development of antitubercular agents because it is essential for M. tuberculosis and is absent from humans. Chorismate synthase (CS is the seventh enzyme of this route and catalyzes the NADH- and FMN-dependent synthesis of chorismate, a precursor of aromatic amino acids, naphthoquinones, menaquinones, and mycobactins. Although the M. tuberculosis Rv2540c (aroF sequence has been annotated to encode a chorismate synthase, there has been no report on its correct assignment and functional characterization of its protein product. Results In the present work, we describe DNA amplification of aroF-encoded CS from M. tuberculosis (MtCS, molecular cloning, protein expression, and purification to homogeneity. N-terminal amino acid sequencing, mass spectrometry and gel filtration chromatography were employed to determine identity, subunit molecular weight and oligomeric state in solution of homogeneous recombinant MtCS. The bifunctionality of MtCS was determined by measurements of both chorismate synthase and NADH:FMN oxidoreductase activities. The flavin reductase activity was characterized, showing the existence of a complex between FMNox and MtCS. FMNox and NADH equilibrium binding was measured. Primary deuterium, solvent and multiple kinetic isotope effects are described and suggest distinct steps for hydride and proton transfers, with the former being more rate-limiting. Conclusion This is the first report showing that a bacterial CS is bifunctional. Primary deuterium kinetic isotope effects show that C4-proS hydrogen is being transferred during the reduction of FMNox by NADH and that hydride transfer contributes significantly to the rate-limiting step of FMN reduction reaction. Solvent kinetic isotope effects and

  12. Oxidants and not alkylating agents induce rapid mtDNA loss and mitochondrial dysfunction

    Science.gov (United States)

    Furda, Amy M.; Marrangoni, Adele M.; Lokshin, Anna; Van Houten, Bennett

    2013-01-01

    Mitochondrial DNA (mtDNA) is essential for proper mitochondrial function and encodes 22 tRNAs, 2 rRNAs and 13 polypeptides that make up subunits of complex I, III, IV, in the electron transport chain and complex V, the ATP synthase. Although mitochondrial dysfunction has been implicated in processes such as premature aging, neurodegeneration, and cancer, it has not been shown whether persistent mtDNA damage causes a loss of oxidative phosphorylation. We addressed this question by treating mouse embryonic fibroblasts with either hydrogen peroxide (H2O2) or the alkylating agent methyl methanesulfonate (MMS) and measuring several endpoints, including mtDNA damage and repair rates using QPCR, levels of mitochondrial- and nuclear-encoded proteins using antibody analysis, and a pharmacologic profile of mitochondria using the Seahorse Extracellular Flux Analyzer. We show that a 60 min treatment with H2O2 causes persistent mtDNA lesions, mtDNA loss, decreased levels of a nuclear-encoded mitochondrial subunit, a loss of ATP-linked oxidative phosphorylation and a loss of total reserve capacity. Conversely, a 60 min treatment with 2 mM MMS causes persistent mtDNA lesions but no mtDNA loss, no decrease in levels of a nuclear-encoded mitochondrial subunit, and no mitochondrial dysfunction. These results suggest that persistent mtDNA damage is not sufficient to cause mitochondrial dysfunction. PMID:22766155

  13. DNA repair and cancer

    International Nuclear Information System (INIS)

    Rathore, Shakuntla; Joshi, Pankaj Kumar; Gaur, Sudha

    2012-01-01

    DNA repair refers to a collection of processes by which a cell identifies and corrects damage to the DNA molecule that encode it's genome. In human cells, both normal metabolic activities and environmental factors such as UV light and radiation can cause DNA damage, resulting in as many one million individual molecular lesions per day. Many of these lesions cause structural damage to the DNA molecule and can alter or eliminate the cell's ability to transcribe the gene that the affected DNA encodes. Other lesions include potentially harmful mutation in cell's genome which affect the survival of it's daughter cells after it undergoes mitosis. As a consequence, the DNA repair process is constantly active as it responds to damage in the DNA structure. Inherited mutation that affect DNA repair genes are strongly associated with high cancer risks in humans. Hereditary non polyposis colorectal cancer (HNPCC) is strongly associated with specific mutation in the DNA mismatch repair pathway. BRCA1, BRCA2 two famous mutation conferring a hugely increased risk of breast cancer on carrier, are both associated with a large number of DNA repair pathway, especially NHEJ and homologous recombination. Cancer therapy procedures such as chemotherapy and radiotherapy work by overwhelming the capacity of the cell to repair DNA damage, resulting in cell death. Cells that are most rapidly dividing most typically cancer cells are preferentially affected. The side effect is that other non-cancerous but rapidly dividing cells such as stem cells in the bone marrow are also affected. Modern cancer treatment attempt to localize the DNA damage to cells and tissue only associated with cancer, either by physical means (concentrating the therapeutic agent in the region of the tumor) or by biochemical means (exploiting a feature unique to cancer cells in the body). (author)

  14. Yeast DNA-repair gene RAD14 encodes a zinc metalloprotein with affinity for ultraviolet-damaged DNA

    International Nuclear Information System (INIS)

    Guzder, S.N.; Sung, P.; Prakash, S.; Prakash, L.

    1993-01-01

    Xeroderma pigmentosum (XP) patients suffer from a high incidence of skin cancers due to a defect in excision repair of UV light-damaged DNA. Of the seven XP complementation groups, A--G, group A represents a severe and frequent form of the disease. The Saccharomyces cerevisiae RAD14 gene is a homolog of the XP-A correcting (XPAC) gene. Like XP-A cells, rad14-null mutants are defective in the incision step of excision repair of UV-damaged DNA. The authors have purified RAD14 protein to homogeneity from extract of a yeast strain genetically tailored to overexpress RAD14. As determined by atomic emission spectroscopy, RAD14 contains one zinc atom. They also show in vitro that RAD14 binds zinc but does not bind other divalent metal ions. In DNA mobility-shift assays, RAD14 binds specifically to UV-damaged DNA. Removal of cyclobutane pyrimidine dimers from damaged DNA by enzymatic photoreactivation has no effect on binding, strongly suggesting that RAD14 recognizes pyrimidine(6-4)pyrimidone photoproduct sites. These findings indicate that RAD14 functions in damage recognition during excision repair. 37 refs., 4 figs

  15. DNA controlled assembly of liposomes

    DEFF Research Database (Denmark)

    Vogel, Stefan; Jakobsen, Ulla; Simonsen, Adam Cohen

    2009-01-01

    DNA-encoding of solid nanoparticles requires surfacechemistry, which is often tedious and not generally applicable. In the present study non-covalently attached DNA are used to assemble soft nanoparticles (liposomes) in solution. This process displays remarkably sharp thermal transitions from...... assembled to disassembled state for which reason this method allows easy and fast detection of polynucleotides (e.g. DNA or RNA), including single nucleotide polymorphisms as well as insertions and deletions....

  16. Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.

    Science.gov (United States)

    Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M

    1991-02-15

    The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.

  17. Next-generation digital information storage in DNA.

    Science.gov (United States)

    Church, George M; Gao, Yuan; Kosuri, Sriram

    2012-09-28

    Digital information is accumulating at an astounding rate, straining our ability to store and archive it. DNA is among the most dense and stable information media known. The development of new technologies in both DNA synthesis and sequencing make DNA an increasingly feasible digital storage medium. We developed a strategy to encode arbitrary digital information in DNA, wrote a 5.27-megabit book using DNA microchips, and read the book by using next-generation DNA sequencing.

  18. Segmenting the human genome based on states of neutral genetic divergence.

    Science.gov (United States)

    Kuruppumullage Don, Prabhani; Ananda, Guruprasad; Chiaromonte, Francesca; Makova, Kateryna D

    2013-09-03

    Many studies have demonstrated that divergence levels generated by different mutation types vary and covary across the human genome. To improve our still-incomplete understanding of the mechanistic basis of this phenomenon, we analyze several mutation types simultaneously, anchoring their variation to specific regions of the genome. Using hidden Markov models on insertion, deletion, nucleotide substitution, and microsatellite divergence estimates inferred from human-orangutan alignments of neutrally evolving genomic sequences, we segment the human genome into regions corresponding to different divergence states--each uniquely characterized by specific combinations of divergence levels. We then parsed the mutagenic contributions of various biochemical processes associating divergence states with a broad range of genomic landscape features. We find that high divergence states inhabit guanine- and cytosine (GC)-rich, highly recombining subtelomeric regions; low divergence states cover inner parts of autosomes; chromosome X forms its own state with lowest divergence; and a state of elevated microsatellite mutability is interspersed across the genome. These general trends are mirrored in human diversity data from the 1000 Genomes Project, and departures from them highlight the evolutionary history of primate chromosomes. We also find that genes and noncoding functional marks [annotations from the Encyclopedia of DNA Elements (ENCODE)] are concentrated in high divergence states. Our results provide a powerful tool for biomedical data analysis: segmentations can be used to screen personal genome variants--including those associated with cancer and other diseases--and to improve computational predictions of noncoding functional elements.

  19. Comparative d2/d3 LSU–rDNA sequence study of some Iranian ...

    African Journals Online (AJOL)

    SERVER

    2007-11-05

    Nov 5, 2007 ... segments yielded one fragment at over all sequenced isolates as 787 bp in size. The DNA sequences were aligned .... expansion segments of the 28S rDNA subunit (D2/D3. LSU-rDNA) are the ... isolated from different geographical location from tea shrubs infested roots of Guilan province, Iran (Table 1).

  20. Modular verification of chemical reaction network encodings via serializability analysis

    Science.gov (United States)

    Lakin, Matthew R.; Stefanovic, Darko; Phillips, Andrew

    2015-01-01

    Chemical reaction networks are a powerful means of specifying the intended behaviour of synthetic biochemical systems. A high-level formal specification, expressed as a chemical reaction network, may be compiled into a lower-level encoding, which can be directly implemented in wet chemistry and may itself be expressed as a chemical reaction network. Here we present conditions under which a lower-level encoding correctly emulates the sequential dynamics of a high-level chemical reaction network. We require that encodings are transactional, such that their execution is divided by a “commit reaction” that irreversibly separates the reactant-consuming phase of the encoding from the product-generating phase. We also impose restrictions on the sharing of species between reaction encodings, based on a notion of “extra tolerance”, which defines species that may be shared between encodings without enabling unwanted reactions. Our notion of correctness is serializability of interleaved reaction encodings, and if all reaction encodings satisfy our correctness properties then we can infer that the global dynamics of the system are correct. This allows us to infer correctness of any system constructed using verified encodings. As an example, we show how this approach may be used to verify two- and four-domain DNA strand displacement encodings of chemical reaction networks, and we generalize our result to the limit where the populations of helper species are unlimited. PMID:27325906

  1. Genetic analysis of RPA single-stranded DNA binding protein in Haloferax volcanii

    OpenAIRE

    Stroud, A. L.

    2012-01-01

    Replication protein A (RPA) is a single-stranded DNA-binding protein that is present in all three domains of life. The roles of RPA include stabilising and protecting single- stranded DNA from nuclease degradation during DNA replication and repair. To achieve this, RPA uses an oligosaccharide-binding fold (OB fold) to bind single- stranded DNA. Haloferax volcanii encodes three RPAs – RPA1, RPA2 and RPA3, of which rpa1 and rpa3 are in operons with genes encoding associated proteins (APs). ...

  2. C-terminal phenylalanine of bacteriophage T7 single-stranded DNA-binding protein is essential for strand displacement synthesis by T7 DNA polymerase at a nick in DNA.

    Science.gov (United States)

    Ghosh, Sharmistha; Marintcheva, Boriana; Takahashi, Masateru; Richardson, Charles C

    2009-10-30

    Single-stranded DNA-binding protein (gp2.5), encoded by gene 2.5 of bacteriophage T7, plays an essential role in DNA replication. Not only does it remove impediments of secondary structure in the DNA, it also modulates the activities of the other replication proteins. The acidic C-terminal tail of gp2.5, bearing a C-terminal phenylalanine, physically and functionally interacts with the helicase and DNA polymerase. Deletion of the phenylalanine or substitution with a nonaromatic amino acid gives rise to a dominant lethal phenotype, and the altered gp2.5 has reduced affinity for T7 DNA polymerase. Suppressors of the dominant lethal phenotype have led to the identification of mutations in gene 5 that encodes the T7 DNA polymerase. The altered residues in the polymerase are solvent-exposed and lie in regions that are adjacent to the bound DNA. gp2.5 lacking the C-terminal phenylalanine has a lower affinity for gp5-thioredoxin relative to the wild-type gp2.5, and this affinity is partially restored by the suppressor mutations in DNA polymerase. gp2.5 enables T7 DNA polymerase to catalyze strand displacement DNA synthesis at a nick in DNA. The resulting 5'-single-stranded DNA tail provides a loading site for T7 DNA helicase. gp2.5 lacking the C-terminal phenylalanine does not support this event with wild-type DNA polymerase but does to a limited extent with T7 DNA polymerase harboring the suppressor mutations.

  3. C-terminal Phenylalanine of Bacteriophage T7 Single-stranded DNA-binding Protein Is Essential for Strand Displacement Synthesis by T7 DNA Polymerase at a Nick in DNA*

    Science.gov (United States)

    Ghosh, Sharmistha; Marintcheva, Boriana; Takahashi, Masateru; Richardson, Charles C.

    2009-01-01

    Single-stranded DNA-binding protein (gp2.5), encoded by gene 2.5 of bacteriophage T7, plays an essential role in DNA replication. Not only does it remove impediments of secondary structure in the DNA, it also modulates the activities of the other replication proteins. The acidic C-terminal tail of gp2.5, bearing a C-terminal phenylalanine, physically and functionally interacts with the helicase and DNA polymerase. Deletion of the phenylalanine or substitution with a nonaromatic amino acid gives rise to a dominant lethal phenotype, and the altered gp2.5 has reduced affinity for T7 DNA polymerase. Suppressors of the dominant lethal phenotype have led to the identification of mutations in gene 5 that encodes the T7 DNA polymerase. The altered residues in the polymerase are solvent-exposed and lie in regions that are adjacent to the bound DNA. gp2.5 lacking the C-terminal phenylalanine has a lower affinity for gp5-thioredoxin relative to the wild-type gp2.5, and this affinity is partially restored by the suppressor mutations in DNA polymerase. gp2.5 enables T7 DNA polymerase to catalyze strand displacement DNA synthesis at a nick in DNA. The resulting 5′-single-stranded DNA tail provides a loading site for T7 DNA helicase. gp2.5 lacking the C-terminal phenylalanine does not support this event with wild-type DNA polymerase but does to a limited extent with T7 DNA polymerase harboring the suppressor mutations. PMID:19726688

  4. Molecular cloning of a cDNA encoding the precursor of adenoregulin from frog skin. Relationships with the vertebrate defensive peptides, dermaseptins.

    Science.gov (United States)

    Amiche, M; Ducancel, F; Lajeunesse, E; Boulain, J C; Ménez, A; Nicolas, P

    1993-03-31

    Adenoregulin has recently been isolated from Phyllomedusa skin as a 33 amino acid residues peptide which enhanced binding of agonists to the A1 adenosine receptor. In order to study the structure of the precursor of adenoregulin we constructed a cDNA library from mRNAs extracted from the skin of Phyllomedusa bicolor. We detected the complete nucleotide sequence of a cDNA encoding the adenoregulin biosynthetic precursor. The deduced sequence of the precursor is 81 amino acids long, exhibits a putative signal sequence at the NH2 terminus and contains a single copy of the biologically active peptide at the COOH terminus. Structural and conformational homologies that are observed between adenoregulin and the dermaseptins, antimicrobial peptides exhibiting strong membranolytic activities against various pathogenic agents, suggest that adenoregulin is an additional member of the growing family of cytotropic antimicrobial peptides that allow vertebrate animals to defend themselves against microorganisms. As such, the adenosine receptor regulating activity of adenoregulin could be due to its ability to interact with and disrupt membranes lipid bilayers.

  5. Bubble coalescence in breathing DNA

    DEFF Research Database (Denmark)

    Novotný, Tomas; Pedersen, Jonas Nyvold; Ambjörnsson, Tobias

    2007-01-01

    We investigate the coalescence of two DNA bubbles initially located at weak segments and separated by a more stable barrier region in a designed construct of double-stranded DNA. The characteristic time for bubble coalescence and the corresponding distribution are derived, as well as the distribu...... vicious walkers in opposite potentials....

  6. Colorimetric Detection of Specific DNA Segments Amplified by Polymerase Chain Reactions

    Science.gov (United States)

    Kemp, David J.; Smith, Donald B.; Foote, Simon J.; Samaras, N.; Peterson, M. Gregory

    1989-04-01

    The polymerase chain reaction (PCR) procedure has many potential applications in mass screening. We describe here a general assay for colorimetric detection of amplified DNA. The target DNA is first amplified by PCR, and then a second set of oligonucleotides, nested between the first two, is incorporated by three or more PCR cycles. These oligonucleotides bear ligands: for example, one can be biotinylated and the other can contain a site for a double-stranded DNA-binding protein. After linkage to an immobilized affinity reagent (such as a cloned DNA-binding protein, which we describe here) and labeling with a second affinity reagent (for example, avidin) linked to horseradish peroxidase, reaction with a chromogenic substrate allows detection of the amplified DNA. This amplified DNA assay (ADA) is rapid, is readily applicable to mass screening, and uses routine equipment. We show here that it can be used to detect human immunodeficiency virus sequences specifically against a background of human DNA.

  7. Footprinting of Chlorella virus DNA ligase bound at a nick in duplex DNA.

    Science.gov (United States)

    Odell, M; Shuman, S

    1999-05-14

    The 298-amino acid ATP-dependent DNA ligase of Chlorella virus PBCV-1 is the smallest eukaryotic DNA ligase known. The enzyme has intrinsic specificity for binding to nicked duplex DNA. To delineate the ligase-DNA interface, we have footprinted the enzyme binding site on DNA and the DNA binding site on ligase. The size of the exonuclease III footprint of ligase bound a single nick in duplex DNA is 19-21 nucleotides. The footprint is asymmetric, extending 8-9 nucleotides on the 3'-OH side of the nick and 11-12 nucleotides on the 5'-phosphate side. The 5'-phosphate moiety is essential for the binding of Chlorella virus ligase to nicked DNA. Here we show that the 3'-OH moiety is not required for nick recognition. The Chlorella virus ligase binds to a nicked ligand containing 2',3'-dideoxy and 5'-phosphate termini, but cannot catalyze adenylation of the 5'-end. Hence, the 3'-OH is important for step 2 chemistry even though it is not itself chemically transformed during DNA-adenylate formation. A 2'-OH cannot substitute for the essential 3'-OH in adenylation at a nick or even in strand closure at a preadenylated nick. The protein side of the ligase-DNA interface was probed by limited proteolysis of ligase with trypsin and chymotrypsin in the presence and absence of nicked DNA. Protease accessible sites are clustered within a short segment from amino acids 210-225 located distal to conserved motif V. The ligase is protected from proteolysis by nicked DNA. Protease cleavage of the native enzyme prior to DNA addition results in loss of DNA binding. These results suggest a bipartite domain structure in which the interdomain segment either comprises part of the DNA binding site or undergoes a conformational change upon DNA binding. The domain structure of Chlorella virus ligase inferred from the solution experiments is consistent with the structure of T7 DNA ligase determined by x-ray crystallography.

  8. A Sequence-Specific Interaction between the Saccharomyces cerevisiae rRNA Gene Repeats and a Locus Encoding an RNA Polymerase I Subunit Affects Ribosomal DNA Stability

    Science.gov (United States)

    Cahyani, Inswasti; Cridge, Andrew G.; Engelke, David R.; Ganley, Austen R. D.

    2014-01-01

    The spatial organization of eukaryotic genomes is linked to their functions. However, how individual features of the global spatial structure contribute to nuclear function remains largely unknown. We previously identified a high-frequency interchromosomal interaction within the Saccharomyces cerevisiae genome that occurs between the intergenic spacer of the ribosomal DNA (rDNA) repeats and the intergenic sequence between the locus encoding the second largest RNA polymerase I subunit and a lysine tRNA gene [i.e., RPA135-tK(CUU)P]. Here, we used quantitative chromosome conformation capture in combination with replacement mapping to identify a 75-bp sequence within the RPA135-tK(CUU)P intergenic region that is involved in the interaction. We demonstrate that the RPA135-IGS1 interaction is dependent on the rDNA copy number and the Msn2 protein. Surprisingly, we found that the interaction does not govern RPA135 transcription. Instead, replacement of a 605-bp region within the RPA135-tK(CUU)P intergenic region results in a reduction in the RPA135-IGS1 interaction level and fluctuations in rDNA copy number. We conclude that the chromosomal interaction that occurs between the RPA135-tK(CUU)P and rDNA IGS1 loci stabilizes rDNA repeat number and contributes to the maintenance of nucleolar stability. Our results provide evidence that the DNA loci involved in chromosomal interactions are composite elements, sections of which function in stabilizing the interaction or mediating a functional outcome. PMID:25421713

  9. Fanconi anemia (cross)linked to DNA repair.

    Science.gov (United States)

    Niedernhofer, Laura J; Lalai, Astrid S; Hoeijmakers, Jan H J

    2005-12-29

    Fanconi anemia is characterized by hypersensitivity to DNA interstrand crosslinks (ICLs) and susceptibility to tumor formation. Despite the identification of numerous Fanconi anemia (FANC) genes, the mechanism by which proteins encoded by these genes protect a cell from DNA interstrand crosslinks remains unclear. The recent discovery of two DNA helicases that, when defective, cause Fanconi anemia tips the balance in favor of the direct involvement of the FANC proteins in DNA repair and the bypass of DNA lesions.

  10. Vaccination with DNA encoding truncated enterohemorrhagic Escherichia coli (EHEC factor for adherence-1 gene (efa-1’ confers protective immunity to mice infected with E. coli O157:H7

    Directory of Open Access Journals (Sweden)

    Roberto eRiquelme-Neira

    2016-01-01

    Full Text Available Enterohemorrhagic Escherichia coli (EHEC O157:H7 is the predominant causative agent of hemorrhagic colitis in humans and is the cause of haemolytic uraemic syndrome and other illnesses. Cattle have been implicated as the main reservoir of this organism. Here, we evaluated the immunogenicity and protective efficacy of a DNA vaccine encoding conserved sequences of truncated EHEC factor for adherence-1 (efa-1’ in a mouse model. Intranasal administration of plasmid DNA carrying the efa-1’ gene (pVAXefa-1’ into C57BL/6 mice elicited both humoral and cellular immune responses. In animals immunized with pVAXefa-1`, EHEC-secreted protein-specific IgM and IgG antibodies were detected in sera at day 45. Anti-EHEC-secreted protein sIgA was also detected in nasal and bronchoalveolar lavages. In addition, antigen-specific T-cell-proliferation, IL-10 and IFN-γ were observed upon re-stimulation with either heat-killed bacteria or EHEC-secreted proteins. Vaccinated animals were also protected against challenge with E. coli O157:H7 strain EDL933. These results suggest that DNA vaccine encoding efa-1´ have therapeutic potential in interventions against EHEC infections. This approach could lead to a new strategy in the production of vaccines that prevent infections in cattle.

  11. Cloning of an epoxide hydrolase encoding gene from Rhodotorula mucilaginosa and functional expresion in Yarrowia lipolytica

    CSIR Research Space (South Africa)

    Labuschagne, M

    2007-01-01

    Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...

  12. Isolation and characterization of cDNA clones for carrot extensin and a proline-rich 33-kDa protein

    International Nuclear Information System (INIS)

    Chen, J.; Varner, J.E.

    1985-01-01

    Extensins are hydroxyproline-rich glycoproteins associated with most dicotyledonous plant cell walls. To isolate cDNA clones encoding extensin, the authors started by isolating poly(A) + RNA from carrot root tissue, and then translating the RNA in vitro, in the presence of tritiated leucine or proline. A 33-kDa peptide was identified in the translation products as a putative extensin precursor. From a cDNA library constructed with poly(A) + RNA from wounded carrots, one cDNA clone (pDC5) was identified that specifically hybridized to poly(A) + RNA encoding this 33-kDa peptide. They isolated three cDNA clones (pDC11, pDC12, and pDC16) from another cDNA library using pCD5 as a probe. DNA sequence data, RNA hybridization analysis, and hybrid released in vitro translation indicate that the cDNA clones pDC11 encodes extensin and that cDNA clones pDC12 and pDC16 encode the 33-kDa peptide, which as yet has an unknown identity and function. The assumption that the 33-kDa peptide was an extensin precursor was invalid. RNA hybridization analysis showed that RNA encoded by both clone types is accumulated upon wounding

  13. Intrinsic bent DNA sites in the chromosomal replication origin of Xylella fastidiosa 9a5c

    Directory of Open Access Journals (Sweden)

    F. Gimenes

    2008-04-01

    Full Text Available The features of the nucleotide sequences in both replication and promoter regions have been investigated in many organisms. Intrinsically bent DNA sites associated with transcription have been described in several prokaryotic organisms. The aim of the present study was to investigate intrinsic bent DNA sites in the segment that holds the chromosomal replication origin, oriC, of Xylella fastidiosa 9a5c. Electrophoretic behavior analyses, as well as in silico analyses of both the 2-D projection and helical parameters, were performed. The chromosomal segment analyzed contains the initial sequence of the rpmH gene, an intergenic region, the dnaA gene, the oriC sequence, and the 5' partial sequence of the dnaN gene. The analysis revealed fragments with reduced electrophoretic mobility, which indicates the presence of curved DNA segments. The analysis of the helical parameter ENDS ratio revealed three bent DNA sites (b1, b2, and b3 located in the rpmH-dnaA intergenic region, the dnaA gene, and the oriC 5' end, respectively. The chromosomal segment of X. fastidiosa analyzed here is rich in phased AT tracts and in CAnT motifs. The 2-D projection indicated a segment whose structure was determined by the cumulative effect of all bent DNA sites. Further, the in silico analysis of the three different bacterial oriC sequences indicated similar negative roll and twist >34.00° values. The DnaA box sequences, and other motifs in them, may be associated with the intrinsic DNA curvature.

  14. Size and Base Composition of RNA in Supercoiled Plasmid DNA

    Science.gov (United States)

    Williams, Peter H.; Boyer, Herbert W.; Helinski, Donald R.

    1973-01-01

    The average size and base composition of the covalently integrated RNA segment in supercoiled ColE1 DNA synthesized in Escherichia coli in the presence of chloramphenicol (CM-ColE1 DNA) have been determined by two independent methods. The two approaches yielded similar results, indicating that the RNA segment in CM-ColE1 DNA contains GMP at the 5′ end and comprises on the average 25 to 26 ribonucleotides with a base composition of 10-11 G, 3 A, 5-6 C, and 6-7 U. PMID:4359488

  15. Formulation and delivery of dermal DNA vaccines

    NARCIS (Netherlands)

    van den Berg, J.H.

    2009-01-01

    DNA vaccination is an appealing strategy of active vaccination, leading to the intracellular production of the encoding antigen which results in an efficient activation of an antigen specific immune response. Intradermal DNA tattooing was recently developed as a simple and robust method to induce

  16. Lectin cDNA and transgenic plants derived therefrom

    Science.gov (United States)

    Raikhel, Natasha V.

    2000-10-03

    Transgenic plants containing cDNA encoding Gramineae lectin are described. The plants preferably contain cDNA coding for barley lectin and store the lectin in the leaves. The transgenic plants, particularly the leaves exhibit insecticidal and fungicidal properties.

  17. A newly identified DNA ligase of Saccharomyces cerevisiae involved in RAD52-independent repair of DNA double-strand breaks

    Science.gov (United States)

    Schär, Primo; Herrmann, Gernot; Daly, Graham; Lindahl, Tomas

    1997-01-01

    Eukaryotic DNA ligases are ATP-dependent DNA strand-joining enzymes that participate in DNA replication, repair, and recombination. Whereas mammalian cells contain several different DNA ligases, encoded by at least three distinct genes, only one DNA ligase has been detected previously in either budding yeast or fission yeast. Here, we describe a newly identified nonessential Saccharomyces cerevisiae gene that encodes a DNA ligase distinct from the CDC9 gene product. This DNA ligase shares significant amino acid sequence homology with human DNA ligase IV; accordingly, we designate the yeast gene LIG4. Recombinant LIG4 protein forms a covalent enzyme-AMP complex and can join a DNA single-strand break in a DNA/RNA hybrid duplex, the preferred substrate in vitro. Disruption of the LIG4 gene causes only marginally increased cellular sensitivity to several DNA damaging agents, and does not further sensitize cdc9 or rad52 mutant cells. In contrast, lig4 mutant cells have a 1000-fold reduced capacity for correct recircularization of linearized plasmids by illegitimate end-joining after transformation. Moreover, homozygous lig4 mutant diploids sporulate less efficiently than isogenic wild-type cells, and show retarded progression through meiotic prophase I. Spore viability is normal, but lig4 mutants appear to produce a higher proportion of tetrads with only three viable spores. The mutant phenotypes are consistent with functions of LIG4 in an illegitimate DNA end-joining pathway and ensuring efficient meiosis. PMID:9271115

  18. Cloning and molecular characterization of the glyceraldehyde-3-phosphate dehydrogenase-encoding gene and cDNA from the plant pathogenic fungus Glomerella cingulata.

    Science.gov (United States)

    Templeton, M D; Rikkerink, E H; Solon, S L; Crowhurst, R N

    1992-12-01

    The glyceraldehyde-3-phosphate dehydrogenase gene (gpdA) has been identified from a genomic DNA library prepared from the plant pathogenic fungus Glomerella cingulata. Nucleotide sequence data revealed that this gene codes for a putative 338-amino-acid protein encoded by two exons of 129 and 885 bp, separated by an intron 216 bp long. The 5' leader sequence is also spliced by an intron of 156 bp. A cDNA clone was prepared using the polymerase chain reaction, the sequence of which was used to confirm the presence of the intron in the coding sequence and the splicing of the 5' leader sequence. The transcriptional start point (tsp) was mapped at -253 nt from the site of the initiation of translation by primer extension and is adjacent to a 42-bp pyrimidine-rich region. The general structure of the 5' flanking region shows similarities to gpdA from Aspergillus nidulans. The putative protein product is 71-86% identical at the aa level to GPDs from Aspergillus nidulans, Cryphonectria parasitica, Curvularia lunata, Podospora anserina and Ustilago maydis.

  19. Retroviral DNA Integration

    Science.gov (United States)

    2016-01-01

    The integration of a DNA copy of the viral RNA genome into host chromatin is the defining step of retroviral replication. This enzymatic process is catalyzed by the virus-encoded integrase protein, which is conserved among retroviruses and LTR-retrotransposons. Retroviral integration proceeds via two integrase activities: 3′-processing of the viral DNA ends, followed by the strand transfer of the processed ends into host cell chromosomal DNA. Herein we review the molecular mechanism of retroviral DNA integration, with an emphasis on reaction chemistries and architectures of the nucleoprotein complexes involved. We additionally discuss the latest advances on anti-integrase drug development for the treatment of AIDS and the utility of integrating retroviral vectors in gene therapy applications. PMID:27198982

  20. Hypermutability of CpG dinucleotides in the propeptide-encoding sequence of the human albumin gene

    International Nuclear Information System (INIS)

    Brennan, S.O.; Peach, R.; Myles, T.; George, P.; Arai, Kunio; Madison, J.; Watkins, S.; Putnam, F.W.; Laurell, C.B.; Galliano, M.

    1990-01-01

    An electrophoretically slow albumin variant was detected with a phenotype frequency of about 1:1,000 in Sweden and was also found in a family of Scottish descent from Kaikoura, New Zealand, and in five families in Tradate, Italy. Structural study established that the major variant component was arginyl-albumin, in which arginine at the -1 position of the propeptide is still attached to the processed albumin. A minor component with the amino-terminal sequence of proalbumin was also present as 3-6% of the total albumin. After amplification of the gene segment encoding the prepro sequence of albumin, specific hybridization of DNA to an oligonucleotide probe encoding cysteine at position -2 indicated the mutation of arginine at the -2 position to cysteine (-2 Arg → Cys). This produced the propeptide sequence Arg-Gly-Val-Phe-Cys-Arg. This was confirmed by sequence analysis after pyridylethylation of the cysteine. This mutation produces an alternate signal peptidase cleavage site in the variant proalbumin precursor of arginyl-albumin giving rise to two possible products, arginyl-albumin and the variant proalbumin. Another plasma from Bremen had an alloalbumin with a previously described substitution (1 Asp → Val), which also affects propeptide cleavage. Hypermutability of two CpG dinucleotides in the codons for the diarginyl sequence may account for the frequency of mutations in the propeptide. Mutation at these two sites results in a series of recurrent proalbumin variants that have arisen independently in diverse populations

  1. Molecular cloning and sequence analysis of complementary DNA encoding rat mammary gland medium-chain S-acyl fatty acid synthetase thio ester hydrolase

    International Nuclear Information System (INIS)

    Safford, R.; de Silva, J.; Lucas, C.

    1987-01-01

    Poly(A) + RNA from pregnant rat mammary glands was size-fractionated by sucrose gradient centrifugation, and fractions enriched in medium-chain S-acyl fatty acid synthetase thio ester hydrolase (MCH) were identified by in vitro translation and immunoprecipitation. A cDNA library was constructed, in pBR322, from enriched poly(A) + RNA and screened with two oligonucleotide probes deduced from rat MCH amino acid sequence data. Cross-hybridizing clones were isolated and found to contain cDNA inserts ranging from ∼ 1100 to 1550 base pairs (bp). A 1550-bp cDNA insert, from clone 43H09, was confirmed to encode MCH by hybrid-select translation/immunoprecipitation studies and by comparison of the amino acid sequence deduced from the DNA sequence of the clone to the amino acid sequence of the MCH peptides. Northern blot analysis revealed the size of the MCH mRNA to be 1500 nucleotides, and it is therefore concluded that the 1550-bp insert (including G x C tails) of clone 43H09 represents a full- or near-full-length copy of the MCH gene. The rat MCH sequence is the first reported sequence of a thioesterase from a mammalian source, but comparison of the deduced amino acid sequences of MCH and the recently published mallard duck medium-chain S-acyl fatty acid synthetase thioesterase reveals significant homology. In particular, a seven amino acid sequence containing the proposed active serine of the duck thioesterase is found to be perfectly conserved in rat MCH

  2. Plasmids encoding PKI(1-31), a specific inhibitor of cAMP-stimulated gene expression, inhibit the basal transcriptional activity of some but not all cAMP-regulated DNA response elements in JEG-3 cells.

    Science.gov (United States)

    Grove, J R; Deutsch, P J; Price, D J; Habener, J F; Avruch, J

    1989-11-25

    Plasmids that encode a bioactive amino-terminal fragment of the heat-stable inhibitor of the cAMP-dependent protein kinase, PKI(1-31), were employed to characterize the role of this protein kinase in the control of transcriptional activity mediated by three DNA regulatory elements in the JEG-3 human placental cell line. The 5'-flanking sequence of the human collagenase gene contains the heptameric sequence, 5'-TGAGTCA-3', previously identified as a "phorbol ester" response element. Reporter genes containing either the intact 1.2-kilobase 5'-flanking sequence from the human collagenase gene or just the 7-base pair (bp) response element, when coupled to an enhancerless promoter, each exhibit both cAMP and phorbol ester-stimulated expression in JEG-3 cells. Cotransfection of either construct with plasmids encoding PKI(1-31) inhibits cAMP-stimulated but not basal- or phorbol ester-stimulated expression. Pretreatment of cells with phorbol ester for 1 or 2 days abrogates completely the response to rechallenge with phorbol ester but does not alter the basal expression of either construct; cAMP-stimulated expression, while modestly inhibited, remains vigorous. The 5'-flanking sequence of the human chorionic gonadotropin-alpha subunit (HCG alpha) gene has two copies of the sequence, 5'-TGACGTCA-3', contained in directly adjacent identical 18-bp segments, previously identified as a cAMP-response element. Reporter genes containing either the intact 1.5 kilobase of 5'-flanking sequence from the HCG alpha gene, or just the 36-bp tandem repeat cAMP response element, when coupled to an enhancerless promoter, both exhibit a vigorous cAMP stimulation of expression but no response to phorbol ester in JEG-3 cells. Cotransfection with plasmids encoding PKI(1-31) inhibits both basal and cAMP-stimulated expression in a parallel fashion. The 5'-flanking sequence of the human enkephalin gene mediates cAMP-stimulated expression of reporter genes in both JEG-3 and CV-1 cells. Plasmids

  3. Automated breast segmentation in ultrasound computer tomography SAFT images

    Science.gov (United States)

    Hopp, T.; You, W.; Zapf, M.; Tan, W. Y.; Gemmeke, H.; Ruiter, N. V.

    2017-03-01

    Ultrasound Computer Tomography (USCT) is a promising new imaging system for breast cancer diagnosis. An essential step before further processing is to remove the water background from the reconstructed images. In this paper we present a fully-automated image segmentation method based on three-dimensional active contours. The active contour method is extended by applying gradient vector flow and encoding the USCT aperture characteristics as additional weighting terms. A surface detection algorithm based on a ray model is developed to initialize the active contour, which is iteratively deformed to capture the breast outline in USCT reflection images. The evaluation with synthetic data showed that the method is able to cope with noisy images, and is not influenced by the position of the breast and the presence of scattering objects within the breast. The proposed method was applied to 14 in-vivo images resulting in an average surface deviation from a manual segmentation of 2.7 mm. We conclude that automated segmentation of USCT reflection images is feasible and produces results comparable to a manual segmentation. By applying the proposed method, reproducible segmentation results can be obtained without manual interaction by an expert.

  4. Restricted diffusion of DNA segments within the isolated Escherichia coli nucleoid.

    NARCIS (Netherlands)

    Cunha, S.; Woldringh, C.L.; Odijk, T.

    2005-01-01

    To study the dynamics and organization of the DNA within isolated Escherichia coli nucleoids, we track the movement of a specific DNA region. Labeling of such a region is achieved using the Lac-O/Lac-I system. The Lac repressor-GFP fusion protein binds to the DNA section where tandem repeats of the

  5. Event segmentation improves event memory up to one month later.

    Science.gov (United States)

    Flores, Shaney; Bailey, Heather R; Eisenberg, Michelle L; Zacks, Jeffrey M

    2017-08-01

    When people observe everyday activity, they spontaneously parse it into discrete meaningful events. Individuals who segment activity in a more normative fashion show better subsequent memory for the events. If segmenting events effectively leads to better memory, does asking people to attend to segmentation improve subsequent memory? To answer this question, participants viewed movies of naturalistic activity with instructions to remember the activity for a later test, and in some conditions additionally pressed a button to segment the movies into meaningful events or performed a control condition that required button-pressing but not attending to segmentation. In 5 experiments, memory for the movies was assessed at intervals ranging from immediately following viewing to 1 month later. Performing the event segmentation task led to superior memory at delays ranging from 10 min to 1 month. Further, individual differences in segmentation ability predicted individual differences in memory performance for up to a month following encoding. This study provides the first evidence that manipulating event segmentation affects memory over long delays and that individual differences in event segmentation are related to differences in memory over long delays. These effects suggest that attending to how an activity breaks down into meaningful events contributes to memory formation. Instructing people to more effectively segment events may serve as a potential intervention to alleviate everyday memory complaints in aging and clinical populations. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  6. DNA Methylation Modulates Nociceptive Sensitization after Incision.

    Directory of Open Access Journals (Sweden)

    Yuan Sun

    Full Text Available DNA methylation is a key epigenetic mechanism controlling DNA accessibility and gene expression. Blockade of DNA methylation can significantly affect pain behaviors implicated in neuropathic and inflammatory pain. However, the role of DNA methylation with regard to postoperative pain has not yet been explored. In this study we sought to investigate the role of DNA methylation in modulating incisional pain and identify possible targets under DNA methylation and contributing to incisional pain. DNA methyltranferase (DNMT inhibitor 5-Aza-2'-deoxycytidine significantly reduced incision-induced mechanical allodynia and thermal sensitivity. Aza-2'-deoxycytidine also reduced hindpaw swelling after incision, suggesting an anti-inflammatory effect. Global DNA methylation and DNMT3b expression were increased in skin after incision, but none of DNMT1, DNMT3a or DNMT3b was altered in spinal cord or DRG. The expression of proopiomelanocortin Pomc encoding β-endorphin and Oprm1 encoding the mu-opioid receptor were upregulated peripherally after incision; moreover, Oprm1 expression was further increased under DNMT inhibitor treatment. Finally, local peripheral injection of the opioid receptor antagonist naloxone significantly exacerbated incision-induced mechanical hypersensitivity. These results suggest that DNA methylation is functionally relevant to incisional nociceptive sensitization, and that mu-opioid receptor signaling might be one methylation regulated pathway controlling sensitization after incision.

