Classifying Coding DNA with Nucleotide Statistics

Directory of Open Access Journals (Sweden)

Nicolas Carels

2009-10-01

Full Text Available In this report, we compared the success rate of classification of coding sequences (CDS vs. introns by Codon Structure Factor (CSF and by a method that we called Universal Feature Method (UFM. UFM is based on the scoring of purine bias (Rrr and stop codon frequency. We show that the success rate of CDS/intron classification by UFM is higher than by CSF. UFM classifies ORFs as coding or non-coding through a score based on (i the stop codon distribution, (ii the product of purine probabilities in the three positions of nucleotide triplets, (iii the product of Cytosine (C, Guanine (G, and Adenine (A probabilities in the 1st, 2nd, and 3rd positions of triplets, respectively, (iv the probabilities of G in 1st and 2nd position of triplets and (v the distance of their GC3 vs. GC2 levels to the regression line of the universal correlation. More than 80% of CDSs (true positives of Homo sapiens (>250 bp, Drosophila melanogaster (>250 bp and Arabidopsis thaliana (>200 bp are successfully classified with a false positive rate lower or equal to 5%. The method releases coding sequences in their coding strand and coding frame, which allows their automatic translation into protein sequences with 95% confidence. The method is a natural consequence of the compositional bias of nucleotides in coding sequences.

Deregulation of purine pathway in Bacillus subtilis and its use in riboflavin biosynthesis

Science.gov (United States)

2014-01-01

Background Purine nucleotides are essential metabolites for living organisms because they are involved in many important processes, such as nucleic acid synthesis, energy supply, and biosynthesis of several amino acids and riboflavin. Owing to the pivotal roles of purines in cell physiology, the pool of intracellular purine nucleotides must be maintained under strict control, and hence the de novo purine biosynthetic pathway is tightly regulated by transcription repression and inhibition mechanism. Deregulation of purine pathway is essential for this pathway engineering in Bacillus subtilis. Results Deregulation of purine pathway was attempted to improve purine nucleotides supply, based on a riboflavin producer B. subtilis strain with modification of its rib operon. To eliminate transcription repression, the pur operon repressor PurR and the 5’-UTR of pur operon containing a guanine-sensing riboswitch were disrupted. Quantitative RT-PCR analysis revealed that the relative transcription levels of purine genes were up-regulated about 380 times. Furthermore, site-directed mutagenesis was successfully introduced into PRPP amidotransferase (encoded by purF) to remove feedback inhibition by homologous alignment and analysis. Overexpression of the novel mutant PurF (D293V, K316Q and S400W) significantly increased PRPP amidotransferase activity and triggered a strong refractory effect on purine nucleotides mediated inhibition. Intracellular metabolite target analysis indicated that the purine nucleotides supply in engineered strains was facilitated by a stepwise gene-targeted deregulation. With these genetic manipulations, we managed to enhance the metabolic flow through purine pathway and consequently increased riboflavin production 3-fold (826.52 mg/L) in the purF-VQW mutant strain. Conclusions A sequential optimization strategy was applied to deregulate the rib operon and purine pathway of B. subtilis to create genetic diversities and to improve riboflavin production

Simultaneous quantification by HPLC of purines in umami soup stock and evaluation of their effects on extracellular and intracellular purine metabolism.

Science.gov (United States)

Fukuuchi, T; Iyama, N; Yamaoka, N; Kaneko, K

2018-04-13

Ribonucleotide flavor enhancers such as inosine monophosphate (IMP) and guanosine monophosphate (GMP) provide umami taste, similarly to glutamine. Japanese cuisine frequently uses soup stocks containing these nucleotides to enhance umami. We quantified 18 types of purines (nucleotides, nucleosides, and purine bases) in three soup stocks (chicken, consommé, and dried bonito soup). IMP was the most abundant purine in all umami soup stocks, followed by hypoxanthine, inosine, and GMP. The IMP content of dried bonito soup was the highest of the three soup stocks. We also evaluated the effects of these purines on extracellular and intracellular purine metabolism in HepG2 cells after adding each umami soup stock to the cells. An increase in inosine and hypoxanthine was evident 1 h and 4 h after soup stock addition, and a low amount of xanthine and guanosine was observed in the extracellular medium. The addition of chicken soup stock resulted in increased intracellular and extracellular levels of uric acid and guanosine. Purine metabolism may be affected by ingredients present in soups.

Nucleotide sequence preservation of human mitochondrial DNA

International Nuclear Information System (INIS)

Monnat, R.J. Jr.; Loeb, L.A.

1985-01-01

Recombinant DNA techniques have been used to quantitate the amount of nucleotide sequence divergence in the mitochondrial DNA population of individual normal humans. Mitochondrial DNA was isolated from the peripheral blood lymphocytes of five normal humans and cloned in M13 mp11; 49 kilobases of nucleotide sequence information was obtained from 248 independently isolated clones from the five normal donors. Both between- and within-individual differences were identified. Between-individual differences were identified in approximately = to 1/200 nucleotides. In contrast, only one within-individual difference was identified in 49 kilobases of nucleotide sequence information. This high degree of mitochondrial nucleotide sequence homogeneity in human somatic cells is in marked contrast to the rapid evolutionary divergence of human mitochondrial DNA and suggests the existence of mechanisms for the concerted preservation of mammalian mitochondrial DNA sequences in single organisms

T.C.G triplet in an antiparallel purine.purine.pyrimidine DNA triplex. Conformational studies by NMR.

Science.gov (United States)

Dittrich, K; Gu, J; Tinder, R; Hogan, M; Gao, X

1994-04-12

The antiparallel purine.purine.pyrimidine DNA triplex, RRY6, which contains a T.C.G inverted triplet in the center of the sequence, was examined by proton and phosphorous two-dimensional NMR spectroscopy. The local conformation of the T.C.G triplet (T4.C11.G18) and the effect of this triplet on the global helical structure were analyzed in detail. The formation of the T.C.G triplet is confirmed by a set of cross-strand NOEs, including unusual cross-strand NOEs between the third strand and the pyrimidine strand as opposed to the purine strand of the duplex. NMR data suggest that the T.C.G triplet may be present in an equilibrium between a non-hydrogen-bonded form and a T(O4)-C(NH2) hydrogen-bonded form and that there is a distortion of the in-plane alignment of the three bases. The flanking G.G.C base triplets are well-defined on the 5'-side of T4, but somewhat interrupted on the 3'-side of T4. The effect of the third strand binding on the Watson-Crick duplex was probed by an NMR study of the free duplex RY6. NMR parameters are affected mostly around the T.C.G inversion site. The perturbations extend to at least two adjacent base triplets on either side. The binding of the third purine strand and the accommodation of a central T.C.G inversion in RRY6 does not require a readjustment in sugar pucker, which remains in the range of C2'-endo. 31P resonances of RRY6 distribute over a range of 2.2 ppm. The H-P coupling patterns of the third strand differ from those of the duplex. General spectral patterns defined by the marker protons of the RRY and YRY triplexes are compared.

Elevated Levels of DNA Strand Breaks Induced by a Base Analog in the Human Cell Line with the P32T ITPA Variant

Science.gov (United States)

Waisertreiger, Irina S.-R.; Menezes, Miriam R.; Randazzo, James; Pavlov, Youri I.

2010-01-01

Base analogs are powerful antimetabolites and dangerous mutagens generated endogenously by oxidative stress, inflammation, and aberrant nucleotide biosynthesis. Human inosine triphosphate pyrophosphatase (ITPA) hydrolyzes triphosphates of noncanonical purine bases (i.e., ITP, dITP, XTP, dXTP, or their mimic: 6-hydroxyaminopurine (HAP) deoxynucleoside triphosphate) and thus regulates nucleotide pools and protects cells from DNA damage. We demonstrate that the model purine base analog HAP induces DNA breaks in human cells and leads to elevation of levels of ITPA. A human polymorphic allele of the ITPA, 94C->A encodes for the enzyme with a P32T amino-acid change and leads to accumulation of nonhydrolyzed ITP. The polymorphism has been associated with adverse reaction to purine base-analog drugs. The level of both spontaneous and HAP-induced DNA breaks is elevated in the cell line with the ITPA P32T variant. The results suggested that human ITPA plays a pivotal role in the protection of DNA from noncanonical purine base analogs. PMID:20936128

Elevated Levels of DNA Strand Breaks Induced by a Base Analog in the Human Cell Line with the P32T ITPA Variant

Directory of Open Access Journals (Sweden)

Irina S.-R. Waisertreiger

2010-01-01

Full Text Available Base analogs are powerful antimetabolites and dangerous mutagens generated endogenously by oxidative stress, inflammation, and aberrant nucleotide biosynthesis. Human inosine triphosphate pyrophosphatase (ITPA hydrolyzes triphosphates of noncanonical purine bases (i.e., ITP, dITP, XTP, dXTP, or their mimic: 6-hydroxyaminopurine (HAP deoxynucleoside triphosphate and thus regulates nucleotide pools and protects cells from DNA damage. We demonstrate that the model purine base analog HAP induces DNA breaks in human cells and leads to elevation of levels of ITPA. A human polymorphic allele of the ITPA, 94C->A encodes for the enzyme with a P32T amino-acid change and leads to accumulation of nonhydrolyzed ITP. The polymorphism has been associated with adverse reaction to purine base-analog drugs. The level of both spontaneous and HAP-induced DNA breaks is elevated in the cell line with the ITPA P32T variant. The results suggested that human ITPA plays a pivotal role in the protection of DNA from noncanonical purine base analogs.

Imidazopyridine- and purine-thioacetamide derivatives: potent inhibitors of nucleotide pyrophosphatase/phosphodiesterase 1 (NPP1).

Science.gov (United States)

Chang, Lei; Lee, Sang-Yong; Leonczak, Piotr; Rozenski, Jef; De Jonghe, Steven; Hanck, Theodor; Müller, Christa E; Herdewijn, Piet

2014-12-11

Nucleotide pyrophosphatase/phosphodiesterase 1 (NPP1) belongs to the family of ecto-nucleotidases, which control extracellular nucleotide, nucleoside, and (di)phosphate levels. To study the (patho)physiological roles of NPP1 potent and selective inhibitors with drug-like properties are required. Therefore, a compound library was screened for NPP1 inhibitors using a colorimetric assay with p-nitrophenyl 5'-thymidine monophosphate (p-Nph-5'-TMP) as an artificial substrate. This led to the discovery of 2-(3H-imidazo[4,5-b]pyridin-2-ylthio)-N-(3,4-dimethoxyphenyl)acetamide (5a) as a hit compound with a Ki value of 217 nM. Subsequent structure-activity relationship studies led to the development of purine and imidazo[4,5-b]pyridine analogues with high inhibitory potency (Ki values of 5.00 nM and 29.6 nM, respectively) when assayed with p-Nph-5'-TMP as a substrate. Surprisingly, the compounds were significantly less potent when tested versus ATP as a substrate, with Ki values in the low micromolar range. A prototypic inhibitor was investigated for its mechanism of inhibition and found to be competitive versus both substrates.

Substitution of Active Site Tyrosines with Tryptophan Alters the Free Energy for Nucleotide Flipping by Human Alkyladenine DNA Glycosylase†

Science.gov (United States)

Hendershot, Jenna M.; Wolfe, Abigail E.; O'Brien, Patrick J.

2011-01-01

Human alkyladenine DNA glycosylase (AAG) locates and excises a wide variety of structurally diverse alkylated and oxidized purine lesions from DNA to initiate the base excision repair pathway. Recognition of a base lesion requires flipping of the damaged nucleotide into a relatively open active site pocket between two conserved tyrosine residues, Y127 and Y159. We have mutated each of these amino acids to tryptophan and measured the kinetic effects on the nucleotide flipping and base excision steps. The Y127W and Y159W mutant proteins have robust glycosylase activity toward DNA containing 1,N6-ethenoadenine (εA), within 4-fold of that of the wildtype enzyme, raising the possibility that tryptophan fluorescence could be used to probe the DNA binding and nucleotide flipping steps. Stopped-flow fluorescence was used to compare the time-dependent changes in tryptophan fluorescence and εA fluorescence. For both mutants, the tryptophan fluorescence exhibited two-step binding with essentially identical rate constants as were observed for the εA fluorescence changes. These results provide evidence that AAG forms an initial recognition complex in which the active site pocket is perturbed and the stacking of the damaged base is disrupted. Upon complete nucleotide flipping, there is further quenching of the tryptophan fluorescence with coincident quenching of the εA fluorescence. Although these mutations do not have large effects on the rate constant for excision of εA, there are dramatic effects on the rate constants for nucleotide flipping that result in 40 to 100-fold decreases in the flipping equilibrium relative to wildtype. Most of this effect is due to an increased rate of unflipping, but surprisingly the Y159W mutation causes a 5-fold increase in the rate constant for flipping. The large effect on the equilibrium for nucleotide flipping explains the greater deleterious effects that these mutations have on the glycosylase activity toward base lesions that are in

One-electron oxidation reactions of purine and pyrimidine bases in cellular DNA.

Science.gov (United States)

Cadet, Jean; Wagner, J Richard; Shafirovich, Vladimir; Geacintov, Nicholas E

2014-06-01

The aim of this survey is to critically review the available information on one-electron oxidation reactions of nucleobases in cellular DNA with emphasis on damage induced through the transient generation of purine and pyrimidine radical cations. Since the indirect effect of ionizing radiation mediated by hydroxyl radical is predominant in cells, efforts have been made to selectively ionize bases using suitable one-electron oxidants that consist among others of high intensity UVC laser pulses. Thus, the main oxidation product in cellular DNA was found to be 8-oxo-7,8-dihydroguanine as a result of direct bi-photonic ionization of guanine bases and indirect formation of guanine radical cations through hole transfer reactions from other base radical cations. The formation of 8-oxo-7,8-dihydroguanine and other purine and pyrimidine degradation products was rationalized in terms of the initial generation of related radical cations followed by either hydration or deprotonation reactions in agreement with mechanistic pathways inferred from detailed mechanistic studies. The guanine radical cation has been shown to be implicated in three other nucleophilic additions that give rise to DNA-protein and DNA-DNA cross-links in model systems. Evidence was recently provided for the occurrence of these three reactions in cellular DNA. There is growing evidence that one-electron oxidation reactions of nucleobases whose mechanisms have been characterized in model studies involving aqueous solutions take place in a similar way in cells. It may also be pointed out that the above cross-linked lesions are only produced from the guanine radical cation and may be considered as diagnostic products of the direct effect of ionizing radiation.

Molecular mechanisms of DNA photodamage

International Nuclear Information System (INIS)

Starrs, S.M.

2000-05-01

Photodamage in DNA, caused by ultraviolet (UV) light, can occur by direct excitation of the nucleobases or indirectly via the action of photosensitisers. Such, DNA photodamage can be potentially mutagenic or lethal. Among the methods available for detecting UV-induced DNA damage, gel sequencing protocols, utilising synthetic oligodeoxyribonucleotides as targets for UV radiation, allow photolesions to be mapped at nucleotide resolution. This approach has been applied to investigate both DNA damage mechanisms. Following a general overview of DNA photoreactivity, and a description of the main experimental procedures, Chapter 3 identifies the origin of an anomalous mobility shift observed in purine chemical sequence ladders that can confuse the interpretation of DNA cleavage results; measures to abolish this shift are also described. Chapters 4 and 5 examine the alkali-labile DNA damage photosensitised by representative nonsteroidal antiinflammatory drugs (NSAIDs) and the fluoroquinolone antibiotics. Suprofen was the most photoactive NSAID studied, producing different patterns of guanine-specific damage in single-stranded and duplex DNA. Uniform modification of guanine bases, typifying attack by singlet oxygen, was observed in single-stranded oligodeoxyribonucleotides. In duplex molecules, modification was limited to the 5'-G of GG doublets, which is indicative of an electron transfer. The effect of quenchers and photoproduct analysis substantiated these findings. The quinolone, nalidixic acid, behaves similarly. The random base cleavage photosensitised by the fluoroquinolones, has been attributed to free radicals produced during their photodecomposition. Chapter 6 addresses the photoreactivity of purines within unusual DNA structures formed by the repeat sequences (GGA) n and (GA) n , and a minihairpin. There was no definitive evidence for enhanced purine reactivity caused by direct excitation. Finally, Chapter 7 investigates the mutagenic potential of a dimeric

The Purine Bias of Coding Sequences is Determined by Physicochemical Constraints on Proteins.

Science.gov (United States)

Ponce de Leon, Miguel; de Miranda, Antonio Basilio; Alvarez-Valin, Fernando; Carels, Nicolas

2014-01-01

For this report, we analyzed protein secondary structures in relation to the statistics of three nucleotide codon positions. The purpose of this investigation was to find which properties of the ribosome, tRNA or protein level, could explain the purine bias (Rrr) as it is observed in coding DNA. We found that the Rrr pattern is the consequence of a regularity (the codon structure) resulting from physicochemical constraints on proteins and thermodynamic constraints on ribosomal machinery. The physicochemical constraints on proteins mainly come from the hydropathy and molecular weight (MW) of secondary structures as well as the energy cost of amino acid synthesis. These constraints appear through a network of statistical correlations, such as (i) the cost of amino acid synthesis, which is in favor of a higher level of guanine in the first codon position, (ii) the constructive contribution of hydropathy alternation in proteins, (iii) the spatial organization of secondary structure in proteins according to solvent accessibility, (iv) the spatial organization of secondary structure according to amino acid hydropathy, (v) the statistical correlation of MW with protein secondary structures and their overall hydropathy, (vi) the statistical correlation of thymine in the second codon position with hydropathy and the energy cost of amino acid synthesis, and (vii) the statistical correlation of adenine in the second codon position with amino acid complexity and the MW of secondary protein structures. Amino acid physicochemical properties and functional constraints on proteins constitute a code that is translated into a purine bias within the coding DNA via tRNAs. In that sense, the Rrr pattern within coding DNA is the effect of information transfer on nucleotide composition from protein to DNA by selection according to the codon positions. Thus, coding DNA structure and ribosomal machinery co-evolved to minimize the energy cost of protein coding given the functional

Ionization of Purine Tautomers in Nucleobases, Nucleosides, and Nucleotides: From the Gas Phase to the Aqueous Environment

Czech Academy of Sciences Publication Activity Database

Pluhařová, Eva; Jungwirth, Pavel; Bradforth, S. E.; Slavíček, P.

2011-01-01

Roč. 115, č. 5 (2011), s. 1294-1305 ISSN 1520-6106 R&D Projects: GA MŠk LC512; GA ČR GA203/08/0114 Grant - others:GA ČR(CZ) GA203/09/0422 Program:GA Institutional research plan: CEZ:AV0Z40550506 Keywords : DNA bases * purines * ab initio Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 3.696, year: 2011

Structure, stability, and thermodynamics of a short intermolecular purine-purine-pyrimidine triple helix

International Nuclear Information System (INIS)

Pilch, D.S.; Shafer, R.H.; Levenson, C.

1991-01-01

The authors have investigated the structure and physical chemistry of the d(C 3 T 4 C 3 )·2[d(G 3 A 4 G 3 )] triple helix by polyacrylamide gel electrophoresis (PAGE), 1 H NMR, and ultraviolet (UV) absorption spectroscopy. The triplex was stabilized with MgCl 2 at neutral pH. PAGE studies verify the stoichiometry of the strands comprising the triplex and indicate that the orientation of the third strand in purine-purine-pyrimidine (pur-pur-pyr) triplexes is antiparallel with respect to the purine strand of the underlying duplex. Imino proton NMR spectra provide evidence for the existence of new purine-purine (pur·pur) hydrogen bonds, in addition to those of the Watson-Crick (W-C) base pairs, in the triplex structure. These new hydrogen bonds are likely to correspond to the interaction between third-strand guanine NH1 imino protons and the N7 atoms of guanine residues on the puring strand of the underlying duplex. Thermal denaturation of the triplex proceeds to single strands in one step, under the conditions used in this study. Binding of the third strand appears to enhance the thermal stability of the duplex by 1-3 C, depending on the DNA concentration. This marked enhancement in stability, coupled with the lack of an acidic pH requirement, suggests that pur-pur-pyr triplexes are appealing choices for use in applications involving oligonucleotide targeting of duplex DNA in vitro and in vivo

Purine receptor P2Y_6 mediates cellular response to γ-ray-induced DNA damage

International Nuclear Information System (INIS)

Ide, Shunta; Nishimaki, Naoko; Tsukimoto, Mitsutoshi; Kojima, Shuji

2014-01-01

We previously showed that nucleotide P2 receptor agonists such as ATP and UTP amplify γ-ray-induced focus formation of phosphorylated histone H2A variant H2AX (γH2AX), which is considered to be an indicator of DNA damage so far, by activating purine P2Y_6 and P2Y_1_2 receptors. Therefore, we hypothesized that these P2 receptors play a role in inducing the repair response to γ-ray-induced DNA damage. In the present study, we tested this idea by using human lung cancer A549 cells. First, reverse-transcription polymerase chain reaction (RT-PCR) showed that P2Y_6 receptor is highly expressed in A549 cells, but P2Y_1_2 receptor is only weakly expressed. Next, colony formation assay revealed that P2Y_6 receptor antagonist MRS2578 markedly reduced the survival rate of γ-ray-exposed A549 cells. The survival rate was also significantly reduced in P2Y_6-knock-down cells, compared with scramble siRNA-transfected cells. Since it has reported that phosphorylation of ERK1/2 after activation of EGFR via P2Y_6 and P2Y_1_2 receptors is involved in the repair response to γ-ray-induced DNA damage, we next examined whether γ-ray-induced phosphorylation of ERK1/2 was also inhibited by MRS2578 in A549 cells. We found that it was. Taken together, these findings indicate that purinergic signaling through P2Y_6 receptor, followed by ERK1/2 activation, promotes the cellular repair response to γ-ray-induced DNA damage. (author)

DNA Nucleotides Detection via capacitance properties of Graphene

Science.gov (United States)

Khadempar, Nahid; Berahman, Masoud; Yazdanpanah, Arash

2016-05-01

In the present paper a new method is suggested to detect the DNA nucleotides on a first-principles calculation of the electronic features of DNA bases which chemisorbed to a graphene sheet placed between two gold electrodes in a contact-channel-contact system. The capacitance properties of graphene in the channel are surveyed using non-equilibrium Green's function coupled with the Density Functional Theory. Thus, the capacitance properties of graphene are theoretically investigated in a biological environment, and, using a novel method, the effect of the chemisorbed DNA nucleotides on electrical charges on the surface of graphene is deciphered. Several parameters in this method are also extracted including Electrostatic energy, Induced density, induced electrostatic potential, Electron difference potential and Electron difference density. The qualitative and quantitative differences among these parameters can be used to identify DNA nucleotides. Some of the advantages of this approach include its ease and high accuracy. What distinguishes the current research is that it is the first experiment to investigate the capacitance properties of gaphene changes in the biological environment and the effect of chemisorbed DNA nucleotides on the surface of graphene on the charge.

DNA Nucleotide Sequence Restricted by the RI Endonuclease

Science.gov (United States)

Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.

1972-01-01

The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974

Stretches of alternating pyrimidine/purines and purines are respectively linked with pathogenicity and growth temperature in prokaryotes

DEFF Research Database (Denmark)

Ussery, David; Bohlin, J; Hardy, SP

2009-01-01

BACKGROUND: The genomic fractions of purine (RR) and alternating pyrimidine/purine (YR) stretches of 10 base pairs or more, have been linked to genomic AT content, the formation of different DNA helices, strand-biased gene distribution, DNA structure, and more. Although some of these factors are ...... phyla. RR stretches are overrepresented in all phyla except for the Actinobacteria and beta-Proteobacteria. In contrast, YR tracts are underrepresented in all phyla except for the beta-Proteobacterial group. YR-stretches are associated with phylum, pathogenicity and habitat, whilst RR...

Molecular mechanisms of DNA photodamage

Energy Technology Data Exchange (ETDEWEB)

Starrs, S.M

2000-05-01

Photodamage in DNA, caused by ultraviolet (UV) light, can occur by direct excitation of the nucleobases or indirectly via the action of photosensitisers. Such, DNA photodamage can be potentially mutagenic or lethal. Among the methods available for detecting UV-induced DNA damage, gel sequencing protocols, utilising synthetic oligodeoxyribonucleotides as targets for UV radiation, allow photolesions to be mapped at nucleotide resolution. This approach has been applied to investigate both DNA damage mechanisms. Following a general overview of DNA photoreactivity, and a description of the main experimental procedures, Chapter 3 identifies the origin of an anomalous mobility shift observed in purine chemical sequence ladders that can confuse the interpretation of DNA cleavage results; measures to abolish this shift are also described. Chapters 4 and 5 examine the alkali-labile DNA damage photosensitised by representative nonsteroidal antiinflammatory drugs (NSAIDs) and the fluoroquinolone antibiotics. Suprofen was the most photoactive NSAID studied, producing different patterns of guanine-specific damage in single-stranded and duplex DNA. Uniform modification of guanine bases, typifying attack by singlet oxygen, was observed in single-stranded oligodeoxyribonucleotides. In duplex molecules, modification was limited to the 5'-G of GG doublets, which is indicative of an electron transfer. The effect of quenchers and photoproduct analysis substantiated these findings. The quinolone, nalidixic acid, behaves similarly. The random base cleavage photosensitised by the fluoroquinolones, has been attributed to free radicals produced during their photodecomposition. Chapter 6 addresses the photoreactivity of purines within unusual DNA structures formed by the repeat sequences (GGA){sub n} and (GA){sub n}, and a minihairpin. There was no definitive evidence for enhanced purine reactivity caused by direct excitation. Finally, Chapter 7 investigates the mutagenic potential of a

Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide-protein complexes.

Science.gov (United States)

Kondo, Jiro; Westhof, Eric

2011-10-01

Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide-protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson-Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson-Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues.

Preliminary crystallographic studies of purine nucleoside phosphorylase from the cariogenic pathogen Streptococcus mutans

International Nuclear Information System (INIS)

Hou, Qiao-Ming; Liu, Xiang; Brostromer, Erik; Li, Lan-Fen; Su, Xiao-Dong

2009-01-01

Purine nucleoside phosphorylase (PNP), which is a pivotal enzyme in the nucleotide-salvage pathway, has been expressed in Escherichia coli strain BL21 (DE3) in a soluble form at a high level. After purification of the PNP enzyme, the protein was crystallized using the sitting-drop vapour-diffusion technique. The punA gene of the cariogenic pathogen Streptococcus mutans encodes purine nucleoside phosphorylase (PNP), which is a pivotal enzyme in the nucleotide-salvage pathway, catalyzing the phosphorolysis of purine nucleosides to generate purine bases and α-ribose 1-phosphate. In the present work, the PNP protein was expressed in Escherichia coli strain BL21 (DE3) in a soluble form at a high level. After purification of the PNP enzyme, the protein was crystallized using the sitting-drop vapour-diffusion technique; the crystals diffracted to 1.6 Å resolution at best. The crystals belonged to space group H3, with unit-cell parameters a = b = 113.0, c = 60.1 Å

The regulation of aortic endothelial cells by purines and pyrimidines involves co-existing P2y-purinoceptors and nucleotide receptors linked to phospholipase C.

Science.gov (United States)

Wilkinson, G F; Purkiss, J R; Boarder, M R

1993-03-01

1. We have examined the phospholipase C responses in bovine aortic endothelial cells to purines (ATP, ADP and analogues) and the pyrimidine, uridine triphosphate (UTP). 2. The cells responded to purines in a manner consistent with the presence of P2y purinoceptors; both 2-methylthioadenosine 5'-triphosphate (2MeSATP) and adenosine 5'-0-(2-thiodiphosphate) (ADP beta S) were potent agonists (EC50 0.41 microM and 0.85 microM respectively) while beta, gamma-methylene ATP at 300 microM was not. 3. The cells also responded to UTP. The maximal response to UTP was less than that for either 2MeSATP and ADP beta S while adenosine 5'-0-(3-thiotriphosphate) (ATP gamma S) gave the largest maximal response. 4. The concentration-effect curve to UTP was additive in the presence of either 2MeSATP or ADP beta S. However, the concentration-effect curves to ATP gamma S reached the same maximum in the presence or absence of UTP. 5. Suramin, at concentrations between 10 microM and 100 microM was a competitive antagonist for the response to ADP beta S and 2MeSATP but not the response to UTP. 6. The results show that there are two separate, co-existing, receptor populations: P2y-purinoceptors (responding to purines) and nucleotide receptors (responding to both purines and pyrimidines). We conclude that purines such as ATP/ADP may regulate aortic endothelial cells by interacting with two phospholipase C-linked receptors.

Critical role of DNA intercalation in enzyme-catalyzed nucleotide flipping

Science.gov (United States)

Hendershot, Jenna M.; O'Brien, Patrick J.

2014-01-01

Nucleotide flipping is a common feature of DNA-modifying enzymes that allows access to target sites within duplex DNA. Structural studies have identified many intercalating amino acid side chains in a wide variety of enzymes, but the functional contribution of these intercalating residues is poorly understood. We used site-directed mutagenesis and transient kinetic approaches to dissect the energetic contribution of intercalation for human alkyladenine DNA glycosylase, an enzyme that initiates repair of alkylation damage. When AAG flips out a damaged nucleotide, the void in the duplex is filled by a conserved tyrosine (Y162). We find that tyrosine intercalation confers 140-fold stabilization of the extrahelical specific recognition complex, and that Y162 functions as a plug to slow the rate of unflipping by 6000-fold relative to the Y162A mutant. Surprisingly, mutation to the smaller alanine side chain increases the rate of nucleotide flipping by 50-fold relative to the wild-type enzyme. This provides evidence against the popular model that DNA intercalation accelerates nucleotide flipping. In the case of AAG, DNA intercalation contributes to the specific binding of a damaged nucleotide, but this enhanced specificity comes at the cost of reduced speed of nucleotide flipping. PMID:25324304

Detection of DNA nucleotides on pretreated boron doped diamond electrodes

Energy Technology Data Exchange (ETDEWEB)

Garbellini, Gustavo S.; Uliana, Carolina V.; Yamanaka, Hideko [UNESP, Araraquara, SP (Brazil). Inst. de Quimica

2011-07-01

The individual detection and equimolar mixture of DNA nucleotides guanosine monophosphate (GMP), adenosine monophosphate (AMP), thymidine (TMP) and cytidine (CMP) 5'-monophosphate using square wave voltammetry was performed on boron doped diamond (BDD) electrodes cathodically (Red-DDB) and anodically (Oxi-DDB) pretreated. The oxidation of individual DNA nucleotides was more sensitive on Oxi-BDD electrode. In a simultaneous detection of nucleotides, the responses of GMP, AMP, TMP and CMP were very adequate on both treated electrodes. Particularly, more sensitive and separate peaks for TMP and CMP on Oxi-BDD and Red-BDD electrodes, respectively, were observed after deconvolution procedure. The detection of nucleotides in aqueous solutions will certainly contribute for genotoxic evaluation of substances and hybridization reactions by immobilizing ss or ds-DNA on BDD surface. (author)

Electrical detection and quantification of single and mixed DNA nucleotides in suspension

Science.gov (United States)

Ahmad, Mahmoud Al; Panicker, Neena G.; Rizvi, Tahir A.; Mustafa, Farah

2016-09-01

High speed sequential identification of the building blocks of DNA, (deoxyribonucleotides or nucleotides for short) without labeling or processing in long reads of DNA is the need of the hour. This can be accomplished through exploiting their unique electrical properties. In this study, the four different types of nucleotides that constitute a DNA molecule were suspended in a buffer followed by performing several types of electrical measurements. These electrical parameters were then used to quantify the suspended DNA nucleotides. Thus, we present a purely electrical counting scheme based on the semiconductor theory that allows one to determine the number of nucleotides in a solution by measuring their capacitance-voltage dependency. The nucleotide count was observed to be similar to the multiplication of the corresponding dopant concentration and debye volume after de-embedding the buffer contribution. The presented approach allows for a fast and label-free quantification of single and mixed nucleotides in a solution.

Distribution of ³H within purine nucleotides of Ehrlich mouse ascites tumour cells after intraabdominal injection of myo-[2-³H]inositol

DEFF Research Database (Denmark)

Christensen, Søren; Klenow, H.; Overgaard-Hansen, Kay

2000-01-01

/desorption the nucleotides were dephosphorylated, enriched with [U-14C]adenosine, and exposed to purine-nucleoside specific enzymes. Reverse phase HPLC and radioactivity measurement demonstrated that for adenosine about 82% of total stable 3H label was in ribose and thus about 18% in adenine. For guanosine about 89...

The immediate nucleotide precursor, guanosine triphosphate, in the riboflavin biosynthetic pathway

International Nuclear Information System (INIS)

Mitsuda, Hisateru; Nakajima, Kenji; Nadamoto, Tomonori

1977-01-01

In the present paper, the nucleotide precursor of riboflavin was investigated by experiments with labeled purines using non-growing cells of Eremothecium ashbyii. The added purines, at 10 -4 M, were effectively incorporated into riboflavin at an early stage of riboflavin biosynthesis under the experimental conditions. In particular, both labeled xanthine and labeled guanine were specifically transported to guanosine nucleotides, GMP, GDP, GDP-Mannose and GTP, in the course of the riboflavin biosynthesis. A comparison of specific activities of labeled guanosine nucleotides and labeled riboflavin indicated that the nucleotide precursor of riboflavin is guanosine triphosphate. From the results obtained, a biosynthetic pathway of riboflavin is proposed. (auth.)

Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.

Science.gov (United States)

Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant

2017-11-28

Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.

Multiple sclerosis: evaluation of purine nucleotide metabolism in central nervous system in association with serum levels of selected fat-soluble antioxidants.

Science.gov (United States)

Kuračka, Lubomír; Kalnovičová, Terézia; Kucharská, Jarmila; Turčáni, Peter

2014-01-01

In the pathogenesis of demyelinating diseases including multiple sclerosis (MS) an important role is played by oxidative stress. Increased energy requirements during remyelination of axons and mitochondria failure is one of the causes of axonal degeneration and disability in MS. In this context, we analyzed to what extent the increase in purine catabolism is associated with selected blood lipophilic antioxidants and if there is any association with alterations in serum levels of coenzyme Q10. Blood serum and cerebrospinal fluid (CSF) samples from 42 patients with diagnosed MS and 34 noninflammatory neurologic patients (control group) were analyzed. Compared to control group, MS patients had significantly elevated values of all purine nucleotide metabolites, except adenosine. Serum lipophilic antioxidants γ -tocopherol, β -carotene, and coenzyme Q10 for the vast majority of MS patients were deficient or moved within the border of lower physiological values. Serum levels of TBARS, marker of lipid peroxidation, were increased by 81% in the MS patients. The results indicate that the deficit of lipophilic antioxidants in blood of MS patients may have a negative impact on bioenergetics of reparative remyelinating processes and promote neurodegeneration.

Nucleotide compositional asymmetry between the leading and lagging strands of eubacterial genomes

KAUST Repository

Qu, Hongzhu

2010-12-01

Nucleotide compositional asymmetry (NCA) between leading and lagging strands (LeS and LaS) is dynamic and diverse among eubacterial genomes due to different mutation and selection forces. A thorough investigation is needed in order to study the relationship between nucleotide composition dynamics and gene distribution biases. Based on a collection of 364 eubacterial genomes that were grouped according to a DnaE-based scheme (DnaE1-DnaE1, DnaE2-DnaE1, and DnaE3-PolC), we investigated NCA and nucleotide composition gradients at three codon positions and found that there was universal G-enrichment on LeS among all groups. This was due to a strong selection for G-heading (codon position1 or cp1) codons and mutation pressure that led to more G-ending (cp3) codons. Moreover, a slight T-enrichment of LeS due to the mutation of cytosine deamination at cp3 was universal among DnaE1-DnaE1 and DnaE2-DnaE1 genomes, but was not clearly seen among DnaE3-PolC genomes, in which A-enrichment of LeS was proposed to be the effect of selections unique to polC and a mutation bias toward A-richness at cp1 that may be a result of transcription-coupled DNA repair mechanisms. Furthermore, strand-biased gene distribution enhances the purine-richness of LeS for DnaE3-PolC genomes and T-richness of LeS for DnaE1-DnaE1 and DnaE2-dnaE1 genomes. © 2010 Institut Pasteur.

Nucleotide compositional asymmetry between the leading and lagging strands of eubacterial genomes

KAUST Repository

Qu, Hongzhu; Wu, Hao; Zhang, Tongwu; Zhang, Zhang; Hu, Songnian; Yu, Jun

2010-01-01

Nucleotide compositional asymmetry (NCA) between leading and lagging strands (LeS and LaS) is dynamic and diverse among eubacterial genomes due to different mutation and selection forces. A thorough investigation is needed in order to study the relationship between nucleotide composition dynamics and gene distribution biases. Based on a collection of 364 eubacterial genomes that were grouped according to a DnaE-based scheme (DnaE1-DnaE1, DnaE2-DnaE1, and DnaE3-PolC), we investigated NCA and nucleotide composition gradients at three codon positions and found that there was universal G-enrichment on LeS among all groups. This was due to a strong selection for G-heading (codon position1 or cp1) codons and mutation pressure that led to more G-ending (cp3) codons. Moreover, a slight T-enrichment of LeS due to the mutation of cytosine deamination at cp3 was universal among DnaE1-DnaE1 and DnaE2-DnaE1 genomes, but was not clearly seen among DnaE3-PolC genomes, in which A-enrichment of LeS was proposed to be the effect of selections unique to polC and a mutation bias toward A-richness at cp1 that may be a result of transcription-coupled DNA repair mechanisms. Furthermore, strand-biased gene distribution enhances the purine-richness of LeS for DnaE3-PolC genomes and T-richness of LeS for DnaE1-DnaE1 and DnaE2-dnaE1 genomes. © 2010 Institut Pasteur.

Modeling compositional dynamics based on GC and purine contents of protein-coding sequences

KAUST Repository

Zhang, Zhang

2010-11-08

Background: Understanding the compositional dynamics of genomes and their coding sequences is of great significance in gaining clues into molecular evolution and a large number of publically-available genome sequences have allowed us to quantitatively predict deviations of empirical data from their theoretical counterparts. However, the quantification of theoretical compositional variations for a wide diversity of genomes remains a major challenge.Results: To model the compositional dynamics of protein-coding sequences, we propose two simple models that take into account both mutation and selection effects, which act differently at the three codon positions, and use both GC and purine contents as compositional parameters. The two models concern the theoretical composition of nucleotides, codons, and amino acids, with no prerequisite of homologous sequences or their alignments. We evaluated the two models by quantifying theoretical compositions of a large collection of protein-coding sequences (including 46 of Archaea, 686 of Bacteria, and 826 of Eukarya), yielding consistent theoretical compositions across all the collected sequences.Conclusions: We show that the compositions of nucleotides, codons, and amino acids are largely determined by both GC and purine contents and suggest that deviations of the observed from the expected compositions may reflect compositional signatures that arise from a complex interplay between mutation and selection via DNA replication and repair mechanisms.Reviewers: This article was reviewed by Zhaolei Zhang (nominated by Mark Gerstein), Guruprasad Ananda (nominated by Kateryna Makova), and Daniel Haft. 2010 Zhang and Yu; licensee BioMed Central Ltd.

Modeling compositional dynamics based on GC and purine contents of protein-coding sequences

KAUST Repository

Zhang, Zhang; Yu, Jun

2010-01-01

Background: Understanding the compositional dynamics of genomes and their coding sequences is of great significance in gaining clues into molecular evolution and a large number of publically-available genome sequences have allowed us to quantitatively predict deviations of empirical data from their theoretical counterparts. However, the quantification of theoretical compositional variations for a wide diversity of genomes remains a major challenge.Results: To model the compositional dynamics of protein-coding sequences, we propose two simple models that take into account both mutation and selection effects, which act differently at the three codon positions, and use both GC and purine contents as compositional parameters. The two models concern the theoretical composition of nucleotides, codons, and amino acids, with no prerequisite of homologous sequences or their alignments. We evaluated the two models by quantifying theoretical compositions of a large collection of protein-coding sequences (including 46 of Archaea, 686 of Bacteria, and 826 of Eukarya), yielding consistent theoretical compositions across all the collected sequences.Conclusions: We show that the compositions of nucleotides, codons, and amino acids are largely determined by both GC and purine contents and suggest that deviations of the observed from the expected compositions may reflect compositional signatures that arise from a complex interplay between mutation and selection via DNA replication and repair mechanisms.Reviewers: This article was reviewed by Zhaolei Zhang (nominated by Mark Gerstein), Guruprasad Ananda (nominated by Kateryna Makova), and Daniel Haft. 2010 Zhang and Yu; licensee BioMed Central Ltd.

Statistical properties and fractals of nucleotide clusters in DNA sequences

International Nuclear Information System (INIS)

Sun Tingting; Zhang Linxi; Chen Jin; Jiang Zhouting

2004-01-01

Statistical properties of nucleotide clusters in DNA sequences and their fractals are investigated in this paper. The average size of nucleotide clusters in non-coding sequence is larger than that in coding sequence. We investigate the cluster-size distribution P(S) for human chromosomes 21 and 22, and the results are different from previous works. The cluster-size distribution P(S 1 +S 2 ) with the total size of sequential Pu-cluster and Py-cluster S 1 +S 2 is studied. We observe that P(S 1 +S 2 ) follows an exponential decay both in coding and non-coding sequences. However, we get different results for human chromosomes 21 and 22. The probability distribution P(S 1 ,S 2 ) of nucleotide clusters with the size of sequential Pu-cluster and Py-cluster S 1 and S 2 respectively, is also examined. In the meantime, some of the linear correlations are obtained in the double logarithmic plots of the fluctuation F(l) versus nucleotide cluster distance l along the DNA chain. The power spectrums of nucleotide clusters are also discussed, and it is concluded that the curves are flat and hardly changed and the 1/3 frequency is neither observed in coding sequence nor in non-coding sequence. These investigations can provide some insights into the nucleotide clusters of DNA sequences

Anion-exchange analysis of isotopically labelled nucleotides, nucleosides, and bases in metabolic disorders

International Nuclear Information System (INIS)

Nissinen, E.A.O.

1987-01-01

This paper on the importance of cellular purines and pyrimidines is evidenced by the multitude of diseases, such as hyperuricemia, orotic aciduria, gout, Lesch-Nyhan syndrome, immunodeficiencies with B- and T-cell dysfunctions, etc. which result from aberrant metabolism. In addition, the use of purine and pyrimidine analogs in chemotherapy is of growing interest. Purine metabolism consists of a complex network of biochemical pathway. These pathways are under complicated feedback regulation and there also exists a close relationship between purine and pyrimidine metabolism. In addition, these pathways interact with those of the carbohydrate, amino acid, and energy metabolism. Since metabolic pathways are closely interrelated, a change in the concentration of a particular metabolite may lead to many changes in the overall metabolic profiles. For instance, in the area of nucleotide metabolism, the inhibition of IMP dehydrogenase by mycophenolic acid leads to various changes in both purine and pyrimidine nucleotide pools. Inhibition of de nova purine biosynthesis by methotrexate leads to many changes in purine and pyrimidine ribonucleotides and deoxyribonucleotides. Thus, the simultaneous measurement of all cellular purine and pyrimidine metabolites from individuals whose metabolism is altered, either by a metabolic disease or by the action of drugs, may further our understanding of cellular metabolism

Isotopically labelled pyrimidines and purines

International Nuclear Information System (INIS)

Balaban, A.T.; Bally, I.

1987-01-01

Among the three diazines, pyrimidine is by far the most important one because its derivatives uracil, thymine and cytosine are constituents of the ubiquitous deoxynucleic acids (DNA) and ribonucleic acids (RNA). Other derivatives of pyrimidine without condensed rings include barbiturates, alloxan, orotic acid and thiamine or vitamin B 1 . From the polycyclic derivatives of pyrimidine such as pteridine, alloxazine, and purine, the latter, through its derivatives adenine and guanine complete the list of bases which occur in DNA and RNA: in addition, other purine derivatives such as hypoxanthine, xanthine, theobromine, theophylline, caffeine and uric acid are important natural products with biological activity. The paper presents methods for preparing isotopically labeled pyrimidines as well as purine derivatives. For convenience, the authors describe separately carbon-labeled with radioisotopes 11 C (T 1/2 = 20.3 min) and 14 C (T 1/2 = 5736 years) or the stable isotope 13 C (natural abundance 1.1%) and then hydrogen-labeled systems with the radioisotope 3 H ≡ T (T 1/2 = 12.346 years) or with the stable isotope 2 H ≡ D (natural abundance 0.015%). We do not separate stable from radioactive isotopes because the synthetic methods are identical for the same element; however, the introduction of hydrogen isotopes into organic molecules is often performed by reactions such as isotope exchange which cannot take place in the case of carbon isotopes

The Tomato Nucleotide-binding Leucine-rich Repeat Immune Receptor I-2 Couples DNA-binding to Nucleotide-binding Domain Nucleotide Exchange*

Science.gov (United States)

Fenyk, Stepan; Dixon, Christopher H.; Gittens, William H.; Townsend, Philip D.; Sharples, Gary J.; Pålsson, Lars-Olof; Takken, Frank L. W.; Cann, Martin J.

2016-01-01

Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. PMID:26601946

The Tomato Nucleotide-binding Leucine-rich Repeat Immune Receptor I-2 Couples DNA-binding to Nucleotide-binding Domain Nucleotide Exchange.

Science.gov (United States)

Fenyk, Stepan; Dixon, Christopher H; Gittens, William H; Townsend, Philip D; Sharples, Gary J; Pålsson, Lars-Olof; Takken, Frank L W; Cann, Martin J

2016-01-15

Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable plants to recognize and respond to pathogen attack. Previously, we demonstrated that the Rx1 NLR of potato is able to bind and bend DNA in vitro. DNA binding in situ requires its genuine activation following pathogen perception. However, it is unknown whether other NLR proteins are also able to bind DNA. Nor is it known how DNA binding relates to the ATPase activity intrinsic to NLR switch function required to immune activation. Here we investigate these issues using a recombinant protein corresponding to the N-terminal coiled-coil and nucleotide-binding domain regions of the I-2 NLR of tomato. Wild type I-2 protein bound nucleic acids with a preference of ssDNA ≈ dsDNA > ssRNA, which is distinct from Rx1. I-2 induced bending and melting of DNA. Notably, ATP enhanced DNA binding relative to ADP in the wild type protein, the null P-loop mutant K207R, and the autoactive mutant S233F. DNA binding was found to activate the intrinsic ATPase activity of I-2. Because DNA binding by I-2 was decreased in the presence of ADP when compared with ATP, a cyclic mechanism emerges; activated ATP-associated I-2 binds to DNA, which enhances ATP hydrolysis, releasing ADP-bound I-2 from the DNA. Thus DNA binding is a general property of at least a subset of NLR proteins, and NLR activation is directly linked to its activity at DNA. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Protected DNA strand displacement for enhanced single nucleotide discrimination in double-stranded DNA.

Science.gov (United States)

Khodakov, Dmitriy A; Khodakova, Anastasia S; Huang, David M; Linacre, Adrian; Ellis, Amanda V

2015-03-04

Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within double-stranded DNA generated from real-life human mitochondrial DNA samples. Aside from the potential diagnostic value, the current study represents an additional way to control the strand displacement reaction rate without altering other reaction parameters and provides new insights into the influence of single nucleotide substitutions on 3- and 4-way branch migration efficiency and kinetics.

Erythrocytic Adenosine Monophosphate as an Alternative Purine Source in Plasmodium falciparum*

Science.gov (United States)

Cassera, María B.; Hazleton, Keith Z.; Riegelhaupt, Paul M.; Merino, Emilio F.; Luo, Minkui; Akabas, Myles H.; Schramm, Vern L.

2008-01-01

Plasmodium falciparum is a purine auxotroph, salvaging purines from erythrocytes for synthesis of RNA and DNA. Hypoxanthine is the key precursor for purine metabolism in Plasmodium. Inhibition of hypoxanthine-forming reactions in both erythrocytes and parasites is lethal to cultured P. falciparum. We observed that high concentrations of adenosine can rescue cultured parasites from purine nucleoside phosphorylase and adenosine deaminase blockade but not when erythrocyte adenosine kinase is also inhibited. P. falciparum lacks adenosine kinase but can salvage AMP synthesized in the erythrocyte cytoplasm to provide purines when both human and Plasmodium purine nucleoside phosphorylases and adenosine deaminases are inhibited. Transport studies in Xenopus laevis oocytes expressing the P. falciparum nucleoside transporter PfNT1 established that this transporter does not transport AMP. These metabolic patterns establish the existence of a novel nucleoside monophosphate transport pathway in P. falciparum. PMID:18799466

Cy3 and Cy5 dyes attached to oligonucleotide terminus stabilize DNA duplexes: predictive thermodynamic model.

Science.gov (United States)

Moreira, Bernardo G; You, Yong; Owczarzy, Richard

2015-03-01

Cyanine dyes are important chemical modifications of oligonucleotides exhibiting intensive and stable fluorescence at visible light wavelengths. When Cy3 or Cy5 dye is attached to 5' end of a DNA duplex, the dye stacks on the terminal base pair and stabilizes the duplex. Using optical melting experiments, we have determined thermodynamic parameters that can predict the effects of the dyes on duplex stability quantitatively (ΔG°, Tm). Both Cy dyes enhance duplex formation by 1.2 kcal/mol on average, however, this Gibbs energy contribution is sequence-dependent. If the Cy5 is attached to a pyrimidine nucleotide of pyrimidine-purine base pair, the stabilization is larger compared to the attachment to a purine nucleotide. This is likely due to increased stacking interactions of the dye to the purine of the complementary strand. Dangling (unpaired) nucleotides at duplex terminus are also known to enhance duplex stability. Stabilization originated from the Cy dyes is significantly larger than the stabilization due to the presence of dangling nucleotides. If both the dangling base and Cy3 are present, their thermodynamic contributions are approximately additive. New thermodynamic parameters improve predictions of duplex folding, which will help design oligonucleotide sequences for biophysical, biological, engineering, and nanotechnology applications. Copyright © 2015. Published by Elsevier B.V.

Natural transformation of bacteria by fragmented, damaged and ancient DNA

DEFF Research Database (Denmark)

Overballe-Petersen, Søren

with fullgenome comparisons that the process has general relevance in extant bacteria. Our findings reveal that the large environmental reservoir of short and damaged DNA retains capacity for natural transformation, even after thousands of years. This describes for the first time a process by which cells can...... transfer playing an important role early in the evolution of life. The published article explains the chemical structure behind an observed degradation difference between the two purine-nucleotides guanosine and adenosine in ancient DNA. We also point at new uses for high-through-put DNA sequencing...

Pediatric neurological syndromes and inborn errors of purine metabolism.

Science.gov (United States)

Camici, Marcella; Micheli, Vanna; Ipata, Piero Luigi; Tozzi, Maria Grazia

2010-02-01

This review is devised to gather the presently known inborn errors of purine metabolism that manifest neurological pediatric syndromes. The aim is to draw a comprehensive picture of these rare diseases, characterized by unexpected and often devastating neurological symptoms. Although investigated for many years, most purine metabolism disorders associated to psychomotor dysfunctions still hide the molecular link between the metabolic derangement and the neurological manifestations. This basically indicates that many of the actual functions of nucleosides and nucleotides in the development and function of several organs, in particular central nervous system, are still unknown. Both superactivity and deficiency of phosphoribosylpyrophosphate synthetase cause hereditary disorders characterized, in most cases, by neurological impairments. The deficiency of adenylosuccinate lyase and 5-amino-4-imidazolecarboxamide ribotide transformylase/IMP cyclohydrolase, both belonging to the de novo purine synthesis pathway, is also associated to severe neurological manifestations. Among catabolic enzymes, hyperactivity of ectosolic 5'-nucleotidase, as well as deficiency of purine nucleoside phosphorylase and adenosine deaminase also lead to syndromes affecting the central nervous system. The most severe pathologies are associated to the deficiency of the salvage pathway enzymes hypoxanthine-guanine phosphoribosyltransferase and deoxyguanosine kinase: the former due to an unexplained adverse effect exerted on the development and/or differentiation of dopaminergic neurons, the latter due to a clear impairment of mitochondrial functions. The assessment of hypo- or hyperuricemic conditions is suggestive of purine enzyme dysfunctions, but most disorders of purine metabolism may escape the clinical investigation because they are not associated to these metabolic derangements. This review may represent a starting point stimulating both scientists and physicians involved in the study of

Roles of the active site residues and metal cofactors in noncanonical base-pairing during catalysis by human DNA polymerase iota.

Science.gov (United States)

Makarova, Alena V; Ignatov, Artem; Miropolskaya, Nataliya; Kulbachinskiy, Andrey

2014-10-01

Human DNA polymerase iota (Pol ι) is a Y-family polymerase that can bypass various DNA lesions but possesses very low fidelity of DNA synthesis in vitro. Structural analysis of Pol ι revealed a narrow active site that promotes noncanonical base-pairing during catalysis. To better understand the structure-function relationships in the active site of Pol ι we investigated substitutions of individual amino acid residues in its fingers domain that contact either the templating or the incoming nucleotide. Two of the substitutions, Y39A and Q59A, significantly decreased the catalytic activity but improved the fidelity of Pol ι. Surprisingly, in the presence of Mn(2+) ions, the wild-type and mutant Pol ι variants efficiently incorporated nucleotides opposite template purines containing modifications that disrupted either Hoogsteen or Watson-Crick base-pairing, suggesting that Pol ι may use various types of interactions during nucleotide addition. In contrast, in Mg(2+) reactions, wild-type Pol ι was dependent on Hoogsteen base-pairing, the Y39A mutant was essentially inactive, and the Q59A mutant promoted Watson-Crick interactions with template purines. The results suggest that Pol ι utilizes distinct mechanisms of nucleotide incorporation depending on the metal cofactor and reveal important roles of specific residues from the fingers domain in base-pairing and catalysis. Copyright © 2014 Elsevier B.V. All rights reserved.

Radicals of DNA and DNA nucleotides generated by ionising radiation

International Nuclear Information System (INIS)

Przybytniak, G.

2004-01-01

A first stage of cell processes leading to DNA damage of initiated by radical reactions. In a model system such transformations were generated by ionising radiation which involves production of electron loss and electron gain centers of the substrate and radical formation. Using cryogenic ESR spectroscopy it was found that the DNA nucleotides, which convert to radical anions upon electron capture undergo the separation of unpaired spin and charge due to protonation. Circular and linear dichroism studies enabled to conclude that iron ions(III) induce strong changes in the DNA helical structure indicating their coordination with nitrogen bases. The repair of DNA radicals produced via radiolytic oxidation, i.e. the guanine radical cation and the allyl type radical of thymine, is possible at elevated temperatures due to the involvement of sulphydryl groups. The influence of the thiol charge is then limited

Nucleotide sequence analysis of regions of adenovirus 5 DNA containing the origins of DNA replication

International Nuclear Information System (INIS)

Steenbergh, P.H.

1979-01-01

The purpose of the investigations described is the determination of nucleotide sequences at the molecular ends of the linear adenovirus type 5 DNA. Knowledge of the primary structure at the termini of this DNA molecule is of particular interest in the study of the mechanism of replication of adenovirus DNA. The initiation- and termination sites of adenovirus DNA replication are located at the ends of the DNA molecule. (Auth.)

Excretion of purine base derivatives after intake of bacterial protein meal in pigs

DEFF Research Database (Denmark)

Hellwing, Anne Louise Frydendahl; Tauson, Anne-Helene; Skrede, A.

2007-01-01

Bacterial protein meal has a high content ofprotein but also of RNA and DNA. Sixteen barrows were allocated to four diets containing increasing levels of bacterial protein meal (BPM), from weaning to 80 kg live weight, to evaluate whether the RNA and DNA contents of BPM influenced the retention...... of nitrogen. It was hypothesised that an increased intake of RNA and DNA would lead to an increased urinary excretion of purine base derivatives and increased plasma concentrations. Retention of nitrogen was unaffected by dietary content of BPM (P=0.08) and the urinary excretion of purine base derivatives...

[Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].

Science.gov (United States)

Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I

1985-11-01

The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.

Wobble↔Watson-Crick tautomeric transitions in the homo-purine DNA mismatches: a key to the intimate mechanisms of the spontaneous transversions.

Science.gov (United States)

Brovarets', Ol'ha O; Hovorun, Dmytro M

2015-01-01

The intrinsic capability of the homo-purine DNA base mispairs to perform wobble↔Watson-Crick/Topal-Fresco tautomeric transitions via the sequential intrapair double proton transfer was discovered for the first time using QM (MP2/DFT) and QTAIM methodologies that are crucial for understanding the microstructural mechanisms of the spontaneous transversions.

An unusual mode of DNA duplex association: Watson-Crick interaction of all-purine deoxyribonucleic acids.

Science.gov (United States)

Battersby, Thomas R; Albalos, Maria; Friesenhahn, Michel J

2007-05-01

Nucleic acid duplexes associating through purine-purine base pairing have been constructed and characterized in a remarkable demonstration of nucleic acids with mixed sequence and a natural backbone in an alternative duplex structure. The antiparallel deoxyribose all-purine duplexes associate specifically through Watson-Crick pairing, violating the nucleobase size-complementarity pairing convention found in Nature. Sequence-specific recognition displayed by these structures makes the duplexes suitable, in principle, for information storage and replication fundamental to molecular evolution in all living organisms. All-purine duplexes can be formed through association of purines found in natural ribonucleosides. Key to the formation of these duplexes is the N(3)-H tautomer of isoguanine, preferred in the duplex, but not in aqueous solution. The duplexes have relevance to evolution of the modern genetic code and can be used for molecular recognition of natural nucleic acids.

The hormonal regulation of purine biosynthesis: control of the inosinic acid branch point

International Nuclear Information System (INIS)

Pizzichini, M.; Di Stefano, A.; Marinello, E.; Pompucci, G.

1986-01-01

This paper studies the behavior of purine biosynthesis de novo in the levator animal muscle (LAM) of adult rats, before, after castration, and after testosterone administration. The incorporation of C 14-formate into the acid-soluble bases was performed as an index of the overall rate of purine nucleotide synthesis. It is shown that castration reduces the content, the specific activity of total bases and of the single bases in the LAM, indicating an inferior turnover. The increased turnover of guanylic acid, which is always present although not as much as adenylic acid, will favor the sunthesis of RNA in the sexual organs

Photogeneration and reactivity of naphthoquinone methides as purine selective DNA alkylating agents.

Science.gov (United States)

Verga, Daniela; Nadai, Matteo; Doria, Filippo; Percivalle, Claudia; Di Antonio, Marco; Palumbo, Manlio; Richter, Sara N; Freccero, Mauro

2010-10-20

A one-step protecting-group-free synthesis of both 6-hydroxy-naphthalene-2-carbaldehyde and the bifunctional binaphthalenyl derivative afforded 6-hydroxymethylnaphthalen-2-ol, 6-methylaminomethyl-naphthalen-2-ol, [(2-hydroxy-3-naphthyl)methyl]trimethyl ammonium iodide, and a small library of bifunctional binol analogues in good yields. Irradiation of naphthol quaternary ammonium salt and binol-derivatives (X = OH, NHR, NMe(3)(+), OCOCH(3), and L-proline) at 310 and 360 nm resulted in the photogeneration of the 2,6-naphthoquinone-6-methide (NQM) and binol quinone methide analogues (BQMs) by a water-mediated excited-state proton transfer (ESPT). The hydration, the mono- and bis-alkylation reactions of morpholine and 2-ethanethiol, as N and S prototype nucleophiles, by the transient NQM (λ(max) 310, 330 nm) and BQMs (λ(max) 360 nm) were investigated in water by product distribution analysis and laser flash photolysis (LFP). Both the photogeneration and the reactivity of NQM and BQMs exhibited striking differences. BQMs were at least 2 orders of magnitude more reactive than NQM, and they were generated much more efficiently from a greater variety of photoprecursors including the hydroxymethyl, quaternary ammonium salt and several binol-amino acids. On the contrary, the only efficient precursor of NQM was the quaternary ammonium salt. All water-soluble BQM precursors were further investigated for their ability to alkylate and cross-link plasmid DNA and oligonucleotides by gel electrophoresis: the BQMs were more efficient than the isomeric o-BQM (binol quinone methide analogue of 2,3-naphthoquinone-3-methide). Sequence analysis by gel electrophoresis, HPLC, and MS showed that the alkylation occurred at purines, with a preference for guanine. In particular, a BQM was able to alkylate N7 of guanines resulting in depurination at the oligonucleotide level, and ribose loss at the nucleotide level. The photoreactivity of BQM precursors translated into photocytotoxic and

Presence of a consensus DNA motif at nearby DNA sequence of the mutation susceptible CG nucleotides.

Science.gov (United States)

Chowdhury, Kaushik; Kumar, Suresh; Sharma, Tanu; Sharma, Ankit; Bhagat, Meenakshi; Kamai, Asangla; Ford, Bridget M; Asthana, Shailendra; Mandal, Chandi C

2018-01-10

Complexity in tissues affected by cancer arises from somatic mutations and epigenetic modifications in the genome. The mutation susceptible hotspots present within the genome indicate a non-random nature and/or a position specific selection of mutation. An association exists between the occurrence of mutations and epigenetic DNA methylation. This study is primarily aimed at determining mutation status, and identifying a signature for predicting mutation prone zones of tumor suppressor (TS) genes. Nearby sequences from the top five positions having a higher mutation frequency in each gene of 42 TS genes were selected from a cosmic database and were considered as mutation prone zones. The conserved motifs present in the mutation prone DNA fragments were identified. Molecular docking studies were done to determine putative interactions between the identified conserved motifs and enzyme methyltransferase DNMT1. Collective analysis of 42 TS genes found GC as the most commonly replaced and AT as the most commonly formed residues after mutation. Analysis of the top 5 mutated positions of each gene (210 DNA segments for 42 TS genes) identified that CG nucleotides of the amino acid codons (e.g., Arginine) are most susceptible to mutation, and found a consensus DNA "T/AGC/GAGGA/TG" sequence present in these mutation prone DNA segments. Similar to TS genes, analysis of 54 oncogenes not only found CG nucleotides of the amino acid Arg as the most susceptible to mutation, but also identified the presence of similar consensus DNA motifs in the mutation prone DNA fragments (270 DNA segments for 54 oncogenes) of oncogenes. Docking studies depicted that, upon binding of DNMT1 methylates to this consensus DNA motif (C residues of CpG islands), mutation was likely to occur. Thus, this study proposes that DNMT1 mediated methylation in chromosomal DNA may decrease if a foreign DNA segment containing this consensus sequence along with CG nucleotides is exogenously introduced to dividing

Effects of caffeine on purine metabolism and ultraviolet light-induced lethality in cultured mammalian cells

International Nuclear Information System (INIS)

Waldren, C.A.; Patterson, D.

