WorldWideScience

Sample records for dna primers

  1. DNA Extraction and Primer Selection

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Nielsen, Per Halkjær; Albertsen, Mads

    Talk regarding pitfalls in DNA extraction and 16S amplicon primer choice when performing community analysis of complex microbial communities. The talk was a part of Workshop 2 "Principles, Potential, and Limitations of Novel Molecular Methods in Water Engineering; from Amplicon Sequencing to -omics...

  2. Binary electrokinetic separation of target DNA from background DNA primers.

    Energy Technology Data Exchange (ETDEWEB)

    James, Conrad D.; Derzon, Mark Steven

    2005-10-01

    This report contains the summary of LDRD project 91312, titled ''Binary Electrokinetic Separation of Target DNA from Background DNA Primers''. This work is the first product of a collaboration with Columbia University and the Northeast BioDefense Center of Excellence. In conjunction with Ian Lipkin's lab, we are developing a technique to reduce false positive events, due to the detection of unhybridized reporter molecules, in a sensitive and multiplexed detection scheme for nucleic acids developed by the Lipkin lab. This is the most significant problem in the operation of their capability. As they are developing the tools for rapidly detecting the entire panel of hemorrhagic fevers this technology will immediately serve an important national need. The goal of this work was to attempt to separate nucleic acid from a preprocessed sample. We demonstrated the preconcentration of kilobase-pair length double-stranded DNA targets, and observed little preconcentration of 60 base-pair length single-stranded DNA probes. These objectives were accomplished in microdevice formats that are compatible with larger detection systems for sample pre-processing. Combined with Columbia's expertise, this technology would enable a unique, fast, and potentially compact method for detecting/identifying genetically-modified organisms and multiplexed rapid nucleic acid identification. Another competing approach is the DARPA funded IRIS Pharmaceutical TIGER platform which requires many hours for operation, and an 800k$ piece of equipment that fills a room. The Columbia/SNL system could provide a result in 30 minutes, at the cost of a few thousand dollars for the platform, and would be the size of a shoebox or smaller.

  3. One fungus , which genes ? Development and assessment of universal primers for potential secondary fungal DNA barcodes

    NARCIS (Netherlands)

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Irinyi, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, A.D. van; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martín, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, Z.W. de; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, G.S. de; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, M. de; Robert, V.

    2015-01-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic

  4. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes

    NARCIS (Netherlands)

    Stielow, J.B.; Lévesque, C.A.; Seifert, K.A.; Meyer, W.; Irinyi, L.; Smits, D.; Renfurm, R.; Verkley, G.J.M.; Groenewald, M.; Chaduli, D.; Lomascolo, A.; Welti, S.; Lesage-Meessen, L.; Favel, A.; Al-Hatmi, A.M.S.; Damm, U.; Yilmaz, N.; Houbraken, J.; Lombard, L.; Quaedvlieg, W.; Binder, M.; Vaas, L.A.I.; Vu, D.; Yurkov, A.; Begerow, D.; Roehl, O.; Guerreiro, M.; Fonseca, A.; Samerpitak, K.; Diepeningen, van A.D.; Dolatabadi, S.; Moreno, L.F.; Casaregola, S.; Mallet, S.; Jacques, N.; Roscini, L.; Egidi, E.; Bizet, C.; Garcia-Hermoso, D.; Martin, M.P.; Deng, S.; Groenewald, J.Z.; Boekhout, T.; Beer, de Z.W.; Barnes, I.; Duong, T.A.; Wingfield, M.J.; Hoog, de G.S.; Crous, P.W.; Lewis, C.T.; Hambleton, S.; Moussa, T.A.A.; Al-Zahrani, H.S.; Almaghrabi, O.A.; Louis-Seize, G.; Assabgui, R.; McCormick, W.; Omer, G.; Dukik, K.; Cardinali, G.; Eberhardt, U.; Vries, de M.; Robert, V.

    2015-01-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers

  5. Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.

    Science.gov (United States)

    Wu, Z; Nagano, I; Xu, D; Takahashi, Y

    1997-03-01

    Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.

  6. Primer retention owing to the absence of RNase H1 is catastrophic for mitochondrial DNA replication.

    Science.gov (United States)

    Holmes, J Bradley; Akman, Gokhan; Wood, Stuart R; Sakhuja, Kiran; Cerritelli, Susana M; Moss, Chloe; Bowmaker, Mark R; Jacobs, Howard T; Crouch, Robert J; Holt, Ian J

    2015-07-28

    Encoding ribonuclease H1 (RNase H1) degrades RNA hybridized to DNA, and its function is essential for mitochondrial DNA maintenance in the developing mouse. Here we define the role of RNase H1 in mitochondrial DNA replication. Analysis of replicating mitochondrial DNA in embryonic fibroblasts lacking RNase H1 reveals retention of three primers in the major noncoding region (NCR) and one at the prominent lagging-strand initiation site termed Ori-L. Primer retention does not lead immediately to depletion, as the persistent RNA is fully incorporated in mitochondrial DNA. However, the retained primers present an obstacle to the mitochondrial DNA polymerase γ in subsequent rounds of replication and lead to the catastrophic generation of a double-strand break at the origin when the resulting gapped molecules are copied. Hence, the essential role of RNase H1 in mitochondrial DNA replication is the removal of primers at the origin of replication.

  7. Specific amplification of bacterial DNA by optimized so-called universal bacterial primers in samples rich of plant DNA.

    Science.gov (United States)

    Dorn-In, Samart; Bassitta, Rupert; Schwaiger, Karin; Bauer, Johann; Hölzel, Christina S

    2015-06-01

    Universal primers targeting the bacterial 16S-rRNA-gene allow quantification of the total bacterial load in variable sample types by qPCR. However, many universal primer pairs also amplify DNA of plants or even of archaea and other eukaryotic cells. By using these primers, the total bacterial load might be misevaluated, whenever samples contain high amounts of non-target DNA. Thus, this study aimed to provide primer pairs which are suitable for quantification and identification of bacterial DNA in samples such as feed, spices and sample material from digesters. For 42 primers, mismatches to the sequence of chloroplasts and mitochondria of plants were evaluated. Six primer pairs were further analyzed with regard to the question whether they anneal to DNA of archaea, animal tissue and fungi. Subsequently they were tested with sample matrix such as plants, feed, feces, soil and environmental samples. To this purpose, the target DNA in the samples was quantified by qPCR. The PCR products of plant and feed samples were further processed for the Single Strand Conformation Polymorphism method followed by sequence analysis. The sequencing results revealed that primer pair 335F/769R amplified only bacterial DNA in samples such as plants and animal feed, in which the DNA of plants prevailed. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. The fidelity of reverse transcription differs in reactions primed with RNA versus DNA primers

    NARCIS (Netherlands)

    Oude Essink, B. B.; Berkhout, B.

    1999-01-01

    Reverse transcriptase enzymes (RT) convert single-stranded retroviral RNA genomes into double-stranded DNA. The RT enzyme can use both RNA and DNA primers, the former being used exclusively during initiation of minus- and plus-strand synthesis. Initiation of minus-strand DNA synthesis occurs by

  9. Disclosing bias in bisulfite assay: MethPrimers underestimate high DNA methylation.

    Directory of Open Access Journals (Sweden)

    Andrea Fuso

    Full Text Available Discordant results obtained in bisulfite assays using MethPrimers (PCR primers designed using MethPrimer software or assuming that non-CpGs cytosines are non methylated versus primers insensitive to cytosine methylation lead us to hypothesize a technical bias. We therefore used the two kinds of primers to study different experimental models and methylation statuses. We demonstrated that MethPrimers negatively select hypermethylated DNA sequences in the PCR step of the bisulfite assay, resulting in CpG methylation underestimation and non-CpG methylation masking, failing to evidence differential methylation statuses. We also describe the characteristics of "Methylation-Insensitive Primers" (MIPs, having degenerated bases (G/A to cope with the uncertain C/U conversion. As CpG and non-CpG DNA methylation patterns are largely variable depending on the species, developmental stage, tissue and cell type, a variable extent of the bias is expected. The more the methylome is methylated, the greater is the extent of the bias, with a prevalent effect of non-CpG methylation. These findings suggest a revision of several DNA methylation patterns so far documented and also point out the necessity of applying unbiased analyses to the increasing number of epigenomic studies.

  10. Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

    Directory of Open Access Journals (Sweden)

    Zuiter Afnan

    2012-08-01

    Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

  11. Generation of sequence signatures from DNA amplification fingerprints with mini-hairpin and microsatellite primers.

    Science.gov (United States)

    Caetano-Anollés, G; Gresshoff, P M

    1996-06-01

    DNA amplification fingerprinting (DAF) with mini-hairpins harboring arbitrary "core" sequences at their 3' termini were used to fingerprint a variety of templates, including PCR products and whole genomes, to establish genetic relationships between plant tax at the interspecific and intraspecific level, and to identify closely related fungal isolates and plant accessions. No correlation was observed between the sequence of the arbitrary core, the stability of the mini-hairpin structure and DAF efficiency. Mini-hairpin primers with short arbitrary cores and primers complementary to simple sequence repeats present in microsatellites were also used to generate arbitrary signatures from amplification profiles (ASAP). The ASAP strategy is a dual-step amplification procedure that uses at least one primer in each fingerprinting stage. ASAP was able to reproducibly amplify DAF products (representing about 10-15 kb of sequence) following careful optimization of amplification parameters such as primer and template concentration. Avoidance of primer sequences partially complementary to DAF product termini was necessary in order to produce distinct fingerprints. This allowed the combinatorial use of oligomers in nucleic acid screening, with numerous ASAP fingerprinting reactions based on a limited number of primer sequences. Mini-hairpin primers and ASAP analysis significantly increased detection of polymorphic DNA, separating closely related bermudagrass (Cynodon) cultivars and detecting putatively linked markers in bulked segregant analysis of the soybean (Glycine max) supernodulation (nitrate-tolerant symbiosis) locus.

  12. Family-specific vs. universal PCR primers for the study of mitochondrial DNA in plants

    Directory of Open Access Journals (Sweden)

    Aleksić Jelena M.

    2016-01-01

    Full Text Available Mitochondrial genomes (mtDNAs or mitogenomes of seed plants are characterized by a notoriously unstable organization on account of which available so-called universal or consensus primers may fail to fulfil their foreseen function - amplification of various mtDNA regions in a broad range of plant taxa. Thus, the primers developed for groups assumed to have similar organization of their mitogenomes, such as families, may facilitate a broader usage of more variable non-coding portions of these genomes in group members. Using in silico PCR method and six available complete mitogenomes of Fabaceae, it has been demonstrated that only three out of 36 published universal primer and three Medicago sativa-specific primer pairs that amplify various mtDNA regions are suitable for six representatives of the Fabaceae family upon minor modifications, and develop 21 Fabaceae-specific primer pairs for amplification of all 14 cis-splicing introns in genes of NADH subunits (nad genes which represent the most commonly used non-coding mtDNA regions in various studies in plants. Using the same method and six available complete mitogenomes of representatives of related families Cucurbitaceae, Euphorbiaceae and Rosaceae and a model plant, Arabidopsis thaliana, it has further been demonstrated that applicability of newly developed primer pairs for amplification of nad introns in more or less related taxa was dependent not only on species evolutionary distances but also on their genome sizes. A reported set of 24 primer pairs is a valuable resource which may facilitate a broader usage of mtDNA variability in future studies at both intra- and inter-specific levels in Fabaceae, which is the third largest family of flowering plants rarely studied at the mtDNA level, and in other more or less related taxa. [Projekat Ministarstva nauke Republike Srbije, br. 173005

  13. [Design of primers to DNA of lactic acid bacteria].

    Science.gov (United States)

    Lashchevskiĭ, V V; Kovalenko, N K

    2003-01-01

    Primers LP1-LP2 to the gene 16S rRNA have been developed, which permit to differentiate lactic acid bacteria: Lactobacillus plantarum, L. delbrueckii subsp. bulgaricus and Streptococcus salivarius subsp. thermophilus. The strain-specific and species-specific differentiations are possible under different annealing temperature. Additional fragments, which are synthesized outside the framework of gene 16S rRNA reading, provide for the strain-specific type of differentiation, and the fragment F864 read in the gene 16S rRNA permits identifying L. plantarum.

  14. N-terminal domains of human DNA polymerase lambda promote primer realignment during translesion DNA synthesis

    Science.gov (United States)

    Taggart, David J.; Dayeh, Daniel M.; Fredrickson, Saul W.; Suo, Zucai

    2014-01-01

    The X-family DNA polymerases λ (Polλ) and β (Polβ) possess similar 5′-2-deoxyribose-5-phosphatelyase (dRPase) and polymerase domains. Besides these domains, Polλ also possesses a BRCA1 C-terminal (BRCT) domain and a proline-rich domain at its N terminus. However, it is unclear how these non-enzymatic domains contribute to the unique biological functions of Polλ. Here, we used primer extension assays and a newly developed high-throughput short oligonucleotide sequencing assay (HT-SOSA) to compare the efficiency of lesion bypass and fidelity of human Polβ, Polλ and two N-terminal deletion constructs of Polλ during the bypass of either an abasic site or a 8-oxo-7,8-dihydro-2′-deoxyguanosine (8-oxodG) lesion. We demonstrate that the BRCT domain of Polλ enhances the efficiency of abasic site bypass by approximately 1.6-fold. In contrast, deletion of the N-terminal domains of Polλ did not affect the efficiency of 8-oxodG bypass relative to nucleotide incorporations opposite undamaged dG. HT-SOSA analysis demonstrated that Polλ and Polβ preferentially generated −1 or −2 frameshift mutations when bypassing an abasic site and the single or double base deletion frequency was highly sequence dependent. Interestingly, the BRCT and proline-rich domains of Polλ cooperatively promoted the generation of −2 frameshift mutations when the abasic site was situated within a sequence context that was susceptible to homology-driven primer realignment. Furthermore, both N-terminal domains of Polλ increased the generation of −1 frameshift mutations during 8-oxodG bypass and influenced the frequency of substitution mutations produced by Polλ opposite the 8-oxodG lesion. Overall, our data support a model wherein the BRCT and proline-rich domains of Polλ act cooperatively to promote primer/template realignment between DNA strands of limited sequence homology. This function of the N-terminal domains may facilitate the role of Polλ as a gap-filling polymerase

  15. 3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.

    Science.gov (United States)

    Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong

    2008-09-01

    We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.

  16. Amplification of marine methanotrophic enrichment DNA with 16S rDNA PCR primers for type II alpha proteobacteria methanotrophs.

    Science.gov (United States)

    Rockne, Karl J; Strand, Stuart E

    2003-09-01

    Type II alpha proteobacteria methanotrophs are capable of a wide range of cometabolic transformations of chlorinated solvents and polycyclic aromatic hydrocarbons (PAHs), and this activity has been exploited in many terrestrial bioremediation systems. However, at present, all known obligately marine methanotrophic isolates are Type I gamma proteobacteria which do not have this activity to the extent of Type II methanotrophs. In previous work in our laboratory, determining the presence of Type II alpha proteobacteria methanotrophs in marine enrichment cultures that co-metabolized PAHs required a more sensitive assay. 16S rDNA PCR primers were designed based on oligonucleotide probes for serine pathway methanotrophs and serine pathway methylotrophs with an approximate amplification fragment size of 870 base pairs. Comparison of the primers using double primer BLAST searches in established nucleotide databases showed potential amplification with all Methylocystis and Methylosinus spp., as well as potential amplification with Methylocella palustrus. DNA from Methylosinus trichosporium OB3b, a Type II methanotroph, amplified with the primers with a fragment size of approximately 850 base pairs, whereas DNA extracted from Methylomonas methanica, a Type I methanotroph, did not. The primers were used to amplify DNA extracted from two marine methanotrophic enrichment cultures: a low nitrogen/low copper enrichment to select for Type II methanotrophs and a high nitrogen/high copper enrichment to select for Type I methanotrophs. Although DNA from both cultures amplified with the PCR primers, amplification was stronger in cultures that were specifically enriched for Type II methanotrophs, suggesting the presence of higher numbers of Type II methanotrophs. These results provide further evidence for the existence of Type II marine methanotrophs, suggesting the possibility of exploiting cometabolic activity in marine systems.

  17. Molecular Basis for DNA Double-Strand Break Annealing and Primer Extension by an NHEJ DNA Polymerase

    Directory of Open Access Journals (Sweden)

    Nigel C. Brissett

    2013-11-01

    Full Text Available Nonhomologous end-joining (NHEJ is one of the major DNA double-strand break (DSB repair pathways. The mechanisms by which breaks are competently brought together and extended during NHEJ is poorly understood. As polymerases extend DNA in a 5′-3′ direction by nucleotide addition to a primer, it is unclear how NHEJ polymerases fill in break termini containing 3′ overhangs that lack a primer strand. Here, we describe, at the molecular level, how prokaryotic NHEJ polymerases configure a primer-template substrate by annealing the 3′ overhanging strands from opposing breaks, forming a gapped intermediate that can be extended in trans. We identify structural elements that facilitate docking of the 3′ ends in the active sites of adjacent polymerases and reveal how the termini act as primers for extension of the annealed break, thus explaining how such DSBs are extended in trans. This study clarifies how polymerases couple break-synapsis to catalysis, providing a molecular mechanism to explain how primer extension is achieved on DNA breaks.

  18. Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

    DEFF Research Database (Denmark)

    Balcells, Ingrid; Cirera Salicio, Susanna; Busk, Peter K.

    2011-01-01

    BACKGROUND: MicroRNAs are important regulators of gene expression at the post-transcriptional level and play an important role in many biological processes. Due to the important biological role it is of great interest to quantitatively determine their expression level in different biological...... be designed with a success rate of 94%. The method was able to quantify synthetic templates over eight orders of magnitude and readily discriminated between microRNAs with single nucleotide differences. Importantly, PCR with DNA primers yielded significantly higher amplification efficiencies of biological...... samples than a similar method based on locked nucleic acids-spiked primers, which is in agreement with the observation that locked nucleic acid interferes with efficient amplification of short templates. The higher amplification efficiency of DNA primers translates into higher sensitivity and precision...

  19. Nonspecific amplification of human DNA by Streptococcus pneumoniae LytA primer

    Directory of Open Access Journals (Sweden)

    Helen Hencida Thangamony

    2018-01-01

    Full Text Available Background: Determination of various analytical parameters is essential for the validation of primers used for in-house nucleic acid amplification tests. While standardising a high-resolution melt analysis (HRMA for detection of Streptococcus pneumoniae in acute pyogenic meningitis, we encountered non-specific amplification of certain base pair sequences of human DNA by Centers for Disease Control & Prevention, USA recommended S. pneumoniae LytA primer. Materials and Methods: HRMA was standardised using DNA extracted from an ATCC strain of S. pneumoniae using SP LytA F373 primer and Type-it HRMTM polymerase chain reaction kit in Rotor-Gene Q Thermal Cycler according to the manufacturer's instructions. Specificity of the primers was determined in dry and wet laboratory experiments against diverse related and unrelated microbial pathogens by HRMA and on DNA extracted from unspiked clinical samples negative for SP DNA. Sensitivity was determined by calculating lower limit of detection threshold in experiments with spiked samples. The amplicon from spiked experiments was sequenced and analysed through Gene Bank. Results: Our dry/wet laboratory experiments showed two separate curves and different Tm values indicating certain non-specific amplification by the primer. Basic Local Alignment Search Tool (BLAST analysis of the amplicon obtained in the spiked experiment showed sequences of human chromosome 20 associated with Homo sapiens protein tyrosine phosphatase, receptor type T gene. The problem was resolved by stopping the reaction at 30th Ct cycle and observing the Tm values. Conclusion: Since HRMA is done without a specific probe, one should be aware of non-specific amplifications while using primers for HRMA of human clinical samples.

  20. Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.

    Science.gov (United States)

    Françoso, E; Arias, M C

    2013-09-01

    Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.

  1. Optimization of β-glucan synthase gene primers for molecular DNA fingerprinting in Pleurotus pulmonarious

    Science.gov (United States)

    Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen

    2015-09-01

    Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.

  2. One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes.

    Science.gov (United States)

    Stielow, J B; Lévesque, C A; Seifert, K A; Meyer, W; Iriny, L; Smits, D; Renfurm, R; Verkley, G J M; Groenewald, M; Chaduli, D; Lomascolo, A; Welti, S; Lesage-Meessen, L; Favel, A; Al-Hatmi, A M S; Damm, U; Yilmaz, N; Houbraken, J; Lombard, L; Quaedvlieg, W; Binder, M; Vaas, L A I; Vu, D; Yurkov, A; Begerow, D; Roehl, O; Guerreiro, M; Fonseca, A; Samerpitak, K; van Diepeningen, A D; Dolatabadi, S; Moreno, L F; Casaregola, S; Mallet, S; Jacques, N; Roscini, L; Egidi, E; Bizet, C; Garcia-Hermoso, D; Martín, M P; Deng, S; Groenewald, J Z; Boekhout, T; de Beer, Z W; Barnes, I; Duong, T A; Wingfield, M J; de Hoog, G S; Crous, P W; Lewis, C T; Hambleton, S; Moussa, T A A; Al-Zahrani, H S; Almaghrabi, O A; Louis-Seize, G; Assabgui, R; McCormick, W; Omer, G; Dukik, K; Cardinali, G; Eberhardt, U; de Vries, M; Robert, V

    2015-12-01

    The aim of this study was to assess potential candidate gene regions and corresponding universal primer pairs as secondary DNA barcodes for the fungal kingdom, additional to ITS rDNA as primary barcode. Amplification efficiencies of 14 (partially) universal primer pairs targeting eight genetic markers were tested across > 1 500 species (1 931 strains or specimens) and the outcomes of almost twenty thousand (19 577) polymerase chain reactions were evaluated. We tested several well-known primer pairs that amplify: i) sections of the nuclear ribosomal RNA gene large subunit (D1-D2 domains of 26/28S); ii) the complete internal transcribed spacer region (ITS1/2); iii) partial β -tubulin II (TUB2); iv) γ-actin (ACT); v) translation elongation factor 1-α (TEF1α); and vi) the second largest subunit of RNA-polymerase II (partial RPB2, section 5-6). Their PCR efficiencies were compared with novel candidate primers corresponding to: i) the fungal-specific translation elongation factor 3 (TEF3); ii) a small ribosomal protein necessary for t-RNA docking; iii) the 60S L10 (L1) RP; iv) DNA topoisomerase I (TOPI); v) phosphoglycerate kinase (PGK); vi) hypothetical protein LNS2; and vii) alternative sections of TEF1α. Results showed that several gene sections are accessible to universal primers (or primers universal for phyla) yielding a single PCR-product. Barcode gap and multi-dimensional scaling analyses revealed that some of the tested candidate markers have universal properties providing adequate infra- and inter-specific variation that make them attractive barcodes for species identification. Among these gene sections, a novel high fidelity primer pair for TEF1α, already widely used as a phylogenetic marker in mycology, has potential as a supplementary DNA barcode with superior resolution to ITS. Both TOPI and PGK show promise for the Ascomycota, while TOPI and LNS2 are attractive for the Pucciniomycotina, for which universal primers for ribosomal subunits often fail.

  3. Comparison between Mt-DNA D-Loop and Cyt B primers for porcine DNA detection in meat products

    Science.gov (United States)

    Hamzah, Azhana; Mutalib, Sahilah Abd.; Babji, Abdul Salam

    2013-11-01

    This study was conducted to detect the presence of porcine DNA in meat products in the market using conventional polymerase chain reaction (PCR) and commercial PCR-southern hybridization analysis. Porcine DNA detection in meat products was tested due to some issues associated with the adulteration of food products in Malaysia. This is an important issue especially for Halal authentication which is required for some religious practices such as in Islam and Hinduisms. Many techniques have been developed for determining the Halal status of food products. In this paper, mt-DNA D-loop primer and cytochrome (cyt) b were used to detect the presence of porcine DNA in meat products. Positive and negative controls were always present for each batch of extraction. DNA of raw pork meat was used as a positive control while nucleus free water is used as negative control. A pair of oligonucleotide primer was used namely Pork1 and Pork2 which produced amplicon of 531 base pair (bp) in size. While, PCR-southern hybridization was conducted using primers readily supplied by commercial PCR-Southern hybridization and produced amplicon with 276 bp in size. In the present study, demonstrated that none of the samples were contaminated with porcine residuals but selected samples with pork meat were positive. The species-specific PCR amplification yielded excellent results for identification of pork derivatives in food products and it is a potentially reliable and suitable technique in routine food analysis for Halal certification.

  4. Primer-Independent DNA Synthesis by a Family B DNA Polymerase from Self-Replicating Mobile Genetic Elements

    Directory of Open Access Journals (Sweden)

    Modesto Redrejo-Rodríguez

    2017-11-01

    Full Text Available Family B DNA polymerases (PolBs play a central role during replication of viral and cellular chromosomes. Here, we report the discovery of a third major group of PolBs, which we denote primer-independent PolB (piPolB, that might be a link between the previously known protein-primed and RNA/DNA-primed PolBs. PiPolBs are encoded by highly diverse mobile genetic elements, pipolins, integrated in the genomes of diverse bacteria and also present as circular plasmids in mitochondria. Biochemical characterization showed that piPolB displays efficient DNA polymerization activity that can use undamaged and damaged templates and is endowed with proofreading and strand displacement capacities. Remarkably, the protein is also capable of template-dependent de novo DNA synthesis, i.e., DNA-priming activity, thereby breaking the long-standing dogma that replicative DNA polymerases require a pre-existing primer for DNA synthesis. We suggest that piPolBs are involved in self-replication of pipolins and may also contribute to bacterial DNA damage tolerance.

  5. Triazole-linked DNA as a primer surrogate in the synthesis of first-strand cDNA.

    Science.gov (United States)

    Fujino, Tomoko; Yasumoto, Ken-ichi; Yamazaki, Naomi; Hasome, Ai; Sogawa, Kazuhiro; Isobe, Hiroyuki

    2011-11-04

    A phosphate-eliminated nonnatural oligonucleotide serves as a primer surrogate in reverse transcription reaction of mRNA. Despite of the nonnatural triazole linkages in the surrogate, the reverse transcriptase effectively elongated cDNA sequences on the 3'-downstream of the primer by transcription of the complementary sequence of mRNA. A structure-activity comparison with the reference natural oligonucleotides shows the superior priming activity of the surrogate containing triazole-linkages. The nonnatural linkages also protect the transcribed cDNA from digestion reactions with 5'-exonuclease and enable us to remove noise transcripts of unknown origins. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Detection and typing of human papillomavirus in archival cervical cancer specimens by DNA amplification with consensus primers

    NARCIS (Netherlands)

    RESNICK, R. M.; Cornelissen, M. T.; WRIGHT, D. K.; EICHINGER, G. H.; FOX, H. S.; ter Schegget, J.; MANOS, M. M.

    1990-01-01

    We developed a polymerase chain reaction DNA amplification system using two distinct consensus oligonucleotide primer sets for the improved detection and typing of a broad spectrum of human genital papillomavirus (HPV) sequences, including those of novel viruses. The system incorporates one primer

  7. A two primers random amplified polymorphic DNA procedure to obtain polymerase chain reaction fingerprints of bacterial species.

    Science.gov (United States)

    Rivas, R; Velázquez, E; Valverde, A; Mateos, P F; Martínez-Molina, E

    2001-04-01

    Polymerase chain reation (PCR) fingerprints are used to characterize and recognize bacteria and are generally obtained using universal primers that generate an array of DNA amplicons, which can be separated by electrophoresis. Universal primers 8F and 1491 R have been used to amplify specifically 16S rDNA. We have used these primers at an annealing temperature of 50 degrees C. Agarose gel electrophoresis of PCR products revealed several bands. The band pattern of each bacterial species was different and the strains belonging to the same species shared an identical pattern. The patterns obtained did not show variations with plasmid DNA content or the growth stage of the bacteria. The peculiarity of the randomly amplified polymorphic DNA (RAPD) described in this work lies in the use of two large primers (proximately 20 nt) to obtain the pattern, since normally a only smaller primer is used, and in the new application for the primers used to amplify 16S rDNA. This new procedure, called two primers (TP)-RAPD fingerprinting, is thus rapid, sensitive, reliable, highly reproducible and suitable for experiments with a large number of microorganisms, and can be applied to bacterial taxonomy, ecological studies and for the detection of new bacterial species.

  8. Back to basics – the influence of DNA extraction and primer choice on phylogenetic analysis in activated sludge communities

    DEFF Research Database (Denmark)

    Albertsen, Mads; Karst, Søren Michael; Ziegler, Anja Sloth

    intensity and primer choice on the observed community using 16S rDNA amplicon sequencing. Quantitative fluorescence in situ hybridization (qFISH) was used as a DNA extraction independent method to evaluate the results. The bead beating intensity correlated with cell-wall strength and showed...... that the manufacture recommended settings were insufficient to retrieve a large part of the community. In addition, the in silico “best” primer set was found to greatly underestimate a number of important phyla when compared to qFISH results. The findings underline the need for sample specific and DNA extraction...

  9. A set of primers for analyzing chloroplast DNA diversity in Citrus and related genera.

    Science.gov (United States)

    Cheng, Yunjiang; de Vicente, M Carmen; Meng, Haijun; Guo, Wenwu; Tao, Nengguo; Deng, Xiuxin

    2005-06-01

    Chloroplast simple sequence repeat (cpSSR) markers in Citrus were developed and used to analyze chloroplast diversity of Citrus and closely related genera. Fourteen cpSSR primer pairs from the chloroplast genomes of tobacco (Nicotiana tabacum L.) and Arabidopsis were found useful for analyzing the Citrus chloroplast genome (cpDNA) and recoded with the prefix SPCC (SSR Primers for Citrus Chloroplast). Eleven of the 14 primer pairs revealed some degree of polymorphism among 34 genotypes of Citrus, Fortunella, Poncirus and some of their hybrids, with polymorphism information content (PIC) values ranging from 0.057 to 0.732, and 18 haplotypes were identified. The cpSSR data were analyzed with NTSYS-pc software, and the genetic relationships suggested by the unweighted pair group method based on arithmetic means (UPGMA) dendrogram were congruent with previous taxonomic investigations: the results showed that all samples fell into seven major clusters, i.e., Citrus medica L., Poncirus, Fortunella, C. ichangensis Blanco, C. reticulata Swingle, C. aurantifolia (Christm.) Swingle and C. grandis (L.) Osbeck. The results of previous studies combined with our cpSSR analyses revealed that: (1) Calamondin (C. madurensis Swingle) is the result of hybridization between kumquat (Fortunella) and mandarin (C. reticulata), where kumquat acted as the female parent; (2) Ichang papeda (C. ichangensis) has a unique taxonomic status; and (3) although Bendiguangju mandarin (C. reticulata) and Satsuma mandarin (C. reticulata) are similar in fruit shape and leaf morphology, they have different maternal parents. Bendiguangju mandarin has the same cytoplasm as sweet orange (C. sinensis), whereas Satsuma mandarin has the cytoplasm of C. reticulata. Seventeen PCR products from SPCC1 and 21 from SPCC11 were cloned and sequenced. The results revealed that mononucleotide repeats as well as insertions and deletions of small segments of DNA were associated with SPCC1 polymorphism, whereas polymorphism

  10. MSP-HTPrimer: a high-throughput primer design tool to improve assay design for DNA methylation analysis in epigenetics.

    Science.gov (United States)

    Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas

    2016-01-01

    Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic

  11. Development of Prevotella intermedia-specific PCR primers based on the nucleotide sequences of a DNA probe Pig27.

    Science.gov (United States)

    Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki

    2011-03-01

    The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.

  12. Back to Basics – The Influence of DNA Extraction and Primer Choice on Phylogenetic Analysis of Activated Sludge Communities

    DEFF Research Database (Denmark)

    Albertsen, Mads; Karst, Søren Michael; Ziegler, Anja Sloth

    2015-01-01

    the impact of a number of parameters on the observed microbial community: bead beating intensity, primer choice, extracellular DNA removal, and various PCR settings. In total, 176 samples were subjected to 16S rRNA amplicon sequencing, and selected samples were investigated throughmetagenomics...... and metatranscriptomics. Quantitative fluorescence in situ hybridization was used as a DNA extraction-independent method for qualitative comparison. In general, an effect on the observed community was found on all parameters tested, although bead beating and primer choice had the largest effect. The effect of bead...

  13. Enzymatic primer-extension with glycerol-nucleoside triphosphates on DNA templates.

    Directory of Open Access Journals (Sweden)

    Jesse J Chen

    Full Text Available BACKGROUND: Glycerol nucleic acid (GNA has an acyclic phosphoglycerol backbone repeat-unit, but forms stable duplexes based on Watson-Crick base-pairing. Because of its structural simplicity, GNA is of particular interest with respect to the possibility of evolving functional polymers by in vitro selection. Template-dependent GNA synthesis is essential to any GNA-based selection system. PRINCIPAL FINDINGS: In this study, we investigated the ability of various DNA polymerases to use glycerol-nucleoside triphosphates (gNTPs as substrates for GNA synthesis on DNA templates. Therminator DNA polymerase catalyzes quantitative primer-extension by the incorporation of two glyceronucleotides, with much less efficient extension up to five glyceronucleotides. Steady-state kinetic experiments suggested that GNA synthesis by Therminator was affected by both decreased catalytic rates and weakened substrate binding, especially for pyrimidines. In an attempt to improve pyrimidine incorporation by providing additional stacking interactions, we synthesized two new gNTP analogs with 5-propynyl substituted pyrimidine nucleobases. This led to more efficient incorporation of gC, but not gT. CONCLUSIONS: We suggest that directed evolution of Therminator might lead to mutants with improved substrate binding and catalytic efficiency.

  14. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong; Qian, Pei-Yuan

    2009-01-01

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions

  15. Inhibition of non-templated nucleotide addition by DNA polymerases in primer extension using twisted intercalating nucleic acid modified templates

    Czech Academy of Sciences Publication Activity Database

    Güixens-Gallardo, Pedro; Hocek, Michal; Perlíková, Pavla

    2016-01-01

    Roč. 26, č. 2 (2016), s. 288-291 ISSN 0960-894X R&D Projects: GA ČR GBP206/12/G151 Institutional support: RVO:61388963 Keywords : DNA polymerases * nucleotide addition * primer extension * oligonucleotides * twisted intercalating nucleic acid Subject RIV: CC - Organic Chemistry Impact factor: 2.454, year: 2016

  16. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong

    2009-10-09

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

  17. Universal and blocking primer mismatches limit the use of high-throughput DNA sequencing for the quantitative metabarcoding of arthropods.

    Science.gov (United States)

    Piñol, J; Mir, G; Gomez-Polo, P; Agustí, N

    2015-07-01

    The quantification of the biological diversity in environmental samples using high-throughput DNA sequencing is hindered by the PCR bias caused by variable primer-template mismatches of the individual species. In some dietary studies, there is the added problem that samples are enriched with predator DNA, so often a predator-specific blocking oligonucleotide is used to alleviate the problem. However, specific blocking oligonucleotides could coblock nontarget species to some degree. Here, we accurately estimate the extent of the PCR biases induced by universal and blocking primers on a mock community prepared with DNA of twelve species of terrestrial arthropods. We also compare universal and blocking primer biases with those induced by variable annealing temperature and number of PCR cycles. The results show that reads of all species were recovered after PCR enrichment at our control conditions (no blocking oligonucleotide, 45 °C annealing temperature and 40 cycles) and high-throughput sequencing. They also show that the four factors considered biased the final proportions of the species to some degree. Among these factors, the number of primer-template mismatches of each species had a disproportionate effect (up to five orders of magnitude) on the amplification efficiency. In particular, the number of primer-template mismatches explained most of the variation (~3/4) in the amplification efficiency of the species. The effect of blocking oligonucleotide concentration on nontarget species relative abundance was also significant, but less important (below one order of magnitude). Considering the results reported here, the quantitative potential of the technique is limited, and only qualitative results (the species list) are reliable, at least when targeting the barcoding COI region. © 2014 John Wiley & Sons Ltd.

  18. TREHALOSE-BASED ADDITIVE IMPROVED INTER-PRIMER BINDING SITE REACTIONS FOR DNA ISOLATED FROM RECALCITRANT PLANTS

    Directory of Open Access Journals (Sweden)

    Veronika Lancíková

    2014-02-01

    Full Text Available Trehalose-based (TBT-PAR additive was tested in order to optimize PCR amplification for DNA isolated from recalcitrant plants. Retrotransposon-based inter-primer binding site reactions were significantly improved with TBT-PAR solution using genomic DNA isolated from flax (Linum usitatissimum L., genotypes Kyivskyi, Bethune grown in radio-contaminated and non-radioactive remediated Chernobyl experimental fields. Additionally, similar improvements were observed using 19 recalcitrant genotypes of maize (Zea mays L. and three genotypes of yacon (Smallanthus sonchifolius, Poepp. et Endl., genotypes PER05, ECU45, BOL22 grown in standard field conditions.

  19. Fluorescent quenching-based quantitative detection of specific DNA/RNA using a BODIPY® FL-labeled probe or primer

    Science.gov (United States)

    Kurata, Shinya; Kanagawa, Takahiro; Yamada, Kazutaka; Torimura, Masaki; Yokomaku, Toyokazu; Kamagata, Yoichi; Kurane, Ryuichiro

    2001-01-01

    We have developed a simple method for the quantitative detection of specific DNA or RNA molecules based on the finding that BODIPY® FL fluorescence was quenched by its interaction with a uniquely positioned guanine. This approach makes use of an oligonucleotide probe or primer containing a BODIPY® FL-modified cytosine at its 5′-end. When such a probe was hybridized with a target DNA, its fluorescence was quenched by the guanine in the target, complementary to the modified cytosine, and the quench rate was proportional to the amount of target DNA. This widely applicable technique will be used directly with larger samples or in conjunction with the polymerase chain reaction to quantify small DNA samples. PMID:11239011

  20. Simultaneous identification and DNA barcoding of six Eimeria species infecting turkeys using PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus.

    Science.gov (United States)

    Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R

    2015-05-01

    Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.

  1. Optimized mtDNA Control Region Primer Extension Capture Analysis for Forensically Relevant Samples and Highly Compromised mtDNA of Different Age and Origin

    Directory of Open Access Journals (Sweden)

    Mayra Eduardoff

    2017-09-01

    Full Text Available The analysis of mitochondrial DNA (mtDNA has proven useful in forensic genetics and ancient DNA (aDNA studies, where specimens are often highly compromised and DNA quality and quantity are low. In forensic genetics, the mtDNA control region (CR is commonly sequenced using established Sanger-type Sequencing (STS protocols involving fragment sizes down to approximately 150 base pairs (bp. Recent developments include Massively Parallel Sequencing (MPS of (multiplex PCR-generated libraries using the same amplicon sizes. Molecular genetic studies on archaeological remains that harbor more degraded aDNA have pioneered alternative approaches to target mtDNA, such as capture hybridization and primer extension capture (PEC methods followed by MPS. These assays target smaller mtDNA fragment sizes (down to 50 bp or less, and have proven to be substantially more successful in obtaining useful mtDNA sequences from these samples compared to electrophoretic methods. Here, we present the modification and optimization of a PEC method, earlier developed for sequencing the Neanderthal mitochondrial genome, with forensic applications in mind. Our approach was designed for a more sensitive enrichment of the mtDNA CR in a single tube assay and short laboratory turnaround times, thus complying with forensic practices. We characterized the method using sheared, high quantity mtDNA (six samples, and tested challenging forensic samples (n = 2 as well as compromised solid tissue samples (n = 15 up to 8 kyrs of age. The PEC MPS method produced reliable and plausible mtDNA haplotypes that were useful in the forensic context. It yielded plausible data in samples that did not provide results with STS and other MPS techniques. We addressed the issue of contamination by including four generations of negative controls, and discuss the results in the forensic context. We finally offer perspectives for future research to enable the validation and accreditation of the PEC MPS

  2. Novel primer specific false terminations during DNA sequencing reactions: danger of inaccuracy of mutation analysis in molecular diagnostics

    Science.gov (United States)

    Anwar, R; Booth, A; Churchill, A J; Markham, A F

    1996-01-01

    The determination of nucleotide sequence is fundamental to the identification and molecular analysis of genes. Direct sequencing of PCR products is now becoming a commonplace procedure for haplotype analysis, and for defining mutations and polymorphism within genes, particularly for diagnostic purposes. A previously unrecognised phenomenon, primer related variability, observed in sequence data generated using Taq cycle sequencing and T7 Sequenase sequencing, is reported. This suggests that caution is necessary when interpreting DNA sequence data. This is particularly important in situations where treatment may be dependent on the accuracy of the molecular diagnosis. Images PMID:16696096

  3. Development and validation of an rDNA operon based primer walking strategy applicable to de novo bacterial genome finishing.

    Directory of Open Access Journals (Sweden)

    Alexander William Eastman

    2015-01-01

    Full Text Available Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing

  4. RPA physically interacts with the human DNA glycosylase NEIL1 to regulate excision of oxidative DNA base damage in primer-template structures.

    Science.gov (United States)

    Theriot, Corey A; Hegde, Muralidhar L; Hazra, Tapas K; Mitra, Sankar

    2010-06-04

    The human DNA glycosylase NEIL1, activated during the S-phase, has been shown to excise oxidized base lesions in single-strand DNA substrates. Furthermore, our previous work demonstrating functional interaction of NEIL1 with PCNA and flap endonuclease 1 (FEN1) suggested its involvement in replication-associated repair. Here we show interaction of NEIL1 with replication protein A (RPA), the heterotrimeric single-strand DNA binding protein that is essential for replication and other DNA transactions. The NEIL1 immunocomplex isolated from human cells contains RPA, and its abundance in the complex increases after exposure to oxidative stress. NEIL1 directly interacts with the large subunit of RPA (K(d) approximately 20 nM) via the common interacting interface (residues 312-349) in NEIL1's disordered C-terminal region. RPA inhibits the base excision activity of both wild-type NEIL1 (389 residues) and its C-terminal deletion CDelta78 mutant (lacking the interaction domain) for repairing 5-hydroxyuracil (5-OHU) in a primer-template structure mimicking the DNA replication fork. This inhibition is reduced when the damage is located near the primer-template junction. Contrarily, RPA moderately stimulates wild-type NEIL1 but not the CDelta78 mutant when 5-OHU is located within the duplex region. While NEIL1 is inhibited by both RPA and Escherichia coli single-strand DNA binding protein, only inhibition by RPA is relieved by PCNA. These results showing modulation of NEIL1's activity on single-stranded DNA substrate by RPA and PCNA support NEIL1's involvement in repairing the replicating genome. Copyright 2010 Elsevier B.V. All rights reserved.

  5. Primer and barcode gap identification and DNA barcode generation for species discrimination in plants

    OpenAIRE

    Deepu Mathew

    2015-01-01

    This book chapter details the protocols for DNA barcoding in plants, starting from DNA isolation, sequencing, sequence annotation using MEGA, till identification of barcode gaps. A good chapter for beginners in plant taxonomy

  6. Reverse transcription using random pentadecamer primers increases yield and quality of resulting cDNA

    DEFF Research Database (Denmark)

    Stangegaard, Michael; Dufva, I.H.; Dufva, Hans Martin

    2006-01-01

    oligonucleotides (pentadecamers) consistently, yielded at least 2 fold as much cDNA as did random hexamers using either-poly(A) RNA or an amplified version of messenger RNA (aRNA) as a template. The cDNA generated using pentadecamers did not differ in size distribution or the amount of incorporated label compared...... with cDNA generated with random hexamers. The increased efficiency of priming using random pentadecamers resulted in reverse transcription of > 80% of the template aRNA, while random hexamers induced reverse transcription of only 40% of the template aRNA. This suggests a better coverage...... that random pentadecamers can replace random hexamers in reverse transcription reactions on both poly(A) RNA and amplified RNA, resulting in higher cDNA yields and quality....

  7. An Undergraduate Laboratory Experiment for Upper-Level Forensic Science, Biochemistry, or Molecular Biology Courses: Human DNA Amplification Using STR Single Locus Primers by Real-Time PCR with SYBR Green Detection

    Science.gov (United States)

    Elkins, Kelly M.; Kadunc, Raelynn E.

    2012-01-01

    In this laboratory experiment, real-time polymerase chain reaction (real-time PCR) was conducted using published human TPOX single-locus DNA primers for validation and various student-designed short tandem repeat (STR) primers for Combined DNA Index System (CODIS) loci. SYBR Green was used to detect the amplification of the expected amplicons. The…

  8. A need for standardization in drinking water analysis – an investigation of DNA extraction procedure, primer choice and detection limit of 16S rRNA amplicon sequencing

    DEFF Research Database (Denmark)

    Brandt, Jakob; Nielsen, Per Halkjær; Albertsen, Mads

    have been made to illuminate the effects specifically related to bacterial communities in drinking water. In this study, we investigated the impact of the DNA extraction and primer choice on the observed community structure, and we also estimated the detection limit of the 16S rRNA amplicon sequencing...

  9. Development and evaluation of specific PCR primers targeting the ribosomal DNA-internal transcribed spacer (ITS) region of peritrich ciliates in environmental samples

    Science.gov (United States)

    Su, Lei; Zhang, Qianqian; Gong, Jun

    2017-07-01

    Peritrich ciliates are highly diverse and can be important bacterial grazers in aquatic ecosystems. Morphological identifications of peritrich species and assemblages in the environment are time-consuming and expertise-demanding. In this study, two peritrich-specific PCR primers were newly designed to amplify a fragment including the internal transcribed spacer (ITS) region of ribosomal rDNA from environmental samples. The primers showed high specificity in silico, and in tests with peritrich isolates and environmental DNA. Application of these primers in clone library construction and sequencing yielded exclusively sequences of peritrichs for water and sediment samples. We also found the ITS1, ITS2, ITS, D1 region of 28S rDNA, and ITS+D1 region co-varied with, and generally more variable than, the V9 region of 18S rDNA in peritrichs. The newly designed specific primers thus provide additional tools to study the molecular diversity, community composition, and phylogeography of these ecologically important protists in different systems.

  10. A set of 100 chloroplast DNA primer pairs to study population genetics and phylogeny in monocotylenons

    DEFF Research Database (Denmark)

    Scarcelli, Nora; Bernaud, Adeline; Eiserhardt, Wolf L.

    2011-01-01

    Chloroplast DNA sequences are of great interest for population genetics and phylogenetic studies. However, only a small set of markers are commonly used. Most of them have been designed for amplification in a large range of Angiosperms and are located in the Large Single Copy (LSC). Here we...... anticipate that it will also be useful for phylogeny and bar-coding studies....

  11. Mapping of gene transcripts by nuclease protection assays and cDNA primer extension

    International Nuclear Information System (INIS)

    Calzone, F.J.; Britten, R.J.; Davidson, E.J.

    1987-01-01

    An important problem often faced in the molecular characterization of genes is the precise mapping of those genomic sequences transcribed into RNA. This requires identification of the genomic site initiating gene transcription, the location of genomic sequences removed from the primary gene transcript during RNA processing, and knowledge of sequences terminating the processed gene transcript. The objective of the protocols described here is the generation of transcription maps utilizing relatively uncharacterized gene fragments. The basic approach is hybridization of a single-stranded DNA probe with cellular RNA, followed by treatment with a single-strand-specific nuclease that does not attack DNA-RNA hybrids, in order to destroy any unreacted probe sequences. Thus the probe sequences included in the hybrid duplexes are protected from nuclease digestion. The sizes of the protected probe fragments determined by gel electrophoresis correspond to the lengths of the hybridized sequence elements

  12. The Mini-Chromosome Maintenance (Mcm) Complexes Interact with DNA Polymerase α-Primase and Stimulate Its Ability to Synthesize RNA Primers

    Science.gov (United States)

    You, Zhiying; De Falco, Mariarosaria; Kamada, Katsuhiko; Pisani, Francesca M.; Masai, Hisao

    2013-01-01

    The Mini-chromosome maintenance (Mcm) proteins are essential as central components for the DNA unwinding machinery during eukaryotic DNA replication. DNA primase activity is required at the DNA replication fork to synthesize short RNA primers for DNA chain elongation on the lagging strand. Although direct physical and functional interactions between helicase and primase have been known in many prokaryotic and viral systems, potential interactions between helicase and primase have not been explored in eukaryotes. Using purified Mcm and DNA primase complexes, a direct physical interaction is detected in pull-down assays between the Mcm2∼7 complex and the hetero-dimeric DNA primase composed of the p48 and p58 subunits. The Mcm4/6/7 complex co-sediments with the primase and the DNA polymerase α-primase complex in glycerol gradient centrifugation and forms a Mcm4/6/7-primase-DNA ternary complex in gel-shift assays. Both the Mcm4/6/7 and Mcm2∼7 complexes stimulate RNA primer synthesis by DNA primase in vitro. However, primase inhibits the Mcm4/6/7 helicase activity and this inhibition is abolished by the addition of competitor DNA. In contrast, the ATP hydrolysis activity of Mcm4/6/7 complex is not affected by primase. Mcm and primase proteins mutually stimulate their DNA-binding activities. Our findings indicate that a direct physical interaction between primase and Mcm proteins may facilitate priming reaction by the former protein, suggesting that efficient DNA synthesis through helicase-primase interactions may be conserved in eukaryotic chromosomes. PMID:23977294

  13. The mini-chromosome maintenance (Mcm complexes interact with DNA polymerase α-primase and stimulate its ability to synthesize RNA primers.

    Directory of Open Access Journals (Sweden)

    Zhiying You

    Full Text Available The Mini-chromosome maintenance (Mcm proteins are essential as central components for the DNA unwinding machinery during eukaryotic DNA replication. DNA primase activity is required at the DNA replication fork to synthesize short RNA primers for DNA chain elongation on the lagging strand. Although direct physical and functional interactions between helicase and primase have been known in many prokaryotic and viral systems, potential interactions between helicase and primase have not been explored in eukaryotes. Using purified Mcm and DNA primase complexes, a direct physical interaction is detected in pull-down assays between the Mcm2~7 complex and the hetero-dimeric DNA primase composed of the p48 and p58 subunits. The Mcm4/6/7 complex co-sediments with the primase and the DNA polymerase α-primase complex in glycerol gradient centrifugation and forms a Mcm4/6/7-primase-DNA ternary complex in gel-shift assays. Both the Mcm4/6/7 and Mcm2~7 complexes stimulate RNA primer synthesis by DNA primase in vitro. However, primase inhibits the Mcm4/6/7 helicase activity and this inhibition is abolished by the addition of competitor DNA. In contrast, the ATP hydrolysis activity of Mcm4/6/7 complex is not affected by primase. Mcm and primase proteins mutually stimulate their DNA-binding activities. Our findings indicate that a direct physical interaction between primase and Mcm proteins may facilitate priming reaction by the former protein, suggesting that efficient DNA synthesis through helicase-primase interactions may be conserved in eukaryotic chromosomes.

  14. Phylogenetic Analysis and Molecular Characterization of Xanthium sibiricum Using DNA Barcoding, PCR-RFLP, and Specific Primers.

    Science.gov (United States)

    Tomasello, Salvatore; Heubl, Günther

    2017-07-01

    The fruits of Xanthium sibiricum have been widely used in traditional Chinese medicine for the treatment of nasal sinusitis and headaches. The genus Xanthium (cocklebur) is a taxonomically complex genus. Different taxonomic concepts have been proposed, some including several species, others lumping the different taxa in a few extremely polymorphic species. Due to the morphological similarities between species, the correct authentication of X. sibiricum is very difficult. Therefore, we established a polymerase chain reaction-restriction fragment length polymorphism method and diagnostic PCR based on nuclear internal transcribed spacer and chloroplast trnQ-rps16 barcodes to differentiate X. sibirium from related species.Results from the phylogenetic analyses based on sequence information from four marker regions (plastidal psbA-trnH and trnQ-rps16 and nuclear ITS and D35 ) support those taxonomic concepts accepting a reduced number of species, as four to five major clades are revealed in the phylogenetic reconstructions. X. sibiricum , together with some accessions from closely related taxa, is always supported as monophyletic, constituting a well-defined genetic entity. Allele-specific primer pairs for ITS and trnQ-rps16 were designed to amplify diagnostic products from the genomic DNA of X. sibiricum . Specific PCR in combination with digestion using the restriction enzyme Mse I allowed for the identification of X. sibiricum by producing specific restriction patterns. The results demonstrate that the applied techniques provide effective and accurate authentication of X. sibiricum . Georg Thieme Verlag KG Stuttgart · New York.

  15. Opening the treasure chest: A DNA-barcoding primer set for most higher taxa of Central European birds and mammals from museum collections.

    Directory of Open Access Journals (Sweden)

    Sylvia Schäffer

    Full Text Available DNA-barcoding is a rapidly developing method for efficiently identifying samples to species level by means of short standard DNA sequences. However, reliable species assignment requires the availability of a comprehensive DNA barcode reference library, and hence numerous initiatives aim at generating such barcode databases for particular taxa or geographic regions. Historical museum collections represent a potentially invaluable source for the DNA-barcoding of many taxa. This is particularly true for birds and mammals, for which collecting fresh (voucher material is often very difficult to (nearly impossible due to the special animal welfare and conservation regulations that apply to vertebrates in general, and birds and mammals in particular. Moreover, even great efforts might not guarantee sufficiently complete sampling of fresh material in a short period of time. DNA extracted from historical samples is usually degraded, such that only short fragments can be amplified, rendering the recovery of the barcoding region as a single fragment impossible. Here, we present a new set of primers that allows the efficient amplification and sequencing of the entire barcoding region in most higher taxa of Central European birds and mammals in six overlapping fragments, thus greatly increasing the value of historical museum collections for generating DNA barcode reference libraries. Applying our new primer set in recently established NGS protocols promises to further increase the efficiency of barcoding old bird and mammal specimens.

  16. MethPrimer: designing primers for methylation PCRs.

    Science.gov (United States)

    Li, Long-Cheng; Dahiya, Rajvir

    2002-11-01

    DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.

  17. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    reaction (PCR), oligo hybridization and DNA sequencing. Proper primer design is actually one of the most important factors/steps in successful DNA sequencing. Various bioinformatics programs are available for selection of primer pairs from a template sequence. The plethora programs for PCR primer design reflects the.

  18. Can DNA-Based Ecosystem Assessments Quantify Species Abundance? Testing Primer Bias and Biomass--Sequence Relationships with an Innovative Metabarcoding Protocol.

    Directory of Open Access Journals (Sweden)

    Vasco Elbrecht

    Full Text Available Metabarcoding is an emerging genetic tool to rapidly assess biodiversity in ecosystems. It involves high-throughput sequencing of a standard gene from an environmental sample and comparison to a reference database. However, no consensus has emerged regarding laboratory pipelines to screen species diversity and infer species abundances from environmental samples. In particular, the effect of primer bias and the detection limit for specimens with a low biomass has not been systematically examined, when processing samples in bulk. We developed and tested a DNA metabarcoding protocol that utilises the standard cytochrome c oxidase subunit I (COI barcoding fragment to detect freshwater macroinvertebrate taxa. DNA was extracted in bulk, amplified in a single PCR step, and purified, and the libraries were directly sequenced in two independent MiSeq runs (300-bp paired-end reads. Specifically, we assessed the influence of specimen biomass on sequence read abundance by sequencing 31 specimens of a stonefly species with known haplotypes spanning three orders of magnitude in biomass (experiment I. Then, we tested the recovery of 52 different freshwater invertebrate taxa of similar biomass using the same standard barcoding primers (experiment II. Each experiment was replicated ten times to maximise statistical power. The results of both experiments were consistent across replicates. We found a distinct positive correlation between species biomass and resulting numbers of MiSeq reads. Furthermore, we reliably recovered 83% of the 52 taxa used to test primer bias. However, sequence abundance varied by four orders of magnitudes between taxa despite the use of similar amounts of biomass. Our metabarcoding approach yielded reliable results for high-throughput assessments. However, the results indicated that primer efficiency is highly species-specific, which would prevent straightforward assessments of species abundance and biomass in a sample. Thus, PCR

  19. First large-scale DNA barcoding assessment of reptiles in the biodiversity hotspot of Madagascar, based on newly designed COI primers.

    Science.gov (United States)

    Nagy, Zoltán T; Sonet, Gontran; Glaw, Frank; Vences, Miguel

    2012-01-01

    DNA barcoding of non-avian reptiles based on the cytochrome oxidase subunit I (COI) gene is still in a very early stage, mainly due to technical problems. Using a newly developed set of reptile-specific primers for COI we present the first comprehensive study targeting the entire reptile fauna of the fourth-largest island in the world, the biodiversity hotspot of Madagascar. Representatives of the majority of Madagascan non-avian reptile species (including Squamata and Testudines) were sampled and successfully DNA barcoded. The new primer pair achieved a constantly high success rate (72.7-100%) for most squamates. More than 250 species of reptiles (out of the 393 described ones; representing around 64% of the known diversity of species) were barcoded. The average interspecific genetic distance within families ranged from a low of 13.4% in the Boidae to a high of 29.8% in the Gekkonidae. Using the average genetic divergence between sister species as a threshold, 41-48 new candidate (undescribed) species were identified. Simulations were used to evaluate the performance of DNA barcoding as a function of completeness of taxon sampling and fragment length. Compared with available multi-gene phylogenies, DNA barcoding correctly assigned most samples to species, genus and family with high confidence and the analysis of fewer taxa resulted in an increased number of well supported lineages. Shorter marker-lengths generally decreased the number of well supported nodes, but even mini-barcodes of 100 bp correctly assigned many samples to genus and family. The new protocols might help to promote DNA barcoding of reptiles and the established library of reference DNA barcodes will facilitate the molecular identification of Madagascan reptiles. Our results might be useful to easily recognize undescribed diversity (i.e. novel taxa), to resolve taxonomic problems, and to monitor the international pet trade without specialized expert knowledge.

  20. First Large-Scale DNA Barcoding Assessment of Reptiles in the Biodiversity Hotspot of Madagascar, Based on Newly Designed COI Primers

    Science.gov (United States)

    Nagy, Zoltán T.; Sonet, Gontran; Glaw, Frank; Vences, Miguel

    2012-01-01

    Background DNA barcoding of non-avian reptiles based on the cytochrome oxidase subunit I (COI) gene is still in a very early stage, mainly due to technical problems. Using a newly developed set of reptile-specific primers for COI we present the first comprehensive study targeting the entire reptile fauna of the fourth-largest island in the world, the biodiversity hotspot of Madagascar. Methodology/Principal Findings Representatives of the majority of Madagascan non-avian reptile species (including Squamata and Testudines) were sampled and successfully DNA barcoded. The new primer pair achieved a constantly high success rate (72.7–100%) for most squamates. More than 250 species of reptiles (out of the 393 described ones; representing around 64% of the known diversity of species) were barcoded. The average interspecific genetic distance within families ranged from a low of 13.4% in the Boidae to a high of 29.8% in the Gekkonidae. Using the average genetic divergence between sister species as a threshold, 41–48 new candidate (undescribed) species were identified. Simulations were used to evaluate the performance of DNA barcoding as a function of completeness of taxon sampling and fragment length. Compared with available multi-gene phylogenies, DNA barcoding correctly assigned most samples to species, genus and family with high confidence and the analysis of fewer taxa resulted in an increased number of well supported lineages. Shorter marker-lengths generally decreased the number of well supported nodes, but even mini-barcodes of 100 bp correctly assigned many samples to genus and family. Conclusions/Significance The new protocols might help to promote DNA barcoding of reptiles and the established library of reference DNA barcodes will facilitate the molecular identification of Madagascan reptiles. Our results might be useful to easily recognize undescribed diversity (i.e. novel taxa), to resolve taxonomic problems, and to monitor the international pet trade

  1. Typing of multiple single-nucleotide polymorphisms using ribonuclease cleavage of DNA/RNA chimeric single-base extension primers and detection by MALDI-TOF mass spectrometry

    DEFF Research Database (Denmark)

    Mengel-From, Jonas; Sanchez Sanchez, Juan Jose; Børsting, Claus

    2005-01-01

    A novel single-base extension (SBE) assay using cleavable and noncleavable SBE primers in the same reaction mix is described. The cleavable SBE primers consisted of deoxyribonucleotides and one ribonucleotide (hereafter denoted chimeric primers), whereas the noncleavable SBE primers consisted....... A ribonuclease mix was developed to specifically cleave the chimeric primers, irrespective of the base of the ribonucleotide, whereas standard primers without a ribonucleotide were unaffected by the ribonuclease treatment. The SBE products were analyzed in linear mode using a matrix-assisted laser desorption...... containing 9 chimeric primers and 8 standard primers....