  7. Identification of a basic helix-loop-helix-type transcription regulator gene in Aspergillus oryzae by systematically deleting large chromosomal segments.

    Science.gov (United States)

    Jin, Feng Jie; Takahashi, Tadashi; Machida, Masayuki; Koyama, Yasuji

    2009-09-01

    We previously developed two methods (loop-out and replacement-type recombination) for generating large-scale chromosomal deletions that can be applied to more effective chromosomal engineering in Aspergillus oryzae. In this study, the replacement-type method is used to systematically delete large chromosomal DNA segments to identify essential and nonessential regions in chromosome 7 (2.93 Mb), which is the smallest A. oryzae chromosome and contains a large number of nonsyntenic blocks. We constructed 12 mutants harboring deletions that spanned 16- to 150-kb segments of chromosome 7 and scored phenotypic changes in the resulting mutants. Among the deletion mutants, strains designated Delta5 and Delta7 displayed clear phenotypic changes involving growth and conidiation. In particular, the Delta5 mutant exhibited vigorous growth and conidiation, potentially beneficial characteristics for certain industrial applications. Further deletion analysis allowed identification of the AO090011000215 gene as the gene responsible for the Delta5 mutant phenotype. The AO090011000215 gene was predicted to encode a helix-loop-helix binding protein belonging to the bHLH family of transcription factors. These results illustrate the potential of the approach for identifying novel functional genes.

  8. DNA Vaccine Electroporation and Molecular Adjuvants

    Science.gov (United States)

    2016-03-16

    Suschak and Schmaljohn DNA Vaccine Electroporation and Molecular Adjuvants 1 Abstract To date, there is no protective vaccine for Ebola virus...the formulation of DNA launched virus-like particles (VLP). In this case, the antigen is encoded in one DNA plasmid, while structural proteins are...Virol, 2010. 155(12): p. 2083-103. 2. Feldmann, H. and T.W. Geisbert, Ebola haemorrhagic fever. Lancet, 2011. 377(9768): p. 849-62. 3. Hart, M.K

  9. Alien DNA introgression and wheat DNA rearrangements in a stable wheat line derived from the early generation of distant hybridization.

    Science.gov (United States)

    Zhang, Lianquan; Liu, Dengcai; Yan, Zehong; Zheng, Youliang

    2005-10-01

    Polyploidy has been found to be common in plants. Bread or common wheat (Triticum aestivum L., 2n=42) is a good example of allopolyploid made up of three diploid genomes A, B and D. In recent years, by the study of mimicking the origination of common wheat, it was found that changes of DNA sequence and gene expression occurred at the early stages of artificial allohexaploid between tetraploid wheat and Aegilops tauschii, which was probably favorable to genetic diploidization of new synthetic hexaploid wheat. Common wheat 99L2 is a new line stable in genetic, which was derived from the early self-pollinated generation of wide hybrids between common wheat and rye. In this study, it was found that at least two rye DNA segments had been introgressed into 99L2. This result suggested that a mechanism of alien DNA introgression may exist, which was different from the traditional mechanism of chromosome pairing and DNA recombination between wheat and alien species. Meanwhile, during the introgression process of alien rye DNA segments, the changes in DNA sequences of wheat itself occurred.

  10. Base excision repair deficient mice lacking the Aag alkyladenine DNA glycosylase.

    NARCIS (Netherlands)

    B.P. Engelward (Bevin); G. Weeda (Geert); M.D. Wyatt; J.L.M. Broekhof (Jose'); J. de Wit (Jan); I. Donker (Ingrid); J.M. Allan (James); B. Gold (Bert); J.H.J. Hoeijmakers (Jan); L.D. Samson (Leona)

    1997-01-01

    textabstract3-methyladenine (3MeA) DNA glycosylases remove 3MeAs from alkylated DNA to initiate the base excision repair pathway. Here we report the generation of mice deficient in the 3MeA DNA glycosylase encoded by the Aag (Mpg) gene. Alkyladenine DNA glycosylase turns out to be the major DNA

  11. Actin and myosin contribute to mammalian mitochondrial DNA maintenance

    Science.gov (United States)

    Reyes, A.; He, J.; Mao, C. C.; Bailey, L. J.; Di Re, M.; Sembongi, H.; Kazak, L.; Dzionek, K.; Holmes, J. B.; Cluett, T. J.; Harbour, M. E.; Fearnley, I. M.; Crouch, R. J.; Conti, M. A.; Adelstein, R. S.; Walker, J. E.; Holt, I. J.

    2011-01-01

    Mitochondrial DNA maintenance and segregation are dependent on the actin cytoskeleton in budding yeast. We found two cytoskeletal proteins among six proteins tightly associated with rat liver mitochondrial DNA: non-muscle myosin heavy chain IIA and β-actin. In human cells, transient gene silencing of MYH9 (encoding non-muscle myosin heavy chain IIA), or the closely related MYH10 gene (encoding non-muscle myosin heavy chain IIB), altered the topology and increased the copy number of mitochondrial DNA; and the latter effect was enhanced when both genes were targeted simultaneously. In contrast, genetic ablation of non-muscle myosin IIB was associated with a 60% decrease in mitochondrial DNA copy number in mouse embryonic fibroblasts, compared to control cells. Gene silencing of β-actin also affected mitochondrial DNA copy number and organization. Protease-protection experiments and iodixanol gradient analysis suggest some β-actin and non-muscle myosin heavy chain IIA reside within human mitochondria and confirm that they are associated with mitochondrial DNA. Collectively, these results strongly implicate the actomyosin cytoskeleton in mammalian mitochondrial DNA maintenance. PMID:21398640

  12. Identification and Characterization of a Novel Hepta-Segmented dsRNA Virus From the Phytopathogenic Fungus Colletotrichum fructicola

    Directory of Open Access Journals (Sweden)

    Lifeng Zhai

    2018-04-01

    Full Text Available A novel hepta-segmented double-stranded RNA (dsRNA virus was isolated and characterized from the strain FJ-4 of the phytopathogenic fungus Colletotrichum fructicola, and was named Colletotrichum fructicola chrysovirus 1 (CfCV1. The full-length cDNAs of dsRNA1–7 were 3620, 2801, 2687, 2437, 1750, 1536, and 1211 bp, respectively. The 5′- and 3′-untranslated regions of the seven dsRNAs share highly similar internal sequence and contain conserved sequence stretches, indicating that they have a common virus origin. The 5′-and 3′-UTRs of the seven dsRNAs were predicted to fold into stable stem-loop structures. CfCV1 contains spherical virions that are 35 nm in diameter consisting of seven segments. The largest dsRNA of CfCV1 encodes an RNA-dependent RNA polymerase (RdRp, and the second dsRNA encodes a viral capsid protein (CP. The dsRNA5 encodes a C2H2-type zinc finger protein containing an R-rich region and a G-rich region. The smallest dsRNA is a satellite-like RNA. The functions of the other proteins encoded by dsRNA3, dsRNA4, dsRNA6 are unknown. Phylogenetic analysis, based on RdRp and CP, indicated that CfCV1 is phylogenetically related to Botryosphaeria dothidea chrysovirus 1 (BdCV1, and Penicillium janczewskii chrysovirus 2 (PjCV2, a cluster of an independent cluster II group in the family Chrysoviridae. Importantly, all the seven segments of CfCV1 were transmitted successfully to other virus-free strains with an all-or-none fashion. CfCV1 exerts minor influence on the growth of C. fructicola but can confer hypovirulence to the fungal host. To our knowledge, this is the first report of a hepta-segmented tentative chrysovirus in C. fructicola.

  13. Crystallization and preliminary X-ray crystallographic studies on the parD-encoded protein Kid from Escherichia coli plasmid R1

    NARCIS (Netherlands)

    Hargreaves, D.; Giraldo, R.; Santos-Sierra, S.; Boelens, R.; Rice, D.W.; Díaz Orejas, R.; Rafferty, J.B.

    2002-01-01

    DNA replication in Escherichia coli and therefore bacterial proliferation relies upon the efficient functioning of the DnaB helicase. The toxin protein Kid from the plasmid-stability system parD encoded on plasmid R1 of E. coli is thought to target and block DnaB-dependent DNA replication. The

  14. Cloning and sequencing of the cDNA encoding a core protein of the paired helical filament of Alzheimer's disease: Identification as the microtubule-associated protein tau

    International Nuclear Information System (INIS)

    Goedert, M.; Wischik, C.M.; Crowther, R.A.; Walker, J.E.; Klug, A.

    1988-01-01

    Screening of cDNA libraries prepared from the frontal cortex of an Alzheimer's disease patient and from fetal human brain has led to isolation of the cDNA for a core protein of the paired helical filament of Alzheimer's disease. The partial amino acid sequence of this core protein was used to design synthetic oligonucleotide probes. The cDNA encodes a protein of 352 amino acids that contains a characteristic amino acid repeat in its carboxyl-terminal half. This protein is highly homologous to the sequence of the mouse microtubule-associated protein tau and thus constitutes the human equivalent of mouse tau. RNA blot analysis indicates the presence of two major transcripts, 6 and 2 kilobases long, with a wide distribution in normal human brain. Tau protein mRNAs were found in normal amounts in the frontal cortex from patients with Alzheimer's disease. The proof that at least part of tau protein forms a component of the paired helical filament core opens the way to understanding the mode of formation of paired helical filaments and thus, ultimately, the pathogenesis of Alzheimer's disease

  15. Vibrio Phage KVP40 Encodes a Functional NAD+ Salvage Pathway.

    Science.gov (United States)

    Lee, Jae Yun; Li, Zhiqun; Miller, Eric S

    2017-05-01

    The genome of T4-type Vibrio bacteriophage KVP40 has five genes predicted to encode proteins of pyridine nucleotide metabolism, of which two, nadV and natV , would suffice for an NAD + salvage pathway. NadV is an apparent nicotinamide phosphoribosyltransferase (NAmPRTase), and NatV is an apparent bifunctional nicotinamide mononucleotide adenylyltransferase (NMNATase) and nicotinamide-adenine dinucleotide pyrophosphatase (Nudix hydrolase). Genes encoding the predicted salvage pathway were cloned and expressed in Escherichia coli , the proteins were purified, and their enzymatic properties were examined. KVP40 NadV NAmPRTase is active in vitro , and a clone complements a Salmonella mutant defective in both the bacterial de novo and salvage pathways. Similar to other NAmPRTases, the KVP40 enzyme displayed ATPase activity indicative of energy coupling in the reaction mechanism. The NatV NMNATase activity was measured in a coupled reaction system demonstrating NAD + biosynthesis from nicotinamide, phosphoribosyl pyrophosphate, and ATP. The NatV Nudix hydrolase domain was also shown to be active, with preferred substrates of ADP-ribose, NAD + , and NADH. Expression analysis using reverse transcription-quantitative PCR (qRT-PCR) and enzyme assays of infected Vibrio parahaemolyticus cells demonstrated nadV and natV transcription during the early and delayed-early periods of infection when other KVP40 genes of nucleotide precursor metabolism are expressed. The distribution and phylogeny of NadV and NatV proteins among several large double-stranded DNA (dsDNA) myophages, and also those from some very large siphophages, suggest broad relevance of pyridine nucleotide scavenging in virus-infected cells. NAD + biosynthesis presents another important metabolic resource control point by large, rapidly replicating dsDNA bacteriophages. IMPORTANCE T4-type bacteriophages enhance DNA precursor synthesis through reductive reactions that use NADH/NADPH as the electron donor and NAD

  16. Squeeze-SegNet: a new fast deep convolutional neural network for semantic segmentation

    Science.gov (United States)

    Nanfack, Geraldin; Elhassouny, Azeddine; Oulad Haj Thami, Rachid

    2018-04-01

    The recent researches in Deep Convolutional Neural Network have focused their attention on improving accuracy that provide significant advances. However, if they were limited to classification tasks, nowadays with contributions from Scientific Communities who are embarking in this field, they have become very useful in higher level tasks such as object detection and pixel-wise semantic segmentation. Thus, brilliant ideas in the field of semantic segmentation with deep learning have completed the state of the art of accuracy, however this architectures become very difficult to apply in embedded systems as is the case for autonomous driving. We present a new Deep fully Convolutional Neural Network for pixel-wise semantic segmentation which we call Squeeze-SegNet. The architecture is based on Encoder-Decoder style. We use a SqueezeNet-like encoder and a decoder formed by our proposed squeeze-decoder module and upsample layer using downsample indices like in SegNet and we add a deconvolution layer to provide final multi-channel feature map. On datasets like Camvid or City-states, our net gets SegNet-level accuracy with less than 10 times fewer parameters than SegNet.

  17. Centromeric DNA replication reconstitution reveals DNA loops and ATR checkpoint suppression.

    Science.gov (United States)

    Aze, Antoine; Sannino, Vincenzo; Soffientini, Paolo; Bachi, Angela; Costanzo, Vincenzo

    2016-06-01

    Half of the human genome is made up of repetitive DNA. However, mechanisms underlying replication of chromosome regions containing repetitive DNA are poorly understood. We reconstituted replication of defined human chromosome segments using bacterial artificial chromosomes in Xenopus laevis egg extract. Using this approach we characterized the chromatin assembly and replication dynamics of centromeric alpha-satellite DNA. Proteomic analysis of centromeric chromatin revealed replication-dependent enrichment of a network of DNA repair factors including the MSH2-6 complex, which was required for efficient centromeric DNA replication. However, contrary to expectations, the ATR-dependent checkpoint monitoring DNA replication fork arrest could not be activated on highly repetitive DNA due to the inability of the single-stranded DNA binding protein RPA to accumulate on chromatin. Electron microscopy of centromeric DNA and supercoil mapping revealed the presence of topoisomerase I-dependent DNA loops embedded in a protein matrix enriched for SMC2-4 proteins. This arrangement suppressed ATR signalling by preventing RPA hyper-loading, facilitating replication of centromeric DNA. These findings have important implications for our understanding of repetitive DNA metabolism and centromere organization under normal and stressful conditions.

  18. Selecting one of several mating types through gene segment joining and deletion in Tetrahymena thermophila.

    Directory of Open Access Journals (Sweden)

    Marcella D Cervantes

    Full Text Available The unicellular eukaryote Tetrahymena thermophila has seven mating types. Cells can mate only when they recognize cells of a different mating type as non-self. As a ciliate, Tetrahymena separates its germline and soma into two nuclei. During growth the somatic nucleus is responsible for all gene transcription while the germline nucleus remains silent. During mating, a new somatic nucleus is differentiated from a germline nucleus and mating type is decided by a stochastic process. We report here that the somatic mating type locus contains a pair of genes arranged head-to-head. Each gene encodes a mating type-specific segment and a transmembrane domain that is shared by all mating types. Somatic gene knockouts showed both genes are required for efficient non-self recognition and successful mating, as assessed by pair formation and progeny production. The germline mating type locus consists of a tandem array of incomplete gene pairs representing each potential mating type. During mating, a complete new gene pair is assembled at the somatic mating type locus; the incomplete genes of one gene pair are completed by joining to gene segments at each end of germline array. All other germline gene pairs are deleted in the process. These programmed DNA rearrangements make this a fascinating system of mating type determination.

  19. DNA Encoding Training Using 3D Gesture Interaction.

    Science.gov (United States)

    Nicola, Stelian; Handrea, Flavia-Laura; Crişan-Vida, Mihaela; Stoicu-Tivadar, Lăcrămioara

    2017-01-01

    The work described in this paper summarizes the development process and presents the results of a human genetics training application, studying the 20 amino acids formed by the combination of the 3 nucleotides of DNA targeting mainly medical and bioinformatics students. Currently, the domain applications using recognized human gestures of the Leap Motion sensor are used in molecules controlling and learning from Mendeleev table or in visualizing the animated reactions of specific molecules with water. The novelty in the current application consists in using the Leap Motion sensor creating new gestures for the application control and creating a tag based algorithm corresponding to each amino acid, depending on the position in the 3D virtual space of the 4 nucleotides of DNA and their type. The team proposes a 3D application based on Unity editor and on Leap Motion sensor where the user has the liberty of forming different combinations of the 20 amino acids. The results confirm that this new type of study of medicine/biochemistry using the Leap Motion sensor for handling amino acids is suitable for students. The application is original and interactive and the users can create their own amino acid structures in a 3D-like environment which they could not do otherwise using traditional pen-and-paper.

  20. Multiresolution analysis applied to text-independent phone segmentation

    International Nuclear Information System (INIS)

    Cherniz, AnalIa S; Torres, MarIa E; Rufiner, Hugo L; Esposito, Anna

    2007-01-01

    Automatic speech segmentation is of fundamental importance in different speech applications. The most common implementations are based on hidden Markov models. They use a statistical modelling of the phonetic units to align the data along a known transcription. This is an expensive and time-consuming process, because of the huge amount of data needed to train the system. Text-independent speech segmentation procedures have been developed to overcome some of these problems. These methods detect transitions in the evolution of the time-varying features that represent the speech signal. Speech representation plays a central role is the segmentation task. In this work, two new speech parameterizations based on the continuous multiresolution entropy, using Shannon entropy, and the continuous multiresolution divergence, using Kullback-Leibler distance, are proposed. These approaches have been compared with the classical Melbank parameterization. The proposed encodings increase significantly the segmentation performance. Parameterization based on the continuous multiresolution divergence shows the best results, increasing the number of correctly detected boundaries and decreasing the amount of erroneously inserted points. This suggests that the parameterization based on multiresolution information measures provide information related to acoustic features that take into account phonemic transitions

  1. Identification of cDNA encoding an additional α subunit of a human GTP-binding protein: Expression of three αi subtypes in human tissues and cell lines

    International Nuclear Information System (INIS)

    Kim, S.; Ang, S.L.; Bloch, D.B.; Bloch, K.D.; Kawahara, Y.; Tolman, C.; Lee, R.; Seidman, J.G.; Neer, E.J.

    1988-01-01

    The guanine nucleotide-binding proteins (G proteins), which mediate hormonal regulation of many membrane functions, are composed of α, β, and γ subunits. The authors have cloned and characterized cDNA from a human T-cell library encoding a form of α i that is different from the human α i subtypes previously reported. α i is the α subunit of a class of G proteins that inhibits adenylate cyclase and regulates other enzymes and ion channels. This cDNA encodes a polypeptide of 354 amino acids and is assigned to encode the α i-3 subtype of G proteins on the basis of its similarity to other α i -like cDNAs and the presence of a predicted site for ADP ribosylation by pertussis toxin. They have determined the expression of mRNA for this and two other subtypes of human α i (α i-1 and α i-2 ) in a variety of human fetal tissues and in human cell lines. All three α i subtypes were present in the tissues tested. However, analysis of individual cell types reveals specificity of α i-1 expression. mRNA for α i-1 is absent in T cells, B cells, and monocytes but is present in other cell lines. The finding of differential expression of α i-1 genes may permit characterization of distinct physiological roles for this α i subunit. mRNA for α i-2 and α i-3 was found in all the primary and transformed cell lines tested. Thus, some cells contain all three α i subtypes. This observation raises the question of how cells prevent cross talk among receptors that are coupled to effectors through such similar α proteins

  2. An encoding device and a method of encoding

    DEFF Research Database (Denmark)

    2012-01-01

    The present invention relates to an encoding device, such as an optical position encoder, for encoding input from an object, and a method for encoding input from an object, for determining a position of an object that interferes with light of the device. The encoding device comprises a light source...... in the area in the space and may interfere with the light, which interference may be encoded into a position or activation....

  3. DNA Vaccine Encoding the Chimeric Form of Schistosoma mansoni Sm-TSP2 and Sm29 Confers Partial Protection against Challenge Infection.

    Directory of Open Access Journals (Sweden)

    Natan Raimundo Gonçalves de Assis

    Full Text Available Schistosomiasis is an important parasitic disease worldwide that affects more than 207 million people in 76 countries and causes approximately 250,000 deaths per year. The best long-term strategy to control schistosomiasis is through immunization combined with drug treatment. Due to the ability of DNA vaccines to generate humoral and cellular immune responses, such vaccines are considered a promising approach against schistosomiasis. Sm29 and tetraspanin-2 (Sm-TSP2 are two proteins that are located in the S. mansoni tegument of adult worms and schistosomula and induce high levels of protection through recombinant protein immunization. In this study, we transfected BHK-21 cells with plasmids encoding Sm29, Sm-TSP2 or a chimera containing both genes. Using RT-PCR analysis and western blot, we confirmed that the DNA vaccine constructs were transcribed and translated, respectively, in BHK-21 cells. After immunization of mice, we evaluated the reduction in worm burden. We observed worm burden reductions of 17-22%, 22%, 31-32% and 24-32% in animals immunized with the pUMVC3/Sm29, pUMVC3/SmTSP-2, pUMVC3/Chimera and pUMVC3/Sm29 + pUMVC3/SmTSP-2 plasmids, respectively. We evaluated the humoral response elicited by DNA vaccines, and animals immunized with pUMVC3/Sm29 and pUMVC3/Sm29 + pUMVC3/SmTSP-2 showed higher titers of anti-Sm29 antibodies. The cytokine profile produced by the spleen cells of immunized mice was then evaluated. We observed higher production of Th1 cytokines, such as TNF-α and IFN-γ, in vaccinated mice and no significant production of IL-4 and IL-5. The DNA vaccines tested in this study showed the ability to generate a protective immune response against schistosomiasis, probably through the production of Th1 cytokines. However, future strategies aiming to optimize the protective response induced by a chimeric DNA construct need to be developed.

  4. DNA Vaccine Encoding the Chimeric Form of Schistosoma mansoni Sm-TSP2 and Sm29 Confers Partial Protection against Challenge Infection

    Science.gov (United States)

    Gonçalves de Assis, Natan Raimundo; Batistoni de Morais, Suellen; Figueiredo, Bárbara Castro Pimentel; Ricci, Natasha Delaqua; de Almeida, Leonardo Augusto; da Silva Pinheiro, Carina; Martins, Vicente de Paulo; Oliveira, Sergio Costa

    2015-01-01

    Schistosomiasis is an important parasitic disease worldwide that affects more than 207 million people in 76 countries and causes approximately 250,000 deaths per year. The best long-term strategy to control schistosomiasis is through immunization combined with drug treatment. Due to the ability of DNA vaccines to generate humoral and cellular immune responses, such vaccines are considered a promising approach against schistosomiasis. Sm29 and tetraspanin-2 (Sm-TSP2) are two proteins that are located in the S. mansoni tegument of adult worms and schistosomula and induce high levels of protection through recombinant protein immunization. In this study, we transfected BHK-21 cells with plasmids encoding Sm29, Sm-TSP2 or a chimera containing both genes. Using RT-PCR analysis and western blot, we confirmed that the DNA vaccine constructs were transcribed and translated, respectively, in BHK-21 cells. After immunization of mice, we evaluated the reduction in worm burden. We observed worm burden reductions of 17-22%, 22%, 31-32% and 24-32% in animals immunized with the pUMVC3/Sm29, pUMVC3/SmTSP-2, pUMVC3/Chimera and pUMVC3/Sm29 + pUMVC3/SmTSP-2 plasmids, respectively. We evaluated the humoral response elicited by DNA vaccines, and animals immunized with pUMVC3/Sm29 and pUMVC3/Sm29 + pUMVC3/SmTSP-2 showed higher titers of anti-Sm29 antibodies. The cytokine profile produced by the spleen cells of immunized mice was then evaluated. We observed higher production of Th1 cytokines, such as TNF-α and IFN-γ, in vaccinated mice and no significant production of IL-4 and IL-5. The DNA vaccines tested in this study showed the ability to generate a protective immune response against schistosomiasis, probably through the production of Th1 cytokines. However, future strategies aiming to optimize the protective response induced by a chimeric DNA construct need to be developed. PMID:25942636

  5. Exploratory analysis of genomic segmentations with Segtools

    Directory of Open Access Journals (Sweden)

    Buske Orion J

    2011-10-01

    Full Text Available Abstract Background As genome-wide experiments and annotations become more prevalent, researchers increasingly require tools to help interpret data at this scale. Many functional genomics experiments involve partitioning the genome into labeled segments, such that segments sharing the same label exhibit one or more biochemical or functional traits. For example, a collection of ChlP-seq experiments yields a compendium of peaks, each labeled with one or more associated DNA-binding proteins. Similarly, manually or automatically generated annotations of functional genomic elements, including cis-regulatory modules and protein-coding or RNA genes, can also be summarized as genomic segmentations. Results We present a software toolkit called Segtools that simplifies and automates the exploration of genomic segmentations. The software operates as a series of interacting tools, each of which provides one mode of summarization. These various tools can be pipelined and summarized in a single HTML page. We describe the Segtools toolkit and demonstrate its use in interpreting a collection of human histone modification data sets and Plasmodium falciparum local chromatin structure data sets. Conclusions Segtools provides a convenient, powerful means of interpreting a genomic segmentation.

  6. Submicrometre geometrically encoded fluorescent barcodes self-assembled from DNA

    Science.gov (United States)

    Lin, Chenxiang; Jungmann, Ralf; Leifer, Andrew M.; Li, Chao; Levner, Daniel; Church, George M.; Shih, William M.; Yin, Peng

    2012-10-01

    The identification and differentiation of a large number of distinct molecular species with high temporal and spatial resolution is a major challenge in biomedical science. Fluorescence microscopy is a powerful tool, but its multiplexing ability is limited by the number of spectrally distinguishable fluorophores. Here, we used (deoxy)ribonucleic acid (DNA)-origami technology to construct submicrometre nanorods that act as fluorescent barcodes. We demonstrate that spatial control over the positioning of fluorophores on the surface of a stiff DNA nanorod can produce 216 distinct barcodes that can be decoded unambiguously using epifluorescence or total internal reflection fluorescence microscopy. Barcodes with higher spatial information density were demonstrated via the construction of super-resolution barcodes with features spaced by ˜40 nm. One species of the barcodes was used to tag yeast surface receptors, which suggests their potential applications as in situ imaging probes for diverse biomolecular and cellular entities in their native environments.

  7. Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli

    DEFF Research Database (Denmark)

    Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne

    1995-01-01

    The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...

  8. DNA repair methyltransferase (Mgmt) knockout mice are sensitive to the lethal effects of chemotherapeutic alkylating agents.

    NARCIS (Netherlands)

    B.J. Glassner (Brian); G. Weeda (Geert); J.M. Allan (James); J.L.M. Broekhof (Jose'); N.H.E. Carls (Nick); I. Donker (Ingrid); B.P. Engelward (Bevin); R.J. Hampson (Richard); R. Hersmus (Remko); M.J. Hickman (Mark); R.B. Roth (Richard); H.B. Warren (Henry); M.M. Wu (Mavis); J.H.J. Hoeijmakers (Jan); L.D. Samson (Leona)

    1999-01-01

    textabstractWe have generated mice deficient in O6-methylguanine DNA methyltransferase activity encoded by the murine Mgmt gene using homologous recombination to delete the region encoding the Mgmt active site cysteine. Tissues from Mgmt null mice displayed very low O6-methylguanine DNA

  9. Intranasal delivery of cationic PLGA nano/microparticles-loaded FMDV DNA vaccine encoding IL-6 elicited protective immunity against FMDV challenge.

    Directory of Open Access Journals (Sweden)

    Gang Wang

    Full Text Available Mucosal vaccination has been demonstrated to be an effective means of eliciting protective immunity against aerosol infections of foot and mouth disease virus (FMDV and various approaches have been used to improve mucosal response to this pathogen. In this study, cationic PLGA (poly(lactide-co-glycolide nano/microparticles were used as an intranasal delivery vehicle as a means administering FMDV DNA vaccine encoding the FMDV capsid protein and the bovine IL-6 gene as a means of enhancing mucosal and systemic immune responses in animals. Three eukaryotic expression plasmids with or without bovine IL-6 gene (pc-P12A3C, pc-IL2AP12A3C and pc-P12AIL3C were generated. The two latter plasmids were designed with the IL-6 gene located either before or between the P12A and 3C genes, respectively, as a means of determining if the location of the IL-6 gene affected capsid assembly and the subsequent immune response. Guinea pigs and rats were intranasally vaccinated with the respective chitosan-coated PLGA nano/microparticles-loaded FMDV DNA vaccine formulations. Animals immunized with pc-P12AIL3C (followed by animals vaccinated with pc-P12A3C and pc-IL2AP12A3C developed the highest levels of antigen-specific serum IgG and IgA antibody responses and the highest levels of sIgA (secretory IgA present in mucosal tissues. However, the highest levels of neutralizing antibodies were generated in pc-IL2AP12A3C-immunized animals (followed by pc-P12AIL3C- and then in pc-P12A3C-immunized animals. pc-IL2AP12A3C-immunized animals also developed stronger cell mediated immune responses (followed by pc-P12AIL3C- and pc-P12A3C-immunized animals as evidenced by antigen-specific T-cell proliferation and expression levels of IFN-γ by both CD4+ and CD8+ splenic T cells. The percentage of animals protected against FMDV challenge following immunizations with pc-IL2AP12A3C, pc-P12AIL3C or pc-P12A3C were 3/5, 1/5 and 0/5, respectively. These data suggested that intranasal delivery

  10. Length quantization of DNA partially expelled from heads of a bacteriophage T3 mutant

    Energy Technology Data Exchange (ETDEWEB)

    Serwer, Philip, E-mail: serwer@uthscsa.edu [Department of Biochemistry, The University of Texas Health Science Center, 7703 Floyd Curl Drive, San Antonio, TX 78229-3900 (United States); Wright, Elena T. [Department of Biochemistry, The University of Texas Health Science Center, 7703 Floyd Curl Drive, San Antonio, TX 78229-3900 (United States); Liu, Zheng; Jiang, Wen [Markey Center for Structural Biology, Department of Biological Sciences, Purdue University, West Lafayette, IN 47907 (United States)

    2014-05-15

    DNA packaging of phages phi29, T3 and T7 sometimes produces incompletely packaged DNA with quantized lengths, based on gel electrophoretic band formation. We discover here a packaging ATPase-free, in vitro model for packaged DNA length quantization. We use directed evolution to isolate a five-site T3 point mutant that hyper-produces tail-free capsids with mature DNA (heads). Three tail gene mutations, but no head gene mutations, are present. A variable-length DNA segment leaks from some mutant heads, based on DNase I-protection assay and electron microscopy. The protected DNA segment has quantized lengths, based on restriction endonuclease analysis: six sharp bands of DNA missing 3.7–12.3% of the last end packaged. Native gel electrophoresis confirms quantized DNA expulsion and, after removal of external DNA, provides evidence that capsid radius is the quantization-ruler. Capsid-based DNA length quantization possibly evolved via selection for stalling that provides time for feedback control during DNA packaging and injection. - Graphical abstract: Highlights: • We implement directed evolution- and DNA-sequencing-based phage assembly genetics. • We purify stable, mutant phage heads with a partially leaked mature DNA molecule. • Native gels and DNase-protection show leaked DNA segments to have quantized lengths. • Native gels after DNase I-removal of leaked DNA reveal the capsids to vary in radius. • Thus, we hypothesize leaked DNA quantization via variably quantized capsid radius.

  11. The replicative DNA polymerase of herpes simplex virus 1 exhibits apurinic/apyrimidinic and 5′-deoxyribose phosphate lyase activities

    OpenAIRE

    Bogani, Federica; Boehmer, Paul E.

    2008-01-01

    Base excision repair (BER) is essential for maintaining genome stability both to counter the accumulation of unusual bases and to protect from base loss in the DNA. Herpes simplex virus 1 (HSV-1) is a large dsDNA virus that encodes its own DNA replication machinery, including enzymes involved in nucleotide metabolism. We report on a replicative family B and a herpesvirus-encoded DNA Pol that possesses DNA lyase activity. We have discovered that the catalytic subunit of the HSV-1 DNA polymeras...

  12. DNA replication stress restricts ribosomal DNA copy number.

    Science.gov (United States)

    Salim, Devika; Bradford, William D; Freeland, Amy; Cady, Gillian; Wang, Jianmin; Pruitt, Steven C; Gerton, Jennifer L

    2017-09-01

    Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.

  13. DNA replication stress restricts ribosomal DNA copy number

    Science.gov (United States)

    Salim, Devika; Bradford, William D.; Freeland, Amy; Cady, Gillian; Wang, Jianmin

    2017-01-01

    Ribosomal RNAs (rRNAs) in budding yeast are encoded by ~100–200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA) locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how “normal” copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2)-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a “normal” rDNA copy number. PMID:28915237

  14. DNA replication stress restricts ribosomal DNA copy number.

    Directory of Open Access Journals (Sweden)

    Devika Salim

    2017-09-01

    Full Text Available Ribosomal RNAs (rRNAs in budding yeast are encoded by ~100-200 repeats of a 9.1kb sequence arranged in tandem on chromosome XII, the ribosomal DNA (rDNA locus. Copy number of rDNA repeat units in eukaryotic cells is maintained far in excess of the requirement for ribosome biogenesis. Despite the importance of the repeats for both ribosomal and non-ribosomal functions, it is currently not known how "normal" copy number is determined or maintained. To identify essential genes involved in the maintenance of rDNA copy number, we developed a droplet digital PCR based assay to measure rDNA copy number in yeast and used it to screen a yeast conditional temperature-sensitive mutant collection of essential genes. Our screen revealed that low rDNA copy number is associated with compromised DNA replication. Further, subculturing yeast under two separate conditions of DNA replication stress selected for a contraction of the rDNA array independent of the replication fork blocking protein, Fob1. Interestingly, cells with a contracted array grew better than their counterparts with normal copy number under conditions of DNA replication stress. Our data indicate that DNA replication stresses select for a smaller rDNA array. We speculate that this liberates scarce replication factors for use by the rest of the genome, which in turn helps cells complete DNA replication and continue to propagate. Interestingly, tumors from mini chromosome maintenance 2 (MCM2-deficient mice also show a loss of rDNA repeats. Our data suggest that a reduction in rDNA copy number may indicate a history of DNA replication stress, and that rDNA array size could serve as a diagnostic marker for replication stress. Taken together, these data begin to suggest the selective pressures that combine to yield a "normal" rDNA copy number.

  15. Preclinical and clinical safety studies on DNA vaccines.

    NARCIS (Netherlands)

    Schalk, Johanna A C; Mooi, Frits R; Berbers, Guy A M; Aerts, Leon A G J M van; Ovelgönne, Hans; Kimman, Tjeerd G

    2007-01-01

    DNA vaccines are based on the transfer of genetic material, encoding an antigen, to the cells of the vaccine recipient. Despite high expectations of DNA vaccines as a result of promising preclinical data their clinical utility remains unproven. However, much data is gathered in preclinical and

  16. Somatic DNA recombination yielding circular DNA and deletion of a genomic region in embryonic brain

    International Nuclear Information System (INIS)

    Maeda, Toyoki; Chijiiwa, Yoshiharu; Tsuji, Hideo; Sakoda, Saburo; Tani, Kenzaburo; Suzuki, Tomokazu

    2004-01-01

    In this study, a mouse genomic region is identified that undergoes DNA rearrangement and yields circular DNA in brain during embryogenesis. External region-directed inverse polymerase chain reaction on circular DNA extracted from late embryonic brain tissue repeatedly detected DNA of this region containing recombination joints. Wide-range genomic PCR and digestion-circularization PCR analysis showed this region underwent recombination accompanied with deletion of intervening sequences, including the circularized regions. This region was mapped by fluorescence in situ hybridization to C1 on mouse chromosome 16, where no gene and no physiological DNA rearrangement had been identified. DNA sequence in the region has segmental homology to an orthologous region on human chromosome 3q.13. These observations demonstrated somatic DNA recombination yielding genomic deletions in brain during embryogenesis

  17. Automated segmentation of blood-flow regions in large thoracic arteries using 3D-cine PC-MRI measurements.

    Science.gov (United States)

    van Pelt, Roy; Nguyen, Huy; ter Haar Romeny, Bart; Vilanova, Anna

    2012-03-01

    Quantitative analysis of vascular blood flow, acquired by phase-contrast MRI, requires accurate segmentation of the vessel lumen. In clinical practice, 2D-cine velocity-encoded slices are inspected, and the lumen is segmented manually. However, segmentation of time-resolved volumetric blood-flow measurements is a tedious and time-consuming task requiring automation. Automated segmentation of large thoracic arteries, based solely on the 3D-cine phase-contrast MRI (PC-MRI) blood-flow data, was done. An active surface model, which is fast and topologically stable, was used. The active surface model requires an initial surface, approximating the desired segmentation. A method to generate this surface was developed based on a voxel-wise temporal maximum of blood-flow velocities. The active surface model balances forces, based on the surface structure and image features derived from the blood-flow data. The segmentation results were validated using volunteer studies, including time-resolved 3D and 2D blood-flow data. The segmented surface was intersected with a velocity-encoded PC-MRI slice, resulting in a cross-sectional contour of the lumen. These cross-sections were compared to reference contours that were manually delineated on high-resolution 2D-cine slices. The automated approach closely approximates the manual blood-flow segmentations, with error distances on the order of the voxel size. The initial surface provides a close approximation of the desired luminal geometry. This improves the convergence time of the active surface and facilitates parametrization. An active surface approach for vessel lumen segmentation was developed, suitable for quantitative analysis of 3D-cine PC-MRI blood-flow data. As opposed to prior thresholding and level-set approaches, the active surface model is topologically stable. A method to generate an initial approximate surface was developed, and various features that influence the segmentation model were evaluated. The active surface

  18. Variability and repertoire size of T-cell receptor V alpha gene segments.

    Science.gov (United States)

    Becker, D M; Pattern, P; Chien, Y; Yokota, T; Eshhar, Z; Giedlin, M; Gascoigne, N R; Goodnow, C; Wolf, R; Arai, K

    The immune system of higher organisms is composed largely of two distinct cell types, B lymphocytes and T lymphocytes, each of which is independently capable of recognizing an enormous number of distinct entities through their antigen receptors; surface immunoglobulin in the case of the former, and the T-cell receptor (TCR) in the case of the latter. In both cell types, the genes encoding the antigen receptors consist of multiple gene segments which recombine during maturation to produce many possible peptides. One striking difference between B- and T-cell recognition that has not yet been resolved by the structural data is the fact that T cells generally require a major histocompatibility determinant together with an antigen whereas, in most cases, antibodies recognize antigen alone. Recently, we and others have found that a series of TCR V beta gene sequences show conservation of many of the same residues that are conserved between heavy- and light-chain immunoglobulin V regions, and these V beta sequences are predicted to have an immunoglobulin-like secondary structure. To extend these studies, we have isolated and sequenced eight additional alpha-chain complementary cDNA clones and compared them with published sequences. Analyses of these sequences, reported here, indicate that V alpha regions have many of the characteristics of V beta gene segments but differ in that they almost always occur as cross-hybridizing gene families. We conclude that there may be very different selective pressures operating on V alpha and V beta sequences and that the V alpha repertoire may be considerably larger than that of V beta.

  19. A deep learning method for lincRNA detection using auto-encoder algorithm.

    Science.gov (United States)

    Yu, Ning; Yu, Zeng; Pan, Yi

    2017-12-06

    RNA sequencing technique (RNA-seq) enables scientists to develop novel data-driven methods for discovering more unidentified lincRNAs. Meantime, knowledge-based technologies are experiencing a potential revolution ignited by the new deep learning methods. By scanning the newly found data set from RNA-seq, scientists have found that: (1) the expression of lincRNAs appears to be regulated, that is, the relevance exists along the DNA sequences; (2) lincRNAs contain some conversed patterns/motifs tethered together by non-conserved regions. The two evidences give the reasoning for adopting knowledge-based deep learning methods in lincRNA detection. Similar to coding region transcription, non-coding regions are split at transcriptional sites. However, regulatory RNAs rather than message RNAs are generated. That is, the transcribed RNAs participate the biological process as regulatory units instead of generating proteins. Identifying these transcriptional regions from non-coding regions is the first step towards lincRNA recognition. The auto-encoder method achieves 100% and 92.4% prediction accuracy on transcription sites over the putative data sets. The experimental results also show the excellent performance of predictive deep neural network on the lincRNA data sets compared with support vector machine and traditional neural network. In addition, it is validated through the newly discovered lincRNA data set and one unreported transcription site is found by feeding the whole annotated sequences through the deep learning machine, which indicates that deep learning method has the extensive ability for lincRNA prediction. The transcriptional sequences of lincRNAs are collected from the annotated human DNA genome data. Subsequently, a two-layer deep neural network is developed for the lincRNA detection, which adopts the auto-encoder algorithm and utilizes different encoding schemes to obtain the best performance over intergenic DNA sequence data. Driven by those newly

  20. Mitochondrially-Encoded Adenosine Triphosphate Synthase 6 Gene Haplotype Variation among World Population during 2003-2013

    OpenAIRE

    Steven Steven; Yoni F Syukriani; Julius B Dewanto

    2016-01-01

    Background: Adaptation and natural selection serve as an important part of evolution. Adaptation in molecular level can lead to genetic drift which causes mutation of genetic material; one of which is polymorphism of mitochondrial DNA (mtDNA). The aim of this study is to verify the polymorphism of mitochondrially-encoded Adenosine Triphosphate synthase6gene (MT-ATP6) as one of mtDNA building blocks among tropic, sub-tropic, and polar areas. Methods: This descriptive quantitative research used...