1979-01-01

Caffeine, at doses which enhance the killing action of ultraviolet light, inhibits both de novo synthesis and the utilization of exogenous purines in cultured CHO-K1, a Chinese hamster ovary cell line. The effect is dose dependent, with a caffeine concentration of 7.5 mM producing a 90% reduction in 15 min. Interference with utilization of exogenous purines was seen as a substantial decrease in the conversion of [14C]hypoxanthine, [14C]adenine, or [14C]guanine into their respective di- and triphosphates in the presence of caffeine. Thus, one of the ways by which antimetabolites and caffeine act to enhance ultraviolet light killing may be by interference with the supply of purine nucleotides needed for repair

Interaction of organophosphorus pesticides with DNA nucleotides on a Boron-doped diamond electrode

Energy Technology Data Exchange (ETDEWEB)

Garbellini, Gustavo S.; Uliana, Carolina V.; Yamanaka, Hideko, E-mail: gustgarb@yahoo.com.br [Universidade Estadual Paulista Julio de Mesquita Filho (UNESP), Bauru, SP (Brazil). Dept. de Quimica Analitica

2013-12-01

Diamond electrode was used to evaluate the interaction of the nucleotides guanosine monophosphate (GMP) and adenosine monophosphate (AMP) with the pesticides chlorpyrifos, methamidophos and monocrotophos. Changes were observed in the currents and peak potentials of the nucleotide voltammograms in the presence of the pesticides, with dependence on the pesticide concentration (from 5.0 Multiplication-Sign 10{sup -7} to 5.0 Multiplication-Sign 10{sup -5} mol L{sup -1}) and the interaction time (from 1 min to 4 h). This is probably due to binding of the pesticides to the nitrogenous bases present in the nucleotides, which could lead to problems in the DNA replication and biological functions of nucleotides. The pesticides showed stronger interaction with AMP than with GMP. Studies of the interaction of 50 Micro-Sign g mL{sup -1} DNA with the pesticides (from 30 min to 4 h and from 1.0 Multiplication-Sign 10{sup -6} to 6.0 Multiplication-Sign 10{sup -5} mol L{sup -1}) did not reveal any peaks relating to double helix opening or DNA unwinding. (author)

Glucose-nucleobase pairs within DNA: impact of hydrophobicity, alternative linking unit and DNA polymerase nucleotide insertion studies† †Electronic supplementary information (ESI) available. See DOI: 10.1039/c7sc04850e

Science.gov (United States)

Vengut-Climent, Empar; Peñalver, Pablo; Lucas, Ricardo; Gómez-Pinto, Irene; Aviñó, Anna; Muro-Pastor, Alicia M.; Galbis, Elsa; de Paz, M. Violante; Fonseca Guerra, Célia; Bickelhaupt, F. Matthias; Eritja, Ramón; González, Carlos

2018-01-01

Recently, we studied glucose-nucleobase pairs, a binding motif found in aminoglycoside–RNA recognition. DNA duplexes with glucose as a nucleobase were able to hybridize and were selective for purines. They were less stable than natural DNA but still fit well on regular B-DNA. These results opened up the possible use of glucose as a non-aromatic DNA base mimic. Here, we have studied the incorporation and thermal stability of glucose with different types of anchoring units and alternative apolar sugar-nucleobase pairs. When we explored butanetriol instead of glycerol as a wider anchoring unit, we did not gain duplex thermal stability. This result confirmed the necessity of a more conformationally restricted linker to increase the overall duplex stability. Permethylated glucose-nucleobase pairs showed similar stability to glucoside-nucleobase pairs but no selectivity for a specific nucleobase, possibly due to the absence of hydrogen bonds between them. The three-dimensional structure of the duplex solved by NMR located both, the hydrophobic permethylated glucose and the nucleobase, inside the DNA helix as in the case of glucose-nucleobase pairs. Quantum chemical calculations on glucose-nucleobase pairs indicate that the attachment of the sugar to the DNA skeleton through the OH1 or OH4 positions yields the highest binding energies. Moreover, glucose was very selective for guanine when attached through OH1 or OH4 to the DNA. Finally, we examined DNA polymerase insertion of nucleotides in front of the saccharide unit. KF– polymerase from E. coli inserted A and G opposite glc and 6dglc with low efficiency but notable selectivity. It is even capable of extending the new pair although its efficiency depended on the DNA sequence. In contrast, Bst 2.0, SIII and BIOTAQ™ DNA polymerases seem to display a loop-out mechanism possibly due to the flexible glycerol linker used instead of deoxyribose. PMID:29780486

The nucleotide sequence of human transition protein 1 cDNA

Energy Technology Data Exchange (ETDEWEB)

Luerssen, H; Hoyer-Fender, S; Engel, W [Universitaet Goettingen (West Germany)

1988-08-11

The authors have screened a human testis cDNA library with an oligonucleotide of 81 mer prepared according to a part of the published nucleotide sequence of the rat transition protein TP 1. They have isolated a cDNA clone with the length of 441 bp containing the coding region of 162 bp for human transition protein 1. There is about 84% homology in the coding region of the sequence compared to rat. The human cDNA-clone encodes a polypeptide of 54 amino acids of which 7 are different to that of rat.

Classification of pseudo pairs between nucleotide bases and amino acids by analysis of nucleotide–protein complexes

Science.gov (United States)

Kondo, Jiro; Westhof, Eric

2011-01-01

Nucleotide bases are recognized by amino acid residues in a variety of DNA/RNA binding and nucleotide binding proteins. In this study, a total of 446 crystal structures of nucleotide–protein complexes are analyzed manually and pseudo pairs together with single and bifurcated hydrogen bonds observed between bases and amino acids are classified and annotated. Only 5 of the 20 usual amino acid residues, Asn, Gln, Asp, Glu and Arg, are able to orient in a coplanar fashion in order to form pseudo pairs with nucleotide bases through two hydrogen bonds. The peptide backbone can also form pseudo pairs with nucleotide bases and presents a strong bias for binding to the adenine base. The Watson–Crick side of the nucleotide bases is the major interaction edge participating in such pseudo pairs. Pseudo pairs between the Watson–Crick edge of guanine and Asp are frequently observed. The Hoogsteen edge of the purine bases is a good discriminatory element in recognition of nucleotide bases by protein side chains through the pseudo pairing: the Hoogsteen edge of adenine is recognized by various amino acids while the Hoogsteen edge of guanine is only recognized by Arg. The sugar edge is rarely recognized by either the side-chain or peptide backbone of amino acid residues. PMID:21737431

Flexible double-headed cytosine-linked 2'-deoxycytidine nucleotides. Synthesis, polymerase incorporation to DNA and interaction with DNA methyltransferases

Czech Academy of Sciences Publication Activity Database

Kielkowski, Pavel; Cahová, Hana; Pohl, Radek; Hocek, Michal

2016-01-01

Roč. 24, č. 6 (2016), s. 1268-1276 ISSN 0968-0896 R&D Projects: GA ČR GBP206/12/G151 Institutional support: RVO:61388963 Keywords : nucleosides * nucleotides * pyrimidines * DNA methyltransferases * DNA polymerases Subject RIV: CC - Organic Chemistry Impact factor: 2.930, year: 2016

Three-dimensional structure of E. Coli purine nucleoside phosphorylase at 0.99 Å resolution

Energy Technology Data Exchange (ETDEWEB)

Timofeev, V. I., E-mail: tostars@mail.ru [Russian Academy of Sciences, Shubnikov Institute of Crystallography (Russian Federation); Abramchik, Yu. A., E-mail: ugama@yandex.ru [Russian Academy of Sciences, Shemyakin–Ovchinnikov Institute of Bioorganic Chemistry (Russian Federation); Zhukhlistova, N. E., E-mail: inna@ns.crys.ras.ru [Russian Academy of Sciences, Shubnikov Institute of Crystallography (Russian Federation); Muravieva, T. I.; Esipov, R. S. [Russian Academy of Sciences, Shemyakin–Ovchinnikov Institute of Bioorganic Chemistry (Russian Federation); Kuranova, I. P. [Russian Academy of Sciences, Shubnikov Institute of Crystallography (Russian Federation)

2016-03-15

Purine nucleoside phosphorylases (PNPs) catalyze the reversible phosphorolysis of nucleosides and are key enzymes involved in nucleotide metabolism. They are essential for normal cell function and can catalyze the transglycosylation. Crystals of E. coli PNP were grown in microgravity by the capillary counterdiffusion method through a gel layer. The three-dimensional structure of the enzyme was determined by the molecular-replacement method at 0.99 Å resolution. The structural features are considered, and the structure of E. coli PNP is compared with the structures of the free enzyme and its complexes with purine base derivatives established earlier. A comparison of the environment of the purine base in the complex of PNP with formycin A and of the pyrimidine base in the complex of uridine phosphorylase with thymidine revealed the main structural features of the base-binding sites. Coordinates of the atomic model determined with high accuracy were deposited in the Protein Data Bank (PDB-ID: 4RJ2).

The effect of cyclophosphamide and gamma irradiation on adenosine deaminase and purine nucleoside phosphorylase in mice

International Nuclear Information System (INIS)

Hosek, B.; Bohaecek, J.; Sikulova, J.

1991-01-01

Changes in ADA and PNP activities in the spleens and thymuses of mice were studied after a single administration of cyclophosphamide and after whole-body gamma irradiation, applied alone or three days after CY application, In the first days after the treatment the enzyme activities were significantly depressed with the exception of ADA in the spleen, where a high elevation in relation to controls was observed. During the regeneration period a pronounced rise of PNP activity in the spleen occurred mainly after a combined application of CY and irradiation. In the thymus the regeneration was manifested by a mild increase of both ADA and PNP activities towards control values. The findings suggest that the expressive changes of ADA and PNP activities, participating in the purine salvage pathway, may, after a cytotoxic treatment, influence the nucleotide pool and DNA synthesis in lymphoid organs

Internucleotide correlations and nucleotide periodicity in Drosophila mtDNA: New evidence for panselective evolution

Directory of Open Access Journals (Sweden)

Carlos Y Valenzuela

2010-01-01

Full Text Available Analysis for the homogeneity of the distribution of the second base of dinucleotides in relation to the first, whose bases are separated by 0, 1, 2,... 21 nucleotide sites, was performed with the VIH-1 genome (cDNA, the Drosophila mtDNA, the Drosophila Torso gene and the human p-globin gene. These four DNA segments showed highly significant heterogeneities of base distributions that cannot be accounted for by neutral or nearly neutral evolution or by the "neighbor influence" of nucleotides on mutation rates. High correlations are found in the bases of dinucleotides separated by 0, 1 and more number of sites. A periodicity of three consecutive significance values (measured by the x²9 was found only in Drosophila mtDNA. This periodicity may be due to an unknown structure or organization of mtDNA. This non-random distribution of the two bases of dinucleotides widespread throughout these DNA segments is rather compatible with panselective evolution and generalized internucleotide co-adaptation.

An Ultraviolet Resonance Raman Spectroscopic Study of Cisplatin and Transplatin Interactions with Genomic DNA.

Science.gov (United States)

Geng, Jiafeng; Aioub, Mena; El-Sayed, Mostafa A; Barry, Bridgette A

2017-09-28

Ultraviolet resonance Raman (UVRR) spectroscopy is a label-free method to define biomacromolecular interactions with anticancer compounds. Using UVRR, we describe the binding interactions of two Pt(II) compounds, cisplatin (cis-diamminedichloroplatinum(II)) and its isomer, transplatin, with nucleotides and genomic DNA. Cisplatin binds to DNA and other cellular components and triggers apoptosis, whereas transplatin is clinically ineffective. Here, a 244 nm UVRR study shows that purine UVRR bands are altered in frequency and intensity when mononucleotides are treated with cisplatin. This result is consistent with previous suggestions that purine N7 provides the cisplatin-binding site. The addition of cisplatin to DNA also causes changes in the UVRR spectrum, consistent with binding of platinum to purine N7 and disruption of hydrogen-bonding interactions between base pairs. Equally important is that transplatin treatment of DNA generates similar UVRR spectral changes, when compared to cisplatin-treated samples. Kinetic analysis, performed by monitoring decreases of the 1492 cm -1 band, reveals biphasic kinetics and is consistent with a two-step binding mechanism for both platinum compounds. For cisplatin-DNA, the rate constants (6.8 × 10 -5 and 6.5 × 10 -6 s -1 ) are assigned to the formation of monofunctional adducts and to bifunctional, intrastrand cross-linking, respectively. In transplatin-DNA, there is a 3.4-fold decrease in the rate constant of the slow phase, compared with the cisplatin samples. This change is attributed to generation of interstrand, rather than intrastrand, adducts. This longer reaction time may result in increased competition in the cellular environment and account, at least in part, for the lower pharmacological efficacy of transplatin.

Identification of Critical Residues for the Tight Binding of Both Correct and Incorrect Nucleotides to Human DNA Polymerase λ

Science.gov (United States)

Brown, Jessica A.; Pack, Lindsey R.; Sherrer, Shanen M.; Kshetry, Ajay K.; Newmister, Sean A.; Fowler, Jason D.; Taylor, John-Stephen; Suo, Zucai

2010-01-01

DNA polymerase λ (Pol λ) is a novel X-family DNA polymerase that shares 34% sequence identity with DNA polymerase β (Pol β). Pre-steady state kinetic studies have shown that the Pol λ•DNA complex binds both correct and incorrect nucleotides 130-fold tighter on average than the Pol β•DNA complex, although, the base substitution fidelity of both polymerases is 10−4 to 10−5. To better understand Pol λ’s tight nucleotide binding affinity, we created single- and double-substitution mutants of Pol λ to disrupt interactions between active site residues and an incoming nucleotide or a template base. Single-turnover kinetic assays showed that Pol λ binds to an incoming nucleotide via cooperative interactions with active site residues (R386, R420, K422, Y505, F506, A510, and R514). Disrupting protein interactions with an incoming correct or incorrect nucleotide impacted binding with each of the common structural moieties in the following order: triphosphate ≫ base > ribose. In addition, the loss of Watson-Crick hydrogen bonding between the nucleotide and template base led to a moderate increase in the Kd. The fidelity of Pol λ was maintained predominantly by a single residue, R517, which has minor groove interactions with the DNA template. PMID:20851705

The nucleotide sequence of the right-hand terminus of adenovirus type 5 DNA: Implications for the mechanism of DNA replication

NARCIS (Netherlands)

Steenbergh, P.H.; Sussenbach, J.S.

The nucleotide sequence of the right-hand terminal 3% of adenovirus type 5 (Ad5) DNA has been determined, using the chemical degradation technique developed by Maxam and Gilbert (1977). This region of the genome comprises the 1003 basepair long HindIII-I fragment and the first 75 nucleotides of the

DNA incorporation of 6-thioguanine nucleotides during maintenance therapy of childhood acute lymphoblastic leukaemia and non-Hodgkin lymphoma

DEFF Research Database (Denmark)

Hedeland, Rikke L; Hvidt, Kristian; Nersting, Jacob

2010-01-01

To explore the DNA incorporation of 6-thioguanine nucleotide levels (DNA-6TGN) during 6-mercaptopurine (6MP) therapy of childhood acute lymphoblastic leukaemia (ALL) and non-Hodgkin lymphoma (NHL) and its relation to erythrocyte levels of their metabolites: 6-thioguanine-nucleotides (E-6TGN...

Structural basis for the binding and incorporation of nucleotide analogs with L-stereochemistry by human DNA polymerase λ

OpenAIRE

Vyas, Rajan; Zahurancik, Walter J.; Suo, Zucai

2014-01-01

DNA polymerases are known to select against L-nucleotides, the enantiomers of natural D-nucleotides. However, the structural basis for D-stereoselectivity of a DNA polymerase has not been established, although two L-nucleoside analogs, lamivudine and emtricitabine, have been widely used as anti-HIV and anti-hepatitis B drugs. Here, we report ternary crystal structures of human DNA polymerase λ in complex with DNA and L-deoxycytidine 5′-triphosphate, or its analogs (the triphosphates of lamivu...

Nucleotide sequence determination of the region in adenovirus 5 DNA involved in cell transformation

International Nuclear Information System (INIS)

Maat, J.

1978-01-01

A description is given of investigations into the primary structure of the transforming region of adenovirus type 5 DNA. The phenomenon of cell transformation is discussed in general terms and the principles of a number of fairly recent techniques, which have been in use for DNA sequence determination since 1975 are dealt with. A few of the author's own techniques are described which deal both with nucleotide sequence analysis and with the determination of DNA cleavage sites of restriction endonucleases. The results are given of the mapping of cleavage sites in the HpaI-E fragment of adenovirus DNA of HpaII, HaeIII, AluI, HinfI and TaqI and of the determination of the nucleotide sequence in the transforming region of adenovirus type 5 DNA. The results of the sequence determination of the Ad5 HindIII-G fragment are discussed in relation with the investigation on the transforming proteins isolated from in vitro and in vivo synthesizing systems. Labelling procedures of DNA are described including the exonuclease III/DNA polymerase 1 method and TA polynucleotide kinase labelling of DNA fragments. (Auth.)

Horizontal gene transfer and nucleotide compositional anomaly in large DNA viruses

Directory of Open Access Journals (Sweden)

Ogata Hiroyuki

2007-12-01

Full Text Available Abstract Background DNA viruses have a wide range of genome sizes (5 kb up to 1.2 Mb, compared to 0.16 Mb to 1.5 Mb for obligate parasitic bacteria that do not correlate with their virulence or the taxonomic distribution of their hosts. The reasons for such large variation are unclear. According to the traditional view of viruses as gifted "gene pickpockets", large viral genome sizes could originate from numerous gene acquisitions from their hosts. We investigated this hypothesis by studying 67 large DNA viruses with genome sizes larger than 150 kb, including the recently characterized giant mimivirus. Given that horizontally transferred DNA often have anomalous nucleotide compositions differing from the rest of the genome, we conducted a detailed analysis of the inter- and intra-genome compositional properties of these viruses. We then interpreted their compositional heterogeneity in terms of possible causes, including strand asymmetry, gene function/expression, and horizontal transfer. Results We first show that the global nucleotide composition and nucleotide word usage of viral genomes are species-specific and distinct from those of their hosts. Next, we identified compositionally anomalous (cA genes in viral genomes, using a method based on Bayesian inference. The proportion of cA genes is highly variable across viruses and does not exhibit a significant correlation with genome size. The vast majority of the cA genes were of unknown function, lacking homologs in the databases. For genes with known homologs, we found a substantial enrichment of cA genes in specific functional classes for some of the viruses. No significant association was found between cA genes and compositional strand asymmetry. A possible exogenous origin for a small fraction of the cA genes could be confirmed by phylogenetic reconstruction. Conclusion At odds with the traditional dogma, our results argue against frequent genetic transfers to large DNA viruses from their

Purine content of some Philippine foods

International Nuclear Information System (INIS)

Lontoc, A.V.; Ladines, E.O.; Jalandoon, S.A.

1993-01-01

To facilitate dietary advice for prevention and management of hyperuricemia, the content of individual purines, namely: adenine, hypoxanthine, guanine and xanthine was determined in market samples of 161 legumes and dried beans, 41 organ meats, and 25 finfishes and shellfishes using Waters HPLC Model ALC/GPC 244. Analysis for moisture, protein and purines were conducted on the slurries or dried forms of the edible portions of the food samples. Food samples were subsequently classified into three categories adapted from Williams' dietary guide for purines, expressed in decreasing levels of total purines per 100 g serving. Category 1 foods are those that contain very large amount (150 to 1000 mg) of total purines; category 2 foods are those that contain a large amount (75-<150 mg) of total purines; and category 3 foods are those that contain a moderate amount (up to 75 mg) of total purines. (auth.). 17 refs.; 8 tabs

Protected DNA strand displacement for enhanced single nucleotide discrimination in double-stranded DNA

OpenAIRE

Khodakov, Dmitriy A.; Khodakova, Anastasia S.; Huang, David M.; Linacre, Adrian; Ellis, Amanda V.

2015-01-01

Single nucleotide polymorphisms (SNPs) are a prime source of genetic diversity. Discriminating between different SNPs provides an enormous leap towards the better understanding of the uniqueness of biological systems. Here we report on a new approach for SNP discrimination using toehold-mediated DNA strand displacement. The distinctiveness of the approach is based on the combination of both 3- and 4-way branch migration mechanisms, which allows for reliable discrimination of SNPs within doubl...

Functionalized Solid Electrodes for Electrochemical Biosensing of Purine Nucleobases and Their Analogues: A Review

Science.gov (United States)

Sharma, Vimal Kumar; Jelen, Frantisek; Trnkova, Libuse

2015-01-01

Interest in electrochemical analysis of purine nucleobases and few other important purine derivatives has been growing rapidly. Over the period of the past decade, the design of electrochemical biosensors has been focused on achieving high sensitivity and efficiency. The range of existing electrochemical methods with carbon electrode displays the highest rate in the development of biosensors. Moreover, modification of electrode surfaces based on nanomaterials is frequently used due to their extraordinary conductivity and surface to volume ratio. Different strategies for modifying electrode surfaces facilitate electron transport between the electrode surface and biomolecules, including DNA, oligonucleotides and their components. This review aims to summarize recent developments in the electrochemical analysis of purine derivatives, as well as discuss different applications. PMID:25594595

Functionalized Solid Electrodes for Electrochemical Biosensing of Purine Nucleobases and Their Analogues: A Review

Directory of Open Access Journals (Sweden)

Vimal Kumar Sharma

2015-01-01

Full Text Available Interest in electrochemical analysis of purine nucleobases and few other important purine derivatives has been growing rapidly. Over the period of the past decade, the design of electrochemical biosensors has been focused on achieving high sensitivity and efficiency. The range of existing electrochemical methods with carbon electrode displays the highest rate in the development of biosensors. Moreover, modification of electrode surfaces based on nanomaterials is frequently used due to their extraordinary conductivity and surface to volume ratio. Different strategies for modifying electrode surfaces facilitate electron transport between the electrode surface and biomolecules, including DNA, oligonucleotides and their components. This review aims to summarize recent developments in the electrochemical analysis of purine derivatives, as well as discuss different applications.

Trichomonas vaginalis NTPDase and ecto-5'-nucleotidase hydrolyze guanine nucleotides and increase extracellular guanosine levels under serum restriction.

Science.gov (United States)

Menezes, Camila Braz; Durgante, Juliano; de Oliveira, Rafael Rodrigues; Dos Santos, Victor Hugo Jacks Mendes; Rodrigues, Luiz Frederico; Garcia, Solange Cristina; Dos Santos, Odelta; Tasca, Tiana

2016-05-01

accumulation of the nucleoside. The transcript levels of the five TvNTPDases gene sequences were analyzed by qRT-PCR and the highest gene expressions were found for TvNTPDase 2 and 4. The extracellular guanosine uptake was observed as (13C)GTP nucleotide into parasite DNA and it was lower than that observed for adenosine, labeled as (13C)ATP. These findings indicate the T. vaginalis preference for adenosine uptake and the accumulation of guanosine in the extracellular milieu, corroborating with HPLC data. Our data demonstrate, for the first time, the cascade of guanine nucleotides in T. vaginalis and open possibilities on the study of guanine-related purines other than the classical intracellular activity of G proteins for signal transduction. Copyright © 2016 Elsevier B.V. All rights reserved.

Defects in maintenance of mitochondrial DNA are associated with intramitochondrial nucleotide imbalances.

Science.gov (United States)

Ashley, Neil; Adams, Susan; Slama, Abdelhamid; Zeviani, Massimo; Suomalainen, Anu; Andreu, Antonio L; Naviaux, Robert K; Poulton, Joanna

2007-06-15

Defects in mtDNA maintenance range from fatal multisystem childhood diseases, such as Alpers syndrome, to milder diseases in adults, including mtDNA depletion syndromes (MDS) and familial progressive external ophthalmoplegia (AdPEO). Most are associated with defects in genes involved in mitochondrial deoxynucleotide metabolism or utilization, such as mutations in thymidine kinase 2 (TK2) as well as the mtDNA replicative helicase, Twinkle and gamma polymerase (POLG). We have developed an in vitro system to measure incorporation of radiolabelled dNTPs into mitochondria of saponin permeabilized cells. We used this to compare the rates of mtDNA synthesis in cells from 12 patients with diseases of mtDNA maintenance. We observed reduced incorporation of exogenous alpha (32)P-dTTP in fibroblasts from a patient with Alpers syndrome associated with the A467T substitution in POLG, a patient with dGK mutations, and a patient with mtDNA depletion of unknown origin compared to controls. However, incorporation of alpha (32)P-dTTP relative to either cell doubling time or alpha (32)P-dCTP incorporation was increased in patients with thymidine kinase deficiency or PEO as the result of TWINKLE mutations compared with controls. The specific activity of newly synthesized mtDNA depends on the size of the endogenous pool diluting the exogenous labelled nucleotide. Our result is consistent with a deficiency in the intramitochondrial pool of dTTP relative to dCTP in cells from patients with TK2 deficiency and TWINKLE mutations. Such DNA precursor asymmetry could cause pausing of the replication complex and hence exacerbate the propensity for age-related mtDNA mutations. Because deviations from the normal concentrations of dNTPs are known to be mutagenic, we suggest that intramitochondrial nucleotide imbalance could underlie the multiple mtDNA mutations observed in these patients.

cDNA cloning and nucleotide sequence comparison of Chinese hamster metallothionein I and II mRNAs

Energy Technology Data Exchange (ETDEWEB)

Griffith, B B; Walters, R A; Enger, M D; Hildebrand, C E; Griffith, J K

1983-01-01

Polyadenylated RNA was extracted from a cadmium resistant Chinese hamster (CHO) cell line, enriched for metal-induced, abundant RNA sequences and cloned as double-stranded cDNA in the plasmid pBR322. Two cDNA clones, pCHMT1 and pCHMT2, encoding two Chinese hamster isometallothioneins were identified, and the nucleotide sequence of each insert was determined. The two Chinese hamster metallothioneins show nucleotide sequence homologies of 80% in the protein coding region and approximately 35% in both the 5' and 3' untranslated regions. Interestingly, an 8 nucleotide sequence (TGTAAATA) has been conserved in sequence and position in the 3' untranslated regions of each metallothionein mRNA sequenced thus far. Estimated nucleotide substitution rates derived from interspecies comparisons were used to calculate a metallothionein gene duplication time of 45 to 120 million years ago. 39 references, 1 figure, 1 table.

Temporal patterns of damage and decay kinetics of DNA retrieved from plant herbarium specimens.

Science.gov (United States)

Weiß, Clemens L; Schuenemann, Verena J; Devos, Jane; Shirsekar, Gautam; Reiter, Ella; Gould, Billie A; Stinchcombe, John R; Krause, Johannes; Burbano, Hernán A

2016-06-01

Herbaria archive a record of changes of worldwide plant biodiversity harbouring millions of specimens that contain DNA suitable for genome sequencing. To profit from this resource, it is fundamental to understand in detail the process of DNA degradation in herbarium specimens. We investigated patterns of DNA fragmentation and nucleotide misincorporation by analysing 86 herbarium samples spanning the last 300 years using Illumina shotgun sequencing. We found an exponential decay relationship between DNA fragmentation and time, and estimated a per nucleotide fragmentation rate of 1.66 × 10(-4) per year, which is six times faster than the rate estimated for ancient bones. Additionally, we found that strand breaks occur specially before purines, and that depurination-driven DNA breakage occurs constantly through time and can to a great extent explain decreasing fragment length over time. Similar to what has been found analysing ancient DNA from bones, we found a strong correlation between the deamination-driven accumulation of cytosine to thymine substitutions and time, which reinforces the importance of substitution patterns to authenticate the ancient/historical nature of DNA fragments. Accurate estimations of DNA degradation through time will allow informed decisions about laboratory and computational procedures to take advantage of the vast collection of worldwide herbarium specimens.

Nucleotide Excision DNA Repair is Associated with Age-Related Vascular Dysfunction

Science.gov (United States)

Durik, Matej; Kavousi, Maryam; van der Pluijm, Ingrid; Isaacs, Aaron; Cheng, Caroline; Verdonk, Koen; Loot, Annemarieke E.; Oeseburg, Hisko; Musterd-Bhaggoe, Usha; Leijten, Frank; van Veghel, Richard; de Vries, Rene; Rudez, Goran; Brandt, Renata; Ridwan, Yanto R.; van Deel, Elza D.; de Boer, Martine; Tempel, Dennie; Fleming, Ingrid; Mitchell, Gary F.; Verwoert, Germaine C.; Tarasov, Kirill V.; Uitterlinden, Andre G.; Hofman, Albert; Duckers, Henricus J.; van Duijn, Cornelia M.; Oostra, Ben A.; Witteman, Jacqueline C.M.; Duncker, Dirk J.; Danser, A.H. Jan; Hoeijmakers, Jan H.; Roks, Anton J.M.

2012-01-01

Background Vascular dysfunction in atherosclerosis and diabetes, as observed in the aging population of developed societies, is associated with vascular DNA damage and cell senescence. We hypothesized that cumulative DNA damage during aging contributes to vascular dysfunction. Methods and Results In mice with genomic instability due to the defective nucleotide excision repair genes ERCC1 and XPD (Ercc1d/− and XpdTTD mice), we explored age-dependent vascular function as compared to wild-type mice. Ercc1d/− mice showed increased vascular cell senescence, accelerated development of vasodilator dysfunction, increased vascular stiffness and elevated blood pressure at very young age. The vasodilator dysfunction was due to decreased endothelial eNOS levels as well as impaired smooth muscle cell function, which involved phosphodiesterase (PDE) activity. Similar to Ercc1d/− mice, age-related endothelium-dependent vasodilator dysfunction in XpdTTD animals was increased. To investigate the implications for human vascular disease, we explored associations between single nucleotide polymorphisms (SNPs) of selected nucleotide excision repair genes and arterial stiffness within the AortaGen Consortium, and found a significant association of a SNP (rs2029298) in the putative promoter region of DDB2 gene with carotid-femoral pulse wave velocity. Conclusions Mice with genomic instability recapitulate age-dependent vascular dysfunction as observed in animal models and in humans, but with an accelerated progression, as compared to wild type mice. In addition, we found associations between variations in human DNA repair genes and markers for vascular stiffness which is associated with aging. Our study supports the concept that genomic instability contributes importantly to the development of cardiovascular disease. PMID:22705887

Nucleotide Metabolism and its Control in Lactic Acid Bacteria

DEFF Research Database (Denmark)

Kilstrup, Mogens; Hammer, Karin; Jensen, Peter Ruhdal

2005-01-01

Most metabolic reactions are connected through either their utilization of nucleotides or their utilization of nucleotides or their regulation by these metabolites. In this review the biosynthetic pathways for pyrimidine and purine metabolism in lactic acid bacteria are described including...... the interconversion pathways, the formation of deoxyribonucleotides and the salvage pathways for use of exogenous precursors. The data for the enzymatic and the genetic regulation of these pathways are reviewed, as well as the gene organizations in different lactic acid bacteria. Mutant phenotypes and methods...... for manipulation of nucleotide pools are also discussed. Our aim is to provide an overview of the physiology and genetics of nucleotide metabolism and its regulation that will facilitate the interpretation of data arising from genetics, metabolomics, proteomics, and transcriptomics in lactic acid bacteria....

Purine nucleotide synthesis from exogenous adenine and guanine in rodent small intestine

International Nuclear Information System (INIS)

Gross, C.J.; Karlberg, P.K.; Savaiano, D.A.

1986-01-01

14 C-Adenine and 14 C-guanine uptake was studied in isolated guinea pig enterocytes. Cells were incubated in Hank's buffer and separated from the medium by centrifugation through silicone oil into 1M PCA. Uptake was temperature and concentration dependent. Both compounds were incorporated into nucleotides as measured by HPLC and HVE. Adenine was more extensively incorporated into nucleotides than was guanine. Adenine nucleotides accounted for about 70% of the intracellular label after 30 min with a majority being ADP and ATP (medium concentration = 10 μM). Guanine nucleotides accounted for only 30% of the intracellular label after 30 min. Labeled intracellular free adenine or guanine were not detected. Significantly more guanine vs. adenine was converted to uric acid. After 30 min, 11.5 +/- 3.9% (n=3) and 83.0 +/- 8.4% (n=4) of the label was present as uric acid in the medium when adenine and guanine, respectively, were the substrate. After 1 min, 34.8 +/- 3.4% (n=4) of the label in the medium was present as uric acid when guanine was the substrate. Decreasing the concentration of adenine resulted in an increase in the percent of uric acid in the medium. 14 C-adenine (75 nmol) was injected into 1 gm segments of rat jejunum. After 5 min., segments were quickly flushed and the tissue homogenized in 1M PCA. Only uric acid was present after 5 min (n=6). In contrast, in animals fasted 3 to 5 days, less conversion to uric acid was observed in the intestinal content (50-80% of the same dose was still present as adenine after 5 min) and nucleotide formation was observed in the tissue. The results indicate that uric acid and nucleotide synthesis from exogenous adenine and guanine are concentration dependent and affected by nutritional state

Prolonged fasting increases purine recycling in post-weaned northern elephant seals.

Science.gov (United States)

Soñanez-Organis, José Guadalupe; Vázquez-Medina, José Pablo; Zenteno-Savín, Tania; Aguilar, Andres; Crocker, Daniel E; Ortiz, Rudy M

2012-05-01

Northern elephant seals are naturally adapted to prolonged periods (1-2 months) of absolute food and water deprivation (fasting). In terrestrial mammals, food deprivation stimulates ATP degradation and decreases ATP synthesis, resulting in the accumulation of purines (ATP degradation byproducts). Hypoxanthine-guanine phosphoribosyl transferase (HGPRT) salvages ATP by recycling the purine degradation products derived from xanthine oxidase (XO) metabolism, which also promotes oxidant production. The contributions of HGPRT to purine recycling during prolonged food deprivation in marine mammals are not well defined. In the present study we cloned and characterized the complete and partial cDNA sequences that encode for HGPRT and xanthine oxidoreductase (XOR) in northern elephant seals. We also measured XO protein expression and circulating activity, along with xanthine and hypoxanthine plasma content in fasting northern elephant seal pups. Blood, adipose and muscle tissue samples were collected from animals after 1, 3, 5 and 7 weeks of their natural post-weaning fast. The complete HGPRT and partial XOR cDNA sequences are 771 and 345 bp long and encode proteins of 218 and 115 amino acids, respectively, with conserved domains important for their function and regulation. XOR mRNA and XO protein expression increased 3-fold and 1.7-fold with fasting, respectively, whereas HGPRT mRNA (4-fold) and protein (2-fold) expression increased after 7 weeks in adipose tissue and muscle. Plasma xanthine (3-fold) and hypoxanthine (2.5-fold) levels, and XO (1.7- to 20-fold) and HGPRT (1.5- to 1.7-fold) activities increased during the last 2 weeks of fasting. Results suggest that prolonged fasting in elephant seal pups is associated with increased capacity to recycle purines, which may contribute to ameliorating oxidant production and enhancing the supply of ATP, both of which would be beneficial during prolonged food deprivation and appear to be adaptive in this species.

PCR/LDR/capillary electrophoresis for detection of single-nucleotide differences between fetal and maternal DNA in maternal plasma.

Science.gov (United States)

Yi, Ping; Chen, Zhuqin; Zhao, Yan; Guo, Jianxin; Fu, Huabin; Zhou, Yuanguo; Yu, Lili; Li, Li

2009-03-01

The discovery of fetal DNA in maternal plasma has opened up an approach for noninvasive diagnosis. We have now assessed the possibility of detecting single-nucleotide differences between fetal and maternal DNA in maternal plasma by polymerase chain reaction (PCR)/ligase detection reaction((LDR)/capillary electrophoresis. PCR/LDR/capillary electrophoresis was applied to detect the genotype of c.454-397T>gene (ESR1) from experimental DNA models of maternal plasma at different sensitivity levels and 13 maternal plasma samples.alphaC in estrogen receptor. (1) Our results demonstrated that the technique could discriminate low abundance single-nucleotide mutation with a mutant/normal allele ratio up to 1:10 000. (2) Examination of ESR1 c.454-397T>C genotypes by using the method of restriction fragment length analysis was performed in 25 pregnant women, of whom 13 pregnant women had homozygous genotypes. The c.454-397T>C genotypes of paternally inherited fetal DNA in maternal plasma of these 13 women were detected by PCR/LDR/capillary electrophoresis, which were accordant with the results of umbilical cord blood. PCR/LDR/capillary electrophoresis has very high sensitivity to distinguish low abundance single nucleotide differences and can discriminate point mutations and single-nucleotide polymorphisms(SNPs) of paternally inherited fetal DNA in maternal plasma.

Distinct Purine Distribution in Carbonaceous Chondrites

Science.gov (United States)

Callahan, Michael P.; Smith, Karen E.; Cleaves, Henderson J.; Ruzicka, Josef; Stern, Jennifer C.; Glavin, Daniel P.; House, Christopher H.; Dworkin, Jason P.

2011-01-01

(l, 2, and 3) and one ureilite. Analysis via liquid chromatography coupled with electrospray triple-stage mass spectrometry or orbitrap mass spectrometry employed a targeted approach for analysis focused on the five canonical RNA/DNA nucleobases as well as 14 non-canonical pyrimidines and purines, which have bcen observed under plausible prebiotic reactions.

Molecular cloning of a human glycophorin B cDNA: nucleotide sequence and genomic relationship to glycophorin A

International Nuclear Information System (INIS)

Siebert, P.D.; Fukuda, M.

1987-01-01

The authors describe the isolation and nucleotide sequence of a human glycophorin B cDNA. The cDNA was identified by differential hybridization of synthetic oligonucleotide probes to a human erythroleukemic cell line (K562) cDNA library constructed in phage vector λgt10. The nucleotide sequence of the glycophorin B cDNA was compared with that of a previously cloned glycophorin A cDNA. The nucleotide sequences encoding the NH 2 -terminal leader peptide and first 26 amino acids of the two proteins are nearly identical. This homologous region is followed by areas specific to either glycophorin A or B and a number of small regions of homology, which in turn are followed by a very homologous region encoding the presumed membrane-spanning portion of the proteins. They used RNA blot hybridization with both cDNA and synthetic oligonucleotide probes to prove our previous hypothesis that glycophorin B is encoded by a single 0.5- to 0.6-kb mRNA and to show that glycophorins A and B are negatively and coordinately regulated by a tumor-promoting phorbol ester, phorbol 12-myristate 13-acetate. They established the intron/exon structure of the glycophorin A and B genes by oligonucleotide mapping; the results suggest a complex evolution of the glycophorin genes

Pre-Steady State Kinetic Investigation of the Incorporation of Anti-Hepatitis B Nucleotide Analogs Catalyzed by Non-Canonical Human DNA Polymerases

Science.gov (United States)

Brown, Jessica A.; Pack, Lindsey R.; Fowler, Jason D.; Suo, Zucai

2011-01-01

Antiviral nucleoside analogs have been developed to inhibit the enzymatic activities of the hepatitis B virus (HBV) polymerase, thereby preventing the replication and production of HBV. However, the usage of these analogs can be limited by drug toxicity because the 5′-triphosphates of these nucleoside analogs (nucleotide analogs) are potential substrates for human DNA polymerases to incorporate into host DNA. Although they are poor substrates for human replicative DNA polymerases, it remains to be established whether these nucleotide analogs are substrates for the recently discovered human X- and Y-family DNA polymerases. Using pre-steady state kinetic techniques, we have measured the substrate specificity values for human DNA polymerases β, λ, η, ι, κ, and Rev1 incorporating the active forms of the following anti-HBV nucleoside analogs approved for clinical use: adefovir, tenofovir, lamivudine, telbivudine, and entecavir. Compared to the incorporation of a natural nucleotide, most of the nucleotide analogs were incorporated less efficiently (2 to >122,000) by the six human DNA polymerases. In addition, the potential for entecavir and telbivudine, two drugs which possess a 3′-hydroxyl, to become embedded into human DNA was examined by primer extension and DNA ligation assays. These results suggested that telbivudine functions as a chain terminator while entecavir was efficiently extended by the six enzymes and was a substrate for human DNA ligase I. Our findings suggested that incorporation of anti-HBV nucleotide analogs catalyzed by human X- and Y-family polymerases may contribute to clinical toxicity. PMID:22132702

Señales purinérgicas Purinergic signals

Directory of Open Access Journals (Sweden)

Eduardo R Lazarowski

2009-04-01

Full Text Available En la última década se ha aportado clara evidencia de que tanto nucleósidos como nucleótidos de adenina y uridina pueden funcionar como factores de señalización extracelular. Su acción es mediada por dos tipos principales de receptores de superficie denominados purinérgicos. Los receptores P1 se activan por adenosina, y son todos metabotrópicos, mientras que los receptores de nucleótidos (ATP, ADP, UTP y UDP y nucleótidos-azúcares (UDP-glucosa y UDP-galactosa pueden ser metabotrópicos (P2Y o ionotrópicos (P2X. La importancia y complejidad de este sistema de señalización se evidencia por la diversidad de mecanismos de liberación de nucleótidos al medio extracelular y por la distribución ubicua de varios grupos de ectonucleotidasas capaces de catalizar la degradación y conversión de nucleótidos. Hasta el momento se han descrito y clonado una veintena de estos receptores que modulan una variedad de respuestas, como el impulso nervioso, la respuesta inflamatoria, la secreción de insulina, la regulación del tono vascular y la percepción del dolor. En la presente revisión se describen las características estructurales y farmacológicas de los receptores purinérgicos y se analiza la interacción dinámica entre estos receptores, los nucleósidos y nucleótidos, y las ectonucleotidasas, con especial atención a la dinámica de la agregación plaquetaria, la respuesta inmune y la hidratación de las mucosas respiratorias.In the last decade evidence accumulated that nucleosides and nucleotides of both uridine and adenine can act as extracellular signaling factors. Their action is mediated by two main types of surface receptors commonly known as purinergic. P1 receptors are metabotropic and activated by adenosine, whereas receptors for nucleotides (ATP, ADP, UTP and UDP and nucleotide-sugars (UDP-glucose and UDP-galactose can be either metabotropic (P2Y or ionotropic (P2X. The importance and complexity of this signaling system

Recognition of damaged DNA by Escherichia coli Fpg protein: insights from structural and kinetic data

International Nuclear Information System (INIS)

Zharkov, Dmitry O.; Ishchenko, Alexander A.; Douglas, Kenneth T.; Nevinsky, Georgy A.

2003-01-01

Formamidopyrimidine-DNA glycosylase (Fpg) excises oxidized purines from damaged DNA. The recent determination of the three-dimensional structure of the covalent complex of DNA with Escherichia coli Fpg, obtained by reducing the Schiff base intermediate formed during the reaction [Gilboa et al., J. Biol. Chem. 277 (2002) 19811] has revealed a number of potential specific and non-specific interactions between Fpg and DNA. We analyze the structural data for Fpg in the light of the kinetic and thermodynamic data obtained by the method of stepwise increase in ligand complexity to estimate relative contributions of individual nucleotide units of lesion-containing DNA to its total affinity for this enzyme [Ishchenko et al., Biochemistry 41 (2002) 7540]. Stopped-flow kinetic analysis that has allowed the dissection of Fpg catalysis in time [Fedorova et al., Biochemistry 41 (2002) 1520] is also correlated with the structural data

Phenolic Amides Are Potent Inhibitors of De Novo Nucleotide Biosynthesis.

Science.gov (United States)

Pisithkul, Tippapha; Jacobson, Tyler B; O'Brien, Thomas J; Stevenson, David M; Amador-Noguez, Daniel

2015-09-01

An outstanding challenge toward efficient production of biofuels and value-added chemicals from plant biomass is the impact that lignocellulose-derived inhibitors have on microbial fermentations. Elucidating the mechanisms that underlie their toxicity is critical for developing strategies to overcome them. Here, using Escherichia coli as a model system, we investigated the metabolic effects and toxicity mechanisms of feruloyl amide and coumaroyl amide, the predominant phenolic compounds in ammonia-pretreated biomass hydrolysates. Using metabolomics, isotope tracers, and biochemical assays, we showed that these two phenolic amides act as potent and fast-acting inhibitors of purine and pyrimidine biosynthetic pathways. Feruloyl or coumaroyl amide exposure leads to (i) a rapid buildup of 5-phosphoribosyl-1-pyrophosphate (PRPP), a key precursor in nucleotide biosynthesis, (ii) a rapid decrease in the levels of pyrimidine biosynthetic intermediates, and (iii) a long-term generalized decrease in nucleotide and deoxynucleotide levels. Tracer experiments using (13)C-labeled sugars and [(15)N]ammonia demonstrated that carbon and nitrogen fluxes into nucleotides and deoxynucleotides are inhibited by these phenolic amides. We found that these effects are mediated via direct inhibition of glutamine amidotransferases that participate in nucleotide biosynthetic pathways. In particular, feruloyl amide is a competitive inhibitor of glutamine PRPP amidotransferase (PurF), which catalyzes the first committed step in de novo purine biosynthesis. Finally, external nucleoside supplementation prevents phenolic amide-mediated growth inhibition by allowing nucleotide biosynthesis via salvage pathways. The results presented here will help in the development of strategies to overcome toxicity of phenolic compounds and facilitate engineering of more efficient microbial producers of biofuels and chemicals. Copyright © 2015, Pisithkul et al.

Phenolic Amides Are Potent Inhibitors of De Novo Nucleotide Biosynthesis

Science.gov (United States)

Pisithkul, Tippapha; Jacobson, Tyler B.; O'Brien, Thomas J.; Stevenson, David M.

2015-01-01

An outstanding challenge toward efficient production of biofuels and value-added chemicals from plant biomass is the impact that lignocellulose-derived inhibitors have on microbial fermentations. Elucidating the mechanisms that underlie their toxicity is critical for developing strategies to overcome them. Here, using Escherichia coli as a model system, we investigated the metabolic effects and toxicity mechanisms of feruloyl amide and coumaroyl amide, the predominant phenolic compounds in ammonia-pretreated biomass hydrolysates. Using metabolomics, isotope tracers, and biochemical assays, we showed that these two phenolic amides act as potent and fast-acting inhibitors of purine and pyrimidine biosynthetic pathways. Feruloyl or coumaroyl amide exposure leads to (i) a rapid buildup of 5-phosphoribosyl-1-pyrophosphate (PRPP), a key precursor in nucleotide biosynthesis, (ii) a rapid decrease in the levels of pyrimidine biosynthetic intermediates, and (iii) a long-term generalized decrease in nucleotide and deoxynucleotide levels. Tracer experiments using 13C-labeled sugars and [15N]ammonia demonstrated that carbon and nitrogen fluxes into nucleotides and deoxynucleotides are inhibited by these phenolic amides. We found that these effects are mediated via direct inhibition of glutamine amidotransferases that participate in nucleotide biosynthetic pathways. In particular, feruloyl amide is a competitive inhibitor of glutamine PRPP amidotransferase (PurF), which catalyzes the first committed step in de novo purine biosynthesis. Finally, external nucleoside supplementation prevents phenolic amide-mediated growth inhibition by allowing nucleotide biosynthesis via salvage pathways. The results presented here will help in the development of strategies to overcome toxicity of phenolic compounds and facilitate engineering of more efficient microbial producers of biofuels and chemicals. PMID:26070680

Nucleotide-mimetic synthetic ligands for DNA-recognizing enzymes One-step purification of Pfu DNA polymerase.

Science.gov (United States)

Melissis, S; Labrou, N E; Clonis, Y D

2006-07-28

The commercial availability of DNA polymerases has revolutionized molecular biotechnology and certain sectors of the bio-industry. Therefore, the development of affinity adsorbents for purification of DNA polymerases is of academic interest and practical importance. In the present study we describe the design, synthesis and evaluation of a combinatorial library of novel affinity ligands for the purification of DNA polymerases (Pols). Pyrococcus furiosus DNA polymerase (Pfu Pol) was employed as a proof-of-principle example. Affinity ligand design was based on mimicking the natural interactions between deoxynucleoside-triphosphates (dNTPs) and the B-motif, a conserved structural moiety found in Pol-I and Pol-II family of enzymes. Solid-phase 'structure-guided' combinatorial chemistry was used to construct a library of 26 variants of the B-motif-binding 'lead' ligand X-Trz-Y (X is a purine derivative and Y is an aliphatic/aromatic sulphonate or phosphonate derivative) using 1,3,5-triazine (Trz) as the scaffold for assembly. The 'lead' ligand showed complementarity against a Lys and a Tyr residue of the polymerase B-motif. The ligand library was screened for its ability to bind and purify Pfu Pol from Escherichia coli extract. One immobilized ligand (oABSAd), bearing 9-aminoethyladenine (AEAd) and sulfanilic acid (oABS) linked on the triazine scaffold, displayed the highest purifying ability and binding capacity (0,55 mg Pfu Pol/g wet gel). Adsorption equilibrium studies with this affinity ligand and Pfu Pol determined a dissociation constant (K(D)) of 83 nM for the respective complex. The oABSAd affinity adsorbent was exploited in the development of a facile Pfu Pol purification protocol, affording homogeneous enzyme (>99% purity) in a single chromatography step. Quality control tests showed that Pfu Pol purified on the B-motif-complementing ligand is free of nucleic acids and contaminating nuclease activities, therefore, suitable for experimental use.

Molecular dynamics simulations of the DNA interaction with metallic nanoparticles and TiO2 surfaces

International Nuclear Information System (INIS)

Kholmurodov, Kh.T.; Krasavin, E.A.; Dushanov, E.B.; Hassan, H.K.; Galal, A.; ElHabashy, H.A.; Sweilam, N.H.; Yasuoka, K.

2013-01-01

The understanding of the mechanism of DNA interactions and binding with metallic nanoparticles (NPs) and surfaces represents a great interest in today's medicine applications due to diagnostic and treatment of oncology diseases. Recent experimental and simulation studies involve the DNA interaction with highly localized proton beams or metallic NPs (such as Ag, Au, etc.), aimed at targeted cancer therapy through the injection of metal micro- or nanoparticles into the tumor tissue with consequent local microwave or laser heating. The effects of mutational structure changes in DNA and protein structures could result in destroying of native chemical (hydrogen) bonds or, on the contrary, creating of new bonds that do not normally exist there. The cause of such changes might be the alteration of one or several nucleotides (in DNA) or the substitution of specific amino acid residues (in proteins) that can lead to the essential structural destabilization or unfolding. At the atomic or molecular level, the replacement of one nucleotide by another (in DNA double helices) or replacement of one amino acid residue by another (in proteins) cause essential modifications of the molecular force fields of the environment that break locally important hydrogen bonds underlying the structural stability of the biological molecules. In this work, the molecular dynamics(MD) simulations were performed for four DNA models and the flexibilities of the purine and pyrimidine nucleotides during the interaction process with the metallic NPs and TiO 2 surface were clarified

Mapping DNA methylation by transverse current sequencing: Reduction of noise from neighboring nucleotides

Science.gov (United States)

Alvarez, Jose; Massey, Steven; Kalitsov, Alan; Velev, Julian

Nanopore sequencing via transverse current has emerged as a competitive candidate for mapping DNA methylation without needed bisulfite-treatment, fluorescent tag, or PCR amplification. By eliminating the error producing amplification step, long read lengths become feasible, which greatly simplifies the assembly process and reduces the time and the cost inherent in current technologies. However, due to the large error rates of nanopore sequencing, single base resolution has not been reached. A very important source of noise is the intrinsic structural noise in the electric signature of the nucleotide arising from the influence of neighboring nucleotides. In this work we perform calculations of the tunneling current through DNA molecules in nanopores using the non-equilibrium electron transport method within an effective multi-orbital tight-binding model derived from first-principles calculations. We develop a base-calling algorithm accounting for the correlations of the current through neighboring bases, which in principle can reduce the error rate below any desired precision. Using this method we show that we can clearly distinguish DNA methylation and other base modifications based on the reading of the tunneling current.

Cross-coupling reactions of unprotected halopurine bases, nucleosides, nucleotides and nucleoside triphosphates with 4-boronophenylalanine in water. Synthesis of (purin-8-yl)- and (purin-6-yl)phenylalanines

Czech Academy of Sciences Publication Activity Database

Čapek, Petr; Pohl, Radek; Hocek, Michal

2006-01-01

Roč. 4, č. 11 (2006), s. 2278-2284 ISSN 1477-0520 R&D Projects: GA AV ČR(CZ) 1QS400550501; GA MŠk(CZ) 1M0508 Institutional research plan: CEZ:AV0Z40550506 Keywords : amino acids * purines * nucleosides * cross-coupling reactions Subject RIV: CC - Organic Chemistry Impact factor: 2.874, year: 2006

The Potato Nucleotide-binding Leucine-rich Repeat (NLR) Immune Receptor Rx1 Is a Pathogen-dependent DNA-deforming Protein*

Science.gov (United States)

Fenyk, Stepan; Townsend, Philip D.; Dixon, Christopher H.; Spies, Gerhard B.; de San Eustaquio Campillo, Alba; Slootweg, Erik J.; Westerhof, Lotte B.; Gawehns, Fleur K. K.; Knight, Marc R.; Sharples, Gary J.; Goverse, Aska; Pålsson, Lars-Olof; Takken, Frank L. W.; Cann, Martin J.

2015-01-01

Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable cells to respond to pathogen attack. Several NLRs act in the nucleus; however, conserved nuclear targets that support their role in immunity are unknown. Previously, we noted a structural homology between the nucleotide-binding domain of NLRs and DNA replication origin-binding Cdc6/Orc1 proteins. Here we show that the NB-ARC (nucleotide-binding, Apaf-1, R-proteins, and CED-4) domain of the Rx1 NLR of potato binds nucleic acids. Rx1 induces ATP-dependent bending and melting of DNA in vitro, dependent upon a functional P-loop. In situ full-length Rx1 binds nuclear DNA following activation by its cognate pathogen-derived effector protein, the coat protein of potato virus X. In line with its obligatory nucleocytoplasmic distribution, DNA binding was only observed when Rx1 was allowed to freely translocate between both compartments and was activated in the cytoplasm. Immune activation induced by an unrelated NLR-effector pair did not trigger an Rx1-DNA interaction. DNA binding is therefore not merely a consequence of immune activation. These data establish a role for DNA distortion in Rx1 immune signaling and define DNA as a molecular target of an activated NLR. PMID:26306038

[Features of influence adenosine, AMP and hyperadrenalinemiya on the immune status, metabolic enzymes of purine nucleotides and the antioxidant defense system].

Science.gov (United States)

Tapbergenov, S O; Sovetov, B S; Tapbergenov, A T

2016-11-01

Administration of a large dose of adrenaline (4 mg/kg 60 min before analysis) increased blood levels of total leukocytes, lymphocytes, decreased T-cell suppressors, leukocyte migration inhibition reaction (LMIR) and NBT test, but increased the level of conjugated dienes (CD). Administration of AMPand adenosine increased levels of total leukocytes, lymphocytes, T- lymphocytes, T-helpers, decreased the level of malondialdehyde (MDA), LMIR, and T-cell suppressors. Sympathetic hyperactivation induced by administration of a large dose of adrenaline (4 mg/kg 60 min before analysis) was accompanied by an increase in heart and liver activities of glutathione peroxidase (GPx), catalase, AMP deaminase (AMPD), and adenosine deaminase (AD). Administration of AMP or adenosine caused a decrease in activities of glutathione reductase (GR), GPx, catalase, a decrease in the MDA level and an increase in activities of AMPD and AD in the heart. In the liver AMP and adenosine also caused a decrease in activities of glutathione reductase (GR), GPx, a decrease in the MDA level and an increase in activities of AMPD and AD. The data obtained suggest that administration of adrenaline, AMP, and adenosine influences activity of enzymes involved in purine nucleotide metabolism. However, in contrast to adrenaline, administration of AMP or adenosine does not provoke stress reaction.

Bypass of a 5',8-cyclopurine-2'-deoxynucleoside by DNA polymerase β during DNA replication and base excision repair leads to nucleotide misinsertions and DNA strand breaks.

Science.gov (United States)

Jiang, Zhongliang; Xu, Meng; Lai, Yanhao; Laverde, Eduardo E; Terzidis, Michael A; Masi, Annalisa; Chatgilialoglu, Chryssostomos; Liu, Yuan

2015-09-01

5',8-Cyclopurine-2'-deoxynucleosides including 5',8-cyclo-dA (cdA) and 5',8-cyclo-dG (cdG) are induced by hydroxyl radicals resulting from oxidative stress such as ionizing radiation. 5',8-cyclopurine-2'-deoxynucleoside lesions are repaired by nucleotide excision repair with low efficiency, thereby leading to their accumulation in the human genome and lesion bypass by DNA polymerases during DNA replication and base excision repair (BER). In this study, for the first time, we discovered that DNA polymerase β (pol β) efficiently bypassed a 5'R-cdA, but inefficiently bypassed a 5'S-cdA during DNA replication and BER. We found that cell extracts from pol β wild-type mouse embryonic fibroblasts exhibited significant DNA synthesis activity in bypassing a cdA lesion located in replication and BER intermediates. However, pol β knock-out cell extracts exhibited little DNA synthesis to bypass the lesion. This indicates that pol β plays an important role in bypassing a cdA lesion during DNA replication and BER. Furthermore, we demonstrated that pol β inserted both a correct and incorrect nucleotide to bypass a cdA at a low concentration. Nucleotide misinsertion was significantly stimulated by a high concentration of pol β, indicating a mutagenic effect induced by pol β lesion bypass synthesis of a 5',8-cyclopurine-2'-deoxynucleoside. Moreover, we found that bypass of a 5'S-cdA by pol β generated an intermediate that failed to be extended by pol β, resulting in accumulation of single-strand DNA breaks. Our study provides the first evidence that pol β plays an important role in bypassing a 5',8-cyclo-dA during DNA replication and repair, as well as new insight into mutagenic effects and genome instability resulting from pol β bypassing of a cdA lesion. Copyright © 2015 Elsevier B.V. All rights reserved.

Electron attachment to DNA single strands: gas phase and aqueous solution.

Science.gov (United States)

Gu, Jiande; Xie, Yaoming; Schaefer, Henry F

2007-01-01

The 2'-deoxyguanosine-3',5'-diphosphate, 2'-deoxyadenosine-3',5'-diphosphate, 2'-deoxycytidine-3',5'-diphosphate and 2'-deoxythymidine-3',5'-diphosphate systems are the smallest units of a DNA single strand. Exploring these comprehensive subunits with reliable density functional methods enables one to approach reasonable predictions of the properties of DNA single strands. With these models, DNA single strands are found to have a strong tendency to capture low-energy electrons. The vertical attachment energies (VEAs) predicted for 3',5'-dTDP (0.17 eV) and 3',5'-dGDP (0.14 eV) indicate that both the thymine-rich and the guanine-rich DNA single strands have the ability to capture electrons. The adiabatic electron affinities (AEAs) of the nucleotides considered here range from 0.22 to 0.52 eV and follow the order 3',5'-dTDP > 3',5'-dCDP > 3',5'-dGDP > 3',5'-dADP. A substantial increase in the AEA is observed compared to that of the corresponding nucleic acid bases and the corresponding nucleosides. Furthermore, aqueous solution simulations dramatically increase the electron attracting properties of the DNA single strands. The present investigation illustrates that in the gas phase, the excess electron is situated both on the nucleobase and on the phosphate moiety for DNA single strands. However, the distribution of the extra negative charge is uneven. The attached electron favors the base moiety for the pyrimidine, while it prefers the 3'-phosphate subunit for the purine DNA single strands. In contrast, the attached electron is tightly bound to the base fragment for the cytidine, thymidine and adenosine nucleotides, while it almost exclusively resides in the vicinity of the 3'-phosphate group for the guanosine nucleotides due to the solvent effects. The comparatively low vertical detachment energies (VDEs) predicted for 3',5'-dADP(-) (0.26 eV) and 3',5'-dGDP(-) (0.32 eV) indicate that electron detachment might compete with reactions having high activation barriers

Robust embryo identification using first polar body single nucleotide polymorphism microarray-based DNA fingerprinting.

Science.gov (United States)

Treff, Nathan R; Su, Jing; Kasabwala, Natasha; Tao, Xin; Miller, Kathleen A; Scott, Richard T

2010-05-01

This study sought to validate a novel, minimally invasive system for embryo tracking by single nucleotide polymorphism microarray-based DNA fingerprinting of the first polar body. First polar body-based assignments of which embryos implanted and were delivered after multiple ET were 100% consistent with previously validated embryo DNA fingerprinting-based assignments. Copyright 2010 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

Kinetic Basis of Nucleotide Selection Employed by a Protein Template-Dependent DNA Polymerase†

Science.gov (United States)

Brown, Jessica A.; Fowler, Jason D.; Suo, Zucai

2010-01-01

Rev1, a Y-family DNA polymerase, contributes to spontaneous and DNA damage-induced mutagenic events. In this paper, we have employed pre-steady state kinetic methodology to establish a kinetic basis for nucleotide selection by human Rev1, a unique nucleotidyl transferase that uses a protein template-directed mechanism to preferentially instruct dCTP incorporation. This work demonstrated that the high incorporation efficiency of dCTP is dependent on both substrates: an incoming dCTP and a templating base dG. The extremely low base substitution fidelity of human Rev1 (100 to 10-5) was due to the preferred misincorporation of dCTP with templating bases dA, dT, and dC over correct dNTPs. Using non-natural nucleotide analogs, we showed that hydrogen bonding interactions between residue R357 of human Rev1 and an incoming dNTP are not essential for DNA synthesis. Lastly, human Rev1 discriminates between ribonucleotides and deoxyribonucleotides mainly by reducing the rate of incorporation, and the sugar selectivity of human Rev1 is sensitive to both the size and orientation of the 2′-substituent of a ribonucleotide. PMID:20518555

Poly(alizarin red)/Graphene modified glassy carbon electrode for simultaneous determination of purine and pyrimidine

International Nuclear Information System (INIS)

Ba Xi; Luo Liqiang; Ding Yaping; Zhang Zhen; Chu Yuliang; Wang Bijun; Ouyang Xiaoqian

2012-01-01

Graphical abstract: DPVs of PAR/Graphene/GCE (a) and the bare GCE (c) in 0.1 M PBS containing 50.0 μM G, 50.0 μM A, 100.0 μM T and 100.0 μM C, (b) PAR/Graphene/GCE in 0.1 M PBS. Highlights: ► The sensor exhibited well-separated peaks and low detection limit. ► The sensor possesses high sensitivity and wide linear range. ► The sensor was used for simultaneous detection of G, A, T and C successfully. ► The sensor was applied in a fish sperm DNA sample with satisfactory results. ► The proposed sensor has good stability and reproducibility. - Abstract: In this work, a poly(alizarin red)/Graphene composite film modified glassy carbon electrode (PAR/Graphene/GCE) was prepared for simultaneous determination of four DNA bases (guanine, adenine, thymine and cytosine) without any pretreatment. The morphology and interface property of PAR/Graphene films were examined by scanning electron microscopy and electrochemical impedance spectroscopy. The PAR/Graphene/GCE exhibited excellent electrocatalytic activity toward purine (guanine and adenine) and pyrimidine (thymine and cytosine) in 0.1 M phosphate buffer solution (pH 7.4). Under optimum conditions, differential pulse voltammetry was used to detect the oxidation of purine and pyrimidine. The results showed that PAR/Graphene/GCE exhibited well-separated peaks, low detection limit, high sensitivity and wide linear range for simultaneous detection of purine and pyrimidine. The proposed sensor also has good stability and reproducibility. Furthermore, the modified electrode was applied for the detection of DNA bases in a fish sperm DNA sample with satisfactory results.

The Potato Nucleotide-binding Leucine-rich Repeat (NLR) Immune Receptor Rx1 Is a Pathogen-dependent DNA-deforming Protein.