  2. Use of reiterative primer extension methodology to map UV-induced photoproducts at the nucleotide level in the laci gene from genomic DNA

    International Nuclear Information System (INIS)

    Chandrasekhar, D.; Houten, B. Van

    1994-01-01

    A newly developed reiterative primer extension assay has been employed to examine photoproduct formation and repair at the nucleotide level. Analysis of UV-induced DNA photoproduct hotspots in the first 184 base pairs of the laci genes of genomic E. coli DNA has revealed that photoproducts are formed linearly with dose and display a sequence-dependent increase. Generally, pyrimdine dimers were twice as frequent as all other UV-induced photoproducts. However, specific sites showed differing distributions. A post-irradiation recovery period revealed differences in the repair efficiency at individual nucleotides. Repair of photoproducts on the transcribed strand was generally twice as efficient as repair of photoproducts on the nontranscribed strand, indicating that strand-specific DNA repair occurs in the constitutively transcribed laci gene of E. coli. The UV-induced DNA photoproduct distribution following repair was well correlated with an established UV-induced mutation spectrum for wild-type E. coli cells. This analysis revealed that photoproduct hotspots on the efficiently repaired transcribed strand did not correlate with mutagenic hotspots. These data strongly support the hypothesis that mutations arise at inefficiently repaired sites on the nontranscribed strand

  3. Identification of fungal DNA barcode targets and PCR primers based on Pfam protein families and taxonomic hierarchy

    NARCIS (Netherlands)

    Lewis, C.T.; Bilkhu, S.; Robert, V.; Eberhardt, U.; Szoke, S.; Seifert, K.A.; Lévesque, C.A.

    2011-01-01

    Abstract: DNA barcoding is the application of DNA sequences of standardized genetic markers for the identification of eukaryotic organisms. We attempted to identify alternative candidate barcode gene targets for the fungal biota from available fungal genomes using a taxonomy-aware processing

  4. Use of arbitrary DNA primers, polyacrylamide gel electrophoresis and silver staining for identity testing, gene discovery and analysis of gene expression

    International Nuclear Information System (INIS)

    Gresshoff, P.

    1998-01-01

    To understand chemically-induced genomic differences in soybean mutants differing in their ability to enter the nitrogen-fixing symbiosis involving Bradyrhizobium japonicum, molecular techniques were developed to aid the map-based, or positional, cloning. DNA marker technology involving single arbitrary primers was used to enrich regional RFLP linkage data. Molecular techniques, including two-dimensional pulse field gel electrophoresis, were developed to ascertain the first physical mapping in soybean, leading to the conclusion that in the region of marker pA-36 on linkage group H, 1 cM equals about 500 cM. High molecular weight DNA was isolated and cloned into yeast or bacterial artificial chromosomes (YACs/ BACs). YACs were used to analyze soybean genome structure, revealing that over half of the genome contains repetitive DNA. Genetic and molecular tools are now available to facilitate the isolation of plant genes directly involved in symbiosis. The further characterization of these genes, along with the determination of the mechanisms that lead to the mutation, will be of value to other plants and induced mutation research. (author)

  5. Accessibility of. gamma. -ray induced primer toward DNA polymerase I of Escherichia coli during soaking of barley seed

    Energy Technology Data Exchange (ETDEWEB)

    Yamaguchi, H; Tatara, A; Naito, T [Tokyo Univ. (Japan). Faculty of Agriculture

    1976-09-01

    After dry barley seeds were irradiated with ..gamma..-rays and soaked for various times, the squashed preparations were made of the first leaf meristems and incubated with E.coli DNA polymerase I with appropriate substrates. The incorporation of nucleotides with DNA polymerase occurred in the cells fixed at late G/sub 1/ after 15 kR and at middle and late G/sub 1/ after 30 kR, respectively. There was an interrelation between the incorporation of nucleotides by DNA polymerase and the chromatin diffusion throughout a nucleus. The observations were interpreted in terms of the accessibility of 3'-0H groups of DNA breaks which accompanies the change of the conformation of chromatin fibres.

  6. PHUSER (Primer Help for USER): a novel tool for USER fusion primer design

    DEFF Research Database (Denmark)

    Olsen, Lars Rønn; Hansen, Niels Bjørn; Bonde, Mads

    2011-01-01

    containing a customizable USER cassette. Designing primers using PHUSER ensures that the primers have similar annealing temperature (Tm), which is essential for efficient PCR. PHUSER also avoids identical overhangs, thereby ensuring correct order of assembly of DNA fragments. All possible primers...

  7. UniPrimer: A Web-Based Primer Design Tool for Comparative Analyses of Primate Genomes

    Directory of Open Access Journals (Sweden)

    Nomin Batnyam

    2012-01-01

    Full Text Available Whole genome sequences of various primates have been released due to advanced DNA-sequencing technology. A combination of computational data mining and the polymerase chain reaction (PCR assay to validate the data is an excellent method for conducting comparative genomics. Thus, designing primers for PCR is an essential procedure for a comparative analysis of primate genomes. Here, we developed and introduced UniPrimer for use in those studies. UniPrimer is a web-based tool that designs PCR- and DNA-sequencing primers. It compares the sequences from six different primates (human, chimpanzee, gorilla, orangutan, gibbon, and rhesus macaque and designs primers on the conserved region across species. UniPrimer is linked to RepeatMasker, Primer3Plus, and OligoCalc softwares to produce primers with high accuracy and UCSC In-Silico PCR to confirm whether the designed primers work. To test the performance of UniPrimer, we designed primers on sample sequences using UniPrimer and manually designed primers for the same sequences. The comparison of the two processes showed that UniPrimer was more effective than manual work in terms of saving time and reducing errors.

  8. Next-Generation DNA Sequencing of VH/VL Repertoires: A Primer and Guide to Applications in Single-Domain Antibody Discovery.

    Science.gov (United States)

    Henry, Kevin A

    2018-01-01

    Immunogenetic analyses of expressed antibody repertoires are becoming increasingly common experimental investigations and are critical to furthering our understanding of autoimmunity, infectious disease, and cancer. Next-generation DNA sequencing (NGS) technologies have now made it possible to interrogate antibody repertoires to unprecedented depths, typically by sequencing of cDNAs encoding immunoglobulin variable domains. In this chapter, we describe simple, fast, and reliable methods for producing and sequencing multiplex PCR amplicons derived from the variable regions (V H , V H H or V L ) of rearranged immunoglobulin heavy and light chain genes using the Illumina MiSeq platform. We include complete protocols and primer sets for amplicon sequencing of V H /V H H/V L repertoires directly from human, mouse, and llama lymphocytes as well as from phage-displayed V H /V H H/V L libraries; these can be easily be adapted to other types of amplicons with little modification. The resulting amplicons are diverse and representative, even using as few as 10 3 input B cells, and their generation is relatively inexpensive, requiring no special equipment and only a limited set of primers. In the absence of heavy-light chain pairing, single-domain antibodies are uniquely amenable to NGS analyses. We present a number of applications of NGS technology useful in discovery of single-domain antibodies from phage display libraries, including: (i) assessment of library functionality; (ii) confirmation of desired library randomization; (iii) estimation of library diversity; and (iv) monitoring the progress of panning experiments. While the case studies presented here are of phage-displayed single-domain antibody libraries, the principles extend to other types of in vitro display libraries.

  9. Tools for Ultraspecific Probe/Primer Design

    National Research Council Canada - National Science Library

    Fofanov, Yurly

    2006-01-01

    .... Our approach will deliver DNA probes and PCR primers that have an unprecedentedly low probability of false positives or confusion by environmental background, and which resist evasion by threat agent engineering...

  10. MRI Primer

    International Nuclear Information System (INIS)

    Oldendorf, W.; Oldendorf, W. Jr.

    1991-01-01

    Designed for studies, radiologists, and clinicians at all levels of training, this book provides a basic introduction to the principles, physics, and instrumentation of magnetic resonance imaging. The fundamental concepts that are essential for the optimal clinical use of MRI are thoroughly explained in easily accessible terms. To facilitate the reader's comprehension, the material is presented nonmathematically, using no equations and a minimum of symbols and abbreviations. MRI Primer presents a clear account of the phenomenon of nuclear magnetic resonance and the use of gradient magnetic fields to create clinically useful images of cross-sectional slices. Close attention is given to the magnetization vector as a means of expressing nuclear behavior, the role of T 1 and T 2 weighing in imaging, the use of contrast agents, and the pulse sequences most often used in clinical practice, as well as to the relative capabilities and limitations of MRI and CT. The basic hardware components of an MRI scanner are described in detail. Sample MRI scans illustrate how MRI characterizes tissue. An appendix provides a brief introduction to quantum processes in MRI

  11. Variation in extragenic repetitive DNA sequences in Pseudomonas syringae and potential use of modified REP primers in the identification of closely related isolates

    Directory of Open Access Journals (Sweden)

    Elif Çepni

    2012-01-01

    Full Text Available In this study, Pseudomonas syringe pathovars isolated from olive, tomato and bean were identified by species-specific PCR and their genetic diversity was assessed by repetitive extragenic palindromic (REP-PCR. Reverse universal primers for REP-PCR were designed by using the bases of A, T, G or C at the positions of 1, 4 and 11 to identify additional polymorphism in the banding patterns. Binding of the primers to different annealing sites in the genome revealed additional fingerprint patterns in eight isolates of P. savastanoi pv. savastanoi and two isolates of P. syringae pv. tomato. The use of four different bases in the primer sequences did not affect the PCR reproducibility and was very efficient in revealing intra-pathovar diversity, particularly in P. savastanoi pv. savastanoi. At the pathovar level, the primer BOX1AR yielded shared fragments, in addition to five bands that discriminated among the pathovars P. syringae pv. phaseolicola, P. savastanoi pv. savastanoi and P. syringae pv. tomato. REP-PCR with a modified primer containing C produced identical bands among the isolates in a pathovar but separated three pathovars more distinctly than four other primers. Although REP-and BOX-PCRs have been successfully used in the molecular identification of Pseudomonas isolates from Turkish flora, a PCR based on inter-enterobacterial repetitive intergenic concensus (ERIC sequences failed to produce clear banding patterns in this study.

  12. Primer3_masker: integrating masking of template sequence with primer design software.

    Science.gov (United States)

    Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido

    2018-06-01

    Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.

  13. MPprimer: a program for reliable multiplex PCR primer design

    Directory of Open Access Journals (Sweden)

    Wang Xiaolei

    2010-03-01

    Full Text Available Abstract Background Multiplex PCR, defined as the simultaneous amplification of multiple regions of a DNA template or multiple DNA templates using more than one primer set (comprising a forward primer and a reverse primer in one tube, has been widely used in diagnostic applications of clinical and environmental microbiology studies. However, primer design for multiplex PCR is still a challenging problem and several factors need to be considered. These problems include mis-priming due to nonspecific binding to non-target DNA templates, primer dimerization, and the inability to separate and purify DNA amplicons with similar electrophoretic mobility. Results A program named MPprimer was developed to help users for reliable multiplex PCR primer design. It employs the widely used primer design program Primer3 and the primer specificity evaluation program MFEprimer to design and evaluate the candidate primers based on genomic or transcript DNA database, followed by careful examination to avoid primer dimerization. The graph-expanding algorithm derived from the greedy algorithm was used to determine the optimal primer set combinations (PSCs for multiplex PCR assay. In addition, MPprimer provides a virtual electrophotogram to help users choose the best PSC. The experimental validation from 2× to 5× plex PCR demonstrates the reliability of MPprimer. As another example, MPprimer is able to design the multiplex PCR primers for DMD (dystrophin gene which caused Duchenne Muscular Dystrophy, which has 79 exons, for 20×, 20×, 20×, 14×, and 5× plex PCR reactions in five tubes to detect underlying exon deletions. Conclusions MPprimer is a valuable tool for designing specific, non-dimerizing primer set combinations with constrained amplicons size for multiplex PCR assays.

  14. Development of SCAR marker specific to non-toxic Jatropha curcas L. and designing a novel multiplexing PCR along with nrDNA ITS primers to circumvent the false negative detection

    KAUST Repository

    Mastan, Shaik G.

    2011-05-10

    Jatropha curcas L., a multipurpose shrub, has acquired significant economic importance for its seed oil which can be converted to biodiesel an emerging alternative to petro-diesel. In addition to the commercial value, it is also having medicinal and even high nutritional value to use as animal fodder which is limited due to the toxicity. Development of molecular marker will enable to differentiate non-toxic from toxic variety of J. curcas in a mixed population and also for quality control since the toxic components of J. curcas has deleterious effect on animals. In the present study, the efforts were made to generate the specific SCAR marker for toxic and/or non-toxic J. curcas from RAPD markers. Among the markers specific for toxic and non-toxic varieties, four were selected, purified, cloned, sequenced, and designed primers out of which one set of primers NT-JC/SCAR I/OPQ15-F and R could able to discriminate the non-toxic with toxic Jatropha by giving expected 430 bp size amplification in non-toxic variety. Furthermore, novel multiplex PCR was designed using the nrDNA ITS primers to overcome the false negatives. Present work also demonstrates utility of the conserved regions of nrDNA coding genes in ruling out the artifacts in PCR-like false negatives frequently occur in SCAR due to various reasons. The specific SCAR markers generated in the present investigation will help to distinguish non-toxic from toxic varieties of J. curcas or vice versa, and isolated marker along with designed multiplex protocol has applications in quality control for selective cultivation of non-toxic variety and will also assist in breeding and molecular mapping studies. © 2011 Springer Science+Business Media, LLC.

  15. Polyacid macromolecule primers

    Science.gov (United States)

    Sugama, Toshifumi.

    1989-12-26

    Hydrophilic polyacids are described, such as macromolecules of polyitaconic acid and polyacrylic acid, where such macromolecules have molecular weights >50,000 as primers between a polymeric top coating, such as polyurethane, and an oxidized aluminum or aluminum alloy. A near monolayer of primer is used in polymeric adhesive/oxidized aluminum adhered joint systems in 0.05% primer concentration to give superior results in standard peel tests. 2 figs.

  16. An iterative method for selecting degenerate multiplex PCR primers.

    Science.gov (United States)

    Souvenir, Richard; Buhler, Jeremy; Stormo, Gary; Zhang, Weixiong

    2007-01-01

    Single-nucleotide polymorphism (SNP) genotyping is an important molecular genetics process, which can produce results that will be useful in the medical field. Because of inherent complexities in DNA manipulation and analysis, many different methods have been proposed for a standard assay. One of the proposed techniques for performing SNP genotyping requires amplifying regions of DNA surrounding a large number of SNP loci. To automate a portion of this particular method, it is necessary to select a set of primers for the experiment. Selecting these primers can be formulated as the Multiple Degenerate Primer Design (MDPD) problem. The Multiple, Iterative Primer Selector (MIPS) is an iterative beam-search algorithm for MDPD. Theoretical and experimental analyses show that this algorithm performs well compared with the limits of degenerate primer design. Furthermore, MIPS outperforms an existing algorithm that was designed for a related degenerate primer selection problem.

  17. Development of techniques using DNA analysis method for detection/analysis of radiation-induced mutation. Development of an useful probe/primer and improvement of detection efficacy

    International Nuclear Information System (INIS)

    Maekawa, Hideaki; Tsuchida, Kozo; Hashido, Kazuo; Takada, Naoko; Kameoka, Yosuke; Hirata, Makoto

    1999-01-01

    Previously, it was demonstrated that detection of centromere became easy and reliable through fluorescent staining by FISH method using a probe of the sequence preserved in α-satelite DNA. Since it was, however, found inappropriate to detect dicentrics based on the relative amount of DNA probe on each chromosome. A prove which allows homogeneous detection of α-satelite DNA for each chromosome was constructed. A presumed sequence specific to kinetochore, CENP-B box was amplified by PCR method and the product DNA was used as a probe. However, the variation in amounts of probe DNA among chromosomes was decreased by only about 20%. Then, a program for image processing of the results obtained from FISH using α-satelite DNA was constructed to use as a marker for centromere. When compared with detection of abnormal chromosomes stained by the conventional method, calculation efficacy for only detection of centromere was improved by the use of this program. Calculation to discriminate the normal or not was still complicated and the detection efficacy was little improved. Chromosomal abnormalities in lymphocytes were used to detect the effects of radiation. In this method, it is needed to shift the phase of cells into metaphase. The mutation induced by radiation might be often repaired during shifting. To exclude this possibility, DNA extraction was conducted at a low temperature and immediately after exposure to 137 Cs, and a rapid genome detection method was established using the genome DNA. As the model genomes, the following three were used: 1) long chain repeated sequences widely dispersed over chromosome, 2) cluster genes, 3) single copy genes. The effects of radiation were detectable at 1-2 Gy for the long repeated sequences and at 7 Gy for the cluster genes, respectively, whereas no significant effects were observed at any Gy tested for the single copy genes. Amplification was marked in the cells exposed at 1-10 Gy (peak at 4 Gy), suggesting that these regions had

  18. Storage conditions of blood samples and primer selection affect the yield of cDNA polymerase chain reaction products of hepatitis C virus

    NARCIS (Netherlands)

    Cuypers, H. T.; Bresters, D.; Winkel, I. N.; Reesink, H. W.; Weiner, A. J.; Houghton, M.; van der Poel, C. L.; Lelie, P. N.

    1992-01-01

    We have noticed that suboptimal specimen processing and storage conditions may cause false-negative results in the detection of hepatitis C virus (HCV) RNA in plasma or serum. To establish the influence of specimen handling in a serological laboratory on the rate of detection of HCV RNA by the cDNA

  19. Quick spacecraft charging primer

    International Nuclear Information System (INIS)

    Larsen, Brian Arthur

    2014-01-01

    This is a presentation in PDF format which is a quick spacecraft charging primer, meant to be used for program training. It goes into detail about charging physics, RBSP examples, and how to identify charging.

  20. Nanotechnology: A Policy Primer

    Science.gov (United States)

    2013-06-24

    savings in the United States of 24 million barrels of oil.4 • Universal access to clean water. Nanotechnology water desalination and filtration...CRS Report for Congress Prepared for Members and Committees of Congress Nanotechnology : A Policy Primer John F. Sargent Jr. Specialist...COVERED 00-00-2013 to 00-00-2013 4. TITLE AND SUBTITLE Nanotechnology : A Policy Primer 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT

  1. Primers for phylogeny reconstruction in Bignonieae (Bignoniaceae) using herbarium samples.

    Science.gov (United States)

    Zuntini, Alexandre R; Fonseca, Luiz Henrique M; Lohmann, Lúcia G

    2013-09-01

    New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. • Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. • The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  2. Primers for Phylogeny Reconstruction in Bignonieae (Bignoniaceae Using Herbarium Samples

    Directory of Open Access Journals (Sweden)

    Alexandre R. Zuntini

    2013-08-01

    Full Text Available Premise of the study: New primers were developed for Bignonieae to enable phylogenetic studies within this clade using herbarium samples. Methods and Results: Internal primers were designed based on available sequences of the plastid ndhF gene and the rpl32-trnL intergenic spacer region, and the nuclear gene PepC. The resulting primers were used to amplify DNA extracted from herbarium materials. High-quality data were obtained from herbarium samples up to 53 yr old. Conclusions: The standardized methodology allows the inclusion of herbarium materials as alternative sources of DNA for phylogenetic studies in Bignonieae.

  3. Cross-kingdom amplification using bacteria-specific primers: complications for studies of coral microbial ecology.

    Science.gov (United States)

    Galkiewicz, Julia P; Kellogg, Christina A

    2008-12-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  4. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

    OpenAIRE

    Galkiewicz, Julia P.; Kellogg, Christina A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.

  5. Cross-Kingdom Amplification Using Bacteria-Specific Primers: Complications for Studies of Coral Microbial Ecology▿

    Science.gov (United States)

    Galkiewicz, Julia P.; Kellogg, Christina A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299

  6. Cloning-free template DNA preparation for cell-free protein synthesis via two-step PCR using versatile primer designs with short 3'-UTR.

    Science.gov (United States)

    Nomoto, Mika; Tada, Yasuomi

    2018-01-01

    Cell-free protein synthesis (CFPS) systems largely retain the endogenous translation machinery of the host organism, making them highly applicable for proteomics analysis of diverse biological processes. However, laborious and time-consuming cloning procedures hinder progress with CFPS systems. Herein, we report the development of a rapid and efficient two-step polymerase chain reaction (PCR) method to prepare linear DNA templates for a wheat germ CFPS system. We developed a novel, effective short 3'-untranslated region (3'-UTR) sequence that facilitates translation. Application of the short 3'-UTR to two-step PCR enabled the generation of various transcription templates from the same plasmid, including fusion proteins with N- or C-terminal tags, and truncated proteins. Our method supports the cloning-free expression of target proteins using an mRNA pool from biological material. The established system is a highly versatile platform for in vitro protein synthesis using wheat germ CFPS. © 2017 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.

  7. The Los Alamos primer

    CERN Document Server

    Serber, Robert

    2018-01-01

    Unabridged declassified value reproduction of The Los Alamos Primer by Robert Serber, in full color with all censor markings. This is the booklet given to new workers at Los Alamos during World War II, to catch them up on how to build a practical fission bomb. The Primer was driven by Robert Oppenheimer asking his protégé Robert Serber to summarize all knowledge and possible solutions known as of April 1943 in a series of lectures. Serber did such an excellent job that the notes from the series was turned into The Los Alamos Primer. Serber was known as an expert that bridged theory and reality, and so was also chosen to be one of the first Americans to enter Hiroshima and Nagasaki to assess the atomic damage in 1945.

  8. China Energy Primer

    Energy Technology Data Exchange (ETDEWEB)

    Ni, Chun Chun

    2009-11-16

    Based on extensive analysis of the 'China Energy Databook Version 7' (October 2008) this Primer for China's Energy Industry draws a broad picture of China's energy industry with the two goals of helping users read and interpret the data presented in the 'China Energy Databook' and understand the historical evolution of China's energy inustry. Primer provides comprehensive historical reviews of China's energy industry including its supply and demand, exports and imports, investments, environment, and most importantly, its complicated pricing system, a key element in the analysis of China's energy sector.

  9. Cytotoxic and genotoxic evaluation of orthodontic adhesives with primer and without primer exposed to electron beam irradiation - an in-vitro study

    International Nuclear Information System (INIS)

    Ravi, M.S.; Panchasara, Chirag; Vijay, R.; Suchetha Kumari, N.; Sanjeev, Ganesh

    2013-01-01

    To evaluate the in vitro genotoxicity and cytotoxicity of two visible light-cured adhesives. The materials tested were 1. orthodontic adhesive with primer (Transbond XT3M) and 2. Orthodontic adhesive without primer (Heliosit, Ivoclar Vivadent AG), Cured sterile individual masses were exposed to 2 kGy electron beam radiation, both irradiated and non irradiated materials were immersed in Phosphate buffer saline and left at 370℃ for 24 hr. Then a volume of 200 μL of the extract medium was mixed with human peripheral blood lymphocyte tested for comet assay by single cell DNA Damage assay and Apoptosis by DNA diffusion agar assay. Evaluation of cytotoxicity was carried out by Hemolysis assay method. Haemolytic activity of orthodontic adhesive without primer (53.34±3.12) was slightly more than that of orthodontic adhesive with primer (52.9±.88). In case of Apoptosis, adhesive with primer (188.92±55.05) and adhesives without primer (186.75±101.83) showed increased diffusion of DNA compared to normal lymphocyte (111.22±8.78). However the level of DNA diffusion was not significantly different between the two adhesives. Both adhesives were cytotoxic and induced apoptosis. Adhesives without primer were found to be slightly toxic than that of adhesive with primer. Both the adhesives had no significant effect on the percentage of DNA tail and olive tail moment of DNA exposed to electron beam radiation. (author)

  10. Semantic Web Primer

    NARCIS (Netherlands)

    Antoniou, Grigoris; Harmelen, Frank van

    2004-01-01

    The development of the Semantic Web, with machine-readable content, has the potential to revolutionize the World Wide Web and its use. A Semantic Web Primer provides an introduction and guide to this still emerging field, describing its key ideas, languages, and technologies. Suitable for use as a

  11. Defense Primer: DOD Contractors

    Science.gov (United States)

    2017-02-10

    functions, from intelligence analysis or software development to landscaping or food service. Why does DOD use individual contractors? Going back to...that provide professional services, from research to management support. The bulk of contractors—more than 70%—provide products, and these include...10 U.S.C. Part IV: Service, Supply, and Procurement. CRS Products CRS In Focus IF10548, Defense Primer: U.S. Defense Industrial Base, by Daniel

  12. Coal Bed Methane Primer

    Energy Technology Data Exchange (ETDEWEB)

    Dan Arthur; Bruce Langhus; Jon Seekins

    2005-05-25

    During the second half of the 1990's Coal Bed Methane (CBM) production increased dramatically nationwide to represent a significant new source of income and natural gas for many independent and established producers. Matching these soaring production rates during this period was a heightened public awareness of environmental concerns. These concerns left unexplained and under-addressed have created a significant growth in public involvement generating literally thousands of unfocused project comments for various regional NEPA efforts resulting in the delayed development of public and fee lands. The accelerating interest in CBM development coupled to the growth in public involvement has prompted the conceptualization of this project for the development of a CBM Primer. The Primer is designed to serve as a summary document, which introduces and encapsulates information pertinent to the development of Coal Bed Methane (CBM), including focused discussions of coal deposits, methane as a natural formed gas, split mineral estates, development techniques, operational issues, producing methods, applicable regulatory frameworks, land and resource management, mitigation measures, preparation of project plans, data availability, Indian Trust issues and relevant environmental technologies. An important aspect of gaining access to federal, state, tribal, or fee lands involves education of a broad array of stakeholders, including land and mineral owners, regulators, conservationists, tribal governments, special interest groups, and numerous others that could be impacted by the development of coal bed methane. Perhaps the most crucial aspect of successfully developing CBM resources is stakeholder education. Currently, an inconsistent picture of CBM exists. There is a significant lack of understanding on the parts of nearly all stakeholders, including industry, government, special interest groups, and land owners. It is envisioned the Primer would being used by a variety of

  13. Predictive maintenance primer

    International Nuclear Information System (INIS)

    Flude, J.W.; Nicholas, J.R.

    1991-04-01

    This Predictive Maintenance Primer provides utility plant personnel with a single-source reference to predictive maintenance analysis methods and technologies used successfully by utilities and other industries. It is intended to be a ready reference to personnel considering starting, expanding or improving a predictive maintenance program. This Primer includes a discussion of various analysis methods and how they overlap and interrelate. Additionally, eighteen predictive maintenance technologies are discussed in sufficient detail for the user to evaluate the potential of each technology for specific applications. This document is designed to allow inclusion of additional technologies in the future. To gather the information necessary to create this initial Primer the Nuclear Maintenance Applications Center (NMAC) collected experience data from eighteen utilities plus other industry and government sources. NMAC also contacted equipment manufacturers for information pertaining to equipment utilization, maintenance, and technical specifications. The Primer includes a discussion of six methods used by analysts to study predictive maintenance data. These are: trend analysis; pattern recognition; correlation; test against limits or ranges; relative comparison data; and statistical process analysis. Following the analysis methods discussions are detailed descriptions for eighteen technologies analysts have found useful for predictive maintenance programs at power plants and other industrial facilities. Each technology subchapter has a description of the operating principles involved in the technology, a listing of plant equipment where the technology can be applied, and a general description of the monitoring equipment. Additionally, these descriptions include a discussion of results obtained from actual equipment users and preferred analysis techniques to be used on data obtained from the technology. 5 refs., 30 figs

  14. Quantitative Experimental Determination of Primer-Dimer Formation Risk by Free-Solution Conjugate Electrophoresis

    Science.gov (United States)

    Desmarais, Samantha M.; Leitner, Thomas; Barron, Annelise E.

    2012-01-01

    DNA barcodes are short, unique ssDNA primers that “mark” individual biomolecules. To gain better understanding of biophysical parameters constraining primer-dimer formation between primers that incorporate barcode sequences, we have developed a capillary electrophoresis method that utilizes drag-tag-DNA conjugates to quantify dimerization risk between primer-barcode pairs. Results obtained with this unique free-solution conjugate electrophoresis (FSCE) approach are useful as quantitatively precise input data to parameterize computation models of dimerization risk. A set of fluorescently labeled, model primer-barcode conjugates were designed with complementary regions of differing lengths to quantify heterodimerization as a function of temperature. Primer-dimer cases comprised two 30-mer primers, one of which was covalently conjugated to a lab-made, chemically synthesized poly-N-methoxyethylglycine drag-tag, which reduced electrophoretic mobility of ssDNA to distinguish it from ds primer-dimers. The drag-tags also provided a shift in mobility for the dsDNA species, which allowed us to quantitate primer-dimer formation. In the experimental studies, pairs of oligonucleotide primer-barcodes with fully or partially complementary sequences were annealed, and then separated by free-solution conjugate CE at different temperatures, to assess effects on primer-dimer formation. When less than 30 out of 30 basepairs were bonded, dimerization was inversely correlated to temperature. Dimerization occurred when more than 15 consecutive basepairs formed, yet non-consecutive basepairs did not create stable dimers even when 20 out of 30 possible basepairs bonded. The use of free-solution electrophoresis in combination with a peptoid drag-tag and different fluorophores enabled precise separation of short DNA fragments to establish a new mobility shift assay for detection of primer-dimer formation. PMID:22331820

  15. Real-time colorimetric detection of DNA methylation of the PAX1 gene in cervical scrapings for cervical cancer screening with thiol-labeled PCR primers and gold nanoparticles

    Directory of Open Access Journals (Sweden)

    Huang J

    2016-10-01

    Full Text Available Jin Huang,1,2 Yu-Ligh Liou,1,2 Ya-Nan Kang,3 Zhi-Rong Tan,1,2 Ming-Jing Peng,1,2 Hong-Hao Zhou1,2 1Department of Clinical Pharmacology, Xiangya Hospital, Central South University, 2Institute of Clinical Pharmacology, Hunan Key Laboratory of Pharmacogenetics, Central South University, 3Department of Obstetrics and Gynecology, Xiangya Hospital, Central South University, Changsha, Hunan, People’s Republic of China Background: DNA methylation can induce carcinogenesis by silencing key tumor suppressor genes. Analysis of aberrant methylation of tumor suppressor genes can be used as a prognostic and predictive biomarker for cancer. In this study, we propose a colorimetric method for the detection of DNA methylation of the paired box gene 1 (PAX1 gene in cervical scrapings obtained from 42 patients who underwent cervical colposcopic biopsy. Methods: A thiolated methylation-specific polymerase chain reaction (MSP primer was used to generate MSP products labeled with the thiol group at one end. After bisulfite conversion and MSP amplification, the unmodified gold nanoparticles (AuNPs were placed in a reaction tube and NaCl was added to induce aggregation of bare AuNPs without generating polymerase chain reaction products. After salt addition, the color of AuNPs remained red in the methylated PAX1 gene samples because of binding to the MSP-amplified products. By contrast, the color of the AuNP colloid solution changed from red to blue in the non-methylated PAX1 gene samples because of aggregation of AuNPs in the absence of the MSP-amplified products. Furthermore, PAX1 methylation was quantitatively detected in cervical scrapings of patients with varied pathological degrees of cervical cancer. Conventional quantitative MSP (qMSP was also performed for comparison. Results: The two methods showed a significant correlation of the methylation frequency of the PAX1 gene in cervical scrapings with severity of cervical cancer (n=42, P<0.05. The results of the

  16. A Quantum Groups Primer

    Science.gov (United States)

    Majid, Shahn

    2002-05-01

    Here is a self-contained introduction to quantum groups as algebraic objects. Based on the author's lecture notes for the Part III pure mathematics course at Cambridge University, the book is suitable as a primary text for graduate courses in quantum groups or supplementary reading for modern courses in advanced algebra. The material assumes knowledge of basic and linear algebra. Some familiarity with semisimple Lie algebras would also be helpful. The volume is a primer for mathematicians but it will also be useful for mathematical physicists.

  17. The R primer

    CERN Document Server

    Ekstrom, Claus Thorn

    2011-01-01

    Newcomers to R are often intimidated by the command-line interface, the vast number of functions and packages, or the processes of importing data and performing a simple statistical analysis. The R Primer provides a collection of concise examples and solutions to R problems frequently encountered by new users of this statistical software.Rather than explore the many options available for every command as well as the ever-increasing number of packages, the book focuses on the basics of data preparation and analysis and gives examples that can be used as a starting point. The numerous examples i

  18. Primer on Health Surveys

    Directory of Open Access Journals (Sweden)

    David L Nordstrom

    2012-06-01

    Full Text Available The aim of this paper is to introduce novice researchers to surveys as a method of data collection. It starts with the definition of a survey, its major purposes and types as well as changes in the goals surveys have helped to achieve over time. Advantages and disadvantages of surveys over population censuses and medical examinations are discussed. Approaches to questionnaire construction are introduced along with properties that questionnaires are evaluated for. Modes of administration, sample size issues, and data analysis approaches are also introduced. The primer is illustrated with examples of surveys conducted in different countries with various public health purposes.

  19. Math primer for engineers

    CERN Document Server

    Cryer, CW

    2014-01-01

    Mathematics and engineering are inevitably interrelated, and this interaction will steadily increase as the use of mathematical modelling grows. Although mathematicians and engineers often misunderstand one another, their basic approach is quite similar, as is the historical development of their respective disciplines. The purpose of this Math Primer is to provide a brief introduction to those parts of mathematics which are, or could be, useful in engineering, especially bioengineering. The aim is to summarize the ideas covered in each subject area without going into exhaustive detail. Formula

  20. Universal primers that amplify RNA from all three flavivirus subgroups

    Directory of Open Access Journals (Sweden)

    Barnard Ross T

    2008-01-01

    Full Text Available Abstract Background Species within the Flavivirus genus pose public health problems around the world. Increasing cases of Dengue and Japanese encephalitis virus in Asia, frequent outbreaks of Yellow fever virus in Africa and South America, and the ongoing spread of West Nile virus throughout the Americas, show the geographical burden of flavivirus diseases. Flavivirus infections are often indistinct from and confused with other febrile illnesses. Here we review the specificity of published primers, and describe a new universal primer pair that can detect a wide range of flaviviruses, including viruses from each of the recognised subgroups. Results Bioinformatic analysis of 257 published full-length Flavivirus genomes revealed conserved regions not previously targeted by primers. Two degenerate primers, Flav100F and Flav200R were designed from these regions and used to generate an 800 base pair cDNA product. The region amplified encoded part of the methyltransferase and most of the RNA-dependent-RNA-polymerase (NS5 coding sequence. One-step RT-PCR testing was successful using standard conditions with RNA from over 60 different flavivirus strains representing about 50 species. The cDNA from each virus isolate was sequenced then used in phylogenetic analyses and database searches to confirm the identity of the template RNA. Conclusion Comprehensive testing has revealed the broad specificity of these primers. We briefly discuss the advantages and uses of these universal primers.

  1. El primer virreinato americano

    Directory of Open Access Journals (Sweden)

    Cassá, Roberto

    2006-12-01

    Full Text Available This article explores the government of viceroy Christopher Columbus in the American territories. We return to the first Spanish settlement in Santo Domingo and the contradictions inherent to this expansionist proyect. The contradictions were part of the logic of the absolutist state and Columbus’ reaction against the controls imposed by the monarchs. Secondly, we look into the dificulties that the Admiral encountered to develop a mercantilist model. In this context, we examine the rationale behind the first government of the Indies and the features that defined the new West Indian society.

    El artículo trata sobre el gobierno de Cristóbal Colón en tierras americanas. Retomamos el tema del primer emplazamiento español en Santo Domingo y las contradicciones que tuvo aquel proyecto debido a la lógica del estado absolutista, a la ambición desmedida del descubridor y a su reacción ante los controles que desde un principio impusieron los monarcas. En un segundo momento analizamos las dificultades que encontró el Almirante para desarrollar un modelo mercantilista acorde a sus ideas y a los acuerdos a que llegó con la Corona. En ese contexto analizamos la lógica del primer gobierno colombinista en las Indias y los rasgos que definieron la nueva sociedad antillana.

  2. Cross-kingdom amplification using Bacteria-specific primers: Complications for studies of coral microbial ecology

    Science.gov (United States)

    Galkiewicz, J.P.; Kellogg, C.A.

    2008-01-01

    PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.

  3. A primer on water

    Science.gov (United States)

    Leopold, Luna Bergere; Langbein, Walter Basil

    1960-01-01

    When you open the faucet you expect water to flow. And you expect it to flow night or day, summer or winter, whether you want to fill a glass or water the lawn. It should be clean and pure, without any odor.You have seen or read about places where the water doesn't have these qualities. You may have lived in a city where you were allowed to water the lawn only during a few hours of certain days. We know a large town where the water turns brown after every big rainstorm.Beginning shortly after World War II, large areas in the Southwestern United States had a 10-year drought, and newspapers published a lot of information about its effects. Some people say that the growing demand for water will cause serious shortages over much of the country in the next 10 to 40 years. But it has always been true that while water wells and springs dry up in some places, floods may be occurring in other places at the same time.Nearly every month news stories are published describing floods somewhere in the country. In fact, every year, on the average, 75,000 persons are forced from their homes by floods. In some years, as in 1951 when the lower Kansas River experienced a great flood, half a million people are affected. To understand the reasons for such recurring distress, it is necessary to know something about rivers and about the flat land or flood plain that borders the river.Interest in water and related problems is growing as our population increases and as the use of water becomes steadily greater. To help meet this heightened interest in general information about water and its use and control is the reason this primer was written. The primer is in two parts. The first part tells about hydrology, or the science that concerns the relation of water to our earth, and the second part describes the development of water supplies and the use of water. The Geological Survey is publishing this primer in nontechnical language in the hope that it will enable the general reader to

  4. Promotion primer. Foerderfibel

    Energy Technology Data Exchange (ETDEWEB)

    1981-01-01

    This revised edition of the promotion primer is to serve as a topical orientation aid for industrial firms, unions, boards and other bodies interested where the actions of governmental R and D and innovation policy are compiled and clearly arranged. It is important for the success of governmental aids that the institutions concerned are informed about all possibilities of the promotion, financing and advisory programme. Beyond the presentation of the research promotion sectors, the fiscal measures and the contractual as well as the joint research this revised edition focussess on the fields of consultative services for innovation and information. For many firms the access to qualified information and guidance is of particular importance. That is why this brochure points out the ways towards governmental research promotion. The BMFT has provided a remarkable contribution to research promotion by establishing information and consultative services for trade and industry.

  5. Metabolomics: A Primer.

    Science.gov (United States)

    Liu, Xiaojing; Locasale, Jason W

    2017-04-01

    Metabolomics generates a profile of small molecules that are derived from cellular metabolism and can directly reflect the outcome of complex networks of biochemical reactions, thus providing insights into multiple aspects of cellular physiology. Technological advances have enabled rapid and increasingly expansive data acquisition with samples as small as single cells; however, substantial challenges in the field remain. In this primer we provide an overview of metabolomics, especially mass spectrometry (MS)-based metabolomics, which uses liquid chromatography (LC) for separation, and discuss its utilities and limitations. We identify and discuss several areas at the frontier of metabolomics. Our goal is to give the reader a sense of what might be accomplished when conducting a metabolomics experiment, now and in the near future. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. A Brief Taxometrics Primer

    Science.gov (United States)

    Beauchaine, Theodore P.

    2009-01-01

    Taxometric procedures provide an empirical means of determining which psychiatric disorders are typologically distinct from normal behavioral functioning. Although most disorders reflect extremes along continuously distributed behavioral traits, identifying those that are discrete has important implications for accurate diagnosis, effective treatment, early identification of risk, and improved understanding of etiology. This article provides (a) brief descriptions of the conceptual bases of several taxometric procedures, (b) example analyses using simulated data, and (c) strategies for avoiding common pitfalls that are often observed in taxometrics research. To date, most taxometrics studies have appeared in the adult psychopathology literature. It is hoped that this primer will encourage interested readers to extend taxometrics research to child and adolescent populations. PMID:18088222

  7. Optimization of ISSR-PCR reaction system and selection of primers in Bryum argenteum

    Directory of Open Access Journals (Sweden)

    Ma Xiaoying

    2017-02-01

    Full Text Available In order to determine optimum ISSR-PCR reaction system for moss Bryum argenteum,the concentrations of template DNA primers,dNTPs,Mg2+ and Taq DNA polymerase were optimized in four levels by PCR orthogonal experimental method. The appropriate primers were screened from 100 primers by temperature gradient PCR,and the optimal anneal temperature of the screened primers were determined. The results showed that the optimized 20 μL ISSR-PCR reaction system was as follows:template DNA 20 ng/20 μL,primers 0.45 μmol/L,Mg2+2.65 mmol/L,Taq DNA polymerase 0.4 U/20 μL,dNTPs 0.45 mmol/L. Using this system,50 primers with clear bands,repeatability well and polymorphism highly were selected from 100 primers. The establishment of this system,the screened primers and the annealing temperature could provide a theoretical basis for further research on the genetic diversity of bryophytes using ISSR molecular markers.

  8. Note: Primer Amysat 001; Fragment size is 211bp

    Indian Academy of Sciences (India)

    Renuka

    Bhandara : Lanes 1–14 represent different strains of Bhandara Ecorace. Note: Primer Amysat 001; Fragment size is 211bp. Fig. 1. SSR profiles generated from genomic DNA of 16 strains from different individuals of (A.L, D. TV, D. BV, Modal, Sukinda, Raily, Bhandara) ecoraces of tasar silk worm, Antheraea mylitta using the.

  9. Primer design for a prokaryotic differential display RT-PCR.

    Science.gov (United States)

    Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

    1997-05-01

    We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

  10. Simple sequence repeat marker loci discovery using SSR primer.

    Science.gov (United States)

    Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David

    2004-06-12

    Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/

  11. Radiation protection primer

    International Nuclear Information System (INIS)

    Aigner, R.; Melzer, E.; Seissler, H.

    1986-01-01

    This 'radiation protection primer' does not pretend to give absolute, final answers to the many questions that have been arising after the Chernobyl accident. What it is intended to supply, as a schematic overview of problems resulting from nuclear accidents, and a likewise systematic outline of possible solutions and sensible reactions to such an event. The book takes up questions such as: What has happened to the soil. Will future harvests be 'clean' again. What does radioactivity to our drinking water and other waters. What are the effects of a radioactive fallout on food. What may we eat or drink. What happens to the human body after intake of radioactive air, or - even only slightly - contaminated food or water. What can we do to protect our health, and the health of our children. Is there anything else we can do in order to avoid such a disaster in future, except from shutting-off all reactors. The book itself presents some answers and advice, along with a list of terms and explanations, and addresses to apply to for further advice and information. (orig./HP) [de

  12. Primer Extension Mutagenesis Powered by Selective Rolling Circle Amplification

    Science.gov (United States)

    Huovinen, Tuomas; Brockmann, Eeva-Christine; Akter, Sultana; Perez-Gamarra, Susan; Ylä-Pelto, Jani; Liu, Yuan; Lamminmäki, Urpo

    2012-01-01

    Primer extension mutagenesis is a popular tool to create libraries for in vitro evolution experiments. Here we describe a further improvement of the method described by T.A. Kunkel using uracil-containing single-stranded DNA as the template for the primer extension by additional uracil-DNA glycosylase treatment and rolling circle amplification (RCA) steps. It is shown that removal of uracil bases from the template leads to selective amplification of the nascently synthesized circular DNA strand carrying the desired mutations by phi29 DNA polymerase. Selective RCA (sRCA) of the DNA heteroduplex formed in Kunkel's mutagenesis increases the mutagenesis efficiency from 50% close to 100% and the number of transformants 300-fold without notable diversity bias. We also observed that both the mutated and the wild-type DNA were present in at least one third of the cells transformed directly with Kunkel's heteroduplex. In contrast, the cells transformed with sRCA product contained only mutated DNA. In sRCA, the complex cell-based selection for the mutant strand is replaced with the more controllable enzyme-based selection and less DNA is needed for library creation. Construction of a gene library of ten billion members is demonstrated with the described method with 240 nanograms of DNA as starting material. PMID:22355397

  13. A comprehensive collection of experimentally validated primers for Polymerase Chain Reaction quantitation of murine transcript abundance

    Directory of Open Access Journals (Sweden)

    Wang Xiaowei

    2008-12-01

    Full Text Available Abstract Background Quantitative polymerase chain reaction (QPCR is a widely applied analytical method for the accurate determination of transcript abundance. Primers for QPCR have been designed on a genomic scale but non-specific amplification of non-target genes has frequently been a problem. Although several online databases have been created for the storage and retrieval of experimentally validated primers, only a few thousand primer pairs are currently present in existing databases and the primers are not designed for use under a common PCR thermal profile. Results We previously reported the implementation of an algorithm to predict PCR primers for most known human and mouse genes. We now report the use of that resource to identify 17483 pairs of primers that have been experimentally verified to amplify unique sequences corresponding to distinct murine transcripts. The primer pairs have been validated by gel electrophoresis, DNA sequence analysis and thermal denaturation profile. In addition to the validation studies, we have determined the uniformity of amplification using the primers and the technical reproducibility of the QPCR reaction using the popular and inexpensive SYBR Green I detection method. Conclusion We have identified an experimentally validated collection of murine primer pairs for PCR and QPCR which can be used under a common PCR thermal profile, allowing the evaluation of transcript abundance of a large number of genes in parallel. This feature is increasingly attractive for confirming and/or making more precise data trends observed from experiments performed with DNA microarrays.

  14. Specific primer design of mitochondrial 12S rRNA for species identification in raw meats

    Science.gov (United States)

    Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.

    2018-01-01

    Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.

  15. A database of PCR primers for the chloroplast genomes of higher plants

    Science.gov (United States)

    Heinze, Berthold

    2007-01-01

    Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny) or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species). The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata). Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution. PMID:17326828

  16. A database of PCR primers for the chloroplast genomes of higher plants

    Directory of Open Access Journals (Sweden)

    Heinze Berthold

    2007-02-01

    Full Text Available Abstract Background Chloroplast genomes evolve slowly and many primers for PCR amplification and analysis of chloroplast sequences can be used across a wide array of genera. In some cases 'universal' primers have been designed for the purpose of working across species boundaries. However, the essential information on these primer sequences is scattered throughout the literature. Results A database is presented here which assembles published primer information for chloroplast DNA. Additional primers were designed to fill gaps where little or no primer information could be found. Amplicons are either the genes themselves (typically useful in studies of sequence variation in higher-order phylogeny or they are spacers, introns, and intergenic regions (for studies of phylogeographic patterns within and among species. The current list of 'generic' primers consists of more than 700 sequences. Wherever possible, we give the locations of the primers in the thirteen fully sequenced chloroplast genomes (Nicotiana tabacum, Atropa belladonna, Spinacia oleracea, Arabidopsis thaliana, Populus trichocarpa, Oryza sativa, Pinus thunbergii, Marchantia polymorpha, Zea mays, Oenothera elata, Acorus calamus, Eucalyptus globulus, Medicago trunculata. Conclusion The database described here is designed to serve as a resource for researchers who are venturing into the study of poorly described chloroplast genomes, whether for large- or small-scale DNA sequencing projects, to study molecular variation or to investigate chloroplast evolution.

  17. Asymmetric PCR for good quality ssDNA generation towards DNA aptamer production

    Directory of Open Access Journals (Sweden)

    Junji Tominaga4

    2012-04-01

    Full Text Available Aptamers are ssDNA or RNA that binds to wide variety of target molecules with high affinity and specificity producedby systematic evolution of ligands by exponential enrichment (SELEX. Compared to RNA aptamer, DNA aptamer is muchmore stable, favourable to be used in many applications. The most critical step in DNA SELEX experiment is the conversion ofdsDNA to ssDNA. The purpose of this study was to develop an economic and efficient approach of generating ssDNA byusing asymmetric PCR. Our results showed that primer ratio (sense primer:antisense primer of 20:1 and sense primer amountof 10 to 100 pmol, up to 20 PCR cycles using 20 ng of initial template, in combination with polyacrylamide gel electrophoresis,were the optimal conditions for generating good quality and quantity of ssDNA. The generation of ssDNA via this approachcan greatly enhance the success rate of DNA aptamer generation.

  18. Primer on molecular genetics. DOE Human Genome Program

    Energy Technology Data Exchange (ETDEWEB)

    1992-04-01

    This report is taken from the April 1992 draft of the DOE Human Genome 1991--1992 Program Report, which is expected to be published in May 1992. The primer is intended to be an introduction to basic principles of molecular genetics pertaining to the genome project. The material contained herein is not final and may be incomplete. Techniques of genetic mapping and DNA sequencing are described.

  19. Freshwater Wetlands: A Citizen's Primer.

    Science.gov (United States)

    Catskill Center for Conservation and Development, Inc., Hobart, NY.

    The purpose of this "primer" for the general public is to describe the general characteristics of wetlands and how wetland alteration adversely affects the well-being of humans. Particular emphasis is placed on wetlands in New York State and the northeast. Topics discussed include wetland values, destruction of wetlands, the costs of…

  20. A Hearing Aid Primer 1

    Science.gov (United States)

    Yetter, Carol J.

    2009-01-01

    This hearing aid primer is designed to define the differences among the three levels of hearing instrument technology: conventional analog circuit technology (most basic), digitally programmable/analog circuit technology (moderately advanced), and fully digital technology (most advanced). Both moderate and advanced technologies mean that hearing…

  1. A classical primer for QCD

    International Nuclear Information System (INIS)

    Moriyasu, K.

    1981-01-01

    A basic primer for QCD is presented using a semiclassical approach to the colour Maxwell equations. The non-Abelian nature of colour symmetry and the violation of superposition by colour fields is compared with QED. A simple discussion of asymptotic freedom is also presented. (author)

  2. 30 CFR 56.6304 - Primer protection.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 56.6304 Section 56.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Primer protection. (a) Tamping shall not be done directly on a primer. (b) Rigid cartridges of explosives...

  3. Conserved PCR primer set designing for closely-related species to complete mitochondrial genome sequencing using a sliding window-based PSO algorithm.

    Directory of Open Access Journals (Sweden)

    Cheng-Hong Yang

    Full Text Available BACKGROUND: Complete mitochondrial (mt genome sequencing is becoming increasingly common for phylogenetic reconstruction and as a model for genome evolution. For long template sequencing, i.e., like the entire mtDNA, it is essential to design primers for Polymerase Chain Reaction (PCR amplicons which are partly overlapping each other. The presented chromosome walking strategy provides the overlapping design to solve the problem for unreliable sequencing data at the 5' end and provides the effective sequencing. However, current algorithms and tools are mostly focused on the primer design for a local region in the genomic sequence. Accordingly, it is still challenging to provide the primer sets for the entire mtDNA. METHODOLOGY/PRINCIPAL FINDINGS: The purpose of this study is to develop an integrated primer design algorithm for entire mt genome in general, and for the common primer sets for closely-related species in particular. We introduce ClustalW to generate the multiple sequence alignment needed to find the conserved sequences in closely-related species. These conserved sequences are suitable for designing the common primers for the entire mtDNA. Using a heuristic algorithm particle swarm optimization (PSO, all the designed primers were computationally validated to fit the common primer design constraints, such as the melting temperature, primer length and GC content, PCR product length, secondary structure, specificity, and terminal limitation. The overlap requirement for PCR amplicons in the entire mtDNA is satisfied by defining the overlapping region with the sliding window technology. Finally, primer sets were designed within the overlapping region. The primer sets for the entire mtDNA sequences were successfully demonstrated in the example of two closely-related fish species. The pseudo code for the primer design algorithm is provided. CONCLUSIONS/SIGNIFICANCE: In conclusion, it can be said that our proposed sliding window-based PSO

  4. A Primer to Slow Light

    OpenAIRE

    Leonhardt, U.

    2001-01-01

    Laboratory-based optical analogs of astronomical objects such as black holes rely on the creation of light with an extremely low or even vanishing group velocity (slow light). These brief notes represent a pedagogical attempt towards elucidating this extraordinary form of light. This paper is a contribution to the book Artificial Black Holes edited by Mario Novello, Matt Visser and Grigori Volovik. The paper is intended as a primer, an introduction to the subject for non-experts, not as a det...

  5. GST-PRIME: an algorithm for genome-wide primer design.

    Science.gov (United States)

    Leister, Dario; Varotto, Claudio

    2007-01-01

    The profiling of mRNA expression based on DNA arrays has become a powerful tool to study genome-wide transcription of genes in a number of organisms. GST-PRIME is a software package created to facilitate large-scale primer design for the amplification of probes to be immobilized on arrays for transcriptome analyses, even though it can be also applied in low-throughput approaches. GST-PRIME allows highly efficient, direct amplification of gene-sequence tags (GSTs) from genomic DNA (gDNA), starting from annotated genome or transcript sequences. GST-PRIME provides a customer-friendly platform for automatic primer design, and despite the relative simplicity of the algorithm, experimental tests in the model plant species Arabidopsis thaliana confirmed the reliability of the software. This chapter describes the algorithm used for primer design, its input and output files, and the installation of the standalone package and its use.

  6. Determination of the species specificity of the primers for the detection of chicken and turkey meat by realtime PCR method

    Directory of Open Access Journals (Sweden)

    Lenka Maršálková

    2014-07-01

    Full Text Available The aim of this work was to use TaqMan Real-Time PCR for quantitative authentication of chicken and turkey meat. To meet this purpose, a specific pair of primers and TaqMan probe was used. The test was aimed at identifying the reaction cycle of turkey and chicken meat using by two sets of primers. With first set of primer designed for chicken we obtained the following results: Cp = 16.18 for 100% chicken DNA Cp = 29, 18 100% turkey DNA It was also amplified DNA of pig that exceeded the detection threshold fluorescence intensities in the 31.07 cycle (Cp = 31.07. Using primers designed for turkey we obtained the following results Cp = 31.16 for 100% CHDNA, Cp =16.18 100% TDNA. It was also amplified the 100% DNA of rabbit in 31.63 cycle (Cp = 31.63 and deer in cycle 32 (Cp = 32. The DNA of all other animal species was amplificated after more than 35 cycles (Cp >35. It follows that the second detection primer pair is specific enough to unrelated species of animals by 30 cycles of the reaction. Species authentication based on DNA analysis from this perspective overcomes all the shortcomings of proteins. At present, DNA analysis use different types of PCR. Is the most progressive Real-time PCR, which is suitable for the specific use of detection (primers and TaqMan probe. The TaqMan Real-time PCR is within the sensitivity and specificity, clearly one of the best methods for identifying the species of chicken and turkey meat. The specificity of this method, however, depends primarily on the specificity of the primers and TaqMan probe. The 30 cycle reaction was chosen by us as the threshold for specificity using primers for authentication chicken and turkey meat.

  7. Using long ssDNA polynucleotides to amplify STRs loci in degraded DNA samples

    Science.gov (United States)

    Pérez Santángelo, Agustín; Corti Bielsa, Rodrigo M.; Sala, Andrea; Ginart, Santiago; Corach, Daniel

    2017-01-01

    Obtaining informative short tandem repeat (STR) profiles from degraded DNA samples is a challenging task usually undermined by locus or allele dropouts and peak-high imbalances observed in capillary electrophoresis (CE) electropherograms, especially for those markers with large amplicon sizes. We hereby show that the current STR assays may be greatly improved for the detection of genetic markers in degraded DNA samples by using long single stranded DNA polynucleotides (ssDNA polynucleotides) as surrogates for PCR primers. These long primers allow a closer annealing to the repeat sequences, thereby reducing the length of the template required for the amplification in fragmented DNA samples, while at the same time rendering amplicons of larger sizes suitable for multiplex assays. We also demonstrate that the annealing of long ssDNA polynucleotides does not need to be fully complementary in the 5’ region of the primers, thus allowing for the design of practically any long primer sequence for developing new multiplex assays. Furthermore, genotyping of intact DNA samples could also benefit from utilizing long primers since their close annealing to the target STR sequences may overcome wrong profiling generated by insertions/deletions present between the STR region and the annealing site of the primers. Additionally, long ssDNA polynucleotides might be utilized in multiplex PCR assays for other types of degraded or fragmented DNA, e.g. circulating, cell-free DNA (ccfDNA). PMID:29099837

  8. A primer of multivariate statistics

    CERN Document Server

    Harris, Richard J

    2014-01-01

    Drawing upon more than 30 years of experience in working with statistics, Dr. Richard J. Harris has updated A Primer of Multivariate Statistics to provide a model of balance between how-to and why. This classic text covers multivariate techniques with a taste of latent variable approaches. Throughout the book there is a focus on the importance of describing and testing one's interpretations of the emergent variables that are produced by multivariate analysis. This edition retains its conversational writing style while focusing on classical techniques. The book gives the reader a feel for why

  9. Evaluation of highly conserved hsp65-specific nested PCR primers for diagnosing Mycobacterium tuberculosis.

    Science.gov (United States)

    Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G

    2017-02-01

    To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.

  10. Avoiding cross hybridization by choosing nonredundant targets on cDNA arrays

    DEFF Research Database (Denmark)

    Nielsen, Henrik Bjørn; Knudsen, Steen

    2002-01-01

    PROBEWIZ designs PCR primers for amplifying probes for cDNA arrays. The probes are designed to have minimal homology to other expressed sequences from a given organism. The primer selection is based on user-defined penalties for homology, primer quality, and proximity to the 3' end.......PROBEWIZ designs PCR primers for amplifying probes for cDNA arrays. The probes are designed to have minimal homology to other expressed sequences from a given organism. The primer selection is based on user-defined penalties for homology, primer quality, and proximity to the 3' end....

  11. DNA fingerprinting for the authentication of Ruta graveolens

    African Journals Online (AJOL)

    Jane

    2011-08-15

    Aug 15, 2011 ... In this study, random amplified polymorphic DNA (RAPD) was employed to ... samples using the DNA isolated from the dried leaf, seed and stem of both samples. ..... opposite strands and is complementary to the primer for.

  12. A primer on pseudorandom generators

    CERN Document Server

    Goldreich, Oded

    2010-01-01

    A fresh look at the question of randomness was taken in the theory of computing: A distribution is pseudorandom if it cannot be distinguished from the uniform distribution by any efficient procedure. This paradigm, originally associating efficient procedures with polynomial-time algorithms, has been applied with respect to a variety of natural classes of distinguishing procedures. The resulting theory of pseudorandomness is relevant to science at large and is closely related to central areas of computer science, such as algorithmic design, complexity theory, and cryptography. This primer surveys the theory of pseudorandomness, starting with the general paradigm, and discussing various incarnations while emphasizing the case of general-purpose pseudorandom generators (withstanding any polynomial-time distinguisher). Additional topics include the "derandomization" of arbitrary probabilistic polynomial-time algorithms, pseudorandom generators withstanding space-bounded distinguishers, and several natural notions...

  13. A Primer on Observational Measurement.

    Science.gov (United States)

    Girard, Jeffrey M; Cohn, Jeffrey F

    2016-08-01

    Observational measurement plays an integral role in a variety of scientific endeavors within biology, psychology, sociology, education, medicine, and marketing. The current article provides an interdisciplinary primer on observational measurement; in particular, it highlights recent advances in observational methodology and the challenges that accompany such growth. First, we detail the various types of instrument that can be used to standardize measurements across observers. Second, we argue for the importance of validity in observational measurement and provide several approaches to validation based on contemporary validity theory. Third, we outline the challenges currently faced by observational researchers pertaining to measurement drift, observer reactivity, reliability analysis, and time/expense. Fourth, we describe recent advances in computer-assisted measurement, fully automated measurement, and statistical data analysis. Finally, we identify several key directions for future observational research to explore.

  14. A primer on quantum fluids

    CERN Document Server

    Barenghi, Carlo

    2016-01-01

    The aim of this primer is to cover the essential theoretical information, quickly and concisely, in order to enable senior undergraduate and beginning graduate students to tackle projects in topical research areas of quantum fluids, for example, solitons, vortices and collective modes. The selection of the material, both regarding the content and level of presentation, draws on the authors analysis of the success of relevant research projects with newcomers to the field, as well as of the students feedback from many taught and self-study courses on the subject matter. Starting with a brief historical overview, this text covers particle statistics, weakly interacting condensates and their dynamics and finally superfluid helium and quantum turbulence. At the end of each chapter (apart from the first) there will be some exercises. Detailed solutions can be made available to instructors upon request to the authors. .