  1. Human Chromosome 7: DNA Sequence and Biology

    OpenAIRE

    Scherer, Stephen W.; Cheung, Joseph; MacDonald, Jeffrey R.; Osborne, Lucy R.; Nakabayashi, Kazuhiko; Herbrick, Jo-Anne; Carson, Andrew R.; Parker-Katiraee, Layla; Skaug, Jennifer; Khaja, Razi; Zhang, Junjun; Hudek, Alexander K.; Li, Martin; Haddad, May; Duggan, Gavin E.

    2003-01-01

    DNA sequence and annotation of the entire human chromosome 7, encompassing nearly 158 million nucleotides of DNA and 1917 gene structures, are presented. To generate a higher order description, additional structural features such as imprinted genes, fragile sites, and segmental duplications were integrated at the level of the DNA sequence with medical genetic data, including 440 chromosome rearrangement breakpoints associated with disease. This approach enabled the discovery of candidate gene...

  2. The cDNA sequence of a neutral horseradish peroxidase.

    Science.gov (United States)

    Bartonek-Roxå, E; Eriksson, H; Mattiasson, B

    1991-02-16

    A cDNA clone encoding a horseradish (Armoracia rusticana) peroxidase has been isolated and characterized. The cDNA contains 1378 nucleotides excluding the poly(A) tail and the deduced protein contains 327 amino acids which includes a 28 amino acid leader sequence. The predicted amino acid sequence is nine amino acids shorter than the major isoenzyme belonging to the horseradish peroxidase C group (HRP-C) and the sequence shows 53.7% identity with this isoenzyme. The described clone encodes nine cysteines of which eight correspond well with the cysteines found in HRP-C. Five potential N-glycosylation sites with the general sequence Asn-X-Thr/Ser are present in the deduced sequence. Compared to the earlier described HRP-C this is three glycosylation sites less. The shorter sequence and fewer N-glycosylation sites give the native isoenzyme a molecular weight of several thousands less than the horseradish peroxidase C isoenzymes. Comparison with the net charge value of HRP-C indicates that the described cDNA clone encodes a peroxidase which has either the same or a slightly less basic pI value, depending on whether the encoded protein is N-terminally blocked or not. This excludes the possibility that HRP-n could belong to either the HRP-A, -D or -E groups. The low sequence identity (53.7%) with HRP-C indicates that the described clone does not belong to the HRP-C isoenzyme group and comparison of the total amino acid composition with the HRP-B group does not place the described clone within this isoenzyme group. Our conclusion is that the described cDNA clone encodes a neutral horseradish peroxidase which belongs to a new, not earlier described, horseradish peroxidase group.

  3. A Run-Length Encoding Approach for Path Analysis of C. elegans Search Behavior

    Directory of Open Access Journals (Sweden)

    Li Huang

    2016-01-01

    Full Text Available The nematode Caenorhabditis elegans explores the environment using a combination of different movement patterns, which include straight movement, reversal, and turns. We propose to quantify C. elegans movement behavior using a computer vision approach based on run-length encoding of step-length data. In this approach, the path of C. elegans is encoded as a string of characters, where each character represents a path segment of a specific type of movement. With these encoded string data, we perform k-means cluster analysis to distinguish movement behaviors resulting from different genotypes and food availability. We found that shallow and sharp turns are the most critical factors in distinguishing the differences among the movement behaviors. To validate our approach, we examined the movement behavior of tph-1 mutants that lack an enzyme responsible for serotonin biosynthesis. A k-means cluster analysis with the path string-encoded data showed that tph-1 movement behavior on food is similar to that of wild-type animals off food. We suggest that this run-length encoding approach is applicable to trajectory data in animal or human mobility data.

  4. The ANGULATA7 gene encodes a DnaJ-like zinc finger-domain protein involved in chloroplast function and leaf development in Arabidopsis.

    Science.gov (United States)

    Muñoz-Nortes, Tamara; Pérez-Pérez, José Manuel; Ponce, María Rosa; Candela, Héctor; Micol, José Luis

    2017-03-01

    The characterization of mutants with altered leaf shape and pigmentation has previously allowed the identification of nuclear genes that encode plastid-localized proteins that perform essential functions in leaf growth and development. A large-scale screen previously allowed us to isolate ethyl methanesulfonate-induced mutants with small rosettes and pale green leaves with prominent marginal teeth, which were assigned to a phenotypic class that we dubbed Angulata. The molecular characterization of the 12 genes assigned to this phenotypic class should help us to advance our understanding of the still poorly understood relationship between chloroplast biogenesis and leaf morphogenesis. In this article, we report the phenotypic and molecular characterization of the angulata7-1 (anu7-1) mutant of Arabidopsis thaliana, which we found to be a hypomorphic allele of the EMB2737 gene, which was previously known only for its embryonic-lethal mutations. ANU7 encodes a plant-specific protein that contains a domain similar to the central cysteine-rich domain of DnaJ proteins. The observed genetic interaction of anu7-1 with a loss-of-function allele of GENOMES UNCOUPLED1 suggests that the anu7-1 mutation triggers a retrograde signal that leads to changes in the expression of many genes that normally function in the chloroplasts. Many such genes are expressed at higher levels in anu7-1 rosettes, with a significant overrepresentation of those required for the expression of plastid genome genes. Like in other mutants with altered expression of plastid-encoded genes, we found that anu7-1 exhibits defects in the arrangement of thylakoidal membranes, which appear locally unappressed. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

  5. LAMP-1-chimeric DNA vaccines enhance the antibody response in Japanese flounder, Paralichthys olivaceus.

    Science.gov (United States)

    Rondón-Barragán, Iang; Nozaki, Reiko; Hirono, Ikuo; Kondo, Hidehiro

    2017-08-01

    DNA vaccination is one method to protect farmed fish from viral and bacterial diseases. Chimeric antigens encoded by DNA vaccines have been shown to increase the resistance to viral diseases. Here, we sequenced the gene encoding lysosome-associated membrane protein-1 from Japanese flounder, Paralichthys olivaceus, (JfLAMP-1) and assessed its use in a chimeric DNA vaccine fused with the major capsule protein (MCP) from red seabream iridovirus (RSIV). JfLAMP-1 cDNA has a length of 1248 bp encoding 415 aa, which contains transmembrane and cytoplasmic domains. JfLAMP-1 is constitutively expressed in several tissues and its expression in spleen was upregulated following injection of formalin-killed cells (FKC) of Edwardsiella tarda. Immunofluorescence analysis showed that JfLAMP-1 is distributed in the small and large granules in the cytoplasm and groups close to the nucleus. The DNA encoding the luminal domain of JfLAMP-1 was replaced with the gene for the RSIV MCP, and the construct was cloned in an expression vector (pCIneo). Fish vaccinated with pCLAMP-MCP had significantly higher antibody levels than fish vaccinated with pCIneo vector harboring the MCP gene (p day 30 post-vaccination. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Isolation and characterization of a cDNA encoding phytochrome A in the non-photosynthetic parasitic plant, Orobanche minor Sm.

    Science.gov (United States)

    Trakulnaleamsai, Chitra; Okazawa, Atsushi; An, Chung-Il; Kajiyama, Shin'ichiro; Fukusaki, Ei'ichiro; Yoneyama, Koichi; Takeuchi, Yasutomo; Kobayashi, Akio

    2005-01-01

    In this study, the isolation and characterization of a phytochrome A (PHYA) homologous cDNA (OmPHYA) in the non-photosynthetic holoparasitic plant Orobanche minor are described. The present findings provide the first report of the presence of a PHYA homolog in the holoparasite. This study found that OmPHYA is of similar size to the other PHYAs of green plants and shows 72, 77, and 77% amino acid sequence identity with PHYA in Arabidopsis, potato, and tobacco respectively. The OmPHYA contains a conserved chromophore attachment cysteine at position 323. Although OmPHYA shows high sequence identity with other PHYAs in green plants, 13 amino acid substitutions located in both the N and C-terminal domains are observed (a total of 26 amino acids). OmPHYA is encoded by a single gene within the O. minor genome. The abundance of the OmPHYA transcript as well as nuclear translocation of OmphyA occurs in a light-dependent manner.

  7. Unprecedented loss of ammonia assimilation capability in a urease-encoding bacterial mutualist

    Directory of Open Access Journals (Sweden)

    Wernegreen Jennifer J

    2010-12-01

    Full Text Available Abstract Background Blochmannia are obligately intracellular bacterial mutualists of ants of the tribe Camponotini. Blochmannia perform key nutritional functions for the host, including synthesis of several essential amino acids. We used Illumina technology to sequence the genome of Blochmannia associated with Camponotus vafer. Results Although Blochmannia vafer retains many nutritional functions, it is missing glutamine synthetase (glnA, a component of the nitrogen recycling pathway encoded by the previously sequenced B. floridanus and B. pennsylvanicus. With the exception of Ureaplasma, B. vafer is the only sequenced bacterium to date that encodes urease but lacks the ability to assimilate ammonia into glutamine or glutamate. Loss of glnA occurred in a deletion hotspot near the putative replication origin. Overall, compared to the likely gene set of their common ancestor, 31 genes are missing or eroded in B. vafer, compared to 28 in B. floridanus and four in B. pennsylvanicus. Three genes (queA, visC and yggS show convergent loss or erosion, suggesting relaxed selection for their functions. Eight B. vafer genes contain frameshifts in homopolymeric tracts that may be corrected by transcriptional slippage. Two of these encode DNA replication proteins: dnaX, which we infer is also frameshifted in B. floridanus, and dnaG. Conclusions Comparing the B. vafer genome with B. pennsylvanicus and B. floridanus refines the core genes shared within the mutualist group, thereby clarifying functions required across ant host species. This third genome also allows us to track gene loss and erosion in a phylogenetic context to more fully understand processes of genome reduction.

  8. DNA damage induction of ribonucleotide reductase.

    OpenAIRE

    Elledge, S J; Davis, R W

    1989-01-01

    RNR2 encodes the small subunit of ribonucleotide reductase, the enzyme that catalyzes the first step in the pathway for the production of deoxyribonucleotides needed for DNA synthesis. RNR2 is a member of a group of genes whose activities are cell cycle regulated and that are transcriptionally induced in response to the stress of DNA damage. An RNR2-lacZ fusion was used to further characterize the regulation of RNR2 and the pathway responsible for its response to DNA damage. beta-Galactosidas...

  9. An Unusual Phage Repressor Encoded by Mycobacteriophage BPs.

    Directory of Open Access Journals (Sweden)

    Valerie M Villanueva

    Full Text Available Temperate bacteriophages express transcription repressors that maintain lysogeny by down-regulating lytic promoters and confer superinfection immunity. Repressor regulation is critical to the outcome of infection-lysogenic or lytic growth-as well as prophage induction into lytic replication. Mycobacteriophage BPs and its relatives use an unusual integration-dependent immunity system in which the phage attachment site (attP is located within the repressor gene (33 such that site-specific integration leads to synthesis of a prophage-encoded product (gp33103 that is 33 residues shorter at its C-terminus than the virally-encoded protein (gp33136. However, the shorter form of the repressor (gp33103 is stable and active in repression of the early lytic promoter PR, whereas the longer virally-encoded form (gp33136 is inactive due to targeted degradation via a C-terminal ssrA-like tag. We show here that both forms of the repressor bind similarly to the 33-34 intergenic regulatory region, and that BPs gp33103 is a tetramer in solution. The BPs gp33103 repressor binds to five regulatory regions spanning the BPs genome, and regulates four promoters including the early lytic promoter, PR. BPs gp33103 has a complex pattern of DNA recognition in which a full operator binding site contains two half sites separated by a variable spacer, and BPs gp33103 induces a DNA bend at the full operator site but not a half site. The operator site structure is unusual in that one half site corresponds to a 12 bp palindrome identified previously, but the other half site is a highly variable variant of the palindrome.

  10. A Major Facilitator Superfamily protein encoded by TcMucK gene is not required for cuticle pigmentation, growth and development in Tribolium castaneum.

    Science.gov (United States)

    Mun, Seulgi; Noh, Mi Young; Osanai-Futahashi, Mizuko; Muthukrishnan, Subbaratnam; Kramer, Karl J; Arakane, Yasuyuki

    2014-06-01

    Insect cuticle pigmentation and sclerotization (tanning) are vital physiological processes for insect growth, development and survival. We have previously identified several colorless precursor molecules as well as enzymes involved in their biosynthesis and processing to yield the mature intensely colored body cuticle pigments. A recent study indicated that the Bombyx mori (silkmoth) gene, BmMucK, which encodes a protein orthologous to a Culex pipiens quiquefasciatus (Southern house mosquito) cis,cis, muconate transporter, is a member of the "Major Facilitator Superfamily" (MFS) of transporter proteins and is associated with the appearance of pigmented body segments of naturally occurring body color mutants of B. mori. While RNA interference of the BmMucK gene failed to result in any observable phenotype, RNAi using a dsRNA for an orthologous gene from the red flour beetle, Tribolium castaneum, was reported to result in molting defects and darkening of the cuticle and some body parts, leading to the suggestion that orthologs of MucK genes may differ in their functions among insects. To verify the role and essentiality of the ortholog of this gene in development and body pigmentation function in T. castaneum we obtained cDNAs for the orthologous gene (TcMucK) from RNA isolated from the GA-1 wild-type strain of T. castaneum. The sequence of a 1524 nucleotides-long cDNA for TcMucK which encodes the putatively full-length protein, was assembled from two overlapping RT-PCR fragments and the expression profile of this gene during development was analyzed by real-time PCR. This cDNA encodes a 55.8 kDa protein consisting of 507 amino acid residues and includes 11 putative transmembrane segments. Transcripts of TcMucK were detected throughout all of the developmental stages analyzed. The function of this gene was explored by injection of two different double-stranded RNAs targeting different regions of the TcMucK gene (dsTcMucKs) into young larvae to down

  11. cDNA cloning, sequence analysis, and chromosomal localization of the gene for human carnitine palmitoyltransferase

    International Nuclear Information System (INIS)

    Finocchiaro, G.; Taroni, F.; Martin, A.L.; Colombo, I.; Tarelli, G.T.; DiDonato, S.; Rocchi, M.

    1991-01-01

    The authors have cloned and sequenced a cDNA encoding human liver carnitine palmitoyltransferase an inner mitochondrial membrane enzyme that plays a major role in the fatty acid oxidation pathway. Mixed oligonucleotide primers whose sequences were deduced from one tryptic peptide obtained from purified CPTase were used in a polymerase chain reaction, allowing the amplification of a 0.12-kilobase fragment of human genomic DNA encoding such a peptide. A 60-base-pair (bp) oligonucleotide synthesized on the basis of the sequence from this fragment was used for the screening of a cDNA library from human liver and hybridized to a cDNA insert of 2255 bp. This cDNA contains an open reading frame of 1974 bp that encodes a protein of 658 amino acid residues including 25 residues of an NH 2 -terminal leader peptide. The assignment of this open reading frame to human liver CPTase is confirmed by matches to seven different amino acid sequences of tryptic peptides derived from pure human CPTase and by the 82.2% homology with the amino acid sequence of rat CPTase. The NH 2 -terminal region of CPTase contains a leucine-proline motif that is shared by carnitine acetyl- and octanoyltransferases and by choline acetyltransferase. The gene encoding CPTase was assigned to human chromosome 1, region 1q12-1pter, by hybridization of CPTase cDNA with a DNA panel of 19 human-hanster somatic cell hybrids

  12. Design and Analysis of Compact DNA Strand Displacement Circuits for Analog Computation Using Autocatalytic Amplifiers.

    Science.gov (United States)

    Song, Tianqi; Garg, Sudhanshu; Mokhtar, Reem; Bui, Hieu; Reif, John

    2018-01-19

    A main goal in DNA computing is to build DNA circuits to compute designated functions using a minimal number of DNA strands. Here, we propose a novel architecture to build compact DNA strand displacement circuits to compute a broad scope of functions in an analog fashion. A circuit by this architecture is composed of three autocatalytic amplifiers, and the amplifiers interact to perform computation. We show DNA circuits to compute functions sqrt(x), ln(x) and exp(x) for x in tunable ranges with simulation results. A key innovation in our architecture, inspired by Napier's use of logarithm transforms to compute square roots on a slide rule, is to make use of autocatalytic amplifiers to do logarithmic and exponential transforms in concentration and time. In particular, we convert from the input that is encoded by the initial concentration of the input DNA strand, to time, and then back again to the output encoded by the concentration of the output DNA strand at equilibrium. This combined use of strand-concentration and time encoding of computational values may have impact on other forms of molecular computation.

  13. ATP- and NAD+-dependent DNA ligases share an essential function in the halophilic archaeon Haloferax volcanii

    DEFF Research Database (Denmark)

    Zhao, A.; Gray, F. C; MacNeill, S. A.

    2006-01-01

    DNA ligases join the ends of DNA molecules during replication, repair and recombination. ATP-dependent ligases are found predominantly in the eukarya and archaea whereas NAD+-dependent DNA ligases are found only in the eubacteria and in entomopoxviruses. Using the genetically tractable halophile....... volcanii also encodes an NAD+-dependent DNA ligase family member, LigN, the first such enzyme to be identified in the archaea, and present phylogenetic analysis indicating that the gene encoding this protein has been acquired by lateral gene transfer (LGT) from eubacteria. As with LigA, we show that Lig...

  14. Zea mI, the maize homolog of the allergen-encoding Lol pI gene of rye grass.

    Science.gov (United States)

    Broadwater, A H; Rubinstein, A L; Chay, C H; Klapper, D G; Bedinger, P A

    1993-09-15

    Sequence analysis of a pollen-specific cDNA from maize has identified a homolog (Zea mI) of the gene (Lol pI) encoding the major allergen of rye-grass pollen. The protein encoded by the partial cDNA sequence is 59.3% identical and 72.7% similar to the comparable region of the reported amino acid sequence of Lol pIA. Southern analysis indicates that this cDNA represents a member of a small multigene family in maize. Northern analysis shows expression only in pollen, not in vegetative or female floral tissues. The timing of expression is developmentally regulated, occurring at a low level prior to the first pollen mitosis and at a high level after this postmeiotic division. Western analysis detects a protein in maize pollen lysates using polyclonal antiserum and monoclonal antibodies directed against purified Lolium perenne allergen.

  15. The structures of bovine herpesvirus 1 virion and concatemeric DNA: implications for cleavage and packaging of herpesvirus genomes

    International Nuclear Information System (INIS)

    Schynts, Frederic; McVoy, Michael A.; Meurens, Francois; Detry, Bruno; Epstein, Alberto L.; Thiry, Etienne

    2003-01-01

    Herpesvirus genomes are often characterized by the presence of direct and inverted repeats that delineate their grouping into six structural classes. Class D genomes consist of a long (L) segment and a short (S) segment. The latter is flanked by large inverted repeats. DNA replication produces concatemers of head-to-tail linked genomes that are cleaved into unit genomes during the process of packaging DNA into capsids. Packaged class D genomes are an equimolar mixture of two isomers in which S is in either of two orientations, presumably a consequence of homologous recombination between the inverted repeats. The L segment remains predominantly fixed in a prototype (P) orientation; however, low levels of genomes having inverted L (I L ) segments have been reported for some class D herpesviruses. Inefficient formation of class D I L genomes has been attributed to infrequent L segment inversion, but recent detection of frequent inverted L segments in equine herpesvirus 1 concatemers [Virology 229 (1997) 415-420] suggests that the defect may be at the level of cleavage and packaging rather than inversion. In this study, the structures of virion and concatemeric DNA of another class D herpesvirus, bovine herpesvirus 1, were determined. Virion DNA contained low levels of I L genomes, whereas concatemeric DNA contained significant amounts of L segments in both P and I L orientations. However, concatemeric termini exhibited a preponderance of L termini derived from P isomers which was comparable to the preponderance of P genomes found in virion DNA. Thus, the defect in formation of I L genomes appears to lie at the level of concatemer cleavage. These results have important implications for the mechanisms by which herpesvirus DNA cleavage and packaging occur

  16. High-resolution NMR studies of chimeric DNA-RNA-DNA duplexes, heteronomous base pairing, and continuous base stacking at junctions

    International Nuclear Information System (INIS)

    Chou, Shanho; Flynn, P.; Wang, A.; Reid, B.

    1991-01-01

    Two symmetrical DNA-RNA-DNA duplex chimeras, d(CGCG)r(AAUU)d(CGCG) (designated rAAUU) and d(CGCG)r(UAUA)d(CGCG) (designated rUAUA), and a nonsymmetrical chimeric duplex, d(CGTT)r(AUAA)d(TGCG)/d(CGCA)r(UUAU)d(AACG) (designated rAUAA), as well as their pure DNA analogues, containing dU instead of T, have been synthesized by solid-phase phosphoramidite methods and studied by high-resolution NMR techniques. The 1D imino proton NOE spectra of these d-r-d chimeras indicate normal Watson-Crick hydrogen bonding and base stacking at the junction region. Preliminary qualitative NOESY, COSY, and chemical shift data suggest that the internal RNA segment contains C3'-endo (A-type) sugar conformations except for the first RNA residues (position 5 and 17) following the 3' end of the DNA block, which, unlike the other six ribonucleotides, exhibit detectable H1'-H2' J coupling. The nucleosides of the two flanking DNA segments appear to adopt a fairly normal C2'-endo B-DNA conformation except at the junction with the RNA blocks (residues 4 and 16), where the last DNA residue appears to adopt an intermediate sugar conformation. The data indicate that A-type and B-type conformations can coexist in a single short continuous nucleic acid duplex, but these results differ somewhat from previous theoretical model studies

  17. Cloning, molecular characterization and expression of a cDNA encoding a functional NADH-cytochrome b5 reductase from Mucor racemosus PTCC 5305 in E. coli

    Directory of Open Access Journals (Sweden)

    NED A SETAYESH

    2009-01-01

    Full Text Available The present work aims to study a new NADH-cytochrome b5 reductase (cb5r from Mucor racemosus PTCC 5305. A cDNA coding for cb s r was isolated from a Mucor racemosus PTCC 5305 cDNA library. The nucleotide sequence of the cDNA including coding and sequences flanking regions was determined. The open reading frame starting from ATG and ending with TAG stop codon encoded 228 amino acids and displayed the closest similarity (73% with Mortierella alpina cb s r. Lack of hydrophobic residues in the N-terminal sequence was apparent, suggesting that the enzyme is a soluble isoform. The coding sequence was then cloned in the pET16b transcription vector carrying an N-terminal-linked His-Tag® sequence and expressed in Escherichia coli BL21 (DE3. The enzyme was then homogeneously purified by a metal affinity column. The recombinant Mucor enzyme was shown to have its optimal activity at pH and temperature of about 7.5 and 40 °C, respectively. The apparent Km value was calculated to be 13 μM for ferricyanide. To our knowledge, this is the first report on cloning and expression of a native fungal soluble isoform of NADH-cytochrome b5 reductase in E. coli.

  18. Segment scheduling method for reducing 360° video streaming latency

    Science.gov (United States)

    Gudumasu, Srinivas; Asbun, Eduardo; He, Yong; Ye, Yan

    2017-09-01

    360° video is an emerging new format in the media industry enabled by the growing availability of virtual reality devices. It provides the viewer a new sense of presence and immersion. Compared to conventional rectilinear video (2D or 3D), 360° video poses a new and difficult set of engineering challenges on video processing and delivery. Enabling comfortable and immersive user experience requires very high video quality and very low latency, while the large video file size poses a challenge to delivering 360° video in a quality manner at scale. Conventionally, 360° video represented in equirectangular or other projection formats can be encoded as a single standards-compliant bitstream using existing video codecs such as H.264/AVC or H.265/HEVC. Such method usually needs very high bandwidth to provide an immersive user experience. While at the client side, much of such high bandwidth and the computational power used to decode the video are wasted because the user only watches a small portion (i.e., viewport) of the entire picture. Viewport dependent 360°video processing and delivery approaches spend more bandwidth on the viewport than on non-viewports and are therefore able to reduce the overall transmission bandwidth. This paper proposes a dual buffer segment scheduling algorithm for viewport adaptive streaming methods to reduce latency when switching between high quality viewports in 360° video streaming. The approach decouples the scheduling of viewport segments and non-viewport segments to ensure the viewport segment requested matches the latest user head orientation. A base layer buffer stores all lower quality segments, and a viewport buffer stores high quality viewport segments corresponding to the most recent viewer's head orientation. The scheduling scheme determines viewport requesting time based on the buffer status and the head orientation. This paper also discusses how to deploy the proposed scheduling design for various viewport adaptive video

  19. Laser desorption mass spectrometry for high-throughput DNA analysis and its applications

    Science.gov (United States)

    Chen, C. H. Winston; Golovlev, Valeri V.; Taranenko, N. I.; Allman, S. L.; Isola, Narayana R.; Potter, N. T.; Matteson, K. J.; Chang, Linus Y.

    1999-05-01

    Laser desorption mass spectrometry (LDMS) has been developed for DNA sequencing, disease diagnosis, and DNA fingerprinting for forensic applications. With LDMS, the speed of DNA analysis can be much faster than conventional gel electrophoresis. No dye or radioactive tagging to DNA segments for detection is needed. LDMS is emerging as a new alternative technology for DNA analysis.

  20. Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.

    Directory of Open Access Journals (Sweden)

    Sher L Hendrickson

    2010-09-01

    Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.

  1. Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

    NARCIS (Netherlands)

    Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

    1983-01-01

    The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

  2. Signal sequence and keyword trap in silico for selection of full-length human cDNAs encoding secretion or membrane proteins from oligo-capped cDNA libraries.

    Science.gov (United States)

    Otsuki, Tetsuji; Ota, Toshio; Nishikawa, Tetsuo; Hayashi, Koji; Suzuki, Yutaka; Yamamoto, Jun-ichi; Wakamatsu, Ai; Kimura, Kouichi; Sakamoto, Katsuhiko; Hatano, Naoto; Kawai, Yuri; Ishii, Shizuko; Saito, Kaoru; Kojima, Shin-ichi; Sugiyama, Tomoyasu; Ono, Tetsuyoshi; Okano, Kazunori; Yoshikawa, Yoko; Aotsuka, Satoshi; Sasaki, Naokazu; Hattori, Atsushi; Okumura, Koji; Nagai, Keiichi; Sugano, Sumio; Isogai, Takao

    2005-01-01

    We have developed an in silico method of selection of human full-length cDNAs encoding secretion or membrane proteins from oligo-capped cDNA libraries. Fullness rates were increased to about 80% by combination of the oligo-capping method and ATGpr, software for prediction of translation start point and the coding potential. Then, using 5'-end single-pass sequences, cDNAs having the signal sequence were selected by PSORT ('signal sequence trap'). We also applied 'secretion or membrane protein-related keyword trap' based on the result of BLAST search against the SWISS-PROT database for the cDNAs which could not be selected by PSORT. Using the above procedures, 789 cDNAs were primarily selected and subjected to full-length sequencing, and 334 of these cDNAs were finally selected as novel. Most of the cDNAs (295 cDNAs: 88.3%) were predicted to encode secretion or membrane proteins. In particular, 165(80.5%) of the 205 cDNAs selected by PSORT were predicted to have signal sequences, while 70 (54.2%) of the 129 cDNAs selected by 'keyword trap' preserved the secretion or membrane protein-related keywords. Many important cDNAs were obtained, including transporters, receptors, and ligands, involved in significant cellular functions. Thus, an efficient method of selecting secretion or membrane protein-encoding cDNAs was developed by combining the above four procedures.

  3. Novel Point Mutations and A8027G Polymorphism in Mitochondrial-DNA-Encoded Cytochrome c Oxidase II Gene in Mexican Patients with Probable Alzheimer Disease

    Directory of Open Access Journals (Sweden)

    Verónica Loera-Castañeda

    2014-01-01

    Full Text Available Mitochondrial dysfunction has been thought to contribute to Alzheimer disease (AD pathogenesis through the accumulation of mitochondrial DNA mutations and net production of reactive oxygen species (ROS. Mitochondrial cytochrome c-oxidase plays a key role in the regulation of aerobic production of energy and is composed of 13 subunits. The 3 largest subunits (I, II, and III forming the catalytic core are encoded by mitochondrial DNA. The aim of this work was to look for mutations in mitochondrial cytochrome c-oxidase gene II (MTCO II in blood samples from probable AD Mexican patients. MTCO II gene was sequenced in 33 patients with diagnosis of probable AD. Four patients (12% harbored the A8027G polymorphism and three of them were early onset (EO AD cases with familial history of the disease. In addition, other four patients with EOAD had only one of the following point mutations: A8003C, T8082C, C8201T, or G7603A. Neither of the point mutations found in this work has been described previously for AD patients, and the A8027G polymorphism has been described previously; however, it hasn’t been related to AD. We will need further investigation to demonstrate the role of the point mutations of mitochondrial DNA in the pathogenesis of AD.

  4. Molecular cloning and expression analysis of a cDNAs encoding androgenic gland hormone precursors from two Porcellionidae species, Porcellio scaber and P. dilatatus

    OpenAIRE

    Ohira, Tsuyoshi; Hasegawa, Yuriko; Okuno, Atsuro; Nagasawa, Hiromichi

    2003-01-01

    Male sexual characteristics in Crustacea are induced by androgenic gland hormone (AGH), which is produced by the male-specific androgenic gland. Recently, AGH in the terrestrial isopod Armadillidium vulgare was characterized and its cDNA cloned, the first example in which the structure of AGH was elucidated. We report here the molecular cloning of cDNAs encoding AGH precursors from two additional terrestrial isopods, Porcellio scaber and P. dilatatus. cDNA fragments encoding Porcellio scaber ...

  5. Processing and display of medical three dimensional arrays of numerical data using octree encoding

    International Nuclear Information System (INIS)

    Amans, J.L.; Darier, P.

    1985-01-01

    Imaging modalities such as X-ray computerized Tomography (CT), Nuclear Medicine and Nuclear Magnetic Resonance can produce three-dimensional (3-D) arrays of numerical data of medical object internal structures. The analysis of 3-D data by synthetic generation of realistic images is an important area of computer graphics and imaging. We are currently developing experimental software that allows the analysis, processing and display of 3-D arrays of numerical data that are organized in a related hierarchical data structure using OCTREE (octal-tree) encoding technique based on a recursive subdivision of the data volume. The OCTREE encoding structure is an extension of the two-dimensional tree structure: the quadtree, developed for image processing applications. Before any operations, the 3-D array of data is OCTREE encoded, thereafter all processings are concerned with the encoded object. The elementary process for the elaboration of a synthetic image includes: conditioning the volume: volume partition (numerical and spatial segmentation), choice of the view-point..., two dimensional display, either by spatial integration (radiography) or by shaded surface representation. This paper introduces these different concepts and specifies the advantages of OCTREE encoding techniques in realizing these operations. Furthermore the application of the OCTREE encoding scheme to the display of 3-D medical volumes generated from multiple CT scans is presented

  6. Searching for cellular partners of hantaviral nonstructural protein NSs: Y2H screening of mouse cDNA library and analysis of cellular interactome.

    Science.gov (United States)

    Rönnberg, Tuomas; Jääskeläinen, Kirsi; Blot, Guillaume; Parviainen, Ville; Vaheri, Antti; Renkonen, Risto; Bouloy, Michele; Plyusnin, Alexander

    2012-01-01

    Hantaviruses (Bunyaviridae) are negative-strand RNA viruses with a tripartite genome. The small (S) segment encodes the nucleocapsid protein and, in some hantaviruses, also the nonstructural protein (NSs). The aim of this study was to find potential cellular partners for the hantaviral NSs protein. Toward this aim, yeast two-hybrid (Y2H) screening of mouse cDNA library was performed followed by a search for potential NSs protein counterparts via analyzing a cellular interactome. The resulting interaction network was shown to form logical, clustered structures. Furthermore, several potential binding partners for the NSs protein, for instance ACBD3, were identified and, to prove the principle, interaction between NSs and ACBD3 proteins was demonstrated biochemically.

  7. Comparison of DNA strand-break simulated with different DNA models

    International Nuclear Information System (INIS)

    Xie, Wenzhang; Li, Junli; Qiu, Rui; Yan, Congchong; Zeng, Zhi; Li, Chunyan

    2013-01-01

    Full text of the publication follows. In Monte Carlo simulation of DNA damage, the geometric model of DNA is of great importance. To study the influence of DNA model on the simulation of DNA damage, three DNA models were created in this paper. They were a volume model and two atomic models with different parameters. Direct DNA strand-break induced by low-energy electrons were simulated respectively with the three models. The results show that most of the energy depositions in the DNA segments do not lead to strand-breaks. The simple single strand-break (SSB) tends to be the predominant damage type, and the contribution of complex double strand-break (DSB) to the total DSB cannot be neglected. Among the yields of all the three DNA target models applied here, the yields of the volume model are the highest, the yields of the atomic model with double van der Waals radii (r) take the second place, whereas the yields of the atomic model with single r come last. On average, the ratios of SSB yields are approximately equivalent to the corresponding ratios of the models' volume. However, there seems to be no clear relationship between the DSB yields and the models' volume. (authors)

  8. Tlys, a newly identified Sulfolobus spindle-shaped virus 1 transcript expressed in the lysogenic state, encodes a DNA-binding protein interacting at the promoters of the early genes

    DEFF Research Database (Denmark)

    Fusco, Salvatore; She, Qunxin; Bartolucci, Simonetta

    2013-01-01

    -binding motif. DNA-binding assays demonstrated that the recombinant F55, purified from Escherichia coli, is indeed a putative transcription factor able to recognize site specifically target sequences in the promoters of the early induced T5, T6, and Tind transcripts, as well as of its own promoter. Binding...... the growth of the lysogenic host. The correponding gene f55 lies between two transcriptional units (T6 and Tind) that are upregulated upon UV irradiation. The open reading frame f55 encodes a 6.3-kDa protein which shows sequence identity with negative regulators that fold into the ribbon-helix-helix DNA....... Taking together the transcriptional analysis data and the biochemical evidences, we surmise that the protein F55 is involved in the regulation of the lysogenic state of SSV1....

  9. The pectin lyase-encoding gene (pnl) family from Glomerella cingulata: characterization of pnlA and its expression in yeast.

    Science.gov (United States)

    Templeton, M D; Sharrock, K R; Bowen, J K; Crowhurst, R N; Rikkerink, E H

    1994-05-03

    Oligodeoxyribonucleotide primers were designed from conserved amino acid (aa) sequences between pectin lyase D (PNLD) from Aspergillus niger and pectate lyases A and E (PELA/E) from Erwinia chrysanthemi. The polymerase chain reaction (PCR) was used with these primers to amplify genomic DNA from the plant pathogenic fungus Glomerella cingulata. Three different 220-bp fragments with homology to PNL-encoding genes from A. niger, and a 320-bp fragment with homology to PEL-encoding genes from Nicotiana tabacum and E. carotovora were cloned. One of the 220-bp PCR products (designated pnlA) was used as a probe to isolate a PNL-encoding gene from a lambda genomic DNA library prepared from G. cingulata. Nucleotide (nt) sequence data revealed that this gene has seven exons and codes for a putative 380-aa protein. The nt sequence of a cDNA clone, prepared using PCR, confirmed the presence of the six introns. The positions of the introns were different from the sites of the five introns present in the three PNL-encoding genes previously sequenced from A. niger. PNLA was synthesised in yeast by cloning the cDNA into the expression vector, pEMBLYex-4, and enzymatically active protein was secreted into the culture medium. Significantly higher expression was achieved when the context of the start codon, CACCATG, was mutated to CAAAATG, a consensus sequence commonly found in highly expressed yeast genes. The produced protein had an isoelectric point (pI) of 9.4, the same as that for the G. cingulata pnlA product.(ABSTRACT TRUNCATED AT 250 WORDS)

  10. Methods for transforming and expression screening of filamentous fungal cells with a DNA library

    Science.gov (United States)

    Teter, Sarah; Lamsa, Michael; Cherry, Joel; Ward, Connie

    2015-06-02

    The present invention relates to methods for expression screening of filamentous fungal transformants, comprising: (a) isolating single colony transformants of a DNA library introduced into E. coli; (b) preparing DNA from each of the single colony E. coli transformants; (c) introducing a sample of each of the DNA preparations of step (b) into separate suspensions of protoplasts of a filamentous fungus to obtain transformants thereof, wherein each transformant contains one or more copies of an individual polynucleotide from the DNA library; (d) growing the individual filamentous fungal transformants of step (c) on selective growth medium, thereby permitting growth of the filamentous fungal transformants, while suppressing growth of untransformed filamentous fungi; and (e) measuring activity or a property of each polypeptide encoded by the individual polynucleotides. The present invention also relates to isolated polynucleotides encoding polypeptides of interest obtained by such methods, to nucleic acid constructs, expression vectors, and recombinant host cells comprising the isolated polynucleotides, and to methods of producing the polypeptides encoded by the isolated polynucleotides.

  11. Two modes of interaction of the single-stranded DNA-binding protein of bacteriophage T7 with the DNA polymerase-thioredoxin complex

    KAUST Repository

    Ghosh, Sharmistha; Hamdan, Samir; Richardson, Charles C.

    2010-01-01

    The DNA polymerase encoded by bacteriophage T7 has low processivity. Escherichia coli thioredoxin binds to a segment of 76 residues in the thumb subdomain of the polymerase and increases the processivity. The binding of thioredoxin leads to the formation of two basic loops, loops A and B, located within the thioredoxin-binding domain (TBD). Both loops interact with the acidic C terminus of the T7 helicase. A relatively weak electrostatic mode involves the C-terminal tail of the helicase and the TBD, whereas a high affinity interaction that does not involve the C-terminal tail occurs when the polymerase is in a polymerization mode. T7 gene 2.5 single-stranded DNA-binding protein (gp2.5) also has an acidic C-terminal tail. gp2.5 also has two modes of interaction with the polymerase, but both involve the C-terminal tail of gp2.5. An electrostatic interaction requires the basic residues in loops A and B, and gp2.5 binds to both loops with similar affinity as measured by surface plasmon resonance. When the polymerase is in a polymerization mode, the C terminus of gene 2.5 protein interacts with the polymerase in regions outside the TBD.gp2.5 increases the processivity of the polymerase-helicase complex during leading strand synthesis. When loop B of the TBD is altered, abortive DNA products are observed during leading strand synthesis. Loop B appears to play an important role in communication with the helicase and gp2.5, whereas loop A plays a stabilizing role in these interactions. © 2010 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. Two modes of interaction of the single-stranded DNA-binding protein of bacteriophage T7 with the DNA polymerase-thioredoxin complex

    KAUST Repository

    Ghosh, Sharmistha

    2010-04-06

    The DNA polymerase encoded by bacteriophage T7 has low processivity. Escherichia coli thioredoxin binds to a segment of 76 residues in the thumb subdomain of the polymerase and increases the processivity. The binding of thioredoxin leads to the formation of two basic loops, loops A and B, located within the thioredoxin-binding domain (TBD). Both loops interact with the acidic C terminus of the T7 helicase. A relatively weak electrostatic mode involves the C-terminal tail of the helicase and the TBD, whereas a high affinity interaction that does not involve the C-terminal tail occurs when the polymerase is in a polymerization mode. T7 gene 2.5 single-stranded DNA-binding protein (gp2.5) also has an acidic C-terminal tail. gp2.5 also has two modes of interaction with the polymerase, but both involve the C-terminal tail of gp2.5. An electrostatic interaction requires the basic residues in loops A and B, and gp2.5 binds to both loops with similar affinity as measured by surface plasmon resonance. When the polymerase is in a polymerization mode, the C terminus of gene 2.5 protein interacts with the polymerase in regions outside the TBD.gp2.5 increases the processivity of the polymerase-helicase complex during leading strand synthesis. When loop B of the TBD is altered, abortive DNA products are observed during leading strand synthesis. Loop B appears to play an important role in communication with the helicase and gp2.5, whereas loop A plays a stabilizing role in these interactions. © 2010 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. Safety and efficacy of a xenogeneic DNA vaccine encoding for human tyrosinase as adjunctive treatment for oral malignant melanoma in dogs following surgical excision of the primary tumor.