Science.gov (United States)

Fenyk, Stepan; Townsend, Philip D; Dixon, Christopher H; Spies, Gerhard B; de San Eustaquio Campillo, Alba; Slootweg, Erik J; Westerhof, Lotte B; Gawehns, Fleur K K; Knight, Marc R; Sharples, Gary J; Goverse, Aska; Pålsson, Lars-Olof; Takken, Frank L W; Cann, Martin J

2015-10-09

Plant nucleotide-binding leucine-rich repeat (NLR) proteins enable cells to respond to pathogen attack. Several NLRs act in the nucleus; however, conserved nuclear targets that support their role in immunity are unknown. Previously, we noted a structural homology between the nucleotide-binding domain of NLRs and DNA replication origin-binding Cdc6/Orc1 proteins. Here we show that the NB-ARC (nucleotide-binding, Apaf-1, R-proteins, and CED-4) domain of the Rx1 NLR of potato binds nucleic acids. Rx1 induces ATP-dependent bending and melting of DNA in vitro, dependent upon a functional P-loop. In situ full-length Rx1 binds nuclear DNA following activation by its cognate pathogen-derived effector protein, the coat protein of potato virus X. In line with its obligatory nucleocytoplasmic distribution, DNA binding was only observed when Rx1 was allowed to freely translocate between both compartments and was activated in the cytoplasm. Immune activation induced by an unrelated NLR-effector pair did not trigger an Rx1-DNA interaction. DNA binding is therefore not merely a consequence of immune activation. These data establish a role for DNA distortion in Rx1 immune signaling and define DNA as a molecular target of an activated NLR. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Helicase and Polymerase Move Together Close to the Fork Junction and Copy DNA in One-Nucleotide Steps

Directory of Open Access Journals (Sweden)

Manjula Pandey

2014-03-01

Full Text Available By simultaneously measuring DNA synthesis and dNTP hydrolysis, we show that T7 DNA polymerase and T7 gp4 helicase move in sync during leading-strand synthesis, taking one-nucleotide steps and hydrolyzing one dNTP per base-pair unwound/copied. The cooperative catalysis enables the helicase and polymerase to move at a uniformly fast rate without guanine:cytosine (GC dependency or idling with futile NTP hydrolysis. We show that the helicase and polymerase are located close to the replication fork junction. This architecture enables the polymerase to use its strand-displacement synthesis to increase the unwinding rate, whereas the helicase aids this process by translocating along single-stranded DNA and trapping the unwound bases. Thus, in contrast to the helicase-only unwinding model, our results suggest a model in which the helicase and polymerase are moving in one-nucleotide steps, DNA synthesis drives fork unwinding, and a role of the helicase is to trap the unwound bases and prevent DNA reannealing.

Technical reproducibility of single-nucleotide and size-based DNA biomarker assessment using DNA extracted from formalin-fixed, paraffin-embedded tissues.

Science.gov (United States)

Zhang, Shenli; Tan, Iain B; Sapari, Nur S; Grabsch, Heike I; Okines, Alicia; Smyth, Elizabeth C; Aoyama, Toru; Hewitt, Lindsay C; Inam, Imran; Bottomley, Dan; Nankivell, Matthew; Stenning, Sally P; Cunningham, David; Wotherspoon, Andrew; Tsuburaya, Akira; Yoshikawa, Takaki; Soong, Richie; Tan, Patrick

2015-05-01

DNA extracted from formalin-fixed, paraffin-embedded (FFPE) tissues has been used in the past to analyze genetic polymorphisms. We evaluated the technical reproducibility of different types of assays for gene polymorphisms using DNA extracted from FFPE material. By using the MassARRAY iPLEX system, we investigated polymorphisms in DPYD (rs1801159 and rs3918290), UMPS (rs1801019), ERCC1 (rs11615), ERCC1 (rs3212986), and ERCC2 (rs13181) in 56 FFPE DNA samples. By using PCR, followed by size-based gel electrophoresis, we also examined TYMS 5' untranslated region 2R/3R repeats and GSTT1 deletions in 50 FFPE DNA samples and 34 DNAs extracted from fresh-frozen tissues and cell lines. Each polymorphism was analyzed by two independent runs. We found that iPLEX biomarker assays measuring single-nucleotide polymorphisms provided consistent concordant results. However, by using FFPE DNA, size-based PCR biomarkers (GSTT1 and TYMS 5' untranslated region) were discrepant in 32.7% (16/49, with exact 95% CI, 19.9%-47.5%; exact binomial confidence limit test) and 4.2% (2/48, with exact 95% CI, 0.5%-14.3%) of cases, respectively, whereas no discrepancies were observed using intact genomic DNA. Our findings suggest that DNA from FFPE material can be used to reliably test single-nucleotide polymorphisms. However, results based on size-based PCR biomarkers, and particularly GSTT1 deletions, using FFPE DNA need to be interpreted with caution. Independent repeated assays should be performed on all cases to assess potential discrepancies. Copyright © 2015 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

Analysis of multiple single nucleotide polymorphisms (SNP) on DNA traces from plasma and dried blood samples

NARCIS (Netherlands)

Catsburg, Arnold; van der Zwet, Wil C.; Morre, Servaas A.; Ouburg, Sander; Vandenbroucke-Grauls, Christina M. J. E.; Savelkoul, Paul H. M.

2007-01-01

Reliable analysis of single nucleotide polymorphisms (SNPs) in DNA derived from samples containing low numbers of cells or from suboptimal sources can be difficult. A new procedure to characterize multiple SNPs in traces of DNA from plasma and old dried blood samples was developed. Six SNPs in the

DNA mutation motifs in the genes associated with inherited diseases.

Directory of Open Access Journals (Sweden)

Michal Růžička

Full Text Available Mutations in human genes can be responsible for inherited genetic disorders and cancer. Mutations can arise due to environmental factors or spontaneously. It has been shown that certain DNA sequences are more prone to mutate. These sites are termed hotspots and exhibit a higher mutation frequency than expected by chance. In contrast, DNA sequences with lower mutation frequencies than expected by chance are termed coldspots. Mutation hotspots are usually derived from a mutation spectrum, which reflects particular population where an effect of a common ancestor plays a role. To detect coldspots/hotspots unaffected by population bias, we analysed the presence of germline mutations obtained from HGMD database in the 5-nucleotide segments repeatedly occurring in genes associated with common inherited disorders, in particular, the PAH, LDLR, CFTR, F8, and F9 genes. Statistically significant sequences (mutational motifs rarely associated with mutations (coldspots and frequently associated with mutations (hotspots exhibited characteristic sequence patterns, e.g. coldspots contained purine tract while hotspots showed alternating purine-pyrimidine bases, often with the presence of CpG dinucleotide. Using molecular dynamics simulations and free energy calculations, we analysed the global bending properties of two selected coldspots and two hotspots with a G/T mismatch. We observed that the coldspots were inherently more flexible than the hotspots. We assume that this property might be critical for effective mismatch repair as DNA with a mutation recognized by MutSα protein is noticeably bent.

Genotoxicity of formaldehyde: Molecular basis of DNA damage and mutation

Directory of Open Access Journals (Sweden)

Masanobu eKawanishi

2014-09-01

Full Text Available Formaldehyde is commonly used in the chemical industry and is present in the environment, such as vehicle emissions, some building materials, food and tobacco smoke. It also occurs as a natural product in most organisms, the sources of which include a number of metabolic processes. It causes various acute and chronic adverse effects in humans if they inhale its fumes. Among the chronic effects on human health, we summarize data on genotoxicity and carcinogenicity in this review, and we particularly focus on the molecular mechanisms involved in the formaldehyde mutagenesis. Formaldehyde mainly induces N-hydroxymethyl mono-adducts on guanine, adenine and cytosine, and N-methylene crosslinks between adjacent purines in DNA. These crosslinks are types of DNA damage potentially fatal for cell survival if they are not removed by the nucleotide excision repair pathway. In the previous studies, we showed evidence that formaldehyde causes intra-strand crosslinks between purines in DNA using a unique method (Matsuda et al. Nucleic Acids Res. 26, 1769-1774,1998. Using shuttle vector plasmids, we also showed that formaldehyde as well as acetaldehyde induces tandem base substitutions, mainly at 5’-GG and 5’-GA sequences, which would arise from the intra-strand crosslinks. These mutation features are different from those of other aldehydes such as crotonaldehyde, acrolein, glyoxal and methylglyoxal. These findings provide molecular clues to improve our understanding of the genotoxicity and carcinogenicity of formaldehyde.

Identification of sugarcane genes involved in the purine synthesis pathway

Directory of Open Access Journals (Sweden)

Mario A. Jancso

2001-12-01

Full Text Available Nucleotide synthesis is of central importance to all cells. In most organisms, the purine nucleotides are synthesized de novo from non-nucleotide precursors such as amino acids, ammonia and carbon dioxide. An understanding of the enzymes involved in sugarcane purine synthesis opens the possibility of using these enzymes as targets for chemicals which may be effective in combating phytopathogen. Such an approach has already been applied to several parasites and types of cancer. The strategy described in this paper was applied to identify sugarcane clusters for each step of the de novo purine synthesis pathway. Representative sequences of this pathway were chosen from the National Center for Biotechnology Information (NCBI database and used to search the translated sugarcane expressed sequence tag (SUCEST database using the available basic local alignment search tool (BLAST facility. Retrieved clusters were further tested for the statistical significance of the alignment by an implementation (PRSS3 of the Monte Carlo shuffling algorithm calibrated using known protein sequences of divergent taxa along the phylogenetic tree. The sequences were compared to each other and to the sugarcane clusters selected using BLAST analysis, with the resulting table of p-values indicating the degree of divergence of each enzyme within different taxa and in relation to the sugarcane clusters. The results obtained by this strategy allowed us to identify the sugarcane proteins participating in the purine synthesis pathway.A via de síntese de purino nucleotídeos é considerada uma via de central importância para todas as células. Na maioria dos organismos, os purino nucleotídeos são sintetizados ''de novo'' a partir de precursores não-nucleotídicos como amino ácidos, amônia e dióxido de carbono. O conhecimento das enzimas envolvidas na via de síntese de purinas da cana-de-açúcar vai abrir a possibilidade do uso dessas enzimas como alvos no desenho

Formation of (DNA)2-LNA triplet with recombinant base recognition: A quantum mechanical study

Science.gov (United States)

Mall, Vijaya Shri; Tiwari, Rakesh Kumar

2018-05-01

The formation of DNA triple helix offers the verity of new possibilities in molecular biology. However its applications are limited to purine and pyrimidine rich sequences recognized by forming Hoogsteen/Reverse Hoogsteen triplets in major groove sites of DNA duplex. To overcome this drawback modification in bases backbone and glucose of nucleotide unit of DNA have been proposed so that the third strand base recognized by both the bases of DNA duplex by forming Recombinant type(R-type) of bonding in mixed sequences. Here we performed Quanrum Mechanical (Hartree-Fock and DFT) methodology on natural DNA and Locked Nucleic Acids(LNA) triplets using 6-31G and some other new advance basis sets. Study suggests energetically stable conformation has been observed for recombinant triplets in order of G-C*G > A-T*A > G-C*C > T-A*T for both type of triplets. Interestingly LNA leads to more stable conformation in all set of triplets, clearly suggests an important biological tool to overcome above mentioned drawbacks.

Metabolic Reprogramming During Purine Stress in the Protozoan Pathogen Leishmania donovani

Energy Technology Data Exchange (ETDEWEB)

Martin, Jessica L.; Yates, Phillip A.; Soysa, Radika; Alfaro, Joshua F.; Yang, Feng; Burnum-Johnson, Kristin E.; Petyuk, Vladislav A.; Weitz, Karl K.; Camp, David G.; Smith, Richard D.; Wilmarth, Phillip A.; David, Larry L.; Ramasamy, Gowthaman; Myler, Peter J.; Carter, Nicola S.

2014-02-27

The ability of Leishmania to survive in their insect or mammalian host is dependent upon an ability to sense and adapt to changes in the microenvironment. However, little is known about the molecular mechanisms underlying the parasite response to environmental changes, such as nutrient availability. To elucidate nutrient stress response pathways in Leishmania donovani, we have used purine starvation as the paradigm. The salvage of purines from the host milieu is obligatory for parasite replication; nevertheless, purine-starved parasites can persist in culture without supplementary purine for over 3 months, indicating that the response to purine starvation is robust and engenders parasite survival under conditions of extreme scarcity. To understand metabolic reprogramming during purine starvation we have employed global approaches. Whole proteome comparisons between purine-starved and purine-replete parasites over a 6-48 h span have revealed a temporal and coordinated response to purine starvation. Purine transporters and enzymes involved in acquisition at the cell surface are upregulated within a few hours of purine removal from the media, while other key purine salvage components are upregulated later in the time-course and more modestly. After 48 h, the proteome of purine-starved parasites is extensively remodeled and adaptations to purine stress appear tailored to deal with both purine deprivation and general stress. To probe the molecular mechanisms affecting proteome remodeling in response to purine starvation, comparative RNA-seq analyses, qRT-PCR, and luciferase reporter assays were performed on purine-starved versus purine-replete parasites. While the regulation of a minority of proteins tracked with changes at the mRNA level, for many regulated proteins it appears that proteome remodeling during purine stress occurs primarily via translational and/or post-translational mechanisms.

An ameliorative protocol for the quantification of purine 5',8-cyclo-2'-deoxynucleosides in oxidized DNA

Science.gov (United States)

Terzidis, Michael; Chatgilialoglu, Chryssostomos

2015-07-01

5',8-Cyclo-2'-deoxyadenosine (cdA) and 5',8-cyclo-2'-deoxyguanosine (cdG) are lesions resulting from hydroxyl radical (HO•) attack on the 5'H of the nucleoside sugar moiety and exist in both 5'R and 5'S diastereomeric forms. Increased levels of cdA and cdG are linked to Nucleotide Excision Repair mechanism deficiency and mutagenesis. Discrepancies in the damage measurements reported over recent years indicated the weakness of the actual protocols, in particular for ensuring the quantitative release of these lesions from the DNA sample and the appropriate method for their analysis. Herein we report the detailed revision leading to a cost-effective and efficient protocol for the DNA damage measurement, consisting of the nuclease benzonase and nuclease P1 enzymatic combination for DNA digestion followed by liquid chromatography isotope dilution tandem mass spectrometry analysis.

Poly(alizarin red)/Graphene modified glassy carbon electrode for simultaneous determination of purine and pyrimidine

Energy Technology Data Exchange (ETDEWEB)

Ba Xi; Luo Liqiang [Department of Chemistry, Shanghai University, Shanghai 200444 (China); Ding Yaping, E-mail: wdingyp@sina.com [Department of Chemistry, Shanghai University, Shanghai 200444 (China); Zhang Zhen [Department of Chemistry, Shanghai University, Shanghai 200444 (China); Chu Yuliang [Instrumental Analysis and Research Center, Shanghai University, Shanghai 200444 (China); Wang Bijun; Ouyang Xiaoqian [Department of Chemistry, Shanghai University, Shanghai 200444 (China)

2012-11-08

Graphical abstract: DPVs of PAR/Graphene/GCE (a) and the bare GCE (c) in 0.1 M PBS containing 50.0 {mu}M G, 50.0 {mu}M A, 100.0 {mu}M T and 100.0 {mu}M C, (b) PAR/Graphene/GCE in 0.1 M PBS. Highlights: Black-Right-Pointing-Pointer The sensor exhibited well-separated peaks and low detection limit. Black-Right-Pointing-Pointer The sensor possesses high sensitivity and wide linear range. Black-Right-Pointing-Pointer The sensor was used for simultaneous detection of G, A, T and C successfully. Black-Right-Pointing-Pointer The sensor was applied in a fish sperm DNA sample with satisfactory results. Black-Right-Pointing-Pointer The proposed sensor has good stability and reproducibility. - Abstract: In this work, a poly(alizarin red)/Graphene composite film modified glassy carbon electrode (PAR/Graphene/GCE) was prepared for simultaneous determination of four DNA bases (guanine, adenine, thymine and cytosine) without any pretreatment. The morphology and interface property of PAR/Graphene films were examined by scanning electron microscopy and electrochemical impedance spectroscopy. The PAR/Graphene/GCE exhibited excellent electrocatalytic activity toward purine (guanine and adenine) and pyrimidine (thymine and cytosine) in 0.1 M phosphate buffer solution (pH 7.4). Under optimum conditions, differential pulse voltammetry was used to detect the oxidation of purine and pyrimidine. The results showed that PAR/Graphene/GCE exhibited well-separated peaks, low detection limit, high sensitivity and wide linear range for simultaneous detection of purine and pyrimidine. The proposed sensor also has good stability and reproducibility. Furthermore, the modified electrode was applied for the detection of DNA bases in a fish sperm DNA sample with satisfactory results.

Synthesis and spectroscopy of clay intercalated Cu(II) bio-monomer complexes: coordination of Cu(II) with purines and nucleotides

NARCIS (Netherlands)

Weckhuysen, B.M.; Leeman, H.; Schoonheydt, R.A.

1999-01-01

The spectroscopic properties of Cu(bio-monomer)nm+ complexes [BM=bio-monomer (purine, adenine, guanine, hypoxanthine, 5-ADP and 5-GMP)] in saponite clays have been investigated by diffuse reflectance spectroscopy (DRS) in the UV-Vis-NIR region and electron paramagnetic resonance (EPR) at X-band.

An Engineered Kinetic Amplification Mechanism for Single Nucleotide Variant Discrimination by DNA Hybridization Probes.

Science.gov (United States)

Chen, Sherry Xi; Seelig, Georg

2016-04-20

Even a single-nucleotide difference between the sequences of two otherwise identical biological nucleic acids can have dramatic functional consequences. Here, we use model-guided reaction pathway engineering to quantitatively improve the performance of selective hybridization probes in recognizing single nucleotide variants (SNVs). Specifically, we build a detection system that combines discrimination by competition with DNA strand displacement-based catalytic amplification. We show, both mathematically and experimentally, that the single nucleotide selectivity of such a system in binding to single-stranded DNA and RNA is quadratically better than discrimination due to competitive hybridization alone. As an additional benefit the integrated circuit inherits the property of amplification and provides at least 10-fold better sensitivity than standard hybridization probes. Moreover, we demonstrate how the detection mechanism can be tuned such that the detection reaction is agnostic to the position of the SNV within the target sequence. in contrast, prior strand displacement-based probes designed for kinetic discrimination are highly sensitive to position effects. We apply our system to reliably discriminate between different members of the let-7 microRNA family that differ in only a single base position. Our results demonstrate the power of systematic reaction network design to quantitatively improve biotechnology.

The Formation of Nucleobases from the Ultraviolet Photoirradiation of Purine in Simple Astrophysical Ice Analogues.

Science.gov (United States)

Materese, Christopher K; Nuevo, Michel; Sandford, Scott A

2017-08-01

Nucleobases are the informational subunits of RNA and DNA and are essential to all known forms of life. The nucleobases can be divided into two groups of molecules: the pyrimidine-based compounds that include uracil, cytosine, and thymine, and the purine-based compounds that include adenine and guanine. Previous work in our laboratory has demonstrated that uracil, cytosine, thymine, and other nonbiological, less common nucleobases can form abiotically from the UV photoirradiation of pyrimidine in simple astrophysical ice analogues containing combinations of H 2 O, NH 3 , and CH 4 . In this work, we focused on the UV photoirradiation of purine mixed with combinations of H 2 O and NH 3 ices to determine whether or not the full complement of biological nucleobases can be formed abiotically under astrophysical conditions. Room-temperature analyses of the resulting photoproducts resulted in the detection of adenine, guanine, and numerous other functionalized purine derivatives. Key Words: Pyrimidine-Nucleobases-Interstellar; Ices-Cometary; Ices-Molecular processes-Prebiotic chemistry. Astrobiology 17, 761-770.

Nucleotide pools dictate the identity and frequency of ribonucleotide incorporation in mitochondrial DNA.

Directory of Open Access Journals (Sweden)

Anna-Karin Berglund

2017-02-01

Full Text Available Previous work has demonstrated the presence of ribonucleotides in human mitochondrial DNA (mtDNA and in the present study we use a genome-wide approach to precisely map the location of these. We find that ribonucleotides are distributed evenly between the heavy- and light-strand of mtDNA. The relative levels of incorporated ribonucleotides reflect that DNA polymerase γ discriminates the four ribonucleotides differentially during DNA synthesis. The observed pattern is also dependent on the mitochondrial deoxyribonucleotide (dNTP pools and disease-causing mutations that change these pools alter both the absolute and relative levels of incorporated ribonucleotides. Our analyses strongly suggest that DNA polymerase γ-dependent incorporation is the main source of ribonucleotides in mtDNA and argues against the existence of a mitochondrial ribonucleotide excision repair pathway in human cells. Furthermore, we clearly demonstrate that when dNTP pools are limiting, ribonucleotides serve as a source of building blocks to maintain DNA replication. Increased levels of embedded ribonucleotides in patient cells with disturbed nucleotide pools may contribute to a pathogenic mechanism that affects mtDNA stability and impair new rounds of mtDNA replication.

Nucleotide pools dictate the identity and frequency of ribonucleotide incorporation in mitochondrial DNA.

Science.gov (United States)

Berglund, Anna-Karin; Navarrete, Clara; Engqvist, Martin K M; Hoberg, Emily; Szilagyi, Zsolt; Taylor, Robert W; Gustafsson, Claes M; Falkenberg, Maria; Clausen, Anders R

2017-02-01

Previous work has demonstrated the presence of ribonucleotides in human mitochondrial DNA (mtDNA) and in the present study we use a genome-wide approach to precisely map the location of these. We find that ribonucleotides are distributed evenly between the heavy- and light-strand of mtDNA. The relative levels of incorporated ribonucleotides reflect that DNA polymerase γ discriminates the four ribonucleotides differentially during DNA synthesis. The observed pattern is also dependent on the mitochondrial deoxyribonucleotide (dNTP) pools and disease-causing mutations that change these pools alter both the absolute and relative levels of incorporated ribonucleotides. Our analyses strongly suggest that DNA polymerase γ-dependent incorporation is the main source of ribonucleotides in mtDNA and argues against the existence of a mitochondrial ribonucleotide excision repair pathway in human cells. Furthermore, we clearly demonstrate that when dNTP pools are limiting, ribonucleotides serve as a source of building blocks to maintain DNA replication. Increased levels of embedded ribonucleotides in patient cells with disturbed nucleotide pools may contribute to a pathogenic mechanism that affects mtDNA stability and impair new rounds of mtDNA replication.

NDR1 modulates the UV-induced DNA-damage checkpoint and nucleotide excision repair

Energy Technology Data Exchange (ETDEWEB)

Park, Jeong-Min; Choi, Ji Ye [Department of Biological Science, Dong-A University, Busan (Korea, Republic of); Yi, Joo Mi [Research Center, Dongnam Institute of Radiological & Medical Sciences, Busan (Korea, Republic of); Chung, Jin Woong; Leem, Sun-Hee; Koh, Sang Seok [Department of Biological Science, Dong-A University, Busan (Korea, Republic of); Kang, Tae-Hong, E-mail: thkang@dau.ac.kr [Department of Biological Science, Dong-A University, Busan (Korea, Republic of)

2015-06-05

Nucleotide excision repair (NER) is the sole mechanism of UV-induced DNA lesion repair in mammals. A single round of NER requires multiple components including seven core NER factors, xeroderma pigmentosum A–G (XPA–XPG), and many auxiliary effector proteins including ATR serine/threonine kinase. The XPA protein helps to verify DNA damage and thus plays a rate-limiting role in NER. Hence, the regulation of XPA is important for the entire NER kinetic. We found that NDR1, a novel XPA-interacting protein, modulates NER by modulating the UV-induced DNA-damage checkpoint. In quiescent cells, NDR1 localized mainly in the cytoplasm. After UV irradiation, NDR1 accumulated in the nucleus. The siRNA knockdown of NDR1 delayed the repair of UV-induced cyclobutane pyrimidine dimers in both normal cells and cancer cells. It did not, however, alter the expression levels or the chromatin association levels of the core NER factors following UV irradiation. Instead, the NDR1-depleted cells displayed reduced activity of ATR for some set of its substrates including CHK1 and p53, suggesting that NDR1 modulates NER indirectly via the ATR pathway. - Highlights: • NDR1 is a novel XPA-interacting protein. • NDR1 accumulates in the nucleus in response to UV irradiation. • NDR1 modulates NER (nucleotide excision repair) by modulating the UV-induced DNA-damage checkpoint response.

Synthesis and NMR of {sup 15}N-labeled DNA fragments

Energy Technology Data Exchange (ETDEWEB)

Jones, R.A. [Rutgers, The State Univ. of New Jersey, Piscataway, NJ (United States)

1994-12-01

DNA fragments labeled with {sup 15}N at the ring nitrogens and at the exocyclic amino groups can be used to obtain novel insight into interactions such as base pairing, hydration, drug binding, and protein binding. A number of synthetic routes to {sup 15}N-labeled pyrimidine nucleosides, purines, and purine nucleosides have been reported. Moreover, many of these labeled bases or monomers have been incorporated into nucleic acids, either by chemical synthesis or by biosynthetic procedures. The focus of this chapter will be on the preparation of {sup 15}N-labeled purine 2{prime}-deoxynucleosides, their incorporation into DNA fragments by chemical synthesis, and the results of NMR studies using these labeled DNA fragments.

The Stringent Response Induced by Phosphate Limitation Promotes Purine Salvage in Agrobacterium fabrum.

Science.gov (United States)

Sivapragasam, Smitha; Deochand, Dinesh K; Meariman, Jacob K; Grove, Anne

2017-10-31

Agrobacterium fabrum induces tumor growth in susceptible plant species. The upregulation of virulence genes that occurs when the bacterium senses plant-derived compounds is enhanced by acidic pH and limiting inorganic phosphate. Nutrient starvation may also trigger the stringent response, and purine salvage is among the pathways expected to be favored under such conditions. We show here that phosphate limitation induces the stringent response, as evidenced by production of (p)ppGpp, and that the xdhCSML operon encoding the purine salvage enzyme xanthine dehydrogenase is upregulated ∼15-fold. The xdhCSML operon is under control of the TetR family transcription factor XdhR; direct binding of ppGpp to XdhR attenuates DNA binding, and the enhanced xdhCSML expression correlates with increased cellular levels of (p)ppGpp. Xanthine dehydrogenase may also divert purines away from salvage pathways to form urate, the ligand for the transcription factor PecS, which in the plant pathogen Dickeya dadantii is a key regulator of virulence gene expression. However, urate levels remain low under conditions that produce increased levels of xdhCSML expression, and neither acidic pH nor limiting phosphate results in induction of genes under control of PecS. Instead, expression of such genes is induced only by externally supplemented urate. Taken together, our data indicate that purine salvage is favored during the stringent response induced by phosphate starvation, suggesting that control of this pathway may constitute a novel approach to modulating virulence. Because bacterial purine catabolism appears to be unaffected, as evidenced by the absence of urate accumulation, we further propose that the PecS regulon is induced by only host-derived urate.

DNA detection and single nucleotide mutation identification using SERS for molecular diagnostics and global health

Science.gov (United States)

Ngo, Hoan T.; Gandra, Naveen; Fales, Andrew M.; Taylor, Steve M.; Vo-Dinh, Tuan

2017-02-01

Nucleic acid-based molecular diagnostics at the point-of-care (POC) and in resource-limited settings is still a challenge. We present a sensitive yet simple DNA detection method with single nucleotide polymorphism (SNP) identification capability. The detection scheme involves sandwich hybridization of magnetic beads conjugated with capture probes, target sequences, and ultrabright surface-enhanced Raman Scattering (SERS) nanorattles conjugated with reporter probes. Upon hybridization, the sandwich probes are concentrated at the detection focus controlled by a magnetic system for SERS measurements. The ultrabright SERS nanorattles, consisting of a core and a shell with resonance Raman reporters loaded in the gap space between the core and the shell, serve as SERS tags for ultrasensitive signal detection. Specific DNA sequences of the malaria parasite Plasmodium falciparum and dengue virus 1 (DENV1) were used as the model marker system. Detection limit of approximately 100 attomoles was achieved. Single nucleotide polymorphism (SNP) discrimination of wild type malaria DNA and mutant malaria DNA, which confers resistance to artemisinin drugs, was also demonstrated. The results demonstrate the molecular diagnostic potential of the nanorattle-based method to both detect and genotype infectious pathogens. The method's simplicity makes it a suitable candidate for molecular diagnosis at the POC and in resource-limited settings.

DNA-binding polarity of human replication protein A positions nucleases in nucleotide excision repair.

Science.gov (United States)

de Laat, W L; Appeldoorn, E; Sugasawa, K; Weterings, E; Jaspers, N G; Hoeijmakers, J H

1998-08-15

The human single-stranded DNA-binding replication A protein (RPA) is involved in various DNA-processing events. By comparing the affinity of hRPA for artificial DNA hairpin structures with 3'- or 5'-protruding single-stranded arms, we found that hRPA binds ssDNA with a defined polarity; a strong ssDNA interaction domain of hRPA is positioned at the 5' side of its binding region, a weak ssDNA-binding domain resides at the 3' side. Polarity appears crucial for positioning of the excision repair nucleases XPG and ERCC1-XPF on the DNA. With the 3'-oriented side of hRPA facing a duplex ssDNA junction, hRPA interacts with and stimulates ERCC1-XPF, whereas the 5'-oriented side of hRPA at a DNA junction allows stable binding of XPG to hRPA. Our data pinpoint hRPA to the undamaged strand during nucleotide excision repair. Polarity of hRPA on ssDNA is likely to contribute to the directionality of other hRPA-dependent processes as well.

pH dependent interaction of biofunctionalized CdS nanoparticles with nucleobases and nucleotides: A fluorimetric study

International Nuclear Information System (INIS)

Chatterjee, Anindita; Priyam, Amiya; Bhattacharya, Subhash C.; Saha, Abhijit

2007-01-01

The interaction of DNA bases and corresponding nucleotides with CdS nanoparticles (NPs), biofunctionalized by cysteine, has been investigated by absorption and fluorescence spectroscopy. Unique enhancement effect of adenine, in contrast to other nucleobases, on the luminescence of cysteine capped CdS (cys-CdS) NPs at both pH 7.5 and 10.5 was found, the extent of enhancement being much higher at pH 10.5. At the latter pH, the difference optical absorption spectra show development of new peak at 278 nm with corresponding decrease in the absorption of adenine at 260 nm, which is attributed to binding of adenine anion to the CdS surface through N7 of the purine ring. Appearance of a new band at 478 cm -1 and concomitant shift in the C 8 -N 7 vibrations to 1610 cm -1 in the FTIR spectra of cys-CdS NPs with adenine also suggest Cd-N7 binding on the particle surface. Amongst various nucleotides, ATP exhibited maximum luminescence enhancement on CdS NPs for a given change in concentration in the micro-molar range at physiological pH. A quantitative correlation between ATP concentration and PL enhancement of CdS NPs has been established, a step which in future might assist in developing new protocols for fluorescence sensing of adenine nucleotides under certain pathological conditions

The regulation of aortic endothelial cells by purines and pyrimidines involves co-existing P2y-purinoceptors and nucleotide receptors linked to phospholipase C.

OpenAIRE

Wilkinson, G. F.; Purkiss, J. R.; Boarder, M. R.

1993-01-01

1. We have examined the phospholipase C responses in bovine aortic endothelial cells to purines (ATP, ADP and analogues) and the pyrimidine, uridine triphosphate (UTP). 2. The cells responded to purines in a manner consistent with the presence of P2y purinoceptors; both 2-methylthioadenosine 5'-triphosphate (2MeSATP) and adenosine 5'-0-(2-thiodiphosphate) (ADP beta S) were potent agonists (EC50 0.41 microM and 0.85 microM respectively) while beta, gamma-methylene ATP at 300 microM was not. 3....

A nucleotide-analogue-induced gain of function corrects the error-prone nature of human DNA polymerase iota.

Science.gov (United States)

Ketkar, Amit; Zafar, Maroof K; Banerjee, Surajit; Marquez, Victor E; Egli, Martin; Eoff, Robert L

2012-06-27

Y-family DNA polymerases participate in replication stress and DNA damage tolerance mechanisms. The properties that allow these enzymes to copy past bulky adducts or distorted template DNA can result in a greater propensity for them to make mistakes. Of the four human Y-family members, human DNA polymerase iota (hpol ι) is the most error-prone. In the current study, we elucidate the molecular basis for improving the fidelity of hpol ι through use of the fixed-conformation nucleotide North-methanocarba-2'-deoxyadenosine triphosphate (N-MC-dATP). Three crystal structures were solved of hpol ι in complex with DNA containing a template 2'-deoxythymidine (dT) paired with an incoming dNTP or modified nucleotide triphosphate. The ternary complex of hpol ι inserting N-MC-dATP opposite dT reveals that the adenine ring is stabilized in the anti orientation about the pseudo-glycosyl torsion angle, which mimics precisely the mutagenic arrangement of dGTP:dT normally preferred by hpol ι. The stabilized anti conformation occurs without notable contacts from the protein but likely results from constraints imposed by the bicyclo[3.1.0]hexane scaffold of the modified nucleotide. Unmodified dATP and South-MC-dATP each adopt syn glycosyl orientations to form Hoogsteen base pairs with dT. The Hoogsteen orientation exhibits weaker base-stacking interactions and is less catalytically favorable than anti N-MC-dATP. Thus, N-MC-dATP corrects the error-prone nature of hpol ι by preventing the Hoogsteen base-pairing mode normally observed for hpol ι-catalyzed insertion of dATP opposite dT. These results provide a previously unrecognized means of altering the efficiency and the fidelity of a human translesion DNA polymerase.

A nucleotide analogue induced gain of function corrects the error-prone nature of human DNA polymerase iota

Science.gov (United States)

Ketkar, Amit; Zafar, Maroof K.; Banerjee, Surajit; Marquez, Victor E.; Egli, Martin; Eoff, Robert L

2012-01-01

Y-family DNA polymerases participate in replication stress and DNA damage tolerance mechanisms. The properties that allow these enzymes to copy past bulky adducts or distorted template DNA can result in a greater propensity for them to make mistakes. Of the four human Y-family members, human DNA polymerase iota (hpol ι) is the most error-prone. In the current study, we elucidate the molecular basis for improving the fidelity of hpol ι through use of the fixed-conformation nucleotide North-methanocarba-2′-deoxyadenosine triphosphate (N-MC-dATP). Three crystal structures were solved of hpol ι in complex with DNA containing a template 2′-deoxythymidine (dT) paired with an incoming dNTP or modified nucleotide triphosphate. The ternary complex of hpol ι inserting N-MC-dATP opposite dT reveals that the adenine ring is stabilized in the anti orientation about the pseudo-glycosyl torsion angle (χ), which mimics precisely the mutagenic arrangement of dGTP:dT normally preferred by hpol ι. The stabilized anti conformation occurs without notable contacts from the protein but likely results from constraints imposed by the bicyclo[3.1.0]hexane scaffold of the modified nucleotide. Unmodified dATP and South-MC-dATP each adopt syn glycosyl orientations to form Hoogsteen base pairs with dT. The Hoogsteen orientation exhibits weaker base stacking interactions and is less catalytically favorable than anti N-MC-dATP. Thus, N-MC-dATP corrects the error-prone nature of hpol ι by preventing the Hoogsteen base-pairing mode normally observed for hpol ι-catalyzed insertion of dATP opposite dT. These results provide a previously unrecognized means of altering the efficiency and the fidelity of a human translesion DNA polymerase. PMID:22632140

Modulation of mutagenesis in eukaryotes by DNA replication fork dynamics and quality of nucleotide pools

Science.gov (United States)

Waisertreiger, Irina S.-R.; Liston, Victoria G.; Menezes, Miriam R.; Kim, Hyun-Min; Lobachev, Kirill S.; Stepchenkova, Elena I.; Tahirov, Tahir H.; Rogozin, Igor B.; Pavlov, Youri. I.

2014-01-01

The rate of mutations in eukaryotes depends on a plethora of factors and is not immediately derived from the fidelity of DNA polymerases (Pols). Replication of chromosomes containing the anti-parallel strands of duplex DNA occurs through the copying of leading and lagging strand templates by a trio of Pols α, δ and ε, with the assistance of Pol ζ and Y-family Pols at difficult DNA template structures or sites of DNA damage. The parameters of the synthesis at a given location are dictated by the quality and quantity of nucleotides in the pools, replication fork architecture, transcription status, regulation of Pol switches, and structure of chromatin. The result of these transactions is a subject of survey and editing by DNA repair. PMID:23055184

ssDNA Pairing Accuracy Increases When Abasic Sites Divide Nucleotides into Small Groups.

Directory of Open Access Journals (Sweden)

Alexandra Peacock-Villada

Full Text Available Accurate sequence dependent pairing of single-stranded DNA (ssDNA molecules plays an important role in gene chips, DNA origami, and polymerase chain reactions. In many assays accurate pairing depends on mismatched sequences melting at lower temperatures than matched sequences; however, for sequences longer than ~10 nucleotides, single mismatches and correct matches have melting temperature differences of less than 3°C. We demonstrate that appropriately grouping of 35 bases in ssDNA using abasic sites increases the difference between the melting temperature of correct bases and the melting temperature of mismatched base pairings. Importantly, in the presence of appropriately spaced abasic sites mismatches near one end of a long dsDNA destabilize the annealing at the other end much more effectively than in systems without the abasic sites, suggesting that the dsDNA melts more uniformly in the presence of appropriately spaced abasic sites. In sum, the presence of appropriately spaced abasic sites allows temperature to more accurately discriminate correct base pairings from incorrect ones.

Targeting a Novel Plasmodium falciparum Purine Recycling Pathway with Specific Immucillins

International Nuclear Information System (INIS)

Ting, L; Shi, W; Lewandowicz, A; Singh, V; Mwakingwe, A; Birck, M R; Taylor Ringia, E A; Bench, G; Madrid, D C; Tyler, P C; Evans, G B; Furneaux, R H; Schramm, V L; Kim, K.

2004-01-01

Plasmodium falciparum is unable to synthesize purine bases and relies upon purine salvage and purine recycling to meet its purine needs. We report that purines formed as products of the polyamine pathway are recycled in a novel pathway in which 5'-methylthioinosine is generated by adenosine deaminase. The action of P. falciparum purine nucleoside phosphorylase is a convergent step of purine salvage, converting both 5'-methylthioinosine and inosine to hypoxanthine. We used accelerator mass spectrometry to verify that 5'-methylthioinosine is an active nucleic acid precursor in P. falciparum. Prior studies have shown that inhibitors of purine salvage enzymes kill malaria, but potent malaria-specific inhibitors of these enzymes have not previously been described. 5'-methylthio-Immucillin-H, a transition state analogue inhibitor that is selective for malarial over human purine nucleoside phosphorylase, kills P. falciparum in culture. Immucillins are currently in clinical trials for other indications and may have application as antimalarials

Templated Chemistry for Sequence-Specific Fluorogenic Detection of Duplex DNA

Science.gov (United States)

Li, Hao; Franzini, Raphael M.; Bruner, Christopher; Kool, Eric T.

2015-01-01

We describe the development of templated fluorogenic chemistry for detection of specific sequences of duplex DNA in solution. In this approach, two modified homopyrimidine oligodeoxynucleotide probes are designed to bind by triple helix formation at adjacent positions on a specific purine-rich target sequence of duplex DNA. One fluorescein-labeled probe contains an α-azidoether linker to a fluorescence quencher; the second (trigger) probe carries a triarylphosphine, designed to reduce the azide and cleave the linker. The data showed that at pH 5.6 these probes yielded a strong fluorescence signal within minutes on addition to a complementary homopurine duplex DNA target. The signal increased by a factor of ca. 60, and was completely dependent on the presence of the target DNA. Replacement of cytosine in the probes with pseudoisocytosine allowed the templated chemistry to proceed readily at pH 7. Single nucleotide mismatches in the target oligonucleotide slowed the templated reaction considerably, demonstrating high sequence selectivity. The use of templated fluorogenic chemistry for detection of duplex DNAs has not been previously reported and may allow detection of double stranded DNA, at least for homopurine-homopyrimidine target sites, under native, non-disturbing conditions. PMID:20859985

DNA-thioguanine nucleotide concentration and relapse-free survival during maintenance therapy of childhood acute lymphoblastic leukaemia (NOPHO ALL2008)

DEFF Research Database (Denmark)

Nielsen, Stine Nygaard; Grell, Kathrine; Nersting, Jacob

2017-01-01

BACKGROUND: Adjustment of mercaptopurine and methotrexate maintenance therapy of acute lymphoblastic leukaemia by leucocyte count is confounded by natural variations. Cytotoxicity is primarily mediated by DNA-incorporated thioguanine nucleotides (DNA-TGN). The aim of this study was to establish w...

Structural and kinetic insights into binding and incorporation of L-nucleotide analogs by a Y-family DNA polymerase

OpenAIRE

Gaur, Vineet; Vyas, Rajan; Fowler, Jason D.; Efthimiopoulos, Georgia; Feng, Joy Y.; Suo, Zucai

2014-01-01

Considering that all natural nucleotides (D-dNTPs) and the building blocks (D-dNMPs) of DNA chains possess D-stereochemistry, DNA polymerases and reverse transcriptases (RTs) likely possess strongD-stereoselectivity by preferably binding and incorporating D-dNTPs over unnatural L-dNTPs during DNA synthesis. Surprisingly, a structural basis for the discrimination against L-dNTPs by DNA polymerases or RTs has not been established although L-deoxycytidine analogs (lamivudine and emtricitabine) a...

Synthesis of Hydrazone-Modified Nucleotides and Their Polymerase Incorporation onto DNA for Redox Labeling

Czech Academy of Sciences Publication Activity Database

Raindlová, Veronika; Pohl, Radek; Klepetářová, Blanka; Havran, Luděk; Šimková, Eva; Horáková Brázdilová, Petra; Pivoňková, Hana; Fojta, Miroslav; Hocek, Michal

2012-01-01

Roč. 77, č. 8 (2012), s. 652-662 ISSN 2192-6506 R&D Projects: GA AV ČR(CZ) IAA400040901; GA ČR GBP206/12/G151 Institutional research plan: CEZ:AV0Z40550506; CEZ:AV0Z50040702 Keywords : DNA * oligonucleotides * polymerase * hydrazones * nucleotides Subject RIV: CC - Organic Chemistry

A statistical model for investigating binding probabilities of DNA nucleotide sequences using microarrays.

Science.gov (United States)

Lee, Mei-Ling Ting; Bulyk, Martha L; Whitmore, G A; Church, George M

2002-12-01

There is considerable scientific interest in knowing the probability that a site-specific transcription factor will bind to a given DNA sequence. Microarray methods provide an effective means for assessing the binding affinities of a large number of DNA sequences as demonstrated by Bulyk et al. (2001, Proceedings of the National Academy of Sciences, USA 98, 7158-7163) in their study of the DNA-binding specificities of Zif268 zinc fingers using microarray technology. In a follow-up investigation, Bulyk, Johnson, and Church (2002, Nucleic Acid Research 30, 1255-1261) studied the interdependence of nucleotides on the binding affinities of transcription proteins. Our article is motivated by this pair of studies. We present a general statistical methodology for analyzing microarray intensity measurements reflecting DNA-protein interactions. The log probability of a protein binding to a DNA sequence on an array is modeled using a linear ANOVA model. This model is convenient because it employs familiar statistical concepts and procedures and also because it is effective for investigating the probability structure of the binding mechanism.

UvrD Participation in Nucleotide Excision Repair Is Required for the Recovery of DNA Synthesis following UV-Induced Damage in Escherichia coli

Directory of Open Access Journals (Sweden)

Kelley N. Newton

2012-01-01

Full Text Available UvrD is a DNA helicase that participates in nucleotide excision repair and several replication-associated processes, including methyl-directed mismatch repair and recombination. UvrD is capable of displacing oligonucleotides from synthetic forked DNA structures in vitro and is essential for viability in the absence of Rep, a helicase associated with processing replication forks. These observations have led others to propose that UvrD may promote fork regression and facilitate resetting of the replication fork following arrest. However, the molecular activity of UvrD at replication forks in vivo has not been directly examined. In this study, we characterized the role UvrD has in processing and restoring replication forks following arrest by UV-induced DNA damage. We show that UvrD is required for DNA synthesis to recover. However, in the absence of UvrD, the displacement and partial degradation of the nascent DNA at the arrested fork occur normally. In addition, damage-induced replication intermediates persist and accumulate in uvrD mutants in a manner that is similar to that observed in other nucleotide excision repair mutants. These data indicate that, following arrest by DNA damage, UvrD is not required to catalyze fork regression in vivo and suggest that the failure of uvrD mutants to restore DNA synthesis following UV-induced arrest relates to its role in nucleotide excision repair.

Synthesis of carbon-11-labeled imidazopyridine- and purine-thioacetamide derivatives as new potential PET tracers for imaging of nucleotide pyrophosphatase/phosphodiesterase 1 (NPP1).

Science.gov (United States)

Gao, Mingzhang; Wang, Min; Zheng, Qi-Huang

2016-03-01

The target tracer carbon-11-labeled imidazopyridine- and purine-thioacetamide derivatives, N-(3-[(11)C]methoxy-4-methoxyphenyl)-2-((5-methoxy-3H-imidazo[4,5-b]pyridin-2-yl)thio)acetamide (3-[(11)C]4a) and N-(4-[(11)C]methoxy-3-methoxyphenyl)-2-((5-methoxy-3H-imidazo[4,5-b]pyridin-2-yl)thio)acetamide (4-[(11)C]4a); 2-((6-amino-9H-purin-8-yl)thio)-N-(3-[(11)C]methoxy-4-methoxyphenyl)acetamide (3-[(11)C]8a) and 2-((6-amino-9H-purin-8-yl)thio)-N-(4-[(11)C]methoxy-3-methoxyphenyl)acetamide (4-[(11)C]8a), were prepared by O-[(11)C]methylation of their corresponding precursors with [(11)C]CH3OTf under basic condition (2N NaOH) and isolated by a simplified solid-phase extraction (SPE) method in 50-60% radiochemical yields based on [(11)C]CO2 and decay corrected to end of bombardment (EOB). The overall synthesis time from EOB was 23min, the radiochemical purity was >99%, and the specific activity at end of synthesis (EOS) was 185-555GBq/μmol. Copyright © 2016 Elsevier Ltd. All rights reserved.

Long Term Expression of Drosophila melanogaster Nucleoside Kinase in Thymidine Kinase 2-deficient Mice with No Lethal Effects Caused by Nucleotide Pool Imbalances*

Science.gov (United States)

Krishnan, Shuba; Paredes, João A.; Zhou, Xiaoshan; Kuiper, Raoul V.; Hultenby, Kjell; Curbo, Sophie; Karlsson, Anna

2014-01-01

Mitochondrial DNA depletion caused by thymidine kinase 2 (TK2) deficiency can be compensated by a nucleoside kinase from Drosophila melanogaster (Dm-dNK) in mice. We show that transgene expression of Dm-dNK in Tk2 knock-out (Tk2−/−) mice extended the life span of Tk2−/− mice from 3 weeks to at least 20 months. The Dm-dNK+/−Tk2−/− mice maintained normal mitochondrial DNA levels throughout the observation time. A significant difference in total body weight due to the reduction of subcutaneous and visceral fat in the Dm-dNK+/−Tk2−/− mice was the only visible difference compared with control mice. This indicates an effect on fat metabolism mediated through residual Tk2 deficiency because Dm-dNK expression was low in both liver and fat tissues. Dm-dNK expression led to increased dNTP pools and an increase in the catabolism of purine and pyrimidine nucleotides but these alterations did not apparently affect the mice during the 20 months of observation. In conclusion, Dm-dNK expression in the cell nucleus expanded the total dNTP pools to levels required for efficient mitochondrial DNA synthesis, thereby compensated the Tk2 deficiency, during a normal life span of the mice. The Dm-dNK+/− mouse serves as a model for nucleoside gene or enzyme substitutions, nucleotide imbalances, and dNTP alterations in different tissues. PMID:25296759

Long term expression of Drosophila melanogaster nucleoside kinase in thymidine kinase 2-deficient mice with no lethal effects caused by nucleotide pool imbalances.

Science.gov (United States)

Krishnan, Shuba; Paredes, João A; Zhou, Xiaoshan; Kuiper, Raoul V; Hultenby, Kjell; Curbo, Sophie; Karlsson, Anna

2014-11-21

Mitochondrial DNA depletion caused by thymidine kinase 2 (TK2) deficiency can be compensated by a nucleoside kinase from Drosophila melanogaster (Dm-dNK) in mice. We show that transgene expression of Dm-dNK in Tk2 knock-out (Tk2(-/-)) mice extended the life span of Tk2(-/-) mice from 3 weeks to at least 20 months. The Dm-dNK(+/-)Tk2(-/-) mice maintained normal mitochondrial DNA levels throughout the observation time. A significant difference in total body weight due to the reduction of subcutaneous and visceral fat in the Dm-dNK(+/-)Tk2(-/-) mice was the only visible difference compared with control mice. This indicates an effect on fat metabolism mediated through residual Tk2 deficiency because Dm-dNK expression was low in both liver and fat tissues. Dm-dNK expression led to increased dNTP pools and an increase in the catabolism of purine and pyrimidine nucleotides but these alterations did not apparently affect the mice during the 20 months of observation. In conclusion, Dm-dNK expression in the cell nucleus expanded the total dNTP pools to levels required for efficient mitochondrial DNA synthesis, thereby compensated the Tk2 deficiency, during a normal life span of the mice. The Dm-dNK(+/-) mouse serves as a model for nucleoside gene or enzyme substitutions, nucleotide imbalances, and dNTP alterations in different tissues. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

The effect of DNA repair defects on reproductive performance in nucleotide excision repair (NER) mouse models: an epidemiological approach

NARCIS (Netherlands)

Tsai, P.S.; Nielen, M.; Horst, G.T.J. van der; Colenbrander, B.; Heesterbeek, J.A.P.; Fentener van Vlissingen, J.M.

2005-01-01

In this study, we used an epidemiological approach to analyze an animal database of DNA repair deficient mice on reproductive performance in five Nucleotide Excision Repair (NER) mutant mouse models on a C57BL/6 genetic background, namely CSA, CSB, XPA, XPC [models for the human DNA repair disorders

Effect of seven Indian plant extracts on Fenton reaction-mediated damage to DNA constituents.

Science.gov (United States)

Kar, Indrani; Chattopadhyaya, Rajagopal

2017-11-01

The influences of substoichiometric amounts of seven plant extracts in the Fenton reaction-mediated damage to deoxynucleosides, deoxynucleoside monophosphates, deoxynucleoside triphosphates, and supercoiled plasmid DNA were studied to rationalize anticancer properties reported in some of these extracts. Extracts from Acacia catechu, Emblica officinalis, Spondias dulcis, Terminalia belerica, Terminalia chebula, as well as gallic acid, epicatechin, chebulagic acid and chebulinic acid enhance the extent of damage in Fenton reactions with all monomeric substrates but protect supercoiled plasmid DNA, compared to standard Fenton reactions. The damage to pyrimidine nucleosides/nucleotides is enhanced by these extracts and compounds to a greater extent than for purine ones in a concentration dependent manner. Dolichos biflorus and Hemidesmus indicus extracts generally do not show this enhancement for the monomeric substrates though they protect plasmid DNA. Compared to standard Fenton reactions for deoxynucleosides with ethanol, the presence of these five plant extracts render ethanol scavenging less effective as the radical is generated in the vicinity of the target. Since substoichiometric amounts of these extracts and the four compounds produce this effect, a catalytic mechanism involving the presence of a ternary complex of the nucleoside/nucleotide substrate, a plant compound and the hydroxyl radical is proposed. Such a mechanism cannot operate for plasmid DNA as the planar rings in the extract compounds cannot stack with the duplex DNA bases. These plant extracts, by enhancing Fenton reaction-mediated damage to deoxynucleoside triphosphates, slow down DNA replication in rapidly dividing cancer cells, thus contributing to their anticancer properties.

Functional and Structural Characterization of Purine Nucleoside Phosphorylase from Kluyveromyces lactis and Its Potential Applications in Reducing Purine Content in Food.

Science.gov (United States)

Mahor, Durga; Priyanka, Anu; Prasad, Gandham S; Thakur, Krishan Gopal

2016-01-01

Consumption of foods and beverages with high purine content increases the risk of hyperuricemia, which causes gout and can lead to cardiovascular, renal, and other metabolic disorders. As patients often find dietary restrictions challenging, enzymatically lowering purine content in popular foods and beverages offers a safe and attractive strategy to control hyperuricemia. Here, we report structurally and functionally characterized purine nucleoside phosphorylase (PNP) from Kluyveromyces lactis (KlacPNP), a key enzyme involved in the purine degradation pathway. We report a 1.97 Å resolution crystal structure of homotrimeric KlacPNP with an intrinsically bound hypoxanthine in the active site. KlacPNP belongs to the nucleoside phosphorylase-I (NP-I) family, and it specifically utilizes 6-oxopurine substrates in the following order: inosine > guanosine > xanthosine, but is inactive towards adenosine. To engineer enzymes with broad substrate specificity, we created two point variants, KlacPNPN256D and KlacPNPN256E, by replacing the catalytically active Asn256 with Asp and Glu, respectively, based on structural and comparative sequence analysis. KlacPNPN256D not only displayed broad substrate specificity by utilizing both 6-oxopurines and 6-aminopurines in the order adenosine > inosine > xanthosine > guanosine, but also displayed reversal of substrate specificity. In contrast, KlacPNPN256E was highly specific to inosine and could not utilize other tested substrates. Beer consumption is associated with increased risk of developing gout, owing to its high purine content. Here, we demonstrate that KlacPNP and KlacPNPN256D could be used to catalyze a key reaction involved in lowering beer purine content. Biochemical properties of these enzymes such as activity across a wide pH range, optimum activity at about 25°C, and stability for months at about 8°C, make them suitable candidates for food and beverage industries. Since KlacPNPN256D has broad substrate specificity, a

Modification of nucleotide metabolism in relationship with differentiation and in response to irradiation in human tumour cells

International Nuclear Information System (INIS)

Wei, Shuang

1998-01-01

This research thesis reports the study of the metabolism of nucleotides in human tumour cells. The first part addresses the modifications of nucleotide (more specifically purine) metabolism in relationship with human melanoma cell proliferation and differentiation. The second part addresses the modifications of this metabolism in response to an irradiation in human colon tumour cells. For each part, the author proposes a bibliographic synthesis, and a presentation of studied cells and of methods used to grow cells, and respectively to proliferate and differentiate them or to irradiate them, and then discusses the obtained results [fr

Evolutionary constraints and the neutral theory. [mutation-caused nucleotide substitutions in DNA

Science.gov (United States)

Jukes, T. H.; Kimura, M.

1984-01-01

The neutral theory of molecular evolution postulates that nucleotide substitutions inherently take place in DNA as a result of point mutations followed by random genetic drift. In the absence of selective constraints, the substitution rate reaches the maximum value set by the mutation rate. The rate in globin pseudogenes is about 5 x 10 to the -9th substitutions per site per year in mammals. Rates slower than this indicate the presence of constraints imposed by negative (natural) selection, which rejects and discards deleterious mutations.

Stacking of purines in water: the role of dipolar interactions in caffeine.

Science.gov (United States)

Tavagnacco, L; Di Fonzo, S; D'Amico, F; Masciovecchio, C; Brady, J W; Cesàro, A

2016-05-11

During the last few decades it has been ascertained that base stacking is one of the major contributions stabilizing nucleic acid conformations. However, the understanding of the nature of the interactions involved in the stacking process remains under debate and it is a subject of theoretical and experimental studies. Structural similarity between purine bases (guanine and adenine) in DNA and the caffeine molecule makes caffeine an excellent model for the purine bases. The present study clearly shows that dipolar interactions play a fundamental role in determining stacking of purine molecules in solution. In order to reach this achievement, polarized ultraviolet Raman resonant scattering experiments have been carried out on caffeine aqueous solutions as a function of concentration and temperature. The investigation pointed out at the aggregation and solvation properties, particularly at elevated temperatures. Kubo-Anderson theory was used as a framework to investigate the non-coincidence effect (NCE) occurring in the totally symmetric breathing modes of the purine rings, and in the bending modes of the methyl groups of caffeine. The NCE concentration dependence shows that caffeine aggregation at 80 °C occurs by planar stacking of the hydrophobic faces. The data clearly indicate that dipolar interactions determine the reorientational motion of the molecules in solution and are the driving force for the stacking of caffeine. In parallel, the observed dephasing times imply a change in caffeine interactions as a function of temperature and concentration. A decrease, at low water content, of the dephasing time for the ring breathing vibration mode indicates that self-association alters the solvation structure that is detectable at low concentration. These results are in agreement with simulation predictions and serve as an important validation of the models used in those calculations.

Nucleotide Excision Repair and Transcription-coupled DNA Repair Abrogate the Impact of DNA Damage on Transcription*

Science.gov (United States)

Nadkarni, Aditi; Burns, John A.; Gandolfi, Alberto; Chowdhury, Moinuddin A.; Cartularo, Laura; Berens, Christian; Geacintov, Nicholas E.; Scicchitano, David A.

2016-01-01

DNA adducts derived from carcinogenic polycyclic aromatic hydrocarbons like benzo[a]pyrene (B[a]P) and benzo[c]phenanthrene (B[c]Ph) impede replication and transcription, resulting in aberrant cell division and gene expression. Global nucleotide excision repair (NER) and transcription-coupled DNA repair (TCR) are among the DNA repair pathways that evolved to maintain genome integrity by removing DNA damage. The interplay between global NER and TCR in repairing the polycyclic aromatic hydrocarbon-derived DNA adducts (+)-trans-anti-B[a]P-N6-dA, which is subject to NER and blocks transcription in vitro, and (+)-trans-anti-B[c]Ph-N6-dA, which is a poor substrate for NER but also blocks transcription in vitro, was tested. The results show that both adducts inhibit transcription in human cells that lack both NER and TCR. The (+)-trans-anti-B[a]P-N6-dA lesion exhibited no detectable effect on transcription in cells proficient in NER but lacking TCR, indicating that NER can remove the lesion in the absence of TCR, which is consistent with in vitro data. In primary human cells lacking NER, (+)-trans-anti-B[a]P-N6-dA exhibited a deleterious effect on transcription that was less severe than in cells lacking both pathways, suggesting that TCR can repair the adduct but not as effectively as global NER. In contrast, (+)-trans-anti-B[c]Ph-N6-dA dramatically reduces transcript production in cells proficient in global NER but lacking TCR, indicating that TCR is necessary for the removal of this adduct, which is consistent with in vitro data showing that it is a poor substrate for NER. Hence, both global NER and TCR enhance the recovery of gene expression following DNA damage, and TCR plays an important role in removing DNA damage that is refractory to NER. PMID:26559971

Purine biosynthesis is the bottleneck in trimethoprim-treated Bacillus subtilis.

Science.gov (United States)

Stepanek, Jennifer Janina; Schäkermann, Sina; Wenzel, Michaela; Prochnow, Pascal; Bandow, Julia Elisabeth

2016-10-01

Trimethoprim is a folate biosynthesis inhibitor. Tetrahydrofolates are essential for the transfer of C 1 units in several biochemical pathways including purine, thymine, methionine, and glycine biosynthesis. This study addressed the effects of folate biosynthesis inhibition on bacterial physiology. Two complementary proteomic approaches were employed to analyze the response of Bacillus subtilis to trimethoprim. Acute changes in protein synthesis rates were monitored by radioactive pulse labeling of newly synthesized proteins and subsequent 2DE analysis. Changes in protein levels were detected using gel-free quantitative MS. Proteins involved in purine and histidine biosynthesis, the σ B -dependent general stress response, and sporulation were upregulated. Most prominently, the PurR-regulon required for de novo purine biosynthesis was derepressed indicating purine depletion. The general stress response was activated energy dependently and in a subpopulation of treated cultures an early onset of sporulation was observed, most likely triggered by low guanosine triphosphate levels. Supplementation of adenosine triphosphate, adenosine, and guanosine to the medium substantially decreased antibacterial activity, showing that purine depletion becomes the bottleneck in trimethoprim-treated B. subtilis. The frequently prescribed antibiotic trimethoprim causes purine depletion in B. subtilis, which can be complemented by supplementing purines to the medium. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Associations between purine metabolites and clinical symptoms in schizophrenia.

Directory of Open Access Journals (Sweden)

Jeffrey K Yao

Full Text Available The antioxidant defense system, which is known to be dysregulated in schizophrenia, is closely linked to the dynamics of purine pathway. Thus, alterations in the homeostatic balance in the purine pathway may be involved in the pathophysiology of schizophrenia.Breakdown products in purine pathway were measured using high-pressure liquid chromatography coupled with a coulometric multi-electrode array system for 25 first-episode neuroleptic-naïve patients with schizophrenia at baseline and at 4-weeks following initiation of treatment with antipsychotic medication. Associations between these metabolites and clinical and neurological symptoms were examined at both time points. The ratio of uric acid and guanine measured at baseline predicted clinical improvement following four weeks of treatment with antipsychotic medication. Baseline levels of purine metabolites also predicted clinical and neurological symtpoms recorded at baseline; level of guanosine was associated with degree of clinical thought disturbance, and the ratio of xanthosine to guanosine at baseline predicted degree of impairment in the repetition and sequencing of actions.Findings suggest an association between optimal levels of purine byproducts and dynamics in clinical symptoms and adjustment, as well as in the integrity of sensory and motor processing. Taken together, alterations in purine catabolism may have clinical relevance in schizophrenia pathology.

Using purine skews to predict genes in AT-rich poxviruses

Directory of Open Access Journals (Sweden)

Upton Chris

2005-02-01

Full Text Available Abstract Background Clusters or runs of purines on the mRNA synonymous strand have been found in many different organisms including orthopoxviruses. The purine bias that is exhibited by these clusters can be observed using a purine skew and in the case of poxviruses, these skews can be used to help determine the coding strand of a particular segment of the genome. Combined with previous findings that minor ORFs have lower than average aspartate and glutamate composition and higher than average serine composition, purine content can be used to predict the likelihood of a poxvirus ORF being a "real gene". Results Using purine skews and a "quality" measure designed to incorporate previous findings about minor ORFs, we have found that in our training case (vaccinia virus strain Copenhagen, 59 of 65 minor (small and unlikely to be a real genes ORFs were correctly classified as being minor. Of the 201 major (large and likely to be real genes vaccinia ORFs, 192 were correctly classified as being major. Performing a similar analysis with the entomopoxvirus amsacta moorei (AMEV, it was found that 4 major ORFs were incorrectly classified as minor and 9 minor ORFs were incorrectly classified as major. The purine abundance observed for major ORFs in vaccinia virus was found to stem primarily from the first codon position with both the second and third codon positions containing roughly equal amounts of purines and pyrimidines. Conclusion Purine skews and a "quality" measure can be used to predict functional ORFs and purine skews in particular can be used to determine which of two overlapping ORFs is most likely to be the real gene if neither of the two ORFs has orthologs in other poxviruses.