  15. 30 CFR 57.6304 - Primer protection.

    Science.gov (United States)

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Primer protection. 57.6304 Section 57.6304 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... Transportation-Surface and Underground § 57.6304 Primer protection. (a) Tamping shall not be done directly on a...

  16. PriFi - Using a Multiple Alignment of Related Sequences to Find Primers for  Amplification of Homologs

    DEFF Research Database (Denmark)

    Fredslund, Jakob; Schauser, Leif; Madsen, Lene Heegaard

    2005-01-01

    Using a comparative approach, the web program PriFi (http://cgi-www.daimi.au.dk/cgi-chili/PriFi/main) designs pairs of primers useful for PCR amplification of genomic DNA in species where prior sequence information is not available. The program works with an alignment of DNA sequences from phylog...

  17. Table 1. Primers sequences information. Primer name Sequence ...

    Indian Academy of Sciences (India)

    Administrator

    Figure 5. Selected microsatellite markers indicated maternal mosaicism was not caused by DNA contamination. We did not find any of the proband's paternal microsatellite markers mixed with the mother's (A). The positive control was generated by mixing 10% proband's sample with 90% his mother's sample (B).

  18. Evaluation of genetic diversity in open pollinated guava by iPBS primers

    International Nuclear Information System (INIS)

    Mehmood, A.; Jaskani, M.J.; Ahmad, S.; Ahmad, R.

    2013-01-01

    DNA markers are important tools for assessing genetic diversity and relationships among species, cultivars and breeding materials. Many horticultural species are lacking genomic information. DNA markers that do not require prior knowledge of DNA sequences are therefore appealing for horticultural research. A retrotransposon-based DNA marker system, iPBS (inter primer binding sites) developed from conserved primer binding sites within retrotransposons, was used to study the genetic variation and relationships in ornamental guava. PCR from 6 iPBS primers (dominant markers) produced a total of 113 bands (52.38-100% polymorphic) ranging from 150 bp to 3000 bp, and the mean PIC value for each primer ranging from 0.1245 to 0.3698. Molecular information generated from both iPBS was separately scored in a matrix for phylogenetic dendrogram construction. The phylogenetic dendrogram based on iPBS markers reflected morphologic classifications of the accessions that were studied. The iPBS PCR-based genome fingerprinting technology in this study is low-cost and provides another effective alternative in differentiation of accessions in guava (Psidium guajava Linn.) and related species or genera. (author)

  19. Development of specific primers for the detection of HVA1 from ...

    African Journals Online (AJOL)

    aghomotsegin

    2014-01-22

    Jan 22, 2014 ... can potentially improve the stress tolerance in plants. (Bajaj et al. ... protein) from barley was engineered in rice (Chandra et al., 2004; Rohila et al., .... US), 400 nM forward and reverse primers, 100 ng of DNA template in 25 µl ...

  20. Integrating PCR Theory and Bioinformatics into a Research-oriented Primer Design Exercise

    OpenAIRE

    Robertson, Amber L.; Phillips, Allison R.

    2008-01-01

    Polymerase chain reaction (PCR) is a conceptually difficult technique that embodies many fundamental biological processes. Traditionally, students have struggled to analyze PCR results due to an incomplete understanding of the biological concepts (theory) of DNA replication and strand complementarity. Here we describe the design of a novel research-oriented exercise that prepares students to design DNA primers for PCR. Our exercise design includes broad and specific learning goals and assessm...

  1. Identification and DNA fingerprinting of Legionella strains by randomly amplified polymorphic DNA analysis.

    OpenAIRE

    Bansal, N S; McDonell, F

    1997-01-01

    The randomly amplified polymorphic DNA (RAPD) technique was used in the development of a fingerprinting (typing) and identification protocol for Legionella strains. Twenty decamer random oligonucleotide primers were screened for their discriminatory abilities. Two candidate primers were selected. By using a combination of these primers, RAPD analysis allowed for the differentiation between all different species, between the serogroups, and further differentiation between subtypes of the same ...

  2. KULTUR PRIMER FIBROBLAS: PENELITIAN PENDAHULUAN

    Directory of Open Access Journals (Sweden)

    Yuli Kurniawati

    2015-05-01

    Full Text Available AbstrakKultur sel fibroblas banyak digunakan untuk penelitian proses penyembuhan luka dan penuaankulit. Metode ini digunakan untuk melihat perkembangan sel, proliferasi kinetik seluler, sertabiosintesis komponen matriks ekstraseluler. Penelitian pendahuluan ini dilakukan untuk optimasiteknik laboratorium serta berbagai kendala yang didapatkan saat kultur fibroblas. Kultur primerfibroblas dibagi menjadi 2 jenis sampel yaitu sampel yang berasal dari embrio mencit usia 7,5–9,5 hari, dan kulit pasien keloid. Sampel dari embrio mencit dilakukan kultur primer denganmetode dissociated fibroblast. Sampel jaringan keloid dan kulit normal dikultur dengan metodeskin explant. Fibroblas yang berasal dari kultur primer embrio mencit tumbuh baik sehinggadapat dilakukan subkultur dan disimpan di dalam nitrogen cair suhu -198°C. Fibroblas yangberasal dari sampel keloid pertama tumbuh sesuai pola pertumbuhan fibroblas, namun padasampel kedua terdapat kontaminasi Paecilomyces sp. yang merupakan salah satu jenis jamurkontaminan. Sel fibroblas mudah untuk dikultur karena memiliki kemampuan tumbuh danmelekat yang tinggi serta regenerasi cepat, namun penelitian lebih lanjut untuk optimasi teknikkultur dan pencegahan kontaminasi masih dibutuhkan sehingga sel dapat tumbuh baik.AbstractFibroblast cell culture method has been used for wound healing and skin aging studies. Thismethod was used for cell development imaging study, celullar kinetic proliferation andextracelullar matrix component biosynthesis. This preeliminary study was done for laboratoricaltechnic optimation as well as problems appeared in fibroblast culture. Fibroblasts primary culturewas divided into 2 type of samples, from 7.5-9.5-day-mice embryo and keloid-patient skin.Primary culture with dissociated fibroblast method was done for mice embryo sample. Keloidtissue sample and normal skin were cultured with skin explant method. Fibroblasts that weretaken from mice embryo primary culture grew well

  3. Multicolor-based discrimination of 21 short tandem repeats and amelogenin using four fluorescent universal primers.

    Science.gov (United States)

    Asari, Masaru; Okuda, Katsuhiro; Hoshina, Chisato; Omura, Tomohiro; Tasaki, Yoshikazu; Shiono, Hiroshi; Matsubara, Kazuo; Shimizu, Keiko

    2016-02-01

    The aim of this study was to develop a cost-effective genotyping method using high-quality DNA for human identification. A total of 21 short tandem repeats (STRs) and amelogenin were selected, and fluorescent fragments at 22 loci were simultaneously amplified in a single-tube reaction using locus-specific primers with 24-base universal tails and four fluorescent universal primers. Several nucleotide substitutions in universal tails and fluorescent universal primers enabled the detection of specific fluorescent fragments from the 22 loci. Multiplex polymerase chain reaction (PCR) produced intense FAM-, VIC-, NED-, and PET-labeled fragments ranging from 90 to 400 bp, and these fragments were discriminated using standard capillary electrophoretic analysis. The selected 22 loci were also analyzed using two commercial kits (the AmpFLSTR Identifiler Kit and the PowerPlex ESX 17 System), and results for two loci (D19S433 and D16S539) were discordant between these kits due to mutations at the primer binding sites. All genotypes from the 100 samples were determined using 2.5 ng of DNA by our method, and the expected alleles were completely recovered. Multiplex 22-locus genotyping using four fluorescent universal primers effectively reduces the costs to less than 20% of genotyping using commercial kits, and our method would be useful to detect silent alleles from commercial kit analysis. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Thinking in systems a primer

    CERN Document Server

    Meadows, Donella H

    2008-01-01

    In the years following her role as the lead author of the international bestseller, "Limits to Growth"-the first book to show the consequences of unchecked growth on a finite planet- Donella Meadows remained a pioneer of environmental and social analysis until her untimely death in 2001. Meadows' newly released manuscript, "Thinking in Systems", is a concise and crucial book offering insight for problem solving on scales ranging from the personal to the global. Edited by the Sustainability Institute's Diana Wright, this essential primer brings systems thinking out of the realm of computers and equations and into the tangible world, showing readers how to develop the systems-thinking skills that thought leaders across the globe consider critical for 21st-century life. Some of the biggest problems facing the world-war, hunger, poverty, and environmental degradation-are essentially system failures. They cannot be solved by fixing one piece in isolation from the others, because even seemingly minor details have e...

  5. Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

    Science.gov (United States)

    Yofe, Ido; Schuldiner, Maya

    2014-02-01

    The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.

  6. Primer on spontaneous heating and pyrophoricity

    Energy Technology Data Exchange (ETDEWEB)

    1994-12-01

    This primer was prepared as an information resource for personnel responsible for operation of DOE nuclear facilities. It has sections on combustion principles, spontaneous heating/ignition of hydrocarbons and organics, pyrophoric gases and liquids, pyrophoric nonmetallic solids, pyrophoric metals (including Pu and U), and accident case studies. Although the information in this primer is not all-encompassing, it should provide the reader with a fundamental knowledge level sufficient to recognize most spontaneous combustion hazards and how to prevent ignition and widespread fires. This primer is provided as an information resource only, and is not intended to replace any fire protection or hazardous material training.

  7. PCR-based cDNA library construction: general cDNA libraries at the level of a few cells.

    OpenAIRE

    Belyavsky, A; Vinogradova, T; Rajewsky, K

    1989-01-01

    A procedure for the construction of general cDNA libraries is described which is based on the amplification of total cDNA in vitro. The first cDNA strand is synthesized from total RNA using an oligo(dT)-containing primer. After oligo(dG) tailing the total cDNA is amplified by PCR using two primers complementary to oligo(dA) and oligo(dG) ends of the cDNA. For insertion of the cDNA into a vector a controlled trimming of the 3' ends of the cDNA by Klenow enzyme was used. Starting from 10 J558L ...

  8. Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR

    Science.gov (United States)

    Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan

    2002-01-01

    AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381

  9. Eukaryotic DNA Replicases

    KAUST Repository

    Zaher, Manal S.; Oke, Muse; Hamdan, Samir

    2014-01-01

    The current model of the eukaryotic DNA replication fork includes three replicative DNA polymerases, polymerase α/primase complex (Pol α), polymerase δ (Pol δ), and polymerase ε (Pol ε). The primase synthesizes 8–12 nucleotide RNA primers that are extended by the DNA polymerization activity of Pol α into 30–35 nucleotide RNA-DNA primers. Replication factor C (RFC) opens the polymerase clamp-like processivity factor, proliferating cell nuclear antigen (PCNA), and loads it onto the primer-template. Pol δ utilizes PCNA to mediate highly processive DNA synthesis, while Pol ε has intrinsic high processivity that is modestly stimulated by PCNA. Pol ε replicates the leading strand and Pol δ replicates the lagging strand in a division of labor that is not strict. The three polymerases are comprised of multiple subunits and share unifying features in their large catalytic and B subunits. The remaining subunits are evolutionarily not related and perform diverse functions. The catalytic subunits are members of family B, which are distinguished by their larger sizes due to inserts in their N- and C-terminal regions. The sizes of these inserts vary among the three polymerases, and their functions remain largely unknown. Strikingly, the quaternary structures of Pol α, Pol δ, and Pol ε are arranged similarly. The catalytic subunits adopt a globular structure that is linked via its conserved C-terminal region to the B subunit. The remaining subunits are linked to the catalytic and B subunits in a highly flexible manner.

  10. Eukaryotic DNA Replicases

    KAUST Repository

    Zaher, Manal S.

    2014-11-21

    The current model of the eukaryotic DNA replication fork includes three replicative DNA polymerases, polymerase α/primase complex (Pol α), polymerase δ (Pol δ), and polymerase ε (Pol ε). The primase synthesizes 8–12 nucleotide RNA primers that are extended by the DNA polymerization activity of Pol α into 30–35 nucleotide RNA-DNA primers. Replication factor C (RFC) opens the polymerase clamp-like processivity factor, proliferating cell nuclear antigen (PCNA), and loads it onto the primer-template. Pol δ utilizes PCNA to mediate highly processive DNA synthesis, while Pol ε has intrinsic high processivity that is modestly stimulated by PCNA. Pol ε replicates the leading strand and Pol δ replicates the lagging strand in a division of labor that is not strict. The three polymerases are comprised of multiple subunits and share unifying features in their large catalytic and B subunits. The remaining subunits are evolutionarily not related and perform diverse functions. The catalytic subunits are members of family B, which are distinguished by their larger sizes due to inserts in their N- and C-terminal regions. The sizes of these inserts vary among the three polymerases, and their functions remain largely unknown. Strikingly, the quaternary structures of Pol α, Pol δ, and Pol ε are arranged similarly. The catalytic subunits adopt a globular structure that is linked via its conserved C-terminal region to the B subunit. The remaining subunits are linked to the catalytic and B subunits in a highly flexible manner.

  11. Developing DNA barcoding (matK) primers for marama bean ...

    African Journals Online (AJOL)

    The homology found with Tylosema fassoglensis (trnK gene) and Pisum sativum (matK gene) suggests that an identical region was amplified for Tylosema esculentum. A phylogenetic tree was constructed based on the matK sequences and the results suggest that the matK region can also be used in determining levels of ...

  12. A practical primer on geostatistics

    Science.gov (United States)

    Olea, Ricardo A.

    2009-01-01

    has significant methodological implications.Historical Remarks—As a discipline, geostatistics was firmly established in the 1960s by the French engineer Georges Matheron, who was interested in the appraisal of ore reserves in mining. Geostatistics did not develop overnight. Like other disciplines, it has built on previous results, many of which were formulated with different objectives in various fields.Pioneers—Seminal ideas conceptually related to what today we call geostatistics or spatial statistics are found in the work of several pioneers, including: 1940s: A.N. Kolmogorov in turbulent flow and N. Wiener in stochastic processing; 1950s: D. Krige in mining; 1960s: B. Mathern in forestry and L.S. Gandin in meteorologyCalculations—Serious applications of geostatistics require the use of digital computers. Although for most geostatistical techniques rudimentary implementation from scratch is fairly straightforward, coding programs from scratch is recommended only as part of a practice that may help users to gain a better grasp of the formulations.Software—For professional work, the reader should employ software packages that have been thoroughly tested to handle any sampling scheme, that run as efficiently as possible, and that offer graphic capabilities for the analysis and display of results. This primer employs primarily the package Stanford Geomodeling Software (SGeMS) - recently developed at the Energy Resources Engineering Department at Stanford University - as a way to show how to obtain results practically. This applied side of the primer should not be interpreted as the notes being a manual for the use of SGeMS. The main objective of the primer is to help the reader gain an understanding of the fundamental concepts and tools in geostatistics.Organization of the Primer—The chapters of greatest importance are those covering kriging and simulation. All other materials are peripheral and are included for better comprehension of these main

  13. Gold nanoparticle-assisted primer walking for closing the human chromosomal gap

    DEFF Research Database (Denmark)

    Li, H; Shi, B; Li, X

    2013-01-01

    The finished sequence of the human genome still contains 260 euchromatic gaps. All the PCR-based genome walking techniques used to close gaps have common limitations, such as low efficiency and low specificity. We herein describe a strategy to solve this problem by employing gold nanoparticles (Au......NPs) to improve the efficiency in primer walking amplification. We used this strategy to close a gap in human chromosome 5 containing a DNA stretch composed of the 12SAT repeat. The obtained gap sequence is highly conserved among several mammalian genomes. The demonstrated AuNP-assisted primer walking strategy...

  14. Bioinformatic tools for PCR Primer design

    African Journals Online (AJOL)

    ES

    Bioinformatics is an emerging scientific discipline that uses information ... complex biological questions. ... and computer programs for various purposes of primer ..... polymerase chain reaction: Human Immunodeficiency Virus 1 model studies.

  15. Hexavalent Chromium IV-Free Primer Development

    Science.gov (United States)

    Alldredge, Michael J.; Buck, Amy L.

    2015-01-01

    Primer materials provide corrosion protection for metal parts as well as an increased adhesion between metallic substrates and thermal protection systems (TPSs). Current primers for use in cryogenic applications contain hexavalent chromium. This hexavalent chromium provides excellent corrosion protection even in a cryogenic environment, but it is a carcinogen that requires special equipment and waste control procedures to use. The hazardous nature of hexavalent chromium makes it an obsolescence risk in the future. This study included two phases of evaluation. Thirteen primers were initially identified as candidates and twelve of those primers were tested in phase 1. Four of the best performing candidates from phase 1 continued into phase 2 testing. Phase 1 testing consisted mostly of liquid constituent and physical property testing. Cryoflex and salt fog testing were included in phase 1 because of their importance to the overall success of a candidate material. Phase 2 consisted of physical, thermal, and mechanical properties for nominally processed and fabricated specimens.

  16. Quantitative Microbial Risk Assessment Tutorial - Primer

    Science.gov (United States)

    This document provides a Quantitative Microbial Risk Assessment (QMRA) primer that organizes QMRA tutorials. The tutorials describe functionality of a QMRA infrastructure, guide the user through software use and assessment options, provide step-by-step instructions for implementi...

  17. Menopause 101: A Primer for the Perimenopausal

    Science.gov (United States)

    ... Abstracts Media Award Recipients Media Policy Media Requests Menopause 101: A primer for the perimenopausal The information ... about 2 years earlier. Common Body Changes at Menopause Each woman’s experience of menopause is different. Many ...

  18. Multiplexing Short Primers for Viral Family PCR

    Energy Technology Data Exchange (ETDEWEB)

    Gardner, S N; Hiddessen, A L; Hara, C A; Williams, P L; Wagner, M; Colston, B W

    2008-06-26

    We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and for several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.

  19. VizPrimer: a web server for visualized PCR primer design based on known gene structure.

    Science.gov (United States)

    Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang

    2011-12-15

    The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.

  20. DNA polymerase preference determines PCR priming efficiency.

    Science.gov (United States)

    Pan, Wenjing; Byrne-Steele, Miranda; Wang, Chunlin; Lu, Stanley; Clemmons, Scott; Zahorchak, Robert J; Han, Jian

    2014-01-30

    Polymerase chain reaction (PCR) is one of the most important developments in modern biotechnology. However, PCR is known to introduce biases, especially during multiplex reactions. Recent studies have implicated the DNA polymerase as the primary source of bias, particularly initiation of polymerization on the template strand. In our study, amplification from a synthetic library containing a 12 nucleotide random portion was used to provide an in-depth characterization of DNA polymerase priming bias. The synthetic library was amplified with three commercially available DNA polymerases using an anchored primer with a random 3' hexamer end. After normalization, the next generation sequencing (NGS) results of the amplified libraries were directly compared to the unamplified synthetic library. Here, high throughput sequencing was used to systematically demonstrate and characterize DNA polymerase priming bias. We demonstrate that certain sequence motifs are preferred over others as primers where the six nucleotide sequences at the 3' end of the primer, as well as the sequences four base pairs downstream of the priming site, may influence priming efficiencies. DNA polymerases in the same family from two different commercial vendors prefer similar motifs, while another commercially available enzyme from a different DNA polymerase family prefers different motifs. Furthermore, the preferred priming motifs are GC-rich. The DNA polymerase preference for certain sequence motifs was verified by amplification from single-primer templates. We incorporated the observed DNA polymerase preference into a primer-design program that guides the placement of the primer to an optimal location on the template. DNA polymerase priming bias was characterized using a synthetic library amplification system and NGS. The characterization of DNA polymerase priming bias was then utilized to guide the primer-design process and demonstrate varying amplification efficiencies among three commercially

  1. Enhanced peptide nucleic acid binding to supercoiled DNA: possible implications for DNA "breathing" dynamics

    DEFF Research Database (Denmark)

    Bentin, T; Nielsen, Peter E.

    1996-01-01

    The influence of DNA topology on peptide nucleic acid (PNA) binding was studied. Formation of sequence-specific PNA2/dsDNA (double-stranded DNA) complexes was monitored by a potassium permanganate probing/primer extension assay. At low ionic strengths, the binding of PNA was 2-3 times more...

  2. Canadian municipal carbon trading primer

    International Nuclear Information System (INIS)

    Seskus, A.

    2002-01-01

    The trading of greenhouse gas (GHG) emissions is being suggested as an effective economic way to meet Canada's Kyoto target. Emissions trading is a market-based instrument that can help achieve environmental improvements while using the market to absorb the economical and effective measures to achieve emissions reductions. Placing a value on emissions means that in order to minimize costs, companies will be motivated to apply the lowest-cost emission reductions possible for regulatory approval. The two main types of emissions trading that exist in Canada are the trading of emissions that lead to the formation of smog or acid rain, and the trading of greenhouse gas emissions that lead to climate change. Since carbon dioxide is the most prevalent GHG, making up approximately 75 per cent of Canadian GHG emissions, the trading of units of GHGs is often referred to as carbon trading. The impact that emissions trading will have on municipal operations was the focus of this primer. The trading of GHG involves buying and selling of allowances of GHGs between contracting parties, usually between one party that is short of GHG credits and another that has excess credits. The 3 common approaches to emissions trading include allowance trading (cap and trade), credit trading (baseline and credit), and a hybrid system which combines both credit and allowance trading systems. The issues that impact municipalities include the debate regarding who owns the credits from landfills, particularly if power is generated using landfill gas and the power is sold as green power. Other viable questions were also addressed, including who can claim emission reduction credits if a city implements energy efficiency projects, or fuel substitution programs. Also, will municipalities be allowed to trade internationally, for example, with municipalities in the United States, and how should they spend their money earned from selling credits. This report also presents highlights from 3 emissions

  3. DNA barcoding amphibians and reptiles.

    Science.gov (United States)

    Vences, Miguel; Nagy, Zoltán T; Sonet, Gontran; Verheyen, Erik

    2012-01-01

    Only a few major research programs are currently targeting COI barcoding of amphibians and reptiles (including chelonians and crocodiles), two major groups of tetrapods. Amphibian and reptile species are typically old, strongly divergent, and contain deep conspecific lineages which might lead to problems in species assignment with incomplete reference databases. As far as known, there is no single pair of COI primers that will guarantee a sufficient rate of success across all amphibian and reptile taxa, or within major subclades of amphibians and reptiles, which means that the PCR amplification strategy needs to be adjusted depending on the specific research question. In general, many more amphibian and reptile taxa have been sequenced for 16S rDNA, which for some purposes may be a suitable complementary marker, at least until a more comprehensive COI reference database becomes available. DNA barcoding has successfully been used to identify amphibian larval stages (tadpoles) in species-rich tropical assemblages. Tissue sampling, DNA extraction, and amplification of COI is straightforward in amphibians and reptiles. Single primer pairs are likely to have a failure rate between 5 and 50% if taxa of a wide taxonomic range are targeted; in such cases the use of primer cocktails or subsequent hierarchical usage of different primer pairs is necessary. If the target group is taxonomically limited, many studies have followed a strategy of designing specific primers which then allow an easy and reliable amplification of all samples.

  4. Genus-Specific Primers for Study of Fusarium Communities in Field Samples

    Science.gov (United States)

    Edel-Hermann, Véronique; Gautheron, Nadine; Durling, Mikael Brandström; Kolseth, Anna-Karin; Steinberg, Christian; Persson, Paula; Friberg, Hanna

    2015-01-01

    Fusarium is a large and diverse genus of fungi of great agricultural and economic importance, containing many plant pathogens and mycotoxin producers. To date, high-throughput sequencing of Fusarium communities has been limited by the lack of genus-specific primers targeting regions with high discriminatory power at the species level. In the present study, we evaluated two Fusarium-specific primer pairs targeting translation elongation factor 1 (TEF1). We also present the new primer pair Fa+7/Ra+6. Mock Fusarium communities reflecting phylogenetic diversity were used to evaluate the accuracy of the primers in reflecting the relative abundance of the species. TEF1 amplicons were subjected to 454 high-throughput sequencing to characterize Fusarium communities. Field samples from soil and wheat kernels were included to test the method on more-complex material. For kernel samples, a single PCR was sufficient, while for soil samples, nested PCR was necessary. The newly developed primer pairs Fa+7/Ra+6 and Fa/Ra accurately reflected Fusarium species composition in mock DNA communities. In field samples, 47 Fusarium operational taxonomic units were identified, with the highest Fusarium diversity in soil. The Fusarium community in soil was dominated by members of the Fusarium incarnatum-Fusarium equiseti species complex, contradicting findings in previous studies. The method was successfully applied to analyze Fusarium communities in soil and plant material and can facilitate further studies of Fusarium ecology. PMID:26519387

  5. Polyadenylated Sequencing Primers Enable Complete Readability of PCR Amplicons Analyzed by Dideoxynucleotide Sequencing

    Directory of Open Access Journals (Sweden)

    Martin Beránek

    2012-01-01

    Full Text Available Dideoxynucleotide DNA sequencing is one of the principal procedures in molecular biology. Loss of an initial part of nucleotides behind the 3' end of the sequencing primer limits the readability of sequenced amplicons. We present a method which extends the readability by using sequencing primers modified by polyadenylated tails attached to their 5' ends. Performing a polymerase chain reaction, we amplified eight amplicons of six human genes (AMELX, APOE, HFE, MBL2, SERPINA1 and TGFB1 ranging from 106 bp to 680 bp. Polyadenylation of the sequencing primers minimized the loss of bases in all amplicons. Complete sequences of shorter products (AMELX 106 bp, SERPINA1 121 bp, HFE 208 bp, APOE 244 bp, MBL2 317 bp were obtained. In addition, in the case of TGFB1 products (366 bp, 432 bp, and 680 bp, respectively, the lengths of sequencing readings were significantly longer if adenylated primers were used. Thus, single strand dideoxynucleotide sequencing with adenylated primers enables complete or near complete readability of short PCR amplicons.

  6. Real-time PCR (qPCR) primer design using free online software.

    Science.gov (United States)

    Thornton, Brenda; Basu, Chhandak

    2011-01-01

    Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.

  7. Detection of Ophiocordyceps sinensis and Its Common Adulterates Using Species-Specific Primers

    Science.gov (United States)

    Liu, Yang; Wang, Xiao-yue; Gao, Zi-tong; Han, Jian-ping; Xiang, Li

    2017-01-01

    Ophiocordyceps sinensis is a fungus that infects Hepialidae caterpillars, mummifying the larvae and producing characteristic fruiting bodies (stromata) that are processed into one of the most valued traditional Chinese medicines (TCM). The product commands a very high price due to a high demand but a very limited supply. Adulteration with other fungi is a common problem and there is a need to test preparation for the presence of the correct fungus. In the current study, a PCR-based approach for the identification of O. sinensis based on a segment of the internal transcribed spacer (ITS) region was developed. The segments is 146-bp in size and is likely to be amplified even in materials where processing led to DNA fragmentation. Primer development was based on the alignment of sequence data generated from a total of 89 samples of O. sinensis and potential adulterants as well as sequences date from 41 Ophiocordyceps species and 26 Cordyceps species available in GenBank. Tests with primer pair, DCF4/DCR4, demonstrated generation of an amplicon from DNA extracted from O. sinensis stromata, but not from extracts derived from adulterants. Species-specific primer pairs were also developed and tested for detection of the common adulterants, Cordyceps gunnii, Cordyceps cicadae, Cordyceps militaris, Cordyceps liangshanensis and Ophiocordyceps nutans. The collection of primers developed in the present study will be useful for the authentication of preparation claiming to only contain O. sinensis and for the detection of fungi used as adulterants in these preparations. PMID:28680424

  8. Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Esther Lantero

    2017-07-01

    Full Text Available Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L. trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control

  9. Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae)

    Energy Technology Data Exchange (ETDEWEB)

    Lantero, E.; Matallanas, B.; Ochando, M.D.; Pascual, S.; Callejas, C.

    2017-07-01

    Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L.) trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control.

  10. Specific and sensitive primers for the detection of predated olive fruit flies, Bactrocera oleae (Diptera: Tephritidae)

    International Nuclear Information System (INIS)

    Lantero, E.; Matallanas, B.; Ochando, M.D.; Pascual, S.; Callejas, C.

    2017-01-01

    Bactrocera oleae, the olive fruit fly, is a major pest of olive (Olea europaea L.) trees worldwide. Its presence can cause important losses, with consequences for the economies of countries that produce and export table olives and olive oil. Efforts to control olive fruit fly populations have, however, been insufficient. Now more than ever, environmentally friendly alternatives need to be considered in potential control programs. Generalist predators could provide a way of managing this pest naturally. However, the identification of candidate predator species is essential if such a management system is to be introduced. The present paper describes a set of species-specific primers for detecting the presence of B. oleae DNA in the gut of predatory arthropods. All primers were tested for checking cross-reactive amplification of other fruit fly DNA and evaluated in heterospecific mixes of nucleic acids. All were found to be very sensitive for B. oleae. Subsequent feeding trials were conducted using one of the most abundant species of ground dwelling carabids in olive groves in south-eastern Madrid, Spain. These trials allowed determining that 253F-334R and 334F-253R primer pairs had the highest detection efficiency with an ID50 of around 78 h. These primers therefore provide a very useful tool for screening the gut contents of potential predators of B. oleae, and can thus reveal candidate species for the pest's biological control.

  11. Climate Change, Health, and Communication: A Primer.

    Science.gov (United States)

    Chadwick, Amy E

    2016-01-01

    Climate change is one of the most serious and pervasive challenges facing us today. Our changing climate has implications not only for the ecosystems upon which we depend, but also for human health. Health communication scholars are well-positioned to aid in the mitigation of and response to climate change and its health effects. To help theorists, researchers, and practitioners engage in these efforts, this primer explains relevant issues and vocabulary associated with climate change and its impacts on health. First, this primer provides an overview of climate change, its causes and consequences, and its impacts on health. Then, the primer describes ways to decrease impacts and identifies roles for health communication scholars in efforts to address climate change and its health effects.

  12. Microsatellite Primers for Fungus-Growing Ants

    DEFF Research Database (Denmark)

    Villesen Fredsted, Palle; Gertsch, Pia J.; Boomsma, Jacobus Jan (Koos)

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  13. Microsatellite primers for fungus-growing ants

    DEFF Research Database (Denmark)

    Villesen, Palle; Gertsch, P J; Boomsma, JJ

    2002-01-01

    We isolated five polymorphic microsatellite loci from a library of two thousand recombinant clones of two fungus-growing ant species, Cyphomyrmex longiscapus and Trachymyrmex cf. zeteki. Amplification and heterozygosity were tested in five species of higher attine ants using both the newly...... developed primers and earlier published primers that were developed for fungus-growing ants. A total of 20 variable microsatellite loci, developed for six different species of fungus-growing ants, are now available for studying the population genetics and colony kin-structure of these ants....

  14. Mechanism of sequence-specific template binding by the DNA primase of bacteriophage T7

    KAUST Repository

    Lee, Seung-Joo; Zhu, Bin; Hamdan, Samir; Richardson, Charles C.

    2010-01-01

    DNA primases catalyze the synthesis of the oligoribonucleotides required for the initiation of lagging strand DNA synthesis. Biochemical studies have elucidated the mechanism for the sequence-specific synthesis of primers. However, the physical

  15. SSR marker based DNA fingerprinting and diversity study in rice ...

    African Journals Online (AJOL)

    The genetic diversity and DNA fingerprinting of 15 elite rice genotypes using 30 SSR primers on chromosome numbers 7-12 was investigated. The results revealed that all the primers showed distinct polymorphism among the cultivars studied indicating the robust nature of microsatellites in revealing polymorphism. Cluster ...

  16. A primer on motor vehicle air pollution.

    Science.gov (United States)

    1973-01-01

    This primer presents a brief state-of-the art review of motor vehicle air pollution. Its purpose is to aid highway personnel in understanding the nature of this environmental problem on our highways and to present possible solutions for its abatement...

  17. A Primer on Basic Effect Size Concepts.

    Science.gov (United States)

    Elmore, Patricia B.; Rotou, Ourania

    The increased interest in reporting effect sizes means that it is necessary to consider what should be included in a primer on effect sizes. A review of papers on effect sizes and commonly repeated statistical analyses suggests that it is important to discuss effect sizes relative to bivariate correlation, t-tests, analysis of variance/covariance,…

  18. Scrimer: designing primers from transcriptome data

    Czech Academy of Sciences Publication Activity Database

    Mořkovský, Libor; Pačes, Jan; Rídl, Jakub; Reifová, R.

    2015-01-01

    Roč. 15, č. 6 (2015), s. 1415-1420 ISSN 1755-098X R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 ; RVO:68378050 Keywords : next-generation sequencing * primer design * SNaPshot * SNP genotyping * transcriptome Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.298, year: 2015

  19. Forest Interpreter's Primer on Fire Management.

    Science.gov (United States)

    Zelker, Thomas M.

    Specifically prepared for the use of Forest Service field-based interpreters of the management, protection, and use of forest and range resources and the associated human, cultural, and natural history found on these lands, this book is the second in a series of six primers on the multiple use of forest and range resources. Following an…

  20. RAPD analysis of alfalfa DNA mutation via N+ implantation

    International Nuclear Information System (INIS)

    Li Yufeng; Huang Qunce; Yu Zengliang; Liang Yunzhang

    2003-01-01

    Germination capacity of alfalfa seeds under low energy N + implantation manifests oscillations going down with dose strength. From analyzing alfalfa genome DNA under low energy N + implantation by RAPD (Random Amplified Polymorphous DNA), it is recommended that 30 polymorphic DNA fragments be amplified with 8 primers in total 100 primers, and fluorescence intensity of the identical DNA fragment amplified by RAPD is different between CK and treatments. Number of different polymorphic DNA fragments between treatment and CK via N + implantation manifests going up with dose strength

  1. Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

    International Nuclear Information System (INIS)

    Zhan Fangfang; Zhou Xiaoming; Xing Da

    2013-01-01

    Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs–TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: ► A novel method for detection of rotavirus has been developed. ► In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. ► To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. ► The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2′-bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs–TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection. In this study, rotavirus in fecal specimens was successfully detected within 1.5 h. Experimental

  2. Rapid and sensitive electrochemiluminescence detection of rotavirus by magnetic primer based reverse transcription-polymerase chain reaction

    Energy Technology Data Exchange (ETDEWEB)

    Zhan Fangfang; Zhou Xiaoming [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China); Xing Da, E-mail: xingda@scnu.edu.cn [MOE Key Laboratory of Laser Life Science and Institute of Laser Life Science, College of Biophotonics, South China Normal University, Guangzhou 510631 (China)

    2013-01-25

    Graphical abstract: In this work, we have developed and demonstrated a magnetic primer based RT-PCR assay for ECL detection of rotavirus. In the presence of two functional primers (magnetic primer and TBR-primer) and PCR reagents, cDNA from RT was amplified directly onto MPs during PCR cycles of denaturation, annealing and extension. The resulting MPs-TBR complexes were easily loaded on the electrode surface and produced a concentrated ECL signal. The figure shows the schematic illustration of magnetic primer RT-PCR based ECL assay for rotavirus detection. Highlights: Black-Right-Pointing-Pointer A novel method for detection of rotavirus has been developed. Black-Right-Pointing-Pointer In the presence of magnetic primer, TBR-primer and PCR reagents, cDNA form RT was amplified directly onto MPs. Black-Right-Pointing-Pointer To obtain the best sensing and efficient performance, important parameters associated with the efficiency were investigated carefully. Black-Right-Pointing-Pointer The proposed method will find numerous applications in food safety field and clinical diagnosis. - Abstract: A novel method for detection of rotavirus has been developed by integrating magnetic primer based reverse transcription-polymerase chain reaction (RT-PCR) with electrochemiluminescence (ECL) detection. This is realized by accomplishing RT of rotavirus RNA in traditional way and performing PCR of the resulting cDNA fragment on the surface of magnetic particles (MPs). In order to implement PCR on MPs and achieve rapid ECL detection, forward and reverse primers are bounded to MPs and tris-(2,2 Prime -bipyridyl) ruthenium (TBR), respectively. After RT-PCR amplification, the TBR labels are directly enriched onto the surface of MPs. Then the MPs-TBR complexes can be loaded on the electrode surface and analyzed by magnetic ECL platform without any post-modification or post-incubation process. So some laborious manual operations can be avoided to achieve rapid yet sensitive detection

  3. Criticality calculations with MCNP trademark: A primer

    International Nuclear Information System (INIS)

    Harmon, C.D. II; Busch, R.D.; Briesmeister, J.F.; Forster, R.A.

    1994-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst increasingly is required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his/her facility. This primer will help you, the analyst, understand and use the MCNP Monte Carlo code for nuclear criticality safety analyses. It assumes that you have a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with MCNP in particular. Appendix A gives an introduction to Monte Carlo techniques. The primer is designed to teach by example, with each example illustrating two or three features of MCNP that are useful in criticality analyses. Beginning with a Quickstart chapter, the primer gives an overview of the basic requirements for MCNP input and allows you to run a simple criticality problem with MCNP. This chapter is not designed to explain either the input or the MCNP options in detail; but rather it introduces basic concepts that are further explained in following chapters. Each chapter begins with a list of basic objectives that identify the goal of the chapter, and a list of the individual MCNP features that are covered in detail in the unique chapter example problems. It is expected that on completion of the primer you will be comfortable using MCNP in criticality calculations and will be capable of handling 80 to 90 percent of the situations that normally arise in a facility. The primer provides a set of basic input files that you can selectively modify to fit the particular problem at hand

  4. Rust transformation/rust compatible primers

    Science.gov (United States)

    Emeric, Dario A.; Miller, Christopher E.

    1993-01-01

    Proper surface preparation has been the key to obtain good performance by a surface coating. The major obstacle in preparing a corroded or rusted surface is the complete removal of the contaminants and the corrosion products. Sandblasting has been traditionally used to remove the corrosion products before painting. However, sandblasting can be expensive, may be prohibited by local health regulations and is not applicable in every situation. To get around these obstacles, Industry developed rust converters/rust transformers and rust compatible primers (high solids epoxies). The potential use of these products for military equipment led personnel of the Belvoir Research, Development and Engineering Center (BRDEC) to evaluate the commercially available rust transformers and rust compatible primers. Prior laboratory experience with commercially available rust converters, as well as field studies in Hawaii and Puerto Rico, revealed poor performance, several inherent limitations, and lack of reliability. It was obvious from our studies that the performance of rust converting products was more dependent on the amount and type of rust present, as well as the degree of permeability of the coating, than on the product's ability to form an organometallic complex with the rust. Based on these results, it was decided that the Military should develop their own rust converter formulation and specification. The compound described in the specification is for use on a rusted surface before the application of an organic coating (bituminous compounds, primer or topcoat). These coatings should end the need for sandblasting or the removing of the adherent corrosion products. They also will prepare the surface for the application of the organic coating. Several commercially available rust compatible primers (RCP) were also tested using corroded surfaces. All of the evaluated RCP failed our laboratory tests for primers.

  5. PriFi - Using a Multiple Alignment of Related Sequences to Find Primers for  Amplification of Homologs

    DEFF Research Database (Denmark)

    Fredslund, Jakob; Schauser, Leif; Madsen, Lene Heegaard

    2005-01-01

    Using a comparative approach, the web program PriFi (http://cgi-www.daimi.au.dk/cgi-chili/PriFi/main) designs pairs of primers useful for PCR amplification of genomic DNA in species where prior sequence information is not available. The program works with an alignment of DNA sequences from...... of a procedure for developing general markers serving as common anchor loci across species. To accommodate users with special preferences, configuration settings and criteria can be customized....

  6. Detection of Mycosphaerella graminicola in Wheat Leaves by a Microsatellite Dinucleotide Specific-Primer

    Directory of Open Access Journals (Sweden)

    Joseph-Alexander Verreet

    2011-01-01

    Full Text Available Early detection of infection is very important for efficient management of Mycosphaerella graminicola leaf blotch. To monitor and quantify the occurrence of this fungus during the growing season, a diagnostic method based on real-time PCR was developed. Standard and real-time PCR assays were developed using SYBR Green chemistry to quantify M. graminicola in vitro or in wheat samples. Microsatellite dinucleotide specific-primers were designed based on microsatellite repeats of sequences present in the genome of M. graminicola. Specificity was checked by analyzing DNA of 55 M. graminicola isolates obtained from different geographical origins. The method appears to be highly specific for detecting M. graminicola; no fluorescent signals were observed from 14 other closely related taxa. Primer (CT 7 G amplified a specific amplicon of 570 bp from all M. graminicola isolates. The primers did not amplify DNA extracted from 14 other fungal species. The approximate melting temperature (Tm of the (CT 7 G primer was 84.2 °C. The detection limit of the real-time PCR assay with the primer sets (CT 7 G is 10 fg/25 µL, as compared to 10 pg/25 µL using conventional PCR technology. From symptomless leaves, a PCR fragment could be generated two days after inoculation. Both conventional and real-time PCR could successfully detect the fungus from artificially inoculated wheat leaves. However, real-time PCR appeared much more sensitive than conventional PCR. The developed quantitative real-time PCR method proved to be rapid, sensitive, specific, cost-effective and reliable for the identification and quantification of M. graminicola in wheat.

  7. Economics : pricing, demand, and economic efficiency : a primer.

    Science.gov (United States)

    2008-11-01

    The Congestion Pricing Primer Series is part of : FHWAs outreach efforts to introduce the various : aspects of congestion pricing to decision-makers and : transportation professionals in the United States. The : primers are intended to lay out the...

  8. Primer on consumer marketing research : procedures, methods, and tools

    Science.gov (United States)

    1994-03-01

    The Volpe Center developed a marketing research primer which provides a guide to the approach, procedures, and research tools used by private industry in predicting consumer response. The final two chapters of the primer focus on the challenges of do...

  9. Method for priming and DNA sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Mugasimangalam, R.C.; Ulanovsky, L.E.

    1997-12-01

    A method is presented for improving the priming specificity of an oligonucleotide primer that is non-unique in a nucleic acid template which includes selecting a continuous stretch of several nucleotides in the template DNA where one of the four bases does not occur in the stretch. This also includes bringing the template DNA in contract with a non-unique primer partially or fully complimentary to the sequence immediately upstream of the selected sequence stretch. This results in polymerase-mediated differential extension of the primer in the presence of a subset of deoxyribonucleotide triphosphates that does not contain the base complementary to the base absent in the selected sequence stretch. These reactions occur at a temperature sufficiently low for allowing the extension of the non-unique primer. The method causes polymerase-mediated extension reactions in the presence of all four natural deoxyribonucleotide triphosphates or modifications. At this high temperature discrimination occurs against priming sites of the non-unique primer where the differential extension has not made the primer sufficiently stable to prime. However, the primer extended at the selected stretch is sufficiently stable to prime.

  10. Optimization Of ISSR Markers For DNA Fingerprinting In Stevia Rebaudiana Bertoni

    International Nuclear Information System (INIS)

    Lyena Watty Zuraine Ahmad; Lyena Watty Zuraine Ahmad; Azhar Mohamad; Mohamad Osman; Zarina Zainuddin; Fatin Izzati Mohd Khari

    2014-01-01

    ISSR or inter-simple sequence repeat is PCR based markers which required no prior DNA sequence knowledge of the studied organism. It has been proved to overcome limitations in other genetic marker techniques. In this study, 100 ISSR primers which comprised of 80 specific primers and 20 degenerate primers were used. All of the primers were tested on gradient temperatures from 45-55 degree Celsius. For positive amplification, 62 specific primers (77.5 %) and 18 degenerate primers (90.0 %) were recorded as working primers. The most efficient temperature for 25 primers was 55 degree Celsius. Marker derived from ISSR profiling is a powerful approach for identification and molecular classification of Stevia rebaudiana bertoni. (author)

  11. Removal of PCR error products and unincorporated primers by metal-chelate affinity chromatography.

    Directory of Open Access Journals (Sweden)

    Indhu Kanakaraj

    Full Text Available Immobilized Metal Affinity Chromatography (IMAC has been used for decades to purify proteins on the basis of amino acid content, especially surface-exposed histidines and "histidine tags" genetically added to recombinant proteins. We and others have extended the use of IMAC to purification of nucleic acids via interactions with the nucleotide bases, especially purines, of single-stranded RNA and DNA. We also have demonstrated the purification of plasmid DNA from contaminating genomic DNA by IMAC capture of selectively-denatured genomic DNA. Here we describe an efficient method of purifying PCR products by specifically removing error products, excess primers, and unincorporated dNTPs from PCR product mixtures using flow-through metal-chelate affinity adsorption. By flowing a PCR product mixture through a Cu(2+-iminodiacetic acid (IDA agarose spin column, 94-99% of the dNTPs and nearly all the primers can be removed. Many of the error products commonly formed by Taq polymerase also are removed. Sequencing of the IMAC-processed PCR product gave base-calling accuracy comparable to that obtained with a commercial PCR product purification method. The results show that IMAC matrices (specifically Cu(2+-IDA agarose can be used for the purification of PCR products. Due to the generality of the base-specific mechanism of adsorption, IMAC matrices may also be used in the purification of oligonucleotides, cDNA, mRNA and micro RNAs.

  12. Bioinformatic tools and guideline for PCR primer design | Abd ...

    African Journals Online (AJOL)

    Bioinformatics has become an essential tool not only for basic research but also for applied research in biotechnology and biomedical sciences. Optimal primer sequence and appropriate primer concentration are essential for maximal specificity and efficiency of PCR. A poorly designed primer can result in little or no ...

  13. Novel oligonucleotide primers reveal a high diversity of microbes which drive phosphorous turnover in soil.

    Science.gov (United States)

    Bergkemper, Fabian; Kublik, Susanne; Lang, Friederike; Krüger, Jaane; Vestergaard, Gisle; Schloter, Michael; Schulz, Stefanie

    2016-06-01

    Phosphorus (P) is of central importance for cellular life but likewise a limiting macronutrient in numerous environments. Certainly microorganisms have proven their ability to increase the phosphorus bioavailability by mineralization of organic-P and solubilization of inorganic-P. On the other hand they efficiently take up P and compete with other biota for phosphorus. However the actual microbial community that is associated to the turnover of this crucial macronutrient in different ecosystems remains largely anonymous especially taking effects of seasonality and spatial heterogeneity into account. In this study seven oligonucleotide primers are presented which target genes coding for microbial acid and alkaline phosphatases (phoN, phoD), phytases (appA), phosphonatases (phnX) as well as the quinoprotein glucose dehydrogenase (gcd) and different P transporters (pitA, pstS). Illumina amplicon sequencing of soil genomic DNA underlined the high rate of primer specificity towards the respective target gene which usually ranged between 98% and 100% (phoN: 87%). As expected the primers amplified genes from a broad diversity of distinct microorganisms. Using DNA from a beech dominated forest soil, the highest microbial diversity was detected for the alkaline phosphatase (phoD) gene which was amplified from 15 distinct phyla respectively 81 families. Noteworthy the primers also allowed amplification of phoD from 6 fungal orders. The genes coding for acid phosphatase (phoN) and the quinoprotein glucose dehydrogenase (gcd) were amplified from 20 respectively 17 different microbial orders. In comparison the phytase and phosphonatase (appA, phnX) primers covered 13 bacterial orders from 2 different phyla respectively. Although the amplified microbial diversity was apparently limited both primers reliably detected all orders that contributed to the P turnover in the investigated soil as revealed by a previous metagenomic approach. Genes that code for microbial P transporter

  14. The use of coded PCR primers enables high-throughput sequencing of multiple homolog amplification products by 454 parallel sequencing.

    Directory of Open Access Journals (Sweden)

    Jonas Binladen

    2007-02-01

    Full Text Available The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR reactions and subsequent sequencing runs have been unable to combine template DNA from multiple individuals, as homologous sequences cannot be subsequently assigned to their original sources.We use conventional PCR with 5'-nucleotide tagged primers to generate homologous DNA amplification products from multiple specimens, followed by sequencing through the high-throughput Genome Sequence 20 DNA Sequencing System (GS20, Roche/454 Life Sciences. Each DNA sequence is subsequently traced back to its individual source through 5'tag-analysis.We demonstrate that this new approach enables the assignment of virtually all the generated DNA sequences to the correct source once sequencing anomalies are accounted for (miss-assignment rate<0.4%. Therefore, the method enables accurate sequencing and assignment of homologous DNA sequences from multiple sources in single high-throughput GS20 run. We observe a bias in the distribution of the differently tagged primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution of the sequences as sorted by the second nucleotide of the dinucleotide tags. As the results are based on a single GS20 run, the general applicability of the approach requires confirmation. However, our experiments demonstrate that 5'primer tagging is a useful method in which the sequencing power of the GS20 can be applied to PCR-based assays of multiple homologous PCR products. The new approach will be of value to a broad range of research areas, such as those of comparative genomics, complete mitochondrial

  15. Blocking human contaminant DNA during PCR allows amplification of rare mammal species from sedimentary ancient DNA

    DEFF Research Database (Denmark)

    Boessenkool, Sanne; Epp, Laura S.; Haile, James Seymour

    2012-01-01

    the amplification of contaminant sequences to such an extent that retrieval of the endogenous DNA is severely restricted. The application of blocking primers is a promising tool to avoid this bias and can greatly enhance the quantity and the diversity of the endogenous DNA sequences that are amplified....

  16. DESAIN PRIMER UNTUK AMPLIFIKASI FRAGMEN GEN inhA ISOLAT 134 MULTIDRUG RESISTANCE TUBERCULOSIS (MDR-TB DENGAN METODE POLYMERASE CHAIN REACTION

    Directory of Open Access Journals (Sweden)

    Luk Ketut Budi Maitriani

    2015-10-01

    Full Text Available ABSTRAK    : Penelitian ini bertujuan untuk memperoleh sepasang primer terbaik hasil desain secara in silico menggunakan program Clone Manager Suite 6 (University of Groningen. Primer ini didesain untuk digunakan dalam mengamplifikasi fragmen gen inhA isolat klinis Multidrug Resistance Tuberculosis (MDR-TB mencakup kodon 94 (nukleotida 280-282. Kodon 94 gen inhA merupakan posisi yang sering mengalami mutasi dan mengakibatkan koresisten terhadap isoniazid dan ethionamid. Desain primer menggunakan sekuen gen inhA Mycobacterium tuberculosis yang diperoleh dari situs www.ncbi.nlm.nih.gov (GenBank : AF106077. Hasil desain diperoleh sepasang primer terbaik dan diuji secara in vitro menggunakan metode Polymerase Chain Reaction (PCR. Template DNA yang digunakan adalah isolat klinis MDR-TB. Proses amplifikasi diawali dengan denaturasi awal pada 95°C selama 15 menit dan diikuti oleh 45 siklus amplifikasi (denaturasi pada suhu 94°C selama 1 menit, annealing pada 56°C selama 1 menit 20 detik dan elongasi pada 72°C selama 2 menit serta diakhiri dengan elongasi akhir pada 72°C selama 10 menit. Produk PCR dideteksi menggunakan elektroforesis gel agarosa 1,5%. Kesimpulan penelitian adalah diperoleh sepasang primer terbaik berdasarkan kriteria pada program Clone Manager Suite 6 (University of Groningen, meliputi: panjang primer, %GC, Tm (melting temperature, interaksi primer (dimers dan hairpins, stabilitas primer, repeats, runs dan false priming. Primer tersebut meliputi, primer forward (pF-inhA 5’ CTGGTTAGCGGAATCATCAC 3’ dan primer reverse (pR-inhA 5’ CGACCGTCATCCA-GTTGTA 3’ dengan ukuran produk 460 pb.   ABSTRACT: The aim of this study was to obtain the best pair of primer as result in silico design using Clone Manager Suite 6 program (University of Groningen. The primer was designed for amplifying inhA gene fragment of Multidrug Resistance Tuberculosis (MDR-TB clinical isolates include codon 94 (nucleotide 280-282. Codon 94 of inhA gene is

  17. The use of coded PCR primers enables high-throughput sequencing of multiple homolog amplification products by 454 parallel sequencing

    DEFF Research Database (Denmark)

    Binladen, Jonas; Gilbert, M Thomas P; Bollback, Jonathan P

    2007-01-01

    BACKGROUND: The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform) has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR) reactions and subsequent sequencing runs have been unable to combine...... primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution...

  18. A new set of primers for the detection of Toxoplasma gondii in amniotic fluid using polymerase chain reaction.

    Science.gov (United States)

    Pelloux, H; Weiss, J; Simon, J; Muet, F; Fricker-Hidalgo, H; Goullier-Fleuret, A; Ambroise-Thomas, P

    1996-04-15

    A new PCR system including a pair of primers, a probe and an internal control were designed from the B1 gene of Toxoplasma gondii. The system described allowed the detection of less than 10 tachyzoites of the RH strain of T. gondii. Among 21 amniotic fluid samples, this system diagnosed the cases of congenital toxoplasmosis which were simultaneously diagnosed using mice inoculation, in vitro culture, and serology from both amniotic fluid and fetal blood. These results show that these new primers allow for a highly sensitive detection of T. gondii DNA.

  19. CRISPR Primer Designer: Design primers for knockout and chromosome imaging CRISPR-Cas system.

    Science.gov (United States)

    Yan, Meng; Zhou, Shi-Rong; Xue, Hong-Wei

    2015-07-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated system enables biologists to edit genomes precisely and provides a powerful tool for perturbing endogenous gene regulation, modulation of epigenetic markers, and genome architecture. However, there are concerns about the specificity of the system, especially the usages of knocking out a gene. Previous designing tools either were mostly built-in websites or ran as command-line programs, and none of them ran locally and acquired a user-friendly interface. In addition, with the development of CRISPR-derived systems, such as chromosome imaging, there were still no tools helping users to generate specific end-user spacers. We herein present CRISPR Primer Designer for researchers to design primers for CRISPR applications. The program has a user-friendly interface, can analyze the BLAST results by using multiple parameters, score for each candidate spacer, and generate the primers when using a certain plasmid. In addition, CRISPR Primer Designer runs locally and can be used to search spacer clusters, and exports primers for the CRISPR-Cas system-based chromosome imaging system. © 2014 Institute of Botany, Chinese Academy of Sciences.

  20. Impact of DNA3'pp5'G capping on repair reactions at DNA 3' ends.

    Science.gov (United States)

    Das, Ushati; Chauleau, Mathieu; Ordonez, Heather; Shuman, Stewart

    2014-08-05

    Many biological scenarios generate "dirty" DNA 3'-PO4 ends that cannot be sealed by classic DNA ligases or extended by DNA polymerases. The noncanonical ligase RtcB can "cap" these ends via a unique chemical mechanism entailing transfer of GMP from a covalent RtcB-GMP intermediate to a DNA 3'-PO4 to form DNA3'pp5'G. Here, we show that capping protects DNA 3' ends from resection by Escherichia coli exonucleases I and III and from end-healing by T4 polynucleotide 3' phosphatase. By contrast, the cap is an effective primer for DNA synthesis. E. coli DNA polymerase I and Mycobacterium DinB1 extend the DNAppG primer to form an alkali-labile DNApp(rG)pDNA product. The addition of dNTP depends on pairing of the cap guanine with an opposing cytosine in the template strand. Aprataxin, an enzyme implicated in repair of A5'pp5'DNA ends formed during abortive ligation by classic ligases, is highly effective as a DNA 3' decapping enzyme, converting DNAppG to DNA3'p and GMP. We conclude that the biochemical impact of DNA capping is to prevent resection and healing of a 3'-PO4 end, while permitting DNA synthesis, at the price of embedding a ribonucleotide and a pyrophosphate linkage in the repaired strand. Aprataxin affords a means to counter the impact of DNA capping.

  1. Bacillus subtilis DNA polymerases, PolC and DnaE, are required for both leading and lagging strand synthesis in SPP1 origin-dependent DNA replication

    Science.gov (United States)

    Seco, Elena M.

    2017-01-01

    Abstract Firmicutes have two distinct replicative DNA polymerases, the PolC leading strand polymerase, and PolC and DnaE synthesizing the lagging strand. We have reconstituted in vitro Bacillus subtilis bacteriophage SPP1 θ-type DNA replication, which initiates unidirectionally at oriL. With this system we show that DnaE is not only restricted to lagging strand synthesis as previously suggested. DnaG primase and DnaE polymerase are required for initiation of DNA replication on both strands. DnaE and DnaG synthesize in concert a hybrid RNA/DNA ‘initiation primer’ on both leading and lagging strands at the SPP1 oriL region, as it does the eukaryotic Pol α complex. DnaE, as a RNA-primed DNA polymerase, extends this initial primer in a reaction modulated by DnaG and one single-strand binding protein (SSB, SsbA or G36P), and hands off the initiation primer to PolC, a DNA-primed DNA polymerase. Then, PolC, stimulated by DnaG and the SSBs, performs the bulk of DNA chain elongation at both leading and lagging strands. Overall, these modulations by the SSBs and DnaG may contribute to the mechanism of polymerase switch at Firmicutes replisomes. PMID:28575448

  2. Differentiation of mycoplasmalike organisms (MLOs) in European fruit trees by PCR using specific primers derived from the sequence of a chromosomal fragment of the apple proliferation MLO.

    Science.gov (United States)

    Jarausch, W; Saillard, C; Dosba, F; Bové, J M

    1994-01-01

    A 1.8-kb chromosomal DNA fragment of the mycoplasmalike organism (MLO) associated with apple proliferation was sequenced. Three putative open reading frames were observed on this fragment. The protein encoded by open reading frame 2 shows significant homologies with bacterial nitroreductases. From the nucleotide sequence four primer pairs for PCR were chosen to specifically amplify DNA from MLOs associated with European diseases of fruit trees. Primer pairs specific for (i) Malus-affecting MLOs, (ii) Malus- and Prunus-affecting MLOs, and (iii) Malus-, Prunus-, and Pyrus-affecting MLOs were obtained. Restriction enzyme analysis of the amplification products revealed restriction fragment length polymorphisms between Malus-, Prunus, and Pyrus-affecting MLOs as well as between different isolates of the apple proliferation MLO. No amplification with either primer pair could be obtained with DNA from 12 different MLOs experimentally maintained in periwinkle. Images PMID:7916180

  3. Modified Proofreading PCR for Detection of Point Mutations, Insertions and Deletions Using a ddNTP-Blocked Primer

    Science.gov (United States)

    Chen, Qianqian; Chen, Xiaoxiang; Zhang, Sichao; Lan, Ke; Lu, Jian; Zhang, Chiyu

    2015-01-01

    The development of simple, accurate, rapid and cost-effective technologies for mutation detection is crucial to the early diagnosis and prevention of numerous genetic diseases, pharmacogenetics, and drug resistance. Proofreading PCR (PR-PCR) was developed for mutation detection in 1998 but is rarely applied due to its low efficiency in allele discrimination. Here we developed a modified PR-PCR method using a ddNTP-blocked primer and a mixture of DNA polymerases with and without the 3'-5' proofreading function. The ddNTP-blocked primer exhibited the best blocking efficiency to avoid nonspecific primer extension while the mixture of a tiny amount of high-fidelity DNA polymerase with a routine amount of Taq DNA polymerase provided the best discrimination and amplification effects. The modified PR-PCR method is quite capable of detecting various mutation types, including point mutations and insertions/deletions (indels), and allows discrimination amplification when the mismatch is located within the last eight nucleotides from the 3'-end of the ddNTP-blocked primer. The modified PR-PCR has a sensitivity of 1-5 × 102 copies and a selectivity of 5 × 10-5 mutant among 107 copies of wild-type DNA. It showed a 100% accuracy rate in the detection of P72R germ-line mutation in the TP53 gene among 60 clinical blood samples, and a high potential to detect rifampin-resistant mutations at low frequency in Mycobacterium tuberculosis using an adaptor and a fusion-blocked primer. These results suggest that the modified PR-PCR technique is effective in detection of various mutations or polymorphisms as a simple, sensitive and promising approach. PMID:25915410

  4. High-throughput sequencing of 16S rRNA gene amplicons: effects of extraction procedure, primer length and annealing temperature.