    Science.gov (United States)

    Grosenbaugh, Deborah A; Leard, A Timothy; Bergman, Philip J; Klein, Mary K; Meleo, Karri; Susaneck, Steven; Hess, Paul R; Jankowski, Monika K; Jones, Pamela D; Leibman, Nicole F; Johnson, Maribeth H; Kurzman, Ilene D; Wolchok, Jedd D

    2011-12-01

    To evaluate the safety and efficacy of a vaccine containing plasmid DNA with an insert encoding human tyrosinase (ie, huTyr vaccine) as adjunctive treatment for oral malignant melanoma (MM) in dogs. 111 dogs (58 prospectively enrolled in a multicenter clinical trial and 53 historical controls) with stage II or III oral MM (modified World Health Organization staging scale, I to IV) in which locoregional disease control was achieved. 58 dogs received an initial series of 4 injections of huTyr vaccine (102 μg of DNA/injection) administered transdermally by use of a needle-free IM vaccination device. Dogs were monitored for adverse reactions. Surviving dogs received booster injections at 6-month intervals thereafter. Survival time for vaccinates was compared with that of historical control dogs via Kaplan-Meier survival analysis for the outcome of death. Kaplan-Meier analysis of survival time until death attributable to MM was determined to be significantly improved for dogs that received the huTyr vaccine, compared with that of historical controls. However, median survival time could not be determined for vaccinates because dogs as adjunctive treatment for oral MM. Response to DNA vaccination in dogs with oral MM may be useful in development of plasmid DNA vaccination protocols for human patients with similar disease.

  14. Cloning of the cDNA for human 12-lipoxygenase

    International Nuclear Information System (INIS)

    Izumi, T.; Hoshiko, S.; Radmark, O.; Samuelsson, B.

    1990-01-01

    A full-length cDNA clone encoding 12-lipoxygenase was isolated from a human platelet cDNA library by using a cDNA for human reticulocyte 15-lipoxygenase as probe for the initial screening. The cDNA had an open reading frame encoding 662 amino acid residues with a calculated molecular weight of 75,590. Three independent clones revealed minor heterogeneities in their DNA sequences. Thus, in three positions of the deduced amino acid sequence, there is a choice between two different amino acids. The deduced sequence from the clone plT3 showed 65% identity with human reticulocyte 15-lipoxygenase and 42% identity with human leukocyte 5-lipoxygenase. The 12-lipoxygenase cDNA recognized a 3.0-kilobase mRNA species in platelets and human erythroleukemia cells (HEL cells). Phorbol 12-tetradecanoyl 13-acetate induced megakaryocytic differentiation of HEL cells and 12-lipoxygenase activity and increased mRNA for 12-lipoxygenase. The identity of the cloned 12-lipoxygenase was assured by expression in a mammalian cell line (COS cells). Human platelet 12-lipoxygenase has been difficult to purify to homogeneity. The cloning of this cDNA will increase the possibilities to elucidate the structure and function of this enzyme

  15. [Molecular cloning and characterization of cDNA of the rpc10+ gene encoding the smallest subunit of nuclear RNA polymerases of Schizosaccharomyces pombe].

    Science.gov (United States)

    Shpakovskiĭ, G V; Lebedenko, E N

    1997-05-01

    The full-length cDNA of the rpc10+ gene encoding mini-subunit Rpc10, which is common for all three nuclear RNA polymerases of the fission yeast Schizosaccharomyces pombe, was cloned and sequenced. The Rpc10 subunit of Sz. pombe and its homologs from S. cerevisiae and H. sapiens are positively charged proteins with a highly conserved C-terminal region and an invariant zinc-binding domain (Zn-finger) of a typical amino acid composition: YxCx2Cx12RCx2CGxR. Functional tests of heterospecific complementation, using tetrad analysis or plasmid shuffling, showed that the Rpc10 subunit of Sz. pombe can successfully replace the homologous ABC10 alpha subunit in nuclear RNA polymerases I-III of S. cerevisiae.

  16. Classification with an edge: Improving semantic image segmentation with boundary detection

    Science.gov (United States)

    Marmanis, D.; Schindler, K.; Wegner, J. D.; Galliani, S.; Datcu, M.; Stilla, U.

    2018-01-01

    We present an end-to-end trainable deep convolutional neural network (DCNN) for semantic segmentation with built-in awareness of semantically meaningful boundaries. Semantic segmentation is a fundamental remote sensing task, and most state-of-the-art methods rely on DCNNs as their workhorse. A major reason for their success is that deep networks learn to accumulate contextual information over very large receptive fields. However, this success comes at a cost, since the associated loss of effective spatial resolution washes out high-frequency details and leads to blurry object boundaries. Here, we propose to counter this effect by combining semantic segmentation with semantically informed edge detection, thus making class boundaries explicit in the model. First, we construct a comparatively simple, memory-efficient model by adding boundary detection to the SEGNET encoder-decoder architecture. Second, we also include boundary detection in FCN-type models and set up a high-end classifier ensemble. We show that boundary detection significantly improves semantic segmentation with CNNs in an end-to-end training scheme. Our best model achieves >90% overall accuracy on the ISPRS Vaihingen benchmark.

  17. DNA vaccine expressing herpes simplex virus 1 glycoprotein C and D protects mice against herpes simplex keratitis

    OpenAIRE

    Li-Li Dong; Ru Tang; Yu-Jia Zhai; Tejsu Malla; Kai Hu

    2017-01-01

    AIM: To investigate whether DNA vaccine encoding herpes simplex virus 1 (HSV-1) glycoprotein C (gC) and glycoprotein D (gD) will achieve better protective effect against herpes simplex keratitis (HSK) than DNA vaccine encoding gD alone. METHODS: DNA vaccine expressing gD or gC combined gD (gD.gC) were constructed and carried by chitosan nanoparticle. The expression of fusion protein gD and gC were detected in DNA/nanoparticle transfected 293T cells by Western-blot. For immunization, mice w...

  18. Genetic and phylogenetic characterization of the type II cyclobutane pyrimidine dimer photolyases encoded by Leporipoxviruses

    International Nuclear Information System (INIS)

    Bennett, C. James; Webb, Melissa; Willer, David O.; Evans, David H.

    2003-01-01

    Shope fibroma virus and myxoma virus encode proteins predicted to be Type II photolyases. These are enzymes that catalyze light-dependent repair of cyclobutane pyrimidine dimers (CPDs). When the Shope fibroma virus S127L gene was expressed in an Escherichia coli strain lacking functional CPD repair pathways, the expressed gene protected the bacteria from 70-75% of the ultraviolet (UV) light-induced cytotoxic DNA damage. This proportion suggests that Leporipoxvirus photolyases can only repair CPDs, which typically comprise ∼70% of the damage caused by short wavelength UV light. To test whether these enzymes can protect virus genomes from UV, we exposed virus suspensions to UV-C light followed by graded exposure to filtered visible light. Viruses encoding a deletion of the putative photolyase gene were unable to photoreactivate UV damage while this treatment again eliminated 70-90% of the lethal photoproducts in wild-type viruses. Western blotting detected photolyase protein in extracts prepared from purified virions and it can be deduced that the poxvirion interior must be fluid enough to permit diffusion of this ∼50-kDa DNA-binding protein to the sites where it catalyzes photoreactivation. Photolyase promoters are difficult to categorize using bioinformatics methods, as they do not obviously resemble any of the known poxvirus promoter motifs. By fusing the SFV promoter to DNA encoding a luciferase open reading frame, the photolyase promoter was found to exhibit very weak late promoter activity. These data show that the genomes of Leporipoxviruses, similar to that of fowlpox virus, encode catalytically active photolyases. Phylogenetic studies also confirmed the monophyletic origin of poxviruses and suggest an ancient origin for these genes and perhaps poxviruses

  19. Impaired odour discrimination on desynchronization of odour-encoding neural assemblies

    Science.gov (United States)

    Stopfer, Mark; Bhagavan, Seetha; Smith, Brian H.; Laurent, Gilles

    1997-11-01

    Stimulus-evoked oscillatory synchronization of neural assemblies has been described in the olfactory and visual systems of several vertebrates and invertebrates. In locusts, information about odour identity is contained in the timing of action potentials in an oscillatory population response, suggesting that oscillations may reflect a common reference for messages encoded in time. Although the stimulus-evoked oscillatory phenomenon is reliable, its roles in sensation, perception, memory formation and pattern recognition remain to be demonstrated - a task requiring a behavioural paradigm. Using honeybees, we now demonstrate that odour encoding involves, as it does in locusts, the oscillatory synchronization of assemblies of projection neurons and that this synchronization is also selectively abolished by picrotoxin, an antagonist of the GABAA (γ-aminobutyric acid) receptor. By using a behavioural learning paradigm, we show that picrotoxin-induced desynchronization impairs the discrimination of molecularly similar odorants, but not that of dissimilar odorants. It appears, therefore, that oscillatory synchronization of neuronal assemblies is functionally relevant, and essential for fine sensory discrimination. This suggests that oscillatory synchronization and the kind of temporal encoding it affords provide an additional dimension by which the brain could segment spatially overlapping stimulus representations.

  20. A magnetic bead-based method for concentrating DNA from human urine for downstream detection.

    Science.gov (United States)

    Bordelon, Hali; Russ, Patricia K; Wright, David W; Haselton, Frederick R

    2013-01-01

    Due to the presence of PCR inhibitors, PCR cannot be used directly on most clinical samples, including human urine, without pre-treatment. A magnetic bead-based strategy is one potential method to collect biomarkers from urine samples and separate the biomarkers from PCR inhibitors. In this report, a 1 mL urine sample was mixed within the bulb of a transfer pipette containing lyophilized nucleic acid-silica adsorption buffer and silica-coated magnetic beads. After mixing, the sample was transferred from the pipette bulb to a small diameter tube, and captured biomarkers were concentrated using magnetic entrainment of beads through pre-arrayed wash solutions separated by small air gaps. Feasibility was tested using synthetic segments of the 140 bp tuberculosis IS6110 DNA sequence spiked into pooled human urine samples. DNA recovery was evaluated by qPCR. Despite the presence of spiked DNA, no DNA was detectable in unextracted urine samples, presumably due to the presence of PCR inhibitors. However, following extraction with the magnetic bead-based method, we found that ∼50% of spiked TB DNA was recovered from human urine containing roughly 5×10(3) to 5×10(8) copies of IS6110 DNA. In addition, the DNA was concentrated approximately ten-fold into water. The final concentration of DNA in the eluate was 5×10(6), 14×10(6), and 8×10(6) copies/µL for 1, 3, and 5 mL urine samples, respectively. Lyophilized and freshly prepared reagents within the transfer pipette produced similar results, suggesting that long-term storage without refrigeration is possible. DNA recovery increased with the length of the spiked DNA segments from 10±0.9% for a 75 bp DNA sequence to 42±4% for a 100 bp segment and 58±9% for a 140 bp segment. The estimated LOD was 77 copies of DNA/µL of urine. The strategy presented here provides a simple means to achieve high nucleic acid recovery from easily obtained urine samples, which does not contain inhibitors of PCR.

  1. Cowpea Mosaic Virus-Encoded Protease Does Not Recognize Primary Translation Products of M RNAs from Other Comoviruses.

    Science.gov (United States)

    Goldbach, R; Krijt, J

    1982-09-01

    The protease encoded by the large (B) RNA segment of cowpea mosaic virus was tested for its ability to recognize the in vitro translation products of the small (M) RNA segment from the comoviruses squash mosaic virus, red clover mottle virus, and cowpea severe mosaic virus (CPsMV, strains Dg and Ark), and from the nepovirus tomato black ring virus. Like M RNA from cowpea mosaic virus, the M RNAs from squash mosaic virus, red clover mottle virus, CPsMV-Dg, and CPsMV-Ark were all translated into two large polypeptides with apparent molecular weights which were different for each virus and even for the two CPsMV strains. Neither the in vitro products from squash mosaic virus, red clover mottle virus, and CPsMV M RNAs nor the in vitro product from tomato black ring virus RNA-2 were processed by the cowpea mosaic virus-encoded protease, indicating that the activity of this enzyme is highly specific.

  2. Cloning of human genes encoding novel G protein-coupled receptors

    Energy Technology Data Exchange (ETDEWEB)

    Marchese, A.; Docherty, J.M.; Heiber, M. [Univ. of Toronto, (Canada)] [and others

    1994-10-01

    We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.

  3. A Traceless Aryl-Triazene Linker for DNA-Directed Chemistry

    DEFF Research Database (Denmark)

    Hejesen, Christian; Pedersen, Lars Kolster; Gothelf, Kurt Vesterager

    2013-01-01

    DNA-directed synthesis of encoded combinatorial libraries of small organic compounds most often involves transfer of organic building blocks from one DNA strand to another. This requires cleavable linkers to enable cleavage of the link to the original DNA strand from which the building block...... is transferred. Relatively few cleavable linkers are available for DNA-directed synthesis and most often they leave an amino group at the organic molecule. Here we have extended the application of 10 aryltriazenes as traceless linkers for DNA-directed synthesis. After reaction of one building block...

  4. Generation of Gene-Engineered Chimeric DNA Molecules for Specific Therapy of Autoimmune Diseases

    Science.gov (United States)

    Gesheva, Vera; Szekeres, Zsuzsanna; Mihaylova, Nikolina; Dimitrova, Iliyana; Nikolova, Maria; Erdei, Anna; Prechl, Jozsef

    2012-01-01

    Abstract Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by the development of self-reactive B and T cells and autoantibody production. In particular, double-stranded DNA-specific B cells play an important role in lupus progression, and their selective elimination is a reasonable approach for effective therapy of SLE. DNA-based vaccines aim at the induction of immune response against the vector-encoded antigen. Here, we are exploring, as a new DNA-based therapy of SLE, a chimeric DNA molecule encoding a DNA-mimotope peptide, and the Fv but not the immunogenic Fc fragment of an FcγRIIb-specific monoclonal antibody. This DNA construct was inserted in the expression vector pNut and used as a naked DNA vaccine in a mouse model of lupus. The chimeric DNA molecule can be expressed in eukaryotic cells and cross-links cell surface receptors on DNA-specific B cells, delivering an inhibitory intracellular signal. Intramuscular administration of the recombinant DNA molecule to lupus-prone MRL/lpr mice prevented increase in IgG anti-DNA antibodies and was associated with a low degree of proteinuria, modulation of cytokine profile, and suppression of lupus nephritis. PMID:23075110

  5. Cowpea Mosaic Virus-Encoded Protease Does Not Recognize Primary Translation Products of M RNAs from Other Comoviruses

    OpenAIRE

    Goldbach, Rob; Krijt, Jette

    1982-01-01

    The protease encoded by the large (B) RNA segment of cowpea mosaic virus was tested for its ability to recognize the in vitro translation products of the small (M) RNA segment from the comoviruses squash mosaic virus, red clover mottle virus, and cowpea severe mosaic virus (CPsMV, strains Dg and Ark), and from the nepovirus tomato black ring virus. Like M RNA from cowpea mosaic virus, the M RNAs from squash mosaic virus, red clover mottle virus, CPsMV-Dg, and CPsMV-Ark were all translated int...

  6. RPO41-independent maintenance of [rho-] mitochondrial DNA in Saccharomyces cerevisiae.

    Science.gov (United States)

    Fangman, W L; Henly, J W; Brewer, B J

    1990-01-01

    A subset of promoters in the mitochondrial DNA (mtDNA) of the yeast Saccharomyces cerevisiae has been proposed to participate in replication initiation, giving rise to a primer through site-specific cleavage of an RNA transcript. To test whether transcription is essential for mtDNA maintenance, we examined two simple mtDNA deletion ([rho-]) genomes in yeast cells. One genome (HS3324) contains a consensus promoter (ATATAAGTA) for the mitochondrial RNA polymerase encoded by the nuclear gene RPO41, and the other genome (4a) does not. As anticipated, in RPO41 cells transcripts from the HS3324 genome were more abundant than were transcripts from the 4a genome. When the RPO41 gene was disrupted, both [rho-] genomes were efficiently maintained. The level of transcripts from HS3324 mtDNA was decreased greater than 400-fold in cells carrying the RPO41 disrupted gene; however, the low-level transcripts from 4a mtDNA were undiminished. These results indicate that replication of [rho-] genomes can be initiated in the absence of wild-type levels of the RPO41-encoded RNA polymerase.

  7. Dendritic cell mediated delivery of plasmid DNA encoding LAMP/HIV-1 Gag fusion immunogen enhances T cell epitope responses in HLA DR4 transgenic mice.

    Directory of Open Access Journals (Sweden)

    Gregory G Simon

    2010-01-01

    Full Text Available This report describes the identification and bioinformatics analysis of HLA-DR4-restricted HIV-1 Gag epitope peptides, and the application of dendritic cell mediated immunization of DNA plasmid constructs. BALB/c (H-2d and HLA-DR4 (DRA1*0101, DRB1*0401 transgenic mice were immunized with immature dendritic cells transfected by a recombinant DNA plasmid encoding the lysosome-associated membrane protein-1/HIV-1 Gag (pLAMP/gag chimera antigen. Three immunization protocols were compared: 1 primary subcutaneous immunization with 1x10(5 immature dendritic cells transfected by electroporation with the pLAMP/gag DNA plasmid, and a second subcutaneous immunization with the naked pLAMP/gag DNA plasmid; 2 primary immunization as above, and a second subcutaneous immunization with a pool of overlapping peptides spanning the HIV-1 Gag sequence; and 3 immunization twice by subcutaneous injection of the pLAMP/gag DNA plasmid. Primary immunization with pLAMP/gag-transfected dendritic cells elicited the greatest number of peptide specific T-cell responses, as measured by ex vivo IFN-gamma ELISpot assay, both in BALB/c and HLA-DR4 transgenic mice. The pLAMP/gag-transfected dendritic cells prime and naked DNA boost immunization protocol also resulted in an increased apparent avidity of peptide in the ELISpot assay. Strikingly, 20 of 25 peptide-specific T-cell responses in the HLA-DR4 transgenic mice contained sequences that corresponded, entirely or partially to 18 of the 19 human HLA-DR4 epitopes listed in the HIV molecular immunology database. Selection of the most conserved epitope peptides as vaccine targets was facilitated by analysis of their representation and variability in all reported sequences. These data provide a model system that demonstrates a the superiority of immunization with dendritic cells transfected with LAMP/gag plasmid DNA, as compared to naked DNA, b the value of HLA transgenic mice as a model system for the identification and evaluation

  8. Discovery of cofactor-specific, bactericidal Mycobacterium tuberculosis InhA inhibitors using DNA-encoded library technology.

    Science.gov (United States)

    Soutter, Holly H; Centrella, Paolo; Clark, Matthew A; Cuozzo, John W; Dumelin, Christoph E; Guie, Marie-Aude; Habeshian, Sevan; Keefe, Anthony D; Kennedy, Kaitlyn M; Sigel, Eric A; Troast, Dawn M; Zhang, Ying; Ferguson, Andrew D; Davies, Gareth; Stead, Eleanor R; Breed, Jason; Madhavapeddi, Prashanti; Read, Jon A

    2016-12-06

    Millions of individuals are infected with and die from tuberculosis (TB) each year, and multidrug-resistant (MDR) strains of TB are increasingly prevalent. As such, there is an urgent need to identify novel drugs to treat TB infections. Current frontline therapies include the drug isoniazid, which inhibits the essential NADH-dependent enoyl-acyl-carrier protein (ACP) reductase, InhA. To inhibit InhA, isoniazid must be activated by the catalase-peroxidase KatG. Isoniazid resistance is linked primarily to mutations in the katG gene. Discovery of InhA inhibitors that do not require KatG activation is crucial to combat MDR TB. Multiple discovery efforts have been made against InhA in recent years. Until recently, despite achieving high potency against the enzyme, these efforts have been thwarted by lack of cellular activity. We describe here the use of DNA-encoded X-Chem (DEX) screening, combined with selection of appropriate physical properties, to identify multiple classes of InhA inhibitors with cell-based activity. The utilization of DEX screening allowed the interrogation of very large compound libraries (10 11 unique small molecules) against multiple forms of the InhA enzyme in a multiplexed format. Comparison of the enriched library members across various screening conditions allowed the identification of cofactor-specific inhibitors of InhA that do not require activation by KatG, many of which had bactericidal activity in cell-based assays.

  9. Application of encoded library technology (ELT) to a protein-protein interaction target: discovery of a potent class of integrin lymphocyte function-associated antigen 1 (LFA-1) antagonists.

    Science.gov (United States)

    Kollmann, Christopher S; Bai, Xiaopeng; Tsai, Ching-Hsuan; Yang, Hongfang; Lind, Kenneth E; Skinner, Steven R; Zhu, Zhengrong; Israel, David I; Cuozzo, John W; Morgan, Barry A; Yuki, Koichi; Xie, Can; Springer, Timothy A; Shimaoka, Motomu; Evindar, Ghotas

    2014-04-01

    The inhibition of protein-protein interactions remains a challenge for traditional small molecule drug discovery. Here we describe the use of DNA-encoded library technology for the discovery of small molecules that are potent inhibitors of the interaction between lymphocyte function-associated antigen 1 and its ligand intercellular adhesion molecule 1. A DNA-encoded library with a potential complexity of 4.1 billion compounds was exposed to the I-domain of the target protein and the bound ligands were affinity selected, yielding an enriched small-molecule hit family. Compounds representing this family were synthesized without their DNA encoding moiety and found to inhibit the lymphocyte function-associated antigen 1/intercellular adhesion molecule-1 interaction with submicromolar potency in both ELISA and cell adhesion assays. Re-synthesized compounds conjugated to DNA or a fluorophore were demonstrated to bind to cells expressing the target protein. Copyright © 2014 Elsevier Ltd. All rights reserved.

  10. In Situ Dark Adaptation Enhances the Efficiency of DNA Extraction from Mature Pin Oak (Quercus palustris Leaves, Facilitating the Identification of Partial Sequences of the 18S rRNA and Isoprene Synthase (IspS Genes

    Directory of Open Access Journals (Sweden)

    Csengele E. Barta

    2017-10-01

    Full Text Available Mature oak (Quercus spp. leaves, although abundantly available during the plants’ developmental cycle, are rarely exploited as viable sources of genomic DNA. These leaves are rich in metabolites difficult to remove during standard DNA purification, interfering with downstream molecular genetics applications. The current work assessed whether in situ dark adaptation, to deplete sugar reserves and inhibit secondary metabolite synthesis could compensate for the difficulties encountered when isolating DNA from mature leaves rich in secondary metabolites. We optimized a rapid, commercial kit based method to extract genomic DNA from dark- and light-adapted leaves. We demonstrated that in situ dark adaptation increases the yield and quality of genomic DNA obtained from mature oak leaves, yielding templates of sufficiently high quality for direct downstream applications, such as PCR amplification and gene identification. The quality of templates isolated from dark-adapted pin oak leaves particularly improved the amplification of larger fragments in our experiments. From DNA extracts prepared with our optimized method, we identified for the first time partial segments of the genes encoding 18S rRNA and isoprene synthase (IspS from pin oak (Quercus palustris, whose full genome has not yet been sequenced.

  11. Immunogenicity of a DNA-launched replicon-based canine parvovirus DNA vaccine expressing VP2 antigen in dogs.

    Science.gov (United States)

    Dahiya, Shyam S; Saini, Mohini; Kumar, Pankaj; Gupta, Praveen K

    2012-10-01

    A replicon-based DNA vaccine encoding VP2 gene of canine parvovirus (CPV) was developed by cloning CPV-VP2 gene into a replicon-based DNA vaccine vector (pAlpha). The characteristics of a replicon-based DNA vaccine like, self-amplification of transcripts and induction of apoptosis were analyzed in transfected mammalian cells. When the pAlpha-CPV-VP2 was injected intradermal as DNA-launched replicon-based DNA vaccine in dogs, it induced CPV-specific humoral and cell mediated immune responses. The virus neutralization antibody and lymphocyte proliferative responses were higher than conventional CPV DNA vaccine and commercial CPV vaccine. These results indicated that DNA-launched replicon-based CPV DNA vaccine was effective in inducing both CPV-specific humoral and cellular immune responses and can be considered as effective alternative to conventional CPV DNA vaccine and commercial CPV vaccine. Crown Copyright © 2012. Published by Elsevier India Pvt Ltd. All rights reserved.

  12. Efficacy of chimeric DNA vaccines encoding Eimeria tenella 5401 and chicken IFN-γ or IL-2 against coccidiosis in chickens.

    Science.gov (United States)

    Song, Xiaokai; Huang, Xinmei; Yan, Ruofeng; Xu, Lixin; Li, Xiangrui

    2015-09-01

    Chimeric DNA vaccines encoding Eimeria tenella (E. tenella) surface antigen 5401 were constructed and their efficacies against E. tenella challenge were studied. The open reading frame (ORF) of 5401 was cloned into the prokaryotic expression vector pGEX-4T2 to express the recombinant protein and the expressed recombinant protein was identified by Western blot. The ORF of 5401 and chicken cytokine gene IFN-γ or IL-2 were cloned into the eukaryotic expression vector pVAX1 consecutively to construct DNA vaccines pVAX-5401-IFN-γ, pVAX-5401-IL-2 and pVAX-5401. The expression of aim genes in vivo was detected by reverse transcription-polymerase chain reaction and Western blot. Fourteen-day-old chickens were inoculated twice at an interval of 7 days with 100 µg of plasmids pVAX-5401, pVAX-5401-IFN-γ and pVAX-5401-IL-2 or 200 µg of recombinant 5401 protein by leg intramuscular injection, respectively. Seven days after the second inoculation, all chickens except the unchallenged control group were challenged orally with 5 × 10(4) sporulated oocysts of E. tenella. Seven days after challenge, all chickens were weighted and slaughtered to determine the effects of immunization. The results showed the recombinant protein was about 90 kDa and reacted with antiserum against soluble sporozoites. The animal experiment showed that all the DNA vaccines pVAX-5401, pVAX-5401-IFN-γ or pVAX-5401-IL-2 and the recombinant 5401 protein could obviously alleviate body weight loss and cecal lesions as compared with non-vaccinated challenged control and empty vector pVAX1control. Furthermore, pVAX-5401-IFN-γ or pVAX-5401-IL-2 induced anti-coccidial index (ACI) of 180.01 or 177.24 which were significantly higher than that of pVAX-5401. The results suggested that 5401 was an effective candidate antigen for vaccine. This finding also suggested that chicken IFN-γ or IL-2 could effectively improve the efficacies of DNA vaccines against avian coccidiosis. Copyright © 2015 Elsevier

  13. The double par locus of virulence factor pB171: DNA segregation is correlated with oscillation of ParA

    DEFF Research Database (Denmark)

    Ebersbach, G; Gerdes, K; Charbon, Gitte Ebersbach

    2001-01-01

    Prokaryotic plasmids and chromosomes encode partitioning (par) loci that segregate DNA to daughter cells before cell division. Recent database analyses showed that almost all known par loci encode an ATPase and a DNA-binding protein, and one or more cis-acting regions where the proteins act. All...

  14. Structural changes of ultraviolet-irradiated DNA derived from hydrodynamic measurements

    International Nuclear Information System (INIS)

    Triebel, H.; Reinert, K.E.; Baeer, H.; Lang, H.

    1979-01-01

    The paper reports on sedimentation and viscosity measurements performed on ultraviolet-irradiated DNA from T7 phage and calf thymus. From the hydrodynamic data the relative changes in the mean molecular weight, radius of gyration, and effective Kuhn statistical segment length were calculated. The results show that ultraviolet irradiation (254 nm) leads to a significant decrease of the effective statistical segment length of DNA which may be due to small local helix kinks (produced by the generation of photodimers) and a local increase of chain flexibility. Alterations in the overall DNA conformation may be observed even at low fluence where the mean molecular weight almost stays constant. The locally distorted helix regions possibly may serve as recognition sites in the first step of excision repair. (Auth.)

  15. A damage-responsive DNA binding protein regulates transcription of the yeast DNA repair gene PHR1

    International Nuclear Information System (INIS)

    Sebastian, J.; Sancar, G.B.

    1991-01-01

    The PHR1 gene of Saccharomyces cerevisiae encodes the DNA repair enzyme photolyase. Transcription of PHR1 increases in response to treatment of cells with 254-nm radiation and chemical agents that damage DNA. The authors here the identification of a damage-responsive DNA binding protein, termed photolyase regulatory protein (PRP), and its cognate binding site, termed the PHR1 transcription after DNA damage. PRP activity, monitored by electrophoretic-mobility-shift assay, was detected in cells during normal growth but disappeared within 30 min after irradiation. Copper-phenanthroline footprinting of PRP-DNA complexes revealed that PRP protects a 39-base-pair region of PHR1 5' flanking sequence beginning 40 base pairs upstream from the coding sequence. Thus these observations establish that PRP is a damage-responsive repressor of PHR1 transcription

  16. Cloning of a cDNA encoding the rat high molecular weight neurofilament peptide (NF-H): Developmental and tissue expression in the rat, and mapping of its human homologue to chromosomes 1 and 22

    International Nuclear Information System (INIS)

    Lieberburg, I.; Spinner, N.; Snyder, S.

    1989-01-01

    Neurofilaments (NFs) are the intermediate filaments specific to nervous tissue. Three peptides with apparent molecular masses of approximately 68 (NF-L), 145 (NF-M), and 200 (NF-H) kDa appear to be the major components of NF. The expression of these peptides is specific to nervous tissue and is developmentally regulated. Recently, complete cDNAs encoding NF-L and NF-M, and partial cDNAs encoding NF-H, have been described. To better understand the normal pathophysiology of NFs the authors chose to clone the cDNA encoding the rat NF-H peptide. Using monoclonal antibodies that recognized NF-H, they screened a rat brain λgt11 library and identified a clone that contained a 2,100-nucleotide cDNA insert representing the carboxyl-terminal portion of the NF-H protein. Levels of NF-H mRNA varied 20-fold among brain regions, with highest levels in pons/medulla, spinal cord, and cerebellum, and lowest levels in olfactory bulb and hypothalamus. Based on these results, the authors infer that half of the developmental increase and most of the interregional variation in the levels of the NF-H mRNA are mediated through message stabilization. Sequence information revealed that the carboxyl-terminal region of the NF-H peptide contained a unique serine-, proline-, alanine-, glutamic acid-, and lysine-rich repeat. Genomic blots revealed a single copy of the gene in the rat genome and two copies in the human genome. In situ hybridizations performed on human chromosomes mapped the NF-H gene to chromosomes 1 and 22

  17. AN IMPROVED FUZZY CLUSTERING ALGORITHM FOR MICROARRAY IMAGE SPOTS SEGMENTATION

    Directory of Open Access Journals (Sweden)

    V.G. Biju

    2015-11-01

    Full Text Available An automatic cDNA microarray image processing using an improved fuzzy clustering algorithm is presented in this paper. The spot segmentation algorithm proposed uses the gridding technique developed by the authors earlier, for finding the co-ordinates of each spot in an image. Automatic cropping of spots from microarray image is done using these co-ordinates. The present paper proposes an improved fuzzy clustering algorithm Possibility fuzzy local information c means (PFLICM to segment the spot foreground (FG from background (BG. The PFLICM improves fuzzy local information c means (FLICM algorithm by incorporating typicality of a pixel along with gray level information and local spatial information. The performance of the algorithm is validated using a set of simulated cDNA microarray images added with different levels of AWGN noise. The strength of the algorithm is tested by computing the parameters such as the Segmentation matching factor (SMF, Probability of error (pe, Discrepancy distance (D and Normal mean square error (NMSE. SMF value obtained for PFLICM algorithm shows an improvement of 0.9 % and 0.7 % for high noise and low noise microarray images respectively compared to FLICM algorithm. The PFLICM algorithm is also applied on real microarray images and gene expression values are computed.

  18. Segment-specific terminal sequences of Bunyamwera bunyavirus regulate genome replication

    International Nuclear Information System (INIS)

    Barr, John N.; Elliott, Richard M.; Dunn, Ewan F.; Wertz, Gail W.

    2003-01-01

    Bunyamwera virus (BUNV) is the prototype of both the Orthobunyavirus genus and the Bunyaviridae family of segmented negative sense RNA viruses. The tripartite BUNV genome consists of small (S), medium (M), and large (L) segments that are transcribed to give a single mRNA and replicated to generate an antigenome that is the template for synthesis of further genomic RNA strands. We modified an existing cDNA-derived RNA synthesis system to allow identification of BUNV RNA replication and transcription products by direct metabolic labeling. Direct RNA analysis allowed us to distinguish between template activities that affected either RNA replication or mRNA transcription, an ability that was not possible using previous reporter gene expression assays. We generated genome analogs containing the entire nontranslated terminal sequences of the S, M, and L BUNV segments surrounding a common sequence. Analysis of RNAs synthesized from these templates revealed that the relative abilities of BUNV segments to perform RNA replication was M > L > S. Exchange of segment-specific terminal nucleotides identified a 12-nt region located within both the 3' and 5' termini of the M segment that correlated with its high replication ability

  19. Nucleotide sequence of the hexA gene for DNA mismatch repair in Streptococcus pneumoniae and homology of hexA to mutS of Escherichia coli and Salmonella typhimurium

    International Nuclear Information System (INIS)

    Priebe, S.D.; Hadi, S.M.; Greenberg, B.; Lacks, S.A.

    1988-01-01

    The Hex system of heteroduplex DNA base mismatch repair operates in Streptococcus pneumoniae after transformation and replication to correct donor and nascent DNA strands, respectively. A functionally similar system, called Mut, operates in Escherichia coli and Salmonella typhimurium. The nucleotide sequence of a 3.8-kilobase segment from the S. pneumoniae chromosome that includes the 2.7-kilobase hexA gene was determined. Chromosomal DNA used as donor to measure Hex phenotype was irradiated with UV light. An open reading frame that could encode a 17-kilodalton polypeptide (OrfC) was located just upstream of the gene encoding a polypeptide of 95 kilodaltons corresponding to HexA. Shine-Dalgarno sequences and putative promoters were identified upstream of each protein start site. Insertion mutations showed that only HexA functioned in mismatch repair and that the promoter for hexA transcription was located within the OrfC-coding region. The HexA polypeptide contains a consensus sequence for ATP- or GTP-binding sites in proteins. Comparison of the entire HexA protein sequence to that of MutS of S. typhimurium, showed the proteins to be homologous, inasmuch as 36% of their amino acid residues were identical. This homology indicates that the Hex and Mut systems of mismatch repair evolved from an ancestor common to the gram-positive streptococci and the gram-negative enterobacteria. It is the first direct evidence linking the two systems

  20. DNA gyrase with a single catalytic tyrosine can catalyze DNA supercoiling by a nicking-closing mechanism

    Science.gov (United States)

    Gubaev, Airat; Weidlich, Daniela; Klostermeier, Dagmar

    2016-01-01

    The topological state of DNA is important for replication, recombination and transcription, and is regulated in vivo by DNA topoisomerases. Gyrase introduces negative supercoils into DNA at the expense of ATP hydrolysis. It is the accepted view that gyrase achieves supercoiling by a strand passage mechanism, in which double-stranded DNA is cleaved, and a second double-stranded segment is passed through the gap, converting a positive DNA node into a negative node. We show here that gyrase with only one catalytic tyrosine that cleaves a single strand of its DNA substrate can catalyze DNA supercoiling without strand passage. We propose an alternative mechanism for DNA supercoiling via nicking and closing of DNA that involves trapping, segregation and relaxation of two positive supercoils. In contrast to DNA supercoiling, ATP-dependent relaxation and decatenation of DNA by gyrase lacking the C-terminal domains require both tyrosines and strand passage. Our results point towards mechanistic plasticity of gyrase and might pave the way for finding novel and specific mechanism-based gyrase inhibitors. PMID:27557712

  1. An improved K-means clustering method for cDNA microarray image segmentation.

    Science.gov (United States)

    Wang, T N; Li, T J; Shao, G F; Wu, S X

    2015-07-14

    Microarray technology is a powerful tool for human genetic research and other biomedical applications. Numerous improvements to the standard K-means algorithm have been carried out to complete the image segmentation step. However, most of the previous studies classify the image into two clusters. In this paper, we propose a novel K-means algorithm, which first classifies the image into three clusters, and then one of the three clusters is divided as the background region and the other two clusters, as the foreground region. The proposed method was evaluated on six different data sets. The analyses of accuracy, efficiency, expression values, special gene spots, and noise images demonstrate the effectiveness of our method in improving the segmentation quality.

  2. Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

    OpenAIRE

    Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

    1988-01-01

    Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding t...

  3. Evaluation of humoral and cellular immune responses to a DNA vaccine encoding chicken type II collagen for rheumatoid arthritis in normal rats.

    Science.gov (United States)

    Xiao, Zhao; Juan, Long; Song, Yun; Zhijian, Zhang; Jing, Jin; Kun, Yu; Yuna, Hao; Dongfa, Dai; Lili, Ding; Liuxin, Tan; Fei, Liang; Nan, Liu; Fang, Yuan; Yuying, Sun; Yongzhi, Xi

    2015-01-01

    A major challenge in the development of effective therapies for rheumatoid arthritis (RA) is finding a method for the specific inhibition of the inflammatory disease processes without the induction of generalized immunosuppression. Of note, the development of therapeutic DNA vaccines and boosters that may restore immunological tolerance remains a high priority. pcDNA-CCOL2A1 is a therapeutic DNA vaccine encoding chicken type II collagen(CCII). This vaccine was developed by our laboratory and has been shown to exhibit efficacy comparable to that of the current "gold standard" treatment, methotrexate (MTX). Here, we used enzyme-linked immunosorbent assays with anti-CII IgG antibodies, quantified the expression levels of Th1, Th2, and Th3 cytokines, and performed flow cytometric analyses of different T-cell subsets, including Th1, Th2, Th17, Tc, Ts, Treg, and CD4(+)CD29(+)T cells to systemically evaluate humoral and cellular immune responses to pcDNA-CCOL2A1 vaccine in normal rats. Similar to our observations at maximum dosage of 3 mg/kg, vaccination of normal rats with 300 μg/kg pcDNA-CCOL2A1 vaccine did not induce the production of anti-CII IgG. Furthermore, no significant changes were observed in the expression levels of pro-inflammatory cytokines interleukin (IL)-1α, IL-5, IL-6, IL-12(IL-23p40), monocyte chemotactic protein (MCP)-1, macrophage inflammatory protein (MIP)-1α, regulated on activation in normal T-cell expressed and secreted (RANTES), receptor activator for nuclear factor-κB ligand (RANKL), and granulocyte colony-stimulating factor (G-CSF) or anti-inflammatory cytokines IL-4 and IL-10 in vaccinated normal rats relative to that in controls(P > 0.05). However, transforming growth factor (TGF)-β levels were significantly increased on days 10 and 14, while interferon (IFN)-γ and tumor necrosis factor (TNF)-α levels were significantly decreased on days 28 and 35 after vaccination(P 0.05), with the exception of Treg cells, which were significantly

  4. CC1, a novel crenarchaeal DNA binding protein.

    Science.gov (United States)

    Luo, Xiao; Schwarz-Linek, Uli; Botting, Catherine H; Hensel, Reinhard; Siebers, Bettina; White, Malcolm F

    2007-01-01

    The genomes of the related crenarchaea Pyrobaculum aerophilum and Thermoproteus tenax lack any obvious gene encoding a single-stranded DNA binding protein (SSB). SSBs are essential for DNA replication, recombination, and repair and are found in all other genomes across the three domains of life. These two archaeal genomes also have only one identifiable gene encoding a chromatin protein (the Alba protein), while most other archaea have at least two different abundant chromatin proteins. We performed a biochemical screen for novel nucleic acid binding proteins present in cell extracts of T. tenax. An assay for proteins capable of binding to a single-stranded DNA oligonucleotide resulted in identification of three proteins. The first protein, Alba, has been shown previously to bind single-stranded DNA as well as duplex DNA. The two other proteins, which we designated CC1 (for crenarchaeal chromatin protein 1), are very closely related to one another, and homologs are restricted to the P. aerophilum and Aeropyrum pernix genomes. CC1 is a 6-kDa, monomeric, basic protein that is expressed at a high level in T. tenax. This protein binds single- and double-stranded DNAs with similar affinities. These properties are consistent with a role for CC1 as a crenarchaeal chromatin protein.

  5. The mitochondrial gene encoding ribosomal protein S12 has been translocated to the nuclear genome in Oenothera.

    Science.gov (United States)

    Grohmann, L; Brennicke, A; Schuster, W

    1992-01-01

    The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526

  6. Cloning and functional expression of a cDNA encoding stearoyl-ACP Δ9-desaturase from the endosperm of coconut (Cocos nucifera L.).