Purine nucleoside phosphorylase deficiency in two unrelated Saudi patients

International Nuclear Information System (INIS)

Alangari, Abdullah; AlHarbi, Abdullah; AlGhonaium Abdulaziz; Santisteban, Ines; Hershfield, Michael

2009-01-01

Purine nucleoside phosphorylase (PNP) deficiency is a rare autosomal recessive metabolic disorder that results in combined immunodeficiency, neurologic dysfunction and autoimmunity. PNP deficiency has never been reported from Saudi Arabia or in patients with an Arabic ethnic background. We report on two Saudi girls with PNP deficiency. Both showed severe lymphopenia and neurological involvement. Sequencing of the PNP gene of one girl revealed a novel missense mutation Pro146>Leu in exon 4 due to a change in the codon from CCT>CTT. Expression of PNP (146L) cDNA in E coli indicated that the mutation greatly reduced, but did not completely eliminate PNP activity. (author)

Nucleotide excision repair pathway assessment in DNA exposed to low-intensity red and infrared lasers

International Nuclear Information System (INIS)

Fonseca, A.S.; Campos, V.M.A.; Magalhaes, L.A.G.; Paoli, F.

2015-01-01

Low-intensity lasers are used for prevention and management of oral mucositis induced by anticancer therapy, but the effectiveness of treatment depends on the genetic characteristics of affected cells. This study evaluated the survival and induction of filamentation of Escherichia coli cells deficient in the nucleotide excision repair pathway, and the action of T 4 endonuclease V on plasmid DNA exposed to low-intensity red and near-infrared laser light. Cultures of wild-type (strain AB1157) E. coli and strain AB1886 (deficient in uvrA protein) were exposed to red (660 nm) and infrared (808 nm) lasers at various fluences, powers and emission modes to study bacterial survival and filamentation. Also, plasmid DNA was exposed to laser light to study DNA lesions produced in vitro by T 4 endonuclease V. Low-intensity lasers: i) had no effect on survival of wild-type E. coli but decreased the survival of uvrA protein-deficient cells, ii) induced bacterial filamentation, iii) did not alter the electrophoretic profile of plasmids in agarose gels, and iv) did not alter the electrophoretic profile of plasmids incubated with T 4 endonuclease V. These results increase our understanding of the effects of laser light on cells with various genetic characteristics, such as xeroderma pigmentosum cells deficient in nucleotide excision pathway activity in patients with mucositis treated by low-intensity lasers. (author)

Nucleotide excision repair pathway assessment in DNA exposed to low-intensity red and infrared lasers

Energy Technology Data Exchange (ETDEWEB)

Fonseca, A.S.; Campos, V.M.A.; Magalhaes, L.A.G., E-mail: adnfonseca@ig.com.br [Instituto de Biologia Roberto Alcantara Gomes, Rio de Janeiro, RJ (Brazil). Departamento de Biofisica e Biometria. Lab. de Ciencias Radiologicas; Paoli, F. [Universidade Federal de Juiz de Fora (UFJF), Juiz de Fora, MG (Brazil). Instituto de Ciencias Biologicas. Departamento de Morfologia

2015-10-15

Low-intensity lasers are used for prevention and management of oral mucositis induced by anticancer therapy, but the effectiveness of treatment depends on the genetic characteristics of affected cells. This study evaluated the survival and induction of filamentation of Escherichia coli cells deficient in the nucleotide excision repair pathway, and the action of T{sub 4} endonuclease V on plasmid DNA exposed to low-intensity red and near-infrared laser light. Cultures of wild-type (strain AB1157) E. coli and strain AB1886 (deficient in uvrA protein) were exposed to red (660 nm) and infrared (808 nm) lasers at various fluences, powers and emission modes to study bacterial survival and filamentation. Also, plasmid DNA was exposed to laser light to study DNA lesions produced in vitro by T{sub 4} endonuclease V. Low-intensity lasers: i) had no effect on survival of wild-type E. coli but decreased the survival of uvrA protein-deficient cells, ii) induced bacterial filamentation, iii) did not alter the electrophoretic profile of plasmids in agarose gels, and iv) did not alter the electrophoretic profile of plasmids incubated with T{sub 4} endonuclease V. These results increase our understanding of the effects of laser light on cells with various genetic characteristics, such as xeroderma pigmentosum cells deficient in nucleotide excision pathway activity in patients with mucositis treated by low-intensity lasers. (author)

Role of Metal Oxides in Chemical Evolution: Interaction of Ribose Nucleotides with Alumina

Science.gov (United States)

Arora, Avnish Kumar; Kamaluddin

2009-03-01

Interaction of ribonucleotides—namely, 5‧-AMP, 5‧-GMP, 5‧-CMP, and 5‧-UMP—with acidic, neutral, and basic alumina has been studied. Purine nucleotides showed higher adsorption on alumina in comparison with pyrimidine nucleotides under acidic conditions. Adsorption data obtained followed Langmuir adsorption isotherm, and Xm and KL values were calculated. On the basis of infrared spectral studies of ribonucleotides, alumina, and ribonucleotide-alumina adducts, we propose that the nitrogen base and phosphate moiety of the ribonucleotides interact with the positive charge surface of alumina. Results of the present study may indicate the importance of alumina in concentrating organic molecules from dilute aqueous solutions in primeval seas in the course of chemical evolution on Earth.

Antioxidant effect of naturally occurring xanthines on the oxidative damage of DNA bases

International Nuclear Information System (INIS)

Vieira, A.J.S.C.; Telo, J.P.; Pereira, H.F.; Patrocinio, P.F.; Dias, R.M.B.

1999-01-01

The repair of the oxidised radicals of adenine and guanosine by several naturally occurring xanthines was studied. Each pair of DNA purine/xanthine was made to react with the sulphate radical and the decrease of the concentration of both compounds was measured by HPLC as a function of irradiation time. The results show that xanthine efficiently prevents the oxidation of the two DNA purines. Theophylline and para-xanthine repair the oxidizes radical of adenine but not the one from guanosine. Theobromine and caffeine to do not show any protecting effect. An order of the oxidation potentials of all the purines studied is proposed. (authors)

Determination of the recognition site for adenine-specific methylase of Shigella sonnei 47 by hydazinolysis of DNA, followed by separation of the purine oligonucleotides by thin-layer chromatography on DEAE-cellulose

International Nuclear Information System (INIS)

Lopatina, N.G.; Kirnos, M.D.; Suchkov, S.V.; Vanyushin, B.F.; Nikol'skaya, I.I.; Debov, S.S.

1985-01-01

A method has been developed for the separation of oligopurine units according to length and composition by two-dimensional thin-layer chromatography on plates with DEAE-cellulose, permitting a comparative analysis of the content of various purine isopliths in DNA of different origin. In the case of the analysis of methylated DNA, the method permits a comparison of the substrate specificity of various enzymes of methylation of the adenine residues in DNA. In conjunction with enzymatic treatment of labeled methylated isopliths, the method permits determination of the methylatable sequence and in a number of cases an ascertainment of the recognition site for adenine-specific methylase as a whole. The proposed method was used to establish the fact that the methylase Ssol recognizes the sequence 5'...G-A-A-T-T-C...3' and methylates the adenine residue closest to its 5'-end

Glucagon infusion increases rate of purine synthesis de novo in rat liver

International Nuclear Information System (INIS)

Itakura, Mitsuo; Maeda, Noriaki; Tsuchiya, Masami; Yamashita, Kamejiro

1987-01-01

Based on the parallel increases of glucagon, the second peak of hepatic cAMP, and the rate of purine synthesis de novo in the prereplicative period in regenerating rate liver after a 70% hepatectomy, it was hypothesized that glucagon is responsible for the increased rate of purine synthesis de novo. To test this hypothesis, the effect of glucagon or dibutyryl cAMP infusion on the rate of purine synthesis de novo in rat liver was studied. Glucagon infusion but not insulin or glucose infusion increased the rate of purine synthesis de novo, which was assayed by [ 14 C]glycine or [ 14 C]formate incorporation, by 2.7- to 4.3-fold. Glucagon infusion increased cAMP concentrations by 4.9-fold and 5-phosphoribosyl-1-pyrophosphate concentrations by 1.5-fold in liver but did not change the specific activity of amidophosphoribosyltransferase or purine ribonucleotide concentrations. Dibutyryl cAMP infusion also increased the rate of purine synthesis de novo by 2.2- to 4.0-fold. Because glucagon infusion increased the rate of purine synthesis de novo in the presence of unchanged purine ribonucleotide concentrations, it is concluded that glucagon after infusion or in animals after a 70% hepatectomy is playing an anabolic role to increase the rate of purine synthesis de novo by increasing cAMP and 5-phosphoribosyl-1-pyrophosphate concentrations

Altering the spectrum of immunoglobulin V gene somatic hypermutation by modifying the active site of AID.

Science.gov (United States)

Wang, Meng; Rada, Cristina; Neuberger, Michael S

2010-01-18

High-affinity antibodies are generated by somatic hypermutation with nucleotide substitutions introduced into the IgV in a semirandom fashion, but with intrinsic mutational hotspots strategically located to optimize antibody affinity maturation. The process is dependent on activation-induced deaminase (AID), an enzyme that can deaminate deoxycytidine in DNA in vitro, where its activity is sensitive to the identity of the 5'-flanking nucleotide. As a critical test of whether such DNA deamination activity underpins antibody diversification and to gain insight into the extent to which the antibody mutation spectrum is dependent on the intrinsic substrate specificity of AID, we investigated whether it is possible to change the IgV mutation spectrum by altering AID's active site such that it prefers a pyrimidine (rather than a purine) flanking the targeted deoxycytidine. Consistent with the DNA deamination mechanism, B cells expressing the modified AID proteins yield altered IgV mutation spectra (exhibiting a purine-->pyrimidine shift in flanking nucleotide preference) and altered hotspots. However, AID-catalyzed deamination of IgV targets in vitro does not yield the same degree of hotspot dominance to that observed in vivo, indicating the importance of features beyond AID's active site and DNA local sequence environment in determining in vivo hotspot dominance.

Genotyping of Single Nucleotide Polymorphisms in DNA Isolated from Serum Using Sequenom MassARRAY Technology.

Directory of Open Access Journals (Sweden)

Tess V Clendenen

Full Text Available Large epidemiologic studies have the potential to make valuable contributions to the assessment of gene-environment interactions because they prospectively collected detailed exposure data. Some of these studies, however, have only serum or plasma samples as a low quantity source of DNA.We examined whether DNA isolated from serum can be used to reliably and accurately genotype single nucleotide polymorphisms (SNPs using Sequenom multiplex SNP genotyping technology. We genotyped 81 SNPs using samples from 158 participants in the NYU Women's Health Study. Each participant had DNA from serum and at least one paired DNA sample isolated from a high quality source of DNA, i.e. clots and/or cell precipitates, for comparison.We observed that 60 of the 81 SNPs (74% had high call frequencies (≥95% using DNA from serum, only slightly lower than the 85% of SNPs with high call frequencies in DNA from clots or cell precipitates. Of the 57 SNPs with high call frequencies for serum, clot, and cell precipitate DNA, 54 (95% had highly concordant (>98% genotype calls across all three sample types. High purity was not a critical factor to successful genotyping.Our results suggest that this multiplex SNP genotyping method can be used reliably on DNA from serum in large-scale epidemiologic studies.

Synthesis of 8-amino and 8-substituted amino derivatives of acyclic purine nucleoside and nucleotide analogs. Alkylation of 8-substituted purine bases

Czech Academy of Sciences Publication Activity Database

Janeba, Zlatko; Holý, Antonín

2001-01-01

Roč. 20, 4-7 (2001), s. 1103-1106 ISSN 1525-7770 R&D Projects: GA ČR GV203/96/K001 Institutional research plan: CEZ:AV0Z4055905 Keywords : nucleotide analogs Subject RIV: CC - Organic Chemistry Impact factor: 0.508, year: 2001

Synthesis of Aldehyde-Linked Nucleotides and DNA and Their Bioconjugations with Lysine and Peptides through Reductive Amination

Czech Academy of Sciences Publication Activity Database

Raindlová, Veronika; Pohl, Radek; Hocek, Michal

2012-01-01

Roč. 18, č. 13 (2012), s. 4080-4087 ISSN 0947-6539 R&D Projects: GA ČR GA203/09/0317 Institutional research plan: CEZ:AV0Z40550506 Keywords : nucleotides * aldehydes * DNA * reductive amination * bioconjugations Subject RIV: CC - Organic Chemistry Impact factor: 5.831, year: 2012

Nucleotide Excision Repair and Transcription-coupled DNA Repair Abrogate the Impact of DNA Damage on Transcription.

Science.gov (United States)

Nadkarni, Aditi; Burns, John A; Gandolfi, Alberto; Chowdhury, Moinuddin A; Cartularo, Laura; Berens, Christian; Geacintov, Nicholas E; Scicchitano, David A

2016-01-08

DNA adducts derived from carcinogenic polycyclic aromatic hydrocarbons like benzo[a]pyrene (B[a]P) and benzo[c]phenanthrene (B[c]Ph) impede replication and transcription, resulting in aberrant cell division and gene expression. Global nucleotide excision repair (NER) and transcription-coupled DNA repair (TCR) are among the DNA repair pathways that evolved to maintain genome integrity by removing DNA damage. The interplay between global NER and TCR in repairing the polycyclic aromatic hydrocarbon-derived DNA adducts (+)-trans-anti-B[a]P-N(6)-dA, which is subject to NER and blocks transcription in vitro, and (+)-trans-anti-B[c]Ph-N(6)-dA, which is a poor substrate for NER but also blocks transcription in vitro, was tested. The results show that both adducts inhibit transcription in human cells that lack both NER and TCR. The (+)-trans-anti-B[a]P-N(6)-dA lesion exhibited no detectable effect on transcription in cells proficient in NER but lacking TCR, indicating that NER can remove the lesion in the absence of TCR, which is consistent with in vitro data. In primary human cells lacking NER, (+)-trans-anti-B[a]P-N(6)-dA exhibited a deleterious effect on transcription that was less severe than in cells lacking both pathways, suggesting that TCR can repair the adduct but not as effectively as global NER. In contrast, (+)-trans-anti-B[c]Ph-N(6)-dA dramatically reduces transcript production in cells proficient in global NER but lacking TCR, indicating that TCR is necessary for the removal of this adduct, which is consistent with in vitro data showing that it is a poor substrate for NER. Hence, both global NER and TCR enhance the recovery of gene expression following DNA damage, and TCR plays an important role in removing DNA damage that is refractory to NER. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Heterosis and heritability estimates of purine alkaloids and ...

African Journals Online (AJOL)

Dry cocoa beans displayed high content of purine alkaloids (2.1 and 8.8 mg g-1 for caffein and theobromine, respectively), and polyphenols (25 and 2978 μg g-1 for catechin and epicatechin, respectively). Among the five cocoa clones, SNK16 was the highest in purine alkaloid (caffein and theobromin) and flavanol ...

Design, Synthesis and Antiviral Activity of 5-Hydroxymethyl-3-phosphonyl-4,5-dihydrofuran Analogs of Nucleotides

International Nuclear Information System (INIS)

Lee, Hee Yoon; Lee, Ki Ho; Hah, Jung Hwan; Moon, Deuk Kyu; Lee, Chong Kyo

2010-01-01

We have designed and synthesized functionalized dihydrofurylphosphonates that are constrained analogs of 1-alkenyl-phosphonate derivatives of purine/pyrimidine nucleotides as they bear phosphonyl groups at the 3-position and bases at the methyl group of the 5-position of the furan ring. This newly designed dihydrofurylphosphonate analogs of nucleotide showed antiviral activity. Through the current synthetic strategy, structural diversification can be easily attainable for structure activity relationship study and for the better antiviral compounds. Phosphonate esters play an important role in studying the biological system as a hydrolytically stable replacement of phosphate groups and as prodrugs of phosphonates. In continuation of our study on the chemistry of 1-alkenylphosphonates, we were interested in designing and developing versatile synthetic routes to conformationally constrained structures of al-kenylphosphonate nucleotide analogs

Homology modeling, molecular docking and DNA binding studies of nucleotide excision repair UvrC protein from M. tuberculosis.

Science.gov (United States)

Parulekar, Rishikesh S; Barage, Sagar H; Jalkute, Chidambar B; Dhanavade, Maruti J; Fandilolu, Prayagraj M; Sonawane, Kailas D

2013-08-01

Mycobacterium tuberculosis is a Gram positive, acid-fast bacteria belonging to genus Mycobacterium, is the leading causative agent of most cases of tuberculosis. The pathogenicity of the bacteria is enhanced by its developed DNA repair mechanism which consists of machineries such as nucleotide excision repair. Nucleotide excision repair consists of excinuclease protein UvrABC endonuclease, multi-enzymatic complex which carries out repair of damaged DNA in sequential manner. UvrC protein is a part of this complex and thus helps to repair the damaged DNA of M. tuberculosis. Hence, structural bioinformatics study of UvrC protein from M. tuberculosis was carried out using homology modeling and molecular docking techniques. Assessment of the reliability of the homology model was carried out by predicting its secondary structure along with its model validation. The predicted structure was docked with the ATP and the interacting amino acid residues of UvrC protein with the ATP were found to be TRP539, PHE89, GLU536, ILE402 and ARG575. The binding of UvrC protein with the DNA showed two different domains. The residues from domain I of the protein VAL526, THR524 and LEU521 interact with the DNA whereas, amino acids interacting from the domain II of the UvrC protein included ARG597, GLU595, GLY594 and GLY592 residues. This predicted model could be useful to design new inhibitors of UvrC enzyme to prevent pathogenesis of Mycobacterium and so the tuberculosis.

Enzymatic Regulation of Cytosolic Thymidine Kinase 1 and Mitochondrial Thymidine Kinase 2

DEFF Research Database (Denmark)

Munch-Petersen, Birgitte

2010-01-01

The central enzyme on the de novo pathway for synthesis of DNA precursors, the deoxyribonucleoside triphosphates, is ribonucleotide reductase (RNR). Deoxythymidine triphosphate (dTTP) has a key role in control of RNR activity shifting the specificity from pyrimidine to purine nucleotide reduction...

Schizosaccharomyces pombe MutSα and MutLα Maintain Stability of Tetra-Nucleotide Repeats and Msh3 of Hepta-Nucleotide Repeats

Directory of Open Access Journals (Sweden)

Desirée Villahermosa

2017-05-01

Full Text Available Defective mismatch repair (MMR in humans is associated with colon cancer and instability of microsatellites, that is, DNA sequences with one or several nucleotides repeated. Key factors of eukaryotic MMR are the heterodimers MutSα (Msh2-Msh6, which recognizes base-base mismatches and unpaired nucleotides in DNA, and MutLα (Mlh1-Pms1, which facilitates downstream steps. In addition, MutSβ (Msh2-Msh3 recognizes DNA loops of various sizes, although our previous data and the data presented here suggest that Msh3 of Schizosaccharomyces pombe does not play a role in MMR. To test microsatellite stability in S. pombe and hence DNA loop repair, we have inserted tetra-, penta-, and hepta-nucleotide repeats in the ade6 gene and determined their Ade+ reversion rates and spectra in wild type and various mutants. Our data indicate that loops with four unpaired nucleotides in the nascent and the template strand are the upper limit of MutSα- and MutLα-mediated MMR in S. pombe. Stability of hepta-nucleotide repeats requires Msh3 and Exo1 in MMR-independent processes as well as the DNA repair proteins Rad50, Rad51, and Rad2FEN1. Most strikingly, mutation rates in the double mutants msh3 exo1 and msh3 rad51 were decreased when compared to respective single mutants, indicating that Msh3 prevents error prone processes carried out by Exo1 and Rad51. We conclude that Msh3 has no obvious function in MMR in S. pombe, but contributes to DNA repeat stability in MMR-independent processes.

Occurrence of theobromine synthase genes in purine alkaloid-free species of Camellia plants.

Science.gov (United States)

Ishida, Mariko; Kitao, Naoko; Mizuno, Kouichi; Tanikawa, Natsu; Kato, Misako

2009-02-01

Caffeine (1,3,7-trimethylxanthine) and theobromine (3,7-dimethylxanthine) are purine alkaloids that are present in high concentrations in plants of some species of Camellia. However, most members of the genus Camellia contain no purine alkaloids. Tracer experiments using [8-(14)C]adenine and [8-(14)C]theobromine showed that the purine alkaloid pathway is not fully functional in leaves of purine alkaloid-free species. In five species of purine alkaloid-free Camellia plants, sufficient evidence was obtained to show the occurrence of genes that are homologous to caffeine synthase. Recombinant enzymes derived from purine alkaloid-free species showed only theobromine synthase activity. Unlike the caffeine synthase gene, these genes were expressed more strongly in mature tissue than in young tissue.

Synthesis and biological properties of 5-azido-2'-deoxyuridine 5'-triphosphate, a photoactive nucleotide suitable for making light-sensitive DNA

International Nuclear Information System (INIS)

Evans, R.K.; Haley, B.E.

1987-01-01

A photoactive nucleotide analogue of dUTP, 5-azido-2'-deoxyuridine 5'-triphosphate (5-N 3 dUTP), was synthesized from dUMP in five steps. The key reaction in the synthesis of 5-N 3 dUTP is the nitration of dUMP in 98% yield in 5 min at 25 0 C using an excess of nitrosonium tetrafluoroborate in anhydrous dimethylformamide. Reduction of the resulting 5-nitro compound with zinc and 20 mM HCl gave 5-aminodeoxyuridine monophosphate (5-NH 2 dUMP). Diazotization of 5-NH 2 dUMP with HNO 2 followed by the addition NaN 3 to the acidic diazonium salt solution gave a photoactive nucleotide derivative in 80-90% yield. The monophosphate product was identified as 5-N 3 dUMP by proton NMR, UV, IR, and chromatographic analysis as well as by the mode of synthesis and its photosensitivity. After formation of 5-N 3 dUTP through a chemical coupling of pyrophosphate to 5-N 3 dUMP, the triphosphate form of the nucleotide was found to support DNA synthesis by Escherichia coli DNA polymerase I at a rate indistinguishable from that supported by dTTP. When UMP was used as the starting compound, 5-N 3 UTP was formed in an analogous fashion with similar yields and produced a photoactive nucleotide which is a substrate for E. coli RNA polymerase. To prepare [γ- 32 P]-5-N 3 dUTP for use as an active-site-directed photoaffinity labeling reagent, a simple method of preparing γ- 32 P-labeled pyrimidine nucleotides was developed. [γ- 32 P]-5-N 3 dUTP is an effective photoaffinity labeling reagent for DNA polymerase I and was found to bind to the active site with a 2-fold higher affinity than dTTP. The photoactivity of 5-N 3 dUMP is stable to extremes of pH, and [γ- 32 P]-5-N 3 dUTP was an effective photolabeling reagent even in the presence of 10 mM dithiothreitol

RPA and XPA interaction with DNA structures mimicking intermediates of the late stages in nucleotide excision repair.

Science.gov (United States)

Krasikova, Yuliya S; Rechkunova, Nadejda I; Maltseva, Ekaterina A; Lavrik, Olga I

2018-01-01

Replication protein A (RPA) and the xeroderma pigmentosum group A (XPA) protein are indispensable for both pathways of nucleotide excision repair (NER). Here we analyze the interaction of RPA and XPA with DNA containing a flap and different size gaps that imitate intermediates of the late NER stages. Using gel mobility shift assays, we found that RPA affinity for DNA decreased when DNA contained both extended gap and similar sized flap in comparison with gapped-DNA structure. Moreover, crosslinking experiments with the flap-gap DNA revealed that RPA interacts mainly with the ssDNA platform within the long gap and contacts flap in DNA with a short gap. XPA exhibits higher affinity for bubble-DNA structures than to flap-gap-containing DNA. Protein titration analysis showed that formation of the RPA-XPA-DNA ternary complex depends on the protein concentration ratio and these proteins can function as independent players or in tandem. Using fluorescently-labelled RPA, direct interaction of this protein with XPA was detected and characterized quantitatively. The data obtained allow us to suggest that XPA can be involved in the post-incision NER stages via its interaction with RPA.

RPA and XPA interaction with DNA structures mimicking intermediates of the late stages in nucleotide excision repair.

Directory of Open Access Journals (Sweden)

Yuliya S Krasikova

Full Text Available Replication protein A (RPA and the xeroderma pigmentosum group A (XPA protein are indispensable for both pathways of nucleotide excision repair (NER. Here we analyze the interaction of RPA and XPA with DNA containing a flap and different size gaps that imitate intermediates of the late NER stages. Using gel mobility shift assays, we found that RPA affinity for DNA decreased when DNA contained both extended gap and similar sized flap in comparison with gapped-DNA structure. Moreover, crosslinking experiments with the flap-gap DNA revealed that RPA interacts mainly with the ssDNA platform within the long gap and contacts flap in DNA with a short gap. XPA exhibits higher affinity for bubble-DNA structures than to flap-gap-containing DNA. Protein titration analysis showed that formation of the RPA-XPA-DNA ternary complex depends on the protein concentration ratio and these proteins can function as independent players or in tandem. Using fluorescently-labelled RPA, direct interaction of this protein with XPA was detected and characterized quantitatively. The data obtained allow us to suggest that XPA can be involved in the post-incision NER stages via its interaction with RPA.

Bias of purine stretches in sequenced chromosomes

DEFF Research Database (Denmark)

Ussery, David; Soumpasis, Dikeos Mario; Brunak, Søren

2002-01-01

/pur tracts was slightly less than expected, with an average of 0.8%. One of the most surprising findings is a clear difference in the length distributions of the regions studied between prokaryotes and eukaryotes. Whereas short-range correlations can explain the length distributions in prokaryotes......, in eukaryotes there is an abundance of long stretches of purines or alternating purine/pyrimidine tracts, which cannot be explained in this way; these sequences are likely to play an important role in eukaryotic chromosome organisation....

DNA damage in lens epithelium of cataract patients in vivo and ex vivo.

Science.gov (United States)

Øsnes-Ringen, Oyvind; Azqueta, Amaia O; Moe, Morten C; Zetterström, Charlotta; Røger, Magnus; Nicolaissen, Bjørn; Collins, Andrew R

2013-11-01

DNA damage has been described in the human cataractous lens epithelium, and oxidative stress generated by UV radiation and endogenous metabolic processes has been suggested to play a significant role in the pathogenesis of cataract. In this study, the aim was to explore the quality and relative quantity of DNA damage in lens epithelium of cataract patients in vivo and after incubation in a cell culture system. Capsulotomy specimens were analysed, before and after 1 week of ex vivo cultivation, using the comet assay to measure DNA strand breaks, oxidized purine and pyrimidine bases and UV-induced cyclobutane pyrimidine dimers. DNA strand breaks were barely detectable, oxidized pyrimidines and pyrimidine dimers were present at low levels, whereas there was a relatively high level of oxidized purines, which further increased after cultivation. The observed levels of oxidized purines in cataractous lens epithelium may support a theory consistent with light damage and oxidative stress as mediators of molecular damage to the human lens epithelium. Damage commonly associated with UV-B irradiation was relatively low. The levels of oxidized purines increased further in a commonly used culture system. This is of interest considering the importance and versatility of ex vivo systems in studies exploring the pathogenesis of cataract. © 2012 The Authors. Acta Ophthalmologica © 2012 Acta Ophthalmologica Scandinavica Foundation.

Engineered split in Pfu DNA polymerase fingers domain improves incorporation of nucleotide γ-phosphate derivative

Science.gov (United States)

Hansen, Connie J.; Wu, Lydia; Fox, Jeffrey D.; Arezi, Bahram; Hogrefe, Holly H.

2011-01-01

Using compartmentalized self-replication (CSR), we evolved a version of Pyrococcus furiosus (Pfu) DNA polymerase that tolerates modification of the γ-phosphate of an incoming nucleotide. A Q484R mutation in α-helix P of the fingers domain, coupled with an unintended translational termination-reinitiation (split) near the finger tip, dramatically improve incorporation of a bulky γ-phosphate-O-linker-dabcyl substituent. Whether synthesized by coupled translation from a bicistronic (−1 frameshift) clone, or reconstituted from separately expressed and purified fragments, split Pfu mutant behaves identically to wild-type DNA polymerase with respect to chromatographic behavior, steady-state kinetic parameters (for dCTP), and PCR performance. Although naturally-occurring splits have been identified previously in the finger tip region of T4 gp43 variants, this is the first time a split (in combination with a point mutation) has been shown to broaden substrate utilization. Moreover, this latest example of a split hyperthermophilic archaeal DNA polymerase further illustrates the modular nature of the Family B DNA polymerase structure. PMID:21062827

Engineered split in Pfu DNA polymerase fingers domain improves incorporation of nucleotide gamma-phosphate derivative.

Science.gov (United States)

Hansen, Connie J; Wu, Lydia; Fox, Jeffrey D; Arezi, Bahram; Hogrefe, Holly H

2011-03-01

Using compartmentalized self-replication (CSR), we evolved a version of Pyrococcus furiosus (Pfu) DNA polymerase that tolerates modification of the γ-phosphate of an incoming nucleotide. A Q484R mutation in α-helix P of the fingers domain, coupled with an unintended translational termination-reinitiation (split) near the finger tip, dramatically improve incorporation of a bulky γ-phosphate-O-linker-dabcyl substituent. Whether synthesized by coupled translation from a bicistronic (-1 frameshift) clone, or reconstituted from separately expressed and purified fragments, split Pfu mutant behaves identically to wild-type DNA polymerase with respect to chromatographic behavior, steady-state kinetic parameters (for dCTP), and PCR performance. Although naturally-occurring splits have been identified previously in the finger tip region of T4 gp43 variants, this is the first time a split (in combination with a point mutation) has been shown to broaden substrate utilization. Moreover, this latest example of a split hyperthermophilic archaeal DNA polymerase further illustrates the modular nature of the Family B DNA polymerase structure.

Multiple Sclerosis: Evaluation of Purine Nucleotide Metabolism in Central Nervous System in Association with Serum Levels of Selected Fat-Soluble Antioxidants

OpenAIRE

Kuračka, Ľubomír; Kalnovičová, Terézia; Kucharská, Jarmila; Turčáni, Peter

2014-01-01

In the pathogenesis of demyelinating diseases including multiple sclerosis (MS) an important role is played by oxidative stress. Increased energy requirements during remyelination of axons and mitochondria failure is one of the causes of axonal degeneration and disability in MS. In this context, we analyzed to what extent the increase in purine catabolism is associated with selected blood lipophilic antioxidants and if there is any association with alterations in serum levels of coenzyme Q10....

Guanine nucleotide binding to the Bateman domain mediates the allosteric inhibition of eukaryotic IMP dehydrogenases

Science.gov (United States)

Buey, Rubén M.; Ledesma-Amaro, Rodrigo; Velázquez-Campoy, Adrián; Balsera, Mónica; Chagoyen, Mónica; de Pereda, José M.; Revuelta, José L.

2015-11-01

Inosine-5'-monophosphate dehydrogenase (IMPDH) plays key roles in purine nucleotide metabolism and cell proliferation. Although IMPDH is a widely studied therapeutic target, there is limited information about its physiological regulation. Using Ashbya gossypii as a model, we describe the molecular mechanism and the structural basis for the allosteric regulation of IMPDH by guanine nucleotides. We report that GTP and GDP bind to the regulatory Bateman domain, inducing octamers with compromised catalytic activity. Our data suggest that eukaryotic and prokaryotic IMPDHs might have developed different regulatory mechanisms, with GTP/GDP inhibiting only eukaryotic IMPDHs. Interestingly, mutations associated with human retinopathies map into the guanine nucleotide-binding sites including a previously undescribed non-canonical site and disrupt allosteric inhibition. Together, our results shed light on the mechanisms of the allosteric regulation of enzymes mediated by Bateman domains and provide a molecular basis for certain retinopathies, opening the door to new therapeutic approaches.

Whole Blood PCR Amplification with Pfu DNA Polymerase and Its Application in Single-Nucleotide Polymorphism Analysis.

Science.gov (United States)

Liu, Er-Ping; Wang, Yan; He, Xiao-Hui; Guan, Jun-Jie; Wang, Jin; Qin, Zheng-Hong; Sun, Wan-Ping

2015-11-01

Point-of-care genetic analysis may require polymerase chain reaction (PCR) to be carried out on whole blood. However, human blood contains natural inhibitors of PCR such as hemoglobin, immunoglobulin G, lactoferrin, and proteases, as well as anticoagulant agents, including EDTA and heparin that can reduce whole blood PCR efficiency. Our purpose was to develop a highly specific, direct whole blood single-nucleotide polymorphism (SNP) analysis method based on allele-specific (AS) PCR that is mediated by Pfu DNA polymerase and phosphorothioate-modified AS primers. At high Mg(2+) concentrations, Pfu DNA polymerase efficiently amplified genomic DNA in a reaction solution containing up to 14% whole blood. Among the three anticoagulants tested, Pfu DNA polymerase showed the highest activity with sodium citrate. Meanwhile, Triton X-100 and betaine inhibited Pfu DNA polymerase activity in whole blood PCR, whereas trehalose had virtually no effect. These findings provided for the development of a low-cost, simple, and fast direct whole blood genotyping method that uses Pfu DNA polymerase combined with phosphorothioate AS primers for CYP2C9*3 and VKORC1(-1639) loci. With its high DNA amplification efficiency and tolerance of various blood conditions, Pfu DNA polymerase can be used in clinical laboratories to analyze SNPs in whole blood samples.

Nucleotide excision repair in yeast

NARCIS (Netherlands)

Eijk, Patrick van

2012-01-01

Nucleotide Excision Repair (NER) is a conserved DNA repair pathway capable of removing a broad spectrum of DNA damage. In human cells a defect in NER leads to the disorder Xeroderma pigmentosum (XP). The yeast Saccharomyces cerevisiae is an excellent model organism to study the mechanism of NER. The

Significant contribution of the 3′→5′ exonuclease activity to the high fidelity of nucleotide incorporation catalyzed by human DNA polymerase ϵ

Science.gov (United States)

Zahurancik, Walter J.; Klein, Seth J.; Suo, Zucai

2014-01-01

Most eukaryotic DNA replication is performed by A- and B-family DNA polymerases which possess a faithful polymerase activity that preferentially incorporates correct over incorrect nucleotides. Additionally, many replicative polymerases have an efficient 3′→5′ exonuclease activity that excises misincorporated nucleotides. Together, these activities contribute to overall low polymerase error frequency (one error per 106–108 incorporations) and support faithful eukaryotic genome replication. Eukaryotic DNA polymerase ϵ (Polϵ) is one of three main replicative DNA polymerases for nuclear genomic replication and is responsible for leading strand synthesis. Here, we employed pre-steady-state kinetic methods and determined the overall fidelity of human Polϵ (hPolϵ) by measuring the individual contributions of its polymerase and 3′→5′ exonuclease activities. The polymerase activity of hPolϵ has a high base substitution fidelity (10−4–10−7) resulting from large decreases in both nucleotide incorporation rate constants and ground-state binding affinities for incorrect relative to correct nucleotides. The 3′→5′ exonuclease activity of hPolϵ further enhances polymerization fidelity by an unprecedented 3.5 × 102 to 1.2 × 104-fold. The resulting overall fidelity of hPolϵ (10−6–10−11) justifies hPolϵ to be a primary enzyme to replicate human nuclear genome (0.1–1.0 error per round). Consistently, somatic mutations in hPolϵ, which decrease its exonuclease activity, are connected with mutator phenotypes and cancer formation. PMID:25414327

Recognition and processing of a new repertoire of DNA substrates by human 3-methyladenine DNA glycosylase (AAG).

Science.gov (United States)

Lee, Chun-Yue I; Delaney, James C; Kartalou, Maria; Lingaraju, Gondichatnahalli M; Maor-Shoshani, Ayelet; Essigmann, John M; Samson, Leona D

2009-03-10

The human 3-methyladenine DNA glycosylase (AAG) recognizes and excises a broad range of purines damaged by alkylation and oxidative damage, including 3-methyladenine, 7-methylguanine, hypoxanthine (Hx), and 1,N(6)-ethenoadenine (epsilonA). The crystal structures of AAG bound to epsilonA have provided insights into the structural basis for substrate recognition, base excision, and exclusion of normal purines and pyrimidines from its substrate recognition pocket. In this study, we explore the substrate specificity of full-length and truncated Delta80AAG on a library of oligonucleotides containing structurally diverse base modifications. Substrate binding and base excision kinetics of AAG with 13 damaged oligonucleotides were examined. We found that AAG bound to a wide variety of purine and pyrimidine lesions but excised only a few of them. Single-turnover excision kinetics showed that in addition to the well-known epsilonA and Hx substrates, 1-methylguanine (m1G) was also excised efficiently by AAG. Thus, along with epsilonA and ethanoadenine (EA), m1G is another substrate that is shared between AAG and the direct repair protein AlkB. In addition, we found that both the full-length and truncated AAG excised 1,N(2)-ethenoguanine (1,N(2)-epsilonG), albeit weakly, from duplex DNA. Uracil was excised from both single- and double-stranded DNA, but only by full-length AAG, indicating that the N-terminus of AAG may influence glycosylase activity for some substrates. Although AAG has been primarily shown to act on double-stranded DNA, AAG excised both epsilonA and Hx from single-stranded DNA, suggesting the possible significance of repair of these frequent lesions in single-stranded DNA transiently generated during replication and transcription.

A new activity of anti-HIV and anti-tumor protein GAP31: DNA adenosine glycosidase - Structural and modeling insight into its functions

Energy Technology Data Exchange (ETDEWEB)

Li, Hui-Guang [Department of Biochemistry, New York University School of Medicine, New York, NY 10016 (United States); Huang, Philip L. [American Biosciences, Boston, MA 02114 (United States); Zhang, Dawei; Sun, Yongtao [Department of Biochemistry, New York University School of Medicine, New York, NY 10016 (United States); Chen, Hao-Chia [Endocrinology and Reproduction Research Branch, National Institute of Child Health and Human Development, NIH, Bethesda, MD 20892 (United States); Zhang, John [Department of Chemistry, New York University, New York, NY 10003 (United States); Huang, Paul L. [Department of Medicine, Harvard Medical School and Massachusetts General Hospital, Boston, MA 02114 (United States); Kong, Xiang-Peng, E-mail: xiangpeng.kong@med.nyu.edu [Department of Biochemistry, New York University School of Medicine, New York, NY 10016 (United States); Lee-Huang, Sylvia, E-mail: sylvia.lee-huang@med.nyu.edu [Department of Biochemistry, New York University School of Medicine, New York, NY 10016 (United States)

2010-01-01

We report here the high-resolution atomic structures of GAP31 crystallized in the presence of HIV-LTR DNA oligonucleotides systematically designed to examine the adenosine glycosidase activity of this anti-HIV and anti-tumor plant protein. Structural analysis and molecular modeling lead to several novel findings. First, adenine is bound at the active site in the crystal structures of GAP31 to HIV-LTR duplex DNA with 5' overhanging adenosine ends, such as the 3'-processed HIV-LTR DNA but not to DNA duplex with blunt ends. Second, the active site pocket of GAP31 is ideally suited to accommodate the 5' overhanging adenosine of the 3'-processed HIV-LTR DNA and the active site residues are positioned to perform the adenosine glycosidase activity. Third, GAP31 also removes the 5'-end adenine from single-stranded HIV-LTR DNA oligonucleotide as well as any exposed adenosine, including that of single nucleotide dAMP but not from AMP. Fourth, GAP31 does not de-purinate guanosine from di-nucleotide GT. These results suggest that GAP31 has DNA adenosine glycosidase activity against accessible adenosine. This activity is distinct from the generally known RNA N-glycosidase activity toward the 28S rRNA. It may be an alternative function that contributes to the antiviral and anti-tumor activities of GAP31. These results provide molecular insights consistent with the anti-HIV mechanisms of GAP31 in its inhibition on the integration of viral DNA into the host genome by HIV-integrase as well as irreversible topological relaxation of the supercoiled viral DNA.

Physical interaction between components of DNA mismatch repair and nucleotide excision repair

International Nuclear Information System (INIS)

Bertrand, P.; Tishkoff, D.X.; Filosi, N.; Dasgupta, R.; Kolodner, R.D.

1998-01-01

Nucleotide excision repair (NER) and DNA mismatch repair are required for some common processes although the biochemical basis for this requirement is unknown. Saccharomyces cerevisiae RAD14 was identified in a two-hybrid screen using MSH2 as 'bait,' and pairwise interactions between MSH2 and RAD1, RAD2, RAD3, RAD10, RAD14, and RAD25 subsequently were demonstrated by two-hybrid analysis. MSH2 coimmunoprecipitated specifically with epitope-tagged versions of RAD2, RAD10, RAD14, and RAD25. MSH2 and RAD10 were found to interact in msh3 msh6 and mlh1 pms1 double mutants, suggesting a direct interaction with MSH2. Mutations in MSH2 increased the UV sensitivity of NER-deficient yeast strains, and msh2 mutations were epistatic to the mutator phenotype observed in NER-deficient strains. These data suggest that MSH2 and possibly other components of DNA mismatch repair exist in a complex with NER proteins, providing a biochemical and genetical basis for these proteins to function in common processes

Development of Prevotella intermedia-specific PCR primers based on the nucleotide sequences of a DNA probe Pig27.

Science.gov (United States)

Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki

2011-03-01

The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.

Identification of genes containing expanded purine repeats in the human genome and their apparent protective role against cancer.

Science.gov (United States)

Singh, Himanshu Narayan; Rajeswari, Moganty R

2016-01-01

Purine repeat sequences present in a gene are unique as they have high propensity to form unusual DNA-triple helix structures. Friedreich's ataxia is the only human disease that is well known to be associated with DNA-triplexes formed by purine repeats. The purpose of this study was to recognize the expanded purine repeats (EPRs) in human genome and find their correlation with cancer pathogenesis. We developed "PuRepeatFinder.pl" algorithm to identify non-overlapping EPRs without pyrimidine interruptions in the human genome and customized for searching repeat lengths, n ≥ 200. A total of 1158 EPRs were identified in the genome which followed Wakeby distribution. Two hundred and ninety-six EPRs were found in geneic regions of 282 genes (EPR-genes). Gene clustering of EPR-genes was done based on their cellular function and a large number of EPR-genes were found to be enzymes/enzyme modulators. Meta-analysis of 282 EPR-genes identified only 63 EPR-genes in association with cancer, mostly in breast, lung, and blood cancers. Protein-protein interaction network analysis of all 282 EPR-genes identified proteins including those in cadherins and VEGF. The two observations, that EPRs can induce mutations under malignant conditions and that identification of some EPR-gene products in vital cell signaling-mediated pathways, together suggest the crucial role of EPRs in carcinogenesis. The new link between EPR-genes and their functionally interacting proteins throws a new dimension in the present understanding of cancer pathogenesis and can help in planning therapeutic strategies. Validation of present results using techniques like NGS is required to establish the role of the EPR genes in cancer pathology.

Estimation of rumen microbial-nitrogen of sheep using urinary excretion of purine derivatives

International Nuclear Information System (INIS)

Liu Dasen; Shan Anshan

2004-01-01

Determination of rumen microbial-nitrogen of sheep using urinary excretion of purine derivative was studied. Uric acid and xanthine + hypoxanthine were not affected by diets, but total purine derivatives for 1 mg borax/kg diet was higher than other diets (p<0.05). Microbial-nitrogen estimated from allantoin was not affected by diets, but that of 1 mg borax/kg diet estimated from total purine derivatives was higher than other diets (p<0.05). Microbial-nitrogen estimated from total purine derivatives was higher than that from allantoin

Purine biosynthesis in archaea: variations on a theme

Directory of Open Access Journals (Sweden)

Brown Anne M

2011-12-01

Full Text Available Abstract Background The ability to perform de novo biosynthesis of purines is present in organisms in all three domains of life, reflecting the essentiality of these molecules to life. Although the pathway is quite similar in eukaryotes and bacteria, the archaeal pathway is more variable. A careful manual curation of genes in this pathway demonstrates the value of manual curation in archaea, even in pathways that have been well-studied in other domains. Results We searched the Integrated Microbial Genome system (IMG for the 17 distinct genes involved in the 11 steps of de novo purine biosynthesis in 65 sequenced archaea, finding 738 predicted proteins with sequence similarity to known purine biosynthesis enzymes. Each sequence was manually inspected for the presence of active site residues and other residues known or suspected to be required for function. Many apparently purine-biosynthesizing archaea lack evidence for a single enzyme, either glycinamide ribonucleotide formyltransferase or inosine monophosphate cyclohydrolase, suggesting that there are at least two more gene variants in the purine biosynthetic pathway to discover. Variations in domain arrangement of formylglycinamidine ribonucleotide synthetase and substantial problems in aminoimidazole carboxamide ribonucleotide formyltransferase and inosine monophosphate cyclohydrolase assignments were also identified. Manual curation revealed some overly specific annotations in the IMG gene product name, with predicted proteins without essential active site residues assigned product names implying enzymatic activity (21 proteins, 2.8% of proteins inspected or Enzyme Commission (E. C. numbers (57 proteins, 7.7%. There were also 57 proteins (7.7% assigned overly generic names and 78 proteins (10.6% without E.C. numbers as part of the assigned name when a specific enzyme name and E. C. number were well-justified. Conclusions The patchy distribution of purine biosynthetic genes in archaea is

Nucleotide sequence of cloned cDNA for human sphingolipid activator protein 1 precursor

International Nuclear Information System (INIS)

Dewji, N.N.; Wenger, D.A.; O'Brien, J.S.

1987-01-01

Two cDNA clones encoding prepro-sphingolipid activator protein 1 (SAP-1) were isolated from a λ gt11 human hepatoma expression library using polyclonal antibodies. These had inserts of ≅ 2 kilobases (λ-S-1.2 and λ-S-1.3) and both were both homologous with a previously isolated clone (λ-S-1.1) for mature SAP-1. The authors report here the nucleotide sequence of the longer two EcoRI fragments of S-1.2 and S-1.3 that were not the same and the derived amino acid sequences of mature SAP-1 and its prepro form. The open reading frame encodes 19 amino acids, which are colinear with the amino-terminal sequence of mature SAP-1, and extends far beyond the predicted carboxyl terminus of mature SAP-1, indicating extensive carboxyl-terminal processing. The nucleotide sequence of cDNA encoding prepro-SAP-1 includes 1449 bases from the assigned initiation codon ATG at base-pair 472 to the stop codon TGA at base-pair 1921. The first 23 amino acids coded after the initiation ATG are characteristic of a signal peptide. The calculated molecular mass for a polypeptide encoded by 1449 bases is ≅ 53 kDa, in keeping with the reported value for pro-SAP-1. The data indicate that after removal of the signal peptide mature SAP-1 is generated by removing an additional 7 amino acids from the amino terminus and ≅ 373 amino acids from the carboxyl terminus. One potential glycosylation site was previously found in mature SAP-1. Three additional potential glycosylation sites are present in the processed carboxyl-terminal polypeptide, which they designate as P-2

Purine derivate content and amino acid profile in larval stages of three edible insects.

Science.gov (United States)

Bednářová, Martina; Borkovcová, Marie; Komprda, Tomáš

2014-01-15

Considering their high content of protein, insects are a valuable alternative protein source. However, no evaluation of their purine content has so far been done. High content of purine derivates may lead to the exclusion of such food from the diet of people with specific diseases. The aim of this study was to analyse the content of selected purine derivates and amino acid profile in the three insect species most often used for entomophagy in Europe and compare them with the purine content in egg white and chicken breast. The content of individual purine derivates and their total content were significantly dependent on insect species. The purine content in all three species was significantly higher (P < 0.05) than in egg white, but some values were significantly lower (P < 0.05) than in chicken breast. The total protein content was 548.9 g kg(-1) dry matter (DM) in mealworm (Tenebrio molitor), 551.6 g kg(-1) DM in superworm (Zophobas atratus) and 564.9 g kg(-1) DM in cricket (Gryllus assimilis). Larvae of mealworm and superworm are protein-rich and purine-low meat alternatives. In contrast, cricket nymphs are protein-rich and purine-rich and cannot be recommended for people with hyperuricemia or gout. © 2013 Society of Chemical Industry.

Biological treatment in clarificated purines pilot plant; Depuracion biologica en plant piloto del clarificado de los purines

Energy Technology Data Exchange (ETDEWEB)

Bosque Hernandez, J. L. del; Martin Sanchez, J. L. [Universidad de Salamanca (Spain)

2004-07-01

With the purpose of eliminating the environmental problem that suppose the residuals, denominated. Purines, it is necessary to treat them so that they can take advantage. for it, in the part I of the work, the treatment that facilitates the operation of separation of the solid in suspension of the raw purin that allows to decrease the matter organic present in the liquid phase, settled down as well as, the increase of the power fertilizer in the solid phase. The part II of this investigation have as purpose the treatment of the phase it liquidates obtained previously to adapt it for their use like water of industrial type and the solid phase as fertilizer. (Author) 5 refs.

Condensing the information in DNA with double-headed nucleotides

DEFF Research Database (Denmark)

Hornum, Mick; Sharma, Pawan K; Reslow-Jacobsen, Charlotte

2017-01-01

A normal duplex holds as many Watson-Crick base pairs as the number of nucleotides in its constituent strands. Here we establish that single nucleotides can be designed to functionally imitate dinucleotides without compromising binding affinity. This effectively allows sequence information...

Curcumin stably interacts with DNA hairpin through minor groove binding and demonstrates enhanced cytotoxicity in combination with FdU nucleotides.

Science.gov (United States)

Ghosh, Supratim; Mallick, Sumana; Das, Upasana; Verma, Ajay; Pal, Uttam; Chatterjee, Sabyasachi; Nandy, Abhishek; Saha, Krishna D; Maiti, Nakul Chandra; Baishya, Bikash; Suresh Kumar, G; Gmeiner, William H

2018-03-01

We report, based on biophysical studies and molecular mechanical calculations that curcumin binds DNA hairpin in the minor groove adjacent to the loop region forming a stable complex. UV-Vis and fluorescence spectroscopy indicated interaction of curcumin with DNA hairpin. In this novel binding motif, two ɣ H of curcumin heptadiene chain are closely positioned to the A 16 -H8 and A 17 -H8, while G 12 -H8 is located in the close proximity of curcumin α H. Molecular dynamics (MD) simulations suggest, the complex is stabilized by noncovalent forces including; π-π stacking, H-bonding and hydrophobic interactions. Nuclear magnetic resonance (NMR) spectroscopy in combination with molecular dynamics simulations indicated curcumin is bound in the minor groove, while circular dichroism (CD) spectra suggested minute enhancement in base stacking and a little change in DNA helicity, without significant conformational change of DNA hairpin structure. The DNA:curcumin complex formed with FdU nucleotides rather than Thymidine, demonstrated enhanced cytotoxicity towards oral cancer cells relative to the only FdU substituted hairpin. Fluorescence co-localization demonstrated stability of the complex in biologically relevant conditions, including its cellular uptake. Acridine orange/EtBr staining further confirmed the enhanced cytotoxic effects of the complex, suggesting apoptosis as mode of cell death. Thus, curcumin can be noncovalently complexed to small DNA hairpin for cellular delivery and the complex showed increased cytotoxicity in combination with FdU nucleotides, demonstrating its potential for advanced cancer therapy. Copyright © 2017 Elsevier B.V. All rights reserved.

Synthesis of modified oligonucleotides that contain purine and pyrimidine radio-induced base lesions

International Nuclear Information System (INIS)

Romieu, Anthony

1999-01-01

Different factors as oxidizing or carcinogenesis agents, UV and ionizing radiations,.... can generate a wide, spectrum of DNA base damages. In order to study the biochemical and structural features of these DNA damages, it is important to prepare short DNA fragments (20 to 50 bases long) bearing a single or several modifications at specific sites in their sequences. The chemical synthesis is a powerful tool to prepare such modified DNA fragments. This work focusses on the chemical incorporation of several modified nucleosides formed in DNA by ionizing radiations or by photo-sensitization. The first part of this study describes the preparation of a phosphoramidite synthon of 5-hydroxy-2'-deoxyuridine and its subsequent incorporation into synthetic oligonucleotides ranging from 14 to 33 bases long. In a second part (chapters Ill and IV), the synthesis and incorporation of original radiation-induced tandem lesions: the carbon-bridged cyclo-nucleosides are presented. Both (5'R)- and (5'S) diastereomers of 5',8-cyclo-2'-deoxyadenosine and 5',8-cyclo-2'-deoxyguanosine have been individually inserted into various different oligonucleotides (3 to 22 bases long) by using the standard phosphoramidite chemistry. The chemical incorporation of a pyrimidine analogue: (5'S, 6S)-5',6-cyclo-5,6-dihydro-thymidine has been also achieved. The loss of aromaticity of this modified nucleoside and its poor reactivity required the development of a synthetic strategy entirely different from that used for the preparation and subsequent incorporation of the phosphoramidite synthons of 5',8-cyclo-purine-2'-deoxyribo-nucleosides. The third part of this study deals with the synthesis of a phosphoramidite synthon of 4-hydroxy-8-oxo-4,8-dihydro-2'-deoxyguanosine. The two (4R)- and (4S)- diastereomers of this oxidized purine have been separated and individually inserted in several synthetic DNA fragments. No epimerization of C-4 position was observed during the solid-phase synthesis and during the

Brain purine metabolism and xanthine dehydrogenase/oxidase conversion in hyperammonemia are under control of NMDA receptors and nitric oxide.

Science.gov (United States)

Kaminsky, Yury; Kosenko, Elena

2009-10-19

In hyperammonemia, a decrease in brain ATP can be a result of adenine nucleotide catabolism. Xanthine dehydrogenase (XD) and xanthine oxidase (XO) are the end steps in the purine catabolic pathway and directly involved in depletion of the adenylate pool in the cell. Besides, XD can easily be converted to XO to produce reactive oxygen species in the cell. In this study, the effects of acute ammonia intoxication in vivo on brain adenine nucleotide pool and xanthine and hypoxanthine, the end degradation products of adenine nucleotides, during the conversion of XD to XO were studied. Injection of rats with ammonium acetate was shown to lead to the dramatic decrease in the ATP level, adenine nucleotide pool size and adenylate energy charge and to the great increase in hypoxanthine and xanthine 11 min after the lethal dose indicating rapid degradation of adenylates. Conversion of XD to XO in hyperammonemic rat brain was evidenced by elevated XO/XD activity ratio. Injection of MK-801, a NMDA receptor blocker, prevented ammonia-induced catabolism of adenine nucleotides and conversion of XD to XO suggesting that in vivo these processes are mediated by activation of NMDA receptors. The in vitro dose-dependent effects of sodium nitroprusside, a NO donor, on XD and XO activities are indicative of the direct modification of the enzymes by nitric oxide. This is the first report evidencing the increase in brain xanthine and hypoxanthine levels and adenine nucleotide breakdown in acute ammonia intoxication and NMDA receptor-mediated prevention of these alterations.

Inhibition of non-templated nucleotide addition by DNA polymerases in primer extension using twisted intercalating nucleic acid modified templates

Czech Academy of Sciences Publication Activity Database

Güixens-Gallardo, Pedro; Hocek, Michal; Perlíková, Pavla

2016-01-01

Roč. 26, č. 2 (2016), s. 288-291 ISSN 0960-894X R&D Projects: GA ČR GBP206/12/G151 Institutional support: RVO:61388963 Keywords : DNA polymerases * nucleotide addition * primer extension * oligonucleotides * twisted intercalating nucleic acid Subject RIV: CC - Organic Chemistry Impact factor: 2.454, year: 2016

Purine biosynthesis de novo by lymphocytes in gout

International Nuclear Information System (INIS)

Kamoun, P.; Chanard, J.; Brami, M.; Funck-Brentano, J.L.

1978-01-01

A method of measurement in vitro of purine biosynthesis de novo in human circulating blood lymphocytes is proposed. The rate of early reactions of purine biosynthesis de novo was determined by the incorporation of [ 14 C]formate into N-formyl glycinamide ribonucleotide when the subsequent reactions of the metabolic pathway were completely inhibited by the antibiotic azaserine. Synthesis of 14 C-labelled N-formyl glycinamide ribonucleotide by lymphocytes was measured in healthy control subjects and patients with primary gout or hyperuricaemia secondary to renal failure, with or without allopurinol therapy. The average synthesis was higher in gouty patients without therapy than in control subjects, but the values contained overlap the normal range. In secondary hyperuricaemia the synthesis was at same value as in control subjects. These results are in agreement with the inconstant acceleration of purine biosynthesis de novo in gouty patients as seen by others with measurement of [ 14 C]glycine incorporation into urinary uric acid. (author)

Use of reiterative primer extension methodology to map UV-induced photoproducts at the nucleotide level in the laci gene from genomic DNA

International Nuclear Information System (INIS)

Chandrasekhar, D.; Houten, B. Van

1994-01-01

A newly developed reiterative primer extension assay has been employed to examine photoproduct formation and repair at the nucleotide level. Analysis of UV-induced DNA photoproduct hotspots in the first 184 base pairs of the laci genes of genomic E. coli DNA has revealed that photoproducts are formed linearly with dose and display a sequence-dependent increase. Generally, pyrimdine dimers were twice as frequent as all other UV-induced photoproducts. However, specific sites showed differing distributions. A post-irradiation recovery period revealed differences in the repair efficiency at individual nucleotides. Repair of photoproducts on the transcribed strand was generally twice as efficient as repair of photoproducts on the nontranscribed strand, indicating that strand-specific DNA repair occurs in the constitutively transcribed laci gene of E. coli. The UV-induced DNA photoproduct distribution following repair was well correlated with an established UV-induced mutation spectrum for wild-type E. coli cells. This analysis revealed that photoproduct hotspots on the efficiently repaired transcribed strand did not correlate with mutagenic hotspots. These data strongly support the hypothesis that mutations arise at inefficiently repaired sites on the nontranscribed strand

Metabolic Interactions of Purine Derivatives with Human ABC Transporter ABCG2: Genetic Testing to Assess Gout Risk.

Science.gov (United States)

Ishikawa, Toshihisa; Aw, Wanping; Kaneko, Kiyoko

2013-11-04

In mammals, excess purine nucleosides are removed from the body by breakdown in the liver and excretion from the kidneys. Uric acid is the end product of purine metabolism in humans. Two-thirds of uric acid in the human body is normally excreted through the kidney, whereas one-third undergoes uricolysis (decomposition of uric acid) in the gut. Elevated serum uric acid levels result in gout and could be a risk factor for cardiovascular disease and diabetes. Recent studies have shown that human ATP-binding cassette transporter ABCG2 plays a role of renal excretion of uric acid. Two non-synonymous single nucleotide polymorphisms (SNPs), i.e., 421C>A (major) and 376C>T (minor), in the ABCG2 gene result in impaired transport activity, owing to ubiquitination-mediated proteosomal degradation and truncation of ABCG2, respectively. These genetic polymorphisms are associated with hyperuricemia and gout. Allele frequencies of those SNPs are significantly higher in Asian populations than they are in African and Caucasian populations. A rapid and isothermal genotyping method has been developed to detect the SNP 421C>A, where one drop of peripheral blood is sufficient for the detection. Development of simple genotyping methods would serve to improve prevention and early therapeutic intervention for high-risk individuals in personalized healthcare.

Detecting deletions, insertions, and single nucleotide substitutions in cloned β-globin genes and new polymorphic nucleotide substitutions in β-globin genes in a Japanese population using ribonuclease cleavage at mismatches in RNA: DNA duplexes

International Nuclear Information System (INIS)

Hiyama, Keiko; Kodaira, Mieko; Satoh, Chiyoko.

1990-08-01

The applicability of ribonuclease (RNase) cleavage at mismatches in RNA:DNA duplexes (the RNase cleavage method) for determining nucleotide variant rates was examined in a Japanese population. DNA segments of various lengths obtained from four different regions of one normal and three thalassemic cloned human β-globin genes were inserted into transcription vectors. Sense and antisense RNA probes uniformly labeled with 32 P were prepared. When RNA probes of 771 nucleotides (nt) or less were hybridized with cloned DNAs and the resulting duplexes were treated with a mixture of RNases A and T1, the length of products agreed with theoretical values. Twelve possible mismatches were examined. Since both sense and antisense probes were used, uncleavable mismatches such as G:T and G:G which were made from one combination of RNA and DNA strands could be converted to the cleavable C:A and C:C mismatches, respectively, by using the opposite combination. Deletions and insertions of one (G), four(TTCT), five (ATTTT), and 10 (ATTTTATTTT) nt were easily detected. A polymorphic substitution of T to C at position 666 of the second intervening sequence (IVS2-666) of the β-globin gene was detected using genomic DNAs from cell lines established from the peripheral B lymphocytes of 59 unrelated Japanese from Hiroshima or those amplified by polymerase chain reaction (PCR). The frequency of the gene with C at the IVS2-666 (allele C) was 0.48 and that of the gene with T (allene T) was 0.52. Two new polymorphic substitutions of C to A and A to T were detected at nucleotide positions 1789 and 1945 from the capping site, respectively, using genomic DNAs amplified by PCR. We conclude that it would be feasible to use the RNase cleavage method combined with PCR for large-scale screening of variation in chromosomal DNA. (J.P.N.)

Structural and catalytic effects of an invariant purine substitution in the hammerhead ribozyme: implications for the mechanism of acid–base catalysis

Science.gov (United States)

Schultz, Eric P.; Vasquez, Ernesto E.; Scott, William G.

2014-01-01

The hammerhead ribozyme catalyzes RNA cleavage via acid–base catalysis. Whether it does so by general acid–base catalysis, in which the RNA itself donates and abstracts protons in the transition state, as is typically assumed, or by specific acid–base catalysis, in which the RNA plays a structural role and proton transfer is mediated by active-site water molecules, is unknown. Previous biochemical and crystallographic experiments implicate an invariant purine in the active site, G12, as the general base. However, G12 may play a structural role consistent with specific base catalysis. To better understand the role of G12 in the mechanism of hammerhead catalysis, a 2.2 Å resolution crystal structure of a hammerhead ribozyme from Schistosoma mansoni with a purine substituted for G12 in the active site of the ribozyme was obtained. Comparison of this structure (PDB entry 3zd4), in which A12 is substituted for G, with three previously determined structures that now serve as important experimental controls, allows the identification of structural perturbations that are owing to the purine substitution itself. Kinetic measurements for G12 purine-substituted schistosomal hammerheads confirm a previously observed dependence of rate on the pK a of the substituted purine; in both cases inosine, which is similar to G in pK a and hydrogen-bonding properties, is unexpectedly inactive. Structural comparisons indicate that this may primarily be owing to the lack of the exocyclic 2-amino group in the G12A and G12I substitutions and its structural effect upon both the nucleotide base and phosphate of A9. The latter involves the perturbation of a previously identified and well characterized metal ion-binding site known to be catalytically important in both minimal and full-length hammerhead ribozyme sequences. The results permit it to be suggested that G12 plays an important role in stabilizing the active-site structure. This result, although not inconsistent with the

Structural and catalytic effects of an invariant purine substitution in the hammerhead ribozyme: implications for the mechanism of acid-base catalysis.