    Science.gov (United States)

    Sergeant, Martin J; Constantinidou, Chrystala; Cogan, Tristan; Penn, Charles W; Pallen, Mark J

    2012-01-01

    The analysis of 16S-rDNA sequences to assess the bacterial community composition of a sample is a widely used technique that has increased with the advent of high throughput sequencing. Although considerable effort has been devoted to identifying the most informative region of the 16S gene and the optimal informatics procedures to process the data, little attention has been paid to the PCR step, in particular annealing temperature and primer length. To address this, amplicons derived from 16S-rDNA were generated from chicken caecal content DNA using different annealing temperatures, primers and different DNA extraction procedures. The amplicons were pyrosequenced to determine the optimal protocols for capture of maximum bacterial diversity from a chicken caecal sample. Even at very low annealing temperatures there was little effect on the community structure, although the abundance of some OTUs such as Bifidobacterium increased. Using shorter primers did not reveal any novel OTUs but did change the community profile obtained. Mechanical disruption of the sample by bead beating had a significant effect on the results obtained, as did repeated freezing and thawing. In conclusion, existing primers and standard annealing temperatures captured as much diversity as lower annealing temperatures and shorter primers.

  5. Low-copy nuclear primers and ycf1 primers in Cactaceae.

    Science.gov (United States)

    Franck, Alan R; Cochrane, Bruce J; Garey, James R

    2012-10-01

    To increase the number of variable regions available for phylogenetic study in the Cactaceae, primers were developed for a portion of the plastid ycf1 gene and intron-spanning regions of two low-copy nuclear genes (isi1, nhx1). • Primers were tested on several families within Caryophyllales, focusing on the Cactaceae. Gel electrophoresis indicated positive amplification in most samples. Sequences of these three regions (isi1, nhx1, ycf1) from Harrisia exhibited variation similar to or greater than two plastid regions (atpB-rbcL intergenic spacer and rpl16 intron). • The isi, nhx, and ycf1 primers amplify phylogenetically useful information applicable to the Cactaceae and other families in the Caryophyllales.

  6. Ancient DNA

    DEFF Research Database (Denmark)

    Willerslev, Eske; Cooper, Alan

    2004-01-01

    ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair......ancient DNA, palaeontology, palaeoecology, archaeology, population genetics, DNA damage and repair...

  7. A method for automatically extracting infectious disease-related primers and probes from the literature

    Directory of Open Access Journals (Sweden)

    Pérez-Rey David

    2010-08-01

    Full Text Available Abstract Background Primer and probe sequences are the main components of nucleic acid-based detection systems. Biologists use primers and probes for different tasks, some related to the diagnosis and prescription of infectious diseases. The biological literature is the main information source for empirically validated primer and probe sequences. Therefore, it is becoming increasingly important for researchers to navigate this important information. In this paper, we present a four-phase method for extracting and annotating primer/probe sequences from the literature. These phases are: (1 convert each document into a tree of paper sections, (2 detect the candidate sequences using a set of finite state machine-based recognizers, (3 refine problem sequences using a rule-based expert system, and (4 annotate the extracted sequences with their related organism/gene information. Results We tested our approach using a test set composed of 297 manuscripts. The extracted sequences and their organism/gene annotations were manually evaluated by a panel of molecular biologists. The results of the evaluation show that our approach is suitable for automatically extracting DNA sequences, achieving precision/recall rates of 97.98% and 95.77%, respectively. In addition, 76.66% of the detected sequences were correctly annotated with their organism name. The system also provided correct gene-related information for 46.18% of the sequences assigned a correct organism name. Conclusions We believe that the proposed method can facilitate routine tasks for biomedical researchers using molecular methods to diagnose and prescribe different infectious diseases. In addition, the proposed method can be expanded to detect and extract other biological sequences from the literature. The extracted information can also be used to readily update available primer/probe databases or to create new databases from scratch.

  8. Bayesian models a statistical primer for ecologists

    CERN Document Server

    Hobbs, N Thompson

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods-in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach. Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probabili

  9. Signals and systems primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2006-01-01

    Signals and Systems Primer with MATLAB® equally emphasizes the fundamentals of both analog and digital signals and systems. To ensure insight into the basic concepts and methods, the text presents a variety of examples that illustrate a wide range of applications, from microelectromechanical to worldwide communication systems. It also provides MATLAB functions and procedures for practice and verification of these concepts.Taking a pedagogical approach, the author builds a solid foundation in signal processing as well as analog and digital systems. The book first introduces orthogonal signals,

  10. The replisome uses mRNA as a primer after colliding with RNA polymerase.

    Science.gov (United States)

    Pomerantz, Richard T; O'Donnell, Mike

    2008-12-11

    Replication forks are impeded by DNA damage and protein-nucleic acid complexes such as transcribing RNA polymerase. For example, head-on collision of the replisome with RNA polymerase results in replication fork arrest. However, co-directional collision of the replisome with RNA polymerase has little or no effect on fork progression. Here we examine co-directional collisions between a replisome and RNA polymerase in vitro. We show that the Escherichia coli replisome uses the RNA transcript as a primer to continue leading-strand synthesis after the collision with RNA polymerase that is displaced from the DNA. This action results in a discontinuity in the leading strand, yet the replisome remains intact and bound to DNA during the entire process. These findings underscore the notable plasticity by which the replisome operates to circumvent obstacles in its path and may explain why the leading strand is synthesized discontinuously in vivo.

  11. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    International Nuclear Information System (INIS)

    Jothikumar, N.; Hill, Vincent R.

    2013-01-01

    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

  12. A novel photoinduced electron transfer (PET) primer technique for rapid real-time PCR detection of Cryptosporidium spp

    Energy Technology Data Exchange (ETDEWEB)

    Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.

    2013-06-28

    Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forward or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource

  13. Primer on CDM programme of activities

    Energy Technology Data Exchange (ETDEWEB)

    Hinostroza, M. (UNEP Risoe Centre, Roskilde (Denmark)); Lescano, A.D. (A2G Carbon Partners (Peru)); Alvarez, J.M. (Ministerio del Ambiente del Peru (Peru)); Avendano, F.M. (EEA Fund Management Ltd. (United Kingdom)

    2009-07-01

    As an advanced modality introduced in 2005, the Programmatic CDM (POA) is expected to address asymmetries of participation, especially of very small-scale project activities in certain areas, key sectors and many countries with considerable potential for greenhouse gas emission reductions, not reached by the traditional single-project-based CDM. Latest experiences with POAs and the recently finalized official guidance governing the Programmatic CDM are the grassroots of this Primer, which has the purpose of supporting the fully understanding of rules and procedures of POAs by interpreting them and analyzing real POA cases. Professional and experts from the public and private entities have contributed to the development of this Primer, produced by the UNEP Risoe Centre, as part of knowledge support activities for the Capacity Development for the CDM (CD4CDM) project. The overall objective of the CD4CDM is to develop the capacities of host countries to identify, design, approve, finance, implement CDM projects and commercialize CERs in participating countries. The CDM4CDM is funded by the Netherlands Ministry of Foreign Affairs. (author)

  14. Bayesian models: A statistical primer for ecologists

    Science.gov (United States)

    Hobbs, N. Thompson; Hooten, Mevin B.

    2015-01-01

    Bayesian modeling has become an indispensable tool for ecological research because it is uniquely suited to deal with complexity in a statistically coherent way. This textbook provides a comprehensive and accessible introduction to the latest Bayesian methods—in language ecologists can understand. Unlike other books on the subject, this one emphasizes the principles behind the computations, giving ecologists a big-picture understanding of how to implement this powerful statistical approach.Bayesian Models is an essential primer for non-statisticians. It begins with a definition of probability and develops a step-by-step sequence of connected ideas, including basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and inference from single and multiple models. This unique book places less emphasis on computer coding, favoring instead a concise presentation of the mathematical statistics needed to understand how and why Bayesian analysis works. It also explains how to write out properly formulated hierarchical Bayesian models and use them in computing, research papers, and proposals.This primer enables ecologists to understand the statistical principles behind Bayesian modeling and apply them to research, teaching, policy, and management.Presents the mathematical and statistical foundations of Bayesian modeling in language accessible to non-statisticiansCovers basic distribution theory, network diagrams, hierarchical models, Markov chain Monte Carlo, and moreDeemphasizes computer coding in favor of basic principlesExplains how to write out properly factored statistical expressions representing Bayesian models

  15. Medium Caliber Lead-Free Electric Primer. Version 2

    Science.gov (United States)

    2012-09-01

    2008). Safe Drinking Water Act of 1986 lists lead compounds as carcinogens (27 CCR 27001 – Dec. 2008). EPA began a Phase I assessment to determine...primer cups was our standard method, wet loading using solvents (hexane and iso -propanol) was investigated to reduce risk of accidental ignition...LOADING OPERATION (Single Die) Wet primer mix charge with solvent (Hexane/ Iso -Propanol) and stir to mix to a uniform slurry Insert primer cup in

  16. LAVA: An Open-Source Approach To Designing LAMP (Loop-Mediated Isothermal Amplification DNA Signatures

    Directory of Open Access Journals (Sweden)

    Gardner Shea N

    2011-06-01

    Full Text Available Abstract Background We developed an extendable open-source Loop-mediated isothermal AMPlification (LAMP signature design program called LAVA (LAMP Assay Versatile Analysis. LAVA was created in response to limitations of existing LAMP signature programs. Results LAVA identifies combinations of six primer regions for basic LAMP signatures, or combinations of eight primer regions for LAMP signatures with loop primers, which can be used as LAMP signatures. The identified primers are conserved among target organism sequences. Primer combinations are optimized based on lengths, melting temperatures, and spacing among primer sites. We compare LAMP signature candidates for Staphylococcus aureus created both by LAVA and by PrimerExplorer. We also include signatures from a sample run targeting all strains of Mycobacterium tuberculosis. Conclusions We have designed and demonstrated new software for identifying signature candidates appropriate for LAMP assays. The software is available for download at http://lava-dna.googlecode.com/.

  17. High-speed measurement of firearm primer blast waves

    OpenAIRE

    Courtney, Michael; Daviscourt, Joshua; Eng, Jonathan; Courtney, Amy

    2012-01-01

    This article describes a method and results for direct high-speed measurements of firearm primer blast waves employing a high-speed pressure transducer located at the muzzle to record the blast pressure wave produced by primer ignition. Key findings are: 1) Most of the lead styphnate based primer models tested show 5.2-11.3% standard deviation in the magnitudes of their peak pressure. 2) In contrast, lead-free diazodinitrophenol (DDNP) based primers had standard deviations of the peak blast p...

  18. Brownfields Technology Primer: Selecting and Using Phytoremediation for Site Cleanup

    Science.gov (United States)

    This primer explains the phytoremediation process, discusses the potential advantages and considerations in selecting phytoremediation to clean up brownfields sites, and provides information on additional resources about phytoremediation.

  19. An Evolutionary/Biochemical Connection Between Promoter- and Primer-Dependent Polymerases Revealed by Selective Evolution of Ligands by Exponential Enrichment (SELEX).

    Science.gov (United States)

    Fenstermacher, Katherine J; Achuthan, Vasudevan; Schneider, Thomas D; DeStefano, Jeffrey J

    2018-01-16

    DNA polymerases (DNAPs) recognize 3' recessed termini on duplex DNA and carry out nucleotide catalysis. Unlike promoter-specific RNA polymerases (RNAPs), no sequence specificity is required for binding or initiation of catalysis. Despite this, previous results indicate that viral reverse transcriptases bind much more tightly to DNA primers that mimic the polypurine tract. In the current report, primer sequences that bind with high affinity to Taq and Klenow polymerases were identified using a modified Selective Evolution of Ligands by Exponential Enrichment (SELEX) approach. Two Taq -specific primers that bound ∼10 (Taq1) and over 100 (Taq2) times more stably than controls to Taq were identified. Taq1 contained 8 nucleotides (5' -CACTAAAG-3') that matched the phage T3 RNAP "core" promoter. Both primers dramatically outcompeted primers with similar binding thermodynamics in PCR reactions. Similarly, exonuclease minus Klenow polymerase also selected a high affinity primer that contained a related core promoter sequence from phage T7 RNAP (5' -ACTATAG-3'). For both Taq and Klenow, even small modifications to the sequence resulted in large losses in binding affinity suggesting that binding was highly sequence-specific. The results are discussed in the context of possible effects on multi-primer (multiplex) PCR assays, molecular information theory, and the evolution of RNAPs and DNAPs. Importance This work further demonstrates that primer-dependent DNA polymerases can have strong sequence biases leading to dramatically tighter binding to specific sequences. These may be related to biological function, or be a consequences of the structural architecture of the enzyme. New sequence specificity for Taq and Klenow polymerases were uncovered and among them were sequences that contained the core promoter elements from T3 and T7 phage RNA polymerase promoters. This suggests the intriguing possibility that phage RNA polymerases exploited intrinsic binding affinities of

  20. Great Lakes rivermouths: a primer for managers

    Science.gov (United States)

    Pebbles, Victoria; Larson, James; Seelbach, Paul; Pebbles, Victoria; Larson, James; Seelbach, Paul

    2013-01-01

    Between the North American Great Lakes and their tributaries are the places where the confluence of river and lake waters creates a distinct ecosystem: the rivermouth ecosystem. Human development has often centered around these rivermouths, in part, because they provide a rich array of ecosystem services. Not surprisingly, centuries of intense human activity have led to substantial pressures on, and alterations to, these ecosystems, often diminishing or degrading their ecological functions and associated ecological services. Many Great Lakes rivermouths are the focus of intense restoration efforts. For example, 36 of the active Great Lakes Areas of Concern (AOCs) are rivermouths or areas that include one or more rivermouths. Historically, research of rivermouth ecosystems has been piecemeal, focused on the Great Lakes proper or on the upper reaches of tributaries, with little direct study of the rivermouth itself. Researchers have been divided among disciplines, agencies and institutions; and they often work independently and use disparate venues to communicate their work. Management has also been fragmented with a focus on smaller, localized, sub-habitat units and socio-political or economic elements, rather than system-level consideration. This Primer presents the case for a more holistic approach to rivermouth science and management that can enable restoration of ecosystem services with multiple benefits to humans and the Great Lakes ecosystem. A conceptual model is presented with supporting text that describes the structures and processes common to all rivermouths, substantiating the case for treating these ecosystems as an identifiable class.1 Ecological services provided by rivermouths and changes in how humans value those services over time are illustrated through case studies of two Great Lakes rivermouths—the St. Louis River and the Maumee River. Specific ecosystem services are identified in italics throughout this Primer and follow definitions described

  1. Modified Primers for the Identification of Nonpathogenic Fusarium oxysporum Isolates That Have Biological Control Potential against Fusarium Wilt of Cucumber in Taiwan

    Science.gov (United States)

    Wang, Chaojen; Lin, Yisheng; Lin, Yinghong; Chung, Wenhsin

    2013-01-01

    Previous investigations demonstrated that Fusarium oxysporum (Fo), which is not pathogenic to cucumbers, could serve as a biological control agent for managing Fusarium wilt of cucumber caused by Fo f. sp. cucumerinum (Foc) in Taiwan. However, thus far it has not been possible to separate the populations of pathogenic Fo from the nonpathogenic isolates that have biological control potential through their morphological characteristics. Although these two populations can be distinguished from one another using a bioassay, the work is laborious and time-consuming. In this study, a fragment of the intergenic spacer (IGS) region of ribosomal DNA from an Fo biological control agent, Fo366, was PCR-amplified with published general primers, FIGS11/FIGS12 and sequenced. A new primer, NPIGS-R, which was designed based on the IGS sequence, was paired with the FIGS11 primer. These primers were then evaluated for their specificity to amplify DNA from nonpathogenic Fo isolates that have biological control potential. The results showed that the modified primer pair, FIGS11/NPIGS-R, amplified a 500-bp DNA fragment from five of seven nonpathogenic Fo isolates. These five Fo isolates delayed symptom development of cucumber Fusarium wilt in greenhouse bioassay tests. Seventy-seven Fo isolates were obtained from the soil and plant tissues and then subjected to amplification using the modified primer pair; six samples showed positive amplification. These six isolates did not cause symptoms on cucumber seedlings when grown in peat moss infested with the isolates and delayed disease development when the same plants were subsequently inoculated with a virulent isolate of Foc. Therefore, the modified primer pair may prove useful for the identification of Fo isolates that are nonpathogenic to cucumber which can potentially act as biocontrol agents for Fusarium wilt of cucumber. PMID:23762289

  2. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2015-01-01

    This primer offers readers an introduction to the central concepts that form our modern understanding of complex and emergent behavior, together with detailed coverage of accompanying mathematical methods. All calculations are presented step by step and are easy to follow. This new fourth edition has been fully reorganized and includes new chapters, figures and exercises. The core aspects of modern complex system sciences are presented in the first chapters, covering network theory, dynamical systems, bifurcation and catastrophe theory, chaos and adaptive processes, together with the principle of self-organization in reaction-diffusion systems and social animals. Modern information theoretical principles are treated in further chapters, together with the concept of self-organized criticality, gene regulation networks, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase transitions and the cognitive system approach to the brain. Technical course prerequisites are the standard ...

  3. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2007-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  4. Complex and Adaptive Dynamical Systems A Primer

    CERN Document Server

    Gros, Claudius

    2011-01-01

    We are living in an ever more complex world, an epoch where human actions can accordingly acquire far-reaching potentialities. Complex and adaptive dynamical systems are ubiquitous in the world surrounding us and require us to adapt to new realities and the way of dealing with them. This primer has been developed with the aim of conveying a wide range of "commons-sense" knowledge in the field of quantitative complex system science at an introductory level, providing an entry point to this both fascinating and vitally important subject. The approach is modular and phenomenology driven. Examples of emerging phenomena of generic importance treated in this book are: -- The small world phenomenon in social and scale-free networks. -- Phase transitions and self-organized criticality in adaptive systems. -- Life at the edge of chaos and coevolutionary avalanches resulting from the unfolding of all living. -- The concept of living dynamical systems and emotional diffusive control within cognitive system theory. Techn...

  5. Complex and adaptive dynamical systems a primer

    CERN Document Server

    Gros, Claudius

    2013-01-01

    Complex system theory is rapidly developing and gaining importance, providing tools and concepts central to our modern understanding of emergent phenomena. This primer offers an introduction to this area together with detailed coverage of the mathematics involved. All calculations are presented step by step and are straightforward to follow. This new third edition comes with new material, figures and exercises. Network theory, dynamical systems and information theory, the core of modern complex system sciences, are developed in the first three chapters, covering basic concepts and phenomena like small-world networks, bifurcation theory and information entropy. Further chapters use a modular approach to address the most important concepts in complex system sciences, with the emergence and self-organization playing a central role. Prominent examples are self-organized criticality in adaptive systems, life at the edge of chaos, hypercycles and coevolutionary avalanches, synchronization phenomena, absorbing phase...

  6. MCNPTM criticality primer and training experiences

    International Nuclear Information System (INIS)

    Briesmeister, J.; Forster, R.A.; Busch, R.

    1995-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, the analyst may have little experience with the specific codes available at his or her facility. Usually, the codes are quite complex, black boxes capable of analyzing numerous problems with a myriad of input options. Documentation for these codes is designed to cover all the possible configurations and types of analyses but does not give much detail on any particular type of analysis. For criticality calculations, the user of a code is primarily interested in the value of the effective multiplication factor for a system (k eff ). Most codes will provide this, and truckloads of other information that may be less pertinent to criticality calculations. Based on discussions with code users in the nuclear criticality safety community, it was decided that a simple document discussing the ins and outs of criticality calculations with specific codes would be quite useful. The Transport Methods Group, XTM, at Los Alamos National Laboratory (LANL) decided to develop a primer for criticality calculations with their Monte Carlo code, MCNP. This was a joint task between LANL with a knowledge and understanding of the nuances and capabilities of MCNP and the University of New Mexico with a knowledge and understanding of nuclear criticality safety calculations and educating first time users of neutronics calculations. The initial problem was that the MCNP manual just contained too much information. Almost everything one needs to know about MCNP can be found in the manual; the problem is that there is more information than a user requires to do a simple k eff calculation. The basic concept of the primer was to distill the manual to create a document whose only focus was criticality calculations using MCNP

  7. Primer for criticality calculations with DANTSYS

    International Nuclear Information System (INIS)

    Busch, R.D.

    1996-01-01

    With the closure of many experimental facilities, the nuclear criticality safety analyst is increasingly required to rely on computer calculations to identify safe limits for the handling and storage of fissile materials. However, in many cases, the analyst has little experience with the specific codes available at his or her facility. Typically, two types of codes are available: deterministic codes such as ANISN or DANTSYS that solve an approximate model exactly and Monte Carlo Codes such as KENO or MCNP that solve an exact model approximately. Often, the analyst feels that the deterministic codes are too simple and will not provide the necessary information, so most modeling uses Monte Carlo methods. This sometimes means that hours of effort are expended to produce results available in minutes from deterministic codes. A substantial amount of reliable information on nuclear systems can be obtained using deterministic methods if the user understands their limitations. To guide criticality specialists in this area, the Nuclear Criticality Safety Group at the University of New Mexico in cooperation with the Radiation Transport Group at Los Alamos National Laboratory has designed a primer to help the analyst understand and use the DANTSYS deterministic transport code for nuclear criticality safety analyses. (DANTSYS is the name of a suite of codes that users more commonly know as ONEDANT, TWODANT, TWOHEX, and THREEDANT.) It assumes a college education in a technical field, but there is no assumption of familiarity with neutronics codes in general or with DANTSYS in particular. The primer is designed to teach by example, with each example illustrating two or three DANTSYS features useful in criticality analyses

  8. DNA Sequences of RAPD Fragments in the Egyptian cotton ...

    African Journals Online (AJOL)

    Random Amplified Polymorphic DNAs (RAPDs) is a DNA polymorphism assay based on the amplification of random DNA segments with single primers of arbitrary nucleotide sequence. Despite the fact that the RAPD technique has become a very powerful tool and has found use in numerous applications, yet, the nature of ...

  9. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Namhai Chua; Kush, A.

    1993-02-16

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids.

  10. Null alleles and sequence variations at primer binding sites of STR loci within multiplex typing systems.

    Science.gov (United States)

    Yao, Yining; Yang, Qinrui; Shao, Chengchen; Liu, Baonian; Zhou, Yuxiang; Xu, Hongmei; Zhou, Yueqin; Tang, Qiqun; Xie, Jianhui

    2018-01-01

    Rare variants are widely observed in human genome and sequence variations at primer binding sites might impair the process of PCR amplification resulting in dropouts of alleles, named as null alleles. In this study, 5 cases from routine paternity testing using PowerPlex ® 21 System for STR genotyping were considered to harbor null alleles at TH01, FGA, D5S818, D8S1179, and D16S539, respectively. The dropout of alleles was confirmed by using alternative commercial kits AGCU Expressmarker 22 PCR amplification kit and AmpFℓSTR ® . Identifiler ® Plus Kit, and sequencing results revealed a single base variation at the primer binding site of each STR locus. Results from the collection of previous reports show that null alleles at D5S818 were frequently observed in population detected by two PowerPlex ® typing systems and null alleles at D19S433 were mostly observed in Japanese population detected by two AmpFℓSTR™ typing systems. Furthermore, the most popular mutation type appeared the transition from C to T with G to A, which might have a potential relationship with DNA methylation. Altogether, these results can provide helpful information in forensic practice to the elimination of genotyping discrepancy and the development of primer sets. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. The Fluid Reading Primer: Animated Decoding Support for Emergent Readers.

    Science.gov (United States)

    Zellweger, Polle T.; Mackinlay, Jock D.

    A prototype application called the Fluid Reading Primer was developed to help emergent readers with the process of decoding written words into their spoken forms. The Fluid Reading Primer is part of a larger research project called Fluid Documents, which is exploring the use of interactive animation of typography to show additional information in…

  12. Marketing Information Products and Services : A Primer for ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Couverture du livre Marketing Information Products and Services : A Primer for Librarians and Information Professionals. Directeur(s) : Abhinandan K. Jain, Ashok Jambhekar, T.P.Rama Rao et S. Sreenivas Rao. Maison(s) ...

  13. Nonequilibrium Phase Transitions Associated with DNA Replication

    Science.gov (United States)

    2011-02-11

    polymerases) catalyzing the growth of a DNA primer strand (the nascent chain of nucleotides complementary to the template strand) based on the Watson ...the fraction (error rate) of monomers for which y, where y is the correct Watson - Crick complementary base of , can be obtained by ¼ X...Nonequilibrium Phase Transitions Associated with DNA Replication Hyung-June Woo* and Anders Wallqvist Biotechnology High Performance Computing

  14. Pyrovanadolysis, a Pyrophosphorolysis-like Reaction Mediated by Pyrovanadate, Mn2+, and DNA Polymerase of Bacteriophage T7

    NARCIS (Netherlands)

    Akabayov, Barak; Kulczyk, Arkadiusz W.; Akabayov, Sabine R.; Theile, Christopher; McLaughlin, Larry W.; Beauchamp, Benjamin; van Oijen, Antoine M.; Richardson, Charles C.

    2011-01-01

    DNA polymerases catalyze the 3'-5'-pyrophosphorolysis of a DNA primer annealed to a DNA template in the presence of pyrophosphate (PPi). In this reversal of the polymerization reaction, deoxynucleotides in DNA are converted to deoxynucleoside 5'-triphosphates. Based on the charge, size, and geometry

  15. Possible roles of HIV-1 nucleocapsid protein in the specificity of proviral DNA synthesis and in its variability.

    Science.gov (United States)

    Lapadat-Tapolsky, M; Gabus, C; Rau, M; Darlix, J L

    1997-05-02

    Retroviral nucleocapsid (NC) protein is an integral part of the virion nucleocapsid where it coats the dimeric RNA genome. Due to its nucleic acid binding and annealing activities, NC protein directs the annealing of the tRNA primer to the primer binding site and greatly facilitates minus strand DNA elongation and transfer while protecting the nucleic acids against nuclease degradation. To understand the role of NCp7 in viral DNA synthesis, we examined the influence of NCp7 on self-primed versus primer-specific reverse transcription. The results show that HIV-1 NCp7 can extensively inhibit self-primed reverse transcription of viral and cellular RNAs while promoting primer-specific synthesis of proviral DNA. The role of NCp7 vis-a-vis the presence of mutations in the viral DNA during minus strand elongation was examined. NCp7 maximized the annealing between a cDNA(-) primer containing one to five consecutive errors and an RNA representing the 3' end of the genome. The ability of reverse transcriptase (RT) in the presence of NCp7 to subsequently extend the mutated primers depended upon the position of the mismatch within the primer:template complex. When the mutations were at the polymerisation site, primer extension by RT in the presence of NCp7 was very high, about 40% for one mismatch and 3% for five consecutive mismatches. Mutations within the DNA primer or at its 5' end had little effect on the extension of viral DNA by RT. Taken together these results indicate that NCp7 plays major roles in proviral DNA synthesis within the virion core due to its ability to promote prime-specific proviral DNA synthesis while concurrently inhibiting non-specific reverse transcription of viral and cellular RNAs. Moreover, the observation that NCp7 enhances the incorporation of mutations during minus strand DNA elongation favours the notion that NCp7 is a factor contributing to the high mutation rate of HIV-1.

  16. RUCS: Rapid identification of PCR primers for unique core sequences

    DEFF Research Database (Denmark)

    Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik

    2017-01-01

    Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous, and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs...... for the targets in silico . Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex...... in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin...

  17. [Identification of Clonorchis sinensis metacercariae based on PCR targeting ribosomal DNA ITS regions and COX1 gene].

    Science.gov (United States)

    Yang, Qing-Li; Shen, Ji-Qing; Jiang, Zhi-Hua; Yang, Yi-Chao; Li, Hong-Mei; Chen, Ying-Dan; Zhou, Xiao-Nong

    2014-06-01

    To identify Clonorchis sinensis metacercariae using PCR targeting ribosomal DNA ITS region and COX1 gene. Pseudorasbora parva were collected from Hengxian County of Guangxi at the end of May 2013. Single metacercaria of C. sinensis and other trematodes were separated from muscle tissue of P. parva by digestion method. Primers targeting ribosomal DNA ITS region and COX1 gene of C. sinensis were designed for PCR and the universal primers were used as control. The sensitivity and specificity of the PCR detection were analyzed. C. sinensis metacercariae at different stages were identified by PCR. DNA from single C. sinensis metacercaria was detected by PCR targeting ribosomal DNA ITS region and COX1 gene. The specific amplicans have sizes of 437/549, 156/249 and 195/166 bp, respectively. The ratio of the two positive numbers in PCR with universal primers and specific primers targeting C. sinensis ribosomal DNA ITS1 and ITS2 regions was 0.905 and 0.952, respectively. The target gene fragments were amplified by PCR using COX1 gene-specific primers. The PCR with specific primers did not show any non-specific amplification. However, the PCR with universal primers targeting ribosomal DNA ITS regions performed serious non-specific amplification. C. sinensis metacercariae at different stages are identified by morphological observation and PCR method. Species-specific primers targeting ribosomal DNA ITS region show higher sensitivity and specificity than the universal primers. PCR targeting COX1 gene shows similar sensitivity and specificity to PCR with specific primers targeting ribosomal DNA ITS regions.

  18. Metabolic primers for detection of (Per)chlorate-reducing bacteria in the environment and phylogenetic analysis of cld gene sequences.

    Science.gov (United States)

    Bender, Kelly S; Rice, Melissa R; Fugate, William H; Coates, John D; Achenbach, Laurie A

    2004-09-01

    Natural attenuation of the environmental contaminant perchlorate is a cost-effective alternative to current removal methods. The success of natural perchlorate remediation is dependent on the presence and activity of dissimilatory (per)chlorate-reducing bacteria (DPRB) within a target site. To detect DPRB in the environment, two degenerate primer sets targeting the chlorite dismutase (cld) gene were developed and optimized. A nested PCR approach was used in conjunction with these primer sets to increase the sensitivity of the molecular detection method. Screening of environmental samples indicated that all products amplified by this method were cld gene sequences. These sequences were obtained from pristine sites as well as contaminated sites from which DPRB were isolated. More than one cld phylotype was also identified from some samples, indicating the presence of more than one DPRB strain at those sites. The use of these primer sets represents a direct and sensitive molecular method for the qualitative detection of (per)chlorate-reducing bacteria in the environment, thus offering another tool for monitoring natural attenuation. Sequences of cld genes isolated in the course of this project were also generated from various DPRB and provided the first opportunity for a phylogenetic treatment of this metabolic gene. Comparisons of the cld and 16S ribosomal DNA (rDNA) gene trees indicated that the cld gene does not track 16S rDNA phylogeny, further implicating the possible role of horizontal transfer in the evolution of (per)chlorate respiration.

  19. Improved primer sequences for the mitochondrial ND1, ND3/4 and ND5/6 segments in salmonid fishes : application to RFLP analysis of Atlantic salmon

    DEFF Research Database (Denmark)

    Eg Nielsen, Einar; Hansen, Michael Møller; Mensberg, Karen-Lise Dons

    1998-01-01

    New specific primers for the mtDNA segments ND1, ND3/4 and ND5/6 designed from the rainbow trout sequence, improved PCR amplification for salmonid fishes. RFLP analysis revealed restriction site variation for all three segments in Atlantic salmon. Eleven haplotypes were detected in a screening...

  20. VNTR fingerprinting of Kluyveromyces marxianus strains WT, 7-1, and 8-1 by using different primer types to give best results in PCR and on electrophorese gel in order to find differentiation of the DNA of the yeast strains.

    Science.gov (United States)

    Using mutagenized Kluyveromyces marxianus strains (WT, 7-1, 8-1) we wish to find out the variable numbered tandem repeats (VNTR) of each of the DNA strains from the different mutagenized K. marxianus strains. To do this we used Phusion HF Buffer Pack to try and give a clear picture of the VNTR by u...

  1. Relativistic Astrophysics and Cosmology: A Primer

    International Nuclear Information System (INIS)

    Abramowicz, Marek A

    2007-01-01

    'Relativistic Astrophysics and Cosmology: A Primer' by Peter Hoyng, was published last year by Springer. The book is based on lectures given by the author at University of Utrecht to advanced undergraduates. This is a short and scholarly book. In about 300 pages, the author has covered the most interesting and important applications of Albert Einstein's general relativity in present-day astrophysics and cosmology: black holes, neutron stars, gravitational waves, and the cosmic microwave background. The book stresses theory, but also discusses several experimental and observational topics, such as the Gravity Probe B mission, interferometer detectors of gravitational waves and the power spectrum of the cosmic microwave background. The coverage is not uniform. Some topics are discussed in depth, others are only briefly mentioned. The book obviously reflects the author's own research interests and his preferences for specific mathematical methods, and the choice of the original artwork that illustrates the book (and appears on its cover) is a very personal one. I consider this personal touch an advantage, even if I do not always agree with the author's choices. For example, I employ Killing vectors as a very useful mathematical tool not only in my research on black holes, but also in my classes. I find that my students prefer it when discussions of particle, photon and fluid motion in the Schwarzschild and Kerr spacetimes are based explicitly and directly on the Killing vectors rather than on coordinate calculations. The latter approach is, of course, the traditional one, and is used in Peter Hoyng's book. Reading the book is a stimulating experience, because the reader can almost feel the author's presence. The author's opinions, his mathematical taste, his research pleasures, and his pedagogical passion are apparent everywhere. Lecturers contemplating a new course on relativistic astrophysics could adopt Hoyng's book as the text. Their students will be in the author

  2. Value for money assessment for public-private partnerships : a primer.

    Science.gov (United States)

    2015-01-01

    This primer addresses Value for Money Assessment for public-private partnerships (P3s). Companion : primers on Financial Assessment and Risk Assessment for P3s are also available as part of this series of : primers.

  3. Simultaneous Profiling of DNA Mutation and Methylation by Melting Analysis Using Magnetoresistive Biosensor Array

    DEFF Research Database (Denmark)

    Rizzi, Giovanni; Lee, Jung-Rok; Dahl, Christina

    2017-01-01

    specificity. Genomic (mutation) or bisulphite-treated (methylation) DNA is amplified using nondiscriminatory primers, and the amplicons are then hybridized to a giant magnetoresistive (GMR) biosensor array followed by melting curve measurements. The GMR biosensor platform offers scalable multiplexed detection...

  4. Polymerase chain reaction-mediated DNA fingerprinting for epidemiological studies on Campylobacter spp

    NARCIS (Netherlands)

    Giesendorf, B A; Goossens, H; Niesters, H G; Van Belkum, A; Koeken, A; Endtz, H P; Stegeman, H; Quint, W G

    The applicability of polymerase chain reaction (PCR)-mediated DNA typing, with primers complementary to dispersed repetitive DNA sequences and arbitrarily chosen DNA motifs, to study the epidemiology of campylobacter infection was evaluated. With a single PCR reaction and simple gel electrophoresis,

  5. Complementation of a primer binding site-impaired murine leukemia virus-derived retroviral vector by a genetically engineered tRNA-like primer

    DEFF Research Database (Denmark)

    Lund, Anders Henrik; Duch, M; Lovmand, J

    1997-01-01

    , but not with a noncomplementary tRNA-like molecule. The engineered primer was shown to be involved in both the initiation of first-strand synthesis and second-strand transfer. These results provide an in vivo demonstration that the retroviral replication machinery may recognize sequence complementarity rather than actual primer...... binding site and 3' primer sequences. Use of mutated primer binding site vectors replicating via engineered primers may add additional control features to retroviral gene transfer technology....

  6. Fluorescent-increase kinetics of different fluorescent reporters used for qPCR depend on monitoring chemistry, targeted sequence, type of DNA input and PCR efficiency

    International Nuclear Information System (INIS)

    Ruijter, Jan M.; Hoff, Maurice J. B. van den; Lorenz, Peter; Tuomi, Jari M.; Hecker, Michael

    2014-01-01

    The analysis of quantitative PCR data usually does not take into account the fact that the increase in fluorescence depends on the monitoring chemistry, the input of ds-DNA or ss-cDNA, and the directionality of the targeting of probes or primers. The monitoring chemistries currently available can be categorized into six groups: (A) DNA-binding dyes; (B) hybridization probes; (C) hydrolysis probes; (D) LUX primers; (E) hairpin primers; and (F) the QZyme system. We have determined the kinetics of the increase in fluorescence for each of these groups with respect to the input of both ds-DNA and ss-cDNA. For the latter, we also evaluated mRNA and cDNA targeting probes or primers. This analysis revealed three situations. Hydrolysis probes and LUX primers, compared to DNA-binding dyes, do not require a correction of the observed quantification cycle. Hybridization probes and hairpin primers require a correction of −1 cycle (dubbed C-lag), while the QZyme system requires the C-lag correction and an efficiency-dependent C-shift correction. A PCR efficiency value can be derived from the relative increase in fluorescence in the exponential phase of the amplification curve for all monitoring chemistries. In case of hydrolysis probes, LUX primers and hairpin primers, however, this should be performed after cycle 12, and for the QZyme system after cycle 19, to keep the overestimation of the PCR efficiency below 0.5 %. (author)

  7. In Silico PCR Tools for a Fast Primer, Probe, and Advanced Searching.

    Science.gov (United States)

    Kalendar, Ruslan; Muterko, Alexandr; Shamekova, Malika; Zhambakin, Kabyl

    2017-01-01

    The polymerase chain reaction (PCR) is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. The principle of this technique has been further used and applied in plenty of other simple or complex nucleic acid amplification technologies (NAAT). In parallel to laboratory "wet bench" experiments for nucleic acid amplification technologies, in silico or virtual (bioinformatics) approaches have been developed, among which in silico PCR analysis. In silico NAAT analysis is a useful and efficient complementary method to ensure the specificity of primers or probes for an extensive range of PCR applications from homology gene discovery, molecular diagnosis, DNA fingerprinting, and repeat searching. Predicting sensitivity and specificity of primers and probes requires a search to determine whether they match a database with an optimal number of mismatches, similarity, and stability. In the development of in silico bioinformatics tools for nucleic acid amplification technologies, the prospects for the development of new NAAT or similar approaches should be taken into account, including forward-looking and comprehensive analysis that is not limited to only one PCR technique variant. The software FastPCR and the online Java web tool are integrated tools for in silico PCR of linear and circular DNA, multiple primer or probe searches in large or small databases and for advanced search. These tools are suitable for processing of batch files that are essential for automation when working with large amounts of data. The FastPCR software is available for download at http://primerdigital.com/fastpcr.html and the online Java version at http://primerdigital.com/tools/pcr.html .

  8. Validation of a Non-Specific Dye Real-Time PCR Assay for Porcine Adulteration in Meatball Using ND5 Primer

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2017-07-01

    Full Text Available Porcine adulteration in meatball samples were analyzed using real-time polymerase chain reaction (RT-PCR, based on the ND5 primer obtained by previous study. This work consisted of three stages which were annealing temperature optimization, method validation, and application. DNA template was extracted using phenol-CIAA (chloroform-iso amyl alcohol method. The optimum annealing temperature for ND5 primers (forward primer 5'-CATTCGCCTCACTCACATTAACC-3' and reverse primer 5'-AAGAGAGAGTTCTACGGTCTGTAG-3' was 58.0 °C, obtained after testing annealing at 50.5 to 59.5 °C gradient temperature with 5 °C interval. Melting curve analysis was done at 65.0 to 95.0 °C, with increasing temperature for 0.5 °C per 2 sec. Method was validated for its specificity, precision and limit of detection. RT-PCR method with ND5 primers produced 227 bp DNA fragment with 78.50 °C Tm value. From eight commercial meatball samples, one was detected containing porcine. The methods showed high specificity and precision, with experimentally determined limits for porcine were no less than 1%.

  9. Primer on electricity futures and other derivatives

    Energy Technology Data Exchange (ETDEWEB)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area.

  10. A primer on systematic reviews in toxicology.

    Science.gov (United States)

    Hoffmann, Sebastian; de Vries, Rob B M; Stephens, Martin L; Beck, Nancy B; Dirven, Hubert A A M; Fowle, John R; Goodman, Julie E; Hartung, Thomas; Kimber, Ian; Lalu, Manoj M; Thayer, Kristina; Whaley, Paul; Wikoff, Daniele; Tsaioun, Katya

    2017-07-01

    Systematic reviews, pioneered in the clinical field, provide a transparent, methodologically rigorous and reproducible means of summarizing the available evidence on a precisely framed research question. Having matured to a well-established approach in many research fields, systematic reviews are receiving increasing attention as a potential tool for answering toxicological questions. In the larger framework of evidence-based toxicology, the advantages and obstacles of, as well as the approaches for, adapting and adopting systematic reviews to toxicology are still being explored. To provide the toxicology community with a starting point for conducting or understanding systematic reviews, we herein summarized available guidance documents from various fields of application. We have elaborated on the systematic review process by breaking it down into ten steps, starting with planning the project, framing the question, and writing and publishing the protocol, and concluding with interpretation and reporting. In addition, we have identified the specific methodological challenges of toxicological questions and have summarized how these can be addressed. Ultimately, this primer is intended to stimulate scientific discussions of the identified issues to fuel the development of toxicology-specific methodology and to encourage the application of systematic review methodology to toxicological issues.

  11. Primer on electricity futures and other derivatives

    International Nuclear Information System (INIS)

    Stoft, S.; Belden, T.; Goldman, C.; Pickle, S.

    1998-01-01

    Increased competition in bulk power and retail electricity markets is likely to lower electricity prices, but will also result in greater price volatility as the industry moves away from administratively determined, cost-based rates and encourages market-driven prices. Price volatility introduces new risks for generators, consumers, and marketers. Electricity futures and other derivatives can help each of these market participants manage, or hedge, price risks in a competitive electricity market. Futures contracts are legally binding and negotiable contracts that call for the future delivery of a commodity. In most cases, physical delivery does not take place, and the futures contract is closed by buying or selling a futures contract on or near the delivery date. Other electric rate derivatives include options, price swaps, basis swaps, and forward contracts. This report is intended as a primer for public utility commissioners and their staff on futures and other financial instruments used to manage price risks. The report also explores some of the difficult choices facing regulators as they attempt to develop policies in this area

  12. Detection and Identification of Bursaphelenchus Species with DNA Fingerprinting and Polymerase Chain Reaction

    OpenAIRE

    Harmey, Judith H.; Harmey, Matthew A.

    1993-01-01

    We have evaluated the potential of DNA-based methods to identify and differentiate Bursaphelenchus spp. and isolates. The isolation of a DNA probe, designated X14, and development of a DNA fingerprinting method for the identification and differentiation of Bursaphelenchus species and strains is described. Polymerase chain reaction (PCR) amplification of DNA isolated from Bursaphelenchus species using two primers derived from the sequence of the cloned repetitive DNA fragment X14 resulted in m...

  13. Microsatellite Primers in the Lichen Symbiotic Alga Trebouxia decolorans (Trebouxiophyceae

    Directory of Open Access Journals (Sweden)

    Francesco Dal Grande

    2013-03-01

    Full Text Available Premise of the study: Polymorphic microsatellite markers were developed for the symbiotic green alga Trebouxia decolorans to study fine-scale population structure and clonal diversity. Methods and Results: Using Illumina pyrosequencing, 20 microsatellite primer sets were developed for T. decolorans. The primer sets were tested on 43 individuals sampled from four subpopulations in Germany. The primers amplified di-, tri-, and tetranucleotide repeats with three to 15 alleles per locus, and the unbiased haploid diversity per locus ranged from 0.636 to 0.821. Conclusions: The identified microsatellite markers will be useful to study the genetic diversity, dispersal, and reproductive mode of this common lichen photobiont.

  14. A physicists guide to The Los Alamos Primer

    International Nuclear Information System (INIS)

    Reed, B Cameron

    2016-01-01

    In April 1943, a group of scientists at the newly established Los Alamos Laboratory were given a series of lectures by Robert Serber on what was then known of the physics and engineering issues involved in developing fission bombs. Serber’s lectures were recorded in a 24 page report titled The Los Alamos Primer , which was subsequently declassified and published in book form. This paper describes the background to the Primer and analyzes the physics contained in its 22 sections. The motivation for this paper is to provide a firm foundation of the background and contents of the Primer for physicists interested in the Manhattan Project and nuclear weapons. (invited comment)

  15. Detection of bacterial soft-rot of crown imperial caused by Pectobacterium carotovorum subsp. carotovorum using specific PCR primers

    Directory of Open Access Journals (Sweden)

    E. Mahmoudi

    2007-08-01

    Full Text Available Pectobacterium is one of the major destructive causal agent in most crop plants throughout the world. During a survey in spring of 2005 in the rangeland of Kermanshah and Isfahan, provinces of Iran, samples of bulbs and stems of crown imperial with brown spot and soft rot were collected. Eight strains of pectolytic Erwinia were isolated and purified from these samples. Phenotypic tests indicated that the strains were gram-negative, facultative anaerobic, rod shaped, motile with peritrichous flagella. They were oxidase negative, catalase positive and also able to macerate potato slices. Pathogenicity of all the strains were confirmed on corn, philodendron and crown imperial by inoculation of these crops with a bacterial suspension and reisolation of the strain from symptomatic tissues. A pair of specific PCR primers was used to detect these bacterial strains. The primer set (EXPCCF/EXPCCR amplified a single fragment of the expected size (0.55 kb from genomic DNA of all strains used in this study. In nested PCR, the primer set (INPCCR/INPCCF amplified the expected single fragment (0.4 kb from the PCR product of first PCR amplification. On the basis of the biochemical and phenotypic characteristics and PCR amplification by the specific PCR primers, these strains were identified as Pectobacterium carotovorum subsp. carotovorum. This is the first report of occurrence of crown imperial bacterial soft-rot in Iran.

  16. Heterologous primer transferability and access to microsatellite loci polymorphism in ‘somnus’ passion fruit tree (Passiflora setacea DC

    Directory of Open Access Journals (Sweden)

    Douglas de Almeida Pereira

    2015-09-01

    Full Text Available Primer pairs that access microsatellite loci, initially constructed through the genome of Passiflora edulis Sims flavicarpa and P. alata, were tested concerning their ability to access microsatellite loci in ‘somnus’ passion fruit tree (P. setacea individuals. Seven out of the thirty one primer pairs tested were able to access DNA polymorphism in the genome of this wild Passiflora species, by evaluating six natural populations, located in a transition area between the biomes Caatinga and Cerrado, in the state of Bahia, Brazil. The number of alleles/loci was small, oscillating from 1 to 4. The average heterozygosity observed per locus in all populations ranged from 0.13 to 0.40. There was transference of heterologous microsatellite primer pairs from the Passiflora genus to ‘somnus’ passion fruit tree, constituting a new set of primers that access random co-dominant locus in this species, useful for conservationist purposes and pre-improvement of ‘somnus’ passion fruit tree.

  17. Sensitivitas dan Spesifisitas Nested Polymerase Chain Reaction untuk Mendeteksi DNA Coxiella burnetii (SENSITIVITY AND SPECIFICITY OF NESTED POLYMERASE CHAIN REACTION FOR DETECTION OF COXIELLA BURNETII DNA

    Directory of Open Access Journals (Sweden)

    Trioso Purnawarman

    2014-04-01

    Full Text Available Sensitivity and specificity of nested polymerase chain reaction (nested PCR to detect Coxiella burnetii(C. burnetii DNA were studied. The primer system which consists of external primers (OMP1 and OMP2and internal primers (OMP3 and OMP4, was designed from the nucleotide sequence of the com I geneencoding for 27 kDa outer membrane protein and used to specifically amplify a 501 bp and 438 bp fragment.This nested PCR assay was 50 fold more sensitive than that of using PCR external primer only. TheNested PCR has a detection limit as low as 300 pg/?l. Specificity studies showed that nested PCR onlydetected C. burnetii DNA and did not happened Brucella abortus, Escherichia coli, Pseudomonas aeruginosaand Campylobacter Jejuni DNA. Nested PCR has high senstively and specificaly diagnostic method of C.burnetii as agent of Q fever disease.

  18. Molecular mechanism of DNA replication-coupled inactivation of the initiator protein in Escherichia coli: interaction of DnaA with the sliding clamp-loaded DNA and the sliding clamp-Hda complex.

    Science.gov (United States)

    Su'etsugu, Masayuki; Takata, Makoto; Kubota, Toshio; Matsuda, Yusaku; Katayama, Tsutomu

    2004-06-01

    In Escherichia coli, the ATP-DnaA protein initiates chromosomal replication. After the DNA polymerase III holoenzyme is loaded on to DNA, DnaA-bound ATP is hydrolysed in a manner depending on Hda protein and the DNA-loaded form of the DNA polymerase III sliding clamp subunit, which yields ADP-DnaA, an inactivated form for initiation. This regulatory DnaA-inactivation represses extra initiation events. In this study, in vitro replication intermediates and structured DNA mimicking replicational intermediates were first used to identify structural prerequisites in the process of DnaA-ATP hydrolysis. Unlike duplex DNA loaded with sliding clamps, primer RNA-DNA heteroduplexes loaded with clamps were not associated with DnaA-ATP hydrolysis, and duplex DNA provided in trans did not rescue this defect. At least 40-bp duplex DNA is competent for the DnaA-ATP hydrolysis when a single clamp was loaded. The DnaA-ATP hydrolysis was inhibited when ATP-DnaA was tightly bound to a DnaA box-bearing oligonucleotide. These results imply that the DnaA-ATP hydrolysis involves the direct interaction of ATP-DnaA with duplex DNA flanking the sliding clamp. Furthermore, Hda protein formed a stable complex with the sliding clamp. Based on these, we suggest a mechanical basis in the DnaA-inactivation that ATP-DnaA interacts with the Hda-clamp complex with the aid of DNA binding. Copyright Blackwell Publishing Limited

  19. Preparation and Characterization of Acrylic Primer for Concrete Substrate Application

    Directory of Open Access Journals (Sweden)

    El-Sayed Negim

    2016-01-01

    Full Text Available This study dealt with the properties of acrylic primer for concrete substrate using acrylic syrup, made from a methyl methacrylate monomer solution of terpolymers. Terpolymer systems consisting of methyl methacrylate (MMA, 2-ethylhexyl acrylate (2-EHA, and methacrylic acid (MAA with different chemical composition ratios of MMA and 2-EHA were synthesized through bulk polymerization using azobisisobutyronitrile (AIBN as initiator. The terpolymer composition is characterized by FTIR, 1H NMR, DSC, TGA, and SEM. The glass transition temperature and the thermal stability increased with increasing amounts of MMA in the terpolymer backbone. The effect of chemical composition of terpolymers on physicomechanical properties of primer films was investigated. However, increasing the amount of MMA in terpolymer backbone increased tensile and contact angle of primer films while elongation at break, water absorption, and bond strength are decreased. In particular, the primer syrup containing 65% 2-EHA has good bonding strength with concrete substrate around 1.1 MPa.

  20. Designing for transportation management and operations : a primer.

    Science.gov (United States)

    2013-02-01

    This primer is focused on the collaborative and systematic consideration of management and operations during transportation : project design and development. This is termed designing for operations. Effectively designing for operations involves...

  1. Assessment of SCAR markers to design real-time PCR primers for rhizosphere quantification of Azospirillum brasilense phytostimulatory inoculants of maize.

    Science.gov (United States)

    Couillerot, O; Poirier, M-A; Prigent-Combaret, C; Mavingui, P; Caballero-Mellado, J; Moënne-Loccoz, Y

    2010-08-01

    To assess the applicability of sequence characterized amplified region (SCAR) markers obtained from BOX, ERIC and RAPD fragments to design primers for real-time PCR quantification of the phytostimulatory maize inoculants Azospirillum brasilense UAP-154 and CFN-535 in the rhizosphere. Primers were designed based on strain-specific SCAR markers and were screened for successful amplification of target strain and absence of cross-reaction with other Azospirillum strains. The specificity of primers thus selected was verified under real-time PCR conditions using genomic DNA from strain collection and DNA from rhizosphere samples. The detection limit was 60 fg DNA with pure cultures and 4 x 10(3) (for UAP-154) and 4 x 10(4) CFU g(-1) (for CFN-535) in the maize rhizosphere. Inoculant quantification was effective from 10(4) to 10(8) CFU g(-1) soil. BOX-based SCAR markers were useful to find primers for strain-specific real-time PCR quantification of each A. brasilense inoculant in the maize rhizosphere. Effective root colonization is a prerequisite for successful Azospirillum phytostimulation, but cultivation-independent monitoring methods were lacking. The real-time PCR methods developed here will help understand the effect of environmental conditions on root colonization and phytostimulation by A. brasilense UAP-154 and CFN-535.

  2. [Development of specific and degenerated primers to CesA genes encoding flax (Linum usitatissimum L.) cellulose synthase].

    Science.gov (United States)

    Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V

    2010-01-01

    Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.

  3. Detection of Vibrio harveyi using hemolysin primer in tiger shrimp Penaeus monodon

    Directory of Open Access Journals (Sweden)

    Irma Suriyani

    2015-05-01

    Full Text Available ABSTRACT This study was aimed to analyze the sensitivity and ability of primer hemolysin in detecting pathogenetic Vibrio on tiger shrimp post-larvae (PL exposed under different exposure times in media inoculated with Vibrio harveyi. The PL of tiger shrimp were infected with 106 cfu/mL of V. harveyi by immersion method for three, six, 12, 24, 48 and 72 hours. The presence of hemolisin genes was detected by PCR techniques. The electrophoresis detected narrow hemolysin genes after PL were exposed for three and six hours. Clear visible bands of DNA Vibrio were observed for 12 hours of exposure. In contrast, no detected hemolysin gene of Vibrio was observed for PL exposed within 24, 48, and 72 hours. The rapid detection on Vibrio pathogenic for tiger shrimp PL should be conducted within three to 12 hours of exposure. No recommendation in utilizing this rapid detection for tiger shrimp PL exposed beyond 12 hours of V. harveyi. Keywords: specific primer, luminous Vibrio bacteria, pathogenic, PCR method, hemolysin gene  ABSTRAK Penelitian ini bertujuan untuk mengetahui kemampuan atau sensitivitas primer hemolisin dalam mendeteksi Vibrio patogen dengan lama pemaparan berbeda. Penelitian ini dilakukan dengan menginfeksikan Vibrio harveyi pada benur udang dengan metode perendaman pada konsentrasi 106 cfu/mL. Pengambilan sampel dilakukan pada waktu tiga, enam, 12, 24, 48, dan 72 jam pascainfeksi. Keberadaan gen hemolisin pada bakteri V. harveyi dideteksi menggunakan teknik polymerase chain reaction (PCR. Hasil elektroforesis memperlihatkan bahwa pada pemaparan tiga dan enam jam keberadaan gen hemolisin dari bakteri Vibrio patogen yang diinfeksikan sudah dapat terdeteksi pada benur walaupun masih terlihat tipis. Pada pemaparan 12 jam terlihat sangat jelas pita-pita DNA dari bakteri patogen. Sedangkan pada pemaparan 24, 48, dan 72 jam sudah tidak terdeteksi lagi gen hemolisin dari bakteri Vibrio. Hal ini diduga disebabkan terjadinya penurunan populasi

  4. Study in mutation of alfalfa genome DNA due to low energy N+ implantation using RAPD

    International Nuclear Information System (INIS)

    Chen Roulei; Song Daojun; Yu Zengliang; Li Yufeng; Liang Yunzhang

    2001-01-01

    After implanted by various dosage N + beams, germination rate of alfalfa seeds appears to be saddle line with dosage increasing. The authors have studied in mutation of genome DNA due to low energy N + implantation, and concluded that 30 differential DNA fragments have been amplified by 8 primers (S 41 , S 42 , S 45 , S 46 , S 50 , S 52 , S 56 , S 58 ) in 100 primers, moreover, number of differential DNA fragments between CK and treatments increases with dosage. Consequently, low energy ion implantation can cause mutation of alfalfa genome DNA. The more dosage it is, the more mutation alfalfa will be

  5. Studies on DNA repair in Bacillus subtilis

    International Nuclear Information System (INIS)

    Inoue, Tadashi; Kada, Tsuneo

    1977-01-01

    An enzyme which enhances the priming activity of γ-irradiated DNA for type I DNA polymerase (EC 2.7.7.7) was identified and partially purified from extracts of Bacillus subtilis cells. The enzyme preferentially degraded γ-irradiated DNA into acid-soluble materials. DNA preparations treated with heat, ultraviolet light, pancreatic DNAase (EC 3.1.4.5) or micrococcal DNAase (EC 3.1.4.7) were not susceptible to the enzyme. However, sonication rendered DNA susceptible to the enzyme to some extent. From these results, it is supposed that this enzyme may function by 'cleaning' damaged terminals produced by γ-irradiation to serve as effective primer of sites for repair synthesis by the type I DNA polymerase

  6. Genome instabilities arising from ribonucleotides in DNA.

    Science.gov (United States)

    Klein, Hannah L

    2017-08-01

    Genomic DNA is transiently contaminated with ribonucleotide residues during the process of DNA replication through misincorporation by the replicative DNA polymerases α, δ and ε, and by the normal replication process on the lagging strand, which uses RNA primers. These ribonucleotides are efficiently removed during replication by RNase H enzymes and the lagging strand synthesis machinery. However, when ribonucleotides remain in DNA they can distort the DNA helix, affect machineries for DNA replication, transcription and repair, and can stimulate genomic instabilities which are manifest as increased mutation, recombination and chromosome alterations. The genomic instabilities associated with embedded ribonucleotides are considered here, along with a discussion of the origin of the lesions that stimulate particular classes of instabilities. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Detection and differentiation of Fusarium oxysporum f. sp. lycopersici race 1 using loop-mediated isothermal amplification with three primer sets.

    Science.gov (United States)

    Ayukawa, Y; Komatsu, K; Kashiwa, T; Akai, K; Yamada, M; Teraoka, T; Arie, T

    2016-09-01

    Fusarium oxysporum f. sp. lycopersici (Fol) causes tomato wilt. Based on the difference in pathogenicity towards tomato cultivars, Fol is classified into three races. In this study, a rapid method is developed for the detection and discrimination of Fol race 1 using a loop-mediated isothermal amplification (LAMP) assay with two primer sets targeting a region of the nucleotide sequence of the SIX4 gene specific for race 1 and a primer set targeting the SIX5 gene, conserved in all known Fol isolates. Upon LAMP reaction, amplification using all three primer sets was observed only when DNA of Fol race 1 was used as a template, and not when DNA of other Fol races or other fungal species was used. This method could detect 300 fg of Fol race 1 DNA, a 100-fold higher sensitivity than that obtained by conventional PCR. The method can also detect DNA extracted from soil artificially infested with Fol race 1. It is now possible to detect Fol race 1 in colonies and infected tomato stems without DNA isolation. This method is a rapid and simple tool for discrimination of Fol race 1. This study developed a loop-mediated isothermal amplification (LAMP) assay for detection and differentiation of Fusarium oxysporum f. sp. lycopersici (Fol) race 1 by using three primer sets targeting for the SIX4 and SIX5 genes. These genes are present together only in Fol race 1. This method can detect Fol race 1 in infected tomato stems without DNA extraction, affording an efficient diagnosis of Fusarium wilt on tomatoes in the field. © 2016 The Society for Applied Microbiology.

  8. Genetic alterations of hepatocellular carcinoma by random amplified polymorphic DNA analysis and cloning sequencing of tumor differential DNA fragment

    Science.gov (United States)

    Xian, Zhi-Hong; Cong, Wen-Ming; Zhang, Shu-Hui; Wu, Meng-Chao

    2005-01-01

    AIM: To study the genetic alterations and their association with clinicopathological characteristics of hepatocellular carcinoma (HCC), and to find the tumor related DNA fragments. METHODS: DNA isolated from tumors and corresponding noncancerous liver tissues of 56 HCC patients was amplified by random amplified polymorphic DNA (RAPD) with 10 random 10-mer arbitrary primers. The RAPD bands showing obvious differences in tumor tissue DNA corresponding to that of normal tissue were separated, purified, cloned and sequenced. DNA sequences were analyzed and compared with GenBank data. RESULTS: A total of 56 cases of HCC were demonstrated to have genetic alterations, which were detected by at least one primer. The detestability of genetic alterations ranged from 20% to 70% in each case, and 17.9% to 50% in each primer. Serum HBV infection, tumor size, histological grade, tumor capsule, as well as tumor intrahepatic metastasis, might be correlated with genetic alterations on certain primers. A band with a higher intensity of 480 bp or so amplified fragments in tumor DNA relative to normal DNA could be seen in 27 of 56 tumor samples using primer 4. Sequence analysis of these fragments showed 91% homology with Homo sapiens double homeobox protein DUX10 gene. CONCLUSION: Genetic alterations are a frequent event in HCC, and tumor related DNA fragments have been found in this study, which may be associated with hepatocarcin-ogenesis. RAPD is an effective method for the identification and analysis of genetic alterations in HCC, and may provide new information for further evaluating the molecular mechanism of hepatocarcinogenesis. PMID:15996039

  9. Application of a double-enrichment procedure for microsatellite isolation and the use of tailed primers for high throughput genotyping

    Directory of Open Access Journals (Sweden)

    Fábio Mendonça Diniz

    2007-03-01

    Full Text Available The number of microsatellite loci and their allelic diversity contribute to increase accuracy and informativity of genetic estimates, however, the isolation of microsatellite loci is not only laborious but also quite expensive. We used (GATAn and (GACAn tetranucleotide probes and single- and double-enrichment hybridization to construct and screen a genomic library with an increased proportion of DNA fragments containing repeat motifs. Repeats were found using both types of hybridization but the double-enrichment procedure recovered sequences of which 100% contained (GATAn and (GACAn motifs. Microsatellite loci primers were then designed with an M13R-tail or CAG-tag to produce scorable PCR products with minimal stutter. The approach used in this study suggests that double-enrichment is a worthwhile strategy when isolating repeat motifs from eukaryotic genomes. Moreover, the use of tailed microsatellite primers provides increased resolution for compound microsatellite loci, with a significant decrease in costs.