    Science.gov (United States)

    Gao, Lingchao; Sun, Ruhao; Liang, Yuanxue; Zhang, Mengdan; Zheng, Yusheng; Li, Dongdong

    2014-10-01

    Coconut (Cocos nucifera L.) is an economically tropical fruit tree with special fatty acid compositions. The stearoyl-acyl carrier protein (ACP) desaturase (SAD) plays a key role in the properties of the majority of cellular glycerolipids. In this paper, a full-length cDNA of a stearoyl-acyl carrier protein desaturase, designated CocoFAD, was isolated from cDNA library prepared from the endosperm of coconut (C. nucifera L.). An 1176 bp cDNA from overlapped PCR products containing ORF encoding a 391-amino acid (aa) protein was obtained. The coded protein was virtually identical and shared the homology to other Δ9-desaturase plant sequences (greater than 80% as similarity to that of Elaeis guineensis Jacq). The real-time fluorescent quantitative PCR result indicated that the yield of CocoFAD was the highest in the endosperm of 8-month-old coconut and leaf, and the yield was reduced to 50% of the highest level in the endosperm of 15-month-old coconut. The coding region showed heterologous expression in strain INVSc1 of yeast (Saccharomyces cerevisiae). GC-MS analysis showed that the levels of palmitoleic acid (16:1) and oleic acid (18:1) were improved significantly; meanwhile stearic acid (18:0) was reduced. These results indicated that the plastidial Δ9 desaturase from the endosperm of coconut was involved in the biosynthesis of hexadecenoic acid and octadecenoic acid, which was similar with other plants. These results may be valuable for understanding the mechanism of fatty acid metabolism and the genetic improvement of CocoFAD gene in palm plants in the future. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. DNA Sequences of RAPD Fragments in the Egyptian cotton ...

    African Journals Online (AJOL)

    Random Amplified Polymorphic DNAs (RAPDs) is a DNA polymorphism assay based on the amplification of random DNA segments with single primers of arbitrary nucleotide sequence. Despite the fact that the RAPD technique has become a very powerful tool and has found use in numerous applications, yet, the nature of ...

  8. Optical Characterization of Oligonucleotide DNA Influenced by Magnetic Fields

    Directory of Open Access Journals (Sweden)

    Seyedeh Maryam Banihashemian

    2013-09-01

    Full Text Available UV-VIS spectroscopic analysis of oligonucleotide DNA exposed to different magnetic fields was performed in order to investigate the relationship between DNA extinction coefficients and optical parameters according to magnetic-field strength. The results with the oligonucleotides adenine-thymine 100 mer (AT-100 DNA and cytosine-guanine 100 mer (CG-100 DNA indicate that the magnetic field influences DNA molar extinction coefficients and refractive indexes. The imaginary parts of the refractive index and molar extinction coefficients of the AT-100 and CG-100 DNA decreased after exposure to a magnetic field of 750 mT due to cleavage of the DNA oligonucleotides into smaller segments.

  9. Protocols for 16S rDNA Array Analyses of Microbial Communities by Sequence-Specific Labeling of DNA Probes

    Directory of Open Access Journals (Sweden)

    Knut Rudi

    2003-01-01

    Full Text Available Analyses of complex microbial communities are becoming increasingly important. Bottlenecks in these analyses, however, are the tools to actually describe the biodiversity. Novel protocols for DNA array-based analyses of microbial communities are presented. In these protocols, the specificity obtained by sequence-specific labeling of DNA probes is combined with the possibility of detecting several different probes simultaneously by DNA array hybridization. The gene encoding 16S ribosomal RNA was chosen as the target in these analyses. This gene contains both universally conserved regions and regions with relatively high variability. The universally conserved regions are used for PCR amplification primers, while the variable regions are used for the specific probes. Protocols are presented for DNA purification, probe construction, probe labeling, and DNA array hybridizations.

  10. DNA requirements for interaction of the C-terminal region of Ku80 with the DNA-dependent protein kinase catalytic subunit (DNA-PKcs).

    Science.gov (United States)

    Radhakrishnan, Sarvan Kumar; Lees-Miller, Susan P

    2017-09-01

    Non-homologous end joining (NHEJ) is the major pathway for the repair of ionizing radiation induced DNA double strand breaks (DSBs) in human cells. Critical to NHEJ is the DNA-dependent interaction of the Ku70/80 heterodimer with the DNA-dependent protein kinase catalytic subunit (DNA-PKcs) to form the DNA-PK holoenzyme. However, precisely how Ku recruits DNA-PKcs to DSBs ends to enhance its kinase activity has remained enigmatic, with contradictory findings reported in the literature. Here we address the role of the Ku80 C-terminal region (CTR) in the DNA-dependent interaction of Ku70/80 with DNA-PKcs using purified components and defined DNA structures. Our results show that the Ku80 CTR is required for interaction with DNA-PKcs on short segments of blunt ended 25bp dsDNA or 25bp dsDNA with a 15-base poly dA single stranded (ss) DNA extension, but this requirement is less stringent on longer dsDNA molecules (35bp blunt ended dsDNA) or 25bp duplex DNA with either a 15-base poly dT or poly dC ssDNA extension. Moreover, the DNA-PKcs-Ku complex preferentially forms on 25 bp DNA with a poly-pyrimidine ssDNA extension.Our work clarifies the role of the Ku80 CTR and dsDNA ends on the interaction of DNA-PKcs with Ku and provides key information to guide assembly and biology of NHEJ complexes. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. DNA vaccines for aquacultured fish

    DEFF Research Database (Denmark)

    Lorenzen, Niels; LaPatra, S.E.

    2005-01-01

    of licensing and public acceptance of the technology. The potential benefits of DNA vaccines for farmed fish include improved animal welfare, reduced environmental impacts of aquaculture activities, increased food quality and quantity, and more sustainable production. Testing under commercial production......Deoxyribonucleic acid (DNA) vaccination is based on the administration of the gene encoding the vaccine antigen, rather than the antigen itself. Subsequent expression of the antigen by cells in the vaccinated hosts triggers the host immune system. Among the many experimental DNA vaccines tested...... in various animal species as well as in humans, the vaccines against rhabdovirus diseases in fish have given some of the most promising results. A single intramuscular (IM) injection of microgram amounts of DNA induces rapid and long-lasting protection in farmed salmonids against economically important...

  12. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

    Science.gov (United States)

    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich

    1998-01-01

    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820

  13. Signals of historical interlocus gene conversion in human segmental duplications.

    Directory of Open Access Journals (Sweden)

    Beth L Dumont

    Full Text Available Standard methods of DNA sequence analysis assume that sequences evolve independently, yet this assumption may not be appropriate for segmental duplications that exchange variants via interlocus gene conversion (IGC. Here, we use high quality multiple sequence alignments from well-annotated segmental duplications to systematically identify IGC signals in the human reference genome. Our analysis combines two complementary methods: (i a paralog quartet method that uses DNA sequence simulations to identify a statistical excess of sites consistent with inter-paralog exchange, and (ii the alignment-based method implemented in the GENECONV program. One-quarter (25.4% of the paralog families in our analysis harbor clear IGC signals by the quartet approach. Using GENECONV, we identify 1477 gene conversion tracks that cumulatively span 1.54 Mb of the genome. Our analyses confirm the previously reported high rates of IGC in subtelomeric regions and Y-chromosome palindromes, and identify multiple novel IGC hotspots, including the pregnancy specific glycoproteins and the neuroblastoma breakpoint gene families. Although the duplication history of a paralog family is described by a single tree, we show that IGC has introduced incredible site-to-site variation in the evolutionary relationships among paralogs in the human genome. Our findings indicate that IGC has left significant footprints in patterns of sequence diversity across segmental duplications in the human genome, out-pacing the contributions of single base mutation by orders of magnitude. Collectively, the IGC signals we report comprise a catalog that will provide a critical reference for interpreting observed patterns of DNA sequence variation across duplicated genomic regions, including targets of recent adaptive evolution in humans.

  14. Cloning and expression of cDNA coding for bouganin.

    Science.gov (United States)

    den Hartog, Marcel T; Lubelli, Chiara; Boon, Louis; Heerkens, Sijmie; Ortiz Buijsse, Antonio P; de Boer, Mark; Stirpe, Fiorenzo

    2002-03-01

    Bouganin is a ribosome-inactivating protein that recently was isolated from Bougainvillea spectabilis Willd. In this work, the cloning and expression of the cDNA encoding for bouganin is described. From the cDNA, the amino-acid sequence was deduced, which correlated with the primary sequence data obtained by amino-acid sequencing on the native protein. Bouganin is synthesized as a pro-peptide consisting of 305 amino acids, the first 26 of which act as a leader signal while the 29 C-terminal amino acids are cleaved during processing of the molecule. The mature protein consists of 250 amino acids. Using the cDNA sequence encoding the mature protein of 250 amino acids, a recombinant protein was expressed, purified and characterized. The recombinant molecule had similar activity in a cell-free protein synthesis assay and had comparable toxicity on living cells as compared to the isolated native bouganin.

  15. Segment-based dose optimization using a genetic algorithm

    International Nuclear Information System (INIS)

    Cotrutz, Cristian; Xing Lei

    2003-01-01

    Intensity modulated radiation therapy (IMRT) inverse planning is conventionally done in two steps. Firstly, the intensity maps of the treatment beams are optimized using a dose optimization algorithm. Each of them is then decomposed into a number of segments using a leaf-sequencing algorithm for delivery. An alternative approach is to pre-assign a fixed number of field apertures and optimize directly the shapes and weights of the apertures. While the latter approach has the advantage of eliminating the leaf-sequencing step, the optimization of aperture shapes is less straightforward than that of beamlet-based optimization because of the complex dependence of the dose on the field shapes, and their weights. In this work we report a genetic algorithm for segment-based optimization. Different from a gradient iterative approach or simulated annealing, the algorithm finds the optimum solution from a population of candidate plans. In this technique, each solution is encoded using three chromosomes: one for the position of the left-bank leaves of each segment, the second for the position of the right-bank and the third for the weights of the segments defined by the first two chromosomes. The convergence towards the optimum is realized by crossover and mutation operators that ensure proper exchange of information between the three chromosomes of all the solutions in the population. The algorithm is applied to a phantom and a prostate case and the results are compared with those obtained using beamlet-based optimization. The main conclusion drawn from this study is that the genetic optimization of segment shapes and weights can produce highly conformal dose distribution. In addition, our study also confirms previous findings that fewer segments are generally needed to generate plans that are comparable with the plans obtained using beamlet-based optimization. Thus the technique may have useful applications in facilitating IMRT treatment planning

  16. Segmental heterogeneity of enzymatic response during compensatory renal growth

    International Nuclear Information System (INIS)

    Hoang, T.; Bergeron, M.

    1985-01-01

    The activities of DNA polymerase α and key enzymes of gluconeogenesis and glycolysis were measured in different segments of the rat nephron at various times (up to 96 hrs) following a unilateral nephrectomy (UNx). Tubule fragments were obtained after collagenase treatment followed by centrifugation on a Percoll gradient. The DNA polymerase α activity in control rats showed moderate and similar values in different segmental extracts as well as in the whole kidney extract (1700-1800 μμmole[ 3 H] dAMP/mg DNA). In Unx rats, activity in proximal tubules (PT) measured at 24, 48, 72 and 96 hrs after nephrectomy represented an increase of 60%, 200%, 420% and 370% respectively over control values. Distal tubule fragments (DT) showed only minor increases. The results demonstrate that the proximal tubule accounts for most of the compensatory renal growth (CRG) in the remaining kidney. The gluconeogenic and glycolytic enzymes were confined to the PT and those of glycolysis to the DT fragments. Following UNx, the specific activities of these enzymes were not modified in the remaining kidney; however, the overall activity of gluconeogenesis was increased as a result of the cell hyperplasia occurring in the PT. The work also illustrates that biochemical studies of CRG on the whole organ may provide misleading information due to the presence of heterogeneous cell populations in the mammalian kidney and to their uneven response in CRG

  17. Tyramine Hydrochloride Based Label-Free System for Operating Various DNA Logic Gates and a DNA Caliper for Base Number Measurements.

    Science.gov (United States)

    Fan, Daoqing; Zhu, Xiaoqing; Dong, Shaojun; Wang, Erkang

    2017-07-05

    DNA is believed to be a promising candidate for molecular logic computation, and the fluorogenic/colorimetric substrates of G-quadruplex DNAzyme (G4zyme) are broadly used as label-free output reporters of DNA logic circuits. Herein, for the first time, tyramine-HCl (a fluorogenic substrate of G4zyme) is applied to DNA logic computation and a series of label-free DNA-input logic gates, including elementary AND, OR, and INHIBIT logic gates, as well as a two to one encoder, are constructed. Furthermore, a DNA caliper that can measure the base number of target DNA as low as three bases is also fabricated. This DNA caliper can also perform concatenated AND-AND logic computation to fulfil the requirements of sophisticated logic computing. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Tensor GSVD of patient- and platform-matched tumor and normal DNA copy-number profiles uncovers chromosome arm-wide patterns of tumor-exclusive platform-consistent alterations encoding for cell transformation and predicting ovarian cancer survival.

    Directory of Open Access Journals (Sweden)

    Preethi Sankaranarayanan

    Full Text Available The number of large-scale high-dimensional datasets recording different aspects of a single disease is growing, accompanied by a need for frameworks that can create one coherent model from multiple tensors of matched columns, e.g., patients and platforms, but independent rows, e.g., probes. We define and prove the mathematical properties of a novel tensor generalized singular value decomposition (GSVD, which can simultaneously find the similarities and dissimilarities, i.e., patterns of varying relative significance, between any two such tensors. We demonstrate the tensor GSVD in comparative modeling of patient- and platform-matched but probe-independent ovarian serous cystadenocarcinoma (OV tumor, mostly high-grade, and normal DNA copy-number profiles, across each chromosome arm, and combination of two arms, separately. The modeling uncovers previously unrecognized patterns of tumor-exclusive platform-consistent co-occurring copy-number alterations (CNAs. We find, first, and validate that each of the patterns across only 7p and Xq, and the combination of 6p+12p, is correlated with a patient's prognosis, is independent of the tumor's stage, the best predictor of OV survival to date, and together with stage makes a better predictor than stage alone. Second, these patterns include most known OV-associated CNAs that map to these chromosome arms, as well as several previously unreported, yet frequent focal CNAs. Third, differential mRNA, microRNA, and protein expression consistently map to the DNA CNAs. A coherent picture emerges for each pattern, suggesting roles for the CNAs in OV pathogenesis and personalized therapy. In 6p+12p, deletion of the p21-encoding CDKN1A and p38-encoding MAPK14 and amplification of RAD51AP1 and KRAS encode for human cell transformation, and are correlated with a cell's immortality, and a patient's shorter survival time. In 7p, RPA3 deletion and POLD2 amplification are correlated with DNA stability, and a longer survival

  19. MMS exposure promotes increased MtDNA mutagenesis in the presence of replication-defective disease-associated DNA polymerase γ variants.

    Science.gov (United States)

    Stumpf, Jeffrey D; Copeland, William C

    2014-10-01

    Mitochondrial DNA (mtDNA) encodes proteins essential for ATP production. Mutant variants of the mtDNA polymerase cause mutagenesis that contributes to aging, genetic diseases, and sensitivity to environmental agents. We interrogated mtDNA replication in Saccharomyces cerevisiae strains with disease-associated mutations affecting conserved regions of the mtDNA polymerase, Mip1, in the presence of the wild type Mip1. Mutant frequency arising from mtDNA base substitutions that confer erythromycin resistance and deletions between 21-nucleotide direct repeats was determined. Previously, increased mutagenesis was observed in strains encoding mutant variants that were insufficient to maintain mtDNA and that were not expected to reduce polymerase fidelity or exonuclease proofreading. Increased mutagenesis could be explained by mutant variants stalling the replication fork, thereby predisposing the template DNA to irreparable damage that is bypassed with poor fidelity. This hypothesis suggests that the exogenous base-alkylating agent, methyl methanesulfonate (MMS), would further increase mtDNA mutagenesis. Mitochondrial mutagenesis associated with MMS exposure was increased up to 30-fold in mip1 mutants containing disease-associated alterations that affect polymerase activity. Disrupting exonuclease activity of mutant variants was not associated with increased spontaneous mutagenesis compared with exonuclease-proficient alleles, suggesting that most or all of the mtDNA was replicated by wild type Mip1. A novel subset of C to G transversions was responsible for about half of the mutants arising after MMS exposure implicating error-prone bypass of methylated cytosines as the predominant mutational mechanism. Exposure to MMS does not disrupt exonuclease activity that suppresses deletions between 21-nucleotide direct repeats, suggesting the MMS-induce mutagenesis is not explained by inactivated exonuclease activity. Further, trace amounts of CdCl2 inhibit mtDNA replication but

  20. A non extensive approach for DNA breaking by ionizing radiation

    OpenAIRE

    Sotolongo-Costa, O; Guzman, F; Antoranz, JC; Rodgers, GJ; Rodriguez, O; Arruda Neto, JDT; Deepman, A

    2002-01-01

    Tsallis entropy and a maximum entropy principle allows to reproduce experimental data of DNA double strand breaking by electron and neutron radiation. Analytic results for the probability of finding a DNA segment of length l are obtained reproducing quite well the fragment distribution function experimentally obtained.

  1. A Multiantigenic DNA Vaccine That Induces Broad Hepatitis C Virus-Specific T-Cell Responses in Mice.

    Science.gov (United States)

    Gummow, Jason; Li, Yanrui; Yu, Wenbo; Garrod, Tamsin; Wijesundara, Danushka; Brennan, Amelia J; Mullick, Ranajoy; Voskoboinik, Ilia; Grubor-Bauk, Branka; Gowans, Eric J

    2015-08-01

    There are 3 to 4 million new hepatitis C virus (HCV) infections annually around the world, but no vaccine is available. Robust T-cell mediated responses are necessary for effective clearance of the virus, and DNA vaccines result in a cell-mediated bias. Adjuvants are often required for effective vaccination, but during natural lytic viral infections damage-associated molecular patterns (DAMPs) are released, which act as natural adjuvants. Hence, a vaccine that induces cell necrosis and releases DAMPs will result in cell-mediated immunity (CMI), similar to that resulting from natural lytic viral infection. We have generated a DNA vaccine with the ability to elicit strong CMI against the HCV nonstructural (NS) proteins (3, 4A, 4B, and 5B) by encoding a cytolytic protein, perforin (PRF), and the antigens on a single plasmid. We examined the efficacy of the vaccines in C57BL/6 mice, as determined by gamma interferon enzyme-linked immunosorbent spot assay, cell proliferation studies, and intracellular cytokine production. Initially, we showed that encoding the NS4A protein in a vaccine which encoded only NS3 reduced the immunogenicity of NS3, whereas including PRF increased NS3 immunogenicity. In contrast, the inclusion of NS4A increased the immunogenicity of the NS3, NS4B, andNS5B proteins, when encoded in a DNA vaccine that also encoded PRF. Finally, vaccines that also encoded PRF elicited similar levels of CMI against each protein after vaccination with DNA encoding NS3, NS4A, NS4B, and NS5B compared to mice vaccinated with DNA encoding only NS3 or NS4B/5B. Thus, we have developed a promising "multiantigen" vaccine that elicits robust CMI. Since their development, vaccines have reduced the global burden of disease. One strategy for vaccine development is to use commercially viable DNA technology, which has the potential to generate robust immune responses. Hepatitis C virus causes chronic liver infection and is a leading cause of liver cancer. To date, no vaccine is

  2. Heterologous expression of a Rauvolfia cDNA encoding strictosidine glucosidase, a biosynthetic key to over 2000 monoterpenoid indole alkaloids.

    Science.gov (United States)

    Gerasimenko, Irina; Sheludko, Yuri; Ma, Xueyan; Stöckigt, Joachim

    2002-04-01

    Strictosidine glucosidase (SG) is an enzyme that catalyses the second step in the biosynthesis of various classes of monoterpenoid indole alkaloids. Based on the comparison of cDNA sequences of SG from Catharanthus roseus and raucaffricine glucosidase (RG) from Rauvolfia serpentina, primers for RT-PCR were designed and the cDNA encoding SG was cloned from R. serpentina cell suspension cultures. The active enzyme was expressed in Escherichia coli and purified to homogeneity. Analysis of its deduced amino-acid sequence assigned the SG from R. serpentina to family 1 of glycosyl hydrolases. In contrast to the SG from C. roseus, the enzyme from R. serpentina is predicted to lack an uncleavable N-terminal signal sequence, which is believed to direct proteins to the endoplasmic reticulum. The temperature and pH optimum, enzyme kinetic parameters and substrate specificity of the heterologously expressed SG were studied and compared to those of the C. roseus enzyme, revealing some differences between the two glucosidases. In vitro deglucosylation of strictosidine by R. serpentina SG proceeds by the same mechanism as has been shown for the C. roseus enzyme preparation. The reaction gives rise to the end product cathenamine and involves 4,21-dehydrocorynantheine aldehyde as an intermediate. The enzymatic hydrolysis of dolichantoside (Nbeta-methylstrictosidine) leads to several products. One of them was identified as a new compound, 3-isocorreantine A. From the data it can be concluded that the divergence of the biosynthetic pathways leading to different classes of indole alkaloids formed in R. serpentina and C. roseus cell suspension cultures occurs at a later stage than strictosidine deglucosylation.

  3. A magnetic bead-based method for concentrating DNA from human urine for downstream detection.

    Directory of Open Access Journals (Sweden)

    Hali Bordelon

    Full Text Available Due to the presence of PCR inhibitors, PCR cannot be used directly on most clinical samples, including human urine, without pre-treatment. A magnetic bead-based strategy is one potential method to collect biomarkers from urine samples and separate the biomarkers from PCR inhibitors. In this report, a 1 mL urine sample was mixed within the bulb of a transfer pipette containing lyophilized nucleic acid-silica adsorption buffer and silica-coated magnetic beads. After mixing, the sample was transferred from the pipette bulb to a small diameter tube, and captured biomarkers were concentrated using magnetic entrainment of beads through pre-arrayed wash solutions separated by small air gaps. Feasibility was tested using synthetic segments of the 140 bp tuberculosis IS6110 DNA sequence spiked into pooled human urine samples. DNA recovery was evaluated by qPCR. Despite the presence of spiked DNA, no DNA was detectable in unextracted urine samples, presumably due to the presence of PCR inhibitors. However, following extraction with the magnetic bead-based method, we found that ∼50% of spiked TB DNA was recovered from human urine containing roughly 5×10(3 to 5×10(8 copies of IS6110 DNA. In addition, the DNA was concentrated approximately ten-fold into water. The final concentration of DNA in the eluate was 5×10(6, 14×10(6, and 8×10(6 copies/µL for 1, 3, and 5 mL urine samples, respectively. Lyophilized and freshly prepared reagents within the transfer pipette produced similar results, suggesting that long-term storage without refrigeration is possible. DNA recovery increased with the length of the spiked DNA segments from 10±0.9% for a 75 bp DNA sequence to 42±4% for a 100 bp segment and 58±9% for a 140 bp segment. The estimated LOD was 77 copies of DNA/µL of urine. The strategy presented here provides a simple means to achieve high nucleic acid recovery from easily obtained urine samples, which does not contain inhibitors of PCR.

  4. Self-assembled DNA Structures for Nanoconstruction

    Science.gov (United States)

    Yan, Hao; Yin, Peng; Park, Sung Ha; Li, Hanying; Feng, Liping; Guan, Xiaoju; Liu, Dage; Reif, John H.; LaBean, Thomas H.

    2004-09-01

    In recent years, a number of research groups have begun developing nanofabrication methods based on DNA self-assembly. Here we review our recent experimental progress to utilize novel DNA nanostructures for self-assembly as well as for templates in the fabrication of functional nano-patterned materials. We have prototyped a new DNA nanostructure known as a cross structure. This nanostructure has a 4-fold symmetry which promotes its self-assembly into tetragonal 2D lattices. We have utilized the tetragonal 2D lattices as templates for highly conductive metallic nanowires and periodic 2D protein nano-arrays. We have constructed and characterized a DNA nanotube, a new self-assembling superstructure composed of DNA tiles. We have also demonstrated an aperiodic DNA lattice composed of DNA tiles assembled around a long scaffold strand; the system translates information encoded in the scaffold strand into a specific and reprogrammable barcode pattern. We have achieved metallic nanoparticle linear arrays templated on self-assembled 1D DNA arrays. We have designed and demonstrated a 2-state DNA lattice, which displays expand/contract motion switched by DNA nanoactuators. We have also achieved an autonomous DNA motor executing unidirectional motion along a linear DNA track.

  5. Usher syndrome type 1-associated cadherins shape the photoreceptor outer segment.

    Science.gov (United States)

    Schietroma, Cataldo; Parain, Karine; Estivalet, Amrit; Aghaie, Asadollah; Boutet de Monvel, Jacques; Picaud, Serge; Sahel, José-Alain; Perron, Muriel; El-Amraoui, Aziz; Petit, Christine

    2017-06-05

    Usher syndrome type 1 (USH1) causes combined hearing and sight defects, but how mutations in USH1 genes lead to retinal dystrophy in patients remains elusive. The USH1 protein complex is associated with calyceal processes, which are microvilli of unknown function surrounding the base of the photoreceptor outer segment. We show that in Xenopus tropicalis , these processes are connected to the outer-segment membrane by links composed of protocadherin-15 (USH1F protein). Protocadherin-15 deficiency, obtained by a knockdown approach, leads to impaired photoreceptor function and abnormally shaped photoreceptor outer segments. Rod basal outer disks displayed excessive outgrowth, and cone outer segments were curved, with lamellae of heterogeneous sizes, defects also observed upon knockdown of Cdh23 , encoding cadherin-23 (USH1D protein). The calyceal processes were virtually absent in cones and displayed markedly reduced F-actin content in rods, suggesting that protocadherin-15-containing links are essential for their development and/or maintenance. We propose that calyceal processes, together with their associated links, control the sizing of rod disks and cone lamellae throughout their daily renewal. © 2017 Schietroma et al.

  6. Method for introducing unidirectional nested deletions

    Science.gov (United States)

    Dunn, J.J.; Quesada, M.A.; Randesi, M.

    1999-07-27

    Disclosed is a method for the introduction of unidirectional deletions in a cloned DNA segment. More specifically, the method comprises providing a recombinant DNA construct comprising a DNA segment of interest inserted in a cloning vector. The cloning vector has an f1 endonuclease recognition sequence adjacent to the insertion site of the DNA segment of interest. The recombinant DNA construct is then contacted with the protein pII encoded by gene II of phage f1 thereby generating a single-stranded nick. The nicked DNA is then contacted with E. coli Exonuclease III thereby expanding the single-stranded nick into a single-stranded gap. The single-stranded gapped DNA is then contacted with a single-strand-specific endonuclease thereby producing a linearized DNA molecule containing a double-stranded deletion corresponding in size to the single-stranded gap. The DNA treated in this manner is then incubated with DNA ligase under conditions appropriate for ligation. Also disclosed is a method for producing single-stranded DNA probes. In this embodiment, single-stranded gapped DNA, produced as described above, is contacted with a DNA polymerase in the presence of labeled nucleotides to fill in the gap. This DNA is then linearized by digestion with a restriction enzyme which cuts outside the DNA segment of interest. The product of this digestion is then denatured to produce a labeled single-stranded nucleic acid probe. 1 fig.

  7. Fibre autoradiography of repair and replication in DNA from single cells: the effect of DNA synthesis inhibitors

    Energy Technology Data Exchange (ETDEWEB)

    Ockey, C.H.

    1982-04-01

    DNA fibre autoradiography, after incorporation of high specific activity /sup 3/H-thymidine and /sup 3/H-deoxycytidine, has been used to investigate repair in DNA fibres from single cells following UV, or methyl-methane sulphonate (MMS) treatment. Asynchronously growing human fibroblasts, leucocytes, and HeLa cells at different phases of the cell cycle have been investigated. Isotope incorporation in repair could be differentiated from that involved in replication by the distribution and density of silver grains along the DNA fibres. Grain distribution due to repair was continuous over long stretches of the fibres and was at a low density, occasionally interspersed with short slightly denser segments. Replication labelling on the other hand, was dense and usually in short tandem segments. Repair labelling was of a similar overall density in fibres from a single cell, but differed in intensity from cell to cell. In mutagen treated Go (leucocytes) of G/sub 1/ (HeLa cells), repair labelling was not increased by the presence of the DNA inhibitors, hydroxyurea (HU) or 5-fluorodeoxyuridine (FUdR). Repair was not detectable in S cells however without the use of these inhibitors to reduce endogenous nucleoside production. FUdR enhanced the repair labelling in S cells only slightly, while HU increased it beyond that observed in UV irradiated, HU treated, G/sub 1/ cells. The intensity of repair labelling in fibres from mutagen treated S cells appears to be proportional to the degree of reduction of DNA chain elongation in replicons.

  8. Primer-Independent DNA Synthesis by a Family B DNA Polymerase from Self-Replicating Mobile Genetic Elements

    Directory of Open Access Journals (Sweden)

    Modesto Redrejo-Rodríguez

    2017-11-01

    Full Text Available Family B DNA polymerases (PolBs play a central role during replication of viral and cellular chromosomes. Here, we report the discovery of a third major group of PolBs, which we denote primer-independent PolB (piPolB, that might be a link between the previously known protein-primed and RNA/DNA-primed PolBs. PiPolBs are encoded by highly diverse mobile genetic elements, pipolins, integrated in the genomes of diverse bacteria and also present as circular plasmids in mitochondria. Biochemical characterization showed that piPolB displays efficient DNA polymerization activity that can use undamaged and damaged templates and is endowed with proofreading and strand displacement capacities. Remarkably, the protein is also capable of template-dependent de novo DNA synthesis, i.e., DNA-priming activity, thereby breaking the long-standing dogma that replicative DNA polymerases require a pre-existing primer for DNA synthesis. We suggest that piPolBs are involved in self-replication of pipolins and may also contribute to bacterial DNA damage tolerance.

  9. Genetic divergence and phylogenetic relationships in grey mullets (Teleostei: Mugilidae) based on PCR-RFLP analysis of mtDNA segments.

    Science.gov (United States)

    Papasotiropoulos, V; Klossa-Kilia, E; Kilias, G; Alahiotis, S

    2002-04-01

    The genetic differentiation and phylogenetic relationships among five species of the Mugilidae family (Mugil cephalus, Chelon labrosus, Liza aurata, Liza ramada, and Liza saliens) were investigated at the mtDNA level, on samples taken from Messolongi lagoon-Greece. RFLP analysis of three PCR-amplified mtDNA gene segments (12s rRNA, 16s rRNA, and CO I) was used. Ten, eight, and nine restriction enzymes were found to have at least one recognition site at 12s rRNA, 16s rRNA, and CO I genes, respectively. Several fragment patterns were revealed to be species-specific, and thus they could be useful in species taxonomy as diagnostic markers, as well as for further evolutionary studies. Seven different haplotypes were detected. The greatest amount of genetic differentiation was observed at the interspecific level, while little variation was revealed at the intraspecific level. The highest values of nucleotide sequence divergence were observed between M. cephalus and all the other species, while the lowest was found between C. labrosus and L. saliens. Dendrograms obtained by the three different methods (UPGMA, Neighbor-Joining, and Dollo parsimony), were found to exhibit in all cases the same topology. According to this, the most distinct species is M. cephalus, while the other species are clustered in two separate groups, thefirst one containing L. aurata and L. ramada, the other L. saliens and C. labrosus. This last clustering makes the monophyletic origin of the genus Liza questionable.

  10. Automatic DNA Diagnosis for 1D Gel Electrophoresis Images using Bio-image Processing Technique.

    Science.gov (United States)

    Intarapanich, Apichart; Kaewkamnerd, Saowaluck; Shaw, Philip J; Ukosakit, Kittipat; Tragoonrung, Somvong; Tongsima, Sissades

    2015-01-01

    DNA gel electrophoresis is a molecular biology technique for separating different sizes of DNA fragments. Applications of DNA gel electrophoresis include DNA fingerprinting (genetic diagnosis), size estimation of DNA, and DNA separation for Southern blotting. Accurate interpretation of DNA banding patterns from electrophoretic images can be laborious and error prone when a large number of bands are interrogated manually. Although many bio-imaging techniques have been proposed, none of them can fully automate the typing of DNA owing to the complexities of migration patterns typically obtained. We developed an image-processing tool that automatically calls genotypes from DNA gel electrophoresis images. The image processing workflow comprises three main steps: 1) lane segmentation, 2) extraction of DNA bands and 3) band genotyping classification. The tool was originally intended to facilitate large-scale genotyping analysis of sugarcane cultivars. We tested the proposed tool on 10 gel images (433 cultivars) obtained from polyacrylamide gel electrophoresis (PAGE) of PCR amplicons for detecting intron length polymorphisms (ILP) on one locus of the sugarcanes. These gel images demonstrated many challenges in automated lane/band segmentation in image processing including lane distortion, band deformity, high degree of noise in the background, and bands that are very close together (doublets). Using the proposed bio-imaging workflow, lanes and DNA bands contained within are properly segmented, even for adjacent bands with aberrant migration that cannot be separated by conventional techniques. The software, called GELect, automatically performs genotype calling on each lane by comparing with an all-banding reference, which was created by clustering the existing bands into the non-redundant set of reference bands. The automated genotype calling results were verified by independent manual typing by molecular biologists. This work presents an automated genotyping tool from DNA

  11. Automatic DNA Diagnosis for 1D Gel Electrophoresis Images using Bio-image Processing Technique

    Science.gov (United States)

    2015-01-01

    Background DNA gel electrophoresis is a molecular biology technique for separating different sizes of DNA fragments. Applications of DNA gel electrophoresis include DNA fingerprinting (genetic diagnosis), size estimation of DNA, and DNA separation for Southern blotting. Accurate interpretation of DNA banding patterns from electrophoretic images can be laborious and error prone when a large number of bands are interrogated manually. Although many bio-imaging techniques have been proposed, none of them can fully automate the typing of DNA owing to the complexities of migration patterns typically obtained. Results We developed an image-processing tool that automatically calls genotypes from DNA gel electrophoresis images. The image processing workflow comprises three main steps: 1) lane segmentation, 2) extraction of DNA bands and 3) band genotyping classification. The tool was originally intended to facilitate large-scale genotyping analysis of sugarcane cultivars. We tested the proposed tool on 10 gel images (433 cultivars) obtained from polyacrylamide gel electrophoresis (PAGE) of PCR amplicons for detecting intron length polymorphisms (ILP) on one locus of the sugarcanes. These gel images demonstrated many challenges in automated lane/band segmentation in image processing including lane distortion, band deformity, high degree of noise in the background, and bands that are very close together (doublets). Using the proposed bio-imaging workflow, lanes and DNA bands contained within are properly segmented, even for adjacent bands with aberrant migration that cannot be separated by conventional techniques. The software, called GELect, automatically performs genotype calling on each lane by comparing with an all-banding reference, which was created by clustering the existing bands into the non-redundant set of reference bands. The automated genotype calling results were verified by independent manual typing by molecular biologists. Conclusions This work presents an

  12. The quest for a general and reliable fungal DNA barcode

    NARCIS (Netherlands)

    Robert, V.; Szöke, S.; Eberhardt, U.; Cardinali, G.; Meyer, W.; Seifert, K.A.; Levesques, A.; Lewis, C.T.

    2011-01-01

    DNA sequences are key elements for both identification and classification of living organisms. Mainly for historical reasons, a limited number of genes are currently used for this purpose. From a mathematical point of view, any DNA segment, at any location, even outside of coding regions and even if

  13. Human mitochondrial DNA (mtDNA) types in Malaysia

    International Nuclear Information System (INIS)

    Lian, L.H.; Koh, C.L.; Lim, M.E.

    2000-01-01

    Each human cell contains hundreds of mitochondria and thousands of double-stranded circular mtDNA. The delineation of human mtDNA variation and genetics over the past decade has provided unique and often startling insights into human evolution, degenerative diseases, and aging. Each mtDNA of 16,569 base pairs, encodes 13 polypeptides essential to the enzymes of the mitochondrial energy generating pathway, plus the necessary tRNAs and rRNAs. The highly polymorphic noncoding D-(displacement) loop region, also called the control region, is approximately 1.2 kb long. It contains two well-characterized hypervariable (HV-) regions, HV1 and HV2. MtDNA identification is usually based on these sequence differences. According to the TWTGDAM (Technical Working Group for DNA Analysis Methods), the minimum requirement for a mtDNA database for HV1 is from positions 16024 to 16365 and for HV2, from positions 00073 to 00340. The targeted Malaysian population subgroups for this study were mainly the Malays, Chinese, Indians, and indigenous Ibans, Bidayuhs, Kadazan-Dusuns, and Bajaus. Research methodologies undertaken included DNA extraction of samples from unrelated individuals, amplification of the specific regions via the polymerase chain reaction (PCR), and preparation of template DNA for sequencing by using an automated DNA sequencer. Sufficient nucleotide sequence data were generated from the mtDNA analysis. When the sequences were analyzed, sequence variations were found to be caused by nucleotide substitutions, insertions, and deletions. Of the three causes of the sequence variations, nucleotide substitutions (86.1%) accounted for the vast majority of polymorphism. It is noted that transitions (83.5%) were predominant when compared to the significantly lower frequencies of transversions (2.6%). Insertions (0.9%) and deletions (13.0%) were rather rare and found only in HV2. The data generated will also form the basis of a Malaysian DNA sequence database of mtDNA D

  14. Genetic variation of the Borrelia burgdorferi gene vlsE involves cassette-specific, segmental gene conversion.

    Science.gov (United States)

    Zhang, J R; Norris, S J

    1998-08-01

    The Lyme disease spirochete Borrelia burgdorferi possesses 15 silent vls cassettes and a vls expression site (vlsE) encoding a surface-exposed lipoprotein. Segments of the silent vls cassettes have been shown to recombine with the vlsE cassette region in the mammalian host, resulting in combinatorial antigenic variation. Despite promiscuous recombination within the vlsE cassette region, the 5' and 3' coding sequences of vlsE that flank the cassette region are not subject to sequence variation during these recombination events. The segments of the silent vls cassettes recombine in the vlsE cassette region through a unidirectional process such that the sequence and organization of the silent vls loci are not affected. As a result of recombination, the previously expressed segments are replaced by incoming segments and apparently degraded. These results provide evidence for a gene conversion mechanism in VlsE antigenic variation.

  15. Induction of protective immune responses in mice by double DNA ...

    African Journals Online (AJOL)

    Purpose: To investigate the efficacy of a double DNA vaccine encoding of Brucella melitensis omp31 gene and of Escherichia coli eae gene in inducing protective immune response in a mouse model. Methods: After performing PCR assays and cloning both the eae and omp31 genes, the generated DNA vaccines were ...

  16. DNA prime/Adenovirus boost malaria vaccine encoding P. falciparum CSP and AMA1 induces sterile protection associated with cell-mediated immunity.

    Directory of Open Access Journals (Sweden)

    Ilin Chuang

    Full Text Available BACKGROUND: Gene-based vaccination using prime/boost regimens protects animals and humans against malaria, inducing cell-mediated responses that in animal models target liver stage malaria parasites. We tested a DNA prime/adenovirus boost malaria vaccine in a Phase 1 clinical trial with controlled human malaria infection. METHODOLOGY/PRINCIPAL FINDINGS: The vaccine regimen was three monthly doses of two DNA plasmids (DNA followed four months later by a single boost with two non-replicating human serotype 5 adenovirus vectors (Ad. The constructs encoded genes expressing P. falciparum circumsporozoite protein (CSP and apical membrane antigen-1 (AMA1. The regimen was safe and well-tolerated, with mostly mild adverse events that occurred at the site of injection. Only one AE (diarrhea, possibly related to immunization, was severe (Grade 3, preventing daily activities. Four weeks after the Ad boost, 15 study subjects were challenged with P. falciparum sporozoites by mosquito bite, and four (27% were sterilely protected. Antibody responses by ELISA rose after Ad boost but were low (CSP geometric mean titer 210, range 44-817; AMA1 geometric mean micrograms/milliliter 11.9, range 1.5-102 and were not associated with protection. Ex vivo IFN-γ ELISpot responses after Ad boost were modest (CSP geometric mean spot forming cells/million peripheral blood mononuclear cells 86, range 13-408; AMA1 348, range 88-1270 and were highest in three protected subjects. ELISpot responses to AMA1 were significantly associated with protection (p = 0.019. Flow cytometry identified predominant IFN-γ mono-secreting CD8+ T cell responses in three protected subjects. No subjects with high pre-existing anti-Ad5 neutralizing antibodies were protected but the association was not statistically significant. SIGNIFICANCE: The DNA/Ad regimen provided the highest sterile immunity achieved against malaria following immunization with a gene-based subunit vaccine (27%. Protection

  17. The segment as the minimal planning unit in speech production: evidence based on absolute response latencies.

    Science.gov (United States)

    Kawamoto, Alan H; Liu, Qiang; Lee, Ria J; Grebe, Patricia R

    2014-01-01

    A minimal amount of information about a word must be phonologically and phonetically encoded before a person can begin to utter that word. Most researchers assume that the minimum is the complete word or possibly the initial syllable. However, there is some evidence that the initial segment is sufficient based on longer durations when the initial segment is primed. In two experiments in which the initial segment of a monosyllabic word is primed or not primed, we present additional evidence based on very short absolute response times determined on the basis of acoustic and articulatory onset relative to presentation of the complete target. We argue that the previous failures to find very short absolute response times when the initial segment is primed are due in part to the exclusive use of acoustic onset as a measure of response latency, the exclusion of responses with very short acoustic latencies, the manner of articulation of the initial segment (i.e., plosive vs. nonplosive), and individual differences. Theoretical implications of the segment as the minimal planning unit are considered.