Science.gov (United States)

Schultz, Eric P; Vasquez, Ernesto E; Scott, William G

2014-09-01

The hammerhead ribozyme catalyzes RNA cleavage via acid-base catalysis. Whether it does so by general acid-base catalysis, in which the RNA itself donates and abstracts protons in the transition state, as is typically assumed, or by specific acid-base catalysis, in which the RNA plays a structural role and proton transfer is mediated by active-site water molecules, is unknown. Previous biochemical and crystallographic experiments implicate an invariant purine in the active site, G12, as the general base. However, G12 may play a structural role consistent with specific base catalysis. To better understand the role of G12 in the mechanism of hammerhead catalysis, a 2.2 Å resolution crystal structure of a hammerhead ribozyme from Schistosoma mansoni with a purine substituted for G12 in the active site of the ribozyme was obtained. Comparison of this structure (PDB entry 3zd4), in which A12 is substituted for G, with three previously determined structures that now serve as important experimental controls, allows the identification of structural perturbations that are owing to the purine substitution itself. Kinetic measurements for G12 purine-substituted schistosomal hammerheads confirm a previously observed dependence of rate on the pK(a) of the substituted purine; in both cases inosine, which is similar to G in pK(a) and hydrogen-bonding properties, is unexpectedly inactive. Structural comparisons indicate that this may primarily be owing to the lack of the exocyclic 2-amino group in the G12A and G12I substitutions and its structural effect upon both the nucleotide base and phosphate of A9. The latter involves the perturbation of a previously identified and well characterized metal ion-binding site known to be catalytically important in both minimal and full-length hammerhead ribozyme sequences. The results permit it to be suggested that G12 plays an important role in stabilizing the active-site structure. This result, although not inconsistent with the potential

Purine Restriction Induces Pronounced Translational Upregulation of the NT1 Adenosine/Pyrimidine Nucleoside Transporter in Leishmania major

OpenAIRE

Ortiz, Diana; Valdés, Raquel; Sanchez, Marco A.; Hayenga, Johanna; Elya, Carolyn; Detke, Siegfried; Landfear, Scott M.

2010-01-01

Leishmania and other parasitic protozoa are unable to synthesize purines de novo and are reliant upon purine nucleoside and nucleobase transporters to import preformed purines from their hosts. To study the roles of the four purine permeases NT1-NT4 in Leishmania major, null mutants in each transporter gene were prepared and the effect of each gene deletion on purine uptake was monitored. Deletion of the NT3 purine nucleobase transporter gene or both NT3 and the NT2 nucleoside transporter gen...

An Expanding Role For Purine Uptake Permease (PUP -like Transporters In Plant Secondary Metabolism.

Directory of Open Access Journals (Sweden)

John G. Jelesko

2012-05-01

Full Text Available For the past decade, our understanding of the plant purine uptake permease (PUP transporter family of was primarily oriented on purine nucleobase substrates and their tissue-specific expression patterns in Arabidopsis. However, a tobacco PUP-like homolog demonstrating nicotine uptake permease (NUP activity was recently shown to affect both nicotine metabolism and root cell growth. These new findings expand the physiological role for PUP-like transporters to include plant secondary metabolism. Molecular evolution analyses of PUP-like transporters indicate they are distinct group within an ancient super family of drug and metabolite transporters (DMTs. The PUP-like family originated during terrestrial plant evolution sometime between the bryophytes and the lycophytes. A phylogenetic analysis indicates that the PUP-like transporters were likely were derived from a pre-existing nucleotide sugar transporter family within the DMT super family. Within the lycophyte Selaginella, there are three paralogous groups of PUP-like transporters. One of the three PUP-like paralogous groups showed an extensive pattern of gene duplication and diversification within the angiosperm lineage, whereas the other two more ancestral PUP-like paralogous groups did not. Biochemical characterization of four closely-related PUP-like paralogs together with model-based phylogenetic analyses indicate both subfunctionalization and neofunctionalization during the molecular evolution of angiosperm PUP-like transporters. These findings suggest that members of the PUP-like family of DMT transporters are likely involved in diverse primary and secondary plant metabolic pathways.

Efficiency and Fidelity of Human DNA Polymerases λ and β during Gap-Filling DNA Synthesis

Science.gov (United States)

Brown, Jessica A.; Pack, Lindsey R.; Sanman, Laura E.; Suo, Zucai

2010-01-01

The base excision repair (BER) pathway coordinates the replacement of 1 to 10 nucleotides at sites of single-base lesions. This process generates DNA substrates with various gap sizes which can alter the catalytic efficiency and fidelity of a DNA polymerase during gap-filling DNA synthesis. Here, we quantitatively determined the substrate specificity and base substitution fidelity of human DNA polymerase λ (Pol λ), an enzyme proposed to support the known BER DNA polymerase β (Pol β), as it filled 1- to 10-nucleotide gaps at 1-nucleotide intervals. Pol λ incorporated a correct nucleotide with relatively high efficiency until the gap size exceeded 9 nucleotides. Unlike Pol λ, Pol β did not have an absolute threshold on gap size as the catalytic efficiency for a correct dNTP gradually decreased as the gap size increased from 2 to 10 nucleotides and then recovered for non-gapped DNA. Surprisingly, an increase in gap size resulted in lower polymerase fidelity for Pol λ, and this downregulation of fidelity was controlled by its non-enzymatic N-terminal domains. Overall, Pol λ was up to 160-fold more error-prone than Pol β, thereby suggesting Pol λ would be more mutagenic during long gap-filling DNA synthesis. In addition, dCTP was the preferred misincorporation for Pol λ and its N-terminal domain truncation mutants. This nucleotide preference was shown to be dependent upon the identity of the adjacent 5′-template base. Our results suggested that both Pol λ and Pol β would catalyze nucleotide incorporation with the highest combination of efficiency and accuracy when the DNA substrate contains a single-nucleotide gap. Thus, Pol λ, like Pol β, is better suited to catalyze gap-filling DNA synthesis during short-patch BER in vivo, although, Pol λ may play a role in long-patch BER. PMID:20961817

Experimental and theoretical dipole moments of purines in their ground and lowest excited singlet states

Science.gov (United States)

Aaron, Jean-Jacques; Diabou Gaye, Mame; Párkányi, Cyril; Cho, Nam Sook; Von Szentpály, László

1987-01-01

The ground-state dipole moments of seven biologically important purines (purine, 6-chloropurine, 6-mercaptopurine, hypoxanthine, theobromine, theophylline and caffeine) were determined at 25°C in acetic acid (all the above compounds with the exception of purine) and in ethyl acetate (purine, theophylline and caffeine). Because of its low solubility, it was not possible to measure the dipole moment of uric acid. The first excited singlet-state dipole moments were obtained on the basis of the Bakhshiev and Chamma—Viallet equations using the variation of the Stokes shift with the solvent dielectric constant-refractive index term. The theoretical dipole moments for all the purines listed above and including uric acid were calculated by combining the use of the PPP (π-LCI-SCF-MO) method for the π-contribution to the overall dipole moment with the σ-contribution obtained as a vector sum of the σbond moments and group moments. The experimental and theoretical values were compared with the data available in the literature for some of the purines under study. For several purines, the calculations were carried out for different tautomeric forms. Excited singlet-state dipole moments are smaller than the ground-state values by 0.8 to 2.2 Debye units for all purines under study with the exception of 6-chloropurine. The effects of the structure upon the ground- and excited-state dipole moments of the purines are discussed.

Arabidopsis RNASE THREE LIKE2 Modulates the Expression of Protein-Coding Genes via 24-Nucleotide Small Interfering RNA-Directed DNA Methylation.

Science.gov (United States)

Elvira-Matelot, Emilie; Hachet, Mélanie; Shamandi, Nahid; Comella, Pascale; Sáez-Vásquez, Julio; Zytnicki, Matthias; Vaucheret, Hervé

2016-02-01

RNaseIII enzymes catalyze the cleavage of double-stranded RNA (dsRNA) and have diverse functions in RNA maturation. Arabidopsis thaliana RNASE THREE LIKE2 (RTL2), which carries one RNaseIII and two dsRNA binding (DRB) domains, is a unique Arabidopsis RNaseIII enzyme resembling the budding yeast small interfering RNA (siRNA)-producing Dcr1 enzyme. Here, we show that RTL2 modulates the production of a subset of small RNAs and that this activity depends on both its RNaseIII and DRB domains. However, the mode of action of RTL2 differs from that of Dcr1. Whereas Dcr1 directly cleaves dsRNAs into 23-nucleotide siRNAs, RTL2 likely cleaves dsRNAs into longer molecules, which are subsequently processed into small RNAs by the DICER-LIKE enzymes. Depending on the dsRNA considered, RTL2-mediated maturation either improves (RTL2-dependent loci) or reduces (RTL2-sensitive loci) the production of small RNAs. Because the vast majority of RTL2-regulated loci correspond to transposons and intergenic regions producing 24-nucleotide siRNAs that guide DNA methylation, RTL2 depletion modifies DNA methylation in these regions. Nevertheless, 13% of RTL2-regulated loci correspond to protein-coding genes. We show that changes in 24-nucleotide siRNA levels also affect DNA methylation levels at such loci and inversely correlate with mRNA steady state levels, thus implicating RTL2 in the regulation of protein-coding gene expression. © 2016 American Society of Plant Biologists. All rights reserved.

Important role of the nucleotide excision repair pathway in Mycobacterium smegmatis in conferring protection against commonly encountered DNA-damaging agents.

Science.gov (United States)

Kurthkoti, Krishna; Kumar, Pradeep; Jain, Ruchi; Varshney, Umesh

2008-09-01

Mycobacteria are an important group of human pathogens. Although the DNA repair mechanisms in mycobacteria are not well understood, these are vital for the pathogen's persistence in the host macrophages. In this study, we generated a null mutation in the uvrB gene of Mycobacterium smegmatis to allow us to compare the significance of the nucleotide excision repair (NER) pathway with two important base excision repair pathways, initiated by uracil DNA glycosylase (Ung) and formamidopyrimidine DNA glycosylase (Fpg or MutM), in an isogenic strain background. The strain deficient in NER was the most sensitive to commonly encountered DNA-damaging agents such as UV, low pH, reactive oxygen species, hypoxia, and was also sensitive to acidified nitrite. Taken together with previous observations on NER-deficient M. tuberculosis, these results suggest that NER is an important DNA repair pathway in mycobacteria.

Effect of point substitutions within the minimal DNA-binding domain of xeroderma pigmentosum group A protein on interaction with DNA intermediates of nucleotide excision repair.

Science.gov (United States)

Maltseva, E A; Krasikova, Y S; Naegeli, H; Lavrik, O I; Rechkunova, N I

2014-06-01

Xeroderma pigmentosum factor A (XPA) is one of the key proteins in the nucleotide excision repair (NER) process. The effects of point substitutions in the DNA-binding domain of XPA (positively charged lysine residues replaced by negatively charged glutamate residues: XPA K204E, K179E, K141E, and tandem mutant K141E/K179E) on the interaction of the protein with DNA structures modeling intermediates of the damage recognition and pre-incision stages in NER were analyzed. All these mutations decreased the affinity of the protein to DNA, the effect depending on the substitution and the DNA structure. The mutant as well as wild-type proteins bind with highest efficiency partly open damaged DNA duplex, and the affinity of the mutants to this DNA is reduced in the order: K204E > K179E > K141E = K141/179E. For all the mutants, decrease in DNA binding efficiency was more pronounced in the case of full duplex and single-stranded DNA than with bubble-DNA structure, the difference between protein affinities to different DNA structures increasing as DNA binding activity of the mutant decreased. No effect of the studied XPA mutations on the location of the protein on the partially open DNA duplex was observed using photoinduced crosslinking with 5-I-dUMP in different positions of the damaged DNA strand. These results combined with earlier published data suggest no direct correlation between DNA binding and activity in NER for these XPA mutants.

Synthesis of aldehyde-linked nucleotides and DNA and their bioconjugations with lysine and peptides through reductive amination.

Science.gov (United States)

Raindlová, Veronika; Pohl, Radek; Hocek, Michal

2012-03-26

5-(5-Formylthienyl)-, 5-(4-formylphenyl)- and 5-(2-fluoro-5-formylphenyl)cytosine 2'-deoxyribonucleoside mono- (dC(R)MP) and triphosphates (dC(R)TP) were prepared by aqueous Suzuki-Miyaura cross-coupling of 5-iodocytosine nucleotides with the corresponding formylarylboronic acids. The dC(R)TPs were excellent substrates for DNA polymerases and were incorporated into DNA by primer extension or PCR. Reductive aminations of the model dC(R)MPs with lysine or lysine-containing tripeptide were studied and optimized. In aqueous phosphate buffer (pH 6.7) the yields of the reductive aminations with tripeptide III were up to 25 %. Bioconjugation of an aldehyde-containing DNA with a lysine-containing tripeptide was achieved through reductive amination in yields of up to 90 % in aqueous phosphate buffer. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Versatile synthesis and biological evaluation of novel 3’-fluorinated purine nucleosides

Directory of Open Access Journals (Sweden)

Hang Ren

2015-12-01

Full Text Available A unified synthetic strategy accessing novel 3'-fluorinated purine nucleoside derivatives and their biological evaluation were achieved. Novel 3’-fluorinated analogues were constructed from a common 3’-deoxy-3’-fluororibofuranose intermediate. Employing Suzuki and Stille cross-coupling reactions, fifteen 3’-fluororibose purine nucleosides 1–15 and eight 3’-fluororibose 2-chloro/2-aminopurine nucleosides 16–23 with various substituents at position 6 of the purine ring were efficiently synthesized. Furthermore, 3’-fluorine analogs of natural products nebularine and 6-methylpurine riboside were constructed via our convergent synthetic strategy. Synthesized nucleosides were tested against HT116 (colon cancer and 143B (osteosarcoma cancer tumor cell lines. We have demonstrated 3’-fluorine purine nucleoside analogues display potent tumor cell growth inhibition activity at sub- or low micromolar concentration.

True Lies: The Double Life of the Nucleotide Excision Repair Factors in Transcription and DNA Repair

Directory of Open Access Journals (Sweden)

Nicolas Le May

2010-01-01

Full Text Available Nucleotide excision repair (NER is a major DNA repair pathway in eukaryotic cells. NER removes structurally diverse lesions such as pyrimidine dimers, arising upon UV irradiation or bulky chemical adducts, arising upon exposure to carcinogens and some chemotherapeutic drugs. NER defects lead to three genetic disorders that result in predisposition to cancers, accelerated aging, neurological and developmental defects. During NER, more than 30 polypeptides cooperate to recognize, incise, and excise a damaged oligonucleotide from the genomic DNA. Recent papers reveal an additional and unexpected role for the NER factors. In the absence of a genotoxic attack, the promoters of RNA polymerases I- and II-dependent genes recruit XPA, XPC, XPG, and XPF to initiate gene expression. A model that includes the growth arrest and DNA damage 45α protein (Gadd45α and the NER factors, in order to maintain the promoter of active genes under a hypomethylated state, has been proposed but remains controversial. This paper focuses on the double life of the NER factors in DNA repair and transcription and describes the possible roles of these factors in the RNA synthesis process.

Heat-transfer resistance at solid-liquid interfaces: a tool for the detection of single-nucleotide polymorphisms in DNA.

Science.gov (United States)

van Grinsven, Bart; Vanden Bon, Natalie; Strauven, Hannelore; Grieten, Lars; Murib, Mohammed; Monroy, Kathia L Jiménez; Janssens, Stoffel D; Haenen, Ken; Schöning, Michael J; Vermeeren, Veronique; Ameloot, Marcel; Michiels, Luc; Thoelen, Ronald; De Ceuninck, Ward; Wagner, Patrick

2012-03-27

In this article, we report on the heat-transfer resistance at interfaces as a novel, denaturation-based method to detect single-nucleotide polymorphisms in DNA. We observed that a molecular brush of double-stranded DNA grafted onto synthetic diamond surfaces does not notably affect the heat-transfer resistance at the solid-to-liquid interface. In contrast to this, molecular brushes of single-stranded DNA cause, surprisingly, a substantially higher heat-transfer resistance and behave like a thermally insulating layer. This effect can be utilized to identify ds-DNA melting temperatures via the switching from low- to high heat-transfer resistance. The melting temperatures identified with this method for different DNA duplexes (29 base pairs without and with built-in mutations) correlate nicely with data calculated by modeling. The method is fast, label-free (without the need for fluorescent or radioactive markers), allows for repetitive measurements, and can also be extended toward array formats. Reference measurements by confocal fluorescence microscopy and impedance spectroscopy confirm that the switching of heat-transfer resistance upon denaturation is indeed related to the thermal on-chip denaturation of DNA. © 2012 American Chemical Society

Nucleotide excision repair II: From yeast to mammals

NARCIS (Netherlands)

J.H.J. Hoeijmakers (Jan)

1993-01-01

textabstractAn intricate network of repair systems safeguards the integrity of genetic material, by eliminating DNA lesions induced by numerous environmental and endogenous genotoxic agents. Nucleotide excision repair (NER) is one of the most versatile DNA repair systems. Deficiencies in this

Metabolic Interactions of Purine Derivatives with Human ABC Transporter ABCG2: Genetic Testing to Assess Gout Risk

Directory of Open Access Journals (Sweden)

Kiyoko Kaneko

2013-11-01

Full Text Available In mammals, excess purine nucleosides are removed from the body by breakdown in the liver and excretion from the kidneys. Uric acid is the end product of purine metabolism in humans. Two-thirds of uric acid in the human body is normally excreted through the kidney, whereas one-third undergoes uricolysis (decomposition of uric acid in the gut. Elevated serum uric acid levels result in gout and could be a risk factor for cardiovascular disease and diabetes. Recent studies have shown that human ATP-binding cassette transporter ABCG2 plays a role of renal excretion of uric acid. Two non-synonymous single nucleotide polymorphisms (SNPs, i.e., 421C>A (major and 376C>T (minor, in the ABCG2 gene result in impaired transport activity, owing to ubiquitination-mediated proteosomal degradation and truncation of ABCG2, respectively. These genetic polymorphisms are associated with hyperuricemia and gout. Allele frequencies of those SNPs are significantly higher in Asian populations than they are in African and Caucasian populations. A rapid and isothermal genotyping method has been developed to detect the SNP 421C>A, where one drop of peripheral blood is sufficient for the detection. Development of simple genotyping methods would serve to improve prevention and early therapeutic intervention for high-risk individuals in personalized healthcare.

Purine Bases in Blood Plasma of Patients with Chronic Pulmonary Diseases

Directory of Open Access Journals (Sweden)

Larissa E. Muravluyova

2012-09-01

Full Text Available The article is focused on the study of purine bases and intermediates of purine catabolism in plasma of patients with chronic obstructive bronchitis and idiopathic interstitial pneumonia. Decrease of adenine and hypoxantine in plasma of patients with idiopathic interstitial pneumonia was registered. Increase of guanine in plasma of patients with chronic obstructive pulmonary disease was established.

Antioxidant effect of naturally occurring xanthines on the oxidative damage of DNA bases

Science.gov (United States)

Vieira, A. J. S. C.; Telo, J. P.; Pereira, H. F.; Patrocínio, P. F.; Dias, R. M. B.

1999-01-01

The repair of the oxidised radicals of adenine and guanosine by several naturally occurring xanthines was studied. Each pair of DNA purine/xanthine was made to react with the sulphate radical and the decrease of the concentration of both compounds was measured by HPLC as a function of irradiation time. The results show that xanthine efficiently prevents the oxidation of the two DNA purines. Theophyline and paraxanthine repair the oxidised radical of adenine but not the one from guanosine. Theobromine and caffeine do not show any protecting effect. An order of the oxidation potentials of all the purines studied is proposed. La réparation des radicaux oxydés de l'adénine et de la guanosine par des xanthines naturelles a été étudiée en soumettant chaque paire base de l'ADN/xanthine à l'oxydation par le radical sulfate et en mesurant par HPLC la disparition des deux composés en fonction du temps d'irradiation. Les résultats montrent que la xanthine joue un rôle protecteur efficace contre l'oxydation des deux purines de l'ADN. La théophyline et la paraxanthine réparent le radical oxydé de l'adénine mais pas celui de la guanosine. La théobromine et la cafeíne n'ont pas d'effet protecteur. Un ordre de potentiels d'oxydation des purines étudiées est proposé.

Purines and Neuronal Excitability: Links to the Ketogenic Diet

Science.gov (United States)

Masino, SA; Kawamura, M; Ruskin, DN; Geiger, JD; Boison, D

2011-01-01

ATP and adenosine are purines that play dual roles in cell metabolism and neuronal signaling. Acting at the A1 receptor (A1R) subtype, adenosine acts directly on neurons to inhibit excitability and is a powerful endogenous neuroprotective and anticonvulsant molecule. Previous research showed an increase in ATP and other cell energy parameters when an animal is administered a ketogenic diet, an established metabolic therapy to reduce epileptic seizures, but the relationship among purines, neuronal excitability and the ketogenic diet was unclear. Recent work in vivo and in vitro tested the specific hypothesis that adenosine acting at A1Rs is a key mechanism underlying the success of ketogenic diet therapy and yielded direct evidence linking A1Rs to the antiepileptic effects of a ketogenic diet. Specifically, an in vitro mimic of a ketogenic diet revealed an A1R-dependent metabolic autocrine hyperpolarization of hippocampal neurons. In parallel, applying the ketogenic diet in vivo to transgenic mouse models with spontaneous electrographic seizures revealed that intact A1Rs are necessary for the seizure-suppressing effects of the diet. This is the first direct in vivo evidence linking A1Rs to the antiepileptic effects of a ketogenic diet. Other predictions of the relationship between purines and the ketogenic diet are discussed. Taken together, recent research on the role of purines may offer new opportunities for metabolic therapy and insight into its underlying mechanisms. PMID:21880467

Direct N9-arylation of purines with aryl halides

DEFF Research Database (Denmark)

Larsen, Anders Foller; Ulven, Trond

2014-01-01

An efficient method for N-arylation of purines is reported. The N-arylation is catalysed by Cu(i) and 4,7-bis(2-hydroxyethylamino)-1,10-phenanthroline (BHPhen) in aqueous DMF or ethanol. The reaction generally proceeds with high selectivity for the N(9)-position.......An efficient method for N-arylation of purines is reported. The N-arylation is catalysed by Cu(i) and 4,7-bis(2-hydroxyethylamino)-1,10-phenanthroline (BHPhen) in aqueous DMF or ethanol. The reaction generally proceeds with high selectivity for the N(9)-position....

In-silico single nucleotide polymorphisms (SNP) mining of Sorghum ...

African Journals Online (AJOL)

Single nucleotide polymorphisms (SNPs) may be considered the ultimate genetic markers as they represent the finest resolution of a DNA sequence (a single nucleotide), and are generally abundant in populations with a low mutation rate. SNPs are important tools in studying complex genetic traits and genome evolution.

Purines and Carotid Body: New Roles in Pathological Conditions

Directory of Open Access Journals (Sweden)

Silvia V. Conde

2017-12-01

Full Text Available It is known that adenosine and adenosine-5′-triphosphate (ATP are excitatory mediators involved in carotid body (CB hypoxic signaling. The CBs are peripheral chemoreceptors classically defined by O2, CO2, and pH sensors. When hypoxia activates the CB, it induces the release of neurotransmitters from chemoreceptor cells leading to an increase in the action potentials frequency at the carotid sinus nerve (CSN. This increase in the firing frequency of the CSN is integrated in the brainstem to induce cardiorespiratory compensatory responses. In the last decade several pathologies, as, hypertension, diabetes, obstructive sleep apnea and heart failure have been associated with CB overactivation. In the first section of the present manuscript we review in a concise manner fundamental aspects of purine metabolism. The second section is devoted to the role of purines on the hypoxic response of the CB, providing the state-of-the art for the presence of adenosine and ATP receptors in the CB; for the role of purines at presynaptic level in CB chemoreceptor cells, as well as, its metabolism and regulation; at postsynaptic level in the CSN activity; and on the ventilatory responses to hypoxia. Recently, we have showed that adenosine is involved in CB hypersensitization during chronic intermittent hypoxia (CIH, which mimics obstructive sleep apnea, since caffeine, a non-selective adenosine receptor antagonist that inhibits A2A and A2B adenosine receptors, decreased CSN chemosensory activity in animals subjected to CIH. Apart from this involvement of adenosine in CB sensitization in sleep apnea, it was recently found that P2X3 ATP receptor in the CB contributes to increased chemoreflex hypersensitivity and hypertension in spontaneously hypertension rats. Therefore the last section of this manuscript is devoted to review the recent findings on the role of purines in CB-mediated pathologies as hypertension, diabetes and sleep apnea emphasizing the potential

Mitochondrial DNA single nucleotide polymorphism associated with weight estimated breeding values in Nelore cattle (Bos indicus

Directory of Open Access Journals (Sweden)

Fernando Henrique Biase

2007-01-01

Full Text Available We sampled 119 Nelore cattle (Bos indicus, 69 harboring B. indicus mtDNA plus 50 carrying Bos taurus mtDNA, to estimate the frequencies of putative mtDNA single nucleotide polymorphisms (SNPs and investigate their association with Nelore weight and scrotal circumference estimated breeding values (EBVs. The PCR restriction fragment length polymorphism (PCR-RFLP method was used to detect polymorphisms in the mitochondrial asparagine, cysteine, glycine, leucine and proline transporter RNA (tRNA genes (tRNAasn, tRNAcys, tRNAgly, tRNAleu and tRNApro. The 50 cattle carrying B. taurus mtDNA were monomorphic for all the tRNA gene SNPs analyzed, suggesting that they are specific to mtDNA from B. indicus cattle. No tRNAcys or tRNAgly polymorphisms were detected in any of the cattle but we did detect polymorphic SNPs in the tRNAasn, tRNAleu and tRNApro genes in the cattle harboring B. indicus mtDNA, with the same allele observed in the B. taurus sequence being present in the following percentage of cattle harboring B. indicus mtDNA: 72.46% for tRNAasn, 95.23% for tRNAleu and 90.62% for tRNApro. Analyses of variance using the tRNAasn SNP as the independent variable and EBVs as the dependent variable showed that the G -> T SNP was significantly associated (p < 0.05 with maternal EBVs for weight at 120 and 210 days (p < 0.05 and animal's EBVs for weight at 210, 365 and 455 days. There was no association of the tRNAasn SNP with the scrotal circumference EBVs. These results confirm that mtDNA can affect weight and that mtDNA polymorphisms can be a source of genetic variation for quantitative traits.

Metabolism of xanthine and hypoxanthine in the tea plant (Thea sinensis L.).

Science.gov (United States)

Suzuki, T; Takahashi, E

1975-01-01

1. The metabolism of xanthine and hypoxanthine in excised shoot tips of tea was studied with micromolar amounts of [2(-14)C]xanthine or [8(-14)C]hypoxanthine. Almost all of the radioactive compounds supplied were utilized by tea shoot tips by 30 h after their uptake. 2. The main products of [2(-14)C]xanthine and [8(-14)C]hypoxanthine metabolism in tea shoots were urea, allantoin and allantoic acid. There was also incorporation of the label into theobromine, caffeine and RNA purine nucleotides. 3. The results indicate that tea plants can catabolize purine bases by the same pathways as animals. It is also suggested that tea plants have the ability to snythesize purine nucleotides from glycine by the pathways of purine biosynthesis de novo and from hypoxanthine and xanthine by the pathway of purine salvage. 4. The results of incorporation of more radioactivity from [8(-14)C]hypoxanthine than from [2(-14)C]xanthine into RNA purine nucleotides and caffeine suggest that hypoxanthine is a more effective precursor of caffeine biosynthesis than xanthine. The formation of caffeine from hypoxanthine is a result of nucleotide synthesis via the pathway of purine salvage. PMID:1147906

A Cascade of Thermophilic Enzymes As an Approach to the Synthesis of Modified Nucleotides.

Science.gov (United States)

Esipov, R S; Abramchik, Yu A; Fateev, I V; Konstantinova, I D; Kostromina, M A; Muravyova, T I; Artemova, K G; Miroshnikov, A I

2016-01-01

We propose a new approach for the synthesis of biologically important nucleotides which includes a multi-enzymatic cascade conversion of D -pentoses into purine nucleotides. The approach exploits nucleic acid exchange enzymes from thermophilic microorganisms: ribokinase, phosphoribosylpyrophosphate synthetase, and adenine phosphoribosyltransferase. We cloned the ribokinase gene from Thermus sp . 2.9, as well as two different genes of phosphoribosylpyrophosphate synthetase (PRPP-synthetase) and the adenine phosphoribosyltransferase (APR-transferase) gene from Thermus thermophilus HB27 into the expression vectors, generated high-yield E. coli producer strains, developed methods for the purification of the enzymes, and investigated enzyme substrate specificity. The enzymes were used for the conversion of D -pentoses into 5-phosphates that were further converted into 5-phospho-α- D -pentofuranose 1-pyrophosphates by means of ribokinase and PRPP-synthetases. Target nucleotides were obtained through the condensation of the pyrophosphates with adenine and its derivatives in a reaction catalyzed by APR-transferase. 2-Chloro- and 2-fluoroadenosine monophosphates were synthesized from D -ribose and appropriate heterobases in one pot using a system of thermophilic enzymes in the presence of ATP, ribokinase, PRPP-synthetase, and APR-transferase.

Purine restriction induces pronounced translational upregulation of the NT1 adenosine/pyrimidine nucleoside transporter in Leishmania major.

Science.gov (United States)

Ortiz, Diana; Valdés, Raquel; Sanchez, Marco A; Hayenga, Johanna; Elya, Carolyn; Detke, Siegfried; Landfear, Scott M

2010-10-01

Leishmania and other parasitic protozoa are unable to synthesize purines de novo and are reliant upon purine nucleoside and nucleobase transporters to import preformed purines from their hosts. To study the roles of the four purine permeases NT1-NT4 in Leishmania major, null mutants in each transporter gene were prepared and the effect of each gene deletion on purine uptake was monitored. Deletion of the NT3 purine nucleobase transporter gene or both NT3 and the NT2 nucleoside transporter gene resulted in pronounced upregulation of adenosine and uridine uptake mediated by the NT1 permease and also induced up to a 200-fold enhancement in the level of the NT1 protein but not mRNA. A similar level of upregulation of NT1 was achieved in wild-type promastigotes that were transferred to medium deficient in purines. Pulse labelling and treatment of cells with the translation inhibitor cycloheximide revealed that control of NT1 expression occurs primarily at the level of translation and not protein turnover. These observations imply the existence of a translational control mechanism that enhances the ability of Leishmania parasites to import essential purines when they are present at limiting concentrations. © 2010 Blackwell Publishing Ltd.

Nucleotide excision repair in the test tube.

NARCIS (Netherlands)

N.G.J. Jaspers (Nicolaas); J.H.J. Hoeijmakers (Jan)

1995-01-01

textabstractThe eukaryotic nucleotide excision-repair pathway has been reconstituted in vitro, an achievement that should hasten the full enzymological characterization of this highly complex DNA-repair pathway.

Genome-wide screening for genes whose deletions confer sensitivity to mutagenic purine base analogs in yeast

Directory of Open Access Journals (Sweden)

Kozmin Stanislav G

2005-06-01

Full Text Available Abstract Background N-hydroxylated base analogs, such as 6-hydroxylaminopurine (HAP and 2-amino-6-hydroxylaminopurine (AHA, are strong mutagens in various organisms due to their ambiguous base-pairing properties. The systems protecting cells from HAP and related noncanonical purines in Escherichia coli include specialized deoxyribonucleoside triphosphatase RdgB, DNA repair endonuclease V, and a molybdenum cofactor-dependent system. Fewer HAP-detoxification systems have been identified in yeast Saccharomyces cerevisiae and other eukaryotes. Cellular systems protecting from AHA are unknown. In the present study, we performed a genome-wide search for genes whose deletions confer sensitivity to HAP and AHA in yeast. Results We screened the library of yeast deletion mutants for sensitivity to the toxic and mutagenic action of HAP and AHA. We identified novel genes involved in the genetic control of base analogs sensitivity, including genes controlling purine metabolism, cytoskeleton organization, and amino acid metabolism. Conclusion We developed a method for screening the yeast deletion library for sensitivity to the mutagenic and toxic action of base analogs and identified 16 novel genes controlling pathways of protection from HAP. Three of them also protect from AHA.

The immunosuppressives FK 506 and cyclosporin A inhibit the generation of protein factors binding to the two purine boxes of the interleukin 2 enhancer.

Science.gov (United States)

Brabletz, T; Pietrowski, I; Serfling, E

1991-01-11

Like Cyclosporin A (CsA), the macrolide FK 506 is a potent immunosuppressive that inhibits early steps of T cell activation, including the synthesis of Interleukin 2 (II-2) and numerous other lymphokines. The block of II-2 synthesis occurs at the transcriptional level. At concentrations that block T cell activation, FK 506 and CsA inhibit the proto-enhancer activity of Purine boxes of the II-2 promoter and the generation of lymphocyte-specific factors binding to the Purine boxes. Under the same conditions, the DNA binding of other II-2 enhancer factors remains unaffected by both compounds. These results support the view that FK 506 and CsA, which both inhibit the activity of peptidylprolyl cis/trans isomerases, suppress T cell activation by a similar, if not identical mechanism.

Antioxidant effect of naturally occurring xanthines on the oxidative damage of DNA bases; Effet antioxydant de xanthines naturelles sur le dommage oxydant des bases de l`ADN

Energy Technology Data Exchange (ETDEWEB)

Vieira, A.J.S.C.; Telo, J.P.; Pereira, H.F.; Patrocinio, P.F. [Instituto Superior Tecnico, Lisbon (Portugal); Dias, R.M.B. [Instituto Tecnologico e Nuclear, Sacavem codex (Portugal). Dept. de Quimica

1999-01-01

The repair of the oxidised radicals of adenine and guanosine by several naturally occurring xanthines was studied. Each pair of DNA purine/xanthine was made to react with the sulphate radical and the decrease of the concentration of both compounds was measured by HPLC as a function of irradiation time. The results show that xanthine efficiently prevents the oxidation of the two DNA purines. Theophylline and para-xanthine repair the oxidizes radical of adenine but not the one from guanosine. Theobromine and caffeine to do not show any protecting effect. An order of the oxidation potentials of all the purines studied is proposed. (authors) 10 refs.

Are glutathione S transferases involved in DNA damage signalling? Interactions with DNA damage and repair revealed from molecular epidemiology studies

International Nuclear Information System (INIS)

Dusinska, Maria; Staruchova, Marta; Horska, Alexandra; Smolkova, Bozena; Collins, Andrew; Bonassi, Stefano; Volkovova, Katarina

2012-01-01

Glutathione S-transferases (GSTs) are members of a multigene family of isoenzymes that are important in the control of oxidative stress and in phase II metabolism. Acting non-enzymically, GSTs can modulate signalling pathways of cell proliferation, cell differentiation and apoptosis. Using a molecular epidemiology approach, we have investigated a potential involvement of GSTs in DNA damage processing, specifically the modulation of DNA repair in a group of 388 healthy adult volunteers; 239 with at least 5 years of occupational exposure to asbestos, stone wool or glass fibre, and 149 reference subjects. We measured DNA damage in lymphocytes using the comet assay (alkaline single cell gel electrophoresis): strand breaks (SBs) and alkali-labile sites, oxidised pyrimidines with endonuclease III, and oxidised purines with formamidopyrimidine DNA glycosylase. We also measured GST activity in erythrocytes, and the capacity for base excision repair (BER) in a lymphocyte extract. Polymorphisms in genes encoding three GST isoenzymes were determined, namely deletion of GSTM1 and GSTT1 and single nucleotide polymorphism Ile105Val in GSTP1. Consumption of vegetables and wine correlated negatively with DNA damage and modulated BER. GST activity correlated with oxidised bases and with BER capacity, and differed depending on polymorphisms in GSTP1, GSTT1 and GSTM1. A significantly lower BER rate was associated with the homozygous GSTT1 deletion in all asbestos site subjects and in the corresponding reference group. Multifactorial analysis revealed effects of sex and exposure in GSTP1 Ile/Val heterozygotes but not in Ile/Ile homozygotes. These variants affected also SBs levels, mainly by interactions of GSTP1 genotype with exposure, with sex, and with smoking habit; and by an interaction between sex and smoking. Our results show that GST polymorphisms and GST activity can apparently influence DNA stability and repair of oxidised bases, suggesting a potential new role for these

Are glutathione S transferases involved in DNA damage signalling? Interactions with DNA damage and repair revealed from molecular epidemiology studies

Energy Technology Data Exchange (ETDEWEB)

Dusinska, Maria, E-mail: Maria.DUSINSKA@nilu.no [CEE-Health Effects Group, NILU - Norwegian Institute for Air Research, Kjeller (Norway); Staruchova, Marta; Horska, Alexandra [Department of Experimental and Applied Genetics, Slovak Medical University, Bratislava (Slovakia); Smolkova, Bozena [Laboratory of Cancer Genetics, Cancer Research Institute of the Slovak Academy of Sciences, Bratislava (Slovakia); Collins, Andrew [Department of Nutrition, Faculty of Medicine, University of Oslo (Norway); Bonassi, Stefano [Unit of Clinical and Molecular Epidemiology, IRCCS San Raffaele Pisana, Rome (Italy); Volkovova, Katarina [Department of Experimental and Applied Genetics, Slovak Medical University, Bratislava (Slovakia)

2012-08-01

Glutathione S-transferases (GSTs) are members of a multigene family of isoenzymes that are important in the control of oxidative stress and in phase II metabolism. Acting non-enzymically, GSTs can modulate signalling pathways of cell proliferation, cell differentiation and apoptosis. Using a molecular epidemiology approach, we have investigated a potential involvement of GSTs in DNA damage processing, specifically the modulation of DNA repair in a group of 388 healthy adult volunteers; 239 with at least 5 years of occupational exposure to asbestos, stone wool or glass fibre, and 149 reference subjects. We measured DNA damage in lymphocytes using the comet assay (alkaline single cell gel electrophoresis): strand breaks (SBs) and alkali-labile sites, oxidised pyrimidines with endonuclease III, and oxidised purines with formamidopyrimidine DNA glycosylase. We also measured GST activity in erythrocytes, and the capacity for base excision repair (BER) in a lymphocyte extract. Polymorphisms in genes encoding three GST isoenzymes were determined, namely deletion of GSTM1 and GSTT1 and single nucleotide polymorphism Ile105Val in GSTP1. Consumption of vegetables and wine correlated negatively with DNA damage and modulated BER. GST activity correlated with oxidised bases and with BER capacity, and differed depending on polymorphisms in GSTP1, GSTT1 and GSTM1. A significantly lower BER rate was associated with the homozygous GSTT1 deletion in all asbestos site subjects and in the corresponding reference group. Multifactorial analysis revealed effects of sex and exposure in GSTP1 Ile/Val heterozygotes but not in Ile/Ile homozygotes. These variants affected also SBs levels, mainly by interactions of GSTP1 genotype with exposure, with sex, and with smoking habit; and by an interaction between sex and smoking. Our results show that GST polymorphisms and GST activity can apparently influence DNA stability and repair of oxidised bases, suggesting a potential new role for these

Functionalized Solid Electrodes for Electrochemical Biosensing of Purine Nucleobases and Their Analogues: A Review

Czech Academy of Sciences Publication Activity Database

Sharma, V.K.; Jelen, František; Trnková, L.

2015-01-01

Roč. 15, č. 1 (2015), s. 1564-1600 ISSN 1424-8220 Institutional support: RVO:68081707 Keywords : purine derivatives * electrochemistry of purines * carbon electrode Subject RIV: BO - Biophysics Impact factor: 2.033, year: 2015

Different characteristics and nucleotide binding properties of inosine monophosphate dehydrogenase (IMPDH isoforms.

Directory of Open Access Journals (Sweden)

Elaine C Thomas

Full Text Available We recently reported that Inosine Monophosphate Dehydrogenase (IMPDH, a rate-limiting enzyme in de novo guanine nucleotide biosynthesis, clustered into macrostructures in response to decreased nucleotide levels and that there were differences between the IMPDH isoforms, IMPDH1 and IMPDH2. We hypothesised that the Bateman domains, which are present in both isoforms and serve as energy-sensing/allosteric modules in unrelated proteins, would contribute to isoform-specific differences and that mutations situated in and around this domain in IMPDH1 which give rise to retinitis pigmentosa (RP would compromise regulation. We employed immuno-electron microscopy to investigate the ultrastructure of IMPDH macrostructures and live-cell imaging to follow clustering of an IMPDH2-GFP chimera in real-time. Using a series of IMPDH1/IMPDH2 chimera we demonstrated that the propensity to cluster was conferred by the N-terminal 244 amino acids, which includes the Bateman domain. A protease protection assay suggested isoform-specific purine nucleotide binding characteristics, with ATP protecting IMPDH1 and AMP protecting IMPDH2, via a mechanism involving conformational changes upon nucleotide binding to the Bateman domain without affecting IMPDH catalytic activity. ATP binding to IMPDH1 was confirmed in a nucleotide binding assay. The RP-causing mutation, R224P, abolished ATP binding and nucleotide protection and this correlated with an altered propensity to cluster. Collectively these data demonstrate that (i the isoforms are differentially regulated by AMP and ATP by a mechanism involving the Bateman domain, (ii communication occurs between the Bateman and catalytic domains and (iii the RP-causing mutations compromise such regulation. These findings support the idea that the IMPDH isoforms are subject to distinct regulation and that regulatory defects contribute to human disease.

Sequence dependence of electron-induced DNA strand breakage revealed by DNA nanoarrays

DEFF Research Database (Denmark)

Keller, Adrian; Rackwitz, Jenny; Cauët, Emilie

2014-01-01

The electronic structure of DNA is determined by its nucleotide sequence, which is for instance exploited in molecular electronics. Here we demonstrate that also the DNA strand breakage induced by low-energy electrons (18 eV) depends on the nucleotide sequence. To determine the absolute cross sec...

Synthesis of analogues of purine nucleotides selectively labeled by tritium on the C-8 of the purine ring and evaluation of the stability of tritium label

Czech Academy of Sciences Publication Activity Database

Elbert, Tomáš

2010-01-01

Roč. 53, č. 3 (2010), s. 156-157 ISSN 0362-4803. [Workshop of the International Isotope Society - Central European Division. The Synthesis and applications of Isotopes and Isotopically Labelled Compounds /16./. 01.10.2009-02.10.2009, Bad Soden] Institutional research plan: CEZ:AV0Z40550506 Keywords : acyclic nucleotide analogues * tritium Subject RIV: CC - Organic Chemistry

JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures.

Science.gov (United States)

Shi, Jieming; Li, Xi; Dong, Min; Graham, Mitchell; Yadav, Nehul; Liang, Chun

2017-01-01

Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html.

JNSViewer—A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures

Science.gov (United States)

Dong, Min; Graham, Mitchell; Yadav, Nehul

2017-01-01

Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome) were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html. PMID:28582416

JNSViewer-A JavaScript-based Nucleotide Sequence Viewer for DNA/RNA secondary structures.

Directory of Open Access Journals (Sweden)

Jieming Shi

Full Text Available Many tools are available for visualizing RNA or DNA secondary structures, but there is scarce implementation in JavaScript that provides seamless integration with the increasingly popular web computational platforms. We have developed JNSViewer, a highly interactive web service, which is bundled with several popular tools for DNA/RNA secondary structure prediction and can provide precise and interactive correspondence among nucleotides, dot-bracket data, secondary structure graphs, and genic annotations. In JNSViewer, users can perform RNA secondary structure predictions with different programs and settings, add customized genic annotations in GFF format to structure graphs, search for specific linear motifs, and extract relevant structure graphs of sub-sequences. JNSViewer also allows users to choose a transcript or specific segment of Arabidopsis thaliana genome sequences and predict the corresponding secondary structure. Popular genome browsers (i.e., JBrowse and BrowserGenome were integrated into JNSViewer to provide powerful visualizations of chromosomal locations, genic annotations, and secondary structures. In addition, we used StructureFold with default settings to predict some RNA structures for Arabidopsis by incorporating in vivo high-throughput RNA structure profiling data and stored the results in our web server, which might be a useful resource for RNA secondary structure studies in plants. JNSViewer is available at http://bioinfolab.miamioh.edu/jnsviewer/index.html.

Single Nucleotide Polymorphism

DEFF Research Database (Denmark)

Børsting, Claus; Pereira, Vania; Andersen, Jeppe Dyrberg

2014-01-01

Single nucleotide polymorphisms (SNPs) are the most frequent DNA sequence variations in the genome. They have been studied extensively in the last decade with various purposes in mind. In this chapter, we will discuss the advantages and disadvantages of using SNPs for human identification...... of SNPs. This will allow acquisition of more information from the sample materials and open up for new possibilities as well as new challenges....

Role of oxidative DNA damage in genome instability and cancer

International Nuclear Information System (INIS)

Bignami, M.; Kunkel, T.

2009-01-01

Inactivation of mismatch repair (MMR) is associated with a dramatic genomic instability that is observed experimentally as a mutator phenotype and micro satellite instability (MSI). It has been implicit that the massive genetic instability in MMR defective cells simply reflects the accumulation of spontaneous DNA polymerase errors during DNA replication. We recently identified oxidation damage, a common threat to DNA integrity to which purines are very susceptible, as an important cofactor in this genetic instability

Molecular and biochemical characterization of caffeine synthase and purine alkaloid concentration in guarana fruit.

Science.gov (United States)

Schimpl, Flávia Camila; Kiyota, Eduardo; Mayer, Juliana Lischka Sampaio; Gonçalves, José Francisco de Carvalho; da Silva, José Ferreira; Mazzafera, Paulo

2014-09-01

Guarana seeds have the highest caffeine concentration among plants accumulating purine alkaloids, but in contrast with coffee and tea, practically nothing is known about caffeine metabolism in this Amazonian plant. In this study, the levels of purine alkaloids in tissues of five guarana cultivars were determined. Theobromine was the main alkaloid that accumulated in leaves, stems, inflorescences and pericarps of fruit, while caffeine accumulated in the seeds and reached levels from 3.3% to 5.8%. In all tissues analysed, the alkaloid concentration, whether theobromine or caffeine, was higher in young/immature tissues, then decreasing with plant development/maturation. Caffeine synthase activity was highest in seeds of immature fruit. A nucleotide sequence (PcCS) was assembled with sequences retrieved from the EST database REALGENE using sequences of caffeine synthase from coffee and tea, whose expression was also highest in seeds from immature fruit. The PcCS has 1083bp and the protein sequence has greater similarity and identity with the caffeine synthase from cocoa (BTS1) and tea (TCS1). A recombinant PcCS allowed functional characterization of the enzyme as a bifunctional CS, able to catalyse the methylation of 7-methylxanthine to theobromine (3,7-dimethylxanthine), and theobromine to caffeine (1,3,7-trimethylxanthine), respectively. Among several substrates tested, PcCS showed higher affinity for theobromine, differing from all other caffeine synthases described so far, which have higher affinity for paraxanthine. When compared to previous knowledge on the protein structure of coffee caffeine synthase, the unique substrate affinity of PcCS is probably explained by the amino acid residues found in the active site of the predicted protein. Copyright © 2014 Elsevier Ltd. All rights reserved.

Genetics Home Reference: purine nucleoside phosphorylase deficiency

Science.gov (United States)

... the expand/collapse boxes. Description Purine nucleoside phosphorylase deficiency is one of several disorders that damage the immune system and cause severe combined immunodeficiency (SCID). People with SCID lack virtually all immune protection from foreign invaders such as bacteria, viruses, and ...

Ethanol-induced activation of adenine nucleotide turnover. Evidence for a role of acetate

International Nuclear Information System (INIS)

Puig, J.G.; Fox, I.H.

1984-01-01

Consumption of alcohol causes hyperuricemia by decreasing urate excretion and increasing its production. Our previous studies indicate that ethanol administration increases uric acid production by increasing ATP degradation to uric acid precursors. To test the hypothesis that ethanol-induced increased urate production results from acetate metabolism and enhanced adenosine triphosphate turnover, we gave intravenous sodium acetate, sodium chloride and ethanol (0.1 mmol/kg per min for 1 h) to five normal subjects. Acetate plasma levels increased from 0.04 +/- 0.01 mM (mean +/- SE) to peak values of 0.35 +/- 0.07 mM and to 0.08 +/- 0.01 mM during acetate and ethanol infusions, respectively. Urinary oxypurines increased to 223 +/- 13% and 316 +/- 44% of the base-line values during acetate and ethanol infusions, respectively. Urinary radioactivity from the adenine nucleotide pool labeled with [8-14C] adenine increased to 171 +/- 27% and to 128 +/- 8% of the base-line values after acetate and ethanol infusions. These data indicate that both ethanol and acetate increase purine nucleotide degradation by enhancing the turnover of the adenine nucleotide pool. They support the hypothesis that acetate metabolism contributes to the increased production of urate associated with ethanol intake

Direct detection of single-nucleotide polymorphisms in bacterial DNA by SNPtrap

DEFF Research Database (Denmark)

Grønlund, Hugo Ahlm; Moen, Birgitte; Hoorfar, Jeffrey

2011-01-01

A major challenge with single-nucleotide polymorphism (SNP) fingerprinting of bacteria and higher organisms is the combination of genome-wide screenings with the potential of multiplexing and accurate SNP detection. Single-nucleotide extension by the minisequencing principle represents a technolo...

DNA damage and radical reactions: Mechanistic aspects, formation in cells and repair studies

International Nuclear Information System (INIS)

Cadet, J.; Ravanat, J.L.; Carell, T.; Cellai, L.; Chatgilialoglu, Ch.; Gimisis, Th.; Miranda, M.; O'Neill, P.; Robert, M.

2008-01-01

Several examples of oxidative and reductive reactions of DNA components that lead to single and tandem modifications are discussed in this review. These include nucleophilic addition reactions of the one-electron oxidation-mediated guanine radical cation and the one-electron reduced intermediate of 8-bromo-purine 2'-de-oxy-ribo-nucleosides that give rise to either an oxidizing guanine radical or related 5',8-cyclo-purine nucleosides. In addition, mechanistic insights into the reductive pathways involved in the photolyase induced reversal of cyclo-buta-cli-pyrimidine and pyrimidine (6-4) pyrimidone photoproducts are provided. Evidence for the occurrence and validation in cellular DNA of (OH) · radical degradation pathways of guanine that have been established in model systems has been gained from the accurate measurement of degradation products. Relevant information on biochemical aspects of the repair of single and clustered oxidatively generated damage to DNA has been gained from detailed investigations that rely on the synthesis of suitable modified probes. Thus the preparation of stable carbocyclic derivatives of purine nucleoside containing defined sequence oligonucleotides has allowed detailed crystallographic studies of the recognition step of the base damage by enzymes implicated in the base excision repair (BER) pathway. Detailed insights are provided on the BER processing of non-double strand break bi-stranded clustered damage that may consist of base lesions, a single strand break or abasic sites and represent one of the main deleterious classes of radiation-induced DNA damage. (authors)

Enzymatic production of dietary nucleotides from low-soluble purine bases by an efficient, thermostable and alkali-tolerant biocatalyst.

Science.gov (United States)

Del Arco, J; Cejudo-Sanches, J; Esteban, I; Clemente-Suárez, V J; Hormigo, D; Perona, A; Fernández-Lucas, J

2017-12-15

Traditionally, enzymatic synthesis of nucleoside-5'-monophosphates (5'-NMPs) using low water-soluble purine bases has been described as less efficient due to their low solubility in aqueous media. The use of enzymes from extremophiles, such as thermophiles or alkaliphiles, offers the potential to increase solubilisation of these bases by employing high temperatures or alkaline pH. This study describes the cloning, expression and purification of hypoxanthine-guanine-xanthine phosphoribosyltransferase from Thermus thermophilus (TtHGXPRT). Biochemical characterization indicates TtHGXPRT as a homotetramer with excellent activity and stability across a broad range of temperatures (50-90°C) and ionic strengths (0-500mMNaCl), but it also reveals an unusually high activity and stability under alkaline conditions (pH range 8-11). In order to explore the potential of TtHGXPRT as an industrial biocatalyst, enzymatic production of several dietary 5'-NMPs, such as 5'-GMP and 5'-IMP, was carried out at high concentrations of guanine and hypoxanthine. Copyright © 2017 Elsevier Ltd. All rights reserved.

Poly(ADP-ribose) polymerase 1 escorts XPC to UV-induced DNA lesions during nucleotide excision repair.

Science.gov (United States)

Robu, Mihaela; Shah, Rashmi G; Purohit, Nupur K; Zhou, Pengbo; Naegeli, Hanspeter; Shah, Girish M

2017-08-15

Xeroderma pigmentosum C (XPC) protein initiates the global genomic subpathway of nucleotide excision repair (GG-NER) for removal of UV-induced direct photolesions from genomic DNA. The XPC has an inherent capacity to identify and stabilize at the DNA lesion sites, and this function is facilitated in the genomic context by UV-damaged DNA-binding protein 2 (DDB2), which is part of a multiprotein UV-DDB ubiquitin ligase complex. The nuclear enzyme poly(ADP-ribose) polymerase 1 (PARP1) has been shown to facilitate the lesion recognition step of GG-NER via its interaction with DDB2 at the lesion site. Here, we show that PARP1 plays an additional DDB2-independent direct role in recruitment and stabilization of XPC at the UV-induced DNA lesions to promote GG-NER. It forms a stable complex with XPC in the nucleoplasm under steady-state conditions before irradiation and rapidly escorts it to the damaged DNA after UV irradiation in a DDB2-independent manner. The catalytic activity of PARP1 is not required for the initial complex formation with XPC in the nucleoplasm but it enhances the recruitment of XPC to the DNA lesion site after irradiation. Using purified proteins, we also show that the PARP1-XPC complex facilitates the handover of XPC to the UV-lesion site in the presence of the UV-DDB ligase complex. Thus, the lesion search function of XPC in the genomic context is controlled by XPC itself, DDB2, and PARP1. Our results reveal a paradigm that the known interaction of many proteins with PARP1 under steady-state conditions could have functional significance for these proteins.

Absence of zero-temperature transmission rate of a double-chain tight-binding model for DNA with random sequence of nucleotides in thermodynamic limit

International Nuclear Information System (INIS)

Xiong Gang; Wang, X.R.

2005-01-01

The zero-temperature transmission rate spectrum of a double-chain tight-binding model for real DNA is calculated. It is shown that a band of extended-like states exists only for finite chain length with strong inter-chain coupling. While the whole spectrum tends to zero in thermodynamic limit, regardless of the strength of inter-chain coupling. It is also shown that a more faithful model for real DNA with periodic sugar-phosphate chains in backbone structures can be mapped into the above simple double-chain tight-binding model. Combined with above results, the transmission rate of real DNA with long random sequence of nucleotides is expected to be poor

Influence of oxidized purine processing on strand directionality of mismatch repair.

Science.gov (United States)

Repmann, Simone; Olivera-Harris, Maite; Jiricny, Josef

2015-04-17

Replicative DNA polymerases are high fidelity enzymes that misincorporate nucleotides into nascent DNA with a frequency lower than [1/10(5)], and this precision is improved to about [1/10(7)] by their proofreading activity. Because this fidelity is insufficient to replicate most genomes without error, nature evolved postreplicative mismatch repair (MMR), which improves the fidelity of DNA replication by up to 3 orders of magnitude through correcting biosynthetic errors that escaped proofreading. MMR must be able to recognize non-Watson-Crick base pairs and excise the misincorporated nucleotides from the nascent DNA strand, which carries by definition the erroneous genetic information. In eukaryotes, MMR is believed to be directed to the nascent strand by preexisting discontinuities such as gaps between Okazaki fragments in the lagging strand or breaks in the leading strand generated by the mismatch-activated endonuclease of the MutL homologs PMS1 in yeast and PMS2 in vertebrates. We recently demonstrated that the eukaryotic MMR machinery can make use also of strand breaks arising during excision of uracils or ribonucleotides from DNA. We now show that intermediates of MutY homolog-dependent excision of adenines mispaired with 8-oxoguanine (G(O)) also act as MMR initiation sites in extracts of human cells or Xenopus laevis eggs. Unexpectedly, G(O)/C pairs were not processed in these extracts and failed to affect MMR directionality, but extracts supplemented with exogenous 8-oxoguanine DNA glycosylase (OGG1) did so. Because OGG1-mediated excision of G(O) might misdirect MMR to the template strand, our findings suggest that OGG1 activity might be inhibited during MMR. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Research on urinary excretion of purine derivatives in ruminants: Past, present and future

International Nuclear Information System (INIS)

Chen, X.B.; Orskov, E.R.

2004-01-01

Research on urinary excretion of purine derivatives (PD), namely allantoin, uric acid, xanthine and hypoxanthine, in ruminants have been carried out with an objective to use the excretion of these purine metabolites as a parameter to estimate the intestinal flow of microbial protein. This paper reviews the published literature, from the first paper in 1931 to the current date. The current status of understanding in some key topics is discussed. The topics include: endogenous excretion, modelling the response of PD excretion to purine absorption, calculation of microbial N supply from PD excretion, use of spot urine measurement, possible use of plasma or milk PD as an alterative index, and applications in ruminant nutrition research. This review also covers the current understanding of PD excretion in different animal species, including sheep, cattle, goats, buffaloes, llamas, camels, yak and deer. Progress in analytical methods for the determination of purine derivatives is also discussed. Finally, areas of future research are highlighted. The paper stresses the need for more studies on metabolism of PD in the tissue, the kinetics of PD in the blood and physiological processes of renal excretion, so as to understand better the mechanism that accounts for the between-species and within species variation in PD excretion. Development of simpler and more rapid methods for defining the endogenous excretion and purine input-output relationship is also an area for future work. (author)

Determination of alkylation of bacterial DNA as a rapid test for toxicological evaluation of alkylating xenobiotic agents

Energy Technology Data Exchange (ETDEWEB)

Botzenhart, K.; Waldner-Sander, S.; Schweinsberg, F.

1986-05-01

Alkylated purine bases from hydrolized DNA can be separated by HPLC and quantified with a fluorescence detector. We applied this method to bacterial DNA. 7-methylguanine was detected after treatment of Serratia marcescens with iodoacetamide, dimethyl sulfate and with polluted air.

Chemistry of the 8-Nitroguanine DNA Lesion: Reactivity, Labelling and Repair.

Science.gov (United States)

Alexander, Katie J; McConville, Matthew; Williams, Kathryn R; Luzyanin, Konstantin V; O'Neil, Ian A; Cosstick, Richard

2018-02-26

The 8-nitroguanine lesion in DNA is increasingly associated with inflammation-related carcinogenesis, whereas the same modification on guanosine 3',5'-cyclic monophosphate generates a second messenger in NO-mediated signal transduction. Very little is known about the chemistry of 8-nitroguanine nucleotides, despite the fact that their biological effects are closely linked to their chemical properties. To this end, a selection of chemical reactions have been performed on 8-nitroguanine nucleosides and oligodeoxynucleotides. Reactions with alkylating reagents reveal how the 8-nitro substituent affects the reactivity of the purine ring, by significantly decreasing the reactivity of the N2 position, whilst the relative reactivity at N1 appears to be enhanced. Interestingly, the displacement of the nitro group with thiols results in an efficient and specific method of labelling this lesion and is demonstrated in oligodeoxynucleotides. Additionally, the repair of this lesion is also shown to be a chemically feasible reaction through a reductive denitration with a hydride source. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

NMR and molecular modeling evidence for a G·A mismatch base pair in a purine-rich DNA duplex

International Nuclear Information System (INIS)

Li, Ying; Wilson, W.D.; Zon, G.

1991-01-01

1 H NMR experiments indicate that the oligomer 5'-d(ATGAGCGAATA) forms an unusual 10-base-pair duplex with 4 G·A base pairs and a 3' unpaired adenosine. NMR results indicate that guanoxine imino protons of the F·A mismatches are not hydrogen bonded but are stacked in the helix. A G→ I substitution in either G·A base pair causes a dramatic decrtease in duplex stability and indicates that hydrogen bonding of the guanosine amino group is critical. Nuclear Overhauser effect spectroscopy (NOESY) and two-dimensional correlated spectroscopy (COSY) results indicate that the overall duplex conformation is in the B-family. Cross-strand NOEs in two-dimensional NOESY spectra between a mismatched AH2 and an AH1' of the other mismatched base pair and between a mismatched GH8 and GNH1 of the other mismatch establish a purine-purine stacking pattern, adenosine over adenosine and guanosine over guanosine, which strongly stabilizes the duplex. A computer graphics molecular model of the ususual duplex was constructed with G·A base pairs containing A-NH 2 to GN3 and G-NH 2 to AN7 hydrogen bonds and B-form base pairs on both sides of the G·A pairs [5'-d(ATGAGC)]. The energy-minimized duplex satisfies all experimental constraints from NOESY and COSY results. A hydrogen bond from G-NH 2 of the mismatch to a phosphate oxygen is predicted

Nucleotide fluctuation of radiation-resistant Halobacterium sp. NRC-1 single-stranded DNA-binding protein (RPA) genes

Science.gov (United States)

Holden, Todd; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Gadura, N.; Schneider, P.; Sullivan, R.; Flamholz, A.; Lieberman, D.; Cheung, T. D.

2009-08-01

The Single-Stranded DNA-Binding Protein (RPA) Genes in gamma ray radiation-resistant halophilic archaeon Halobacterium sp. NRC-1 were analyzed in terms of their nucleotide fluctuations. In an ATCG sequence, each base was assigned a number equal to its atomic number. The resulting numerical sequence was the basis of the statistical analysis in this study. Fractal analysis using the Higuchi method gave fractal dimensions of 2.04 and 2.06 for the gene sequences VNG2160 and VNG2162, respectively. The 16S rRNA sequence has a fractal dimension of 1.99. The di-nucleotide Shannon entropy values were found to be negatively correlated with the observed fractal dimensions (R2~ 0.992, N=3). Inclusion of Deinococcus radiodurans Rad-A in the regression analysis decreases the R2 slightly to 0.98 (N=4). A third VNG2163 RPA gene of unknown function but with upregulation activity under irradiation was found to have a fractal dimension of 2.05 and a Shannon entropy of 3.77 bits. The above results are similar to those found in bacterial Deinococcus radiodurans and suggest that their high radiation resistance property would have favored selection of CG di-nucleotide pairs. The two transcription factors TbpD (VNG7114) and TfbA (VNG 2184) were also studied. Using VNG7114, VNG2184, and VNG2163; the regression analysis of fractal dimension versus Shannon entropy shows that R2 ~ 0.997 for N =3. The VNG2163 unknown function may be related to the pathways with transcriptions closely regulated to sequences VNG7114 and VNG2184.

Histone displacement during nucleotide excision repair

DEFF Research Database (Denmark)

Dinant, C.; Bartek, J.; Bekker-Jensen, S.

2012-01-01

Nucleotide excision repair (NER) is an important DNA repair mechanism required for cellular resistance against UV light and toxic chemicals such as those found in tobacco smoke. In living cells, NER efficiently detects and removes DNA lesions within the large nuclear macromolecular complex called...... of histone variants and histone displacement (including nucleosome sliding). Here we review current knowledge, and speculate about current unknowns, regarding those chromatin remodeling activities that physically displace histones before, during and after NER....

Evolutionary convergence in the biosyntheses of the imidazole moieties of histidine and purines.