  10. Software-Supported USER Cloning Strategies for Site-Directed Mutagenesis and DNA Assembly

    DEFF Research Database (Denmark)

    Genee, Hans Jasper; Bonde, Mads Tvillinggaard; Bagger, Frederik Otzen

    2015-01-01

    USER cloning is a fast and versatile method for engineering of plasmid DNA. We have developed a user friendly Web server tool that automates the design of optimal PCR primers for several distinct USER cloning-based applications. Our Web server, named AMUSER (Automated DNA Modifications with USER...... cloning), facilitates DNA assembly and introduction of virtually any type of site-directed mutagenesis by designing optimal PCR primers for the desired genetic changes. To demonstrate the utility, we designed primers for a simultaneous two-position site-directed mutagenesis of green fluorescent protein...... (GFP) to yellow fluorescent protein (YFP), which in a single step reaction resulted in a 94% cloning efficiency. AMUSER also supports degenerate nucleotide primers, single insert combinatorial assembly, and flexible parameters for PCR amplification. AMUSER is freely available online at ....

  11. The novel primers for mammal species identification-based mitochondrial cytochrome b sequence: implication for reserved wild animals in Thailand and endangered mammal species in Southeast Asia.

    Science.gov (United States)

    Muangkram, Yuttamol; Wajjwalku, Worawidh; Amano, Akira; Sukmak, Manakorn

    2018-01-01

    We presented the powerful techniques for species identification using the short amplicon of mitochondrial cytochrome b gene sequence. Two faecal samples and one single hair sample of the Asian tapir were tested using the new cytochrome b primers. The results showed a high sequence similarity with the mainland Asian tapir group. The comparative sequence analysis of the reserved wild mammals in Thailand and the other endangered mammal species from Southeast Asia comprehensibly verified the potential of our novel primers. The forward and reverse primers were 94.2 and 93.2%, respectively, by the average value of the sequence identity among 77 species sequences, and the overall mean distance was 35.9%. This development technique could provide rapid, simple, and reliable tools for species confirmation. Especially, it could recognize the problematic biological specimens contained less DNA material from illegal products and assist with wildlife crime investigation of threatened species and related forensic casework.

  12. Mechanism of sequence-specific template binding by the DNA primase of bacteriophage T7

    KAUST Repository

    Lee, Seung-Joo

    2010-03-28

    DNA primases catalyze the synthesis of the oligoribonucleotides required for the initiation of lagging strand DNA synthesis. Biochemical studies have elucidated the mechanism for the sequence-specific synthesis of primers. However, the physical interactions of the primase with the DNA template to explain the basis of specificity have not been demonstrated. Using a combination of surface plasmon resonance and biochemical assays, we show that T7 DNA primase has only a slightly higher affinity for DNA containing the primase recognition sequence (5\\'-TGGTC-3\\') than for DNA lacking the recognition site. However, this binding is drastically enhanced by the presence of the cognate Nucleoside triphosphates (NTPs), Adenosine triphosphate (ATP) and Cytosine triphosphate (CTP) that are incorporated into the primer, pppACCA. Formation of the dimer, pppAC, the initial step of sequence-specific primer synthesis, is not sufficient for the stable binding. Preformed primers exhibit significantly less selective binding than that observed with ATP and CTP. Alterations in subdomains of the primase result in loss of selective DNA binding. We present a model in which conformational changes induced during primer synthesis facilitate contact between the zinc-binding domain and the polymerase domain. The Author(s) 2010. Published by Oxford University Press.

  13. An efficient method for DNA extraction from Cladosporioid fungi.

    Science.gov (United States)

    Moslem, M A; Bahkali, A H; Abd-Elsalam, K A; Wit, P J G M

    2010-11-23

    We developed an efficient method for DNA extraction from Cladosporioid fungi, which are important fungal plant pathogens. The cell wall of Cladosporioid fungi is often melanized, which makes it difficult to extract DNA from their cells. In order to overcome this we grew these fungi for three days on agar plates and extracted DNA from mycelium mats after manual or electric homogenization. High-quality DNA was isolated, with an A(260)/A(280) ratio ranging between 1.6 and 2.0. Isolated genomic DNA was efficiently digested with restriction enzymes and produced distinct banding patterns on agarose gels for the different Cladosporium species. Clear DNA fragments from the isolated DNA were amplified by PCR using small and large subunit rDNA primers, demonstrating that this method provides DNA of sufficiently high quality for molecular analyses.

  14. Komparasi Metode Isolasi DNA Patogen Antraknosa dan Bulai untuk Deteksi PCR

    Directory of Open Access Journals (Sweden)

    Ade Syahputra

    2016-11-01

    Full Text Available Polymerase chain reaction (PCR is an important tool for detection, identification and monitoring of quarantine pests in Indonesia. DNA isolation method from target organism is an important step to provide adequate DNA template for performing PCR. Objective of the research was to compare conventional, commercial kit, FTA-card and its modification methods of DNA isolation to be used in PCR detection for Colletotrichum acutatum and Peronosclerospora sorghi from chili and maize, respectively. DNA obtained from various isolation methods were measured using UV-vis nanodrop-spectrophotometry.  DNA amplification was performed using DNA concentration of 15 ng µL-1 from each isolation method with gradual primer concentrations of 0.4; 0.6; 0.8; and 1.0 mM. The highest concentration of DNA was achieved with conventional methods for C. acutatum from pure culture and P. sorghi from maize leaf. Best DNA purity was obtained from isolation method using commercial kit for C. acutatum from infected fruit (1.94 and from conventional method for C. acutatum from pure culture (1.91. The highest total yield of isolated DNA was achieved by modified FTA-card for C. acutatum from pure culture. In general DNA amplification using various primer concentration gave positive results although DNA bands intensity was varied from faint to very bright.  Furthermore PCR optimization using the best primer concentration from previous reaction showed that all DNA templates resulted in thick and bright DNA bands.

  15. DNA2—An Important Player in DNA Damage Response or Just Another DNA Maintenance Protein?

    Directory of Open Access Journals (Sweden)

    Elzbieta Pawłowska

    2017-07-01

    Full Text Available The human DNA2 (DNA replication helicase/nuclease 2 protein is expressed in both the nucleus and mitochondria, where it displays ATPase-dependent nuclease and helicase activities. DNA2 plays an important role in the removing of long flaps in DNA replication and long-patch base excision repair (LP-BER, interacting with the replication protein A (RPA and the flap endonuclease 1 (FEN1. DNA2 can promote the restart of arrested replication fork along with Werner syndrome ATP-dependent helicase (WRN and Bloom syndrome protein (BLM. In mitochondria, DNA2 can facilitate primer removal during strand-displacement replication. DNA2 is involved in DNA double strand (DSB repair, in which it is complexed with BLM, RPA and MRN for DNA strand resection required for homologous recombination repair. DNA2 can be a major protein involved in the repair of complex DNA damage containing a DSB and a 5′ adduct resulting from a chemical group bound to DNA 5′ ends, created by ionizing radiation and several anticancer drugs, including etoposide, mitoxantrone and some anthracyclines. The role of DNA2 in telomere end maintenance and cell cycle regulation suggests its more general role in keeping genomic stability, which is impaired in cancer. Therefore DNA2 can be an attractive target in cancer therapy. This is supported by enhanced expression of DNA2 in many cancer cell lines with oncogene activation and premalignant cells. Therefore, DNA2 can be considered as a potential marker, useful in cancer therapy. DNA2, along with PARP1 inhibition, may be considered as a potential target for inducing synthetic lethality, a concept of killing tumor cells by targeting two essential genes.

  16. MCMC-ODPR: Primer design optimization using Markov Chain Monte Carlo sampling

    Directory of Open Access Journals (Sweden)

    Kitchen James L

    2012-11-01

    Full Text Available Abstract Background Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR algorithm. Results After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. Conclusions MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  17. MCMC-ODPR: primer design optimization using Markov Chain Monte Carlo sampling.

    Science.gov (United States)

    Kitchen, James L; Moore, Jonathan D; Palmer, Sarah A; Allaby, Robin G

    2012-11-05

    Next generation sequencing technologies often require numerous primer designs that require good target coverage that can be financially costly. We aimed to develop a system that would implement primer reuse to design degenerate primers that could be designed around SNPs, thus find the fewest necessary primers and the lowest cost whilst maintaining an acceptable coverage and provide a cost effective solution. We have implemented Metropolis-Hastings Markov Chain Monte Carlo for optimizing primer reuse. We call it the Markov Chain Monte Carlo Optimized Degenerate Primer Reuse (MCMC-ODPR) algorithm. After repeating the program 1020 times to assess the variance, an average of 17.14% fewer primers were found to be necessary using MCMC-ODPR for an equivalent coverage without implementing primer reuse. The algorithm was able to reuse primers up to five times. We compared MCMC-ODPR with single sequence primer design programs Primer3 and Primer-BLAST and achieved a lower primer cost per amplicon base covered of 0.21 and 0.19 and 0.18 primer nucleotides on three separate gene sequences, respectively. With multiple sequences, MCMC-ODPR achieved a lower cost per base covered of 0.19 than programs BatchPrimer3 and PAMPS, which achieved 0.25 and 0.64 primer nucleotides, respectively. MCMC-ODPR is a useful tool for designing primers at various melting temperatures at good target coverage. By combining degeneracy with optimal primer reuse the user may increase coverage of sequences amplified by the designed primers at significantly lower costs. Our analyses showed that overall MCMC-ODPR outperformed the other primer-design programs in our study in terms of cost per covered base.

  18. Development of DNA marker for Fusarium resistance in Pisang Berangan

    International Nuclear Information System (INIS)

    Affrida Abu Hassan; Mohd Nazir Basiran; Rosmawati Shaharuddin

    2000-01-01

    Fusarium wilt (Panama disease), a disease caused by a soil-bome fungus Fusarium oxysporum f. sp. cubense, is regarded as one of the most significant threats to banana (Musa spp.) production worldwide. In Malaysia, it is affecting the Cavendish as well as Pisang Berangan which are widely planted for export as well as for local consumption. Pisang Berangan mutant line (MB96) which was obtained through induced mutation by gamma irradiation has showed certain degree of tolerance towards the disease. Attempts were made to utilise Polymerase Chain Reaction (PCR) based techniques i.e. RAPD (Random Amplified Polymorphic DNA) to screen for unique DNA sequences that are associated or closely linked to these tolerance characteristics. Four single 1 Obp primers and five duplex 1 Obp primers combinations were used to detect polymorphism between the DNA of control and 4 mutant lines micropropagated from MB96. As further control, DNA of Pisang Mas was included. Duplex arbitrary primer combinations 11-89 and single primer OPA-3 have produced DNA fragments that are polymorphic between cultivar, Pisang Berangan and Pisang Mas. However the RAPD analysis failed to show any polymorphism between the control and the mutant lines or in between the mutant lines

  19. DNA-binding proteins essential for protein-primed bacteriophage ø29 DNA replication

    Directory of Open Access Journals (Sweden)

    Margarita Salas

    2016-08-01

    Full Text Available Bacillus subtilis phage Φ29 has a linear, double-stranded DNA 19 kb long with an inverted terminal repeat of 6 nucleotides and a protein covalently linked to the 5’ ends of the DNA. This protein, called terminal protein (TP, is the primer for the initiation of replication, a reaction catalyzed by the viral DNA polymerase at the two DNA ends. The DNA polymerase further elongates the nascent DNA chain in a processive manner, coupling strand displacement with elongation. The viral protein p5 is a single-stranded DNA binding protein (SSB that binds to the single strands generated by strand displacement during the elongation process. Viral protein p6 is a double-stranded DNA binding protein (DBP that preferentially binds to the origins of replication at the Φ29 DNA ends and is required for the initiation of replication. Both SSB and DBP are essential for Φ29 DNA amplification. This review focuses on the role of these phage DNA-binding proteins in Φ29 DNA replication both in vitro and in vivo, as well as on the implication of several B. subtilis DNA-binding proteins in different processes of the viral cycle. We will revise the enzymatic activities of the Φ29 DNA polymerase: TP-deoxynucleotidylation, processive DNA polymerization coupled to strand displacement, 3’-5’ exonucleolysis and pyrophosphorolysis. The resolution of the Φ29 DNA polymerase structure has shed light on the translocation mechanism and the determinants responsible for processivity and strand displacement. These two properties have made Φ29 DNA polymerase one of the main enzymes used in the current DNA amplification technologies. The determination of the structure of Φ29 TP revealed the existence of three domains: the priming domain, where the primer residue Ser232, as well as Phe230, involved in the determination of the initiating nucleotide, are located, the intermediate domain, involved in DNA polymerase binding, and the N-terminal domain, responsible for DNA binding

  20. Characterization of highly informative cross-species microsatellite panels for the Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) including five novel primers

    Science.gov (United States)

    Hunter, Margaret Kellogg; Broderick, Damien; Ovenden, Jennifer R.; Tucker, Kimberly Pause; Bonde, Robert K.; McGuire, Peter M.; Lanyon, Janet M.

    2010-01-01

    The Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) are threatened species of aquatic mammals in the order Sirenia. Sirenian conservation and management actions would benefit from a more complete understanding of genetic diversity and population structure. Generally, species-specific microsatellite markers are employed in conservation genetic studies; however, robust markers can be difficult and costly to isolate. To increase the number of available markers, dugong and manatee microsatellite primers were evaluated for cross-species amplification. Furthermore, one manatee and four dugong novel primers are reported. After polymerase chain reaction optimization, 23 (92%) manatee primers successfully amplified dugong DNA, of which 11 (48%) were polymorphic. Of the 32 dugong primers tested, 27 (84%) yielded product in the manatee, of which 17 (63%) were polymorphic. Dugong and manatee primers were compared and the most informative markers were selected to create robust and informative marker-panels for each species. These crossspecies microsatellite marker-panels can be employed to assess other sirenian populations and can provide beneficial information for the protection and management of these unique mammals.

  1. Characterization of highly informative cross-species microsatellite panels for the Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) including five novel primers.

    Science.gov (United States)

    Hunter, Margaret Kellogg; Broderick, Damien; Ovenden, Jennifer R; Tucker, Kimberly Pause; Bonde, Robert K; McGuire, Peter M; Lanyon, Janet M

    2010-03-01

    The Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) are threatened species of aquatic mammals in the order Sirenia. Sirenian conservation and management actions would benefit from a more complete understanding of genetic diversity and population structure. Generally, species-specific microsatellite markers are employed in conservation genetic studies; however, robust markers can be difficult and costly to isolate. To increase the number of available markers, dugong and manatee microsatellite primers were evaluated for cross-species amplification. Furthermore, one manatee and four dugong novel primers are reported. After polymerase chain reaction optimization, 23 (92%) manatee primers successfully amplified dugong DNA, of which 11 (48%) were polymorphic. Of the 32 dugong primers tested, 27 (84%) yielded product in the manatee, of which 17 (63%) were polymorphic. Dugong and manatee primers were compared and the most informative markers were selected to create robust and informative marker-panels for each species. These cross-species microsatellite marker-panels can be employed to assess other sirenian populations and can provide beneficial information for the protection and management of these unique mammals. Published 2009. This article is a US Government work and is in the public domain in the USA.

  2. Lesion Orientation of O4-Alkylthymidine Influences Replication by Human DNA Polymerase η

    OpenAIRE

    O’Flaherty, D. K.; Patra, A.; Su, Y.; Guengerich, F. P.; Egli, M.; Wilds, C. J.

    2016-01-01

    DNA lesions that elude repair may undergo translesion synthesis catalyzed by Y-family DNA polymerases. O4-Alkylthymidines, persistent adducts that can result from carcinogenic agents, may be encountered by DNA polymerases. The influence of lesion orientation around the C4-O4 bond on processing by human DNA polymerase η (hPol η) was studied for oligonucleotides containing O4-methylthymidine, O4-ethylthymidine, and analogs restricting the O4-methylene group in an anti-orientation. Primer extens...

  3. Development, distribution and application of DNA markers for cereal research

    International Nuclear Information System (INIS)

    Qi, X.; Stephenson, P.; Devos, K.M.; Gale, M.D.

    2001-01-01

    DNA probes and primers are important resources for molecular genetic research and molecular breeding. Presently, more than 2500 wheat probes, 400 barley probes, 800 foxtail, pearl millet and finger millet probes, and approximately 150 wheat microsatellite (SSR) primer pairs have been developed and maintained in our DNA Resource Centre at the John Innes Centre (JIC). To accelerate probe and primer distribution, an 'anchor set' and a 'supplementary anchor set', containing 73 and 31 wheat RFLP probes, respectively, and a standard set of 42 primer pairs for wheat SSR markers were selected. Similarly, a set of 52 pearl millet probes has been selected for distribution. More than 8000 wheat RFLP probes, 2000 wheat SSR primer pairs, 700 millet probes and 200 barley probes have been distributed to more than 250 research groups in 40 countries. Our wheat and millet probes and other grass cDNA probes have been used for comparative genetic studies. The revealed conservation of gene content and gene order has been used to construct maps of many grass species and to predict the locations of key genes from one crop species to another. Developed SSR and AFLP markers in wheat, barley and millet are particularly suited for genetic diversity analyses and map construction. (author)

  4. Establishment of dna fingerprinting in clonal tea improved cultivars from yunnan of china using issr markers

    International Nuclear Information System (INIS)

    Liu, B.Y.; Zhao, C.M.; Sun, X.M.; Jiang, H.B.

    2015-01-01

    In this study, DNA fingerprints were constructed by using ISSR markers for 20 clonal improved varieties developed by two breeding institutes in Yunnan province. Seven core ISSR primers were selected from 15 primers. A total of 110 bands were generated by PAGE with seven core primers, 93 of which were polymorphic bands, the percentage of polymorphic band (PPB) was 84.54%, and the mean value of polymorphism information content (PIC) reached 0.417; the genetic similarity coefficient of the cultivars was 0.574-0.854. The two primers, UBC835 and ISSR2, had high PIC values, and could be used to distinguish all cultivars, presenting the most efficient single primers. Among the all of primer combinations from the seven core primers, the three combinations, UBC835/UBC811, UBC835/ISSR2, and UBC835/ISSR3 showed lower similar coefficients, and more efficient in identifying the 20 improved varieties than the other primer combinations. Then these three primer combinations were further scored in 15 traditional cultivars. The results showed that UBC835/ISSR2 was the optimal primer combination, which could be used to distinguish each material among the 20 clonal improved varieties and 15 traditional cultivals. Finally, the DNA fingerprints of the 20 clonal improved varieties were constructed based on country and region code, breeding institute, core primer name and ISSR marker data. The established fingerprints could provide reliable scientific base for the protection of intellectual property right for these clonal improved varieties, and the important molecular information contained in these fingerprints would be useful for the authenticity identification and genetic relationship analysis of tea varieties. (author)

  5. A DNA Mini-Barcoding System for Authentication of Processed Fish Products.

    Science.gov (United States)

    Shokralla, Shadi; Hellberg, Rosalee S; Handy, Sara M; King, Ian; Hajibabaei, Mehrdad

    2015-10-30

    Species substitution is a form of seafood fraud for the purpose of economic gain. DNA barcoding utilizes species-specific DNA sequence information for specimen identification. Previous work has established the usability of short DNA sequences-mini-barcodes-for identification of specimens harboring degraded DNA. This study aims at establishing a DNA mini-barcoding system for all fish species commonly used in processed fish products in North America. Six mini-barcode primer pairs targeting short (127-314 bp) fragments of the cytochrome c oxidase I (CO1) DNA barcode region were developed by examining over 8,000 DNA barcodes from species in the U.S. Food and Drug Administration (FDA) Seafood List. The mini-barcode primer pairs were then tested against 44 processed fish products representing a range of species and product types. Of the 44 products, 41 (93.2%) could be identified at the species or genus level. The greatest mini-barcoding success rate found with an individual primer pair was 88.6% compared to 20.5% success rate achieved by the full-length DNA barcode primers. Overall, this study presents a mini-barcoding system that can be used to identify a wide range of fish species in commercial products and may be utilized in high throughput DNA sequencing for authentication of heavily processed fish products.

  6. Testing the potential of a ribosomal 16S marker for DNA metabarcoding of insects

    Directory of Open Access Journals (Sweden)

    Vasco Elbrecht

    2016-04-01

    Full Text Available Cytochrome c oxidase I (COI is a powerful marker for DNA barcoding of animals, with good taxonomic resolution and a large reference database. However, when used for DNA metabarcoding, estimation of taxa abundances and species detection are limited due to primer bias caused by highly variable primer binding sites across the COI gene. Therefore, we explored the ability of the 16S ribosomal DNA gene as an alternative metabarcoding marker for species level assessments. Ten bulk samples, each containing equal amounts of tissue from 52 freshwater invertebrate taxa, were sequenced with the Illumina NextSeq 500 system. The 16S primers amplified three more insect species than the Folmer COI primers and amplified more equally, probably due to decreased primer bias. Estimation of biomass might be less biased with 16S than with COI, although variation in read abundances of two orders of magnitudes is still observed. According to these results, the marker choice depends on the scientific question. If the goal is to obtain a taxonomic identification at the species level, then COI is more appropriate due to established reference databases and known taxonomic resolution of this marker, knowing that a greater proportion of insects will be missed using COI Folmer primers. If the goal is to obtain a more comprehensive survey the 16S marker, which requires building a local reference database, or optimised degenerated COI primers could be more appropriate.

  7. Fusion primer and nested integrated PCR (FPNI-PCR: a new high-efficiency strategy for rapid chromosome walking or flanking sequence cloning

    Directory of Open Access Journals (Sweden)

    Wang Zhen

    2011-11-01

    Full Text Available Abstract Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs. These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures.

  8. Rapid identification of probiotic Lactobacillus species by multiplex PCR using species-specific primers based on the region extending from 16S rRNA through 23S rRNA.

    Science.gov (United States)

    Kwon, Hyuk-Sang; Yang, Eun-Hee; Yeon, Seung-Woo; Kang, Byoung-Hwa; Kim, Tae-Yong

    2004-10-15

    This study aimed to develop a novel multiplex polymerase chain reaction (PCR) primer set for the identification of seven probiotic Lactobacillus species such as Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus casei, Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus rhamnosus. The primer set, comprising of seven specific and two conserved primers, was derived from the integrated sequences of 16S and 23S rRNA genes and their rRNA intergenic spacer region of each species. It was able to identify the seven target species with 93.6% accuracy, which exceeds that of the general biochemical methods. The phylogenetic analyses, using 16S rDNA sequences of the probiotic isolates, also provided further support that the results from the multiplex PCR assay were trustworthy. Taken together, we suggest that the multiplex primer set is an efficient tool for simple, rapid and reliable identification of seven Lactobacillus species.

  9. KENO-VI Primer: A Primer for Criticality Calculations with SCALE/KENO-VI Using GeeWiz

    International Nuclear Information System (INIS)

    Bowman, Stephen M.

    2008-01-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory is widely used and accepted around the world for criticality safety analyses. The well-known KENO-VI three-dimensional Monte Carlo criticality computer code is one of the primary criticality safety analysis tools in SCALE. The KENO-VI primer is designed to help a new user understand and use the SCALE/KENO-VI Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO-VI in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO-VI that are useful in criticality analyses. The primer is based on SCALE 6, which includes the Graphically Enhanced Editing Wizard (GeeWiz) Windows user interface. Each example uses GeeWiz to provide the framework for preparing input data and viewing output results. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO-VI input and allows the user to quickly run a simple criticality problem with SCALE/KENO-VI. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO-VI features that are covered in detail in the sample problems in that section. Upon completion of the primer, a new user should be comfortable using GeeWiz to set up criticality problems in SCALE/KENO-VI. The primer provides a starting point for the criticality safety analyst who uses SCALE/KENO-VI. Complete descriptions are provided in the SCALE/KENO-VI manual. Although the primer is self-contained, it is intended as a companion volume to the SCALE/KENO-VI documentation. (The SCALE manual is provided on the SCALE installation DVD.) The primer provides specific examples of

  10. Resistance gene candidates identified by PCR with degenerate oligonucleotide primers map to clusters of resistance genes in lettuce.

    Science.gov (United States)

    Shen, K A; Meyers, B C; Islam-Faridi, M N; Chin, D B; Stelly, D M; Michelmore, R W

    1998-08-01

    The recent cloning of genes for resistance against diverse pathogens from a variety of plants has revealed that many share conserved sequence motifs. This provides the possibility of isolating numerous additional resistance genes by polymerase chain reaction (PCR) with degenerate oligonucleotide primers. We amplified resistance gene candidates (RGCs) from lettuce with multiple combinations of primers with low degeneracy designed from motifs in the nucleotide binding sites (NBSs) of RPS2 of Arabidopsis thaliana and N of tobacco. Genomic DNA, cDNA, and bacterial artificial chromosome (BAC) clones were successfully used as templates. Four families of sequences were identified that had the same similarity to each other as to resistance genes from other species. The relationship of the amplified products to resistance genes was evaluated by several sequence and genetic criteria. The amplified products contained open reading frames with additional sequences characteristic of NBSs. Hybridization of RGCs to genomic DNA and to BAC clones revealed large numbers of related sequences. Genetic analysis demonstrated the existence of clustered multigene families for each of the four RGC sequences. This parallels classical genetic data on clustering of disease resistance genes. Two of the four families mapped to known clusters of resistance genes; these two families were therefore studied in greater detail. Additional evidence that these RGCs could be resistance genes was gained by the identification of leucine-rich repeat (LRR) regions in sequences adjoining the NBS similar to those in RPM1 and RPS2 of A. thaliana. Fluorescent in situ hybridization confirmed the clustered genomic distribution of these sequences. The use of PCR with degenerate oligonucleotide primers is therefore an efficient method to identify numerous RGCs in plants.

  11. Inteligencia emocional y autoconcepto en los estudiantes de primer ciclo

    OpenAIRE

    Castillo Canales, Braulio

    2017-01-01

    En nuestra investigación se tuvo como problema: ¿Qué relación existe entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II? Además el objetivo fue: Determinar la relación entre inteligencia emocional y autoconcepto en los estudiantes de primer ciclo de Administración en Turismo y Hotelería de la Universidad César Vallejo, Lima 2015-II. El tipo de estudio fue básica...

  12. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    Lucas, D.S.

    2004-10-03

    This paper covers the basics of the implementation of the control volume method in the context of the Homogeneous Equilibrium Model (HEM)(T/H) code using the conservation equations of mass, momentum, and energy. This primer uses the advection equation as a template. The discussion will cover the basic equations of the control volume portion of the course in the primer, which includes the advection equation, numerical methods, along with the implementation of the various equations via FORTRAN into computer programs and the final result for a three equation HEM code and its validation.

  13. Isolation of Retroelement from Plant Genomic DNA

    OpenAIRE

    sprotocols

    2014-01-01

    Author: Pat Heslop-Harrison ### Abstract: Retroelements and their derivatives are an ubiquitous and abundant component of plant genomes. From the 1990s, PCR based techniques have been developed to isolate the elements from genomic DNA of different plants, and the methods and primers used are presented here. Major classes of retroelements include the Ty1-copia, the Ty3-gypsy and the LINE (non-LTR) groups. Mixed PCR products representing the full heterogeneous pool of retrotransposo...

  14. Inaccurate DNA synthesis in cell extracts of yeast producing active human DNA polymerase iota.

    Science.gov (United States)

    Makarova, Alena V; Grabow, Corinn; Gening, Leonid V; Tarantul, Vyacheslav Z; Tahirov, Tahir H; Bessho, Tadayoshi; Pavlov, Youri I

    2011-01-31

    Mammalian Pol ι has an unusual combination of properties: it is stimulated by Mn(2+) ions, can bypass some DNA lesions and misincorporates "G" opposite template "T" more frequently than incorporates the correct "A." We recently proposed a method of detection of Pol ι activity in animal cell extracts, based on primer extension opposite the template T with a high concentration of only two nucleotides, dGTP and dATP (incorporation of "G" versus "A" method of Gening, abbreviated as "misGvA"). We provide unambiguous proof of the "misGvA" approach concept and extend the applicability of the method for the studies of variants of Pol ι in the yeast model system with different cation cofactors. We produced human Pol ι in baker's yeast, which do not have a POLI ortholog. The "misGvA" activity is absent in cell extracts containing an empty vector, or producing catalytically dead Pol ι, or Pol ι lacking exon 2, but is robust in the strain producing wild-type Pol ι or its catalytic core, or protein with the active center L62I mutant. The signature pattern of primer extension products resulting from inaccurate DNA synthesis by extracts of cells producing either Pol ι or human Pol η is different. The DNA sequence of the template is critical for the detection of the infidelity of DNA synthesis attributed to DNA Pol ι. The primer/template and composition of the exogenous DNA precursor pool can be adapted to monitor replication fidelity in cell extracts expressing various error-prone Pols or mutator variants of accurate Pols. Finally, we demonstrate that the mutation rates in yeast strains producing human DNA Pols ι and η are not elevated over the control strain, despite highly inaccurate DNA synthesis by their extracts.

  15. Inaccurate DNA synthesis in cell extracts of yeast producing active human DNA polymerase iota.

    Directory of Open Access Journals (Sweden)

    Alena V Makarova

    2011-01-01

    Full Text Available Mammalian Pol ι has an unusual combination of properties: it is stimulated by Mn(2+ ions, can bypass some DNA lesions and misincorporates "G" opposite template "T" more frequently than incorporates the correct "A." We recently proposed a method of detection of Pol ι activity in animal cell extracts, based on primer extension opposite the template T with a high concentration of only two nucleotides, dGTP and dATP (incorporation of "G" versus "A" method of Gening, abbreviated as "misGvA". We provide unambiguous proof of the "misGvA" approach concept and extend the applicability of the method for the studies of variants of Pol ι in the yeast model system with different cation cofactors. We produced human Pol ι in baker's yeast, which do not have a POLI ortholog. The "misGvA" activity is absent in cell extracts containing an empty vector, or producing catalytically dead Pol ι, or Pol ι lacking exon 2, but is robust in the strain producing wild-type Pol ι or its catalytic core, or protein with the active center L62I mutant. The signature pattern of primer extension products resulting from inaccurate DNA synthesis by extracts of cells producing either Pol ι or human Pol η is different. The DNA sequence of the template is critical for the detection of the infidelity of DNA synthesis attributed to DNA Pol ι. The primer/template and composition of the exogenous DNA precursor pool can be adapted to monitor replication fidelity in cell extracts expressing various error-prone Pols or mutator variants of accurate Pols. Finally, we demonstrate that the mutation rates in yeast strains producing human DNA Pols ι and η are not elevated over the control strain, despite highly inaccurate DNA synthesis by their extracts.

  16. Single nucleotide primer extension to detect genetic diseases: Experimental application to hemophilia B (factor IX) and cystic fibrosis genes

    International Nuclear Information System (INIS)

    Kuppuswamy, M.N.; Hoffmann, J.W.; Spitzer, S.G.; Groce, S.L.; Bajaj, S.P.; Kasper, C.K.

    1991-01-01

    In this report, the authors describe an approach to detect the presence of abnormal alleles in those genetic diseases in which frequency of occurrence of the same mutation is high (e.g., hemophilia B). Initially, from each subject, the DNA fragment containing the putative mutation site is amplified by the polymerase chain reaction. For each fragment two reaction mixtures are then prepared. Each contains the amplified fragment, a primer (18-mer or longer) whose sequence is identical to the coding sequence of the normal gene immediately flanking the 5' end of the mutation site, and either an α- 32 P-labeled nucleotide corresponding to the normal coding sequence at the mutation site or an α- 32 P-labeled nucleotide corresponding to the mutant sequence. An essential feature of the present methodology is that the base immediately 3' to the template-bound primer is one of those altered in the mutant, since in this way an extension of the primer by a single base will give an extended molecule characteristic of either the mutant or the wild type. The method is rapid and should be useful in carrier detection and prenatal diagnosis of every genetic disease with a known sequence variation

  17. Forensic analysis of mitochondrial DNA hypervariable region HVII ...

    African Journals Online (AJOL)

    aghomotsegin

    2015-02-04

    Feb 4, 2015 ... as even species thought to be closely related may in time accumulate ... have attracted the interest of population geneticists (Al-. Zahery et al. ... portion of DNA was amplified in two primers: the first one is HVIII-F. (438-459) ...

  18. Efficiency of random amplified polymorphic DNA (RAPD) and inter ...

    African Journals Online (AJOL)

    Efficiency of random amplified polymorphic DNA (RAPD) and inter-simple sequence repeats (ISSR) markers for genotype fingerprinting and genetic diversity studies in canola ( ) ... The number of amplified fragments with RAPD primers ranged from 8 to 21, with the size of amplicons ranging from 162 to 3154 bp.

  19. DNA methylation and genetic diversity analysis of genus Cycas in ...

    African Journals Online (AJOL)

    10 Cycas species as well as one subspecies localized in Thailand were studied using the methylation sensitive amplification polymorphism (MSAP) technique. 11 MSAP primer combinations were used and 720 MSAP bands were generated. The percentages of DNA methylation estimated from MSAP fingerprints were in ...

  20. Supplementary data: Development of nuclear DNA markers for ...

    Indian Academy of Sciences (India)

    Supplementary data: Development of nuclear DNA markers for evolutionary studies in Plasmodium falciparum. Celia Thomas, Sneh Shalini, N. Raghavendra, Meenakshi Choudhary, Anju Verma, Hema Joshi,. A. P. Dash and Aparup Das. J. Genet. 86, 65–68. Primer sequences for amplification of putatively neutral ...

  1. Isolation and characterization of microsatellite DNA loci from Sillago ...

    Indian Academy of Sciences (India)

    A diluted digestion–ligation mixture (1:10) was amplified with adaptor-specific primers (MSEP: 5 -GAT GAG TCC. TGA GTA A-3 ). Amplified DNA fragments, with a size range of 200–1000 bp, were enriched for repeats by mag- netic bead selection with a 5 -biotinylated (AC)15 probes, respectively. Enriched fragments were ...

  2. Primers As Socializing Agents in American and Finnish Schools.

    Science.gov (United States)

    Hyona, Jukka; And Others

    1995-01-01

    Content analysis of 12 Finnish and 18 American primers for grades 3 through 6 published primarily during the 1980s examined story type, plot setting, protagonist's characteristics, dramatic tasks, portrayals of family structure and parental responsibility, and extrafamilial peer and adult relationships. Results suggest that a nation's cultural…

  3. Bond strength of compomers to dentin using acidic primers.

    Science.gov (United States)

    Tate, W H; You, C; Powers, J M

    1999-10-01

    To determine the in vitro bond strengths of seven compomer/bonding agent restorative systems to human dentin. Seven compomer/bonding agents were bonded to human dentin, stored in water at 37 degrees C for 24 hours, and debonded in tension. Bonding conditions were with and without phosphoric acid etching, with and without the use of combined primer/bonding agents, and under moist and wet bond interfaces. Without phosphoric acid etching, F2000/F2000 Compomer Primer/Adhesive and F2000/Single Bond Dental Adhesive System were less sensitive to dentin wetness. With moist dentin, bond strengths of Dyract/Prime & Bond 2.1, Dyract AP/Prime & Bond 2.1, Hytac/OSB light-curing, one-component bonding agent, F2000/Single Bond, and Freedom/STAE single component light-cured dentin/enamel adhesive system, were improved with phosphoric acid etching. Also, with moist dentin, the bond strength of F2000/F2000 Compomer Primer/Adhesive in the 3M Clicker dispensing system was higher without phosphoric acid etching, whereas bonds of Compoglass/Syntac Single-component were not affected by phosphoric acid etching. Bonding did not occur without primer/bonding agent, regardless of surface condition or use of phosphoric acid etching.

  4. Single primer amplification reaction methods reveal exotic and ...

    Indian Academy of Sciences (India)

    Unknown

    mulberry varieties using three different PCR based single primer amplification ..... the results of a multi- variate analysis using Mahalanobis D2 statistic in case of .... Rajan M V, Chaturvedi H K and Sarkar A 1997 Multivariate analysis as an aid ...

  5. Diversity of internal structures in inhibited epoxy primers

    Directory of Open Access Journals (Sweden)

    Anthony E. Hughes

    2015-10-01

    Full Text Available Computed tomography is making a significant impact in the field of materials science in recent years. In this paper the authors report on advances made in three areas of characterization and also identified where further research needs to be focused. First we report on a new approach to data analysis called “Data Constrained Modelling (DCM” in which compositional tomography can be undertaken rather than adsorption or phase contrast tomography. This is achieved by collecting X-ray CT data at different energies and then combining the datasets to reconstruct 3D compositional tomography. Second, on the application of this approach to inhibited primers typical of those used in the aerospace industry. Aerospace primers are effectively composite materials containing inorganic phases which are bound together with a polymer. Understanding the materials science of these systems requires information over several orders of magnitude in length-scale. In this paper we report on how DCM can be used to extend our understanding at the smaller length scales at the limits of resolution of the technique. The third and final advance is in extending the approach to include 4-dimensional studies. In this case we examine the primer before and after leaching. This process causes changes in the primer which can be both detected and quantified using the above approach.

  6. Development of specific primers for genus Fusarium and F. solani ...

    African Journals Online (AJOL)

    Yomi

    2012-01-05

    Jan 5, 2012 ... reproductive parts of plants. They are ... plant species in most parts of the world. .... 20 µl 2.5X master mix (Eppendorf) and 1 µl of each forward and ... List of primers developed for rapid detection of Fusarium sp. and F. solani.

  7. Development of a microsatellite primer set to investigate the genetic ...

    Indian Academy of Sciences (India)

    Development of a microsatellite primer set to investigate the genetic population structure of Armadillidium nasatum (Crustacea, Oniscidea). Séverine Masson, Cédric Faivre, Isabelle Giraud, Catherine Souty-Grosset, Richard Cordaux, Carine Delaunay,. Didier Bouchon and Nicolas Bech. J. Genet. 93, 545-549. Table 1.

  8. Blood Donation and Transfusion: A Primer for Health Educators.

    Science.gov (United States)

    Felts, W. Michael; Glascoff, Mary A.

    1991-01-01

    Presents a primer for health educators about blood donation and transfusion, examining the nature of human blood, the background of blood transfusion, blood donation criteria, risks related to homologous blood transfusion, directed blood donation, potential alternatives to homologous transfusion, and resources for education on the subject. (SM)

  9. A Primer on Concepts and Applications of Proteomics in Neuroscience

    DEFF Research Database (Denmark)

    Hosp, Fabian; Mann, Matthias

    2017-01-01

    The enormous complexity of the central nervous system has impeded its systemic exploration for decades but powerful "omic" technologies are now pushing forward the frontiers of neuroscience research at an increasing pace. This Primer reviews the most recent progress in mass spectrometry (MS...

  10. Bioinspired Catecholic Primers for Rigid and Ductile Dental Resin Composites.

    Science.gov (United States)

    Shin, Eeseul; Ju, Sung Won; An, Larry; Ahn, Eungjin; Ahn, Jin-Soo; Kim, Byeong-Su; Ahn, B Kollbe

    2018-01-17

    In the construction of dental restorative polymer composite materials, surface priming on mineral fillers is essential to improve the mechanical performance of the composites. Here we present bioinspired catechol-functionalized primers for a tougher dental resin composite containing glass fillers. The catecholic primers with different polymerizable end groups were designed and then coated on glass surfaces using a simple drop-casting or dip-coating process. The surface binding ability and possible cross-linking (coupling or chemical bridging between the glass substrate and the dental resin) of the catecholic bifunctional primers were evaluated using atomic force microscopy, contact angle measurements, and the knife shear bonding test and compared to a state-of-the-art silane-based coupling agent. Various mechanical tests including shrinkage and compression tests of the dental resin composites were also conducted. Compression tests of the composites containing the catecholic primed fillers exhibited enhanced mechanical properties, owing to the bidentate hydrogen bonding of catechol moieties to the oxide mineral surface. Furthermore, the superior biocompatibility of the primed surface was confirmed via cell attachment assay, thus providing applicability of catecholic primers for practical dental and biomedical applications.

  11. Characteristics of the population employed in primer sector in Turkey

    Directory of Open Access Journals (Sweden)

    Bayar Rüya

    2006-01-01

    Full Text Available Activities related to the production of raw material like agriculture husbandry, forestry, fishery are called as primer activities. Especially people living in rural areas earn their livings on primer activities, mainly agriculture. Rural planning is inevitable for providing rural development which has an important place in all development of a country. And achievement of this planning depends on putting forth the characteristics of the population living in rural areas with its different aspects. Therefore, the requirements will be introduced more clearly and the increase in the welfare levels of the people living in rural areas will have been achieved. To achieve the rural development and progress, in addition to the features like the size of agricultural products, products that are cultivated, activities like husbandry, forestry, hunting, etc. and the qualities of the enterprises in which these activities are carried out, policies applied, capital, market and technology, the characteristics of the population employed in this sector is also of importance. Considering these points, what is aimed in this study is to put forth the characteristics of the population employed in primer sector in Turkey. According to the census results of the year 2000 in Turkey 38% of the population is employed, and 48% of this work is in primer sector.

  12. Controlling Air Pollution; A Primer on Stationary Source Control Techniques.

    Science.gov (United States)

    Corman, Rena

    This companion document to "Air Pollution Primer" is written for the nonexpert in air pollution; however, it does assume a familiarity with air pollution problems. This work is oriented toward providing the reader with knowledge about current and proposed air quality legislation and knowledge about available technology to meet these standards for…

  13. CRISPR Technology Reveals RAD(51)-ical Mechanisms of Repair in Roundworms: An Educational Primer for Use with "Promotion of Homologous Recombination by SWS-1 in Complex with RAD-51 Paralogs in Caenorhabditis elegans".

    Science.gov (United States)

    Turcotte, Carolyn A; Andrews, Nicolas P; Sloat, Solomon A; Checchi, Paula M

    2016-11-01

    The mechanisms cells use to maintain genetic fidelity via DNA repair and the accuracy of these processes have garnered interest from scientists engaged in basic research to clinicians seeking improved treatment for cancer patients. Despite the continued advances, many details of DNA repair are still incompletely understood. In addition, the inherent complexity of DNA repair processes, even at the most fundamental level, makes it a challenging topic. This primer is meant to assist both educators and students in using a recent paper, "Promotion of homologous recombination by SWS-1 in complex with RAD-51 paralogs in Caenorhabditis elegans," to understand mechanisms of DNA repair. The goals of this primer are to highlight and clarify several key techniques utilized, with special emphasis on the clustered, regularly interspaced, short palindromic repeats technique and the ways in which it has revolutionized genetics research, as well as to provide questions for deeper in-class discussion. Copyright © 2016 by the Genetics Society of America.

  14. DNA barcode of coastal alga ( Chlorella sorokiniana ) from Ago ...

    African Journals Online (AJOL)

    Five different loci 18S, UPA, rbcl, ITS and tufA were tested for their use as deoxyribonucleic acid (DNA) barcode in this study. Although the UPA primers were designed to amplify all phototrophic algae and cyanobacteria, UPA and 18S did not amplified at all for the genus Chlorella while ITS1, ITS2 rDNA and rbcL markers ...

  15. Capillary gel electrophoresis for rapid, high resolution DNA sequencing.

    OpenAIRE

    Swerdlow, H; Gesteland, R

    1990-01-01

    Capillary gel electrophoresis has been demonstrated for the separation and detection of DNA sequencing samples. Enzymatic dideoxy nucleotide chain termination was employed, using fluorescently tagged oligonucleotide primers and laser based on-column detection (limit of detection is 6,000 molecules per peak). Capillary gel separations were shown to be three times faster, with better resolution (2.4 x), and higher separation efficiency (5.4 x) than a conventional automated slab gel DNA sequenci...

  16. Isolation of a sex-linked DNA sequence in cranes.

    Science.gov (United States)

    Duan, W; Fuerst, P A

    2001-01-01

    A female-specific DNA fragment (CSL-W; crane sex-linked DNA on W chromosome) was cloned from female whooping cranes (Grus americana). From the nucleotide sequence of CSL-W, a set of polymerase chain reaction (PCR) primers was identified which amplify a 227-230 bp female-specific fragment from all existing crane species and some other noncrane species. A duplicated versions of the DNA segment, which is found to have a larger size (231-235 bp) than CSL-W in both sexes, was also identified, and was designated CSL-NW (crane sex-linked DNA on non-W chromosome). The nucleotide similarity between the sequences of CSL-W and CSL-NW from whooping cranes was 86.3%. The CSL primers do not amplify any sequence from mammalian DNA, limiting the potential for contamination from human sources. Using the CSL primers in combination with a quick DNA extraction method allows the noninvasive identification of crane gender in less than 10 h. A test of the methodology was carried out on fully developed body feathers from 18 captive cranes and resulted in 100% successful identification.

  17. PCR approach for rapid detection of Escherichia coli in tempe using a specific primer

    Directory of Open Access Journals (Sweden)

    Siti Harnina Bintari

    2014-12-01

    Full Text Available Tempe known as a traditional fermented food originated from Indonesia. It has a unique flavour and texture. It also contains high protein and usually serves to substitute meat, fish, or egg as a complement to rice. The manufacture process of Tempe is quite complex and mostly, the traditional process has not employed the hygienic standard. In the process of Tempe making, there are two critical stages of the whole process; i.e. soaking of soybeans and solid state fermentation by Rhizopus sp. During the process, foodborne pathogen bacteria such as Escherichia coli could contaminate the product of Tempe. The bacterial contamination could be revealed through culture dependent methods which is costly, laborious, and time consuming. Therefore, the culture-independent method such as polymerase chain reaction using a specific primer could be applied to detect target microorganism to save time and labour. In this study, thirty-one Tempe samples collected from different manufacturers in Semarang, Central Java, Indonesia were analysed by PCR. In order to obtain the bacterial genomic DNA, a modified Chelex 100-Microwave method was employed. The results of DNA extraction showed that the method was an applicable method. It gave high quantity and quality of DNA; therefore, it could be applied in the PCR reaction. The DNA samples were employed in PCR for detection of Escherichia coli using Ecoli706F/R. It was found that 27 out of 31 samples were detected having Escherichia coli contamination showed by the presence of the amplified product size 706 bp. The application of this method could significantly reduce costs and time of analysis in the laboratory. Further response after E. coli were detected could be employed, including investigation of the critical factors in Tempe manufacturing process which allowed E. coli contamination.

  18. Refining DNA Barcoding Coupled High Resolution Melting for Discrimination of 12 Closely Related Croton Species.

    Directory of Open Access Journals (Sweden)

    Maslin Osathanunkul

    Full Text Available DNA barcoding coupled high resolution melting (Bar-HRM is an emerging method for species discrimination based on DNA dissociation kinetics. The aim of this work was to evaluate the suitability of different primer sets, derived from selected DNA regions, for Bar-HRM analysis of species in Croton (Euphorbiaceae, one of the largest genera of plants with over 1,200 species. Seven primer pairs were evaluated (matK, rbcL1, rbcL2, rbcL3, rpoC, trnL and ITS1 from four plastid regions, matK, rbcL, rpoC, and trnL, and the nuclear ribosomal marker ITS1. The primer pair derived from the ITS1 region was the single most effective region for the identification of the tested species, whereas the rbcL1 primer pair gave the lowest resolution. It was observed that the ITS1 barcode was the most useful DNA barcoding region overall for species discrimination out of all of the regions and primers assessed. Our Bar-HRM results here also provide further support for the hypothesis that both sequence and base composition affect DNA duplex stability.

  19. Bypass of a psoralen DNA interstrand cross-link by DNA polymerases beta, iota, and kappa in vitro

    Science.gov (United States)

    Smith, Leigh A.; Makarova, Alena V.; Samson, Laura; Thiesen, Katherine E.; Dhar, Alok; Bessho, Tadayoshi

    2012-01-01

    Repair of DNA inter-strand cross-links in mammalian cells involves several biochemically distinctive processes, including the release of one of the cross-linked strands and translesion DNA synthesis (TLS). In this report, we investigated in vitro TLS activity of psoralen DNA inter-strand cross-link by three DNA repair polymerases, DNA polymerase beta, kappa and iota. DNA polymerase beta is capable of bypassing a psoralen cross-link with a low efficiency. Cell extracts prepared from DNA polymerase beta knockout mouse embryonic fibroblast showed a reduced bypass activity of the psoralen cross-link and purified DNA polymerase beta restored the bypass activity. In addition, DNA polymerase iota mis-incorporated thymine across the psoralen cross-link and DNA polymerase kappa extended these mis-paired primer ends, suggesting that DNA polymerase iota may serve as an inserter and DNA polymerase kappa may play a role as an extender in the repair of psoralen DNA inter-strand cross-links. The results demonstrated here indicate that multiple DNA polymerases could participate in TLS steps in mammalian DNA inter-strand cross-link repair. PMID:23106263

  20. Modeling DNA

    Science.gov (United States)

    Robertson, Carol

    2016-01-01

    Deoxyribonucleic acid (DNA) is life's most amazing molecule. It carries the genetic instructions that almost every organism needs to develop and reproduce. In the human genome alone, there are some three billion DNA base pairs. The most difficult part of teaching DNA structure, however, may be getting students to visualize something as small as a…

  1. The ability of T2/B4 primers to detect Leishmania infantum among ...

    African Journals Online (AJOL)

    SERVER

    2008-04-03

    Apr 3, 2008 ... Reverse Primer (5`-CCT CTC TTT TTT CNC TGT GC-3`). (Schönian et al., 1996),. B. Forward Primer (RV1) (5`-GTG GGG GAG GGG CGT TCT-3`) and Reverse Primer (RV2) (5`-ATT TTA CAC CAA CCC CCA GTT-. 3`) (Lachaud et al., 2002; Reale et al., 1999),. C. Forward Primer (T2) (5`-CGG CTT CGC ...

  2. Genetic Constructor: An Online DNA Design Platform.

    Science.gov (United States)

    Bates, Maxwell; Lachoff, Joe; Meech, Duncan; Zulkower, Valentin; Moisy, Anaïs; Luo, Yisha; Tekotte, Hille; Franziska Scheitz, Cornelia Johanna; Khilari, Rupal; Mazzoldi, Florencio; Chandran, Deepak; Groban, Eli

    2017-12-15

    Genetic Constructor is a cloud Computer Aided Design (CAD) application developed to support synthetic biologists from design intent through DNA fabrication and experiment iteration. The platform allows users to design, manage, and navigate complex DNA constructs and libraries, using a new visual language that focuses on functional parts abstracted from sequence. Features like combinatorial libraries and automated primer design allow the user to separate design from construction by focusing on functional intent, and design constraints aid iterative refinement of designs. A plugin architecture enables contributions from scientists and coders to leverage existing powerful software and connect to DNA foundries. The software is easily accessible and platform agnostic, free for academics, and available in an open-source community edition. Genetic Constructor seeks to democratize DNA design, manufacture, and access to tools and services from the synthetic biology community.

  3. Adenovirus 36 DNA in human adipose tissue.

    Science.gov (United States)

    Ponterio, E; Cangemi, R; Mariani, S; Casella, G; De Cesare, A; Trovato, F M; Garozzo, A; Gnessi, L

    2015-12-01

    Recent studies have suggested a possible correlation between obesity and adenovirus 36 (Adv36) infection in humans. As information on adenoviral DNA presence in human adipose tissue are limited, we evaluated the presence of Adv36 DNA in adipose tissue of 21 adult overweight or obese patients. Total DNA was extracted from adipose tissue biopsies. Virus detection was performed using PCR protocols with primers against specific Adv36 fiber protein and the viral oncogenic E4orf1 protein nucleotide sequences. Sequences were aligned with the NCBI database and phylogenetic analyses were carried out with MEGA6 software. Adv36 DNA was found in four samples (19%). This study indicates that some individuals carry Adv36 in the visceral adipose tissue. Further studies are needed to determine the specific effect of Adv36 infection on adipocytes, the prevalence of Adv36 infection and its relationship with obesity in the perspective of developing a vaccine that could potentially prevent or mitigate infection.

  4. QDD: a user-friendly program to select microsatellite markers and design primers from large sequencing projects.

    Science.gov (United States)

    Meglécz, Emese; Costedoat, Caroline; Dubut, Vincent; Gilles, André; Malausa, Thibaut; Pech, Nicolas; Martin, Jean-François

    2010-02-01

    QDD is an open access program providing a user-friendly tool for microsatellite detection and primer design from large sets of DNA sequences. The program is designed to deal with all steps of treatment of raw sequences obtained from pyrosequencing of enriched DNA libraries, but it is also applicable to data obtained through other sequencing methods, using FASTA files as input. The following tasks are completed by QDD: tag sorting, adapter/vector removal, elimination of redundant sequences, detection of possible genomic multicopies (duplicated loci or transposable elements), stringent selection of target microsatellites and customizable primer design. It can treat up to one million sequences of a few hundred base pairs in the tag-sorting step, and up to 50,000 sequences in a single input file for the steps involving estimation of sequence similarity. QDD is freely available under the GPL licence for Windows and Linux from the following web site: http://www.univ-provence.fr/gsite/Local/egee/dir/meglecz/QDD.html. Supplementary data are available at Bioinformatics online.

  5. AFLP analysis of rice transformed with maize DNA by particle beam

    International Nuclear Information System (INIS)

    Ji Shengdong; Chen Peng; Wang Jiachuan; Yuan Zhao; Yue Chunhui; Wang Zhifeng

    2009-01-01

    Many stable heritable rice lines were obtained via five years agricultural selection, which were derived from rice (oryza stative Japonica) Yujing-6 transgened with large fraction DNA of Zhengdan-14 (zea mays L.) by particle beam method. 18 pairs optimum selective primers were got by screening from 64 pairs AFLP selective primers via experiment on two mutant lines, which could amplify many DNA fingerprints and also could amplify polymorphic bands and target bands, both in this two mutant lines. Then the two mutant lines and two controls were analyzed with AFLP, the results showed that many polymorphic bands (such as novel bands, target bands, missing bands) were found in mutant lines. The discrepancy in DNA level indicated that rice, transgened with large fraction DNA of Zhengdan-14 by particle beam, might be inserted maize DNA and inherited steadily in some degree. It also indicated that it was possible to cultivate novel rice variety transformed with wide DNA by particle beam. (authors)

  6. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

    2000-09-27

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  7. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    A Harding; B Metting; C Word; G Bilyard; G Hund; J Amaya; J Weber; S Gajewski; S Underriner; T Peterson

    1998-12-10

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of @oups interacting about topics in bioremediation or the NABIR program. The primer also provides briez usefid models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums.

  8. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders; FINAL

    International Nuclear Information System (INIS)

    Bilyard, G.R.; Word, C.J.; Weber, J.R.; Harding, A.K.

    2000-01-01

    This primer is a tool to help prepare scientists for meetings with stakeholders. It was prepared for staff involved with the Natural and Accelerated Bioremediation Research (NABIR) program, sponsored by the U.S. Department of Energy. It discusses why some efforts in science communication may succeed while others fail, provides methods of approaching group interactions about science that may better orient expert participants, and summarizes experience drawn from observations of groups interacting about topics in bioremediation or the NABIR program. The primer also provides brief, useful models for interacting with either expert or non-expert groups. Finally, it identifies topical areas that may help scientists prepare for public meetings, based on the developers' ongoing research in science communication in public forums

  9. Profil Gangguan Kognitif pada Tumor Intrakranial Primer dan Metastasis

    OpenAIRE

    Kartika Maharani; Andira Larasari; Tiara Aninditha; Yetty Ramli

    2015-01-01

    Gangguan kognitif sering menyertai pasien tumor intrakranial dan menjadi penyebab utama disabilitas. Perbedaan patofisiologi tumor intrakranial primer (TIP) dan metastasis (TM) menyebabkan perbedaan gambaran klinis dan derajat  gangguan kognitif. Tujuan penelitian ini untuk mengetahui prevalensi dan profil gangguan kognitif pasien TIP dan TM. Disain penelitian potong-lintang retrospektif menggunakan data sekunder dari Poliklinik Saraf RSCM pada bulan Januari 2011-Desember 2013. Subjek b...

  10. A primer on the mortgage market and mortgage finance

    OpenAIRE

    Daniel J. McDonald; Daniel L. Thornton

    2008-01-01

    This article is a primer on mortgage finance. It discusses the basics of the mortgage market and mortgage finance. In so doing, it provides useful information that can aid individuals in making better mortgage finance decisions. The discussion and the tools are presented within the context of mortgage finance; however, these same principles and tools can be applied to a wide range of financial decisions.

  11. Transient Heat Transfer Model for Car Body Primer Curing

    OpenAIRE

    D. Zabala; N. Sánchez; J. Pinto

    2010-01-01

    A transient heat transfer mathematical model for the prediction of temperature distribution in the car body during primer baking has been developed by considering the thermal radiation and convection in the furnace chamber and transient heat conduction governing equations in the car framework. The car cockpit is considered like a structure with six flat plates, four vertical plates representing the car doors and the rear and front panels. The other two flat plates are the...

  12. Small Commercial Building Re-tuning: A Primer

    Energy Technology Data Exchange (ETDEWEB)

    Cort, Katherine A.; Hostick, Donna J.; Underhill, Ronald M.; Fernandez, Nicholas; Katipamula, Srinivas

    2013-09-30

    To help building owners and managers address issues related to energy-efficient operation of small buildings, DOE has developed a Small Building Re-tuning training curriculum. This "primer" provides additional background information to understand some of the concepts presented in the Small Building Re-tuning training. The intent is that those who are less familiar with the buidling energy concepts will review this material before taking the building re-tuning training class.

  13. Real-Time PCR Quantification of Chloroplast DNA Supports DNA Barcoding of Plant Species.

    Science.gov (United States)

    Kikkawa, Hitomi S; Tsuge, Kouichiro; Sugita, Ritsuko

    2016-03-01

    Species identification from extracted DNA is sometimes needed for botanical samples. DNA quantification is required for an accurate and effective examination. If a quantitative assay provides unreliable estimates, a higher quantity of DNA than the estimated amount may be used in additional analyses to avoid failure to analyze samples from which extracting DNA is difficult. Compared with conventional methods, real-time quantitative PCR (qPCR) requires a low amount of DNA and enables quantification of dilute DNA solutions accurately. The aim of this study was to develop a qPCR assay for quantification of chloroplast DNA from taxonomically diverse plant species. An absolute quantification method was developed using primers targeting the ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene using SYBR Green I-based qPCR. The calibration curve was generated using the PCR amplicon as the template. DNA extracts from representatives of 13 plant families common in Japan. This demonstrates that qPCR analysis is an effective method for quantification of DNA from plant samples. The results of qPCR assist in the decision-making will determine the success or failure of DNA analysis, indicating the possibility of optimization of the procedure for downstream reactions.