  18. rad-Dependent response of the chk1-encoded protein kinase at the DNA damage checkpoint

    NARCIS (Netherlands)

    Walworth, N.C.; Bernards, R.A.

    1996-01-01

    Exposure of eukaryotic cells to agents that generate DNA damage results in transient arrest of progression through the cell cycle. In fission yeast, the DNA damage checkpoint associated with cell cycle arrest before mitosis requires the protein kinase p56chk1. DNA damage induced by ultraviolet

  19. Genetic selection and DNA sequences of 4.5S RNA homologs

    DEFF Research Database (Denmark)

    Brown, S; Thon, G; Tolentino, E

    1989-01-01

    A general strategy for cloning the functional homologs of an Escherichia coli gene was used to clone homologs of 4.5S RNA from other bacteria. The genes encoding these homologs were selected by their ability to complement a deletion of the gene for 4.5S RNA. DNA sequences of the regions encoding...

  20. [Molecular dynamics of immune complex of photoadduct-containing DNA with Fab-Anti-DNA antibody fragment].

    Science.gov (United States)

    Akberova, N I; Zhmurov, A A; Nevzorova, T A; Litvinov, R I

    2016-01-01

    Antibodies to DNA play an important role in the pathogenesis of autoimmune diseases. The elucidation of structural mechanisms of both the antigen recognition and the interaction of anti-DNA antibodies with DNA will help to understand the role of DNA-containing immune complexes in various pathologies and can provide a basis for new treatment modalities. Moreover, the DNA-antibody complex is an analog of specific intracellular DNA-protein interactions. In this work, we used in silico molecular dynamic simulations of bimolecular complexes of the dsDNA segment containing the Fab fragment of an anti-DNA antibody to obtain the detailed thermodynamic and structural characteristics of dynamic intermolecular interactions. Using computationally modified crystal structure of the Fab-DNA complex (PDB ID: 3VW3), we studied the equilibrium molecular dynamics of the 64M-5 antibody Fab fragment associated with the dsDNA fragment containing the thymine dimer, the product of DNA photodamage. Amino acid residues that constitute paratopes and the complementary nucleotide epitopes for the Fab-DNA construct were identified. Stacking and electrostatic interactions were found to play the main role in mediating the most specific antibody-dsDNA contacts, while hydrogen bonds were less significant. These findings may shed light on the formation and properties of pathogenic anti-DNA antibodies in autoimmune diseases, such as systemic lupus erythematosus associated with skin photosensitivity and DNA photodamage.

  1. Segmentation: Identification of consumer segments

    DEFF Research Database (Denmark)

    Høg, Esben

    2005-01-01

    It is very common to categorise people, especially in the advertising business. Also traditional marketing theory has taken in consumer segments as a favorite topic. Segmentation is closely related to the broader concept of classification. From a historical point of view, classification has its...... origin in other sciences as for example biology, anthropology etc. From an economic point of view, it is called segmentation when specific scientific techniques are used to classify consumers to different characteristic groupings. What is the purpose of segmentation? For example, to be able to obtain...... a basic understanding of grouping people. Advertising agencies may use segmentation totarget advertisements, while food companies may usesegmentation to develop products to various groups of consumers. MAPP has for example investigated the positioning of fish in relation to other food products...

  2. A label field fusion bayesian model and its penalized maximum rand estimator for image segmentation.

    Science.gov (United States)

    Mignotte, Max

    2010-06-01

    This paper presents a novel segmentation approach based on a Markov random field (MRF) fusion model which aims at combining several segmentation results associated with simpler clustering models in order to achieve a more reliable and accurate segmentation result. The proposed fusion model is derived from the recently introduced probabilistic Rand measure for comparing one segmentation result to one or more manual segmentations of the same image. This non-parametric measure allows us to easily derive an appealing fusion model of label fields, easily expressed as a Gibbs distribution, or as a nonstationary MRF model defined on a complete graph. Concretely, this Gibbs energy model encodes the set of binary constraints, in terms of pairs of pixel labels, provided by each segmentation results to be fused. Combined with a prior distribution, this energy-based Gibbs model also allows for definition of an interesting penalized maximum probabilistic rand estimator with which the fusion of simple, quickly estimated, segmentation results appears as an interesting alternative to complex segmentation models existing in the literature. This fusion framework has been successfully applied on the Berkeley image database. The experiments reported in this paper demonstrate that the proposed method is efficient in terms of visual evaluation and quantitative performance measures and performs well compared to the best existing state-of-the-art segmentation methods recently proposed in the literature.

  3. Molecular cloning and chromosome mapping of the human gene encoding protein phosphotyrosyl phosphatase 1B

    International Nuclear Information System (INIS)

    Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.

    1990-01-01

    The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2

  4. Plantago lagopus B Chromosome Is Enriched in 5S rDNA-Derived Satellite DNA

    Czech Academy of Sciences Publication Activity Database

    Kumke, K.; Macas, Jiří; Fuchs, J.; Altschmied, L.; Kour, J.; Dhar, M.K.; Houben, A.

    2016-01-01

    Roč. 148, č. 1 (2016), s. 68-73 ISSN 1424-8581 R&D Projects: GA ČR GBP501/12/G090 Institutional support: RVO:60077344 Keywords : Polymorhpic A chromosome segment * Satellite repeat * Supernumerary chromosome * 5S rDNA Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.354, year: 2016

  5. In vitro efficacy of a gene-activated nerve guidance conduit incorporating non-viral PEI-pDNA nanoparticles carrying genes encoding for NGF, GDNF and c-Jun.

    Science.gov (United States)

    Lackington, William A; Raftery, Rosanne M; O'Brien, Fergal J

    2018-06-07

    Despite the success of tissue engineered nerve guidance conduits (NGCs) for the treatment of small peripheral nerve injuries, autografts remain the clinical gold standard for larger injuries. The delivery of neurotrophic factors from conduits might enhance repair for more effective treatment of larger injuries but the efficacy of such systems is dependent on a safe, effective platform for controlled and localised therapeutic delivery. Gene therapy might offer an innovative approach to control the timing, release and level of neurotrophic factor production by directing cells to transiently sustain therapeutic protein production in situ. In this study, a gene-activated NGC was developed by incorporating non-viral polyethyleneimine-plasmid DNA (PEI-pDNA) nanoparticles (N/P 7 ratio, 2μg dose) with the pDNA encoding for nerve growth factor (NGF), glial derived neurotrophic factor (GDNF) or the transcription factor c-Jun. The physicochemical properties of PEI-pDNA nanoparticles, morphology, size and charge, were shown to be suitable for gene delivery and demonstrated high Schwann cell transfection efficiency (60±13%) in vitro. While all three genes showed therapeutic potential in terms of enhancing neurotrophic cytokine production while promoting neurite outgrowth, delivery of the gene encoding for c-Jun showed the greatest capacity to enhance regenerative cellular processes in vitro. Ultimately, this gene-activated NGC construct was shown to be capable of transfecting both Schwann cells (S42 cells) and neuronal cells (PC12 and dorsal root ganglia) in vitro, demonstrating potential for future therapeutic applications in vivo. The basic requirements of biomaterial-based nerve guidance conduits have now been well established and include being able to bridge a nerve injury to support macroscopic guidance between nerve stumps, while being strong enough to withstand longitudinal tension and circumferential compression, in addition to being mechanically sound to facilitate

  6. The first determination of Trichuris sp. from roe deer by amplification and sequenation of the ITS1-5.8S-ITS2 segment of ribosomal DNA.

    Science.gov (United States)

    Salaba, O; Rylková, K; Vadlejch, J; Petrtýl, M; Scháňková, S; Brožová, A; Jankovská, I; Jebavý, L; Langrová, I

    2013-03-01

    Trichuris nematodes were isolated from roe deer (Capreolus capreolus). At first, nematodes were determined using morphological and biometrical methods. Subsequently genomic DNA was isolated and the ITS1-5.8S-ITS2 segment from ribosomal DNA (RNA) was amplified and sequenced using PCR techniques. With u sing morphological and biometrical methods, female nematodes were identified as Trichuris globulosa, and the only male was identified as Trichuris ovis. The females were classified into four morphotypes. However, analysis of the internal transcribed spacers (ITS1-5.8S-ITS2) of specimens did not confirm this classification. Moreover, the female individuals morphologically determined as T. globulosa were molecularly identified as Trichuris discolor. In the case of the only male molecular analysis match the result of the molecular identification. Furthermore, a comparative phylogenetic study was carried out with the ITS1 and ITS2 sequences of the Trichuris species from various hosts. A comparison of biometric information from T. discolor individuals from this study was also conducted.

  7. Safety and immunogenicity of an oral DNA vaccine encoding Sip of Streptococcus agalactiae from Nile tilapia Oreochromis niloticus delivered by live attenuated Salmonella typhimurium.

    Science.gov (United States)

    Huang, L Y; Wang, K Y; Xiao, D; Chen, D F; Geng, Y; Wang, J; He, Y; Wang, E L; Huang, J L; Xiao, G Y

    2014-05-01

    Attenuated Salmonella typhimurium SL7207 was used as a carrier for a reconstructed DNA vaccine against Streptococcus agalactiae. A 1.02 kb DNA fragment, encoding for a portion of the surface immunogenic protein (Sip) of S. agalactiae was inserted into pVAX1. The recombinant plasmid pVAX1-sip was transfected in EPC cells to detect the transient expression by an indirect immunofluorescence assay, together with Western blot analysis. The pVAX1-sip was transformed by electroporation into SL7207. The stability of pVAX1-sip into Salmonella was over 90% after 50 generations with antibiotic selection in vitro while remained stable over 80% during 35 generations under antibiotic-free conditions. The LD50 of SL/pVAX1-sip was 1.7 × 10(11) CFU/fish by intragastric administration which indicated a quite low virulence. Tilapias were inoculated orally at 10(8) CFU/fish, the recombinant bacteria were found present in intestinal tract, spleens and livers and eventually eliminated from the tissues 4 weeks after immunization. Fish immunized at 10(7), 10(8) and 10(9) CFU/fish with different immunization times caused various levels of serum antibody and an effective protection against lethal challenge with the wild-type strain S. agalactiae. Integration studies showed that the pVAX1-sip did not integrate with tilapia chromosomes. The DNA vaccine SL/pVAX1-sip was proved to be safe and effective in protecting tilapias against S. agalactiae infection. Copyright © 2014 Elsevier Ltd. All rights reserved.

  8. cDNA for the human β2-adrenergic receptor: a protein with multiple membrane-spanning domains and encoded by a gene whose chromosomal location is shared with that of the receptor for platelet-derived growth factor

    International Nuclear Information System (INIS)

    Kobilka, B.K.; Dixon, R.A.F.; Frielle, T.

    1987-01-01

    The authors have isolated and sequenced a cDNA encoding the human β 2 -adrenergic receptor. The deduced amino acid sequence (413 residues) is that of a protein containing seven clusters of hydrophobic amino acids suggestive of membrane-spanning domains. While the protein is 87% identical overall with the previously cloned hamster β 2 -adrenergic receptor, the most highly conserved regions are the putative transmembrane helices (95% identical) and cytoplasmic loops (93% identical), suggesting that these regions of the molecule harbor important functional domains. Several of the transmembrane helices also share lesser degrees of identity with comparable regions of select members of the opsin family of visual pigments. They have localized the gene for the β 2 -adrenergic receptor to q31-q32 on chromosome 5. This is the same position recently determined for the gene encoding the receptor for platelet-derived growth factor and is adjacent to that for the FMS protooncogene, which encodes the receptor for the macrophage colony-stimulating factor

  9. Analysis Of Segmental Duplications In The Pig Genome Based On Next-Generation Sequencing

    DEFF Research Database (Denmark)

    Fadista, João; Bendixen, Christian

    Segmental duplications are >1kb segments of duplicated DNA present in a genome with high sequence identity (>90%). They are associated with genomic rearrangements and provide a significant source of gene and genome evolution within mammalian genomes. Although segmental duplications have been...... extensively studied in other organisms, its analysis in pig has been hampered by the lack of a complete pig genome assembly. By measuring the depth of coverage of Illumina whole-genome shotgun sequencing reads of the Tabasco animal aligned to the latest pig genome assembly (Sus scrofa 10 – based also...... and their associated copy number alterations, focusing on the global organization of these segments and their possible functional significance in porcine phenotypes. This work provides insights into mammalian genome evolution and generates a valuable resource for porcine genomics research...

  10. Recognition of methylated DNA through methyl-CpG binding domain proteins

    DEFF Research Database (Denmark)

    Zou, Xueqing; Ma, Wen; Solov'yov, Ilia

    2012-01-01

    DNA methylation is a key regulatory control route in epigenetics, involving gene silencing and chromosome inactivation. It has been recognized that methyl-CpG binding domain (MBD) proteins play an important role in interpreting the genetic information encoded by methylated DNA (mDNA). Although...... the function of MBD proteins has attracted considerable attention and is well characterized, the mechanism underlying mDNA recognition by MBD proteins is still poorly understood. In this article, we demonstrate that the methyl-CpG dinucleotides are recognized at the MBD-mDNA interface by two MBD arginines...

  11. Gene-gun DNA vaccination aggravates respiratory syncytial virus-induced pneumonitis

    DEFF Research Database (Denmark)

    Bartholdy, Christina; Olszewska, Wieslawa; Stryhn, Anette

    2004-01-01

    elicited with recombinant vaccinia virus expressing the complete RSV M2 protein, but stronger than those induced by a similar DNA construct without the beta2m gene. DNA vaccination led to enhanced pulmonary disease after RSV challenge, with increased weight loss and cell recruitment to the lung. Depletion......A CD8+ T-cell memory response to respiratory syncytial virus (RSV) was generated by using a DNA vaccine construct encoding the dominant Kd-restricted epitope from the viral transcription anti-terminator protein M2 (M2(82-90)), linked covalently to human beta2-microglobulin (beta2m). Cutaneous gene...... of CD8+ T cells reduced, but did not abolish, enhancement of disease. Mice vaccinated with a construct encoding a class I-restricted lymphocytic choriomeningitis virus epitope and beta2m suffered more severe weight loss after RSV infection than unvaccinated RSV-infected mice, although RSV-specific CD8...

  12. Spliced DNA Sequences in the Paramecium Germline: Their Properties and Evolutionary Potential

    Science.gov (United States)

    Catania, Francesco; McGrath, Casey L.; Doak, Thomas G.; Lynch, Michael

    2013-01-01

    Despite playing a crucial role in germline-soma differentiation, the evolutionary significance of developmentally regulated genome rearrangements (DRGRs) has received scant attention. An example of DRGR is DNA splicing, a process that removes segments of DNA interrupting genic and/or intergenic sequences. Perhaps, best known for shaping immune-system genes in vertebrates, DNA splicing plays a central role in the life of ciliated protozoa, where thousands of germline DNA segments are eliminated after sexual reproduction to regenerate a functional somatic genome. Here, we identify and chronicle the properties of 5,286 sequences that putatively undergo DNA splicing (i.e., internal eliminated sequences [IESs]) across the genomes of three closely related species of the ciliate Paramecium (P. tetraurelia, P. biaurelia, and P. sexaurelia). The study reveals that these putative IESs share several physical characteristics. Although our results are consistent with excision events being largely conserved between species, episodes of differential IES retention/excision occur, may have a recent origin, and frequently involve coding regions. Our findings indicate interconversion between somatic—often coding—DNA sequences and noncoding IESs, and provide insights into the role of DNA splicing in creating potentially functional genetic innovation. PMID:23737328

  13. Internucleotide correlations and nucleotide periodicity in Drosophila mtDNA: New evidence for panselective evolution

    Directory of Open Access Journals (Sweden)

    Carlos Y Valenzuela

    2010-01-01

    Full Text Available Analysis for the homogeneity of the distribution of the second base of dinucleotides in relation to the first, whose bases are separated by 0, 1, 2,... 21 nucleotide sites, was performed with the VIH-1 genome (cDNA, the Drosophila mtDNA, the Drosophila Torso gene and the human p-globin gene. These four DNA segments showed highly significant heterogeneities of base distributions that cannot be accounted for by neutral or nearly neutral evolution or by the "neighbor influence" of nucleotides on mutation rates. High correlations are found in the bases of dinucleotides separated by 0, 1 and more number of sites. A periodicity of three consecutive significance values (measured by the x²9 was found only in Drosophila mtDNA. This periodicity may be due to an unknown structure or organization of mtDNA. This non-random distribution of the two bases of dinucleotides widespread throughout these DNA segments is rather compatible with panselective evolution and generalized internucleotide co-adaptation.

  14. Identification and characterization of a novel Cut family cDNA that encodes human copper transporter protein CutC

    International Nuclear Information System (INIS)

    Li Jixi; Ji Chaoneng; Chen Jinzhong; Yang Zhenxing; Wang Yijing; Fei, Xiangwei; Zheng Mei; Gu Xing; Wen Ge; Xie Yi; Mao Yumin

    2005-01-01

    Copper is an essential heavy metal trace element that plays important roles in cell physiology. The Cut family was associated with the copper homeostasis and involved in several important metabolisms, such as uptake, storage, delivery, and efflux of copper. In this study, a novel Cut family cDNA was isolated from the human fetal brain library, which encodes a 273 amino acid protein with a molecular mass of about 29.3 kDa and a calculated pI of 8.17. It was named hCutC (human copper transporter protein CutC). The ORF of hCutC gene was cloned into pQE30 vector and expressed in Escherichia coli M15. The secreted hCutC protein was purified to a homogenicity of 95% by using the Ni-NTA affinity chromatography. RT-PCR analysis showed that the hCutC gene expressed extensively in human tissues. Subcellular location analysis of hCutC-EGFP fusion protein revealed that hCutC was distributed to cytoplasm of COS-7 cells, and both cytoplasm and nucleus of AD293 cells. The results suggest that hCutC may be one shuttle protein and play important roles in intracellular copper trafficking

  15. Cloning and expression of human deoxycytidine kinase cDNA

    International Nuclear Information System (INIS)

    Chottiner, E.G.; Shewach, D.S.; Datta, N.S.; Ashcraft, E.; Gribbin, D.; Ginsburg, D.; Fox, I.H.; Mitchell, B.S.

    1991-01-01

    Deoxycytidine (dCyd) kinase is required for the phosphorylation of several deoxyribonucleosides and certain nucleoside analogs widely employed as antiviral and chemotherapeutic agents. Detailed analysis of this enzyme has been limited, however, by its low abundance and instability. Using oligonucleotides based on primary amino acid sequence derived from purified dCyd kinase, the authors have screened T-lymphoblast cDNA libraries and identified a cDNA sequence that encodes a 30.5-kDa protein corresponding to the subunit molecular mass of the purified protein. Expression of the cDNA in Escherichia coli results in a 40-fold increase in dCyd kinase activity over control levels. Northern blot analysis reveals a single 2.8-kilobase mRNA expressed in T lymphoblasts at 5- to 10-fold higher levels than in B lymphoblasts, and decreased dCyd kinase mRNA levels are present in T-lymphoblast cell lines resistant to arabinofuranosylcytosine and dideoxycytidine. These findings document that this cDNA encodes the T-lymphoblast dCyd kinase responsible for the phosphorylation of dAdo and dGuo as well as dCyd and arabinofuranosylcytosine

  16. Bacteriophage-encoded shiga toxin gene in atypical bacterial host

    Directory of Open Access Journals (Sweden)

    Casas Veronica

    2011-07-01

    Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.

  17. CDNA encoding a polypeptide including a hevein sequence

    Science.gov (United States)

    Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

    1995-03-21

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  18. The Modular Construction of DNA Double Helix

    Indian Academy of Sciences (India)

    discovery, DNA structure has been able to disseminate knowl- edge of key ... band a. This procedure would place segment a, overlapping with d. Glue securely a ... Because of alignment problems, unless great care is taken, the modules do ...

  19. Usher syndrome type 1–associated cadherins shape the photoreceptor outer segment

    Science.gov (United States)

    Parain, Karine; Aghaie, Asadollah; Picaud, Serge

    2017-01-01

    Usher syndrome type 1 (USH1) causes combined hearing and sight defects, but how mutations in USH1 genes lead to retinal dystrophy in patients remains elusive. The USH1 protein complex is associated with calyceal processes, which are microvilli of unknown function surrounding the base of the photoreceptor outer segment. We show that in Xenopus tropicalis, these processes are connected to the outer-segment membrane by links composed of protocadherin-15 (USH1F protein). Protocadherin-15 deficiency, obtained by a knockdown approach, leads to impaired photoreceptor function and abnormally shaped photoreceptor outer segments. Rod basal outer disks displayed excessive outgrowth, and cone outer segments were curved, with lamellae of heterogeneous sizes, defects also observed upon knockdown of Cdh23, encoding cadherin-23 (USH1D protein). The calyceal processes were virtually absent in cones and displayed markedly reduced F-actin content in rods, suggesting that protocadherin-15–containing links are essential for their development and/or maintenance. We propose that calyceal processes, together with their associated links, control the sizing of rod disks and cone lamellae throughout their daily renewal. PMID:28495838

  20. Hierarchical assembly of viral nanotemplates with encoded microparticles via nucleic acid hybridization.

    Science.gov (United States)

    Tan, Wui Siew; Lewis, Christina L; Horelik, Nicholas E; Pregibon, Daniel C; Doyle, Patrick S; Yi, Hyunmin

    2008-11-04

    We demonstrate hierarchical assembly of tobacco mosaic virus (TMV)-based nanotemplates with hydrogel-based encoded microparticles via nucleic acid hybridization. TMV nanotemplates possess a highly defined structure and a genetically engineered high density thiol functionality. The encoded microparticles are produced in a high throughput microfluidic device via stop-flow lithography (SFL) and consist of spatially discrete regions containing encoded identity information, an internal control, and capture DNAs. For the hybridization-based assembly, partially disassembled TMVs were programmed with linker DNAs that contain sequences complementary to both the virus 5' end and a selected capture DNA. Fluorescence microscopy, atomic force microscopy (AFM), and confocal microscopy results clearly indicate facile assembly of TMV nanotemplates onto microparticles with high spatial and sequence selectivity. We anticipate that our hybridization-based assembly strategy could be employed to create multifunctional viral-synthetic hybrid materials in a rapid and high-throughput manner. Additionally, we believe that these viral-synthetic hybrid microparticles may find broad applications in high capacity, multiplexed target sensing.

  1. The replicative DNA polymerase of herpes simplex virus 1 exhibits apurinic/apyrimidinic and 5′-deoxyribose phosphate lyase activities

    Science.gov (United States)

    Bogani, Federica; Boehmer, Paul E.

    2008-01-01

    Base excision repair (BER) is essential for maintaining genome stability both to counter the accumulation of unusual bases and to protect from base loss in the DNA. Herpes simplex virus 1 (HSV-1) is a large dsDNA virus that encodes its own DNA replication machinery, including enzymes involved in nucleotide metabolism. We report on a replicative family B and a herpesvirus-encoded DNA Pol that possesses DNA lyase activity. We have discovered that the catalytic subunit of the HSV-1 DNA polymerase (Pol) (UL30) exhibits apurinic/apyrimidinic (AP) and 5′-deoxyribose phosphate (dRP) lyase activities. These activities are integral to BER and lead to DNA cleavage on the 3′ side of abasic sites and 5′-dRP residues that remain after cleavage by 5′-AP endonuclease. The UL30-catalyzed reaction occurs independently of divalent cation and proceeds via a Schiff base intermediate, indicating that it occurs via a lyase mechanism. Partial proteolysis of the Schiff base shows that the DNA lyase activity resides in the Pol domain of UL30. These observations together with the presence of a virus-encoded uracil DNA glycosylase indicates that HSV-1 has the capacity to perform critical steps in BER. These findings have implications on the role of BER in viral genome maintenance during lytic replication and reactivation from latency. PMID:18695225

  2. cDNA cloning of rat and human medium chain acyl-CoA dehydrogenase (MCAD)

    International Nuclear Information System (INIS)

    Matsubara, Y.; Kraus, J.P.; Rosenberg, L.E.; Tanaka, K.

    1986-01-01

    MCAD is one of three mitochondrial flavoenzymes which catalyze the first step in the β-oxidation of straight chain fatty acids. It is a tetramer with a subunit Mr of 45 kDa. MCAD is synthesized in the cytosol as a 49 kDa precursor polypeptide (pMCAD), imported into mitochondria, and cleaved to the mature form. Genetic deficiency of MCAD causes recurrent episodes of hypoglycemic coma accompanied by medium chain dicarboxylic aciduria. Employing a novel approach, the authors now report isolation of partial rat and human cDNA clones encoding pMCAD. mRNA encoding pMCAD was purified to near homogeneity by polysome immunoadsorption using polyclonal monospecific antibody. Single-stranded [ 32 P]labeled cDNA probe was synthesized using the enriched mRNA as template, and was used to screen directly 16,000 colonies from a total rat liver cDNA library constructed in pBR322. One clone (600 bp) was detected by in situ hybridization. Hybrid-selected translation with this cDNA yielded a 49 kDa polypeptide indistinguishable in size from rat pMCAD and immunoprecipitable with anti-MCAD antibody. Using the rat cDNA as probe, 43,000 colonies from a human liver cDNA library were screened. Four identical positive clones (400 bp) were isolated and positively identified by hybrid-selected translation and immunoprecipitation. The sizes of rat and human mRNAs encoding pMCAD were 2.2 kb and 2.4 kb, respectively, as determined by Northern blotting

  3. A Comparison of Red Fluorescent Proteins to Model DNA Vaccine Expression by Whole Animal In Vivo Imaging.

    Science.gov (United States)

    Kinnear, Ekaterina; Caproni, Lisa J; Tregoning, John S

    2015-01-01

    DNA vaccines can be manufactured cheaply, easily and rapidly and have performed well in pre-clinical animal studies. However, clinical trials have so far been disappointing, failing to evoke a strong immune response, possibly due to poor antigen expression. To improve antigen expression, improved technology to monitor DNA vaccine transfection efficiency is required. In the current study, we compared plasmid encoded tdTomato, mCherry, Katushka, tdKatushka2 and luciferase as reporter proteins for whole animal in vivo imaging. The intramuscular, subcutaneous and tattooing routes were compared and electroporation was used to enhance expression. We observed that overall, fluorescent proteins were not a good tool to assess expression from DNA plasmids, with a highly heterogeneous response between animals. Of the proteins used, intramuscular delivery of DNA encoding either tdTomato or luciferase gave the clearest signal, with some Katushka and tdKatushka2 signal observed. Subcutaneous delivery was weakly visible and nothing was observed following DNA tattooing. DNA encoding haemagglutinin was used to determine whether immune responses mirrored visible expression levels. A protective immune response against H1N1 influenza was induced by all routes, even after a single dose of DNA, though qualitative differences were observed, with tattooing leading to high antibody responses and subcutaneous DNA leading to high CD8 responses. We conclude that of the reporter proteins used, expression from DNA plasmids can best be assessed using tdTomato or luciferase. But, the disconnect between visible expression level and immunogenicity suggests that in vivo whole animal imaging of fluorescent proteins has limited utility for predicting DNA vaccine efficacy.

  4. Molecular cloning of a human glycophorin B cDNA: nucleotide sequence and genomic relationship to glycophorin A

    International Nuclear Information System (INIS)

    Siebert, P.D.; Fukuda, M.

    1987-01-01

    The authors describe the isolation and nucleotide sequence of a human glycophorin B cDNA. The cDNA was identified by differential hybridization of synthetic oligonucleotide probes to a human erythroleukemic cell line (K562) cDNA library constructed in phage vector λgt10. The nucleotide sequence of the glycophorin B cDNA was compared with that of a previously cloned glycophorin A cDNA. The nucleotide sequences encoding the NH 2 -terminal leader peptide and first 26 amino acids of the two proteins are nearly identical. This homologous region is followed by areas specific to either glycophorin A or B and a number of small regions of homology, which in turn are followed by a very homologous region encoding the presumed membrane-spanning portion of the proteins. They used RNA blot hybridization with both cDNA and synthetic oligonucleotide probes to prove our previous hypothesis that glycophorin B is encoded by a single 0.5- to 0.6-kb mRNA and to show that glycophorins A and B are negatively and coordinately regulated by a tumor-promoting phorbol ester, phorbol 12-myristate 13-acetate. They established the intron/exon structure of the glycophorin A and B genes by oligonucleotide mapping; the results suggest a complex evolution of the glycophorin genes

  5. The dnaN gene codes for the beta subunit of DNA polymerase III holoenzyme of escherichia coli.

    Science.gov (United States)

    Burgers, P M; Kornberg, A; Sakakibara, Y

    1981-09-01

    An Escherichia coli mutant, dnaN59, stops DNA synthesis promptly upon a shift to a high temperature; the wild-type dnaN gene carried in a transducing phage encodes a polypeptide of about 41,000 daltons [Sakakibara, Y. & Mizukami, T. (1980) Mol. Gen. Genet. 178, 541-553; Yuasa, S. & Sakakibara, Y. (1980) Mol. Gen. Genet. 180, 267-273]. We now find that the product of dnaN gene is the beta subunit of DNA polymerase III holoenzyme, the principal DNA synthetic multipolypeptide complex in E. coli. The conclusion is based on the following observations: (i) Extracts from dnaN59 cells were defective in phage phi X174 and G4 DNA synthesis after the mutant cells had been exposed to the increased temperature. (ii) The enzymatic defect was overcome by addition of purified beta subunit but not by other subunits of DNA polymerase III holoenzyme or by other replication proteins required for phi X174 DNA synthesis. (iii) Partially purified beta subunit from the dnaN mutant, unlike that from the wild type, was inactive in reconstituting the holoenzyme when mixed with the other purified subunits. (iv) Increased dosage of the dnaN gene provided by a plasmid carrying the gene raised cellular levels of the beta subunit 5- to 6-fold.

  6. Enhanced cellular immune response against SIV Gag induced by immunization with DNA vaccines expressing assembly and release-defective SIV Gag proteins

    International Nuclear Information System (INIS)

    Bu Zhigao; Ye Ling; Compans, Richard W.; Yang Chinglai

    2003-01-01

    Codon-optimized genes were synthesized for the SIVmac239 Gag, a mutant Gag with mutations in the major homology region, and a chimeric Gag containing a protein destruction signal at the N-terminus of Gag. The mutant and chimeric Gag were expressed at levels comparable to that observed for the wild-type Gag protein but their stability and release into the medium were found to be significantly reduced. Immunization of mice with DNA vectors encoding the mutant or chimeric Gag induced fourfold higher levels of anti-SIV Gag CD4 T cell responses than the DNA vector encoding the wild-type SIV Gag. Moreover, anti-SIV Gag CD8 T cell responses induced by DNA vectors encoding the mutant or chimeric Gag were found to be 5- to 10-fold higher than those induced by the DNA construct for the wild-type Gag. These results indicate that mutations disrupting assembly and/or stability of the SIV Gag protein effectively enhance its immunogenicity when expressed from DNA vaccines

  7. Non-essential MCM-related proteins mediate a response to DNA damage in the archaeon Methanococcus maripaludis.

    Science.gov (United States)

    Walters, Alison D; Chong, James P J

    2017-05-01

    The single minichromosome maintenance (MCM) protein found in most archaea has been widely studied as a simplified model for the MCM complex that forms the catalytic core of the eukaryotic replicative helicase. Organisms of the order Methanococcales are unusual in possessing multiple MCM homologues. The Methanococcus maripaludis S2 genome encodes four MCM homologues, McmA-McmD. DNA helicase assays reveal that the unwinding activity of the three MCM-like proteins is highly variable despite sequence similarities and suggests additional motifs that influence MCM function are yet to be identified. While the gene encoding McmA could not be deleted, strains harbouring individual deletions of genes encoding each of the other MCMs display phenotypes consistent with these proteins modulating DNA damage responses. M. maripaludis S2 is the first archaeon in which MCM proteins have been shown to influence the DNA damage response.

  8. Micro-segmented flow applications in chemistry and biology

    CERN Document Server

    Cahill, Brian

    2014-01-01

    The book is dedicated to the method and application potential of micro segmented flow. The recent state of development of this powerful technique is presented in 12 chapters by leading researchers from different countries. In the first section, the principles of generation and manipulation of micro-fluidic segments are explained. In the second section, the micro continuous-flow synthesis of different types of nanomaterials is shown as a typical example for the use of advantages of the technique in chemistry. In the third part, the particular importance of the technique in biotechnical applications is presented demonstrating the progress for miniaturized cell-free processes, for molecular biology and DNA-based diagnostis and sequencing as well as for the development of antibiotics and the evaluation of toxic effects in medicine and environment.

  9. Design, development, and validation of a segment support actuator for the prototype segmented mirror telescope

    Science.gov (United States)

    Deshmukh, Prasanna Gajanan; Mandal, Amaresh; Parihar, Padmakar S.; Nayak, Dayananda; Mishra, Deepta Sundar

    2018-01-01

    Segmented mirror telescopes (SMT) are built using several small hexagonal mirrors positioned and aligned by the three actuators and six edge sensors per segment to maintain the shape of the primary mirror. The actuators are responsible for maintaining and tracking the mirror segments to the desired position, in the presence of external disturbances introduced by wind, vibration, gravity, and temperature. The present paper describes our effort to develop a soft actuator and the actuator controller for prototype SMT at Indian Institute of Astrophysics, Bangalore. The actuator designed, developed, and validated is a soft actuator based on the voice coil motor and flexural elements. It is designed for the range of travel of ±1.5 mm and the force range of 25 N along with an offloading mechanism to reduce the power consumption. A precision controller using a programmable system on chip (PSoC 5Lp) and a customized drive board has also been developed for this actuator. The close loop proportional-integral-derivative (PID) controller implemented in the PSoC gets position feedback from a high-resolution linear optical encoder. The optimum PID gains are derived using relay tuning method. In the laboratory, we have conducted several experiments to test the performance of the prototype soft actuator as well as the controller. We could achieve 5.73- and 10.15-nm RMS position errors in the steady state as well as tracking with a constant speed of 350 nm/s, respectively. We also present the outcome of various performance tests carried out when off-loader is in action as well as the actuator is subjected to dynamic wind loading.

  10. Nucleases Encoded by Integraded Elements CJIE2 and CJIE4 Inhibit Natural Transformation of Campylobacter Jejuni

    NARCIS (Netherlands)

    Gaasbeek, E.J.; Wagenaar, J.A.; Guilhabert, M.R.; Putten, van J.P.; Parker, C.T.; Wal, van der F.J.

    2010-01-01

    The species Campylobacter jejuni is naturally competent for DNA uptake; nevertheless, nonnaturally transformable strains do exist. For a subset of strains we previously showed that a periplasmic DNase, encoded by dns, inhibits natural transformation in C. jejuni. In the present study, genetic

  11. Isolation of Nicotiana plumbaginifolia cDNAs encoding isoforms of serine acetyltransferase and O-acetylserine (thiol) lyase in a yeast two-hybrid system with Escherichia coli cysE and cysK genes as baits.

    Science.gov (United States)

    Liszewska, Frantz; Gaganidze, Dali; Sirko, Agnieszka

    2005-01-01

    We applied the yeast two-hybrid system for screening of a cDNA library of Nicotiana plumbaginifolia for clones encoding plant proteins interacting with two proteins of Escherichia coli: serine acetyltransferase (SAT, the product of cysE gene) and O-acetylserine (thiol)lyase A, also termed cysteine synthase (OASTL-A, the product of cysK gene). Two plant cDNA clones were identified when using the cysE gene as a bait. These clones encode a probable cytosolic isoform of OASTL and an organellar isoform of SAT, respectively, as indicated by evolutionary trees. The second clone, encoding SAT, was identified independently also as a "prey" when using cysK as a bait. Our results reveal the possibility of applying the two-hybrid system for cloning of plant cDNAs encoding enzymes of the cysteine synthase complex in the two-hybrid system. Additionally, using genome walking sequences located upstream of the sat1 cDNA were identified. Subsequently, in silico analyses were performed aiming towards identification of the potential signal peptide and possible location of the deduced mature protein encoded by sat1.

  12. Depletion-induced instability in protein-DNA mixtures: Influence of protein charge and size

    NARCIS (Netherlands)

    Vries, de R.J.

    2006-01-01

    While there is abundant experimental and theoretical work on polymer-induced DNA condensation, it is still unclear whether globular proteins can condense linear DNA or not. We develop a simple analytical approximation for the depletion attraction between rodlike segments of semiflexible

  13. Genomic segments RNA1 and RNA2 of Prunus necrotic ringspot virus codetermine viral pathogenicity to adapt to alternating natural Prunus hosts.

    Science.gov (United States)

    Cui, Hongguang; Hong, Ni; Wang, Guoping; Wang, Aiming

    2013-05-01

    Prunus necrotic ringspot virus (PNRSV) affects Prunus fruit production worldwide. To date, numerous PNRSV isolates with diverse pathological properties have been documented. To study the pathogenicity of PNRSV, which directly or indirectly determines the economic losses of infected fruit trees, we have recently sequenced the complete genome of peach isolate Pch12 and cherry isolate Chr3, belonging to the pathogenically aggressive PV32 group and mild PV96 group, respectively. Here, we constructed the Chr3- and Pch12-derived full-length cDNA clones that were infectious in the experimental host cucumber and their respective natural Prunus hosts. Pch12-derived clones induced much more severe symptoms than Chr3 in cucumber, and the pathogenicity discrepancy between Chr3 and Pch12 was associated with virus accumulation. By reassortment of genomic segments, swapping of partial genomic segments, and site-directed mutagenesis, we identified the 3' terminal nucleotide sequence (1C region) in RNA1 and amino acid K at residue 279 in RNA2-encoded P2 as the severe virulence determinants in Pch12. Gain-of-function experiments demonstrated that both the 1C region and K279 of Pch12 were required for severe virulence and high levels of viral accumulation. Our results suggest that PNRSV RNA1 and RNA2 codetermine viral pathogenicity to adapt to alternating natural Prunus hosts, likely through mediating viral accumulation.

  14. Identification and characterization of genes encoding polycyclic aromatic hydrocarbon dioxygenase and polycyclic aromatic hydrocarbon dihydrodiol dehydrogenase in Pseudomonas putida OUS82.

    OpenAIRE

    Takizawa, N; Kaida, N; Torigoe, S; Moritani, T; Sawada, T; Satoh, S; Kiyohara, H

    1994-01-01

    Naphthalene and phenanthrene are transformed by enzymes encoded by the pah gene cluster of Pseudomonas putida OUS82. The pahA and pahB genes, which encode the first and second enzymes, dioxygenase and cis-dihydrodiol dehydrogenase, respectively, were identified and sequenced. The DNA sequences showed that pahA and pahB were clustered and that pahA consisted of four cistrons, pahAa, pahAb, pahAc, and pahAd, which encode ferredoxin reductase, ferredoxin, and two subunits of the iron-sulfur prot...

  15. Capability of ds-DNA duplex structure in growing fluorescent silver nanoclusters

    International Nuclear Information System (INIS)

    Wu, Tao; Lin, Fan; Hu, Yuehua; Wang, Ying; Zhou, Xiaoshun; Shao, Yong

    2016-01-01

    Silver nanoclusters (AgNCs) have attracted wide interests in variant fields due to their easy synthesis and practical tunability in fluorescence properties. DNA has been generally used as the host to grow AgNCs due to the sequence-dependent fluorescence behavior. Actually, in such DNA, various ss-DNA segments that are structurally confined by the rigid ds-DNA counterparts have been used as the AgNCsГ—Ві growth sites. However, whether the ds-DNA structure plays somewhat role in AgNCsГ—Ві creation has not been well elucidated. Herein, we found that ds-DNA can also accommodate the growth of fluorescent AgNCs. The fluorescent AgNCs grown on ds-DNA should be separated each other and the G/C base pairs with right context sequences are the growth sites of fluorescent AgNCs. The intermediate A/T base pair among the continuous G/C ones seems to quench the growth of fluorescent AgNCs. For the repeat sequences, the fluorescence band position of AgNCs is not changed but the intensity is enhanced upon increasing the ds-DNA length, which is different from the results obtained with the previously reported ss-DNAs. AgNCs should be grown on the ds-DNA major groove, as convinced by the cytosine methylation experiment. Our work demonstrates that besides the ss-DNA role in defining AgNCs, one should also take into account the critical role of the ds-DNA segment in tuning the AgNCsГ—Ві fluorescence property.