Directory of Open Access Journals (Sweden)

Alberto Vázquez-Salazar

Full Text Available The imidazole group is an ubiquitous chemical motif present in several key types of biomolecules. It is a structural moiety of purines, and plays a central role in biological catalysis as part of the side-chain of histidine, the amino acid most frequently found in the catalytic site of enzymes. Histidine biosynthesis starts with both ATP and the pentose phosphoribosyl pyrophosphate (PRPP, which is also the precursor for the de novo synthesis of purines. These two anabolic pathways are also connected by the imidazole intermediate 5-aminoimidazole-4-carboxamide ribotide (AICAR, which is synthesized in both routes but used only in purine biosynthesis. Rather surprisingly, the imidazole moieties of histidine and purines are synthesized by different, non-homologous enzymes. As discussed here, this phenomenon can be understood as a case of functional molecular convergence.In this work, we analyze these polyphyletic processes and argue that the independent origin of the corresponding enzymes is best explained by the differences in the function of each of the molecules to which the imidazole moiety is attached. Since the imidazole present in histidine is a catalytic moiety, its chemical arrangement allows it to act as an acid or a base. On the contrary, the de novo biosynthesis of purines starts with an activated ribose and all the successive intermediates are ribotides, with the key β-glycosidic bondage joining the ribose and the imidazole moiety. This prevents purine ribonucleotides to exhibit any imidazole-dependent catalytic activity, and may have been the critical trait for the evolution of two separate imidazole-synthesizing-enzymes. We also suggest that, in evolutionary terms, the biosynthesis of purines predated that of histidine.As reviewed here, other biosynthetic routes for imidazole molecules are also found in extant metabolism, including the autocatalytic cyclization that occurs during the formation of creatinine from creatine phosphate

Partition coefficients of some purine derivatives and its application to pharmacokinetics.

Science.gov (United States)

Chrzanowska, M; Sobiak, J; Kuehn, M; Dorawa, E; Hermann, T

2009-12-01

Metazathioprine (MAZA), a methylated derivative of azathioprine (AZA), demonstrated the greatest values of apparent and specific partition coefficients in n-octanol/phosphate buffer at pH 5.7 and pH 7.4 among purine derivatives such as 6-mercaptopurine (6-MP), 6-thioguanine (6-TG) and AZA. Introduction of a methyl group into the imidazole ring of AZA increases lipophilic properties of MAZA compared to AZA. Mass balance of purine derivatives in n-octanol and in phosphate buffer indicated their chemical stability in those media.

Modification of Purine and Pyrimidine Nucleosides by Direct C-H Bond Activation

Directory of Open Access Journals (Sweden)

Yong Liang

2015-03-01

Full Text Available Transition metal-catalyzed modifications of the activated heterocyclic bases of nucleosides as well as DNA or RNA fragments employing traditional cross-coupling methods have been well-established in nucleic acid chemistry. This review covers advances in the area of cross-coupling reactions in which nucleosides are functionalized via direct activation of the C8-H bond in purine and the C5-H or C6-H bond in uracil bases. The review focuses on Pd/Cu-catalyzed couplings between unactivated nucleoside bases with aryl halides. It also discusses cross-dehydrogenative arylations and alkenylations as well as other reactions used for modification of nucleoside bases that avoid the use of organometallic precursors and involve direct C-H bond activation in at least one substrate. The scope and efficiency of these coupling reactions along with some mechanistic considerations are discussed.

Nucleotide-excision repair of DNA in cell-free extracts of the yeast Saccharomyces cerevisiae

International Nuclear Information System (INIS)

Wang, Z.; Wu, X.; Friedberg, E.C.

1993-01-01

A wide spectrum of DNA lesions are repaired by the nucleotide-excision repair (NER) pathway in both eukaryotic and prokaryotic cells. We have developed a cell-free system in Saccharomyces cerevisiae that supports NER. NER was monitored by measuring repair synthesis in DNA treated with cisplatin or with UV radiation. Repair synthesis in vitro was defective in extracts of rad1, rad2, and rad10 mutant cells, all of which have mutations in genes whose products are known to be required for NER in vivo. Additionally, repair synthesis was complemented by mixing different mutant extracts, or by adding purified Rad1 or Rad10 protein to rad1 or rad10 mutant extracts, respectively. The latter observation demonstrates that the Rad1 and Rad10 proteins directly participate in the biochemical pathway of NER. NER supported by nuclear extracts requires ATP and Mg 2+ and is stimulated by polyethylene glycol and by small amounts of whole cell extract containing overexpressed Rad2 protein. The nuclear extracts also contain base-excision repair activity that is present at wild-type levels in rad mutant extracts. This cell-free system is expected to facilitate studies on the biochemical pathway of NER in S. cerevisiae

Sensing of nucleosides, nucleotides and DNA using luminescent Eu complex by normal and time resolved fluorescence techniques

Energy Technology Data Exchange (ETDEWEB)

Azab, Hassan A.; Anwar, Zeinab M. [Chemistry Department, Faculty of Science, Suez Canal University, 41522 Ismailia (Egypt); Kamel, Rasha M., E-mail: rashamoka@yahoo.com [Chemistry Department, Faculty of Science, Suez University, 43518 Suez (Egypt); Rashwan, Mai S. [Chemistry Department, Faculty of Science, Suez Canal University, 41522 Ismailia (Egypt)

2016-01-15

The interaction of Eu-1,4,7,10-tetraazacyclododecane (Cyclen) complex by using 4,4,4 trifluoro-1-(2-naphthyl)1,3-butanedione (TNB) as antenna with some nucleosides (guanosine, adenosine, cytidine and inosine), nucleotides (AMP, GMP, CMP, ATP and IMP) and DNA is studied using fluorescence technique. Two detection modes are employed one is the time-resolved mode, and the other is the normal luminescence mode. The time-resolved mode is more sensing than the normal luminescence mode in the present study. By using Benesi–Hildebrand equation binding constants were determined at various temperatures. Thermodynamic parameters showed that the reaction is spontaneous through the obtained negative values of free energy change ΔG. The enthalpy ΔH and the entropy ΔS of reactions were all determined. - Highlights: • This is an application for the detection of biologically important ligands. • The detection limits, binding constants and thermodynamic parameters were evaluated. • Effect of some interferents on the detection of DNA has been investigated.

Sensing of nucleosides, nucleotides and DNA using luminescent Eu complex by normal and time resolved fluorescence techniques

International Nuclear Information System (INIS)

Azab, Hassan A.; Anwar, Zeinab M.; Kamel, Rasha M.; Rashwan, Mai S.

2016-01-01

The interaction of Eu-1,4,7,10-tetraazacyclododecane (Cyclen) complex by using 4,4,4 trifluoro-1-(2-naphthyl)1,3-butanedione (TNB) as antenna with some nucleosides (guanosine, adenosine, cytidine and inosine), nucleotides (AMP, GMP, CMP, ATP and IMP) and DNA is studied using fluorescence technique. Two detection modes are employed one is the time-resolved mode, and the other is the normal luminescence mode. The time-resolved mode is more sensing than the normal luminescence mode in the present study. By using Benesi–Hildebrand equation binding constants were determined at various temperatures. Thermodynamic parameters showed that the reaction is spontaneous through the obtained negative values of free energy change ΔG. The enthalpy ΔH and the entropy ΔS of reactions were all determined. - Highlights: • This is an application for the detection of biologically important ligands. • The detection limits, binding constants and thermodynamic parameters were evaluated. • Effect of some interferents on the detection of DNA has been investigated.

1,3,5-Triazine-based analogues of purine: from isosteres to privileged scaffolds in medicinal chemistry.

Science.gov (United States)

Lim, Felicia Phei Lin; Dolzhenko, Anton V

2014-10-06

Purines can be considered as the most ubiquitous and functional N-heterocyclic compounds in nature. Structural modifications of natural purines, particularly using isosteric ring systems, have been in the focus of many drug discovery programs. Fusion of 1,3,5-triazine ring with pyrrole, pyrazole, imidazole, 1,2,3-triazole or 1,2,4-triazole results in seven bicyclic heterocyclic systems isosteric to purine. Application of the isosterism concept for the development of new compounds with therapeutic potential in areas involving purinergic regulation or purine metabolism led to significant advances in medicinal chemistry of the azolo[1,3,5]triazines. These 1,3,5-triazine-based purine-like scaffolds significantly increase level of molecular diversity and allow covering chemical space in the important areas of medicinal chemistry. Some of these azolo[1,3,5]triazine systems have become privileged scaffolds in the development of inhibitors of various kinases, phosphodiesterase, xanthine oxidase, and thymidine phosphorylase, antagonists of adenosine and corticotropin-releasing hormone receptors, anticancer and antiviral agents. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

Time-resolved fluorescence sensing of N-acetyl amino acids, nucleobases, nucleotides and DNA by the luminescent Tb (III) - 8-alkyl-2-oxo-2H-chromene-3-carbaldehyde probe

Energy Technology Data Exchange (ETDEWEB)

Azab, Hassan A. [Chemistry Department, Faculty of Science, Suez Canal University, 41522 Ismailia (Egypt); Khairy, Gasser M., E-mail: gasser_chemist@yahoo.com [Chemistry Department, Faculty of Science and Arts, Aljouf University, P.O. Box # 2014, Skaka 41421 (Saudi Arabia); Chemistry Department, Faculty of Science, Suez Canal University, 41522 Ismailia (Egypt); Abd El-Ghany, N.; Ahmed, Marwa A. [Chemistry Department, Faculty of Science, Suez Canal University, El-Arish (Egypt)

2016-08-15

A time-resolved (gated) luminescence-based method for the detection of some of N-acetyl amino acids, nucleobases, nucleotides, and DNA using terbium- 8-alkyl-2-oxo-2H-chromene-3-carbaldehyde (AOCC) complex in 1:2 metal: ligand ratio in microtiterplate format has been evolved. The linear range for determination of the selected biomolecules is 0.1–1.0 µM. The detection limit was in the range of 0.0371–0.106 µM. The thermodynamic parameters, and binding constants (K) of N-acetyl amino acids, nucleobases, nucleotides with Tb (III) –(AOCC) {sub 2} complex were calculated. Positive and negative values of entropy (ΔS) and enthalpy (ΔH) changes for Tb (III) –(AOCC){sub 2}– N-acetyl amino acids, nucleobases or nucleotides ternary complexes were evaluated. Selectivity of Tb (III) -complex towards different biomolecules has been studied using ratiometric methods of analysis by comparison of biomolecules binding affinities for Tb (III) -complex. Interaction of Tb (III) complex with DNA has been studied.

Time-resolved fluorescence sensing of N-acetyl amino acids, nucleobases, nucleotides and DNA by the luminescent Tb (III) - 8-alkyl-2-oxo-2H-chromene-3-carbaldehyde probe

International Nuclear Information System (INIS)

Azab, Hassan A.; Khairy, Gasser M.; Abd El-Ghany, N.; Ahmed, Marwa A.

2016-01-01

A time-resolved (gated) luminescence-based method for the detection of some of N-acetyl amino acids, nucleobases, nucleotides, and DNA using terbium- 8-alkyl-2-oxo-2H-chromene-3-carbaldehyde (AOCC) complex in 1:2 metal: ligand ratio in microtiterplate format has been evolved. The linear range for determination of the selected biomolecules is 0.1–1.0 µM. The detection limit was in the range of 0.0371–0.106 µM. The thermodynamic parameters, and binding constants (K) of N-acetyl amino acids, nucleobases, nucleotides with Tb (III) –(AOCC) 2 complex were calculated. Positive and negative values of entropy (ΔS) and enthalpy (ΔH) changes for Tb (III) –(AOCC) 2 – N-acetyl amino acids, nucleobases or nucleotides ternary complexes were evaluated. Selectivity of Tb (III) -complex towards different biomolecules has been studied using ratiometric methods of analysis by comparison of biomolecules binding affinities for Tb (III) -complex. Interaction of Tb (III) complex with DNA has been studied.

Transcriptomic analysis of genes in the nitrogen recycling pathway of meat-type chickens divergently selected for feed efficiency.

Science.gov (United States)

Aggrey, S E; Lee, J; Karnuah, A B; Rekaya, R

2014-04-01

The understanding of the dynamics of ammonia detoxification and excretion in uricotelic species is lagging behind ureotelic species. The relative expression of genes involved in nitrogen recycling and feed efficiency in chickens is unknown. The objective of this study was to investigate the transcriptomics differences in key genes in the nitrogen (N) metabolism and purine biosynthesis pathway in a chicken population divergently selected for low (LRFI) or high (HRFI) residual feed intake at days 35 and 42 using duodenum, liver, pectoralis major (P. major) and kidney. There was a significant positive correlation between RFI and fecal N. The purine salvage pathway was activated in the LRFI compared with HRFI at days 42. The birds in the LRFI population attained greater feed efficiency by having lower FI, increasing their protein retention and producing adequate glutamine to maintain growth compared with the HRFI line. To maintain growth, excess N is deaminated mostly to generate purine nucleotides. Generating purine nucleotides primarily from the purine biosynthesis pathway is energetically costly, and to preserve energy, they preferentially generate nucleotides from the purine salvage pathway. The LRFI birds need to generate sufficient nucleotides to maintain growth despite reduced FI that then results in reduced fecal N. © 2013 Stichting International Foundation for Animal Genetics.

The first 3':5'-cyclic nucleotide-amino acid complex: L-His-cIMP.

Science.gov (United States)

Slepokura, Katarzyna

2012-08-01

In the crystal structure of the L-His-cIMP complex, i.e. L-histidinium inosine 3':5'-cyclic phosphate [systematic name: 5-(2-amino-2-carboxyethyl)-1H-imidazol-3-ium 7-hydroxy-2-oxo-6-(6-oxo-6,9-dihydro-1H-purin-9-yl)-4a,6,7,7a-tetrahydro-4H-1,3,5,2λ(5)-furo[3,2-d][1,3,2λ(5)]dioxaphosphinin-2-olate], C(6)H(10)N(3)O(2)(+)·C(10)H(10)N(4)O(7)P(-), the Hoogsteen edge of the hypoxanthine (Hyp) base of cIMP and the Hyp face are engaged in specific amino acid-nucleotide (His···cIMP) recognition, i.e. by abutting edge-to-edge and by π-π stacking, respectively. The Watson-Crick edge of Hyp and the cIMP phosphate group play a role in nonspecific His···cIMP contacts. The interactions between the cIMP anions (anti/C3'-endo/trans-gauche/chair conformers) are realized mainly between riboses and phosphate groups. The results for this L-His-cIMP complex, compared with those for the previously reported solvated L-His-IMP crystal structure, indicate a different nature of amino acid-nucleotide recognition and interactions upon the 3':5'-cyclization of the nucleotide phosphate group.

Alkylsulfanylphenyl derivatives of cytosine and 7-deazaadenine nucleosides, nucleotides and nucleoside triphosphates. Synthesis, polymerase incorporation to DNA and electrochemical study

Czech Academy of Sciences Publication Activity Database

Macíčková-Cahová, Hana; Pohl, Radek; Horáková Brázdilová, Petra; Havran, Luděk; Špaček, Jan; Fojta, Miroslav; Hocek, Michal

2011-01-01

Roč. 17, č. 21 (2011), s. 5833-5841 ISSN 0947-6539 R&D Projects: GA MŠk(CZ) LC06035; GA MŠk LC512; GA ČR GA203/09/0317; GA AV ČR(CZ) IAA400040901 Institutional research plan: CEZ:AV0Z40550506; CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : DNA polymerases * electrochemistry * nucleosides * nucleotides * organosulfur compounds Subject RIV: CC - Organic Chemistry Impact factor: 5.925, year: 2011

Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

OpenAIRE

Le Gall, O; Candresse, T; Brault, V; Dunez, J

1989-01-01

The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that o...

Single nucleotide editing without DNA cleavage using CRISPR/Cas9-deaminase in the sea urchin embryo.

Science.gov (United States)

Shevidi, Saba; Uchida, Alicia; Schudrowitz, Natalie; Wessel, Gary M; Yajima, Mamiko

2017-12-01

A single base pair mutation in the genome can result in many congenital disorders in humans. The recent gene editing approach using CRISPR/Cas9 has rapidly become a powerful tool to replicate or repair such mutations in the genome. These approaches rely on cleaving DNA, while presenting unexpected risks. In this study, we demonstrate a modified CRISPR/Cas9 system fused to cytosine deaminase (Cas9-DA), which induces a single nucleotide conversion in the genome. Cas9-DA was introduced into sea urchin eggs with sgRNAs targeted for SpAlx1, SpDsh, or SpPks, each of which is critical for skeletogenesis, embryonic axis formation, or pigment formation, respectively. We found that both Cas9 and Cas9-DA edit the genome, and cause predicted phenotypic changes at a similar efficiency. Cas9, however, resulted in significant deletions in the genome centered on the gRNA target sequence, whereas Cas9-DA resulted in single or double nucleotide editing of C to T conversions within the gRNA target sequence. These results suggest that the Cas9-DA approach may be useful for manipulating gene activity with decreased risks of genomic aberrations. Developmental Dynamics 246:1036-1046, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Mitochondrial DNA analysis reveals a low nucleotide diversity of ...

African Journals Online (AJOL)

STORAGESEVER

2009-06-17

Jun 17, 2009 ... gene sequences of C. japonica in China to assess nucleotide sequence diversity (GenBank ... provide a scientific basis for the regional control of forestry .... population (AB015869) was downloaded from GenBank database.

Two purine nucleoside phosphorylases in Bacillus subtilis. Purification and some properties of the adenosine-specific phosphorylase

DEFF Research Database (Denmark)

Jensen, Kaj Frank

1978-01-01

Two purine nucleoside phosphorylases (purine-nucleoside:orthophosphate ribosyltransferase, EC 2.4.2.1) were purified from vegetative Bacillus subtilis cells. One enzyme, inosine-guanosine phosphorylase, showed great similarity to the homologous enzyme of Bacillus cereus. It appeared...

The Coding of Biological Information: From Nucleotide Sequence to Protein Recognition

Science.gov (United States)

Štambuk, Nikola

The paper reviews the classic results of Swanson, Dayhoff, Grantham, Blalock and Root-Bernstein, which link genetic code nucleotide patterns to the protein structure, evolution and molecular recognition. Symbolic representation of the binary addresses defining particular nucleotide and amino acid properties is discussed, with consideration of: structure and metric of the code, direct correspondence between amino acid and nucleotide information, and molecular recognition of the interacting protein motifs coded by the complementary DNA and RNA strands.

DNA probes

International Nuclear Information System (INIS)

Castelino, J.

1992-01-01

The creation of DNA probes for detection of specific nucleotide segments differs from ligand detection in that it is a chemical rather than an immunological reaction. Complementary DNA or RNA is used in place of the antibody and is labelled with 32 P. So far, DNA probes have been successfully employed in the diagnosis of inherited disorders, infectious diseases, and for identification of human oncogenes. The latest approach to the diagnosis of communicable and parasitic infections is based on the use of deoxyribonucleic acid (DNA) probes. The genetic information of all cells is encoded by DNA and DNA probe approach to identification of pathogens is unique because the focus of the method is the nucleic acid content of the organism rather than the products that the nucleic acid encodes. Since every properly classified species has some unique nucleotide sequences that distinguish it from every other species, each organism's genetic composition is in essence a finger print that can be used for its identification. In addition to this specificity, DNA probes offer other advantages in that pathogens may be identified directly in clinical specimens

DNA Polymerase Fidelity: Beyond Right and Wrong.

Science.gov (United States)

Washington, M Todd

2016-11-01

Accurate DNA replication depends on the ability of DNA polymerases to discriminate between correctly and incorrectly paired nucleotides. In this issue of Structure, Batra et al. (2016) show the structural basis for why DNA polymerases do not efficiently add correctly paired nucleotides immediately after incorporating incorrectly paired ones. Copyright © 2016 Elsevier Ltd. All rights reserved.

Sharp switches between regular and swinger mitochondrial replication: 16S rDNA systematically exchanging nucleotides AT+CG in the mitogenome of Kamimuria wangi.

Science.gov (United States)

Seligmann, Hervé

2016-07-01

Swinger DNAs are sequences whose homology with known sequences is detected only by assuming systematic exchanges between nucleotides. Nine symmetric (XY, i.e. AC) and fourteen asymmetric (X->Y->Z, i.e. A->C->G) exchanges exist. All swinger DNA previously detected in GenBank follow the AT+CG exchange, while mitochondrial swinger RNAs distribute among different swinger types. Here different alignment criteria detect 87 additional swinger mitochondrial DNAs (86 from insects), including the first swinger gene embedded within a complete genome, corresponding to the mitochondrial 16S rDNA of the stonefly Kamimuria wangi. Other Kamimuria mt genome regions are "regular", stressing unanswered questions on (a) swinger polymerization regulation; (b) swinger 16S rDNA functions; and (c) specificity to rDNA, in particular 16S rDNA. Sharp switches between regular and swinger replication, together with previous observations on swinger transcription, suggest that swinger replication might be due to a switch in polymerization mode of regular polymerases and the possibility of swinger-encoded information, predicted in primordial genes such as rDNA.

Human mitochondrial DNA (mtDNA) types in Malaysia

International Nuclear Information System (INIS)

Lian, L.H.; Koh, C.L.; Lim, M.E.

2000-01-01

Each human cell contains hundreds of mitochondria and thousands of double-stranded circular mtDNA. The delineation of human mtDNA variation and genetics over the past decade has provided unique and often startling insights into human evolution, degenerative diseases, and aging. Each mtDNA of 16,569 base pairs, encodes 13 polypeptides essential to the enzymes of the mitochondrial energy generating pathway, plus the necessary tRNAs and rRNAs. The highly polymorphic noncoding D-(displacement) loop region, also called the control region, is approximately 1.2 kb long. It contains two well-characterized hypervariable (HV-) regions, HV1 and HV2. MtDNA identification is usually based on these sequence differences. According to the TWTGDAM (Technical Working Group for DNA Analysis Methods), the minimum requirement for a mtDNA database for HV1 is from positions 16024 to 16365 and for HV2, from positions 00073 to 00340. The targeted Malaysian population subgroups for this study were mainly the Malays, Chinese, Indians, and indigenous Ibans, Bidayuhs, Kadazan-Dusuns, and Bajaus. Research methodologies undertaken included DNA extraction of samples from unrelated individuals, amplification of the specific regions via the polymerase chain reaction (PCR), and preparation of template DNA for sequencing by using an automated DNA sequencer. Sufficient nucleotide sequence data were generated from the mtDNA analysis. When the sequences were analyzed, sequence variations were found to be caused by nucleotide substitutions, insertions, and deletions. Of the three causes of the sequence variations, nucleotide substitutions (86.1%) accounted for the vast majority of polymorphism. It is noted that transitions (83.5%) were predominant when compared to the significantly lower frequencies of transversions (2.6%). Insertions (0.9%) and deletions (13.0%) were rather rare and found only in HV2. The data generated will also form the basis of a Malaysian DNA sequence database of mtDNA D

Photosensitized oxidation of DNA and its components

International Nuclear Information System (INIS)

Decarroz, Chantal.

1982-09-01

Chemical changes in DNA components during the photodynamic effect are responsible for Mutagenic and carcinogenic phenomena. Basically two competitive mechanisns involving respectively a charge transfer (type I) and singlet oxygen (type II) are implicated in reactions photo-sensitized by different agents (acridines, phenothiazines, porphyrins, flavins, psoralenes...). A study of the photosensitized oxidation of DNA itself was approached through characterization of the main final products in the case of purine nucleosides. Methyl-2 naphthoquinone - 1,4 (vitamin K 3 ) displays a special photosensitization mechanism involving a cation radical type of intermediary [fr

Microanalysis of DNA by stripping transfer voltammetry

Czech Academy of Sciences Publication Activity Database

Jelen, František; Kouřilová, Alena; Pečinka, Petr; Paleček, Emil

2004-01-01

Roč. 63, 1-2 (2004), s. 249-252 ISSN 1567-5394 R&D Projects: GA ČR GA203/02/0422; GA AV ČR IAA1163201; GA AV ČR IBS5004107 Institutional research plan: CEZ:AV0Z5004920 Keywords : DNA determination * determination of purine base s * linear sweep voltammetry Subject RIV: BO - Biophysics Impact factor: 2.261, year: 2004

The Role of Altered Nucleotide Excision Repair and UVB-Induced DNA Damage in Melanomagenesis

Directory of Open Access Journals (Sweden)

Timothy Budden

2013-01-01

Full Text Available UVB radiation is the most mutagenic component of the UV spectrum that reaches the earth’s surface and causes the development of DNA damage in the form of cyclobutane pyrimidine dimers and 6-4 photoproducts. UV radiation usually results in cellular death, but if left unchecked, it can affect DNA integrity, cell and tissue homeostasis and cause mutations in oncogenes and tumour-suppressor genes. These mutations, if unrepaired, can lead to abnormal cell growth, increasing the risk of cancer development. Epidemiological data strongly associates UV exposure as a major factor in melanoma development, but the exact biological mechanisms involved in this process are yet to be fully elucidated. The nucleotide excision repair (NER pathway is responsible for the repair of UV-induced lesions. Patients with the genetic disorder Xeroderma Pigmentosum have a mutation in one of eight NER genes associated with the XP complementation groups XP-A to XP-G and XP variant (XP-V. XP is characterized by diminished repair capacity, as well as a 1000-fold increase in the incidence of skin cancers, including melanoma. This has suggested a significant role for NER in melanoma development as a result of UVB exposure. This review discusses the current research surrounding UVB radiation and NER capacity and how further investigation of NER could elucidate the role of NER in avoiding UV-induced cellular death resulting in melanomagenesis.

Multifactor dimensionality reduction analysis identifies specific nucleotide patterns promoting genetic polymorphisms

Directory of Open Access Journals (Sweden)

Arehart Eric

2009-03-01

Full Text Available Abstract Background The fidelity of DNA replication serves as the nidus for both genetic evolution and genomic instability fostering disease. Single nucleotide polymorphisms (SNPs constitute greater than 80% of the genetic variation between individuals. A new theory regarding DNA replication fidelity has emerged in which selectivity is governed by base-pair geometry through interactions between the selected nucleotide, the complementary strand, and the polymerase active site. We hypothesize that specific nucleotide combinations in the flanking regions of SNP fragments are associated with mutation. Results We modeled the relationship between DNA sequence and observed polymorphisms using the novel multifactor dimensionality reduction (MDR approach. MDR was originally developed to detect synergistic interactions between multiple SNPs that are predictive of disease susceptibility. We initially assembled data from the Broad Institute as a pilot test for the hypothesis that flanking region patterns associate with mutagenesis (n = 2194. We then confirmed and expanded our inquiry with human SNPs within coding regions and their flanking sequences collected from the National Center for Biotechnology Information (NCBI database (n = 29967 and a control set of sequences (coding region not associated with SNP sites randomly selected from the NCBI database (n = 29967. We discovered seven flanking region pattern associations in the Broad dataset which reached a minimum significance level of p ≤ 0.05. Significant models (p Conclusion The present study represents the first use of this computational methodology for modeling nonlinear patterns in molecular genetics. MDR was able to identify distinct nucleotide patterning around sites of mutations dependent upon the observed nucleotide change. We discovered one flanking region set that included five nucleotides clustered around a specific type of SNP site. Based on the strongly associated patterns identified in

The Purine-Utilizing Bacterium Clostridium acidurici 9a: A Genome-Guided Metabolic Reconsideration

OpenAIRE

Hartwich, Katrin; Poehlein, Anja; Daniel, Rolf

2012-01-01

Clostridium acidurici is an anaerobic, homoacetogenic bacterium, which is able to use purines such as uric acid as sole carbon, nitrogen, and energy source. Together with the two other known purinolytic clostridia C. cylindrosporum and C. purinilyticum, C. acidurici serves as a model organism for investigation of purine fermentation. Here, we present the first complete sequence and analysis of a genome derived from a purinolytic Clostridium. The genome of C. acidurici 9a consists ...

Nucleotide sequence, transcript mapping, and regulation of the RAD2 gene of Saccharomyces cerevisiae

International Nuclear Information System (INIS)

Madura, K.; Prakash, S.

1986-01-01

The authors determined the nucleotide sequence, mapped the 5' and 3' nRNA termini, and examined the regulation of the RAD2 gene of Saccharomyces cerevisiae. A long open reading frame within the RAD2 transcribed region encodes a protein of 1031 amino acids with a calculated molecular weight of 117,847. A disruption of the RAD2 gene that deletes the 78 carboxyl terminal codons results in loss of RAD2 function. The 5' ends of RAD2 mRNA show considerable heterogeneity, mapping 5 to 62 nucleotides upstream of the first ATG codon of the long RAD2 open reading frame. The longest RAD2 transcripts also contain a short open reading frame of 37 codons that precedes and overlaps the 5' end of the long RAD2 open reading frame. The RAD2 3' nRNA end maps 171 nucleotides downstream of the TAA termination codon and 20 nucleotides downstream from a 12-base-pair inverted repeat that might function in transcript termination. Northern blot analysis showed a ninefold increase in steady-state levels of RAD2 mRNA after treatment of yeast cells with UV light. The 5' flanking region of the RAD2 gene contains several direct and inverted repeats and a 44-nuclotide-long purine-rich tract. The sequence T G G A G G C A T T A A found at position - 167 to -156 in the RAD2 gene is similar to at sequence present in the 5' flanking regions of the RAD7 and RAD10 genes

Recurrence plot analysis of DNA sequences

Energy Technology Data Exchange (ETDEWEB)

Wu Zuobing [State Key Laboratory of Nonlinear Mechanics, Institute of Mechanics, Chinese Academy of Sciences, Beijing 100080 (China)]. E-mail: wuzb@lnm.imech.ac.cn

2004-11-15

Recurrence plot technique of DNA sequences is established on metric representation and employed to analyze correlation structure of nucleotide strings. It is found that, in the transference of nucleotide strings, a human DNA fragment has a major correlation distance, but a yeast chromosome's correlation distance has a constant increasing.

Thioredoxin suppresses microscopic hopping of T7 DNA polymerase on duplex DNA

NARCIS (Netherlands)

Etson, Candice M.; Hamdan, Samir M.; Richardson, Charles C.; Oijen, Antoine M. van; Richardson, Charles C.

2010-01-01

The DNA polymerases involved in DNA replication achieve high processivity of nucleotide incorporation by forming a complex with processivity factors. A model system for replicative DNA polymerases, the bacteriophage T7 DNA polymerase (gp5), encoded by gene 5, forms a tight, 1:1 complex with

Contents and retentions of free and total purine bases in lamb meat cooked by several household methods

Directory of Open Access Journals (Sweden)

P. Anfossi

2011-03-01

Full Text Available Concerns about the content of total and free purine bases in muscle foods and their retentions upon cooking have been since long established (Brulé et al., 1988. Recently, though, an important rôle has been acknowledged to dietary sources of preformed purines for the growth of tissues with a rapid turnover and for optimal function of the cellular immune response, up to the point that the positive features of these nutrients seem to outweigh by far the negative ones (ILSI, 1998. Scanty information exists about the total purine content of raw ovine meat, the only available sources of data being a survey by Herbel and Montag (1987 on purine and pyrimidine contents of protein-rich foods and the comprehensive collection of food composition tables compiled by Scherz and Senser (1994...

Computational learning on specificity-determining residue-nucleotide interactions

KAUST Repository

Wong, Ka-Chun; Li, Yue; Peng, Chengbin; Moses, Alan M.; Zhang, Zhaolei

2015-01-01

The protein–DNA interactions between transcription factors and transcription factor binding sites are essential activities in gene regulation. To decipher the binding codes, it is a long-standing challenge to understand the binding mechanism across different transcription factor DNA binding families. Past computational learning studies usually focus on learning and predicting the DNA binding residues on protein side. Taking into account both sides (protein and DNA), we propose and describe a computational study for learning the specificity-determining residue-nucleotide interactions of different known DNA-binding domain families. The proposed learning models are compared to state-of-the-art models comprehensively, demonstrating its competitive learning performance. In addition, we describe and propose two applications which demonstrate how the learnt models can provide meaningful insights into protein–DNA interactions across different DNA binding families.

Computational learning on specificity-determining residue-nucleotide interactions

KAUST Repository

Wong, Ka-Chun

2015-11-02

The protein–DNA interactions between transcription factors and transcription factor binding sites are essential activities in gene regulation. To decipher the binding codes, it is a long-standing challenge to understand the binding mechanism across different transcription factor DNA binding families. Past computational learning studies usually focus on learning and predicting the DNA binding residues on protein side. Taking into account both sides (protein and DNA), we propose and describe a computational study for learning the specificity-determining residue-nucleotide interactions of different known DNA-binding domain families. The proposed learning models are compared to state-of-the-art models comprehensively, demonstrating its competitive learning performance. In addition, we describe and propose two applications which demonstrate how the learnt models can provide meaningful insights into protein–DNA interactions across different DNA binding families.

Nucleotide sequence of a cDNA for branched chain acyltransferase with analysis of the deduced protein structure

International Nuclear Information System (INIS)

Hummel, K.B.; Litwer, S.; Bradford, A.P.; Aitken, A.; Danner, D.J.; Yeaman, S.J.

1988-01-01

Nucleotide sequence was determined for a 1.6-kilobase human cDNA putative for the branched chain acyltransferase protein of the branched chain α-ketoacid dehydrogenase complex. Translation of the sequence reveals an open reading frame encoding a 315-amino acid protein of molecular weight 35,759 followed by 560 bases of 3'-untranslated sequence. Three repeats of the polyadenylation signal hexamer ATTAAA are present prior to the polyadenylate tail. Within the open reading frame is a 10-amino acid fragment which matches exactly the amino acid sequence around the lipoate-lysine residue in bovine kidney branched chain acyltransferase, thus confirming the identity of the cDNA. Analysis of the deduced protein structure for the human branched chain acyltransferase revealed an organization into domains similar to that reported for the acyltransferase proteins of the pyruvate and α-ketoglutarate dehydrogenase complexes. This similarity in organization suggests that a more detailed analysis of the proteins will be required to explain the individual substrate and multienzyme complex specificity shown by these acyltransferases

The sequence specificity of UV-induced DNA damage in a systematically altered DNA sequence.

Science.gov (United States)

Khoe, Clairine V; Chung, Long H; Murray, Vincent

2018-06-01

The sequence specificity of UV-induced DNA damage was investigated in a specifically designed DNA plasmid using two procedures: end-labelling and linear amplification. Absorption of UV photons by DNA leads to dimerisation of pyrimidine bases and produces two major photoproducts, cyclobutane pyrimidine dimers (CPDs) and pyrimidine(6-4)pyrimidone photoproducts (6-4PPs). A previous study had determined that two hexanucleotide sequences, 5'-GCTC*AC and 5'-TATT*AA, were high intensity UV-induced DNA damage sites. The UV clone plasmid was constructed by systematically altering each nucleotide of these two hexanucleotide sequences. One of the main goals of this study was to determine the influence of single nucleotide alterations on the intensity of UV-induced DNA damage. The sequence 5'-GCTC*AC was designed to examine the sequence specificity of 6-4PPs and the highest intensity 6-4PP damage sites were found at 5'-GTTC*CC nucleotides. The sequence 5'-TATT*AA was devised to investigate the sequence specificity of CPDs and the highest intensity CPD damage sites were found at 5'-TTTT*CG nucleotides. It was proposed that the tetranucleotide DNA sequence, 5'-YTC*Y (where Y is T or C), was the consensus sequence for the highest intensity UV-induced 6-4PP adduct sites; while it was 5'-YTT*C for the highest intensity UV-induced CPD damage sites. These consensus tetranucleotides are composed entirely of consecutive pyrimidines and must have a DNA conformation that is highly productive for the absorption of UV photons. Crown Copyright © 2018. Published by Elsevier B.V. All rights reserved.

Measurement and application of purine derivatives: Creatinine ratio in spot urine samples of ruminants

International Nuclear Information System (INIS)

Chen, X.B.; Jayasuriya, M.C.N.; Makkar, H.P.S.

2004-01-01

The daily excretion of purine derivatives in urine has been used to estimate the supply of microbial protein to ruminant animals. The method provides a simple and non-invasive tool to indicate the nutritional status of farm animals. However due to the need for complete collection of urine the potential application at farm level is restricted. Research conducted under the FAO/IAEA Co-ordinated Research Project has indicated that it is possible to use the purine derivatives:creatinine ratio measured in several spot urine samples collected within a day, as an index of microbial protein supply in a banding system for farm application. Some theoretical and experimental aspects in the measurement of purine derivatives:creatinine ratio in spot urine samples and the possible application of the banding system at the farm level are discussed. (author)

DNA Three-Way Junction for Differentiation of Single-Nucleotide Polymorphisms with Fluorescent Copper Nanoparticles.

Science.gov (United States)

Sun, Feifei; You, Ying; Liu, Jie; Song, Quanwei; Shen, Xiaotong; Na, Na; Ouyang, Jin

2017-05-23

A label- and enzyme-free fluorescent sensor for the detection of single-nucleotide polymorphisms (SNPs) at room temperature is proposed, using new copper nanoparticles (CuNPs) as fluorescent reporters. The CuNPs were constructed by using a DNA three-way junction (3WJ) template. In this assay, two complementary adenine/thymine-rich probes can hybridize with the wild-type target simultaneously to construct a 3WJ structure, serving as an efficient scaffold for the generation of CuNPs. However, the CuNPs produce weak fluorescence when the probes bind with a mutant-type target. SNPs can be identified by the difference in fluorescence intensity of the CuNPs. This SNPs detection strategy is straightforward, cost-effective, and avoids the complicated procedures of labeling or enzymatic reactions. The fluorescent sensor is versatile and can be applied to all types of mutation because the probes are programmable. Moreover, the sensor exhibits good detection performance in biological samples. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

DNA probes

Energy Technology Data Exchange (ETDEWEB)

Castelino, J

1993-12-31

The creation of DNA probes for detection of specific nucleotide segments differs from ligand detection in that it is a chemical rather than an immunological reaction. Complementary DNA or RNA is used in place of the antibody and is labelled with {sup 32}P. So far, DNA probes have been successfully employed in the diagnosis of inherited disorders, infectious diseases, and for identification of human oncogenes. The latest approach to the diagnosis of communicable and parasitic infections is based on the use of deoxyribonucleic acid (DNA) probes. The genetic information of all cells is encoded by DNA and DNA probe approach to identification of pathogens is unique because the focus of the method is the nucleic acid content of the organism rather than the products that the nucleic acid encodes. Since every properly classified species has some unique nucleotide sequences that distinguish it from every other species, each organism`s genetic composition is in essence a finger print that can be used for its identification. In addition to this specificity, DNA probes offer other advantages in that pathogens may be identified directly in clinical specimens 10 figs, 2 tabs

DNA Damage, Repair, and Cancer Metabolism

Science.gov (United States)

Turgeon, Marc-Olivier; Perry, Nicholas J. S.; Poulogiannis, George

2018-01-01

Although there has been a renewed interest in the field of cancer metabolism in the last decade, the link between metabolism and DNA damage/DNA repair in cancer has yet to be appreciably explored. In this review, we examine the evidence connecting DNA damage and repair mechanisms with cell metabolism through three principal links. (1) Regulation of methyl- and acetyl-group donors through different metabolic pathways can impact DNA folding and remodeling, an essential part of accurate double strand break repair. (2) Glutamine, aspartate, and other nutrients are essential for de novo nucleotide synthesis, which dictates the availability of the nucleotide pool, and thereby influences DNA repair and replication. (3) Reactive oxygen species, which can increase oxidative DNA damage and hence the load of the DNA-repair machinery, are regulated through different metabolic pathways. Interestingly, while metabolism affects DNA repair, DNA damage can also induce metabolic rewiring. Activation of the DNA damage response (DDR) triggers an increase in nucleotide synthesis and anabolic glucose metabolism, while also reducing glutamine anaplerosis. Furthermore, mutations in genes involved in the DDR and DNA repair also lead to metabolic rewiring. Links between cancer metabolism and DNA damage/DNA repair are increasingly apparent, yielding opportunities to investigate the mechanistic basis behind potential metabolic vulnerabilities of a substantial fraction of tumors. PMID:29459886

Interaction of water with oriented DNA in the A- and B-form conformations

International Nuclear Information System (INIS)

Brandes, R.; Rupprecht, A.; Kearns, D.R.

1989-01-01

High resolution 2 H nuclear magnetic resonance (NMR) was used to investigate the interaction of D 2 O with solid samples of uniaxially oriented Li-DNA (B-form DNA) and Na-DNA (A- and B-form DNA). At low levels of hydration, 0 approximately 4 D 2 O/nucleotide, the 2 H spectra shows a very weak (due to short T2) broad single resonance, suggestive of unrestricted rotational diffusion of the water. At approximately 5 or more D 2 O/nucleotide, the Li-DNA (B-form) spectra suddenly exhibit a large doublet splitting, characteristic of partially ordered water. With increasing hydration, the general trend is a decrease of this splitting. From our analysis we show that the DNA water structure reorganizes as the DNA is progressively hydrated. The D 2 O interaction with Na-DNA is rather different than with Li-DNA. Below 10 D 2 O/nucleotide Na-DNA is normally expected to be in the A-form, and a small, or negligible splitting is observed. In the range 9-19 D 2 O/nucleotide, the splitting increases with increasing hydration. Above approximately 20 D 2 O/nucleotide Na-DNA converts entirely to the B-form and the D 2 O splittings are then similar to those found in Li-DNA. We show that the complex Na-DNA results obtained in the range 0-20 D 2 O/nucleotide are caused by a mixture of A- and B-DNA in those samples

Role of DNA conformation & energetic insights in Msx-1-DNA recognition as revealed by molecular dynamics studies on specific and nonspecific complexes.

Science.gov (United States)

Kachhap, Sangita; Singh, Balvinder

2015-01-01

In most of homeodomain-DNA complexes, glutamine or lysine is present at 50th position and interacts with 5th and 6th nucleotide of core recognition region. Molecular dynamics simulations of Msx-1-DNA complex (Q50-TG) and its variant complexes, that is specific (Q50K-CC), nonspecific (Q50-CC) having mutation in DNA and (Q50K-TG) in protein, have been carried out. Analysis of protein-DNA interactions and structure of DNA in specific and nonspecific complexes show that amino acid residues use sequence-dependent shape of DNA to interact. The binding free energies of all four complexes were analysed to define role of amino acid residue at 50th position in terms of binding strength considering the variation in DNA on stability of protein-DNA complexes. The order of stability of protein-DNA complexes shows that specific complexes are more stable than nonspecific ones. Decomposition analysis shows that N-terminal amino acid residues have been found to contribute maximally in binding free energy of protein-DNA complexes. Among specific protein-DNA complexes, K50 contributes more as compared to Q50 towards binding free energy in respective complexes. The sequence dependence of local conformation of DNA enables Q50/Q50K to make hydrogen bond with nucleotide(s) of DNA. The changes in amino acid sequence of protein are accommodated and stabilized around TAAT core region of DNA having variation in nucleotides.

Palindromic nucleotide analysis in human T cell receptor rearrangements.

Directory of Open Access Journals (Sweden)

Santosh K Srivastava

Full Text Available Diversity of T cell receptor (TCR genes is primarily generated by nucleotide insertions upon rearrangement from their germ line-encoded V, D and J segments. Nucleotide insertions at V-D and D-J junctions are random, but some small subsets of these insertions are exceptional, in that one to three base pairs inversely repeat the sequence of the germline DNA. These short complementary palindromic sequences are called P nucleotides. We apply the ImmunoSeq deep-sequencing assay to the third complementarity determining region (CDR3 of the β chain of T cell receptors, and use the resulting data to study P nucleotides in the repertoire of naïve and memory CD8(+ and CD4(+ T cells. We estimate P nucleotide distributions in a cross section of healthy adults and different T cell subtypes. We show that P nucleotide frequency in all T cell subtypes ranges from 1% to 2%, and that the distribution is highly biased with respect to the coding end of the gene segment. Classification of observed palindromic sequences into P nucleotides using a maximum conditional probability model shows that single base P nucleotides are very rare in VDJ recombination; P nucleotides are primarily two bases long. To explore the role of P nucleotides in thymic selection, we compare P nucleotides in productive and non-productive sequences of CD8(+ naïve T cells. The naïve CD8(+ T cell clones with P nucleotides are more highly expanded.

Silymarin protects epidermal keratinocytes from ultraviolet radiation-induced apoptosis and DNA damage by nucleotide excision repair mechanism.

Directory of Open Access Journals (Sweden)

Santosh K Katiyar

Full Text Available Solar ultraviolet (UV radiation is a well recognized epidemiologic risk factor for melanoma and non-melanoma skin cancers. This observation has been linked to the accumulation of UVB radiation-induced DNA lesions in cells, and that finally lead to the development of skin cancers. Earlier, we have shown that topical treatment of skin with silymarin, a plant flavanoid from milk thistle (Silybum marianum, inhibits photocarcinogenesis in mice; however it is less understood whether chemopreventive effect of silymarin is mediated through the repair of DNA lesions in skin cells and that protect the cells from apoptosis. Here, we show that treatment of normal human epidermal keratinocytes (NHEK with silymarin blocks UVB-induced apoptosis of NHEK in vitro. Silymarin reduces the amount of UVB radiation-induced DNA damage as demonstrated by reduced amounts of cyclobutane pyrimidine dimers (CPDs and as measured by comet assay, and that ultimately may lead to reduced apoptosis of NHEK. The reduction of UV radiation-induced DNA damage by silymarin appears to be related with induction of nucleotide excision repair (NER genes, because UV radiation-induced apoptosis was not blocked by silymarin in NER-deficient human fibroblasts. Cytostaining and dot-blot analysis revealed that silymarin repaired UV-induced CPDs in NER-proficient fibroblasts from a healthy individual but did not repair UV-induced CPD-positive cells in NER-deficient fibroblasts from patients suffering from xeroderma pigmentosum complementation-A disease. Similarly, immunohistochemical analysis revealed that silymarin did not reduce the number of UVB-induced sunburn/apoptotic cells in the skin of NER-deficient mice, but reduced the number of sunburn cells in their wild-type counterparts. Together, these results suggest that silymarin exert the capacity to reduce UV radiation-induced DNA damage and, thus, prevent the harmful effects of UV radiation on the genomic stability of epidermal cells.

Involvement of DNA polymerase δ in DNA repair synthesis in human fibroblasts at late times after ultraviolet irradiation

International Nuclear Information System (INIS)

Dresler, S.L.; Gowans, B.J.; Robinson-Hill, R.M.; Hunting, D.J.

1988-01-01

DNA repair synthesis following UV irradiation of confluent human fibroblasts has a biphasic time course with an early phase of rapid nucleotide incorporation and a late phase of much slower nucleotide incorporation. The biphasic nature of this curve suggests that two distinct DNA repair systems may be operative. Previous studies have specifically implicated DNA polymerase δ as the enzyme involved in DNA repair synthesis occurring immediately after UV damage. In this paper, the authors describe studies of DNA polymerase involvement in DNA repair synthesis in confluent human fibroblasts at late times after UV irradiation. Late UV-induced DNA repair synthesis in both intact and permeable cells was found to be inhibited by aphidicolin, indicating the involvement of one of the aphidicolin-sensitive DNA polymerases, α or δ. In permeable cells, the process was further analyzed by using the nucleotide analogue (butylphenyl)-2'-deoxyguanosine 5'-triphosphate, which inhibits DNA polymerase α several hundred times more strongly than it inhibits DNA polymerase δ. The (butylphenyl)-2'-deoxyguanosine 5'-triphosphate inhibition curve for late UV-induced repair synthesis was very similar to that for polymerase δ. It appears that repair synthesis at late time after UV irradiation, like repair synthesis at early times, is mediated by DNA polymerase δ

Synthesis of (purin-6-yl)acetates and 6-(2-hydroxyethyl)purines via cross-couplings of 6-chloropurines with the Reformatsky reagent

Czech Academy of Sciences Publication Activity Database

Hasník, Zbyněk; Šilhár, Peter; Hocek, Michal

2007-01-01

Roč. 48, č. 32 (2007), s. 5589-5592 ISSN 0040-4039 R&D Projects: GA MŠk 1M0508; GA AV ČR 1QS400550501 Institutional research plan: CEZ:AV0Z40550506 Keywords : purines * nucleosides * cross-coupling reactions Subject RIV: CC - Organic Chemistry Impact factor: 2.615, year: 2007

Effects of pH, temperature, and chemical structure on the stability of S-(purin-6-yl)-L-cysteine: evidence for a novel molecular rearrangement mechanism to yield N-(purin-6-yl)-L-cysteine.

Science.gov (United States)

Elfarra, A A; Hwang, I Y

1996-01-01

The stability of S-(purin-6-yl)-L-cysteine (SPC), a kidney-selective prodrug of 6-mercaptopurine and a putative metabolite of 6-chloropurine, was investigated under various pH and temperature conditions. At room temperature, the half-life (t 1/2) of SPC at either highly acidic (pH 3.6) or basic conditions (pH 9.6) was longer than at neutral or slightly acidic or basic conditions (pH 5.7-8.75). The primary degradation product, N-(purin-6-yl)-L-cysteine (NPC), was isolated using Sephadex LH-20 chromatography and characterized by 1H NMR and FAB/MS after derivatization with 2-iodoacetic acid. These results reveal novel stability requirements and implicate the cysteinyl amino group and the purinyl N-1 nitrogen in the mechanism of SPC rearrangement to NPC. Further evidence for this hypothesis was provided by the findings that the stability of SPC in phosphate buffer (pH 7.4) at 37 degrees C was similar to that of S-(guanin-6-yl)-L-cysteine, whereas S-(purin-6-yl)-N-acetyl-L-cysteine and S-(purin-6-yl)glutathione which have their cysteine amino groups blocked were much more stable than SPC. S-(Purin-6-yl)-L-homocysteine (SPHC) was also more stable than SPC, possibly because the formation of a 6-membered ring transition state as would be expected with SPHC is kinetically less favored than the formation of a 5-membered ring transition state as would be expected with SPC. These results may explain previous in vivo metabolism results of SPC and its analogs and may contribute to a better understanding of stability of structurally related cysteine S-conjugates.

Structure of human DNA polymerase iota and the mechanism of DNA synthesis.

Science.gov (United States)

Makarova, A V; Kulbachinskiy, A V

2012-06-01

Cellular DNA polymerases belong to several families and carry out different functions. Highly accurate replicative DNA polymerases play the major role in cell genome replication. A number of new specialized DNA polymerases were discovered at the turn of XX-XXI centuries and have been intensively studied during the last decade. Due to the special structure of the active site, these enzymes efficiently perform synthesis on damaged DNA but are characterized by low fidelity. Human DNA polymerase iota (Pol ι) belongs to the Y-family of specialized DNA polymerases and is one of the most error-prone enzymes involved in DNA synthesis. In contrast to other DNA polymerases, Pol ι is able to use noncanonical Hoogsteen interactions for nucleotide base pairing. This allows it to incorporate nucleotides opposite various lesions in the DNA template that impair Watson-Crick interactions. Based on the data of X-ray structural analysis of Pol ι in complexes with various DNA templates and dNTP substrates, we consider the structural peculiarities of the Pol ι active site and discuss possible mechanisms that ensure the unique behavior of the enzyme on damaged and undamaged DNA.

Mechanistic Investigation of the Bypass of a Bulky Aromatic DNA Adduct Catalyzed by a Y-family DNA Polymerase

Science.gov (United States)

Gadkari, Varun V.; Tokarsky, E. John; Malik, Chanchal K.; Basu, Ashis K.; Suo, Zucai

2014-01-01

3-Nitrobenzanthrone (3-NBA), a nitropolyaromatic hydrocarbon (NitroPAH) pollutant in diesel exhaust, is a potent mutagen and carcinogen. After metabolic activation, the primary metabolites of 3-NBA react with DNA to form dG and dA adducts. One of the three major adducts identified is N-(2’-deoxyguanosin-8-yl)-3-aminobenzanthrone (dGC8-N-ABA). This bulky adduct likely stalls replicative DNA polymerases but can be traversed by lesion bypass polymerases in vivo. Here, we employed running start assays to show that a site-specifically placed dGC8-N-ABA is bypassed in vitro by Sulfolobus solfataricus DNA polymerase IV (Dpo4), a model Y-family DNA polymerase. However, the nucleotide incorporation rate of Dpo4 was significantly reduced opposite both the lesion and the template position immediately downstream from the lesion site, leading to two strong pause sites. To investigate the kinetic effect of dGC8-N-ABA on polymerization, we utilized pre-steady-state kinetic methods to determine the kinetic parameters for individual nucleotide incorporations upstream, opposite, and downstream from the dGC8-N-ABA lesion. Relative to the replication of the corresponding undamaged DNA template, both nucleotide incorporation efficiency and fidelity of Dpo4 were considerably decreased during dGC8-N-ABA lesion bypass and the subsequent extension step. The lower nucleotide incorporation efficiency caused by the lesion is a result of a significantly reduced dNTP incorporation rate constant and modestly weaker dNTP binding affinity. At both pause sites, nucleotide incorporation followed biphasic kinetics with a fast and a slow phase and their rates varied with nucleotide concentration. In contrast, only the fast phase was observed with undamaged DNA. A kinetic mechanism was proposed for the bypass of dGC8-N-ABA bypass catalyzed by Dpo4. PMID:25048879

Tolbutamide attenuates diazoxide-induced aggravation of hypoxic cell injury.

Science.gov (United States)

Pissarek, M; Reichelt, C; Krauss, G J; Illes, P

1998-11-23

/ADP, GTP/GDP and UTP/UDP ratios uniformly declined at a low pO2. However, only the ATP/ADP ratio was decreased further by diazoxide (300 microM). The observed alterations in nucleotide contents may be of importance for long- and short-term processes related to acute cerebral hypoxia. Thus, hypoxia-induced alterations of purine and pyrimidine nucleotide levels may influence the open state of KATP-channels during the period of reversible hypoxic cerebral injury. Furthermore, alterations during the irreversible period of cerebral injury may also arise, as a consequence of decreased pyrimidine nucleotide contents affecting cell survival viaprotein and DNA synthesis.

Partial nucleotide sequence analysis of 18S ribosomal RNA gene of the four genotypes of Trypanosoma congolense

International Nuclear Information System (INIS)

Osanya, A.; Majiwa, P.A.O.; Kinyanjui, P.W.

2006-01-01

Specific oligonucleotide primers based on conserved nucleotide sequences of 18s ribisomal RNA (18s rRNA) gene of Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum have been designed and used in the ploymerase chain reaction (PCR) to amplify genomic DNA from four different clones each representing a different genotypic group of T. congolence. PCR products of approximately 1Kb were generated using as template DNA from each of the trypanosomes. The PCR products cross-hybridized with genomic DNA from T.brucei, T. simiae and the four genotypes of T.congolense implying significant sequence homology of 18S rRNA gene among trypanosomes. The nucleotide sequence of a segment of the PCR products were determined by direct sequencing to provide partial nucleotide sequence of the 18s rRNA gene in each T.congolense genotypic group. The sequences obtained together with those that have been published for T.brucei reveals that although most regions show inter and intra species nucleotide identity, there are several sites where deletions, insertions and base changes have occured in nucleotide sequence of of T.brucei and the four genotypes of T.congolense.(author)

Synthesis of (Purin-6-yl)methylphosphonate Bases and Nucleosides

Czech Academy of Sciences Publication Activity Database

Hasník, Zbyněk; Pohl, Radek; Hocek, Michal

2010-01-01

Roč. 51, č. 18 (2010), s. 2464-2466 ISSN 0040-4039 R&D Projects: GA MŠk 1M0508 Institutional research plan: CEZ:AV0Z40550506 Keywords : purines * nucleosides * phosphonates * cross-coupling Subject RIV: CC - Organic Chemistry Impact factor: 2.618, year: 2010

Efecto Antagónico in vitro de Actinomicetos Aislados de Purines de Chipaca (Bidens pilosa L. Frente a Phytophthora infestans (Mont de Bary In vitro Antagonistic Effect of Actinomycetes Isolated from Chipaca (Bidens pilosa L. Purins Against Phytophthora infestans (Mont de Bary

Directory of Open Access Journals (Sweden)

Yudy Astrid Fonseca Ardila

2011-12-01

Full Text Available Se estudió el efecto inhibidor de los actinomicetos presentes en purines o extractos fermentados de plantas de chipaca (Bidens pilosa L., sobre el crecimiento de Phytophthora infestans (Mont de Bary, causante del tizón tardío de la papa. Se elaboraron cuatro purines de flores, raíces, hojas-tallos y su mezcla. De estos purines se obtuvieron 25 aislamientos de actinomicetos, cada uno de los cuales se enfrentó con P. infestans en placas de medio de cultivo, utilizando la técnica de anillos de Gauze y estableciendo las concentraciones iniciales de esporas mediante conteos microscópicos en cámara de Neubauer. Los actinomicetos no crecieron en el purin de flores debido, posiblemente, a que en él no se utiliza suelo rizosférico o porque su pH (9 es mayor que el rango normal de crecimiento de estos microorganismos ( pH 6 -; 8. Se evidenció inhibición del crecimiento del oomycete por parte de 8 aislamientos de actinomicetos con porcentajes de inhibición entre 33,3 - 77,8%, provenientes de los purines de raíces, tallos-hojas y mezcla de partes de la planta. La mayor inhibición se obtuvo en los aislamientos AC001, AC010, AC011 y AC025 con conteos de 0,4, 6,0, 3,0, y 3,6 x10(5 esporas mL-1.Purins or liquid fermented extracts of chipaca (Bidens pilosa L. were prepared to establish the inhibitory effect of the actinomycetes found in such biopharmaceutical preparations on the growth of Phytophthora infestans (Mont de Bary, the causative of potato late blight disease. Four purins made from flowers, roots, leaf-steams and a mixture of them were prepared; 25 actinomycete isolates were obtained from these purins and their ability to resist challenge by P. infestans was ascertained in medium plates using the ring Gauze technique and establishing initial concentrations of spores by microscopic counting in Neubauer chamber. Actinomycetes did not grow in flower purin as rhizosphere soil was not used in its preparation or because this particular pH (9

Probe Selection for DNA Microarrays using OligoWiz

DEFF Research Database (Denmark)

Wernersson, Rasmus; Juncker, Agnieszka; Nielsen, Henrik Bjørn

2007-01-01

Nucleotide abundance measurements using DNA microarray technology are possible only if appropriate probes complementary to the target nucleotides can be identified. Here we present a protocol for selecting DNA probes for microarrays using the OligoWiz application. OligoWiz is a client-server appl......Nucleotide abundance measurements using DNA microarray technology are possible only if appropriate probes complementary to the target nucleotides can be identified. Here we present a protocol for selecting DNA probes for microarrays using the OligoWiz application. OligoWiz is a client......-server application that offers a detailed graphical interface and real-time user interaction on the client side, and massive computer power and a large collection of species databases (400, summer 2007) on the server side. Probes are selected according to five weighted scores: cross-hybridization, deltaT(m), folding...... computer skills and can be executed from any Internet-connected computer. The probe selection procedure for a standard microarray design targeting all yeast transcripts can be completed in 1 h....

Assessment of single nucleotide polymorphisms in screening 52 DNA repair and cell cycle control genes in Fanconi anemia patients

Directory of Open Access Journals (Sweden)

Petrović Sandra

2015-01-01

Full Text Available Fanconi anemia (FA is a rare genetically heterogeneous disorder associated with bone marrow failure, birth defects and cancer susceptibility. Apart from the disease- causing mutations in FANC genes, the identification of specific DNA variations, such as single nucleotide polymorphisms (SNPs, in other candidate genes may lead to a better clinical description of this condition enabling individualized treatment with improvement of the prognosis. In this study, we have assessed 95 SNPs located in 52 key genes involved in base excision repair (BER, nucleotide excision repair (NER, mismatch repair (MMR, double strand break (DSB repair and cell cycle control using a DNA repair chip (Asper Biotech, Estonia which includes most of the common variants for the candidate genes. The SNP genotyping was performed in five FA-D2 patients and in one FA-A patient. The polymorphisms studied were synonymous (n=10, nonsynonymous (missense (n=52 and in non-coding regions of the genome (introns and 5 ‘and 3’ untranslated regions (UTR (n=33. Polymorphisms found at the homozygous state are selected for further analysis. Our results have shown a significant inter-individual variability among patients in the type and the frequency of SNPs and also elucidate the need for further studies of polymorphisms located in ATM, APEX APE 1, XRCC1, ERCC2, MSH3, PARP4, NBS1, BARD1, CDKN1B, TP53 and TP53BP1 which may be of great importance for better clinical description of FA. In addition, the present report recommends the use of SNPs as predictive and prognostic genetic markers to individualize therapy of FA patients. [Projekat Ministarstva nauke Republike Srbije, br. 173046

DNA strand breakage by 125I-decay in oligoDNA

International Nuclear Information System (INIS)

Lobachevsky, P.; Martin, R.F.

1996-01-01

Full text: A double-stranded oligodeoxynucleotide containing 125 I-dC in a defined location, with 5'- or 3'- 32 P-end-labelling of either strand, was used to investigate DNA strand breakage resulting from 125 I decay. Samples of the 32 P-end-labelled and 125 I-dC containing oligoDNA were incubated in 20 mM phosphate buffer (PB), or PB + 2 M dimethylsulphoxide (DMSO) at 4 deg during 18-20 days. The 32 P-end-labelled DNA fragments produced by 125 I decays were separated on denaturing polyacrylamide gels, and the 3P activity in each fragment was determined by scintillation counting after elution from the gel. The fragment size distribution was then converted to a distribution of single stranded break probabilities at each nucleotide position. The results indicate that each 125 I decay event produces at least one break in the 125 I-dC containing strand, and causes breakage of the opposite strand in 75-80% of events. Thus, the double stranded break is produced by 125 I decay with probability ∼0.8. Most of single stranded breaks (around 90%) occurred within 5-6 nucleotides of the 125 I-dC, however DNA breaks were detected up to 18-20 nucleotides from the decay site. The average numbers of single stranded breaks per decay are 3.7 (PB) and 3.3 (PB+DMSO) in 125 I-dC containing strand, and 1.5 (PB) and 1.3 (PB+DMSO) in the opposite strand. Deconvolution of strand break probabilities as a function of separation from the 125 I, in terms of both distance (to target deoxyribosyl carbon atoms, in B-DNA) and nucleotide number, show that the latter is an important parameter for the shorter-range damage. This could indicate a role for attenuation/dissipation of damage through the stacked bases. In summary, the results represent a much more extensive set of data than available from earlier experiments on DNA breakage from l25 I-decay, and may provide new mechanistic insights

The nucleotide sequences of two leghemoglobin genes from soybean

DEFF Research Database (Denmark)

Wiborg, O; Hyldig-Nielsen, J J; Jensen, E O

1982-01-01

We present the complete nucleotide sequences of two leghemoglobin genes isolated from soybean DNA. Both genes contain three intervening sequences in identical positions. Comparison of the coding sequences with known amino-acid sequences of soybean leghemoglobins suggest that the two genes...

Inhibiting DNA Polymerases as a Therapeutic Intervention against Cancer

Directory of Open Access Journals (Sweden)

Anthony J. Berdis

2017-11-01

Full Text Available Inhibiting DNA synthesis is an important therapeutic strategy that is widely used to treat a number of hyperproliferative diseases including viral infections, autoimmune disorders, and cancer. This chapter describes two major categories of therapeutic agents used to inhibit DNA synthesis. The first category includes purine and pyrmidine nucleoside analogs that directly inhibit DNA polymerase activity. The second category includes DNA damaging agents including cisplatin and chlorambucil that modify the composition and structure of the nucleic acid substrate to indirectly inhibit DNA synthesis. Special emphasis is placed on describing the molecular mechanisms of these inhibitory effects against chromosomal and mitochondrial DNA polymerases. Discussions are also provided on the mechanisms associated with resistance to these therapeutic agents. A primary focus is toward understanding the roles of specialized DNA polymerases that by-pass DNA lesions produced by DNA damaging agents. Finally, a section is provided that describes emerging areas in developing new therapeutic strategies targeting specialized DNA polymerases.