  14. Molecular characterization of Fagaceae species using inter-primer binding site (iPBS) markers.

    Science.gov (United States)

    Coutinho, João Paulo; Carvalho, Ana; Martín, Antonio; Lima-Brito, José

    2018-04-01

    Retrotransposons (RTNs) contribute for genome evolution, influencing its size and structure. We investigated the utility of the RTN-based markers inter-primer binding site (iPBS) for the molecular characterization of 25 Fagaceae species from genera Castanea, Fagus and Quercus. The assessment of genetic diversity, relationships and structure, as well as taxonomic classification of Fagaceae based on molecular data is important for definition of conservation, forestry management strategies and discrimination among natural hybrids and their parents since natural hybridization may increase with the climate changes. Here, iPBS primers designed by other authors were tested alone and combined. Some of them were discriminative, revealed polymorphism within and among taxa allowing the production of a total of 150 iPBS markers. In addition, several monomorphic iPBS markers were also amplified in each taxon. The UPGMA dendrogram based on the pooled iPBS data revealed 27% of genetic similarity among species. The individuals were clustered per genus and most of the oaks per infrageneric group corroborating the adopted taxonomy. Globally, the iPBS markers demonstrated suitability for DNA fingerprinting, determination of phylogenies and taxonomic discrimination in Fagaceae, and could constitute a useful and alternative tool for germplasm characterization, and for definition of conservation strategies and forestry management. Moreover, these markers would be useful for fingerprinting natural hybrids that share morphological similarities with their parents. Since iPBS markers could also enable insights about RTNs evolution, an eventual correlation among iPBS polymorphism, variability of RTN insertions and/or genome size in Fagaceae is discussed.

  15. Effect of oligonucleotide primers in determining viral variability within hosts

    Directory of Open Access Journals (Sweden)

    Moya Andrés

    2004-12-01

    Full Text Available Abstract Background Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. Results To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient. Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Conclusions Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  16. Effect of oligonucleotide primers in determining viral variability within hosts.

    Science.gov (United States)

    Bracho, Maria Alma; García-Robles, Inmaculada; Jiménez, Nuria; Torres-Puente, Manuela; Moya, Andrés; González-Candelas, Fernando

    2004-12-09

    Genetic variability in viral populations is usually estimated by means of polymerase chain reaction (PCR) based methods in which the relative abundance of each amplicon is assumed to be proportional to the frequency of the corresponding template in the initial sample. Although bias in template-to-product ratios has been described before, its relevance in describing viral genetic variability at the intrapatient level has not been fully assessed yet. To investigate the role of oligonucleotide design in estimating viral variability within hosts, genetic diversity in hepatitis C virus (HCV) populations from eight infected patients was characterised by two parallel PCR amplifications performed with two slightly different sets of primers, followed by cloning and sequencing (mean = 89 cloned sequences per patient). Population genetics analyses of viral populations recovered by pairs of amplifications revealed that in seven patients statistically significant differences were detected between populations sampled with different set of primers. Genetic variability analyses demonstrates that PCR selection due to the choice of primers, differing in their degeneracy degree at some nucleotide positions, can eclipse totally or partially viral variants, hence yielding significant different estimates of viral variability within a single patient and therefore eventually producing quite different qualitative and quantitative descriptions of viral populations within each host.

  17. Sensory reception of the primer pheromone ethyl oleate

    Science.gov (United States)

    Muenz, Thomas S.; Maisonnasse, Alban; Plettner, Erika; Le Conte, Yves; Rössler, Wolfgang

    2012-05-01

    Social work force distribution in honeybee colonies critically depends on subtle adjustments of an age-related polyethism. Pheromones play a crucial role in adjusting physiological and behavioral maturation of nurse bees to foragers. In addition to primer effects of brood pheromone and queen mandibular pheromone—both were shown to influence onset of foraging—direct worker-worker interactions influence adult behavioral maturation. These interactions were narrowed down to the primer pheromone ethyl oleate, which is present at high concentrations in foragers, almost absent in young bees and was shown to delay the onset of foraging. Based on chemical analyses, physiological recordings from the antenna (electroantennograms) and the antennal lobe (calcium imaging), and behavioral assays (associative conditioning of the proboscis extension response), we present evidence that ethyl oleate is most abundant on the cuticle, received by olfactory receptors on the antenna, processed in glomeruli of the antennal lobe, and learned in olfactory centers of the brain. The results are highly suggestive that the primer pheromone ethyl oleate is transmitted and perceived between individuals via olfaction at close range.

  18. Teaching Thermal Hydraulics & Numerical Methods: An Introductory Control Volume Primer

    Energy Technology Data Exchange (ETDEWEB)

    D. S. Lucas

    2004-10-01

    A graduate level course for Thermal Hydraulics (T/H) was taught through Idaho State University in the spring of 2004. A numerical approach was taken for the content of this course since the students were employed at the Idaho National Laboratory and had been users of T/H codes. The majority of the students had expressed an interest in learning about the Courant Limit, mass error, semi-implicit and implicit numerical integration schemes in the context of a computer code. Since no introductory text was found the author developed notes taught from his own research and courses taught for Westinghouse on the subject. The course started with a primer on control volume methods and the construction of a Homogeneous Equilibrium Model (HEM) (T/H) code. The primer was valuable for giving the students the basics behind such codes and their evolution to more complex codes for Thermal Hydraulics and Computational Fluid Dynamics (CFD). The course covered additional material including the Finite Element Method and non-equilibrium (T/H). The control volume primer and the construction of a three-equation (mass, momentum and energy) HEM code are the subject of this paper . The Fortran version of the code covered in this paper is elementary compared to its descendants. The steam tables used are less accurate than the available commercial version written in C Coupled to a Graphical User Interface (GUI). The Fortran version and input files can be downloaded at www.microfusionlab.com.

  19. Characterization and isolation of DNA microsatellite primers in Raja clavata L. (thornback ray, Rajidae)

    NARCIS (Netherlands)

    Chevolot, M; Reusch, TBH; Boele-Bos, S; Stam, WT; Olsen, JL

    The thornback ray, Raja clavata, is an elasmobranch (cartilaginous fish). Since the 1950s, its stock has severely declined. In order to investigate the genetic population structure of the species, we developed microsatellite loci. The five loci reported here have eight to 48 alleles per locus and

  20. Transferability of retrotransposon primers derived from Persimmon (Diospyros kaki Thunb.) across other plant species.

    Science.gov (United States)

    Du, X Y; Hu, Q N; Zhang, Q L; Wang, Y B; Luo, Z R

    2013-06-06

    Retrotransposon-based molecular markers are powerful molecular tools. However, these markers are not readily available due to the difficulty in obtaining species-specific retrotransposon primers. Although recent techniques enabling the rapid isolation of retrotransposon sequences have facilitated primer development, this process nonetheless remains time-consuming and costly. Therefore, research into the transferability of retrotransposon primers developed from one plant species onto others would be of great value. The present study investigated the transferability of retrotransposon primers derived from 'Luotian-tianshi' persimmon (Diospyros kaki Thunb.) across other fruit crops, as well as within the genus using inter-retrotransposon amplified polymorphism molecular marker. Fourteen of the 26 retrotransposon primers tested (53.85%) produced robust and reproducible amplification products across all fruit crops tested, indicating their applicability across plant species. Four of the 13 fruit crops showed the best transferability performances: persimmon, grape, citrus, and peach. Furthermore, similarity coefficients and UPGMA clustering indicated that these primers could further offer a potential tool for germplasm differentiation, parentage identification, genetic diversity assessment, classification, and phylogenetic studies across a variety of plant species. Transferability was further confirmed by examining published primers derived from Rosaceae, Gramineae, and Solanaceae. This study is one of the few currently available studies concerning the transferability of retrotransposon primers across plant species in general, and is the first successful study of the transferability of retrotransposon primers derived from persimmon. The primers presented here will help reduce costs for future retrotransposon primer development and therefore contribute to the popularization of retrotransposon molecular markers.

  1. Preparation of Phi29 DNA polymerase free of amplifiable DNA using ethidium monoazide, an ultraviolet-free light-emitting diode lamp and trehalose.

    Directory of Open Access Journals (Sweden)

    Hirokazu Takahashi

    Full Text Available We previously reported that multiply-primed rolling circle amplification (MRPCA using modified random RNA primers can amplify tiny amounts of circular DNA without producing any byproducts. However, contaminating DNA in recombinant Phi29 DNA polymerase adversely affects the outcome of MPRCA, especially for negative controls such as non-template controls. The amplified DNA in negative control casts doubt on the result of DNA amplification. Since Phi29 DNA polymerase has high affinity for both single-strand and double-stranded DNA, some amount of host DNA will always remain in the recombinant polymerase. Here we describe a procedure for preparing Phi29 DNA polymerase which is essentially free of amplifiable DNA. This procedure is realized by a combination of host DNA removal using appropriate salt concentrations, inactivation of amplifiable DNA using ethidium monoazide, and irradiation with visible light from a light-emitting diode lamp. Any remaining DNA, which likely exists as oligonucleotides captured by the Phi29 DNA polymerase, is degraded by the 3'-5' exonuclease activity of the polymerase itself in the presence of trehalose, used as an anti-aggregation reagent. Phi29 DNA polymerase purified by this procedure has little amplifiable DNA, resulting in reproducible amplification of at least ten copies of plasmid DNA without any byproducts and reducing reaction volume. This procedure could aid the amplification of tiny amounts DNA, thereby providing clear evidence of contamination from laboratory environments, tools and reagents.

  2. Laboratory and gas-fired furnace performance tests of epoxy primers for intumescent coatings

    DEFF Research Database (Denmark)

    Nørgaard, Kristian Petersen; Dam-Johansen, Kim; Catala, Pere

    2014-01-01

    , either to ensure adhesion of the intumescent coating to the steel or to provide corrosion resistance. It is essential to document the performance of the intumescent coating together with the primer to ensure the overall quality of coating system. In the present work, two epoxy primers were used...... to a gas-fired furnace following the ISO834 fire curve (a so-called cellulosic fire), one of the primers selected performed well and the other poorly. From tests in the electrically heated oven, it was found that both primers were sensitive to the film thickness employed and the presence of oxygen....... At oxygen-rich conditions, higher primer thicknesses gave weaker performance. In addition, a color change from red to black was observed in nitrogen, while the color remained red in the oxygen-nitrogen mixture. In summary, the results suggest that an adequate choice of primer, primer thickness...

  3. PCR with Paracoccidioides brasiliensis specific primers: potential use in ecological studies PCR com «primers» específicos de Paracoccidioides brasiliensis: uso potencial em estudos ecológicos

    Directory of Open Access Journals (Sweden)

    S. DÍEZ

    1999-11-01

    Full Text Available The precise microenvironment of Paracoccidioides brasiliensis has not yet been discovered perhaps because the methods used are not sensitive enough. We applied to this purpose the polymerase chain reaction (PCR using three sets of specific primers corresponding to two P. brasiliensis genes. This fungus as well as several other fungi, were grown and their DNA obtained by mechanical disruption and a phenol chloroform isoamylalcohol-based purification method. The DNA served for a PCR reaction that employed specific primers from two P. brasiliensis genes that codify for antigenic proteins, namely, the 27 kDa and the 43 kDa. The lowest detection range for the 27 kDa gene was 3 pg. The amplification for both genes was positive only with DNA from P. brasiliensis; additionally, the mRNA for the 27 kDa gene was present only in P. brasiliensis, as indicated by the Northern analysis. The standardization of PCR technology permitted the amplification of P. brasiliensis DNA in artificially contaminated soils and in tissues of armadillos naturally infected with the fungus. These results indicate that PCR technology could play an important role in the search for P. brasiliensis’ habitat and could also be used in other ecological studies.O microambiente adequado do Paracoccidioides brasiliensis não foi ainda bem esclarecido, talvez porque os métodos utilizados não sejam suficientemente sensíveis. Aplicamos com este propósito, a reação em cadeia da polimerase (PCR usando três jogos de primers específicos do P. brasiliensis, correspondendo a dois dos genes do P. brasiliensis. Este fungo, assim como outros fungos, foram cultivados e seus DNAs obtidos por ruptura mecânica e purificados com mistura de fenol-clorofórmio com álcool isoamílico. Os DNAs serviram para a reação de PCR utilizando-se primers específicos para dois dos genes do P. brasiliensis que codificam para as proteínas antigênicas, denominadas, 27 kDa e 43 kDa. O limite mínimo de

  4. DNA Camouflage

    Science.gov (United States)

    2016-01-08

    1 DNA Camouflage Supplementary Information Bijan Zakeri1,2*, Timothy K. Lu1,2*, Peter A. Carr2,3* 1Department of Electrical Engineering and...ll.mit.edu). Distribution A: Public Release   2 Supplementary Figure 1 DNA camouflage with the 2-state device. (a) In the presence of Cre, DSD-2[α...10 1 + Cre 1 500 1,000 length (bp) chromatogram alignment template − Cre   4 Supplementary Figure 3 DNA camouflage with a switchable

  5. The yeast Ty3 retrotransposon contains a 5'-3' bipartite primer-binding site and encodes nucleocapsid protein NCp9 functionally homologous to HIV-1 NCp7.

    Science.gov (United States)

    Gabus, C; Ficheux, D; Rau, M; Keith, G; Sandmeyer, S; Darlix, J L

    1998-08-17

    Retroviruses, including HIV-1 and the distantly related yeast retroelement Ty3, all encode a nucleoprotein required for virion structure and replication. During an in vitro comparison of HIV-1 and Ty3 nucleoprotein function in RNA dimerization and cDNA synthesis, we discovered a bipartite primer-binding site (PBS) for Ty3 composed of sequences located at opposite ends of the genome. Ty3 cDNA synthesis requires the 3' PBS for primer tRNAiMet annealing to the genomic RNA, and the 5' PBS, in cis or in trans, as the reverse transcription start site. Ty3 RNA alone is unable to dimerize, but formation of dimeric tRNAiMet bound to the PBS was found to direct dimerization of Ty3 RNA-tRNAiMet. Interestingly, HIV-1 nucleocapsid protein NCp7 and Ty3 NCp9 were interchangeable using HIV-1 and Ty3 RNA template-primer systems. Our findings impact on the understanding of non-canonical reverse transcription as well as on the use of Ty3 systems to screen for anti-NCp7 drugs.

  6. Carborane-linked 2'-deoxyuridine 5'-O-triphosphate as building block for polymerase synthesis of carborane-modified DNA.

    Science.gov (United States)

    Balintová, Jana; Simonova, Anna; Białek-Pietras, Magdalena; Olejniczak, Agnieszka; Lesnikowski, Zbigniew J; Hocek, Michal

    2017-11-01

    5-[(p-Carborane-2-yl)ethynyl]-2'-deoxyuridine 5'-O-triphosphate was synthesized and used as a good substrate in enzymatic construction of carborane-modified DNA or oligonucleotides containing up to 21 carborane moieties in primer extension reactions by DNA polymerases. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. The proofreading 3'→5' exonuclease activity of DNA polymerases: a kinetic barrier to translesion DNA synthesis

    International Nuclear Information System (INIS)

    Khare, Vineeta; Eckert, Kristin A.

    2002-01-01

    The 3'→5' exonuclease activity intrinsic to several DNA polymerases plays a primary role in genetic stability; it acts as a first line of defense in correcting DNA polymerase errors. A mismatched basepair at the primer terminus is the preferred substrate for the exonuclease activity over a correct basepair. The efficiency of the exonuclease as a proofreading activity for mispairs containing a DNA lesion varies, however, being dependent upon both the DNA polymerase/exonuclease and the type of DNA lesion. The exonuclease activities intrinsic to the T4 polymerase (family B) and DNA polymerase γ (family A) proofread DNA mispairs opposite endogenous DNA lesions, including alkylation, oxidation, and abasic adducts. However, the exonuclease of the Klenow polymerase cannot discriminate between correct and incorrect bases opposite alkylation and oxidative lesions. DNA damage alters the dynamics of the intramolecular partitioning of DNA substrates between the 3'→5' exonuclease and polymerase activities. Enzymatic idling at lesions occurs when an exonuclease activity efficiently removes the same base that is preferentially incorporated by the DNA polymerase activity. Thus, the exonuclease activity can also act as a kinetic barrier to translesion synthesis (TLS) by preventing the stable incorporation of bases opposite DNA lesions. Understanding the downstream consequences of exonuclease activity at DNA lesions is necessary for elucidating the mechanisms of translesion synthesis and damage-induced cytotoxicity

  8. Non-destructive sampling of ancient insect DNA

    DEFF Research Database (Denmark)

    Thomsen, Philip Francis; Elias, Scott; Gilbert, Tom

    2009-01-01

    BACKGROUND: A major challenge for ancient DNA (aDNA) studies on insect remains is that sampling procedures involve at least partial destruction of the specimens. A recent extraction protocol reveals the possibility of obtaining DNA from past insect remains without causing visual morphological...... of 77-204 base pairs (-bp) in size using species-specific and general insect primers. CONCLUSION/SIGNIFICANCE: The applied non-destructive DNA extraction method shows promising potential on insect museum specimens of historical age as far back as AD 1820, but less so on the ancient permafrost......-preserved insect fossil remains tested, where DNA was obtained from samples up to ca. 26,000 years old. The non-frozen sediment DNA approach appears to have great potential for recording the former presence of insect taxa not normally preserved as macrofossils and opens new frontiers in research on ancient...

  9. DNA cards: determinants of DNA yield and quality in collecting genetic samples for pharmacogenetic studies.

    Science.gov (United States)

    Mas, Sergi; Crescenti, Anna; Gassó, Patricia; Vidal-Taboada, Jose M; Lafuente, Amalia

    2007-08-01

    As pharmacogenetic studies frequently require establishment of DNA banks containing large cohorts with multi-centric designs, inexpensive methods for collecting and storing high-quality DNA are needed. The aims of this study were two-fold: to compare the amount and quality of DNA obtained from two different DNA cards (IsoCode Cards or FTA Classic Cards, Whatman plc, Brentford, Middlesex, UK); and to evaluate the effects of time and storage temperature, as well as the influence of anticoagulant ethylenediaminetetraacetic acid on the DNA elution procedure. The samples were genotyped by several methods typically used in pharmacogenetic studies: multiplex PCR, PCR-restriction fragment length polymorphism, single nucleotide primer extension, and allelic discrimination assay. In addition, they were amplified by whole genome amplification to increase genomic DNA mass. Time, storage temperature and ethylenediaminetetraacetic acid had no significant effects on either DNA card. This study reveals the importance of drying blood spots prior to isolation to avoid haemoglobin interference. Moreover, our results demonstrate that re-isolation protocols could be applied to increase the amount of DNA recovered. The samples analysed were accurately genotyped with all the methods examined herein. In conclusion, our study shows that both DNA cards, IsoCode Cards and FTA Classic Cards, facilitate genetic and pharmacogenetic testing for routine clinical practice.

  10. Sulfolobus Replication Factor C stimulates the activity of DNA Polymerase B1

    DEFF Research Database (Denmark)

    Xing, Xuanxuan; Zhang, Likui; Guo, Li

    2014-01-01

    the hyperthermophilic archaea of the genus Sulfolobus physically interacts with DNA polymerase B1 (PolB1) and enhances both the polymerase and 3'-5' exonuclease activities of PolB1 in an ATP-independent manner. Stimulation of the PolB1 activity by RFC is independent of the ability of RFC to bind DNA but is consistent...... with the ability of RFC to facilitate DNA binding by PolB1 through protein-protein interaction. These results suggest that Sulfolobus RFC may play a role in recruiting DNA polymerase for efficient primer extension, in addition to clamp loading, during DNA replication....

  11. DNA glue

    DEFF Research Database (Denmark)

    Filichev, Vyacheslav V; Astakhova, Irina V.; Malakhov, Andrei D.

    2008-01-01

    Significant alterations in thermal stability of parallel DNA triplexes and antiparallel duplexes were observed upon changing the attachment of ethynylpyrenes from para to ortho in the structure of phenylmethylglycerol inserted as a bulge into DNA (TINA). Insertions of two ortho-TINAs as a pseudo...

  12. Hyperstretching DNA

    NARCIS (Netherlands)

    Schakenraad, Koen; Biebricher, Andreas S.; Sebregts, Maarten; Ten Bensel, Brian; Peterman, Erwin J.G.; Wuite, Gijs J L; Heller, Iddo; Storm, Cornelis; Van Der Schoot, Paul

    2017-01-01

    The three-dimensional structure of DNA is highly susceptible to changes by mechanical and biochemical cues in vivo and in vitro. In particular, large increases in base pair spacing compared to regular B-DNA are effected by mechanical (over)stretching and by intercalation of compounds that are widely

  13. RAPD analysis of Arabidopsis thaliana transferred with total DNA of cabbage by ion beam

    International Nuclear Information System (INIS)

    Bian Po; Yu Zengliang; Qin Guangyong; Huo Yuping; Wang Yan

    2003-01-01

    Two mutants were found among the Arabidopsis thaliana transferred with total DNA of cabbage. Variation of genome of T6 and its offspring were analyzed by RAPD-PCR with 40 random primers. The result from S168 primer was different from the CK, indicating that variation of genome can be made by total DNA transferring by use of ion beam, and this variation is hereditary. It is found that S 168-1850 is included within the gene of ABC transporter by aligning with genome of Arabidopsis thaliana in TAIT

  14. Comparison of various primer sets for detection of Toxoplasma gondii by polymerase chain reaction in fetal tissues from naturally aborted foxes.

    Science.gov (United States)

    Smielewska-Loś, E

    2003-01-01

    Tissues from 4 aborted polar foxes (3 samples of brain and 4 samples of liver) were selected for Toxoplasma gondii PCR assay. Positive results of serological tests of mothers and immunofluorescence test (IFT) of fetal organ smears were the criteria of sample selection. Five sets of primers designed from B1 gene and ITS1 sequences of T. gondii were used for detection of the parasite in fetal fox tissues. All used primer sets successfully amplified T. gondii DNA in PCR from organs which were positive by IFT. Single tube nested PCR also showed positive result from a sample negative by IFT, but this product was not confirmed. The studies showed usefullness of PCR for routine diagnosis of toxoplasmosis in carnivores.

  15. Development of ent-kaurene Oxidase-Based Conserved Intron Spanning Primers for Species Identification in the Genus Poa (Poaceae; Bluegrass

    Directory of Open Access Journals (Sweden)

    Jonathan M. LaMantia

    2018-04-01

    Full Text Available Interspecific hybridization has been attempted to combine the heat and drought of Poa arachnifera Torr. with the turf quality characteristics of several Poa species. Confirmation of an F1 hybrid through morphological analysis of vegetative and flowering characteristics is often time consuming and ambiguous. Ent-kaurene oxidase (KO has been sequenced in rice, barley, and wheat. In rice, each of the five copies of KO gene has unique lengths for the first intron. Conserved intron spanning primers (CISP can be used as a DNA marker to exploit variations of intron lengths that flank conserved gene sequences. In the present study, we developed CISP to sequence partial genomic fragments of the KO gene from seven Poa species. Through sequence analysis, species-specific primers were also developed to produce co-dominant markers that can be used to identify interspecific hybrids between Texas bluegrass and six other Poa species used in the present study.

  16. Development of Primer Sets for Loop-Mediated Isothermal Amplification that Enables Rapid and Specific Detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae

    Directory of Open Access Journals (Sweden)

    Deguo Wang

    2015-05-01

    Full Text Available Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies.

  17. Development of Primer Sets for Loop-Mediated Isothermal Amplification that Enables Rapid and Specific Detection of Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae.

    Science.gov (United States)

    Wang, Deguo; Liu, Yanhong

    2015-05-26

    Streptococcus dysgalactiae, Streptococcus uberis and Streptococcus agalactiae are the three main pathogens causing bovine mastitis, with great losses to the dairy industry. Rapid and specific loop-mediated isothermal amplification methods (LAMP) for identification and differentiation of these three pathogens are not available. With the 16S rRNA gene and 16S-23S rRNA intergenic spacers as targets, four sets of LAMP primers were designed for identification and differentiation of S. dysgalactiae, S. uberis and S. agalactiae. The detection limit of all four LAMP primer sets were 0.1 pg DNA template per reaction, the LAMP method with 16S rRNA gene and 16S-23S rRNA intergenic spacers as the targets can differentiate the three pathogens, which is potentially useful in epidemiological studies.

  18. A plastome primer set for comprehensive quantitative real time RT-PCR analysis of Zea mays: a starter primer set for other Poaceae species

    Directory of Open Access Journals (Sweden)

    Dunn Sade N

    2008-06-01

    Full Text Available Abstract Background Quantitative Real Time RT-PCR (q2(RTPCR is a maturing technique which gives researchers the ability to quantify and compare very small amounts of nucleic acids. Primer design and optimization is an essential yet time consuming aspect of using q2(RTPCR. In this paper we describe the design and empirical optimization of primers to amplify and quantify plastid RNAs from Zea mays that are robust enough to use with other closely related species. Results Primers were designed and successfully optimized for 57 of the 104 reported genes in the maize plastome plus two nuclear genes. All 59 primer pairs produced single amplicons after end-point reverse transcriptase polymerase chain reactions (RT-PCR as visualized on agarose gels and subsequently verified by q2(RTPCR. Primer pairs were divided into several categories based on the optimization requirements or the uniqueness of the target gene. An in silico test suggested the majority of the primer sets should work with other members of the Poaceae family. An in vitro test of the primer set on two unsequenced species (Panicum virgatum and Miscanthus sinensis supported this assumption by successfully producing single amplicons for each primer pair. Conclusion Due to the highly conserved chloroplast genome in plant families it is possible to utilize primer pairs designed against one genomic sequence to detect the presence and abundance of plastid genes or transcripts from genomes that have yet to be sequenced. Analysis of steady state transcription of vital system genes is a necessary requirement to comprehensively elucidate gene expression in any organism. The primer pairs reported in this paper were designed for q2(RTPCR of maize chloroplast genes but should be useful for other members of the Poaceae family. Both in silico and in vitro data are presented to support this assumption.

  19. A new building block for DNA network formation by self-assembly and polymerase chain reaction.

    Science.gov (United States)

    Bußkamp, Holger; Keller, Sascha; Robotta, Marta; Drescher, Malte; Marx, Andreas

    2014-01-01

    The predictability of DNA self-assembly is exploited in many nanotechnological approaches. Inspired by naturally existing self-assembled DNA architectures, branched DNA has been developed that allows self-assembly to predesigned architectures with dimensions on the nanometer scale. DNA is an attractive material for generation of nanostructures due to a plethora of enzymes which modify DNA with high accuracy, providing a toolbox for many different manipulations to construct nanometer scaled objects. We present a straightforward synthesis of a rigid DNA branching building block successfully used for the generation of DNA networks by self-assembly and network formation by enzymatic DNA synthesis. The Y-shaped 3-armed DNA construct, bearing 3 primer strands is accepted by Taq DNA polymerase. The enzyme uses each arm as primer strand and incorporates the branched construct into large assemblies during PCR. The networks were investigated by agarose gel electrophoresis, atomic force microscopy, dynamic light scattering, and electron paramagnetic resonance spectroscopy. The findings indicate that rather rigid DNA networks were formed. This presents a new bottom-up approach for DNA material formation and might find applications like in the generation of functional hydrogels.

  20. Plan de negocio de una escuela infantil (primer ciclo)

    OpenAIRE

    San Román Gómez, Ana de

    2014-01-01

    El presente documento establece los pasos a seguir para poner en marcha una escuela infantil en el barrio de Butarque, en Madrid. En un primer lugar se han realizado diversos estudios, tanto sobre el sector como sobre el área geográfica, ya que se partía de una situación de absoluto desconocimiento. En el análisis del sector se ha puesto de manifiesto que las competencias en educación en España están reguladas por el Ministerio en primera instancia, pero las Autonomías tienen también una g...

  1. A primer on physical-layer network coding

    CERN Document Server

    Liew, Soung Chang; Zhang, Shengli

    2015-01-01

    The concept of physical-layer network coding (PNC) was proposed in 2006 for application in wireless networks. Since then it has developed into a subfield of communications and networking with a wide following. This book is a primer on PNC. It is the outcome of a set of lecture notes for a course for beginning graduate students at The Chinese University of Hong Kong. The target audience is expected to have some prior background knowledge in communication theory and wireless communications, but not working knowledge at the research level. Indeed, a goal of this book/course is to allow the reader

  2. Guidelines - A Primer for Communicating Effectively with NABIR Stakeholders

    Energy Technology Data Exchange (ETDEWEB)

    Weber, James R.; Schell, Charlotte J.; Marino, T; Bilyard, Gordon R.

    2004-02-10

    This version of the communication primer comprises two interlocking parts: Pat 1, a practical section, intended to prepare you for public interactions, and Part 2, a theoretical section that provides social and technical bases for the practices recommended in Part 1. The mutual support of practice and theory is very familiar in science and clearly requires a willingness to observe and revise our prior assumptions--in this document, we invoke both. We hope that is offering will represent a step both towards improving practice and maturing the theory of practical science communication.

  3. A finite element primer for beginners the basics

    CERN Document Server

    Zohdi, Tarek I

    2014-01-01

    The purpose of this primer is to provide the basics of the Finite Element Method, primarily illustrated through a classical model problem, linearized elasticity. The topics covered are:(1) Weighted residual methods and Galerkin approximations,(2) A model problem for one-dimensional?linear elastostatics,(3) Weak formulations in one dimension,(4) Minimum principles in one dimension,(5) Error estimation in one dimension,(5) Construction of Finite Element basis functions in one dimension,(6) Gaussian Quadrature,(7) Iterative solvers and element by element data structures,(8) A model problem for th

  4. Discrete random signal processing and filtering primer with Matlab

    CERN Document Server

    Poularikas, Alexander D

    2013-01-01

    Engineers in all fields will appreciate a practical guide that combines several new effective MATLAB® problem-solving approaches and the very latest in discrete random signal processing and filtering.Numerous Useful Examples, Problems, and Solutions - An Extensive and Powerful ReviewWritten for practicing engineers seeking to strengthen their practical grasp of random signal processing, Discrete Random Signal Processing and Filtering Primer with MATLAB provides the opportunity to doubly enhance their skills. The author, a leading expert in the field of electrical and computer engineering, offe

  5. Accelerating MATLAB with GPU computing a primer with examples

    CERN Document Server

    Suh, Jung W

    2013-01-01

    Beyond simulation and algorithm development, many developers increasingly use MATLAB even for product deployment in computationally heavy fields. This often demands that MATLAB codes run faster by leveraging the distributed parallelism of Graphics Processing Units (GPUs). While MATLAB successfully provides high-level functions as a simulation tool for rapid prototyping, the underlying details and knowledge needed for utilizing GPUs make MATLAB users hesitate to step into it. Accelerating MATLAB with GPUs offers a primer on bridging this gap. Starting with the basics, setting up MATLAB for

  6. Automated guided vehicle systems a primer with practical applications

    CERN Document Server

    Ullrich, Günter

    2015-01-01

    This primer is directed at experts and practitioners in intralogistics who are concerned with optimizing material flows. The presentation is comprehensive covering both, practical and theoretical aspects with a moderate degree of specialization, using clear and concise language. Areas of operation as well as technical standards of all relevant components and functions are described. Recent developments in technology and in the markets are taken into account. The goal of this book is to further stronger use of automated guided transport systems and the enhancement of their future performance.

  7. Atmel AVR Microcontroller Primer Programming and Interfacing, Second Edition

    CERN Document Server

    Barrett, Steven F

    2012-01-01

    This textbook provides practicing scientists and engineers a primer on the Atmel AVR microcontroller. In this second edition we highlight the popular ATmega164 microcontroller and other pin-for-pin controllers in the family with a complement of flash memory up to 128 kbytes. The second edition also adds a chapter on embedded system design fundamentals and provides extended examples on two different autonomous robots. Our approach is to provide the fundamental skills to quickly get up and operating with this internationally popular microcontroller. We cover the main subsystems aboard the ATmega

  8. Adhesion of epoxy primer to hydrotalcite conversion coated AA2024

    Science.gov (United States)

    Leggat, Robert Benton, III

    Hydrotalcite-based (HT) conversion coatings are being developed as an environmentally benign alternative to chromate conversion coatings (CCC). Accelerated exposure tests were conducted on epoxy primed, HT-modified AA2024 to gauge service performance. HT-based conversion coatings did not perform as well as the CCC when used with an epoxy primer. The current HT chemistries are optimized for stand-alone corrosion protection, however additional research into the primer/HT interactions is necessary before they can be implemented within a coating scheme. The relative contribution of mechanical and physico-chemical interactions in controlling adhesion has been investigated in this study. Practical adhesion tests were used to assess the dry and wet bond strength of epoxy primer on HT coatings using the pull-off tensile strength (POTS) as the figure of merit. The practical adhesion of HT coated samples generally fell between that observed for the CCC and bare AA2024. Laboratory testing was done to assess the physical and chemical properties of HT coatings. Contact angle measurements were performed using powders representative of different HT chemistries to evaluate the dispersive and acid-base character of the surface. The wet POTS correlated with the electrodynamic (dipole + dispersive) parameter of the surface tension. The HT surfaces were found to be predominantly basic. Given the basicity of epoxy, these results indicate that increasing the acidic character of HT coatings may increase the adhesion performance. This was supported by electrokinetic measurements in which the dry POTS was found to increase with decreasing conversion coating iso-electric point. The correlations with the dry and wet state adhesion are interpreted as indicating that dry state adhesion is optimized by minimizing unfavorable polar interactions between the basic epoxy and HT interfaces. Wet state adhesion, where polar interactions are disrupted, is dictated by non-polar bonding. FTIR

  9. Transport phenomena in Newtonian fluids a concise primer

    CERN Document Server

    Olsson, Per

    2013-01-01

    This short primer provides a concise and tutorial-style introduction to transport phenomena in Newtonian fluids , in particular the transport of mass, energy and momentum.  The reader will find detailed derivations of the transport equations for these phenomena, as well as selected analytical solutions to the transport equations in some simple geometries. After a brief introduction to the basic mathematics used in the text, Chapter 2, which deals with momentum transport, presents a derivation of the Navier-Stokes-Duhem equation describing the basic flow in a Newtonian fluid.  Also provided at

  10. PCR performance of a thermostable heterodimeric archaeal DNA polymerase

    Science.gov (United States)

    Killelea, Tom; Ralec, Céline; Bossé, Audrey; Henneke, Ghislaine

    2014-01-01

    DNA polymerases are versatile tools used in numerous important molecular biological core technologies like the ubiquitous polymerase chain reaction (PCR), cDNA cloning, genome sequencing, and nucleic acid based diagnostics. Taking into account the multiple DNA amplification techniques in use, different DNA polymerases must be optimized for each type of application. One of the current tendencies is to reengineer or to discover new DNA polymerases with increased performance and broadened substrate spectra. At present, there is a great demand for such enzymes in applications, e.g., forensics or paleogenomics. Current major limitations hinge on the inability of conventional PCR enzymes, such as Taq, to amplify degraded or low amounts of template DNA. Besides, a wide range of PCR inhibitors can also impede reactions of nucleic acid amplification. Here we looked at the PCR performances of the proof-reading D-type DNA polymerase from P. abyssi, Pab-polD. Fragments, 3 kilobases in length, were specifically PCR-amplified in its optimized reaction buffer. Pab-polD showed not only a greater resistance to high denaturation temperatures than Taq during cycling, but also a superior tolerance to the presence of potential inhibitors. Proficient proof-reading Pab-polD enzyme could also extend a primer containing up to two mismatches at the 3' primer termini. Overall, we found valuable biochemical properties in Pab-polD compared to the conventional Taq, which makes the enzyme ideally suited for cutting-edge PCR-applications. PMID:24847315

  11. PCR performance of a thermostable heterodimeric archaeal DNA polymerase

    Directory of Open Access Journals (Sweden)

    Tom eKillelea

    2014-05-01

    Full Text Available DNA polymerases are versatile tools used in numerous important molecular biological core technologies like the ubiquitous polymerase chain reaction (PCR, cDNA cloning, genome sequencing and nucleic acid based diagnostics. Taking into account the multiple DNA amplification techniques in use, different DNA polymerases must be optimized for each type of application. One of the current tendencies is to reengineer or to discover new DNA polymerases with increased performance and broadened substrate spectra. At present, there is a great demand for such enzymes in applications, e.g., forensics or paleogenomics. Current major limitations hinge on the inability of conventional PCR enzymes, such as Taq, to amplify degraded or low amounts of template DNA. Besides, a wide range of PCR inhibitors can also impede reactions of nucleic acid amplification. Here we looked at the PCR performances of the proof-reading D-type DNA polymerase from P. abyssi, Pab-polD. Fragments, 3 kilobases in length, were specifically PCR-amplified in its optimized reaction buffer. Pab-polD showed not only a greater resistance to high denaturation temperatures than Taq during cycling, but also a superior tolerance to the presence of potential inhibitors. Proficient proof-reading Pab-polD enzyme could also extend a primer containing up to two mismatches at the 3’ primer termini. Overall, we found valuable biochemical properties in Pab-polD compared to the conventional Taq, which makes the enzyme ideally suited for cutting-edge PCR-applications.

  12. Development of genomic microsatellite multiplex PCR using dye-labeled universal primer and its validation in pedigree analysis of Pacific oyster ( Crassostrea gigas)

    Science.gov (United States)

    Liu, Ting; Li, Qi; Song, Junlin; Yu, Hong

    2017-02-01

    There is an increasing requirement for traceability of aquaculture products, both for consumer protection and for food safety. There are high error rates in the conventional traceability systems depending on physical labels. Genetic traceability technique depending on DNA-based tracking system can overcome this problem. Genealogy information is essential for genetic traceability, and microsatellite DNA marker is a good choice for pedigree analysis. As increasing genotyping throughput of microsatellites, microsatellite multiplex PCR has become a fast and cost-effective technique. As a commercially important cultured aquatic species, Pacific oyster Crassostrea gigas has the highest global production. The objective of this study was to develop microsatellite multiplex PCR panels with dye-labeled universal primer for pedigree analysis in C. gigas, and these multiplex PCRs were validated using 12 full-sib families with known pedigrees. Here we developed six informative multiplex PCRs using 18 genomic microsatellites in C. gigas. Each multiplex panel contained a single universal primer M13(-21) used as a tail on each locus-specific forward primer and a single universal primer M13(-21) labeled with fluorophores. The polymorphisms of the markers were moderate, with an average of 10.3 alleles per locus and average polymorphic information content of 0.740. The observed heterozygosity per locus ranged from 0.492 to 0.822. Cervus simulations revealed that the six panels would still be of great value when massive families were analysed. Pedigree analysis of real offspring demonstrated that 100% of the offspring were unambiguously allocated to their parents when two multiplex PCRs were used. The six sets of multiplex PCRs can be an important tool for tracing cultured individuals, population genetic analysis, and selective breeding program in C. gigas.

  13. Molecular characterization of Anthurium genotypes by using DNA fingerprinting and SPAR markers.

    Science.gov (United States)

    Souza Neto, J D; Soares, T C B; Motta, L B; Cabral, P D S; Silva, J A

    2014-07-02

    We characterized single primer amplification reaction (SPAR) molecular markers from 20 genotypes of Anthurium andraeanum Lind., including 3 from commercial varieties and 17 from 2 communities in the State of Espírito Santo, Brazil. Twenty-four SPAR, consisting of 7 random amplified polymorphic DNA and 17 inter-simple sequence repeat markers were used to estimate the genetic diversity of 20 Anthurium accessions. The set of SPAR markers generated 288 bands and showed an average polymorphism percentage of 93.39%, ranging from 71.43 to 100%. The polymorphism information content (PIC) of the random amplified polymorphic DNA primers averaged 0.364 and ranged from 0.258 to 0.490. Primer OPF 06 showed the lowest PIC, while OPAM 14 was the highest. The average PIC of the inter-simple sequence repeat primers was 0.299, with values ranging from 0.196 to 0.401. Primer UBC 845 had the lowest PIC (0.196), while primer UCB 810 had the highest (0.401). By using the complement of Jaccard's similarity index and unweighted pair group method with arithmetic mean clustering, 5 clusters were formed with a cophenetic correlation coefficient of 0.8093, indicating an acceptable clustering consistency. However, no genotype clustering patterns agreed with the morphological data. The Anthurium genotypes investigated in this study are a germplasm source for conservational research and may be used in improvement programs for this species.

  14. Molecular genotyping of Colletotrichum species based on arbitrarily primed PCR, A + T-Rich DNA, and nuclear DNA analyses

    Science.gov (United States)

    Freeman, S.; Pham, M.; Rodriguez, R.J.

    1993-01-01

    Molecular genotyping of Colletotrichum species based on arbitrarily primed PCR, A + T-rich DNA, and nuclear DNA analyses. Experimental Mycology 17, 309-322. Isolates of Colletotrichum were grouped into 10 separate species based on arbitrarily primed PCR (ap-PCR), A + T-rich DNA (AT-DNA) and nuclear DNA banding patterns. In general, the grouping of Colletotrichum isolates by these molecular approaches corresponded to that done by classical taxonomic identification, however, some exceptions were observed. PCR amplification of genomic DNA using four different primers allowed for reliable differentiation between isolates of the 10 species. HaeIII digestion patterns of AT-DNA also distinguished between species of Colletotrichum by generating species-specific band patterns. In addition, hybridization of the repetitive DNA element (GcpR1) to genomic DNA identified a unique set of Pst 1-digested nuclear DNA fragments in each of the 10 species of Colletotrichum tested. Multiple isolates of C. acutatum, C. coccodes, C. fragariae, C. lindemuthianum, C. magna, C. orbiculare, C. graminicola from maize, and C. graminicola from sorghum showed 86-100% intraspecies similarity based on ap-PCR and AT-DNA analyses. Interspecies similarity determined by ap-PCR and AT-DNA analyses varied between 0 and 33%. Three distinct banding patterns were detected in isolates of C. gloeosporioides from strawberry. Similarly, three different banding patterns were observed among isolates of C. musae from diseased banana.

  15. An In silico approach for the evaluation of DNA barcodes

    Directory of Open Access Journals (Sweden)

    Shehzad Wasim

    2010-07-01

    Full Text Available Abstract Background DNA barcoding is a key tool for assessing biodiversity in both taxonomic and environmental studies. Essential features of barcodes include their applicability to a wide spectrum of taxa and their ability to identify even closely related species. Several DNA regions have been proposed as barcodes and the region selected strongly influences the output of a study. However, formal comparisons between barcodes remained limited until now. Here we present a standard method for evaluating barcode quality, based on the use of a new bioinformatic tool that performs in silico PCR over large databases. We illustrate this approach by comparing the taxonomic coverage and the resolution of several DNA regions already proposed for the barcoding of vertebrates. To assess the relationship between in silico and in vitro PCR, we also developed specific primers amplifying different species of Felidae, and we tested them using both kinds of PCR Results Tests on specific primers confirmed the correspondence between in silico and in vitro PCR. Nevertheless, results of in silico and in vitro PCRs can be somehow different, also because tuning PCR conditions can increase the performance of primers with limited taxonomic coverage. The in silico evaluation of DNA barcodes showed a strong variation of taxonomic coverage (i.e., universality: barcodes based on highly degenerated primers and those corresponding to the conserved region of the Cyt-b showed the highest coverage. As expected, longer barcodes had a better resolution than shorter ones, which are however more convenient for ecological studies analysing environmental samples. Conclusions In silico PCR could be used to improve the performance of a study, by allowing the preliminary comparison of several DNA regions in order to identify the most appropriate barcode depending on the study aims.

  16. DNA probes

    International Nuclear Information System (INIS)

    Castelino, J.

    1992-01-01

    The creation of DNA probes for detection of specific nucleotide segments differs from ligand detection in that it is a chemical rather than an immunological reaction. Complementary DNA or RNA is used in place of the antibody and is labelled with 32 P. So far, DNA probes have been successfully employed in the diagnosis of inherited disorders, infectious diseases, and for identification of human oncogenes. The latest approach to the diagnosis of communicable and parasitic infections is based on the use of deoxyribonucleic acid (DNA) probes. The genetic information of all cells is encoded by DNA and DNA probe approach to identification of pathogens is unique because the focus of the method is the nucleic acid content of the organism rather than the products that the nucleic acid encodes. Since every properly classified species has some unique nucleotide sequences that distinguish it from every other species, each organism's genetic composition is in essence a finger print that can be used for its identification. In addition to this specificity, DNA probes offer other advantages in that pathogens may be identified directly in clinical specimens

  17. DNA probes

    Energy Technology Data Exchange (ETDEWEB)

    Castelino, J

    1993-12-31

    The creation of DNA probes for detection of specific nucleotide segments differs from ligand detection in that it is a chemical rather than an immunological reaction. Complementary DNA or RNA is used in place of the antibody and is labelled with {sup 32}P. So far, DNA probes have been successfully employed in the diagnosis of inherited disorders, infectious diseases, and for identification of human oncogenes. The latest approach to the diagnosis of communicable and parasitic infections is based on the use of deoxyribonucleic acid (DNA) probes. The genetic information of all cells is encoded by DNA and DNA probe approach to identification of pathogens is unique because the focus of the method is the nucleic acid content of the organism rather than the products that the nucleic acid encodes. Since every properly classified species has some unique nucleotide sequences that distinguish it from every other species, each organism`s genetic composition is in essence a finger print that can be used for its identification. In addition to this specificity, DNA probes offer other advantages in that pathogens may be identified directly in clinical specimens 10 figs, 2 tabs

  18. EGNAS: an exhaustive DNA sequence design algorithm

    Directory of Open Access Journals (Sweden)

    Kick Alfred

    2012-06-01

    Full Text Available Abstract Background The molecular recognition based on the complementary base pairing of deoxyribonucleic acid (DNA is the fundamental principle in the fields of genetics, DNA nanotechnology and DNA computing. We present an exhaustive DNA sequence design algorithm that allows to generate sets containing a maximum number of sequences with defined properties. EGNAS (Exhaustive Generation of Nucleic Acid Sequences offers the possibility of controlling both interstrand and intrastrand properties. The guanine-cytosine content can be adjusted. Sequences can be forced to start and end with guanine or cytosine. This option reduces the risk of “fraying” of DNA strands. It is possible to limit cross hybridizations of a defined length, and to adjust the uniqueness of sequences. Self-complementarity and hairpin structures of certain length can be avoided. Sequences and subsequences can optionally be forbidden. Furthermore, sequences can be designed to have minimum interactions with predefined strands and neighboring sequences. Results The algorithm is realized in a C++ program. TAG sequences can be generated and combined with primers for single-base extension reactions, which were described for multiplexed genotyping of single nucleotide polymorphisms. Thereby, possible foldback through intrastrand interaction of TAG-primer pairs can be limited. The design of sequences for specific attachment of molecular constructs to DNA origami is presented. Conclusions We developed a new software tool called EGNAS for the design of unique nucleic acid sequences. The presented exhaustive algorithm allows to generate greater sets of sequences than with previous software and equal constraints. EGNAS is freely available for noncommercial use at http://www.chm.tu-dresden.de/pc6/EGNAS.

  19. Establishing a novel single-copy primer-internal intron-spanning PCR (spiPCR) procedure for the direct detection of gene doping.

    Science.gov (United States)

    Beiter, Thomas; Zimmermann, Martina; Fragasso, Annunziata; Armeanu, Sorin; Lauer, Ulrich M; Bitzer, Michael; Su, Hua; Young, William L; Niess, Andreas M; Simon, Perikles

    2008-01-01

    So far, the abuse of gene transfer technology in sport, so-called gene doping, is undetectable. However, recent studies in somatic gene therapy indicate that long-term presence of transgenic DNA (tDNA) following various gene transfer protocols can be found in DNA isolated from whole blood using conventional PCR protocols. Application of these protocols for the direct detection of gene doping would require almost complete knowledge about the sequence of the genetic information that has been transferred. Here, we develop and describe the novel single-copy primer-internal intron-spanning PCR (spiPCR) procedure that overcomes this difficulty. Apart from the interesting perspectives that this spiPCR procedure offers in the fight against gene doping, this technology could also be of interest in biodistribution and biosafety studies for gene therapeutic applications.

  20. DNA polymorphisms revealed by the RAPD technique show differences between radionuclide-contaminated and uncontaminated mosquitofish populations

    International Nuclear Information System (INIS)

    Theodorakis, C.W.; Shugart, L.R.

    1993-01-01

    In 1977, approximately 250 Mosquitofish (Gambusia affines) were transplanted from a relatively uncontaminated site into a small pond on the Oak Ridge Reservation that is heavily contaminated with radionuclides. DNA polymorphisms, using the RAPD technique, were examined in order to determine if any genetic differentiation had occurred between the two populations. Also, fish from another radionuclide-contaminated population (White Oak Lake) and two unrelated non-contaminated populations were also examined. The RAPD (Randomly Amplified Polymorphic DNA) technique uses the polymerase chain reaction with a short oligonucleotide primer to produce DNA fragments of various lengths. When analyzed by gel electrophoresis, these fragments form banding patterns similar to DNA fingerprints. A total of 26 primers were used to produce DNA band patterns, many of which revealed population differences. In addition several primers revealed banding patterns which differentiated between the Crystal Springs and Pond 3513 populations. Furthermore, bands found at high frequency in Pond 3513 and White Oak Lake populations were absent or present at a lower frequency in the non-contaminated populations. For some primers, the contaminated populations showed more DNA bands per individual, and fish with more bands had fewer DNA strand breaks than the fish with fewer bands. These data will be discussed with relation to biomonitoring programs and evolution of resistance to genotoxins in natural populations

  1. DNA amplification fingerprinting using 10 x polymerase chain reaction buffer with ammonium sulfate for human identification

    International Nuclear Information System (INIS)

    Baransel, Asyun; Dugler, Hikmat E.; Tokdemir, Mehmet

    2004-01-01

    The polymerase chain reaction (PCR) - based DNA amplification fingerprinting (DAF) or randomly amplified polymorphic DNA (RAPD) is based on a strategy using a single arbitrary oligonucleotide primer to generate anonymous amplification of genomic DNA. On this basic strategy, in this study, we aimed to test individual differences and usefulness of 2 basic primers (5-CGCGCCGG-3 and 5-TGCCGAGCTG-3) and examined whether there is a positive effect on results of 10 x PCR buffer with ammonium sulfate. A new approach in DNA fingerprinting, 10 x PCR buffer with ammonium sulfate, is presented in the study. Primers with single 8 and 10 nucleotides in length and 2 different PCR buffers with or without ammonium sulfate were used to identify 135 volunteers with no blood relationship. This study was carried out at the Pharmacology Laboratory, University of Gaziantep, School of Medicine, Turkey between 1999 and 2000. An average of 10 major bands representing 500-1500 base pair (bp) in length was determined as amplified DNA products on standard agarose gels for these volunteers. The use of ammonium sulfate in 10 x PCR buffers has increased to 92% success ratio of individual difference obtained from the 8 nucleotides primer. With this study, more reliable results can be obtained by using ammonium sulfate in 10 x PCR buffers. (author)

  2. Primer: Fracture mechanics in the nuclear power industry

    International Nuclear Information System (INIS)

    Wessel, E.T.; Server, W.L.; Kennedy, E.L.

    1990-01-01

    This Primer is intended to familiarize utility engineers with the fracture mechanics technology and to provide the basis for a working knowledge of the subject. It is directed towards all the engineering disciplines that are involved either directly or indirectly with the structural reliability of electrical power generation equipment and systems. These engineering disciplines include such areas as: design and stress analysis, metallurgy and materials, nondestructive inspection and quality control, structural analysis and reliability engineering, chemical engineering and water chemistry control, and architectural engineering. This Primer does not provide a comprehensive, in-depth treatment of all the detailed aspects involved in fracture mechanics. It does, however, provide sufficient information and a common vocabulary that should enable engineers to: read and converse intelligently about the subject, understand and utilize ASME Codes and Regulatory Guides involving fracture mechanics, absorb technical information presented and discussed at various technical meetings, and begin to apply this technology towards actual engineering problems encountered in the course of their work. Example problems are provided to further enhance an understanding of fracture mechanics. Also, Appendix A describes fracture mechanics computer codes available through EPRI to analyze rotors, reactor pressure vessels and piping

  3. De neurocirujano a primer ministro de Salud de la Argentina

    Directory of Open Access Journals (Sweden)

    Karina Inés Ramacciotti

    2008-01-01

    Full Text Available La trayectoria y los vínculos que entabló Ramón Carrillo con anterioridad a ejercer el cargo de primer secretario de Salud Pública en la Argentina (1946 no han sido objeto de estudio pormenorizado. Así pues en este artículo se analizarán en primer lugar, una serie de cartas de lectores publicadas en La Semana Médica en los primeros años de la década del '40 del siglo XX. Estas notas permiten comprender las disputas internas que se produjeron en la Facultad de Ciencias Médicas al producirse el concurso de Titular de Neurocirugía de la Universidad de Buenos Aires. En segundo lugar, se revisará cómo Carrillo pasa de ocupar este prestigioso cargo académico a convertirse en decano interi- no de la Facultad de Ciencias Médicas. Son las relaciones que anuda durante estos años las que lo posicionan en un escenario político privilegiado para alcanzar un relevante puesto en la administración pública.

  4. FullSSR: Microsatellite Finder and Primer Designer

    Directory of Open Access Journals (Sweden)

    Sebastián Metz

    2016-01-01

    Full Text Available Microsatellites are genomic sequences comprised of tandem repeats of short nucleotide motifs widely used as molecular markers in population genetics. FullSSR is a new bioinformatic tool for microsatellite (SSR loci detection and primer design using genomic data from NGS assay. The software was tested with 2000 sequences of Oryza sativa shotgun sequencing project from the National Center of Biotechnology Information Trace Archive and with partial genome sequencing with ROCHE 454® from Caiman latirostris, Salvator merianae, Aegla platensis, and Zilchiopsis collastinensis. FullSSR performance was compared against other similar SSR search programs. The results of the use of this kind of approach depend on the parameters set by the user. In addition, results can be affected by the analyzed sequences because of differences among the genomes. FullSSR simplifies the detection of SSRs and primer design on a big data set. The command line interface of FullSSR was intended to be used as part of genomic analysis tools pipeline; however, it can be used as a stand-alone program because the results are easily interpreted for a nonexpert user.

  5. Microsatellite Primer Development for Post Oak, Quercus stellata (Fagaceae

    Directory of Open Access Journals (Sweden)

    Warren B. Chatwin

    2014-10-01

    Full Text Available Premise of the study: The American Cross Timbers forest ecosystem runs from southeastern Kansas to Central Texas and is primarily composed of post oak (Quercus stellata. This old-growth forest currently occupies only about 2% of its ancestral range. To facilitate genetic research on this species, we developed microsatellite primers specific to post oak from reduced genomic libraries. Methods and Results: Two Q. stellata individuals, sampled from the northern and southern range of the post oak forest, were subject to genomic reduction and 454 pyrosequencing. Bioinformatic analysis identified putative microsatellites from which 12 polymorphic primer sets were screened on three populations. The number of alleles observed ranged from five to 20 across all populations, while observed and expected heterozygosity values ranged from 0.05 to 0.833 and 0.236 to 0.893, respectively, within individual populations. Conclusions: We report the development of microsatellite markers, specific to post oak, to aid the study of genetic diversity and population structure of extant forest remnants.

  6. Yeast tRNAPhe expressed in human cells can be selected by HIV-1 for use as a reverse transcription primer

    International Nuclear Information System (INIS)

    Kelly, Nathan J.; Morrow, Casey D.

    2003-01-01

    All naturally occurring human immune deficiency viruses (HIV-1) select and use tRNA Lys,3 as the primer for reverse transcription. Studies to elucidate the mechanism of tRNA selection from the intracellular milieu have been hampered due to the difficulties in manipulating the endogenous levels of tRNA Lys,3 . We have previously described a mutant HIV-1 with a primer binding site (PBS) complementary to yeast tRNA Phe (psHIV-Phe) that relies on transfection of yeast tRNA Phe for infectivity. To more accurately recapitulate the selection process, a cDNA was designed for the intracellular expression of the yeast tRNA Phe . Increasing amounts of the plasmid encoding tRNA Phe resulted in a corresponding increase in levels of yeast tRNA Phe in the cell. The yeast tRNA Phe isolated from cells transfected with the cDNA for yeast tRNA Phe , or in the cell lines expressing yeast tRNA Phe , were aminoacylated, indicating that the expressed yeast tRNA Phe was incorporated into tRNA biogenesis pathways and translation. Increasing the cytoplasmic levels of tRNA Phe resulted in increased encapsidation of tRNA Phe in viruses with a PBS complementary to tRNA Phe (psHIV-Phe) or tRNA Lys,3 (wild-type HIV-1). Production of infectious psHIV-Phe was dependent on the amount of cotransfected tRNA Phe cDNA. Increasing amounts of plasmids encoding yeast tRNA Phe produced an increase of infectious psHIV-Phe that plateaued at a level lower than that from the transfection of the wild-type genome, which uses tRNA Lys,3 as the primer for reverse transcription. Cell lines were generated that expressed yeast tRNA Phe at levels approximately 0.1% of that for tRNA Lys,3 . Even with this reduced level of yeast tRNA Phe , the cell lines complemented psHIV-Phe over background levels. The results of these studies demonstrate that intracellular levels of primer tRNA can have a direct effect on HIV-1 infectivity and further support the role for PBS-tRNA complementarity in the primer selection process

  7. Development and use of tuf gene-based primers for the multiplex PCR detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum in commercial dairy products.

    Science.gov (United States)

    Sheu, Sen-Je; Hwang, Wen-zhe; Chen, Hsin-Chih; Chiang, Yu-Cheng; Tsen, Hau-Yang

    2009-01-01

    PCR primers specific for the detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum were designed based on the elongation factor Tu gene (tuf). The specificity of these four primer sets were confirmed by PCR with 88 bacterial strains of Lactobacillus, Enterococcus, Bifidobacterium, and other bacterial species. Results indicated that these primer sets generated predicted PCR products of 397, 230, 202, and 161 bp for L. acidophilus, L. delbrueckii, L. casei group, and B. longum, respectively. Bacterial species other than the target organisms tested did not generate false-positive results. When these four primer sets were combined for the simultaneous detection of the lactic acid bacteria (LAB) in fermented milk products including yogurt, the LAB species listed on the labels of these products could be identified without the preenrichment step. The identification limit for each LAB strain with this multiplex PCR method was N X 10(3) CFU/ml in milk samples. The results of our multiplex PCR method were confirmed by PCR assay using primers based on the 16S rDNA or the 16S-23S intergenic spacer region and by biochemical tests using the API 50 CHL kit. When this multiplex PCR method was used with the determination of counts of total viable LAB and bifidobacteria, the quality of commercial fermented milk products could be assured.

  8. An integrated web medicinal materials DNA database: MMDBD (Medicinal Materials DNA Barcode Database

    Directory of Open Access Journals (Sweden)

    But Paul

    2010-06-01

    Full Text Available Abstract Background Thousands of plants and animals possess pharmacological properties and there is an increased interest in using these materials for therapy and health maintenance. Efficacies of the application is critically dependent on the use of genuine materials. For time to time, life-threatening poisoning is found because toxic adulterant or substitute is administered. DNA barcoding provides a definitive means of authentication and for conducting molecular systematics studies. Owing to the reduced cost in DNA authentication, the volume of the DNA barcodes produced for medicinal materials is on the rise and necessitates the development of an integrated DNA database. Description We have developed an integrated DNA barcode multimedia information platform- Medicinal Materials DNA Barcode Database (MMDBD for data retrieval and similarity search. MMDBD contains over 1000 species of medicinal materials listed in the Chinese Pharmacopoeia and American Herbal Pharmacopoeia. MMDBD also contains useful information of the medicinal material, including resources, adulterant information, medical parts, photographs, primers used for obtaining the barcodes and key references. MMDBD can be accessed at http://www.cuhk.edu.hk/icm/mmdbd.htm. Conclusions This work provides a centralized medicinal materials DNA barcode database and bioinformatics tools for data storage, analysis and exchange for promoting the identification of medicinal materials. MMDBD has the largest collection of DNA barcodes of medicinal materials and is a useful resource for researchers in conservation, systematic study, forensic and herbal industry.

  9. Frequent dual initiation of reverse transcription in murine leukemia virus-based vectors containing two primer-binding sites

    International Nuclear Information System (INIS)

    Voronin, Yegor A.; Pathak, Vinay K.