  16. Specific DNA binding of a potential transcriptional regulator, inosine 5'-monophosphate dehydrogenase-related protein VII, to the promoter region of a methyl coenzyme m reductase I-encoding operon retrieved from Methanothermobacter thermautotrophicus strain DeltaH.

    Science.gov (United States)

    Shinzato, Naoya; Enoki, Miho; Sato, Hiroaki; Nakamura, Kohei; Matsui, Toru; Kamagata, Yoichi

    2008-10-01

    Two methyl coenzyme M reductases (MCRs) encoded by the mcr and mrt operons of the hydrogenotrophic methanogen Methanothermobacter thermautotrophicus DeltaH are expressed in response to H(2) availability. In the present study, cis elements and trans-acting factors responsible for the gene expression of MCRs were investigated by using electrophoretic mobility shift assay (EMSA) and affinity particle purification. A survey of their operator regions by EMSA with protein extracts from mrt-expressing cultures restricted them to 46- and 41-bp-long mcr and mrt upstream regions, respectively. Affinity particle purification of DNA-binding proteins conjugated with putative operator regions resulted in the retrieval of a protein attributed to IMP dehydrogenase-related protein VII (IMPDH VII). IMPDH VII is predicted to have a winged helix-turn-helix DNA-binding motif and two cystathionine beta-synthase domains, and it has been suspected to be an energy-sensing module. EMSA with oligonucleotide probes with unusual sequences showed that the binding site of IMPDH VII mostly overlaps the factor B-responsible element-TATA box of the mcr operon. The results presented here suggest that IMPDH VII encoded by MTH126 is a plausible candidate for the transcriptional regulator of the mcr operon in this methanogen.

  17. Dielectric properties of DNA oligonucleotides on the surface of silicon nanostructures

    Energy Technology Data Exchange (ETDEWEB)

    Bagraev, N. T., E-mail: bagraev@mail.ioffe.ru [St. Petersburg Polytechnic University (Russian Federation); Chernev, A. L. [Russian Academy of Sciences, St. Petersburg Academic University—Nanotechnology Research and Education Center (Russian Federation); Klyachkin, L. E. [St. Petersburg Polytechnic University (Russian Federation); Malyarenko, A. M. [Russian Academy of Sciences, Ioffe Physical–Technical Institute (Russian Federation); Emel’yanov, A. K.; Dubina, M. V. [Russian Academy of Sciences, St. Petersburg Academic University—Nanotechnology Research and Education Center (Russian Federation)

    2016-10-15

    Planar silicon nanostructures that are formed as a very narrow silicon quantum well confined by δ barriers heavily doped with boron are used to study the dielectric properties of DNA oligonucleotides deposited onto the surface of the nanostructures. The capacitance characteristics of the silicon nanostructures with oligonucleotides deposited onto their surface are determined by recording the local tunneling current–voltage characteristics by means of scanning tunneling microscopy. The results show the possibility of identifying the local dielectric properties of DNA oligonucleotide segments consisting of repeating G–C pairs. These properties apparently give grounds to correlate the segments with polymer molecules exhibiting the properties of multiferroics.

  18. Tensor GSVD of Patient- and Platform-Matched Tumor and Normal DNA Copy-Number Profiles Uncovers Chromosome Arm-Wide Patterns of Tumor-Exclusive Platform-Consistent Alterations Encoding for Cell Transformation and Predicting Ovarian Cancer Survival

    Science.gov (United States)

    Sankaranarayanan, Preethi; Schomay, Theodore E.; Aiello, Katherine A.; Alter, Orly

    2015-01-01

    The number of large-scale high-dimensional datasets recording different aspects of a single disease is growing, accompanied by a need for frameworks that can create one coherent model from multiple tensors of matched columns, e.g., patients and platforms, but independent rows, e.g., probes. We define and prove the mathematical properties of a novel tensor generalized singular value decomposition (GSVD), which can simultaneously find the similarities and dissimilarities, i.e., patterns of varying relative significance, between any two such tensors. We demonstrate the tensor GSVD in comparative modeling of patient- and platform-matched but probe-independent ovarian serous cystadenocarcinoma (OV) tumor, mostly high-grade, and normal DNA copy-number profiles, across each chromosome arm, and combination of two arms, separately. The modeling uncovers previously unrecognized patterns of tumor-exclusive platform-consistent co-occurring copy-number alterations (CNAs). We find, first, and validate that each of the patterns across only 7p and Xq, and the combination of 6p+12p, is correlated with a patient’s prognosis, is independent of the tumor’s stage, the best predictor of OV survival to date, and together with stage makes a better predictor than stage alone. Second, these patterns include most known OV-associated CNAs that map to these chromosome arms, as well as several previously unreported, yet frequent focal CNAs. Third, differential mRNA, microRNA, and protein expression consistently map to the DNA CNAs. A coherent picture emerges for each pattern, suggesting roles for the CNAs in OV pathogenesis and personalized therapy. In 6p+12p, deletion of the p21-encoding CDKN1A and p38-encoding MAPK14 and amplification of RAD51AP1 and KRAS encode for human cell transformation, and are correlated with a cell’s immortality, and a patient’s shorter survival time. In 7p, RPA3 deletion and POLD2 amplification are correlated with DNA stability, and a longer survival. In Xq

  19. Global Kalman filter approaches to estimate absolute angles of lower limb segments.

    Science.gov (United States)

    Nogueira, Samuel L; Lambrecht, Stefan; Inoue, Roberto S; Bortole, Magdo; Montagnoli, Arlindo N; Moreno, Juan C; Rocon, Eduardo; Terra, Marco H; Siqueira, Adriano A G; Pons, Jose L

    2017-05-16

    In this paper we propose the use of global Kalman filters (KFs) to estimate absolute angles of lower limb segments. Standard approaches adopt KFs to improve the performance of inertial sensors based on individual link configurations. In consequence, for a multi-body system like a lower limb exoskeleton, the inertial measurements of one link (e.g., the shank) are not taken into account in other link angle estimations (e.g., foot). Global KF approaches, on the other hand, correlate the collective contribution of all signals from lower limb segments observed in the state-space model through the filtering process. We present a novel global KF (matricial global KF) relying only on inertial sensor data, and validate both this KF and a previously presented global KF (Markov Jump Linear Systems, MJLS-based KF), which fuses data from inertial sensors and encoders from an exoskeleton. We furthermore compare both methods to the commonly used local KF. The results indicate that the global KFs performed significantly better than the local KF, with an average root mean square error (RMSE) of respectively 0.942° for the MJLS-based KF, 1.167° for the matrical global KF, and 1.202° for the local KFs. Including the data from the exoskeleton encoders also resulted in a significant increase in performance. The results indicate that the current practice of using KFs based on local models is suboptimal. Both the presented KF based on inertial sensor data, as well our previously presented global approach fusing inertial sensor data with data from exoskeleton encoders, were superior to local KFs. We therefore recommend to use global KFs for gait analysis and exoskeleton control.

  20. Comparative analysis and molecular characterization of a gene BANF1 encoded a DNA-binding protein during mitosis from the Giant Panda and Black Bear.

    Science.gov (United States)

    Zeng, Yichun; Hou, Yi-Ling; Ding, Xiang; Hou, Wan-Ru; Li, Jian

    2014-01-01

    Barrier to autointegration factor 1 (BANF1) is a DNA-binding protein found in the nucleus and cytoplasm of eukaryotic cells that functions to establish nuclear architecture during mitosis. The cDNA and the genomic sequence of BANF1 were cloned from the Giant Panda (Ailuropoda melanoleuca) and Black Bear (Ursus thibetanus mupinensis) using RT-PCR technology and Touchdown-PCR, respectively. The cDNA of the BANF1 cloned from Giant Panda and Black Bear is 297 bp in size, containing an open reading frame of 270 bp encoding 89 amino acids. The length of the genomic sequence from Giant Panda is 521 bp, from Black Bear is 536 bp, which were found both to possess 2 exons. Alignment analysis indicated that the nucleotide sequence and the deduced amino acid sequence are highly conserved to some mammalian species studied. Topology prediction showed there is one Protein kinase C phosphorylation site, one Casein kinase II phosphorylation site, one Tyrosine kinase phosphorylation site, one N-myristoylation site, and one Amidation site in the BANF1 protein of the Giant Panda, and there is one Protein kinase C phosphorylation site, one Tyrosine kinase phosphorylation site, one N-myristoylation site, and one Amidation site in the BANF1 protein of the Black Bear. The BANF1 gene can be readily expressed in E. coli. Results showed that the protein BANF1 fusion with the N-terminally His-tagged form gave rise to the accumulation of an expected 14 kD polypeptide that formed inclusion bodies. The expression products obtained could be used to purify the proteins and study their function further.

  1. Assignment of simian rotavirus SA11 temperature-sensitive mutant groups B and E to genome segments

    International Nuclear Information System (INIS)

    Gombold, J.L.; Estes, M.K.; Ramig, R.F.

    1985-01-01

    Recombinant (reassortant) viruses were selected from crosses between temperature-sensitive (ts) mutants of simian rotavirus SA11 and wild-type human rotavirus Wa. The double-stranded genome RNAs of the reassortants were examined by electrophoresis in Tris-glycine-buffered polyacrylamide gels and by dot hybridization with a cloned DNA probe for genome segment 2. Analysis of replacements of genome segments in the reassortants allowed construction of a map correlating genome segments providing functions interchangeable between SA11 and Wa. The reassortants revealed a functional correspondence in order of increasing electrophoretic mobility of genome segments. Analysis of the parental origin of genome segments in ts+ SA11/Wa reassortants derived from the crosses SA11 tsB(339) X Wa and SA11 tsE(1400) X Wa revealed that the group B lesion of tsB(339) was located on genome segment 3 and the group E lesion of tsE(1400) was on segment 8

  2. Assignment of simian rotavirus SA11 temperature-sensitive mutant groups B and E to genome segments

    Energy Technology Data Exchange (ETDEWEB)

    Gombold, J.L.; Estes, M.K.; Ramig, R.F.

    1985-05-01

    Recombinant (reassortant) viruses were selected from crosses between temperature-sensitive (ts) mutants of simian rotavirus SA11 and wild-type human rotavirus Wa. The double-stranded genome RNAs of the reassortants were examined by electrophoresis in Tris-glycine-buffered polyacrylamide gels and by dot hybridization with a cloned DNA probe for genome segment 2. Analysis of replacements of genome segments in the reassortants allowed construction of a map correlating genome segments providing functions interchangeable between SA11 and Wa. The reassortants revealed a functional correspondence in order of increasing electrophoretic mobility of genome segments. Analysis of the parental origin of genome segments in ts+ SA11/Wa reassortants derived from the crosses SA11 tsB(339) X Wa and SA11 tsE(1400) X Wa revealed that the group B lesion of tsB(339) was located on genome segment 3 and the group E lesion of tsE(1400) was on segment 8.

  3. Identification of functional elements and regulatory circuits by Drosophila modENCODE

    Energy Technology Data Exchange (ETDEWEB)

    Roy, Sushmita; Ernst, Jason; Kharchenko, Peter V.; Kheradpour, Pouya; Negre, Nicolas; Eaton, Matthew L.; Landolin, Jane M.; Bristow, Christopher A.; Ma, Lijia; Lin, Michael F.; Washietl, Stefan; Arshinoff, Bradley I.; Ay, Ferhat; Meyer, Patrick E.; Robine, Nicolas; Washington, Nicole L.; Stefano, Luisa Di; Berezikov, Eugene; Brown, Christopher D.; Candeias, Rogerio; Carlson, Joseph W.; Carr, Adrian; Jungreis, Irwin; Marbach, Daniel; Sealfon, Rachel; Tolstorukov, Michael Y.; Will, Sebastian; Alekseyenko, Artyom A.; Artieri, Carlo; Booth, Benjamin W.; Brooks, Angela N.; Dai, Qi; Davis, Carrie A.; Duff, Michael O.; Feng, Xin; Gorchakov, Andrey A.; Gu, Tingting; Henikoff, Jorja G.; Kapranov, Philipp; Li, Renhua; MacAlpine, Heather K.; Malone, John; Minoda, Aki; Nordman, Jared; Okamura, Katsutomo; Perry, Marc; Powell, Sara K.; Riddle, Nicole C.; Sakai, Akiko; Samsonova, Anastasia; Sandler, Jeremy E.; Schwartz, Yuri B.; Sher, Noa; Spokony, Rebecca; Sturgill, David; van Baren, Marijke; Wan, Kenneth H.; Yang, Li; Yu, Charles; Feingold, Elise; Good, Peter; Guyer, Mark; Lowdon, Rebecca; Ahmad, Kami; Andrews, Justen; Berger, Bonnie; Brenner, Steven E.; Brent, Michael R.; Cherbas, Lucy; Elgin, Sarah C. R.; Gingeras, Thomas R.; Grossman, Robert; Hoskins, Roger A.; Kaufman, Thomas C.; Kent, William; Kuroda, Mitzi I.; Orr-Weaver, Terry; Perrimon, Norbert; Pirrotta, Vincenzo; Posakony, James W.; Ren, Bing; Russell, Steven; Cherbas, Peter; Graveley, Brenton R.; Lewis, Suzanna; Micklem, Gos; Oliver, Brian; Park, Peter J.; Celniker, Susan E.; Henikoff, Steven; Karpen, Gary H.; Lai, Eric C.; MacAlpine, David M.; Stein, Lincoln D.; White, Kevin P.; Kellis, Manolis

    2010-12-22

    To gain insight into how genomic information is translated into cellular and developmental programs, the Drosophila model organism Encyclopedia of DNA Elements (modENCODE) project is comprehensively mapping transcripts, histone modifications, chromosomal proteins, transcription factors, replication proteins and intermediates, and nucleosome properties across a developmental time course and in multiple cell lines. We have generated more than 700 data sets and discovered protein-coding, noncoding, RNA regulatory, replication, and chromatin elements, more than tripling the annotated portion of the Drosophila genome. Correlated activity patterns of these elements reveal a functional regulatory network, which predicts putative new functions for genes, reveals stage- and tissue-specific regulators, and enables gene-expression prediction. Our results provide a foundation for directed experimental and computational studies in Drosophila and related species and also a model for systematic data integration toward comprehensive genomic and functional annotation. Several years after the complete genetic sequencing of many species, it is still unclear how to translate genomic information into a functional map of cellular and developmental programs. The Encyclopedia of DNA Elements (ENCODE) (1) and model organism ENCODE (modENCODE) (2) projects use diverse genomic assays to comprehensively annotate the Homo sapiens (human), Drosophila melanogaster (fruit fly), and Caenorhabditis elegans (worm) genomes, through systematic generation and computational integration of functional genomic data sets. Previous genomic studies in flies have made seminal contributions to our understanding of basic biological mechanisms and genome functions, facilitated by genetic, experimental, computational, and manual annotation of the euchromatic and heterochromatic genome (3), small genome size, short life cycle, and a deep knowledge of development, gene function, and chromosome biology. The functions

  4. Status of the segment interconnect, cable segment ancillary logic, and the cable segment hybrid driver projects

    International Nuclear Information System (INIS)

    Swoboda, C.; Barsotti, E.; Chappa, S.; Downing, R.; Goeransson, G.; Lensy, D.; Moore, G.; Rotolo, C.; Urish, J.

    1985-01-01

    The FASTBUS Segment Interconnect (SI) provides a communication path between two otherwise independent, asynchronous bus segments. In particular, the Segment Interconnect links a backplane crate segment to a cable segment. All standard FASTBUS address and data transactions can be passed through the SI or any number of SIs and segments in a path. Thus systems of arbitrary connection complexity can be formed, allowing simultaneous independent processing, yet still permitting devices associated with one segment to be accessed from others. The model S1 Segment Interconnect and the Cable Segment Ancillary Logic covered in this report comply with all the mandatory features stated in the FASTBUS specification document DOE/ER-0189. A block diagram of the SI is shown

  5. Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia

    Directory of Open Access Journals (Sweden)

    B Kazemi

    2009-12-01

    Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective  for the treatment of patients with  hemophilia A or B, who develop antibodies ( referred as inhibitors against  replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains.  Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.

  6. DNA/MVA Vaccines for HIV/AIDS

    Directory of Open Access Journals (Sweden)

    Smita S. Iyer

    2014-02-01

    Full Text Available Since the initial proof-of-concept studies examining the ability of antigen-encoded plasmid DNA to serve as an immunogen, DNA vaccines have evolved as a clinically safe and effective platform for priming HIV-specific cellular and humoral responses in heterologous “prime-boost” vaccination regimens. Direct injection of plasmid DNA into the muscle induces T- and B-cell responses against foreign antigens. However, the insufficient magnitude of this response has led to the development of approaches for enhancing the immunogenicity of DNA vaccines. The last two decades have seen significant progress in the DNA-based vaccine platform with optimized plasmid constructs, improved delivery methods, such as electroporation, the use of molecular adjuvants and novel strategies combining DNA with viral vectors and subunit proteins. These innovations are paving the way for the clinical application of DNA-based HIV vaccines. Here, we review preclinical studies on the DNA-prime/modified vaccinia Ankara (MVA-boost vaccine modality for HIV. There is a great deal of interest in enhancing the immunogenicity of DNA by engineering DNA vaccines to co-express immune modulatory adjuvants. Some of these adjuvants have demonstrated encouraging results in preclinical and clinical studies, and these data will be examined, as well.

  7. Co-expression of an Erwinia chrysanthemi pectate lyase-encoding gene (pelE) and an E. carotovora polygalacturonase-encoding gene (peh1) in Saccharomyces cerevisiae.

    Science.gov (United States)

    Laing, E; Pretorius, I S

    1993-05-01

    A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.

  8. A Region-Based GeneSIS Segmentation Algorithm for the Classification of Remotely Sensed Images

    Directory of Open Access Journals (Sweden)

    Stelios K. Mylonas

    2015-03-01

    Full Text Available This paper proposes an object-based segmentation/classification scheme for remotely sensed images, based on a novel variant of the recently proposed Genetic Sequential Image Segmentation (GeneSIS algorithm. GeneSIS segments the image in an iterative manner, whereby at each iteration a single object is extracted via a genetic-based object extraction algorithm. Contrary to the previous pixel-based GeneSIS where the candidate objects to be extracted were evaluated through the fuzzy content of their included pixels, in the newly developed region-based GeneSIS algorithm, a watershed-driven fine segmentation map is initially obtained from the original image, which serves as the basis for the forthcoming GeneSIS segmentation. Furthermore, in order to enhance the spatial search capabilities, we introduce a more descriptive encoding scheme in the object extraction algorithm, where the structural search modules are represented by polygonal shapes. Our objectives in the new framework are posed as follows: enhance the flexibility of the algorithm in extracting more flexible object shapes, assure high level classification accuracies, and reduce the execution time of the segmentation, while at the same time preserving all the inherent attributes of the GeneSIS approach. Finally, exploiting the inherent attribute of GeneSIS to produce multiple segmentations, we also propose two segmentation fusion schemes that operate on the ensemble of segmentations generated by GeneSIS. Our approaches are tested on an urban and two agricultural images. The results show that region-based GeneSIS has considerably lower computational demands compared to the pixel-based one. Furthermore, the suggested methods achieve higher classification accuracies and good segmentation maps compared to a series of existing algorithms.

  9. Genetic analysis of the pelA-pelE cluster encoding the acidic and basic pectate lyases in Erwinia chrysanthemi EC16.

    Science.gov (United States)

    Barras, F; Chatterjee, A K

    1987-10-01

    In Erwinia chrysanthemi (EC16) the clustered pelA and pelE genes encode an acidic (pI 4.2) and a basic (pI 10.0) pectate lyase (Pel), respectively. The pelA gene has been isolated on a 1.2 kb restriction fragment and the direction of transcription determined. DNA hybridization analysis showed that the pelE sequence shares DNA homology with pelA but not with pelB or pelC, two genes encoding other Pel species in EC16. Since Pel A and Pel E enzymes showed little similarity in terms of catalytic properties, it is proposed that pelA and pelE are duplicates which have highly diverged.

  10. Virus-encoded chemokine receptors--putative novel antiviral drug targets

    DEFF Research Database (Denmark)

    Rosenkilde, Mette M

    2005-01-01

    Large DNA viruses, in particular herpes- and poxviruses, have evolved proteins that serve as mimics or decoys for endogenous proteins in the host. The chemokines and their receptors serve key functions in both innate and adaptive immunity through control of leukocyte trafficking, and have...... receptors belong to the superfamily of G-protein coupled 7TM receptors that per se are excellent drug targets. At present, non-peptide antagonists have been developed against many chemokine receptors. The potentials of the virus-encoded chemokine receptors as drug targets--ie. as novel antiviral strategies...

  11. ERP Correlates of Encoding Success and Encoding Selectivity in Attention Switching

    Science.gov (United States)

    Yeung, Nick

    2016-01-01

    Long-term memory encoding depends critically on effective processing of incoming information. The degree to which participants engage in effective encoding can be indexed in electroencephalographic (EEG) data by studying event-related potential (ERP) subsequent memory effects. The current study investigated ERP correlates of memory success operationalised with two different measures—memory selectivity and global memory—to assess whether previously observed ERP subsequent memory effects reflect focused encoding of task-relevant information (memory selectivity), general encoding success (global memory), or both. Building on previous work, the present study combined an attention switching paradigm—in which participants were presented with compound object-word stimuli and switched between attending to the object or the word across trials—with a later recognition memory test for those stimuli, while recording their EEG. Our results provided clear evidence that subsequent memory effects resulted from selective attentional focusing and effective top-down control (memory selectivity) in contrast to more general encoding success effects (global memory). Further analyses addressed the question of whether successful encoding depended on similar control mechanisms to those involved in attention switching. Interestingly, differences in the ERP correlates of attention switching and successful encoding, particularly during the poststimulus period, indicated that variability in encoding success occurred independently of prestimulus demands for top-down cognitive control. These results suggest that while effects of selective attention and selective encoding co-occur behaviourally their ERP correlates are at least partly dissociable. PMID:27907075

  12. Cloning and sequencing of a gene encoding a 21-kilodalton outer membrane protein from Bordetella avium and expression of the gene in Salmonella typhimurium.

    Science.gov (United States)

    Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R

    1992-01-01

    Three gene libraries of Bordetella avium 197 DNA were prepared in Escherichia coli LE392 by using the cosmid vectors pCP13 and pYA2329, a derivative of pCP13 specifying spectinomycin resistance. The cosmid libraries were screened with convalescent-phase anti-B. avium turkey sera and polyclonal rabbit antisera against B. avium 197 outer membrane proteins. One E. coli recombinant clone produced a 56-kDa protein which reacted with convalescent-phase serum from a turkey infected with B. avium 197. In addition, five E. coli recombinant clones were identified which produced B. avium outer membrane proteins with molecular masses of 21, 38, 40, 43, and 48 kDa. At least one of these E. coli clones, which encoded the 21-kDa protein, reacted with both convalescent-phase turkey sera and antibody against B. avium 197 outer membrane proteins. The gene for the 21-kDa outer membrane protein was localized by Tn5seq1 mutagenesis, and the nucleotide sequence was determined by dideoxy sequencing. DNA sequence analysis of the 21-kDa protein revealed an open reading frame of 582 bases that resulted in a predicted protein of 194 amino acids. Comparison of the predicted amino acid sequence of the gene encoding the 21-kDa outer membrane protein with protein sequences in the National Biomedical Research Foundation protein sequence data base indicated significant homology to the OmpA proteins of Shigella dysenteriae, Enterobacter aerogenes, E. coli, and Salmonella typhimurium and to Neisseria gonorrhoeae outer membrane protein III, Haemophilus influenzae protein P6, and Pseudomonas aeruginosa porin protein F. The gene (ompA) encoding the B. avium 21-kDa protein hybridized with 4.1-kb DNA fragments from EcoRI-digested, chromosomal DNA of Bordetella pertussis and Bordetella bronchiseptica and with 6.0- and 3.2-kb DNA fragments from EcoRI-digested, chromosomal DNA of B. avium and B. avium-like DNA, respectively. A 6.75-kb DNA fragment encoding the B. avium 21-kDa protein was subcloned into the

  13. Loss of long term protection with the inclusion of HIV pol to a DNA vaccine encoding gag.

    Science.gov (United States)

    Garrod, Tamsin J; Gargett, Tessa; Yu, Wenbo; Major, Lee; Burrell, Christopher J; Wesselingh, Steven; Suhrbier, Andreas; Grubor-Bauk, Branka; Gowans, Eric J

    2014-11-04

    Traditional vaccine strategies that induce antibody responses have failed to protect against HIV infection in clinical trials, and thus cell-mediated immunity is now an additional criterion. Recent clinical trials that aimed to induce strong T cell responses failed to do so. Therefore, to enhance induction of protective T cell responses, it is crucial that the optimum antigen combination is chosen. Limited research has been performed into the number of antigens selected for an HIV vaccine. This study aimed to compare DNA vaccines encoding either a single HIV antigen or a combination of two antigens, using intradermal vaccination of C57BL/6 mice. Immune assays were performed on splenocytes, and in vivo protection was examined by challenge with a chimeric virus, EcoHIV, able to infect mouse but not human leukocytes, at 10 days (short term) and 60 days (long term) post final vaccination. At 60 days there was significantly lower frequency of induced antigen-specific CD8(+) T cells in the spleens of pCMVgag-pol-vaccinated mice compared with mice which received pCMVgag only. Most importantly, short term viral control of EcoHIV was similar for pCMVgag and pCMVgag-pol-vaccinated mice at day 10, but only the pCMVgag-vaccinated significantly controlled EcoHIV at day 60 compared with pCMV-vaccinated mice, showing that control was reduced with the inclusion of the HIV pol gene. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins.

    Science.gov (United States)

    Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman

    2012-09-01

    Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.

  15. Role of Mitochondrial DNA Copy Number Alteration in Human Renal Cell Carcinoma

    Directory of Open Access Journals (Sweden)

    Chen-Sung Lin

    2016-05-01

    Full Text Available We investigated the role of mitochondrial DNA (mtDNA copy number alteration in human renal cell carcinoma (RCC. The mtDNA copy numbers of paired cancer and non-cancer parts from five resected RCC kidneys after radical nephrectomy were determined by quantitative polymerase chain reaction (Q-PCR. An RCC cell line, 786-O, was infected by lentiviral particles to knock down mitochondrial transcriptional factor A (TFAM. Null target (NT and TFAM-knockdown (TFAM-KD represented the control and knockdown 786-O clones, respectively. Protein or mRNA expression levels of TFAM; mtDNA-encoded NADH dehydrogenase subunit 1 (ND1, ND6 and cytochrome c oxidase subunit 2 (COX-2; nuclear DNA (nDNA-encoded succinate dehydrogenase subunit A (SDHA; v-akt murine thymoma viral oncogene homolog 1 gene (AKT-encoded AKT and v-myc myelocytomatosis viral oncogene homolog gene (c-MYC-encoded MYC; glycolytic enzymes including hexokinase II (HK-II, glucose 6-phosphate isomerase (GPI, phosphofructokinase (PFK, and lactate dehydrogenase subunit A (LDHA; and hypoxia-inducible factors the HIF-1α and HIF-2α, pyruvate dehydrogenase kinase 1 (PDK1, and pyruvate dehydrogenase E1 component α subunit (PDHA1 were analyzed by Western blot or Q-PCR. Bioenergetic parameters of cellular metabolism, basal mitochondrial oxygen consumption rate (mOCRB and basal extracellular acidification rate (ECARB, were measured by a Seahorse XFe-24 analyzer. Cell invasiveness was evaluated by a trans-well migration assay and vimentin expression. Doxorubicin was used as a chemotherapeutic agent. The results showed a decrease of mtDNA copy numbers in resected RCC tissues (p = 0.043. The TFAM-KD clone expressed lower mtDNA copy number (p = 0.034, lower mRNA levels of TFAM (p = 0.008, ND1 (p = 0.007, and ND6 (p = 0.017, and lower protein levels of TFAM and COX-2 than did the NT clone. By contrast, the protein levels of HIF-2α, HK-II, PFK, LDHA, AKT, MYC and vimentin; trans-well migration activity (p = 0

  16. Complete cDNA sequence of human complement C1s and close physical linkage of the homologous genes C1s and C1r

    International Nuclear Information System (INIS)

    Tosi, M.; Duponchel, C.; Meo, T.; Julier, C.

    1987-01-01

    Overlapping molecular clones encoding the complement subcomponent C1s were isolated from a human liver cDNA library. The nucleotide sequence reconstructed from these clones spans about 85% of the length of the liver C1s messenger RNAs, which occur in three distinct size classes around 3 kilobases in length. Comparisons with the sequence of C1r, the other enzymatic subcomponent of C1, reveal 40% amino acid identity and conservation of all the cysteine residues. Beside the serine protease domain, the following sequence motifs, previously described in C1r, were also found in C1s: (a) two repeats of the type found in the Ba fragment of complement factor B and in several other complement but also noncomplement proteins, (b) a cysteine-rich segment homologous to the repeats of epidermal growth factor precursor, and (c) a duplicated segment found only in C1r and C1s. Differences in each of these structural motifs provide significant clues for the interpretation of the functional divergence of these interacting serine protease zymogens. Hybridizations of C1r and C1s probes to restriction endonuclease fragments of genomic DNA demonstrate close physical linkage of the corresponding genes. The implications of this finding are discussed with respect to the evolution of C1r and C1s after their origin by tandem gene duplication and to the previously observed combined hereditary deficiencies of Clr and Cls

  17. Protein tyrosine phosphatase encoded in Cotesia plutellae bracovirus suppresses a larva-to-pupa metamorphosis of the diamondback moth, Plutella xylostella.

    Science.gov (United States)

    Kim, Jiwan; Hepat, Rahul; Lee, Daeweon; Kim, Yonggyun

    2013-09-01

    Parasitization by an endoparasitoid wasp, Cotesia plutellae, inhibits a larva-to-pupa metamorphosis of the diamondback moth, Plutella xylostella. This study tested an inhibitory effect of C. plutellae bracovirus (CpBV) on the metamorphosis of P. xylostella. Parasitized P. xylostella exhibited significantly reduced prothoracic gland (PTG) development at the last instar compared to nonparasitized larvae. Expression of the ecdysone receptor (EcR) was markedly suppressed during the last instar larvae parasitized by C. plutellae. By contrast, expression of the insulin receptor (InR) significantly increased in the parasitized larvae. Microinjection of CpBV significantly inhibited the larva-to-pupa metamorphosis of nonparasitized larvae in a dose-dependent manner. Injection of CpBV also inhibited the expression of the EcR and increased the expression of the InR. Individual CpBV segments were transiently expressed in its encoded genes in nonparasitized larvae and screened to determine antimetamorphic viral gene(s). Out of 21 CpBV segments, two viral segments (CpBV-S22 and CpBV-S27) were proved to inhibit larva-to-pupa metamorphosis by transient expression assay. RNA interference of each gene encoded in the viral segments was applied to determine antimetamorphic gene(s). Protein tyrosine phosphatase, early expressed gene, and four hypothetical genes were selected to be associated with the antimetamorphic activity of CpBV. These results suggest that antimetamorphosis of P. xylostella parasitized by C. plutellae is induced by inhibiting PTG development and subsequent ecdysteroid signaling with viral factors of CpBV. Copyright © 2013 Elsevier Inc. All rights reserved.

  18. Distinct kinetics of human DNA ligases I, IIIalpha, IIIbeta, and IV reveal direct DNA sensing ability and differential physiological functions in DNA repair

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Xi; Ballin, Jeff D.; Della-Maria, Julie; Tsai, Miaw-Sheue; White, Elizabeth J.; Tomkinson, Alan E.; Wilson, Gerald M.

    2009-05-11

    The three human LIG genes encode polypeptides that catalyze phosphodiester bond formation during DNA replication, recombination and repair. While numerous studies have identified protein partners of the human DNA ligases (hLigs), there has been little characterization of the catalytic properties of these enzymes. In this study, we developed and optimized a fluorescence-based DNA ligation assay to characterize the activities of purified hLigs. Although hLigI joins DNA nicks, it has no detectable activity on linear duplex DNA substrates with short, cohesive single-strand ends. By contrast, hLigIII{beta} and the hLigIII{alpha}/XRCC1 and hLigIV/XRCC4 complexes are active on both nicked and linear duplex DNA substrates. Surprisingly, hLigIV/XRCC4, which is a key component of the major non-homologous end joining (NHEJ) pathway, is significantly less active than hLigIII on a linear duplex DNA substrate. Notably, hLigIV/XRCC4 molecules only catalyze a single ligation event in the absence or presence of ATP. The failure to catalyze subsequent ligation events reflects a defect in the enzyme-adenylation step of the next ligation reaction and suggests that, unless there is an in vivo mechanism to reactivate DNA ligase IV/XRCC4 following phosphodiester bond formation, the cellular NHEJ capacity will be determined by the number of adenylated DNA ligaseIV/XRCC4 molecules.

  19. Helical chirality: a link between local interactions and global topology in DNA.

    Directory of Open Access Journals (Sweden)

    Youri Timsit

    Full Text Available DNA supercoiling plays a major role in many cellular functions. The global DNA conformation is however intimately linked to local DNA-DNA interactions influencing both the physical properties and the biological functions of the supercoiled molecule. Juxtaposition of DNA double helices in ubiquitous crossover arrangements participates in multiple functions such as recombination, gene regulation and DNA packaging. However, little is currently known about how the structure and stability of direct DNA-DNA interactions influence the topological state of DNA. Here, a crystallographic analysis shows that due to the intrinsic helical chirality of DNA, crossovers of opposite handedness exhibit markedly different geometries. While right-handed crossovers are self-fitted by sequence-specific groove-backbone interaction and bridging Mg(2+ sites, left-handed crossovers are juxtaposed by groove-groove interaction. Our previous calculations have shown that the different geometries result in differential stabilisation in solution, in the presence of divalent cations. The present study reveals that the various topological states of the cell are associated with different inter-segmental interactions. While the unstable left-handed crossovers are exclusively formed in negatively supercoiled DNA, stable right-handed crossovers constitute the local signature of an unusual topological state in the cell, such as the positively supercoiled or relaxed DNA. These findings not only provide a simple mechanism for locally sensing the DNA topology but also lead to the prediction that, due to their different tertiary intra-molecular interactions, supercoiled molecules of opposite signs must display markedly different physical properties. Sticky inter-segmental interactions in positively supercoiled or relaxed DNA are expected to greatly slow down the slithering dynamics of DNA. We therefore suggest that the intrinsic helical chirality of DNA may have oriented the early

  20. Viroids: how to infect a host and cause disease without encoding proteins.

    Science.gov (United States)

    Navarro, Beatriz; Gisel, Andreas; Rodio, Maria-Elena; Delgado, Sonia; Flores, Ricardo; Di Serio, Francesco

    2012-07-01

    Despite being composed by a single-stranded, circular, non-protein-coding RNA of just 246-401 nucleotides (nt), viroids can incite in their host plants symptoms similar to those caused by DNA and RNA viruses, which have genomes at least 20-fold bigger and encode proteins. On the other hand, certain non-protein-coding plant satellite RNAs display structural similarities with viroids but for replication and transmission they need to parasitize specific helper viruses (modifying concomitantly the symptoms they induce). While phenotypic alterations accompanying infection by viruses may partly result from expressing the proteins they code for, how the non-protein-coding viroids (and satellite RNAs) cause disease remains a conundrum. Initial ideas on viroid pathogenesis focused on a direct interaction of the genomic RNA with host proteins resulting in their malfunction. With the advent of RNA silencing, it was alternatively proposed that symptoms could be produced by viroid-derived small RNAs (vd-sRNAs) -generated by the host defensive machinery- targeting specific host mRNA or DNA sequences for post-transcriptional or transcriptional gene silencing, respectively, a hypothesis that could also explain pathogenesis of non-protein-coding satellite RNAs. Evidence sustaining this view has been circumstantial, but recent data provide support for it in two cases: i) the yellow symptoms associated with a specific satellite RNA result from a 22-nt small RNA (derived from the 24-nt fragment of the satellite genome harboring the pathogenic determinant), which is complementary to a segment of the mRNA of the chlorophyll biosynthetic gene CHLI and targets it for cleavage by the RNA silencing machinery, and ii) two 21-nt vd-sRNAS containing the pathogenic determinant of the albino phenotype induced by a chloroplast-replicating viroid target for cleavage the mRNA coding for the chloroplastic heat-shock protein 90 via RNA silencing too. This evidence, which is compelling for the

  1. aldB, an RpoS-dependent gene in Escherichia coli encoding an aldehyde dehydrogenase that is repressed by Fis and activated by Crp.

    OpenAIRE

    Xu, J; Johnson, R C

    1995-01-01

    Escherichia coli aldB was identified as a gene that is negatively regulated by Fis but positively regulated by RpoS. The complete DNA sequence determined in this study indicates that aldB encodes a 56.3-kDa protein which shares a high degree of homology with an acetaldehyde dehydrogenase encoded by acoD of Alcaligenes eutrophus and an aldehyde dehydrogenase encoded by aldA of Vibrio cholerae and significant homology with a group of other aldehyde dehydrogenases from prokaryotes and eukaryotes...

  2. Segmented block copolymers with monodisperse aramide end-segments

    NARCIS (Netherlands)

    Araichimani, A.; Gaymans, R.J.

    2008-01-01

    Segmented block copolymers were synthesized using monodisperse diaramide (TT) as hard segments and PTMO with a molecular weight of 2 900 g · mol-1 as soft segments. The aramide: PTMO segment ratio was increased from 1:1 to 2:1 thereby changing the structure from a high molecular weight multi-block

  3. A DNA vaccine encoding multiple HIV CD4 epitopes elicits vigorous polyfunctional, long-lived CD4+ and CD8+ T cell responses.

    Directory of Open Access Journals (Sweden)

    Daniela Santoro Rosa

    Full Text Available T-cell based vaccines against HIV have the goal of limiting both transmission and disease progression by inducing broad and functionally relevant T cell responses. Moreover, polyfunctional and long-lived specific memory T cells have been associated to vaccine-induced protection. CD4(+ T cells are important for the generation and maintenance of functional CD8(+ cytotoxic T cells. We have recently developed a DNA vaccine encoding 18 conserved multiple HLA-DR-binding HIV-1 CD4 epitopes (HIVBr18, capable of eliciting broad CD4(+ T cell responses in multiple HLA class II transgenic mice. Here, we evaluated the breadth and functional profile of HIVBr18-induced immune responses in BALB/c mice. Immunized mice displayed high-magnitude, broad CD4(+/CD8(+ T cell responses, and 8/18 vaccine-encoded peptides were recognized. In addition, HIVBr18 immunization was able to induce polyfunctional CD4(+ and CD8(+ T cells that proliferate and produce any two cytokines (IFNγ/TNFα, IFNγ/IL-2 or TNFα/IL-2 simultaneously in response to HIV-1 peptides. For CD4(+ T cells exclusively, we also detected cells that proliferate and produce all three tested cytokines simultaneously (IFNγ/TNFα/IL-2. The vaccine also generated long-lived central and effector memory CD4(+ T cells, a desirable feature for T-cell based vaccines. By virtue of inducing broad, polyfunctional and long-lived T cell responses against conserved CD4(+ T cell epitopes, combined administration of this vaccine concept may provide sustained help for CD8(+ T cells and antibody responses- elicited by other HIV immunogens.

  4. Gardenia jasminoides Encodes an Inhibitor-2 Protein for Protein Phosphatase Type 1

    Science.gov (United States)

    Gao, Lan; Li, Hao-Ming

    2017-08-01

    Protein phosphatase-1 (PP1) regulates diverse, essential cellular processes such as cell cycle progression, protein synthesis, muscle contraction, carbohydrate metabolism, transcription and neuronal signaling. Inhibitor-2 (I-2) can inhibit the activity of PP1 and has been found in diverse organisms. In this work, a Gardenia jasminoides fruit cDNA library was constructed, and the GjI-2 cDNA was isolated from the cDNA library by sequencing method. The GjI-2 cDNA contains a predicted 543 bp open reading frame that encodes 180 amino acids. The bioinformatics analysis suggested that the GjI-2 has conserved PP1c binding motif, and contains a conserved phosphorylation site, which is important in regulation of its activity. The three-dimensional model structure of GjI-2 was buite, its similar with the structure of I-2 from mouse. The results suggest that GjI-2 has relatively conserved RVxF, FxxR/KxR/K and HYNE motif, and these motifs are involved in interaction with PP1.

  5. Molecular genetic and biochemical analyses of a DNA repair gene from Serratia marcescens

    International Nuclear Information System (INIS)

    Murphy, K.E.