Differences in substrate specificity of C(5)-substituted or C(5)-unsubstituted pyrimidine nucleotides by DNA polymerases from thermophilic bacteria, archaea, and phages.

Science.gov (United States)

Sawai, Hiroaki; Nagashima, Junichi; Kuwahara, Msayasu; Kitagata, Rina; Tamura, Takehiro; Matsui, Ikuo

2007-09-01

The pyrimidine bases of RNA are uracil (U) and cytosine (C), while thymine (T) and C are used for DNA. The C(5) position of C and U is unsubstituted, whereas the C(5) of T is substituted with a Me group. Miller et al. hypothesized that various C(5)-substituted uracil derivatives were formed during chemical evolution, and that C(5)-substituted U derivatives may have played important roles in the transition from an 'RNA world' to a 'DNA-RNA-protein world'. Hyperthermophilic bacteria and archaea are considered to be primitive organisms that are evolutionarily close to the universal ancestor of all life on earth. Thus, we examined the substrate specificity of several C(5)-substituted or C(5)-unsubstituted dUTP and dCTP analogs for several DNA polymerases from hyperthermophilic bacteria, hyperthermophilic archaea, and viruses during PCR or primer extension reaction. The substrate specificity of the C(5)-substituted or C(5)-unsubstituted pyrimidine nucleotides varied greatly depending on the type of DNA polymerase. The significance of this difference in substrate specificity in terms of the origin and evolution of the DNA replication system is discussed briefly.

Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

International Nuclear Information System (INIS)

Lo, A.; Yang, H.L.

1990-01-01

This patent describes a composition of matter that is specific for Neisseria gonorrhoeae. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of Neisseria gonorrhoeae to the amount of the sequence which hybridizes to chromosomal DNA of Neisseria meningitidis is greater than about five. The ratio being obtained by a method described

Footprinting of Chlorella virus DNA ligase bound at a nick in duplex DNA.

Science.gov (United States)

Odell, M; Shuman, S

1999-05-14

The 298-amino acid ATP-dependent DNA ligase of Chlorella virus PBCV-1 is the smallest eukaryotic DNA ligase known. The enzyme has intrinsic specificity for binding to nicked duplex DNA. To delineate the ligase-DNA interface, we have footprinted the enzyme binding site on DNA and the DNA binding site on ligase. The size of the exonuclease III footprint of ligase bound a single nick in duplex DNA is 19-21 nucleotides. The footprint is asymmetric, extending 8-9 nucleotides on the 3'-OH side of the nick and 11-12 nucleotides on the 5'-phosphate side. The 5'-phosphate moiety is essential for the binding of Chlorella virus ligase to nicked DNA. Here we show that the 3'-OH moiety is not required for nick recognition. The Chlorella virus ligase binds to a nicked ligand containing 2',3'-dideoxy and 5'-phosphate termini, but cannot catalyze adenylation of the 5'-end. Hence, the 3'-OH is important for step 2 chemistry even though it is not itself chemically transformed during DNA-adenylate formation. A 2'-OH cannot substitute for the essential 3'-OH in adenylation at a nick or even in strand closure at a preadenylated nick. The protein side of the ligase-DNA interface was probed by limited proteolysis of ligase with trypsin and chymotrypsin in the presence and absence of nicked DNA. Protease accessible sites are clustered within a short segment from amino acids 210-225 located distal to conserved motif V. The ligase is protected from proteolysis by nicked DNA. Protease cleavage of the native enzyme prior to DNA addition results in loss of DNA binding. These results suggest a bipartite domain structure in which the interdomain segment either comprises part of the DNA binding site or undergoes a conformational change upon DNA binding. The domain structure of Chlorella virus ligase inferred from the solution experiments is consistent with the structure of T7 DNA ligase determined by x-ray crystallography.

Synthesis and Cytotoxic Activity of Some New 2,6-Substituted Purines

Directory of Open Access Journals (Sweden)

Nageswara Rao Kode

2011-07-01

Full Text Available A seriesof twenty four acyclic unsaturated 2,6-substututed purines 5a-20b were synthesized. These compounds were evaluated for cytotoxic activity against NCI-60 DTP human tumor cell line screen at 10µMconcentration. N9-[(Z-4'-chloro-2'-butenyl-1'-yl]-2,6-dichloropurine(5a, N9-[4'-chloro-2'-butynyl-1'-yl]-2,6-dichloropurine(10a, N9-[(E-2',3'-dibromo-4'-chloro-2'-butenyl-1'-yl]-6-methoxypurine(14and N9-[4'-chloro-2'-butynyl-1'-yl]-6-(4-methoxyphenyl-purine(19exhibited highly potent cytotoxic activity with GI50 values in the 1–5 µM range for most human tumor cell lines. Other compounds exhibited moderate activity.

ACCUMULATION OF M1DG DNA ADDUCTS AFTER CHRONIC EXPOSURE TO PCBS, BUT NOT FROM ACUTE EXPOSURE TO DIOXIN-LIKE COMPOUNDS

Science.gov (United States)

ABSTRACT: Oxidative DNA damage is one of the key events leading to mutation and cancer. The present study examined the accumulation of M1dG DNA adducts, 3-(2’-deoxy-β-D-erythro-pentofuranosyl)-pyrimido[1,2-a]-purin-10(3H)-one, after single or yearly exposur...

The Mapping of Predicted Triplex DNA:RNA in the Drosophila Genome Reveals a Prominent Location in Development- and Morphogenesis-Related Genes

Directory of Open Access Journals (Sweden)

Claude Pasquier

2017-07-01

Full Text Available Double-stranded DNA is able to form triple-helical structures by accommodating a third nucleotide strand. A nucleic acid triplex occurs according to Hoogsteen rules that predict the stability and affinity of the third strand bound to the Watson–Crick duplex. The “triplex-forming oligonucleotide” (TFO can be a short sequence of RNA that binds to the major groove of the targeted duplex only when this duplex presents a sequence of purine or pyrimidine bases in one of the DNA strands. Many nuclear proteins are known to bind triplex DNA or DNA:RNA, but their biological functions are unexplored. We identified sequences that are capable of engaging as the “triplex-forming oligonucleotide” in both the pre-lncRNA and pre-mRNA collections of Drosophila melanogaster. These motifs were matched against the Drosophila genome in order to identify putative sequences of triplex formation in intergenic regions, promoters, and introns/exons. Most of the identified TFOs appear to be located in the intronic region of the analyzed genes. Computational prediction of the most targeted genes by TFOs originating from pre-lncRNAs and pre-mRNAs revealed that they are restrictively associated with development- and morphogenesis-related gene networks. The refined analysis by Gene Ontology enrichment demonstrates that some individual TFOs present genome-wide scale matches that are located in numerous genes and regulatory sequences. The triplex DNA:RNA computational mapping at the genome-wide scale suggests broad interference in the regulatory process of the gene networks orchestrated by TFO RNAs acting in association simultaneously at multiple sites.

Modes of DNA repair and replication

International Nuclear Information System (INIS)

Hanawalt, P.; Kondo, S.

1979-01-01

Modes of DNA repair and replication require close coordination as well as some overlap of enzyme functions. Some classes of recovery deficient mutants may have defects in replication rather than repair modes. Lesions such as the pyrimidine dimers produced by ultraviolet light irradiation are the blocks to normal DNA replication in vivo and in vitro. The DNA synthesis by the DNA polymerase 1 of E. coli is blocked at one nucleotide away from the dimerized pyrimidines in template strands. Thus, some DNA polymerases seem to be unable to incorporate nucleotides opposite to the non-pairing lesions in template DNA strands. The lesions in template DNA strands may block the sequential addition of nucleotides in the synthesis of daughter strands. Normal replication utilizes a constitutive ''error-free'' mode that copies DNA templates with high fidelity, but which may be totally blocked at a lesion that obscures the appropriate base pairing specificity. It might be expected that modified replication system exhibits generally high error frequency. The error rate of DNA polymerases may be controlled by the degree of phosphorylation of the enzyme. Inducible SOS system is controlled by recA genes that also control the pathways for recombination. It is possible that SOS system involves some process other than the modification of a blocked replication apparatus to permit error-prone transdimer synthesis. (Yamashita, S.)

Next-generation sequencing offers new insights into DNA degradation

DEFF Research Database (Denmark)

Overballe-Petersen, Søren; Orlando, Ludovic Antoine Alexandre; Willerslev, Eske

2012-01-01

The processes underlying DNA degradation are central to various disciplines, including cancer research, forensics and archaeology. The sequencing of ancient DNA molecules on next-generation sequencing platforms provides direct measurements of cytosine deamination, depurination and fragmentation...... rates that previously were obtained only from extrapolations of results from in vitro kinetic experiments performed over short timescales. For example, recent next-generation sequencing of ancient DNA reveals purine bases as one of the main targets of postmortem hydrolytic damage, through base...... elimination and strand breakage. It also shows substantially increased rates of DNA base-loss at guanosine. In this review, we argue that the latter results from an electron resonance structure unique to guanosine rather than adenosine having an extra resonance structure over guanosine as previously suggested....

Nucleic acid labeling with [3H]orotic acid and nucleotide profile in rats in protein deprivation, enteral and parenteral essential amino acid administration, and 5-fluorouracil treatment

International Nuclear Information System (INIS)

Jakobsson, B.; el Hag, I.A.; Andersson, M.; Christensson, P.I.; Stenram, U.

1990-01-01

Rats were fed a 0% casein diet for 1 week, with or without enteral or parenteral administration of essential amino acids, or a 25% casein diet, in one group supplemented with 5-fluorouracil treatment. Ninety minutes before sacrifice the rats were given a tracer of [3H]orotic acid. Incorporation into the acid soluble fraction, RNA, and DNA was determined in liver, small intestine, bone marrow, and kidney. Nucleotide profile was examined in liver and intestine. Protein deficiency caused inter alia a decrease in body weight; a decrease in RNA/DNA ratio and an increase in the specific RNA labeling in liver and kidney; an altered nucleotide profile in the liver; an increase in the nucleotide/DNA and RNA/DNA ratios and a decrease in the specific labeling of the acid soluble fraction, RNA, and DNA in the bone marrow. These changes were prevented to the same extent by giving essential amino acids, either orally or intravenously. The minor changes in intestinal nucleotide profile in protein deprivation were prevented to a slightly larger extent by amino acids orally than parenterally. 5-Fluorouracil treatment gave a decrease in the RNA/DNA ratio in the liver and kidney but an increase in the nucleotide/DNA and RNA/DNA ratios in the bone marrow. Nucleotide profiles were unaltered. The amount of DNA per gram of tissue decreased in bone marrow and increased in kidney. Parenteral administration per se resulted in almost no changes

Nucleotide excision repair I: from E.coli to yeast.

NARCIS (Netherlands)

J.H.J. Hoeijmakers (Jan)

1993-01-01

textabstractGenetic information is constantly deteriorating, mainly as a consequence of the action of numerous genotoxic agents. In order to cope with this fundamental problem, all living organisms have acquired a complex network of DNA repair systems to safeguard their genetic integrity. Nucleotide

Development of a single nucleotide polymorphism (SNP) marker for ...

African Journals Online (AJOL)

The nature of the single nucleotide polymorphism (SNP) marker was validated by DNA sequencing of the parental PCR products. Using high resolution melt (HRM) profiles and normalised difference plots, we successfully differentiated the homozygous dominant (wild type), homozygous recessive (LPA) and heterozygous ...

Isolation and characterization of human glycophorin A cDNA clones by a synthetic oligonucleotide approach: nucleotide sequence and mRNA structure

International Nuclear Information System (INIS)

Siebert, P.D.; Fukuda, M.

1986-01-01

In an effort to understand the relationships among and the regulation of human glycophorins, the authors have isolated and characterized several glycophorin A-specific cDNA clones obtained from a human erythroleukemic K562 cell cDNA library. This was accomplished by using mixed synthetic oligonucleotides, corresponding to various regions of the known amino acid sequence, to prime the synthesis of the cDNA as well as to screen the cDNA library. They also used synthetic oligonucleotides to sequence the largest of the glycophorin cDNAs. The nucleotide sequence obtained suggests the presence of a potential leader peptide, consistent with the membrane localization of this glycoprotein. Examination of the structure of glycophorin mRNA by blot hybridization revealed the existence of several electrophoretically distinct mRNAs numbering three or four, depending on the size of the glycophorin cDNA used as a hybridization probe. The smaller cDNA hybridized to three mRNAs of approximately 2.8, 1.7, and 1.0 kilobases. In contrast, the larger cDNA hybridized to an additional mRNA of approximately 0.6 kilobases. Further examination of the relationships between these multiple mRNAs by blot hybridization was conducted with the use of exact-sequence oligonucleotide probes constructed from various regions of the cDNA representing portions of the amino acid sequence of glycophorin A with or without known homology with glycophorin B. In total, the results obtained are consistent with the hypothesis that the three larger mRNAs represent glycophorin A gene transcripts and that the smallest (0.6 kilobase) mRNA may be specific for glycophorin B

Identification of the DNA-Binding Domains of Human Replication Protein A That Recognize G-Quadruplex DNA

Directory of Open Access Journals (Sweden)

Aishwarya Prakash

2011-01-01

Full Text Available Replication protein A (RPA, a key player in DNA metabolism, has 6 single-stranded DNA-(ssDNA- binding domains (DBDs A-F. SELEX experiments with the DBDs-C, -D, and -E retrieve a 20-nt G-quadruplex forming sequence. Binding studies show that RPA-DE binds preferentially to the G-quadruplex DNA, a unique preference not observed with other RPA constructs. Circular dichroism experiments show that RPA-CDE-core can unfold the G-quadruplex while RPA-DE stabilizes it. Binding studies show that RPA-C binds pyrimidine- and purine-rich sequences similarly. This difference between RPA-C and RPA-DE binding was also indicated by the inability of RPA-CDE-core to unfold an oligonucleotide containing a TC-region 5′ to the G-quadruplex. Molecular modeling studies of RPA-DE and telomere-binding proteins Pot1 and Stn1 reveal structural similarities between the proteins and illuminate potential DNA-binding sites for RPA-DE and Stn1. These data indicate that DBDs of RPA have different ssDNA recognition properties.

Development of laser-induced fluorescence detection to assay DNA damage

International Nuclear Information System (INIS)

Sharma, M.; Freund, H.G.

1991-01-01

A precolumn derivation method has been developed for high performance liquid chromatographic (HPLC) analysis of DNA damage using fluorescence detection. The modified nucleotide, having excised enzymatically from the exposed DNA, is enriched from the normal nucleotides and labeled with a fluorescent reagent. The labeling procedure involves phosphoramidation of the nucleotide with ethylenediamine (EDA) followed by conjugation of the free amino end of the phosphoramidate with 5-dimethylaminonaphthalene 1-sulfonyl chloride, commonly known as Dansyl chloride. The dansylated nucleotide can be analyzed with a sub-picomole limit of detection (LOD) by conventional HPLC using a conventional fluorescence detector. By combining microbore HPLC with laser-induced fluorescence (LIF) detection, the authors present the development of an analytical system that has sub-femtomole LOD for real-time analysis of the dansylated nucleotide. In this paper the application of the developed system in fluorescence postlabeling assay of a small alkyl-modified nucleotide (5-methyl CMP) in calf-thymus DNA is discussed

2′-O-methyl nucleotide modified DNA substrates influence the ...

Indian Academy of Sciences (India)

2014-07-18

Jul 18, 2014 ... 1. Introduction. Due to the development of novel nucleotide derivatives, ..... which is located in a spiral ring made of 152-157 bases before α6. ..... 8 126–. 130. Majlessi M, Nelson NC and Becker MM 1998 Advantages of 2'-O-.

Embryotoxicity induced by alkylating agents. Some methodological aspects of DNA alkylation studies in murine embryos using ethylmethanesulfonate.

Science.gov (United States)

Platzek, T; Bochert, G; Rahm, U; Neubert, D

1987-05-01

Synthesis and spectroscopic analysis of some alkylated DNA purine bases are described. HPLC separation methods are developed for the determination of DNA alkylation rates in mammalian embryonic tissues. Following treatment of pregnant mice with the ethylating agent ethylmethanesulfonate (EMS), an appreciable amount of alkylation (ethylation and methylation) was found in the nuclear DNA of the embryos during organogenesis. The results are discussed in context of our thesis that a certain amount of DNA alkylation in the embryos is correlated to the teratogenic potential of alkylating agents.

Influence of infection by Toxoplasma gondii on purine levels and E-ADA activity in the brain of mice experimentally infected mice.

Science.gov (United States)

Tonin, Alexandre A; Da Silva, Aleksandro S; Casali, Emerson A; Silveira, Stephanie S; Moritz, Cesar E J; Camillo, Giovana; Flores, Mariana M; Fighera, Rafael; Thomé, Gustavo R; Morsch, Vera M; Schetinger, Maria Rosa C; Rue, Mario De La; Vogel, Fernanda S F; Lopes, Sonia T A

2014-07-01

The aim of this study was to assess the purine levels and E-ADA activity in the brain of mice (BALB/c) experimentally infected with Toxoplasma gondii. In experiment I (n=24) the mice were infected with RH strain of T. gondii, while in experiment II (n=36) they were infected with strain ME-49 of T. gondii. Our results showed that, for RH strain (acute phase), an increase in both periods in the levels of ATP, ADP, AMP, adenosine, hypoxanthine, xanthine (only on day 6 PI) and uric acid (only on day 6 PI). By the other hand, the RH strain led, on days 4 and 6 PI, to a reduction in the concentration of inosine. ME-49, a cystogenic strain, showed some differences in acute and chronic phase, since on day 6 PI the levels of ATP and ADP were increased, while on day 30 these same nucleotides were reduced. On day 60 PI, ME-49 induced a reduction in the levels of ATP, ADP, AMP, adenosine, inosine and xanthine, while uric acid was increased. A decrease of E-ADA activity was observed in brain on days 4 and 6 PI (RH), and 30 PI (ME-49); however on day 60 PI E-ADA activity was increased for infection by ME-49 strain. Therefore, it was possible to conclude that infection with T. gondii changes the purine levels and the activity of E-ADA in brain, which may be associated with neurological signs commonly observed in this disease. Copyright © 2014 Elsevier Inc. All rights reserved.

DNA oligonucleotide duplexes containing intramolecular platinated cross-links: energetics, hydration, sequence, and ionic effects.

Science.gov (United States)

Kankia, Besik I; Soto, Ana Maria; Burns, Nicole; Shikiya, Ronald; Tung, Chang-Shung; Marky, Luis A

2002-11-05

The anticancer activity of cisplatin arises from its ability to bind covalently to DNA, forming primarily intrastrand cross-links to adjacent purine residues; the most common adducts involve d(GpG) (65%) and d(ApG) (25%) intrastrand cross-links. The incorporation of these platinum adducts in a B-DNA helix induces local distortions, causing bending and unwinding of the DNA. In this work, we used temperature-dependent UV spectroscopy to investigate the unfolding thermodynamics, and associated ionic effects, of two sets of DNA decamer duplexes containing either cis-[Pt(NH(3))(2)[d(GpG

Nucleotide sequence composition and method for detection of neisseria gonorrhoeae

Energy Technology Data Exchange (ETDEWEB)

Lo, A.; Yang, H.L.

1990-02-13

This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.

A biological inspired fuzzy adaptive window median filter (FAWMF) for enhancing DNA signal processing.

Science.gov (United States)

Ahmad, Muneer; Jung, Low Tan; Bhuiyan, Al-Amin

2017-10-01

Digital signal processing techniques commonly employ fixed length window filters to process the signal contents. DNA signals differ in characteristics from common digital signals since they carry nucleotides as contents. The nucleotides own genetic code context and fuzzy behaviors due to their special structure and order in DNA strand. Employing conventional fixed length window filters for DNA signal processing produce spectral leakage and hence results in signal noise. A biological context aware adaptive window filter is required to process the DNA signals. This paper introduces a biological inspired fuzzy adaptive window median filter (FAWMF) which computes the fuzzy membership strength of nucleotides in each slide of window and filters nucleotides based on median filtering with a combination of s-shaped and z-shaped filters. Since coding regions cause 3-base periodicity by an unbalanced nucleotides' distribution producing a relatively high bias for nucleotides' usage, such fundamental characteristic of nucleotides has been exploited in FAWMF to suppress the signal noise. Along with adaptive response of FAWMF, a strong correlation between median nucleotides and the Π shaped filter was observed which produced enhanced discrimination between coding and non-coding regions contrary to fixed length conventional window filters. The proposed FAWMF attains a significant enhancement in coding regions identification i.e. 40% to 125% as compared to other conventional window filters tested over more than 250 benchmarked and randomly taken DNA datasets of different organisms. This study proves that conventional fixed length window filters applied to DNA signals do not achieve significant results since the nucleotides carry genetic code context. The proposed FAWMF algorithm is adaptive and outperforms significantly to process DNA signal contents. The algorithm applied to variety of DNA datasets produced noteworthy discrimination between coding and non-coding regions contrary

Estimation of microbial protein supply in ruminants using urinary purine derivatives

International Nuclear Information System (INIS)

Makkar, H.P.S.; Chen, X.B.

2004-01-01

This publication presents various models, describing the quantitative excretion of purine derivatives in urine, developed for various breeds of cattle and for sheep, goat, camel and buffalo and their use for estimation of microbial protein supply in ruminant livestock. It also describes progress made over the last decade in analytical methods for determining purine derivatives, and a unique approach for estimating microbial protein supply using spot urine samples developed under the FAO/IAEA CRP. This approach of using spot urine samples dispenses with quantitative recovery of urine, enabling its use by field and extension workers for evaluation of the nutritional status of farm animals. Future areas of research are also highlighted in the book. This book is a good source of reference for research workers, students and extension workers alike

The effect of purine phosphonomethoxyalkyl derivatives on DNA synthesis in Cho Chinese hamster cells

Energy Technology Data Exchange (ETDEWEB)

Stetina, R [Institute of Experimental Medicine, Laboratory of Developmental Toxicology, Academy of Sciences of Czech Republic, 51783 Olesnice v Orlickych horach (Czech Republic); Votruba, I; Holy, A; Merta, A [Institute of Organic Chemistry and Biochemistry, Academy of Sciences of Czech Republic (Czech Republic)

1994-12-31

The inhibition of incorporation of {sup 3}H-thymidine and the changes of the rate of nascent DNA chain elongation were investigated in Cho Chinese hamster cells treated with (S)-(3-hydroxy-2-phosphonomethoxypropyl) (HPMP) and N-(2-phosphonomethoxyethyl) (PME) derivatives of adenine (A), guanine (G) and 2,6-diaminopurine (DAP). No direct correlation was observed in PME and HPMP derivatives between cytotoxicity, inhibition of {sup 3}H-thymidine incorporation and inhibition of nascent DNA chain elongation. The highest cytotoxicity and inhibition of DNA synthesis were caused by PMEG. The limited extent of inhibition of DNA elongation was encountered in the case of HPMPG and HPMPA. With PMEA, weak inhibition of elongation of DNA was observed only after a prolonged exposure (6 h). None of the investigated drugs induced DNA breaks. (author) 4 figs., 23 refs.

The Fanconi anaemia components UBE2T and FANCM are functionally linked to nucleotide excision repair.

Directory of Open Access Journals (Sweden)

Ian R Kelsall

Full Text Available The many proteins that function in the Fanconi anaemia (FA monoubiquitylation pathway initiate replicative DNA crosslink repair. However, it is not clear whether individual FA genes participate in DNA repair pathways other than homologous recombination and translesion bypass. Here we show that avian DT40 cell knockouts of two integral FA genes--UBE2T and FANCM are unexpectedly sensitive to UV-induced DNA damage. Comprehensive genetic dissection experiments indicate that both of these FA genes collaborate to promote nucleotide excision repair rather than translesion bypass to protect cells form UV genotoxicity. Furthermore, UBE2T deficiency impacts on the efficient removal of the UV-induced photolesion cyclobutane pyrimidine dimer. Therefore, this work reveals that the FA pathway shares two components with nucleotide excision repair, intimating not only crosstalk between the two major repair pathways, but also potentially identifying a UBE2T-mediated ubiquitin-signalling response pathway that contributes to nucleotide excision repair.

Purine derivative excretion and microbial protein synthesis in sheep ...

African Journals Online (AJOL)

In a 3 x 3 Latin square design experiment, urinary excretions of purine derivatives (allantoin N, Uric acid N, Xanthine + Hypoxanthine N) were measured and used to estimate microbial N yield in 9 sheep fed roughage- based diet supplemented with 0, 150 and 300g DM grass silage respectively. Daily urinary excretions of ...

DNA-thioguanine nucleotide concentration and relapse-free survival during maintenance therapy of childhood acute lymphoblastic leukaemia (NOPHO ALL2008): a prospective substudy of a phase 3 trial.

Science.gov (United States)

Nielsen, Stine Nygaard; Grell, Kathrine; Nersting, Jacob; Abrahamsson, Jonas; Lund, Bendik; Kanerva, Jukka; Jónsson, Ólafur Gísli; Vaitkeviciene, Goda; Pruunsild, Kaie; Hjalgrim, Lisa Lyngsie; Schmiegelow, Kjeld

2017-04-01

Adjustment of mercaptopurine and methotrexate maintenance therapy of acute lymphoblastic leukaemia by leucocyte count is confounded by natural variations. Cytotoxicity is primarily mediated by DNA-incorporated thioguanine nucleotides (DNA-TGN). The aim of this study was to establish whether DNA-TGN concentrations in blood leucocytes during maintenance therapy are associated with relapse-free survival. In this substudy of the NOPHO ALL2008 phase 3 trial done in 23 hospitals in seven European countries (Denmark, Estonia, Finland, Iceland, Lithuania, Norway, and Sweden), we analysed data from centralised and blinded analyses of 6-mercaptopurine and methotrexate metabolites in blood samples from patients with non-high-risk childhood acute lymphoblastic leukaemia. Eligible patients were aged 1·0-17·9 years; had been diagnosed with non-high-risk precursor B-cell or T-cell leukaemia; had been treated according to the Nordic Society of Pediatric Hematology and Oncology ALL2008 protocol; and had reached maintenance therapy in first remission. Maintenance therapy was (mercaptopurine 75 mg/m 2 once per day and methotrexate 20 mg/m 2 once per week, targeted to a leucocyte count of 1·5-3·0 × 10 9 cells per L). We measured DNA-TGN and erythrocyte concentrations of TGN nucleotides, methylated mercaptopurine metabolites, and methotrexate polyglutamates. The primary objective was the association of DNA-TGN concentrations and 6-mercaptopurine and methotrexate metabolites with relapse-free survival. The secondary endpoint was the assessment of DNA-TGN concentration and 6-mercaptopurine and methotrexate metabolites during maintenance therapy phase 2. Between Nov 26, 2008 and June 14, 2016, 1509 patients from the NOPHO ALL2008 study were assessed for eligibility in the DNA-TGN substudy, of which 918 (89%) of 1026 eligible patients had at least one DNA-TGN measurement and were included in the analyses. Median follow-up was 4·6 years (IQR 3·1-6·1). Relapse-free survival was

Sequence-based prediction of protein-binding sites in DNA: comparative study of two SVM models.

Science.gov (United States)

Park, Byungkyu; Im, Jinyong; Tuvshinjargal, Narankhuu; Lee, Wook; Han, Kyungsook

2014-11-01

As many structures of protein-DNA complexes have been known in the past years, several computational methods have been developed to predict DNA-binding sites in proteins. However, its inverse problem (i.e., predicting protein-binding sites in DNA) has received much less attention. One of the reasons is that the differences between the interaction propensities of nucleotides are much smaller than those between amino acids. Another reason is that DNA exhibits less diverse sequence patterns than protein. Therefore, predicting protein-binding DNA nucleotides is much harder than predicting DNA-binding amino acids. We computed the interaction propensity (IP) of nucleotide triplets with amino acids using an extensive dataset of protein-DNA complexes, and developed two support vector machine (SVM) models that predict protein-binding nucleotides from sequence data alone. One SVM model predicts protein-binding nucleotides using DNA sequence data alone, and the other SVM model predicts protein-binding nucleotides using both DNA and protein sequences. In a 10-fold cross-validation with 1519 DNA sequences, the SVM model that uses DNA sequence data only predicted protein-binding nucleotides with an accuracy of 67.0%, an F-measure of 67.1%, and a Matthews correlation coefficient (MCC) of 0.340. With an independent dataset of 181 DNAs that were not used in training, it achieved an accuracy of 66.2%, an F-measure 66.3% and a MCC of 0.324. Another SVM model that uses both DNA and protein sequences achieved an accuracy of 69.6%, an F-measure of 69.6%, and a MCC of 0.383 in a 10-fold cross-validation with 1519 DNA sequences and 859 protein sequences. With an independent dataset of 181 DNAs and 143 proteins, it showed an accuracy of 67.3%, an F-measure of 66.5% and a MCC of 0.329. Both in cross-validation and independent testing, the second SVM model that used both DNA and protein sequence data showed better performance than the first model that used DNA sequence data. To the best of

Nucleotide sequence of Hungarian grapevine chrome mosaic nepovirus RNA1.

Science.gov (United States)

Le Gall, O; Candresse, T; Brault, V; Dunez, J

1989-10-11

The nucleotide sequence of the RNA1 of hungarian grapevine chrome mosaic virus, a nepovirus very closely related to tomato black ring virus, has been determined from cDNA clones. It is 7212 nucleotides in length excluding the 3' terminal poly(A) tail and contains a large open reading frame extending from nucleotides 216 to 6971. The presumably encoded polyprotein is 2252 amino acids in length with a molecular weight of 250 kDa. The primary structure of the polyprotein was compared with that of other viral polyproteins, revealing the same general genetic organization as that of other picorna-like viruses (comoviruses, potyviruses and picornaviruses), except that an additional protein is suspected to occupy the N-terminus of the polyprotein.

Purine analogs as phosphatidylinositol 4-kinase III beta inhibitors

Czech Academy of Sciences Publication Activity Database

Šála, Michal; Kögler, Martin; Plačková, Pavla; Mejdrová, Ivana; Hřebabecký, Hubert; Procházková, Eliška; Strunin, Dmytro; Lee, G.; Birkuš, G.; Weber, Jan; Mertlíková-Kaiserová, Helena; Nencka, Radim

2016-01-01

Roč. 26, č. 11 (2016), s. 2706-2712 ISSN 0960-894X R&D Projects: GA ČR GA15-09310S; GA MŠk LO1302 Institutional support: RVO:61388963 Keywords : phosphatidylinositol 4-kinase * purine * PI4K III beta * antiviral agent * hepatitis C virus Subject RIV: CC - Organic Chemistry Impact factor: 2.454, year: 2016

DNA sequence evolution in fast evolving mitochondrial DNA nad1 exons in Geraniaceae and Plantaginaceae

NARCIS (Netherlands)

Bakker, F.T.; Breman, F.; Merckx, V.

2006-01-01

Previously, nucleotide substitution rates in mitochondrial DNA of Geraniaceae and Plantaginaceae have been shown to be exceptionally high compared with other angiosperm mtDNA lineages. It has also been shown that mtDNA introns were lost in Geraniaceae and Plantaginaceae. In this study we compile 127

Growth in rice cells requires de novo purine biosynthesis by the blast fungus Magnaporthe oryzae

Science.gov (United States)

Fernandez, Jessie; Yang, Kuan Ting; Cornwell, Kathryn M.; Wright, Janet D.; Wilson, Richard A.

2013-01-01

Increasing incidences of human disease, crop destruction and ecosystem perturbations are attributable to fungi and threaten socioeconomic progress and food security on a global scale. The blast fungus Magnaporthe oryzae is the most devastating pathogen of cultivated rice, but its metabolic requirements in the host are unclear. Here we report that a purine-requiring mutant of M. oryzae could develop functional appressoria, penetrate host cells and undergo the morphogenetic transition to elaborate bulbous invasive hyphae from primary hyphae, but further in planta growth was aborted. Invasive hyphal growth following rice cell ingress is thus dependent on de novo purine biosynthesis by the pathogen and, moreover, plant sources of purines are neither available to the mutant nor required by the wild type during the early biotrophic phase of infection. This work provides new knowledge about the metabolic interface between fungus and host that might be applicable to other important intracellular fungal pathogens. PMID:23928947

Nucleotide Manipulatives to Illustrate the Central Dogma

OpenAIRE

Sonja B. Yung; Todd P. Primm

2015-01-01

The central dogma is a core concept that is critical for introductory biology and microbiology students to master. However, students often struggle to conceptualize the processes involved, and fail to move beyond simply memorizing the basic facts. To encourage critical thinking, we have designed a set of magnetic nucleotide manipulatives that allow students to model DNA structure, along with the processes of replication, transcription, and translation.

Effect of tempe waste on excreation of purine derivatives and microbial–N supply in lactating Etawah crossbred goats

Directory of Open Access Journals (Sweden)

D.A Astuti

2002-10-01

Full Text Available The aim of this study was to evaluate excretion of purine derivatives and microbial–N supply in lactating Etawah crossbred goats fed with fermented soybean waste. Sixteen first lactating goats were randomly allotted into four dietary treatment groups that received 50% king grass plus R1: 50% concentrate, R2: 25% concentrate and 25% fresh tempe waste, R3: 25% concentrate and 25% fermented tempe waste, and R4: 25% concentrate and 25% gelatinizing of liquid tempe waste. Fermented tempe waste was made by fermentation of tempe waste (seed content of soybean using Aspergillus niger, while for the gellatinizing of liquid tempe waste was made by gelatinized with maize flour. Protein balance studies were conducted during two week trial and at the end of the research. Urinary protein and purine derivatives were collected for analysis. Microbial–N supply was calculated from purine derivatives excretion. Results showed that nitrogen consumptions were significantly different between R4 and three other treatments and apparent digestible nitrogen in R3 were higher than that of R4 (P<0.05. The nitrogen retention in R1 and R3 were higher than that of R2 and R4. Urinary purine derivatives in this study showed that allantoin, xanthine and hypoxanthine in R3 were higher than that of R4, while R1 and R2 were the same and the highest uric acid excretion and total purine derivatives were observed in R3. Microbial–N supply were significantly different between all treatments where R3 was the highest. This research concluded that fermented soybean waste had the highest total purine derivatives excretion and microbial–N supply to the lactating Etawah crossbred goats.

Analysis of DNA binding by human factor xeroderma pigmentosum complementation group A (XPA) provides insight into its interactions with nucleotide excision repair substrates.

Science.gov (United States)

Sugitani, Norie; Voehler, Markus W; Roh, Michelle S; Topolska-Woś, Agnieszka M; Chazin, Walter J

2017-10-13

Xeroderma pigmentosum (XP) complementation group A (XPA) is an essential scaffolding protein in the multiprotein nucleotide excision repair (NER) machinery. The interaction of XPA with DNA is a core function of this protein; a number of mutations in the DNA-binding domain (DBD) are associated with XP disease. Although structures of the central globular domain of human XPA and data on binding of DNA substrates have been reported, the structural basis for XPA's DNA-binding activity remains unknown. X-ray crystal structures of the central globular domain of yeast XPA (Rad14) with lesion-containing DNA duplexes have provided valuable insights, but the DNA substrates used for this study do not correspond to the substrates of XPA as it functions within the NER machinery. To better understand the DNA-binding activity of human XPA in NER, we used NMR to investigate the interaction of its DBD with a range of DNA substrates. We found that XPA binds different single-stranded/double-stranded junction DNA substrates with a common surface. Comparisons of our NMR-based mapping of binding residues with the previously reported Rad14-DNA crystal structures revealed similarities and differences in substrate binding between XPA and Rad14. This includes direct evidence for DNA contacts to the residues extending C-terminally from the globular core, which are lacking in the Rad14 construct. Moreover, mutation of the XPA residue corresponding to Phe-262 in Rad14, previously reported as being critical for DNA binding, had only a moderate effect on the DNA-binding activity of XPA. The DNA-binding properties of several disease-associated mutations in the DBD were investigated. These results suggest that for XPA mutants exhibiting altered DNA-binding properties, a correlation exists between the extent of reduction in DNA-binding affinity and the severity of symptoms in XP patients. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Urinary excretion of purine derivatives as an index of microbial protein synthesis in the camel (Camelus dromedarius).

Science.gov (United States)

Guerouali, Abdelhai; El Gass, Youssef; Balcells, Joaquim; Belenguer, Alvaro; Nolan, John

2004-08-01

Five experiments were carried out to extend knowledge of purine metabolism in the camel (Camelus dromedarius) and to establish a model to enable microbial protein outflow from the forestomachs to be estimated from the urinary excretion of purine derivatives (PD; i.e. xanthine, hypoxanthine, uric acid, allantoin). In experiment 1, four camels were fasted for five consecutive days to enable endogenous PD excretion in urine to be determined. Total PD excretion decreased during the fasting period to 267 (SE 41.5) micromol/kg body weight (W)0.75 per d. Allantoin and xanthine + hypoxanthine were consistently 86 and 6.1 % of total urinary PD during this period but uric acid increased from 3.6 % to 7.4 %. Xanthine oxidase activity in tissues (experiment 2) was (micromol/min per g fresh tissue) 0.038 in liver and 0.005 in gut mucosa but was not detected in plasma. In experiment 3, the duodenal supply of yeast containing exogenous purines produced a linear increase in urinary PD excretion rate with the slope indicating that 0.63 was excreted in urine. After taking account of endogenous PD excretion, the relationship can be used to predict purine outflow from the rumen. From the latter prediction, and also the purine:protein ratio in bacteria determined in experiment 5, we predicted the net microbial outflow from the rumen. In experiment 4, with increasing food intake, the rate of PD excretion in the urine increased linearly by about 11.1 mmol PD/kg digestible organic matter intake (DOMI), equivalent to 95 g microbial protein/kg DOMI.

Effects of salicylic acid on post-ischaemic ventricular function and purine efflux in isolated mouse hearts.

Science.gov (United States)

Farthing, Don; Gehr, Lynne; Karnes, H Thomas; Sica, Domenic; Gehr, Todd; Larus, Terri; Farthing, Christine; Xi, Lei

2007-01-01

Acetyl salicylic acid (aspirin) is one of the most widely used drugs in the world. Various plasma concentrations of aspirin and its predominant metabolite, salicylic acid, are required for its antiarthritic (1.5-2.5 mM), anti-inflammatory (0.5-5.0 mM) or antiplatelet (0.18-0.36 mM) actions. A recent study demonstrated the inhibitory effects of both aspirin and salicylic acid on oxidative phosphorylation and ATP synthesis in isolated rat cardiac mitochondria in a dose-dependent manner (0-10 mM concentration range). In this context, the present study was conducted to determine the effects of salicylic acid on inosine efflux (a potential biomarker of acute cardiac ischaemia) as well as cardiac contractile function in the isolated mouse heart following 20 min of zero-flow global ischaemia. Inosine efflux was found at significantly higher concentrations in ischaemic hearts perfused with Krebs buffer fortified with 1.0 mM salicylic acid compared with those without salicylic acid (12575+/-3319 vs. 1437+/-348 ng ml(-1) min(-1), mean+/-SEM, n=6 per group, psalicylic acid potentiates 8.8-fold ATP nucleotide purine catabolism into its metabolites (e.g. inosine, hypoxanthine). Salicylic acid (0.1 or 1.0 mM) did not appreciably inhibit purine nucleoside phosphorylase (the enzyme converts inosine to hypoxanthine) suggesting the augmented inosine efflux was due to the salicylic acid effect on upstream elements of cellular respiration. Whereas post-ischaemic cardiac function was further depressed by 1.0 mM salicylic acid, perfusion with 0.1 mM salicylic acid led to a remarkable functional improvement despite moderately increased inosine efflux (2.7-fold). We conclude that inosine is a sensitive biomarker for detecting cardiac ischaemia and salicylic acid-induced effects on cellular respiration. However, the inosine efflux level appears to be a poor predictor of the individual post-ischaemic cardiac functional recovery in this ex vivo model.

Metabolic modulation of mammalian DNA excision repair

Energy Technology Data Exchange (ETDEWEB)

Schrader, T.J.

1988-01-01

First, ultraviolet light (UVL)- and dimethylsulfate (DMS)-induced excision repair was examined in quiescent and lectin-stimulated bovine lymphocytes. Upon mitogenic stimulation, UVL-induced repair increased by a factor of 2 to 3, and reached this maximum 2 days before the onset of DNA replication. However, DMS-induced repair increased sevenfold in parallel with DNA replication. Repair patch sizes were smaller for DMS-induced damage reflecting patches of 7 nucleotides in quiescent lymphocytes compared to 20 nucleotides induced by UVL. The patch size increased during lymphocyte stimulation until one day prior to the peak of DNA replication when patch sizes of 45 and 35 nucleotides were produced in response to UVL- and DMS-induced damage, respectively. At the peak of DNA replication, the patch sizes were equal for both damaging agents at 34 nucleotides. In the second study, a small amount of repair replication was observed in undamaged quiescent and concanavalin A-stimulated bovine lymphocytes as well as in human T98G glioblastoma cells. Repair incorporation doubled in the presence of hydroxyurea. Thirdly, the enhanced repair replication induced by the poly (ADP-ribose) polymerase inhibitor, 3-aminobenzamide, (3-AB), could not be correlated either with an increased rate of repair in the presence of 3-AB or with the use of hydroxyurea in the repair protocol. Finally, treatment of unstimulated lymphocytes with hyperthermia was accompanied by decreased repair replication while the repair patches remained constant at 20 nucleotides.

Effect of physiological status on endogenous excretion of purine derivatives in cattle

International Nuclear Information System (INIS)

Balcells, J.; Vicente, F.; Orellana-Boero, P.; Martin-Orue, S.; Gonzalez-Ronquillo, M.

2004-01-01

The present study examined the endogenous urinary excretion of purine derivatives (PD: allantoin and uric acid) in normally fed animals in different physiological states. Animals fitted with a simple rumen cannula and a T-shaped duodenal cannula were used in three separate experiments. In Experiment I, three heifers (about 8 months old; 225 ± 4.4 kg) fed a cereal based diet were used. In Experiment 11, two Friesian dry cows (about 24 months old; 696 ± 21 kg) fed at maintenance level on chopped barley straw and barley grain (50:50). In Experiment 3, three multiparous crossbreed Holstein-Friesian cows (560 ± 10 kg, average milk yield 25 ± 3.2 kg/d) in their third lactation were used. The cows were fed a mixed diet (48:52; roughage:concentrate). 15 N ammonium phosphate was infused continuously into the rumen to label microbial purine bases (PB). Duodenal flow of digesta and PB was determined using a dual marker system. After 72-80 h purine enrichment had reached plateau values in body pools and in urine. Daily endogenous PD excretion (μmol/W 0.75 ) obtained in dry cows (310 ± 31.0) were not significantly different from that obtained in growing steers (236 ± 6.0) but were consistently higher (512.4 ± 36.4) in lactating cows. (author)

First-passage problems in DNA replication: effects of template tension on stepping and exonuclease activities of a DNA polymerase motor

International Nuclear Information System (INIS)

Sharma, Ajeet K; Chowdhury, Debashish

2013-01-01

A DNA polymerase (DNAP) replicates a template DNA strand. It also exploits the template as the track for its own motor-like mechanical movement. In the polymerase mode it elongates the nascent DNA by one nucleotide in each step. However, whenever it commits an error by misincorporating an incorrect nucleotide, it can switch to an exonuclease mode. In the latter mode it excises the wrong nucleotide before switching back to its polymerase mode. We develop a stochastic kinetic model of DNA replication that mimics an in vitro experiment where single-stranded DNA, subjected to a mechanical tension F, is converted to double-stranded DNA by a single DNAP. The F-dependence of the average rate of replication, which depends on the rates of both polymerase and exonuclease activities of the DNAP, is in good qualitative agreement with the corresponding experimental results. We introduce nine novel distinct conditional dwell times of a DNAP. Using the method of first-passage times, we also derive the exact analytical expressions for the probability distributions of these conditional dwell times. The predicted F-dependences of these distributions are, in principle, accessible to single-molecule experiments. (paper)

SUMO and ubiquitin-dependent XPC exchange drives nucleotide excision repair

DEFF Research Database (Denmark)

Van Cuijk, Loes; Van Belle, Gijsbert J.; Turkyilmaz, Yasemin

2015-01-01

XPC recognizes UV-induced DNA lesions and initiates their removal by nucleotide excision repair (NER). Damage recognition in NER is tightly controlled by ubiquitin and SUMO modifications. Recent studies have shown that the SUMO-targeted ubiquitin ligase RNF111 promotes K63-linked ubiquitylation o...

The use of permanganate as a sequencing reagent for identification of 5-methylcytosine residues in DNA.

OpenAIRE

Fritzsche, E; Hayatsu, H; Igloi, G L; Iida, S; Kössel, H

1987-01-01

The use of permanganate as a reagent for DNA sequencing by chemical degradation has been studied with respect to its specificity for 5-methylcytosine residues. At weakly acidic pH and room temperature, 0.2 mM potassium permanganate reacts preferentially with thymine, 5-methylcytosine, and to a lesser extent with purine residues, while cytosine remains essentially intact. Permanganate oxidation is, therefore, a suitable DNA sequencing reaction for positive discrimination between 5-methylcytosi...

The nucleotide sequence of satellite RNA in grapevine fanleaf virus, strain F13.

Science.gov (United States)

Fuchs, M; Pinck, M; Serghini, M A; Ravelonandro, M; Walter, B; Pinck, L

1989-04-01

The nucleotide sequence of cDNA copies of grapevine fanleaf virus (strain F13) satellite RNA has been determined. The primary structure obtained was 1114 nucleotides in length, excluding the poly(A) tail, and contained only one long open reading frame encoding a 341 residue, highly hydrophilic polypeptide of Mr37275. The coding sequence was bordered by a leader of 14 nucleotides and a 3'-terminal non-coding region of 74 nucleotides. No homology has been found with small satellite RNAs associated with other nepoviruses. Two limited homologies of eight nucleotides have been detected between the satellite RNA in grapevine fanleaf virus and those in tomato black ring virus, and a consensus sequence U.G/UGAAAAU/AU/AU/A at the 5' end of nepovirus RNAs is reported. A less extended consensus exists in this region in comovirus and picornavirus RNA.

Caracterización de la microbiota bacteriana presente en biorreactores de microalgas alimentados con purines

OpenAIRE

Prado Carrascal, Ana Isabel

2016-01-01

La producción intensiva ganadera, con una alta concentración de animales estabulados, conlleva la generación de grandes cantidades de residuos semilíquidos o purines, cuyo vertido no controlado puede generar contaminación tanto en los suelos como en las aguas superficiales y subterráneas, lo que provoca importantes problemas ambientales que han obligado a legislar su gestión. El tratamiento de los purines tiene por objetivo básico reducir la materia orgánica y el contenido de nutrientes, lo q...

Purine biosynthesis in L1210 leukemia cells is inhibited by 7-hydroxymethotrexate (7-OH-MTX) polyglutamates (PGS)

International Nuclear Information System (INIS)

Seither, R.L.; Matherly, L.H.; Goldman, I.D.

1986-01-01

The biochemical basis for 7-OH-MTX cytotoxicity was examined in L1210 tumor cells. Cells were exposed to 100 μM 7-OH-MTX (approx. 50% growth inhibition) or 10 μM methotrexate (MTX) (approx. 95% growth inhibition) for 6 hrs to allow high levels of PGS to accumulate. Dihydrofolate reductase (DHFR) activity was assessed by dihydrofolate (FH 2 ) pools labeled with 5-formyl-[ 3 H]-tetrahydrofolate (5μM) or 3 H-folic acid (1 μM). FH 2 was not elevated above control levels in 7-OH-MTX treated cells, in contrast to MTX treated cells in which FH 2 increased 4- to 7-fold. 3 H-Deoxyuridine incorporation into DNA was not inhibited in cells containing high levels (11.5 nmol/g dry wt.) of 7-OH-MTX tetraglutamate (7-OH-4-NH 2 -10-CH 3 -PteGlu 4 ), well in excess of the DHFR-binding capacity (7.3 +/- 0.9 nmol/g), indicating a normal rate of thymidylate synthesis. Although small amounts of 7-OH-MTX and its PGS were bound to DHFR in L1210 cells, as assessed by gel filtration, there was evidence for the preferential binding of 7-OH-MTX tetraglutamate. In all cases this was well below the DHFR binding capacity, consistent with normal rates of deoxyuridine metabolism and FH 2 levels in the cell. Incorporation of 14 C-formate (60 min) into thymidylate and amino acids was unaffected by 7-OH-MTX, yet incorporation into purines was inhibited over 50%, supporting a block(s) in de novo purine biosynthesis

Nucleotide Manipulatives to Illustrate the Central Dogma

Directory of Open Access Journals (Sweden)

Sonja B. Yung

2015-08-01

Full Text Available The central dogma is a core concept that is critical for introductory biology and microbiology students to master. However, students often struggle to conceptualize the processes involved, and fail to move beyond simply memorizing the basic facts. To encourage critical thinking, we have designed a set of magnetic nucleotide manipulatives that allow students to model DNA structure, along with the processes of replication, transcription, and translation.

Four new single nucleotide polymorphisms (SNPs) of toll-like ...

African Journals Online (AJOL)

In order to reveal the single nucleotide polymorphisms (SNPs), genotypes and allelic frequencies of each mutation site of TLR7 gene in Chinese native duck breeds, SNPs of duck TLR7 gene were detected by DNA sequencing. The genotypes of 465 native ducks from eight key protected duck breeds were determined by ...

PAH-DNA adducts in environmentally exposed population in relation to metabolic and DNA repair gene polymorphisms

International Nuclear Information System (INIS)

Binkova, Blanka; Chvatalova, Irena; Lnenickova, Zdena; Milcova, Alena; Tulupova, Elena; Farmer, Peter B.; Sram, Radim J.

2007-01-01

Epidemiologic studies indicate that prolonged exposure to particulate air pollution may be associated with increased risk of cardiovascular diseases and cancer in general population. These effects may be attributable to polycyclic aromatic hydrocarbons (PAHs) adsorbed to respirable air particles. It is expected that metabolic and DNA repair gene polymorphisms may modulate individual susceptibility to PAH exposure. This study investigates relationships between exposure to PAHs, polymorphisms of these genes and DNA adducts in group of occupationally exposed policemen (EXP, N = 53, males, aged 22-50 years) working outdoors in the downtown area of Prague and in matched 'unexposed' controls (CON, N = 52). Personal exposure to eight carcinogenic PAHs (c-PAHs) was evaluated by personal samplers during working shift prior to collection of biological samples. Bulky-aromatic DNA adducts were analyzed in lymphocytes by 32 P-postlabeling assay. Polymorphisms of metabolizing (GSTM1, GSTP1, GSTT1, EPHX1, CYP1A1-MspI) and DNA repair (XRCC1, XPD) genes were determined by PCR-based RFLP assays. As potential modifiers and/or cofounders, urinary cotinine levels were analyzed by radioimmunoassay, plasma levels of vitamins A, C, E and folates by HPLC, cholesterol and triglycerides using commercial kits. During the sampling period ambient particulate air pollution was as follows: PM10 32-55 μg/m 3 , PM2.5 27-38 μg/m 3 , c-PAHs 18-22 ng/m 3 ; personal exposure to c-PAHs: 9.7 ng/m 3 versus 5.8 ng/m 3 (P 8 nucleotides versus 0.82 ± 0.23 adducts/10 8 nucleotides, P = 0.065), whereas the level of the B[a]P-'like' adduct was significantly higher in exposed group (0.122 ± 0.036 adducts/10 8 nucleotides versus 0.099 ± 0.035 adducts/10 8 nucleotides, P = 0.003). A significant difference in both the total (P < 0.05) and the B[a]P-'like' DNA adducts (P < 0.01) between smokers and nonsmokers within both groups was observed. A significant positive association between DNA adduct and cotinine

DNA repair is responsible for the presence of oxidatively damaged DNA lesions in urine

International Nuclear Information System (INIS)

Cooke, Marcus S.; Evans, Mark D.; Dove, Rosamund; Rozalski, Rafal; Gackowski, Daniel; Siomek, Agnieszka; Lunec, Joseph; Olinski, Ryszard

2005-01-01

The repair of oxidatively damaged DNA is integral to the maintenance of genomic stability, and hence prevention of a wide variety of pathological conditions, such as aging, cancer and cardiovascular disease. The ability to non-invasively assess DNA repair may provide information regarding repair pathways, variability in repair capacity, and susceptibility to disease. The development of assays to measure urinary DNA lesions offered this potential, although it rapidly became clear that possible contribution from diet and cell turnover may influence urinary lesion levels. Whilst early studies attempted to address these issues, up until now, much of the data appears conflicting. However, recent work from our laboratories, in which human volunteers were fed highly oxidatively modified 15 N-labelled DNA demonstrates that diet does not appear to contribute to urinary levels of 8-hydroxyguanine and 7,8-dihydro-8-oxo-2'-deoxyguanosine. Furthermore, we propose that a number of literature reports form an argument against a contribution from cell death. Indeed we, and others, have presented evidence, which strongly suggests the involvement of cell death to be minimal. Taken together, these data would appear to rule out various confounding factors, leaving DNA repair pathways as the principal source of urinary purine, if not DNA, lesions enabling such measurements to be used as indicators of repair

Enzymatic activities and DNA substrate specificity of Mycobacterium tuberculosis DNA helicase XPB.

Science.gov (United States)

Balasingham, Seetha V; Zegeye, Ephrem Debebe; Homberset, Håvard; Rossi, Marie L; Laerdahl, Jon K; Bohr, Vilhelm A; Tønjum, Tone

2012-01-01

XPB, also known as ERCC3 and RAD25, is a 3' → 5' DNA repair helicase belonging to the superfamily 2 of helicases. XPB is an essential core subunit of the eukaryotic basal transcription factor complex TFIIH. It has two well-established functions: in the context of damaged DNA, XPB facilitates nucleotide excision repair by unwinding double stranded DNA (dsDNA) surrounding a DNA lesion; while in the context of actively transcribing genes, XPB facilitates initiation of RNA polymerase II transcription at gene promoters. Human and other eukaryotic XPB homologs are relatively well characterized compared to conserved homologs found in mycobacteria and archaea. However, more insight into the function of bacterial helicases is central to understanding the mechanism of DNA metabolism and pathogenesis in general. Here, we characterized Mycobacterium tuberculosis XPB (Mtb XPB), a 3'→5' DNA helicase with DNA-dependent ATPase activity. Mtb XPB efficiently catalyzed DNA unwinding in the presence of significant excess of enzyme. The unwinding activity was fueled by ATP or dATP in the presence of Mg(2+)/Mn(2+). Consistent with the 3'→5' polarity of this bacterial XPB helicase, the enzyme required a DNA substrate with a 3' overhang of 15 nucleotides or more. Although Mtb XPB efficiently unwound DNA model substrates with a 3' DNA tail, it was not active on substrates containing a 3' RNA tail. We also found that Mtb XPB efficiently catalyzed ATP-independent annealing of complementary DNA strands. These observations significantly enhance our understanding of the biological roles of Mtb XPB.

Enzymatic activities and DNA substrate specificity of Mycobacterium tuberculosis DNA helicase XPB.

Directory of Open Access Journals (Sweden)

Seetha V Balasingham

Full Text Available XPB, also known as ERCC3 and RAD25, is a 3' → 5' DNA repair helicase belonging to the superfamily 2 of helicases. XPB is an essential core subunit of the eukaryotic basal transcription factor complex TFIIH. It has two well-established functions: in the context of damaged DNA, XPB facilitates nucleotide excision repair by unwinding double stranded DNA (dsDNA surrounding a DNA lesion; while in the context of actively transcribing genes, XPB facilitates initiation of RNA polymerase II transcription at gene promoters. Human and other eukaryotic XPB homologs are relatively well characterized compared to conserved homologs found in mycobacteria and archaea. However, more insight into the function of bacterial helicases is central to understanding the mechanism of DNA metabolism and pathogenesis in general. Here, we characterized Mycobacterium tuberculosis XPB (Mtb XPB, a 3'→5' DNA helicase with DNA-dependent ATPase activity. Mtb XPB efficiently catalyzed DNA unwinding in the presence of significant excess of enzyme. The unwinding activity was fueled by ATP or dATP in the presence of Mg(2+/Mn(2+. Consistent with the 3'→5' polarity of this bacterial XPB helicase, the enzyme required a DNA substrate with a 3' overhang of 15 nucleotides or more. Although Mtb XPB efficiently unwound DNA model substrates with a 3' DNA tail, it was not active on substrates containing a 3' RNA tail. We also found that Mtb XPB efficiently catalyzed ATP-independent annealing of complementary DNA strands. These observations significantly enhance our understanding of the biological roles of Mtb XPB.

Identification of mitochondrial DNA sequence variation and development of single nucleotide polymorphic markers for CMS-D8 in cotton.

Science.gov (United States)

Suzuki, Hideaki; Yu, Jiwen; Wang, Fei; Zhang, Jinfa

2013-06-01

Cytoplasmic male sterility (CMS), which is a maternally inherited trait and controlled by novel chimeric genes in the mitochondrial genome, plays a pivotal role in the production of hybrid seed. In cotton, no PCR-based marker has been developed to discriminate CMS-D8 (from Gossypium trilobum) from its normal Upland cotton (AD1, Gossypium hirsutum) cytoplasm. The objective of the current study was to develop PCR-based single nucleotide polymorphic (SNP) markers from mitochondrial genes for the CMS-D8 cytoplasm. DNA sequence variation in mitochondrial genes involved in the oxidative phosphorylation chain including ATP synthase subunit 1, 4, 6, 8 and 9, and cytochrome c oxidase 1, 2 and 3 subunits were identified by comparing CMS-D8, its isogenic maintainer and restorer lines on the same nuclear genetic background. An allelic specific PCR (AS-PCR) was utilized for SNP typing by incorporating artificial mismatched nucleotides into the third or fourth base from the 3' terminus in both the specific and nonspecific primers. The result indicated that the method modifying allele-specific primers was successful in obtaining eight SNP markers out of eight SNPs using eight primer pairs to discriminate two alleles between AD1 and CMS-D8 cytoplasms. Two of the SNPs for atp1 and cox1 could also be used in combination to discriminate between CMS-D8 and CMS-D2 cytoplasms. Additionally, a PCR-based marker from a nine nucleotide insertion-deletion (InDel) sequence (AATTGTTTT) at the 59-67 bp positions from the start codon of atp6, which is present in the CMS and restorer lines with the D8 cytoplasm but absent in the maintainer line with the AD1 cytoplasm, was also developed. A SNP marker for two nucleotide substitutions (AA in AD1 cytoplasm to CT in CMS-D8 cytoplasm) in the intron (1,506 bp) of cox2 gene was also developed. These PCR-based SNP markers should be useful in discriminating CMS-D8 and AD1 cytoplasms, or those with CMS-D2 cytoplasm as a rapid, simple, inexpensive, and

OligArch: A software tool to allow artificially expanded genetic information systems (AEGIS to guide the autonomous self-assembly of long DNA constructs from multiple DNA single strands

Directory of Open Access Journals (Sweden)

Kevin M. Bradley

2014-08-01

Full Text Available Synthetic biologists wishing to self-assemble large DNA (L-DNA constructs from small DNA fragments made by automated synthesis need fragments that hybridize predictably. Such predictability is difficult to obtain with nucleotides built from just the four standard nucleotides. Natural DNA's peculiar combination of strong and weak G:C and A:T pairs, the context-dependence of the strengths of those pairs, unimolecular strand folding that competes with desired interstrand hybridization, and non-Watson–Crick interactions available to standard DNA, all contribute to this unpredictability. In principle, adding extra nucleotides to the genetic alphabet can improve the predictability and reliability of autonomous DNA self-assembly, simply by increasing the information density of oligonucleotide sequences. These extra nucleotides are now available as parts of artificially expanded genetic information systems (AEGIS, and tools are now available to generate entirely standard DNA from AEGIS DNA during PCR amplification. Here, we describe the OligArch (for "oligonucleotide architecting" software, an application that permits synthetic biologists to engineer optimally self-assembling DNA constructs from both six- and eight-letter AEGIS alphabets. This software has been used to design oligonucleotides that self-assemble to form complete genes from 20 or more single-stranded synthetic oligonucleotides. OligArch is therefore a key element of a scalable and integrated infrastructure for the rapid and designed engineering of biology.

Regulation of nucleotide excision repair through ubiquitination

Institute of Scientific and Technical Information of China (English)

Jia Li; Audesh Bhat; Wei Xiao

2011-01-01

Nucleotide excision repair (NER) is the most versatile DNA-repair pathway in all organisms.While bacteria require only three proteins to complete the incision step of NER,eukaryotes employ about 30 proteins to complete the same step.Here we summarize recent studies demonstrating that ubiquitination,a post-translational modification,plays critical roles in regulating the NER activity either dependent on or independent of ubiquitin-proteolysis.Several NER components have been shown as targets of ubiquitination while others are actively involved in the ubiquitination process.We argue through this analysis that ubiquitination serves to coordinate various steps of NER and meanwhile connect NER with other related pathways to achieve the efficient global DNA-damage response.

Gene set analysis of purine and pyrimidine antimetabolites cancer therapies.

Science.gov (United States)

Fridley, Brooke L; Batzler, Anthony; Li, Liang; Li, Fang; Matimba, Alice; Jenkins, Gregory D; Ji, Yuan; Wang, Liewei; Weinshilboum, Richard M

2011-11-01

Responses to therapies, either with regard to toxicities or efficacy, are expected to involve complex relationships of gene products within the same molecular pathway or functional gene set. Therefore, pathways or gene sets, as opposed to single genes, may better reflect the true underlying biology and may be more appropriate units for analysis of pharmacogenomic studies. Application of such methods to pharmacogenomic studies may enable the detection of more subtle effects of multiple genes in the same pathway that may be missed by assessing each gene individually. A gene set analysis of 3821 gene sets is presented assessing the association between basal messenger RNA expression and drug cytotoxicity using ethnically defined human lymphoblastoid cell lines for two classes of drugs: pyrimidines [gemcitabine (dFdC) and arabinoside] and purines [6-thioguanine and 6-mercaptopurine]. The gene set nucleoside-diphosphatase activity was found to be significantly associated with both dFdC and arabinoside, whereas gene set γ-aminobutyric acid catabolic process was associated with dFdC and 6-thioguanine. These gene sets were significantly associated with the phenotype even after adjusting for multiple testing. In addition, five associated gene sets were found in common between the pyrimidines and two gene sets for the purines (3',5'-cyclic-AMP phosphodiesterase activity and γ-aminobutyric acid catabolic process) with a P value of less than 0.0001. Functional validation was attempted with four genes each in gene sets for thiopurine and pyrimidine antimetabolites. All four genes selected from the pyrimidine gene sets (PSME3, CANT1, ENTPD6, ADRM1) were validated, but only one (PDE4D) was validated for the thiopurine gene sets. In summary, results from the gene set analysis of pyrimidine and purine therapies, used often in the treatment of various cancers, provide novel insight into the relationship between genomic variation and drug response.