    2003-01-01

    Retroviruses package two copies of viral RNA into each virion. Although each RNA contains a primer-binding site for initiation of DNA synthesis, it is unknown whether reverse transcription is initiated on both RNAs. To determine whether a single virion is capable of initiating reverse transcription more than once, we constructed a murine leukemia virus-based vector containing a second primer-binding site (PBS) derived from spleen necrosis virus and inserted the green fluorescent protein gene (GFP) between the two PBSs. Initiation of reverse transcription at either PBS results in a provirus that expresses GFP. However, initiation at both PBSs can result in the deletion of GFP, which can be detected by flow cytometry and Southern blotting analysis. Approximately 22-29% of the proviruses formed deleted the GFP in a single replication cycle, indicating the minimum proportion of virions that initiated reverse transcription on both PBSs. These results show that a significant proportion of MLV-based vectors containing two PBSs have the capacity to initiate reverse transcription more than once

  10. Design of a Percussion and Electric Primer Gun Firing Power Supply

    Science.gov (United States)

    2014-07-01

    solenoid failure. As new instrumentation techniques such as high-speed video and laser interferometry have been introduced into our gun testing...to drive a solenoid into a percussion primer or ignite the M52A3B1 electric primer. To reduce power requirements, it uses charged capacitor banks to...drive the solenoid or ignite the primer. This report details the design and construction of the power supplies. 15. SUBJECT TERMS power supply

  11. Designing of primers for detection of salmonella typhimirium and enteritidis by heminested PCR

    International Nuclear Information System (INIS)

    Ben salem, Issam

    2007-01-01

    Salmonella are the main responsible agent for the frequent food borne gastrointestinal diseases. In Tunisia, this pathogen is considered one of the most important causes of toxiinfections and its detection using classical methods is laborious and requires a large amount of time for revelation. To solve this problem, we developed a rapid molecular technique for the detection of the invA virulence gene sequence which is found in the majority of Salmonella spp. This technique is a hemi nested PCR amplification using specific primers designed and by bioinformatics tools. The detection method consisted of pre-enrichment of the sample in buffered peptone water (BPW), followed by a total DNA extraction step prior to single tube hemi nested PCR amplification. This method was found highly specific and sensitive to detect low levels of salmonella typhimurium and salmonella enteritidis (1cfu/ 25g) in naturally contaminated spicy sausage (merguez) samples. These results can benefit the public health agencies concerning microbiological and quality aspects of the commercial and traditional merguez meat production in Tunisia. (Author)

  12. Detection and Identification of Probiotic Lactobacillus plantarum Strains by Multiplex PCR Using RAPD-Derived Primers.

    Science.gov (United States)

    Galanis, Alex; Kourkoutas, Yiannis; Tassou, Chrysoula C; Chorianopoulos, Nikos

    2015-10-22

    Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB) strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD) Sequenced Characterized Amplified Region (SCAR) analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry.

  13. Detection and Identification of Probiotic Lactobacillus plantarum Strains by Multiplex PCR Using RAPD-Derived Primers

    Directory of Open Access Journals (Sweden)

    Alex Galanis

    2015-10-01

    Full Text Available Lactobacillus plantarum 2035 and Lactobacillus plantarum ACA-DC 2640 are two lactic acid bacteria (LAB strains that have been isolated from Feta cheese. Both display significant potential for the production of novel probiotic food products. The aim of the present study was the development of an accurate and efficient method for the molecular detection and identification of the above strains in a single reaction. A multiplex PCR assay was designed for each strain, based on specific primers derived from Random Amplified Polymorphic DNA (RAPD Sequenced Characterized Amplified Region (SCAR analysis. The specificity of the assay was tested with a total of 23 different LAB strains, for L. plantarum 2035 and L. plantarum ACA-DC 2640. The multiplex PCR assay was also successfully applied for the detection of the above cultures in yogurt samples prepared in our lab. The proposed methodology may be applied for monitoring the presence of these strains in food products, thus evaluating their probiotic character. Moreover, our strategy may be adapted for other novel LAB strains with probiotic potential, thus providing a powerful tool for molecular discrimination that could be invaluable to the food industry.

  14. DNA methylation

    DEFF Research Database (Denmark)

    Williams, Kristine; Christensen, Jesper; Helin, Kristian

    2012-01-01

    DNA methylation is involved in key cellular processes, including X-chromosome inactivation, imprinting and transcriptional silencing of specific genes and repetitive elements. DNA methylation patterns are frequently perturbed in human diseases such as imprinting disorders and cancer. The recent...... discovery that the three members of the TET protein family can convert 5-methylcytosine (5mC) into 5-hydroxymethylcytosine (5hmC) has provided a potential mechanism leading to DNA demethylation. Moreover, the demonstration that TET2 is frequently mutated in haematopoietic tumours suggests that the TET...... proteins are important regulators of cellular identity. Here, we review the current knowledge regarding the function of the TET proteins, and discuss various mechanisms by which they contribute to transcriptional control. We propose that the TET proteins have an important role in regulating DNA methylation...

  15. DNA data

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Raw DNA chromatogram data produced by the ABI 373, 377, 3130 and 3730 automated sequencing machines in ABI format. These are from fish (primarily Sebastes spp.,...

  16. DNA nanotechnology

    Science.gov (United States)

    Seeman, Nadrian C.; Sleiman, Hanadi F.

    2018-01-01

    DNA is the molecule that stores and transmits genetic information in biological systems. The field of DNA nanotechnology takes this molecule out of its biological context and uses its information to assemble structural motifs and then to connect them together. This field has had a remarkable impact on nanoscience and nanotechnology, and has been revolutionary in our ability to control molecular self-assembly. In this Review, we summarize the approaches used to assemble DNA nanostructures and examine their emerging applications in areas such as biophysics, diagnostics, nanoparticle and protein assembly, biomolecule structure determination, drug delivery and synthetic biology. The introduction of orthogonal interactions into DNA nanostructures is discussed, and finally, a perspective on the future directions of this field is presented.

  17. Direct detection of chicken genomic DNA for gender determination by thymine-DNA glycosylase.

    Science.gov (United States)

    Porat, N; Bogdanov, K; Danielli, A; Arie, A; Samina, I; Hadani, A

    2011-02-01

    1. Birds, especially nestlings, are generally difficult to sex by morphology and early detection of chick gender in ovo in the hatchery would facilitate removal of unwanted chicks and diminish welfare objections regarding culling after hatch. 2. We describe a method to determine chicken gender without the need for PCR via use of Thymine-DNA Glycosylase (TDG). TDG restores thymine (T)/guanine (G) mismatches to cytosine (C)/G. We show here, that like DNA Polymerase, TDG can recognise, bind and function on a primer hybridised to chicken genomic DNA. 3. The primer contained a T to mismatch a G in a chicken genomic template and the T/G was cleaved with high fidelity by TDG. Thus, the chicken genomic DNA can be identified without PCR amplification via direct and linear detection. Sensitivity was increased using gender specific sequences from the chicken genome. 4. Currently, these are laboratory results, but we anticipate that further development will allow this method to be used in non-laboratory settings, where PCR cannot be employed.

  18. Performance testing of lead free primers: blast waves, velocity variations, and environmental testing

    OpenAIRE

    Courtney, Elya; Courtney, Amy; Summer, Peter David; Courtney, Michael

    2014-01-01

    Results are presented for lead free primers based on diazodinitrophenol (DDNP)compared with tests on lead styphnate based primers. First, barrel friction measurements in 5.56 mm NATO are presented. Second, shot to shot variations in blast waves are presented as determined by detonating primers in a 7.62x51mm rifle chamber with a firing pin, but without any powder or bullet loaded and measuring the blast wave at the muzzle with a high speed pressure transducer. Third, variations in primer blas...

  19. Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.

    Science.gov (United States)

    Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis

    2018-03-01

    Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.

  20. An environmentally acceptable primer for galvanized steel: Formulation and evaluation by SVET

    Energy Technology Data Exchange (ETDEWEB)

    Simoes, A.M.P., E-mail: alda.simoes@ist.utl.p [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Carbonari, R.O.; Di Sarli, A.R.; Amo, B. del [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal); Romagnoli, R., E-mail: estelectro@cidepint.gov.a [CIDEPINT - Centro de Investigacion y Desarrollo en Tecnologia de Pinturas (CIC-CONICET), Calle 52 e/121 y 122, 1900 La Plata (Argentina); TULisbon, Instituto Superior Tecnico, DEQB, Av. Rovisco Pais, 1049-001 Lisboa (Portugal)

    2011-01-15

    Research highlights: {yields} Chromates can be replaced successfully by aluminium phosphosilicate in paint systems. {yields} The solvents of the primer are eco-friendly ones. {yields} The primer adheres on galvanized steel and allows top-coating. {yields} The binder of the primer is compatible with other binders for top-coating. - Abstract: The object of this paper was to formulate a two-pack wash primer employing aluminium phosphosilicate as active anticorrosive pigment instead of basic zinc chromate. The anticorrosive action of the primer was evaluated by the polarization technique and the scanning vibrating electrode technique (SVET). The exposed surface was then examined by scanning electron microscopy (SEM) and the surface composition determined by energy dispersive X-ray (EDX) analysis. The primer was finally integrated in a complete paint scheme whose anticorrosive performance was evaluated by the salt spray chamber and electrochemical impedance spectroscopy. The adhesion of the primer plus a painting system was also evaluated by standard ASTM D 3359-90 test method. The wash primer pigmented with zinc chromate was used as reference. Results indicated that basic zinc chromate could be replaced by the more eco-friendly wash-primer containing aluminium phosphosilicate.

  1. The Corrosion Protection of 2219-T87 Aluminum by Organic and Inorganic Zinc-Rich Primers

    Science.gov (United States)

    Danford, M. D.; Mendrek, M. J.; Walsh, D. W.

    1995-01-01

    The behavior of zinc-rich primer-coated 2219-T87 aluminum in a 3.5-percent Na-Cl was investigated using electrochemical techniques. The alternating current (ac) method of electrochemical impedance spectroscopy (EIS), in the frequency range of 0.001 to 40,000 Hz, and the direct current (dc) method of polarization resistance (PR) were used to evaluate the characteristics of an organic, epoxy zinc-rich primer and an inorganic, ethyl silicate zinc-rich primer. A dc electrochemical galvanic corrosion test was also used to determine the corrosion current of each zinc-rich primer anode coupled to a 2219-T87 aluminum cathode. Duration of the EIS/PR and galvanic testing was 21 days and 24 h, respectively. The galvanic test results demonstrated a very high galvanic current between the aluminum cathode and both zinc-rich primer anodes (37.9 pA/CM2 and 23.7 pA/CM2 for the organic and inorganic primers, respectively). The PR results demonstrated a much higher corrosion rate of the zinc in the inorganic primer than in the organic primer, due primarily to the higher porosity in the former. Based on this investigation, the inorganic zinc-rich primer appears to provide superior galvanic protection and is recommended for additional study for application in the solid rocket booster aft skirt.

  2. DNA expressions - A formal notation for DNA

    NARCIS (Netherlands)

    Vliet, Rudy van

    2015-01-01

    We describe a formal notation for DNA molecules that may contain nicks and gaps. The resulting DNA expressions denote formal DNA molecules. Different DNA expressions may denote the same molecule. Such DNA expressions are called equivalent. We examine which DNA expressions are minimal, which

  3. Coordinated leading and lagging strand DNA synthesis by using the herpes simplex virus 1 replication complex and minicircle DNA templates.

    Science.gov (United States)

    Stengel, Gudrun; Kuchta, Robert D

    2011-01-01

    The origin-specific replication of the herpes simplex virus 1 genome requires seven proteins: the helicase-primase (UL5-UL8-UL52), the DNA polymerase (UL30-UL42), the single-strand DNA binding protein (ICP8), and the origin-binding protein (UL9). We reconstituted these proteins, excluding UL9, on synthetic minicircular DNA templates and monitored leading and lagging strand DNA synthesis using the strand-specific incorporation of dTMP and dAMP. Critical features of the assays that led to efficient leading and lagging stand synthesis included high helicase-primase concentrations and a lagging strand template whose sequence resembled that of the viral DNA. Depending on the nature of the minicircle template, the replication complex synthesized leading and lagging strand products at molar ratios varying between 1:1 and 3:1. Lagging strand products (∼0.2 to 0.6 kb) were significantly shorter than leading strand products (∼2 to 10 kb), and conditions that stimulated primer synthesis led to shorter lagging strand products. ICP8 was not essential; however, its presence stimulated DNA synthesis and increased the length of both leading and lagging strand products. Curiously, human DNA polymerase α (p70-p180 or p49-p58-p70-p180), which improves the utilization of RNA primers synthesized by herpesvirus primase on linear DNA templates, had no effect on the replication of the minicircles. The lack of stimulation by polymerase α suggests the existence of a macromolecular assembly that enhances the utilization of RNA primers and may functionally couple leading and lagging strand synthesis. Evidence for functional coupling is further provided by our observations that (i) leading and lagging strand synthesis produce equal amounts of DNA, (ii) leading strand synthesis proceeds faster under conditions that disable primer synthesis on the lagging strand, and (iii) conditions that accelerate helicase-catalyzed DNA unwinding stimulate decoupled leading strand synthesis but not

  4. Detection of mutations in genes by specific LNA primers

    DEFF Research Database (Denmark)

    2001-01-01

    acid (LNA). LNA oligomers obey the Watson-Crick base-pairing rules and form duplexes that are significantly more stable than similar duplexes formed by DNA. The "allele-specific" LNA-containing oligonucleotides wherein the LNA nucleotide(s) are found at the 3' position can be extended by means......The present invention relates to a method of detecting variant nucleic acid whose nucleotide sequence differs from one another at a single (or more) position(s). The method uses a set of chimeric oligonucleotides containing DNA monomers and monomers of a novel class of DNA analogues, locked nucleic...

  5. Identification of a common single nucleotide polymorphism at the primer binding site of D2S1360 that causes heterozygote peak imbalance when using the Investigator HDplex Kit.

    Science.gov (United States)

    Inokuchi, Shota; Yamashita, Yasuhiro; Nishimura, Kazuma; Nakanishi, Hiroaki; Saito, Kazuyuki

    2017-11-01

    Phenomena known as null alleles and peak imbalance can occur because of mutations in the primer binding sites used for DNA typing. In these cases, an accurate statistical evaluation of DNA typing is difficult. The estimated likelihood ratio is incorrectly calculated because of the null allele and allele dropout caused by mutation-induced peak imbalance. Although a number of studies have attempted to uncover examples of these phenomena, few reports are available on the human identification kit manufactured by Qiagen. In this study, 196 Japanese individuals who were heterozygous at D2S1360 were genotyped using an Investigator HDplex Kit with optimal amounts of DNA. A peak imbalance was frequently observed at the D2S1360 locus. We performed a sequencing analysis of the area surrounding the D2S1360 repeat motif to identify the cause for peak imbalance. A point mutation (G>A transition) 136 nucleotides upstream from the D2S1360 repeat motif was discovered in a number of samples. The allele frequency of the mutation was 0.0566 in the Japanese population. Therefore, human identification or kinship testing using the Investigator HDplex Kit requires caution because of the higher frequency of single nucleotide polymorphisms at the primer binding site of D2S1360 locus in the Japanese population.

  6. Quantification of low-expressed mRNA using 5' LNA-containing real-time PCR primers

    International Nuclear Information System (INIS)

    Malgoyre, A.; Banzet, S.; Mouret, C.; Bigard, A.X.; Peinnequin, A.

    2007-01-01

    Real-time RT-PCR is the most sensitive and accurate method for mRNA quantification. Using specific recombinant DNA as a template, real-time PCR allows accurate quantification within a 7-log range and increased sensitivity below 10 copies. However, when using RT-PCR to quantify mRNA in biological samples, a stochastic off-targeted amplification can occur. Classical adjustments of assay parameters have minimal effects on such amplification. This undesirable amplification appears mostly to be dependent on specific to non-specific target ratio rather than on the absolute quantity of the specific target. This drawback, which decreases assay reliability, mostly appears when quantifying low-expressed transcript in a whole organ. An original primer design using properties of LNA allows to block off-target amplification. 5'-LNA substitution strengthens 5'-hybridization. Consequently on-target hybridization is stabilized and the probability for the off-target to lead to amplification is decreased

  7. What Is Mitochondrial DNA?

    Science.gov (United States)

    ... DNA What is mitochondrial DNA? What is mitochondrial DNA? Although most DNA is packaged in chromosomes within ... proteins. For more information about mitochondria and mitochondrial DNA: Molecular Expressions, a web site from the Florida ...

  8. Detection of DNA polymorphisms in Dendrobium Sonia White mutant lines

    International Nuclear Information System (INIS)

    Affrida Abu Hassan; Putri Noor Faizah Megat Mohd Tahir; Zaiton Ahmad; Mohd Nazir Basiran

    2006-01-01

    Dendrobium Sonia white mutant lines were obtained through gamma ray induced mutation of purple flower Dendrobium Sonia at dosage 35 Gy. Amplified Fragment Length Polymorphism (AFLP) technique was used to compare genomic variations in these mutant lines with the control. Our objectives were to detect polymorphic fragments from these mutants to provide useful information on genes involving in flower colour expression. AFLP is a PCR based DNA fingerprinting technique. It involves digestion of DNA with restriction enzymes, ligation of adapter and selective amplification using primer with one (pre-amplification) and three (selective amplification) arbitrary nucleotides. A total number of 20 primer combinations have been tested and 7 produced clear fingerprint patterns. Of these, 13 polymorphic bands have been successfully isolate and cloned. (Author)

  9. Second-strand cDNA synthesis: classical method

    International Nuclear Information System (INIS)

    Gubler, U.

    1987-01-01

    The classical scheme for the synthesis of double-stranded cDNA as it was reported in 1976 is described. Reverse transcription of mRNA with oligo(dT) as the primer generates first strands with a small loop at the 3' end of the cDNA (the end that corresponds to the 5' end of the mRNA). Subsequent removal of the mRNA by alkaline hydrolysis leaves single-stranded cDNA molecules again with a small 3' loop. This loop can be used by either reverse transcriptase or Klenow fragment of DNA polymerase I as a primer for second-strand synthesis. The resulting products are double-stranded cDNA molecules that are covalently closed at the end corresponding to the 5' end of the original mRNA. Subsequent cleavage of the short piece of single-stranded cDNA within the loop with the single-strand-specific S 1 nuclease generate open double-stranded molecules that can be used for molecular cloning in plasmids or in phage. Useful variations of this scheme have been described

  10. Mitochondrial DNA replication: a PrimPol perspective

    Science.gov (United States)

    Bailey, Laura J.

    2017-01-01

    PrimPol, (primase–polymerase), the most recently identified eukaryotic polymerase, has roles in both nuclear and mitochondrial DNA maintenance. PrimPol is capable of acting as a DNA polymerase, with the ability to extend primers and also bypass a variety of oxidative and photolesions. In addition, PrimPol also functions as a primase, catalysing the preferential formation of DNA primers in a zinc finger-dependent manner. Although PrimPol's catalytic activities have been uncovered in vitro, we still know little about how and why it is targeted to the mitochondrion and what its key roles are in the maintenance of this multicopy DNA molecule. Unlike nuclear DNA, the mammalian mitochondrial genome is circular and the organelle has many unique proteins essential for its maintenance, presenting a differing environment within which PrimPol must function. Here, we discuss what is currently known about the mechanisms of DNA replication in the mitochondrion, the proteins that carry out these processes and how PrimPol is likely to be involved in assisting this vital cellular process. PMID:28408491

  11. A Sensitive and Specific PCR Based Method for Identification of Cryptosporidium Sp. Using New Primers from 18S Ribosomal RNA

    Directory of Open Access Journals (Sweden)

    M Heydarnezhadi

    2011-09-01

    Full Text Available Background: The main goal of the present study was to develop a new sensitive and specific PCR based method for Identification of Cryptosporidium sp. using novel primers from 18S ribosomal RNA. Cryptosporidi­osis in high-risk host groups particularly in neonates and immuno-compromised individuals may result in death. To the best of our knowledge this is the first study regarding develop a new PCR based method to diagnose the cryptosporidiosis in Iran.Methods: A total of 850 human fecal samples from patients clinically suspected to cryptosporidiosis and 100 healthy and diarrheic cattle stool specimens were collected. The simplified formol-ether concentration method was carried out for all samples. They were then examined microscopically by modified Ziehl-Neel­sen staining method. Total DNA was extracted by QIA amp DNA stool mini kit was carried out by using designed prim­ers.Results: Twenty nine cases of cryptosporidiosis infection in human and 30 samples from cattle microscopi­cally were posi­tive. The described primary and nested PCR method could detect all Cryptospori­dium positive samples from human and cattle. Regards to suspected negative samples in pri­mary PCR examination, the Nested PCR could ap­prove two more positive results. Furthermore, Nested PCR analysis was able to detect one more case which was nega­tive in both microscopically examination and primary PCR. Specificity of the test was 100%. Sensitivity of Nested PCR in comparison to our gold standard; microscopy after Ridley concentration modified ziehl-Neelsen, was 100 %.Conclusion: Our developed PCR based method by using new primers devised from 18S ribosomal RNA revealed the ability for identification of the Cryptosporidium species such as C. parvum and C. huminis with high specificity and sensitivity.

  12. Protocols for 16S rDNA Array Analyses of Microbial Communities by Sequence-Specific Labeling of DNA Probes

    Directory of Open Access Journals (Sweden)

    Knut Rudi

    2003-01-01

    Full Text Available Analyses of complex microbial communities are becoming increasingly important. Bottlenecks in these analyses, however, are the tools to actually describe the biodiversity. Novel protocols for DNA array-based analyses of microbial communities are presented. In these protocols, the specificity obtained by sequence-specific labeling of DNA probes is combined with the possibility of detecting several different probes simultaneously by DNA array hybridization. The gene encoding 16S ribosomal RNA was chosen as the target in these analyses. This gene contains both universally conserved regions and regions with relatively high variability. The universally conserved regions are used for PCR amplification primers, while the variable regions are used for the specific probes. Protocols are presented for DNA purification, probe construction, probe labeling, and DNA array hybridizations.

  13. DNA barcode for genetic traceability of Nile Perch and Nile Tilapia

    International Nuclear Information System (INIS)

    Avossa, Valeria

    2017-01-01

    For this study, mitochondrial DNA was extracted from 55 fish samples (26 Nile Perch Samples and 29 Nile Tilapia Samples collected from 3 different Ugandan regions of Lake Victoria. In order to optimize the PCR method, we also extracted DNA from two other different fish samples: one from Italy and one from a Viennese market. The COI gene was amplified using universal primers (COI2, COI3, cocktails of 8 and 4 primers respectively). After the amplification step, the amplicons were analysed using gel electrophoresis , in order to establish that the set primers worked well in the samples. The positive results of an agarose gel electrophoresis analysis with the PCR amplicons (amplicons length ~700pb) are shown.

  14. Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing

    Directory of Open Access Journals (Sweden)

    Li Kelvin

    2012-11-01

    Full Text Available Abstract Background In a high-throughput environment, to PCR amplify and sequence a large set of viral isolates from populations that are potentially heterogeneous and continuously evolving, the use of degenerate PCR primers is an important strategy. Degenerate primers allow for the PCR amplification of a wider range of viral isolates with only one set of pre-mixed primers, thus increasing amplification success rates and minimizing the necessity for genome finishing activities. To successfully select a large set of degenerate PCR primers necessary to tile across an entire viral genome and maximize their success, this process is best performed computationally. Results We have developed a fully automated degenerate PCR primer design system that plays a key role in the J. Craig Venter Institute’s (JCVI high-throughput viral sequencing pipeline. A consensus viral genome, or a set of consensus segment sequences in the case of a segmented virus, is specified using IUPAC ambiguity codes in the consensus template sequence to represent the allelic diversity of the target population. PCR primer pairs are then selected computationally to produce a minimal amplicon set capable of tiling across the full length of the specified target region. As part of the tiling process, primer pairs are computationally screened to meet the criteria for successful PCR with one of two described amplification protocols. The actual sequencing success rates for designed primers for measles virus, mumps virus, human parainfluenza virus 1 and 3, human respiratory syncytial virus A and B and human metapneumovirus are described, where >90% of designed primer pairs were able to consistently successfully amplify >75% of the isolates. Conclusions Augmenting our previously developed and published JCVI Primer Design Pipeline, we achieved similarly high sequencing success rates with only minor software modifications. The recommended methodology for the construction of the consensus

  15. Accurate quantification of mouse mitochondrial DNA without co-amplification of nuclear mitochondrial insertion sequences.

    Science.gov (United States)

    Malik, Afshan N; Czajka, Anna; Cunningham, Phil

    2016-07-01

    Mitochondria contain an extra-nuclear genome in the form of mitochondrial DNA (MtDNA), damage to which can lead to inflammation and bioenergetic deficit. Changes in MtDNA levels are increasingly used as a biomarker of mitochondrial dysfunction. We previously reported that in humans, fragments in the nuclear genome known as nuclear mitochondrial insertion sequences (NumtS) affect accurate quantification of MtDNA. In the current paper our aim was to determine whether mouse NumtS affect the quantification of MtDNA and to establish a method designed to avoid this. The existence of NumtS in the mouse genome was confirmed using blast N, unique MtDNA regions were identified using FASTA, and MtDNA primers which do not co-amplify NumtS were designed and tested. MtDNA copy numbers were determined in a range of mouse tissues as the ratio of the mitochondrial and nuclear genome using real time qPCR and absolute quantification. Approximately 95% of mouse MtDNA was duplicated in the nuclear genome as NumtS which were located in 15 out of 21 chromosomes. A unique region was identified and primers flanking this region were used. MtDNA levels differed significantly in mouse tissues being the highest in the heart, with levels in descending order (highest to lowest) in kidney, liver, blood, brain, islets and lung. The presence of NumtS in the nuclear genome of mouse could lead to erroneous data when studying MtDNA content or mutation. The unique primers described here will allow accurate quantification of MtDNA content in mouse models without co-amplification of NumtS. Copyright © 2016 Elsevier B.V. and Mitochondria Research Society. All rights reserved.

  16. Perinatal transmission of human papilomavirus DNA

    Directory of Open Access Journals (Sweden)

    Serafini Eduardo P

    2009-06-01

    Full Text Available Abstract The purpose was to study the perinatal transmission of human papillomavirus DNA (HPV-DNA in 63 mother-newborn pairs, besides looking at the epidemiological factors involved in the viral DNA transmission. The following sampling methods were used: (1 in the pregnant woman, when was recruited, in cervix and clinical lesions of the vagina, vulva and perineal region; (2 in the newborn, (a buccal, axillary and inguinal regions; (b nasopharyngeal aspirate, and (c cord blood; (3 in the children, buccal was repeated in the 4th week and 6th and 12th month of life. HPV-DNA was identified using two methodologies: multiplex PCR (PGMY09 and MY11 primers and nested-PCR (genotypes 6/11, 16, 18, 31, 33, 42, 52 and 58. Perinatal transmission was considered when concordance was found in type-specific HPV between mother/newborn or mother/child. HPV-DNA genital was detected in 49 pregnant women submitted to delivery. Eleven newborns (22.4%, n = 11/49 were HPV-DNA positive. In 8 cases (16.3%, n = 8/49 there was type specific HPV concordance between mother/newborn samples. At the end of the first month of life three children (6.1%, n = 3/49 became HPV-DNA positive, while two remained positive from birth. In 3 cases (100%, n = 3/3 there was type specific HPV concordance between mother/newborn samples. In the 6th month, a child (2%, n = 1/49 had become HPV-DNA positive between the 1st and 6th month of life, and there was type specific HPV concordance of mother/newborn samples. All the HPV-DNA positive children (22.4%, n = 11/49 at birth and at the end first month of life (6.1%, n = 3/49 became HPV-DNA negative at the age of 6 months. The HPV-DNA positive child (2%, n = 1/49 from 1st to the 6th month of life became HPV-DNA negative between the 6th and 12th month of life and one child had anogenital warts. In the twelfth month all (100%, n = 49/49 the children studied were HPV-DNA negative. A positive and significant correlation was observed between perinatal

  17. A preferred region for recombinational patch repair in the 5' untranslated region of primer binding site-impaired murine leukemia virus vectors

    DEFF Research Database (Denmark)

    Mikkelsen, J G; Lund, Anders Henrik; Kristensen, K D

    1996-01-01

    , suggesting the involvement of a specific endogenous virus-like sequence in patch repair rescue of the primer binding site mutants. The putative recombination partner RNA was found in virions from psi-2 cells as detected by analysis of glutamine tRNA-initiated cDNA and by sequence analysis of regions...... site to allow correct second-strand transfer in reverse transcription. The system thereby selects for a reverse transcriptase-mediated recombination event in the 5' untranslated region. A panel of sequence differences between the recombination partners in this region has allowed mapping of the site...

  18. Primer Vector Optimization: Survey of Theory, new Analysis and Applications

    Science.gov (United States)

    Guzman

    This paper presents a preliminary study in developing a set of optimization tools for orbit rendezvous, transfer and station keeping. This work is part of a large scale effort undergoing at NASA Goddard Space Flight Center and a.i. solutions, Inc. to build generic methods, which will enable missions with tight fuel budgets. Since no single optimization technique can solve efficiently all existing problems, a library of tools where the user could pick the method most suited for the particular mission is envisioned. The first trajectory optimization technique explored is Lawden's primer vector theory [Ref. 1]. Primer vector theory can be considered as a byproduct of applying Calculus of Variations (COV) techniques to the problem of minimizing the fuel usage of impulsive trajectories. For an n-impulse trajectory, it involves the solution of n-1 two-point boundary value problems. In this paper, we look at some of the different formulations of the primer vector (dependent on the frame employed and on the force model). Also, the applicability of primer vector theory is examined in effort to understand when and why the theory can fail. Specifically, since COV is based on "small variations", singularities in the linearized (variational) equations of motion along the arcs must be taken into account. These singularities are a recurring problem in analyzes that employ "small variations" [Refs. 2, 3]. For example, singularities in the (2-body problem) variational equations along elliptic arcs occur when [Ref. 4], 1) the difference between the initial and final times is a multiple of the reference orbit period, 2) the difference between the initial and final true anomalies are given by k, for k= 0, 1, 2, 3,..., note that this cover the 3) the time of flight is a minimum for the given difference in true anomaly. For the N-body problem, the situation is more complex and is still under investigation. Several examples, such as the initialization of an orbit (ascent trajectory) and

  19. Primer and interviews: The dynamic stem cell niche.

    Science.gov (United States)

    Kiefer, Julie C

    2011-03-01

    A stem cell niche is a microenvironment that supports self-renewal of a population of stem cells, and their production of differentiated cells. While the definition evokes images of a stem cell Shangri-La-where a serene stem cell pool nestles within a niche that shelters and sustains it-the reality is much more tumultuous. Niches are subject to an ever-changing maelstrom of environmental factors, the ravages of old age, and the sly tactics of disease. Presented here is a basic overview of the different ways in which stem cell niches respond to local and systemic environments, and their impact on stem cell behavior. The primer culminates with a discussion of the topic with stem cell and niche biologists D. Leanne Jones, Ph.D., and Tudorita Tumbar, Ph.D. Copyright © 2011 Wiley-Liss, Inc.

  20. Demystifying eResearch a primer for librarians

    CERN Document Server

    Martin, Victoria

    2014-01-01

    Today's librarians need to be technology-savvy information experts who understand how to manage datasets. Demystifying eResearch: A Primer for Librarians prepares librarians for careers that involve eResearch, clearly defining what it is and how it impacts library services and collections, explaining key terms and concepts, and explaining the importance of the field. You will come to understand exactly how the use of networked computing technologies enhances and supports collaboration and innovative methods particularly in scientific research, learn about eResearch library initiatives and best practices, and recognize the professional development opportunities that eResearch offers. This book takes the broad approach to the complex topic of eResearch and how it pertains to the library community, providing an introduction that will be accessible to readers without a background in electronic research. The author presents a conceptual overview of eResearch with real-world examples of electronic research activit...

  1. Primer Part 1-The building blocks of epilepsy genetics.

    Science.gov (United States)

    Helbig, Ingo; Heinzen, Erin L; Mefford, Heather C

    2016-06-01

    This is the first of a two-part primer on the genetics of the epilepsies within the Genetic Literacy Series of the Genetics Commission of the International League Against Epilepsy. In Part 1, we cover the foundations of epilepsy genetics including genetic epidemiology and the range of genetic variants that can affect the risk for developing epilepsy. We discuss various epidemiologic study designs that have been applied to the genetics of the epilepsies including population studies, which provide compelling evidence for a strong genetic contribution in many epilepsies. We discuss genetic risk factors varying in size, frequency, inheritance pattern, effect size, and phenotypic specificity, and provide examples of how genetic risk factors within the various categories increase the risk for epilepsy. We end by highlighting trends in epilepsy genetics including the increasing use of massive parallel sequencing technologies. Wiley Periodicals, Inc. © 2016 International League Against Epilepsy.

  2. ITS primers for the identification of marketable Boletus.

    Science.gov (United States)

    Mello, Antonietta; Ghignone, Stefano; Vizzini, Alfredo; Sechi, Clizia; Ruiu, Pino; Bonfante, Paola

    2006-02-10

    Boletus species belonging to the section Boletus are the most frequently eaten fungi among those harvested in natural conditions in Europe. This section groups 10 taxa which are hardly distinguishable on the basis of their morphology. Some of them have been shown to induce allergic IgE-mediated symptoms either through inhalation, ingestion or contact. Since questions relating to the presence of allergens in any of the species most in demand (B. edulis, B. aereus, B. pinophilus, B. aestivalis, all classified as B. edulis s.l.) remain open, together with the absence of tools which distinguish the species, we sequenced the ITS region of 28 Boletus samples and then we designed specific primers. These allowed the effective separation of the taxa. In addition, the phylogenetic tree obtained from the sequences alignment revealed that B. violaceofuscus, a spectacular Chinese fungus considered belonging to the section Boletus and often sold intermixed with B. edulis s.l. specimens, clusters outside the section Boletus.

  3. A matter of degrees: A primer on global warming

    International Nuclear Information System (INIS)

    1993-01-01

    A primer on global warming is presented in order to provide information to Canadians on making environmentally responsible decisions. The fundamentals of natural climate change, the atmospheric environment, factors that influence climate, and the greenhouse effect are explained. Global warming is then discussed with reference to paleoclimatic research, the influence of human activity on increased concentrations of greenhouse gases, and predictions of future climates. The possible impacts of global warming on Canada are described for such sectors as forests, fisheries, agriculture, sea levels, health, energy supply and demand, and the Arctic regions. The actions that citizens and governments can take in order to mitigate or adapt to global warming are then presented. A glossary and index are included. 55 refs., 17 figs

  4. Inhibition of HIV-1 reverse transcriptase-catalyzed synthesis by intercalated DNA Benzo[a]Pyrene 7,8-Dihydrodiol-9,10-Epoxide adducts.

    Directory of Open Access Journals (Sweden)

    Parvathi Chary

    Full Text Available To aid in the characterization of the relationship of structure and function for human immunodeficiency virus type-1 reverse transcriptase (HIV-1 RT, this investigation utilized DNAs containing benzo[a]pyrene-7,8-dihydrodiol-9,10-epoxide (BPDE-modified primers and templates as a probe of the architecture of this complex. BPDE lesions that differed in their stereochemistry around the C10 position were covalently linked to N (6-adenine and positioned in either the primer or template strand of a duplex template-primer. HIV-1 RT exhibited a stereoisomer-specific and strand-specific difference in replication when the BPDE-lesion was placed in the template versus the primer strand. When the C10 R-BPDE adduct was positioned in the primer strand in duplex DNA, 5 nucleotides from the 3΄ end of the primer terminus, HIV-1 RT could not fully replicate the template, producing truncated products; this block to further synthesis did not affect rates of dissociation or DNA binding affinity. Additionally, when the adducts were in the same relative position, but located in the template strand, similar truncated products were observed with both the C10 R and C10 S BPDE adducts. These data suggest that the presence of covalently-linked intercalative DNA adducts distant from the active site can lead to termination of DNA synthesis catalyzed by HIV-1 RT.

  5. A health and safety primer for the practicing health physicist

    International Nuclear Information System (INIS)

    Hylko, J.M.; Bradshaw, M.C.; Ross, L.E.; Brennan, M.J.; Pomatto, C.B.; Shelly, F.C.

    1996-01-01

    Environmental restoration (ER) is the process of removing a facility from service, the demolition of structures the identification and disposal of all hazardous and radioactive wastes, the decontamination of equipment and materials, and the restoration of a site for unrestricted use. The number of ER projects encompassing hazardous, industrial, and radiological conditions is expected to increase in response to various program requirements or mission changes. As a result, the practicing health physicist (HP) may have to address unique health and safety (H and S) issues beyond those of performing routine radiological activities. These unique H and S issues could include, but are not limited to the razing of buildings, the removal of radioactive materials and hazardous chemicals, below-grade excavation, confined space entry, storing flammable or combustible liquids, monitoring exposure to hazardous substances, contacting energized systems (e.g., electricity, hydraulics), noise abatement, the nullification of manufacturer warranties, and the operation and movement of heavy equipment. The purpose of this paper is to educate the practicing HP about these issues by reviewing specific regulations governing all H and S activities, and to provide an example of a site-specific H and S primer (e.g., Health and Safety Plan [HASP]). This primer advices the practicing HP about sound H and S principles, furnishes basic strategies for performing a hazard assessment/job safety analysis (HA/JSA) that can be applied to any ER project, and describes various engineering and administrative controls to mitigate hazardous exposures to ER personnel. In addition, 26 inspection checklist topics are available from the primary author to evaluate the adequacy of the engineering and administrative controls, or to necessitate the use of personal protective equipment (PPE) thereby mitigating the corresponding hazard. (author)

  6. Phylogeny and genetic diversity of Bridgeoporus nobilissimus inferred using mitochondrial and nuclear rDNA sequences

    Science.gov (United States)

    Redberg, G.L.; Hibbett, D.S.; Ammirati, J.F.; Rodriguez, R.J.

    2003-01-01

    The genetic diversity and phylogeny of Bridgeoporus nobilissimus have been analyzed. DNA was extracted from spores collected from individual fruiting bodies representing six geographically distinct populations in Oregon and Washington. Spore samples collected contained low levels of bacteria, yeast and a filamentous fungal species. Using taxon-specific PCR primers, it was possible to discriminate among rDNA from bacteria, yeast, a filamentous associate and B. nobilissimus. Nuclear rDNA internal transcribed spacer (ITS) region sequences of B. nobilissimus were compared among individuals representing six populations and were found to have less than 2% variation. These sequences also were used to design dual and nested PCR primers for B. nobilissimus-specific amplification. Mitochondrial small-subunit rDNA sequences were used in a phylogenetic analysis that placed B. nobilissimus in the hymenochaetoid clade, where it was associated with Oxyporus and Schizopora.

  7. Highly parallel and short-acting amplification with locus-specific primers to detect single nucleotide polymorphisms by the DigiTag2 assay.

    Directory of Open Access Journals (Sweden)

    Nao Nishida

    Full Text Available The DigiTag2 assay enables analysis of a set of 96 SNPs using Kapa 2GFast HotStart DNA polymerase with a new protocol that has a total running time of about 7 hours, which is 6 hours shorter than the previous protocol. Quality parameters (conversion rate, call rate, reproducibility and concordance were at the same levels as when genotype calls were acquired using the previous protocol. Multiplex PCR with 192 pairs of locus-specific primers was available for target preparation in the DigiTag2 assay without the optimization of reaction conditions, and quality parameters had the same levels as those acquired with 96-plex PCR. The locus-specific primers were able to achieve sufficient (concentration of target amplicon ≥5 nM and specific (concentration of unexpected amplicons <2 nM amplification within 2 hours, were also able to achieve detectable amplifications even when working in a 96-plex or 192-plex form. The improved DigiTag2 assay will be an efficient platform for screening an intermediate number of SNPs (tens to hundreds of sites in the replication analysis after genome-wide association study. Moreover, highly parallel and short-acting amplification with locus-specific primers may thus facilitate widespread application to other PCR-based assays.

  8. Pitfalls in genetic testing: a case of a SNP in primer-annealing region leading to allele dropout in BRCA1.

    Science.gov (United States)

    Silva, Felipe Carneiro; Torrezan, Giovana Tardin; Brianese, Rafael Canfield; Stabellini, Raquel; Carraro, Dirce Maria

    2017-07-01

    Hereditary breast and ovarian cancer is characterized by mutations in BRCA1 or BRCA2 genes and PCR-based screening techniques, such as capillary sequencing and next-generation sequencing (NGS), are considered gold standard methods for detection of pathogenic mutations in these genes. Single-nucleotide polymorphisms (SNPs) constitute a vast source of variation in the human genome and represent a risk for misdiagnosis in genetic testing, since the presence of a SNP in primer-annealing sites may cause false negative results due to allele dropout. However, few reports are available and the frequency of this phenomenon in diagnostic assays remains unknown. In this article, we investigated the causes of a false negative capillary sequencing result in BRCA1 involving a mother-daughter dyad. Using several molecular strategies, including different DNA polymerases, primer redesign, allele-specific PCR and NGS, we established that the initial misdiagnosis was caused by a SNP located in the primer-annealing region, leading to allele dropout of the mutated allele. Assuming that this problem can also occur in any PCR-based method that are widely used in diagnostic settings, the clinical report presented here draws attention for one of the limitations of genetic testing in general, for which medical and laboratory communities need to be aware.

  9. PCNA mono-ubiquitination and activation of translesion DNA polymerases by DNA polymerase {alpha}.

    Science.gov (United States)

    Suzuki, Motoshi; Niimi, Atsuko; Limsirichaikul, Siripan; Tomida, Shuta; Miao Huang, Qin; Izuta, Shunji; Usukura, Jiro; Itoh, Yasutomo; Hishida, Takashi; Akashi, Tomohiro; Nakagawa, Yoshiyuki; Kikuchi, Akihiko; Pavlov, Youri; Murate, Takashi; Takahashi, Takashi

    2009-07-01

    Translesion DNA synthesis (TLS) involves PCNA mono-ubiquitination and TLS DNA polymerases (pols). Recent evidence has shown that the mono-ubiquitination is induced not only by DNA damage but also by other factors that induce stalling of the DNA replication fork. We studied the effect of spontaneous DNA replication errors on PCNA mono-ubiquitination and TLS induction. In the pol1L868F strain, which expressed an error-prone pol alpha, PCNA was spontaneously mono-ubiquitinated. Pol alpha L868F had a rate-limiting step at the extension from mismatched primer termini. Electron microscopic observation showed the accumulation of a single-stranded region at the DNA replication fork in yeast cells. For pol alpha errors, pol zeta participated in a generation of +1 frameshifts. Furthermore, in the pol1L868F strain, UV-induced mutations were lower than in the wild-type and a pol delta mutant strain (pol3-5DV), and deletion of the RAD30 gene (pol eta) suppressed this defect. These data suggest that nucleotide misincorporation by pol alpha induces exposure of single-stranded DNA, PCNA mono-ubiquitination and activates TLS pols.

  10. DNA extraction from coral reef sediment bacteria for the polymerase chain reaction.

    Science.gov (United States)

    Guthrie, J N; Moriarty, D J; Blackall, L L

    2000-12-15

    A rapid and effective method for the direct extraction of high molecular weight amplifiable DNA from two coral reef sediments was developed. DNA was amplified by the polymerase chain reaction (PCR) using 16S rDNA specific primers. The amplicons were digested with HaeIII, HinP1I and MspI and separated using polyacrylamide gel electrophoresis and silver staining. The resulting amplified ribosomal DNA restriction analysis (ARDRA) patterns were used as a fingerprint to discern differences between the coral reef sediment samples. Results indicated that ARDRA is an effective method for determining differences within the bacterial community amongst different environmental samples.

  11. A rapid method for screening arrayed plasmid cDNA library by PCR

    International Nuclear Information System (INIS)

    Hu Yingchun; Zhang Kaitai; Wu Dechang; Li Gang; Xiang Xiaoqiong

    1999-01-01

    Objective: To develop a PCR-based method for rapid and effective screening of arrayed plasmid cDNA library. Methods: The plasmid cDNA library was arrayed and screened by PCR with a particular set of primers. Results: Four positive clones were obtained through about one week. Conclusion: This method can be applied to screening not only normal cDNA clones, but also cDNA clones-containing small size fragments. This method offers significant advantages over traditional screening method in terms of sensitivity, specificity and efficiency

  12. Duplex Alu Screening for Degraded DNA of Skeletal Human Remains

    Directory of Open Access Journals (Sweden)

    Fabian Haß

    2017-10-01

    Full Text Available The human-specific Alu elements, belonging to the class of Short INterspersed Elements (SINEs, have been shown to be a powerful tool for population genetic studies. An earlier study in this department showed that it was possible to analyze Alu presence/absence in 3000-year-old skeletal human remains from the Bronze Age Lichtenstein cave in Lower Saxony, Germany. We developed duplex Alu screening PCRs with flanking primers for two Alu elements, each combined with a single internal Alu primer. By adding an internal primer, the approximately 400–500 bp presence signals of Alu elements can be detected within a range of less than 200 bp. Thus, our PCR approach is suited for highly fragmented ancient DNA samples, whereas NGS analyses frequently are unable to handle repetitive elements. With this analysis system, we examined remains of 12 individuals from the Lichtenstein cave with different degrees of DNA degradation. The duplex PCRs showed fully informative amplification results for all of the chosen Alu loci in eight of the 12 samples. Our analysis system showed that Alu presence/absence analysis is possible in samples with different degrees of DNA degradation and it reduces the amount of valuable skeletal material needed by a factor of four, as compared with a singleplex approach.

  13. DNAzyme Feedback Amplification: Relaying Molecular Recognition to Exponential DNA Amplification.

    Science.gov (United States)

    Liu, Meng; Yin, Qingxin; McConnell, Erin M; Chang, Yangyang; Brennan, John D; Li, Yingfu

    2018-03-26

    Technologies capable of linking DNA amplification to molecular recognition are very desirable for ultrasensitive biosensing applications. We have developed a simple but powerful isothermal DNA amplification method, termed DNAzyme feedback amplification (DFA), that is capable of relaying molecular recognition to exponential DNA amplification. The method incorporates both an RNA-cleaving DNAzyme (RCD) and rolling circle amplification (RCA) carried out by a special DNA polymerase using a circular DNA template. DFA begins with a stimulus-dependent RCA reaction, producing tandemly linked RCDs in long-chain DNA products. These RCDs cleave an RNA-containing DNA sequence to form additional primers that hybridize to the circular DNA molecule, giving rise to DNA assemblies that act as the new inputs for RCA. The RCA reaction and the cleavage event keep on feeding each other autonomously, resulting in exponential growth of repetitive DNA sequences that can be easily detected. This method can be used for the detection of both nucleic acid based targets and non-nucleic acid analytes. In this article, we discuss the conceptual framework of the feedback amplification approach, the essential features of this method as well as remaining challenges and possible solutions. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Variants of sequence family B Thermococcus kodakaraensis DNA polymerase with increased mismatch extension selectivity.

    Directory of Open Access Journals (Sweden)

    Claudia Huber

    Full Text Available Fidelity and selectivity of DNA polymerases are critical determinants for the biology of life, as well as important tools for biotechnological applications. DNA polymerases catalyze the formation of DNA strands by adding deoxynucleotides to a primer, which is complementarily bound to a template. To ensure the integrity of the genome, DNA polymerases select the correct nucleotide and further extend the nascent DNA strand. Thus, DNA polymerase fidelity is pivotal for ensuring that cells can replicate their genome with minimal error. DNA polymerases are, however, further optimized for more specific biotechnological or diagnostic applications. Here we report on the semi-rational design of mutant libraries derived by saturation mutagenesis at single sites of a 3'-5'-exonuclease deficient variant of Thermococcus kodakaraensis DNA polymerase (KOD pol and the discovery for variants with enhanced mismatch extension selectivity by screening. Sites of potential interest for saturation mutagenesis were selected by their proximity to primer or template strands. The resulting libraries were screened via quantitative real-time PCR. We identified three variants with single amino acid exchanges-R501C, R606Q, and R606W-which exhibited increased mismatch extension selectivity. These variants were further characterized towards their potential in mismatch discrimination. Additionally, the identified enzymes were also able to differentiate between cytosine and 5-methylcytosine. Our results demonstrate the potential in characterizing and developing DNA polymerases for specific PCR based applications in DNA biotechnology and diagnostics.

  15. 40 CFR 63.745 - Standards: Primer and topcoat application operations.

    Science.gov (United States)

    2010-07-01

    ... CATEGORIES (CONTINUED) National Emission Standards for Aerospace Manufacturing and Rework Facilities § 63.745.../L (4.5 lb/gal) of primer (less water), as applied, for general aviation rework facilities; or 650 g... (4.5 lb/gal) of primer (less water and exempt solvents), as applied, for general aviation rework...

  16. Sediment transport primer: estimating bed-material transport in gravel-bed rivers

    Science.gov (United States)

    Peter Wilcock; John Pitlick; Yantao Cui

    2009-01-01

    This primer accompanies the release of BAGS, software developed to calculate sediment transport rate in gravel-bed rivers. BAGS and other programs facilitate calculation and can reduce some errors, but cannot ensure that calculations are accurate or relevant. This primer was written to help the software user define relevant and tractable problems, select appropriate...

  17. Móvil remisión de V. cinta del primer móvil.

    OpenAIRE

    2011-01-01

    [ES] Definición del término Móvil remisión de V. cinta del primer móvil. en el diccionario Dicter. [EN] Definition of the word Móvil remisión de V. cinta del primer móvil. in the dictionary Dicter.

  18. The Universal Primer - An open source solution for archiving, organizing and streaming live lectures

    DEFF Research Database (Denmark)

    Christoffersen, Marc Juul; Panton, Hans Christian Hansen; Krajowski-Kukiel, Maciej

    2011-01-01

    . The goal of the Universal Primer is to address these problems, and allow anyone, anywhere, to teach or learn anything that can be reasonably taught or learned through a computer. The Universal Primer is 1: A fully open source solution for streaming live lectures. And 2: A Wikipedia-like website...

  19. Taxon-specific PCR primers to detect two inconspicuous arbuscular mycorrhizal fungi from temperate agricultural grassland

    NARCIS (Netherlands)

    Gamper, H.A.; Leuchtmann, A.

    2007-01-01

    Taxon-specific polymerase chain reaction (PCR) primers enable detection of arbuscular mycorrhizal fungi (AMF, Glomeromycota) in plant roots where the fungi lack discriminative morphological and biochemical characters. We designed and validated pairs of new PCR primers targeted to the flanking

  20. GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.

    Science.gov (United States)

    Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart

    2011-01-01

    The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.

  1. Decreased mitochondrial DNA content in blood samples of patients with stage I breast cancer

    International Nuclear Information System (INIS)

    Xia, Peng; An, Han-Xiang; Dang, Cheng-Xue; Radpour, Ramin; Kohler, Corina; Fokas, Emmanouil; Engenhart-Cabillic, Rita; Holzgreve, Wolfgang; Zhong, Xiao Yan

    2009-01-01

    Alterations of mitochondrial DNA (mtDNA) have been implicated in carcinogenesis. We developed an accurate multiplex quantitative real-time PCR for synchronized determination of mtDNA and nuclear DNA (nDNA). We sought to investigate whether mtDNA content in the peripheral blood of breast cancer patients is associated with clinical and pathological parameters. Peripheral blood samples were collected from 60 patients with breast cancer and 51 age-matched healthy individuals as control. DNA was extracted from peripheral blood for the quantification of mtDNA and nDNA, using a one-step multiplex real-time PCR. A FAM labeled MGB probe and primers were used to amplify the mtDNA sequence of the ATP 8 gene, and a VIC labeled MGB probe and primers were employed to amplify the glyceraldehyde-3-phosphate-dehydrogenase gene. mtDNA content was correlated with tumor stage, menstruation status, and age of patients as well as lymph node status and the expression of estrogen receptor (ER), progesterone receptor (PR) and Her-2/neu protein. The content of mtDNA in stage I breast cancer patients was significantly lower than in other stages (overall P = 0.023). Reduced mtDNA was found often in post menopausal cancer group (P = 0.024). No difference in mtDNA content, in regards to age (p = 0.564), lymph node involvement (p = 0.673), ER (p = 0.877), PR (p = 0.763), and Her-2/neu expression (p = 0.335), was observed. Early detection of breast cancer has proved difficult and current detection methods are inadequate. In the present study, decreased mtDNA content in the peripheral blood of patients with breast cancer was strongly associated with stage I. The use of mtDNA may have diagnostic value and further studies are required to validate it as a potential biomarker for early detection of breast cancer

  2. The effects of three different grinding methods in DNA extraction of ...

    African Journals Online (AJOL)

    uwerhiavwe

    2013-04-17

    Apr 17, 2013 ... The effects of three different grinding methods in DNA extraction of cowpea .... 100 mg of the leaf tissues were weighed in an electronic balance. CTAB method .... The primers were synthesized by Life Technologies (AB & Invitrogen). .... This work was supported by 'Shuang-Zhi Plan' of Sichuan. Agricultural ...

  3. cDNA sequence and tissue expression analysis of glucokinase from ...

    African Journals Online (AJOL)

    Yomi

    2012-01-10

    Jan 10, 2012 ... distribution of GK mRNA in brain, mesenteric adipose tissue, spleen, white muscle and liver of grass ... expression profile of GK mRNA in liver normalized with β-actin level was 31, 454 and 649-fold compared .... Primers and expected products used for GK gene cDNA RT-PCR, RACE and real-time PCR.

  4. A next generation semiconductor based sequencing approach for the identification of meat species in DNA mixtures.

    Directory of Open Access Journals (Sweden)

    Francesca Bertolini

    Full Text Available The identification of the species of origin of meat and meat products is an important issue to prevent and detect frauds that might have economic, ethical and health implications. In this paper we evaluated the potential of the next generation semiconductor based sequencing technology (Ion Torrent Personal Genome Machine for the identification of DNA from meat species (pig, horse, cattle, sheep, rabbit, chicken, turkey, pheasant, duck, goose and pigeon as well as from human and rat in DNA mixtures through the sequencing of PCR products obtained from different couples of universal primers that amplify 12S and 16S rRNA mitochondrial DNA genes. Six libraries were produced including PCR products obtained separately from 13 species or from DNA mixtures containing DNA from all species or only avian or only mammalian species at equimolar concentration or at 1:10 or 1:50 ratios for pig and horse DNA. Sequencing obtained a total of 33,294,511 called nucleotides of which 29,109,688 with Q20 (87.43% in a total of 215,944 reads. Different alignment algorithms were used to assign the species based on sequence data. Error rate calculated after confirmation of the obtained sequences by Sanger sequencing ranged from 0.0003 to 0.02 for the different species. Correlation about the number of reads per species between different libraries was high for mammalian species (0.97 and lower for avian species (0.70. PCR competition limited the efficiency of amplification and sequencing for avian species for some primer pairs. Detection of low level of pig and horse DNA was possible with reads obtained from different primer pairs. The sequencing of the products obtained from different universal PCR primers could be a useful strategy to overcome potential problems of amplification. Based on these results, the Ion Torrent technology can be applied for the identification of meat species in DNA mixtures.

  5. Eukaryotic ribosome display with in situ DNA recovery.

    Science.gov (United States)

    He, Mingyue; Edwards, Bryan M; Kastelic, Damjana; Taussig, Michael J

    2012-01-01

    Ribosome display is a cell-free display technology for in vitro selection and optimisation of proteins from large diversified libraries. It operates through the formation of stable protein-ribosome-mRNA (PRM) complexes and selection of ligand-binding proteins, followed by DNA recovery from the selected genetic information. Both prokaryotic and eukaryotic ribosome display systems have been developed. In this chapter, we describe the eukaryotic rabbit reticulocyte method in which a distinct in situ single-primer RT-PCR procedure is used to recover DNA from the selected PRM complexes without the need for prior disruption of the ribosome.

  6. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

    1993-02-16

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a pu GOVERNMENT RIGHTS This application was funded under Department of Energy Contract DE-AC02-76ER01338. The U.S. Government has certain rights under this application and any patent issuing thereon.

  7. DNA Vaccines

    Indian Academy of Sciences (India)

    diseases. Keywords. DNA vaccine, immune response, antibodies, infectious diseases. GENERAL .... tein vaccines require expensive virus/protein purification tech- niques as ... sphere continue to remain major health hazards in developing nations. ... significance since it can be produced at a very low cost and can be stored ...

  8. DNA Investigations.

    Science.gov (United States)

    Mayo, Ellen S.; Bertino, Anthony J.

    1991-01-01

    Presents a simulation activity that allow students to work through the exercise of DNA profiling and to grapple with some analytical and ethical questions involving a couple arranging with a surrogate mother to have a baby. Can be used to teach the principles of restriction enzyme digestion, gel electrophoresis, and probe hybridization. (MDH)

  9. Constructing and detecting a cDNA library for mites.

    Science.gov (United States)

    Hu, Li; Zhao, YaE; Cheng, Juan; Yang, YuanJun; Li, Chen; Lu, ZhaoHui

    2015-10-01

    RNA extraction and construction of complementary DNA (cDNA) library for mites have been quite challenging due to difficulties in acquiring tiny living mites and breaking their hard chitin. The present study is to explore a better method to construct cDNA library for mites that will lay the foundation on transcriptome and molecular pathogenesis research. We selected Psoroptes cuniculi as an experimental subject and took the following steps to construct and verify cDNA library. First, we combined liquid nitrogen grinding with TRIzol for total RNA extraction. Then, switching mechanism at 5' end of the RNA transcript (SMART) technique was used to construct full-length cDNA library. To evaluate the quality of cDNA library, the library titer and recombination rate were calculated. The reliability of cDNA library was detected by sequencing and analyzing positive clones and genes amplified by specific primers. The results showed that the RNA concentration was 836 ng/μl and the absorbance ratio at 260/280 nm was 1.82. The library titer was 5.31 × 10(5) plaque-forming unit (PFU)/ml and the recombination rate was 98.21%, indicating that the library was of good quality. In the 33 expressed sequence tags (ESTs) of P. cuniculi, two clones of 1656 and 1658 bp were almost identical with only three variable sites detected, which had an identity of 99.63% with that of Psoroptes ovis, indicating that the cDNA library was reliable. Further detection by specific primers demonstrated that the 553-bp Pso c II gene sequences of P. cuniculi had an identity of 98.56% with those of P. ovis, confirming that the cDNA library was not only reliable but also feasible.

  10. 800,000 year old mammoth DNA, modern elephant DNA or PCR artefact?

    Science.gov (United States)

    Binladen, Jonas; Gilbert, M Thomas P; Willerslev, Eske

    2007-02-22

    Poulakakis and colleagues (Poulakakis et al. 2006: Biol. Lett. 2, 451-454), report the recovery of 'authentic' mammoth DNA from an 800,000-year-old fragment of bone excavated on the island of Crete. In light of results from other ancient DNA studies that indicate how DNA survival is unlikely in samples, which are recovered from warm environments and are relatively old (e.g. more than 100,000 years), these findings come as a great surprise. Here, we show that problems exist with the methodological approaches used in the study. First, the nested PCR technique as reported is nonsensical--one of the second round 'nested' primers falls outside the amplicon of the first round PCR. More worryingly, the binding region of one of the first round primers (Elcytb320R) falls within the short 43 base pair reported mammoth sequence, specifically covering two of the three reportedly diagnostic Elephas polymorphisms. Finally, we demonstrate using a simple BLAST search in GenBank that the claimed 'uniquely derived character state' for mammoths is in fact also found within modern elephants.

  11. VARIAN NON-DELESI 9 PASANG BASA DNA MITOKONDRIA MANUSIA SAMPEL FORENSIK BALI

    Directory of Open Access Journals (Sweden)

    Gun Gun Gumilar

    2005-06-01

    Full Text Available One of human mitochondrial DNA (mtDNA variant is a 9 base pairs (bp deletion in the COII/tRNALys intergenic region. In construction mtDNA nomenclature, 9-bp deletion database consist of primary and secondary data is needed, including Bali bombing forensic samples. Here we report a 9-bp non- deletion mtDNA variant from Bali bombing forensic samples to complete primary data. Polymerase Chain Reaction (PCR technique with 2 set primer was used to detect 9-bp deletion. The PCR result was detected by agarose gel electrophoresis, which showed two bands (0.1 and 0.4 kb for non-deletion variant control, and one band (0.4 kb for deletion variant control. If the sample has 9-bp deletion, only one of the primer pairs could amplify a fragment of 0.4 kb. If the sample does not have 9-bp deletion, the other primer pair will amplify a 0.1 kb product. The result showed that none of the 24 samples has 9-bp deletion. These results are contributed to the human mtDNA database and nomenclature construction. Keywords: mtDNA, 9-bp deletion, PCR

  12. Optimal conditions to use Pfu exo(-) DNA polymerase for highly efficient ligation-mediated polymerase chain reaction protocols.