    1989-01-01

    In Escherichia coli, the SOS response and two 3-methyladenine DNA glycosylases (TagI and TagII) are required for repair of DNA damaged by alkylating agents such as methyl methanesulfonate (MMS). Mutations of the recA gene eliminate the SOS response. TagI and TagII are encoded by the tag and alkA genes, respectively. A gene (rpr) encoding 3-methyladenine DNA glycosylase activity was isolated from the Gram-negative bacterium Serratia marcescens. The gene, localized to a 1.5-kilobase pair SmaI-HindIII restriction fragment, was cloned into plasmid pUC18. The clone complemented E. coli tag alkA and recA mutations for MMS resistance. The rpr gene did not, however, complement recA mutations for resistance to ultraviolet light or the ability to perform homologous recombination reactions, nor did it complement E. coli ada or alkB mutations. Two proteins of molecular weights 42,000 and 16,000 were produced from the rpr locus. Analysis of deletion and insertion mutants of rpr suggested that the 42kD molecule is the active protein. The 16kD protein may either be a breakdown product of the 42kD species or may be encoded by another gene overlapping the reading frame of the rpr gene. Biochemical assays showed that the rpr gene product (Rpr) possesses 3-methyladenine DNA glycosylase activity

  6. Engineered cell-cell communication via DNA messaging

    Directory of Open Access Journals (Sweden)

    Ortiz Monica E

    2012-09-01

    Full Text Available Abstract Background Evolution has selected for organisms that benefit from genetically encoded cell-cell communication. Engineers have begun to repurpose elements of natural communication systems to realize programmed pattern formation and coordinate other population-level behaviors. However, existing engineered systems rely on system-specific small molecules to send molecular messages among cells. Thus, the information transmission capacity of current engineered biological communication systems is physically limited by specific biomolecules that are capable of sending only a single message, typically “regulate transcription.” Results We have engineered a cell-cell communication platform using bacteriophage M13 gene products to autonomously package and deliver heterologous DNA messages of varying lengths and encoded functions. We demonstrate the decoupling of messages from a common communication channel via the autonomous transmission of various arbitrary genetic messages. Further, we increase the range of engineered DNA messaging across semisolid media by linking message transmission or receipt to active cellular chemotaxis. Conclusions We demonstrate decoupling of a communication channel from message transmission within engineered biological systems via the autonomous targeted transduction of user-specified heterologous DNA messages. We also demonstrate that bacteriophage M13 particle production and message transduction occurs among chemotactic bacteria. We use chemotaxis to improve the range of DNA messaging, increasing both transmission distance and communication bit rates relative to existing small molecule-based communication systems. We postulate that integration of different engineered cell-cell communication platforms will allow for more complex spatial programming of dynamic cellular consortia.

  7. Segmentation of consumer's markets and evaluation of market's segments

    OpenAIRE

    ŠVECOVÁ, Iveta

    2013-01-01

    The goal of this bachelor thesis was to explain a possibly segmentation of consumer´s markets for a chosen company, and to present a suitable goods offer, so it would be suitable to the needs of selected segments. The work is divided into theoretical and practical part. First part describes marketing, segmentation, segmentation of consumer's markets, consumer's market, market's segments a other terms. Second part describes an evaluation of questionnaire survey, discovering of market's segment...

  8. biomvRhsmm: Genomic Segmentation with Hidden Semi-Markov Model

    Directory of Open Access Journals (Sweden)

    Yang Du

    2014-01-01

    Full Text Available High-throughput technologies like tiling array and next-generation sequencing (NGS generate continuous homogeneous segments or signal peaks in the genome that represent transcripts and transcript variants (transcript mapping and quantification, regions of deletion and amplification (copy number variation, or regions characterized by particular common features like chromatin state or DNA methylation ratio (epigenetic modifications. However, the volume and output of data produced by these technologies present challenges in analysis. Here, a hidden semi-Markov model (HSMM is implemented and tailored to handle multiple genomic profile, to better facilitate genome annotation by assisting in the detection of transcripts, regulatory regions, and copy number variation by holistic microarray or NGS. With support for various data distributions, instead of limiting itself to one specific application, the proposed hidden semi-Markov model is designed to allow modeling options to accommodate different types of genomic data and to serve as a general segmentation engine. By incorporating genomic positions into the sojourn distribution of HSMM, with optional prior learning using annotation or previous studies, the modeling output is more biologically sensible. The proposed model has been compared with several other state-of-the-art segmentation models through simulation benchmarking, which shows that our efficient implementation achieves comparable or better sensitivity and specificity in genomic segmentation.

  9. Differential mitochondrial DNA and gene expression in inherited retinal dysplasia in miniature Schnauzer dogs.

    Science.gov (United States)

    Appleyard, Greg D; Forsyth, George W; Kiehlbauch, Laura M; Sigfrid, Kristen N; Hanik, Heather L J; Quon, Anita; Loewen, Matthew E; Grahn, Bruce H

    2006-05-01

    To investigate the molecular basis of inherited retinal dysplasia in miniature Schnauzers. Retina and retinal pigment epithelial tissues were collected from canine subjects at the age of 3 weeks. Total RNA isolated from these tissues was reverse transcribed to make representative cDNA pools that were compared for differences in gene expression by using a subtractive hybridization technique referred to as representational difference analysis (RDA). Expression differences identified by RDA were confirmed and quantified by real-time reverse-transcription PCR. Mitochondrial morphology from leukocytes and skeletal muscle of normal and affected miniature Schnauzers was examined by transmission electron microscopy. RDA screening of retinal pigment epithelial cDNA identified differences in mRNA transcript coding for two mitochondrial (mt) proteins--cytochrome oxidase subunit 1 and NADH dehydrogenase subunit 6--in affected dogs. Contrary to expectations, these identified sequences did not contain mutations. Based on the implication of mt-DNA-encoded proteins by the RDA experiments we used real-time PCR to compare the relative amounts of mt-DNA template in white blood cells from normal and affected dogs. White blood cells of affected dogs contained less than 30% of the normal amount of two specific mtDNA sequences, compared with the content of the nuclear-encoded glyceraldehyde-3-phosphate dehydrogenase (GA-3-PDH) reference gene. Retina and RPE tissue from affected dogs had reduced mRNA transcript levels for the two mitochondrial genes detected in the RDA experiment. Transcript levels for another mtDNA-encoded gene as well as the nuclear-encoded mitochondrial Tfam transcription factor were reduced in these tissues in affected dogs. Mitochondria from affected dogs were reduced in number and size and were unusually electron dense. Reduced levels of nuclear and mitochondrial transcripts in the retina and RPE of miniature Schnauzers affected with retinal dysplasia suggest that

  10. Deep Deconvolutional Neural Network for Target Segmentation of Nasopharyngeal Cancer in Planning Computed Tomography Images.

    Science.gov (United States)

    Men, Kuo; Chen, Xinyuan; Zhang, Ye; Zhang, Tao; Dai, Jianrong; Yi, Junlin; Li, Yexiong

    2017-01-01

    Radiotherapy is one of the main treatment methods for nasopharyngeal carcinoma (NPC). It requires exact delineation of the nasopharynx gross tumor volume (GTVnx), the metastatic lymph node gross tumor volume (GTVnd), the clinical target volume (CTV), and organs at risk in the planning computed tomography images. However, this task is time-consuming and operator dependent. In the present study, we developed an end-to-end deep deconvolutional neural network (DDNN) for segmentation of these targets. The proposed DDNN is an end-to-end architecture enabling fast training and testing. It consists of two important components: an encoder network and a decoder network. The encoder network was used to extract the visual features of a medical image and the decoder network was used to recover the original resolution by deploying deconvolution. A total of 230 patients diagnosed with NPC stage I or stage II were included in this study. Data from 184 patients were chosen randomly as a training set to adjust the parameters of DDNN, and the remaining 46 patients were the test set to assess the performance of the model. The Dice similarity coefficient (DSC) was used to quantify the segmentation results of the GTVnx, GTVnd, and CTV. In addition, the performance of DDNN was compared with the VGG-16 model. The proposed DDNN method outperformed the VGG-16 in all the segmentation. The mean DSC values of DDNN were 80.9% for GTVnx, 62.3% for the GTVnd, and 82.6% for CTV, whereas VGG-16 obtained 72.3, 33.7, and 73.7% for the DSC values, respectively. DDNN can be used to segment the GTVnx and CTV accurately. The accuracy for the GTVnd segmentation was relatively low due to the considerable differences in its shape, volume, and location among patients. The accuracy is expected to increase with more training data and combination of MR images. In conclusion, DDNN has the potential to improve the consistency of contouring and streamline radiotherapy workflows, but careful human review and a

  11. Pathological mechanisms underlying single large‐scale mitochondrial DNA deletions

    Science.gov (United States)

    Rocha, Mariana C.; Rosa, Hannah S.; Grady, John P.; Blakely, Emma L.; He, Langping; Romain, Nadine; Haller, Ronald G.; Newman, Jane; McFarland, Robert; Ng, Yi Shiau; Gorman, Grainne S.; Schaefer, Andrew M.; Tuppen, Helen A.; Taylor, Robert W.

    2018-01-01

    Objective Single, large‐scale deletions in mitochondrial DNA (mtDNA) are a common cause of mitochondrial disease. This study aimed to investigate the relationship between the genetic defect and molecular phenotype to improve understanding of pathogenic mechanisms associated with single, large‐scale mtDNA deletions in skeletal muscle. Methods We investigated 23 muscle biopsies taken from adult patients (6 males/17 females with a mean age of 43 years) with characterized single, large‐scale mtDNA deletions. Mitochondrial respiratory chain deficiency in skeletal muscle biopsies was quantified by immunoreactivity levels for complex I and complex IV proteins. Single muscle fibers with varying degrees of deficiency were selected from 6 patient biopsies for determination of mtDNA deletion level and copy number by quantitative polymerase chain reaction. Results We have defined 3 “classes” of single, large‐scale deletion with distinct patterns of mitochondrial deficiency, determined by the size and location of the deletion. Single fiber analyses showed that fibers with greater respiratory chain deficiency harbored higher levels of mtDNA deletion with an increase in total mtDNA copy number. For the first time, we have demonstrated that threshold levels for complex I and complex IV deficiency differ based on deletion class. Interpretation Combining genetic and immunofluorescent assays, we conclude that thresholds for complex I and complex IV deficiency are modulated by the deletion of complex‐specific protein‐encoding genes. Furthermore, removal of mt‐tRNA genes impacts specific complexes only at high deletion levels, when complex‐specific protein‐encoding genes remain. These novel findings provide valuable insight into the pathogenic mechanisms associated with these mutations. Ann Neurol 2018;83:115–130 PMID:29283441

  12. The Relationship Between Transcript Expression Levels of Nuclear Encoded (TFAM, NRF1 and Mitochondrial Encoded (MT-CO1 Genes in Single Human Oocytes During Oocyte Maturation

    Directory of Open Access Journals (Sweden)

    Ghaffari Novin M.

    2015-06-01

    Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.

  13. On the Immortality of Television Sets: ?Function? in the Human Genome According to the Evolution-Free Gospel of ENCODE

    OpenAIRE

    Graur, Dan; Zheng, Yichen; Price, Nicholas; Azevedo, Ricardo B.R.; Zufall, Rebecca A.; Elhaik, Eran

    2013-01-01

    A recent slew of ENCyclopedia Of DNA Elements (ENCODE) Consortium publications, specifically the article signed by all Consortium members, put forward the idea that more than 80% of the human genome is functional. This claim flies in the face of current estimates according to which the fraction of the genome that is evolutionarily conserved through purifying selection is less than 10%. Thus, according to the ENCODE Consortium, a biological function can be maintained indefinitely without selec...

  14. Discovery of a Potent Class of PI3Kα Inhibitors with Unique Binding Mode via Encoded Library Technology (ELT).

    Science.gov (United States)

    Yang, Hongfang; Medeiros, Patricia F; Raha, Kaushik; Elkins, Patricia; Lind, Kenneth E; Lehr, Ruth; Adams, Nicholas D; Burgess, Joelle L; Schmidt, Stanley J; Knight, Steven D; Auger, Kurt R; Schaber, Michael D; Franklin, G Joseph; Ding, Yun; DeLorey, Jennifer L; Centrella, Paolo A; Mataruse, Sibongile; Skinner, Steven R; Clark, Matthew A; Cuozzo, John W; Evindar, Ghotas

    2015-05-14

    In the search of PI3K p110α wild type and H1047R mutant selective small molecule leads, an encoded library technology (ELT) campaign against the desired target proteins was performed which led to the discovery of a selective chemotype for PI3K isoforms from a three-cycle DNA encoded library. An X-ray crystal structure of a representative inhibitor from this chemotype demonstrated a unique binding mode in the p110α protein.

  15. Deformable MR Prostate Segmentation via Deep Feature Learning and Sparse Patch Matching.

    Science.gov (United States)

    Guo, Yanrong; Gao, Yaozong; Shen, Dinggang

    2016-04-01

    Automatic and reliable segmentation of the prostate is an important but difficult task for various clinical applications such as prostate cancer radiotherapy. The main challenges for accurate MR prostate localization lie in two aspects: (1) inhomogeneous and inconsistent appearance around prostate boundary, and (2) the large shape variation across different patients. To tackle these two problems, we propose a new deformable MR prostate segmentation method by unifying deep feature learning with the sparse patch matching. First, instead of directly using handcrafted features, we propose to learn the latent feature representation from prostate MR images by the stacked sparse auto-encoder (SSAE). Since the deep learning algorithm learns the feature hierarchy from the data, the learned features are often more concise and effective than the handcrafted features in describing the underlying data. To improve the discriminability of learned features, we further refine the feature representation in a supervised fashion. Second, based on the learned features, a sparse patch matching method is proposed to infer a prostate likelihood map by transferring the prostate labels from multiple atlases to the new prostate MR image. Finally, a deformable segmentation is used to integrate a sparse shape model with the prostate likelihood map for achieving the final segmentation. The proposed method has been extensively evaluated on the dataset that contains 66 T2-wighted prostate MR images. Experimental results show that the deep-learned features are more effective than the handcrafted features in guiding MR prostate segmentation. Moreover, our method shows superior performance than other state-of-the-art segmentation methods.

  16. Automated segmentation of muscle and adipose tissue on CT images for human body composition analysis

    Science.gov (United States)

    Chung, Howard; Cobzas, Dana; Birdsell, Laura; Lieffers, Jessica; Baracos, Vickie

    2009-02-01

    The ability to compute body composition in cancer patients lends itself to determining the specific clinical outcomes associated with fat and lean tissue stores. For example, a wasting syndrome of advanced disease associates with shortened survival. Moreover, certain tissue compartments represent sites for drug distribution and are likely determinants of chemotherapy efficacy and toxicity. CT images are abundant, but these cannot be fully exploited unless there exist practical and fast approaches for tissue quantification. Here we propose a fully automated method for segmenting muscle, visceral and subcutaneous adipose tissues, taking the approach of shape modeling for the analysis of skeletal muscle. Muscle shape is represented using PCA encoded Free Form Deformations with respect to a mean shape. The shape model is learned from manually segmented images and used in conjunction with a tissue appearance prior. VAT and SAT are segmented based on the final deformed muscle shape. In comparing the automatic and manual methods, coefficients of variation (COV) (1 - 2%), were similar to or smaller than inter- and intra-observer COVs reported for manual segmentation.

  17. Endohedral confinement of a DNA dodecamer onto pristine carbon nanotubes and the stability of the canonical B form

    International Nuclear Information System (INIS)

    Cruz, Fernando J. A. L.; Pablo, Juan J. de; Mota, José P. B.

    2014-01-01

    Although carbon nanotubes are potential candidates for DNA encapsulation and subsequent delivery of biological payloads to living cells, the thermodynamical spontaneity of DNA encapsulation under physiological conditions is still a matter of debate. Using enhanced sampling techniques, we show for the first time that, given a sufficiently large carbon nanotube, the confinement of a double-stranded DNA segment, 5′-D( * CP * GP * CP * GP * AP * AP * TP * TP * CP * GP * CP * G)-3′, is thermodynamically favourable under physiological environments (134 mM, 310 K, 1 bar), leading to DNA-nanotube hybrids with lower free energy than the unconfined biomolecule. A diameter threshold of 3 nm is established below which encapsulation is inhibited. The confined DNA segment maintains its translational mobility and exhibits the main geometrical features of the canonical B form. To accommodate itself within the nanopore, the DNA's end-to-end length increases from 3.85 nm up to approximately 4.1 nm, due to a ∼0.3 nm elastic expansion of the strand termini. The canonical Watson-Crick H-bond network is essentially conserved throughout encapsulation, showing that the contact between the DNA segment and the hydrophobic carbon walls results in minor rearrangements of the nucleotides H-bonding. The results obtained here are paramount to the usage of carbon nanotubes as encapsulation media for next generation drug delivery technologies

  18. General Staining and Segmentation Procedures for High Content Imaging and Analysis.

    Science.gov (United States)

    Chambers, Kevin M; Mandavilli, Bhaskar S; Dolman, Nick J; Janes, Michael S

    2018-01-01

    Automated quantitative fluorescence microscopy, also known as high content imaging (HCI), is a rapidly growing analytical approach in cell biology. Because automated image analysis relies heavily on robust demarcation of cells and subcellular regions, reliable methods for labeling cells is a critical component of the HCI workflow. Labeling of cells for image segmentation is typically performed with fluorescent probes that bind DNA for nuclear-based cell demarcation or with those which react with proteins for image analysis based on whole cell staining. These reagents, along with instrument and software settings, play an important role in the successful segmentation of cells in a population for automated and quantitative image analysis. In this chapter, we describe standard procedures for labeling and image segmentation in both live and fixed cell samples. The chapter will also provide troubleshooting guidelines for some of the common problems associated with these aspects of HCI.

  19. Growth hormone and prolactin in Andrias davidianus: cDNA cloning, tissue distribution and phylogenetic analysis.

    Science.gov (United States)

    Yang, Liping; Meng, Zining; Liu, Yun; Zhang, Yong; Liu, Xiaochun; Lu, Danqi; Huang, Junhai; Lin, Haoran

    2010-01-15

    The Chinese giant salamander (Andrias davidianus) is one of the largest and 'living fossil' species of amphibian. To obtain genetic information for this species, the cDNAs encoding growth hormone (adGH) and prolactin (adPRL) were cloned from a pituitary cDNA library. The isolated adGH cDNA consisted of 864 bp and encoded a propeptide of 215 amino acids, while the cDNA of adPRL was 1106 bp in length and encoded a putative peptide of 229 amino acids. Expression of the GH and PRL mRNA was only detected in the pituitary. Phylogenetic analyses were performed based on the isolated pituitary hormone sequences using maximum parsimony and neighbor-joining algorithms. The clustering results are similar to that based on the morphological characteristics or the rRNA genes, which indicate that the two orders (Anura and Caudata) of amphibian were monophyletic, and that A. davidianus was diverged early in the Caudate clade. These results indicated that both the GH and PRL sequence might be useful to study the phylogenies of relatively moderate evolved groups.

  20. A DNA Vaccine Protects Human Immune Cells against Zika Virus Infection in Humanized Mice

    Directory of Open Access Journals (Sweden)

    Guohua Yi

    2017-11-01

    Full Text Available A DNA vaccine encoding prM and E protein has been shown to induce protection against Zika virus (ZIKV infection in mice and monkeys. However, its effectiveness in humans remains undefined. Moreover, identification of which immune cell types are specifically infected in humans is unclear. We show that human myeloid cells and B cells are primary targets of ZIKV in humanized mice. We also show that a DNA vaccine encoding full length prM and E protein protects humanized mice from ZIKV infection. Following administration of the DNA vaccine, humanized DRAG mice developed antibodies targeting ZIKV as measured by ELISA and neutralization assays. Moreover, following ZIKV challenge, vaccinated animals presented virtually no detectable virus in human cells and in serum, whereas unvaccinated animals displayed robust infection, as measured by qRT-PCR. Our results utilizing humanized mice show potential efficacy for a targeted DNA vaccine against ZIKV in humans.

  1. The nucleotide sequence of human transition protein 1 cDNA

    Energy Technology Data Exchange (ETDEWEB)

    Luerssen, H; Hoyer-Fender, S; Engel, W [Universitaet Goettingen (West Germany)

    1988-08-11

    The authors have screened a human testis cDNA library with an oligonucleotide of 81 mer prepared according to a part of the published nucleotide sequence of the rat transition protein TP 1. They have isolated a cDNA clone with the length of 441 bp containing the coding region of 162 bp for human transition protein 1. There is about 84% homology in the coding region of the sequence compared to rat. The human cDNA-clone encodes a polypeptide of 54 amino acids of which 7 are different to that of rat.

  2. Combining segmentation and attention: a new foveal attention model

    Directory of Open Access Journals (Sweden)

    Rebeca eMarfil

    2014-08-01

    Full Text Available Artificial vision systems cannot process all the information that they receive from the world in real time because it is highly expensive and inefficient in terms of computational cost. Inspired by biological perception systems, articial attention models pursuit to select only the relevant part of the scene. Besides, it is well established that the units of attention on human vision are not merely spatial but closely related to perceptual objects (proto-objects. This implies a strong bidirectional relationship between segmentation and attention processes. Therefore, while the segmentation process is the responsible to extract the proto-objects from the scene, attention can guide segmentation, arising the concept of foveal attention. When the focus of attention is deployed from one visual unit to another, the rest of the scene is perceived but at a lower resolution that the focused object. The result is a multi-resolution visual perception in which the fovea, a dimple on the central retina, provides the highest resolution vision. In this paper, a bottom-up foveal attention model is presented. In this model the input image is a foveal image represented using a Cartesian Foveal Geometry (CFG, which encodes the field of view of the sensor as a fovea (placed in the focus of attention surrounded by a set of concentric rings with decreasing resolution. Then multirresolution perceptual segmentation is performed by building a foveal polygon using the Bounded Irregular Pyramid (BIP. Bottom-up attention is enclosed in the same structure, allowing to set the fovea over the most salient image proto-object. Saliency is computed as a linear combination of multiple low level features such us colour and intensity contrast, symmetry, orientation and roundness. Obtained results from natural images show that the performance of the combination of hierarchical foveal segmentation and saliency estimation is good in terms of accuracy and speed.

  3. Topology of a Membrane Associated Regulator of Prokaryotic DNA Replication

    National Research Council Canada - National Science Library

    Firshein, William

    1998-01-01

    This proposal has focused on a broad host range plasmid, RK2, as a model system to study how a pair of initiation proteins encoded by the plasmid for DNA replication function when replication occurs...

  4. Ancient mtDNA genetic variants modulate mtDNA transcription and replication.

    Directory of Open Access Journals (Sweden)

    Sarit Suissa

    2009-05-01

    Full Text Available Although the functional consequences of mitochondrial DNA (mtDNA genetic backgrounds (haplotypes, haplogroups have been demonstrated by both disease association studies and cell culture experiments, it is not clear which of the mutations within the haplogroup carry functional implications and which are "evolutionary silent hitchhikers". We set forth to study the functionality of haplogroup-defining mutations within the mtDNA transcription/replication regulatory region by in vitro transcription, hypothesizing that haplogroup-defining mutations occurring within regulatory motifs of mtDNA could affect these processes. We thus screened >2500 complete human mtDNAs representing all major populations worldwide for natural variation in experimentally established protein binding sites and regulatory regions comprising a total of 241 bp in each mtDNA. Our screen revealed 77/241 sites showing point mutations that could be divided into non-fixed (57/77, 74% and haplogroup/sub-haplogroup-defining changes (i.e., population fixed changes, 20/77, 26%. The variant defining Caucasian haplogroup J (C295T increased the binding of TFAM (Electro Mobility Shift Assay and the capacity of in vitro L-strand transcription, especially of a shorter transcript that maps immediately upstream of conserved sequence block 1 (CSB1, a region associated with RNA priming of mtDNA replication. Consistent with this finding, cybrids (i.e., cells sharing the same nuclear genetic background but differing in their mtDNA backgrounds harboring haplogroup J mtDNA had a >2 fold increase in mtDNA copy number, as compared to cybrids containing haplogroup H, with no apparent differences in steady state levels of mtDNA-encoded transcripts. Hence, a haplogroup J regulatory region mutation affects mtDNA replication or stability, which may partially account for the phenotypic impact of this haplogroup. Our analysis thus demonstrates, for the first time, the functional impact of particular mtDNA

  5. Cloning and characterization of the human colipase cDNA

    International Nuclear Information System (INIS)

    Lowe, M.E.; Rosenblum, J.L.; McEwen, P.; Strauss, A.W.

    1990-01-01

    Pancreatic lipase hydrolyzes dietary triglycerides to monoglycerides and fatty acids. In the presence of bile salts, the activity of pancreatic lipase is markedly decreased. The activity can be restored by the addition of colipase, a low molecular weight protein secreted by the pancreas. The action of pancreatic lipase in the gut lumen is dependent upon its interaction with colipase. As a first step in elucidating the molecular events governing the interaction of lipase and colipase with each other and with fatty acids, a cDNA encoding human colipase was isolated from a λgt11 cDNA library with a rabbit polyclonal anti-human colipase antibody. The full-length 525 bp cDNA contained an open reading frame encoding 112 amino acids, including a 17 amino acid signal peptide. The predicted sequence contains 100% of the published protein sequence for human colipase determined by chemical methods, but predicts the presence of five additional NH 2 -terminal amino acids and four additional COOH-terminal amino acids. Comparison of the predicted protein sequence with the known sequences of colipase from other species reveals regions of extensive identity. The authors report, for the first time, a cDNA for colipase. The cDNA predicts a human procolipase an suggests that there may also be processing at the COOH-terminus. The regions of identity with colipase from other species will aid in defining the interaction with lipase and lipids through site-specific mutagenesis

  6. Pharmaceutical development of the plasmid DNA vaccine pDERMATT

    NARCIS (Netherlands)

    Quaak, S.G.L.

    2009-01-01

    The discovery of tumor specific antigens and self tolerance mechanisms against these antigens led to the assumption that antigens circulating at sufficient concentration levels could break this self tolerance mechanism and evoke immunological antitumor effects. pDERMATT (plasmid DNA encoding

  7. Molecular cloning and characterization of Antheraea mylitta cytoplasmic polyhedrosis virus polyhedrin gene and its variant forms

    International Nuclear Information System (INIS)

    Sinha-Datta, Uma; Chavali, Venkata Ramana Murthy; Ghosh, Ananta K.

    2005-01-01

    The segments 10 (S10) of the 11 double stranded RNA genomes from Antheraea mylitta cytoplasmic polyhedrosis virus (AmCPV) encoding a novel polyhedrin polypeptide was converted to cDNA, cloned, and sequenced. Three cDNA clones consisting of 1502 (AmCPV10-1), 1120 (AmCPV10-2), and 1415 (AmCPV10-3) nucleotides encoding polyhedrin of 254, 339, and 319 amino acids with molecular masses of 29, 39, and 37 kDa, respectively, were obtained, and verified by Northern analysis. These clones showed 70-94% sequence identity among them but none with any sequences in databases. The expression of AmCPV10-1 cDNA encoded polyhedrin in Sf-9 cells was detected by immunoblot analysis and formation of polyhedra by electron microscopy, as observed in AmCPV-infected gut cells, but no expression of AmCPV10-2 or AmCPV10-3 cDNA was detected, indicating that during AmCPV replication, along with functional S10 RNA, some defective variant forms of S10 RNAs are packaged in virion particles

  8. Isolation and characterization of the dnaA gene of Rickettsia prowazekii

    International Nuclear Information System (INIS)

    Waite, R.T.; Shaw, E.I.; Winkler, H.H.; Wood, D.G.

    1998-01-01

    The dnaA gene encoding the initiator protein of DNA replication was isolated from the obligate intracellular bacterium, Rickettsia prowazekii. Comparison of the deduced amino acid sequence of R. prowazekii DnaA with other bacterial DnaA proteins revealed extensive similarity. However, the rickettsial sequence is unique in the number of basic lysine residues found within a highly conserved portion of the putative DNA binding region, suggesting that the rickettsial protein may recognize a DNA sequence that differs from the consensus DnaA box sequence identified in other bacteria. Consensus DnaA box sequences, found upstream of many bacterial dnaA genes, were not identified upstream of rickettsial dnaA gene. In addition, gene organization within this region differed from that of other bacteria. The putative start of transcription of the rickettsial dnaA gene was localized to a site 522 nucleotides upstream of the DnaA start codon. Key words: Rickettsia prowazekii; dnaA gene; initiator protein (authors)

  9. Archaeal RNA polymerase arrests transcription at DNA lesions.

    Science.gov (United States)

    Gehring, Alexandra M; Santangelo, Thomas J

    2017-01-01

    Transcription elongation is not uniform and transcription is often hindered by protein-bound factors or DNA lesions that limit translocation and impair catalysis. Despite the high degree of sequence and structural homology of the multi-subunit RNA polymerases (RNAP), substantial differences in response to DNA lesions have been reported. Archaea encode only a single RNAP with striking structural conservation with eukaryotic RNAP II (Pol II). Here, we demonstrate that the archaeal RNAP from Thermococcus kodakarensis is sensitive to a variety of DNA lesions that pause and arrest RNAP at or adjacent to the site of DNA damage. DNA damage only halts elongation when present in the template strand, and the damage often results in RNAP arresting such that the lesion would be encapsulated with the transcription elongation complex. The strand-specific halt to archaeal transcription elongation on modified templates is supportive of RNAP recognizing DNA damage and potentially initiating DNA repair through a process akin to the well-described transcription-coupled DNA repair (TCR) pathways in Bacteria and Eukarya.

  10. Rv0004 is a new essential member of the mycobacterial DNA replication machinery.

    Science.gov (United States)

    Mann, Katherine M; Huang, Deborah L; Hooppaw, Anna J; Logsdon, Michelle M; Richardson, Kirill; Lee, Hark Joon; Kimmey, Jacqueline M; Aldridge, Bree B; Stallings, Christina L

    2017-11-01

    DNA replication is fundamental for life, yet a detailed understanding of bacterial DNA replication is limited outside the organisms Escherichia coli and Bacillus subtilis. Many bacteria, including mycobacteria, encode no identified homologs of helicase loaders or regulators of the initiator protein DnaA, despite these factors being essential for DNA replication in E. coli and B. subtilis. In this study we discover that a previously uncharacterized protein, Rv0004, from the human pathogen Mycobacterium tuberculosis is essential for bacterial viability and that depletion of Rv0004 leads to a block in cell cycle progression. Using a combination of genetic and biochemical approaches, we found that Rv0004 has a role in DNA replication, interacts with DNA and the replicative helicase DnaB, and affects DnaB-DnaA complex formation. We also identify a conserved domain in Rv0004 that is predicted to structurally resemble the N-terminal protein-protein interaction domain of DnaA. Mutation of a single conserved tryptophan within Rv0004's DnaA N-terminal-like domain leads to phenotypes similar to those observed upon Rv0004 depletion and can affect the association of Rv0004 with DnaB. In addition, using live cell imaging during depletion of Rv0004, we have uncovered a previously unappreciated role for DNA replication in coordinating mycobacterial cell division and cell size. Together, our data support that Rv0004 encodes a homolog of the recently identified DciA family of proteins found in most bacteria that lack the DnaC-DnaI helicase loaders in E. coli and B. subtilis. Therefore, the mechanisms of Rv0004 elucidated here likely apply to other DciA homologs and reveal insight into the diversity of bacterial strategies in even the most conserved biological processes.

  11. A DEMETER-like DNA demethylase governs tomato fruit ripening.

    Science.gov (United States)

    Liu, Ruie; How-Kit, Alexandre; Stammitti, Linda; Teyssier, Emeline; Rolin, Dominique; Mortain-Bertrand, Anne; Halle, Stefanie; Liu, Mingchun; Kong, Junhua; Wu, Chaoqun; Degraeve-Guibault, Charlotte; Chapman, Natalie H; Maucourt, Mickael; Hodgman, T Charlie; Tost, Jörg; Bouzayen, Mondher; Hong, Yiguo; Seymour, Graham B; Giovannoni, James J; Gallusci, Philippe

    2015-08-25

    In plants, genomic DNA methylation which contributes to development and stress responses can be actively removed by DEMETER-like DNA demethylases (DMLs). Indeed, in Arabidopsis DMLs are important for maternal imprinting and endosperm demethylation, but only a few studies demonstrate the developmental roles of active DNA demethylation conclusively in this plant. Here, we show a direct cause and effect relationship between active DNA demethylation mainly mediated by the tomato DML, SlDML2, and fruit ripening- an important developmental process unique to plants. RNAi SlDML2 knockdown results in ripening inhibition via hypermethylation and repression of the expression of genes encoding ripening transcription factors and rate-limiting enzymes of key biochemical processes such as carotenoid synthesis. Our data demonstrate that active DNA demethylation is central to the control of ripening in tomato.

  12. Genetic and biochemical identification of a novel single-stranded DNA binding complex in Haloferax volcanii

    Directory of Open Access Journals (Sweden)

    Amy eStroud

    2012-06-01

    Full Text Available Single-stranded DNA binding proteins play an essential role in DNA replication and repair. They use oligosaccharide-binding folds, a five-stranded ß-sheet coiled into a closed barrel, to bind to single-stranded DNA thereby protecting and stabilizing the DNA. In eukaryotes the single-stranded DNA binding protein is known as replication protein A (RPA and consists of three distinct subunits that function as a heterotrimer. The bacterial homolog is termed single-stranded DNA-binding protein (SSB and functions as a homotetramer. In the archaeon Haloferax volcanii there are three genes encoding homologs of RPA. Two of the rpa genes (rpa1 and rpa3 exist in operons with a novel gene specific to Euryarchaeota, this gene encodes a protein that we have termed rpa-associated protein (RPAP. The rpap genes encode proteins belonging to COG3390 group and feature oligosaccharide-binding folds, suggesting that they might cooperate with RPA in binding to single-stranded DNA. Our genetic analysis showed that rpa1 and rpa3 deletion mutants have differing phenotypes; only ∆rpa3 strains are hypersensitive to DNA damaging agents. Deletion of the rpa3-associated gene rpap3 led to similar levels of DNA damage sensitivity, as did deletion of the rpa3 operon, suggesting that RPA3 and RPAP3 function in the same pathway. Protein pull-downs involving recombinant hexahistidine-tagged RPAs showed that RPA3 co-purifies with RPAP3, and RPA1 co-purifies with RPAP1. This indicates that the RPAs interact only with their respective associated proteins; this was corroborated by the inability to construct rpa1 rpap3 and rpa3 rpap1 double mutants. This is the first report investigating the individual function of the archaeal COG3390 RPA-associated proteins. We have shown genetically and biochemically that the RPAPs interact with their respective RPAs, and have uncovered a novel single-stranded DNA binding complex that is unique to Euryarchaeota.

  13. Genetic and Biochemical Identification of a Novel Single-Stranded DNA-Binding Complex in Haloferax volcanii.

    Science.gov (United States)

    Stroud, Amy; Liddell, Susan; Allers, Thorsten

    2012-01-01

    Single-stranded DNA (ssDNA)-binding proteins play an essential role in DNA replication and repair. They use oligonucleotide/oligosaccharide-binding (OB)-folds, a five-stranded β-sheet coiled into a closed barrel, to bind to ssDNA thereby protecting and stabilizing the DNA. In eukaryotes the ssDNA-binding protein (SSB) is known as replication protein A (RPA) and consists of three distinct subunits that function as a heterotrimer. The bacterial homolog is termed SSB and functions as a homotetramer. In the archaeon Haloferax volcanii there are three genes encoding homologs of RPA. Two of the rpa genes (rpa1 and rpa3) exist in operons with a novel gene specific to Euryarchaeota; this gene encodes a protein that we have termed RPA-associated protein (rpap). The rpap genes encode proteins belonging to COG3390 group and feature OB-folds, suggesting that they might cooperate with RPA in binding to ssDNA. Our genetic analysis showed that rpa1 and rpa3 deletion mutants have differing phenotypes; only Δrpa3 strains are hypersensitive to DNA damaging agents. Deletion of the rpa3-associated gene rpap3 led to similar levels of DNA damage sensitivity, as did deletion of the rpa3 operon, suggesting that RPA3 and RPAP3 function in the same pathway. Protein pull-downs involving recombinant hexahistidine-tagged RPAs showed that RPA3 co-purifies with RPAP3, and RPA1 co-purifies with RPAP1. This indicates that the RPAs interact only with their respective associated proteins; this was corroborated by the inability to construct rpa1 rpap3 and rpa3 rpap1 double mutants. This is the first report investigating the individual function of the archaeal COG3390 RPA-associated proteins (RPAPs). We have shown genetically and biochemically that the RPAPs interact with their respective RPAs, and have uncovered a novel single-stranded DNA-binding complex that is unique to Euryarchaeota.

  14. Hoogsteen base pairs proximal and distal to echinomycin binding sites on DNA

    International Nuclear Information System (INIS)

    Mendel, D.; Dervan, P.B.

    1987-01-01

    Forms of the DNA double helix containing non-Watson-Crick base-pairing have been discovered recently based on x-ray diffraction analysis of quionoxaline antibiotic-oligonucleotide complexes. In an effort to find evidence for Hoogsteen base-pairing at quinoxaline-binding sites in solution, chemical footprinting (differential cleavage reactivity) of echinomycin bound to DNA restriction fragments was examined. The authors report that purines (A>G) in the first and/or fourth base-pair positions of occupied echinomycin-binding sites are hyperreactive to diethyl pyrocarbonate. The correspondence of the solid-state data and the sites of diethyl pyrocarbonate hyperreactivity suggests that diethyl pyrocarbonate may be a sensitive reagent for the detection of Hoogsteen base-pairing in solution. Moreover, a 12-base-pair segment of alternating A-T DNA, which is 6 base pairs away from the nearest strong echinomycin-binding site, is also hyperreactive to diethyl pyrocarbonate in the presence of echinomycin. This hyperreactive segment may be an altered form of right-handed DNA that is entirely Hoogsteen base-paired

  15. Abnormal recovery of DNA replication in ultraviolet-irradiated cell cultures of Drosophila melanogaster which are defective in DNA repair

    International Nuclear Information System (INIS)

    Brown, T.C.; Boyd, J.B.

    1981-01-01

    Cell cultures prepared from embryos of a control stock of Drosophila melanogaster respond to ultraviolet light with a decline and subsequent recovery both of thymidine incorporation and in the ability to synthesize nascent DNA in long segments. Recovery of one or both capacities is absent or diminished in irradiated cells from ten nonallelic mutants that are defective in DNA repair and from four of five nonallelic mutagen-sensitive mutants that exhibit normal repair capabilities. Recovery of thymidine incorporation is not observed in nine of ten DNA repair-defective mutants. On the other hand, partial or complete recovery of incorporation is observed in all but one repair-proficient mutagen-sensitive mutant. (orig./AJ) [de

  16. Cooperation of DNA-PKcs and WRN helicase in the maintenance of telomeric D-loops

    DEFF Research Database (Denmark)

    Kusumoto-Matsuo, Rika; Opresko, Patricia L; Ramsden, Dale

    2010-01-01

    Werner syndrome is an inherited human progeriod syndrome caused by mutations in the gene encoding the Werner Syndrome protein, WRN. It has both 3'-5' DNA helicase and exonuclease activities, and is suggested to have roles in many aspects of DNA metabolism, including DNA repair and telomere...... D-loop model substrate. In addition, the length of telomeric G-tails decreases in DNA-PKcs knockdown cells, and this phenotype is reversed by overexpression of WRN helicase. These results suggest that WRN and DNA-PKcs may cooperatively prevent G-tail shortening in vivo....

  17. Fission yeast cdc24(+) encodes a novel replication factor required for chromosome integrity.

    Science.gov (United States)

    Gould, K L; Burns, C G; Feoktistova, A; Hu, C P; Pasion, S G; Forsburg, S L

    1998-07-01

    A mutation within the Schizosaccharomyces pombe cdc24(+) gene was identified previously in a screen for cell division cycle mutants and the cdc24(+) gene was determined to be essential for S phase in this yeast. We have isolated the cdc24(+) gene by complementation of a new temperature-sensitive allele of the gene, cdc24-G1. The DNA sequence predicts the presence of an open reading frame punctuated by six introns which encodes a pioneer protein of 58 kD. A cdc24 null mutant was generated by homologous recombination. Haploid cells lacking cdc24(+) are inviable, indicating that cdc24(+) is an essential gene. The transcript of cdc24(+) is present at constant levels throughout the cell cycle. Cells lacking cdc24(+) function show a checkpoint-dependent arrest with a 2N DNA content, indicating a block late in S phase. Arrest is accompanied by a rapid loss of viability and chromosome breakage. An S. pombe homolog of the replicative DNA helicase DNA2 of S. cerevisiae suppresses cdc24. These results suggest that Cdc24p plays a role in the progression of normal