The DNA Repair Repertoire of Mycobacterium smegmatis FenA Includes the Incision of DNA 5' Flaps and the Removal of 5' Adenylylated Products of Aborted Nick Ligation.

Science.gov (United States)

Uson, Maria Loressa; Ghosh, Shreya; Shuman, Stewart

2017-09-01

We characterize Mycobacterium smegmatis FenA as a manganese-dependent 5'-flap endonuclease homologous to the 5'-exonuclease of DNA polymerase I. FenA incises a nicked 5' flap between the first and second nucleotides of the duplex segment to yield a 1-nucleotide gapped DNA, which is then further resected in dinucleotide steps. Initial FenA cleavage at a Y-flap or nick occurs between the first and second nucleotides of the duplex. However, when the template 3' single strand is eliminated to create a 5'-tailed duplex, FenA incision shifts to between the second and third nucleotides. A double-flap substrate with a mobile junction (mimicking limited strand displacement synthesis during gap repair) is preferentially incised as the 1-nucleotide 3'-flap isomer, with the scissile phosphodiester shifted by one nucleotide versus a static double flap. FenA efficiently removes the 5' App(dN) terminus of an aborted nick ligation reaction intermediate, thereby highlighting FenA as an agent of repair of such lesions, which are formed under a variety of circumstances by bacterial NAD + -dependent DNA ligases and especially by mycobacterial DNA ligases D and C. IMPORTANCE Structure-specific DNA endonucleases are implicated in bacterial DNA replication, repair, and recombination, yet there is scant knowledge of the roster and catalytic repertoire of such nucleases in Mycobacteria This study identifies M. smegmatis FenA as a stand-alone endonuclease homologous to the 5'-exonuclease domain of mycobacterial DNA polymerase 1. FenA incises 5' flaps, 5' nicks, and 5' App(dN) intermediates of aborted nick ligation. The isolated N-terminal domain of M. smegmatis Pol1 is also shown to be a flap endonuclease. Copyright © 2017 American Society for Microbiology.

An overview of DNA fingerprinting with 32P nucleotides

International Nuclear Information System (INIS)

Pappas, G.G.

1992-01-01

The DNA probes radiolabeled with 32 P, a primary tool employed by researchers in the life sciences for > 20 yr, are used by private companies, state-run laboratories, and the FBI to generate autoradiographs displaying the unique banding patterns that constitute the DNA fingerprint. The ability to identify an individual or animal from a biological sample has profound implications. Unidentified bodies, unrecognizable remains, and missing children can be tested and the DNA fingerprint compared to those of family members for positive identification. Paternity can be established before a child's birth. Immigration disputes can easily be resolved. Other uses include pedigree determination and testing for cell-line cross-contamination. Using a DNA fingerprint to determine the guilt or innocence of an individual allegedly involved in a violent crime is very controversial and has great legal and moral implications for society. Forensic laboratories have been challenged to ensure a level of quality control and quality assurance consistent with the weight given to these tests when used as evidence in a court of law

Derivative Technology of DNA Barcoding (Nucleotide Signature and SNP Double Peak Methods) Detects Adulterants and Substitution in Chinese Patent Medicines.

Science.gov (United States)

Gao, Zitong; Liu, Yang; Wang, Xiaoyue; Song, Jingyuan; Chen, Shilin; Ragupathy, Subramanyam; Han, Jianping; Newmaster, Steven G

2017-07-19

Lonicerae japonicae Flos has been used to produce hundred kinds of Chinese patent medicines (CPMs) in China. Economically motivated adulterants have been documented, leading to market instability and a decline in consumer confidence. ITS2 has been used to identify raw medicinal materials, but it's not suitable for the identification of botanical extracts and complex CPMs. Therefore, a short barcode for the identification of processed CPMs would be profitable. A 34 bp nucleotide signature (5' CTAGCGGTGGTCGTACGATAGCCAATGCATGAGT 3') was developed derived from ITS2 region of Eucommiae Folium based on unique motifs. Mixtures of powdered Lonicerae japonicae Flos and Lonicerae Flos resulted in double peaks at the expected SNP (Single Nucleotide Polymorphisms) positions, of which the height of the peaks were roughly indicative of the species' ratio in the mixed powder. Subsequently we tested 20 extracts and 47 CPMs labelled as containing some species of Lonicera. The results revealed only 17% of the extracts and 22% of the CPMs were authentic, others exist substitution or adulterant; 7% were shown to contain both of two adulterants Eucommiae Folium and Lonicerae Flos. The methods developed in this study will widely broaden the application of DNA barcode in quality assurance of natural health products.

Break-induced ATR and Ddb1-Cul4(Cdt)² ubiquitin ligase-dependent nucleotide synthesis promotes homologous recombination repair in fission yeast

DEFF Research Database (Denmark)

Moss, Jennifer; Tinline-Purvis, Helen; Walker, Carol A

2010-01-01

Nucleotide synthesis is a universal response to DNA damage, but how this response facilitates DNA repair and cell survival is unclear. Here we establish a role for DNA damage-induced nucleotide synthesis in homologous recombination (HR) repair in fission yeast. Using a genetic screen, we found...... the Ddb1-Cul4(Cdt)² ubiquitin ligase complex and ribonucleotide reductase (RNR) to be required for HR repair of a DNA double-strand break (DSB). The Ddb1-Cul4(Cdt)² ubiquitin ligase complex is required for degradation of Spd1, an inhibitor of RNR in fission yeast. Accordingly, deleting spd1(+) suppressed...

Nucleic acid nanomaterials: Silver-wired DNA

Science.gov (United States)

Auffinger, Pascal; Ennifar, Eric

2017-10-01

DNA double helical structures are supramolecular assemblies that are typically held together by classical Watson-Crick pairing. Now, nucleotide chelation of silver ions supports an extended silver-DNA hybrid duplex featuring an uninterrupted silver array.

DNA Origami-Graphene Hybrid Nanopore for DNA Detection.

Science.gov (United States)

Barati Farimani, Amir; Dibaeinia, Payam; Aluru, Narayana R

2017-01-11

DNA origami nanostructures can be used to functionalize solid-state nanopores for single molecule studies. In this study, we characterized a nanopore in a DNA origami-graphene heterostructure for DNA detection. The DNA origami nanopore is functionalized with a specific nucleotide type at the edge of the pore. Using extensive molecular dynamics (MD) simulations, we computed and analyzed the ionic conductivity of nanopores in heterostructures carpeted with one or two layers of DNA origami on graphene. We demonstrate that a nanopore in DNA origami-graphene gives rise to distinguishable dwell times for the four DNA base types, whereas for a nanopore in bare graphene, the dwell time is almost the same for all types of bases. The specific interactions (hydrogen bonds) between DNA origami and the translocating DNA strand yield different residence times and ionic currents. We also conclude that the speed of DNA translocation decreases due to the friction between the dangling bases at the pore mouth and the sequencing DNA strands.

Different effects of guanine nucleotides (GDP and GTP) on protein-mediated mitochondrial proton leak.

Science.gov (United States)

Woyda-Ploszczyca, Andrzej M; Jarmuszkiewicz, Wieslawa

2014-01-01

In this study, we compared the influence of GDP and GTP on isolated mitochondria respiring under conditions favoring oxidative phosphorylation (OXPHOS) and under conditions excluding this process, i.e., in the presence of carboxyatractyloside, an adenine nucleotide translocase inhibitor, and/or oligomycin, an FOF1-ATP synthase inhibitor. Using mitochondria isolated from rat kidney and human endothelial cells, we found that the action of GDP and GTP can differ diametrically depending on the conditions. Namely, under conditions favoring OXPHOS, both in the absence and presence of linoleic acid, an activator of uncoupling proteins (UCPs), the addition of 1 mM GDP resulted in the state 4 (non-phosphorylating respiration)-state 3 (phosphorylating respiration) transition, which is characteristic of ADP oxidative phosphorylation. In contrast, the addition of 1 mM GTP resulted in a decrease in the respiratory rate and an increase in the membrane potential, which is characteristic of UCP inhibition. The stimulatory effect of GDP, but not GTP, was also observed in inside-out submitochondrial particles prepared from rat kidney mitochondria. However, the effects of GDP and GTP were more similar in the presence of OXPHOS inhibitors. The importance of these observations in connection with the action of UCPs, adenine nucleotide translocase (or other carboxyatractyloside-sensitive carriers), carboxyatractyloside- and purine nucleotide-insensitive carriers, as well as nucleoside-diphosphate kinase (NDPK) are considered. Because the measurements favoring oxidative phosphorylation better reflect in vivo conditions, our study strongly supports the idea that GDP cannot be considered a significant physiological inhibitor of UCP. Moreover, it appears that, under native conditions, GTP functions as a more efficient UCP inhibitor than GDP and ATP.

Polymerization by DNA polymerase eta is blocked by cis-diamminedichloroplatinum(II) 1,3-d(GpTpG) cross-link: implications for cytotoxic effects in nucleotide excision repair-negative tumor cells.

Science.gov (United States)

Chijiwa, Shotaro; Masutani, Chikahide; Hanaoka, Fumio; Iwai, Shigenori; Kuraoka, Isao

2010-03-01

cis-Diamminedichloroplatinum(II) (cisplatin) forms DNA adducts that interfere with replication and transcription. The most common adducts formed in vivo are 1,2-intrastrand d(GpG) cross-links (Pt-GG) and d(ApG) cross-links (Pt-AG), with minor amounts of 1,3-d(GpNpG) cross-links (Pt-GNG), interstrand cross-links and monoadducts. Although the relative contribution of these different adducts to toxicity is not known, literature implicates that Pt-GG and Pt-AG adducts block replication. Thus, nucleotide excision repair (NER), by which platinum adducts are excised, and translesion DNA synthesis (TLS), which permits adduct bypass, are thought to be associated with cisplatin resistance. Recent studies have reported that the clinical benefit from platinum-based chemotherapy is high if tumor cells express low levels of NER factors. To investigate the role of platinum-DNA adducts in mediating tumor cell survival by TLS, we examined whether 1,3-intrastrand d(GpTpG) platinum cross-links (Pt-GTG), which probably exist in NER-negative tumor cells but not in NER-positive tumor cells, are bypassed by the translesion DNA polymerase eta (pol eta), which is known to bypass Pt-GG. We show that pol eta can incorporate the correct deoxycytidine triphosphate opposite the first 3'-cross-linked G of Pt-GTG but cannot insert any nucleotides opposite the second intact T or the third 5'-cross-linked G of the adducts, thereby suggesting that TLS does not facilitate replication past Pt-GTG adducts. Thus, our findings implicate Pt-GNG adducts as mediating the cytotoxicity of platinum-DNA adducts in NER-negative tumors in vivo.

Exposure to Ultrafine Particles from Ambient Air and Oxidative Stress-Induced DNA Damage

DEFF Research Database (Denmark)

Bräuner, Elvira Vaclavik; Forchhammer, Lykke; Møller, Peter

2007-01-01

mononuclear cells (PBMCs) during controlled exposure to urban air particles with assignment of number concentration (NC) to four size modes with average diameters of 12, 23, 57, and 212 nm. DESIGN. Twenty-nine healthy adults participated in a randomized, two-factor cross-over study with or without biking...... exercise for 180 min and with exposure to particles (NC 6169-15362/cm3) or filtered air (NC 91-542/cm3) for 24 hr. METHODS: The levels of DNA strand breaks (SBs), oxidized purines as formamidopyrimidine DNA glycolase (FPG) sites, and activity of 7,8-dihydro-8-oxoguanine-DNA glycosylase (OGG1) in PBMCs were...

A Lateral Flow Biosensor for the Detection of Single Nucleotide Polymorphisms.

Science.gov (United States)

Zeng, Lingwen; Xiao, Zhuo

2017-01-01

A lateral flow biosensor (LFB) is introduced for the detection of single nucleotide polymorphisms (SNPs). The assay is composed of two steps: circular strand displacement reaction and lateral flow biosensor detection. In step 1, the nucleotide at SNP site is recognized by T4 DNA ligase and the signal is amplified by strand displacement DNA polymerase, which can be accomplished at a constant temperature. In step 2, the reaction product of step 1 is detected by a lateral flow biosensor, which is a rapid and cost effective tool for nuclei acid detection. Comparing with conventional methods, it requires no complicated machines. It is suitable for the use of point of care diagnostics. Therefore, this simple, cost effective, robust, and promising LFB detection method of SNP has great potential for the detection of genetic diseases, personalized medicine, cancer related mutations, and drug-resistant mutations of infectious agents.

Development of Equation Based on Urinary Purine Derivatives to Estimate Rumen Microbial Protein Production in Goats

International Nuclear Information System (INIS)

Jetana, Thongsuk; Abdullah, Norhani; Liang, Boo Juan; Syed Salim, Syed Jalaludin; Ho, Wan Yin

2003-06-01

Three experiments were conducted at the farm of the Universiti Putra Malaysia, Serdang, Selangor, Malaysia, to establish a model as an index for estimating rumen microbial protein production. In Experiment 1, six Ferral male goats (wt. 40.2±4.6 kg) were used to determine the endogenous purine derivatives (PD) excreted in the urine by fasting. In Experiment 2, four Ferral male goats (wt. 39.6±1.8 kg) were used to measure the proportion of plasma PD excreted in the urine by using [ 14 C]-uric acid as a marker at two levels of feed intake (40% and 80% voluntary intake), using an incomplete 2x4 Latin square experimental design. The feed consisted of 40% oil palm frond and 60% concentrate (OPFC). In Experiment 3, four Ferral male goats fed (OPFC)) were slaughtered and rumen contents were taken for measurements of purine and total nitrogen contents of mixed rumen microbes. The results showed that endogenous PD (allantoin, uric acid, xanthine and hypoxanthine) excreted in the urine obtained by the fasting trial was 202±17 μmol/kg BW 0 . 75 d - 1. The average percentage recovery of plasma PD excretion in the urine by using [ 14 C)-uric acid as a marker was 83±2.0% (cv=6.88, ranged 76.3-91.4%, n=8). Percentage recovery was not affected by levels of feed intake. The ratio of purine N: total N in the mixed rumen liquid associated bacteria (LAB) was 0.085. In this study, a preliminary model for goats was established by using the information from the recovery of labeled PD [ 14 C]-uric acid and the fasting PD excretion. The model obtained was Y 0.83X + 0.202 x BW 0 . 75 , where Y = PD excretion in the urine (mmol/d) X PD absorption at small intestine (mmol/d) BW 0 . 75 = Metabolic body weight (kg) Thus the microbial nitrogen based on total PD (MNpd) can be calculated as follows: MNpd = 70 x X = 0.992 x X (g/d) 0.085 x 0.83 x 1000 where 0.085 is the ratio of purine-N: total N in mixed rumen microbes, 0.83 is the average of digestibility of microbial purine from published

OrthoANI: An improved algorithm and software for calculating average nucleotide identity.

Science.gov (United States)

Lee, Imchang; Ouk Kim, Yeong; Park, Sang-Cheol; Chun, Jongsik

2016-02-01

Species demarcation in Bacteria and Archaea is mainly based on overall genome relatedness, which serves a framework for modern microbiology. Current practice for obtaining these measures between two strains is shifting from experimentally determined similarity obtained by DNA-DNA hybridization (DDH) to genome-sequence-based similarity. Average nucleotide identity (ANI) is a simple algorithm that mimics DDH. Like DDH, ANI values between two genome sequences may be different from each other when reciprocal calculations are compared. We compared 63 690 pairs of genome sequences and found that the differences in reciprocal ANI values are significantly high, exceeding 1 % in some cases. To resolve this problem of not being symmetrical, a new algorithm, named OrthoANI, was developed to accommodate the concept of orthology for which both genome sequences were fragmented and only orthologous fragment pairs taken into consideration for calculating nucleotide identities. OrthoANI is highly correlated with ANI (using BLASTn) and the former showed approximately 0.1 % higher values than the latter. In conclusion, OrthoANI provides a more robust and faster means of calculating average nucleotide identity for taxonomic purposes. The standalone software tools are freely available at http://www.ezbiocloud.net/sw/oat.

On fuzzy semantic similarity measure for DNA coding.

Science.gov (United States)

Ahmad, Muneer; Jung, Low Tang; Bhuiyan, Md Al-Amin

2016-02-01

A coding measure scheme numerically translates the DNA sequence to a time domain signal for protein coding regions identification. A number of coding measure schemes based on numerology, geometry, fixed mapping, statistical characteristics and chemical attributes of nucleotides have been proposed in recent decades. Such coding measure schemes lack the biologically meaningful aspects of nucleotide data and hence do not significantly discriminate coding regions from non-coding regions. This paper presents a novel fuzzy semantic similarity measure (FSSM) coding scheme centering on FSSM codons׳ clustering and genetic code context of nucleotides. Certain natural characteristics of nucleotides i.e. appearance as a unique combination of triplets, preserving special structure and occurrence, and ability to own and share density distributions in codons have been exploited in FSSM. The nucleotides׳ fuzzy behaviors, semantic similarities and defuzzification based on the center of gravity of nucleotides revealed a strong correlation between nucleotides in codons. The proposed FSSM coding scheme attains a significant enhancement in coding regions identification i.e. 36-133% as compared to other existing coding measure schemes tested over more than 250 benchmarked and randomly taken DNA datasets of different organisms. Copyright © 2015 Elsevier Ltd. All rights reserved.

Detection of new single nucleotide polymorphisms by means of real ...

Indian Academy of Sciences (India)

Unknown

amplified millions to billions of times by means of a PCR before the PCR product ... Keywords. Single nucleotide polymorphism; real time PCR; DNA melting curve analysis. ... VAL158MET SNP and alcoholism and to test for interac- tions between the .... indicate a heterozygote sample (VAL/MET genotype). The curve with ...

Enzymatic synthesis of RNAs capped with nucleotide analogues reveals the molecular basis for substrate selectivity of RNA capping enzyme: impacts on RNA metabolism.

Directory of Open Access Journals (Sweden)

Moheshwarnath Issur

Full Text Available RNA cap binding proteins have evolved to specifically bind to the N7-methyl guanosine cap structure found at the 5' ends of eukaryotic mRNAs. The specificity of RNA capping enzymes towards GTP for the synthesis of this structure is therefore crucial for mRNA metabolism. The fact that ribavirin triphosphate was described as a substrate of a viral RNA capping enzyme, raised the possibility that RNAs capped with nucleotide analogues could be generated in cellulo. Owing to the fact that this prospect potentially has wide pharmacological implications, we decided to investigate whether the active site of the model Paramecium bursaria Chlorella virus-1 RNA capping enzyme was flexible enough to accommodate various purine analogues. Using this approach, we identified several key structural determinants at each step of the RNA capping reaction and generated RNAs harboring various different cap analogues. Moreover, we monitored the binding affinity of these novel capped RNAs to the eIF4E protein and evaluated their translational properties in cellulo. Overall, this study establishes a molecular rationale for the specific selection of GTP over other NTPs by RNA capping enzyme It also demonstrates that RNAs can be enzymatically capped with certain purine nucleotide analogs, and it also describes the impacts of modified RNA caps on specific steps involved in mRNA metabolism. For instance, our results indicate that the N7-methyl group of the classical N7-methyl guanosine cap is not always indispensable for binding to eIF4E and subsequently for translation when compensatory modifications are present on the capped residue. Overall, these findings have important implications for our understanding of the molecular determinants involved in both RNA capping and RNA metabolism.

Nucleotide Excision Repair in Cellular Chromatin: Studies with Yeast from Nucleotide to Gene to Genome

Directory of Open Access Journals (Sweden)

Simon Reed

2012-09-01

Full Text Available Here we review our development of, and results with, high resolution studies on global genome nucleotide excision repair (GGNER in Saccharomyces cerevisiae. We have focused on how GGNER relates to histone acetylation for its functioning and we have identified the histone acetyl tranferase Gcn5 and acetylation at lysines 9/14 of histone H3 as a major factor in enabling efficient repair. We consider results employing primarily MFA2 as a model gene, but also those with URA3 located at subtelomeric sequences. In the latter case we also see a role for acetylation at histone H4. We then go on to outline the development of a high resolution genome-wide approach that enables one to examine correlations between histone modifications and the nucleotide excision repair (NER of UV-induced cyclobutane pyrimidine dimers throughout entire genomes. This is an approach that will enable rapid advances in understanding the complexities of how compacted chromatin in chromosomes is processed to access DNA damage and then returned to its pre-damaged status to maintain epigenetic codes.

Purine salvage in the apicomplexan Sarcocystis neurona, and generation of hypoxanthine-xanthine-guanine phosphoribosyltransferase-deficient clones for positive-negative selection of transgenic parasites.

Science.gov (United States)

Dangoudoubiyam, Sriveny; Zhang, Zijing; Howe, Daniel K

2014-09-01

Sarcocystis neurona is an apicomplexan parasite that causes severe neurological disease in horses and marine mammals. The Apicomplexa are all obligate intracellular parasites that lack purine biosynthesis pathways and rely on the host cell for their purine requirements. Hypoxanthine-xanthine-guanine phosphoribosyltransferase (HXGPRT) and adenosine kinase (AK) are key enzymes that function in two complementary purine salvage pathways in apicomplexans. Bioinformatic searches of the S. neurona genome revealed genes encoding HXGPRT, AK and all of the major purine salvage enzymes except purine nucleoside phosphorylase. Wild-type S. neurona were able to grow in the presence of mycophenolic acid (MPA) but were inhibited by 6-thioxanthine (6-TX), suggesting that the pathways involving either HXGPRT or AK are functional in this parasite. Prior work with Toxoplasma gondii demonstrated the utility of HXGPRT as a positive-negative selection marker. To enable the use of HXGPRT in S. neurona, the SnHXGPRT gene sequence was determined and a gene-targeting plasmid was transfected into S. neurona. SnHXGPRT-deficient mutants were selected with 6-TX, and single-cell clones were obtained. These Sn∆HXG parasites were susceptible to MPA and could be complemented using the heterologous T. gondii HXGPRT gene. In summary, S. neurona possesses both purine salvage pathways described in apicomplexans, thus allowing the use of HXGPRT as a positive-negative drug selection marker in this parasite.

Abiotic synthesis of purines and other heterocyclic compounds by the action of electrical discharges

Science.gov (United States)

Yuasa, S.; Flory, D.; Basile, B.; Oro, J.

1984-01-01

The synthesis of purines and pyrimidines using Oparin-Urey-type primitive earth atmospheres has been demonstrated by reacting methane, ethane, and ammonia in electrical discharges. Adenine, guaine, 4-aminoimidazole-5-carboxamide (AICA), and isocytosine have been identified by UV spectrometry and paper chromatography as the products of the reaction. The total yields of the identified heterocyclic compounds are 0.0023 percent. It is concluded that adenine synthesis occurs at a much lower concentration of hydrogen cyanide than has been shown by earlier studies. Pathways for the synthesis of purines from hydrogen cyanide are discussed, and a comparison of the heterocyclic compounds that have been identified in meteorites and in prebiotic reactions is presented.

Radiation chemical and photochemical study of Z-DNA modified by 2-aminopurine and 8- bromodeoxyguanosine

International Nuclear Information System (INIS)

Kimura, T.; Kawai, K.; Majima, T.

2003-01-01

DNA is able to take a number of local conformations. (CG) n repeats have the highest potential to Z-DNA which has a left-handed zig-zag backbone and unusual syn-conformation purine base. Because of the polymorphic nature of dinucleotide repeats, it seems possible that Z-DNA forming sequences may provide a source of genetic variation if they occur in regions that are important for the regulation of gene activity. Here, we investigated structural properties of Z-DNA compared with those of B-DNA with respects to one-electron attachment reaction of 8-bromodeoxyguanosine (dBrG) and fluorescence properties of 2-aminopurine (Ap). To investigate one-electron attachment reaction of Z-DNA, we synthesized oligodeoxynucleotides modified by dBrG in which syn-conformation deoxyguanosine was stabilized by steric repulsion between 8-bromo group of dBrG and sugar moiety in Z-DNA. Debromination from the dBrG modified oligodeoxynucleotides occurred from the one-electron attachment during the gamma-ray irradiation. The structural dependence of B- and Z-DNA was observed in the one-electron attachment reaction. Interestingly, the higher conversion of dBrG were observed in the Z-DNA than in the B-DNA. Since the solvent accessibility to purine base in Z-DNA increases compared with that in B-DNA, it is suggested that the electron attachment is enhanced in Z-DNA than in B-DNA. Next we studied the fluorescence properties of Ap in left-handed Z-DNA and compared with those in B-DNA. Since photoexcited adenine analogue Ap can serve as a sensitive probe of DNA structural dynamics, we synthesized Ap- and dBrG-modified oligodeoxynucleotides. Higher intensity was observed in the steady-state fluorescence of Ap in Z-DNA than in B-DNA. A new peak at 275 nm was observed in the excitation spectrum measured at the Ap emission wavelength 370 nm in Z-DNA. This has been explained by the energy transfer from the excited nucleobases to Ap. It is found that Ap is a useful fluorescence probe of Z-DNA

Nucleotide sequence of Phaseolus vulgaris L. alcohol dehydrogenase encoding cDNA and three-dimensional structure prediction of the deduced protein.

Science.gov (United States)

Amelia, Kassim; Khor, Chin Yin; Shah, Farida Habib; Bhore, Subhash J

2015-01-01

Common beans (Phaseolus vulgaris L.) are widely consumed as a source of proteins and natural products. However, its yield needs to be increased. In line with the agenda of Phaseomics (an international consortium), work of expressed sequence tags (ESTs) generation from bean pods was initiated. Altogether, 5972 ESTs have been isolated. Alcohol dehydrogenase (AD) encoding gene cDNA was a noticeable transcript among the generated ESTs. This AD is an important enzyme; therefore, to understand more about it this study was undertaken. The objective of this study was to elucidate P. vulgaris L. AD (PvAD) gene cDNA sequence and to predict the three-dimensional (3D) structure of deduced protein. positive and negative strands of the PvAD cDNA clone were sequenced using M13 forward and M13 reverse primers to elucidate the nucleotide sequence. Deduced PvAD cDNA and protein sequence was analyzed for their basic features using online bioinformatics tools. Sequence comparison was carried out using bl2seq program, and tree-view program was used to construct a phylogenetic tree. The secondary structures and 3D structure of PvAD protein were predicted by using the PHYRE automatic fold recognition server. The sequencing results analysis showed that PvAD cDNA is 1294 bp in length. It's open reading frame encodes for a protein that contains 371 amino acids. Deduced protein sequence analysis showed the presence of putative substrate binding, catalytic Zn binding, and NAD binding sites. Results indicate that the predicted 3D structure of PvAD protein is analogous to the experimentally determined crystal structure of s-nitrosoglutathione reductase from an Arabidopsis species. The 1294 bp long PvAD cDNA encodes for 371 amino acid long protein that contains conserved domains required for biological functions of AD. The predicted deduced PvAD protein's 3D structure reflects the analogy with the crystal structure of Arabidopsis thaliana s-nitrosoglutathione reductase. Further study is required

TD-DFT investigation of the magnetic circular dichroism spectra of some purine and pyrimidine bases of nucleic acids.

Science.gov (United States)

Fahleson, Tobias; Kauczor, Joanna; Norman, Patrick; Santoro, Fabrizio; Improta, Roberto; Coriani, Sonia

2015-05-28

We present a computational study of the magnetic circular dichroism (MCD) spectra in the 200-300 nm wavelength region of purine and its derivative hypoxanthine, as well as of the pyrimidine bases of nucleic acids uracil, thymine, and cytosine, using the B3LYP and CAM-B3LYP functionals. Solvent effects are investigated within the polarizable continuum model and by inclusion of explicit water molecules. In general, the computed spectra are found to be in good agreement with the experimental ones, apart from some overall blue shifts. Both the pseudo-A term shape of the MCD spectra of the purines and the B term shape of the spectra of pyrimidine bases are reproduced. Our calculations also correctly reproduce the reversed phase of the MCD bands in purine compared to that of its derivatives present in nucleic acids. Solvent effects are sizable and system specific, but they do not in general alter the qualitative shape of the spectra. The bands are dominated by the bright π → π* transitions, and our calculations in solution nicely reproduce their energy differences, improving the estimates obtained in the gas phase. Shoulders are predicted for purine and uracil due to n → π* excitations, but they are too weak to be observed in the experiment.

Model of biological quantum logic in DNA.

Science.gov (United States)

Mihelic, F Matthew

2013-08-02

The DNA molecule has properties that allow it to act as a quantum logic processor. It has been demonstrated that there is coherent conduction of electrons longitudinally along the DNA molecule through pi stacking interactions of the aromatic nucleotide bases, and it has also been demonstrated that electrons moving longitudinally along the DNA molecule are subject to a very efficient electron spin filtering effect as the helicity of the DNA molecule interacts with the spin of the electron. This means that, in DNA, electrons are coherently conducted along a very efficient spin filter. Coherent electron spin is held in a logically and thermodynamically reversible chiral symmetry between the C2-endo and C3-endo enantiomers of the deoxyribose moiety in each nucleotide, which enables each nucleotide to function as a quantum gate. The symmetry break that provides for quantum decision in the system is determined by the spin direction of an electron that has an orbital angular momentum that is sufficient to overcome the energy barrier of the double well potential separating the C2-endo and C3-endo enantiomers, and that enantiomeric energy barrier is appropriate to the Landauer limit of the energy necessary to randomize one bit of information.

Genome-wide mapping of DNA strand breaks.

Directory of Open Access Journals (Sweden)

Frédéric Leduc

Full Text Available Determination of cellular DNA damage has so far been limited to global assessment of genome integrity whereas nucleotide-level mapping has been restricted to specific loci by the use of specific primers. Therefore, only limited DNA sequences can be studied and novel regions of genomic instability can hardly be discovered. Using a well-characterized yeast model, we describe a straightforward strategy to map genome-wide DNA strand breaks without compromising nucleotide-level resolution. This technique, termed "damaged DNA immunoprecipitation" (dDIP, uses immunoprecipitation and the terminal deoxynucleotidyl transferase-mediated dUTP-biotin end-labeling (TUNEL to capture DNA at break sites. When used in combination with microarray or next-generation sequencing technologies, dDIP will allow researchers to map genome-wide DNA strand breaks as well as other types of DNA damage and to establish a clear profiling of altered genes and/or intergenic sequences in various experimental conditions. This mapping technique could find several applications for instance in the study of aging, genotoxic drug screening, cancer, meiosis, radiation and oxidative DNA damage.

Effect of training load structure on purine metabolism in middle-distance runners.

Science.gov (United States)

Zieliński, Jacek; Kusy, Krzysztof; Rychlewski, Tadeusz

2011-09-01

There are no studies analyzing the effect of training loads on purine metabolism during long training periods. The study's purpose was to evaluate the effect of training load changes and subsequent detraining on purine metabolism in middle-distance runners during a 1-yr cycle. In four characteristic points of the training cycle, loads assigned to five intensity zones, pre- and postexercise plasma hypoxanthine (Hx) and uric acid, and erythrocyte Hx-guanine phosphoribosyltransferase (HGPRT) activity were determined in 11 male middle-distance runners at the national level, practicing competitive sport for 8.1 ± 0.3 yr and with a mean age of 22.3 ± 0.7 yr, body mass of 73.0 ± 3.4 kg, and body height of 180 ± 2.2 cm. In the competition phase (CP), training loads in aerobic compensation and threshold zones decreased by 65.4% and by 20.5%, respectively. At the same time, anaerobic training loads increased by 132.5% in the VO(2max) zone and by 74.6% in the lactic acid tolerance zone. Postexercise Hx decreased significantly in CP by 6.2 μmol·L(-1). and increased in the transition phase (TP) by 17.4 μmol·L(-1). Both pre- and postexercise HGPRT activity increased significantly in CP by 9.3 nmol·mg(-1)·h(-1). and by 4.9 nmol·mg(-1)·h(-1). , respectively, and decreased significantly in TP by 10.6 nmol·mg(-1)·h(-1). and by 12.0 nmol·mg(-1)·h(-1). , respectively. A significant uric acid increase of 54 μmol·L(-1). was revealed merely in TP. The effect of anaerobic training on purine metabolism is significant despite of a very short total duration of anaerobic loads. Elevated preexercise HGPRT activity in CP suggests adaptation changes consisting in a "permanent readiness" for purine salvage. The detraining in TP leads to reverse adaptation changes. Probably, plasma Hx concentration and erythrocyte HGPRT activity may be considered as a useful measure of training status.

Mismatch oligonucleotides in human and yeast: guidelines for probe design on tiling microarrays

Directory of Open Access Journals (Sweden)

Jee Justin

2008-12-01

Full Text Available Abstract Background Mismatched oligonucleotides are widely used on microarrays to differentiate specific from nonspecific hybridization. While many experiments rely on such oligos, the hybridization behavior of various degrees of mismatch (MM structure has not been extensively studied. Here, we present the results of two large-scale microarray experiments on S. cerevisiae and H. sapiens genomic DNA, to explore MM oligonucleotide behavior with real sample mixtures under tiling-array conditions. Results We examined all possible nucleotide substitutions at the central position of 36-nucleotide probes, and found that nonspecific binding by MM oligos depends upon the individual nucleotide substitutions they incorporate: C→A, C→G and T→A (yielding purine-purine mispairs are most disruptive, whereas A→X were least disruptive. We also quantify a marked GC skew effect: substitutions raising probe GC content exhibit higher intensity (and vice versa. This skew is small in highly-expressed regions (± 0.5% of total intensity range and large (± 2% or more elsewhere. Multiple mismatches per oligo are largely additive in effect: each MM added in a distributed fashion causes an additional 21% intensity drop relative to PM, three-fold more disruptive than adding adjacent mispairs (7% drop per MM. Conclusion We investigate several parameters for oligonucleotide design, including the effects of each central nucleotide substitution on array signal intensity and of multiple MM per oligo. To avoid GC skew, individual substitutions should not alter probe GC content. RNA sample mixture complexity may increase the amount of nonspecific hybridization, magnify GC skew and boost the intensity of MM oligos at all levels.

Optimization of the operation of separation of the solids in suspension of the purines (Part I); Optimizacion de la operacion de separacion de los solidos en suspension de los purines (Parte I)

Energy Technology Data Exchange (ETDEWEB)

Bosque Hernandez, J. L. del; Martin Sanchez, J. L.

2004-07-01

The swinish cattle raising you can calculate in our country m 18 million heads. Locating the Spanish cattle cabin in the second position of the European Union. This sector is of great importance in the economy, having big possibilities of growth, due to the great existent demand. However, the generated residuals, denominated purines, they suppose a great obstacle for the expansion of this sector. The purines mammoth production and other cattle residuals outline a serious problem of environmental contamination; for what is necessary to establish the approaches for an appropriate treatment of the same ones, with the purpose of achieving the elimination of the problems of environmental contamination that you/they generate and, in special way, those contamination of the waters. (Author) 5 refs.

AMPD2 Regulates GTP Synthesis and is Mutated in a Potentially-Treatable Neurodegenerative Brainstem Disorder

Science.gov (United States)

Akizu, Naiara; Cantagrel, Vincent; Schroth, Jana; Cai, Na; Vaux, Keith; McCloskey, Douglas; Naviaux, Robert K.; Vleet, Jeremy Van; Fenstermaker, Ali G.; Silhavy, Jennifer L.; Scheliga, Judith S.; Toyama, Keiko; Morisaki, Hiroko; Sonmez, Fatma Mujgan; Celep, Figen; Oraby, Azza; Zaki, Maha S.; Al-Baradie, Raidah; Faqeih, Eissa; Saleh, Mohammad; Spencer, Emily; Rosti, Rasim Ozgur; Scott, Eric; Nickerson, Elizabeth; Gabriel, Stacey; Morisaki, Takayuki; Holmes, Edward W.; Gleeson, Joseph G.

2013-01-01

Purine biosynthesis and metabolism, conserved in all living organisms, is essential for cellular energy homeostasis and nucleic acids synthesis. The de novo synthesis of purine precursors is under tight negative feedback regulation mediated by adenosine and guanine nucleotides. We describe a new distinct early-onset neurodegenerative condition resulting from mutations in the adenosine monophosphate deaminase 2 gene (AMPD2). Patients have characteristic brain imaging features of pontocerebellar hypoplasia (PCH), due to loss of brainstem and cerebellar parenchyma. We found that AMPD2 plays an evolutionary conserved role in the maintenance of cellular guanine nucleotide pools by regulating the feedback inhibition of adenosine derivatives on de novo purine synthesis. AMPD2 deficiency results in defective GTP-dependent initiation of protein translation, which can be rescued by administration of purine precursors. These data suggest AMPD2-related PCH as a new, potentially treatable early-onset neurodegenerative disease. PMID:23911318

Characterization and DNA-binding specificities of Ralstonia TAL-like effectors

KAUST Repository

Li, Lixin

2013-07-01

Transcription activator-like effectors (TALEs) from Xanthomonas sp. have been used as customizable DNA-binding modules for genome-engineering applications. Ralstonia solanacearum TALE-like proteins (RTLs) exhibit similar structural features to TALEs, including a central DNA-binding domain composed of 35 amino acid-long repeats. Here, we characterize the RTLs and show that they localize in the plant cell nucleus, mediate DNA binding, and might function as transcriptional activators. RTLs have a unique DNA-binding architecture and are enriched in repeat variable di-residues (RVDs), which determine repeat DNA-binding specificities. We determined the DNA-binding specificities for the RVD sequences ND, HN, NP, and NT. The RVD ND mediates highly specific interactions with C nucleotide, HN interacts specifically with A and G nucleotides, and NP binds to C, A, and G nucleotides. Moreover, we developed a highly efficient repeat assembly approach for engineering RTL effectors. Taken together, our data demonstrate that RTLs are unique DNA-targeting modules that are excellent alternatives to be tailored to bind to user-selected DNA sequences for targeted genomic and epigenomic modifications. These findings will facilitate research concerning RTL molecular biology and RTL roles in the pathogenicity of Ralstonia spp. © 2013 The Author.

Catalytic carbene transfer allows the direct customization of cyclic purine dinucleotides.

Science.gov (United States)

Fei, Na; Häussinger, Daniel; Blümli, Seraina; Laventie, Benoît-Joseph; Bizzini, Lorenzo D; Zimmermann, Kaspar; Jenal, Urs; Gillingham, Dennis

2014-08-11

We describe a simple method for the direct modification of nucleobases in cyclic purine dinucleotides, important signalling molecules in both prokaryotes and eukaryotes. The method tolerates all members of the cyclic dinucleotide family and could be used to modulate their function or introduce useful side-chains such as fluorophores and photo-crosslinking groups.

Characterization and immunological identification of cDNA clones encoding two human DNA topoisomerase II isozymes

International Nuclear Information System (INIS)

Chung, T.D.Y.; Drake, F.H.; Tan, K.B.; Per, S.R.; Crooke, S.T.; Mirabelli, C.K.

1989-01-01

Several DNA topoisomerase II partial cDNA clones obtained from a human Raji-HN2 cDNA library were sequenced and two classes of nucleotide sequences were found. One member of the first class, SP1, was identical to an internal fragment of human HeLa cell Topo II cDNA described earlier. A member of the second class, SP11, shared extensive nucleotide (75%) and predicted peptide (92%) sequence similarities with the first two-thirds of HeLa Topo II. Each class of cDNAs hybridized to unique, nonoverlapping restriction enzyme fragments of genomic DNA from several human cell lines. Synthetic 24-mer oligonucleotide probes specific for each cDNA class hybridized to 6.5-kilobase mRNAs; furthermore, hybridization of probe specific for one class was not blocked by probe specific for the other. Antibodies raised against a synthetic SP1-encoded dodecapeptide specifically recognized the 170-kDa form of Topo II, while antibodies raised against the corresponding SP11-encoded dodecapeptide, or a second unique SP11-encoded tridecapeptide, selectively recognized the 180-kDa form of Topo II. These data provide genetic and immunochemical evidence for two Topo II isozymes

PAH-DNA adducts in environmentally exposed population in relation to metabolic and DNA repair gene polymorphisms

Energy Technology Data Exchange (ETDEWEB)

Binkova, Blanka [Laboratory of Genetic Ecotoxicology, Institute of Experimental Medicine AS CR and Health Institute of Central Bohemia, Videnska 1083, 14220 Prague (Czech Republic); Chvatalova, Irena [Laboratory of Genetic Ecotoxicology, Institute of Experimental Medicine AS CR and Health Institute of Central Bohemia, Videnska 1083, 14220 Prague (Czech Republic); Lnenickova, Zdena [Laboratory of Genetic Ecotoxicology, Institute of Experimental Medicine AS CR and Health Institute of Central Bohemia, Videnska 1083, 14220 Prague (Czech Republic); Milcova, Alena [Laboratory of Genetic Ecotoxicology, Institute of Experimental Medicine AS CR and Health Institute of Central Bohemia, Videnska 1083, 14220 Prague (Czech Republic); Tulupova, Elena [Laboratory of Genetic Ecotoxicology, Institute of Experimental Medicine AS CR and Health Institute of Central Bohemia, Videnska 1083, 14220 Prague (Czech Republic); Cancer Biomarkers and Prevention Group, Biocentre, University of Leicester (United Kingdom); Farmer, Peter B. [Cancer Biomarkers and Prevention Group, Biocentre, University of Leicester (United Kingdom); Sram, Radim J. [Laboratory of Genetic Ecotoxicology, Institute of Experimental Medicine AS CR and Health Institute of Central Bohemia, Videnska 1083, 14220 Prague (Czech Republic)]. E-mail: sram@biomed.cas.cz

2007-07-01

Epidemiologic studies indicate that prolonged exposure to particulate air pollution may be associated with increased risk of cardiovascular diseases and cancer in general population. These effects may be attributable to polycyclic aromatic hydrocarbons (PAHs) adsorbed to respirable air particles. It is expected that metabolic and DNA repair gene polymorphisms may modulate individual susceptibility to PAH exposure. This study investigates relationships between exposure to PAHs, polymorphisms of these genes and DNA adducts in group of occupationally exposed policemen (EXP, N = 53, males, aged 22-50 years) working outdoors in the downtown area of Prague and in matched 'unexposed' controls (CON, N = 52). Personal exposure to eight carcinogenic PAHs (c-PAHs) was evaluated by personal samplers during working shift prior to collection of biological samples. Bulky-aromatic DNA adducts were analyzed in lymphocytes by {sup 32}P-postlabeling assay. Polymorphisms of metabolizing (GSTM1, GSTP1, GSTT1, EPHX1, CYP1A1-MspI) and DNA repair (XRCC1, XPD) genes were determined by PCR-based RFLP assays. As potential modifiers and/or cofounders, urinary cotinine levels were analyzed by radioimmunoassay, plasma levels of vitamins A, C, E and folates by HPLC, cholesterol and triglycerides using commercial kits. During the sampling period ambient particulate air pollution was as follows: PM10 32-55 {mu}g/m{sup 3}, PM2.5 27-38 {mu}g/m{sup 3}, c-PAHs 18-22 ng/m{sup 3}; personal exposure to c-PAHs: 9.7 ng/m{sup 3} versus 5.8 ng/m{sup 3} (P < 0.01) for EXP and CON groups, respectively. The total DNA adduct levels did not significantly differ between EXP and CON groups (0.92 {+-} 0.28 adducts/10{sup 8} nucleotides versus 0.82 {+-} 0.23 adducts/10{sup 8} nucleotides, P = 0.065), whereas the level of the B[a]P-'like' adduct was significantly higher in exposed group (0.122 {+-} 0.036 adducts/10{sup 8} nucleotides versus 0.099 {+-} 0.035 adducts/10{sup 8} nucleotides, P = 0

DNA template dependent accuracy variation of nucleotide selection in transcription.

Directory of Open Access Journals (Sweden)

Harriet Mellenius

Full Text Available It has been commonly assumed that the effect of erroneous transcription of DNA genes into messenger RNAs on peptide sequence errors are masked by much more frequent errors of mRNA translation to protein. We present a theoretical model of transcriptional accuracy. It uses experimentally estimated standard free energies of double-stranded DNA and RNA/DNA hybrids and predicts a DNA template dependent transcriptional accuracy variation spanning several orders of magnitude. The model also identifies high-error as well a high-accuracy transcription motifs. The source of the large accuracy span is the context dependent variation of the stacking free energy of pairs of correct and incorrect base pairs in the ever moving transcription bubble. Our model predictions have direct experimental support from recent single molecule based identifications of transcriptional errors in the C. elegans transcriptome. Our conclusions challenge the general view that amino acid substitution errors in proteins are mainly caused by translational errors. It suggests instead that transcriptional error hotspots are the dominating source of peptide sequence errors in some DNA template contexts, while mRNA translation is the major cause of protein errors in other contexts.

Direct determination of tautomerism in purine derivatives by low-temperature NMR spectroscopy

Czech Academy of Sciences Publication Activity Database

Sečkářová, P.; Marek, R.; Maliňáková, K.; Kolehmainen, E.; Hocková, Dana; Hocek, Michal; Sklenář, V.

2004-01-01

Roč. 45, č. 33 (2004), s. 6259-6263 ISSN 0040-4039 R&D Projects: GA MŠk LN00A016 Institutional research plan: CEZ:AV0Z4055905 Keywords : purine * NMR * tautomerism Subject RIV: CC - Organic Chemistry Impact factor: 2.484, year: 2004

Absorption and Intermediary Metabolism of Purines and Pyrimidines in Lactating Dairy Cows

DEFF Research Database (Denmark)

Nielsen, Charlotte Stentoft; Røjen, Betina Amdisen; Jensen, Søren Krogh

2015-01-01

About 20 % of ruminal microbial N in dairy cows derives from purines and pyrimidines; however, their intermediary metabolism and contribution to the overall N metabolism has sparsely been described. In the present study, the postprandial patterns of net portal-drained viscera (PDV) and hepatic...

Nucleotide Excision Repair Lesion-Recognition Protein Rad4 Captures a Pre-Flipped Partner Base in a Benzo[a]pyrene-Derived DNA Lesion: How Structure Impacts the Binding Pathway.

Science.gov (United States)

Mu, Hong; Geacintov, Nicholas E; Min, Jung-Hyun; Zhang, Yingkai; Broyde, Suse

2017-06-19

The xeroderma pigmentosum C protein complex (XPC) recognizes a variety of environmentally induced DNA lesions and is the key in initiating their repair by the nucleotide excision repair (NER) pathway. When bound to a lesion, XPC flips two nucleotide pairs that include the lesion out of the DNA duplex, yielding a productively bound complex that can lead to successful lesion excision. Interestingly, the efficiencies of NER vary greatly among different lesions, influencing their toxicity and mutagenicity in cells. Though differences in XPC binding may influence NER efficiency, it is not understood whether XPC utilizes different mechanisms to achieve productive binding with different lesions. Here, we investigated the well-repaired 10R-(+)-cis-anti-benzo[a]pyrene-N 2 -dG (cis-B[a]P-dG) DNA adduct in a duplex containing normal partner C opposite the lesion. This adduct is derived from the environmental pro-carcinogen benzo[a]pyrene and is likely to be encountered by NER in the cell. We have extensively investigated its binding to the yeast XPC orthologue, Rad4, using umbrella sampling with restrained molecular dynamics simulations and free energy calculations. The NMR solution structure of this lesion in duplex DNA has shown that the dC complementary to the adducted dG is flipped out of the DNA duplex in the absence of XPC. However, it is not known whether the "pre-flipped" base would play a role in its recognition by XPC. Our results show that Rad4 first captures the displaced dC, which is followed by a tightly coupled lesion-extruding pathway for productive binding. This binding path differs significantly from the one deduced for the small cis-syn cyclobutane pyrimidine dimer lesion opposite mismatched thymines [ Mu , H. , ( 2015 ) Biochemistry , 54 ( 34 ), 5263 - 7 ]. The possibility of multiple paths that lead to productive binding to XPC is consistent with the versatile lesion recognition by XPC that is required for successful NER.

Efecto antagónico in vitro de actinomicetos aislados de purines de chipaca (bidens pilosa l.) frente a phytophthora infestans (mont) de bary

OpenAIRE

Fonseca Ardila, Yudy Astrid; Castellanos Suárez, Diana Edith; León Sicard, Tomás Enrique

2011-01-01

Se estudió el efecto inhibidor de los actinomicetos presentes en purines o extractos fermentados de plantas de chipaca (Bidens pilosa L.), sobre el crecimiento de Phytophthora infestans (Mont) de Bary, causante del tizón tardío de la papa. Se elaboraron cuatro purines de flores, raíces, hojas-tallos y su mezcla. De estos purines se obtuvieron 25 aislamientos de actinomicetos, cada uno de los cuales se enfrentó con P. infestans en placas de medio de cultivo, utilizando la técnica de anillos de...

Characterization of the major formamidopyrimidine-DNA glycosylase homolog in Mycobacterium tuberculosis and its linkage to variable tandem repeats.

Science.gov (United States)

Olsen, Ingrid; Balasingham, Seetha V; Davidsen, Tonje; Debebe, Ephrem; Rødland, Einar A; van Soolingen, Dick; Kremer, Kristin; Alseth, Ingrun; Tønjum, Tone

2009-07-01

The ability to repair DNA damage is likely to play an important role in the survival of facultative intracellular parasites because they are exposed to high levels of reactive oxygen species and nitrogen intermediates inside phagocytes. Correcting oxidative damage in purines and pyrimidines is the primary function of the enzymes formamidopyrimidine (faPy)-DNA glycosylase (Fpg) and endonuclease VIII (Nei) of the base excision repair pathway, respectively. Four gene homologs, belonging to the fpg/nei family, have been identified in Mycobacterium tuberculosis H37Rv. The recombinant protein encoded by M. tuberculosis Rv2924c, termed Mtb-Fpg1, was overexpressed, purified and biochemically characterized. The enzyme removed faPy and 5-hydroxycytosine lesions, as well as 8-oxo-7,8-dihydroguanine (8oxoG) opposite to C, T and G. Mtb-Fpg1 thus exhibited substrate specificities typical for Fpg enzymes. Although Mtb-fpg1 showed nearly complete nucleotide sequence conservation in 32 M. tuberculosis isolates, the region upstream of Mtb-fpg1 in these strains contained tandem repeat motifs of variable length. A relationship between repeat length and Mtb-fpg1 expression level was demonstrated in M. tuberculosis strains, indicating that an increased length of the tandem repeats positively influenced the expression levels of Mtb-fpg1. This is the first example of such a tandem repeat region of variable length being linked to the expression level of a bacterial gene.

Inhibition of nucleotide excision repair by fludarabine in normal lymphocytes in vitro, measured by the alkaline single cell gel electrophoresis (comet) assay

Energy Technology Data Exchange (ETDEWEB)

Yamauchi, Takahiro; Kawai, Yasukazu; Ueda, Takanori [Fukui Medical Univ., Matsuoka (Japan)

2002-05-01

Alkylating agents or platinum analogues initiate several excision repair mechanisms, which involve incision of the DNA strand, excision of the damaged nucleotide, gap filling by DNA resynthesis, and rejoining by ligation. The previous study described that nucleotide excision repair permitted incorporation of fludarabine nucleoside (F-area-A) into the repair patch, thereby inhibiting the DNA resynthesis. In the present study, to clarify the repair kinetics in view of the inhibition by F-ara-A, normal lymphocytes were stimulated to undergo nucleotide excision repair by ultraviolet C (UV) irradiation in the presence or absence of F-ara-A. The repair kinetics were determined as DNA single strand breaks resulting from the incision and the rejoining using the alkaline single cell gel electrophoresis (comet) assay. DNA resynthesis was evaluated in terms of the uptake of tritiated thymidine into DNA. The lymphocytes initiated the incision step maximally at 1 h, and completed the rejoining process within 4 h after UV exposure. UV also initiated thymidine uptake, which increased time-dependently and reached a plateau at 4 h. A 2-h pre-incubation with F-ara-A inhibited the repair in a concentration-dependent manner, with the maximal inhibition by 5 {mu}M. This inhibitory effect was demonstrated by the reduction of the thymidine uptake and by the inhibition of the rejoining. A DNA polymerase inhibitor, aphidicolin, and a ribonucleotide reductase inhibitor, hydroxyurea, were not so inhibitory to the repair process as F-ara-A at equimolar concentrations. The present findings suggest that inhibition of nucleotide excision repair may represent a novel therapeutic strategy against cancer, especially in the context of resistant cells with an increased repair capacity. (author)

Anopheles gambiae Purine Nucleoside Phosphorylase: Catalysis, Structure, and Inhibition

Energy Technology Data Exchange (ETDEWEB)

Taylor,E.; Rinaldo-Matthis, A.; Li, L.; Ghanem, M.; Hazleton, K.; Cassera, M.; Almo, S.; Schramm, V.

2007-01-01

The purine salvage pathway of Anopheles gambiae, a mosquito that transmits malaria, has been identified in genome searches on the basis of sequence homology with characterized enzymes. Purine nucleoside phosphorylase (PNP) is a target for the development of therapeutic agents in humans and purine auxotrophs, including malarial parasites. The PNP from Anopheles gambiae (AgPNP) was expressed in Escherichia coli and compared to the PNPs from Homo sapiens (HsPNP) and Plasmodium falciparum (PfPNP). AgPNP has kcat values of 54 and 41 s-1 for 2'-deoxyinosine and inosine, its preferred substrates, and 1.0 s-1 for guanosine. However, the chemical step is fast for AgPNP at 226 s-1 for guanosine in pre-steady-state studies. 5'-Deaza-1'-aza-2'-deoxy-1'-(9-methylene)-Immucillin-H (DADMe-ImmH) is a transition-state mimic for a 2'-deoxyinosine ribocation with a fully dissociated N-ribosidic bond and is a slow-onset, tight-binding inhibitor with a dissociation constant of 3.5 pM. This is the tightest-binding inhibitor known for any PNP, with a remarkable Km/Ki* of 5.4 x 107, and is consistent with enzymatic transition state predictions of enhanced transition-state analogue binding in enzymes with enhanced catalytic efficiency. Deoxyguanosine is a weaker substrate than deoxyinosine, and DADMe-Immucillin-G is less tightly bound than DADMe-ImmH, with a dissociation constant of 23 pM for AgPNP as compared to 7 pM for HsPNP. The crystal structure of AgPNP was determined in complex with DADMe-ImmH and phosphate to a resolution of 2.2 Angstroms to reveal the differences in substrate and inhibitor specificity. The distance from the N1' cation to the phosphate O4 anion is shorter in the AgPNP{center_dot}DADMe-ImmH{center_dot}PO4 complex than in HsPNP{center_dot}DADMe-ImmH{center_dot}SO4, offering one explanation for the stronger inhibitory effect of DADMe-ImmH for AgPNP.

Carcinogen-induced damage to DNA

International Nuclear Information System (INIS)

Strauss, B.; Altamirano, M.; Bose, K.; Sklar, R.; Tatsumi, K.

1979-01-01

Human cells respond to carcinogen-induced damage in their DNA in at least two ways. The first response, excision repair, proceeds by at least three variations, depending on the nature of the damage. Nucleotide excision results in relatively large repair patches but few free DNA breaks, since the endonuclease step is limiting. Apurinic repair is characterized by the appearance of numerous breaks in the DNA and by short repair patches. The pathways behave as though they function independently. Lymphoic cells derived from a xeroderma pigmentosum complementation group C patient are deficient in their ability to perform nucleotide excision and also to excise 6 methoxyguanine adducts, but they are apurinic repair competent. Organisms may bypass damage in their DNA. Lymphoblastoid cells, including those derived from xeroderma pigmentosum treated with 3 H-anti-BPDE, can replicate their DNA at low doses of carcinogen. Unexcised 3 H is found in the light or parental strand of the resulting hybrid DNA when replication occurs in medium with BrdUrd. This observation indicates a bypass reaction occurring by a mechanism involving branch migration at DNA growing points. Branch migration in DNA preparations have been observed, but the evidence is that most occurs in BrdUrd-containing DNA during cell lysis. The measurement of the bifilarly substituted DNA resulting from branch migration is a convenient method of estimating the proportion of new synthesis remaining in the vicinity of the DNA growing point. Treatment with carcinogens or caffeine results in accumulation of DNA growing points accompanied by the synthesis of shortened pieces of daughter DNA

Repair of DNA-polypeptide crosslinks by human excision nuclease

Science.gov (United States)

Reardon, Joyce T.; Sancar, Aziz

2006-03-01

DNA-protein crosslinks are relatively common DNA lesions that form during the physiological processing of DNA by replication and recombination proteins, by side reactions of base excision repair enzymes, and by cellular exposure to bifunctional DNA-damaging agents such as platinum compounds. The mechanism by which pathological DNA-protein crosslinks are repaired in humans is not known. In this study, we investigated the mechanism of recognition and repair of protein-DNA and oligopeptide-DNA crosslinks by the human excision nuclease. Under our assay conditions, the human nucleotide excision repair system did not remove a 16-kDa protein crosslinked to DNA at a detectable level. However, 4- and 12-aa-long oligopeptides crosslinked to the DNA backbone were recognized by some of the damage recognition factors of the human excision nuclease with moderate selectivity and were excised from DNA at relatively efficient rates. Our data suggest that, if coupled with proteolytic degradation of the crosslinked protein, the human excision nuclease may be the major enzyme system for eliminating protein-DNA crosslinks from the genome. damage recognition | nucleotide excision repair

Locked nucleic acid inhibits amplification of contaminating DNA in real-time PCR

DEFF Research Database (Denmark)

Hummelshoj, Lone; Ryder, Lars P; Madsen, Hans O

2005-01-01

and real-time PCR, the addition of LNA showed blocking of the amplification of genomic XBP1 but not cDNA XBP1. To test the effect of melting temperature (Tm) on the LNA, we investigated the number of LNA nucleotides that could be replaced with DNA nucleotides and still retain the blocking activity. More...

DNA adducts of 2,3-epoxy-4-hydroxynonanal: detection of 7-(1', 2'-dihydroxyheptyl)-3H-imidazo[2,1-i]purine and 1,N6-ethenoadenine by gas chromatography/negative ion chemical ionization/mass spectrometry.

Science.gov (United States)

Chen, H J; Zhang, L; Cox, J; Cunningham, J A; Chung, F L

1998-12-01

2,3-Epoxy-4-hydroxynonanal (EH) is a bifunctional aldehyde formed by epoxidation of trans-4-hydroxy-2-nonenal, a peroxidation product of omega-6 polyunsaturated fatty acids. EH is mutagenic and tumorigenic and capable of modifying DNA bases forming etheno adducts in vitro. Recent studies showed that etheno adducts are present in tissue DNA of humans and untreated rodents, suggesting a potential endogenous role of EH in their formation. A sensitive assay is needed so we can determine whether EH is involved in etheno adduct formation in vivo and study the biological significance of the etheno adducts in DNA. In this study, we developed a gas chromatography/negative ion chemical ionization/mass spectrometry assay for the analysis of 1, N6-ethenoadenine (epsilonAde) and 7-(1', 2'-dihydroxyheptyl)-3H-imidazo[2,1-i]purine (DHH-epsilonAde) in DNA; both are products from the reaction of adenine with EH. The assay entails the following sequence of steps: (1) addition of [15N5]epsilonAde and [15N5]DHH-epsilonAde to DNA as internal standards, (2) acid hydrolysis of DNA, (3) adduct enrichment by C18 solid phase extraction (SPE), (4) derivatization by pentafluorobenzylation (PFB), (5) separation of PFB-epsilonAde and PFB-DHH-epsilonAde on a Si SPE column, (6) acetonide (ACT) formation of PFB-DHH-epsilonAde, and (7) GC/MS analysis with selective ion monitoring (SIM). The limit of detection by on-column injection for PFB-epsilonAde monitoring of the (M - PFB)- ion at m/z 158 was 30 amol and for ACT-PFB-DHH-epsilonAde monitoring of the (M - PFB)- ion at m/z 328 was 0.4 fmol; the detection limits for the entire assay were 6.3 fmol for epsilonAde and 36 fmol for DHH-epsilonAde. In calf thymus DNA modified with EH at 37 degreesC for 50 h, both epsilonAde and DHH-epsilonAde were detected at high levels by this method, 4.5 +/- 0.7 and 90.8 +/- 8.7 adducts/10(3) adenine, respectively. These levels were also verified by HPLC fluorescence analysis, indicating that EH extensively reacts

Coupling of the nucleotide incision and 3' {yields} 5' exonuclease activities in Escherichia coli endonuclease IV: Structural and genetic evidences

Energy Technology Data Exchange (ETDEWEB)

Golan, Gali [Hebrew University of Jerusalem, Jerusalem 91904 (Israel); Ishchenko, Alexander A. [Groupe Reparation de l' ADN, CNRS UMR 8126, Univ. Paris-Sud, Institut de Cancerologie Gustave Roussy, 39, rue Camille Desmoulins, F-94805 Villejuif Cedex (France); Khassenov, Bekbolat [National Center for Biotechnology, Astana (Kazakhstan); Shoham, Gil, E-mail: gil2@vms.huji.ac.il [Hebrew University of Jerusalem, Jerusalem 91904 (Israel); Saparbaev, Murat K., E-mail: smurat@igr.fr [Groupe Reparation de l' ADN, CNRS UMR 8126, Univ. Paris-Sud, Institut de Cancerologie Gustave Roussy, 39, rue Camille Desmoulins, F-94805 Villejuif Cedex (France)

2010-03-01

Aerobic respiration generates reactive oxygen species (ROS) as a by-product of cellular metabolism which can damage DNA. The complex nature of oxidative DNA damage requires actions of several repair pathways. Oxidized DNA bases are substrates for two overlapping pathways: base excision repair (BER) and nucleotide incision repair (NIR). In the BER pathway a DNA glycosylase cleaves the N-glycosylic bond between the abnormal base and deoxyribose, leaving either an abasic site or single-stranded DNA break. Alternatively, in the NIR pathway, an apurinic/apyrimidinic (AP) endonuclease incises duplex DNA 5' next to oxidatively damaged nucleotide. The multifunctional Escherichia coli endonuclease IV (Nfo) is involved in both BER and NIR pathways. Nfo incises duplex DNA 5' of a damaged residue but also possesses an intrinsic 3' {yields} 5' exonuclease activity. Herein, we demonstrate that Nfo-catalyzed NIR and exonuclease activities can generate a single-strand gap at the 5' side of 5,6-dihydrouracil residue. Furthermore, we show that Nfo mutants carrying amino acid substitutions H69A and G149D are deficient in both NIR and exonuclease activities, suggesting that these two functions are genetically linked and governed by the same amino acid residues. The crystal structure of Nfo-H69A mutant reveals the loss of one of the active site zinc atoms (Zn1) and rearrangements of the catalytic site, but no gross changes in the overall enzyme conformation. We hypothesize that these minor changes strongly affect the DNA binding of Nfo. Decreased affinity may lead to a different kinking angle of the DNA helix and this in turn thwart nucleotide incision and exonuclease activities of Nfo mutants but to lesser extent of their AP endonuclease function. Based on the biochemical and genetic data we propose a model where nucleotide incision coupled to 3' {yields} 5' exonuclease activity prevents formation of lethal double-strand breaks when repairing bi