    Science.gov (United States)

    Angers, M; Cloutier, J F; Castonguay, A; Drouin, R

    2001-08-15

    Ligation-Mediated Polymerase Chain Reaction (LMPCR) is the most sensitive sequencing technique available to map single-stranded DNA breaks at the nucleotide level of resolution using genomic DNA. LMPCR has been adapted to map DNA damage and reveal DNA-protein interactions inside living cells. However, the sequence context (GC content), the global break frequency and the current combination of DNA polymerases used in LMPCR affect the quality of the results. In this study, we developed and optimized an LMPCR protocol adapted for Pyrococcus furiosus exo(-) DNA polymerase (Pfu exo(-)). The relative efficiency of Pfu exo(-) was compared to T7-modified DNA polymerase (Sequenase 2.0) at the primer extension step and to Thermus aquaticus DNA polymerase (Taq) at the PCR amplification step of LMPCR. At all break frequencies tested, Pfu exo(-) proved to be more efficient than Sequenase 2.0. During both primer extension and PCR amplification steps, the ratio of DNA molecules per unit of DNA polymerase was the main determinant of the efficiency of Pfu exo(-), while the efficiency of Taq was less affected by this ratio. Substitution of NaCl for KCl in the PCR reaction buffer of Taq strikingly improved the efficiency of the DNA polymerase. Pfu exo(-) was clearly more efficient than Taq to specifically amplify extremely GC-rich genomic DNA sequences. Our results show that a combination of Pfu exo(-) at the primer extension step and Taq at the PCR amplification step is ideal for in vivo DNA analysis and DNA damage mapping using LMPCR.

  13. Circulating Differentially Methylated Amylin DNA as a Biomarker of β-Cell Loss in Type 1 Diabetes.

    Directory of Open Access Journals (Sweden)

    John A Olsen

    Full Text Available In type 1 diabetes (T1D, β-cell loss is silent during disease progression. Methylation-sensitive quantitative real-time PCR (qPCR of β-cell-derived DNA in the blood can serve as a biomarker of β-cell death in T1D. Amylin is highly expressed by β-cells in the islet. Here we examined whether demethylated circulating free amylin DNA (cfDNA may serve as a biomarker of β-cell death in T1D. β cells showed unique methylation patterns within the amylin coding region that were not observed with other tissues. The design and use of methylation-specific primers yielded a strong signal for demethylated amylin in purified DNA from murine islets when compared with other tissues. Similarly, methylation-specific primers detected high levels of demethylated amylin DNA in human islets and enriched human β-cells. In vivo testing of the primers revealed an increase in demethylated amylin cfDNA in sera of non-obese diabetic (NOD mice during T1D progression and following the development of hyperglycemia. This increase in amylin cfDNA did not mirror the increase in insulin cfDNA, suggesting that amylin cfDNA may detect β-cell loss in serum samples where insulin cfDNA is undetected. Finally, purified cfDNA from recent onset T1D patients yielded a high signal for demethylated amylin cfDNA when compared with matched healthy controls. These findings support the use of demethylated amylin cfDNA for detection of β-cell-derived DNA. When utilized in conjunction with insulin, this latest assay provides a comprehensive multi-gene approach for the detection of β-cell loss.

  14. A one-step reaction for the rapid identification of Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti using oligonucleotide primers designed from the 16S-23S rRNA intergenic sequences.

    Science.gov (United States)

    Ferchichi, M; Valcheva, R; Prévost, H; Onno, B; Dousset, X

    2008-06-01

    Species-specific primers targeting the 16S-23S ribosomal DNA (rDNA) intergenic spacer region (ISR) were designed to rapidly discriminate between Lactobacillus mindensis, Lactobacillus panis, Lactobacillus paralimentarius, Lactobacillus pontis and Lactobacillus frumenti species recently isolated from French sourdough. The 16S-23S ISRs were amplified using primers 16S/p2 and 23S/p7, which anneal to positions 1388-1406 of the 16S rRNA gene and to positions 207-189 of the 23S rRNA gene respectively, Escherichia coli numbering (GenBank accession number V00331). Clone libraries of the resulting amplicons were constructed using a pCR2.1 TA cloning kit and sequenced. Species-specific primers were designed based on the sequences obtained and were used to amplify the 16S-23S ISR in the Lactobacillus species considered. For all of them, two PCR amplicons, designated as small ISR (S-ISR) and large ISR (L-ISR), were obtained. The L-ISR is composed of the corresponding S-ISR, interrupted by a sequence containing tRNA(Ile) and tRNA(Ala) genes. Based on these sequences, species-specific primers were designed and proved to identify accurately the species considered among 30 reference Lactobacillus species tested. Designed species-specific primers enable a rapid and accurate identification of L. mindensis, L. paralimentarius, L. panis, L. pontis and L. frumenti species among other lactobacilli. The proposed method provides a powerful and convenient means of rapidly identifying some sourdough lactobacilli, which could be of help in large starter culture surveys.

  15. A tool for design of primers for microRNA-specific quantitative RT-qPCR. BMC Bioinformatics

    DEFF Research Database (Denmark)

    Busk, Peter Kamp

    2014-01-01

    of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed......Background MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come...... at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. Results I have developed the software miRprimer for automatic...

  16. KENO V.a Primer: A Primer for Criticality Calculations with SCALE/KENO V.a Using CSPAN for Input

    International Nuclear Information System (INIS)

    Busch, R.D.

    2003-01-01

    The SCALE (Standardized Computer Analyses for Licensing Evaluation) computer software system developed at Oak Ridge National Laboratory (ORNL) is widely used and accepted around the world for criticality safety analyses. The well-known KENO V.a three-dimensional Monte Carlo criticality computer code is the primary criticality safety analysis tool in SCALE. The KENO V.a primer is designed to help a new user understand and use the SCALE/KENO V.a Monte Carlo code for nuclear criticality safety analyses. It assumes that the user has a college education in a technical field. There is no assumption of familiarity with Monte Carlo codes in general or with SCALE/KENO V.a in particular. The primer is designed to teach by example, with each example illustrating two or three features of SCALE/KENO V.a that are useful in criticality analyses. The primer is based on SCALE 4.4a, which includes the Criticality Safety Processor for Analysis (CSPAN) input processor for Windows personal computers (PCs). A second edition of the primer, which uses the new KENO Visual Editor, is currently under development at ORNL and is planned for publication in late 2003. Each example in this first edition of the primer uses CSPAN to provide the framework for data input. Starting with a Quickstart section, the primer gives an overview of the basic requirements for SCALE/KENO V.a input and allows the user to quickly run a simple criticality problem with SCALE/KENO V.a. The sections that follow Quickstart include a list of basic objectives at the beginning that identifies the goal of the section and the individual SCALE/KENO V.a features which are covered in detail in the example problems in that section. Upon completion of the primer, a new user should be comfortable using CSPAN to set up criticality problems in SCALE/KENO V.a

  17. A Primer on Alberta’s Oil sands Royalties

    Directory of Open Access Journals (Sweden)

    Sarah Dobson

    2015-12-01

    Full Text Available Fulfilling its campaign promise, the new NDP government announced a review of Alberta’s royalty framework in June 2015. The province receives royalty revenue from three main sources – natural gas, crude oil, and oil sands. Since the 2009-10 fiscal year the largest contributor to Alberta’s royalty revenues has been the oil sands. If you want a sense of how important oil sands royalties have been for Alberta’s finances, consider this: In the 2014–15 fiscal year, the government collected just over $5 billion from oil sands royalties. These royalties covered over 10 per cent of the province’s operational expenses of $48.6 billion in the same fiscal year. Over the last six fiscal years the oil sands have contributed an average of 10 per cent of revenues to provincial coffers. This makes oil sands royalties the fourth largest contributor behind personal income taxes (23 per cent, federal transfers (13 per cent and corporate income taxes (11 per cent. But how many Albertans really understand how the royalty system works? What do we mean when we say “royalty”? How does the Alberta Government calculate royalties on oil sands producers? If the system is going to change, it’s important that Albertans understand how the current system works. That is what this paper is designed to do. For Albertans to properly judge the impact of new policy, they need a solid understanding of the current policy environment. We all know that oil prices have dropped and oil sands producers are losing profitability. As such, changes to the royalty system could have a deep and profound impact on the sector. Here are some of the issues this primer will study: • Pre-payout projects vs. post-payout projects, in other words, the classification of projects for royalty purposes based on whether the cumulative costs of a project exceed its cumulative revenues • Monthly payment of royalties vs. annual payment • Understanding the unit price of bitumen and how that

  18. Single-tube multiplex PCR using type-specific E6/E7 primers and capillary electrophoresis genotypes 21 human papillomaviruses in neoplasia

    Directory of Open Access Journals (Sweden)

    Warenholt Janina

    2011-01-01

    Full Text Available Abstract Background Human papillomavirus (HPV E6/E7 type-specific oncogenes are required for cervical carcinogenesis. Current PCR protocols for genotyping high-risk HPV in cervical screening are not standardized and usually use consensus primers targeting HPV capsid genes, which are often deleted in neoplasia. PCR fragments are detected using specialized equipment and extra steps, including probe hybridization or primer extension. In published papers, analytical sensitivity is typically compared with a different protocol on the same sample set. A single-tube multiplex PCR containing type-specific primers was developed to target the E6/E7 genes of two low-risk and 19 high-risk genotypes (HPV6, 11 and 16, 18, 26, 31, 33, 35, 39, 45, 51, 52, 53, 56, 58, 59, 66, 68, 70, 73 and 82 and the resulting short fragments were directly genotyped by high-resolution fluorescence capillary electrophoresis. Results The method was validated using long oligonucleotide templates, plasmid clones and 207 clinical samples of DNA from liquid-based cytology, fresh and formalin-fixed specimens and FTA Microcards® imprinted with cut tumor surfaces, swabbed cervical cancers or ejected aspirates from nodal metastases of head and neck carcinomas. Between one and five long oligonucleotide targets per sample were detected without false calls. Each of the 21 genotypes was detected in the clinical sample set with up to five types simultaneously detected in individual specimens. All 101 significant cervical neoplasias (CIN 2 and above, except one adenocarcinoma, contained E6/E7 genes. The resulting genotype distribution accorded with the national pattern with HPV16 and 18 accounting for 69% of tumors. Rare HPV types 70 and 73 were present as the sole genotype in one carcinoma each. One cervical SCC contained DNA from HPV6 and 11 only. Six of twelve oropharyngeal cancer metastases and three neck metastases of unknown origin bore E6/E7 DNA; all but one were HPV16. One neck

  19. A DNA based method to detect the grapevine root-rotting fungus Roesleria subterranea in soil and root samples

    Directory of Open Access Journals (Sweden)

    S. Neuhauser

    2009-05-01

    Full Text Available Roesleria subterranea causes root rot in grapevine and fruit trees. The fungus has long been underestimated as a weak parasite, but during the last years it has been reported to cause severe damages in German vineyards. Direct, observation-based detection of the parasite is time consuming and destructive, as large parts of the rootstocks have to be uprooted and screened for the tiny, stipitate, hypogeous ascomata of R. subterranea. To facilitate rapid detection in vineyards, protocols to extract DNA from soil samples and grapevine roots, and R.-subterranea-specific PCR primers were designed. Twelve DNA-extraction protocols for soil samples were tested in small-scale experiments, and selected parameters were optimised. A protocol based on ball-mill homogenization, DNA extraction with SDS, skim milk, chloroform, and isopropanol, and subsequent purifi cation of the raw extracts with PVPP-spin-columns was most effective. This DNA extraction protocol was found to be suitable for a wide range of soil-types including clay, loam and humic-rich soils. For DNA extraction from grapevine roots a CTAB-based protocol was more reliable for various grapevine rootstock varieties. Roesleria-subterranea-specific primers for the ITS1-5.8S-ITS2 rDNA region were developed and tested for their specifi city to DNA extracts from eleven R. subterranea strains isolated from grapevine and fruit trees. No cross reactions were detected with DNA extracts from 44 different species of fungi isolated from vineyard soils. The sensitivity of the species-specifi c primers in combination with the DNA extraction method for soil was high: as little as 100 fg μl-1 R.-subterranea-DNA was suffi cient for a detection in soil samples and plant material. Given that specifi c primers are available, the presented method will also allow quick and large-scale testing for other root pathogens.

  20. Biomolecular and Structural Analyses of Cauliflower-like DNAs by Ultraviolet, Circular Dichroism, and Fluorescence Spectroscopies in Comparison with Natural DNA

    OpenAIRE

    Gill, Pooria; Ranjbar, Bijan; Saber, Reza; Khajeh, Khosro; Mohammadian, Mehdi

    2011-01-01

    Cauliflower-like DNAs are stem-loop DNAs that are fabricated periodically in inverted repetitions from deoxyribonucleic acid phosphates (dNTPs) by loop-mediated isothermal amplification (LAMP). Cauliflower-like DNAs have ladder-shape behaviors on gel electrophoresis, and increasing the time of LAMP leads to multiplying the repetitions, stem-loops, and electrophoretic bands. Cauliflower-like DNAs were fabricated via LAMP using two loop primers, two bumper primers, dNTPs, a λ-phage DNA template...

  1. Comparison of Ribotyping, Randomly Amplified Polymorphic DNA Analysis, and Pulsed-Field Gel Electrophoresis in Typing of Lactobacillus rhamnosus and L. casei Strains

    OpenAIRE

    Tynkkynen, Soile; Satokari, Reetta; Saarela, Maria; Mattila-Sandholm, Tiina; Saxelin, Maija

    1999-01-01

    A total of 24 strains, biochemically identified as members of the Lactobacillus casei group, were identified by PCR with species-specific primers. The same set of strains was typed by randomly amplified polymorphic DNA (RAPD) analysis, ribotyping, and pulsed-field gel electrophoresis (PFGE) in order to compare the discriminatory power of the methods. Species-specific primers for L. rhamnosus and L. casei identified the type strain L. rhamnosus ATCC 7469 and the neotype strain L. casei ATCC 33...

  2. DNA and bone structure preservation in medieval human skeletons.

    Science.gov (United States)

    Coulson-Thomas, Yvette M; Norton, Andrew L; Coulson-Thomas, Vivien J; Florencio-Silva, Rinaldo; Ali, Nadir; Elmrghni, Samir; Gil, Cristiane D; Sasso, Gisela R S; Dixon, Ronald A; Nader, Helena B

    2015-06-01

    Morphological and ultrastructural data from archaeological human bones are scarce, particularly data that have been correlated with information on the preservation of molecules such as DNA. Here we examine the bone structure of macroscopically well-preserved medieval human skeletons by transmission electron microscopy and immunohistochemistry, and the quantity and quality of DNA extracted from these skeletons. DNA technology has been increasingly used for analyzing physical evidence in archaeological forensics; however, the isolation of ancient DNA is difficult since it is highly degraded, extraction yields are low and the co-extraction of PCR inhibitors is a problem. We adapted and optimised a method that is frequently used for isolating DNA from modern samples, Chelex(®) 100 (Bio-Rad) extraction, for isolating DNA from archaeological human bones and teeth. The isolated DNA was analysed by real-time PCR using primers targeting the sex determining region on the Y chromosome (SRY) and STR typing using the AmpFlSTR(®) Identifiler PCR Amplification kit. Our results clearly show the preservation of bone matrix in medieval bones and the presence of intact osteocytes with well preserved encapsulated nuclei. In addition, we show how effective Chelex(®) 100 is for isolating ancient DNA from archaeological bones and teeth. This optimised method is suitable for STR typing using kits aimed specifically at degraded and difficult DNA templates since amplicons of up to 250bp were successfully amplified. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  3. Investigating the potential use of environmental DNA (eDNA for genetic monitoring of marine mammals.

    Directory of Open Access Journals (Sweden)

    Andrew D Foote

    Full Text Available The exploitation of non-invasive samples has been widely used in genetic monitoring of terrestrial species. In aquatic ecosystems, non-invasive samples such as feces, shed hair or skin, are less accessible. However, the use of environmental DNA (eDNA has recently been shown to be an effective tool for genetic monitoring of species presence in freshwater ecosystems. Detecting species in the marine environment using eDNA potentially offers a greater challenge due to the greater dilution, amount of mixing and salinity compared with most freshwater ecosystems. To determine the potential use of eDNA for genetic monitoring we used specific primers that amplify short mitochondrial DNA sequences to detect the presence of a marine mammal, the harbor porpoise, Phocoena phocoena, in a controlled environment and in natural marine locations. The reliability of the genetic detections was investigated by comparing with detections of harbor porpoise echolocation clicks by static acoustic monitoring devices. While we were able to consistently genetically detect the target species under controlled conditions, the results from natural locations were less consistent and detection by eDNA was less successful than acoustic detections. However, at one site we detected long-finned pilot whale, Globicephala melas, a species rarely sighted in the Baltic. Therefore, with optimization aimed towards processing larger volumes of seawater this method has the potential to compliment current visual and acoustic methods of species detection of marine mammals.

  4. Computational intelligence-based polymerase chain reaction primer selection based on a novel teaching-learning-based optimisation.

    Science.gov (United States)

    Cheng, Yu-Huei

    2014-12-01

    Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.

  5. An Introduction to Programming for Bioscientists: A Python-Based Primer.

    Directory of Open Access Journals (Sweden)

    Berk Ekmekci

    2016-06-01

    Full Text Available Computing has revolutionized the biological sciences over the past several decades, such that virtually all contemporary research in molecular biology, biochemistry, and other biosciences utilizes computer programs. The computational advances have come on many fronts, spurred by fundamental developments in hardware, software, and algorithms. These advances have influenced, and even engendered, a phenomenal array of bioscience fields, including molecular evolution and bioinformatics; genome-, proteome-, transcriptome- and metabolome-wide experimental studies; structural genomics; and atomistic simulations of cellular-scale molecular assemblies as large as ribosomes and intact viruses. In short, much of post-genomic biology is increasingly becoming a form of computational biology. The ability to design and write computer programs is among the most indispensable skills that a modern researcher can cultivate. Python has become a popular programming language in the biosciences, largely because (i its straightforward semantics and clean syntax make it a readily accessible first language; (ii it is expressive and well-suited to object-oriented programming, as well as other modern paradigms; and (iii the many available libraries and third-party toolkits extend the functionality of the core language into virtually every biological domain (sequence and structure analyses, phylogenomics, workflow management systems, etc.. This primer offers a basic introduction to coding, via Python, and it includes concrete examples and exercises to illustrate the language's usage and capabilities; the main text culminates with a final project in structural bioinformatics. A suite of Supplemental Chapters is also provided. Starting with basic concepts, such as that of a "variable," the Chapters methodically advance the reader to the point of writing a graphical user interface to compute the Hamming distance between two DNA sequences.

  6. An Introduction to Programming for Bioscientists: A Python-Based Primer.

    Science.gov (United States)

    Ekmekci, Berk; McAnany, Charles E; Mura, Cameron

    2016-06-01

    Computing has revolutionized the biological sciences over the past several decades, such that virtually all contemporary research in molecular biology, biochemistry, and other biosciences utilizes computer programs. The computational advances have come on many fronts, spurred by fundamental developments in hardware, software, and algorithms. These advances have influenced, and even engendered, a phenomenal array of bioscience fields, including molecular evolution and bioinformatics; genome-, proteome-, transcriptome- and metabolome-wide experimental studies; structural genomics; and atomistic simulations of cellular-scale molecular assemblies as large as ribosomes and intact viruses. In short, much of post-genomic biology is increasingly becoming a form of computational biology. The ability to design and write computer programs is among the most indispensable skills that a modern researcher can cultivate. Python has become a popular programming language in the biosciences, largely because (i) its straightforward semantics and clean syntax make it a readily accessible first language; (ii) it is expressive and well-suited to object-oriented programming, as well as other modern paradigms; and (iii) the many available libraries and third-party toolkits extend the functionality of the core language into virtually every biological domain (sequence and structure analyses, phylogenomics, workflow management systems, etc.). This primer offers a basic introduction to coding, via Python, and it includes concrete examples and exercises to illustrate the language's usage and capabilities; the main text culminates with a final project in structural bioinformatics. A suite of Supplemental Chapters is also provided. Starting with basic concepts, such as that of a "variable," the Chapters methodically advance the reader to the point of writing a graphical user interface to compute the Hamming distance between two DNA sequences.

  7. DNA repair

    International Nuclear Information System (INIS)

    Setlow, R.

    1978-01-01

    Some topics discussed are as follows: difficulty in extrapolating data from E. coli to mammalian systems; mutations caused by UV-induced changes in DNA; mutants deficient in excision repair; other postreplication mechanisms; kinds of excision repair systems; detection of repair by biochemical or biophysical means; human mutants deficient in repair; mutagenic effects of UV on XP cells; and detection of UV-repair defects among XP individuals

  8. Collider physics within the standard model a primer

    CERN Document Server

    Altarelli, Guido

    2017-01-01

    With this graduate-level primer, the principles of the standard model of particle physics receive a particular skillful, personal and enduring exposition by one of the great contributors to the field. In 2013 the late Prof. Altarelli wrote: The discovery of the Higgs boson and the non-observation of new particles or exotic phenomena have made a big step towards completing the experimental confirmation of the standard model of fundamental particle interactions. It is thus a good moment for me to collect, update and improve my graduate lecture notes on quantum chromodynamics and the theory of electroweak interactions, with main focus on collider physics. I hope that these lectures can provide an introduction to the subject for the interested reader, assumed to be already familiar with quantum field theory and some basic facts in elementary particle physics as taught in undergraduate courses. “These lecture notes are a beautiful example of Guido’s unique pedagogical abilities and scientific vision”. From...

  9. Neurociencia y bilingüismo: efecto del primer idioma

    Directory of Open Access Journals (Sweden)

    Germary Díaz-Sánchez

    2013-08-01

    Full Text Available Desde la perspectiva neurobiológica, en este trabajo abordamos los efectos del idioma materno sobre el aprendizaje de una segunda lengua. Aunque existen investigaciones en diferentes países sobre este problema, pocas tratan el enfoque de la neurobiología y, menos aún, cuando se trata del español como idioma materno. Para la investigación se recopiló literatura descriptiva y experimental, con el fin de obtener los datos necesarios para alcanzar los objetivos; se realizó un metaanálisis cualitativo de los datos obtenidos, utilizando tablas de correlación. Los datos reflejaron que la adquisición de un segundo idioma siempre va a estar mediatizada por los esquemas ya establecidos del primer idioma y que existen aspectos neurobiológicos que subyacen a algunos mecanismos de interferencia y a la adquisición de un segundo lenguaje. Además, encontramos que, mientras más similares sean los idiomas, los mecanismos neurales subyacentes facilitan la transferencia del uno al otro.

  10. Esteatosis en un burro (Equus asinus. Primer reporte en Colombia

    Directory of Open Access Journals (Sweden)

    José Cardona Á.

    2011-12-01

    Full Text Available Se describe un caso de esteatosis en un burro (Equus asinus, castrado, de 15 años de edad, procedente del municipio de San Antero (Córdoba, Colombia, al cual se le detectó ligamento nucal engrosado, duro y doloroso, dando la impresión de un doble cuello y edemas subcutáneos indurados en pared costal, abdominal y pectoral. Tambiénpresentó masas duras en la unión de músculos semimembranoso y semitendinoso. Por todo lo anterior, mostró dificultad para realizar movimientos coordinados del cuello, nuca y de traslado. Estos hallazgos obedecen principalmente a una deficiencia de selenio y vitamina E, sirviendo como parámetro diagnóstico para la identificación de esta enfermedad en equinos, por lo cual se determinó la actividad eritrocitica de la enzima glutatión peroxidada (GSH-Px, arrojando resultados muy bajos. Este cuadro es también conocido en equinos como enfermedad de la grasa amarilla o esteatitis, que produce degeneración del tejido adiposo, siendo reemplazado por tejido conectivo con depósitos de calcio. Puede estar asociada a miodegeneración nutricional o distrófica (enfermedad del músculo blanco. Es el primer reporte de esta enfermedad en burros(Equus asinus que se hace en Colombia.

  11. Primer reporte de alcaptonuria en el Perú

    Directory of Open Access Journals (Sweden)

    Daniel Guillén-Mendoza

    Full Text Available La alcaptonuria es un error innato del metabolismo causado por la deficiencia de la homogentisiato 1,2 dioxidasa (HGD, produciéndose un exceso de ácido homogentísico (HGA. Se presenta el caso de una mujer de 57 años quien, desde que nació, su orina se tornaba de color negro; desde hacía 9 años presentaba una pigmentación verdosa en los lechos ungueales que no mejoró con tratamientos antifúngicos y en los últimos 9 meses presentó artrosis de articulaciones grandes que fue empeorando, forzándola a usar una silla de ruedas por el intenso dolor generado por la artrosis de caderas y columna lumbar. Por la descripción de los síntomas se le solicitó la medición de HGA en orina lo que confirmó el diagnóstico de alcaptonuria. Se sugirieron analgésicos, dieta sin productos que contuvieran tirosina y fue referida para cirugía de reemplazo de cadera. Se trata del primer reporte de caso de alcaptonuria en el Perú.

  12. Genetic analysis of presbycusis by arrayed primer extension.

    Science.gov (United States)

    Rodriguez-Paris, Juan; Ballay, Charles; Inserra, Michelle; Stidham, Katrina; Colen, Tahl; Roberson, Joseph; Gardner, Phyllis; Schrijver, Iris

    2008-01-01

    Using the Hereditary Hearing Loss arrayed primer extension (APEX) array, which contains 198 mutations across 8 hearing loss-associated genes (GJB2, GJB6, GJB3, GJA1, SLC26A4, SLC26A5, 12S-rRNA, and tRNA Ser), we compared the frequency of sequence variants in 94 individuals with early presbycusis to 50 unaffected controls and aimed to identify possible genetic contributors. This cross-sectional study was performed at Stanford University with presbycusis samples from the California Ear Institute. The patients were between ages 20 and 65 yr, with adult-onset sensorineural hearing loss of unknown etiology, and carried a clinical diagnosis of early presbycusis. Exclusion criteria comprised known causes of hearing loss such as significant noise exposure, trauma, ototoxic medication, neoplasm, and congenital infection or syndrome, as well as congenital or pediatric onset. Sequence changes were identified in 11.7% and 10% of presbycusis and control alleles, respectively. Among the presbycusis group, these solely occurred within the GJB2 and SLC26A4 genes. Homozygous and compound heterozygous pathogenic mutations were exclusively seen in affected individuals. We were unable to detect a statistically significant difference between our control and affected populations regarding the frequency of sequence variants detected with the APEX array. Individuals who carry two mild mutations in the GJB2 gene possibly have an increased risk of developing early presbycusis.

  13. The corrosion mechanisms for primer coated 2219-T87 aluminum

    Science.gov (United States)

    Danford, Merlin D.; Knockemus, Ward W.

    1987-01-01

    To investigate metal surface corrosion and the breakdown of metal protective coatings, the ac Impedance Method was applied to zinc chromate primer coated 2219-T87 aluminum. The EG&GPARC Model 368 ac Impedance Measurement System, along with dc measurements with the same system using the Polarization Resistance Method, was used to monitor changing properties of coated aluminum disks immersed in 3.5 percent NaCl solutions buffered at pH 5.5 and pH 8.2 over periods of 40 days each. The corrosion system can be represented by an electronic analog called an equivalent circuit consisting of resistors and capacitors in specific arrangements. This equivalent circuit parallels the impedance behavior of the corrosion system during a frequency scan. Values for resistances and capacitances, that can be assigned in the equivalent circuit following a least squares analysis of the data, describe changes occurring on the corroding metal surface and in the protective coatings. A suitable equivalent circuit has been determined which predicts the correct Bode phase and magnitude for the experimental sample. The dc corrosion current density data are related to equivalent circuit element parameters.

  14. A primer on on-demand polymerase chain reaction technology.

    Science.gov (United States)

    Spencer, Maureen; Barnes, Sue; Parada, Jorge; Brown, Scott; Perri, Luci; Uettwiller-Geiger, Denise; Johnson, Helen Boehm; Graham, Denise

    2015-10-01

    Efforts to reduce health care-associated infections (HAIs) have grown in both scale and sophistication over the past few decades; however, the increasing threat of antimicrobial resistance and the impact of new legislation regarding HAIs on health care economics make the fight against them all the more urgent. On-demand polymerase chain reaction (PCR) technology has proven to be a highly effective weapon in this fight, offering the ability to accurately and efficiently identify disease-causing pathogens such that targeted and directed therapy can be initiated at the point of care. As a result, on-demand PCR technology has far-reaching influences on HAI rates, health care outcomes, hospital length of stay, isolation days, patient satisfaction, antibiotic stewardship, and health care economics. The basics of on-demand PCR technology and its potential to impact health care have not been widely incorporated into health care education and enrichment programs for many of those involved in infection control and prevention, however. This article serves as a primer on on-demand PCR technology and its ramifications. Copyright © 2015 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

  15. ITS1: a DNA barcode better than ITS2 in eukaryotes?

    Science.gov (United States)

    Wang, Xin-Cun; Liu, Chang; Huang, Liang; Bengtsson-Palme, Johan; Chen, Haimei; Zhang, Jian-Hui; Cai, Dayong; Li, Jian-Qin

    2015-05-01

    A DNA barcode is a short piece of DNA sequence used for species determination and discovery. The internal transcribed spacer (ITS/ITS2) region has been proposed as the standard DNA barcode for fungi and seed plants and has been widely used in DNA barcoding analyses for other biological groups, for example algae, protists and animals. The ITS region consists of both ITS1 and ITS2 regions. Here, a large-scale meta-analysis was carried out to compare ITS1 and ITS2 from three aspects: PCR amplification, DNA sequencing and species discrimination, in terms of the presence of DNA barcoding gaps, species discrimination efficiency, sequence length distribution, GC content distribution and primer universality. In total, 85 345 sequence pairs in 10 major groups of eukaryotes, including ascomycetes, basidiomycetes, liverworts, mosses, ferns, gymnosperms, monocotyledons, eudicotyledons, insects and fishes, covering 611 families, 3694 genera, and 19 060 species, were analysed. Using similarity-based methods, we calculated species discrimination efficiencies for ITS1 and ITS2 in all major groups, families and genera. Using Fisher's exact test, we found that ITS1 has significantly higher efficiencies than ITS2 in 17 of the 47 families and 20 of the 49 genera, which are sample-rich. By in silico PCR amplification evaluation, primer universality of the extensively applied ITS1 primers was found superior to that of ITS2 primers. Additionally, shorter length of amplification product and lower GC content was discovered to be two other advantages of ITS1 for sequencing. In summary, ITS1 represents a better DNA barcode than ITS2 for eukaryotic species. © 2014 John Wiley & Sons Ltd.

  16. Effects of coordination of diammineplatinum(II) with DNA on the activities of Escherichia coli DNA polymerase I

    International Nuclear Information System (INIS)

    Bernges, F.; Holler, E.

    1988-01-01

    The effects of the reaction of cis- and trans-diamminedichloroplatinum(II) with DNA have been measured with regard to DNA synthesis, 3'-5' exonuclease (proofreading), and 5'-3' exonuclease (repair) activities of Escherichia coli DNA polymerase I. Both isomers inhibit DNA synthetic activity of the polymerase through an increase in K/sub m/ values and a decrease in V/sub max/ values for platinated DNA but not for the nucleoside 5'-triphosphates as the varied substrates. The inhibition is a consequence of lowered binding affinity between platinated DNA and DNA polymerase, and of a platination-induced separation of template and primer strands. Strand separation enhances initial rates of 3'-5' excision of [ 3 H]dCMP from platinated DNA (proofreading), while total excision levels of nucleotides are decreased. In contrast to proofreading activity, the 5'-3' exonuclease activity (repair) discriminates between DNA which had reacted with cis- and with trans-diamminedichloroplatinum(II). While both initial rates and total excision are inhibited for the cis isomer, they are almost not affected for the trans isomer. This differential effect could explain why bacterial growth inhibition requires much higher concentrations of trans- than cis-diamminedichloroplatinum(II)

  17. Profitability primer: a guide to profitability analysis in the electric power industry

    International Nuclear Information System (INIS)

    Woo, C.K.; Lloyd-Zannetti, D.; Martin, J.; Price, S.

    1996-06-01

    As the electric power industry is opened to forces of competition, increased attention must be focused to develop products and services that deliver good value to customers and to identify customer segments that are profitable to serve. This primer introduces the concept of profitability analysis and its application to the electric power industry. The primer recognizes that some segments of the business will remain monopolistic and subject to regulations, while other segments will become competitive. The primer also recognizes that customer profitability is critically dependent on a host of related issues such as how internal costs are allocated to various functions and how revenues are collected and allocated

  18. THE QUALITY IMPROVEMENT OF PRIMER PACKAGING PROCESS USING SIX SIGMA METHODOLOGY

    Directory of Open Access Journals (Sweden)

    Prima Ditahardiyani

    2008-01-01

    Full Text Available The implementation of Six Sigma has become a common theme in many organizations. This paper presents the Six Sigma methodology and its implementation in a primer packaging process of Cranberry drink. DMAIC (Define, Measure, Analyze, Improve and Control approach is used to analyze and to improve the primer packaging process, which have high variability and defects output. After the improvement, the results showed that there was an increasing sigma level. However, it is not significantly and has not achieved the world standard quality, yet. Therefore, the implementation of Six Sigma in primer packaging process of Cranberry drink still has a room for doing a further research.

  19. Molecular passportization of clones of karelian birch using PCRwith semi-specific primers

    Directory of Open Access Journals (Sweden)

    Tatyana V Matveeva

    2008-09-01

    Full Text Available Using 4 clones of Karelian birch (Betula pendula Roth var caretica Merckl. from the collection of the karelian birch of the laboratory of genetics of Research Institute of Forest Genetics and Breeding, Voronezh, one normal tree of Betula pendula Roth, and one tree of B. pubescens Ehrh., collected from the nature, we have analyzed the possibility of application of PCR with semi-specific primers for molecular typing. We found primers with high percentage of polymorphic markers. These primers could be recommended for molecular typing of birch.

  20. Do we need primer for orthodontic bonding? A randomized controlled trial.

    Science.gov (United States)

    Nandhra, Sarabjit Singh; Littlewood, Simon J; Houghton, Nadine; Luther, Friedy; Prabhu, Jagadish; Munyombwe, Theresa; Wood, Simon R

    2015-04-01

    To evaluate the clinical performance of APC™II Victory Series™ (3M Unitek) brackets in direct orthodontic bonding with and without the use of primer. A single-operator, two-centre prospective, non-inferiority randomized controlled clinical trial. The Orthodontic departments at the Leeds Dental Institute and St Luke's Hospital, Bradford, UK. Ethical approval was granted by Leeds (East) Research Ethics Committee on 18th of December 2009 (Reference 09/H1306/102). The protocol was not published prior to trial commencement. Ninety-two patients requiring orthodontic treatment with fixed appliances were randomly allocated to the control (bonded with primer) or test groups (bonded without primer). Patients were randomly allocated to either the control or experimental group. This was performed by preparing opaque numbered sealed envelopes in advance using a random numbers table generated by a computer by an independent third party . Once the envelopes were opened, blinding of the operator and the patient was no longer possible due to the nature of the intervention. Patients were approached for inclusion in the trial if they qualified for NHS orthodontic treatment requiring fixed appliances and had no previous orthodontic treatment. Number of bracket failures, time to bond-up appliances, and the adhesive remnant index (ARI) when bracket failure occurred, over a 12-month period Failure rate with primer was 11.1 per cent and without primer was 15.8 per cent. Bonding without primer was shown statistically to be non-inferior to bonding with primer odds ratio 0.95-2.25 (P = 0.08). Mean difference in bond-up time per bracket was 0.068 minutes (4 seconds), which was not statistically significant (P = 0.402). There was a statistically significant difference in the Adhesive Remnant Index - ARI 0 with primer 49.4 per cent, no primer 76.5 per cent, (P failure rate of 2% to be clinically significant. When bonding with APC™II Victory Series™ brackets without primer was shown

  1. A Primer on Electric Utilities, Deregulation, and Restructuring of U.S. Electricity Markets

    Energy Technology Data Exchange (ETDEWEB)

    Warwick, William M.

    2002-06-03

    This primer is offered as an introduction to utility restructuring to better prepare readers for ongoing changes in public utilities and associated energy markets. It is written for use by individuals with responsibility for the management of facilities that use energy, including energy managers, procurement staff, and managers with responsibility for facility operations and budgets. The primer was prepared by the Pacific Northwest National Laboratory under sponsorship from the U.S. Department of Energy?s Federal Energy Management Program. The impetus for this primer originally came from the Government Services Administration who supported its initial development.

  2. Primer-dependent and primer-independent initiation of double stranded RNA synthesis by purified arabidopsis RNA-dependent RNA polymerases RDR2 and RDR6

    DEFF Research Database (Denmark)

    Devert, Anthony; Fabre, Nicolas; Floris, Maina Huguette Joséphine

    2015-01-01

    ) targeted by RNA silencing. The dsRNA is subsequently cleaved by the ribonuclease DICER-like into secondary small interfering RNAs (siRNAs) that reinforce and/or maintain the silenced state of the target RNA. Models of RNA silencing propose that RDRs could use primer-independent and primer......Cellular RNA-dependent RNA polymerases (RDRs) are fundamental components of RNA silencing in plants and many other eukaryotes. In Arabidopsis thaliana genetic studies have demonstrated that RDR2 and RDR6 are involved in the synthesis of double stranded RNA (dsRNA) from single stranded RNA (ssRNA......-dependent initiation to generate dsRNA from a transcript targeted by primary siRNA or microRNA (miRNA). However, the biochemical activities of RDR proteins are still partly understood. Here, we obtained active recombinant RDR2 and RDR6 in a purified form. We demonstrate that RDR2 and RDR6 have primer...

  3. Programa de acompañamiento para estudiantes de primer ingreso : Marco de referencia y propuesta de trabajo para primer semestre de 2002

    OpenAIRE

    Chinchilla-Brenes, Sonia; Sánchez-Oller, Sylvia

    2001-01-01

    Proyecto de Investigación El problema de la deserción estudiantil es un fenómeno mundial que involucra principalmente a alumnos de primer ingreso a los centros educativos y de manera particular a las instituciones de educación superior las cuales reportan índices de deserción de alrededor del 30% en el primer año. Ante esta situación se hace necesaria la atención de la población de primer ingreso con programas específicos que acompañen a los y las estudiantes en este proceso de ajuste al m...

  4. Reading Mammal Diversity from Flies: The Persistence Period of Amplifiable Mammal mtDNA in Blowfly Guts (Chrysomya megacephala) and a New DNA Mini-Barcode Target.

    Science.gov (United States)

    Lee, Ping-Shin; Sing, Kong-Wah; Wilson, John-James

    2015-01-01

    Most tropical mammal species are threatened or data-deficient. Data collection is impeded by the traditional monitoring approaches which can be laborious, expensive and struggle to detect cryptic diversity. Monitoring approaches using mammal DNA derived from invertebrates are emerging as cost- and time-effective alternatives. As a step towards development of blowfly-derived DNA as an effective method for mammal monitoring in the biodiversity hotspot of Peninsular Malaysia, our objectives were (i) to determine the persistence period of amplifiable mammal mtDNA in blowfly guts through a laboratory feeding experiment (ii) to design and test primers that can selectively amplify mammal COI DNA mini-barcodes in the presence of high concentrations of blowfly DNA. The persistence period of amplifiable mammal mtDNA in blowfly guts was 24 h to 96 h post-feeding indicating the need for collecting flies within 24 h of capture to detect mammal mtDNA of sufficient quantity and quality. We designed a new primer combination for a COI DNA mini-barcode that did not amplify blowfly DNA and showed 89% amplification success for a dataset of mammals from Peninsular Malaysia. The short (205 bp) DNA mini-barcode could distinguish most mammal species (including separating dark taxa) and is of suitable length for high-throughput sequencing. Our new DNA mini-barcode target and a standardized trapping protocol with retrieval of blowflies every 24 h could point the way forward in the development of blowfly-derived DNA as an effective method for mammal monitoring.

  5. Reading Mammal Diversity from Flies: The Persistence Period of Amplifiable Mammal mtDNA in Blowfly Guts (Chrysomya megacephala) and a New DNA Mini-Barcode Target

    Science.gov (United States)

    Lee, Ping-Shin; Sing, Kong-Wah; Wilson, John-James

    2015-01-01

    Most tropical mammal species are threatened or data-deficient. Data collection is impeded by the traditional monitoring approaches which can be laborious, expensive and struggle to detect cryptic diversity. Monitoring approaches using mammal DNA derived from invertebrates are emerging as cost- and time-effective alternatives. As a step towards development of blowfly-derived DNA as an effective method for mammal monitoring in the biodiversity hotspot of Peninsular Malaysia, our objectives were (i) to determine the persistence period of amplifiable mammal mtDNA in blowfly guts through a laboratory feeding experiment (ii) to design and test primers that can selectively amplify mammal COI DNA mini-barcodes in the presence of high concentrations of blowfly DNA. The persistence period of amplifiable mammal mtDNA in blowfly guts was 24 h to 96 h post-feeding indicating the need for collecting flies within 24 h of capture to detect mammal mtDNA of sufficient quantity and quality. We designed a new primer combination for a COI DNA mini-barcode that did not amplify blowfly DNA and showed 89% amplification success for a dataset of mammals from Peninsular Malaysia. The short (205 bp) DNA mini-barcode could distinguish most mammal species (including separating dark taxa) and is of suitable length for high-throughput sequencing. Our new DNA mini-barcode target and a standardized trapping protocol with retrieval of blowflies every 24 h could point the way forward in the development of blowfly-derived DNA as an effective method for mammal monitoring. PMID:25898278

  6. Reading Mammal Diversity from Flies: The Persistence Period of Amplifiable Mammal mtDNA in Blowfly Guts (Chrysomya megacephala and a New DNA Mini-Barcode Target.

    Directory of Open Access Journals (Sweden)

    Ping-Shin Lee

    Full Text Available Most tropical mammal species are threatened or data-deficient. Data collection is impeded by the traditional monitoring approaches which can be laborious, expensive and struggle to detect cryptic diversity. Monitoring approaches using mammal DNA derived from invertebrates are emerging as cost- and time-effective alternatives. As a step towards development of blowfly-derived DNA as an effective method for mammal monitoring in the biodiversity hotspot of Peninsular Malaysia, our objectives were (i to determine the persistence period of amplifiable mammal mtDNA in blowfly guts through a laboratory feeding experiment (ii to design and test primers that can selectively amplify mammal COI DNA mini-barcodes in the presence of high concentrations of blowfly DNA. The persistence period of amplifiable mammal mtDNA in blowfly guts was 24 h to 96 h post-feeding indicating the need for collecting flies within 24 h of capture to detect mammal mtDNA of sufficient quantity and quality. We designed a new primer combination for a COI DNA mini-barcode that did not amplify blowfly DNA and showed 89% amplification success for a dataset of mammals from Peninsular Malaysia. The short (205 bp DNA mini-barcode could distinguish most mammal species (including separating dark taxa and is of suitable length for high-throughput sequencing. Our new DNA mini-barcode target and a standardized trapping protocol with retrieval of blowflies every 24 h could point the way forward in the development of blowfly-derived DNA as an effective method for mammal monitoring.

  7. Cascade DNA nanomachine and exponential amplification biosensing.

    Science.gov (United States)

    Xu, Jianguo; Wu, Zai-Sheng; Shen, Weiyu; Xu, Huo; Li, Hongling; Jia, Lee

    2015-11-15

    DNA is a versatile scaffold for the assembly of multifunctional nanostructures, and potential applications of various DNA nanodevices have been recently demonstrated for disease diagnosis and treatment. In the current study, a powerful cascade DNA nanomachine was developed that can execute the exponential amplification of p53 tumor suppressor gene. During the operation of the newly-proposed DNA nanomachine, dual-cyclical nucleic acid strand-displacement polymerization (dual-CNDP) was ingeniously introduced, where the target trigger is repeatedly used as the fuel molecule and the nicked fragments are dramatically accumulated. Moreover, each displaced nicked fragment is able to activate the another type of cyclical strand-displacement amplification, increasing exponentially the value of fluorescence intensity. Essentially, one target binding event can induce considerable number of subsequent reactions, and the nanodevice was called cascade DNA nanomachine. It can implement several functions, including recognition element, signaling probe, polymerization primer and template. Using the developed autonomous operation of DNA nanomachine, the p53 gene can be quantified in the wide concentration range from 0.05 to 150 nM with the detection limit of 50 pM. If taking into account the final volume of mixture, the detection limit is calculated as lower as 6.2 pM, achieving an desirable assay ability. More strikingly, the mutant gene can be easily distinguished from the wild-type one. The proof-of-concept demonstrations reported herein is expected to promote the development and application of DNA nanomachine, showing great potential value in basic biology and medical diagnosis. Copyright © 2015 Elsevier B.V. All rights reserved.

  8. Epigenetics primer: why the clinician should care about epigenetics.

    Science.gov (United States)

    Duarte, Julio D

    2013-12-01

    Epigenetics describes heritable alterations of gene expression that do not involve DNA sequence variation and are changeable throughout an organism's lifetime. Not only can epigenetic status influence drug response, but it can also be modulated by drugs. In this review, the three major epigenetic mechanisms are described: covalent DNA modification, histone protein modification, and regulation by noncoding RNA. Further, this review describes how drug therapy can influence, and be influenced by, these mechanisms. Drugs with epigenetic mechanisms are already in use, with many more likely to be approved within the next few years. As the understanding of epigenetic processes improves, so will the ability to use these data in the clinic to improve patient care. © 2013 Pharmacotherapy Publications, Inc.

  9. Expression of human DNA polymerase β in Escherichia coli and characterization of the recombinant enzyme

    International Nuclear Information System (INIS)

    Abbotts, J.; SenGupta, D.N.; Zmudzka, B.; Widen, S.G.; Notario, V.; Wilson, S.H.

    1988-01-01

    The coding region of a human β-polymerase cDNA, predicting a 335 amino acid protein, was subcloned in the Escherichia coli expression plasmid pRC23. After induction of transformed cells, the crude soluble extract was found to contain a new protein immunoreactive with β-polymerase antibody and corresponding in size to the protein deduced from the cDNA. This protein was purified in a yield of 1-2 mg/50 g of cells. The recombinant protein had about the same DNA polymerase specific activity as β-polymerase purified from mammalian tissues, and template-primer specificity and immunological properties of the recombinant polymerase were similar to those of natural β-polymerases. The purified enzyme was free of nuclease activity. The authors studied detailed catalytic properties of the recombinant β-polymerase using defined template-primer systems. The results indicate that this β-polymerase is essentially identical with natural β-polymerases. The recombinant enzyme is distributive in mode of synthesis and is capable of detecting changes in the integrity of the single-stranded template, such as methylated bases and a double-stranded region. The enzyme recognizes a template region four to seven bases downstream of the primer 3' end and utilizes alternative primers if this downstream template region is double stranded. The enzyme is unable to synthesize past methylated bases N 3 -methyl-dT or O 6 -methyl-dG

  10. In situ PCR detection of phytoplasma DNA in embryos from coconut palms with lethal yellowing disease.

    Science.gov (United States)

    Cordova, Ivan; Jones, Phil; Harrison, Nigel A; Oropeza, Carlos

    2003-03-01

    SUMMARY DNA of the lethal yellowing (LY) phytoplasma was detected in 13 of 72 embryos from fruits of four diseased Atlantic tall coconut palms by polymerase chain reaction (PCR) assays employing phytoplasma universal rRNA primer pair P1/P7, nested LY group-specific rRNA primer pair 503f/LY16Sr or LY phytoplasma-specific nonribosomal primer pair LYF1/R1. Phytoplasma distribution in sectioned tissues from six PCR positive embryos was determined by in situ PCR and digoxigenin-11-deoxy-UTP (Dig) labelling of amplification products. Dig-labeled DNA products detected by colourimetric assay were clearly evident on sections from the same three embryos investigated in detail by in situ PCRs employing primer pairs P1/P7 or LYF1/R1. Deposition of blue-green stain on sections as a result of each assay was restricted to areas of the embryos corresponding to the plumule and cells ensheathing it. By comparison, similarly treated embryo sections derived from fruits of a symptomless Atlantic tall coconut palm were consistently devoid of any stain. Presence of phytoplasma DNA in embryo tissues suggests the possible potential for seed transmission which remains to be demonstrated.

  11. Improved Method for Direct Detection of Environmental Microorganisms Using an Amplification of 16S rDNA Region

    Science.gov (United States)

    Tsujimura, M.; Akutsu, J.; Zhang, Z.; Sasaki, M.; Tajima, H.; Kawarabayasi, Y.

    2004-12-01

    The thermostable proteins or enzymes were expected to be capable to be utilized in many areas of industries. Many thermophilic microorganisms, which possess the thermostable proteins or enzymes, were identified from the extreme environment. However, many unidentified and uncultivable microorganisms are still remaining in the environment on the earth. It is generally said that the cultivable microorganisms are less than 1% of entire microorganisms living in the earth, remaining over 99% are still uncultivable. As an approach to the uncultivable microorganisms, the PCR amplification of 16S rDNA region using primer sets designed from the conserved region has been generally utilized for detection and community analysis of microorganism in the environment. However, the facts, that PCR amplification introduces the mutation in the amplified DNA fragment and efficiency of PCR amplification is depend on the sequences of primer sets, indicated that the improving of PCR analysis was necessary for more correct detection of microorganisms. As the result of evaluation for the quality of DNA polymerases, sequences of primers used for amplification and conditions of PCR amplification, the DNA polymerase, the primer set and the conditions for amplification, which did not amplify the DNA fragment from the DNA contaminated within the DNA polymerase itself, were successfully selected. Also the rate of mutation in the DNA fragment amplified was evaluated using this conditions and the genomic DNA from cultivable microbes as a template. The result indicated the rate of mutation introduced by PCR was approximately 0.1% to 0.125%. The improved method using these conditions and error rate calculated was applied for the analysis of microorganisms in the geothermal environment. The result indicated that four kinds of dominant microorganisms, including both of bacteria and archaea, were alive within soil in the hot spring in Tohoku Area. We would like to apply this improved method to detection

  12. Evaluation of different PCR primers for denaturing gradient gel electrophoresis (DGGE) analysis of fungal community structure in traditional fermentation starters used for Hong Qu glutinous rice wine.

    Science.gov (United States)

    Lv, Xu-Cong; Jiang, Ya-Jun; Liu, Jie; Guo, Wei-Ling; Liu, Zhi-Bin; Zhang, Wen; Rao, Ping-Fan; Ni, Li

    2017-08-16

    Denaturing gradient gel electrophoresis (DGGE) has become a widely used tool to examine microbial community structure. However, when DGGE is applied to evaluate the fungal community of traditional fermentation starters, the choice of hypervariable ribosomal RNA gene regions is still controversial. In the current study, several previously published fungal PCR primer sets were compared and evaluated using PCR-DGGE, with the purpose of screening a suitable primer set to study the fungal community of traditional fermentation starters for Hong Qu glutinous rice wine. Firstly, different primer sets were used to amplify different hypervariable regions from pure fungal cultures. Except NS1/FR1+ and ITS1fGC/ITS4, other primer sets (NL1+/LS2R, NL3A/NL4GC, FF390/FR1+, NS1/GCFung, NS3+/YM951r and ITS1fGC/ITS2r) amplified the target DNA sequences successfully. Secondly, the selected primer sets were further evaluated based on their resolution to distinguish different fungal cultures through DGGE fingerprints. Three primer sets (NL1+/LS2R, NS1/GCFung and ITS1fGC/ITS2r) were finally selected for investigating the fungal community structure of different traditional fermentation starters for Hong Qu glutinous rice wine. The internal transcribed spacer (ITS) region amplified by ITS1fGC/ITS2r, which is more hypervariable than the 18S rRNA gene and 26S rRNA gene, provides an excellent tool to separate amplification products of different fungal species. Results indicated that PCR-DGGE profile using ITS1fGC/ITS2r showed more abundant fungal species than that using NL1+/LS2R and NS1/GCFung. Therefore, ITS1fGC/ITS2r is the most suitable primer set for PCR-DGGE analysis of fungal community structure in traditional fermentation starters for Hong Qu glutinous rice wine. DGGE profiles based on ITS1fGC/ITS2r revealed the presence of twenty-four fungal species in traditional fermentation starter. A significant difference of fungal community can be observed directly from DGGE fingerprints and

  13. DNA repair

    International Nuclear Information System (INIS)

    Van Zeeland, A.A.

    1984-01-01

    In this chapter a series of DNA repair pathways are discussed which are available to the cell to cope with the problem of DNA damaged by chemical or physical agents. In the case of microorganisms our knowledge about the precise mechanism of each DNA repair pathway and the regulation of it has been improved considerably when mutants deficient in these repair mechanisms became available. In the case of mammalian cells in culture, until recently there were very little repair deficient mutants available, because in almost all mammalian cells in culture at least the diploid number of chromosomes is present. Therefore the frequency of repair deficient mutants in such populations is very low. Nevertheless because replica plating techniques are improving some mutants from Chinese hamsters ovary cells and L5178Y mouse lymphoma cells are now available. In the case of human cells, cultures obtained from patients with certain genetic diseases are available. A number of cells appear to be sensitive to some chemical or physical mutagens. These include cells from patients suffering from xeroderma pigmentosum, Ataxia telangiectasia, Fanconi's anemia, Cockayne's syndrome. However, only in the case of xeroderma pigmentosum cells, has the sensitivity to ultraviolet light been clearly correlated with a deficiency in excision repair of pyrimidine dimers. Furthermore the work with strains obtained from biopsies from man is difficult because these cells generally have low cloning efficiencies and also have a limited lifespan in vitro. It is therefore very important that more repair deficient mutants will become available from established cell lines from human or animal origin

  14. A primer for trading greenhouse gas reductions from landfills

    International Nuclear Information System (INIS)

    2000-06-01

    This introductory level primer on domestic greenhouse gas emissions trading addresses the challenge of dealing with landfill gas emissions of carbon dioxide (CO 2 ) and methane (CH 4 ). It describes the first major emissions trading projects in Canada, the Pilot Emission Reduction Trading (PERT) and the Greenhouse Gas Emission Reduction Trading (GERT) pilot projects which calculate and document the GHG emission reductions that are available from landfill sites. PERT initially focused on nitrogen oxides, volatile organic compounds, carbon monoxide, sulphur dioxide and carbon dioxide. PERT uses the Clean Air Emission Reduction Registry for its emissions trading. Canada completed negotiations of the Kyoto Protocol in December 1997 along with 160 other countries. Upon ratification, Canada will commit to reducing 6 greenhouse gases by 6 per cent below 1990 levels in the period 2008 to 2012. Canada has recognized that it must reduce domestic greenhouse gas emissions to slow global warming which leads to climate change. It has been shown that the capture and destruction of landfill gas can profoundly contribute to meeting the target. One tool that can be used to help meet the objective of reducing GHG emissions is domestic GHG emission trading, or carbon trading, as a result of landfill gas capture and flaring. Landfill gas is generally composed of equal parts of carbon dioxide and methane with some other trace emissions. Accounting for quantities of greenhouse gas emissions is done in equivalent tonnes of carbon dioxide where one tonne of methane reduction is equivalent to 21 tonnes of carbon dioxide in terms of global warming potential. Organics in landfills which lead to the generation of methane are considered to be coming from renewable biomass, therefore, the collection and combustion of landfill gas is also considered to reduce GHG emissions from landfills by 100 per cent on a global basis. Destroying landfill gases can also reduce volatile organic compounds, which

  15. Pharmacological chaperoning: a primer on mechanism and pharmacology.

    Science.gov (United States)

    Leidenheimer, Nancy J; Ryder, Katelyn G

    2014-05-01

    Approximately forty percent of diseases are attributable to protein misfolding, including those for which genetic mutation produces misfolding mutants. Intriguingly, many of these mutants are not terminally misfolded since native-like folding, and subsequent trafficking to functional locations, can be induced by target-specific, small molecules variably termed pharmacological chaperones, pharmacoperones, or pharmacochaperones (PCs). PC targets include enzymes, receptors, transporters, and ion channels, revealing the breadth of proteins that can be engaged by ligand-assisted folding. The purpose of this review is to provide an integrated primer of the diverse mechanisms and pharmacology of PCs. In this regard, we examine the structural mechanisms that underlie PC rescue of misfolding mutants, including the ability of PCs to act as surrogates for defective intramolecular interactions and, at the intermolecular level, overcome oligomerization deficiencies and dominant negative effects, as well as influence the subunit stoichiometry of heteropentameric receptors. Not surprisingly, PC-mediated structural correction of misfolding mutants normalizes interactions with molecular chaperones that participate in protein quality control and forward-trafficking. A variety of small molecules have proven to be efficacious PCs and the advantages and disadvantages of employing orthostatic antagonists, active-site inhibitors, orthostatic agonists, and allosteric modulator PCs are considered. Also examined is the possibility that several therapeutic agents may have unrecognized activity as PCs, and this chaperoning activity may mediate/contribute to therapeutic action and/or account for adverse effects. Lastly, we explore evidence that pharmacological chaperoning exploits intrinsic ligand-assisted folding mechanisms. Given the widespread applicability of PC rescue of mutants associated with protein folding disorders, both in vitro and in vivo, the therapeutic potential of PCs is vast

  16. El menor infractor que comete su primer delito

    Directory of Open Access Journals (Sweden)

    Antonia Luzón García

    2014-10-01

    Full Text Available Existe un consenso social y la sociedad se posiciona al lado del menor maltratado, la cosa cambia cuando el menor es infractor, entonces es declarado culpable y merecedor de castigo. El menor aun siendo infractor es un ser humano con pleno derechos establecidos en la Declaración de Derechos del Niño y en los textos internacionales sobre Derechos Humanos. Mediante la socialización se estrechan los vínculos entre el individuo y el sistema social en el que vive. Por ello, la socialización y sus implicaciones son de nuestro interés para este estudio y conocer qué lleva a un menor a cometer su primer delito. Una correcta socialización, de asunción de normas y valores sociales, pautas, creencias, ritos, etc., posibilita la adaptación y previene de la exclusión social. La combinación de la influencia que ha ejercido los agentes de socialización en el menor y los factores de riesgo como el clima familiar, la adaptación escolar, los rasgos de personalidad y el grupo de iguales nos va a permitir pronosticar la probabilidad de que el menor lleve a cabo comportamientos infractores. En este estudio se intentará demostrar que la mayoría de menores que realizan infracciones penales carecen de un adecuado proceso de socialización con desestructuración familiar, inadaptación escolar y la influencia negativa del grupo de iguales que faciliten una socialización positiva y sana. Este proceso de socialización es importante si queremos comprender el comportamiento humano, entendido como la interiorización de normas y valores que han ido estructurando la personalidad del niño, su manera de pensar, de actuar, en resumidas cuentas su desarrollo mental y social

  17. Making the connection: advancing traffic incident management in transportation planning : a primer.

    Science.gov (United States)

    2013-07-01

    "The intent of this primer is to inform and guide traffic incident management (TIM) professionals and transportation planners to initiate and develop collaborative relationships and advance TIM programs through the metropolitan planning process. The ...

  18. Microsatellite primers in the white proteas (Protea section Exsertae, Proteaceae), a rapidly radiating lineage.

    Science.gov (United States)

    Prunier, Rachel; Latimer, Andrew

    2010-01-01

    Microsatellite primers were developed in the South African sclerophyllous shrub Protea punctata to investigate the degree of population differentiation within and between P. punctata and closely related species. • 10 primer pairs were identified from three individuals of Protea punctata. The primers amplified di- and tri-nucleotide repeats. Across all P. punctata samples, the loci have 8-49 alleles. All primers also amplified in Protea section Exsertae (P. aurea, P. aurea subsp. potbergensis, P. mundii, P. venusta, P. lacticolor, and P. subvestita). The loci had 14-69 alleles across the subgenus. • These results show the broad utility of microsatellite loci for future studies of population genetics in the white proteas and their potential utility across the entire genus.

  19. Transportation Management Area Planning Certification Review Primer: Revised January 18, 2018

    Science.gov (United States)

    2018-01-18

    This primer outlines key concepts and expectations of a Transportation Management Area (TMA) Planning Certification Review. Reflecting on the collective experiences of past Certification Reviews, this includes references to relevant laws and regulati...

  20. Routes to effective evacuation planning primer series : evacuating populations with special needs.

    Science.gov (United States)

    2009-04-01

    Evacuation operations are conducted under the authority of, and based on decisions by, local and state authorities. The purpose of this primer, Evacuating Populations with Special Needs, is to provide local and state emergency managers, government of...